Está en la página 1de 10

Autenticación de café por medio del Análisis PCR-RFLP y un Lab-on-a-Chip electroforesis capilar

El café es uno de los productos alimenticios más importantes del mundo, el intercambio comercial
que consisten casi en su totalidad de las variedades Arábica y Robusta. El primero se considera de
ser de calidad superior y por lo tanto provoca un precio superior. Métodos para diferenciar estas
especies de café podrían llegar a ser beneficioso para la detección de la adulteración ya sea
deliberada o accidental. Este estudio describe un enfoque de la genética molecular para
diferenciar granos de café de procedencia Arábica y Robusta. Este emplea un polimorfismo de
longitud del fragmento de restricción de la reacción en cadena de polimerasa para supervisar un
solo nucleótido poli-morfismo dentro del genoma cloroplástico. Muestras fueron analizadas con
un sistema de electroforesis capilar de lab on a chip. . Este emplea una cadena de la polimerasa
Fragmento de Reacción-polimorfismo de longitud de restricción para supervisar un polimorfismo
de nucleótido único en el genoma cloroplástico. Las muestras fueron analizadas con un sistema de
electroforesis capilar lab-on-a-chip. Mezclas de polvo de café se analizaron con esta técnica,
mostrando un 5% límite de detección. El número de copias de plástidos se encontró a ser
relativamente constante a través de una amplia gama de muestras de granos, lo que sugiere que
esta metodología se puede emplear también para la cuantificación de cualquier adulteración de
Arabica con granos de Robusta.

PALABRAS CLAVES: La autenticación de café; forense de alimentos; SNP; PCR-RFLP; lab-on-a-chip;


cloroplastos

INTRODUCCION

La tergiversación deliberada de los ingredientes de los alimentos en las etiquetas del paquete del
producto es un problema potencial en la industria alimentaria. Como resultado, los forenses de
alimentos es una disciplina emergente que tiene como objetivo garantizar la autenticidad de los
productos alimenticios al mando de un precio superior (1). Uno de ellos es el café, que es uno de
los alimentos básicos más importantes en el comercio mundial. Esto es principalmente debido a su
consumo mundial y la producción masiva mundial total, que ascendió a un promedio de
producción anual de aproximadamente 106 millones de bolsas para la campaña agrícola de
2005/2006 (2). El café también hace una contribución significativa a la economía de muchos países
en desarrollo. La auto polinización, alotetraploide Coffea arabica y Coffea diploide canephora
Pierre (Coffea robusta) representan las dos especies más importantes comercialmente. El primero
es considerado por proveer café de calidad superior y contribuir a > 70% de la producción mundial
de café (3, 4). Por lo tanto, cafés Arábica se venden en ~2-3 veces el precio de los Robustas, debido
a su sabor más fino y mejor calidad (5). Por lo tanto, hay razones económicas serias para exigir
garantizarse que la autenticidad de café. La adulteración de café puede ocurrir en varios pasos en
la cadena de producción del-campo-a-la-taza, y como resultado ambos granos verdes y tostados
además de café molido, necesitan ser autenticado. Empresas que asan requieren genuinos granos
verdes, mientras que los minoristas deben autenticar productos finales como los granos intactos o
granos molidos.

La mayoría de los enfoques analíticos actuales para la discriminación de los cafés Arábica y
Robusta surgen desde el área de la química analítica / instrumentales. En particular, algunos

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
analitos indicativos tales como diterpeno-16-O-metilcafestol (6,7), libre total de aminoácidos (8),
trigonelina (9), triglicéridos (10), ácidos grasos (11), esteroles (12) , kahweol diterpeno (5), y el
perfil de proteínas (13,14) se han utilizado para la caracterización de variedades puras.

Para la detección cuantitativa (CANTIDAD) de los aditivos La espectroscopia infrarroja


transformada de Fourier (FT-IR) en combinación con el análisis de componentes principales (PCA)
y el análisis discriminante clásica (CDA) (15) y el contenido de metal junto con las técnicas de
reconocimiento de patrones de descriptores (16) se han utilizado con resultados exitosos.
Genéticos, es decir, basadas en el ADN, las técnicas tales como los microsatélites (17, 18) y ADN
polimórfico amplificado al azar (RAPD) (19, 20) análisis se han utilizado sólo para la investigación
genética básica, tal como la caracterización de café y la introgresión de genes en muestras puras.
Para nuestra suerte y lo mejor de nuestro conocimiento, no hay obra publicada sobre la
autenticación de café a través de enfoques basados en el ADN. En este estudio, se presenta el uso
de una cadena de la polimerasa Reacción restricción polimorfismo de longitud de fragmentos
(PCR-RFLP) y el enfoque de la electroforesis capilar lab-on-a-chip para detectar la contaminación
de cafés Arábica con Robusta. La elección del objetivo se basó en un estudio filogenético, en el
que se encontraron una serie de polimorfismos de un solo nucleótido (SNP), entre varias especies
de Coffea, lo que indica la existencia de diferentes tipos de cloro entre Arábica y Robusta (21). El
objetivo de ADN seleccionada fue la cloroplástico trnL (UAA ) -trnF (GAA ) intraspacer región, que
presenta tres sustituciones de una sola base que conducen a diferentes chlorotypes para C.
arabica y C. canephora especies (21). Uno de estos SNPs reside en un sitio de restricción PsuI,
resultando en el sitio que está presente en Robusta pero ausente en Arabica. El propósito de este
estudio fue evaluar si este SNP podría ser explotada para la detección / cuantitativa cualitativa de
contaminación Robusta de Arabica utilizando un enfoque de PCR-RFLP.

Materiales y Método

Material de Café: Material de café. El material de café utilizado en este estudio fue judías verdes
Arábica y Robusta de diversos orígenes geográfico (Tabla 1), amablemente proporcionados por
Mercanta Ltd. "Los cazadores de café" (Londres, Reino Unido). Las muestras 1 y 2 se utilizaron
para la mezcla de Arábica y Robusta.

PCR-RFLP MÉTODO PARA LA AUTENTICACIÓN DE CAFÉ


TABLA 1. MUESTRAS DE CAFÉ UTILIZADAS EN ESTE ESTUDIO
N° MUESTRA DE CAFÉ, ORIGEN ESPECIES
1 Robusta, Rwanda C. canephora
2 Café De Cuba, Cuba C. arabica
3 Mysore A, India C. arabica
4 Sumatra Lintung C. arabica
5 Jacaranda Organic Coffe, Brazil C. arabica
6 El Salvador, El Carmen Estate (Icatu) C. arabica
7 India Robusta Mysore C. canephora
8 Maragogype, Nicaragua, Finca El Platanillo C. arabica
1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab
on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
9 Mondo Novo, Natural Sertarzinho Farm C. arabica
10 Accesion 1s/2, Uganda C. canephora
11 Yellow Bourbon, Brazil, Cachoeira Farm C. Arabica

Extracción de ADN y Cuantificación. Se molieron habas verdes (Fruto y semilla comestible de esta
planta) (20 g) en una máquina de fresado (Glen Creston Ltd., Stanmore, Reino Unido) utilizando
una malla de 2,0 mm. Para el análisis de las mezclas, los polvos de grano de café verde que
contiene 1, 5, 10, 30, y 50% de Robusta fueron preparados en un fondo Arábica (CALIDAD). Se
extrajo el ADN de una muestra de 150 mg de polvo utilizando el kit de extracción de ADN
GENESpin (GeneScan Analytics GmbH, Freiburg, Alemania) según las instrucciones del fabricante.
Muestras de ADN extraído, 5µL de cada ADN, se mezclaron inicialmente con SYBR Green I
(Molecular Sondas-Invitrogen Corp., Paisley, Reino Unido), y después de una electroforesis en gel
de agarosa al 1,0%, que se analizaron con un fluoro-S Multi-Imager (Bio-Rad Laboratories,
Hertfordshire, Reino Unido). Lambda sin cortar de ADN (Promega Corp., Southampton, Reino
Unido) en varias concentraciones conocidas también se utilizó para la cuantificación de las
muestras de ADN.

PCR-RFLP Metodología: PCR se realizó en 5.0 µL de 10 x tampón AmpliTaqGold, 5.0 µL( Microlitro)
de 25 mM MgCl2, 1,0µL (Microlitro) de mezcla de dNTPs (10 mM cada uno), 1,0 µL (Microlitro) de
AmpliTaqGold polimerasa (Applied Biosystems, Warrington, Reino Unido), 1,5 µL (Microlitro) (10
pmol) de cada cebador coffea1 (MWG-Biotech GmbH, Ebersberg, Alemania) (Tabla 2), y ~ 40 ng de
ADN genómico total y se hizo hasta 50 µL (Microlitro) volumen final con agua libre de nucleasa
(Sigma-Aldrich, Dorset, Reino Unido) .

Condiciones de PCR fueron 95 ° C durante 10 min, 35 ciclos de 95 ° C durante 30 s, 50 ° C durante


30 s, 72 ° C durante 1 min, y 1 ciclo a 72 ° C durante 10 min. La reacción de amplificación se realizó
en un termociclador AB9700 (Applied Biosystems, Warrington, Reino Unido). Amplificaciones de
PCR fueron purificados directamente de la mezcla de reacción de PCR usando el kit de purificación
QIAquick PCR (Qiagen, Crawley, Reino Unido). Para la elución del ADN, 30 µL de grado molecular
(Sigma-Aldrich) se aplicó agua en el centro de la resina antes de la última etapa de centrifugación.
Amplicones de PCR purificados se cuantificaron utilizando el NanoDrop ND-1000
(NanoDroTechnologies Inc., LabTech, Ringmer, Reino Unido) de acuerdo con los procedimientos
del fabricante. Una muestra 17 µL Microlitro) del amplicón purificado se mezcló con 2 µL de
tampón B (suministrado con la enzima) y la endonucleasa de restricción 1 µL ofPsuI (Fermentas,
GmbH, St. Leon-Rot, Alemania), se agitaron en vórtex, y se incubó a 37 ° C durante 60 min. Se
hicieron mezclas de Arábica y Robusta amplicones a un volumen final de 4(µL Microlitro), y luego
se añadieron 1 L ofPsuI y 4 µL de tampón B. La mezcla de reacción se llevó hasta un volumen
final de 40 µL con agua libre de nucleasa y se trató como anteriormente.

Análisis fragmento de ADN: La visualización de perfiles de fragmentos generados a través de


digestión de restricción se llevó a cabo usando un LabChip-DNA 1000 con el Agilent 2100
electroforesis capilar sistema de lab-on-a-chip (Agilent Technologies Ltd., South Queensferry, UK).
La preparación de ambos chips y los reactivos se llevó a cabo de acuerdo con las instrucciones del

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
fabricante. La cuantificación de los aditivos se basa en la relación de área de pico de Robusta para
el área del pico total de ambas especies, y todo el análisis se llevó a cabo con el software de 2,100
experto (Agilent Technologies UK Ltd.), versión B.01.02.SI136. Las muestras también se llevaron a
cabo en una electroforesis en gel de agarosa al 2% estándar (Melford Laboratories Ltd., Ipswich,
UK), se tiñeron con bromuro de etidio (Invitrogen, Paisley, Reino Unido) (22) y se visualizaron
usando un transiluminador UV junto con un reproductor de imágenes GelDoc 2.000 (Bio-Rad
Laboratories, Southampton, Reino Unido).

PCR en tiempo real: A-PCR en tiempo real se realizó en un ABI Prism 7700 detector de secuencia
(Applied Biosystems, Warrington, UK). Las muestras de ADN fueron amplificadas utilizando ambos
cebadores de PCR específicos nucleares y cloroplásticos en reacciones separadas por duplicado.
Cada reacción contenía 12.5µL de 10 mezclas de corriente × SYBR Green maestro (Applied
Biosystems, Warrington, Reino Unido), 24:03(0.3 pM) de cada cebador (Tabla 2), y ~ 5 ng de ADN
genómico total y se corrió bajo predeterminados estándar condiciones de PCR, que fueron 50 ° C
durante 2 min, 95 ° C durante 10 min, y luego 40 ciclos de 95 ° C durante 15 s y 60 ° C durante 1
min. Muestras de ADN genómico agrupados se realizaron por triplicado para generar una curva
estándar para cada par de cebadores PCR. Los datos se analizaron a continuación con detector de
secuencia v. 1.7 software (Applied Biosystems), y las concentraciones relativas se calcularon de
acuerdo con las instrucciones del usuario. El análisis estadístico entre muestras Arábica y Robusta
se realizó con la prueba de t (dos muestras suponiendo varianzas iguales) en Microsoft Excel.

TABLA 2. PCR PRIMERS UTILIZADOS EN ESTE ESTUDIO

cebador Secuencia 5'-3 ' Objetivo no la adhesión


Coffea1-F AATCGATCTGGACGGAAAAGC trnL-trnF región intragénica CAU93387, CCU93393
de ADN del cloroplasto
Coffea1-R AGCATCCTCATTTTATGAGAAAAGG
GlydeP-F GAGAATTGTGGATTCCCCAGT C Gen nuclear glicina AF042072, AF043097
descarboxilasa P subunidad
GlydeP-R TCAGCAGGGATTCAAGACGTC

RESULTADOS Y DISCUSIÓN

Análisis del Objetivo cloroplásticos: Una sección de 251 pb de cloroplástico trnL (UAA) -trnF
(GAA) intraspacer región, que contiene el sitio de endonucleasa de restricción PsuI, se amplificó
usando cebadores coffea1 (Tabla 2) y las plantillas de ADN extraído de muestras de granos de café
verde que se enumeran en la Tabla 1. Estos cebadores fueron diseñados de tal manera que el sitio
de restricción PsuI estaba situado asimétricamente dentro del amplicón de manera que, en
presencia de un sitio de restricción intacto, digestión con PsuI daría lugar a dos fragmentos de 92 y
159 pb, respectivamente. Los amplicones se purificaron y se sometieron a digestión con PsuI, y los
fragmentos resultantes se analizaron por electroforesis en gel de agarosa estándar. Los resultados
se muestran en la Figura 1. Todos los cafés Arabica probados dieron un solo producto de ~251 pb,
lo que indica que, como se esperaba, el sitio de restricción PsuI ha sido interrumpido por el SNP.

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
En contraste, las dos muestras de Robusta mostraron dos fragmentos más pequeños alrededor de
92 y 159 pb, lo que indica que, otra vez como se predijo, el sitio de la restricción está intacto .
Estos resultados podrían indicar que este SNP podría ser utilizado como un diagnóstico para
diferenciar todas las variedades Arábica y Robusta

FIGURE 1 :electroforesis en gel de agarosa de PCR-RFLP de trnL cloroplástico (UAA) -trnF (GAA)
intraspacer región desde varias C. arabica y C. cultivares canephora. Cada número corresponde al
cultivar enumerados en la Tabla 1: Las muestras de Robusta (carriles 1 y 7); Muestras de Arábica
(carriles 2-6, 8 y 9); (carril L) 100 escalera pb.

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
Figura 2. Alineados electropherogramas de perfiles de PCR-RFLP según lo revelado por la
electroforesis capilar de Agilent 2100 Bioanalyzer: (A) Arábica; (B) Robusta; (C) 50:50 mezcla de
polvos. Asteriscos individuales y dobles corresponden a 15 y 1500 marcadores internos pb,
respectivamente, de acuerdo con las instrucciones del fabricante.

Sin embargo, se debe tener cuidado para aplicaciones futuras porque C. canephora cultivares
pueden haber contribuido en el pasado a la producción de algunas variedades Arábica de
importancia comercial (23). Si el donante femenina era una C. canephora durante la última retro
cruzamiento, entonces el chlorotype es probable que difiera de la de Arábicas tradicionales. Por lo
tanto, una confirmación adicional del chlorotype en cultivos de Arabica individuales es necesario
antes de que éstos podrían ser incluidos en cualquier análisis discriminatorio. Arábica y Robustas
las muestras 2 y 1, respectivamente, se seleccionaron para su posterior análisis (Tabla 1). Los
perfiles de PCR-RFLP de estas dos variedades puras también se analizaron mediante la
electroforesis capilar tecnología lab-on-chip (Figura 2). En este caso, el Arabica genera una única
banda de alta intensidad que corresponde a una longitud de 251 pb, mientras que el Robusta
mostró dos picos correspondientes a los 92 y 159 pb RFLP de PCR de producto. A 50:50 mezcla de
Arábica y Robusta amplicones también fue sometido a la digestión de restricción y el
electroferograma resultante mostró tres picos claros. Estos, cuando se analizaron utilizando el
software experto 2.100, esta mezcla dio una proporción de 50:50 para Arábica / Robusta,
indicando así la aplicación potencial de esta tecnología para discriminar y cuantificar mezclas de
café.

Análisis de la relación de Plastidios número de copias de ADN por célula.

La cuantificación precisa usando un objetivo cloroplástico requeriría el número de copias de ADN


de plástidos para ser estable entre variedades de café. Por lo tanto, el objetivo de este
experimento fue determinar el número de copias de ADN de plástido por célula en varias muestras
de café comercialmente importantes. Una metodología de PCR en tiempo real se creó para
comparar la abundancia relativa de un gen objetivo nuclear y de plástidos. La glicina
descarboxilasa P gen de la subunidad y la región trnL-trnF fueron seleccionados como los objetivos
nucleares y cloroplásticos, respectivamente. La electroforesis en gel de los productos de punto
final confirmó que no productos secundarios o dímeros de cebadores se formaron (datos no
mostrados). Además, ambos pares de cebadores de PCR utilizados muestran la amplificaciónes
con eficiencias similares entre los dos objetivos (datos no mostrados). Por lo tanto, la señal de
fluorescencia refleja con precisión la relación de copia-plastid-nuclear a ADN de acuerdo con la
relación de copia-plástidos de ADN nuclear y Ctc así como Ctn que denotan los valores de Ct para
los objetivos del cloroplasto y nucleares, respectivamente.

PNR ) 2(Ctc-Ctn) (1)

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
Figura 3. Cuantificación de los números de copias de ADN de plástidos, medido a través de PCR en
tiempo real: (arriba) plástidos (Chr) a (Nu) número de copias de ADN nuclear para cada muestra de
café; (abajo) por encima de los números convertidos a copias de ADN de plástidos por célula.

Para tener en cuenta la diferencia en el estado de ploidía de las muestras Arábica y Robusta,
número de copias de ADN de plastidios por la célula entonces se calculó multiplicando los valores
de la relación por un factor de 2 o 4 dependiendo de si la muestra de ADN se originó a partir
Robusta (2N) o Arabica (4N) de café, respectivamente (Figura 3) .Los resultados muestran que el
número de copias plastidio nucleares para las tres muestras Robusta 1, 7, y 10 eran todos ~ 2
veces mayor que la de las muestras de Arábica. Mediante la conversión de este a las copias de
ADN de plástidos por célula, como se describe anteriormente, se encontró que ambas especies
tienen el mismo número de copias de ADN de plástidos por célula (p) 0,9997), siendo 502 ( 91 y
502(40 copias para Robusta y Arábica, respectivamente . Este valor para el número de copias de
ADN de plástidos está en el extremo inferior del rango reportado para otros tejidos de la planta
(24, 25). Sin embargo, se debe aún tomar cuidado cuando se usan objetivos de cloroplastos para la
autenticación porque mientras que el número de copias que se encontró era relativamente
constante entre variedades Arábica y Robusta, había cierta variabilidad, y esto tiene que ser tenido
en cuenta cuando se requiere la cuantificación exacta de la adulteración.

Análisis de amplicón de PCR de mezclas.

Amplicones de PCR generados a partir de, ya sea puro Arábica o Robusta de ADN, se mezclaron a
varias ratios que oscilan de 50:50 a 99: 1 (Arabica / robusta) y se sometieron a restricción PsuI, y
los resultantes productos de PCR-RFLP se analizaron por electroforesis capilar lab-on-a-chip. Se

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
utilizó el software experto de 2100 para calcular las proporciones experimentales de Arábica /
Robusta utilizando las áreas de pico corregidas de los productos de PCR-RFLP (Tabla 3 ).Los valores
experimentales representa frente teórico dieron una regresión lineal (R2) 0,9975) lo que
demuestra que este enfoque era eficaz para la detección de hasta 1% y como un sistema modelo
sugirió que este enfoque podría ser utilizado para autenticar mezclas de café.

Tabla 3. Porcentaje teórico de Robusta Incluido en las mezclas Modelo frente a la experimental
como se analiza a través de la Descrito Enfoque PCR-RFLP y cuantificación de la Electroferograma
Como generada por el 2100 Bioanalyzer

Análisis de café en polvo mezclas.

Las muestras de Arábica puro y granos de café Robusta verde se utiliza para generar un polvo. A
continuación, se prepararon mezclas de Arabica / Robusta en las proporciones 50:50, 70:30,
90:10, 95: 5, y 99. A continuación, se extrajo ADN a partir de estas mezclas y se sometió a análisis
de PCR-RFLP. Perfiles Fragmento fueron detectados inicialmente a través de electroforesis en gel
de agarosa estándar (Figura 4).

Figura 4. electroforesis en gel de agarosa de los perfiles de PCR-RFLP de varias proporciones de


Arabica a mezclas de polvo de café Robusta por triplicado: (a) 50:50, (b) 70:30, (c) 90:10, (d) 95: 5;
(e) 99: 1. El gel se expone a la luz UV con dos tiempos de exposición diferentes, lo que no saturado
(A) y (B) de la señal saturada. El primero dio un límite de detección de ~ 30%, mientras que el
segundo nos permitió caer a ~ 10%.

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
El límite de detección para Robusta en este caso parecía estar en el nivel de inclusión 10%, pero
esto fue sólo después de que el gel había sido expuesto a la luz UV durante un largo tiempo. Esto
ha dado lugar a la saturación de la señal de la banda sin cortar, lo que hace imposible cualquier
intento de cuantificación. Las mismas muestras PCR-RFLP también fueron analizados utilizando el
Agilent 2100 Bioanalyzer. El porcentaje determinado experimentalmente de Robusta se calculó
(Cuadro 3) y, cuando se representa frente a los valores teóricos, dio una curva de regresión lineal
(R2) 0,9772). En este caso, el límite de detección para la inclusión Robusta se redujo a 5%.

Además de los dos fragmentos de corte de 159 y 92 pb y el amplicón de 251 pb sin cortar, el perfil
de PCR-RFLP también mostró picos con tiempos de retención cercano al del amplicón sin cortar.
Estos no estaban presentes cuando el amplicón originó a partir de una especie, que conduce a la
sugerencia de que es probable que sean heterodúplex, que se producen comúnmente durante las
etapas de desnaturalización y rehibridación de una amplificación por PCR de una plantilla que
consta de dos haplotipos diferentes (26) . Picos similares han demostrado que se genere en el
análisis de heteroplasmia mitocondrial (27). El tratamiento de la relación mezcla con CEL1, una
enzima que escinde dichos heterodúplex, ha confirmado esta sugerencia (datos no mostrados).
Por lo tanto, estos picos adicionales fueron excluidos de los cálculos de contenido de aditivo.

En el presente estudio, se describe un método de PCR-RFLP, que en combinación con el Agilent


2100 Bioanalyzer electroforesis capilar lab-on-Achip, se puede utilizar para detectar
cuantitativamente la adulteración en los granos de café verde. El objetivo cloroplástica usedsthe
trnL(UAA)-trnF(GAA) regiones espaciadoras intergénicas se encontró que era discriminatorio para
todas las variedades Arábica y Robusta utilizados en este estudio. Sin embargo, la capacidad de
este objetivo para discriminar todas las variedades de café comercial tendría que ser aún validado
con tantas variedades como sea posible. El uso de una objetivo cloroplástico tiene ventajas obvias
en términos de número de copia, que es probable que haga una detección más sensible, en
comparación con objetivos nucleares. Un problema potencial con el uso de objetivos
cloroplásticos es la posibilidad de que el número de copias puede variar. Por ejemplo, estudios
previos utilizando tejido de la hoja han demostrado que el número de copias de plástidos puede
variar debido a la etapa de desarrollo (24), el tamaño de la célula (25), y la senescencia o la
estación (28). Sin embargo, no hay información sobre la variabilidad, en su caso, en número de
copias de plástidos en semillas (Bean) tejidos. Los resultados presentados aquí, utilizando un
método de PCR en tiempo real, sugeriría que el número de copias de plástidos parece estable en el
tejido del grano de café y que los objetivos cloroplásticos puede ser adecuado para el análisis
cuantitativo de mezclas de café. Sin embargo, aunque los granos utilizados en este estudio se
originó a partir de una variedad de regiones geográficas , se necesitan más estudios para confirmar
que el número de copias de plástidos se mantiene relativamente constante a través de una amplia
gama de variedades y no está influenciada significativamente por el método del medio ambiente o
de los cultivos en el suministro cadena.

Esta metodología, como con estudio similar anterior en especies de peces (29, 30), es muy fácil de
usar, y el análisis utilizando el LabChip es sencillo y relativamente rápido de aproximadamente 60
min por 12 muestras después de la digestión de restricción paso. Esto significaría que esta
1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab
on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple
metodología puede ser adecuado para el análisis de rutina de muestras de café. Un enfoque
similar podría ser empleado para el análisis de granos tostados e incluso café molido
proporcionando que el ADN adecuado para PCR-RFLP se puede extraer de estos productos. Hay
una fuerte posibilidad de que el procesamiento del grano, ya sea a través de calcinación o otra

tratamientos como descafeinado, darán lugar a la degradación del ADN. Un estudio previo (31) ha
demostrado que el ADN adecuado para el análisis de PCR puede ser extraído de los granos
sometidos a diferentes niveles de tostado y de café en polvo comercial.

RECONOCIMIENTO

Mercanta Ltd. "Los Cazadores de café" es reconocido por

proporcionar todo el material de café utilizado en este trabajo. Granos de café

muestra 10 fue proporcionado amablemente por Sylvester Tumusiime.

1. PCR-RFLP  Polimorfismos de longitud de fragmentos de restricción 2.Lab-on-a-chip-Un "lab


on a chip" (LOC) es un dispositivo que integra una o varias funciones propias de un laboratorio en
un único chip cuyas dimensiones van desde solo unos milímetros hasta unos pocos centímetros
cuadrados. 3.SNP Polimorfismo de nucleótido simple