Está en la página 1de 11

UNIDAD V- PRACTICAS DE LABORATORIO MOLECULAR

U.D. BIOLOGA CELULAR Y

PRACTICA DE LA SEMANA
RECONOCIMIENTO Y COMUNICACIN INTERCELULAR INTRODUCCION. A continuacin se le presenta una Hoja de Trabajo y un Crucigrama que deber de resolver, aplicando los conocimientos adquiridos. Discuta en clase los resultados obtenidos.

HOJA DE TRABAJO
1. Pueden los receptores intracelulares interactuar en el plasmalema con las molculas hormonales? Por qu? Cul es la importancia del plasmalema y el citoplasma en el reconocimiento y comunicacin intercelular? Qu importancia celular tienen el reconocimiento y comunicacin intercelular? Qu caracteriza a una clula blanco para su hormona especfica y qu participacin tiene en la comunicacin intercelular? Qu significa, cmo ocurre y qu utilidad celular tiene la accin hormonal? Es la sealizacin qumica una caracterstica del reconocimiento y comunicacin intercelular? Si agregsemos a la clula muscular esqueltica AMPc Ca ++ a nivel citoplasmtica sera posible imitar el efecto de la epinefrina? Justifique su respuesta. Es generalmente el efecto de las hormonas esteroideas ms lenta en manifestarse en sus clulas objetivo que el efecto de la hormona epinefrina en las suyas?. Justifique su respuesta.

2.

3.

4.

5. 6.

7.

8.

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USAC9. 10. Describir un proceso que ejemplifique el fenmeno de amplificacin de la interaccin ligando-receptor. Por cul mecanismo la epinefrina favorece el alza de la concentracin de glucosa en el citosol?

Complete su reporte de laboratorio de HOJA DE TRABAJO.

CRUCIGRAMA
INSTRUCCIONES Auxilindose de todos los textos a su alcance, resuelva el crucigrama de la siguiente manera: Las casillas 1 y 8 se responden con un sustantivo propio que est compuesto por dos palabras. Todas las dems definiciones deber responderlas con una sola palabra. Horizontales: 1 y 8) Enzima membranal que cataliza la conversin de ATP en 35 AMPc. 15) Primer mensajero. 17) Segundo mensajero, cuya sntesis es catalizada por la enzima Guanilato Ciclasa. 18) Catecolamina, Hormona, neurotransmisor que acta como primer mensajero. 19) Unin comunicante. 20) Comunicacin intercelular que se realiza por medio de substancias. 23) Receptores de ligandos liposolubles que se localizan entre el plasmalema y membranas nucleares. (Nota: Tambin los hay en el ncleo). 26) Seal que inicia una respuesta celular. 28) Sinnimo de estmulos qumicos. 29) Catin divalente, considerado como un segundo mensajero. 31) Estructura a la cual se une el primer mensajero especficamente y que permite que la clula que lo posea sea llamada Diana u objetivo de dicho ligando. 32) Sinnimo de clula Diana u objetivo. Verticales: 7) Afn al H20 10) Enzima que cataliza la modificacin covalente de compuestos qumicos por fosforilacin. 14) Cataliza su degradacin la AMPc-Fosfodiesterasa. 16) Primer Mensajero, secretado al medio extracelular, que puede viajar grandes distancias por medio del lquido extracelular, podra poseer variado nmero y tipos de clulas blanco. 2

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USAC21) Receptores de ligandos hidrolubles, localizados en el plasmalema. 22) Afn a los lpidos 24) Estructura celular que compartimentaliza. Est compuesta por dos capas de fosfolpidos anfipticos y protenas tambin anfipticos. Componente ubicuo del mundo celular. 25) Espacio de lugar o de tiempo que media entre dos cosas. 27) Compuesto Qumico que lleva informacin extra e intracelularmente; se le clasifica en primario y secundario. 30) Coenzima, nucletido, intermediario energtico universal; posee en su estructura dos enlaces macrorgicos; donador de grupos fosforilo. CRUCIGRAMA SEMANA CRUCIGRAMA-COMUNICACIN Y RECONOCIMIENTO INTERCELULAR 1A 2D 3 E 4 N 5I 6 L 16 H
R M O N A

7 H 15 L I G A

8C 9I
N D O

L 12 A 13 S 14 10 A C 11
I N A S A
M 17 G M P C

18 N O

24 M 26 E S
M B R A N A

31 R

D R A D R E N O F 20 Q U I M I L 23 L I P O C 27 L O M U E N S A 30 A J E C E P T O P R O

A
N

S I 19 C A

22 L
L O S

21 E 25 D
A L E

I I C P O 28 S E O 29 C A L C U B

32 B L

I S T A N C I A

S T E R O I D E A S

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USACNombre del estudiante:____________________Carn____________ Profesor:___________________ Da:_____________________ HOJA DE TRABAJO DE BIOTECNOLOGA LA BIOTECNOLOGA ha ido favoreciendo a las ciencias de la Salud por medio de descubrimientos de mtodos que ayudan a producir medicamentos y a diagnosticar enfermedades con mayor precisin. A) La Biotecnologa del ADN recombinante contiene como piedra angular el uso de las enzimas de restriccin, que cortan el ADN por secuencias de reconocimiento especficas. 1. 2. 3. 4. 5. Indique cuales son las funciones de Vectores y las clulas husped. Qu son las secuencias palindrmicas Que medicamentos actualmente utiliza la Tecnologa del ADN recombianante para beneficio de los humanos, mencione tres ejemplos. Cul es la utilidad del plsmido? Por qu se utilizan a las bacterias como vectores y no la clula humana en la tecnologa del ADN recombinante?

B) PCR Reaccin en Cadena de la polimerasa. En 1993 Kary Mullis recibi el premio nobel por el desarrollo de la tcnica del PCR. Este mtodo permite la clonacin rpida de segmentos de ADN sin necesidad de clulas vectores. Utiliza un equipo llamado termociclador. Esta metodologa est siendo utilizada para la deteccin de enfermedades en el humano en La facultad de Ciencias Mdicas de la Universidad de San Carlos desde 2005. 6. 7. 8. 9. Indique para que sirven los cebadores primers? Para qu sirve la polimerasa termoresistente ? Muchos programas de PCR utilizan 3 distintas temperaturas, que ocurre en cada distinta temperatura? Investigue que enfermedades pueden ser diagnosticadas por medio del PCR (por lo menos 5)

C) La terapia Gnica es utilizada para beneficio del humano implica la transferencia de una copia de gen NORMAL en un tejido diana (blanco); idealmente al ingresar e integrarse el gen normal al tejido defectuoso, este deber activarse y producir cambios en beneficio del humano enfermo. 10. Defina qu es terapia gnica somtica, terapia de lnea germinal y terapia gnica de incremento. 11. Por qu hay preocupacin ETICA con el uso de Terapia gnica gnica de incremento? d) Microordenaciones de ADN conocidos como MIcroarray DNA Son utilizadas para el rastreo diagnstico ms rpidos y especfico de mltiples genes anmalos en el ser humano. 12. Indique en que consiste esta tcnica moderna en la medicina

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USACD) SECUENCIA DE ADN y Banco de genes De los glbulos blancos (linfocitos) se extrajo ADN y se realiz una prueba de PCR la cual dio un producto. Este producto se enva para secuenciar el ADN y el laboratorio reporta la siguiente secuencia de bases siguiente: SECUENCIA REPORTADA DEL ADN ENVIADO: ATGGAGACTCTTTGCCAACGTTTAAATGTGTGTCAGGACAAAATACTAACACATTATGAAAATGATAGTA CAGACCTACGTGACCATATAGACTATTGGAAACAAATGCGCCTAGAATGTGCTATTTATTACAAGGCCAG AGAAATGGGATTTAAACATATTAACCACCAGGTGGTGCCAGCACTGGCTGTATCAGAGAATAAAGCATTA CAAGCAATTGAACTGTAACTAACGTTAGAAACAATATATAACTCACAATATAGTAATGAAAAGTGGACAT TACAAGATGTTAGCCTAGAAGTGTATTTAACTGCACCAACAGGATGTATAAAAAAACATGGATATACAGT GGAAGTGCAGTTTGATGGAGACATAAGCAATACAATGCATTATACAAACTGGAAATATATATATATTTGT GAAGAAACATCAGTAACTGTGGTAGAGGGTCAAGTTGACTATTATGGTTTATATTATGTTCATGAAGGAA TACAAACATATTTTGTGCAGTTTAAAGATGATGCAGAAAAATATAGTAAAAATAAAGTATGGGAAGTTCA TGCGGGTGGTCAGGTAATATTATGTCCTACATCTGTGTTTAGCAGCGACGAAGTATCCTCTGCTGAAATT AATAGGCAGCACTTGGCCAACCACTCCGCCGCGACCCATACCAAAACCGTCGCCTTGGGCACCAAAGAAA CACAGACGACTATCCAGCGACCAAGATCAGAGCCAGACACCGGAAACCCCTGCCACACCAACAAGTTGTT GCACAGAGACTCAGTGGACTGTGCTCCAATCCTCACTGCAGTTAACAGCTCACACAAAGGACGGATTAAC TGAAATAGTAACACTACACCCATAGTACATTTAAAAGGTGATGCTAATACTTTAAAATGTTTAAGATATA GATTTAAAAAGCATTGTAAATTGTATACGGCAGTGTCGTCCACATGGCATTGGACAGGACATAATGTAAA ACATAAAAGTGCAATTGTTACACTTACATATGATAGTGAATGTCAACGTGAACAATTTTTGTCTCAAGTG AAAATACCAAAAACTATTACAGTGTCTACTGGATTTATGTCTATATGA

Para saber a que corresponde esta secuencia se le aconseja realizar lo siguiente: 1. en su buscador de Internet de preferencia Google escriba BLAST presione enter

Mueva el cursor y presione enter en BLAST: Basic Local Alignment Search Tool y aparecer la siguiente pgina

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USAC-

Coloque el cursor en nucleotide blast y presione ENTER aparecer la siguiente pantalla Copie y pegue la secuencia que se Le informo en la casilla ms Grande a la izquierda

seleccione en la Opciones de la casilla Data Base Nucleotide Collection nr/nt Escriba en la casilla Add Title Prueba 1 y presione ENTER

Aparecer finalmente la pantalla siguiente en donde se le indica a que corresponde la secuencia que consult. Observe que se le hace comparacin a una serie de banco de secuencia por lo regular se comparan las primeras 10. En este caso es la secuencia del HPV por sus siglas en ingls Virus del papiloma 16.

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USAC-

contine explorando las pgina hacia abajo y observar la base de datos

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USACEjercicio A continuacin se le darn diferentes secuencias reportadas por laboratorio donde se realiz la secuencia del producto de 3 PCR , realizadas en la Facultad de Ciencias Mdicas . Si usted desea saber a que corresponde esta secuencia; deber consultar en banco de genes va Internet a que corresponde. Ejercicio 1- secuencia de ADN
AGGACACCAAATGAAAGAATGCACAGAGAGACAGGCTAATTTTTTAGGGAAAATCTGGCCTTCCAACAAG GGGAGGCCAGGGAACTTTCTTCAGAACAGGCCAGAGCCAACAGCCCCACCAGCAGAGAGCTTCGGGTTCG GAGAAGAGATAGCCCCCTCCCCGAAGCAGGAGCCAAAGGAGAAGGAGCTATATCCCTTAGCCTCCCTCAG ATCACTCTTTGGCAACGACCCTTAGTCACAGTAAAAATAGGGGGACAGCTAATAGAAGCCCTATTAGATA CAGGAGCAGATGATACAGTATTAGAAGAGATAACTTTACCAGGAAAATGGAAACCAAAAATGATAGGGGG AATTGGAGGATTTATCAAAGTAAGACAATATGATCAGATACTTATAGAAATTTGTGGAAAAAGGGCCATA GGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGACGAAATATGTTGACTCAAATTGGTTGTA CTTTAAACTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGTCCAAG GGTTAAACAATGGCCATTAACAGAAGAAAAAATAAAAGCGTTAACAGAAATTTGTAATGAAATGGAAAAG GAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAAAAG ACAGCACTAAATGGAGGAAATTGGTAGATTTCAGAGAACTCAATAAAAGAACTCAAGATTTCTGGGAGGT CCAATTAGGAATACCTCATCCCGCGGGATTAAAAAAGAAAAAATCAGTAACAGTACTAGATGTGGGGGAT GCATATTTTTCAGTTCCCTTAGATCCAGACTTTAGAAAGTATACTGCATTCACTATACCTAGTGTAAACA ATGAGATACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAGTATT

Ejercicio 2- Secuencia de ADN


TCAACGGCTTGCCCGTCTCCGCCCGTAGGGGCCGAGAGATACTGCTCGGGCCGGCCGATGGAATGGTCTC TAAGGGGTGGAGGTTGCTGGCGTCCATCACGGCGTATGCCCAGCAGACAAGGGGCCTCCTAGGGTGCATA ATTACCAGCCTAACTGGCCGGGACAAAAACCAAGTGGAGGGTGAGGTCCAGATCGTGTCAACTGCTACCC AAACCTTTCTGGCAACATGCATCAATGGGGTATGCTGGACTGTCTACCACGGAGCCGGGACGAGGACCAT TGCATCACCCAAGGGCCCCGTCATCCAGATGTATACCAATGTGGACAAAGACCTCGTGGGCTGGCCTGCT CCTCAAGGTGCCCGCTCATTGACACCCTGCACCTGCGGCTCCTCGGACCTTTACCTGGTCACGAGGCATG CCGATGTCATTCCCGTGCGCCGGCGGGGTGATAGCAGGGGCAGCCTGCTTTCGCCCCGGCCCATTTCCTA CTTGAAAGGCTCCTCGGGGGGTCCGCTGTTGTGCCCCGCGGGACACGCCGTCGGCATATTCAAGGCCGCG

Ejercicio 3- Secuencia de ADN


TCTGTGGCAAGAGTTGTAAATACTGATGATTATGTGACTCGCACAAGCATATTTTATCATGCTGGCAGTT CTAGATTATTAACTGTTGGTAATCCATATTTTAGGGTTCCTGCAGGTGGTGGCAATAAGCAGGATATTCC TAAGGTTTCTGCATACCAATATAGAGTATTTCGGGTGCAGTTACCTGACCCAAATAAATTTGGTTTACCT GATAATAGTATTTATAATCCTGAAACACAACGTTTAGTGTGGGCCTGTGCTGGTGTGGAAATTGGCCGTG GTCAGCCTTTAGGTGTTGGCCTTAGTGGGCATCCATTTTATAATAAATTAGATGACACTGAAAGTTCCCA TGCCGCTACGTCTAATGTTTCTGAGGACGTTAGGGACAATGTGTCTGTAGATTATAAGCAGACACAGTTA TGTATTTTGGGCTGTGCCCCTGCTATTGGGGAACACTGGGCTAAAGGCACTGCTTGTAAATCGCGTCCTT TATCACAGGGCGATTGCCCCCCTTTAGAACTTAAAAACACAGTTTTGGAAGATGGTGATATGGTAGATAC

Salmo 139;16 Mi embrin vieron tus ojos , y en tu libro estaban escritas todas aquellas cosas que fueron luego formadas, sin faltar una de ellas

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USAC-

PRACTICA DE LA SEMANA de

Envejecimiento

1.

Qu significado tiene el hecho de que cada especie posea una longevidad caracterstica? D algunos ejemplos: Mencione los cambios celulares que han sido observados en clulas cultivadas para la estudio del envejecimiento. La capacidad replicativa de las clulas se encuentra disminuida en clulas que envejecen in vitro; es esta caracterstica una causa o efecto del envejecimiento celular? Defina que son radicales libres, como actan y cul es la principal molcula afectada por su accin en el organismo que envejece. Cul es la relacin entre radicales libres y envejecimiento? El trmino ANTIOXIDANTES, a qu se refiere? Qu relacin tiene la teora autoinmune con el envejecimiento? De acuerdo al proceso de envejecimiento, la teora del error catastrfico se refiere: Cules son los cambios qumicos que ocurren en la molcula de colgeno por el envejecimiento? Mencione los aspectos cardinales del envejecimiento.

2.

3.

4.

5. 6. 7. 8.

9.

10.

Complete su reporte de laboratorio de HOJA DE TRABAJO. 9

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USAC-

Practica de la Semana: OBSERVACION DE CELULAS


CANCEROSAS
I. INTRODUCCION. En algunos casos, el control que regula la multiplicacin celular se altera una clula empieza a crecer y a dividirse SIN CONTROL, aunque el organismo no necesite de ellas. Cuando las clulas descendientes de dicha clula heredan la propensin de crecer y dividirse sin responder a regulacin, el resultado es una clona de clulas que puede alcanzar un tamao considerable. Esta masa de clula es llamada TUMOR y est formada por una clona no deseada. Debido a que los tumores tienen efectos debastadores en los animales que los desarrollan, gran parte de la investigacin se ha encaminado a entender su mecanismo. Los eventos genticos no son heredados por los gametos, son cambios en el DNA de las clulas somticas. El principal cambio es la alteracin de genes preexistentes a ONCOGENES, cuyos productos causan crecimiento celular inapropiado. La investigacin de las bases moleculares de cncer, utiliza el cultivo celular, de esta forma se pueden ver las caractersticas de la enfermedad y explicar sus propiedades por el anlisis de clulas y molculas. Existen TUMORES BENIGNOS que poseen clulas que recuerdan a las clulas normales con actividad normal siendo localizados (no invaden a otros tejidos ni organos), y los TUMORES MALIGNOS que se diferencian de los BENIGNOS por su capacidad de invasin y diseminacin produciendo METASTASIS ( afecta a tejidos rganos vecinos a distancia) siendo potencialmente de mal pronstico. Las clulas cancerosas tienen suficientes caractersticas para ser diferenciadas de una clula normal; esta observacin se hace al microscopio y analizamos lo siguiente: PERDIDA DE RELACION NUCLEO-CITOPLASMA, NUCLEOLO PROMINENTE, AUMENTO EN LA TASA DE MITOSIS Y UNA ESTRUCTURA POBREMENTE ESPECIALIZADA. Las diferentes clulas del cuerpo pueden desarrollar clulas cancerosas, las cuales tienen caractersticas muy parecidas a una clula inmadura normal en cuanto a sus propiedades. La transformacin de clulas normales a cancerosas incluye EFECTOS SOBRE EL CONTROL DE CRECIMIENTO, MORFOLOGA CELULAR, INTERACCION DE CELULA A CELULA, PROPIEDADES DE MEMBRANA, ESTRUCTURA DE CITOESQUELETO, SECRECION DE 10

PRACTICAS DE LABORATORIO DE BIOLOGA CELULAR Y MOLECULAR FACULTAD DE CIENCIAS MDICAS - USACPROTEINA, EXPRESION DE GEN Y MORTALIDAD TRANSFORMADAS PUEDEN CRECER INDEFINIDAMENTE). (CELULAS

Mas de 20 distintos genes celulares normales, pueden convertirse en oncogenes por alteracin gentica. II. OBJETIVOS: 1. Identificar caractersticas de la clula cancerosa. 2. Comparar caractersticas de clula cancerosa y clula normal. 3. Manejar el Microscopio de Luz. III. MATERIALES: Laminillas de tejido del crvix normal. Laminillas de tejido con cncer del crvix Laminillas conteniendo muestras de tejido cancerosas y clulas normales. IV. PROCEDIMIENTO: 1. Observacin de las preparaciones por medio de Microscopio de Luz y descripcin de las caractersticas celulares observadas. 2. Haga esquemas con objetivo seco fuerte. 3. Complete su reporte de laboratorio de MICROSCOPIA. V. INVESTIGAR: 1. Anomalas cromosmicas en genes relacionadas a Tipos de Cncer
TIPO DE CANCER LEUCEMIA MIELOIDE CRNICA CNCER DE MAMAS CNCER DE OVARIOS ANOMALA EN CROMOSOMA(S) GEN(ES)

ESOFAGICO con

clulas

2.- Agentes Infecciosos que promueven el cncer en: A. Cncer del Crvix :_____________________ B. Cncer Gstrico_______________________ V. VI. BIBLIOGRAFIA: -Advances in Cancer Research (Yearly Volumes). Academic Press. Becker, E.F. de 1992. CANCER: A Comprehensive Treatise. PLENUM. RECUERDE QUE EL 80 % DE LAS ASISTENCIAS LE DA DERECHO A EXMEN FINAL .

11