Está en la página 1de 18

OBJETIVOS

 Conocer los pasos de la síntesis de proteínas y que sucede en cada uno de


ellos

 Identificar una enfermedad a causa de sinterización de una proteína que no es


la que se espera

 Comprender como podría afectar a la persona cuando no se sintetiza la


proteína correcta
INTRODUCCION

Se conoce como síntesis de proteínas al proceso por el cual se componen nuevas


proteínas a partir de los veinte aminoácidos esenciales. En este proceso, se transcribe el
ADN en ARN. La síntesis de proteínas se realiza en los ribosomas situados en el
citoplasma celular.

En el proceso de síntesis, los aminoácidos son transportados por ARN de transferencia


correspondiente para cada aminoácido hasta el ARN mensajero donde se unen en la
posición adecuada para formar las nuevas proteínas.

Al finalizar la síntesis de una proteína, se libera el ARN mensajero y puede volver a ser
leído, incluso antes de que la síntesis de una proteína termine, ya puede comenzar la
siguiente, por lo cual, el mismo ARN mensajero puede utilizarse por varios ribosomas al
mismo tiempo.
 Síntesis de proteínas: Se conoce como síntesis de proteínas al proceso por el
cual se componen nuevas proteínas a partir de los veinte aminoácidos
esenciales. En estre proceso, se transcribe el ADN en ARN. La síntesis de
proteínas se realiza en los ribosomas situados en el citoplasma celular. En el
proceso de síntesis, los aminoácidos son transportados por ARN de
transferencia correspondiente para cada aminoácido hasta el ARN mensajero
donde se unen en la posición adecuada para formar las nuevas proteínas. Al
finalizar la síntesis de una proteína, se libera el ARN mensajero y puede volver
a ser leido, incluso antes de que la síntesis de una proteína termine, ya puede
comenzar la siguiente, por lo cual, el mismo ARN mensajero puede utilizarse
por varios ribosomas al mismo tiempo.

 ADN: es el nombre químico de la molécula que contiene la información


genética en todos los seres vivos. La molécula de ADN consiste en dos
cadenas que se enrollan entre ellas para formar una estructura de doble
hélice. Cada cadena tiene una parte central formada por azúcares
(desoxirribosa) y grupos fosfato. Enganchado a cada azúcar hay una de de
las siguientes 4 bases: adenina (A), citosina (C), guanina (G), y timina (T).
Las dos cadenas se mantienen unidas por enlaces entre las bases; la
adenina se enlaza con la timina, y la citosina con la guanina. La secuencia
de estas bases a lo largo de la cadena es lo que codifica las instrucciones
para formar proteínas y moléculas de ARN.

 ARN: El ácido ribonucleico es el otro tipo de ácido nucleico que posibilita la


síntesis de proteínas. Si bien el ADN contiene la información genética, el
ARN es el que permite que esta sea comprendida por las células. Está
compuesto por una cadena simple, al contrario del ADN, que tiene una
doble cadena.

 Duplicación del ADN: El dogma central de la genética molecular es que la


información fluye del ADN al ARN y a través de este a la proteína.
 La replicación del ADN es una propiedad esencial del material genético. Es la
única molécula capaz de hacer copias idénticas de ella misma y ocurre una vez en
cada ciclo celular durante la fase S previa a la mitosis o meiosis, mientras que la
transcripción y traducción ocurren repetidamente durante toda la interfase.
 La duplicación del ADN es un proceso notablemente rápido, a razón de 50
nucleótidos por segundo. Este proceso comienza cuando unas enzimas conocidas
como helicasas rompen uniones entre las bases nitrogenadsa de las dos cadenas
de nucleótidos que conforman la molécula de ADN, de esta manera se abre la
doble hélice.
 Una vez que las dos cadenas se separan, proteínas adicionales, conocidas como
proteínas de unión a cadena simple, se unen a las cadenas individuales,
manteniéndolas separadas y evitando que se retuerzan. Esto posibilita el siguiente
paso, la síntesis real de las nuevas cadenas, catalizadas por enzimas conocidas
como ADN polimerasas. Además es necasria otra enzima, la ARN polimerasa.
Una vez que se han sintetizados las cadenas nuevas, actua otro grupo de
enzimas, las ADN ligasas que une las cadenas.
 Transcripción del ADN: Las instrucciones para fabricar una proteína están en la
molécula de ADN, pero esta no la puede fabricar, para ello es necesarop el ARN.
El ARN se sintetiza a partir de la molécula de ADN mediante el proceso conocido
como transcripción.
 La transcripción comienza cuando la la enzima ARN polimerasa, toma contacto
con el ADN y lo abre y, a medida que la enzima se mueve a lo largo de la molécula
de ADN, se separan las dos cadenas de la molécula. Los nucleótidos que
constituyen los bloques estructurales, se ensamblan en el ARN, siendo esta última
cadena complementaria a la del ADN que tomo como molde

 Traducción: Primero está la iniciación. Esta comienza cuando la molécula de


ARNm se une a la subunidad ribosómica más pequeña. La primera molécula de
ARNt, que lleva el aminoácido se acopla con el codón iniciador AUG de la
molécula de ARNm. Luego se acopla la subunidad ribosómica más grande. Un
segundo ARNt, con su aminoácido unido, se coloca en el sitio A y su anticodón se
acopla con el ARNm. Se forma un enlace peptídico entre los dos aminoácidos
reunidos en el ribosoma. Al mismo tiempo, se rompe el enlace entre el primer
aminoácido y su ARNt
Síntesis de proteínas en eucariotas

El proceso de iniciación de la traducción es significativamente diferente al de procariotas,


comenzando porque la complejidad del aparato traduccional es mayor. Los ARNm
eucarióticos no presentan secuencias equivalentes al sitio de unión a ribosomas de los
procariotas, y por ende el ribosoma tampoco. Otra diferencia particular del proceso en
ambos tipos celulares es que en eucariotas los ARNm son monocistrónicos, o sea que
cada ARNm sólo codifica para una proteína y nunca para varias, por lo que la iniciación de
la traducción sucede una sola vez en cada ARNm, a diferencia de los procariotas, donde
puede haber varios sitios de unión a ribosomas y por ende varios inicios de traducción.

El modelo de Kozac es el más aceptado actualmente para describir el proceso de iniciación


de la traducción en eucariotas. Éste propone que la subunidad pequeña del ribosoma se
une al extremo 5’ del ARNm y se mueve haciendo una especie de exploración o
búsqueda de un codón AUG, deshaciendo las estructuras de tallo y asa que tienen
estabilidades menores a 30 kcal. El proceso requiere absolutamente del capping del ARNm
y de energía en forma de ATP. Al encontrar un codón AUG la búsqueda se detiene y se
inicia la síntesis de proteínas AUG exclusivamente, a diferencia de las bacterias donde a
veces GUG o UUG pueden servir. Las bases anteriores y posteriores al AUG son
importantes, ya que le dan un contexto al codón inicial. Si éste no es adecuado, la
subunidad ribosomal pasará por encima del primer AUG y buscará el siguiente.

Las secuencias líderes de los ARNm eucariotas son de mayor tamaño que las procariotas
y pueden formar estructuras de tallo y asa mediante el apareamiento de bases
complementarias. Es importante que exista la presencia de ciertas estructuras secundarias
en el ARNm para que la traducción suceda, ya que el ribosoma puede reconocerlas. Pero
un exceso de éstas puede evitar que el ribosoma encuentre el AUG correcto. El paso de la
iniciación de la traducción es un punto importante de control de la expresión genética de los
eucariotas.
La síntesis o traducción de proteínas es la actividad sintética más compleja en una célula.
El ensamblado de una proteína requiere todos los diferentes tRNA con sus aminoácidos
unidos, ribosomas, un RNA mensajero, algunas proteínas con funciones distintas, cationes
y GTP (trifosfato de guanosina). La complejidad no es sorprendente si se considera que la
síntesis de proteína necesita la incorporación de 20 diferentes aminoácidos en la secuencia
precisa dirigida por un mensaje codificado en un lenguaje que emplea diversos elementos.
En la descripción siguiente se analizan sobre todo los mecanismos de traducción que
operan en las células bacterianas, que son más simples y mejor conocidos.
El proceso es muy similar en las células eucariotas. La síntesis de una cadena polipeptídica
puede dividirse en tres actividades distintas: inicio de la cadena, elongación de la
cadena y terminación de la cadena. A continuación, se describe cada una de estas
actividades. Es de recordar, que debe haber una activación de aminoácidos (AA). Que
consiste en la preparación de los AAs para entrar en la síntesis de proteínas. Se consume
1 ATP por AA. Las aminoacil-tRNA sintetasas catalizan la unión del AA correcto a su tRNA
y son específicas para cada AA. Algunos AAs tienen más de un tRNA, pero cada tRNA solo
reconoce a un AA. Esta interacción específica entre la aminoacil-tRNa sintetasa y el tRNA
constituye un "segundo código genético". Algunas aminoacil-tRNA sintetasas pueden
realizar incluso corrección de pruebas.

Iniciación.
Una vez que se une a un mRNA, el ribosoma siempre se mueve a lo largo del mRNA de un
codón al próximo, esto es, en bloques consecutivos de tres nucleótidos. Para asegurar que
los tripletes se lean, el ribosoma se une al mRNA en un sitio preciso denominado codón de
inicio, el cual se codifica como AUG. La unión a este codón pone al ribosoma de manera
automática en el marco de lectura de tal modo que el ribosoma lee el mensaje entero, de
manera correcta, desde este punto de inicio. Por ejemplo, en el caso siguiente,
—CUAGUUACAUGCUCCAGUCCGU—
el ribosoma se mueve del codón de inicio, AUG, a los próximos tres nucleótidos, CUC, y
así de forma sucesiva a lo largo de toda la secuencia.

Paso 1: traslado de la subunidad ribosomal pequeña al codón de inicio. Como se


advierte en la figura 5, un mRNA no se une a un ribosoma intacto, sino a las subunidades
pequeña y grande en estadios separados. El primer gran paso de inicio es la unión de la
subunidad ribosomal pequeña a la primera secuencia AUG (o una de las primeras) en el
mensaje, que sirve como el codón de inicio.8 ¿De qué manera la subunidad pequeña
selecciona el codón inicial AUG a medida que se opone a uno interno? Los mRNA
eucariotas poseen una secuencia específica de nucleótidos (secuencia Shine-Dalgarno,
nombrada así por sus descubridores) que se localiza cinco a 10 nucleótidos antes del codón
de inicio. La secuencia Shine-Dalgarno es complementaria de una secuencia de nucleótidos
próxima al extremo 3′ del RNA ribosomal 16S de la subunidad ribosomal pequeña. La
interacción entre estas secuencias complementarias en el mRNA y el rRNA. Sin embargo,
para el inicio se requieren factores de inicio, las cuales son proteínas solubles, los
denominados factores de inicio (designados como IF en procariotas y eIF en eucariotas).
Las células eucariotas necesitan tres factores de inicio (IF1, IF2 e IF3), los cuales se unen
a la subunidad 30S (paso 1, fig. 5). El IF2 es
una proteína que une GTP requerido para la unión del primer aminoacil-tRNA. El IF3 puede
prevenir que la subunidad grande (50S) se una en forma prematura a la subunidad pequeña
30S y también facilita la entrada del aa-tRNA inicial. El IF1 facilita la unión de la subunidad
30S al mRNA y puede prevenir que el aa-tRNA entre a un sitio erróneo en el ribosoma.

Figura 5. Unión de los factores de iniciación al codón AUG de inicio y acoplamiento de la


subunidad 30S del ribosoma.

Paso 2: traslado del primer aa-tRNA al ribosoma. Si se examinan las asignaciones de


codones (fig. 6), se puede observar que AUG codifica no tan sólo al codón de inicio; es el
único codón que codifica a la metionina. En realidad, la metionina siempre es el primer
aminoácido que se incorpora en el extremo aminoterminal de la cadena naciente del
polipéptido. (En procariotas, la metionina inicial porta un grupo formilo, que la convierte en
N-formilmetionina.) En muchos casos, la metionina (o N-formilmetionina) se elimina con
posterioridad por medio de una enzima. Las células poseen dos metionil-tRNA: uno se
utiliza en el inicio de la síntesis de proteína y otro diferente para incorporar residuos de
metionilo en el interior del polipéptido. El aa-tRNA iniciador entra en el sitio P del ribosoma
(que se discute más adelante) donde se une a los codones AUG del mRNA y el factor de
inicio IF2 (paso 2, figura 6). IF1 e IF3 se liberan.

Figura 6. Acoplamiento del primer ARNt con formilmetionina activada al codón AUG unido
a la subunidad 30S y los factores de inicio (eIF).

Paso 3: ensamblado del complejo de inicio completo. Una vez que el tRNA iniciador se
une al codón AUG y el IF3 se desplaza, la subunidad grande se une al complejo y el GTP
unido a IF2 se hidroliza (Figura 7). Es probable que la hidrólisis de GTP genere un cambio
conformacional en el ribosoma necesario para la liberación de IF2-GDP.

Figura 7. Complejo ribosomal completo (30S+50s).

El inicio de la traducción en eucariotas. Las células eucariotas requieren por lo menos

12 factores de inicio que incluyen un total de más de 25 cadenas polipeptídicas. Como se

indica en la figura 8, varios de estos eIF (p. ej., eIF1, eIF1A, eIF5 y eIF3) se unen a la
subunidad 40S, que prepara a la subunidad para su unión con el mRNA. El tRNA iniciador

unido a una metionina también se une a una subunidad 40S antes de su interacción con el

mRNA. El tRNA iniciador entra en el sitio P de la subunidad en asociación con eIF2-GTP.

Una vez que estos sucesos se llevan a cabo, la subunidad ribosomal pequeña con sus

factores de inicio relacionados y el tRNA (que juntos integran un complejo de preinicio 43S)

está listo para encontrar el extremo 5′ del mRNA, que tiene el casquete de metilguanosina

Al principio, el complejo 43S se desplaza hacia el mRNA con la ayuda de un grupo de

factores de inicio que ya se encuentran unidos al mRNA (fig. 8). Entre estos factores fi guran

los siguientes: a) el eIF4E se une al casquete 5′ del mRNA de eucariotas; b) el eIF4A se

moviliza a lo largo del extremo 5′ del mensaje y remueve cualquier región de doble cadena

que podría interferir con el movimiento del complejo 43S a lo largo del mRNA, y c) el eIF4G

sirve como un puente entre el extremo 5′ con el casquete y el extremo 3′ poliadenilado del

mRNA (fig. 8). De esta forma, el eIF4G convierte un mRNA lineal en un mensaje circular.

Una vez que el 43S se une al extremo 5′ del mRNA, el complejo recorre el mensaje hasta

alcanzar una secuencia nucleotídica que reconoce (en general el 5′—CCACCAUGC—3′)

que contiene el codón de inicio AUG. Luego que el complejo 43S alcanza al codón

apropiado AUG, eIF2-GTP se hidroliza, eIF2-GDP (y otros eIF asociados) se eliminan y la

subunidad grande (60S) se une al complejo para completar el inicio.


Figura 8. el inicio comienza con la unión de dos complejos, uno (llamado complejo 43S)
contiene la subunidad ribosomal 40S unida a varios factores de inicio (eIF) y el tRNA
iniciador, mientras que el otro posee el mRNA unido a un grupo separado de factores de
inicio. Esta unión es mediada por una interacción entre eIF3 en el complejo de 43S y
eIF4G en el complejo del mRNA. Una vez que el complejo de 43S se ha unido al extremo
5′ del mRNA, recorre el mensaje hasta alcanzar el codón de inicio apropiado AUG.

Función del Ribosoma Completo en la Síntesis de Proteínas


La función del ribosoma tras alcanzar el punto en el cual se ha ensamblado por completo
un ribosoma, es posible ver de manera más detallada la estructura y función de esta
estructura de múltiples subunidades. Cada ribosoma tiene tres sitios para la vinculación con
moléculas de RNA de transferencia. Estos sitios, denominados sitio A (aminoacilo), sitio P
(peptidilo) y sitio E (de salida), reciben cada tRNA en pasos sucesivos del ciclo de
elongación, como se describe en la siguiente sección. Las posiciones del tRNA unido a los
sitios A, P y E de las subunidades pequeña y grande de los ribosomas se muestran en la
figura 9.
Figura 9. Modelo de Sitios A, P y E en un ribosoma completo.

Elongación o Síntesis
Paso 1: selección del aminoacil-tRNA Con el tRNA iniciador cargado y en posición
dentro del sitio P, el ribosoma queda disponible para la entrada de un segundo aminoacil-
tRNA en el sitio A vacante, lo cual representa el primer paso de la elongación (paso 1, fig.
10). Antes de que el segundo aminoacil-tRNA se una de manera eficiente al mRNA
expuesto en el sitio A, debe combinarse con un factor de elongación de proteína unido a
GTP. Este factor de elongación particular se conoce como EF-Tu (o Tu) en procariotas y
eEF1α en eucariotas. El EF-Tu se requiere para liberar los aminoacil-tRNA hacia el sitio A
del ribosoma. Aunque cualquier complejo aminoacil-tRNA—Tu-GTP puede ingresar al sitio,
sólo el que tiene el anticodón complementario del codón del mRNA alojado en el sitio A
activará los cambios conformacionales necesarios dentro del ribosoma que hacen que el
tRNA permanezca unido al mRNA en el centro de decodificación. Una vez que el aminoacil-
tRNA—Tu-GTP correcto se une al codón del mRNA, el GTP se hidroliza y el complejo Tu-
GDP se libera, con lo cual se abandona el aa-tRNA unido al sitio A del ribosoma. La
regeneración de Tu-GTP a partir del Tu-GDP liberado requiere otro factor de elongación, el
EF-Ts.
Figura 10. Paso 1.

Paso 2: formación del enlace peptídico. Al final del primer paso, los dos aminoácidos,
unidos a sus tRNA separados, se yuxtaponen en una posición en la que pueden reaccionar
entre sí (fig. 10). El segundo paso en el ciclo de elongación es la formación de un enlace
peptídico entre estos dos aminoácidos (paso 2, fig. 10). La formación del enlace peptídico
se realiza cuando el grupo amino del aa-tRNA en el sitio A reacciona con el grupo carbonilo
del aminoácido unido al tRNA del sitio P, con lo que se desplaza el tRNA del sitio P (fig. 10).
Como resultado de esta reacción, el tRNA unido al segundo codón en el sitio A tiene un
dipéptido unido y así el tRNA en el sitio P se desacila. La formación del enlace peptídico
ocurre de manera espontánea sin la utilización de energía externa. La transferasa de
peptidilo, un componente de la subunidad grande ribosomal, cataliza la reacción. Durante
años se asumió que la transferasa de peptidilo era una de las proteínas del ribosoma. Sin
embargo, conforme resultó evidente la potencia catalítica del RNA, la atención se volvió al
RNA ribosomal como catalizador para formación de enlaces peptídicos. En la actualidad se
ha demostrado que la actividad de la transferasa de peptidilo reside en la molécula
ribosomal grande de RNA de la subunidad ribosomal grande. En otras palabras, la
transferasa de peptidilo es una ribozima.
Figura 10. Paso 2 (Enlace peptidico).

Paso 3: translocación. La formación del primer enlace peptídico deja un extremo de la


molécula de tRNA del sitio A todavía fi jado a su codón complementario sobre el mRNA y
el otro extremo de la molécula fi jado a un dipéptido (paso 2, fig. 10). El tRNA del sitio P
queda entonces desprovisto del aminoácido. El siguiente paso, conocido como
translocación, se caracteriza por cambios notorios en la posición entre las dos subunidades
del ribosoma. Como resultado, el ribosoma se mueve tres nucleótidos (un codón) a lo largo
del mRNA en dirección 5′ → 3′ (paso 3, fig. 10). La translocación se acompaña por el
movimiento del dipéptido con tRNA del sitio A al sitio P del ribosoma, todavía enlazado
mediante un puente de hidrógeno al segundo codón del mRNA, y el movimiento del tRNA
desacilado del sitio P al sitio E. Al parecer, la translocación se lleva a cabo por cambios
conformacionales en otro factor de elongación (EF-G en procariotas y eEF2 en eucariotas)
tras la hidrólisis de su GTP relacionado.
Figura 10. Paso 3 – Translocación.
Paso 4: liberación del tRNA desacilado. En el paso final (paso 4, fig. 10), el tRNA
desacilado abandona al ribosoma y queda vacío el sitio E. Por cada ciclo de elongación,
por lo menos dos moléculas de GTP se hidrolizan: una durante la selección del
aminoaciltRNA y una durante la translocación. Cada ciclo de elongación toma alrededor de
la veinteava parte de un segundo, la mayor parte de ese lapso tal vez perdido en buscar los
aa-tRNA del citosol circundante. Una vez que el peptidil-tRNA se ha movido del sitio P por
translocación, el sitio A está de nueva cuenta disponible para la entrada de otro aminoacil-
tRNA, en este caso uno con un anticodón complementario del tercer codón (paso 4, fig. 10).
Cuando el tercer tRNA cargado se vincula con el mRNA en el sitio A, el dipéptido del tRNA
del sitio P se transfiere al aa-tRNA del sitio A y forma el segundo enlace peptídico y, en
consecuencia, un tripéptido fijado al tRNA del sitio A. El tRNA del sitio P otra vez se
encuentra desprovisto del aminoácido. A la formación de enlaces peptídicos le sigue la
translocación del ribosoma al cuarto codón y la expulsión del tRNA desacilado y el ciclo
está listo para comenzar otra vez.
Figura 10. Paso 4 – liberación del ARNt desacilado.

Terminación
Como se muestra en la figura 4, tres de los 64 codones trinucleotídicos funcionan como
codones de terminación que concluyen el ensamblado del polipéptido en lugar de codificar
un aminoácido. No existen tRNA cuyos anticodones sean complementarios de los codones
de detención.10 Cuando el ribosoma alcanza uno de estos codones, UAA, UAG o UGA, la
señal interpretada es la de detener todo el alargamiento adicional y liberar al polipéptido
relacionado hacia el último tRNA. La terminación requiere factores de liberación. Las
bacterias tienen tres de ellos: RF1, que reconoce los codones de terminación UAA y UAG;
el RF2, para los codones de terminación UAA y UGA, y el factor RF3, que no reconoce los
codones específicos pero que incrementa la actividad de otros factores. Las células
eucariotas poseen dos factores de liberación, eRF1 y eRF3, que trabajan de forma conjunta
y reconocen todos los codones de terminación. Los factores de liberación que reconocen
codones (RF1, RF2 y eRF1) entran en el sitio A del ribosoma. Un tripéptido conservado en
un extremo de los factores de liberación interactúa al parecer de modo directo con el codón
de terminación en el sitio A, como lo haría el anticodón de la molécula de tRNA con un
codón de sentido en ese sitio. Entonces se hidroliza el enlace éster que une a la cadena
del polipéptido naciente con el tRNA y el polipéptido completo se libera. Como sucede con
los factores de inicio y elongación, uno de estos factores liberadores (RF3 o eRF3) es una
proteína G que une GTP. El papel preciso de esta proteína es poco claro. Una vez que se
completa la terminación, el ribosoma se disocia de sus subunidades grande y pequeña y se
prepara para iniciar otro ciclo de traducción.
¿Qué sucede cuando se sintetiza una proteína que no se debia?
Enfermedad por inhibición de la sintesis de proteínas
Tricotecenos: son producidas por hongos fitotóxicos del género Fusarium, esencialmente
por las especies: F. tricinctum, F. nivale, F. roseum, F. graminearum, F. solani, F. culmorum
y F. poae. De estas micotoxinas se han identificado más de 200 derivados que se dividen
en dos grupos (A-B), siendo las toxinas más importantes del grupo A la toxina T2, la toxina
HT-2, diacetoxiscirpenol, monoacetoxiscirpenol, triacetoxiscirpenol y escirpentriol, y las del
grupo B son la vomitoxina o deoxinivalenol, fugarenona X, nivalenol. Estas [9:49 a. m.,
21/10/2019] .: toxinas son contaminantes habituales de cereales y pueden generar toxicidad
tanto en animales como en seres humanos (10,33,34). El mecanismo de toxicidad de estas
micotoxinas (cuadro 1) está mediado por su interacción con la unidad ribosomal 60s, lo cual
genera la separación de la subunidad rRNA 28s, el bloqueo de los procesos de elongación
y la activación de proteínas inactivadoras de ribosomas (RIPs), provocando de esta manera
estrés ribotóxico y daños en el rRNA, lo que provoca la inhibición del proceso de traducción
y de la síntesis de proteínas, generando de esta manera toxicidad, inhibición de la síntesis
de ADN y ARN, alteración en la división celular, en la estructura de la membrana. Además,
compromete la integridad y la función de la mitocondria
Referencias
 Biología Celular y Molecular. GERALD, Karp. 6° Edición. Ed. MCGraw Hill.
2011.
 Biología Celular y Molecular. LODISH. 5° Edición. Editorial Médica.
Panamericana. 2011.
 Biología CURTIS, Helena. 7° Edición. 2008.
 Biología Molecular de la Célula, Alberts Bruce, Bay Dannis, Lewis Julian, Raff
Martin, Roberts Keith, Watson James D, 3° Edición. Ediciones Omega, 1996.
 Biología Celular y Molecular, Junqueira Carnerio, 6° Edición. Ed. MCGraw
Hill. 1998.
 Bioquímica Libro con Aplicaciones Clínicas, Devlin Thomas M, TOMO I 3°
Edición, Editorial Reverté, S.A 1999.
 Bioquímica Libro con Aplicaciones Clínicas, Devlin Thomas M, TOMO II 3°
Edición, Editorial Reverté, S.A 2000.
Manual de Laboratorio de Biología Celular y Molecular, Segunda Edición 2012.