P. 1
Sistema de Produccion Equina ED.

Sistema de Produccion Equina ED.

|Views: 1.049|Likes:
Publicado porJairo Montes

More info:

Published by: Jairo Montes on Jul 08, 2013
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

08/21/2014

pdf

text

original

UNIVERSIDAD NACIONAL ABIERTA Y ADISTANCIA

GABRIEL SANTIAGO ALARCÓN GIL.





CONTENIDO


UNIDAD 1.
ASPECTOS ZOOTECNICOS DE LOS EQUINOS

UNIDAD 1. ...............................................................................................................7
ASPECTOS ZOOTECNICOS DE LOS EQUINOS. .................................................7
CAPITULO I CONSIDERACIONES GENERALES.................................................7
LECCION 1. GENERALIDADES DE EQUINOS ......................................................7
HISTORIA DEL EQUINO.........................................................................................7
EL CABALLO EN COLOMBIA. ..............................................................................10
LECCION 2. CLASIFICACIÓN DE LOS EQUINOS. ..............................................11
LECCION 3. BIOLOGIA DEL CABALLO................................................................12
LECCION 4. CLASIFICACION ZOOLOGICA DE LOS CABALLO.........................13
LECCION 5. CRONOMETRIA EQUINA.................................................................15
SALIDA O NACIMIENTO DE LOS MOLARES O MUELAS...................................23
CAPITULO 2..........................................................................................................27
LECCION 6. DETERMINACIÓN DE LAS PRINCIPALES CAPAS O PELAJ ES EN
LOS EQUINOS. .....................................................................................................27
CAPAS COMPUESTAS.........................................................................................32
BLANCOS DE LA CABEZA. ..................................................................................35
ESPIGAS O REMOLINOS. ....................................................................................40
LECCION 7. PARTICULARIDADES DE LAS CAPAS............................................40
LECCION 8. TIPOS DE CABEZAS EN EQUINOS. ...............................................41
LECCION 9. TIPOS DE CUELLOS EN EQUINOS. ...............................................42
LECCION 10. APLOMOS. ....................................................................................44
APLOMOS DE LA EXTREMIDAD ANTERIOR. .....................................................44
APLOMOS DE LA EXTREMIDAD POSTERIOR. ..................................................47
CAPITULO 3..........................................................................................................49
LECCION 11. RAZAS EQUINAS. ..........................................................................49
LECCION 12. DIVERSIDAD EQUINA. ..................................................................49
LECCION 13. RAZAS DE SILLA Y DE TIRO LIVIANO..........................................52
LECCION 14. RAZAS DE TIRO PESADO.............................................................62
LECCION 15. PONIS..............................................................................................72
UNIDAD 2. .............................................................................................................78
MANEJO DE LA PRODUCCION EQUINA............................................................78
CAPITULO 4. NUTRICIÓN Y ALIMENTACIÓN DEL EQUINO.............................78
LECCION 16. ANATOMIA Y FISIOLOGIA DEL APARATO DIGESTIVO
EQUINO..................................................................................................................79
LECCION 17.SELECCION DE FORRAJ ES Y NUTRIENTES...............................85
E
DIGESTIBILIDAD...................................................................................................91
LECCION 18. PRINCIPIOS GENERALES DE LA ALIMENTACIÓN EQUINA.....103
ABREVAMIENTO. ..............................................................................................105
LECCION 19. CANTIDAD DE ALIMENTO SUMINISTRADO...............................111
LECCION 20. CONDICIÓN CORPORAL.............................................................115
CAPÍTULO 5. ......................................................................................................118
REPRODUCCIÓN DE LOS EQUINOS................................................................118
LECCION 21. ANATOMIA Y FISIOLOGIA DE LA REPRODUCCION.................120
APARATO REPRODUCTOR DEL MACHO.........................................................125
LECCION 22. TIPOS DE SERVICIOS MAS UTILIZADOS...................................136
TÉCNICAS DE REPRODUCCIÓN ASISTIDA. ....................................................137
FACTORES ADVERSOS PARA LA REPRODUCCIÓN EN EQUINOS...............140
INSEMINACIÓN ARTIFICIAL EN EQUINOS. ......................................................144
Técnica de inseminación histeroscópica .........................................................................150
Técnicas de inseminación intrauterina profunda..............................................................152
TRANSPLANTE DE EMBRIONES. .....................................................................154
LECCION 23. GESTACION..................................................................................157
ALIMENTACIÓN DE LA HEMBRA DURANTE LA GESTACIÓN.........................162
Diagnóstico de preñez.....................................................................................................164
LECCION 24. EL PARTO. ...................................................................................166
LECCION 25. SELECCIÓN Y MEJORAMIENTO..............................................179
CONCEPTOS GENERALES DE BIOLOGÍA Y GENÉTICA.................................180
HERENCIA Y MECANISMOS RELACIONADOS ................................................184
HEREDABILIDAD DE ALGUNOS RASGOS EN EQUINOS................................188
MEJ ORAMIENTO................................................................................................193
INBREEDING ......................................................................................................203
TENDENCIA DE TRANSMISIÓN DEL COLOR DEL PELAJ E A LA
DESCENDENCIA. ...............................................................................................205
APLICACIONES DE LA GENETICA MOLECULAR A LA INDUSTRIA EQUINA.209
CAPITULO 6. ......................................................................................................214
SANIDAD EN LOS PLANTELES EQUINOS.......................................................214
LECCION 26. CABALLO ENFERMOS VERSUS CABALLOS SANOS ..............215
ENFERMEDADES BACTERIANAS.....................................................................219
ENFERMEDADES MICÓTICAS O PRODUCIDAS POR HONGOS. ...................221
LECCION 27. PROGRAMA GENERAL DE SANIDAD EQUINA..........................226
EMPLEO RACIONAL DE MEDICAMENTOS.......................................................228
PROGRAMA DE VACUNACIÓN. ........................................................................233
CONTROL DE PARÁSITOS INTERNOS Y EXTERNOS DEL CABALLO. ..........236
LECCION 28. CÓLICO EQUINO. .......................................................................241
LECCION 29. ENFERMEDADES DE LOS MIEMBROS DEL EQUINO...............248
Cómo proceder en todos los casos de cojera....................................................................250
LECCION 30. DESINFECTANTES Y DESINFECCIÓN.......................................256
UNIDAD 3. ...........................................................................................................261
ACTIVIDADES COMPLEMENTARIAS EN EQUINOS.......................................261
CAPITULO 7. ......................................................................................................261
MANEJO Y ADIESTRAMIENTO DEL EQUINO.................................................261
LECCION 31. MANEJ O Y ADIESTRAMIENTO DEL CABALLO..........................261
LECCION 32. COMPORTAMIENTO SOCIAL DEL CABALLO............................263
Sus sentidos....................................................................................................................267
Alteraciones del comportamiento....................................................................................270
LECCION 33. DESTETE DEL POTRILLO...........................................................270
Forma brusca o súbita.....................................................................................................272
Forma lenta o Gradual.....................................................................................................273
LECCION 34. DOMA, ADIESTRAMIENTO Y EJ ERCICIO EN LOS EQUINOS...274
LECCION 35. MANEJ O. ......................................................................................278
IDENTIFICACIÓN Y MARCACIÓN DE CABALLOS.................................................278
Hierros Candentes..........................................................................................................279
Tatuaje indeleble debajo del labio...................................................................................279
Marcación con Hierro Frío..............................................................................................279
Identificación por espejuelos. .........................................................................................280
CUIDADO DE LOS CASCOS Y COLOCACIÓN DE HERRAJ ES. .............................283
PRINCIPIOS DE LA HERRADA ..................................................................................285
Material y métodos.........................................................................................................291
LA PICADA DE LA COLA. ...................................................................................295
QUÉ EXPRESA EL CABALLO CON LA COLA..........................................................296
ODONTOLOGÍA EQUINA...................................................................................298
SIGNOS DE PROBLEMAS DENTALES......................................................................298
PROBLEMAS DEL DESEMPEÑO DEL CABALLO RELACIONADOS CON
PROBLEMAS DENTALES...........................................................................................299
SUJ ECIÓN Y DERRIBO DEL EQUINO. .............................................................301
EQUIPOS Y UTENSILIOS PARA UN CORRECTO MANEJ O DEL CABALLO. ..302
LECCION 36. LIMPIEZA DE LOS EQUINOS. .....................................................303
CAPÍTULO 8........................................................................................................308
ALOJAMIENTO Y TRANSPORTE DE LOS EQUINOS.....................................308
LECCION 37. ALOJ AMIENTO.............................................................................308
LECCION 38. TRANSPORTE..............................................................................314
LECCION 39. PRODUCCIÓN DE ASNALES Y MULARES ..............................316
ORIGEN DE LOS ASNALES ...............................................................................317
LECCION 40. PRINCIPALES RAZAS DE ASNOS. .....................................................319
LECCION 41. ORIGEN DE LOS MULARES........................................................322
PRODUCCIÓN DE MULAS..........................................................................................323
LECCION 42. ALIMENTACIÓN, CUIDADOS Y MANEJ O DE ASNALES Y
MULARES............................................................................................................325
CAPITULO 9. ......................................................................................................327
LECCION 43. JUZGAMIENTO DE EQUINOS ....................................................327
LECCION 44. J UZGAMIENTO EQUINO EN COLOMBIA....................................331
LECCION 45. SISTEMA DE J UZGAMIENTO SPECTRUM INTERNACIONAL...340
GLOSARIO DE TÉRMINOS ECUESTRES.........................................................344
BIBLIOGRAFÍA...................................................................................................370
CIBERGRAFÍA....................................................................................................373




LISTADO DE TABLAS





Página
Tabla 1. Constantes Fisiológicas Reproductivas 11
Tabla 2. Oscilaciones De La Temperatura 11
Tabla 3. Respiraciones Por Minuto 11
Tabla 4. Frecuencia Cardiaca Por Minuto 11
Tabla 5. Dientes Temporales 18
Tabla 6 Rasamiento De Los Dientes Temporales 18
Tabla 7. Muda O Cambio De Dientes Temporales 18
Tabla 8. Rasamiento De Dientes Permanentes 19
Tabla 9. Tracto Digestivo Del Caballo Comparado Con El Del
Buey
74
Tabla 10. Diferentes Segmentos Del Tubo Digestivo Del Caballo 74
Tabla 11. Necesidades De Calcio Y Fósforo En El Caballo 91
Tabla 12. Necesidades De Oligoelementos 93
Tabla 13. Necesidades Mínimas En Vitamina A 95
Tabla 14. Ración En Kg. De Concentrado Y Heno O Su
Equivalente En Pasto De Corte O Pasto Fresco Para Una Yegua
Parida De 370 Kg. En Dos Etapas Diferentes
105
Tabla 15. Ración En Kg. De Concentrado Y Heno O Su
Equivalente En Pasto Fresco Para Potros En Distintas Etapas
106
Tabla 16. Evaluación De La Condición Corporal Del Equino 109
Tabla 17. Requerimientos Nutricionales Para Hembras Lactantes 172
Tabla 18. Rasgos y Grado de Heredabilidad en los Equinos 183
Tabla 19. Genotipos y Fenotipos de las Distintas Capas Equinas 202
Tabla 20. Enfermedades Causadas Por Virus 213
Tabla 21. Enfermedades Causadas Por Bacterias 215
Tabla 22. Enfermedades Causadas Por Hongos 216
Tabla 23. Enfermedades Causadas Por Protozoarios 218
Tabla 24. Enfermedades Causadas Por Helmintos 219
Tabla 25. Enfermedades Causadas Por Artrópodos 220



LISTADO DE FIGURAS



Página
Figura 1. Nomenclatura De Los Incisivos 15
Figura 2. Mandíbula Del Equino 16
Figura 3. Dentadura De Los Equinos Según La Edad 22
Figura 4. Tipos De Cabeza Según El Perfil 38
Figura 5. Tipos De Cuello 40
Figura 6. Aplomos Y Defectos Del Tren Anterior, Vista De Frente 42
Figura 7. Aplomos Y Defectos Del Tren Anterior, Vista De Perfil 43
Figura 8. Aplomos Y Defectos Del Tren Posterior, Vista Posterior 44
Figura 9. Aplomos Y Defectos Del Tren Posterior, Vista Lateral 45
Figura 10. Condición Corporal Según El Sistema Henneke 111
Figura 11. Disposición del Esqueleto Con Relación al Casco 277
Figura 12. Herraje Corriente 282


UNIDAD 1.
ASPECTOS ZOOTECNICOS DE LOS EQUINOS.

CAPITULO I CONSIDERACIONES GENERALES

LECCION 1. GENERALIDADES DE EQUINOS
HISTORIA DEL EQUINO

Los equinos han sido y serán por siempre el mejor acompañante del hombre en la
mayoría de sus actividades.

Sobre su origen se ha especulado mucho, sobresaliendo dos grandes teorías, y
son las que mas se acercan a la posible realidad. La primera de ella es la de
Hamilton Smith, que dice que los equinos procedían de una especie salvaje cuya
diferenciación racial radicaba en el color de la capa, lo que explicaría la amplia
variedad de pelajes actuales.

Posteriormente Darwin propuso la teoría de la evolución y el origen de las
especies por selección natural dando a entender que todos los equinos
descienden de un antecesor en común (el caballo de Przewalski, descubierto en
1881, y reconocido como el único antecesor de los caballos domésticos).

http://yegua.tripod.com/historia.htm

Hoy en día se ha comprobado que el caballo es originario de América. Su primer
antepasado era del tamaño de un perro Fox Terrier y vivió hace mas o menos 55
millones de años en América. Se le denomino EOHIPPUS y la prueba de su
existencia la obtuvieron los paleontólogos en fósiles encontrados al sur de Estados
Unidos. Sus miembros anteriores terminaban en cuatro dedos y su dentadura era
similar a la de un roedor no apto para alimentarse de pastos. El dorso era
arqueado y la cabeza pequeña.

A este le siguió el MESOHIPPUS de un tamaño un poco superior al anterior, con
tres dedos en sus extremidades anteriores, y de mayor desarrollo del central que
de los laterales, vivió hasta hace mas o menos 26 millones de años. Y con
posterioridad, el MERYCHIPPUS, último caballo con tres dedos en sus miembros
anteriores, con avanzada atrofia de los dos laterales. Igual que el MESOHIPPUS,
se alimentaba de hierbas blandas por su avanzada transformación dentaria y
mostraba mayor largo de la cabeza pareciendo cada vez mas al equino actual,
este existió hasta hace mas o menos 7 millones de años.

Posteriormente encontramos al PLIOHIPPUS que existió hasta hace 2.5 millones
de años aproximadamente. En este ya se encuentra un solo dedo en los miembros
anteriores y se observa la atrofia total de los laterales. El dedo central termina en
un casco y presentaba importantes transformaciones en los molares, su cráneo
aparece mas largo en relación a los anteriores.

Entre hace 2.6 millones de años y un millón de años aparece el EQUUS
CABALLUS, antecesor más cercano del caballo actual, que emigra del continente
Americano al Asiático a través del estrecho de Bering y llega hasta el occidente de
Europa.

A partir del EQUUS se inicia en Asia la formación de las razas de los primeros
caballos de tiro y de silla que se van agrupando bajo os distintos tipos,
paralelamente a la evolución de la corteza terrestre y a su cubrimiento forestal,
desde el Pony o raza miniatura de 0.90 metros de alzada, hasta los grandes
caballos de tiro pesado de la época moderna como el Shire ingles, que llegan
hasta los 2 metros de alzada.

http://www.veterinaria.org/asociaciones/vet-uy/articulos/artic_eq/001/eq_001.htm
l

Su domesticación, según se cree, fue obra de las tribus que habitaban las orillas
del mar Caspio hace unos 5000 a 6000 años; inicialmente se utilizaba como fuente
de proteína para el consumo y piel para la manufactura, pero con el paso del
tiempo fue tomando gran importancia para el transporte y sobre todo la conquista.

Ya domesticado, se desarrolla fundamentalmente en el Oriente Medio, en tierras
de la Mesopotamia, cuna de la humanidad, y penetra al África por el mediterráneo,
con las culturas egipcia y griega. Y a Europa con los distintos invasores, entre los
que se encuentran los árabes y germanos.

Con respecto a la llegada de los caballos a América podemos asegurar que esta
se produjo a través de los conquistadores españoles, a partir de 1493 en el
segundo viaje de Cristóbal Colón.

Según la historia, los reyes Fernando e Isabel se preocuparon principalmente de
que fueran transportados al nuevo mundo, varios ejemplares equinos; la orden
real era embarcar 25 de los mejores ejemplares de tan noble especie, pero la
verdad es que al continente americano desembarcaron de inferior calidad, de esta
forma podemos deducir, sin temor a equivocarnos, que nuestro caballo
colombiano ni siquiera desciende de los mejores caballos españoles, es así como
a nuestro país le corresponde el privilegio de haber sido el primero de Sudamérica
que utilizo este noble animal.

Los equinos llegados a Colombia eran animales de andar lateral descendientes
del Berberisco africano que ya ejecutaban cuatro tiempos laterales en andoneo, y
caballos de trote y galope, posiblemente de origen Celta-Berberisco, que sirvieron
de semilla a las importantes razas de América del sur entre las cuales se
encuentran, en orden de antigüedad, cuatro alternativas en Colombia: la de Paso
Fino, la de Trote y Galope, la de Trocha sola y la de Trocha y Galope.

Los diversos usos que el hombre ha dado al caballo a través de los tiempos en
orden cronológico son:


- Como medio de alimentación.
- Para fines militares (en las guerras)
- Pasatiempo y diversión en las diferentes culturas.
- Mano de obra en empresas agrícolas y comerciales.
- Para recreo y deporte.


EL CABALLO EN COLOMBIA.

Fuerza, velocidad, suavidad, estampa, brío y nobleza, son según la federación
colombiana de asociaciones equinas (fedequinas) las cualidades que mejor
describen al caballo colombiano.

Como se menciona anteriormente el primer embarque de equinos, hacia América
se realizo en 1493, determinándose como primer punto de cría la República
Dominicana, de allí se distribuyen hacia Cuba, Puerto Rico y Colombia.

En el año de 1525 llegaron los primeros equinos a lo que hoy es Colombia, traídos
por don Rodrigo de Bastidas. Posteriormente en 1533 don Pedro de Heredia y en
1535 Pedro Fernández de Lugo, volvieron a introducir equinos para ser utilizados
como animales de silla y carga en su empresa de expansión y colonización a
través del país.

La mayoría de estos ejemplares, poseían un andar suave que debido a las
condiciones geográficas de la zona, fueron modificando hasta producir los
diferentes andares característicos de nuestros equinos, las regiones de
Cundinamarca, Valle y Antioquia son los departamentos donde mejor se desarrollo
el caballo criollo colombiano.

De Antioquia el caballo se extendió a los departamentos de Caldas, Quindío y
Risaralda, hoy por hoy el eje cafetero es la zona del país donde mayor afición
existe al mundo equino.

Actualmente nuestro caballo, al igual que el café y la esmeraldas, es un símbolo
de Colombia, exportándose a países como Brasil, Puerto Rico Venezuela,
Ecuador, Republica Dominicana, y Estados Unidos, donde viven cerca de 38000
equinos colombianos.

Se calcula que las divisas que se generaron con la explotación equina, es igual a
la procedente de las esmeraldas y que en Colombia generan cerca de 150000
empleos.

En las venas de nuestros caballos corre sangre berberisca, árabe y andaluza,
cuya mezcla y la interacción con la geografía nacional, originó un animal de
características únicas en el mundo, resaltando entre otras lo siguiente:

Elegancia de sus movimientos posiblemente del andaluz, el brío y la perfección de
sus formas del árabe y la calidad y resistencia del berberisco.

En un principio estos animales debieron mezclar su propio andar con el necesario
para la topografía nacional, poco a poco esta información paso a ser genética y
así fue como con los años se perfecciono, con la ayuda de la selección, la
tecnología y el adiestramiento.

La población equina nacional se encuentra distribuida especialmente en los
departamentos de Antioquia, Cundinamarca, Santander, Tolima, Huila, Caldas,
Quindío, Risaralda, Meta, Cauca, Boyacá, y Atlántico entre otros.
Esta población esta representada por ejemplares cuyo género de servicio se
puede resumir así:

DE SILLA Y/O TIRO LIVIANO:
 Salto de obstáculo.
 Polo.
 Carreras.
 Para transporte y recreación.

TIRO PESADO

PONIES


LECCION 2. CLASIFICACIÓN DE LOS EQUINOS.

Los equinos se clasifican desde el punto de vista de la conformación o tamaño,
peso o perfil de la cabeza, así pues tenemos:

POR VOLUMEN O PESO.
Hipermétricos: peso superior a 500 Kg.
Eumétricos: peso medio entre 350y 500 kg.
Elipométricos: peso inferior a 350 kg.


POR SUS PROPORCIONES O TAMAÑO.
Brevilíneos o Braquiomorfos: animales de formas cortas.
Mediolíneos o mesomorfos: formas promedio es decir ni cortas ni largas.
Longilíneos o dolicomorfos: animales de formas alargadas.


POR EL PERFIL DE CABEZA.
Rectilíneos: huesos casi planos.
Concavilíneos: huesos hundidos especialmente.
Convexilíneos: huesos abombados.



LECCION 3. BIOLOGÍA DEL CABALLO.


CONSTANTES FISIOLÓGICAS:

Son todas aquellas manifestaciones de la actividad vital del organismo animal que
pueden ser medidos en un examen clínico y que ponen en evidencia el estado del
mismo.

Tabla 1. Constantes fisiológicas reproductivas.
ESPECIE
DURACIÓN
GESTACIÓN
DURACIÓN
DEL CELO
REAPARICIÓN
DEL CELO
PRIMER
CELO
POSTPARTO
AL NO HABER
FECUNDACIÓN
YEGUA 340 días 6-8 días Cada 21 días
promedio.
7-10 días 12-16 semanas
BURRA 365 días 6-8 días Cada 9-8 días
promedio.
42-56 días 3 semanas
Tomado de diccionario veterinario ¨ECTA¨

Tabla 2. Oscilaciones de la Temperatura.
Individuo Temperatura
CABALLO Y MULO 37.5-38.2 °C
POTRO 37.5-39 °C
ASNO 37.5-39 °C
Tomado de diccionario veterinario ´ECTA¨

Tabla 3. Respiraciones por minuto
Individuo Número de Respiraciones por minuto
CABALLO Y YEGUA DE 8-20
POTROS DE UN AÑO DE 10-15
ASNO Y MULO DE 10-30
Tomado de diccionario veterinario ¨ECTA¨

Tabla 4. Frecuencia cardiaca por minuto
Individuo Número de pulsaciones por minuto
CABALLOS EN GENERAL 36-40
CABALLOS CASTRADOS Y YEGUAS 34-40
POTROS HASTA 14 DÍAS HASTA 100
POTROS HASTA UN MES HASTA 70
POTROS DE 6-12 MESES 60-45
POTROS DE 2-3 AÑOS DE 50-40
ASNO Y MULO 42-50
LECCION 4. CLASIFICACIÓN ZOOLÓGICA DE LOS CABALLOS.

REINO: Animal (seres vivos diferentes a las plantas).
PHYLUM: Chordata (cordados).
SUBPHYLUM: Vertebrata (presencia de columna vertebral).
CLASE: Mamalia (animales de sangre caliente que paren a sus crías vivas y los
amamantan por un periodo de tiempo determinado con una secreción de sus
glándulas mamarias).
ORDEN: Ungulata (mamíferos con cascos, no rumiantes).
SUBORDEN: Perisodatila (un dedo en cada extremidad “solípedos” protegidos por
una fuerte uña denominada casco).
FAMILIA: Equidae (equinos con pequeños pezones en ambos sacos, piel rica en
glándulas, presencia de crin, constitución ágil y ligera).
GENERO: Equus (incluye los caballos, asnos mulas y cebras).
ESPECIE: Caballos (caballos domésticos, se diferencias de los asnos y las cebras
por el pelo mas largo en las crines y la cola, presencia de espejuelos en la parte
interna de las manos, cabeza de menor tamaño, orejas mas cortas, entre otras).
NOMBRE CIENTÍFICO: Equus caballus.
NOMBRE COMÚN: Caballo.

Los equinos son animales vivíparos herbívoros, de reproducción sexual,
alcanzando la pubertad alrededor de 24 a 36 meses, tiempo en el cual tanto el
caballo como la yegua ya pueden aparearse pero solo es aconsejable permitir la
monta en caballos a los cuatro años cuando ya ha alcanzado su completa
capacidad y a los cinco años en yeguas cuando la osificación se encuentra
totalmente terminada. En general es deseable y prudente servirla cuando su
estado general, su tamaño, peso y su salud sea excelente, pero nunca antes de
los dos años y medio. Se acostumbra a ser servicio entre los 30 a 36 meses,
siempre y cuando la alimentación sea de buena calidad.

Normalmente nace una o dos crías (algo excepcional) después de una gestación
de once meses; una yegua puede llegar a tener de cinco a seis crías, en su vida
reproductiva, los equinos poseen 64 cromosomas.

La duración media de la vida del caballo es de unos quince años pero muchos
animales pueden pasar de los 20 años. El caballo crece muy rápidamente y al año
de edad ya tiene el tamaño de un adulto. Sin embargo su desarrollo cesa hasta los
dos años. Desde su nacimiento hasta los cinco años los machos reciben el
nombre de potros, las hembras el de potrancas, de los cinco años en adelante se
llaman respectivamente caballo y yegua.

Viven en casi todo tipo de ecosistemas excepto en los polos, donde el clima es
muy frío y la mayoría de las especies se desarrollan en temperaturas templadas,
son de fácil adaptación a climas diferentes al que nacieron.

La evolución del equino le ha permitido desarrollar patas y remos altamente
especializados en los que ha fundamentado su velocidad, ha reducido al mínimo el
número de huesos en sus extremidades para que el punto de apoyo sean los
extremos de cuatro dedos. Simultáneamente a este fenómeno, se ha producido la
desaparición de los músculos situados por debajo de la rodilla y el corvejón, dado
que esto junto con los otros huesos de los que el caballo carece son los que
permiten a otros animales agarrar y manipular con sus extremidades. El caballo
solo puede mover los remos hacia adelante o hacia atrás, lo que le proporciona un
método optimo de propulsión.

La fuerza se la dan los músculos altamente desarrollados que se insertan en los
huesos del antebrazo, cuya superficies óseas se han ensanchado para cumplir
esta misión.


Su estructura ósea consta de 205 huesos, distribuidos de la siguiente forma:

Columna Vertebral 54
Costillas 36
Esternón 1
Cráneo (incluyendo huesos del oído) 34
Extremidades anteriores 40
Extremidades posteriores 40
TOTAL 205 Huesos


El esqueleto proporciona sostén a los músculos, protección a los órganos internos
y sus componentes poseen la movilidad necesaria para que el animal se desplace
a diferentes velocidades.

Los diferentes tipos de articulación proporcionan diversos grados de movilidad; los
huesos están recubiertos de cartílago que pueden compensar los efectos de
desgaste en la superficie. La articulación se completa con una cápsula y produce
sinovia (liquido articular) cuyo fin es lubricar las superficies articulares. Todo esto
se refuerza por medio de ligamentos que unen los huesos de ambos lados de la
articulación.


http://www.3caballos.com/modules.php?name=Content&pa=showpage&pid=53

LECCION 5. CRONOMETRIA EQUINA.


El sistema más empleado para determinar la edad, ha sido el examen de su
sistema dentario encontrándose que a diferencia de los bovinos, acá si es una
práctica bastante aproximada con relación a la edad verdadera.

Los equinos son heterodontos completos es decir, que se encuentran todos los
tipos de piezas dentales (I, Ca, Pm y Mo).

En las hembras y solo en casos esporádicos se encuentran algunos rudimentos de
los caninos, únicamente en la mandíbula.

Tanto los incisivos como los premolares de los equinos son difiodontos esto quiere
decir que en un momento dado de la vida del ejemplar son reemplazados por
piezas permanentes, mientras que los caninos y molares salen una sola vez, es
decir son permanentes desde su brote.

En los caballos de 5 años, basta simplemente observar el número de piezas
definitivas y temporales que poseen. Desde los 6 a los 12 años se toma en cuenta
el rozamiento o desgaste de los incisivos.

La mejor manera de aprender como se reconoce la edad de un equino es
examinar los dientes de caballos de edades conocidas (verificar con el registro de
nacimiento). En contraste los incisivos permanentes son de mayor tamaño que los
temporales, su color es opaco amarillento y toman una dirección curva de arriba
hacia abajo.


NOMENCLATURA DE LOS INCISIVOS.

Los incisivos en los equinos son 12 en total, son 6 en el maxilar y 6 en la
mandíbula.
Los dos centrales tanto superiores como inferiores reciben el nombre de palas o
pinzas, los que sigue a cada lado: medios o medianos y los mas laterales:
extremos o angulares. Presentan una invaginación en la superficie de masticación,
esto es infundíbulo o tintero que es mas profundo en los incisivos inferiores y que
sirve de guía para determinar la edad, por el mayor o menor desgaste que sufran
o su desaparición total a lo cual se conoce como rasamiento.





Figura 1. Nomenclatura de los incisivos


1. Palas o Pinzas
2. Primeros Medios
3. Segundos Medios
4. Extremos o Angulares
Tomado de Zootecnia General de la UNAD

CANINOS O COLMILLOS.
Son 4 en el macho; en la hembra faltan o son rudimentarios. Interrumpen el
espacio ínter dentario, llamado barra o asiento, dividiéndola en dos partes
desiguales. Los inferiores están más próximos al incisivo angular.
Los caninos salen una sola vez, es decir no se mudan. Generalmente en los
animales jóvenes son blancos y puntiagudos, pequeños comparados con los
incisivos en los animales viejos son amarillentos y su punta aparece desgastada
es decir que se manifiesta redondeada y roma.

MOLARES.
Son 24 en total; 12 en maxilar superior y 12 en la mandíbula. Sin embargo el
número puede estar aumentado por la presencia en el maxilar superior de un
pequeño diente, llamado “diente de lobo” que esta situado delante del verdadero
primer premolar. Esta pequeña pieza dentaria es más o menos frecuente tanto en
los machos como en las hembras.

Esporádicamente puede aparecer en algunos equinos este pequeño diente en la
mandíbula inferior, pero estos casos son aislados.

Los tres primeros molares de cada lado tanto del maxilar como de la mandíbula,
reciben el nombre de premolares, son más grandes y el tamaño de las coronas es
apreciable.

La superficie bucal, es lo que se dirige hacia las mejillas, presenta una cresta
central dirigida longitudinalmente, separando dos surcos. La superficie
masticatoria presenta dos infundíbulos uno anterior y otro posterior, no tan
profundos como los de los incisivos y mucho mas manifiesto en los molares.
Además presenta numerosos pliegues o crestas que hacen las veces de molinos
para triturar los alimentos. Generalmente presentan tres raíces. Los premolares
inferiores o mandibulares tienen una longitud similar a las de los superiores. Su
superficie masticatoria es mas angosta y oblicua. Presentan dos raíces.

Los molares propiamente dichos presentan una corona desarrollados (casi
cuadrada) con excepción del ultimo que presenta sección prismático – triangular.
Presentan dos infundíbulos y los respectivos pliegues o crestas en la superficie
masticatoria. Tiene generalmente tres raíces con excepción del último que puede
presentar cuatro, esto es valido para los molares superiores o maxilares.

Los molares inferiores o mandíbulas, son más anchos que los superiores, los dos
primeros presentan dos raíces, mientras que el tercero o último molar presenta
comúnmente tres.

Aunque los premolares y molares raramente son tenidos en cuenta para la
determinación de la edad, por la dificultad misma para su inspección, sin embargo
en las épocas de erupción o salida coinciden con determinadas edades que en un
momento dado sirven de guía.







Figura 2. Mandíbula del Equino


Maxilar Superior

Maxilar Inferior
Tomado de Zootecnia General de la UNAD




FORMULAS DENTARIAS

Los dientes temporales son más pequeños que los permanentes y su número es
igualmente menor.

Fórmula dentaria temporal: I 6/6 C 0/0 PM 6/6 =24 Piezas dentarias.

La formula de Permanente, tanto para machos como para hembras es la siguiente:

HEMBRAS: I 6/6 C 0/0 PM 6/6 M 6/6=36 o 38. Piezas dentarias.
MACHOS: I 6/6 C 2/2 PM 6/6 M 6/6=40 o 42 Piezas dentarias.


PERIODOS DE VIDA DEL EQUINO:

Se considera que existen tres periodos fundamentales en la vida de un equino:

El primero corresponde desde el nacimiento hasta los 5 años y durante este
periodo el ejemplar recibe la denominación de potro o potranca según el sexo.
El segundo va desde los 5 a los 13 años y entonces el ejemplar es adulto.
El tercero va desde los 14 en adelante y el animal se reseña como viejo.

En la determinación de la edad de los equinos se tiene en cuenta ciertos periodos
de su dentición así:

Nacimiento o salida de los dientes de leche o temporales.
Rasamiento de los dientes de leche.

Se entiende por rasamiento al desgaste que sufre la parte libre del incisivo,
especialmente en su borde anterior, esto es la disminución del infundíbulo hasta
su desaparición.

El proceso de dentición tiene las siguientes fases:

 Erupción de los dientes temporales.
 Muda o cambio de los dientes temporales a permanentes.
 Erupción de los caninos o colmillos.
 Rasamiento de los dientes permanentes.
 Cambio de forma de la superficie libre o de masticación a:

o Forma redondeada.
o Forma triangular.
o Forma biangular.




CARACTERES QUE PRESENTAN LAS PIEZAS DENTARIAS DE UN EQUINO
EN LAS DIFERENTES EDADES.


Tabla 5. Dientes Temporales
DIENTES TEMPORALES O DE LECHE
EDADES SALIDA O REEMPLAZO CARACTERÍSTICAS
5-12. hasta 30 días Nacen las palas, casi
siempre primero las
superiores.
Son pequeños, blancos,
Brillantes y presentan
corona y cuello.
30-40 días Nacen los medios
Del 3 al 9 o 10 mes Nacen los extremos (braquiodontos)



Tabla 6. Rasamiento De Los Dientes Temporales.
RASAMIENTO
A los 10 meses Las pinzas Blancos, pequeños, se
desgastan (va
desapareciendo el
infundíbulo)
A los 12 meses Los medios
De los 15-20 meses Los extremos

Aproximadamente a los 2 años todos los incisivos están rasados y comienzan a
descarnar, esto es que se aflojan o se mueven para iniciarse así la muda de los
mismos.


Tabla 7. Muda O Cambio De Dientes Temporales.
MUDA O CAMBIO
De los 2 ½ a 3 años Mudan las palas o pinzas Gruesos, amarillentos, sin
corona y cuello.
De los 3 ½ a 4 años Mudan los medios
De los 4 ½ a 5 años Mudan los extremos


Alrededor de los 5 años de edad un equino debe presentar todos los incisivos
permanentes, se dice entonces que el animal esta “parejo”.


SALIDA DE LOS CANINOS O COLMILLOS.
Los colmillos hacen su aparición en los equinos machos entre los 3 ½ a los 4 ½
años y como ya se dijo son 4 en total, dos en el maxilar y dos la mandíbula.


Tabla 8 Rasamiento de los dientes permanentes
RASAMIENTO DE LOS DIENTES PERMANENTES
A los 6 años rasan Las palas inferiores Todos van tomando la
forma oval
A los 7 años rasan Los medios inferiores
A los 8 años rasan Los extremos inferiores
A los 9 años rasan Las pinzas superiores
A los 10 años rasan Los medios superiores
De los 10 a los 12 años
rasan
Los extremos superiores



CAMBIOS DE FORMA DE LOS DIENTES.

A medida que el animal envejece, (esto es que ha rasado todos los incisivos) se
dice que el animal esta fuera de marca o fuera de edad y empieza a notarse un
cambio en la forma de la superficie de masticación (corona) que como se ha dicho
presenta hasta este momento forma oval (alongada transversalmente).


a) FORMA REDONDEADA.
A los 9 años presentan forma redondeada en las palas inferiores o mandibulares y
los extremos inferiores o mandibulares, además es posibles observar a partir de
los 9 años que las palas o pinzas inferiores presentan la denominada “estrella
dentaria” que es una línea transversa opaca amarillo – marrón, ubicada en la
dentina, colocada entre el borde labial (anterior) de los dientes y el esmalte
central.

A los 12 años las palas superiores o maxilares aparecen redondeados.
A los 13 años los medios superiores son redondos.
A los 14 años los extremos superiores son redondos.
Esta forma puede aparecer hasta los15 o 16 años, especialmente a nivel de
extremos.


b) FORMA TRIANGULAR.
Por el desgaste sufrido, los incisivos van tomando una forma más o menos
triangular cuyo vértice esta hacia la región lingual. Así se puede presentar dicha
forma a las siguientes edades:
- A los 15 años las palas inferiores o mandibulares.
- A los 16 años los medios inferiores o mandibulares.
- A los 17 años los extremos inferiores o mandibulares.
- Para los superiores: 18 a 23 años respectivamente para palas, medios y
extremos.

c) FORMA BIANGULAR.
En este momento el equino es bastante viejo y sus incisivos toman cierta dirección
de manera que observados los superiores y los inferiores forman hacia la cavidad
bucal un ángulo agudo, la posición esta muy distinta a la de los incisivos del
animal joven en que es prácticamente vertical.
Igualmente en la superficie de masticación, se aprecia como que el diente se
hubiera invertido, esto es, que es angosto en el sentido antero – posterior,
conociéndose a esta forma como biangular.

Esta se presenta en las siguientes edades:
18 años: biangulares las palas inferiores.
19 años: biangulares los medios inferiores.
20 años: biangulares los extremos inferiores.

Para los incisivos superiores, la biangularidad aparece de los 21 a los 23 años
respectivamente para cada uno de los tipos de incisivos.


d) SURCO DE GALVAYNE.
Es posible determinar la edad de los equinos, mediante la observación de los
extremos superiores en su cara lateral, externa o labial, ya que ella suele parecer
un surco o depresión partir de la unión de la encía y hacia su parte central,
prolongándose verticalmente hacia la superficie de masticación (borde libre) que
recibe la denominación de surco de Galvayne.

Es bueno para lograr identificarlo, limpiar un poco el diente para separar el sarro o
residuos de comida que pueden ocultar el mencionado surco.

Este surco o depresión aparece así:

- Se observan en la parte superior y media del extremo superior.
A los 15 años el surco se ha extendido más o menos hasta la mitad vertical del
incisivo.

En el ejemplar adulto, a los 20 años el surco es completo y ha llegado hasta el
borde libre del diente, parece como si el incisivo se hubiera partido en dos
porciones: una anterior y otra posterior.




SALIDA DE LOS PREMOLARES.

TEMPORALES O DE LECHE.
Los premolares 1: aparecen al nacimiento del ejemplar o durante la primera
semana de vida.
Los premolares 2: aparecen en la segunda semana.
Los premolares 3: aparecen entre las 3 – 4 semanas

PERMANENTES.
Los primeros premolares mudan entre lo 2 ½ a 3 años.
Los segundos premolares mudan entre los 3 y 4 años.
Los terceros premolares mudan entre los 4y 5 años.



SALIDA O NACIMIENTO DE LOS MOLARES O MUELAS

Los molares son 12 en total: (6 arriba y 6 abajo). Son permanentes esto es que
nacen una sola vez y no son remplazados.

El primer par de molar nace entre los 9 y los12 meses.

El segundo par molar nace más o menos a los 12 años.

El tercer par molar nace entre los 3 y medio a los 4 años.


Nota: como se dijo anteriormente, en algunos casos puede aparecer un pequeño
premolar adicional en el maxilar superior denominado “diente lobo”, el cual nace
entre los 5 y 6 meses de edad del equino y es de carácter permanente.

En este caso se hablará entonces de 4 pares de premolares en el maxilar superior
y la numeración de adelante hacia atrás será en ese orden, esto es primero a
cuarto premolar.

En los equinos suelen presentarse irregularidades o deformaciones de la
superficie masticatoria, lo cual hace que el equino mantenga la “boca sucia”, esto
es con residuos de forraje, no se tritura bien este y por consiguiente haya
desperdicio y el animal se vea en mal estado nutricional.

En otros casos los premolares y molares, especialmente los del maxilar pueden
presentar posiciones anormales o ectopias (fuera de su sitio natural) que traen
como consecuencia problemas en la masticación o aún dificultades respiratorias.







Figura 3. Dentadura De Los Equinos Según La Edad

Incisivos de leche 6 – 9 mes
Extremos o angulares
naciendo

Incisivos de leche 10 – 12
meses, palas rasadas e
infundíbulo desaparecido

Vista frontal de incisivos
temporales emparejados o
rasados todos. Edad
aproximada 2 años.



Vista lateral incisivos de leche
emparejados, aprox. 2 años de
edad.


Muda de palas o pinzas, vista
frontal. Aprox. 2 ½ a 3 años

Muda de palas o pinzas, vista
lateral. Aprox. 2 ½ a 3 años.


Palas mudadas. Descarna los
medianos. Aprox. 3 años de
edad.


Palas y medianos mudados, las
dos tablas entran en contacto o
uso. Aprox. 4 años de edad


Palas y medianos mudados. Vista
lateral. 4 años.


Palas y medianos mudados.
Comienzan a descarnar los
extremos o angulares. Edad 4
– 4 ½ años.

Iniciación de la muda de
extremos o angulares. Vista
frontal. 4 ½ años.

Muda de extremos. Vista lateral. 4
½ años, colmillo presente.

Muda total de incisivos.
Edad 5 años.


Rasamiento de las palas
mandibulares. Edad 6 años.

Rasamiento de los extremos
mandibulares. Edad 8 años.

Gavilán o cola de alondra.
Es considerado un defecto

Rasamiento de extremos
mandibulares.
Edad 8 años.

Incisivo permanente. Vista lateral.
Edad 9 años. Toman posición
ligeramente oblicua.

Forma redonda de las palas
mandibulares.
Edad 9 años
Incisivos permanentes. Vista
lateral. Edad: mayor de 10
años.

Forma redondeada en palas y
medianos mandibulares. Edad 10
años.

Incisivos permanentes. Vista
lateral. Edad 11 años. Avanza
el desgaste y se inclinan aún
más.

Forma redondeada de las
palas, medianos y extremos
mandibulares. Edad 11 años.

Tomado de Zootecnia General de la UNAD






Incisivo
permanente
rasado

Forma oval
de la sup.
Masticadora

Forma
redondeada

Forma
triangular

Forma
biangular

Incisivo
permanente
o de adulto
rasado. No
existe
delimitación
entre corona,
cuello y raíz.
CAPITULO 2.
LECCION 6. DETERMINACIÓN DE LAS PRINCIPALES CAPAS O
PELAJES EN LOS EQUINOS.


Se entiende por capas o pelajes no solamente al conjunto de pelos y crines que
recubren el cuerpo y el de sus cabos (los cabos son el hocico, la punta de las
orejas, las crines, la cola y las extremidades), sino a las características que estos
presentan en cuanto a su calidad, naturaleza, densidad, disposición, desarrollo,
ondulación y de manera especial su coloración, permitiendo allí diferenciarlo y
reconocerlo entre los demás caballos de manera fenotípica.

El color del pelaje, corresponde genéticamente a la manifestación externa de los
melanocitos (células embriológicamente de origen nervioso), células epiteliales un
poco móviles en la capa profunda de la epidermis, encargadas de dar origen a los
diferentes colores, produciendo básicamente dos tipos de melanina: la eumelanina
(negro) y la feomelanina (marrón). Dependiendo de la mayor o menor cantidad de
una de las dos, se generan tonos oscuros o claros.

De acuerdo al grosor, resistencia, longitud, región corporal del cuerpo que ocupan,
elasticidad, entre otras características del pelo, se pueden distinguir las siguientes
características:

Pelos de cubierta: son la parte principal de revestimiento externo.
Pelos largos: son aquellas de gran diámetro colocado en las crines, tupe, cola, y
menudillo.
Pelos vellos o lana: finos cortos o largos, ligeramente ondulados.
Cerdas: son aquellos pelos burdos, groseros y presentes en la cara interna del
oído ollares y pestañas.
Pelos táctiles o sinusales: de constitución rígida, largos y gruesos presentes en los
labios, cabeza y nariz.

Al nacer el potro se halla cubierto por una especie de lanosidad que generalmente
desaparece alrededor de los 5-8 meses, siendo reemplazado por una capa
diferente a la capa original. La cabeza puede ser un punto de referencia sobre el
color definitivo del cuerpo del caballo.

Para un mejor entendimiento de las capas tomaremos como base la descripción
tomada por el medico veterinario zootecnista J ulio Mario Rodrigues Peña.

Los pelajes se clasifican en dos grandes grupos:

CAPAS SIMPLES.


Son todas aquellas capas que están constituidas en su mayoría por pelos de un
solo color presentándose uniformidad en el cuerpo con excepción de las cerdas de
la crin de la cola o cierto color en los remos.

Estos pelajes a su vez se dividen en:

 Simples totales: en ella tanto el cuerpo como la crin y cola son del mismo
color.

 Simples parciales: en ella el color de la crin, la cola y los remos son
diferentes a la capa general del cuerpo.

Entre las capas simples totales o básicas encontramos tres grupos con sus
respectivos subgrupos así:


BLANCO: capa de poca incidencia donde la mayoría de los pelos que cubre el
cuerpo del animal son blancos presenta las siguientes variedades:


http://www.ansi.okstate.edu/breeds/horses/

Blanco Albino: la piel es de pigmentación rosada y el pelo es blanco, presenta
problemas de dermatitis.
Blanco Plateado: el pelo es blanco generando reflejos metálicos.
Blanco Mate: el pelo es blanco pero en esta ocasión no genera ningún reflejo es
decir es un blanco opaco.
Blanco Porcelana: presenta un color azuloso ya que el color oscuro de la piel se
percibe a través del pelo blanco.
Blanco Amarillento: en el se genera un color cremoso denominado también blanco
sucio.

NEGRO: capa donde casi todos los pelos del animal son de color negro presentan
las siguientes variedades:


Tomada Pesebrera El Puente - Neiva
Negro Azabache: es cuando el color es lustroso, brillante.
Negro Morcillo: ligeramente violáceo.
Negro Peceño: negro desteñido en algunas regiones del exterior

ALAZÁN: pelajes de color rojo amarillento, con crines y cola del mismo color.
Presenta las siguientes variedades


Tomada Pesebrera El Puente - Neiva

Alazán Pálido: es un pelaje casi amarillento.
Alazán Tostado: color similar al color tostado.
Alazán Dorado: pelaje brillante, similar al matiz del oro.
Alazán Bronceado: es más oscuro que el tostado, presentando zonas bronceadas
especialmente en los ijares, muslos y anca.
Alazán Vinoso: capa ligeramente rojiza, similar al vino de cereza.
En el pelaje alazán se puede presentar caballos con crines claras o casi blancas
pero nunca más oscuras que el resto del pelaje y mucho menos negros.

Las capas simples parciales presentan sus grupos así:
BAYO: pelaje amarillento (mezcla de pelos amarillos y blancos predominando los
pelos amarillos) presenta raya de mula y acebraduras, con cabos oscuros, se
presentan las siguientes tonalidades.


http://uco.es

Bayo Claro: color amarillento claro.
Bayo Oscuro: tono subido con relación a la anterior (quemadura).
Bayo Naranja o Naranjuelo: pelos similares al color de la cáscara de la naranja
madura.
Bayo Cervuno: similar al color de los ciervos: es decir fondo bayo o amarillento
con la punta de los pelos negros generando pelajes ligeramente oscuro.

CASTAÑO: color rojizo oscuro parecido al color de la cáscara de la costeña o de
avellana madura (mezcla de pelos rojos y negros predominando los pelos rojos),
presenta crines, cola y remos negros. Es el pelaje de mayor incidencia. Presenta
las siguientes tonalidades:


Tomada Pesebrera El Puente - Neiva

Castaño Claro: matiz apagada, como desteñida.
Castaño Oscuro: ligera, parecido al zaino o al negro peceño. Las regiones de las
axilas, pecho, vientre, ijares entre otras son rojizas.
Castaño Dorado o Boyuno: color rojo encendido, llamado también castaño sangre
de toro o coral, sus cabos son negros.
ISABELA: pelaje habano o café en leche, la cola y los remos son más oscuros que
el resto del cuerpo. Presentándose también animales con remos crines y cola
claras denominándose a esta variedad Isabela dorada o palomino (mezcla de
pelos blancos y amarillos predominando los pelos blancos), sus tonalidades son:


www.3caballos.com

Isabela Claro: color amarillo pálido, con cabos más claros.
Isabela Oscuro: color amarillo oscuro con crin, cola y cabos más oscuros.

RATONERO RUCIO O CISNE: compuesto de pelos grises cenizos con
extremidades y crines negras suele presentar raya de mula y remos asegurados.
Sus variedades son:


http://www.ansi.okstate.edu/breeds/horses/

Ratonero Claro blanquecino pálida.
Ratonero Oscuro: tono negrusco.
Ratonero Ordinario o Común: similar al color de los ratones.


CAPAS COMPUESTAS.


Son aquellas capas compuestas por pelos de dos o más colores, en que estos
pueden aparecer revueltos o bien distribuidos por áreas o zonas perfectamente
delimitadas. Las capas compuestas se dividen así:

Capas compuestas combinadas o entre mezcladas.
Capas compuestas a manchas.

Las capas compuestas combinadas son aquellos pelajes entre mezclados con
mayor, igual o menor proporción de cualquiera de los colores estos son:

TORDO O TORDILLO: capa integrada por pelos blancos y negros entre
mezclados. Denominado también como “moro”.


Tomada Pesebrera El Puente - Neiva

Tordo Claro: mayor proporción de pelos blancos.
Tordo Ordinario: igual proporción de pelos blancos y negros
Tordo Oscuro: predomina los pelos negros, suele presentarse la particularidad
oscura en la cabeza, cuello, y tren posterior, denominándose entonces “moro”.

A su vez el moro presenta las siguientes variedades:
Moro Azul: piel morena y dentro de la combinación de blanco y negro, da visos
azules llamándose moro apizarrado.
Moro Pajizo: color similar a la paja seca.
Moro Rozado (melado): presenta visos rojizos especialmente en el anca, muslos y
costillares.
Moro Verbeno: cabeza oscura o negra y capa blanca rojiza.
Moro Pataconeado: en esta capa los pelos negros de la mezcla se agrupan o
arremolinan en áreas pequeñas más o menos en las costillas, anca y muslos,
asimilando rodajas o patacones.
RUANO O ROANO: capa entre mezclada compuesta por pelos blancos, negros y
rojos (bayos), remos oscuros o negros. Encontramos las siguientes variedades:


www.3caballos.com

Ruano Claro: predominan los pelos blancos.
Ruano Oscuro: predomina los pelos negros.
Ruano Azúcar o Canela: predominan los pelos rojos.
Ruano Ordinario: igual proporción de los tres colores.

ZAINO: es un pelaje entre mezclado de pelos negros y rojos con predominio de los
pelos negros dando visos rojos en el ijar y en el anca.


Tomada Pesebrera El Puente - Neiva

Rocillo: capa integrada por pelos blancos y rojos o ligeramente castaños, conocido
por los caballistas como “color rozado”.




CAPAS COMPUESTAS A MANCHAS.

Son aquellas integradas por pelos de dos o mas colores, pero estos se hayan
dispuestos en manchas perfectas, delimitadas o definidas.

En equinos tenemos la capa pinto o pió:
Capa cuyo fondo son las manchas blancas, alternadas con manchas de otro color.
Esta capa no es aceptada en nuestros caballos de paso.


http://www.ansi.okstate.edu/breeds/horses/

LECCION 7. PARTICULARIDADES DE LAS CAPAS.


Entre las particularidades mas frecuentes en los equinos encontramos:

Rubicana: consiste a que ciertas capas oscuras como el castaño, alazán, zaino,
negro etc. Presentan numerosos pelos blancos por todo el cuerpo a manera de
crines.
Rabicanos: presencia de cerdas claras o blancas en cola.
Lavado: equino con axilas, vientre, ijares y bragada de un matiz mas apagado que
el resto del cuerpo.
Acebrado: es cuando se presentan, fajas negras transversales, especialmente en
los remos, semejantes a las de las cebras.
Raya de mula: franja café u oscura, que se extiende desde la cruz hasta la raíz de
la cola.
Banda crucial: raya oscura que partiendo de la cruz se dirige lateralmente y hacia
abajo sobre el remo anterior, llegando en ocasiones hasta el antebrazo.
Remendado: pelajes con áreas de distintos tamaños y limites irregulares.
Enladrillado: se presentan figuras de pelos oscuros en forma de ladrillo los cuales
se ven en la región del dorso, lomo y en ocasiones en la grupa.
Aleopardado: en capas claras presencia de capas negras parecidas a la del
leopardo.
Carbonaduras o atizonaduras: señales oscuras o negras prolongadas.
Atruchado: sobre pelajes claros se observan pequeñas manchas rojizas o
marrones. Común en equinos tordillos y moros.
Mosqueado: en capas claras, presentan pequeñas manchitas negras.
Características propias de moros y tordillos.
Nevado: en capas oscuras y negras presentan pequeñas manchas blancas.
Hosco: el pelaje se oscurece más en algunas regiones del exterior, como la
cabeza el cuello, el tren posterior y los remos.

BLANCOS DE LA CABEZA.

Estrella: pequeño grupo de pelos blancos de forma irregular localizada en la
frente.

Tomada Pesebrera El Puente – Neiva

Lucero: mancha blanca de mayor tamaño que la estrella y de forma regular o
irregular. Cuando el lucero es prolongado hacia abajo se denomina lucero o listón
corrido o cordón corrido si llega al extremo de la nariz se denomina listón corrido y
prolongados, si el listón es interrumpido se denomina listón interrumpido.

Tomada Pesebrera El Puente – Neiva

Careto: en el prácticamente, dos terceras partes de la cara son blancas la piel
generalmente es rosada o despigmentada; estos equinos pueden tener problemas
de fotosensibilización que ocasiona dermatitis.

Tomada Pesebrera El Puente – Neiva
Listón: banda de pelos blancos sobre fondo diferente que va desde la crines
pasando por el medio de los ojos a los ollares.

Tomada Pesebrera El Puente – Neiva

Malacara o lucero listón ancho: mancha blanca muy grande.


Tomada Pesebrera El Puente – Neiva

Recorte: mancha blanca entre los ollares.

Tomada Pesebrera El Puente – Neiva

Cara blanca: equino de otro color y la cara blanca.


Listón corrido: cuando toca el labio superior o toca ambos labios.
Cuando el blanco de la cabeza toca el labio superior se denomina que el equino
“bebe con el labio superior” o que “bebe blanco”



Tomada Pesebrera El Puente – Neiva


Si la mancha abarca el labio inferior “bebe con el labio inferior”, si ambos labios
son blancos se denomina que el equino “bebe con ambos labios”.

De igual manera suelen encontrarse equinos con manchas rosadas entre los
ollares cubiertos por una vellosidad fina, reseñándose este como “liso de narices”.



BLANCO DE LOS REMOS.


Cuando el pelaje se presenta blanco y con despigmentación de la piel, en la parte
inferior de los remos o extremidades en zonas o áreas de diferentes longitud se
dice que el equino es calzado.

En caballos colombianos de exposición se aceptan manchas blancas o de
pigmentaciones, solo, hasta más debajo de los carpos pero no hasta los
corvejones. Tales manchas no ocasionan un cambio en el nombre que se le da al
color del equino así:





Cuando un caballo posee:

- Una extremidad blanca se le denomina “monoalba”


Tomada Pesebrera El Puente – Neiva

- Dos extremidades blancas se le denominan “dialbo o bialbo”.


Tomada Pesebrera El Puente – Neiva


- Tres extremidades blancas se le denominan “trialbo”


Tomada Pesebrera El Puente – Neiva

- Cuatro extremidades blancas se le denominan “polialbo o cuatrialbo”.


Tomado Pesebrera El Puente – Neiva

En la práctica el factor “calzado” al igual que el careto, predispone al ejemplar que
lo posee a padecer dermatitis, que con el tiempo merma el rendimiento del
ejemplar.
Según la extensión de la mancha blanca en el “factor calzado” los equinos se
clasifican como:

Lunar o corona: pequeña mancha blanca que rodea parcialmente el borde
coronario del casco.

Calzado bajo: mancha blanca desde el casco, pasando por la cuartilla sin tocar el
menudillo.

Calzado: mancha blanca desde el casco hasta el menudillo.

Calzado alto: cuando la mancha blanca cubre el remo hasta tocar la caña.

Calzada muy alta o entero: si la mancha blanca llega al corvejón o la rodilla según
el caso o sobrepasa estas regiones.

Talón externo blanco: mancha blanca en la corona y la cuartilla únicamente del
lado externo.

Talón interno blanco: mancha blanca en corona y cuartilla únicamente del lodo
interno.

Igualmente se puede utilizar esta particularidad del calzado para diferenciar a los
diferentes equinos así:

Calzado de la brida: calzado solo en la mano izquierda.
Calzado de la lanza: calzado del anterior derecho.
Calzado del sable: calzado del remo posterior izquierdo.
Calzado de la fusta: calzado del remo posterior derecho.

Cuando se trata de ejemplares “calzados” es común oír el termino “trabado”
refiriéndose al caballo que es calzado de los remos anteriores, o bien si es calzado
de la mano. Y la pata del mismo lado se dirá entonces: trabado lateral izquierdo o
derecho según el caso; si es calzado de los dos posteriores o en diagonal, esto es
mano y pata opuesta, se le denomina “trastrabado”.


ESPIGAS O REMOLINOS.

Son aquellos pelos que nacieron en dirección diferente a los del resto de la región
en que se encuentran. Pueden ser:

Ordinario: son aquellos que presentan todos los equinos en la frente, garganta,
pecho e ijar.
Extraordinarios: son aquellos remolinos presentes en cualquier otra parte del
cuerpo.

LECCION 8. TIPOS DE CABEZAS EN EQUINOS.

La cabeza del animal puede presentar diferentes formas siendo la más común la
rectangular descarnada, con buena irrigación e inervación.
De acuerdo a la forma del perfil, considerado en toda su extensión o por partes, se
pueden encontrar los siguientes tipos de cabeza:

1.5.1 Cabeza de liebre: Cuando es convexa en el frontal y el resto es ligeramente
plana. Este tipo de cabeza es propia de los potros.

1.5.2 Cabeza Acarnerada: Es cuando casi en su totalidad el frontal es convexo.

1.5.3 Cabeza de Rinoceronte: En ella encontramos un frontal cóncavo. Este tipo
de cabeza hace que el animal genere una mala presentación, demostrando en
algunos casos dificultad al respirar debido a la estrechez de sus fosas nasales.

1.5.4 Cabeza cuadrada: En esta encontramos un perfil rectilíneo y su longitud es
mediana con buena anchura y profundidad. Este tipo de cráneo hace ver al equino
con cierta gracia; es una característica propia de razas orientales como es el caso
de la Berberisca.

Figura 4. Tipos de cabeza Según el Perfil Tomado de Zootecnia General de la UNAD

Cabeza Acarnerada

Cabeza de Liebre

Cabeza Normal

Cabeza de Rinoceronte

Cabeza Cuadrada


LECCION 9. TIPOS DE CUELLOS EN EQUINOS.


Por lo general la forma del cuello es ligeramente piramidal, en donde su borde
superior tiene especial atracción en la estampa del animal.
Su morfología depende de cada animal, el cuello debe guardar armonía entre la
cabeza y el cuero. Se puede dividir en cuatro partes:

- Línea dorsal.
- Línea ventral.
- Lado lateral derecho.
- Lado lateral izquierdo.

De acuerdo con la forma, se conocen las siguientes variedades, algunas de las
cuales son propias y típicas de ciertas razas; otras en cambio se constituyen en
defectos, así pues, tenemos:

*Cuello de gallo o pichón: Es aquel cuello que presenta una convexidad o un
ligero arqueamiento en el borde superior.

*Cuello de cisne: Es aquel que presenta un arqueamiento mas pronunciado en la
unió de la cabeza y el cuello y el resto del borde es mas o menos recto.

*Cuello de ciervo o invertido: Aquí el borde superior se presenta cóncavo y el
inferior ligeramente redondeado o contorneado. Es común encontrarlo en animales
viejos o desnutridos. Desde luego este tipo de cuello es considerado defecto,
aunque en algunos caballos esto favorece la velocidad y puede aceptarse así,
siempre y cuando no sea exagerado.

*Cuello débil: Por lo general se presenta largo, muy descarnado, estrecho, poco
profundo especialmente en su parte anterior. Este cuello se presenta en animales
en mal estado nutricional y de salud, desmeritando de esta manera el buen
desempeño y resistencia ya que casi siempre un cuello delgado corresponde a un
pecho angosto y débil.

*Cuello golpe de hacha: En este tipo de cuello se presenta en su borde superior en
el punto de unión con la cruz una hendidura o depresión marcada.

*Cuello común o piramidal: Es el más común, debe ser largo y recto.

Cuando el borde superior del cuello es muy grueso, se dice que el animal presenta
GATILLO y desde luego constituye defecto en especial en caballos de
competencia y en los de silla.
Equinos dotados de un cuello corto y macizo son poco manejables, carecen de
elegancia y son denominados como CUELLO DE TORO. Otros ejemplares
pueden presentar una depresión en la tabla del cuello, especialmente hacia su
parte posterior e inferior, cerca a la espalda y brazuelo, que se conoce con el
nombre de LANZADA, que es considerada por algunos caballistas como signo de
clase, aunque esto no tiene ningún fundamento.

Es de aclarar que las personas encargadas del adiestramiento y en general el
manejo de los equinos, deben saber, que la posición, longitud y características del
cuello corresponden a su constitución anatómica determinada por la herencia y
por lo tanto no se debe forzar al animal a tomar posiciones o a quebrar o voltear la
cabeza en forma brusca, ya que con ello solo se causa dolor y traumatismos a
nivel de las vértebras o inserciones musculares (luxaciones o esguinces) que
pueden producir merma en el rendimiento del animal y aun inhabilitarlo por
temporal o permanentemente según la gravedad de la lesión.

El borde superior del cuello encontramos la crin o crinera que en cuanto sea mas
larga, espesa o abundante y brillante, mayor es la vistosidad del equino.

La crin debe ir hacia un solo lado, cuando se presenta a un lado y al otro se dice
que la crin es iguanera.

Figura 5. Tipos de cuello

Cuello de Gallo o de Pichón

Cuello Normal o Corriente

Cuello de Cisne

Cuello de Golpe de Hacha o
Hachazo

Cuello de Ciervo o al Revés

Cuello Débil
Tomado de Zootecnia General de la UNAD

LECCION 10. APLOMOS.


Los aplomos son la dirección más conveniente de los miembros locomotores en
toda su longitud o de las diferentes regiones por separado, con relación al suelo o
base de sustentación, de manera que pueda sostener bien el cuerpo para
desplazarse de manera segura y fácil. Para poder observar bien los aplomos es
necesario que el animal se encuentre bien parado sobre sus cuatro remos y
posteriormente hacerlo desplazar al paso o corriendo.

Se determinan mediante líneas imaginarias trazadas desde diversas partes del
exterior del equino hasta el suelo, tomando como punto de referencia entre otras,
algunas articulaciones.

Los defectos en los aplomos pueden ser congénitos o adquiridos. Así pues los
analizaremos de la siguiente manera:

APLOMOS DE LA EXTREMIDAD ANTERIOR.

- Vista de frente.
En ella, la línea imaginaria sale de la parte media o delantera del encuentro, debe
caer al suelo dividiendo en dos partes iguales el resto del miembro anterior que
recorre. Este se toma desde la punta de la espalda.

Se denomina abierto de adelante cuando la línea imaginaria o plomada queda
por dentro y el miembro por fuera, pudiendo ser unilateral o bilateral.

Es cerrado de adelante cuando la plomada queda por fuera y el miembro por
dentro.

El animal cerrado de adelante posee una base de sustentación menos firme y
puede originar un movimiento hacia los lados denominado cuneo.

Otra línea imaginaria o plomada se toma desde el antebrazo, partiendo de la parte
superior y anterior y mas estrecha del antebrazo, debe dividir el resto del miembro
que recorre en dos partes iguales.

Si la plomada queda por dentro y la rodilla por fuera, se dice que el animal es
hueco de rodillas.

Si las rodillas quedan por dentro y la plomada por fuera, se dice que el animal es
zambo o de rodillas boyunas. En ambos casos son defectos de rotación, donde
el miembro se rota quedando las lumbres hacia adentro y el codo hacia afuera;
cuando las lumbres se aproximan se dice que el animal es estebado. Pero si por
el contrario al rotar el miembro las lumbres quedan hacia afuera y el codo se dirige
a los costillares, se dice que el animal es izquierdo.

Figura 6. Aplomos y Defectos del Tren Anterior, vista de frente

Normal

Abierto de adelante

Rodillas boyunas



Cerrado de adelante

Zambo o Chueco Hacia
Adentro

Patizambo o Chueco Hacia
fuera



Izquierdo

Chapín o Estevado
Tomado de Zootecnia General de la UNAD

- Vista de lado (lateral) o de perfil.
La plomada parte desde la parte media y más anterior del encuentro, debe caer
aproximadamente unos diez centímetros por delante de las lumbres del casco.

Se denomina plantado de adelante cuando la distancia entre las lumbres del
casco y la línea imaginaria es muy corta. Si por el contrario la línea imaginaria
queda muy distante (a mas de diez centímetros) se dice que el animal es
remetido de adelante.

Puede suceder que el aplomo del encuentro hasta el menudillo sea normal, pero
que del menudillo a la cuartilla haya mucha distancia lo cual ocasiona el animal
pando o largo de cuartilla.

Si por el contrario, del menudillo a la cuartilla la distancia es muy corta el animal se
llama estaquillado o emballestado, y puede ocasionar el topino que es cuando
el miembro correspondiente se esta apoyando en las lumbres del casco.

Cuando la plomada o línea imaginaria parte desde la parte superior, media y
externa del antebrazo, debiendo tocar el suelo un poco por detrás de los talones
del casco y dividir en dos partes iguales la rodilla, caña y menudillo.

Si las rodillas quedan por delante y la línea imaginaria por detrás se dice que el
animal es corvo o bracicorvo. Si la rodilla queda por detrás y la plomada por
delante se dice que el equino es trascorvo o de rodillas de carnero. Este se
considera un defecto grave debido por mala nutrición en las primeras etapas de
vida o por defectos genéticos.

Figura 7. Aplomos y Defectos del Tren Anterior, vista de perfil

Normal

Plantado

Remetido



Corvo

Trascorvo
Tomado de Zootecnia General de la UNAD
APLOMOS DE LA EXTREMIDAD POSTERIOR.

- Vista posterior.
Cuando la plomada se inicia de la parte media del isquion, debe dividir el miembro
que recorre, en dos partes más o menos iguales siendo un poco mas ancha la
parte de la nalga externa y debe tocar la punta del corvejón dividiéndolo en dos
partes iguales hasta el suelo.
Si la plomada queda por dentro y la extremidad por fuera, se dice que el animal es
abierto de atrás; lo contrario se denomina cerrado de atrás.
Si la punta del corvejón queda por dentro de la plomada se dice que el equino es
zancajoso, en general todos los caballos son zancajosos.
Si los corvejones quedan por fuera y la plomada por dentro se dice que el animal
es hueco de atrás o de los posteriores.

Si la línea imaginaria que partiendo de la punta del corvejón dividiendo el miembro
en dos partes iguales, queda por dentro y el miembro por fuera se dice que el
caballo es abierto de cañas y por el contrario, si la línea queda por fuera y el
miembro queda por dentro se dice que el caballo es cerrado de cañas.

Figura 8. Aplomos y Defectos del Tren Posterior, vista posterior

Normal

Abierto de Atrás

Cerrado de Atrás


Cerrado de Corvejones e Izquierdo

Abierto de Corvejones y Chapín
Tomado de Zootecnia General de la UNAD

- Vista de lateral o de perfil.
Desde la articulación coxofemoral, la línea sale de la parte media y más saliente
de la articulación coxal, debe caer dividiendo en dos partes mas o menos iguales
los cascos, dejando por detrás las cañas y al menudillo, siendo paralelas a estos.
Si no divide el casco en dos partes iguales, quedando el miembro por detrás de la
plomada se dice que el animal es plantado de atrás, si la plomada que da por
detrás y el resto del miembro por delante se dice que el animal es remetido de
atrás o sentado de las posteriores. De igual manera puede suceder que la caña
y el menudillo sean normales y que la línea imaginaria caiga por detrás de la parte
media del casco, se dice entonces que el animal es pando de atrás, largo de
cuartillas o emballestado de atrás.

Puede suceder que de este mismo aplomo la planicie del corvejón pierda el
ángulo, se dice que el caballo es enzancado o patas de riel o de poste,
generalmente este defecto es genético.

Figura 9 Aplomos y Defectos del Tren Posterior. Vista lateral

Normal

Remetido de Atrás

Plantado de Atrás
Tomado de Zootecnia General de la UNAD

CAPITULO 3.
RAZAS EQUINAS.

LECCION 11. CONCEPTO DE RAZA.

Se define raza como un conjunto de individuos que poseen caracteres
morfológicos y fisiológicos llamados etnológicos o raciales semejantes, o que
están identificados en cuanto a su origen, dinámica o estética, es decir que
proviniendo de una misma cepa de origen se asemejan en su aspecto físico y
cualidades fisiológicas y productivas. Estas características además son
transmitidas a sus descendientes como caracteres hereditarios comunes.

Entre estas razas describiremos las de mayor importancia en el país, tanto en
animales de silla o tiro liviano como de animales de tiro pesado y ponis.

LECCION 12. DIVERSIDAD EQUINA.







www.elrincondelascuatropatas.com

Según la doctora Monica Menjalbert dentro de la misma especie, los hay
pequeños, algunos con cabezas que parecen talladas a mano y los colores de sus
pelajes son tan diversos que nos quedamos maravillados al verlos en algún
acontecimiento ecuestre.

Esta diversidad encuentra su respuesta si nos trasladamos a una llanura en medio
de una tropilla de caballos, podremos observar que si nos encontramos en una
región de clima frío, las cabezas de los mismos tendrá una caña nasal convexa, lo
cual es esencial para sobrevivir al aire helado del invierno. En cambio, si nos
encontramos en un desierto, las cabezas serán más pequeñas, con un perfil
cóncavo con ollares grandes y bien abiertos, dado que el aire que respiran es más
cálido.
Comentario [1]: <div
style="float:right;padding-
left:5px;margin-left:4px;">
Comentario [2]: BEGIN
STANDARD TAG - 300 x 250 -
ROS: Run-of-site - DO NOT
MODIFY
Comentario [3]: <IFRAME
FRAMEBORDER=0
MARGINWIDTH=0
MARGINHEIGHT=0
SCROLLING=NO WIDTH=300
HEIGHT=250
SRC="http://ad.adfunky.com/st?ad
_type=iframe&ad_size=300x250&
section=492303"></IFRAME>
Comentario [4]: END TAG
Comentario [5]: </div>

Por lo que la adaptación al ambiente en el que viven, producirá cambios en la
morfología de sus cuerpos. Encontrándonos aquí con un ítem importantísimo en la
evolución de la especie equina. Además, hay que sumarle la mano del hombre en
la formación de las diferentes razas equinas, basándose en el uso que les darían a
sus caballos, recordemos que hasta principios del siglo pasado, nuestro amigo
equino era el principal medio de transporte terrestre. Teniendo en cuenta la mano
del hombre, encontramos la explicación de porque hay tanta diversidad en los
tamaños de los caballos.

Con respecto a la diversidad en los colores de sus pelajes, tenemos que tener en
cuenta que en estado salvaje, en las llanuras, debían mimetizarse con el medio
ambiente para no ser presa fácil de sus depredadores, por lo que se dice que el
caballo con pelaje color bayo (café con leche) es el más puro, dado que con este
pelaje podían confundirse fácilmente con las pasturas de los llanos.

Pero con la domesticación el caballo, seguida por la formación de diversas razas,
nos encontramos con una amplia gama de colores en los pelajes, desde el negro
azabache, pasando por los diferentes tonos de zainos (marrones) hasta llegar al
blanco. En este punto quisiera comentar un hecho muy particular: hay potrillos que
nacen totalmente negros, pero con el pasar de los años, su pelaje se vuelve
tordillo (gris) y en la madurez su pelaje va a ser completamente blanco, pero
conservara el color negro de su piel. Es un hecho que encuentra una explicación
en el campo de la genética.

Hasta aquí nos encontramos con los siguientes ejemplos de la diversidad en la
especie equina:
•Características morfológicas (alzada, características en la cabeza: ojos, orejas,
ollares, caña nasal), las cuales se han afianzado en relación al medio ambiente
que rodea a cada caballo con la intervención de los seres humanos que
moldearon a sus necesidades creando razas especificas equinas.
•Características en los pelajes, en este punto y continuando con lo dicho
anteriormente, les quería comentar que la genética juega un papel importantísimo,
a pesar que hay razas que deben tener un color de pelaje especifico, siempre
nacerá algún individuo que este fuera del standard de cada raza, porque esta
característica es manejada por los genes.
Para entrar en el campo de las razas equinas, les comento que se han separado,
según la utilización de los mismos en dos grupos:
•Animales de sangre caliente: caballos deportivos, ágiles, livianos, elegantes y
aquí nos encontraremos con los Árabes, los cuales constituyen la raza mas pura,
antigua y base para la creación de todas las razas deportivas, como por ejemplo,
el archiconocido pura sangre de carreras, el caballo español, el cuarto de milla, el
criollo y todas las razas destinadas al salto de obstáculos (trakhener, silla
argentino, angloaraba, silla francés, etc.).
•Animales de sangre fría: caballos utilizados para tareas de transporte de
personas, para trabajos rurales y todo lo relacionado con el uso de la fuerza motriz
proporcionada por estos equinos, caracterizados por ser de gran alzada, con
pesos que oscilaban entre los 600kg y 1200kg, de carácter muy tranquilos. Dentro
de este grupo tenemos a los percherones, al caballo de tiro argentino, el norfolk,
etc.), en general podemos decir que cada país europeo tenia su raza de caballo de
tiro, actualmente, al no ser utilizados, quedan muy pocos criadores, estos
animales se usan en ocasiones especiales para fiestas tradicionales o para
trabajos específicos en lugares montañosos que no pueden ser realizados con
vehículos.

Debemos aclarar que muchas razas actuales, se han formado a partir de realizar
cruzas entre estos dos grupos, lo cual ha sido muy beneficioso, dado que se han
combinado cualidades de ambos formando animales excelentes.




www.hormiga.or
g.com




LECCI
ON 13.
RAZAS
DE
SILLA
Y DE
TIRO
LIVIAN
O.

ÁRABE
.




www.caballomania.com


Origen: Arabia (Egipto especialmente)
Clasificación: Eumétrico por peso, mesomorfo por proporciones y rectilíneo o
ligeramente cóncavo por perfil.
Alzada: 1.40 – 1.50 m.
Cabeza cincelada, con frente ancha, en ocasiones ligeramente chata, ojos
salientes, grandes y brillantes, señalando inteligencia y buen carácter, orejas
cortas y erguidas.
Tupe de crines sedosas.
El cuello es piramidal, ligeramente arqueado, largo, presentando una crin larga y
fina. Pecho robusto y ancho. Cuerpo compacto y musculoso con línea dorsal casi
horizontal, grupa ancha y casi nivelada. Extremidades fuertes, estilizadas y largas
en sus cañas. Cola corta, de implantación alta (llevada en arco).
Colores de la capa: tordillo, negro, moro, alazán, y castaño entre otros.
Peso: 400 – 450kg.

La raza Árabe es una de las más antiguas que ha influido más que en ninguna
otra en la población y en el mejoramiento de otras razas de todo el mundo.

La impresión general es la de un animal fogoso y alegre que, no obstante posee
un temperamento dócil. Es excelente para soportar grandes distancias sin
cansancio, aún desplazándose a veloz carrera.


Del caballo árabe se ha dicho que posee:
Cuatro cosas anchas: la frente, el pecho, la grupa y las articulaciones.
Cuatro cosas largas: el cuello, las cañas, el anca y el vientre.
Cuatro cosas cortas: el lomo (riñones) las cuartillas, las orejas y la cola.

Es considerado el padre de todas las razas por su influencia más que ningún otro,
en la formación de buen numero de razas de todo el mundo.




ANGLO – ÁRABE.


www.mascotamigos.com




Se le conoce como “pura sangre francesa” fue el resultado de cruzar ejemplares
árabes y pura sangre ingles (P.S.I.). Combina por lo tanto la entereza y resistencia
típica del árabe. Con la velocidad y resistencia también del P.S.I.
Alzada: de 1.60 – 1.63 m.
Peso: 450kg.
Colores de la capa: castaño, alazán y bayo.
Se utilizan para concursos hípicos en el ejército, policía y aficionados particulares.
Son ejemplares de mucha velocidad y algo de fondo.









BERBERISCA.


www.mascotamigos.com





Origen: Costa de Berberia.
Se cría principalmente en Libia, Argelia y Marruecos. También en algunos países
de Europa.
Clasificación: Eumétrico, mesomorfo y sub – convexilíneo por perfil.
Alzada: 1.40 – 1.50 m.
Cabeza larga, sub – convexilínea, cuello recto, fuerte, redondeado y provisto de
crin larga y sedosa. La cruz algo mas saliente que en el Árabe, hace ver entonces
el lomo ligeramente hundido. La grupa es a menudo cortante, ligeramente caída y
corta. La cola de implantación baja, con muchas crines y poco elegante.
Extremidades medianas, de cañas delgadas y finas, espejuelos pequeños que
pueden faltar en ocasiones en los remos posteriores.
Colores de la capa predominante: bayo, alazán, negro, tordillo y blanco.
Peso: 430 kg.
Sin ser el más elegante de los equinos, es inmensamente sufrido y combina una
considerable velocidad en distancias cortas con una gran resistencia de fondo. La
actitud general es la silla y como caballo de tropa, además de transición de
carruajes liviano.
THOROUGHDREED O P.S.I. (PURA SANGRE INGLESA)


http://blogs.sawebsos.com/index.php/mascotas/2007/02/13/el_caballo

Origen: Inglaterra.
Clasificación: Eumétrico, longilíneo. Sub-convexilíneo. (Intervinieron en su
formación caballos árabes y posiblemente berberiscos).
Alzada: 1.60 – 1.70 m.
Cabeza aristocrática, pequeña y de frente ancha de perfil ligeramente ondulado,
orejas medianas, finas y bien puestas .cuello recto, largo, delgado y flexible; tórax
alto y profundo. Cruz elevada, dorso recto. Grupa larga y casi horizontal. Cola con
excelentes crines. Vientre recogido (de galgo).
Extremidades largas finas, sin exceso de musculatura. Piel delgada y flexible,
recubierta de pelo corto, de crines de cuello gruesas no muy abundantes.
Peso: 400 – 450 kg.
Colores de la capa: alazán castaño, zaino, negro, moro tordillo.
El P.S.I; ha sido igual que su progenitor el árabe, mejorado de otras razas equinas
en diferentes partes del mundo, tanto de equinos de silla como de los ponis. Su
actitud es la velocidad y por lo tanto dentro del grupo de caballo de silla es el
prototipo de “carreras” por excelencia.
QUARTER HORSE.


www.relinchando.com

ORIGEN: norteamericano - sur de estados unidos - Texas (King Ranch).
Clasificación: Eumétrico, hipermétrico, longilíneo y de perfil, mas o menos plano o
ligeramente sub- convexilíneo.
Es el producto de un cruzamiento Inter-recurrente entre razas americanas criollas
(de ascendencia española), la raza árabe, la P.S.I. y la percherona.
Alzada: 1.52 – 1.55 m.
Cabeza cuadrada con orejas cortas.
Posee un fuerte esqueleto, con macizos y poderosos cuartos traseros, hombros y
brazos fuertes, lomo corto y musculoso. Debe su nombre a las carreras de cuartos
de milla en la que compite y para los cuales es especialista.
Colores de la capa: se aceptan cualquier capa predominando, alazán, castaño y
zaino.
Su inteligencia y enorme agilidad hace de el una montura acta para la conducción
del ganado o para todo tipo de actividades ecuestres de recreo.
Peso: 550 – 650kg.
Dentro del grupo de equinos de silla se le considera el típico “caballo de vaquería”,
y de los campesinos que “viven y mueren” montados en sus cabalgaduras.
TRAKEHNER.


www.solocaballo.com.ar

Origen: alemán, desarrollada por el rey Federico Guillermo I (de Prusia).
Clasificación: Eumétrico – hipermétrico, mediolíneo y perfil rectilíneo o ligeramente
cóncavo.
Se obtuvo mediante el cruzamiento del antiguo caballo pequeño lituano, con
padrillos árabes y berberiscos, a cuya descendencia se les agrego sangre P.S.I.
Alzada: de 1.60 – 1.62 m.
Cabeza de tamaño mediana, con orejas pequeñas. Cuello largo algo arqueado, un
poco descarnado, tronco mediano, de Línea dorsal fuerte; grupa ancha,
musculatura fuerte, con cola de desprendimiento alto. Extremidades largas y finas.
De bajo peso: 450 – 600 kg.
Dentro del grupo de equinos para silla se reutiliza como “caballo de salto”, en tanto
que los de menor alzada son utilizados como “caballos de polo”.





PALOMINO.


http://www.ansi.okstate.edu/breeds/horses/

Origen: estados unidos.
Clasificación: Eumétrico, mediolíneo y de perfil mas o menos planos.
Alzada de 1.55 – 1.60 m.
El fenotipo de estos equinos es muy parecido al del quarter horse y algo al del
árabe.
La característica principal es la de su pelaje Isabela o alazán, pero con crines y
cola largos. Sus ojos son claros (zarcos), se admiten señales blancas en las patas
y cara. Los potrillos tienden a oscurecer con la edad.
Se utilizan también como “caballos de salto o de polo”.
Peso: 500 kg.



MORGAN


http://www.ansi.okstate.edu/breeds/horses/

Origen: Estados unidos.
Clasificación: eumetrico, mediolineo y de perfil ligeramente sub-concabilineo.
Alzada: 1.52 – 1.55 m.
Es un pequeño caballo de enorme vigor físico, elegante, dócil, ligero y de gran
fondo. Posee buena conformación dotado de hombros fuertes y extremidades
cortas y musculosas, y con cascos duros.
Colores de la capa: zaino, castaño, alazán y bayo
Se utiliza tanto como caballo de silla (recreo) así como para tiro liviano.
Peso: mas o menos 500 Kg.








HOLSTEIN


http://www.ansi.okstate.edu/breeds/horses/

Origen: Alemania.
Clasificación: Eumétrico – hipermétrico, longilíneo y rectilíneo por perfil.
Alzada: 1.53 – 1.62 m.
Cabeza larga y fina orejas pequeñas y vivaces. Es de constitución vigorosa, con
amplia cavidad toráxica y fuertes cuartos traseros. Extremidades cortas delgadas
pero finas.
Colores de la capa: negro, castaño y bayo.
Peso: 60 Kg.
Es un caballo de buen temperamento, inteligente y voluntarioso para el trabajo, se
le emplea como animal de tiro ligero, velocidad y de paseo.








TENNESSEE.


http://www.ansi.okstate.edu/breeds/horses/

Origen: estados unidos.
Clasificación: Eumétrico, longilíneo y de perfil casi plano.
Alzada: de 1.50 – 1.52 m.
Cabeza esbelta y orejas medianas y alertas. Cuello fuerte y de gran estampa (de
gallo). Crin larga sedosa, abundante, tronco largo, tren posterior vigoroso. Cola
llevada en “arco o en trompa” lo que le da una atractiva estampa. Extremidades
largas, de mediano grosor pero bien aplomadas.
Colores de la capa: negro, alzan, bayo y zaino.
Es una excelente raza para silla con una modalidad de movimiento entre el paso y
el trote, de desplazamiento rítmico y suave. Su temperamento es tranquilo,
hombros particularmente poderosos y patas fuertes.




HANNOVERIANO.


http://www.ansi.okstate.edu/breeds/horses/

Origen: Alemania.
Clasificación: hipermétrico – longilíneo – rectilíneo por perfil.
Alzada: 1.60 – 1.70 m.
Cabeza larga y esbelta, con orejas cortas. Cuello largo, robusto, con crines densas
y finas. Anca fuerte, Cola larga con abundantes cerdas, alta en su nacimiento.
Extremidades largas y finas.
Colores de la capa: castaño, alazán, bayo y negro.
Peso: 480 – 600 Kg.
Es una raza de gran talla, fuerte, erguida. Valiente y trabajador, el caballo
hannoveriano es utilizado como caballo de salto y para ceremonias, ya que su
marcha, es muy elegante, con movimientos largos, algo saltados. (Como trote
corto).






PASO COLOMBIANO.


Tomada Pesebrera El Puente – Neiva

Origen: Formación colombiana, pero con ancestro ante todo español.
Clasificación: Eumétrico, mediolíneo, rectilíneo o ligeramente convexilineo.
Alzada: 1.46 – 1.48 m.
Su formación genética se basa en sus ancestros árabes, berberisco y andaluza,
razón por la cual se encuentran hoy en día, diferencias marcadas en los llamados
caballos criollos.
Su cabeza es esbelta, parecida a la del árabe o del berberisco, con frente ancha y
orejas cortas bien colocadas. Cuello esbelto bien del tipo gallo o del tipo cisne, con
una crin abundante, larga y sedosa. Tronco mediano, con masas musculares
aceptables, de buena profundidad y amplitud, anca redonda, ligeramente
inclinada. Cola llevada como en pluma o llamada también partida con cerdas
largas, finas, sedosas y ligeramente onduladas.
Extremidades medianas, fuertes y bien aplomadas.
Colores de la capa: castaño, moro, zaino, bayo, alazán, negro, bayo cervuno,
tordillo rocillo, roano y rucio.
Peso: 450 Kg.

Teniendo en cuenta el origen del caballo de paso fino, parece haber heredado
cualidades físicas, de trabajo y de comportamiento así:
La elegancia de sus movimientos la pudo haber heredado del andaluz; el brío y la
perfección de las líneas del árabe y la calidad y resistencia (fondo) del berberisco.

Dentro de los caballos de silla, se les utiliza como ejemplares de recreo y
transporte, en las modalidades de paso, trocha pura, trote y galope, trocha y
galope. Los aires de nuestros equinos son reconocidos en todo el mundo por su
elasticidad y suavidad, por la exactitud de sus movimientos, su buen ritmo, su
cadencia y por su elegancia.

En los pasos de nuestro país se destacan cuatro modalidades.

El paso fino Colombiano es un “aire de marcha corta”, en el que el equino se
desplaza por bípedos “laterales”, esto es mano y pata del mismo lado, en
sucesivas batidas de sus remos, pudiéndose oír en pistas sonoras o piso duro
cuatro golpes seguidos correspondientes a la colocación alternante de sus remos
en el suelo. Los movimientos rítmicos, flexionando sus articulaciones y levantando
muy poco las extremidades del piso, por lo cual es el movimiento más seguro y
suave.
Este paso es un poco complejo de entender por lo que se realiza en 8 tiempos,
así:
En el primer tiempo la mano derecha esta en el aire y las tres extremidades
restantes en el piso.
En el segundo tiempo mano derecha y pata izquierda en el aire, extremidades
restantes en el piso.
En el tercer tiempo la pata izquierda esta en el aire y las extremidades restantes
en el piso.
En el cuarto tiempo la mano izquierda y pata izquierda en el aire, extremidades
restantes en el piso.
En el quinto tiempo la mano derecha e izquierda en el aire, y las extremidades
posteriores en el piso.
En el sexto tiempo la mano izquierda y la pata derecha en el aire y las
extremidades restantes en el suelo.
En el séptimo tiempo la pata derecha en el aire y las extremidades restantes en el
piso.
En el octavo tiempo la mano y pata derecha en el aire y las extremidades
restantes en el suelo.
Los equinos de paso fino Colombiano poseen una gran elasticidad en su tren
posterior lo que da una suavidad y tranquilidad en su anca.

El trote y galope es un “aire de marcha alta “en el que el equino se desplaza por
“diagonales” esto es mano y pata opuesta, pudiéndose oír en suelo duro dos
golpes o tiempos seguidos correspondientes a la colocación simultanea de sus
bípedos (mano y pata opuestas) en el primer tiempo encontramos mano izquierda
y pata derecha y el segundo tiempo mano derecha y pata izquierda. El movimiento
es igualmente suave, rítmico, el avance es mayor comparado con el paso fino en
la pista suena TAS, TAS, TAS, TAS.
En cuanto al galope es un movimiento de tres tiempos con apoyo posterior,
marcando el primer tiempo en una de los miembros posteriores, el segundo tiempo
con la otra pata y mano opuesta y el tercer tiempo con la mano contraria. Con sus
remos posteriores se impulsa y con los anteriores avanza, escuchándose en la
pista un sonido similar a CATORCE, CATORCE, CATORCE, CATORCE.

La trocha y galope también es en “aire de marcha alta”, parecido al trote, pero algo
descompuesto, acá también se desplazan por “diagonales” pero se demora mas
en colocar en el suelo la mano que la pata opuesta y por esa razón también se
pueden oír cuatro golpes al tocar el piso, uno por cada remo colocado.
La trocha la realiza en cuatro tiempos en la cual el equino mueve en forma alterna
mano y pata opuestas, pero el animal asienta primero la mano derecha primer
tiempo, luego la pata izquierda segundó tiempo, mano izquierda tercer tiempo y
pata derecha el cuarto tiempo, generando un sonido similar a TRAS, TRAS,
TRAS, TRAS.
El galope es un movimiento de tres tiempos con apoyo posterior, se marca el
primer tiempo con uno de los remos posteriores el segundo con el otro remo
posterior y mano opuesta y el tercer tiempo con la mano contraria, se genera un
sonido similar a CATORCE, CATORCE, CATORCE, CATORCE.

La trocha pura es un ritmo cuyos movimientos son diagonales en 4 tiempos en el
cual el caballo mueve en forma alterna mano y pata opuestas, mano derecha, pata
izquierda, mano izquierda, pata derecha; pero el animal asienta primero la mano
derecha (primer tiempo), luego pata izquierda (segundo tiempo), mano izquierda
(tercer tiempo), pata derecha (cuarto tiempo).Posee mas velocidad que los
trotones.
En la pista suena TRAS, TRAS, TRAS, TRAS, TRAS.
Esta modalidad solo ejecuta el ritmo de la trocha más no el del galope.

Del caballo “se ha dicho” que debe tener algunas cualidades tanto del hombre
como de algunos animales, así:

Del zorro: agilidad, ligeraza, cola al aire.
Del gallo: ojo vivo, pecho ancho y elegancia.
Del buey: pisada firme, fortaleza y mansedumbre.
Del cura: nuca gruesa, testículo largo, buen apetito.
De la mujer: nalga redonda, buenos movimientos, manso al montar.


LECCION 14. RAZAS DE TIRO PESADO.


PERCHERONA

http://ar.geocities.com

Origen: Región de perche en Francia.
Clasificación: Hipermétrica, mesomorfa y rectilínea.
Alzada: 1.52 – 1.70 m. (variedad mediana y grande).
Cabeza cuadrada, pesada, de frente plana y corta, orejas pequeñas, boca grande,
cuello robusto, con el borde superior convexo y el inferior recto. Tronco cilíndrico,
poderosamente musculado, con pecho y lomo ancho, grupa muy potente, apenas
ligeramente inclinado. Extremidades de largo a mediano, cascos generalmente
grandes y muy apreciable la cerneja.
Color de la capa: predominan los tordillos y los moros en ocasiones pataconeados,
así mismo pelajes negro y zainos.
Peso: fluctúa entre 600 – 900 kg. Según el tipo que se considere.
Es una raza fuerte, pesada bien proporcionada. Se le utiliza como trotador de tiro
pesado.

BELGA (variedad brabanzón).


http://agronomia.uchile.cl

Origen: Bélgica.
Clasificación: Hipermétrica, braquimorfa y de perfil próximo al tipo rinoceronte.
Alzada: 1.65 – 1.75m.
Cabeza cuadrada ancha, musculosa, con perfil de rinoceronte (ligeramente
hundido el nasal) orejas pequeñas. Labios gruesos, cuello corto, musculoso, con
borde superior ligeramente arqueado y crin abundante y doble (le cae a lado y
lado) con crines largas gruesas y rizadas. La cruz es ancha carnosa y baja. Tronco
más o menos corto cilíndrico grueso, línea dorsal ancha y hundida, grupa ancha,
doble, redondeada, y musculosa, con la cola de inserción baja y poco poblada.
Extremidades largas. Muy desarrolladas muscularmente, especialmente en las
regiones del muslo y dé la pierna. Cerneja desarrollada, que abarca parte de las
cañas.
Color de la capa: zaino, alazán, castaño, bayo.
Peso: puede sobrepasar los 1000 Kg.
Constituye un caballo de tiro apacible (lento) con paso firme extraordinario poder
de arrastre. Es algo voluntarioso.

SHIIRE.


http://www.ansi.okstate.edu/breeds/horses/

Origen: condados centrales (Shires) de Inglaterra. Desciende del antiguo caballo
negro irlandés, cuyos antepasados fueron los grandes caballos medievales.
Clasificación: hipermétrica, braquimorfa, convexilíneo.
Alzada: hasta 1.80 m. es una de las razas más corpulentas del mundo.
Cabeza grande larga, acarnerada, orejas cortas. Cuello largo y grueso, profundo a
nivel de la inserción con el tronco. Cruz alta, dorso corto, ancho musculoso. Grupa
larga y ancha, musculada y casi horizontal.
Cola de inserción baja. Extremidades largas, fuertes con pelos largos que se
manifiestan principalmente en la rodilla y el corvejón hacia abajo, determinando las
rodillas “patas peludas con polainas”. Casco grande.
Colores de la capa: negro, castaño, moro pataconeado, zaino, tordo y bayo.
Peso: oscila entre 800 – 1000 Kg. Pero hay ejemplares que llegan hasta los 1200
Kg.
Raza excelente para desplazar cargas de varias toneladas, excelente para labores
agrícolas y como animal de tiro urbano.
CLYDESDALE.


http://www.ansi.okstate.edu/breeds/horses/

Origen: Gran Bretaña (valle del clyde).
Clasificación: hipermetrica, mesomorfa, rectilíneo.
Alzada: 1.62 – 1.70 m.
Cabeza grande de perfil recto, orejas grandes, móviles algo caídas. Cuello fuerte
macizo, de longitud mediana, cruz algo alta, ancha y musculada. Línea dorsal
fuerte. Grupa ancha casi nivelada. Vientre recogido. Extremidades largas y
gruesas. Cascos grandes y sólidos. Sus remos son igual que los del SHIIRE,
peludos del carpo y el tarso hacia abajo (enzamarrados).
Colores de la capa: zaino, castaño, tordo, alazán y negro. Suele presentar el factor
“calzado” en sus cuatro patas lo mismo que la cara blanca (listón corrido).
Peso: oscila entre 750 – 900 Kg.
Es una raza famosa por su gran actividad, bondadosa, desenvuelta, con sus
movimientos musculares de gran agilidad. Es un excelente animal de tiro.




SUFFOLK


www.mascotamigos.com

Origen: región de East Anglia al Este de Inglaterra.
Clasificación: hipermetrica, mediolíneo – longilíneo, rectilíneo.
Alzada: 1.60 – 1.62 m.
Cabeza proporcional en longitud y anchura, orejas cortas y abiertas. Cuello corto
profundo, algo musculado crin fina. Tronco largo robusto. Sin exceso de
musculatura. Línea dorsal ancha y fuerte. Grupa larga y redonda. Pecho ancho
desarrollado muscularmente. Extremidades gruesas, redondeadas, con pelos
únicamente en la región de la cerneja. Casco sólido y más o menos grande piel
fina y pelo corto.
Color del pelaje: alazán desde el tostado hasta el crema pálido.
Peso: 750 – 850 Kg.
Una raza activa excelente para trabajos agrícolas. Longeva, dócil, de disposición
constante para sus labores, ya que tiene buen “fondo”.


ARDENES.


http://www.ansi.okstate.edu/breeds/horses/

Origen: región de las Ardenás (frontera Francia – Bélgica).
Clasificación: hipermétrico, mesomorfa y sub concavilínea.
Alzada: 1.55 – 1.60 m.
Cabeza ancha algo descarnada no muy larga. Orejas cortas. Cuello corto con
excelentes crines que en ocasiones se le peinan a manera de moño o trenza.
Tronco largo, macizo, grupa ancha, redonda musculosa. Cola de inserción baja y
poblada de cerdas largas. Extremidades con músculos fuertes, desarrollados.
Cascos grandes. Presenta también pelos largos en la parte más distal de sus
patas.
Color de la capa: alazán, zaino, rocillo, ruano y bayo.
Peso: 500 – 600 Kg.
Es una raza extraordinariamente dócil y paciente idónea para labores de tiro en
actividades agrícolas y urbanas, ya que es resistente al cansancio y muy rustica.





BRETÓN.


http://uco.es

Origen: región de bretaña, al noroeste de Francia.
Clasificación: hipermétrica, mesomorfa y sub concavilínea por perfil.
Alzada: 1.60 m.
Cabeza corta y ancha con orejas medianas. Cuello corto, profundo, macizo y con
crinera larga. Tronco mediano y cilíndrico. Grupa ancha, algo inclinada,
extremidades musculosas, fuertes con buena cerneja.
Color de la capa: bayo, alazán, ruana y hasta zaino.
Peso: 500 – 600 kg.
Se distinguen el bretón de tiro, cuya sangre es una mezcla de percherón, ardenes
y boulones; el portier caballo de de trote por cuyas venas corre sangre del trotador
de Norfolk y de Hacckney, y el corlay (hoy escaso) animal mas ligero de silla y de
tiro que lleva sangre árabe y P.S.I. Esta raza es activa y de buen temperamento.



LECCION 15. PONIS.

De los caballos primitivos TARPAN, de las estepas rusas, del caballo salvaje de
Mongolia, llamado también de PRZEWALKI, se han derivado la mayoría de las
actuales razas y variedades de equinos ponis que se encuentran en los diferentes
países del mundo, algunas de ellas son:


SHETLAND.


http://www.ansi.okstate.edu/breeds/horses/

Origen: Islas del Shetland en gran Bretaña.
Clasificación: Elipométrica. Braquimorfa – mesomorfa y concavilínea por perfil.
Alzada: 0.90 – 1.05 m.
Cabeza pequeña y ancha, armoniosa e inteligente, con ojos muy vivos. Orejas
pequeñas. Tupe largo, desarrollado que le tapa la frente y parte de la cara. Crin
densa y larga. Tronco mediano, con línea dorsal más o menos hundida. Tórax
amplio. Cola descendida y poblada de cerdas largas, remos cortos.
Colores de la capa: negro, zaino, castaño, y píos.
Peso: 180 – 200 kg.
Inicialmente la raza fue utilizada por los hacendados para trabajar la tierra y como
bestia de carga y aun como equino de silla. La mecanización lo ha desplazado de
estas labores, en cambio ha ganado popularidad en montura para niños. La raza
es fuerte, resistente y longeva.
WELSH PONY.


http://www.ansi.okstate.edu/breeds/horses/

Origen: Gales (Gran Bretaña).
Clasificación: Elipométrica, Mesomorfa, Concavilínea.
Alzada: 1.25 – 1.32 m.
Cabeza pequeña y muy viva (menuda), con tupe fino de mediana longitud. Cuello
mediano, fuerte, sin exceso de musculatura, con larga y sedosa crinera. Cola de
inserción de mediana a alta, con cerdas abundantes y largas, de movimientos
graciosos. Remos de longitud mediana, finos y fuertes.
Color de la capa: cualquier color, excepto los píos.
Peso: 250 – 350 kg.
El equino Welsh es un animal valiente e inteligente. Se le emplea como caballo de
silla especialmente para niños; también como ejemplar de tiro de coches.
Existen otras variedades de ponis tales como: PONY de las montañas de Gales,
el tipo Cob y el pony de polo; todos ellos de ascendencia Británica.

NEW FOREST.


http://www.ansi.okstate.edu/breeds/horses/

Origen: région de New Forest en Hampshire, Inglaterra.
Clasificación: Elipometrica, Medialínea y rectilínea por perfil.
Alzada: 1.22 – 1.40 m.
La cabeza tiende a ser grande con tupe corto y sedoso. Orejas medianas y
alertas. Cuello corto, crin fina. Tronco medido con masas musculares suaves.
Grupa redonda. Remos finos. Cola poblada y suelta.
Color de la capa: negro. Bayo, Isabela, castaño. No se aceptan píos.
Peso: 300 – 330 kg.
La raza se destaca por la firmeza del paso y de su adaptabilidad, y en general se
mueven bien con la silla, gracias a la adecuada caída de la espalda. En su
mayoría tienen una sólida osamenta, resistiendo el peso de su cabalgadura sin
denotar cansancio; su carácter dócil facilita su manejo por parte de los niños.





EXMOOR.


http://www.ansi.okstate.edu/breeds/horses/

Origen: condados de Devon y Somerset en Inglaterra.
Clasificación: elipometrica, mesomorfa y rectilínea por perfil.
Alzada: 1.20 – 1.25 m.
Cabeza corta y gruesa con tupe revuelto y áspero, orejas cortas y puntiagudas.
Cuello corto de crines densas. Sus ojos prominentes con pesados parpados
superiores, le confieren una mirada desviada, típica de esta raza. Lomo corto.
Poderosos cuartos traseros extremidades cortas y huesudas el pelaje es corto y
pegado al cuerpo prácticamente impermeable.
Colores del pelaje: bayo, zaino, castaño, colores que tienden a aclararse en la
parte anterior de la cabeza, alrededor de los ojos, parte posterior del vientre y en
las bragadas.
Peso: 230 – 300 kg.
Es un pony excepcionalmente recio, vigoroso, resistente y muy sufrido.
Inteligente e independiente. Se utiliza para silla de niños y tracción de carruajes.


FALABELLA.


http://www.ansi.okstate.edu/breeds/horses/

Origen: Argentina.
Clasificación: elipométrico, braquimorfo y sub concavilínea por perfil.
Alzada: 0.70 m.
Cabeza pequeña con tupe abundante. Orejas cortas, tronco corto y poco
musculado, cola larga remos muy cortos y huesudos.
Color de la capa: cualquier color.
El ha recibido influencia de pequeños pura sangre ingleses con menudos ponis
Shetland. Se utiliza para tiro especialmente y trabajos domésticos. Tienen carácter
amistoso y es inteligente. Es el pony más pequeño del mundo.




UNIDAD 2.
MANEJO DE LA PRODUCCION EQUINA.
CAPITULO 4. NUTRICIÓN Y ALIMENTACIÓN DEL EQUINO



Tomada en Pesebrera El Puente - Neiva


La nutrición implica diversas reacciones típicas y procesos fisiológicos que
trasforman los alimentos en tejidos corporales y esta comprendida por la ingestión,
digestión y absorción de los diferentes nutrientes, su transporte hacia todas las
células del cuerpo, así como la eliminación de elementos no utilizables y productos
de desecho del metabolismo.

En los equinos es mas importante aún comparado con otros animales, que
alimento sea de buena calidad que no estén enmohecidos, alterados o mezclados
con polvo, pues los caballos están mas expuestos que otros animales a ingerir
alimentos alterados, y el heno u otro forraje polvoriento aumenta el riesgo de
enfermedades por vías respiratorias.
Desde el punto de vista digestivo, se reconoce que el caballo es un animal muy
frágil, son muchas las razones que se invocan para explicarlo, entre las cuales
diremos inicialmente que las particularidades de su anatomía y fisiología además
de la gran variedad de regímenes a los que está sometido, contribuyen o son el
origen de bastantes problemas en esta especie.

La digestión de los equinos se caracteriza por ser a la vez una digestión
microbiana (que se realiza en intestino grueso), en los caballos hay dos tipos de
necesidades las de mantenimiento y las de utilización. Las necesidades de
mantenimiento, corresponden a los gastos de la vida en condiciones normales y
las de utilización que corresponden a aquellas que se producen a causas de la
utilización del caballo determinando así que las necesidades de energía,
proteínas, lípidos, fibra, minerales y vitaminas serán distintas para cada animal de
acuerdo a su función y estado fisiológico entre otras.


LECCION 16. ANATOMÍA Y FISIOLOGÍA DEL APARATO
DIGESTIVO DEL EQUINO.


www.3caballos.com

El caballo es un herbívoro monogástrico con un tubo digestivo que se caracteriza
por poseer un estómago relativamente pequeño y un intestino grueso que por el
contrario es muy desarrollado. El sistema digestivo consta de órganos a los que
concierne directamente la recepción y digestión de los alimentos, su paso a través
del cuerpo y la expulsión de la parte no absorbida. Este conjunto de órganos
podría dividirse en dos grupos principales:

- Conducto Alimentario.
- Órganos Accesorios.

El conducto alimentario es tubular y músculo-membranoso y se extiende desde los
labios hasta el ano. El conducto consta de los siguientes segmentos consecutivos:

- Boca
- Faringe
- Esófago
- Estómago
- Intestino delgado
- Intestino grueso

Los órganos accesorios son:
- Dientes
- Lengua
- Glándulas salivales
- Hígado
- Páncreas

En el Cuadro se presenta una comparación entre el tracto digestivo del caballo y
del buey. En el Cuadro siguiente se muestra la relación entre longitud y capacidad
de los diferentes segmentos del tracto gastrointestinal del equino.


Tabla 9. Tracto digestivo del caballo comparado con el del buey.
Longitud en metros Volumen (Litros) Volumen de las diferentes
partes (litros)
En total Relación con la
longitud del
cuerpo
TOTAL Por 100 kg
peso vivo
Estómag
o
Intestinos Ciego
Caballo: 30 20/1 230 40 15 190 30
Buey: 50 30/1 320 50 200 110 10


Tabla 10. Diferentes segmentos del tubo digestivo del caballo.
Longitud
media m.
Longitud
relativa p.100
Capacidad
media 1
Capacidad
relativa p. 100
Estómago “ “ 15 - 18 8,5
Intestino delgado 22 75 64 30
Ciego 1 4 30-35 16
Colon grueso 3-4 11 80-90 38
Colon pequeño 3 10
Colon pequeño y
recto
“ 15 7
30 “ 200-220

Conducto Alimentario.

Boca: El término boca se usa comúnmente para significar cavidad u orificio de
entrada del alimento. Es, en el caballo, una larga cavidad cilíndrica que, cuando
está cerrada, se halla casi enteramente llena por las formaciones que aloja en su
interior y comprende: los labios, las mejillas, las encías, el paladar duro, el paladar
blando, el suelo de la boca (formado por el cuerpo de la mandíbula) y el istmo de
las fauces que es el orificio de comunicación entre la boca y la faringe. Las
funciones de la cavidad bucal y sus anexos comprenden aprehensión,
masticación, insalivación y formación del bolo alimenticio.

La digestión comienza con el ingreso del alimento en la cavidad bucal, tras haber
sido apreciada su calidad por los órganos de los sentidos. La forma de
aprehensión de los alimentos está en consonancia con su naturaleza y
constitución, en los que los dientes, los labios, la lengua, y la cabeza y a veces las
extremidades anteriores participan en diversa proporción. Los équidos utilizan
sobre todo sus labios, que son fuertes, móviles, y sensibles. La aprehensión de los
alimentos sólidos está asegurada por el labio superior muy vigoroso y capaz de
efectuar una excelente selección alimenticia; las hierbas una vez cogidas con los
labios, son introducidas entre los incisivos y trituradas; un ligero movimiento
oscilatorio de la cabeza hacia abajo, o de lado, ayuda a arrancar los “bocados”.
Para la aprehensión de las briznas de forraje, granos y heno, se sirve de los labios
y de la lengua. En el caso de raíces carnosas los équidos arrancan bocados de
ellas mediante los incisivos. El labio superior es igualmente indispensable para el
mantenimiento de los alimentos en la boca durante la masticación.

El abreviamiento se hace por absorción como los herbívoros en general, gracias a
la lengua que funciona como un pistón en el interior de la boca herméticamente
cerrada; la integridad de la cerrazón de los labios es por consiguiente necesaria.
Para beber los caballos introducen solamente la parte media de su abertura labial
en el líquido. Mediante descenso del maxilar inferior y retroceso de la lengua, se
produce una presión negativa en la cavidad oral, lo que provoca la succión del
líquido a través de la abertura labial. Por otra parte, hay que señalar que con
frecuencia el caballo “sopla” sobre su comida antes de consumirla. El polvo que se
puede desprender por este motivo, puede irritar las vías respiratorias hasta
provocar una tenaz tos de pesebrera. La humidificación de los forrajes algo
polvorientos es sin duda un buen paliativo.

Faringe: La faringe es un conducto para el paso común de alimentos y del aire
inspirado, tapizado de mucosa y rodeado de músculos (saco músculo –
membranoso). Es algo infundibuliforme; su porción anterior ancha, se une con la
bota y con la cavidad nasal, mientras su pequeña extremidad posterior se continúa
con el esófago. La faringe puede dividirse un tanto arbitrariamente en porciones
oral, nasal y laríngea. Mide en el caballo aproximadamente 15 centímetros de
longitud y toma importancia cuando en ella se asientan procesos inflamatorios e
infecciosos que se extienden con facilidad por las tubas auditivas o de Eustaquio
hasta las bolsas guturales y el oído medio provocando trastornos agudos o
crónicos de difícil solución.

Esófago. El esófago es un tubo músculo – membranoso, de 125 a 150
centímetros de longitud, que se extiende desde la faringe hasta el estómago,
posee porciones cervical, torácico y abdominal y una vez atraviesa el hiato
esofágico del diafragma termina inmediatamente en el orificio cardinal del
estomago.
Es importante tener en cuenta que el tono muscular del esófago cerca al
estomago no permite que el caballo vomite, por lo cual en caso de que el caballo
tenga una distensión, este se rompe antes de vomitar. Esta situación exige el
suministro de alimentos de buena calidad y con un balance adecuado.

Estómago. El estomago es la gran dilatación del tubo digestivo cuya capacidad es
de aproximadamente el 8 % del total que tiene el aparato digestivo. Se halla detrás
del diagrama del tal forma que se interpone entre el esófago y el intestino delgado.
El estómago se encuentra completamente intraabdominal y por eso la exploración
clínica desde el exterior es totalmente imposible (excepto la exploración mediante
la sonda nasoesofágica).

El estómago de los equinos es un saco en forma de U relativamente pequeño,
variando su capacidad entre 8 y 15 litros; su tamaño, forma y posición se hallan
sujetos a variaciones considerables. En el potro lactante la proporción del
estómago con respecto a la capacidad total del canal digestivo es bastante mayor
que en el caballo adulto. El vomito verdadero (aquel que se acompaña de
arcadas) es supremamente raro en el caballo como en otros herbívoros y cuando
se presenta, se considera un signo grave que revela lesiones importantes del
aparato digestivo. El caballo no puede vomitar, en general, y por lo tanto no puede
librarse de una sobrecarga del estómago. Esto obedece, por una parte, al mayor
alejamiento entre la pared abdominal y el estómago, por lo que la prensa
abdominal no puede actuar directamente sobre aquel durante el acto del vómito y,
por otra parte, a que la musculatura cardial cierra la desembocadura esofágica en
el caballo de una forma notablemente fuerte. Esta oclusión es ordinariamente tan
completa que la distensión del estómago por medio de aire o fluido introducido a
presión a través del píloro puede ser llevado a tal extremo, que se produzca la
rotura del estómago sin necesidad de ligar previamente el esófago. Por la misma
causa puede producirse ruptura del estómago si se introducen líquidos desde el
exterior a través de sonda y simultáneamente existe una parálisis intestinal con
espasmo del píloro. La situación del cardias en inmediata proximidad al píloro y la
desembocadura en ángulo agudo del esófago en el estómago, impiden también la
falta de un centro del vómito, o su desarrollo rudimentario, como causa de la
incapacidad para vomitar. Para prevenir los accidentes favorecidos por los
espasmos del píloro, se recomendará ante todo el abrevar los animales moderada
y progresivamente para evitar los cólicos de agua, cuyo peligro aumenta cuando el
agua es muy fría. El consumo de agua deberá hacerse antes de la toma de
alimentos concentrados secos, ya que de otra manera estos correrían el riesgo de
hincharse en el estómago y provocar indigestiones.

Se aconsejará igualmente el dividir las raciones de alimentos, sobre todo si se
trata de alimentos muy leñosos o por los contrarios muy harinosos susceptibles de
“empastarse” en el estómago.

Al pasar los alimentos por el estomago, se produce una fermentación láctica de los
carbohidratos, realizada por bacterias. La otra función importante del estomago es
regular el paso de los alimentos hacia el intestino delgado.

Intestino Delgado: El intestino delgado es el tubo que pone en conexión el
estómago con el intestino grueso, su capacidad es del 30% del total que tiene el
aparato digestivo. Comienza en el píloro y acaba en la curvatura mayor del ciego;
su longitud media es de aproximadamente 22 metros y cuando está distendido su
diámetro varía de 7,5 a 10 centímetros. Su capacidad es de 40 a 60 litros
aproximadamente. Se divide claramente en una porción fija y otra mesentérica. La
porción fija se denomina duodeno, mientras la porción mesentérica está dividida
en forma arbitraria en dos partes denominadas yeyuno e íleon.

Realmente no existe una línea natural de demarcación, pero se observa aquí un
aumento acentuado del grosor de la pared hacia la parte terminal. El intestino
delgado tiene una capacidad 4 veces mayor a la del estómago; la pared muy
musculosa y ricamente inervada es el asiento de contracciones muy vigorosas que
producen un tránsito muy rápido. La violencia de las contracciones intestinales en
el caballo predispone a lo espasmos que conducen a los taponamientos y a las
invaginaciones, responsables de cólicos muy graves.

Los espasmos desencadenan un vivo dolor que por reflejo, crea las condiciones
para ser aún más doloroso. En esta parte del tubo digestivo del caballo se
encuentra tejido linfoide en forma de nódulos distintos que están esparcidos o en
grupos. En el primer caso se denominan nódulos solitarios; en el último, nódulos
agregados o placas de Peyer. Hay que anotar también que el diámetro del
intestino delgado es pequeño cuando se compara con el diámetro mucho más
grande del ciego y del colon componentes estos últimos del intestino grueso.

Allí hay gran secreción de enzimas: carbohidrasas, proteasas y también de sales
biliares, cuya función es fraccionar los carbohidratos solubles, las proteínas y las
grasas respectivamente, en estructuras mas pequeñas y fáciles de absorber por
las paredes intestinales.
En el intestino delgado es donde se realiza la mayor absorción de nutrientes así:
Carbohidratos solubles (65-75 %), proteínas (60-70 %), grasas (100%), fibra (15-
25%), vitaminas (100 %); la absorción de los minerales depende de cada uno
específicamente (calcio y magnesio 90-99 %, fosforo 20-50%).



Intestino Grueso: El intestino grueso se extiende desde la terminación del íleon
hasta el ano. Su longitud es aproximadamente de 7.5 a 8 metros. Difiere del
intestino delgado por su mayor tamaño, ser en su mayor parte saculado, poseer
cintillas longitudinales y tener una posición más fija. Se divide en ciego, colon
mayor, colon menor y recto. Él ciego es un gran fondo de saco cuyo tamaño,
forma y posición son notables en el caballo. Se intercala entre el intestino delgado
y el colon con una longitud media de aproximadamente 1.25 metros y con
capacidad de 25 a 30 litros. El ciego es cónico y está incurvado a modo de coma.
Su base es objeto de una de las prácticas Médico-quirúrgicas más comunes en la
especie equina, la cecocentesis o punción de la base del ciego, la cual se realiza
en pleno centro de la fosa paralumbar del lado derecho, o sea, en el punto
equidistante de la serie de apófisis transversas lumbares, de la tuberosidad coxal y
de la última costilla, teniendo en cuenta que es precisamente en este sitio donde la
base del ciego contacta directamente con la pared de la fosa derecha; la
trocarización (introducir una aguja o trocar) de la base del ciego en este punto, es
muy valiosa en trastornos digestivos que se acompañan con abundante
producción de gas (timpanización).
En el ciego habitan millones de bacterias y protozoos, cuya función es realizar la
fermentación de fibra y de los carbohidratos solubles que sobrepasaron el intestino
delgado sin ser digeridos y absorbidos. Con la fermentación se producen ácidos
grasos volátiles (acético, propionico y butírico) que se absorben allí mismo y son
utilizados como fuente de energía. En el ciego también se da la mayor absorción
del agua del tracto gastrointestinal, seguido por el colon.

El colon mayor empieza en el orificio cecocólico y termina juntándose con el colon
menor detrás del saco ciego del estómago. Mide de 3 a 3.7 metros de largo y su
diámetro medio es de 20 a 25 centímetros. Su capacidad es más del doble de la
del ciego. El colon menor empieza en la terminación del colon mayor, detrás del
saco cecal del estómago y por debajo del riñón izquierdo y se continúa con el
recto en el estrecho anterior de la pelvis. Mide aproximadamente 3.5 metros de
largo y 7.5 a 10 centímetros de diámetro. El recto es la porción terminal del
intestino y se extiende desde el estrecho anterior de la pelvis hasta el ano. Su
longitud es de 30 centímetros aproximadamente y su dirección puede ser recta u
oblicua. El ano es la porción terminal del conducto alimentario. Está situado debajo
de la raíz de la cola, donde forma una proyección redondeada, con una depresión
central cuando está contraído.
Su capacidad es del 40 a 50 % del total que tiene el aparato digestivo, por lo cual
tiene una gran carga de trabajo. La absorción de nutrientes es: proteínas (30-
40%), fibra (78-85 %), minerales depende de cada uno (calcio y magnesio 1-10 %,
fosforo 50-80%) y agua (100%). El intestino grueso esta conformado al principio
por el ciego y posteriormente por el colon.




Órganos accesorios.

Dientes: La fórmula dentaria como la mayoría de las porciones anteriores del tubo
digestivo aproxima mucho al caballo a un monogástrico verdadero como el cerdo,
por ejemplo. Por el contrario los grandes reservorios del intestino grueso
recuerdan el rumen de los poligástricos y su papel fermentativo con relación al
régimen propio para el herbívoro.

Los dientes morfológicamente son papilas intensamente calcificadas.
Funcionalmente son órganos de aprehensión y masticación y pueden servir como
medios de defensa y de ataque. El caballo como otros mamíferos domésticos
posee dos series de dientes: los temporales o caducos, llamados también
vulgarmente “dientes de leche”, porque son reemplazados durante la época del
crecimiento por los dientes permanentes. Se clasifican según su forma y posición,
como sigue:
- Incisivos
- Caninos
- Premolares
- Molares

Los premolares aparecen en ambas series mientras que los molares Aparecen
sólo en la dentición permanente. El intervalo entre los incisivos y los premolares es
el espacio interalveolar o interdentario. Como los dientes de los dos lados de las
quijadas son normalmente iguales, lo mismo en número que en carácter, la
dentición completa puede indicarse brevemente por una fórmula dentaria, no sin
antes anotar que los dientes temporales o caducos son más pequeños que los
permanentes y su número es igualmente menor.

Lengua: La lengua es un órgano muscular cubierto de mucosa que posee una
parte posterior o raíz, una parte media o cuerpo y un vértice o punta que es libre y
en forma de espátula. La lengua posee muchos vasos sanguíneos y numerosas
papilas. En el caballo las ramas superficiales de la vena lingual pueden utilizarse
para inyecciones intravenosas o tomas de muestra de sangre en casos extremos
(caídas súbitas, colapsos o shocks). En relación con este órgano, algunos caballos
muy jóvenes adquieren el hábito nocivo y deplorable de pasar la lengua por arriba
del freno.
Los especialistas aconsejan escoger un freno de filete con cañones gruesos, no
demasiado ancho con el fin de no desbordar en forma exagerada de uno y otro
lado los labios. La rama ascendente del freno deberá ajustarse y será más bien
corta de manera que levante muy poco la comisura de los labios. El freno estando
así “confortable” y bastante levantado será menos temido por el caballo, tomando
y manteniendo en forma voluntaria el bocado o contacto y no tendrá la idea de
pasar su lengua por arriba ocasionándose heridas en el frenillo.


Glándulas Salivales: Este término se aplica generalmente sólo a tres pares de
glándulas muy grandes situadas a los lados de la cara y partes adyacentes del
cuello, a saber: la parótida, la mandibular y la sublingual. La glándula parótida
llamada así por su proximidad a la oreja, es la más grande de las glándulas
salivares del caballo. La mandibular o submaxilar es mucho más pequeña que la
parótida y es larga, estrecha e incubada. La sublingual se sitúa debajo de la
mucosa de la boca, entre el cuerpo de la lengua y la rama de la mandíbula. Se
cree que la intensidad de la secreción salivar de la parótida está relacionada en un
70%, con la duración de la masticación, y por lo tanto, con la naturaleza física del
alimento; su misión esencial es la de humedecer abundantemente los alimentos
secos lo que exalta verdaderamente el sentido del gusto y por este hecho, hace
que el caballo sea particularmente sensible al sabor de sus alimentos, y sobre
todo sirve para preparar la deglución.

Hígado: Es la glándula de mayor tamaño del cuerpo del equino. La mayor parte de
este órgano se halla a la derecha del plano medio. Su color es rojo pardo con un
peso aproximado de 5 Kg., pero en caballos de tiro puede llegar a pesar casi el
doble; posee tres lóbulos principales (derecho, medio e izquierdo) y un lóbulo
caudal. Su consistencia permite que se lesione fácilmente. Varios ligamentos lo
mantienen fijo en su posición. El tejido que compone el órgano se halla constituido
por lobulillos poligonales de aproximadamente 1.5 milímetros de diámetro, que
están mantenidos juntos por una cantidad pequeña de tejido conectivo. Los
lobulillos están compuestos de células hepáticas, pequeños vasos sanguíneos y
biliares (capilares) y una vena central, todo sostenido por una delicada red de
tejido especializado. Aquí cabe anotar la ausencia de Vejiga o Vesícula Biliar
quizás asociada a la necesidad de abastecer continuamente de Bilis a un animal
que se alimenta sin cesar.

Páncreas: En el caballo el páncreas es un órgano alargado situado en la pared
dorsal del abdomen casi todo a la derecha del plano medio; en estado fresco es
de color rojizo. Su aspecto es parecido al de las glándulas salivales, pero es más
blando. Su peso medio es de aproximadamente 350 gramos.

Es una glándula mixta o sea posee una porción de secreción interna (endocrina) y
otra de secreción externa (exocrina). Esta última elabora jugos digestivos que por
el conducto pancreático desembocan en el duodeno junto al conducto biliar
(colédoco). La porción endocrina produce insulina una hormona importante en la
regulación de los azúcares de la sangre.







Principales Procesos Digestivos del Caballo.




La fisiología digestiva del caballo tiene por rasgos dominantes los siguientes: una
masticación concienzuda, una gran rapidez del tránsito por el estómago, una
digestión por enzimas, breve pero intensa en el intestino delgado, y una acción
microbiana prolongada a nivel de los grandes reservorios del intestino grueso.

En el equino al contrario de lo que sucede en el rumiante, la digestión por
microbios se desarrolla esencialmente a nivel del intestino grueso o sea con
posterioridad a la digestión por enzimas, y a continuación de las zonas de intensa
reabsorción intestinal.

Dentro de los actos preparatorios para la digestión, la aprehensión de los
alimentos, la masticación y la deglución en el equino, dan lugar a
recomendaciones muy provechosas para una mejor alimentación.

Aprehensión: Para la aprehensión de los alimentos sólidos el caballo utiliza el
labio superior el cual es vigoroso, sensible y muy móvil, capaz de realizar una
buena selección del alimento. Si existen lesiones que lo afecten se compromete
seriamente el mantener los alimentos en la boca durante la masticación lo cual es
particularmente grave en el equino, como se describió anteriormente.

El abrevamiento lo realiza el caballo por absorción como los herbívoros en
general, utilizando la lengua a manera de pistón en el interior de la boca
herméticamente cerrada. Por lo tanto, la integridad de este cierre de los labios es
necesaria.

Masticación: El caballo posee un aparato masticador muy potente; la dentadura
forma tablas extensas erizadas de múltiples crestas de esmalte que por
aplastamientos, trituración y frotamiento aseguran una división completa de los
alimentos.

El triturarlos muy bien, es condición esencial para una buena utilización digestiva
posterior.

La masticación es larga, metódica y muy compleja, lo que determina que el equino
coma con lentitud, tanto más, si la ración contiene muchos forrajes ricos en
celulosa. Por lo tanto, es conveniente no acosar al caballo y más bien procurarle
tranquilidad y tiempo cuando se esté alimentando.

Es importante anotar aquí, que es muy conveniente para el equino el humedecerle
y más todavía triturarle los alimentos leñosos para facilitarle su digestión. Los
alimentos insuficientemente masticados serán mal digeridos y correrán el riesgo
de favorecer el desarrollo de cólicos. También es muy importante en el caballo
controlar la perfecta integridad de los dientes; será conveniente usar escofinas,
limas y cortadientes para mejorar el enfrentamiento e igualar las superficies
masticatorias y sobretodo para eliminar los sobredientes, que pueden lesionar las
encías y los labios, por sus características irregulares y traumáticas.

Insalivación y Deglución: La secreción de saliva tiene por objeto humedecer
fuertemente los alimentos secos. Es ideal un abrevamiento abundante en relación
con las características físicas del alimento. La saliva posee un pH del orden de 7.4
a 7.6 contiene una enzima para romper almidones; se cree que está enzima no
tiene suficiente tiempo de actuar por lo tanto la acción química antes del estómago
es despreciable.

La intensidad de la secreción de saliva de la glándula parótida está relacionada en
un 70% con la duración de la masticación lo que favorece y prepara la deglución;
ésta se facilita por la insalivación abundante durante la masticación prolongada de
la ración. En el equino la deglución es irreversible ya que el velo del paladar
impide todo retroceso del bolo alimenticio desde el esófago hacia la boca no
permitiendo que los alimentos sean expulsados por la vía nasal: si esto último
sucede (es muy raro) o bien existe una dilatación del esófago o se ha roto el
cardias evento que ocasiona la muerte rápida del animal.

Digestión en el Estómago: La capacidad máxima del estómago del equino es del
orden de 15 a 18 litros. Sin embargo no se llena más que hasta sus 2/3 partes de
tal forma que su contenido práctico es de alrededor de los 10 litros. La masa de
alimento deglutido en un día puede alcanzar hasta 50 e incluso 70 litros. Si a esto
añadimos los 10 – 30 litros de secreción gástrica tenemos un volumen muy grande
lo que provoca que el estómago tenga que desocuparse de 6 – 8 veces por día.
En una misma comida suceden entonces 2 vaciadas por lo que solamente 1/3 de
los bolos alimenticios son los que se benefician de una permanencia prolongada
(6 – 8 horas) en tanto que un nuevo consumo no conlleve a un tránsito anticipado
hacia el duodeno. En consecuencia la digestión en el estómago posee efectos
sensibles apenas sobre los últimos 10 Litros del bolo deglutido, más o menos el
equivalente a 2 kilos de salvado o 4 kilos de concentrado, mientras el resto no se
retiene más de una hora en el estómago. Este paso rápido por el estómago limita
la acción mecánica y enzimática aunque no impide un leve ataque fermentativo a
este nivel.
La imposibilidad del vómito en razón de los dispositivos anatómicos especialmente
del cardias en los caballos agrava las consecuencias de una sobrecarga gástrica,
a la cual el caballo está predispuesto por la pequeña capacidad de su estómago.

En el plano estrictamente digestivo tiene lugar en el estómago, una degradación
del almidón ya que la enzima de la saliva parece ser no tiene tiempo de actuar.
Interviene en este proceso las diastasas contenidas en el alimento y enzimas
bacterianas. Mediante la actividad bacteriana (región cardial) se producen ácidos
orgánicos predominando el ácido láctico con pequeñas cantidades de ácidos
acético, propiónico y butírico. Estos ácidos más el ácido clorhídrico generado algo
después, acidifican el contenido del estómago (hasta un pH de 5.4 en la zona
fúndica y 2.6 en la región pilórica. La caída del valor del pH disminuye cada vez
más la actividad bacterial. Las proteínas son descompuestas ya, en gran parte, en
el estómago del caballo bajo la acción de la pepsina. En el antro pilórico tiene
lugar probablemente una más intensa digestión proteica, que en las restantes
regiones gástricas hecho que se explica por los valores de pH muy adecuados
para la actividad de la pepsina. El nuevo alimento ingerido sufre inmediatamente
desdoblamientos por acción del agua (hidrólisis) en hidratos de carbono mientras
el resto de la comida anterior se encuentra entonces sometida a desdoblamiento
de proteínas (proteolisis). Las degradaciones de almidones y proteínas varían
según las regiones gástricas y el tiempo transcurrido desde la ingestión del
alimento deglutido, pero en el caballo predomina la degradación de los hidratos de
carbono a este nivel.

DIGESTIÓN EN EL INTESTINO DELGADO.

El intestino delgado representa el segmento primordial de la digestión en él
caballo. La duración del tránsito de los alimentos no excede de 2 – 3 horas.

Las principales secreciones digestivas a este nivel son la biliar, la pancreática y la
intestinal propiamente dicha, estimuladas claramente por la presencia del alimento
y a continuación de la excitación de la pared gástrica,

Sus contenidos son ricos en las enzimas: amilasa, maltasa, lactasa, proteasas,
péptidas y sacarosa sin reconocerse claramente la presencia de lipasa. Todas las
enzimas encuentran un pH propicio a este nivel (6.7 – 6.9 en yeyuno y 7.5 en el
íleon terminal).

La digestión en este punto es esencialmente enzimática y no afecta prácticamente
a la celulosa pero es muy eficaz cuando se trata de materias grasas, proteínas,
minerales o vitaminas y especialmente del almidón, la insulina, sacarosa, lactosa o
sea, lo que se conoce como Extracto No Nitrogenado (ENN) los cuales son
convertidos en glucosa u otros azúcares sencillos de fácil absorción y
metabolismo. Esta glucosa es particularmente importante para el trabajo muscular.

Las materias grasas son muy bien toleradas por el caballo que soporta un
contenido de 15 al 18% en la dieta.

Las proteínas son digeridas y absorbidas principalmente en el intestino delgado y
la tasa de aminoácidos indispensables en la sangre se eleva inmediatamente
luego de la ingestión de alimento y alcanza su máximo dos horas después de esto.

Se cree que el desdoblamiento de proteínas es 10 a 100 veces más activo en el
intestino delgado que en el ciego y alcanza por lo menos al 60 – 70% de las
proteínas del alimento cualesquiera que serán las proporciones de forrajes y de
concentrados en la ración.

La Lisina (aminoácido indispensable) es el factor limitante para el
aprovechamiento eficiente del Nitrógeno; su suplementación se aconseja
especialmente en potros.

Los minerales en conjunto, son absorbidos en el intestino delgado incluyendo al
calcio y al magnesio, siendo la única excepción el fósforo cuya absorción pura no
sucede sino a nivel de colon.

Las vitaminas, tanto las hidrosolubles como las liposolubles, tienen
verdaderamente su sitio de absorción en el intestino delgado. El rápido tránsito de
los forrajes ricos en carotenos por el intestino delgado, explica la mala conversión
en vitamina A por parte de los caballos.

DIGESTIÓN EN EL INTESTINO GRUESO.

El tránsito de los alimentos en el equino es muy lento. Los alimentos son retenidos
en promedio 36 horas en el tubo digestivo y por lo menos 2/3 de este tiempo (24
horas) deben pertenecer a la permanencia en el intestino grueso.

Lo esencial de la digestión a este nivel, es realizado por las fermentaciones
microbianas, muy dinámicas en el ciego y en el colon replegado.

La población de microbios del intestino grueso parece comparable a la que está
presente en el rumen de los poligástricos tanto en características como en su
metabolismo. Entra los principales representantes de esta población dominan las
bacterias gramnegativas. Los principales tipos identificados pertenecen a los
géneros: Estreptococos (bobis y equinus), Bacteroides y Lactobadlllus. Los
protozoarios son mucho más raros (4 a 6 x 10
3
/gramo) que los encontrados en el
rumen bovino.

Las fermentaciones microbianas muy activas en este punto, atacan el sustrato
alimentario, degradando la celulosa con producción de ácidos grasos volátiles,
resintetizando las proteínas bacterianas de alto valor biológico y elaborando las
vitaminas del complejo B. Desafortunadamente el organismo aprovecha muy poco
estas transformaciones tardías que suceden después de las zonas de absorción
intensa (intestino delgado). En el intestino grueso se favorece la digestión de
forrajes ricos en celulosa y se desfavorece la de los cereales, especialmente la
avena, por lo que la posibilidad de carencias proteicas y de vitaminas del complejo
B es muy acentuada en los caballos jóvenes, reproductores y en entrenamiento,
alimentados con regímenes intensivos tradicionales.

En forma breve podríamos resumir los rasgos más sobresalientes de la digestión
del caballo así:
- Masticación larga, metódica y compleja.
- Paso rápido por el estómago
- Digestión por enzimas intensa (aunque breve) en el intestino delgado.
- Fermentación microbiana prolongada en el intestino grueso.

DIGESTIBILIDAD.

En nutrición este término designa de modo general la eficacia de la digestión de
los diversos alimentos en una especie con relación a otra y es una forma de
expresar el resultado del tránsito digestivo sufrido por uno o varios alimentos. En
el caballo como en las otras especies, la digestibilidad es sobre todo una función
de la naturaleza y del porcentaje de celulosa que un alimento contiene ya que ésta
estimula la motilidad intestinal y disminuye de esa manera, la duración de las
acciones digestivas para el conjunto de la ración. Es por eso que la digestibilidad
de los diferentes constituyentes del alimento es un poco paralela a la de la
celulosa. Con relación a este tema en el caballo se puede delimitar claramente las
siguientes características:

- La aptitud para degradar la celulosa es más débil en el caballo con relación
al rumiante.
- Esta inferioridad es tanto más notoria si esta celulosa está más lignificada
(textura o consistencia leñosa)
- La utilización digestiva de proteínas es más elevada en el caballo quizás en
razón de la mayor absorción desde el intestino delgado.
- Entre los forrajes, las leguminosas son mejor aprovechadas por el caballo
que las gramíneas, gracias a la mayor digestibilidad de las materias proteicas y del
extracto no nitrogenado, a pesar de una menor digestibilidad de la celulosa y de
las grasas.
- La cocción no mejora la digestibilidad en sí, pero puede ser provechosa
para una digestión precoz del almidón. Por el contrario, un tratamiento térmico
fuerte, provoca bloqueo y destrucción de aminoácidos (principalmente lisina) y por
consiguiente perjudica la porción nitrogenada de la ración.
- Un triturado de los granos pequeños (trigo, sorgo) o un aplastamiento de los
granos duros (maíz, cebada) favorece la ingestión y acelera el tránsito digestivo
(en el intestino grueso) disminuyendo así la digestibilidad de la celulosa entre un
10-18%.

No todos los nutrientes de un alimento son digeridos y absorbidos por el caballo,
aun así, en los asimilados su digestión varía de acuerdo a dos factores:

- Factores del alimento: los granos quebrados favorecen la digestibilidad;
su cocción la mejora, solo en animales cuya dentición no permite una
adecuada trituración; los alimentos muy fibrosos la limitan y pueden causar
cólicos.

- Factores del caballo: el mal estado de la dentición causa mala
digestibilidad (ausencia de premolares o molares, o la presencia de filos,
también llamados remolones en dichos dientes); el trabajo fuerte también la
disminuye, pero el trabajo moderado la aumenta; la frecuencia de consumo
la aumenta ya que el equino come lento pero constante; también depende
de las particularidades de cada individuo en su capacidad para digerir los
alimentos.

LECCION 17. SELECCIÓN DE FORRAJES Y NUTRIENTES.

Consideraciones Generales.
En términos generales, podemos decir que un alimento es una mezcla o
combinación de principios alimenticios.

Para cubrir las necesidades nutritivas mediante los aportes de alimento en
proporciones equilibradas y suficientes, la dieta al menos debe suministrar los
siguientes principios alimenticios: proteínas, hidratos de carbono (carbohidratos),
grasas, sales inorgánicas, aguas y vitaminas.

Número Clase de alimento.
1 Forrajes secos y alimentos fibrosos.
2 Pasturas, plantas de pastizales y forrajes verdes.
3 Ensilaje.
4 Alimentos energéticos.
5 Suplementos proteicos.
6 Minerales.
7 Vitaminas.
8 Aditivos.

Forrajes y Nutrientes para la Alimentación del Equino.

Aunque todos los nutrientes son muy importantes, de manera general hay un
incremento en el requerimiento de algunos, dependiendo del estado fisiológico, así
pues:
- Proteína: necesaria en especial en potros en crecimiento, yeguas en el
último tercio de la gestación, yeguas en lactancia y sementales en
temporada de servicio

- Fibra: caballos adultos y yeguas con baja intensidad de trabajo.
- Grasa: yeguas en lactancia, yeguas en reproducción mayores de 16 años,
caballos y yeguas bajo entrenamiento intenso, caballos y yeguas en
ganancia de peso.
- Carbohidratos solubles: para potros en crecimiento rápido, yeguas en
preparación para reproducción, yeguas preñadas en el último tercio de la
gestación, yeguas muy productoras de leche, padrillos en temporada de
servicio, caballos y yeguas bajo entrenamiento.
- Vitaminas: para potros en crecimiento moderado o acelerado, caballos y
yeguas bajo entrenamiento o sometidos a estrés y sobre todo en equinos
que no consuman forrajes verdes.
- Minerales: en potros en crecimiento, yeguas preñadas o en lactancia,
equinos en entrenamiento, padrillos en temporada de montas.
- Agua: es requerida en todas las etapas pero en especial en yeguas en
lactancia, equinos bajo entrenamiento, animales que consumen alimentos
deshidratados como henos, pastos peletizados y concentrados.


Los alimentos y sustancias de que disponemos para la nutrición del caballo son
muy variados ya que son a la vez los utilizados para rumiantes y los que
empleamos para alimentar monogástricos; para ser prácticos, se les puede
agrupar en siete categorías principales:
Forrajes
Granos y sus derivados Materias Primas Suculentas y/o Azucaradas Fuentes
Proteicas de Complementación Aditivos Alimentarios
Minerales y Oligoelementos Vitaminas.

Forrajes: Deben ser:

Los de menor contenido en Celulosa
- Mayor Digestibilidad
- Mayor consumo

Los de mejor calidad, determinado por su Estado de Desarrollo.
- En fase de Floración (para gramíneas)
- Desde la aparición de los Botones florales para leguminosas).
Son de varias clases:
Gramíneas: (Pastos), los más comunes: Kikuyo, Ray grass Inglés, Ray grass
anual, Imperial, Festuca roja.

Leguminosas: Las más comunes: Trébol blanco, Trébol rojo (violeta), Alfalfa.

Henos: Sobresalen en la alimentación del caballo:
- De Gramíneas: kikuyo, Ray grass Inglés (poseen menos moho y polvo)
- De leguminosas (más digestibles para el caballo): Sobresalen la alfalfa y el
trébol blanco. Debe limitarse su ingestión.

Paja: Forraje de relleno: De avena (contiene menos celulosa), de Trigo (más
corriente). Deficientes en energía, proteínas y minerales.

Ensilajes: Empleo Moderado y de Buena calidad.
- De Gramíneas (el más usado)
- De Leguminosas (debe ser perfectamente conservado o de lo contrario
debe rechazarse).
- De maíz (para engorde)

Forrajes condicionados: Útiles en áreas urbanas
- Deshidratados industrialmente
- Triturados
- Granulados
Un buen ejemplo son los gránulos de harina de alfalfa deshidratada, los cuales
son ricos en proteína (de excelente calidad), Calcio, Carotenos, Vitaminas.

Granos y sus subproductos.

Son importantes a medida que se aumentan las necesidades energéticas del
caballo, principalmente en función del trabajo.
Los cereales más usados son:
- La avena: (tradicionalmente él de mayor uso)
- La cebada: (la alternativa más económica para reemplazar la anterior)
- El maíz
- El trigo

Los tres últimos pueden sustituir muy bien a la avena; el menos usado es el trigo
(rico en gluten) ya que forma cúmulos en el tubo digestivo.

Los subproductos. De los granos son principalmente’ residuos de molinería y
algunas veces, subproductos de cervecería. Los más comunes:

El salvado de trigo: (emoliente en el tubo digestivo, lo que facilita el tránsito a
través de él. Es rico en celulosa).

Las haninillas, moyuelos y cabezuelas tienen indicaciones parecidas a las del
salvado.

Los Residuos de Cervecería: o de destilerías, en forma seca, se aproximan al
salvado por su riqueza en celulosa. Son fuente importante de vitaminas del
complejo B.

Alimentos suculentos y/o azucarados.

Son muy apetecidos por los caballos. Son ligeramente emolientes y tienen sobre
todo por misión, excitar el apetito y refrescar a aquellos caballos privados de
verdura y sometidos a regímenes más o menos constipantes (intensivos) de los
que el animal termina por cansarse. Los más comunes son:
- Las zanahorias (excelente fuente de carotenos)
- Las remolachas (no muy usadas en nuestro medio)
- Las papas o patatas (de poco uso)
- Las pulpas de remolacha azucarera frescas o ensiladas (de muy buena
calidad)
- Las melazas, de caña o de remolachas ricas en azúcar (casi 45- 50%).
- Residuos secos de Manzana (alimentos económicos de relleno 24% y
energéticos muy usados en otros países).
- El Azúcar al natural, como fuente energética ideal para el trabajo muscular,
aunque aún muy costosa para la alimentación del caballo en nuestro medio.

FUENTES PROTEICAS DE SUPLEMENTACIÓN.

Las fuentes disponibles son diversas y pueden proceder enteramente de proteínas
de origen vegetal, pueden ser:

Habas, Guisantes, Lentejas y Víza: De muy poca disponibilidad en el país y de
poco uso. Requieren cocción previa para evitar irritaciones del tubo digestivo.

Torta de Lino: (Linaza) Rica en mucílagos, sustancias calmantes y ligeramente
laxantes, muy útiles para tubos digestivos fatigados (caballos enfermos y
convalecientes).

Torta de Soya: Compite para la alimentación de aves y puede no ser económica
en un momento dado.

Proteínas de origen animal: Se usan los productos derivados de la leche, la harina
de pescado, desperdicios de carne o residuos de las grasas que rara vez se usan
debido a su alto costo.

ADITIVOS ALIMENTARIOS.

Los antibióticos han sido utilizados a veces, en algunos casos particulares,
especialmente para estimular el crecimiento de potros débiles. Se usan a razón de
20 mg/kg de acción como máximo.
Si se adicionan antibióticos en los alimentos para caballos, debe vigilarse
cuidadosamente las cantidades introducidas y su reparto en el alimento; algunas
de estas sustancias aún a dosis terapéuticas, son el origen de proliferaciones de
Clostridium perfringes en el intestino, un microorganismo sumamente peligroso ya
que ocasiona toxiinfecciones casi siempre mortales. Se debe insistir sobre el
hecho de que la buena calidad de los cereales, sumado a las adecuadas
cantidades de proteína y excelente forraje, configura una dieta completa y torna
innecesaria o elimina por completo la suplementación.

Ningún aditivo puede balancear o equilibrar una dieta pobre, ni se debe enfocar
energías en la búsqueda de “polvos milagrosos” o pociones mágicas que muchas
veces no son sino cebos con afanes comerciales. Cualquier sustancia que se
agregue a las raciones para caballos debe ser estrechamente vigilada y
cuidadosamente evaluada.


MINERALES Y OLIGOELEMENTOS.

Los minerales de suma importancia en el caballo como el calcio y el fósforo, que
determinan el desarrollo y la robustez del esqueleto, el cloruro de sodio (sal
común) cuyas pérdidas se aumentan por la sudoración durante el trabajo y los
oligoelementos (elementos menores) que influyen significativamente sobre la
fertilidad, merecen una consideración especial.

El calcio y el Fósforo: condicionan un esqueleto:
Bien desarrollado
Sólido
Resistente

Los trastornos del metabolismo óseo deben evitarse ya que pueden provocar
• Alteraciones en el desarrollo y solidez del esqueleto.
• Retrasos en la consolidación corporal, no permitiendo la total expresión de
las cualidades genéticas.
• Consecuencias graves en potros jóvenes sometidos a trabajo y
entrenamiento prematuras (fracturas, etc.)

El crecimiento, la gestación, la lactación y el trabajo aumentan netamente las
necesidades de calcio y fósforo.

La relación fosfocálcica es de 1.6 – 1.7 en los jóvenes y de 1.3 - 1.4 en los adultos.

Por lo menos esta relación debe permanecer superior a 1 para prevenir la
sensibilidad a las fracturas.

Los excesos de calcio bloquean o entorpecen la absorción de atrás minerales
como el Magnesio, manganeso, zinc, hierro y cobre.

Las gramíneas son, relativamente débiles en calcio, la alfalfa deshidratada es una
buena fuente de calcio.

Los granos se caracterizan por su exceso de fósforo en relación al calcio, lo cual
se debe vigilar estrechamente.

Tabla 11. Necesidades de calcio y fósforo en el caballo.
Mg/kg de P.V./día P. 100 de la ración
Ca P Ca P
Potro 150 - 180 90-110 0.7 0.4
Yearling 110 - 130 65 - 75 0.6 0.35
Adulto en entretenimiento 35 - 60 20 - 40 0.35 0.25
Adulto con trabajo ligero 60 - 75 35 - 45 0.4 0.3
Yegua en gestación 60 - 85 35 - 55 0.4 0.3
Yegua en lactación 115 - 140 55 - 75 0.6 0.35

Necesidades en calcio y fósforo
Calcio Fósforo
Potro de 6 meses 35 - 40 20 - 25
Yearling 50 - 55 30 - 35
2 años 40 - 50 25 - 30
Caballo adulto en entretenimiento 25 - 30 15 - 20
Caballo en trabajo 30 - 40 20 - 25
Yegua en gestación 35 - 45 25 - 30
Yegua en lactación 65 - 80 35 - 45
Semental 60 - 70 30 - 40

La mayoría de raciones usuales son incompletas en los aportes mínimos de calcio
y fósforo, así como en la relación fosfocálcica.

Por lo tanto no sorprende que los équidos sufran de: Raquitismo, Osteomalacia,
Osteodistrofia fibrosa (osteofibrosis)

El Raquitismo: Es la manifestación de un defecto en la mineralización del hueso
en crecimiento y resulta de una carencia en calcio y fósforo, asociada a una
deficiencia en vitamina D; provoca lo que se conoce como “crisis del crecimiento”
en los potros.

La Osteomalacia: Tiene las mismas causas del raquitismo pero aplicadas al hueso
que ha completado su crecimiento y que acusa un déficit de mineralización sin
deformaciones importantes. Afecta principalmente a hembras lactantes, que
pierden grandes cantidades de minerales a través de la leche, y las cuales no son
compensadas adecuadamente.

La Osteodistrofia proviene de un exceso de fósforo en el alimento que conlleva a.
un aumento del mismo en la sangre y por consecuencia una hipocalcemia. Este es
el origen de un hiperparatiroidismo secundario que provoca la desmineralización
del hueso y su transformación en tejido fibroso. Actualmente la osteofibrosis
reviste, con frecuencia, formas crónicas mucho más severas y que se expresan en
la aparición de sobrehuesos, conchas, esparavanes, tendinitis, desgarros,
fracturas y otros trastornos mecánicos y dolores funcionales causantes de un gran
numero de cojeras.

Cloruro de sodio. Los caballos pierden con relativa facilidad sal por la orina y por el
sudor; esto es más cierto en caso de un trabajo intenso sobre todo en clima cálido.
Las pérdidas salinas son del orden 100 gramos/día de los cuales 35 – 40 son por
la orina y 60 - 65 por el sudor, a razón de 4.5 gramos/litro. Se necesita entonces
complementar ante una situación así, para evitar que aparezcan signos de fatiga y
de menor resistencia al calor. Las carencias más prolongadas se manifiestan por
alteraciones del apetito, jugosidad del pelo, reducción en el crecimiento y en la
secreción láctea. Los aportes de al se reforzarán además cada vez que la emisión
de orine (diuresis) se exagere, bien por consumo forzado de agua o por la
necesidad de excretar restos nitrogenados abundantes en raciones ricas en
proteínas más aún, si estas son de baja calidad.

El sobreconsumo de sal es tan perjudicial como las carencias y más aún, si no se
compensa por un suficiente abrevamiento. Puede ser responsable de trastornos
de la digestión, calambres musculares e incluso accidentes cardiacos con
fibrilación ventricular. La intoxicación es excepcional cuando el agua se deja para
consumo a voluntad y a dosis letal sería entonces. Tan elevada como 1 kilo de sal
por día.


Potasio, Magnesio y Azufre.

El Potasio, es particularmente útil en caballos de deporte ya que previene los
signos de astenia (falta de tono) nerviosa y muscular, aumentando la excitabilidad
neuromuscular. Su exceso induciría gran fatiga muscular y trastornos cardiacos
similares a los producidos por el sodio, acelerando la pérdida de éste por la orina y
entorpeciendo la asimilación del magnesio.

S
El manganeso. Es un sedante del sistema nervioso tanto central como periférico.
Su deficiencia se caracteriza por un aumento marcado en la excitabilidad
muscular, marcha incierta, sudoración profusa, aceleración del ritmo respiratorio y
colapso final. Su digestibilidad se disminuye por los excesos de calcio, fósforo y
potasio. En razón a que contrarresta la toxicidad del amoniaco sanguíneo, las
necesidades aumentan con las raciones muy ricas en nitrógeno.

En condiciones normales estas necesidades son valoradas en 13 mg/kg de peso
vivo que pueden ser cubiertas tanto con magnesia. Esta última sal tiene la ventaja
aportar azufre.

El azufre. Interviene en la elaboración de los estuches córneos, del cráneo y de
los cascos, condicionando la calidad del pelo, junto con el cobre y la vitamina A.
Su carencia no ha sido identificada en el caballo ya que los alimentos por lo
menos cubren ampliamente las necesidades (0.15%) de la dieta. Su exceso
dificulta la asimilación de los oligoelementos.


Oligoelementos o elementos menores.

Las necesidades de estos elementos son poco o mal conocidas en el equino y se
deducen de normas admitidas para otras especies.

Tabla 12. Necesidades de oligoelementos.
Necesidades según el N.C.R.
1973
Recomendaciones según
Concha 1969
Hierro Cobre Cobalto
Zinc Manganeso Yodo
50.5 a 8 0.05 - - 0.1 100 8 0.1 100 a 150 20
0.2

Las necesidades de hierro serian de 50 p.p.m. (partes por millón =mg/kg de
alimento) en periodo de crecimiento y de 40 p.p.m. en el caballo adulto.

Las necesidades pueden ser mayores en caballos productores de suero, en razón
a las sangrías abundantes y frecuentes, para evitar anemia, daño en las células
del hígado y trastornos de su metabolismo.

El cobre es un factor antianémico, junto con el hierro y el cobalto. Sus
necesidades están valorada en 8 p.p.m. en el potro y 5 - 8 p.p.m. en el adulto. Es
uno de los oligoelementos mas importantes ya que intervienen en numerosas
situaciones fisiológicas entre las que se destacan: estimulo a la formación de
colágeno, intervención en la síntesis de elastina y favorecimiento de las síntesis de
melanina entre otros, con lo que indirectamente aumentaría la resistencia a las
fracturas, aliviaría el trabajo cardiaco y mejoraría la calidad del pelaje y del casco.

El cobalto. Hace parte de la vitamina B-12 o cianocobalamina y permite su síntesis
por los microorganismos del tubo digestivo.

El zinc. Es necesario para la osificación, el crecimiento y la reproducción. Las
necesidades en el equino se sitúan alrededor de 50 p.p.m. por termino medio. Se
requiere tomar en cuenta las posibles fallas en la asimilación ligadas a excesos de
calcio, fósforo total, ácido fítico o proteína de soya por lo cual se aconsejaría
suplementar las raciones a 100p.p.m.
El Manganeso es indispensable para el desarrollo óseo y para la fertilidad. Su
carencia puede significar “sobrehuesos” o “corvejones derechos” y retrasos en la
osificación en los jóvenes, mientras que en reproductores puede afectar la libido,
la espermatogenesis y el ciclo estral. Los aportes pueden ser del orden de 50 a
100 p.p.m. especialmente en suelos muy calcificados o con forrajes de
leguminosas.

El yodo estimula también la función reproductiva, su carencia lleva al nacimiento
de potros muertos o muy débiles. En algunas yeguas favorece la entrada en calor
cuando se administran 5 mg diariamente en forma de yoduro de potasio, quizás
por un aumento de la actividad ovárica.

El Selenio es importante para prevenir la distrofia muscular o “enfermedad del
músculo blanco”, especialmente en los potros en los que su carencia provoca
rigidez progresiva en la marcha, dificultades en el sistema cardiorrespiratorio e
incluso muerte.

En la práctica, la ración debería llevar 0.10 a 0.15 p.p.m. de selenio, es decir, 6
mg. por 60 a 70 kg. De materia seca.

El flúor, el plomo y el cadmio son los restantes oligoelementos presentes en las
dietas para equinos y que poseen relativa importancia nutricional.

Resumiendo, las necesidades de estos elementos son cuantitativamente muy
escasas (por definición) y su importancia fisiológica concierne especialmente a la
osificaci6n y la fertilidad y ya que son bien tolerados, es norma practicar
suplementación en forma conjunta y sinérgica con las vitaminas.

Vitaminas.

Las vitaminas pueden ser: liposolubles o hidrosolubles.,
Vitaminas Liposolubles. Que se pueden disolver en las grasas, son: Vitamina A,
Vitamina O, Vitamina E y Vitamina K. Entre ellas la Vitamina A se coloca en primer
lugar por su papel fisiológico fundamental. En el equino sin embargo. La Vitamina
D, por su intervención en la mineralización del esqueleto y la E por su función en
el trabajo muscular, merecen atención especial.

La carencia de Vitamina .A, frecuente en la práctica, afecta en forma selectiva la
reproducción entorpeciendo la producción de espermatozoides, la ovulación, la
nidación y la gestación o conduciendo al nacimiento de potros débiles, sin vigor
para alimentarse y muy sensibles a las enfermedades pulmonares, digestivas,
renales, articulares, del ombligo, ya las infestaciones parasitarias.

La utilización de forrajes deshidratados (harina de alfalfa y de zanahoria picada),
de ensilaje de excelente calidad contrarresta en forma importante el déficit de
vitamina A. Un aporte suplementario se justificaría como prevención de la
infertilidad en planteles de reproducción. Las necesidades mínimas de vitamina A
son.



Tabla 13. Necesidades mínimas en vitamina A (en unidades internacionales).
TIPO DE ANIMAL Por animal y por día Por kg de Alimento
Potro (6 meses) 9000 10600 1600 1700
Yearling (12 - 18 meses) 14000 17500 2250 2500
Adulto en entretenimiento 12500 15000 2250 2200
Adulto en trabajo ligero 12500 15000 1600 1650
Adulto en trabajo medio 12500 15000 1200 1250
Yegua en gestación 24000 30000 4000 4200
Yegua en lactación 25000 30000 2500 2750

La Vitamina E aumenta la estabilidad de los glóbulos rojos en los caballos e
interviene en la integridad de ha célula muscular, protege contra “la enfermedad
de la grasa amarilla”, un desorden del metabolismo de las grasas, común en
ciertas razas de caballos.

Las necesidades serían del orden de 10 mg. por 100 kg. De peso vivo y su acción
es sinérgica con el selenio.

La Vitamina K o vitamina de la coagulación se sintetiza abundantemente en el
tubo digestivo, lo que permite recuperarla en forma suficiente. Las necesidades no
exceden de 1 mg. de vitamina K por caballo /día.

Los alimentos enmohecidos o contaminados por toxinas de hongos (aflatóxinas),
las cuales poseen propiedades antivitamina K, pueden provocar carencias
subclínicas. El empleo terapéutico se justifica con ocasión de un tratamiento
antibiótico intensivo por vía oral que perturbe la síntesis de vitamina K por la
microflora, o en caso de una operación quirúrgica, pero no tiene sentido para
prevenir el sangrado por la nariz (epistaxis) en el caballo de carreras, como es
usual observar en ciertos planteles.

Vitaminas Hidrosolubles. Vitaminas del complejo B y Vitamina C.

Normalmente un caballo adulto sometido a trabajo moderado no sufre de ninguna
carencia de vitaminas hidrosolubles, bien sea porque su dieta las aporta
suficientemente o porque la síntesis intestinal y tisular las provea en forma
adecuada. Quizás el potro cuya flora digestiva es poco activa o el caballo
sometido a trabajo intenso (de vaquería y de carreras) multiplican sus necesidades
hasta diez veces.

Las vitaminas del Complejo B, son importantes en el caballo de deporte,
especialmente las vitaminas B1, B2 o B12.

La Vitamina B1 o Tiamina es importante para el trabajo muscular, controlando la
utilización de los azucares y los lípidos aumentando la reserva energética a nivel
tisular. Las necesidades pueden ser cercanas a 3 mg/Kg. Se sintetiza en el
intestino y su deficiencia produce perdida del apetito, descoordinación nerviosa de
las extremidades, perdida de peso y debilidad.

La Vitamina B2 o Riboflavina sé relaciona también con la oxidación de los
azúcares y lípidos como fuentes de energía de la actividad muscular y evita en el
caballo afecciones oculares como inflamación de la conjuntiva, lagrimeo, fobia a la
luz, lesiones del cristalino, de los humores oculares y de la retina. Las
necesidades en vitamina B2 han sido calculadas en 2.2 mg/Kg. de alimento en el
caballo normal pudiéndose aumentar por el trabajo muscular. Se produce por
síntesis intestinal, su deficiencia produce oftalmia periódica.

La Vitamina B-12 o Cianocobalamina es famosa por su acción contra la anemia y
se emplea en el caballo de carreras buscando elevar los porcentajes de
hemoglobina y la resistencia al esfuerzo físico, técnica por lo general ineficiente si
la ración lleva suficiente cobalto a no ser que el animal padezca de una anemia de
origen patológico. Es sintetizada en el tracto digestivo.

La Niacina, el Acido pantoténico y la Piridoxina poseen papeles fisiológicos muy
ligados a la Riboflavina y su utilización corre pareja al aumento de los gastos de
energía.

Pueden tener interés en los animales jóvenes en crecimiento y en las yeguas en
lactación.

Se resalta aquí que es preferible utilizar levaduras secas o residuos de cervecería
como fuentes de vitaminas del complejo B, en vez de usar estas en estado puro ya
que son poco apetecidas y tienden a reducir el consumo de alimentos.

La Vitamina C no es indispensable en el caballo y más bien su uso incontrolado
estimula la formación de cálculos urinarios y menoscaba la función renal.


LECCION 18. PRINCIPIOS GENERALES DE LA ALIMENTACIÓN
EQUINA.


PRINCIPIOS BÁSICOS.

El éxito en la alimentación de los caballos depende en gran medida del buen juicio
y la habilidad de su cuidador o propietario. Se puede afirmar sin exagerar que la
destreza y en sentido común en la alimentación de los equinos suele ser tan ó
más importante que con otra clase de ganado, aunque siempre lo sea en la
alimentación de cualquier animal. Cabe recordar que como animal de trabajo se
debe alimentar de acuerdo con la clase y la intensidad de la labor que realiza.
Particularmente, la alimentación debe adaptarse a las condiciones especiales de
cada región sin apartarse sin embargo, de las normas modernas de la nutrición
equina asegurando eso si, los mejores resultados en materia de salud, fecundidad
y rentabilidad.

La alimentación del caballo tendrá en cuenta las necesidades propias de los
equinos y las exigencias particulares de cada especialización mas aún si se trata
de caballos de gran valor o aptitud deportiva, recordando que a medida que se
eleva la intensidad del trabajo el nivel de selección (en otras palabras, a medida
que el caballo es “más fino”) las exigencias alimenticias aumentan; éstas tendrán
que ser satisfechas en aras de conservar la salud y obtener mejores resultados,
sin exagerar no obstante, los costos económicos. Aquí conviene señalar que el
potencial o la precocidad genética no se manifestaran plenamente a menos que la
alimentación adecuada lo permita, en otras palabras “la raza entra por la boca”.

En lo concerniente a la salud, los problemas nutricionales abarcan un campo muy
amplio. Cualquier descuido, error, negligencia o desconocimiento de tales
necesidades provocaría desórdenes graves entre los que cabe recordar, los
cólicos, problemas del casco (infosura) intoxicación muscular (Mioglobinuria),
afecciones óseas y trastornos de la reproducción entre otros. Son muchos los
caballos pura sangre de alto precio que ven disminuida su capacidad o han muerto
a consecuencia de lesiones de sus miembros (fisuras, fracturas, infosura, etc.),
estrechamente relacionadas con la alimentación.


NORMAS PRÁCTICAS DE ALIMENTACIÓN DEL EQUINO.

Racionar consiste en balancear, o compensar las necesidades nutritivas mediante
los aportes alimentarios suficientes, equilibrados y adaptados (a la especie, edad,
producción, etc.) palatables (apetentes) y al mismo tiempo, en lo posible,
económicos. La alimentación de los caballos podrá realizarse por tres sistemas a
saber:

- Pastoreo (en potrero).
- Mixto (combina pastoreo y pesebrera).
- Estabulación (el alimento se consume en la cuadra o establo).

Dependiendo del nivel de especialización y de las necesidades particulares el
cuidador podrá escoger uno cualquiera de los sistemas anteriores. Cabe recordar
entonces que:

Para conducir en forma adecuada la alimentación del equino es imperativo tener
en cuenta la Fisiología digestiva lo que permite mejorar la utilización del alimento y
sobre todo para evitar trastornos de origen gastrointestinal, a los que el caballo es
parcialmente sensible.

La ausencia de sustancias tóxicas que alterarían el valor higiénico del alimento,
así como el adecuado equilibrio nutricional permite asegurar la calidad de la ración
como un factor esencial.

La alimentación deberá ajustarse en forma individual en función de los gustos,
apetito, facultades digestivas, metabolismo y consumo. El ajuste de la
alimentación de cada caballo es primordial y requiere el conocimiento, el control, la
atención y la destreza de un cuidador o propietario competente lo que garantizará
el éxito final.

Tales normas generales sumadas a ciertas reglas sencillas son de importancia
primordial y se refieren al abrevamiento, control de la cantidad de alimento, reparto
de las comidas, presentación de la ración y calidad higiénica de los alimentos
utilizados:

ABREVAMIENTO.

http://uco.es
Aunque propiamente un nutriente, el agua es tan importante o mas que el
alimento, ya que es el medio en que se diluyen todos los solutos en el
metabolismo del caballo y es el 68-72 % del peso corporal del animal. El
suministro de agua debe ser constante o por lo menos periódico durante el día ya
que permite la recuperación de los líquidos que el caballo pierde en la orina, las
heces, el sudor y la respiración.

El agua debe ser de buena calidad (potable) sin contaminantes químicos ni
biológicos, apetente con una temperatura media. En lo posible se procurara un
abrevamiento completo y frecuente lo que se asegura mediante el uso de
bebederos individuales. Aquellos caballos sedientos por un trabajo intenso,
durante el verano o los de hipódromo que recién terminan una carrera extenuante
y desean beber, se les permitiría reposar inicialmente para luego ofrecerles agua
impidiéndoles que consuman exageradamente para prevenir los “cólicos de
agua”, ocasionados al llegar gran cantidad de agua fría al estomago en forma
súbita.

Una buena práctica para que el caballo pueda refrescarse, es hacerlo galopar
lentamente en el último kilómetro y posteriormente pasearlo a la marcha durante
diez o quince minutos, para luego ofrecerle agua fresca.

La cantidad de agua que necesita un caballo depende de las condiciones
climáticas y de la intensidad del trabajo realizado. En término medio, un caballo
necesita diariamente alrededor de 55 litros de agua. Es también útil en el plano
nutricional que en el caballo beba DESPUÉS del consumo de forraje (Para facilitar
el tránsito de los mismos) pero ANTES de la ingestión de los alimentos
concentrados. Practicándolo así se evitaran las indigestiones estomacales y se
impedirán las bajas de digestibilidad que afecta a los concentrados cuando se
evacuan muy rápido del estomago bajo el efecto del flujo de agua. Puede ser útil,
en algunos casos, para mejorar la palatabilidad del agua agregar cloruro de sodio,
te, heno o yerbas aromáticas particularmente si tenemos en cuenta aquí, la
importancia de la integridad del cierre de los labios y la función de la lengua en el
proceso de abrevamiento.

LECCION 19. CANTIDAD DE ALIMENTO SUMINISTRADO.

En lo posible y con el fin de evitar los excesos y ser preciso, se recomienda medir
las cantidades que se distribuyen así como las que los animales rechazan o
rehúsan. Es preferible expresarse en términos de peso mas que en términos de
volumen, ya que este ultimo cambia mucho de acuerdo con la presentación del
alimento, ya sean granos enteros, machacados, partidos, etc., o forrajes largos o
aglomerados. Etc.

La cantidad de alimento será siempre ajustada a las necesidades y principalmente
el dar concentrado variara constantemente según la intensidad del trabajo
muscular. Toda sobrecarga nutritiva es peligrosa. Predispone a los cólicos y a los
accidentes de tipo congestivo (inflamación de la lámina de los cascos, “golpe de
sangre” (mioglobinuria), etc. Por eso, siempre que sea posible, esta indicado
agregar a las raciones en donde la avena es el componente principal, una cierta
cantidad de forrajes (pasto), zanahorias o cualquier otra materia prima suculenta,
igualmente puede suministrarse salvado, linaza o sulfato de magnesio ya que los
tres son favorables por su acción laxante.

Cuando el caballo deba entrar en periodo de descanso o reposo se debe reducir
simultáneamente y en forma proporcionada de cantidad de alimento. Si se esta
dando concentrado este deberá reducirse prioritariamente y se podrá sustituir por
alimentos que refresque tales como zanahoria u otros. Los caballos en descanso
tienen necesidades energéticas, proteicas, vitamínicas y minerales bastante bajas,
y podrán ser mantenidos económicamente con alimentos de bajo valor energéticos
que les proporciones las calorías necesarias para mantener la temperatura de su
cuerpo, lo cual es requisito en la inactividad.

El mismo cuidado se debe tener en cuenta para prevenir trastorno digestivo con
sus complicaciones graves, se debe tener cuando el animal regresa del descanso
y deba aumentarse la cantidad de alimento o cuando se requiere colocarlo en
tratamiento intensivo. Tales cambios de régimen deberán efectuarse en forma
progresiva y cuidadosa para lograr conseguir una nueva adaptación de la
motilidad intestinal, de las secreciones y sobre todo de las fermentaciones
digestivas. Cualquier cambio brusco provocara liberación de sustancias toxicas
responsables de trastornos circulatorios y sobrecargas en hígado y riñones.

Reparto de comidas.

Como norma, es conveniente que los alimentos los consuma el caballo en un
ambiente tranquilo, de calma y quietud con lo que se asegura un consumo
máximo, una masticación completa y un buen desarrollo de los procesos
digestivos. De igual manera, la regularidad en la distribución de las comidas
propiciara la buena utilización digestiva así como el equilibrio nervioso del caballo.
Lo más conveniente, es que las comidas sean pequeñas, tan numerosas como
sea posible y bien repartida en el tiempo, siempre en función de las horas de
trabajo. Lo anterior evitara sobrecargar el estomago innecesariamente y le
permitirá consumir enteramente su comida, a un ritmo normal e incluso avanzar su
digestión antes de ser sometido a un trabajo fuerte.

Es aconsejable entonces repartir la cantidad de alimento total del día, en por lo
menos tres comidas para los caballos en actividad, pudiendo aumentarse según la
intensidad y clase de trabajo. Los concentrado, se repartirán a lo largo del día ya
que se consumen rápidamente y su digestión se acomoda mejor a cortos periodos
de descanso. En cambio, los forrajes deberán suministrarse en la tarde, ya que las
horas de reposo de la noche permite una masticación y una digestión más lenta
evitando también el aburrimiento y el peligro de la aparición de “pica” y de tic en
los caballos nerviosos.

Como ejemplo podría utilizarse el modelo propuesto por el profesor Wolter como
sigue:

- Mañana: Una tercera parte de los granos (1/3) y una parte (1/4) del forraje
- Mediodía: Lo mismo de la mañana, 1/3 y ¼.
- Tarde: Una tercera parte de los granos y la mitad del forraje; 1/3 y ½.


PRESENTACIÓN, HIGIENE Y CALIDAD DEL ALIMENTO.

La forma de presentación de la ración actúa en muchas ocasiones sobre de salud
del caballo. Los alimentos muy pulverizados o los henos polvorientos favorecen la
aparición de enfermedades respiratorias.

Los alimentos se podrán presentar en su forma natural y corriente o podrán ser
sometidos a varios procesos buscando siempre mejorar su utilización y eficacia
nutritiva. Los alimentos pueden ser triturados, como suceden con los granos
pequeños como el sorgo y el trigo o aplastados en el caso de los granos duros
(cebada, maíz). La avena comúnmente es machacada (chancada) y humedecida
antes de su distribución. La cebada muchas veces es sometida a cocción
buscando mejorar su digestión a través del ablandamiento. El picado de los
forrajes e incluso su granulación, después de triturarlos, eleva la indigestión,
aumenta su nivel energético y economiza energía en proceso digestivo.

Cualquier método que se use, beneficiara al caballo en por lo menos tres de las
cuatro posibilidades siguientes:

- Asegura una buena manifestación.
- Asegura la velocidad de ingestión.
- Reducirá el gasto del transito digestivo.
- Acelerara la velocidad de digestión.

Es de interés también a la hora de alimentar los equinos utilizar fuetes energéticas
de rápida asimilación como es el caso de la melaza, la panela molida o el azúcar
natural, de gran valor para el esfuerzo muscular.

En lo posible se evitara consumir alimentos de pésima calidad, sucios o de escasa
o nula eficacia nutritiva. Los alimentos no serán:

Polvorientos (henos) o muy pulverizados (gramos).
Fermentados o rancios (maíz).
Mohosos: o contaminados por toxinas de hongos. Cabe recordar el peligro de la
contaminación por cualquiera de las siguientes clases de hongos y toxinas.
Toxina T2 de Fusarium trcinctum.
Aflatoxina de Aspergillus flavus (hemorragias).
Cladosporium herbaram (encefalitis).
Fusarium graminearum (diarreas).
Fusarium monoliforme (encefalomalacia).
Ocratoxinas, Rubratoxinas, etc.

Contaminados por semillas o plantas venenosas; son fuente de intoxicación: el
helecho águila, el sorgo en hierba, la cola de caballo, el cornezuelo de centeno, la
arveja silvestre entre otros.
Contaminados por huevos, larvas o adultos de parásitos gastrointestinales: hace
mención a los forrajes recolectados de praderas húmedas, potreros no rotados,
rastrojos, potreros con mal drenaje y zonas verdes de áreas urbanas infestadas
por perros y otros mamíferos (incluso el hombre).


ALIMENTACIÓN DEL CABALLO EN LAS DIFERENTES ETAPAS DE LA VIDA.

- Alimentación del caballo adulto en reposo.

Durante los periodos de descanso o de baja producción de los caballos solo
necesitan alimento suficiente para su mantenimiento, aunque el animal no utilice
energía, los procesos normales de su organismo continúan en actividad.

Los forrajes pueden constituir la mayoría o incluso la totalidad de la ración, si son
de buena calidad. Un buen pasto, o un aporte de heno a razón de 7 Kg para un
caballo de 475 Kilos de peso vivo, bastan para cubrir las necesidades de un
caballo adulto en reposo. Según la disponibilidad, podrán usarse algunas raíces
(zanahorias, papas, remolachas, etc.) y se mantendrán permanente y libre
disposición de un complemento mineral, más o menos vitaminado que corrija las
eventuales carencias especialmente en sal, fósforo y oligoelementos. Si se trata
del mantenimiento de una cierta actividad o de una fase de recuperación puede
justificarse un cierto grado de complementación a esta ración. Puede usarse
concentrando en cantidad acorde al aumento de los gastos de energía, y de
calidad según la función implicada.


- Alimentación de los equinos destinados a la reproducción.

En periodo de cubriciones: El padrillo debe recibir una alimenticia adecuada
acorde con su edad, su individualidad, su raza, su trabajo y fundamentalmente
según el ritmo de sus montas o cubriciones. Muchas veces se exageran las
necesidades cuantitativas en esta etapa, y entonces formamos reproductores
cebados pero no musculados. La gordura es perjudicial para la fertilidad y la
longevidad del semental.

Un excelente estado de salud que reflejaran en el vigor, la libido o deseo sexual y
la calidad del semen, aspectos que se expresan en una mejor fertilidad. De tal
manera que los sementales sean alimentados con ración compuesta, equilibrada
en proteína, energía, minerales y vitaminas. Durante la época de montas, las
necesidades nitrogenadas y energéticas del semental aumentan paralelamente a
la frecuencia del servicio. En forma inversa algunos sementales muy excitados
pierden el apetito. Es entonces es necesario, aumentar la distribución de alimento
y modificar adecuadamente la ración. Los concentrados, como alimentos
compuestos y completos, juegan un papel importante. El germen de trigo aportara
un buen tenor de vitamina E, mientras que los forrajes condicionados (alfalfa
deshidratada), son excelentes fuentes de proteína, calcio, carotenos y vitaminas.

A manera de ejemplo, podría usarse una ración que contenga por lo menos los
siguientes elementos distribuidos en tres comidas, para un reproductor de 600 u
880 kilos de peso vivo.


Avena =5 kg.
Maiz =1 kg.
Heno =2 Kg.
Pasto =2 kg.
Zanahoria =1. Kg.
Salvado de trigo =1 kg.
Alfalfa deshidratada =2 Kg.


- Comienzo de la gestación (yegua gestante).

La gestación en si, no produce un aumento exagerado de las necesidades, en
cambio es necesario cubrir estas en forma adecuada teniendo en cuenta la
lactancia por una parte y la sucesión rápida de posibles gestaciones por otra.
La yegua deberá entrar en gestación en el mes siguiente al parto, para que se
pueda esperar un potro cada año en nuestro país, solo la mitad de las yeguas
destinadas a reproducción produce una cría cada año, siendo uno de los niveles
reproductivos mas bajos de los animales domésticos. Esta pobre producción se
debe a muchos factores tales como la herencia, factores fisiológicos,
enfermedades, manejo incorrecto durante la crianza, y el alto grado, condición y
nutrición deficientes,

La entrada en gestación corresponde a la fase de acenso incluso al pico de la
secreción de la leche la cual capta el máximo de los elementos nutritivos. La
yegua se ve obligada a “echar mano” de sus reservas para responder a su
secreción Láctea. Si alimentamos insuficientemente a la yegua al final de
gestación, reduciremos las reservas corporales disponibles. Un defisis al comienzo
de la lactación, desplaza la prioridad vacía de la secreción de leche en desprecio
de la función reproductiva. Los calores se harán mas débiles (silentes) y mas
espacios (anestros). El éxito de las cubriciones no se garantizara, bien por
dificultades en la detención del celo, o bien por fallas en la ovulación o en la
nidación. El intervalo entre las gestiones se prolonga y así algunas yeguas no dan
cría sino cada 2 años.

- Durante la gestación.

Se considera que una yegua que ha sido cubierta se encuentra posiblemente
preñada, si no entra nuevamente en calo tres semanas después del último
acoplamiento. Esto no es normal para todas hembras equinas y por esta razón
debe ser observada cuidadosamente hasta confirmar el estado de preñez.

Cuando esto es así, debe colocarse junto con otras hembras en un potrero limpio
y con buen aporte de pasto nutritivo, un pasto de buena calidad le proporcionará
todos los elementos necesarios para su alimentación durante los primeros cuatro
meses. Si el potrero es pequeño y existe mucha competencia por el pasto será
necesaria una alimentación suplementaria que puede ser cubierta suministrándole
1 Kg. de avena o cebada y hasta 2 Kg. de heno de buena calidad. Cuando sea
dudosa la calidad del alimento que se ofrece a la yegua puede recurrirse al uso de
concentrado (1 - 1.5 Kg/día) el cual estará provisto de minerales y vitaminas.

Al final de la gestación, el aumento de las necesidades no es perceptible, sino al
séptimo mes de gestación y progresa poco a poco hasta el onceavo mes, en razón
a que la yegua desarrolla las dos terceras partes de su cría durante los últimos 3.5
- 4 meses antes de parir. Sin embargo, la complementación correspondiente será
un poco mayor para alcanzar los siguientes beneficios:

• Compensar la reducción del apetito, que declina casi 1 Kg. de materia
seca/100 Kg. de peso vivo.
• Obtener un potro más fuerte en el nacimiento, más pesado, más vigoroso
para mamar y más resistente a las enfermedades.
• En el caso que la yegua estuviera delgada se podrá ganar un retorno más
rápido a una nueva gestación y una lactancia persistente y sostenida.

En todo caso la justificación de esta complementación y su nivel dependen del es-
tado de conservación de la yegua. Esta complementación puede ser de 1 después
2 y como máximo 3 Kg. de concentrado por animal diariamente, así como
adecuado forraje y emolientes como el salvado o la linaza para prevenir el
estreñimiento. En todo caso, la complementación no debe sustituir la ración base
que deberá permanecer constante en su nivel de proteínas (un tercio del total de
la ración) y de energía. Teniendo en cuenta la reducción del apetito se buscarán
los forrajes más apetitosos y digestibles que no aumenten de volumen en el
intestino grueso y aporten más elementos nutritivos. En la medida que se pueda
prever el parto con precisión la ración se debe reducir los últimos días para
“liberar” todavía más el abdomen. El grano se debe omitir cuando haya parido la
yegua por lo menos durante los primeros 3 o 4 días para ir reintroduciéndolo
paulatinamente; a manera de control sirve vigilar el estiércol el cual debe ser
relativamente blando.

- Durante la lactancia.

La secreción láctea implica gastos muy importantes que se evalúan según la
velocidad de crecimiento del potro. Por cada kilo de ganancia del potrillo se
requiere el consumo de unos 15 litros de leche que corresponden a 4 ó 5 kilos de
forraje suplementario de excelente calidad, más unos 4 a 5 Kg. de concentrado
por yegua/día, en periodo de producción máxima, (2 - 3 mes) para ir descendiendo
rápidamente según la persistencia de la secreción de leche y el estado corporal de
la yegua. La salida progresiva al pasto de la yegua con su potro se debe vigilar
cuidadosamente, para evitar los excesos de nitrógeno de las praderas tiernas que
provocan cólicos y diarreas en el potro lactante. Por el contrario, si se recurre a
una complementación suficiente y adaptada, la salida progresiva a la pradera trae
grandes beneficios sobre la producción de leche, sin contar con lo que representa
el aire libre para el potrillo.


Tabla 14. Ración En Kg. Concentrado Y Heno O Su Equivalente En Pasto De
Corte O Pasto Fresco, Para Una Yegua Parida De 370 Kg. En 2 Etapas
Diferentes.
ETAPA CONCENTRADO HENO PASTO DE
CORTE
PASTO
FRESCO
Hasta 3 meses 5 - 5.5. 5 - 5.5 15 - 16.5 22 - 25
De 3 meses al
destete
3.5 - 4 6.5 - 7 19.5 - 21 28 - 33
Tomado de solla.


- Alimentación del potro en crecimiento.

Los potros en desarrollo, al igual que otros animales requieren una buena
nutrición, para satisfacer la demanda de los huesos en crecimiento, los músculos y
los tejidos del cuerpo. El potro en crecimiento adquiere la mitad de su peso adulto
en su primer año. Es en este estado donde mayor prevención se debe prestar a la
nutrición del potro ya que los errores y descuidos son graves, frecuentes y
costosos y determinarán todo el porvenir del animal.

La norma será la siguiente: Preparar cuidadosamente el destete durante la
lactación, complementando adecuadamente. Después alimentar equilibrada y en
forma generosa alternando los forrajes de buena calidad con los granos y el
concentrado, garantizado así el mejor desarrollo óseo y muscular, permitiendo la
expresión genética y la mayor precocidad.


Tabla 15. Ración En Kg De Concentrado Y Heno O Su Equivalente Pasto Fresco
Para Potros En Distintas Etapas.
ETAPA CONCENTRADO HENO PASTO DE
CORTE
PASTO
FRESCO
Hasta el
destete
2 - 2.5 0.85 - 1.1 2.5 - 3.3 3.5 - 5
Del destete a
los 12 meses
2.7 - 3 1.8 - 2 5.5 - 6 8 - 9
De 12 - 18
meses
3 - 3.5 3.5 - 4 10.5 - 12 15.75 - 18
Tomado de solla.


- Lactancia.

La lactancia puede ser natural o artificial. La lactancia natural plantea pocos
problemas puesto que el potro dispone de toda la leche de su madre y porque la
lactación es larga y le permite adaptarse paulatinamente a los alimentos secos.

La importancia de la lactación natural radica en el calostro el cual posee una triple
misión práctica: laxante, de protección (inmunitaria) y nutricional.

Por su acción laxante, el calostro activa la evacuación del meconio. Y mientras
más rápido tome el calostro el potro menos necesario será el uso de purgantes o
enemas.

El calostro es muy rico en defensas (anticuerpos) que se transmiten de la madre a
su cría y que lo protegerán contra los microorganismos presentes en el medio
ambiente. El calostro es muy nutritivo, especialmente en energía y vitaminas.
Constituye el alimento ideal para aumentar las reservas en vitaminas y glucosa,
asegurando un mayor vigor y resistencia a las diversas agresiones.

En la yegua cada tetada debe desocupar la glándula mamaria. La retención de
leche favorece la aparición de mastitis (inflamación de la glándula mamaria) lo cual
reducirá la producción en perjuicio del recién nacido.

La lactancia artificial se impone por razones sanitarias bien sea por muerte de la
yegua, nula producción de leche, mastitis, etc. Es exitosa si el potrillo ha tomado el
calostro previamente, caso contrario se puede intentar ayudar con vitaminas,
suero y antibióticos.

El potro puede alimentarse con leche de vaca corregida especialmente del
siguiente modo:

Leche de vaca 700 ml.
Agua hervida 260 ml.
Lactosa o Glucosa 30 gr.
Carbonato de Calcio 5 gr.
Levadura 5 gr.
Azúcar o panela 2 – 3 cucharadas

Se puede dar 500 cc de esta mezcla cada seis horas mediante “biberón” para
después acostumbrar al potro a beber en un balde, teniendo en cuenta el controlar
las cantidades consumidas y las sobras para ir adaptando el consumo.


- Destete.

El destete se hace por lo general en forma tardía entre los 5 y 10 meses. El potro
tiene tiempo para ir adaptándose a los alimentos secos y antes de realizar un
destete completo se le debe preparar ofreciéndole un alimento complementario de
la leche, especialmente concebido para él, además de heno y agua.
El alimento complementario debe atraer al potro y excitar su apetito al máximo.
Tendrá un 14 - 15% de proteína, 0.7% de calcio, 05% de fósforo, suficientes
cantidades dé vitamina A y D y estará en un lugar de libre acceso para el animal.
El destete se retrasará para potros débiles (enclenques) o poco desarrollados y es
preferible fijar este momento cuando el potro logre un peso mínimo de 220 kilos
aproximadamente, o cuando el nivel de consumo fijado de forma arbitraria en 3 - 4
kilos de alimento por día se logre, lo que toma en consideración el desarrollo
fisiológico del potro y su verdadera aptitud para ser privado de la leche.

Cuando los forrajes que constituyen la base de la ración son muy nitrogenados,
los cereales son suficientes para complementar adecuadamente al caballo
sometido a un trabajo muscular. Basta solo con asociar un complemento mineral
rico en sodio y calcio. Si los forrajes cubren las necesidades de entretención en un
trabajo de ligero a moderado, se necesita un aporte de 4 litros de avena por día (o
sea 2 Kg.), o bien de 2 Kg. de cebada y uno de maíz: si el trabajo es más intenso
exigiría aumentar a 6.5 kilogramos de avena o 5 kg. de cebada, o bien 4.5 kg. de
maíz.

Es también posible y recomendable si el bolsillo lo permite, usar alimentos
concentrados aumentando los aportes paralelamente al aumento de los gastos
energéticos, comenzando a manera de ejemplo con 1 kg/día para ir aumentando
según la calidad e intensidad del trabajo realizado.

Por último, es preciso admitir que la apreciación cuantitativa de un esfuerzo
muscular es muy subjetiva, de ahí que la observación atenta del comportamiento
de cada individuo resulta indispensable para realizar las correcciones adecuadas.

FASES DE LA DIGESTIÓN EN LOS EQUINOS.

- Cefálica: es cuando el cerebro del animal prepara el sistema digestivo para
recibir el alimento, después de verlo, olerlo, escucharlo (sonido del
concentrado al caer a un balde) o por ser la hora acostumbrada de
alimentarse diariamente (reloj biológico).
- Oral: es la entrada del alimento en la boca, seguida de la masticación, la
salivación y la deglución (acción de tragar).
- Fermentación del estomago: las bacterias hacen una fermentación láctica
de los carbohidratos que pasan por el estomago.
- Enzimática: se inicia en el intestino delgado por la acción de diferentes
enzimas que descomponen los nutrientes en fracciones más simples,
capases de ser absorbidos por las paredes intestinales.
- Fermentativa del ciego: es la fermentación de la fibra que realizan las
bacterias y los protozoos en el ciego y que produce ácidos grasos volátiles.
Tales bacterias también hacen un aporte en aminoácidos que se absorben
en el colon.
- Absorción final: en el ciego y en el colon se hace una absorción del resto
de los nutrientes y de agua.
- Excreción: la parte del alimento no absorbido se acumula en el recto para
ser excretado como estiércol en forma de bolas a través del ano, cuya
textura depende del contenido de fibra y agua.

El tiempo que dura un alimento en pasar a través del sistema digestivo desde la
boca hasta que los desechos son excretados del organismo, depende del
contenido de fibra y agua de estos. Los alimentos muy fibrosos pueden
tardar hasta 65 o 75 horas.



LECCION 20. CONDICIÓN CORPORAL.


El peso en kilogramos no es el factor más importante para determinar si un caballo
se encuentra en el estado de carnes apropiado, pues depende de cómo se
observa su condición corporal, es decir, la distribución de la grasa de reserva en
su figura exterior.

Se ha presentado el sistema de valoración corporal del caballo, diseñado por el
Doctor Henneke de la Universidad de Texas A. & M., como una guía para poder
reconocer el grado en que se encuentra cada caballo; sin embargo, pueden haber
mínimas variaciones en su aplicación, dependiendo de la temperatura, humedad, y
otros factores medio ambientales; al igual que la raza y el estado fisiológico del
equino pueden presentar algunas variaciones.




Tabla 16. Evaluación de la Condición Corporal del Equino
VALOR CLASE DESCRIPCIÓN
1 Pobre
Extremadamente flaco: el hueso es muy prominente
en las apófisis espinosas, costillas, base de la cola,
punta del anca y punta de la nalga. La estructura
ósea de la cruz, hombros y cuellos es fácilmente
visible.
No se siente tejido graso al tacto.
2 Muy Flaco
Capa de grasa delgada, cubriendo las apófisis
espinales; las apófisis transversales de las vértebras
lumbares se palpan redondeadas. Costillas, base de
la cola, punta del anca y punta de la nalga son
prominentes. Cruz, hombro y cuello levemente
notables.
3 Flaco
Un poco de grasa entre las apófisis espinales, las
apófisis transversales de las vértebras lumbares no
se palpan al tacto. Una capa de grasa delgada
recubre las costillas pero aún así tanto las apófisis
espinales como las costillas se notan visualmente. La
base de la cola es prominente, pero cada vértebra
individual no se identifica visualmente. La punta del
anca aparece redondeada pero fácilmente notable.
Punta de la nalga no se distingue y tanto la cruz, los
hombros y el cuello se encuentran acentuados.
4
Moderadamente
Flaco
Apenas visible la línea externa de las costillas. Base
de la cola prominente dependiendo de la
conformación del caballo, pero la grasa se puede
sentir al tacto alrededor de ella. La punta del anca no
es notable. Cruz, hombros y cuello no tan delgados.
5 Moderado
Lomo nivelado o aplanado. Las costillas no se
pueden distinguir visualmente pero si al tacto. Grasa
alrededor de la base de la cola comenzando a
sentirse esponjosa al tacto. La cruz se ve redondeada
por encima de las apófisis espinales. Hombros y
cuello se observan bien fusionados entre si.
6
Musculoso
Moderado
La grasa sobre las costillas se siente esponjosa. La
grasa alrededor de la base de la cola se siente suave.
Se comienza a depositar grasa a los lados de la cruz,
detrás de los hombros y a los lados del cuello.
7 Musculoso
Puede verse pliegue en el lomo. Las costillas se
pueden sentir individualmente al tacto pero se percibe
grasa entre ellas. La grasa alrededor de la base de la
cola es suave. Hay grasa alrededor de la cruz, detrás
de los hombros y a lo largo del cuello.
8 Gordo
Pliegues en el hombro. Las costillas difícilmente se
distinguen al tacto. Grasa alrededor de la base de la
cola muy suave. La cruz y detrás de los hombros se
encuentran llenos con grasa. El cuello se percibe más
grueso. Se deposita grasa a lo largo de los músculos
en su cara interna.
9
Extremadamente
Gordo
Pliegues en el lomo. Sobre las costillas se observan
parches de grasa como montañitas. Grasa
sobresaliente alrededor de la base de la cola, a lo
largo de la cruz, detrás de los hombros y a lo largo
del cuello. La grasa depositada a lo largo de los
muslos en su cara interna causa fricción entre sí. Los
flancos están llenos con grasa.





Figura 10 Condición Corporal Según el Sistema Henneke

Condición Corporal 1
|

Condición Corporal 2


Condición Corporal 3

Condición Corporal 4


Condición Corporal 5
Condición Corporal 6

Condición Corporal 7

Condición Corporal 8

Condición Corporal 9
http://uco.es


CAPÍTULO 5.
REPRODUCCIÓN DE LOS EQUINOS


Tomada en Pesebrera El Puente - Neiva

La reproducción de los animales guarda especial significado para la perpetuación
de todas y cada una de las especies, los equinos no escapan a este patrón de
comportamiento reproductivo. La interacción de los gametos producidos por
ambos sexos constituye la base del proceso reproductivo y por tanto, de la
perpetuidad de las especies. Si bien en el macho la gametogénesis se produce de
forma continua, en la hembra, la formación y liberación de las células germinales
es un proceso cíclico debido a las interacciones endocrinas que se producen entre
el hipotálamo, la hipófisis y los ovarios .La vida reproductiva se caracteriza en
general por la gametogénesis y por un deseo sexual denominado libido, se hace
posible en la pubertad y continua en gran parte de la vida media hasta la vejez de
los animales. La mayor parte de los machos tienen capacidad para una vida
reproductiva durante todo el año, mientras que las hembras presentan una vida
sexual regida por los ciclos estrales.
En algunas especies la primera ovulación se presenta durante un estro silencioso
ya que durante este la hembra no presenta el comportamiento sintomático del
estro. Para que el periodo de estro transcurra con receptividad sexual, es
necesario que las hormonas esteroides circulen por el torrente sanguíneo.

El desarrollo ovárico comprende periodos o etapas que se inician con la
oogénesis o desarrollo de ovulo derivado de una célula sexual primitiva, la
ovulación y la formación del cuerpo lúteo. Estos procesos a su vez influyen sobre
otras partes del sistema reproductor en sucesión cíclica que se denomina como
ciclo estral.

De todos los animales domésticos la yegua es la mas difícil de manejar
reproductivamente, es un animal poliéstrico, con un ciclo estral de 21 días en
promedio.

La yegua reproductora es aquella que ha alcanzando su completa constitución
anatómica y nerviosa para criar animales propios de la raza a la que pertenece.

La pubertad en las hembras se alcanza entre los 18 – 16 meses dependiendo del
estado de nutrición, desarrollo corporal y raza, la osificación completa termina a
los 5 años, motivo por el cual seria ideal servir las hembra ha esta edad.

En cuanto el macho reproductor o padrillo la pubertad y producción de
espermatozoide los alcanza entre los 13 – 14 meses, la madures sexual la alcanza
a los dos años y medio y tiene completa capacidad a los 4 años considerándose
adulto a los 5 años.


LECCION 21. ANATOMÍA Y FISIOLOGÍA DE LA REPRODUCCION.


APARATO REPRODUCTOR DE LA HEMBRA.

Los órganos reproductivos de la yegua están constituidos por dos ovarios y el
sistema de conductos femeninos que incluye los oviductos, útero, cérvix, vagina,
vestíbulo vaginal y labios vulvares.
Los genitales internos están sostenidos por el ligamento ancho el cual se
subdivide teóricamente en mesovario porque sostiene los ovarios, mesosalpinx
porque sostiene los salpinges u oviductos y mesometrio porque sostiene el útero
Los genitales externos están constituidos por los labios mayores que posee la
vulva, cuya posición es vertical pero con la edad cambia a horizontal, lo cual
también puede ocurrir en hembras preñadas por la tracción que ejerce el útero
grávido.

Así pues tenemos:




Ovarios

Son los órganos reproductores primarios en la hembra; son de forma arriñonada
debido a la presencia de la fosa ovulatoria, 2 a 3 veces más grandes que los de la
vaca. Mide aproximadamente 7.0 x 3.5 x 2.5, producen los gametos femeninos (el
óvulo) y las hormonas sexuales femeninas (estrógenos y progestágenos). La
yegua es un animal MONOTOCO y paren normalmente un producto en cada
periodo gestacional, por lo tanto se produce un óvulo en cada ciclo estral.

El ovario está compuesto por la médula y la corteza, en la yegua estas se
encuentran invertidas, la medula externa constituye el tejido estructural mientras
que los folículos se producen en la corteza central. La médula está compuesta de
vasos sanguíneos, nervios y tejido conjuntivo. La corteza tiene las células y capas
de tejido asociadas con el óvulo y la producción de hormonas; el parénquima, es
conocido como la capa funcional porque contiene los folículos ováricos y las
células que producen hormonas ováricas.

Un folículo primario es una célula germinal rodeada de una capa simple de
células, algunos de éstos alcanzan la madurez y son liberados dentro del sistema
de conductos para su posible fertilización y desarrollo del producto. La mayoría
inician el desarrollo y no lo completan tomándose atrésicos (degenerados).

El folículo primario está en constante estado de crecimiento y maduración. Las
células del folículo rodean al huevo potencial, dando origen al folículo secundario,
cuando el folículo logra acumular líquido entre sus células se clasifica como
terciario. Este, ya maduro, ejerce presión sobre la túnica albugínea tomando la
apariencia de una vejiga llena de líquido en la superficie del ovario que se llama
folículo de Graaf. El líquido en el antro del folículo terciario es rico en estrógenos y
se llama líquido folicular. El cúmulos oophorus, es un montecillo de células, se
localiza en un lado del antro. El huevo potencial descansa sobre los cúmulos
oophorus protegido por la corona radiada.
Al final del crecimiento folicular; el folículo dominante que es el que contiene una
mayor cantidad de estrógenos que actuaran como indicador de la maduración; una
secreción masiva de gonadotropina LH, conocida como pico de LH, activa la
maduración final y la ovulación del folículo dominante; los folículos restantes son
eliminados por atresia folicular, esto en animales monótonos como es el caso de la
yeguas.
Una vez se ha producido la ovulación, los elementos residuales del folículo se
reorganizan para formar un cuerpo lúteo con la función endocrina de secreción de
progesterona. Como consecuencia de la ovulación, la lamina basal se rompe
originando una pequeña hemorragia en la cavidad, producida por la ruptura de los
vasos sanguíneos. El coagulo formado se denomina cuerpo hemorrágico.
Las células epiteliales que revisten la cavidad folicular, comienzan a multiplicarse
bajo el influjo de la LH, desarrollando así el cuerpo amarillo o cuerpo lúteo que se
proyecta a la superficie del ovario.
Si el ovulo ha sido fecundado y sigue el proceso de gestación, el cuerpo lúteo
perdura, actuando como una glándula endocrina que secreta progesterona,
esencial para mantener la gestación.
Por el contrario si la fecundación no se realiza, el cuerpo lúteo, involuciona y
desaparece, desarrollándose en su lugar un proceso cicatrizal llamado cuerpo
blanco.

Oviductos

Los oviductos (llamados también trompas de Falopio o salpinx) son un par de
tubos enrollados que se extienden desde cerca de los ovarios hasta las puntas de
los cuerpos uterinos, con los que se continúan, y están suspendidos por el
mesosalpinx, pliegue peritoneal derivado del ligamento ancho, su longitud es de
25 cm. En sus funciones se incluye, el transporte de huevos y espermatozoides,
además, son el sitio de fertilización y el lugar de las divisiones celulares primarias
del embrión. Consta de tres capas: túnica serosa, túnica muscular y túnica
mucosa.

El oviducto, se divide en tres segmentos. La abertura en forma de embudo cerca
de los ovarios es el infundíbulo. En la yegua, el infundíbulo está separado del
ovario, con numerosos pliegues en la mucosa. El ámpula es el segmento medio,
tiene de 3 a 5 mm. de diámetro y forma casi la mitad de la longitud total del
oviducto. El revestimiento mucoso del ámpula tiene de 20 a 40 pliegues
longitudinales, lo cual aumenta considerablemente el área de la luz. El ámpula se
une al istmo, el tercer segmento, a nivel de la unión ampular ístmica. Esta unión es
difícil de situar anatómicamente, y se ha descrito como una estructura que retrasa
al óvulo varias horas durante el transporte. La fertilización ocurre en esta unión. El
istmo es más pequeño que el ámpula, con un diámetro de 0.5 a 1 mm. El istmo se
une con la punta del cuerno uterino a nivel de la unión uterotubaria. En general, la
actividad del oviducto es estimulada por los estrógenos e inhibida por los
progestágenos.
El ámpula es el sitio donde ocurre la capacitación del espermatozoide y la
fecundación del ovulo. El ovulo permanece en el oviducto durante varios días,
siendo regulado su transporte por los movimientos peristálticos y antiperistálticos
del oviducto.
El o9viducto posee un fluido oviductal que favorece la capacitación del
espermatozoide, dicho fluido esta constituido por trasudados del suero sanguíneo
y productos de secreción de los gránulos de las células secretoras del epitelio
oviductal. Contiene glucoproteinas como la albúmina y la prealbúmina.


Út ero

Es el sitio donde se desarrolla la placenta para la nutrición hematotrófica del feto
permanece en reposo en la gestación y en el parto sufre contracción peristálticas
que inducen la expulsión del feto y sus membranas, se extiende desde la unión
uterotubaria del cérvix. En la yegua la longitud total varía de 35 a 50 cm. La
principal función del útero es retener y nutrir al embrión o feto. Antes que el
embrión se adhiera al útero, la alimentación proviene del vitelo que contiene el
embrión y de la leche uterina secretada por las glándulas de la capa mucosa del
útero. Después de adherirse al útero, los nutrientes y productos de deshecho son
conducidos por la red de circulación materno-fetal, a través de la placenta. La
yegua posee un útero bipartido. Tiene un cuerpo uterino prominente anterior al
conducto cervical y dos cuernos uterinos.

Como en el oviducto, la túnica serosa es la capa externa del útero. El miometrio, la
capa intermedia, está compuesto de dos capas longitudinales delgadas de
músculo liso, con una capa circular más gruesa comprimida entre ellas. Los
estrógenos aumentan el tono del miometrio, proporcionando al útero una
consistencia “erecta Los progestágenos disminuyen el tono del miometrio
causando que el útero se torne más flácido. El endometrio, es la mucosa que
recubre al útero, es más complejo que el resto del sistema de conductos y posee
glándulas simples. Los estrógenos aumentan la irrigación causando
engrosamiento del endometrio y estimulan el crecimiento de las glándulas
endometriales. Los progestágenos causan que las glándulas endometriales se
enrosquen, se ramifiquen y secreten la leche uterina. Las acciones sinergistas de
los estrógenos y progestágenos en el endometrio preparan al útero para la preñez.

El endometrio proporciona un mecanismo para la adhesión de las membranas
extraembrionarias o fetales. Esta unión forma la placenta, y al proceso se le
denomina placentación. Con la formación de la placenta, los nutrientes de la
sangre materna pueden ser transferidos a la sangre embrionaria o fetal y los
productos de deshecho de la sangre embrionaria se pueden eliminar a través de
los sistemas maternos. La yegua posee una adhesión placentaria difusa
superficial, clasificándose como epiteliocoriónica. Esto significa que no ocurre
erosión de los tejidos de las membranas extraembrionarias ni en el endometrio
durante la formación de la placenta. Los nutrientes y gases de la sangre materna
deben pasar a través de las capas de tejidos maternos, extraembrionarios para
alcanzar la sangre embrionaria y viceversa.
Sus funciones son:

 Por las contracciones del miometrio durante el estro, se facilita el transporte
de los espermatozoides desde el cuerpo uterino hasta el oviducto.
 Produce las secreciones necesarias para iniciar la capacitación
espermática.
 Interviene en la regulación de la vida funcional del cuerpo loteó.
 Secreta los carbohidratos y las proteínas necesarias para la nutrición
histotrófica del embrión y los factores y los factores para la subsecuente
implantación.
 Es el sitio donde se desarrolla la placenta para la nutrición hemetotrófica del
feto.
 Cambia de tamaño, estructura y posición para acomodar al prenato a
medida que este crece.
 Permanece en reposo durante la gestación, y en el parto sufre
contracciones peristálticas que inducen a la expulsión del feto y sus
membranas.

Cérvix o cuello uterino.

Es una estructura esfinteriana que se proyecta caudalmente en la vagina Aunque
técnicamente es una parte del útero, el cérvix se describe como un órgano distinto.
Posee una pared gruesa y rígida, la terminación anterior se continúa con el cuerpo
del útero, en tanto que la Terminal posterior se orienta hacia la vagina. La longitud
varía de 5 a 10 cm., con un diámetro externo de 2 a 5 cm. Se define como un
conducto que se abre en el útero. La función primaria del cérvix es prevenir la
contaminación microbiana del útero; sin embargo, también puede servir como
reservorio para el esperma después del apareamiento. El semen se deposita en el
cérvix durante la monta natural en las yeguas.

Altos niveles de estrógenos hacen que el conducto cervical se dilate durante el
estro (celó). El sinergismo entre los grandes niveles de estrógenos y la relaxina
causa una mayor dilatación un poco antes del parto. Esta dilatación del conducto
al parecer hace al útero más vulnerable a los organismos invasores. Sin embargo,
los estrógenos causan que las células epiteliales del cérvix secreten moco, el cual
posee propiedades antibacterianas, con lo cual se protege al útero. Durante la
preñez, el moco se engruesa y forma un tapón gelatinoso que sella y protege al
útero. La eliminación del tapón mucoso incrementa las posibilidades de aborto.
El tapón mucoso o moco cervical varia en su composición con el ciclo estral de la
yegua y esta formado por macromoléculas de mucina de origen epitelial, o sea
compuesto de glicoproteinas que contienen cerca del 25 % de proteínas y 75 % de
carbohidratos. También contiene enzimas como la glucoronidasa, amilasa,
fosforilasa, fosfatasa y esteraza.


Vagina

La vagina es un órgano muscular dilatable que facilita la copula y el paso del feto
durante el parto, tiene forma tubular, es de paredes delgadas y completamente
elástica, es un órgano muscular dilatable que facilita la copula y el paso del feto
durante el parto además de ser el conducto escretor de las secreciones del cervix,
del endometrio y del oviducto Tiene 25 a 30 cm. de longitud. Es el órgano
femenino para la cópula.

Las células epiteliales de la vagina se cornifican (se vuelven células sin núcleo)
bajo la influencia de los estrógenos. En la yegua no observan cambios notorios en
le epitelio a través den ciclo estral los frotis vaginales se pueden utilizar como
ayuda para detectar el estro, aunque este procedimiento es más útil en animales
de laboratorio, no obstante durante el diestro y el anestro el epitelio vaginal esta
cubierto por una secreción de color pardo pegajosa bajo la influencia de la
progesterona, la cubierta epitelial se regenera.
La vagina sirve como conducto excretor de las secreciones del cervix, del
endometrio y del oviducto. También es el canal del nacimiento durante el parto.
Durante el diestro y el anestro el epitelio vaginal esta cubierto por una secreción
de color pardo, pegajosa.


Vulva

La vulva u órgano genital externo consta del vestíbulo con sus anexos y labios. El
vestíbulo es la parte del sistema de conductos femeninos que es común tanto al
sistema reproductor como al urinario. Tiene 10 a 12 cm. de longitud, uniéndose a
la vagina en el orificio uretral externo. En este punto el himen se encuentra bien
definido en la yegua. Posterior al orificio uretral externo, se localiza el divertículo
suburetral (bolsa cerrada). El labio consta de labio menor, pliegues internos o
labios de la vulva y labio mayor, pliegues externos o labios de la vulva.

El clítoris, homólogo del glande del pene en el macho, se localiza ventralmente un
cm. dentro del labio. Contiene tejido eréctil con abundantes nervios sensoriales y
se le encuentra erecto durante el estro. En la yegua es la excepción. Durante el
estro en la yegua, las contracciones frecuentes del labio exponen al clítoris erecto.
Las glándulas vestibulares, localizadas en la parte posterior del vestíbulo, son
activas durante el estro y secretan un moco lubricante para la cópula.
Aunque el sistema reproductor femenino descansa parcialmente en el piso de la
pelvis, el ligamento ancho se considera como la principal estructura de sostén.
Este ligamento sostiene a los-ovarios, oviductos y útero de ambos lados de la
pared dorsal de la pelvis. Los vasos sanguíneos y nervios pasan a través del
ligamento ancho del sistema reproductor femenino. Este sistema está inervado
principalmente por nervios autónomos, sin embargo, se encuentran nervios
sensoriales en la región de la vulva, en especial en la región del clítoris.

Las arterias ováricas, también llamadas arterias uteroováricas, se ramifican e
irrigan a los ovarios, oviductos y parte de los cuernos uterinos. Estas arterias son
más grandes en el lado del ovario que posee un cuerpo lúteo activo. La arteria
uterina media proporciona sangre al resto de los cuernos uterinos y al cuerpo del
útero. Este aumenta durante las fases media y final de la preñez y se puede palpar
como ayuda en el diagnóstico de preñez en yeguas. La arteria hipogástrica se
ramifica para irrigar el cervix, la vagina y la vulva.


Glándula mamaria.

Se encuentra ubicada en la región inguinal, en la parte más alta entre las
extremidades traseras, rozando con el borde interno de estas. Consta de dos
complejos glandulares independientes que se unen externamente, cada uno de los
cuales terminando en un pezón proyectado hacia abajo y levemente hacia delante.
Cada pezón posee entre 2 y 5 agujeros por donde se secreta la leche por el reflejo
de la succión producida por el potro al momento de alimentarse.

APARATO REPRODUCTOR DEL MACHO.
El aparato reproductor masculino consta de escroto, cordones espermáticos,
testículos, glándulas accesorias, pene, prepucio y sistema de conductos
masculinos. El sistema de conductos incluye los vasos eferentes, los conductos
deferentes y la uretra externa.


Testículos

Son órganos pares situados en la cavidad escrotal y orientados horizontalmente
los testículos son los principales órganos de la reproducción en los machos, ya
que producen gametos masculinos (espermatozoides) y hormonas sexuales
masculinas (andrógenos).

En el caballo los testículos durante su vida fetal se encuentran en la cavidad
abdominal, cerca de los mesonefrones o riñones embrionarios y descienden al
escroto poco antes del nacimiento. Los testículos en su vida adulta tienen una
longitud de 10-12 cm. y aproximadamente de 5 cm. de ancho, aunque en la
mayoría de las ocasiones el izquierdo es de mayores proporciones que el derecho,
su peso individual es de 225-300 gr. En algunos casos uno o los dos testículos no
descienden debido a una falla en su desarrollo; si ninguno desciende, el animal
recibe el nombre de criptorquídeo bilateral. Los criptorquídeos bilaterales son
estériles. Si sólo un testículo no desciende, será un criptorquídeo unilateral. Por lo
general, éste es fértil, pero se recomienda no mantenerlo en la explotación como
reproductora ya que esta condición anormal es de carácter hereditario.

Los testículos están cubiertos por la túnica vaginal, tejido seroso extensión del
peritoneo. Esta capa serosa se obtiene a medida que los testículos descienden al
escroto y está adherida a lo largo de él. La capa externa de los testículos es la
túnica albugínea testicular, membrana delgada blanquecina de tejido conectivo
elástico. Por debajo de la túnica albugínea testicular está el parénquima, la capa
funcional de los testículos, es de color amarillento y está dividido en segmentos
por tabiques incompletos de tejido conectivo. Dentro de estos segmentos están los
tubulos seminíferos. Bajo la estimulación de FSH, las células de Sertoli (de
nutrición) producen proteína fijadora de andrógenos e inhibina. Los tubulos
seminíferos son los sitios de producción de espermatozoides. Representan el 80%
del peso de los testículos. Los tubulos seminíferos se unen a una red de tubulos,
la rete testis, que se conectan a 12 o 15 pequeños conductos, los conductos
eferentes, que convergen en la cabeza del epidídimo.

Las células de Leydig (intersticiales) se encuentran en el parénquima de los
testículos, entre los tubulos seminíferos. La LH estimula a las células de Leydig
para producir testosterona en pequeñas cantidades u otros andrógenos.

La testosterona se necesita para el desarrollo de las características sexuales
secundarias y para el comportamiento normal de la cópula.



Escroto y cordón espermático

El escroto es un saco bilobulado que envuelve a los testículos, asimétrico sin
pelos ni vellosidades, en la mayoría de las especies se localiza en la región
inguinal entre los miembros posteriores. Está compuesto de una capa externa de
piel gruesa con numerosas glándulas grandes sudoríparas y sebáceas, la túnica
dartos, divide al escroto en dos bolsas y se adhiere a la túnica vaginal en el fondo
de cada una de ellas.

El cordón espermático conecta a los testículos con un sistema de nutrición de las
arterias (enrolladas sobre sí) testiculares y plexo venoso asociado y los troncos
nerviosos. Además, el cordón espermático está compuesto de fibras musculares
lisas, tejido conectivo y una porción del conducto deferente. Tanto el cordón
espermático como el escroto contribuyen al sostén de los testículos, igualmente
poseen la función conjunta de mantener la temperatura testicular. Esto incluye el
acercar los testículos al cuerpo cuando la temperatura ambiente es muy baja o
dejarlos colgar alejados del cuerpo cuando ésta aumenta. Dos músculos lisos
participan en esto: La túnica dartos, y el cremáster, un músculo liso ubicado
alrededor del cordón espermático, ambos termosensibles.

El plexo pampiniforme, lleva sangre más fría de regreso al organismo, así ocurrirá
cierto grado de enfriamiento de la sangre arterial antes de que llegue a los
testículos. Igualmente el alargamiento del cordón espermático frente a
temperaturas elevadas provoca que haya una superficie mayor para el intercambio
de calor.




Epidídimo

El epidídimo, es el primer conducto externo que sale de los testículos, está unido
longitudinalmente a la superficie de los testículos, y junto con éstos está encerrado
en la túnica vaginal. La cabeza del epidídimo se localiza en la punta del testículo,
donde los conductos eferentes (de 12 a 15 pequeños conductos) se unen para
salir como un solo tubo. El cuerpo del epidídimo se extiende a lo largo del eje
longitudinal del testículo y se continúa con la cauda o cola.

El epidídimo transporta los espermatozoides desde el testículo; varios factores
contribuyen a este movimiento. Un factor es la presión de los nuevos
espermatozoides que se están produciendo, este movimiento es ayudado por la
presión externa creada por el efecto de masaje que ocurre sobre los testículos y el
epidídimo durante el ejercicio normal. Durante la eyaculación, las contracciones de
la capa muscular lisa del epidídimo y una ligera presión negativa (acción de
succión) creada por las contracciones del conducto deferente y la uretra,
desplazan en forma activa a los espermatozoides del epidídimo al conducto
deferente y a la uretra.

Almacenamiento
La mayor parte se almacena en la cola del epidídimo, donde los espermatozoides
concentrados son retenidos en su luz. Allí, las condiciones son óptimas para
preservar la viabilidad de espermatozoides por un tiempo prolongado. El pH bajo,
una alta viscosidad, la gran concentración de bióxido de carbono, la mayor
proporción de potasio a sodio, la influencia de la testosterona y probablemente
otros factores, se combinan para producir un bajo índice metabólico y así lograr
una vida más prolongada a la célula espermática.

Maduración
Cuando los espermatozoides recientemente formados entran a la cabeza a partir
de los conductos eferentes, no tienen la capacidad de motilidad ni fertilidad.
Durante su paso por el epidídimo, adquieren capacidad para moverse y se tornan
fértiles.

En el paso por el epidídimo, los espermatozoides pierden la gota citoplasmática
que se forma en el cuello de cada espermatozoide durante la espermatogénesis,
dicha gota es un indicador de maduración de los espermatozoides en el epidídimo.
Si un porcentaje elevado de los espermatozoides recién eyaculados tienen gotas
citoplasmáticas, se les considera inmaduros y tienen una fertilidad reducida.
La actividad secretora del aumenta la viabilidad de los espermatozoides durante
su almacenamiento.




Conducto deferente y uretra

El conducto deferente es un tubo que sale del extremo distal de la cola de cada
epidídimo, pasa a lo largo del cordón espermático, a través del conducto inguinal
hacía la región pélvica, donde se une a la uretra en su origen, cerca de la apertura
de la vejiga. Su extremo agrandado cerca de la uretra es el ámpula. Este conducto
tiene una capa muscular lisa gruesa en su pared y parece tener como función
única la del transporte de los espermatozoides. Algunos autores sugieren que el
ámpula sirve como almacenamiento de corto tiempo para el semen. Sin embargo,
los espermatozoides envejecen rápidamente en el ámpula.

La uretra es un conducto único que se extiende desde su unión con el ámpula
hasta la porción Terminal del pene. Sirve de conducto excretor tanto para la orina
como para el semen.


Glándulas accesorias
Las glándulas accesorias se localizan a lo largo de la porción pélvica de la uretra
con conductos que vacían sus secreciones en su interior. Estas son las glándulas
vesicales, la próstata y las glándulas bulbouretrales. Contribuyen en gran medida
a proporcionar mayor volumen al semen. Además, sus secreciones son
amortiguadoras y nutrientes, aseguran una motilidad óptima y una buena fertilidad
del semen.


Glándulas Vesi cal es

Son un par de glándulas lobulares que se identifican fácilmente debido a su
abultada apariencia similar a un racimo de uvas. Sus conductos excretores
desembocan cerca a donde se unen la uretra y el ámpula. Contribuyen
sustancialmente en el volumen total del semen, con varios compuestos orgánicos
tales como la fructosa, fuente de energía para los espermatozoides.

• Próstata
Es una glándula única localizada a lo largo y alrededor de la uretra,
posterior a los conductos excretores de las glándulas vesicales, esta
formado por dos lóbulos formados por un istmo El cuerpo prostático es
visible en sistemas genitales aislados y se puede palpar en el caballo.
Contribuye en pequeña medida al volumen del semen. Las secreciones de
la próstata son ricas en iones inorgánicos, como sodio, cloro, calcio y
magnesio.

• Glándulas Bulbouretrales
Son un par de glándulas localizadas a lo largo de la uretra, cerca del punto
donde ésta sale de la pelvis. Contribuyen muy poco al volumen del líquido
seminal. Sus secreciones lavan de residuos de orina en la uretra antes de la
eyaculación.


Pene

Es el órgano de la cópula de los machos. No tiene flexura sigmoidea Se forma
alrededor de la uretra a partir del lugar donde ésta sale de la pelvis; el caballo
tiene músculos retractores del pene, son músculos lisos que se relajan para
permitir la extensión del pene y se contraen para regresar el pene hacia el cuerpo.

El glande del caballo contiene mucho más tejido eréctil del que se encuentra en
toros, cerdos o borregos, es redondeado y la parte anterior presenta una superficie
cóncava (fosa del glande), partir de la cual se proyecta la uretra de cuatro a seis
cm.

El tejido eréctil es cavernoso (como esponja) y se localiza en dos regiones del
pene. El cuerpo esponjoso del pene es el tejido cavernoso situado alrededor de la
uretra. El cuerpo cavernoso del pene es un área más grande de tejido cavernoso
localizada dorsalmenté al cuerpo esponjoso del pene. Estas áreas cavernosas se
llenan de sangre durante la excitación sexual, lo que causa la extensión. Del pene
(erección) y facilita la expulsión final del semen durante la eyaculación.

Cuando el pene del padrillo esta relajado, tiene una longitud aproximada de 50 cm.
desde el inicio del músculo retractor del pene que se encuentra en la cavidad
abdominal, hasta el glande. Durante la erección el pene aumenta su tamaño al
doble o un poco mas.
Se extiende desde la parte anterior del escroto y continua hacia el vientre 5 a 7
cm. Antes del ombligo. En el momento de la micción, el equino saca un poco el
pene del prepucio, pero durante la erección sale unos 50 a 60 cm.


Prepucio

El prepucio es una invaginación de la piel que encierra por completo el extremo
libre del pene. Se le puede dividir en una porción prepeniana, o pliegue externo y
porción penil o pliegues internos. El orificio prepucial está rodeado de pelos largos
y fuertes.






CICLO ESTRAL.

Por ciclo estral se entiende una serie de cambios hormonales que se traducen en
un comportamiento corporal que tiene su momento culminante cuando la hembra
permite ser copulada por el macho.

Fases o etapas del ciclo estral:

Proestro (precelo), Estro (celo o calor), postestro (metaestro o diestro).

En el precelo son perceptibles, en los genitales externos, ciertas alteraciones tales
como edematización y enrojecimiento de los labios vulvares, las hembras
muestran cierta inquietud y comportamiento alterado, pero rechazan el macho.

El período de celo se caracteriza sobre todo por disposición para permitir el
acercamiento y monta por parte de el macho, hay secreción de feromonas en la
orina

Síntomas del celo o calor:
- Alteraciones en los genitales externos:
Se manifiestan, sobre todo, como enrojecimiento (hiperemia),
edematización y secreción mucosa, proveniente de los fluidos cervicales
producidos durante el celo, así como de secreciones de las glándulas
vaginales.

- Síntomas de comportamiento:
Durante el celo muestran las yeguas un comportamiento distinto del
habitual, que es típico de la especie.
Llama la atención, en primer lugar, una alteración de la expresión corporal
total, acompañada por determinadas formas de expresión postural. Además
se puede observar gran inquietud, junto con una continua búsqueda de
contacto con sus compañeros, otros animales o incluso el hombre. La
ingestión de alimentos frecuentemente está perturbada (tiende a disminuir)
La actividad sexual durante el celo se manifiesta sobre todo por simulación
de monta sobre otras hembras o machos. También llama la atención los
relinchos u otros sonidos característicos. En la yegua el signo típico de celo,
lo produce la contracción fuerte y continua de los músculos de la vagina,
dicho movimiento se llama vulgarmente “Guiño vulvar” con él se exhibe el
clítoris, invitando al macho para la cópula.

- Síntomas biológicos acompañantes del celo
Las alteraciones hormonales responsables del celo dan lugar a una serie de
reacciones del organismo que se manifiestan de una manera más o menos
típica en dependencia del ciclo y por tanto también del celo. Las principales
son:
Variaciones de la temperatura corporal.
Evolución cíclica en el epitelio de la mucosa vaginal.
Variaciones en la consistencia y el aspecto del moco cervical.
La apertura del canal cervical.
La secreción de sustancias olorosas.

Control hormonal

El ciclo estral está regulado principalmente por un balance entre las hormonas
esteroides del ovario y las hormonas proteínicas gonadotropinas de la hipófisis
anterior. Así mismo, la progesterona tiene un efecto dominante en la regulación
del ciclo estral. Durante el diestro, cuando las concentraciones de progesterona
son altas; las concentraciones de FSH, LH y los estrógenos totales permanecen
bajos. En el ovario, se puede detectar cierto crecimiento folicular y se asocia con
pequeñas elevaciones de FSH, LH y estrógenos a la mitad del diestro, pero sin ser
tan evidente como el crecimiento folicular típico del día 2 o 3 antes de la ovulación.
De la misma manera, durante la preñes, las grandes concentraciones de
progesterona evitan la liberación de hormonas gonadotrópicas que iniciarían el
comportamiento de estro.

Al final del diestro, la PGF (Prostaglandina F2-alfa) uterina provoca la regresión
del cuerpo lúteo, lo que ocasiona una marcada disminución de las
concentraciones sanguíneas de progesterona. Estas bajas concentraciones de
progesterona pueden servir como estímulo lo que ocasionará liberación de FSH,
LH y prolactina por la hipófisis.

Existe elevación de estrógenos al empezar el estro de las yeguas, disminuyendo
cerca del final del estro; igualmente se pueden observar elevaciones de FSH y LH
que tienen una duración de 8 a 10 horas durante el estro y se presentan 24 horas
antes de la ovulación; la prolactina se eleva cerca del comienzo del estro,
permaneciendo así durante todo el mismo. La FSI-1 estimula el crecimiento
folicular durante el inicio del proestro y directa o indirectamente provoca elevación
de los estrógenos ováricos. La rápida elevación de LH y FS lI-l durante el estro
parece ser requisito necesario para el crecimiento y maduración d los folículos de
Graaf, necesarios para la ovulación.

J unto con el crecimiento folicular hay una elevación de estrógenos; estos se
producen por las células del folículo de Graaf, estos estrógenos causan los signos
fisiológicos y de comportamiento e inician la liberación de LH. Después de la
ovulación se formará un cuerpo lúteo en cada sitio de esta (folículo que liberó el
óvulo). La formación ocurre rápidamente, y para el día 4 o 5 del ciclo estral, ya
está completamente formado y un incremento detectable de progesterona en
sangre indicará la fase de diestro. Le LH tiene influencia dominante en la
formación del cuerpo lúteo. La LH es lúteo-trópica, y junto con la prolactina
mantiene la función del cuerpo lúteo. En forma opuesta la Prostaglandina F2-alfa
al suspender el flujo sanguíneo de metabolitos necesarios para la síntesis de
progestágenos, actúa así como agente lúteo-lítico.

Ovulación

La ovulación, o liberación del óvulo, se produce como consecuencia de la ruptura
del folículo de Graaf. Constituye, así la terminación del proceso de maduración del
folículo y del óvulo. La ovulación depende especialmente de la hormona LH.
Producida la ovulación, el cuerpo lúteo se desarrolla en el interior del folículo roto,
comenzando a segregar la progesterona necesaria para el desarrollo inicial del
huevo y el mantenimiento de la gestación, si es que ha tenido lugar la
fecundación, o para la regulación del ciclo, si esta no se ha producido.

En la yegua la ovulación tiene lugar 24 a 48 horas antes de terminar los signos
externos de calor; este momento puede ser precisado mediante exploración rectal,
efectuada por un Médico Veterinario práctico en la gineco-obstetricia equina; el
folículo maduro se identifica mejor por su consistencia que por su volumen; al
tacto se aprecia que es fluctuante y de paredes delgadas, mientras que el folículo
inmaduro se encuentra provisto de una pared densa. El folículo maduro tiene un
diámetro de 15cm. aproximadamente.

En las yeguas la ovulación se lleva a cabo en la “fosa de la ovulación”, área
definida del ovario y no en cualquier zona, como ocurre en otras especies.


Fecundación
La fecundación es el resultado de la penetración del espermatozoide en el óvulo,
seguida de la fusión de los elementos nucleares y citoplasmáticos de los 2
gametos. Es, pues, la terminación normal de una larga serie de fenómenos
durante los cuales estos elementos adquieren sus propiedades y sus caracteres
como células germinales masculinas o femeninas. Cada uno de ellos interviene
con arreglo a sus propias características genéticas y estructurales.

Transporte del esperma
La ascensión espermática a través del tracto genital es relativamente rápida, el
tramo que separa el cuello uterino de la parte superior de los oviductos se halla
representado esencialmente por el útero, siendo normal considerar a la actividad
de este último como la causa principal del desplazamiento de los
espermatozoides; en cambio, la participación de los movimientos propios de los
espermatozoides y de la actividad de las células ciliadas aparentemente es de
importancia menor en el proceso.

Viabilidad y capacidad fertilizante
Tiene una gran importancia el conocer la duración de la motilidad y de la aptitud
fecundante de los espermatozoides en el tracto genital femenino después del salto
natural o de la inseminación artificial. Para el caso de la especie equina la
duración máxima de la fertilidad es de 144 horas y la duración máxima de la
motilidad es de solo 44 horas.

Salida del óvulo.

La ruptura folicular libera una masa gelatinosa constituida por el líquido folicular y
el óvulo, los cuales pasan al oviducto en virtud de un mecanismo aún no
determinado, pero en el cual parece que intervienen los movimientos ciliares y la
actividad muscular del infundíbulo. La permanencia del óvulo en las trompas es
independiente del tamaño del animal, siendo para la yegua el paso por la zona
tubárica de aproximadamente 96 horas. La migración está asegurada por el
movimiento de las secreciones tubáricas hacia el útero, que a su vez está
condicionado a los movimientos de los cilios vibrátiles del epitelio y a las
contracciones de la
1
musculatura tubárica.
Así mismo la migración ovular depende del equilibrio hormonal estrógeno-
progesterona; los estrógenos retardan la travesía tubárica; un desequilibrio de
estas hormonas podrá, pues, disminuir o acelerar esta migración, encontrándose
en este hecho el origen de algunas formas de esterilidad.

Duración de la fertilidad del óvulo.
La supervivencia del óvulo es relativamente corta, dependiendo de esta
circunstancia el tiempo de fertilización. El período de fecundabilidad del huevo de
la yegua todavía no está medido con exactitud, pero se estima entre 36-48 horas
como máximo.

Características del eyaculado.
El PH del semen es de vital importancia, este debe ser de 7.5 aproximadamente,
esta constituido por plasme seminal y espermatozoides. En el momento de la
eyaculación el semen es expulsado en una especie de bombeo entre 5 y 10
pulsaciones sucesivos, es de tener en cuenta que la primera mitad del eyaculado
contiene el 80% de los espermatozoides de este.
Cuando se va a realizar una valoración del semen se debe tener en cuenta los
siguientes parámetros de evaluación.

La recolección del semen se hace con una vagina artificial, dos veces con
intervalo de una hora, para luego si ser evaluado.
El volumen del eyaculado, que debe ser entre 50 y 70 ml en lo normal pero puede
llegar a 150 o 170 ml.
La concentración espermática, de 30 a 800 millones por milímetro.
Motilidad progresiva, esta va desde 0% a 90%, pero un 70% es considerado como
buena, otro detalle ha tener en cuenta es el tipo de movimiento que desarrollan los
espermatozoides equinos, este es el línea recta y no en zigzag como en la
mayoría de las especies.
La morfología debe presentar una normalidad de un 70 a 80%.
Si se va a realizar conservación de semen, se debe mirar su resistencia a la
congelación, su conteo y su motilidad durante y después del proceso ya que
algunos padrillos producen semen intolerante al proceso de refrigeración y mucho
menos al posterior congelamiento.
La fertilidad del caballo se considera dudosa cuando al valorar el semen este
presenta menos del 50% de los espermatozoides con buena motilidad progresiva
y morfología normal.


Lugar de la fecundación
El encuentro gamético se realiza en la ampolla tubárica en un ambiente líquido de
cualidades apropiadas y especialmente destinado para esta función. La dispersión
de las células foliculares que rodean al óvulo depende de un factor tubárico que
presenta características bioquímicas especiales, en efecto, estas células han
desaparecido cuando el óvulo se encuentra en la zona tubárica de la yegua. Sin
embargo, la fecundación no depende esencialmente de que las células de la
granulosa hayan desaparecido y de que el óvulo se presente desnudo, ya que la
penetración de éste por los espermatozoides puede realizarse sin que esta
dispersión se haya producido, se conoce que las células brindan protección
mecánica al óvulo y a su vez aportan elementos nutritivos a la célula germinal
femenina.


Fertilización
La finalidad de la división sexuada es la de preparar los gametos para que pueda
realizarse la fertilización, es decir, la penetración del gameto femenino por el
masculino para constituir una sola célula: el cigoto o huevo, cuyo desarrollo ulterior
debe terminar con la formación del embrión y posteriormente un nuevo ser. El
proceso de fertilización comprende dos aspectos: mecánico y genético.

Después de que el espermatozoide ha penetrado mecánicamente en el óvulo
(atravesando la zona pelúcida y la corona radiata), lo incita a dividirse y a
desarrollarse embriológicamente. Genéticamente, la fertilización tiene por efecto el
introducir en el óvulo el aporte hereditario del macho. La penetración se produce
gracias a la motilidad propia del espermatozoide y a la intervención de algunos
procesos enzimáticos aportados por él, especialmente aquellos en los que
interviene la acrosina.





VARIACIONES DEL CICLO ESTRAL DE LA YEGUA.

1) Clasificación de la conducta receptiva de la yegua:
a) Muy receptiva (celo fuerte).
b) Receptiva (celo moderado).
c) Poco receptiva (celo débil).
d) Flemática.
e) Pasivamente resistente.
f) Medianamente resistente.
g) Activamente resistente.
2) Manifestaciones externas de celo:
a) Busca el padrillo.
b) Adopta "posición característica".
c) Levanta y tuerce la cola.
d) Clitorea (guiño o centelleo vulvar).
e) Orina escasa y repetitivamente.
f) Se deja montar.

3) Manifestaciones externas de no celo:
a) Amaina las orejas.
b) Aprieta o revolea la cola.
c) Patea.
d) Relincha.
e) Muerde.
f) No se deja montar.

4) Características de la yegua en estro y en no estro.

ÓRGANO ESTRO NO ESTRO
OVARIO Folículo al tacto Sin folículo
UTERO Laxo al tacto Tenso al tacto
CERVIX
Abierto y rojo
Laxo al tacto
Cerrado y pálido
Prieto al tacto
VAGINA
Húmeda y congestionada
Moco fluido filamentoso
Pálida y seca
Mucus como cera
VULVA Tumefacta Normal




LECCION 22. TIPOS DE SERVICIOS MÁS UTILIZADOS EN
EQUINOS.

1) Servicio de campo:
Consiste en colocar al padrillo en un potrero con varias yeguas.
Lamentablemente con este sistema se pierde el control de los servicios, se
desgasta mucho el padrillo pero es el ideal para yeguas "difíciles" o repetitivas. Se
recuperan hembras con disfunciones que, por otros métodos, son más difíciles de
preñar.

2) Servicio de corral:
Se lleva la hembra en celo a un corral donde se encuentra el padrillo. Una vez
realizada la copula, vuelve a su potrero y el padrillo a su pesebrera.

3) Servicio a mano:
Se lleva la yegua en celo a un picadero cerrado (o un lugar determinado al aire
libre), se la manea e higieniza y se la presenta al padrillo para la monta.
Con este sistema, se protege a la yegua y al padrillo, al evitar coses y mordiscos,
entre otros, tanto para el uno como para el otro.

4) Inseminación artificial:

Similar al anterior, pero en vez de dejarlo servir, se le desvía el pene hacia la
vagina artificial para recolectar el semen.

Luego se lo analiza, se diluye y se fracciona para inseminar las yeguas que se
encuentren en celo. Más adelante ahondaremos un poco más sobre el tema.

En nuestro medio el sistema más utilizado es el de monta natural, para que este
se lleva a buen término se deben tener en cuenta algunas normas como son las
siguientes:

Verificación del momento adecuado para la copula.
Lavar con jabón la parte perineal de la yegua incluyendo la vulva.

En lo posible vendar la cola de la yegua para evitar laceraciones en el glande del
pene al momento de la monta con las crines de esta.

Ensueltar la yegua en los remos posteriores, sin que esta quede incomoda pero,
incapaz de cocear al padrillo, provocando accidentes.

El pene del caballo también debe ser lavado pero sin jabón y en lo posible con
abundante agua tibia.

Se debe acercar el padrillo a la yegua, sujetado por una jaquita que nos permita su
dominio.

Antes de permitir la monta debemos asegurarnos de que el pene este en completa
erección.

Se debe separar la cola de la yegua una vez el padrillo se ha montado en ella,
para facilitar la copula.

Una vez el caballo ha eyaculado, su cola hace un leve movimiento de balanceo,
de adelante hacia atrás.
Con el fin de evitar accidentes y facilitar la bajada del reproductor de la yagua se
recomienda mover hacia delante la yegua.


www.caballomania.com

TÉCNICAS DE REPRODUCCIÓN ASISTIDA.


1) Organización de los lotes de retajeo:
a) Clasificar y separar hembras preñadas y vacías.
b) Armar lotes no muy numerosos, tales que permitan al personal
encargado del retajeo, el control individual de las yeguas.
c) Utilizar personal idóneo. El retajeo es una actividad sumamente
importante ya que nos indicara que hembras están aptas para la
fecundación.
d) Utilizar siempre el mismo retajo y el mismo personal. Se apreciaran mejor
los cambios de conducta.


2) Manejo de la yegua en celo:
a) La yegua en celo se lleva a revisión por tacto rectal.
b) Se puede seguir la evolución de los folículos e inseminar día por medio o
cuando se aprecie la presencia de folículo maduro hasta la ovulación.
c) También se puede empezar a inseminar a partir del 2° o 3° día, día por
medio, hasta el fin del celo.
d) Luego, la yegua regresa a su lote de retajeo.
Si no vuelve a ser marcada por el retajo después de 20 días hay un 92 %
de probabilidad de que este preñada.
e) Los datos obtenidos se registran en una planilla especialmente diseñada.
f) Se pueden utilizar hormonales para el manejo reproductivo, siendo las
herramientas más comunes y practicas:
Gonadotropina coriónica humana (actividad gonadotrópica con predominio
luteinizante) en dosis de 5000 UI por yegua vía IM.
Ejerce su efecto sobre el folículo maduro provocando la ovulación.
Prostaglandina F
2
alfa (efecto lúteo-lítico), en dosis de 800 Mg. /yegua, vía
IM. Ejerce su efecto sobre el cuerpo lúteo provocando su lisis.


3) Manejo de los padrillos:
a) Los padrillos se mantienen estabulados, permitiéndoles salir 1 vez por
día a un potrero de aproximadamente 5000 metros cuadrados.
b) Sirven 1 vez por día, aunque cuando las circunstancias lo exigen, pueden
hacer dos saltos (1 a la mañana y 1 a la tarde), eventualmente 3 (1 a la
mañana temprano, 1 al mediodía y 1 a la tarde a última hora).
c) Se puede dar un día por semana de descanso.
d) Se le presenta la yegua en celo, maneada y con trabones.
e) Realiza el servicio a mano, o bien se recoge el semen con vagina
artificial.

4) Manejo del semen:

a) Evaluación rápida: Los datos se registran en una planilla especialmente
diseñada.
Aspectos Macroscópicos Aspectos Microscópicos
Volumen.
Presencia de gel.
Color.
Opacidad.
Consistencia.
Olor.
Ph.

Movilidad general.
Coloración vital (eosina - nigrosina).
Recuento rápido (cámara de recuento
de glóbulos)
La evaluación rápida debe completarse,
cuando el tiempo lo permita, con una
evaluación detallada de la muestra
(recuento espermático, tinciones,
conformación, supervivencia etc.)

b) Dilución y fraccionamiento
Se utiliza diluyente por dos causas fundamentales:
Aumentar el volumen para facilitar el fraccionamiento.
Proteger a los espermatozoides.
Uno de los diluyentes mas utilizados es la lactosa-yema (80 partes de lactosa al
11 % en agua destilada y 20 partes de yema de huevo, con el agregado de
penicilina y estreptomicina).
Se utiliza una dosis de 500 millones de espermatozoides vivos y con motilidad
progresiva. Eventualmente, ante una gran cascada de celos puede reducirse la
dosis inseminante a un mínimo 100 millones tratando de evitar dosis tan bajas en
yeguas próximas a la ovulación.

El volumen a utilizar por yegua puede variar entre 15 y 50 ml.

c) Cálculos:
Un ejemplo practico:
Un padrillo eyacula 100 ml de semen con una concentración de 50 millones
de espermatozoides por ml.
Tener en cuenta los datos que manejamos: volumen y concentración.
Sabemos, entonces, que el total de espermatozoides es de 5000 millones.
Apreciamos que hay un 5 % de espermatozoides muertos y un 15 % sin motilidad
progresiva. Nosotros necesitamos espermatozoides vivos y con motilidad
progresiva.
Descontamos el 20 % y determinamos de esta manera que disponemos de 4000
millones de espermatozoides vivos y con motilidad progresiva.
Tenemos 8 yeguas para inseminar:
Podemos darle una dosis de 500 millones de espermatozoides a cada una
(es una dosis adecuada), pero el volumen que es de 100 ml es insuficiente.
Decidimos darle 20 ml a cada una, por lo tanto necesitamos un volumen
total de 160 ml. Simplemente debemos agregar 60 ml de diluyente al
eyaculado.

d) Inseminación
Higiene de las yeguas:
Lavar con agua y jabón.
Envolver la cola (venda o guante de nylon con el fin de evitar
contaminaciones).
Desinfectar con solución desinfectante (con algodón) abarcando primero
toda la zona genital y luego el interior de la vulva y la fosa clitoriana.
Inseminación propiamente dicha:
Se insemina en forma intrauterina.
Tener presente que se debe pasar el pliego vulvo-vaginal que cubre el
orificio uretral externo.
Masaje posterior:
Se realiza un masaje con el brazo primero vaginal y luego rectal para
expulsar el aire de la vagina.

FACTORES ADVERSOS PARA LA REPRODUCCIÓN EN EQUINOS

De todos los animales domésticos, la yegua es la más difícil de manejar
reproductivamente, destacándose los siguientes factores adversos para su
reproducción:

1) Las yeguas tienen celos estacionados. La falta de luz natural bloquea a
través de la glándula pineal, la actividad ovárica.
2) El periodo de celo de la yegua es largo (7 días), por lo que requiere una
adecuada detección del momento de la ovulación.
3) Es muy común en las yeguas, los ciclos irregulares, muy diferentes del
estándar teórico, especialmente al inicio de la temporada de servicios, tales
como:
a) Ciclos largos o cortos.
b) Celos largos, cortos, interrumpidos o silenciosos.
c) Ovulaciones adelantadas, retrasadas o ausentes.
4) La selección de reproductores no se hace por fertilidad sino por fenotipo,
pedigrí y aptitud deportiva.
5) El semen equino tiene una reputación bien ganada de "difícil de
congelar".
6) No se ha logrado aun, a nivel mundial, un método eficiente para hacer
superovular a las yeguas, característica fundamental para un programa de
transferencia embrionaria.
7) Muchas yeguas deportivas reciben tratamientos hormonales para
aumentar su rendimiento físico que, paralelamente, bloquean y alteran su
fisiología reproductiva.


Fecundación y mortalidad embrionaria.
En las especies domésticas las principales pérdidas reproductivas se deben a
problemas en la fecundación o en las etapas tempranas de la gestación (el primer
tercio de esta), en comparación, las perdidas por abortos y muertes neonatales
son mucho menores.

Fallas en la fecundación.
La fecundación puede fallar por problemas en el tracto reproductivo de la hembra,
por deficiencias en la calidad de los gametos masculino y femenino o por una mala
técnica de inseminación artificial, si este es el caso.

Barreras físicas en el tracto reproductivo de la hembra:
Defectos anatómicos congénitos o adquiridos del tracto reproductivo de la hembra.
Fallas en el desarrollo embrionario del tracto reproductivo de la hembra, que dan
como resultado hipoplasias o aplacías de la vagina, cervix, útero y oviductos, esta
última puede ser unilateral, en cuyo caso se puede intentar la fecundación cuando
haya ovulación en el lado normal.
Entre las anormalidades adquiridas, en el tracto reproductivo se encuentran la
inflamación del oviducto: salpingitis, que es generalmente secuela de metritis
puerperal. Las adherencias en los ovarios, fimbria y oviductos que pueden ser
secuelas de inflamación, manipulación inadecuada del ovario, tratamientos
uterinos agresivos o infecciones invasivas.

Imposibilidad para la unión entre gametos
Esta puede ser causada por los oocitos, por los espermatozoides o por otros
factores que les impiden fusionarse.

Gametos anormales:
Existen varios tipos de anormalidades morfológicas y funcionales de los oocitos:
entre las que se cuentan el gigantismo, forma irregular, rotura de la zona pelúcida.
Anormalidades cromosómicas (el alto grado de consanguinidad incrementa las
posibilidades)
Óvulos diploides. Estos poseen el doble de material genético de lo que
normalmente debe contener un óvulo. Suele deberse a la supresión de la
formación del 2o. cuerpo polar. En estos casos es difícil diferenciar si en realidad
hay una falla en la fertilización o una muerte embrionaria temprana pues en
algunos casos de desbalances genéticos en realidad sí hay fertilización pero el
embrión que se genera no es viable.
Las anormalidades morfológicas y funcionales de los espermatozoides son
frecuentes en ciertos rangos considerados fisiológicos. Por encima de estos
disminuye la capacidad fecundante. Pueden encontrarse fallas genéticas en
espermatozoides aparentemente normales.
- Gametos envejecidos o con poca capacidad fecundante:
Cuando la inseminación se efectúa demasiado tarde, los oocitos están "viejos"
al momento de la llegada de los espermatozoides y las probabilidades de
fertilización disminuyen. Además, si son fecundados, los oocitos envejecidos
tienen mayor probabilidad de sufrir poliespermia.
Cuando la inseminación se efectúa prematuramente, los espermatozoides
pueden encontrarse muertos al momento de la ovulación, o bien haber perdido
su capacidad fecundante. En ocasiones los espermatozoides envejecidos
sufren reacción acrosómica espontánea, lo que impide la fecundación.

- Anticuerpos contra los espermatozoides
Es causa de controversia ya que se han encontrado anticuerpos contra los
espermatozoides en yeguas así como en hembras multíparas que logran
concebir sin problema. Algunos estudios demuestran que no hay relación entre
la presencia de anticuerpos antiespermatozoides en el suero o en el moco
cervical y el "status" de fertilidad de la hembra. Otros estudios proponen que
estos anticuerpos ocasionen algunos casos de "yeguas repetidoras". Resulta
benéfico el uso de semen de otro padrillo o mejor aún, de otra especie.


Mortalidad embrionaria.
Es la muerte del embrión durante la fase inicial de la gestación, antes de que se
formen los huesos. Como resultado se presenta la reabsorción embrionaria sin
aborto. Entre el 25 a 50% de las gestaciones en las especies domésticas termina
en muerte embrionaria y esta se da entre los días 1 y 60 en los equinos, entre los
días 1 y 35 en porcinos, felinos y caninos. Después de estas fechas ocurre muerte
fetal que produce aborto o momificación.
Si el embrión muere antes de que la madre "reconozca" la presencia de la
gestación se conoce como Muerte Embrionaria Temprana. Es la más común en
todas las especies. Si la muerte del embrión ocurre después del reconocimiento
materno de la gestación, se considera Muerte Embrionaria Tardía.
Las causas de muerte embrionaria, tanto temprana como tardía, son muy diversas
y pueden deberse a factores de la madre, del ambiente o del embrión. Una
consideración importante para establecer causas y efectos de mortalidad
embrionaria es determinar si la muerte embrionaria es anterior o posterior a la
regresión del cuerpo lúteo.


Factores maternos.

a. Edad avanzada de la hembra
Las hembras muy jóvenes o mayores suelen tener problemas tanto para lograr la
fertilización del óvulo como para mantener vivo al embrión. Estudios sobre el
ambiente uterino han demostrado variaciones en algunos componentes de los
fluidos del endometrio uterino con variaciones en la cantidad de proteína, sodio,
fósforo, glucosa, calcio, potasio y magnesio. Además la producción hormonal
disminuye en las hembras de mayor edad.

b. Poca producción de progesterona por el cuerpo lúteo
Los niveles de progesterona en los días subsiguientes a la ovulación son críticos
para el desarrollo del embrión y para su tránsito a través del oviducto hacia el
cuerno uterino. El desarrollo del embrión se ve comprometido cuando hay
concentraciones bajas de progesterona, de tal forma que, aunque se logre el
reconocimiento de la gestación, la preñez no logrará mantenerse mucho tiempo.

c. Asincronía entre el desarrollo del embrión y el ambiente uterino.
Si hay un desequilibrio en los niveles de estrógenos y progesterona, el embrión
puede llegar al útero en forma prematura o tardía, ocasionándose una "asincronía"
entre el ambiente uterino y el grado de desarrollo del embrión. Algunos estudios
sugieren que el embrión es especialmente sensible al entorno en la transición
entre mórula y blastocito.

d. Inflamaciones uterinas.
Esta impide la implantación y desarrollo del embrión siendo una de las principales
causas de muerte embrionaria en equinos, en el caso de las "yeguas sucias"


Factores Ambientales.

a) Nutrición: La disponibilidad de nutrientes en la dieta pueden influir en la
muerte embrionaria, particularmente durante la implantación. La mala
condición corporal disminuye las tasas de fecundación y eleva la mortalidad
embrionaria en todas las especies, mientras que la elevada ingestión
calórica aumenta la tasa de ovulación aumentando también la mortalidad
embrionaria.
b) Estrés calórico: Las altas temperaturas ambientales pueden disminuir la
fertilidad, con una alta incidencia de muertes embrionarias. Cuando se
conjugan altas temperaturas con una alta humedad relativa, se aumenta la
muerte embrionaria.
c) Es importante un manejo adecuado del estrés calórico por medio de mayor
área de sombra, aspersores, ventiladores, etc. así como raciones
apropiadas para generar menos calor corporal.
d) Diagnóstico de gestación temprano: La palpación rectal entre los días 28 y
35 es una de las causas de mortalidad embrionaria. Se calcula que la
mortalidad embrionaria causada por palpación es de 3%, pudiendo ser
mucho mayor cuando la palpación es realizada por inexpertos.
e) Factores químicos: se han identificado algunos que incrementan la
probabilidad de muerte embrionaria: Nitratos, Micotoxinas, Exceso de
nitrógeno ureico en sangre, Endotoxemias (pueden causar liberación de
prostaglandinas y luteolísis), Tratamientos contraindicados
(prostaglandinas).
f) Agentes infecciosos específicos.


Factores embrionarios

Dentro de los factores embrionarios causantes de la muerte embrionaria se han
encontrado los siguientes:

a. Poliespermia si el óvulo es fecundado por más de un espermatozoide, el
cigoto formado muere en las primeras horas o días.
b. Consanguinidad: Pueden incrementar las probabilidades homocigocis para
determinados genes recesivos que pueden ser letales para el embrión.
c. Anormalidades cromosómicas: aneuploidías, translocaciones son
causantes de fallas en el desarrollo que pueden ser letales para el embrión,
en especial aquellas que involucran al trofoblasto y las hormonas y factores
que permiten el reconocimiento materno de la gestación.

En la actualidad existen métodos diferentes al de la monta natural para perpetuar
la existencia de las especies, en equinos las más usadas son:


INSEMINACIÓN ARTIFICIAL EN EQUINOS.

La Inseminación Artificial es el procedimiento de fecundación mediante la
introducción, por medios artificiales, del semen extraído de un caballo en una
determinada yegua. Este sistema ha sido de gran ayuda en diversas especies
domésticas, especialmente en vacunos, donde ha permitido un gran progreso
genético tanto en producción de leche como de carne. En los últimos años se ha
perfeccionado y simplificado para usarse en caballos y, es así, que numerosas
razas lo han adoptado en todo el mundo. La principal ventaja, de esta técnica, es
el mejor aprovechamiento de los buenos sementales, en su detrimento, debemos
de decir que si se abusa de algunos “supersementales” perderíamos en diversidad
genética y acabaríamos con más problemas que ventajas. También debemos de
decir, que gracias a la inseminación artificial, esta mucho más asequible, para
cualquier ganadero el cubrir sus yeguas con los mejores sementales del mundo.
La influencia en el precio de los caballos es relativa, si bien es cierto que los
sementales verdaderamente buenos, subirán sus precios, y los mediocres
perderán su función como sementales, ya que podemos acceder a cualquier
semental y en cualquier parte del mundo.

La inseminación artificial en yeguas se puede realizar utilizando:
- Semen fresco
- Semen refrigerado
- Semen congelado

En caso de compra de semen congelado, el manejo del semen es algo distinto, lo
que requiere los conocimientos necesarios para alcanzar gestaciones.
Para inseminar yeguas se debe proceder a un examen exhaustivo del aparato
reproductor de la misma, incluyendo las siguientes operaciones:
- Exploración del aparto reproductor manual, vía rectal
- Examinación ecografica, vía rectal
- Citologías vaginales
- Biopsias uterinas
- Lavados uterinos
- Tratamientos hormonales.

En 1957 se logró el primer embarazo con semen congelado equino. Poco a poco
se investigado más a fondo esta técnica y se ha mejorado en todas sus etapas,
concibiéndose recién en la década de los setenta la comercialización de las
primeras dosis de semen equinas congeladas.
Hoy en día en casi todo el mundo se cuenta con semen congelado de los
principales sementales. En Europa el semen congelado es usado extensamente y
en Norteamérica hay más de una veintena de instalaciones que ofrecen servicios
de congelamiento y el número aumenta rápidamente. Además hay numerosos
sitios que importan y exportan el semen congelado. Chile no es la excepción, y ya
en nuestro país existe una empresa dedicada a este rubro.
Con respecto a los resultados obtenidos en el mundo, es aceptando que las tarifas
de preñez media por celo con semen congelado están alrededor del 30 - 40 %,
comparado con el 65 % o más con el semen fresco o enfriado. Además, hay
variación considerable en las tarifas de preñez alcanzadas con semen congelado
(de 0 - 75 %) atribuible tanto al potro como a la experiencia de la persona que
maneja el semen e insemina las yeguas.

Ventaj as De La Inseminación Artifici al

1. Cuesta menos que mantener un padrillo en la finca.
2. Mejoramiento genético, pues de usar padrillos probados aportando genes
deseados, que inciden en un aumento de los caracteres deseados.
3. Mayor flexibilidad al emplear semen de diferentes padrillos sin costo
adicional, y así se evita la consanguinidad.
4. Control efectivo de enfermedades genitales, eliminando el peligro de
propagación de las mismas.
5. Evita el trabajo de cuidado y manejo del reproductor.
6. La inversión es mucho menor que comprarse un padrillo reconocido.
7. El semen se puede mantener congelado por varios años.
8. Se intensifica el uso del semen de los mejores padrillos.
9. Se pueden utilizar semen de razas especializadas de acuerdo al fin de cada
criadero.
10. Mejor control productivo del lote de yeguas para cría, ya que con el uso de
inseminación artificial, se llevará el control de cada animal (número de
servicio, preñez, fecha de parto, etc.) y se pueden eliminar animales con
problemas reproductivos.
11. Permite la utilización de toros de alto valor genético que, por su costo, no se
podría utilizar en monta natural.
12. Con la inseminación artificial se hace posible la continuidad en el servicio
de los reproductores valiosos que por lesiones, ya no pueden fecundar
naturalmente a las yeguas.


Desventajas de l a inseminación artifici al

1. Se puede diseminar características indeseables de un equino de inferior
calidad, ocasionando un retroceso en el mejoramiento genético.
2. Si no se compra semen de diferentes padrillos, se puede causar una
consaguinidad en el criadero.
3. Si las condiciones y calidad sanitaria en el proceso de recolección e
inseminación, no son las más idóneas, pueden convertirse éstas prácticas
en un medio de propagación de enfermedades.
4. El instrumental requerido y la adquisición del semen, inicialmente puede ser
algo costoso si no se adquiere en cooperativas, clubes cabalísticos o
asociaciones a fin.
5. Se requiere de un personal técnico para la detección del celo, inseminación
y diagnóstico de preñez.




PASOS PARA LA COLECCIÓN DEL SEMEN

Colección de Semen.
La mayor parte de los sementales fácilmente pueden ser entrenados para la
colección de semen. El método más simple es utilizar un maniquí en presencia de
una yegua en calor. El semen será colectado por la desviación del pene hacia una
vagina artificial en donde el semental eyaculará. Por regla general, los sementales
producirán el semen suficiente en cada colección para 8 - 12 dosis de semen
congelado.

Colección de semen (Tomado de http://201.238.246.21/)


Examen in Vitro con microscopio
Después de que es colectado el semen fresco es evaluado para ver su calidad, en
este examen se evalúa la motilidad, concentración, y ph entre otros. Esta
evaluación inicial es importante para determinar si el semen es congelable.


Examen in Vitro con microscopio. (Tomado de http://201.238.246.21/)


Congelación del semen
El semen entonces es diluido, refrescado y envasado en pajuelas de 0,5cc. Estas
pajuelas pueden ser etiquetadas con el nombre del semental, la fecha en que se
congeló el semen y el criadero al que pertenece.

Seguidamente se procede a la carga de las pajuelas estériles y previamente
identificadas con el nombre del semental, el día de congelación y el centro de
reproducción. Gracias a la máquina empajueladora automática este proceso
sucede automáticamente y de manera estéril. También es posible la carga manual
de las pajuelas, debiendo poner especial atención a no incluir burbujas de aire. El
sellado de las mismas, en la máquina, se produce mediante presión/calor,
mientras que en la carga manual es factible mediante la inserción de una bola de
acero inoxidable diseñada para tal objeto.
A continuación tiene lugar la refrigeración de las pajuelas preparadas con el
semen desde la temperatura ambiente hasta alcanzar 5ºC a una tasa de -0,2ºC
El proceso de congelación debe efectuarse en forma gradual y controlada, ya que
la membrana espermática equina es muy frágil. Es por esto que el sistema óptimo
es el congelamiento computarizado, en donde el semen es enfriado gradualmente
con vapor de nitrógeno para luego ser almacenado indefinidamente en el
nitrógeno líquido.






Laboratorio con sistema de congelamiento computarizado. (Tomado de http://201.238.246.21/)


Empajuelado (Tomado de http://201.238.246.21/)

Almacenaje.
Las alternativas para el almacenaje de semen congelado son: el centro
reproductivo o clínica veterinaria que congeló el semen, o el mismo criadero o
dueño del semental. Esta última alternativa requerirá de la compra de tanques de
almacenaje de semen y un suministro de nitrógeno líquido mensual, lo que puede
ser más costoso e inseguro si el semen no es manipulado minuciosamente.


Almacenaje (Tomado de http://201.238.246.21/)


Aspectos a considerar antes de utilizar semen congelado para inseminar sus
yeguas

Hay varios factores para considerar y decidir si se desea usar el semen congelado
para inseminar las yeguas. En primer lugar, los dueños deberían consultar las
regulaciones y normas de las sociedades y federaciones de criadores de distintas
razas en cuanto al empleo de semen congelado y la inseminación artificial.

Para alcanzar resultados satisfactorios usando semen congelado, su yegua
debería ser joven (4 - 15 años), fértil y tener una historia reproductiva normal. Un
examen reproductivo completo realizado por veterinarios expertos en el tema es
aconsejable antes de utilizar semen congelado.


Inseminación
El seguimiento ecográfico reproductivo es fundamental para inseminar yeguas con
semen congelado. Es reconocido que el semen congelado tiene una vida fértil más
corta dentro de la yegua que el semen fresco o enfriado. Lo mejor sería que la
yegua estuviera residente en una clínica veterinaria o centro reproductivo.

Los propietarios tienen poca influencia sobre la calidad del semen una vez que
ellos han seleccionado el semental. Sin embargo, ellos pueden mejorar su éxito si
manejan el semen congelado con veterinarios especialistas, expertos en el
manejo, seguimiento de las yeguas y la inseminación con semen congelado.

Para dueños de sementales, el semen congelado puede suministrar un medio muy
acertado y conveniente de comercializar y dar a conocer su semental mientras
esté en la alta competición, además de conservar el patrimonio genético una vez
que este ya no exista. Por otro lado, para los dueños de las yeguas, el semen
congelado aumenta enormemente la disponibilidad de sementales. Con la
preparación adecuada y la selección de semen de calidad y un operador
experimentado, excelentes resultados pueden ser alcanzados usando semen
congelado.

Inseminación histeroscópica versus Intrauterina profunda.
Aunque los reportes iniciales sobre técnicas de inseminación con dosis bajas en la
yegua estuvieron basados en procedimientos guiados endoscópicamente para
depositar el semen en la UUT, en otros trabajos se ha usado una técnica de
enhebrado transrectal para dirigir un catéter de inseminación flexible hasta el
extremo del cuerno uterino del folículo preovulatorio. En un reporte de Brinsko y
col, los porcentajes de preñez fueron similares después de la inseminación, ya sea
con catéter o por endoscopio, de 5 x 106 espermatozoides móviles en el extremo
del cuerno uterino. En otros trabajos en los que se depositó un número similar de
espermatozoides en el extremo del cuerno uterino usando el catéter, las tasas de
preñez variaron entre el 35 y 50%. Estos estudios sugieren que dosis de
inseminación de aproximadamente 5 x 106 espermatozoides móviles pueden
lograr tasas de preñez aceptables utilizando la técnica intrauterina profunda sin
necesidad de procedimientos endoscopios. En el equino, la UUT representa el
orificio del oviducto que se proyecta dentro de la luz uterina en el extremo del
cuerno uterino. La morfología de la unión uterotubárica varía de una yegua a otra
pero generalmente se observa como una pequeña papila que se proyecta
aproximadamente 3 a 5 mm dentro de la luz uterina. En este punto la luz del
oviducto es extremadamente pequeña y provee una barrera muy efectiva entre el
útero y el oviducto. Inicialmente la inseminación con dosis baja se intentó
mediante canulación de la porción inicial del oviducto previo a la deposición de
semen. Esto se abandonó rápidamente debido a la dificultad para sondear el
oviducto y se inseminó depositando el semen sobre la superficie uterina de la
UUT.
Otros investigadores han intentado mejorar el tránsito espermático hacia adentro
del oviducto mediante la administración local de prostaglandina E2 (PGE2). La
prostaglandina E2 induce la relajación del músculo liso circular del oviducto y
actúa facilitando el transporte del embrión al útero. El pretratamiento tópico con
PGE2 (250 µg) incrementó la tasa de preñez en yeguas inseminadas con 25 x 106
espermatozoides (13/18 vs. 7/16) dentro del cuerno o el cuerpo uterino.

Técnica de inseminación histeroscópica
La selección apropiada de yeguas candidatas para la inseminación con dosis baja
así como la fertilidad del semental influye en el éxito de este procedimiento. Las
candidatas óptimas son las yeguas jóvenes y fértiles sin historia previa de
endometritis post-servicio. Las yeguas más viejas, con evacuación uterina
disminuida, serán candidatas menos deseables y son más propensas a presentar
acumulación intrauterina de líquido después de la inseminación histeroscópica. En
los estudios reportados varía la incidencia de la acumulación de líquido
intrauterino.

Sitio de inseminación
Aunque el mayor esfuerzo en la inseminación con dosis baja ha sido dirigido a la
deposición de semen sobre o cerca de la unión uterotubárica, al menos un estudio
indica que la inseminación con dosis baja en el cuerpo uterino puede también
resultar en fertilidad aceptables comparo la fertilidad después de inseminar con 14
x 106 espermatozoides móviles descongelados en el cuerpo uterino con catéter o
en la UUT con endoscopio. Las tasas de preñez logradas con estas dos técnicas
fueron similares. Los porcentajes de preñez fueron significativamente más bajos
cuando se depositaron, con endoscopio dentro del cuerpo uterino, 3 x 106
espermatozoides móviles descongelados comparados con el depósito en la UUT.
Probablemente haya efectos importantes del semental relacionados con el número
mínimo de espermatozoides necesarios para lograr tasas de fertilidad aceptables
con estas técnicas. No obstante, la posibilidad de lograr tasas de fertilidad
razonables después del depósito de 14 x 106 espermatozoides móviles en el
cuerpo uterino ofrece posibilidades interesantes de mejorar la eficiencia del semen
equino congelado.

Equipo
El uso de un video endoscopio de 1.6 M con un canal de operación facilita la
visualización de la unión uterotubárica en la mayoría de las yeguas. Se pueden
usar endoscopios más cortos; sin embargo, la longitud del endoscopio puede
limitar el acceso fácil al canal de operación y a los controles del endoscopio en
yeguas de mayor tamaño. Es importante el cuidado del canal de operación del
endoscopio para asegurarse que no permanezcan detritos en el mismo después
del procedimiento y que sea removido el desinfectante químico usado en la
limpieza del endoscopio. Los pequeños volúmenes de inseminación usados en
este proceso son extremadamente susceptibles a los contaminantes que quedan
en el canal de biopsia del endoscopio.
En el procedimiento de inseminación, generalmente es usado un catéter de doble
vía. La doble vía ayuda a prevenir la contaminación del semen durante el pasaje a
través del canal de biopsia del endoscopio. La longitud del catéter debería ser al
menos 20 cm. más larga que el canal de biopsia con el objeto de proveer una
longitud adecuada para el trabajo de inseminación. Generalmente son necesarias
un mínimo de tres personas para completar el procedimiento.

Preparación de la yegua
Lo ideal es que las yeguas destinadas a inseminación endoscopica sean sujetadas
en un brete. De acuerdo al temperamento de la yegua, puede requerirse sedación.
Se evacua el recto de la yegua, y se confirma la presencia del folículo
preovulatorio. Se debe llevar a cabo una cuidadosa preparación de la vulva y
periné para el procedimiento vaginal.

Pueden usarse dos métodos de introducción del endoscopio dentro del útero. En
la aproximación histeroscópica estándar, el endoscopio es introducido a través del
cerviz, el útero es localizado y el endoscopio es dirigido visualmente al cuerno
uterino que presenta el folículo preovulatorio. Otra alternativa puede ser introducir
el endoscopio a través del cerviz y guiarlo mediante manipulación rectal hasta el
cuerno uterino. Usando el primer método, es importante confirmar la ubicación del
endoscopio al folículo preovulatorio, ya que con guía visual es fácil desorientarse
en relación a los cuernos uterinos derecho o izquierdo. Una vez que la UUT es
identificada, el catéter de inseminación debe pasarse a través del canal de biopsia
y se deposita el semen directamente en la UUT. No se debe hacer ningún intento
de canular el oviducto durante el procedimiento. Algunos autores consideran
conveniente la introducción de burbujas de aire durante la deposición del semen
para mantener un mayor contacto por tensión superficial en la región de la UUT.
Una vez que se completa la inseminación, el aire que fue introducido durante el
procedimiento debería ser eliminado mediante aspiración a medida que el
endoscopio es retirado del útero
En este procedimiento se requieren un manejo y carga del semen mucho más
cuidadosos debido al bajo número de espermatozoides así como al pequeño
volumen de lo inseminado. Esto es particularmente cierto si se usa semen
criopreservado ya que estas células son mucho más susceptibles al choque frío y
los pequeños volúmenes usados hacen que la transferencia de calor y el choque
térmico sean más probables. Antes de la inseminación, los catéteres y el material
de laboratorio usados para el manejo de semen deben ser precalentados a
temperatura corporal. Una vez que el endoscopio está en su lugar y se identifica la
UUT, el semen diluido se carga dentro del extremo distal del catéter de
inseminación aspirándolo cuidadosamente como un embrión sería aspirado dentro
de una pipeta de transferencia. Luego de cargar el catéter, la inseminación se
debe realizar rápidamente.


Técnicas de inseminación intrauterina profunda.

La preparación de la yegua es similar a la usada para la inseminación
endoscópica, aunque con este procedimiento la necesidad de sedación suele ser
menos frecuente. Se evacuan las heces por palpación rectal y se confirma la
presencia del folículo preovulatorio. Después de la preparación para el
procedimiento vaginal, se realiza la inseminación pasando el catéter de
inseminación a través del cervix. Luego de que el catéter es introducido dentro del
cervix, es guiado por recto hasta el extremo del cuerno uterino l al folículo
preovulatorio. La entrada al cuerno uterino puede ser facilitada tomando la base
del cuerno uterino contralateral y realizando una tracción caudal. Esta maniobra
tiende a enderezar el cuerno uterino opuesto y facilitar el pasaje del catéter hacia
el extremo del cuerno.

Volumen de inseminación
El volumen a inseminar en la unión uterotubárica por histeroscopía varía entre 20
y 200 µl. Cuando se insemina directamente con semen congelado, se deposita un
volumen de 250 a 500 µl (correspondiente a una única pajuela de 0.25 o 0.5 ml).

Los reservorios de espermatozoides.
Aunque un número relativamente grande de espermatozoides es depositado en el
útero de la yegua en el momento del servicio natural o en la inseminación
artificial, relativamente pocos alcanzan el sitio de fertilización en la unión istmo-
ampular del oviducto. La progresión de los espermatozoides a través del tracto
reproductivo de la hembra está asociada a una marcada reducción en el número
de los mismos, así como con una mejoría importante en el porcentaje de
espermatozoides móviles y morfológicamente normales. Se cree que tanto la
unión uterotubárica como la porción inicial del istmo oviductal juegan un papel
importante en la selección de espermatozoides y en la formación de un reservorio
de semen efectivo. El secuestro de espermatozoides en este sitio se produce
rápidamente después del servicio o de la inseminación de tal forma que los
espermatozoides son efectivamente aislados del ambiente uterino dentro de las 4
horas posteriores a la inseminación.

La formación de un reservorio efectivo de semen dentro de la porción inicial del
istmo oviductal parece depender de la adhesión célula-célula entre los
espermatozoides y las células epiteliales oviductales y es capaz de mantener la
fertilidad del espermatozoide equino durante varios días del estro de las yeguas.
Los espermatozoides que están adheridos al epitelio oviductal son bloqueados
para impedir que sufran los cambios de capacitación previos a la fertilización y
poder mantener así una población viable e intacta para participar en la fertilización
en el momento de la ovulación. La adhesión de los espermatozoides al epitelio
oviductal mantiene bajos sus niveles intracelulares de calcio. En el momento de la
ovulación, los espermatozoides son liberados de este reservorio y sufren los
cambios previos a la fertilización necesarios para la unión exitosa a la zona
pelúcida y fertilización.


EL TÉCNICO INSEMINADOR

“Es toda persona técnicamente capacitada para el manejo, cuido y siembra del
material espermático en los órganos genitales de una hembra apta para la
reproducción”.

El inseminador es indudablemente la persona más importante que garantiza el
éxito, o en muchos casos, señala las fallas o anormalidades en un programa de
inseminación artificial. El éxito o fracaso depende en un alto grado de la
responsabilidad y habilidad, no sólo para inseminar, sino también en el
reconocimiento del celo de las yeguas y manejo del semen.



OBLIGACIONES DEL PRÁCTICO INSEMINADOR:

Los inseminadores estarán obligados a:

1. Hacer una revisión minuciosa de todas las yeguas, con el fin de observar su
comportamiento, secreciones vaginales y algunas otras características
anormales que comprometan su reproductividad.
2. Estar pendiente de la aparición de celos, determinar el momento apropiado
de la inseminación y efectuar la misma.
3. Limitarse estrictamente al ejercicio de la inseminación artificial. En ningún
momento podrá intervenir en los campos de competencia del Médico
Veterinario.
4. Tener en su bolsillo una libreta para anotar el número de la yegua,
características, hora, etc., de todos los eventos que suceden a diario en el
programa de inseminación artificial que se le entregó.
5. Notificar obligatoriamente todos y cada una de las observaciones vistas y
anotarlas al Médico Veterinario, supervisor del programa de inseminación
artificial.
6. Realizar los tratamientos a las yeguas, según prescripción del Médico
Veterinario.

TRANSPLANTE DE EMBRIONES.


El primer transplante embrionario en equinos realizado con éxito fue comunicado
por Oguri y Tsutsumi en 1972, pero no fue aceptado como procedimiento en la
industria equina hasta comienzos de los años 80. En 1984 se realiza el 1°
Simposio Internacional Equino en la Universidad de Cornell (USA.), el 2° en
Canadá en el año 1989, y el 3° en Argentina en 1992. Actualmente, a 11 años de
este evento, se nos plantea un gran desafío pues por diferentes motivos, aún no
se ha podido realizar exitosamente ningún transplante embrionario en equinos en
nuestro país.

Hoy día esta técnica es considerada a nivel mundial, como una de las técnicas de
Reproducción Asistida mas utilizada.

Uno de los mayores beneficios de la transferencia embrionaria es la posibilidad de
obtener potrillos de hembras genéticamente superiores, de avanzada edad, que
luego de quedar preñadas les es difícil mantener la gestación, que tienen
antecedentes de reabsorciones embrionarias y/o abortos.
Otra de las posibilidades que nos ofrece esta técnica es el poder usar yeguas de 2
años como donantes, un año antes de llegar a su madurez sexual, y así poder
obtener un potrillo antes de que puedan llevar una gestación a término. También
nos permite mantener en competencia y participar en exposiciones, a ejemplares
genéticamente superiores, al mismo tiempo que obtenemos varios potrillos que
son gestados por yeguas receptoras.

La transferencia embrionaria en el equino no ha tenido el mismo éxito que en el
bovino, ya que no existe un método seguro de superovulación en la yegua, esto
implica que solo se puede obtener un embrión por ciclo si la yegua es gestada. De
todas formas con la tecnología existente actualmente, se podrían obtener de 6 a 8
potrillos por yegua durante una estación reproductiva.

Ventajas del trasplante de embriones

- Obtención de gestaciones de hembras que no pueden llevar a término
embarazos por lesiones o enfermedades uterinas.
- Obtención de múltiples gestaciones por estación reproductiva.
- Obtención de gestaciones de yeguas de dos y tres años de edad y
nacimiento de potros de madres en competición.
- Nacimiento de potros obtenidos tardíamente en la estación reproductora
pero permitiendo que se obtenga otro nacimiento en la estación siguiente.






Las desventajas de la técnica son las siguientes:

- El costo elevado de la técnica.
- La cualificación profesional del equipo veterinario que lo vaya a llevar a
cabo, que es difícil de adquirir en nuestro medio.
- Imposibilidad que muestra la yegua de reaccionar a una superovulación, lo
que ayudaría mucho más a rentabilizar la técnica.

Dentro de las desventajas que debemos enfrentar, una de las de mayor
importancia es, que es muy difícil mantener en un mismo establecimiento yeguas
y padrillos de alta calidad genética y yeguas receptoras. Además algunas
asociaciones de criadores limitan reglamentariamente el número de potrillos por
yegua al año.


Yeguas Receptoras

Uno de los factores más importantes a tener en cuenta para el éxito del programa
es la selección y el manejo de las hembras receptoras. La edad de las receptoras
(entre 3 y 10 años) es uno de los puntos más importantes. También una buena
conformación, y tener igual o mayor peso y tamaño corporal que las yeguas
donantes para poder llevar a término en excelentes condiciones la gestación.
Usualmente se eligen yeguas de razas pesadas o sus cruzas para aprovechar
rusticidad, tamaño, temperamento y aptitudes maternas que facilitaran la cría de
ese potro genéticamente superior.
A estos animales se les realiza un minucioso examen reproductivo, con evaluación
ecográfica diaria por lo menos de dos ciclos consecutivos, para determinar las
características del ciclo de cada yegua en particular(receptoras y donantes),
actividad folicular durante el celo y características de la ovulación, además se los
somete a un exigente plan sanitario que comprende vacunaciones contra
enfermedades como Tétanos, Influenza, Adenitis Rinoneumonitis, etc.,
tratamientos antiparasitarios tácticos y estratégicos y sobre todo un buen nivel
alimenticio para que ganen peso luego de la transferencia.


Yeguas donantes

Al igual que a las receptoras se les realiza un completo examen reproductivo que
incluye tamaño, tono y forma del útero. El cervix, se examina por vía vaginal y se
realiza un cultivo cervical para obtener información del estado del mismo, si se
identifican anormalidades deben ser tratadas antes de su introducción al programa
de transplante. Se las evalúa además para conocer su comportamiento
reproductivo frente al padrillo (retajeo),
Antes de comenzar un programa de transplante se debe escoger un método de
Sincronización de Celos adecuado para sincronizar donantes con receptoras.
Existen varias alternativas, las más utilizadas son la sincronización mediante 2
inyecciones de Prostaglandina F2o y Progestágenos orales durante 12 a 14 días.
Estos tratamientos pueden usarse solos o combinados con luz artificial para
estimular la ovulación sobre todo al inicio de la temporada de servicios (invierno) y
combatir así los celos anovulatorios. Cuando tenemos celos normales y
sincronizados entre donantes y receptoras, y libres de anormalidades uterinas y
ováricas estamos en condiciones de iniciar un programa de Transferencia
Embrionaria.
Durante el celo de la yegua donante se la observa por ecografía para conocer el
momento óptimo de servicio o inseminación artificial. Luego de éste se procede a
la selección, también mediante ecografía, de 2 o más yeguas receptoras (de
acuerdo a la disponibilidad de las mismas), y de éstas se elige una, que de
acuerdo al crecimiento folicular y ovulación se encuentre mas sincronizada con la
donante. Al séptimo u octavo día post ovulación de la donante se realiza la
recolección del embrión mediante lavado uterino transcervical. Se coloca la yegua
donante en un brete se venda la cola y se lava la región perineal con abundante
agua y un detergente suave, se enjuaga y seca. El operador se coloca un guante
de tacto estéril, con gel lubricante también estéril, y procede a la introducción de
un catéter (sonda Foley) a través del cervix, ubicando en el cuerpo del útero el
balón del catéter, que una vez allí es inflado con aire o suero. Se comprueba que
esté en el sitio adecuado traccionando hacia atrás para que no haya reflujo de
líquido. Se lava el útero introduciendo por el catéter 3 lts de PBS o PBS
modificado tibio a 30 a 35 °C. Luego se permite al líquido salir y pasar a través de
un filtro para embriones. Mediante masajeo del útero vía rectal se logra obtener el
80% del total del líquido prefundido el cual si la yegua no tiene problemas uterinos
debería ser claro, libre de restos celulares y sangre. La recuperación de líquido
turbio indica endometritis. Al finalizar el lavado el contenido del filtro se vacía en
una placa de petri para buscar el embrión bajo lupa estereoscópica con un
aumento de 15X. Luego de localizado el embrión se lava 3 o 4 veces con líquido
de enriquecimiento y se observa a mayor aumento para clasificarlo de acuerdo a
una escala que va de 1 (excelente) a 4 (pobre) de acuerdo a las características de
viabilidad embrionaria.

Se introduce en una pajuela 0.5 o 0.25, (mediante aspiración a través de una
pipeta dosificadora para embriones o una pajuela adosada a una jeringa) con
medio de enriquecimiento y se mantiene a temperatura de 37 °C hasta el
momento de la transferencia, preferentemente antes de 2 horas de su recolección.
Se coloca la pajuela dentro de un inyector de Inseminación Artificial descartable,
se protege éste con una camisa sanitaria estéril para evitar la contaminación
durante el pasaje de la misma por la vagina. El operador, con un guante de tacto
estéril, con lubricante también estéril, previo lavado y secado de los genitales de la
yegua receptora, introduce la mano en la vagina con la punta del inyector
protegida en la palma de la mano, rompe la camisa sanitaria y lo introduce a
través del cervix en el cuerpo uterino. Se deposita el embrión lentamente.
Es imprescindible siempre administrarle a la yegua donante Prostaglandina F2o
para que esta retorne al estro,
Y asegurarnos que no se establezca la preñez en aquellas yeguas en la que no se
pudo recolectar embrión.
A los 7 días de realizado el transplante, se realizan ecografías en las receptoras
para diagnosticar preñez, que se repiten a los 20, 35, 50 y 60 días. La muerte
embrionaria entre los días 15 y 60 de la gestación, según los investigadores, no
parece ser mayor en yeguas receptoras de embriones transferidos que en yeguas
inseminadas con semen fresco.
Al igual que en los bovinos, la habilidad del técnico puede ser el factor más
importante que afecte la tasa de preñez cuando los embriones son transferidos.
Se debe tener especial cuidado con la manipulación tanto en el laboratorio cuando
se localiza el embrión, como en la recolección y transferencia del mismo.





















www.3caballos.com
LECCION 23. GESTACIÓN


www.3caballos.com

La gestación de las yeguas tiene una duración de 320 a 360 días, los
alumbramientos en tiempos inferiores entre los 320 y los 300 días son
considerados como prematuros, ya que los productos presentan pequeñez,
debilidad y dificultades para sobrevivir. Los que nacen con menos de 300 días son
considerados abortos y sus posibilidades de sobrevivir son mínimas. En la yegua,
que es una especie unípara (es decir pare por lo general una cría por parto), un 10
a 15% de sus gestaciones parten siendo gemelares, debido a que durante el celo
algunas presentan más de una ovulación. Estas gestaciones gemelares bivitelinas
tienen el siguiente destino: puede reabsorberse espontáneamente una de las
vesículas embrionarias, sin afectarse la otra; morir precozmente ambas,
reabsorbiéndose; producirse aborto de ambos fetos al final de la gestación, o
llegar a parir mellizos.
Si a los antecedentes antes mencionados, agregamos que existe un porcentaje
importante de yeguas que presentan abortos únicos sin una causa clínica
aparente, sumado a muertes de potrillos durante y después del parto por mala
atención de este, explican el porqué, en condiciones de manejo tradicional, es
difícil obtener en las yeguas, resultados de fertilidad, medidos sobre crías nacidas
vivas/año superiores a un 70%.
El mayor número de reabsorciones embrionarias en la yegua se produce alrededor
de los 25-30 días de gestación. En este período es posible ver el embrión pequeño
en la parte inferior de la vesícula, el que va paulatinamente ascendiendo. Por
ecografía y de acuerdo con el porte del embrión e intensidad de los latidos de su
corazón, podemos darnos cuenta del grado de su vitalidad

Durante las primeras etapas de la gestación, el embrión flota libremente, primero
en el oviducto y después en el útero. Sus nutrientes son aquellos que se
almacenan en su propio citoplasma y los que pueden ser absorbidos de la leche
uterina. Solo después de la placentación, proceso por el cual el embrión se
adhiere al útero, éste puede obtener sus nutrientes y transferir sus productos de
desecho a través de la sangre materna. Se sabe que el tiempo de placentación
después de la fertilización se inicia de 50 a 60 días en la yegua. Este período es
difícil de estimar por el tipo de placentación difusa. Antes que el embrión pueda
lograr beneficios de la placentación, ocurrirá desarrollo orgánico completo, incluso
el sistema circulatorio del embrión es funcional, con lo que se permite el correcto
intercambio de nutrientes y gases a través de la circulación materno-fetal. En la
yegua, los embriones también migran libremente, encontrándose el feto con
frecuencia en el lado opuesto al del cuerpo lúteo que se formó al producirse la
ovulación.

Existen tres distintos períodos durante el desarrollo de la concepción. Estos son:
Segmentación, Diferenciación y Crecimiento.

La segmentación
Después de la fertilización el cigoto se divide muchas veces sin aumento del
citoplasma. El tamaño total puede aumentar debido a la absorción de agua. Este
proceso de división celular sin aumento de citoplasma es la segmentación. La
primera segmentación ocasiona la formación de un embrión de 2 células. Luego
se continúa con segmentaciones adicionales así el embrión aumenta de 4, 8, 16 a
32 células, cuando éste pasa del oviducto hacia el útero, se encontrará una masa
de 16 a 32 células protegidas por la zona pelúcida. Esta estructura se denomina
mórula. Durante los siguientes días, el liquido colectado en los espacios
intercelulares se acumulará en el centro, formando el blastocisto, cavidad llena de
líquido (el blastocele) rodeado por una capa de células. Se puede identificar la
masa celular interna, montículo de células en un lado del blastocisto, la cual
formará el cuerpo del embrión. Hasta este momento las células del blastocisto no
están aún diferenciadas. Por lo tanto, no es posible identificar a las células que
formarán un órgano particular del cuerpo. Cerca del término del período de
segmentación, la zona pelúcida se debilita y desintegra, permitiendo que el
blastocisto se alargue, iniciándose la segunda fase.

El amnios es la membrana extraembrionaria más interna, contiene líquidos que
suspenden al embrión protegiéndolo y permitiendo su libre crecimiento. El líquido
amniótico continuará bañando y suspendiendo al feto a lo largo de la gestación.

La capa más externa de las membranas extraembrionarias se denomina corion; El
alantocorion, se forma por la fusión del corion con la alantoides, contiene líquido
con gran cantidad de productos de desecho. Conforme la alantoides va creciendo,
se une con el corion hasta que la membrana corioalantoidea envuelve por
completo el amnios. La membrana corioalantoidea se une al endometrio durante la
placentación y forma la placenta. Después de la placentación, el oxígeno y los
nutrientes de la sangre materna pasan a través de las uniones placentarias a la
circulación del embrión; los productos de desecho, incluyendo el amoniaco y el
bióxido de carbono del embrión, son transportados desde la sangre embrionaria a
través de las uniones placentarias a la sangre materna para su eliminación a
través del sistema materno, Si la membrana corioalantoidea no se desarrolla
apropiadamente, el embrión moriría pronto debido a la falta de oxígeno y
nutrientes, por exceso de productos tóxicos o por ambas causas.


Formación de los órganos
Conforme progresa la formación de las membranas extraembrionarias, se forma
una placa nerviosa a partir de las células ectodérmicas como principio del sistema
nervioso central. El cerebro y la médula espinal primitivos pronto son discernibles.
El aparato circulatorio se desarrolla rápidamente a partir de las células
mesodérmicas; luego pueden identificarse el hígado, páncreas, pulmones y
sistema digestivo conforme se diferencian de las células endodérmicas. A los
pocos días se observan los inicios de los miembros, el origen de la cola y los
cristalinos de los ojos. En este estado de desarrollo, los embriones de la mayoría
de las especies son tan semejantes en apariencia, que no pueden ser
diferenciados.
Durante el período en que se desarrollan otros órganos, también se forma el
sistema reproductor. Los órganos primitivos que aparecen muy temprano en el
período de diferenciación estarán completamente formados al final del período. El
embrión al final de este período aparecerá como un caballo en miniatura. La
cabeza estará completamente llena y los rasgos faciales bien diferenciados.
Piernas, cascos y cola estarán ya formados. En el macho puede identificarse el
escroto. En la hembra ya pueden observarse los botones mamarios y la vulva. La
función de los órganos es limitada al final de la diferenciación, aunque todo lo
necesario para el desarrollo funcional estará ya presente. El período de
diferenciación es crítico, nada que impida la diferenciación normal podrá corregirse
posteriormente en la gestación. Las drogas que impiden la diferenciación normal
de piernas u ojos producirán defectos en el nuevo ser, que solo serán evidentes al
nacimiento. Asimismo, la terapéutica con hormonas sexuales puede impedir la
diferenciación sexual normal.

Crecimiento fetal
Después que se ha completado la diferenciación, el producto de la concepción se
llama feto en vez de embrión. Esta parte de la gestación entre la diferenciación
completa y el parto se ha denominado “período del feto” El acontecimiento
principal en este período es el crecimiento fetal.


Hormonas importantes en la gestación
El mantenimiento de la gestación depende en gran parte de un equilibrio
apropiado de las hormonas. Esto se confirma por el hecho de que cualquier
trastorno del equilibrio hormonal conduce frecuentemente al aborto. El
mantenimiento de un equilibrio apropiado de hormonas a través de toda la
gestación depende de una interrelación entre la madre, la placenta y posiblemente
el feto.

Se ha identificado a la progesterona como la hormona que posee el papel más
importante en el mantenimiento de la gestación. Altos niveles de progesterona
disminuirán el tono del miometrio e inhibirán las contracciones uterinas.
Igualmente altas concentraciones de progesterona detienen el ciclo estral evitando
la liberación de gonadotropinas. La progesterona es producida por el cuerpo lúteo
y por la placenta. El cuerpo lúteo formado en el sitio de la ovulación es activo por
150 a 180 días, posteriormente se forman cuerpos lúteos accesorios en los
ovarios cuando la gonadotropina sérica de la yegua gestante (PMSG) estimula la
formación y luteinización de los folículos terciarios pequeños. Estos se forman
entre 35 y 40 días después de la fertilización y secretan activamente progesterona
entre los 150 y 180 días. Después de los 150 a 180 días post-fertilización, la
progesterona necesaria para el mantenimiento de la gestación en la yegua parece
producirse en la placenta, o al menos en un alto porcentaje de la progesterona
circulante; todos los cuerpos lúteos involucionan en este momento. También una
caída del nivel de progesterona por este tiempo corresponde a un aumento del
nivel de estrógenos. Si la síntesis de progesterona se detiene en cualquier
especie, por lo general la gestación termina a los pocos días.

La relaxina, un polipéptido producido por el cuerpo lúteo y la placenta, es
importante durante la gestación. Durante ésta aumenta su concentración. Los
niveles son mucho más altos durante la última parte de la gestación que al
principio de la misma. Primariamente, la relaxina parece regular el tejido
conjuntivo, lo cual permite a los músculos uterinos estirarse para acomodar al feto
en crecimiento.

Las concentraciones de estrógenos son bajas durante la primera parte de la
gestación pero aumentan a la mitad y última parte de la misma. En yeguas, los
niveles de estrógenos son muy altos durante la segunda mitad de la gestación. La
fuente primaria de estos estrógenos es la placenta. La función principal de los
estrógenos durante la gestación parece ser un sinergismo con la progesterona al
desarrollar y preparar la glándula mamaria para la síntesis de leche después del
parto.

Otras hormonas primarias de la reproducción no parecen jugar un papel
dominante durante la gestación. Se les encuentra en la sangre en bajas
concentraciones. La función normal de la glándula tiroides, paratiroides y otras
glándulas endocrinas que producen hormonas secundarias de la reproducción,
son importantes en el mantenimiento de un óptimo estado metabólico en la madre
lo que permite un desarrollo embrionario y fetal adecuado.


ALIMENTACIÓN DE LA HEMBRA DURANTE LA GESTACIÓN

La condición corporal de la yegua dictará el nivel de alimentación al cual se le
deberá someter. Yeguas gestantes que se encuentran en buena condición
corporal en general: lomo plano o con leve cresta de grasa, que no se note grasa
alrededor de la cola y sobre las costillas. En esta condición corporal en general
pueden ser alimentadas con el mismo nivel nutricional que yeguas no-
gestantes/vacías hasta el octavo mes de gestación. Yeguas que se encuentren
con una condición corporal inferior notándose ya las costillas y espina dorsal y sin
poder palpar nada de grasa, deberán ser suplementadas hasta en un 15%
adicional al nivel de energía para el mantenimiento, al objeto de recuperar la
condición que les falta.

Durante los últimos 3 meses de gestación el requerimiento energético de la yegua
aumenta significativamente a causa del desarrollo fetal. Esto se puede observar
en la siguiente tabla:



Durante los últimos 3 meses de gestación el requerimiento energético de la yegua
aumenta significativamente a causa del desarrollo fetal.

En situaciones donde la yegua no recibe el soporte energético adecuado durante
los últimos 3 meses de gestación, el feto toma prioridad por lo que se observa una
caída en la condición corporal de la yegua a expensas del desarrollo fetal. La
yegua por lo general, tiende a perder su apetito durante los últimos 3 meses de
gestación. La causa se debe básicamente a la presión física que aplica el feto al
tracto gastrointestinal de la yegua. Esta presión inhibe el consumo de la yegua, lo
cual puede resultar fácilmente en una disminución de la condición corporal.
Para conseguir evitar este tipo de problemas se recomienda la suplementación de
raciones con mayor densidad energética durante los últimos 3 meses de
gestación.

Esta práctica puede minimizar el riesgo de cólicos o laminitis que resulten de un
intento de aumentar el consumo de alimento muchas veces a base de
carbohidratos, sobre todo almidones y azúcares que fermentarán en el ciego
provocando endotoxemias.

Así utilizando productos adecuados para yeguas en gestación y lactación también
nos permitirá optimizar la eficiencia reproductora de la yegua.

Es común observar que yeguas a las cuales no se les proporciona una
alimentación equilibrada durante la gestación tengan crías no solamente más
pequeñas, sino que también sufran de algunos de los problemas que se describen
a continuación:

- anormalidades del sistema óseo, principalmente por problemas de niveles
inadecuados de calcio y fósforo
- sistemas inmunológicos débiles
- aumento de la incidencia de enfermedades osteoarticulares
- disminución del desarrollo del cerebro
- disminución de capacidad de supervivencia


En el pasado se creía que se podía tener yeguas en condición corporal alta, es
decir; con crestas de grasa a lo largo del lomo. Relleno de grasa entre las costillas,
grasa blanda que rodea la cabeza de la cola, grasa en el cuello, interior de muslos
y hombros al momento del parto y no se tendrían problemas de distocia o
dificultad de parto. Vale la pena comentar que yeguas gordas son más
susceptibles a padecer problemas de laminitis y producir menos leche que yeguas
en condición corporal normal.




A continuación se puede observar la forma en que los requerimientos nutricionales
DIARIOS de una yegua, peso adulto de 500 Kg., varían conforme avanza su
período de gestación; no solo para energía y proteína sino también para lisina y
algunos minerales, en base a los parámetros del N.R.C.



Destacar el papel del cobre en la alimentación de la yegua, numerosos estudios
apuntan a suplementar a la yegua en cobre para disminuir la incidencia de
procesos de enfermedades del desarrollo en potros.


Diagnóstico de preñez
El diagnóstico de gestación en la yegua, por el método de palpación rectal, necesi-
ta por parte del técnico un perfecto conocimiento de la situación y las
características de los órganos genitales de la yegua vacía. Este examen debe
practicarse con prudencia y tomando las precauciones necesarias, es aconsejable
que sólo lo efectúe un Médico Veterinario familiarizado con este tipo de actividad.

En las yeguas primíparas como en aquellas cuya fecundación ha tenido lugar un
cierto tiempo después del parto, el diagnostico de gestación es posible desde el
trigésimo día; es más difícil en este momento, en las yeguas fecundadas en el celo
de potro, recién parida pues, en estas últimas, el útero no ha sufrido la involución
complete antes de instaurarse una nueva gestación.

El diagnóstico está menor sujeto a dificultades cuando la exploración rectal se
practica entre el día 45 a 60 de gestación.

Al trigésimo día, el cuerno gestante, Generalmente el derecho, está turgente,
rígido y contrasta con la flacidez del cuerpo del útero y del cuerno no gestante. El
embrión en este momento del grosor de un huevo de gallina, puede ser percibido
adelante de la bifurcación de los cuernos.

La mucosa vaginal está pálida y blanquecina; sus paredes están cubiertas de un
moco espeso, gelatinoso que hace difícil la introducción de un especulo. El cuello,
generalmente prominente, está cerrado por espeso tapón gelatinoso.

De los cuarenta y cinco a cincuenta días, la ampolla fetal, del grosor de un huevo
de ganso, ocupa la parte anterior del cuerno; la dilatación presenta una forma más
bien oval que esférica puede medir alrededor de 6 CMS.

A los sesenta días, la dilatación cornual es de unos 8 CMS, da la impresión de una
naranja grande, relativamente blanda al tacto, a este nivel es posible reconocer,
por presión entre los dedos, la presencia de las membranas fetales.

Al tercer mes, la distensión llega a el cuerpo del útero y al cuerno uterino gestante;
alcanza 12.5 cm. de diámetro y se sitúa transversalmente frente a la circunferencia
pelviana. Es importante en esta época no confundir el útero gestante con la vejiga
moderadamente llena.

Entre tres meses y medio y cinco meses, es fácil palpar al feto situado por delante
de la circunferencia pelviana. A partir del día 200 es posible palpar uno u otro
órgano del feto (cabeza, miembros) salvo si el útero se hunde demasiado
profundamente en la cavidad abdominal. Pero en este caso los elementos
siguientes pueden considerarse en favor de una gestación: el hecho de no
encontrar un útero en reposo, la dificultad de prehensión de los órganos, y su
cambio de posición.

Como se ha señalado antes, y a pesar de que se haya admitido que el Ovario
izquierdo funciona más que el derecho, la gestación tiene lugar corrientemente en
el cuerno derecho. El desarrollo mamario se manifiesta en el curso de las tres
últimas semanas de la gestación; es más marcado en las multíparas que en las
primíparas. En los días que preceden al parto, la secreción mamaria es evidente a
nivel de los pezones, y forma un coágulo denominado corrientemente “candelas”.
Estas están generalmente consideradas como un elemento indicativo de la
proximidad del porto.



Hay otros métodos de diagnóstico de preñez en yeguas, como son:

a. Determinaciones hormonales:
-Determinación del nivel progesterónico.
-Determinación del nivel de PMSG
-Determinación de sulfato de estrona en orina.




b. Pruebas Biológicas:
Reacción de Ascheim-Zondeck
Test de Friedman
Test de Galli-Mainini
Método inmunológico (Inhibición de la Hemoaglutinación para PMSG).
Método lnmunoquímico (inmune-electroforesis para PMSG).
Pruebas de Apreciación de Estrógenos.
Método Biológico (Test de Allen-Doisy)
Método Químico (Reacción de Cuboni)



Su empleo tiene diferentes porcentajes de confiabilidad, su costo muchas veces
es elevado y los laboratorios que los efectúan no siempre están en todas las
zonas geográficas del país, sino que se agrupan alrededor de las grandes
ciudades, haciendo poco común su empleo en forma rutinaria.
LECCION 24. EL PARTO.



http://riie.com.ar/?a=47975


El parto requiere de vigilancia permanente, pero desde una distancia prudente que
no moleste a la yegua y de las mejores condiciones medioambientales posibles
como lo son: la comodidad para la futura madre, asepsia, espacio suficiente y
buen suministro de agua limpia y fresca.

Los primeros síntomas del parto son: dilatación vulvar, presencia de leche en la
ubre, conformación del anca que nos demuestra una relajación pélvica y dilatación
del canal del parto, esto se presenta pocas horas antes del parto.



http://riie.com.ar/?a=47975


Por lo general las yeguas no presentan ningún tipo de problema en el parto como
sucede en otras especies domesticas, cuando se presentan suelen ser por mala
presentación del potro.
El parto se desarrolla en varias fases que comprenden principalmente:

• Desencadenamiento de las contracciones uterinas y apertura del cuello.
• Expulsión del producto.
• Expulsión de las envolturas fetales
• Modificaciones puerperales.

Contracciones Uterinas y Dilatación del Cuello.
El parto parece estar determinado por la evolución cíclica de la placenta que
origina un descenso hormonal armoniosamente equilibrado entre las hormonas
fetales (corticoides fetales) y las hormonas de origen materno.

Cualquiera que sea el mecanismo exacto del desencadenamiento del parto, éste
se exterioriza por contracciones rítmicas fuertes y crecientes de la musculatura
uterina. Estas contracciones aparecen solamente unas horas antes del parto; su
duración es de 50 a 60 segundos con intervalo de 3 a 4 minutos haciéndose más
continuas y prolongadas. En las grandes especies las contracciones comienzan en
lo alto del cuerno uterino, recorren éstos en toda su longitud y se agotan a nivel
del cuello.

Es en curso de este período cuando el feto modifica su posición uterina para tomar
“la posición de salida”

El útero y su producto, que hasta entonces reposan sobre la pared abdominal,
deben sufrir un movimiento de desplazamiento hacia las regiones superiores de
forma tal que el útero, el cuello y la vagina constituyen un canal rectilíneo fácil de
franquear por el feto; a esta “rectificación” del canal del parto ayudan las
contracciones de los ligamentos anchos y las contracciones combinadas del útero,
del abdomen y del diafragma (prensa abdominal).

El potro sufre una rotación progresiva que lo acomoda para un parto rápido y
exitoso.
La duración de la preparación del parto es mayor en las primíparas que en las
primíparas.
A las contracciones uterinas se asocian pronto contracciones abdominales, que se
repiten cada 2 a 3 minutos, intensificándose a medida que la cabeza y los
miembros se introducen a través de la cerviz.

Expulsión del Feto
Bajo el efecto de las contracciones uterinas y musculares el feto se introduce en el
canal cervical, la bolsa formada por el corión hace tas veces de cuña ejerciendo
una presión continua por toda la superficie. La tensión interna es tal que la bolsa
alantoidea se rompe, dando así salida a las primeras aguas.

Este último fenómeno va a menudo seguido de un período de tranquilidad. A
consecuencia de nuevos dolores (a causa de las contracciones) el amnios se
introduce a su vez acompañado del feto cuya cabeza y cascos anteriores
franquean el cuello uterino completamente dilatado, la progresión en el canal
pélvico se encuentra facilitada por las modificaciones sufridas por esté órgano;
reblandecimiento de los tejidos blandos, distensión aumentada de las
articulaciones sacroilíacas, y alargamiento de los diámetros sacro pubiano y
sacroilíaco; todos estos procesos estimulados por la acción de la relaxina.

Al cabo de algunos Instantes la bolsa amniótica que aparece entre los labios
vulvares, acaba por romperse bajo el efecto de los esfuerzos expulsivos. Puede
ocurrir que el amnios no se desgarre y que el feto sea expulsado recubierto por el
amnios; pudiendo ser la consecuencia de a asfixia del producto; esto es un hecho
más o menos frecuente en la yegua, por lo cual el parto de éstas debe ser
celosamente vigilado.

Desde que el feto ha franqueado el cuello y se ha introducido en el estrecho
pelviano, las contracciones uterinas y las contracciones abdominales se hacen
más intensas y se suceden a un mayor ritmo.

La cabeza llega a nivel de la abertura vulvar que se dilata progresivamente,
después la franquea mientras el tronco del feto, introducido en el estrecho
pelviano, se adapta a las dimensiones de este conducto.



http://riie.com.ar/?a=47975

Esta fase es muy penosa y dolorosa, exige de la madre esfuerzos expulsivos
intensos. Habiendo franqueado el pecho el estrecho pelviano, algunas
contracciones llevan a la salida total del producto y de una oleada de líquido que
representa el resto de los líquidos amniótico y alantoideo. Durante esta etapa se
serrara la válvula sanguínea natural, que evita que salga sangre del cuerpo del
potro, pero que a la vez le permite extraer la mayor cantidad posible de la
placenta.



http://caballospastoreo.galeon.com/productos766741.html

La yegua a veces permanece acostada una vez a expulsado al potro, por un
periodo de hasta media hora, recuperando fuerzas. Es probable que relinche y
resople para estimular al neonato a pararse, en poco tiempo ella se levantara y
comenzara a lamerlo para estimular la circulación periférica y el ritmo respiratorio.




http://caballospastoreo.galeon.com/productos766741.html
En esta etapa aun quedan colgando membranas fetales sobresaliendo a travez del
canal del parto, estas serán expulsadas tras nuevas contracciones. Este proceso
Dura entre una y dos horas, no es aconsejable tirar de ellas, ya que podrían
romperse, quedándose retenida parte de los anexos fetales, provocándose
complicaciones mayores. La yegua debe eliminarlas tras las primeras 8 horas
posparto.



http://caballospastoreo.galeon.com/productos766741.html

El potro debe intentar levantarse después de aproximadamente media hora de
nacido, cayendo al suelo en repetidas ocasiones hasta que lo consigue. S i no
consigue permanecer de pie el tiempo suficiente para que inicie el proceso de
lactancia, tras media hora de intentos se le debe ayudar un poco guiándolo hacia
la ubre de la yagua ya que es de vital importancia que el potro ingiera el calostro
materno en las primeras dos horas de vida que es cuando su organismo presenta
la mayor absorción de inmunoglobulinas.


Duración del Parto.

http://caballospastoreo.galeon.com/productos766741.html

Es generalmente corto en la yegua; raramente más de 5 a 15 minutos. La yegua
se mantiene habitualmente acostada algunos minutos después del parto y el
cordón umbilical se rompe en el momento de pararse. Una ruptura demasiado
precoz del cordón umbilical puede ser perjudicial a la vida del feto que no ha
podido almacenar toda la sangre placentaria antes de que se instauren los
mecanismos reguladores de su vida autónoma.

La yegua se sitúa normalmente en decúbito lateral total, con los miembros
extendidos, y los partos se producen con mayor frecuencia en periodo nocturno.
Expulsión de las Membranas.
El hipoman es una masa que se mantiene en la boca del potro hasta el momento
del nacimiento. Su función, al parecer es evitar que entren líquidos amnióticos
durante la gestación.

La separación placentaria y su expulsión no están claramente establecidas. Es
verosímil que las modificaciones del equilibrio hormonal que ocurren en el
momento del parto descenso de los niveles de progesterona, aumento-de los
estrógenos circulantes, secreción de oxitócica, etc.), no sean totalmente extrañas
a estos fenómenos, pero ni la importancia ni el mecanismo de su intervención han
sido precisados. Una madurez determinada de la placenta, ligada al equilibrio
hormonal, debe ciertamente alcanzarse para que tenga lugar el desprendimiento y
expulsión placentaria.

En los últimos días de la gestación, el epitelio placentario se degenera, las
vellosidades se reducen y los vasos tienen tendencia estrecharse. Las
contracciones uterinas tienen ciertamente un papel importante: muy activas en el
curso de la expulsión se mantienen después de ésta, produciéndose en olas
peristálticas que comienzan en la parte apical del cuerno en dirección a la cerviz.

Estas contracciones tienen por efecto provocar una inversión del corión, la
constricción vascular, la isquemia y en consecuencia la disociación de las
vellosidades cotiledonarias. Como ya mencionamos, normalmente, en la yegua,
las secundinas son expulsadas en un término de 30 minutos a 3 horas.

La retención de las secundinas más allá de los límites de tiempo indicados debe
considerarse como anormal y necesita intervención para prevenir diversas
complicaciones como la infosura puerperal.

PUERPERIO

Terminado el parto, los órganos genitales vuelven progresivamente a su estado
normal: el útero entra en involución, el endometrio se regenera y finalmente las
manifestaciones estrales reaparecen. Estas modificaciones van precedidas del
flujo loquial.

Los líquidos son secreciones de importancia y color variable, formadas por una
mezcla de exudado y de restos endometriales y carunculares, siendo eliminados
en los días que siguen al parto. Son ligeros, mucosos y de color amarillento, en la
yegua duran 4 a 5 días. El olor nauseabundo de los loquios, su aspecto granuloso
y hemorrágico, su abundancia y persistencia traducen una metritis en evolución o
declarada.

La involución uterina está favorecida por el órgano en sí, por la reducción de la
vascularización, por las modificaciones hormonales y neuronales que acompañan
al parto, por la descomposición enzimática de los polisacáridos miometriales, pero
sobre todo por la persistencia durante algún tiempo de las contracciones
miometriales a pesar de que estas están reducidas en frecuencia e intensidad.

El conjunto de estos factores condiciona la fusión de la capa serosa intersticial, y
la reducción de volumen de las fibras musculares hipertrofiadas en el curso de la
gestación y la nueva transformación en fibras conjuntivas de las fibras musculares
recién formadas. Mientras que el Otero se reduce de volumen, el cuello uterino se
consolida, se vuelve netamente perceptible y se cierra progresivamente de la parte
craneal hacia la parte distal.

La involución es completa en la yegua después de 12 días, época en la cual
puede a veces ser de nuevo fecundada, pero no es completa histológicamente
sino después de tres semanas. Los estros (calores>reaparecen entre 6 a 15 días
post-parto en las yeguas sometidas a buen manejo y que gocen de aceptable
sanidad.


Cuidados a dar a la madre y al neonato

Las yeguas que acaban de parir serán mantenidas en un local con buena
temperatura y con buena cama. La yegua en transpiración intensa será
considerablemente friccionada y se le administrará alimento húmedo, bastante
ligero. Si los esfuerzos expulsivos persisten, interesa efectuar una exploración
uterina para asegurarse que no hay un segundo feto, ni anomalía alguna. Una
exploración así debe por otra parte hacerse normalmente después de cada parto.
Los esfuerzos expulsivos que persistan serán calmados, ya por una anestesia
epidural, o por tranquilizantes o analgésicos suministrados por personal
competente.



Recién Nacido

La vida y el desarrollo del feto están asegurados por la circulación de la sangre
oxigenada de origen placentario ya que la circulación pulmonar es
extremadamente reducida, pues este órgano está completamente colapsado.

Al nacimiento, la circulación umbilical se detiene. El canal arterial y el agujero de
Botal se cierran funcionalmente primero, y anatómicamente más tarde, y la
circulación toma rápidamente en el recién nacido los caracteres que conservará en
el adulto.

El intestino del potro se encuentra lleno de excrementos que se acumulan durante
la vida fetal. Si no se vacía el intestino dentro de las 4-12 horas siguientes al
nacimiento, se puede producir un cólico.

Por otra parte, el recién nacido nace normalmente anóxico y la respiración se
vuelve en él una necesidad absoluta desde que los lazos vasculares que le unían
a la madre se han roto. La primera inspiración está gobernada por el centro
respiratorio, excitado por las modificaciones sanguíneas consecutivas a la anoxia
fisiológica que le acompaña en el nacimiento. Es el acumulo de gas carbónico en
la sangre lo que induce la respiración en el recién nacido de la misma forma que
en el adulto. Los cambios gaseosos se hacen rápidos y activos, a pesar de que la
ampliación pulmonar no sea completa de golpe; algunos minutos después del
nacimiento, el contenido en oxígeno se hace normal.


http://caballospastoreo.galeon.com/productos766741.html

Si el parto se ha detenido o demorado, si la placenta se desprendió antes de la
expulsión del feto, o si el cordón umbilical ha estado demasiado tiempo
comprimido, el feto, privado de sangre arterial y de oxígeno, acaba por asfixiarse.
Así cuando el feto nace en estado de muerte aparente, es indispensable detener
rápidamente vías aéreas libres y practicar la respiración artificial hasta el momento
en los movimientos respiratorios espontáneos se hayan reanudado y adquirido un
ritmo normal. Se puede ayudar a ello, masajeando la región precordial, ejerciendo
tracciones rítmicas de la lengua, insuflando en los ollares humo de tabaco o
tocando la mucosa con ayuda de una solución de vinagre.

Igualmente, se recomienda suspender el recién nacido por las extremidades
posteriores durante algunos segundos; la sangre venosa fluye al cerebro y el gas
carbónico tacita así el centro respiratorio.

El cordón umbilical es el mayor sitio para invasión de bacterias en el neonato, por
ello debe ser desinfectado cuidadosamente con una solución de yodo al 2 %,
evitando así la septicemia del recién nacido.
Tanto madre como hijo se deben dejar solos lo mas pronto posible, para que se
establezca la relación madre-hijo que es de suma importancia para el resto de la
vida del neonato.
Entre los días 30 y 45 antes del parto la yegua debe haberse vacunado contra el
tétano si esto no fue así, se debe vacunar al potro con la antitoxina del tétano de
1.500 unidades.
El calostro es la primera leche producida por la madre para su cría, esta es rica
en energía, proteína, vitamina A, minerales e inmunoglobulinas, al igual que tiene
una función laxante que ayuda a eliminar al meconio. El calostro es secretado en
las primeras 24 – 48 horas después del parto y debe ser consumido `por el potro
en las primeras dos o tres horas después del nacimiento.


Cuidados a dar al cordón umbilical.

El cordón no roto será seccionado bajo tensión de forma que permita el
enrollamiento y la retracción de la arteria. La herida umbilical constituye en todos
los jóvenes un punto vulnerable por donde se establece la infección, debe ser
convenientemente desinfectado con tintura de yodo o por otro antiséptico no
irritante y eventualmente recubierto por un polvo astringente y mosquicida.
Generalmente, el muñón se desprende después de dos o tres días, dejando una
herida umbilical perfectamente cicatrizada. En el potro, es útil administrar una
dosis profiláctica de suero antitetánico, especialmente en climas cálidos y
húmedos.

LACTACIÓN.

El recién nacido será colocado cerca de la madre quien lamiéndolo, le quitará las
mucosidades de que está cubierto; pudiendo igualmente eliminárselas con
fricciones secas. Será acercado a la madre durante la fase de somnolencia de
ésta, quien le acepta generalmente bien al despertar; este será, sin embargo,
vigilado en caso de que no haya sido obtenido el efecto buscado. Uno de los
primeros cuidados es igualmente asegurar la toma del calostro; que suministrará
los anticuerpos que no pueden traspasar la barrera placentaria, proporcionando un
adecuado nivel de defensas al recién nacido, lo que garantizará un índice mayor
de sobre vivencia del nuevo ser.


http://caballospastoreo.galeon.com/productos766741.html

La fase de lactancia es la fase de más alto requerimiento nutricional
(especialmente energético) en la vida productiva de la yegua, excluyendo los
períodos de crecimiento y de trabajo intenso. Es por muchos también la fase de
producción más descuidada. Después del parto, los requerimientos nutricionales
de la yegua aumentan hasta en un 75% por arriba de los requerimientos de
mantenimiento. Este aumento es resultado de las necesidades de producción
láctea y de la ineficiencia intrínseca del proceso de conversión de nutrientes
digestible a leche. Los requerimientos de energía, proteína, minerales y vitaminas
son satisfechos cuando se tiene a las yeguas y los potrillos en pastos de muy alta
calidad y se les suplementa con raciones de alta densidad energética.

La suplementación de la yegua debe también estar enfocada a mejorar la calidad
de la leche que ésta produce, aspecto que se puede hacer a través del uso de
ingredientes y nutrientes específicos. Con esto se puede lograr que el consumo
energético y nutricional del potro sea mayor y por lo tanto su desarrollo mejore.
El pico de lactación ocurre en las fases iniciales y posteriormente disminuye la
producción de leche gradualmente hasta llegar al destete. Durante esta fase es
que la condición corporal de la yegua juega un papel muy importante. Yeguas que
se encuentran en condición corporal correcta, han almacenado reservas de grasa
en el cuerpo. Esta grasa puede ser utilizada por la yegua para ayudarle a
complementar los requisitos energéticos que ella tiene para producir leche. Estos
requisitos son bastante elevados, por lo que sí cuenta con buenas reservas
corporales, la demanda de suplementación alimenticia puede disminuir y las
pérdidas de peso y condición corporal también son menos drásticas.

Es importante que no se le permita a la yegua que pierda mucha condición
corporal, pues esto le afectará su rendimiento reproductivo. Yeguas que llegan al
parto con baja condición corporal o que pierden mucho peso durante los meses
iniciales de la lactancia ven su comportamiento reproductivo seriamente afectado.

Yeguas que son mal alimentadas o con raciones mal equilibradas suelen
presentar síntomas típicos a los que muestras animales bajo condiciones de
limitación de alimento – hambre. Los síntomas pueden ser: mareos, espasmos
musculares, diarreas, retención abdominal de líquidos y posiblemente muerte.

Otro síntoma que debe ser controlado en las yeguas es la defecación, para
identificar oportunamente a animales con estreñimiento. Por lo general, el ejercicio
es el mejor preventivo, aunque en casos específicos ingredientes de tipo laxante
pueden ser utilizados como es el caso del aceite de linaza.

Hay que tener en cuenta que la producción de leche va a ser del 2,5-3% del peso
vivo en el período de máxima producción, la leche de la yegua es bastante pobre
tiene menos materia seca proteína y grasa que la de vaca, aunque
paradójicamente contiene ácidos grasos insaturados omega 3, que se les
relaciona con el desarrollo del cerebro del potro (La leche de la yegua es utilizada
en países como Rusia para la cosmética humana).

Es de resaltar que teniendo en cuenta que no hay transferencia de anticuerpos de
la placenta al feto durante la preñez, el potro nace sin ninguna protección contra
las enfermedades, por lo cual es necesario que el potro mame el calostro lo más
rápido posible, para protegerse de ellas, pues su sistema inmunológico comienza
a funcionar a los 3 meses aproximadamente, esto es conocido como transferencia
pasiva.

Tomada en Pesebrera El Puente - Neiva

El consumo de leche para un potro será de un 25 % de su peso corporal. Por tal
motivo es que los potros maman a intervalos de tiempo muy corto,
aproximadamente veinte minutos entre una y otra, tomando poca cantidad cada
vez.
Los requerimientos nutricionales para yeguas lactantes se contemplan en la
siguiente tabla Estos estándares son los niveles que se consideran promedio para
una yegua con peso adulto de 500 kg. Existe cierta discusión en relación al nivel
exacto de proteína, y muchos asesores nutricionales utilizan estos valores como
base, formulando raciones con un 10 a otras con un 16% más de proteína y
algunos minerales. El objetivo de este aumento tiene que ver con el nivel de
producción de leche, el pico de lactancia, la concentración de nutrientes en la
leche, la reposición de tejido post-parto y el futuro comportamiento reproductivo.

Tabla 17. Requerimientos Nutricionales Para Hembras Lactantes
Fase
Productiva
Energía
Digestible
(Mcal)
Proteína
Bruta
(Gr)
(3)
Lisina
(Gr)
Calcio
(Gr)
Fósforo
(Gr)
Magnesio
(Gr)
Potasio
(Gr)
Vit. A
(UI x
10,000)

Lactación
temprana o
inicial (1)
28.3 1.427 50 56 36 10.9 46 30
Lactación
tardía o final
(2)
24.3 1.048 37 36 22 8.6 33 30
Mantenimiento 16.4 656 23 20 14 7.5 25 15

(1): Se considera “Lactación temprana o inicial”al periodo del nacimiento a los 3 meses post-parto
(2): Se considera “Lactación tardía o final”al periodo de los 3 meses post-parto al destete
(3): El requerimiento de proteína en % de la dieta recomendado por la N.R.C es de 10 a 12% y el que
recomiendan otros investigadores varía entre los 12 y 16%


A partir del 3er mes de lactación la cantidad y calidad de leche secretada es cada
vez menor y de inferior calidad, mientras que las necesidades del potro lactante
van aumentando, así por ejemplo el balance entre los nutrientes secretados por la
leche y los requeridos por el potro es negativo.

SERVICIO DESPUÉS DEL PARTO

La yegua presenta un celo entre los 8 – 12 días después del parto.

Muchos ganaderos prefieren cubrir a la yegua en este celo porque es un celo
siempre visible, en ocasiones luego no muestran síntomas de celo durante la
crianza del potro (la lactancia y la presencia del potro pueden alterar el ciclo
estral). Si no hay lesiones tras el parto se pueden cubrir en el primer celo, pero es
aconsejable no realizarlo por las siguientes razones:

Bajo índice de fertilidad.
Bajo porcentaje de abortos.
Alto porcentaje de reabsorciones fetales.
Alto porcentaje de crías débiles.
Mayor numero de placentas retenidas.
Las crías son más susceptibles a enfermedades.

Aun así si se ha decidido realizar el servicio se debe tener en cuenta que este no
debe realizarse si hubo retención placentaria de más de tres horas, desgarraduras
que no han curado plenamente, traumatismos en el tracto genital, presencia de
exudados u orina en la vagina, mucosa descolorida o congestionada y falta de
tono en útero o vagina. En estos casos hay que esperar a los siguientes celos, una
vez que hayan desaparecido estas lesiones, de los contrario se pueden provocar
infecciones en el útero.

En los días que siguen a la cubrición la yegua debe estar tranquila, evitando
cualquier esfuerzo o excitación. Hay que facilitar la nidación del embrión en el
útero.

Un suplemento, será necesario si existe alguna carencia en especifico esto
depende del tipo de alimentación, ¿que come y en que cantidad? o si está en una
mala condición corporal, una yegua en reproducción debería estar en una
condición corporal de 5 a 6.

La segunda alternativa, es realizar la monta en el segundo celo que presenta la
yegua que generalmente se presenta en le día 28 después del parto, pero debe
recordarse que el índice fecundidad es bajo, en contraste con el servicio pos
destete.
LECCION 25. SELECCIÓN Y MEJORAMIENTO



Tomada en Pesebrera El Puente - Neiva

La cría satisfactoria de los animales depende ante todo de la adecuada elección
de lo progenitores para cada generación sucesiva.
Es lógico que para el logro de mejores individuos que debamos conocer algunos
principios básicos acerca de la división celular, los cromosomas y los genes para
poder entender el mecanismo de la herencia para posteriormente comprender los
conceptos sobre selección y mejoramiento.

Todos los que crían animales por gusto (caballistas criadores de animales de paso
fino, salto o polo), como los que lo hacen por negocio, procuran moldear la forma
externa de sus animales, con arreglo a un plan preconcebido, y completar esa
forma exterior con una combinación de caracteres que dé a los animales un
elevado valor comercial o estético. Así, los criadores de caballos desean obtener
velocidad, temperamento, energía y resistencia, además que el animal sea
simétrico, hermoso y con alto grado de afecto por su amo.

Pueden reunirse estas diversas combinaciones en un mismo animal la respuesta
es sin duda afirmativa, puesto que mediante rigurosos procesos de selección y
mejoramiento podemos obtenerlos. Lograremos criar nuestros animales de tal
modo que no sólo posean las deseadas combinaciones de caracteres, sino que
puedan transmitirlas a sus descendientes. Seguro que si, ya que mediante los
conocimientos modernos sobre reproducción y genética estos campos del
conocimiento día a día son más asequibles a todas las personas vinculadas con la
actividad pecuaria, quienes buscan de adecuada manera mejorar a la especie
equina.

CONCEPTOS GENERALES DE BIOLOGÍA Y GENÉTICA.


http://www.phpwebquest.org/wq25/webquest/soporte_tablon_w.php?id_actividad=18773&id_pagina=1

La célula es el componente básico de toda estructura viva, desde hace más de
300 años Hooke llamó célula a las cavidades regulares que conformaban el
corcho, desde entonces, es mucho lo que se ha descubierto acerca de esta
estructura y sus componentes; pero para nuestro s objetivos nos limitaremos a
recordar algunos conceptos básicos que nos permitan profundizar en nuestro
tema.

Toda célula se compone de un núcleo, de citoplasma en el cual se encuentran los
organelos subcelulares (mitocondrias, retículo endoplásmico, Cuerpo de Golgi),
todo esto rodeado por la membrana celular.

Los conceptos sobre función y estructura celular corresponden .a la biología. La
especialización celular y el agrupamiento de las mismas originan los tejidos
corporales los cuales a su vez se agrupan para dar lugar a los órganos, quienes
serán los encargados de efectuar las funciones fisiológicas y cuya integración
permite al individuo sobrevivir en el medio ambiente

De la célula, la porción más importante la constituye el núcleo, en él se encuentran
los cromosomas, cuyo número es específico para las especies, en el caso de los
equinos éste es de 64 para el caballo, 62 para el asno y 63 en los mulares.

El Número de cromosomas que posea una célula nos permite clasificarlas en dos
grandes grupos:

Células somáticas o diploides: cuyo número cromosómico es el del total para la
especie, constituye el mayor porcentaje de las células del individuo; la división de
éstas se desarrolla por el proceso conocido como mitosis; al final del cual se
originarán dos células idénticas a la primaria.

Células sexuales o Haploide: el número de cromosomas en éstas es la mitad del
de las somáticas. Se conocen a estas células igualmente como gametos
femeninos o masculinos (óvulos o espermatozoides); la división en ellas se
denomina Meiosis. Mediante el aporte parcial de cromosomas (la mitad por cada
sexo) se posibilita que al producirse la fecundación (unión del gameto femenino
con el masculino) se origine un individuo nuevo, con el número total de
cromosomas (número diploide), típico para cada especie.

Cromosomas
Son filamentos compuestos por ácido Desoxirribonucleico (DNA) y proteína; estas
estructuras lineales contienen el material genético compuesto por genes. Los
cromosomas están formados por cromatina, la cual toma un color más intenso en
la división celular, en ella, los bastones (cromosomas) se distribuyen en números
exactamente iguales en ambas células hijas; cada individuo según la especie a
que pertenece contiene en sus células un número definido y característico de
cromosomas, los individuos que exhiben reproducción sexual poseen gametos o
células sexuales las cuales contendrán un número de cromosomas que
corresponde exactamente a la mitad de los que tienen las células somáticas o
corporales.

Genes
Son los factores responsables de los caracteres hereditarios, cada uno de ellos
difiere de los restantes, cada uno posee la misión de controlar uno o más
caracteres hereditarios. Cada gen es una molécula de DNA, en la cual se halla
almacenada la información biológica en forma de un código de tripletas de
nucleótidos constituyendo una doble hélice, para conformar la estructura típica del
DNA; la información de cada gen es “leída” y, en consecuencia, se sintetiza una
proteína específica, esta-constituye la base química del carácter externo o interno
del individuo.

Un animal con dos genes exactamente iguales, a manera de ejemplo dos genes
NN que darán el color negro o dos nn que darán el color pardo, se dice que son
homocigóticos para el carácter del color, si en la célula sexual queda un gen N al
producirse la fecundación y la unión con el alelo diferente, es decir, el n
correspondiente al otro gameto sexual, el producto será Nn, éste se considera
heterocigótico; pero si el color predominante es el negro (NN) este se considerará
dominante frente al otro gen (n) el cual será recesivo para dicha característica.

Los genes dominantes siempre se expresan (aparecen) cada vez que estén
presentes, si el gene es recesivo solo aparecerá cuando se encuentre con un
similar (nn), es por esto que algunas características no aparecen generación tras
generación, sino lo hacen esporádicamente. Los genes dominantes usualmente se
expresan con una letra mayúscula y los recesivos con la misma letra pero en
minúscula. Actualmente se considera como sinónimo de gen el término alelo.

División celular.

Las células somáticas se dividen por mitosis, en ellas el número de cromosomas
corresponde al total para la especie, las células hijas contendrán el mismo número
y por tanto serán idénticas a la que las originó.

Las células sexuales se dividen inicialmente por mitosis y posteriormente por
meiosis, al final las células hijas contendrán la mitad de los cromosomas de la
especie, así el óvulo o el espermatozoide contendrán un número de cromosomas
que permite que al producirse el apareamiento el número básico de cromosomas
volverá a su número básico inicial.

En las células sexuales se da una característica fundamental en la transmisión del
sexo, el macho porta en sus espermatozoides los cromosomas conocidos como
XY o sexuales, el óvulo por su parte porta los llamados XX. EI producto (hijo,
podrá ser XY (macho) o XX (hembra), como producto de la unión de un X o un Y
del macho y un X de la hembra, con esto queda claro que quien define el sexo del
hijo es el macho.


Fenotipo y Genotipo.

Fenotipo: La configuración externa de un individuo con respecto a cierto rasgo
heredado y su interacción con el medio ambiente que lo rodea.

Genotipo: La constitución genética (interna) de un organismo generalmente
expresado con símbolos, se llama su GENOTIPO.


http://es.wikipedia.org

En síntesis, el fenotipo es lo visible: el color, la altura (alzada); el genotipo es la
conformación genética (NN, Nn, nn) que da tal o cual característica, acá debemos
tener en cuenta lo aprendido acerca de DOMINANCIA y RECESIVIDAD, ya que
un animal puede ser fenotípicamente blanco, pero genotípicamente no; así en su
descendencia puede producir un hijo negro aún cuando se halla cruzado con otro
individuo blanco, en éste caso ambos eran blancos recesivos, es decir,
genotípicamente eran recesivos y al unirse produjeron un animal puro recesivo.

Blanco puro dominante BB
Blanco puro recesivo Bb
Negro puro recesivo bb

PADRE MADRE
XY XX
Bb Bb


HIJ OS
B b
B BB Bb
b Bb bb

Estas diferentes posibles combinaciones que dan como resultado distintas
características en los descendientes, se rigen por las leyes de la probabilidad; esto
indica que no siempre es exacto que un hijo tenga ciertas características de uno
de sus padres, sino que esto puede variar y es por esto que los hijos no exhiben
siempre todas las características de sus padres, a veces presenta las de
ancestros más lejanos (abuelos, etc.).

HERENCIA Y MECANISMOS RELACIONADOS

Alosomas
Así se denomina al cromosoma relacionado con la determinación del sexo, más
conocidos como X y Y; las hembras tienen dos alosomas XX; el macho XY.


Autosomas
O cromosomas somáticas, son todo los restantes cromosomas no relacionados
con la determinación del sexo.


Genética
Se define como la disciplina que estudia los fenómenos de la herencia y las
causas de las variaciones entre organismos, a través de ella podemos dilucidar
porqué un caballo PSI (de carreras) difiere de un percherón o de un caballo de
vaquería, aún cuando todos son equinos; así al final podremos aclarar porque no
hay dos organismos idénticos aún dentro de la misma especie, raza o tipo.


http://www.icampus.ucl.ac.be

Herencia.
Por herencia entendemos la semejanza, derivada de los antecesores, entre
organismos emparentados de distinta generación. Se dice que los cromosomas
son “el vehículo de la herencia”, puesto que constituyen el único lazo que une a
dos generaciones sucesivas. Las últimas unidades indivisibles de la herencia son
los genes.

Es usual asociar todo lo referente a la herencia, con los trabajos efectuados por el
monje austriaco Gregorio Mendel, a él se considera el padre de la genética, ya
que fue quien sentó las bases científicas de los mecanismos involucrados en la
herencia y elaboró una teoría sólida acerca de la misma, dicha teoría se conoce
como Herencia Mendeliana, en ésta básicamente se delinea los patrones
probables de cruces monohíbridos, dihíbridos y trihíbridos para características
gobernadas por cromosomas específicos; pero no es útil para estudios de
genética más avanzados, como lo es la genética de poblaciones o cuantitativa.


Al elos Múltiples
Definir este concepto es importante, ya que a través de este mecanismo genético,
se da la coloración del pelaje entre otras muchas características. Por alelos
múltiples se conoce al grupo de genes que determinarán una característica
fenotípica; ya no será el par dé genes solos, sino que serán un grupo de pares de
genes sobre quienes recaerá la responsabilidad de dicha característica, entre ellos
igualmente habrá dominancia y recesividad.


Herencia ligada al sexo
Cuando vimos como se lograba la determinación del sexo genético (XX, hembra y
XY, Macho) apreciamos que quien define el sexo finalmente es el cromosoma Y,
aportado por el macho. Existen algunas características (color de los ojos en
algunas especies) ligadas a dicho cromosoma Y, y por tanto solo se expresarán
en los machos, ya que las hembras no portan en su material genético dicho
cromosoma. Por otra parte, en la mayoría de casos de características ligadas al
sexo, estas solo se harán evidentes si se transmiten a través de los cromosomas
XX correspondientes a la hembra.


Variación
Por ser los genes y sus combinaciones relativamente estables, se han mantenido
a través del tiempo los progresos conseguidos por la evolución. Sin embargo, es
necesario que actúe la variación para que las especies progresen y se adapten a
los cambios medio ambiental es.

Se ha dicho con razón, que: “La variación es a la vez la esperanza y la
desesperación del mejorador”; la esperanza, porque gracias a ella (la variación),
pueden mejorar las razas; la desesperación, porque los animales después de
mejorados notablemente, pueden variar hacia la mediocridad perdiendo
características útiles ya logradas.

La variación es uno de los medios de que disponen los caballistas, éstos están
siempre en busca de variaciones convenientes. Las variaciones puedan ser:
• Germinales: recombinaciones, mutaciones genéticas y cromosómicas.
• Somáticas: modificaciones corporales o de comportamiento (docilidad,
temperamento).

Sabemos que las especies o las razas varían en alzada, tipo, ritmo de crecimiento,
eficiencia en la conversión alimenticia, velocidad, resistencia, docilidad, fertilidad,
longevidad, etc. Estas variaciones son las que se deben tener en cuenta al instituir
programas de selección y mejoramiento, saber cuáles debemos mantener o
cuáles podemos ir desechando.


Ascendencia y descendencia

Ascendencia: Igualmente conocida como pedigree; es el conocimiento de los
ancestros (padres, abuelos), de sus características tanto fenotípicas como
genotípicas. El conocimiento de ésta, favorece en grado sumo la futura selección.

Descendencia: o progenie,- es el conocimiento de sus hijos y nietos. Algunas
van pareciendo más y más a los puros, se comportan como ellos y llegan a ser
casi indistinguibles.
• El medio
• La herencia

Es posible que cada padre careciese de algunos genes necesarios para esa
calidad superior, pero que al juntarse la suma de ellos (genes recesivos) produjera
el resultado encontrado.


Dominancia, Recesividad y Segregación

Dominancia: Así se definen aquellos caracteres unitarios que se manifiestan en la
primera generación, obtenida de un cruce entre organismos que exhiben formas
alternas para una misma característica.

Recesividad: Son aquellos caracteres que no se manifiestan en la primera
generación, pero que si pueden manifestarse en la segunda generación.

Dominancia y Recesividad constituyen una de las leyes de la teoría mendeliana de
la genética.

Segregación: Con éste término se conoce a los genes que ocupan una misma
posición en cromosomas homólogos y que se separan durante la gametogénesis,
yendo cada gen a formar parte de un gameto diferente; por tanto cada progenitor
contribuye con uno de cada dos genes que ocupan el mismo sitio en los
cromosomas homólogos en la constitución genética del hijo. Este principio
constituye-la segunda ley de Mendel.


Sel ección.
La selección natural es el método que tiene la naturaleza para asegurarse el
mantenimiento de los buenos genes y la excelente descendencia. Estimula la
supervivencia de los genéticamente más aptos y asegura la eliminación de los
errores de la naturaleza. Con los animales domésticos, los continuos progresos en
la tecnología veterinaria y la selección artificial permiten a los criadores
desordenar a la Madre Naturaleza a veces para mejor, a veces para peor. En el
mundo de los equinos de raza, muchos animales individuales y sus problemas
genéticos son artificialmente creados o corregidos, mantenidos y propagados por
la intervención humana. En nuestros días, la responsabilidad de mantener una
carga genética saludable y la prevención de los efectos indeseables en la línea y
la raza, recaen principalmente en la integridad de los criadores.
El propósito de la selección artificial es mejorar la carga genética en determinadas
líneas criando equinos de líneas paralelas pero similares. De cualquier forma, una
selección extremadamente unilateral para determinadas características, mientras
que puede mejorar la estructura, la apariencia o la habilidad para el trabajo, es a
menudo a expensas de otros atributos. Los criadores deben comparar los
beneficios potenciales para la raza (como la tipicidad) con las potenciales y
especialmente las probables pérdidas para la especie, como son, los defectos
estructurales y funcionales, la decreciente expectativa de vida.

Desde que el hombre descubrió en el caballo una herramienta de trabajo y
posteriormente de diversión, ha tratado de mejorarlo; al principio lo hizo
empíricamente observando las descendencias y tratando de efectuar
apareamientos entre los animales que según su criterio, presentaban mejores
habilidades o características sobresalientes. En este proceso fue ayudado por la
Selección Natural la cual permitía que las descendencias fueran superiores a los
padres, además que pudieran interrelacionar positivamente con su medio
ambiente.
La selección es la clave de la mejora animal. La selección y los métodos de
reproducción están ligados tan íntimamente, que es imposible pretender
separarlos.

El hombre, producto de la más elaborada evolución, logró crear la Selección
Artificial, mucho más activa y casi siempre más útil; un ejemplo de esta situación lo
podemos encontrar en el cambio logrado en el caballo primitivo o Przhewalski, silo
comparamos con un percherón moderno.

A la selección ha ayudado en alto porcentaje las mejores condiciones nutricionales
y de manejo, pero, no solo estos factores han tenido influencia; desde hace más
de 60 años se conocen los mecanismos de la transmisión hereditaria y desde
entonces han jugado un importante papel en la creación de animales mejores, ya
no solo se emplea el fenotipo como patrón de selección, actualmente se utilizan
métodos más racionales y modernos, lo que ha asegurado la permanencia y/o
creación de razas con excelentes cualidades según el fin que se persiga.

Uno de estos métodos modernos es la Heredabilidad, es decir, la forma y
permanencia de ciertas características en la descendencia, según que el carácter
sea heredablemente alto o bajo, podremos predecir en qué porcentaje se
transmite este a la descendencia y así diseñar convenientemente nuestros
programas de cruces.

En el siguiente Cuadro podemos ver algunos ejemplos de rasgos y su proporción
de heredabilidad en los equinos.

Tabla No 18 Rasgos y grado de heredabilidad en los equinos.
RASGO GRADO DE HEREDABILIDAD
Fertilidad y vigor al destete
Tamaño adulto
Rata de crecimiento después del destete
Tipo y conformación física
Velocidad
Inteligencia
Bajo
Medio – alto
Medio – alto
Medio
Medio – alto
Medio – alto


HEREDABILIDAD DE ALGUNOS RASGOS EN EQUINOS
(Tomado de LASLEY, J . Genetic Principies in Horse breeding).

Según la característica que buscamos o deseamos mejorar debemos emplear
sementales o madres que posean dichas características, esto lo podemos conocer
a través del pedigrí y las pruebas de progenie, es decir, veremos como se han
transmitido en los padres, y si estos ya han tenido experiencia reproductiva, como
los transfirieron a sus hijos.


La herenci a y el medio en relación con la selección.

Estos dos componentes de la selección son importantes en alto grado, uno no
puede expresarse suficientemente sin la participación del otro; ambos poseen
igual importancia, ni genes convenientes en un medio desfavorable, ni genes
deficientes con un buen medio pueden dar una selección provechosa.

En nuestro medio, las condiciones medioambientales distan mucho de ser las
ideales, por las adversas condiciones climáticas, el irregular aporte de forrajes y
alimento por las fluctuaciones en los períodos secos y lluviosos; las variaciones
topográficas en las diferentes zonas del país, la presencia de insectos
hematófagos que: o bien, transmiten enfermedades a los equinos, o los mantienen
en constante stress por sus ‘picaduras; todos estos factores hacen que los
animales que se deban o piensen seleccionar para nuestras condiciones deberán
poseer grandes características de vigor, de resistencia, en síntesis de gran
capacidad de adaptación a las condiciones medioambientales en las cuales se
verán obligados a desarrollar sus labores. Sería ilógico por dar un ejemplo, un
animal de gran belleza, apreciable alzada, pelaje fino, extremidades delgadas que
pretenda ser el prototipo de selección para animales cuya función será el
transporte de carga por las agrestes montañas santandereanas; para este caso
sería mejor, más rentable y de mayor beneficio seleccionar un animal robusto, de
alzada media y resistente.

Un factor primordial a tener en cuenta, en lo referente al medio ambiente, es el
factor relacionado con el aporte de forrajes y nutrientes; nunca debemos olvidar
que podrán ser envidiables las características genéticas en un individuo, pero que
estas nunca podrán expresarse en toda su magnitud en un equino sub o
desnutrido.

Criterios de sel ección

Existen diversos puntos de vista sobre los cuales se pueden realizar programas de
selección; en sí, todos deben satisfacer una afición personal del propietario de la
explotación o pueden llenar un vacío en el mercado, o podrán efectuarse cruces
y/o apareamientos cuyo fin busque acentuar ciertas características de tipo o de
raza de los especimenes cruzados; o buscan la perpetuación de componentes
genéticos de gran valor para la especie.

De la claridad de los objetivos buscados, de la seriedad y continuidad de los
programas y de la experiencia de los caballistas depende el éxito del o los
programas de selección.

Definir metas a alcanzar a corto plazo, en programas genéticos no solo es ilógico,
sino, irrealizable ya que mucho tiempo ha de pasar (3 - 5 años) para que se logre
apreciar la capacidad de transmitir las características buscadas; esto de por sí nos
indica que los programas de selección se deben planear a largo plazo, la
definición de lo buscado (objetivo) debe permanecer a lo largo del programa y no
se debe cambiar de idea u objetivo cada 2 - 3 años, pues esto solo ocasiona el
fracaso rotundo, además se deben tener en cuenta los costos inherentes al
proceso, ya que no siempre los altos costos pueden ser sufragados por la mayor
parte de propietarios vinculados a los équidos.

Lo usual en la definición de los criterios de selección es pensar, si se busca
perpetuar características exhibidas por un individuo (fenotipo), se busque
solidificar un tipo o una raza, o se piense en producir individuos cuya demanda en
el mercado asegure el éxito de la inversión (por ejemplo, crear ejemplares
excelentes de paso fino o caballos pony).



Qué debe conservarse y qué mejorarse


http://www.mundodecaballos.com

Las diferencias que existen entre nuestras razas de caballos, proceden, de que
sus creadores persiguieron ideales distintos al practicar la selección y durante
algún tiempo influyeron de un modo apreciable sobre la frecuencia de
determinados genes, este proceso fue lento y laborioso y no se puede arruinar por
decisiones tomadas a la ligera. A pesar de que los caballos se han seleccionado
durante mucho tiempo conforme a un fenotipo caracterizado por la eficiencia de su
rendimiento para determinada actividad o trabajo, están lejos todavía de ser
homocigóticos (puros), ya sean dominantes o recesivos para los genes
convenientes. La yegua de mejor apariencia no produce el mejor potro cuando se
aparea con el semental X, pero puede originario al ser cubierta con el semental.

Y Solo cuando el caballista haya efectuado un estudio concienzudo de las yeguas
que posee, basándose en registros adecuados y valorando los caracteres
favorables y adversos, está en condiciones de buscar un semental para aparearlo
con ellas. Cuando se trata de seleccionar yeguas o potros, dentro de la
explotación o fuera de ella, debe adoptarse como criterio primordial la posesión de
un tipo aceptable para la clase de caballo de que se trate, no obstante el hecho de
que los descendientes de una yegua no siempre exhiben el mismo tipo y
conformación que ella.

En síntesis, es más probable obtener un potro con las características típicas del
caballo de paso fino colombiano de una yegua de esta clase, que de una hembra
pura sangre y viceversa.

Las yeguas elegidas, además de tener un tipo aceptable, deben pertenecer a
líneas o familias femeninas de buena calidad, en las que haya figurado el mayor
número posible de animales dotados (progenies, descendencia) de una
conformación convenientes.

Pero, la verdadera apreciación de la calidad de un animal como reproductor
reside, claro está, en su capacidad para transmitir sus buenas cualidades. Esta
capacidad se aprecia mediante la comprobación del rendimiento de la
descendencia.

Al seleccionar yeguas de vientre, debe tenerse en cuenta, de un modo especial, la
capacidad de producir crías durante un largo número de años (fecundidad y
longevidad), la mejor manera de juzgar tal capacidad es el estudio de la
genealogía completa del individuo (antecesores directos y colaterales), es decir,
las hembras deben seleccionarse exclusivamente en familias de gran fertilidad.

Finalmente, al seleccionar yeguas o potros debe prestarse mucha atención a los
caracteres que definen la feminidad del animal, esto es, lo que suele llamarse la
calidad de la hembra, que se manifiesta en la finura del esqueleto (variable, como
es lógico de un tipo de caballo a otro) y la finura de la piel y el pelo, unidas a cierta
vivacidad e inteligencia y a una cierta nobleza; toda yegua debe exhibir un
equilibrio general de líneas, con la parte media del cuerpo fuerte y una amplia
anchura de caderas y de grupa, así como poseer una ubre bien desarrollada y
conformada.

Las características pobres o mal definidas, o las que se deban mejorar serán los
puntos que se buscará adicionar, y que deberán ser aportados por el semental con
miras a lograr en el producto, la mayoría de características aceptables, a fin de
que el individuo resulte con un fenotipo acorde a la raza y al tipo producto de la
cruza, además que mantenga en su genotipo, los genes necesarios para la
expresión y transmisión de dichos caracteres.


Sel ección del semental o padrillo.

Lo más conveniente, cuando se trata de obtener un semental, es adquirir o alquilar
para el salto (monta controlada), un animal que haya demostrado ya su capacidad
como reproductor y transmisor del tipo y rendimiento deseados, es decir, un
caballo de calidad probada. Además, el animal deberá poseer un registro sanitario
en el que se pueda constatar que el mismo se encuentra libre de enfermedades
infecciosas de transmisión directa, especialmente aquellas de índole reproductiva,
para este efecto es útil la asesoría de un Médico Veterinario con suficiente
experiencia en la materia.

Desafortunadamente, estos animales no son siempre fáciles de conseguir; por
tanto la mayoría de caballistas tratan de rotar sus padrotes o alquilarlos, pero a un
costo elevado no siempre fácil de cubrir.

El macho elegido debe ser sano, poseer el tipo y la aptitud deseados y pertenecer
a una familia de fertilidad conocida. Debe preferirse el hijo de un semental de
calidad probada cuya descendencia haya sido, en su mayor parte, de buena
calidad, también debe procurarse que la madre sea hija de un semental de calidad
comprobada y haya demostrado su capacidad para transmitir buenas cualidades a
sus descendientes. Hay que reconocer que los animales que reúnen las anteriores
condiciones son escasos, pues no se dispone casi siempre de registros
completos; pero, a medida que la exigencia de éstos vaya en aumento todos los
caballistas tendrán que disponer de ellos facilitando el mejoramiento de la especie.
Es preciso, que el macho exhiba caracteres propios de masculinidad,
convenientemente acusados. El macho debe ser un poco más macizo que la
hembra, de esqueleto más fuerte que ella y con el pecho y el cuarto anterior bien
desarrollados. Debe mostrar temperamento y masculinidad, pero de un tipo tal que
pueda ser dominado en la doma para que el animal resulte dócil.


http://www.mundodecaballos.com

Los principios que rigen la herencia en los caballos son análogos a los que
presiden ésta en otras especies. Un caballo es el producto de sus genes y del
medio en que se desarrolla, pero el medio, en la forma de ejercicio dirigido
desempeña un papel mucho más importante que en cualquier otra especie,
además es importante una adecuada alimentación. En el caballo se necesita
también, más que en ninguna otra especie, un equilibrio adecuado-entre las
diversas partes del cuerpo y entre la constitución física y mental.

La selección de los caballos más veloces creó gradualmente el tipo de caballos de
carrera; la selección basada en la energía creó poco a poco el caballo de tiro
pesado. Los tipos de caballos de carrera y de silla están hoy establecidos de un
modo fundamental. La labor futura con estos tipos se orientará hacia un mayor
rendimiento, para mejorar su velocidad, simetría, equilibrio, capacidad y conducta.
La calidad de la descendencia los hará cada vez más homocigoticos para los
caracteres favorables.


Eficiencia reproductiva
Para que el caballista pueda tener una idea clara de la eficiencia reproductora de
sus caballos sementales y de los lotes de yeguas de vientre debe llevar
cuidadosos registros de los períodos de celo de éstas últimas, del número de
montas necesarias para que conciba cada una, del porcentaje de yeguas
preñadas por cada semental, del peso de los potros al nacer, de la duración de las
gestaciones, etc.

El manejo correcto de la eficiencia reproductiva favorece en grado sumo la
selección de los animales que con mayor seguridad brindarán beneficios en los
programas de cría, y proporcionará elementos de juicio más sólidos en cuanto al
manejo de la explotación en si.


MEJORAMIENTO

Los sistemas de reproducción y selección son los únicos instrumentos con que
cuenta el propietario para mejorar sus animales, puesto que no podemos crear
nuevos genes, sino solamente partir de los que existen para agruparlos en formas
más ventajosas.

Cada raza equina, tal y como está constituida, posee como capital genético el
conjunto de genes que existen en los distintos miembros vivos que la forman.
Cada raza posee un cierto número de genes buenos y un cierto número de genes
malos. Si se puede hacer crecer el número de genes buenos a expensas de los
genes malos (dado que el número de cromosomas quienes portan los genes es
invariable para la especie) la raza mejorará. Si por desgracia ocurre lo contrario, la
raza irá degenerando.

Una raza no puede por sí sola, obtener nuevos genes. No puede esperar un
progreso rápido de la aparición natural de mutaciones (cambios) génicas
favorables, y no se conoce hasta hoy ningún método de crear mutaciones útiles
por medios artificiales. El progreso de las razas, depende por lo tanto, del aumento
relativo en la frecuencia de los genes más favorables y posiblemente de su
recombinación en agrupaciones más convenientes (mediante las cuales se
pueden expresar características superiores). También pueden crearse nuevas
razas cuando sea conveniente o necesario, mediante la combinación de
caracteres que existan en razas distintas por métodos de cruzamiento selectivo
seguido de la cría consanguínea.

La selección y los métodos de reproducción pueden emplearse para influir sobre la
frecuencia de determinados genes, y son los únicos medios de que dispone el
caballista para tal fin constituyen esto el arte de la mejora.


http://www.mundodecaballos.com

Los sistemas de reproducción pueden agruparse en dos clases: cruzamiento y
consanguinidad; el cruzamiento es el apareamiento de animales no
emparentados, la consanguinidad el apareamiento de animales emparentados.

Para establecer en forma práctica el límite claro en la definición del parentesco,
diremos que si dos animales de sexo contrario no tienen ningún antepasado en
cuatro o cinco generaciones anteriores, no están emparentados y su
descendencia será cruzada. En cambio, si el macho y la hembra tienen
antepasados próximos comunes, su descendencia será consanguínea.

Heterosi s.
Se ha observado desde hace mucho tiempo que el apareamiento de animales no
emparentados suele dar origen a descendencias de mayor vigor. Este fenómeno
se conoce con los nombres de Heterosis o Vigor Híbrido, la explicación de este
hecho, se debe a que las especies y las razas poseen grupos algo distintos de
genes favorables (dominantes) y todas ellas poseen algunos genes desfavorables
(recesivos). Cuando se cruzan dos especies o dos razas, un progenitor puede
aportar un gene dominante que oculte un gen recesivo desfavorable aportado por
el otro progenitor y viceversa. El descendiente, por lo tanto, tiene mayor número
de genes dominantes que cualquiera de sus progenitores, y es probable que sea
más vigoroso.

Sin embargo, como los animales híbridos o cruzados son más heterocigóticos, no
pueden esperarse que transmitan sus caracteres tan uniformemente como los
animales de raza pura.
Hibridación


El tipo de cruzamiento en que los progenitores están más alejados, es el
apareamiento de individuos pertenecientes a dos especies distintas y un buen
ejemplo de ella es el apareamiento de las especies caballar y asnal para producir
un mular. Parece probable que el caballo y el asno tengan un antepasado común
en un pasado lejano. La selección natural, basándose en la variación empezó a
separarlos en especies distintas; las divergencias progresaron tanto que en la
actualidad el caballo y el asno son especies distintas. Todavía tienen muchos
genes en común, pero poseen también suficientes genes distintos para que se les
considere como especies diferentes. Sin embargo, hasta ahora sus diferencias
genéticas, aunque suficientes para clasificarlos como especies distintas, no son lo
bastante grandes para impedir que los óvulos de una sean fecundados por
los
1
espermatozoides de otra; de esta unión nacen los mulos, de estos
descendientes, los machos son siempre estériles y las hembras lo son en la gran
mayoría de los casos.

Es indudable, que la naturaleza ha usado la hibridación para producir nuevas
especies. Ni la hibridación, ni ninguna otra forma de reproducción, puedo producir
nuevos genes, lo único que hace cualquier sistema de reproducción es reagrupar
en nuevas combinaciones los genes existentes.

Híbridos comerci al es



www.folkloredelnorte.com.ar

El mayor híbrido conocido en la actualidad, es el mulo, que es hijo del asno y de la
yegua, cruza muy apreciada en nuestro país, y sobre cuyos lomos se transportó
gran parte del desarrollo antioqueño. Se han registrado algunos casos de mulas
fértiles, pero nunca se pudo prolongar estas líneas genéticas. La mula se acerca
más al asno que el burdégano o “macho romo” quien se acerca más al caballo en
sus caracteres generales, este último, es hijo de la burra y el caballo; el burdégano
ha gozado de muy poca aceptación.

El cebroide, híbrido de la cebra y el caballo, es bastante popular en África, no así
en nuestro medio, y sólo, lo registramos como conocimiento complementario, este
híbrido es dócil en grado sumo y resistente al calor y a las enfermedades.



http://www.phpwebquest.org/wq25/webquest/soporte_tablon_w.php?id_actividad=18773&id_pagina=1


En la mayoría de estos programas se buscan tres aspectos fundamentales:
- Mantener las características de pureza (homocigosis) para el fenotipo de la
raza.

- Mejorar el vigor (heterosis) para aumentar la resistencia del individuo al
medio.

- Crear híbridos (hibridación) por sus especiales características de fortaleza y
rendimiento.

Pero sobre todos los conceptos, los cruces deben ser rentables, estarán
enfocados a satisfacer el mercado y el tipo de ejemplar equino que más demanda
tenga según la región en que el productor se encuentre ubicado.

Cruzamiento para l a creación de nuevas razas.

Para la creación de nuevas razas, se ha empleado el cruzamiento, seguido de
selección en la descendencia y de cruzas consanguíneas.

En lo que se refiere a la creación de nuevas razas hay que tener en cuenta dos
hechos. Uno es que si dos criadores parten de dos razas A y B para cruzarlas y
obtener una nueva raza C, llegando así a resultados diferentes, como ninguna de
nuestras razas es completamente homocigótica, ambos mejoradores iniciaron con
seguridad su trabajo con diferente material genético. Además, la distribución al
azar del material hereditario y los diferentes ideales que se haya forjado cada uno,
conducirán generalmente a dos formas distintas de la nueva raza, que será
llamada C, integrada con genes diferentes y, por tanto, dotada de caracteres y
capacidades productivas muy distintas.

El segundo punto respecto a la formación de nuevas razas, es el tiempo empleado
para ello. No existe un criterio fijo para determinar si hacen falta seis generaciones
ó 16 ó 60 para llegar a decir que el resultado del cruzamiento y de la selección
posterior amerita considerarse como una raza pura.

Muchas de las llamadas razas nuevas presentan todavía una gran variación
después de 25 ó 30 años de cuidadosa selección, y hasta las más antiguas de
nuestras razas puras son todavía relativamente heterocigóticas.


Consanguinidad.

Los métodos de reproducción que se han estudiado en los anteriores encisos
(Heterosis, Hibridación, cruzamientos), suponen el apareamiento de animales no
emparentados, que no pertenecen a la misma raza; es decir, suponen la reunión
de porciones de germoplasma (genes) muy diferentes; también puede practicarse
el cruzamiento entre animales pertenecientes a la misma raza y con relación de
parentesco en las últimas tres a cuatro generaciones.

Si se cruzan animales emparentados, que posean uno o más antecesores
comunes en las últimas cuatro o seis generaciones y que, por lo tanto, tienen en
común probablemente un número de genes mayor que el de genes comunes en
dos animales no emparentados, se llega a la consanguinidad.

Existen diversas opiniones respecto a la práctica de la consanguinidad. En
general, tiene mala reputación porque se cree que conduce a degeneración de la
descendencia. Mas adelante abordaremos este tema un poco mas a fondo con el
objeto de aclarar dudas y desarrollar nuevos conceptos.

EL CABALLO ÚTIL EN NUESTRO MEDIO


En nuestro medio, con excepción hecha de algunos yeguerizos de lujo, explotados
principalmente con el ánimo de obtener caballos de salto, carreras, o para el
deporte ecuestre denominado “polo”, y otros que seleccionan el caballo de paso
fino; la cría de caballos es limitada y ocupa un lugar secundario en las actividades
ganaderas. En la mayoría de fincas en las zonas ganaderas (costa, llanos
orientales) producen animales destinados a los servicios de vaquería y se practica
la hibridación a fin de obtener productos (mulas) destinadas a silla o carga.
Dado las condiciones de manejo extensivo de nuestras ganaderías, el caballo de
vaquería, rápido, resistente y fuerte seguirá teniendo gran mercado, además que
será un elemento imprescindible en dicha actividad, es así como nuestros
esfuerzos de mejoramiento y selección deberán estar encaminados a éste tipo de
equino.

La producción de mulas sigue siendo importante, tanto por la topografía de
nuestras zonas de ladera, como por las características socioeconómicas de sus
habitantes, para quienes éste híbrido es elemento de transporte, carga y de tiro;
por tanto su producción tendrá mercado asegurado en los próximos años.

El descubrimiento del ADN Mitocondrial (ADNmt) ha sido uno de los hallazgos
más relevantes sucedidos en la historia reciente de la genética. Mediante su
estudio, los científicos han sido capaces de “rastrear” el origen de los seres vivos
hasta sus primeros ancestros, viajando millones de años en el pasado. Como ha
sucedido en otras oportunidades, estos avances científicos trascienden y son
aplicables a otras disciplinas. En el caso específico de la industria equina el
descubrimiento de estos genes de origen mitocondrial ha cobrado importancia por
la influencia que los mismos parecieran tener sobre la transmisión de caracteres
que están íntimamente ligados al “performance” o a la capacidad atlética. De igual
forma, se han hecho observaciones importantes que han permitido conocer más
sobre los orígenes de los equinos, sugiriendo correcciones en la información o
base de datos hasta ahora incuestionables que manejan los registros
genealógicos (Stud Book) a nivel mundial. Su descubrimientos también ha tenido
especial importancia al darle un soporte científico a algunas de las teorías
utilizadas para establecer “cruces”, las cuales hasta ahora habían gozado de
popularidad solo gracias a la observación que en su momento hizo algún
entusiasta analista de pedigríes.

El pelaje, la forma y el tamaño del cuerpo, la libido, la precocidad, la velocidad, el
carácter, etc., son características cuya presencia o manifestación en un caballo
están regidas por la información contenida en los genes. Estos genes que
constituirán el patrón o molde para la formación de un nuevo ser, provienen del
material genético aportado por el núcleo de las células sexuales, es decir óvulo y
espermatozoide provenientes de la madre y del padre respectivamente, que luego
de unirse al momento de la fecundación darán origen a un nuevo individuo. En
pocas palabras, ambos padres transmiten a su descendencia genes específicos
para contribuir con la apariencia y virtudes del nuevo ser. Sin embargo, el
descubrimiento del ADNmt implica la transmisión de un material genético que pasa
a la descendencia sin estar sujeto a cambio y que es exclusivamente de origen
materno, lo que indica que una parte de la herencia o ciertas características de un
ser vivo son solamente producto de la influencia genética materna.

TIPIFICACION DEL ADN O GENOTIFICACION.
Este examen consiste en realizar una comparación genética del DNA, en la raíz de
la crin de los caballos que nos permite obtener un archivo permanente de los
marcadores genéticos de un ejemplar y hacer la verificación de parentesco de un
equino con sus respectivos padres.
La tecnología inicial de la tipificación sanguínea se hizo obsoleta, sus reactivos
comenzaron a dejar de producirse y fue superada por una nueva tecnología, más
simple, certera y barata. Esta tecnología fue la genotipificacion de ADN a partir del
pelo y bulbo capilar.

La Tipificación Sanguínea ha sido reemplazada a nivel internacional por las
Técnicas de ADN por:

- Mayor eficiencia (hasta el 99.99%) analizando el trío: producto, padre y madre
- Versatilidad en el Tipo de Muestras a Analizar (pelo, sangre, semen, orina,
huesos, dientes, etc.).
- Cumplimiento de Requisitos Internacionales para Importación y Exportación
de Animales, semen y embriones.
- Estandarización de los Resultados según Organismos Internacionales (ISAG,
ISBC).
Tomar una muestra de cabello es sencillo, permite el muestreo de un gran número
de sujetos en menor tiempo, con un mínimo de aflicción causada. Sin embargo
extraer un cabello (junto con el bulbo capilar) puede ser doloroso en algunas
situaciones.





INSTRUCCIONES PARA LA EXTRACCIÓN DE PELO PARA EL ANÁLISIS DE
ADN.

La extracción de la muestra deberá ser realizada por personal técnico
responsable, siguiendo las siguientes instrucciones:

1. Identificar correctamente al animal en base a la ficha filiatoria.

2. Lavar las manos con agua y jabón.

3. Limpiar el peine o rasqueta para eliminar de los mismos pelos u otros residuos
si se va a sacar muestras de varios animales, esta operación deberá repetirla con
cada animal.

4. Pasar el peine o rasqueta por la crin o por la cola del animal –según elija una u
otra para la toma de muestra- a fin de eliminar residuos que puedan contaminar la
muestra a extraer.

5. Separe un mechón de aproximadamente 30 a 40 pelos del nacimiento de la crin
o del nacimiento de la cola del animal, enróllelo en el dedo índice y tire firmemente
del mismo hasta arrancarlo de raíz, verificando la presencia de los bulbos pilosos
imprescindibles para el análisis de ADN.

6. Coloque el mechón de pelo extraído en el sobre, completando los datos
requeridos. Cierre el sobre utilizando el adhesivo.

7. Ante cualquier duda comuníquese con el laboratorio.
Y por último pero no de menor importancia, se debe tener en cuenta estos
consejos para garantizar la veracidad de los resultados.
- E mechón de pelo no debe cortarse sino arrancarse desde la raíz
- Evite la mezcla de pelos de diferentes animales.
- La cantidad de pelo enviada no deberá ser menor a la cantidad solicitada y
el mismo deberá encontrarse limpio y seco.
Históricamente los criterios de identificación fueron características externas de
índole fenotípica (lo que se expresa, lo que se ve). Si bien el criador a los pocos
días de nacido el potrillo crea una ficha individual, siempre surgen inconvenientes
pues muchas de las características externas anotadas pueden desaparecer y
aparecer nuevas, con lo cual es esta una identificación poco confiable. La
aplicación de los grupos sanguíneos, si bien tiene mas precisión e inmutabilidad
que los registros antes mencionados, requiere de muestras de sangre del animal
para su elaboración y solo permite obtener una identificación final, incierta sobre
todo cuando se quiere incluir la paternidad lo cual obliga agregar numerosos
marcadores bioquímicos como enzimas, proteínas etc. y aun así la posibilidad de
incluir una paternidad tiene margen de error.
La confiabilidad es del 99.99 % En los test de paternidad los marcadores
genéticos que se seleccionan se heredan de a pares, unos provienen de la madre
y otros del padre. A partir de este principio es posible poder determinar con una
certeza casi absoluta quienes son los padres biológicos del animal investigado.
Estos estudios se basan en la presencia de variaciones génicas (marcadores)
propias de cada caballo llamados STRs (Short Tandem Repeats) Se estudian
entre 9 a 12 de estos marcadores distribuidos al azar a lo largo de todo el ADN.
Los mismos tienen entre 5-12 variantes reconocidas. Estas variantes se hallan
asignadas por letras y números y están aceptadas en la nomenclatura
internacional. Por ej. AHT4, AHT5, HMS3 etc. Estos marcadores se heredan
según los principios genéticos Mendelianos.
La identificación de los mismos otorga un altísimo nivel de precisión para la
identificación de los caballos analizados. Esto se debe a que es altamente
improbable que en la población mundial equina existan dos caballos con la misma
combinación de estos 9 o 12 marcadores.
El análisis compara el patrón de picos presentes en el hijo con los patrones de
picos presentes en los presuntos padres. Si se tratara de un estudio de paternidad
con un presunto padre, el patrón de picos de este debe coincidir en un 50 % con el
del hijo en estudio, de ser así estaremos frente a una probabilidad de paternidad
del 99, 99 %. Si el caso fuese que el patrón de picos NO COINCIDE con el 50 %
del hijo estaremos frente a una EXCLUSIÓN y una probabilidad de paternidad del
0,00%.
Como lo mencionamos anteriormente el estudio se puede realizar a partir de unos
pelos o crines ARRANCADOS (no cortados), con presencia del bulbo piloso,
siendo este el mas utilizado en la actualidad por nuestros criadores o en muestras
de sangre, semen, biopsias de tejidos, huesos dientes etc.
Existen otros estudios genéticos además de las pruebas de ADN, se puede
realizar el cariotipo o mapa cromosómico. Normalmente el número de
cromosomas en el caballo es de 64. Las anormalidades de los mismos pueden
ocasionar detención de la preñez, o eventualmente luego de los nacimientos
aparición de malformaciones, alteraciones en el crecimiento o futuros trastornos
en la reproducción. Estos análisis pueden ahorrar a los criadores tiempo y dinero
en relación a la cría de animales defectuosos. Un ejemplo es la anomalía
cromosómica denominada XO que puede hallarse en el cariotipo de yeguas
estériles con tamaño pequeño y con ovarios inactivos. Este síndrome se ha
diagnosticado en yeguas pura sangre, árabe, potro Gales, belga y otros.
Para la realización de estos estudios es necesario personal especializado en
técnicas de ADN así como de la interpretación de los resultados obtenidos.
Estos estudios requieren de equipamiento especializado que incluye
termocicladores para la amplificación génica y secuenciadores automáticos.
Ventajas generales de las pruebas de ADN.
1) Mayor poder de exclusión e inclusión de la paternidad que la que otorgan los
métodos convencionales. (Superior a un 99.9%). Como los animales relacionados
comparten numerosos aleles la prueba del ADN es el método mas poderoso y
confiable para distinguir entre diversos animales.
2) Posibilidad de mejorar las cruzas al identificar correctamente a los animales.

3) Simplicidad en la obtención de las muestras para realizar estos estudios del
ADN.

4) Seguridad del material genético comprado en la adquisición de un ejemplar
para la cría.

5) Los marcadores de ADN tienen la ventaja de que se puede obtener resultados a
partir de muestras muy pequeñas y muy fáciles de extraer.

6) Este sistema no genera indeterminaciones porque se accede directamente al
genotipo de los individuos y, por tanto, no se ve afectado por las relaciones de
dominancia ni por las variaciones de penetrancia o expresividad.

7) El ADN no cambia con el tiempo.

8) No hay posibilidad de que dos individuos tengan el mismo perfil en la prueba de
ADN.


Ventajas especificas de acuerdo a la prueba de ADN practicada.


Ventajas de la muestra de pelo (material no perecedero):

1÷ El criador no necesita solicitar turno ni tubos al laboratorio (menor costo).
2÷ No necesita la intervención de un profesional para la extracción de la muestra
(menor costo).
3÷ Se pueden enviar por correo normal (menor costo).
4÷ Puede extraer muestras de pelo de sus animales, guardarlas en su
establecimiento ó remitirlas al laboratorio para almacenar en el Banco de
muestras y ser analizadas, de ser necesario, en el futuro.

Ventajas de la Tipificación del ADN sobre semen:

1÷ Analizando una dosis de semen podrá verificar si la pajilla corresponde al
animal del cual supuestamente proviene, siempre y cuando el reproductor
posea análisis de ADN registrado.
2÷ Permite determinar el perfil de ADN en animales muertos con existencia de
semen.


Ventaja de la Tipificación del ADN sobre muestras de suero (Equinos).

1- Cuando se cuenta con muestras de suero de la mayoría de los ejemplares
equinos analizados por Tip.Sanguínea en su Laboratorio, sobre las que es
factible extraer y analizar el ADN, permitiendo determinar el perfil, aún en
casos de reproductores muertos. Si bien el suero no es la muestra “ideal”
para analizar por la escasa cantidad de células que contiene, es otro tipo de
muestra a la cual se puede recurrir para los casos de animales muertos.


Teniendo en cuenta lo antes explicado, es de gran importancia para los
aficionados y criadores de caballos conocer algunos de los avances en genética
equina que están marcando pautas en la selección y mejora de tan noble especie,
para ello se resaltaran los siguientes artículos que han sido tomados de la revista
de la Federación Nacional Colombiana de Asociaciones Equinas “FEDEQUINAS”.


INBREEDING

La selección y cría por este método puede ser un instrumento mediante el cual los
criadores obtengan equinos cuyos cromosomas contengan genes similares, es
decir, animales que genéticamente sean muy parecidos. Si todo criador de
caballos tiene en su pensamiento un ideal bien definido y se atiene a él al
seleccionar sus animales puede lograr progresos notables, sobre todo si utiliza la
consanguinidad como recurso para fijar un material hereditario prepotente.

En el mundo de los caballos los científicos han dividido la consanguinidad en dos
tipos: consanguinidad estrecha (closebreeding) que es el apareamiento de
animales con parentesco cercanos como padre con hija, hijo con madre, y
hermanos completos. En cambio la consanguinidad lateral (linebreeding) es el
apareamiento de animales con parentesco mas lejanos, como abuelo con nieta, tío
con sobrina, hermanos medios y primos entre sí.


Closebreeding o Consanguinidad estrecha:

Este tipo de cruzamientos se efectúa raramente en la actualidad, ya que la
experiencia ha indicado que tiene como resultado un menor vigor híbrido en los
animales producidos, existen factores en pro y en contra.

Razones en pro:

1. Aumento del grado de pureza de los animales.
2. Permite una eliminación selectiva rígida, ya que es un método selectivo
seguro y rápido para fijar y perpetuar un carácter o grupo de caracteres.
3. Tiende en el futuro a formar líneas o grupos de animales uniformes en
conformación.
4. Genera animales con una prepotencia muy acentuada, es decir, equinos
transmisores de genes muy específicos.

Razones en contra:

1. Aumenta las probabilidades de que aparezcan caracteres recesivos, incluso
afectados por factores degenerativos como lo es la disminución del tamaño,
de la fertilidad y del vigor en general.
2. Al haber un alto grado de selectividad se necesita de una enorme
capacidad de capital de trabajo para poder soportar durante un largo
periodo de tiempo esta selección.
3. No debe ser practicado con animales mediocres o inferiores al término
medio, ya que los productos presentarían una elevada proporción de
caracteres indeseados.
4.


Linebreeding Consanguinidad lateral.

Es considerada fundamental para lograr animales excepcionales, ya que se tiende
a mantener una descendencia emparentada, con algún antecesor muy destacado
y el cual tiene caracteres de calidad superior.

Razones en pro:

1. Es un tipo de programa más prudente y seguro, el cual puede ser encarado
tanto por grandes como por medianos y pequeños criadores.

2. Se tiene un grado más elevado de caracteres deseables que indeseables.

3. Se realiza mejor mediante el cruce con un semental sobresaliente que con
una yegua de mérito, a causa de la mayor cantidad de descendientes del
primero.

4. Permite recurrir a cruces externos, sangre de otros sementales o de otras
yeguas para corregir los defectos comunes.

5. Permite al propietario de uno o varias yeguas de calidad superior, cruzarlas
con padrillos de criaderos dedicados al linebreeding y que tengan
características bien definidas.


Razones en contra:

1. Igual que en el cruce por consanguinidad estrecha, la consanguinidad
lateral no debe ser practicada con animales de calidad mediana, ya que en
estos animales, hay una preponderancia a acentuar caracteres
desfavorables.

Como vemos en principio, debemos manifestar que no existe un método de
reproducción equina que sea único y mejor para todas y cada una de las
circunstancias. Cada programa de cría es un caso particular que requiere un
pormenorizado y cuidadoso estudio. La elección del método depende
principalmente del tamaño y calidad de la manada, del aspecto financiero, de la
habilidad del administrador y especialmente del objetivo previsto por su
propietario.


TENDENCIA DE TRANSMISIÓN DEL COLOR DEL PELAJE A LA
DESCENDENCIA.

Diversos conceptos han surgido a través de los tiempos respecto a la transmisión
del color en los caballos criollos colombianos. La creencia generalmente
conceptúa que el color se transmite directamente de padres a hijos. Sin embargo,
los estudios genéticos realizados hasta el momento, amparados en los conceptos
de la heredabilidad y transmisión de caracteres demuestran que existen diferentes
fórmulas genéticas que condiciona la expresión fenotípica del color del pelaje
dependiendo de su composición y de la dominancia y recesividad de los genes
que la conforman.


Determinación de las Capas o Pelajes:

Se entiende por capas o pelaje no solamente al conjunto de pelos que cubren el
cuerpo del animal sino las características que estos presentan en cuanto a su
calidad, naturaleza, mayor o menor abundancia (densidad), disposición,
desarrollo, ondulación y especialmente su coloración, así como la forma en la que
estos se hallan dispuestos.

El color de la piel (dermis) y mucosas en el caballo corresponde a la manifestación
externa de los llamados melanocitos, células epiteliales en forma de gránulos un
poco móviles, se encuentran en la capa profunda de la epidermis (sub.-dermis), en
el iris y algunos órganos internos siendo las encargadas de dar origen a los tonos
o colores, produciendo básicamente dos tipos de melanina: Eumelanina (negro) y
Feomelanina (marrón). Dependiendo de la mayor o menor cantidad de una de las
dos, da tonos claros u oscuros.

Los melanocitos son células embriológicamente de origen nervioso. Los pelos son
formaciones filamentosas, diferentes según la especie animal y la región corporal
considerada empotradas en la sub.-dermis. En el extremo proximal (raíz) del pelo
se halla el bulbo piloso, a partir del cual el pelo se desarrolla, se nutre y regenera.
La mayor parte del pelo consta de células córneas.

El reconocimiento del color del pelaje es de suma importancia para determinar el
grado de pureza de la mayor parte de las razas. Hay que tener en cuenta que
ciertos factores o causas pueden modificar el color o tono de los pelajes, tales
como la edad del animal. Al nacer el potro se halla cubierto por una especie de
lanosidad que generalmente desaparece entre los 5 – 8 meses siendo entonces
remplazada por una capa estable de color diferente al pelo original. La cabeza, sin
embargo, puede ser un punto del exterior del animal que proporciona algún indicio
del color definitivo que presentará en lo sucesivo el cuerpo del ejemplar.

El color del pelaje en nuestro medio si tiene influencia en cuanto a la
comercialización y posible utilización y méritos de determinado equino; en
ocasiones con algunas razones válidas como por ejemplo el factor careto y los
calzados de los remos, o la adaptación o aclimatación a determinados pisos
térmicos (colores claros vs. colores oscuros).


Predicción del Color de la Capa en Caballos.

¿Es posible conocer la coloración de la capa que tendrá un potro? La respuesta es
afirmativa para las coloraciones básicas más importantes.

La naturaleza de la coloración de las capas es conocida desde hace muchos años,
aunque los genes concretos que intervienen y su modo de acción es algo que
corresponde a la era de la genética molecular. Los genes que intervienen se
pueden agrupar en dos categorías: la primera sería de aquellos que actúan sobre
el desarrollo, diferenciación, proliferación o migración de los melanocitos y la
segunda incluiría genes que actúan sobre la síntesis de melanina.

Los sistemas genéticos más importantes en las coloraciones básicas del caballo
pueden ser agrupados según muestra la tabla 19.

Tabla 19. Genotipos y fenotipos de las distintas capas equinas.

Genotipos y Fenotipos de las distintas capas equinas

Fórmulas Genéticas

Color de la Capa

W Blanco
G Moro
Rn Ruano
E, A, CC, dd, gg, ww, pp Castaño
E, aa, CC, dd, gg, ww, pp Negro
Ee, CCcr, dd, gg, ww, pp Isabela
Ee, CC, dd, gg, ww, pp Alazán
E, A, CCcr, dd, gg, ww, pp Bayo
E, aa, CC, D, gg, ww, pp Ratonero o cisne
ee, CC, D, gg, ww, pp. Cervuno


Genes Responsables de la Coloración Básica:

La interacción entre los genes de cinco loci (los genes C, B, A, E y D) determina la
mayoría de los colores principales del caballo. Otros loci enmascaran, manchan o
transforman en moros o ruanos esos colores.

El gen Extensión (Ee): Responsable de las coloraciones negras y alazanas en
combinación con el Agutí que condiciona la expresión de la eumelanina originando
las capas castañas.
El gen Extensión es el MCIR (Receptor de la melanocortina), la variante E se
diferencia de la variante e por una mutación que da lugar al cambio de un único
aminoácido, la serina pasa a ser una fenilalanina. Este cambio puntual transforma
un receptor sobreactivo (E) responsable de la pigmentación negra en un receptor
no funcional (e) no responsable de la coloración rojiza
El gen Extensión es dominante porque la presencia de una de sus variantes, la
denominada E, productora de la eumelanina, y por lo tanto del pigmento negro,
impide que se exprese la otra variante denominada e, productora de
feonomelanina y por lo tanto de la coloración roja. Para que el animal pueda
presentar la capa negra o, al menos, extremos y cabos negros, es necesario que
el caballo sea portador de una dosis de la variante E del gen Extensión. Si el
caballo es portador de dos dosis de la otra variante del gen, es decir, ee, el caballo
presentará una capa alazana, independientemente de la composición que tenga el
gen Agutí.

El gen Agutí (Aa): Resulta ser un sistema dominante en el que una de las
variantes, la denominada A, permite a un animal portador de al menos una
variante E que la pigmentación negra aparezca solo en los extremos y cabos
dando lugar a la capa castaña. Sin embargo, la otra variante, denominada a, que
se comporta como presente en doble dosis, aa, origina la capa negra siempre que
en el gen Extensión exista al menos una variante E.
Del gen Agutí también se tiene el conocimiento molecular de los cambios que se
producen en la cadena de ADN y que dan lugar a las dos variantes del gen. El gen
responsable se denomina ASIP (Agutí Signalling Protein) y la variante recesiva (a)
se diferencia de la (A) porque le faltan 11 nucleótidos.

Genes que provocan la dilución del color:
El gen Cream (C). El gen Dun (D)
Genes responsables de las capas pintas:
El gen Tobiano (TO)


Genes modificadores.

Son genes que enmascaran el efecto de otros genes implicados. Estos genes con
efectos relativamente pequeños determinan muchas de las variaciones que
experimentan los colores básicos. La acumulación de estos genes modificadores
menos importantes puede producir que algunos genotipos diferentes posean la
misma apariencia.

El gen White (Ww): W se refiere a una variante del gen y w a la otra; genes
responsables del color blanco puro.

El gen Grey (Gg): Responsable del color moro. Este gen tiene un comportamiento
dominante, es decir, la variante del gen que da lugar a la capa mora, simbolizada
por la letra G, domina sobre la variante del gen que no da lugar a la capa mora.
Además este gen enmascara la acción del resto de los genes Extensión o Agutí,
de tal manera que la variante G impide que se manifieste la acción de esos genes.
En genética esta acción de interacción de un gen sobre otro u otros recibe el
nombre de efecto epistático.

Cuando un animal es portador de la variante G, independientemente de cual sea
la otra variable de que es portador, presentará la capa característica Moro, esta es
la característica denominada dominancia. Sólo los animales portadores de las dos
dosis de la variante g no serán moros y podrán, por lo tanto, expresar la
composición genética que lleve en los otros genes, el Extensión y el Agutí.

Cualquier caballo que en el gen Grey sea portador únicamente de la variante g
podrá expresar la capa negra, alazana o castaña de la que son responsables, por
un lado el gen denominado Extensión (E) modulado por el gen Agutí.

El gen Rn: Responsable del color Ruano. Todos estos genes modificadores son
mucho más fuertes que los básicos, puesto que dominan sobre el fenotipo. Sin
embargo es desconocido lo que ocurre genéticamente cuando compiten para
definir color más de un gen modificador.

A partir de una pequeña muestra de sangre o pelos se conocen las variantes
genéticas de que es portador un caballo, lo cual puede resultar de gran utilidad
para combinar adecuadamente los apareamientos con el fin de maximizar las
probabilidades de obtener el potro con la capa deseada.


APLICACIONES DE LA GENETICA MOLECULAR A LA INDUSTRIA EQUINA


Aspectos Básicos de Genética.
Cada individuo tiene las instrucciones para su funcionamiento en unas unidades
llamadas genes, desde las bacterias hasta el hombre, por ahora no es posible ver
los genes directamente, pero si se puede reconocer su presencia gracias a su
funcionamiento (fenotipo) y además, en muchas ocasiones podemos medirlo.

Los organismos están compuestos por células y cada célula tiene dos genes, de
los cuales, de los cuales uno es derivado del padre y el otro de la madre, como se
explico anteriormente, cada uno de los cuales tiene información similar en la
relación con la característica que codifican, pero no necesariamente idéntica. Es
así como cada gen puede tener la información para la existencia de pelo y uno lo
puede tener liso y el otro gen rugoso, entonces podemos hablar que en cada gen
existen por lo menos dos alelos, cuando estos son iguales se dice que el animal
es homocigoto, cuando son diferentes heterocigoto.

En el caso de los 7 genes para el color de los equinos, es necesario recordar que
cada animal posee dos alelos, uno de los ejemplos más interesantes tiene que ver
con el color del pelaje, cuya expresión es el resultado de la interacción de 7 genes,
las diferencias observadas son encontradas por personas entrenadas para la
observación, para muchos de los alelos uno no puede saber mediante la
observación del animal si es o no homocigoto para la presentación de un color.

Los genes Estonia localizados en los cromosomas del núcleo celular, son visibles
solamente en la metafase de la mitosis, gracias a ello podemos saber con certeza
dónde están los genes en los cuales tenemos interés. Estos cromosomas están
compuestos de ácido desoxirribonucleico (ADN) que es la molécula universal de la
herencia, éste a su vez está compuesto por nucleótidos que tienen como identidad
la base nitrogenada que los compone. Así pues el material genético de un
individuo es la sucesión de Guanina (G), Citosina (C), Timina (T), Adenina (A).
Devolviéndonos, los cromosomas tienen millones de pares de bases, localizadas
linealmente y de esta secuencia depende el funcionamiento de los individuos,
solamente el 5% corresponde a genes que podemos ver en forma de fenotipo, el
resto no tiene función al menos por ahora conocida, pero no quiere decir que no
tengan función o que no puedan ser usadas, existen algunas secuencias muy
importantes que son repeticiones específicas llamadas microsatélites que son
utilizadas para la identificación de los individuos, la mayoría de ellos son
repeticiones de dos bases como en el ejemplo:
(…TCAGGTCTACACACACACACACACACACATGCTTATGACT…), se puede
observar que CA se repite alrededor de 10 veces.

Los genomas de mamíferos contienen miles de estos marcadores, que gracias a
su gran variación permiten identificar los individuos lo que le da gran potencial de
uso entre ellos: paternidad, ciencias forenses, diagnóstico de enfermedades
hereditarias e infecciosas.

La identificación de los marcadores moleculares están basados en la utilización de
la técnica de la reacción en cadena de la polimerasa (PCR) y la digestión de los
mismos mediante el uso de endonucleasas separando posteriormente los
fragmentos mediante la electrofóresis, esta metodología que aquí planteamos para
producción animal también se utiliza para el estudio de la distancia genética y
variación poblacional, patrones de historia biogeográfica y pruebas de paternidad.

Dentro de los aspectos de la cría de animales como industria se debe tener en
cuenta que cada día, los productos (animales) han de satisfacer las necesidades
de los clientes, para el caso el andar, el pelaje, la certeza de la filiación, la salud
de los animales. Es en este contexto, donde el mejoramiento debe ser entendido,
así pues debemos estar seguros que un animal tiene un paso definido y si esto es
cuantificable mucho mejor, que tiene una capa de pelaje específica que es hijo de
quien queremos. Es sólo, con objetivos que se puede lograr, cada instante se
tienen muchas posibilidades, el criador escoge una de ellas y se ayuda de las
herramientas existentes.

Hasta hoy, los programas de cría animal se han basado en la recolección
cuidadosa de observaciones de características relacionadas con la producción
(leche, carne, huevos, proteína, peso al nacimiento, ganancia diaria, etc.). Estos
registros son analizados mediante sistemas estadísticos y biométricos con el
ánimo de identificar los animales con efecto positivo o negativo sobre estas
características de importancia económica en los sistemas de producción dentro de
una población. Este sistema que se ha usado por años ha permitido avances
insospechados en selección, especialmente en los machos; hoy en el inicio del
siglo XXI, urge el desarrollo y aplicación de nuevos sistemas de selección que
ayuden a complementar los existentes.

Para mejorar los equinos colombianos es necesario utilizar nuevos sistemas que
complementen los métodos de crianza existentes. Los adelantos en genética
molecular han desarrollado técnicas útiles en mejoramiento, una de éstas es la
Selección Asistida por Marcadores Genéticos (MAS) la cual permite evaluar
características deseadas directamente sobre el material genético de animales
nacidos y por nacer; esta técnica se perfila como la opción para la selección de
animales de este siglo. La utilización de esta técnica, adicionada al uso de nuevas
técnicas de reproducción (transferencia de embriones, inseminación artificial,
clonaje, transgénesis) permite que rápidamente se puedan producir hatos enteros
con características genéticas de producción deseables.

El mejoramiento genético en la cría de animales, se ha dado gracias al desarrollo
de sistemas estadísticos sofisticados que analizan la información sobre
características productivas de interés. Estas técnicas han sido de gran ayuda, en
el rápido cambio de las tazas de mejoramiento genético en las poblaciones. Estas
son consideradas formas de acercamiento al material genético, en lo que se
pudiera considerar una caja negra, ya que no se basan en el análisis directo de los
genes que controlan las características. Los rápidos desarrollos han permitido salir
de esta caja y entrar al conocimiento directo de los genes. De los 70000 genes
existentes, el 95% no tienen función conocida. Para algunas características
relacionadas con variación genética, es complicado identificar a los genes
responsables pues usualmente es más de uno. Algunas veces, para acercarse a
estos genes se han utilizado los marcadores genéticos llamados microsatélites.
Otro concepto desarrollado, y descubierto en los últimos años, fue el de los
polimorfismos, en los que dentro del mismo gen o marcador existen diferencias
identificables en sus secuencias, en las 7 diferentes formas de la hemoglobina o 6
formas de almidón.

La mayoría de las características de importancia en selección de animales
domésticos para producción de alimento son cuantitativas, como consecuencia del
fenotipo observado es el resultado de la acción de los genes responsables con el
medio ambiente. El mapeo de estos genes o locus de características cuantitativas
(QTL), está asociado al desarrollo de los marcadores genéticos que faciliten su
localización. Una alternativa para hacer este tipo de análisis es explotar la
asociación que puede existir entre algunas características monogénicas y su
asociación con el QTL sobre el que se hace la selección. Esta asociación puede
venir de la estratificación de la población en donde se observe el efecto
pleiotrópico del gen sobre ambas características. Algunos ejemplos de ello son la
asociación observada entre la hipercalcemia paralítica periódica y el desarrollo
muscular en los caballos cuarto de milla, hipertermia maligna y el síndrome de
stress porcino y la míelo encefalopatía degenerativa proliferativa (enfermedad de
weaver) y la producción láctea.



La producción láctea, es el resultado de la acción de varios genes, esto significa
que los fenotipos tienen una distribución continua como resultado del
funcionamiento de varios QTL que en ocasiones se confunden con los factores
medioambientales. Esta producción tiene una alta heredabilidad (25 – 50%). Se
conoce además los mecanismos de regulación de su expresión tales como tejido,
sexo, estado y edad.

La información genética recopilada acerca de los caballos podría permitir a los
criadores seleccionar características que estén ligadas a un gen o características
múltiples genes como la fertilidad y las características de desempeño, como un
andar determinado, el color, el brío y la alzada, las cuales hacen parte de la
selección genética de un ejemplar ideal para cualquier criador.


Genética del Paso.

Muchas razas de caballos son distinguidas por determinadas características,
ejemplo de ello son las razas seleccionadas por su habilidad para cabalgar, como
es el caso de nuestro paso fino colombiano. Estas características son transmitidas
genéticamente, pero parecen no estar codificadas por un único gen. La herencia
del andar no se ha establecido todavía, pero se conocen dos hipótesis: El andar
esta enmarcado en la herencia poligénica donde una característica está influida
por más de un gen; en este tipo de herencia, un carácter puede ser controlado por
genes de diferentes locus actuando en forma aditiva; esto es mesurable y esta
influido por la genética, pero también por el medio ambiente. La comprensión de
las características de desempeño depende de la capacidad para identificar y medir
los efectos genéticos y ambientales por separado.

Otros autores han sugerido que existen dos genes que producen los diferentes
tipos de andares conocidos, un gen del paso con su gen modificador cuya
herencia es similar a la de los alelos múltiples.

En la herencia del paso fino, algunos autores basados en la crianza de caballos,
han afirmado que este aire es heredado y no aprendido, ya que se distingue de
otras razas, además porque los ejemplares exhiben desde potro el andar y no
necesitan implementos artificiales o de entrenamiento para realizarlos.

Es así como la evaluación cuidadosa de los marcadores genéticos permitirán
proveer información sobre la existencia de marcadores que estén asociados a uno
u otro andar para ser utilizados en selección.

Las pruebas de paternidad nacieron en la evaluación de los grupos sanguíneos de
los animales, dado el gran polimorfismo existente en ellos.

Estas pruebas se hacen mediante evaluación del ADN de los individuos, y se
basan en la comparación de las secuencias de los microsatélites, de los padres
con las de los hijos. De las muestras se extrae el ADN, que se amplifica y se
obtiene un perfil electroforético de la muestra que se quiere analizar y esta se
compara con el perfil existente de los padres, bien sea porque se tomó la muestra
al tiempo o por la existencia del dato en el banco de ADN, y de esta comparación
se da una respuesta sobre la filiación, que es 100% segura en cuanto a la
exclusión y 99.9% segura en cuanto a la inclusión, es por esto que se deben
comparar. Las pruebas han sido diseñadas, en número de marcadores y en
calidad de los mismos para que lleguen al 100%.

Así pues, la prueba se basa en la comparación de los resultados anteriormente
mostrados con los del padre, y gracias a la combinación de todos los marcadores,
el conocimiento de su frecuencia en la población se pueden asignar los valores de
exactitud anteriormente mencionados.


Enfermedades.

Existe una prueba para la Parálisis por Hipercalcemia Periódica en los animales.
Esta enfermedad ha sido reportada en algunas líneas de caballos cuarto de milla y
apaloosa, los animales usualmente muestran una musculatura bien desarrollada,
está caracterizada por ataques de contracciones musculares, con complicaciones
de las vías aéreas que pueden eventualmente causar la muerte. Se ha identificado
la mutación en el gen que regula los niveles musculares de sodio y potasio que
produce la proteína anormal, así que se pueden identificar los animales que la
posean y tomar decisiones frente a la selección de los mismos.
















CAPITULO 6.
SANIDAD EN LOS PLANTELES EQUINOS



Tomada en Pesebrera El Puente - Neiva


Las enfermedades de los equinos son tanto mas fáciles recombatir cuando más
rápido se reconocen una buena salud, enmarcada en un programa estricto de
sanidad, prevención de enfermedades y control de parásitos, es algo que se
considera fundamental para obtener del caballo un rendimiento acorde con su
trabajo.

Además, de seguir un estricto programa que abarque una buena crianza, un
excelente manejo y una alimentación racional y científica.

Un caballo sano es aquel que trabaja bien y a la inversa, es enfermo aquel que no
produce o cuya utilidad se ha disminuido en forma temporal o permanente a causa
de una enfermedad o cualquier otra situación nociva.

El programa de salud será diferente según se trate, de la región o área involucrada
y será diferente de una finca a otra. Sin embargo, los principios serán los mismos.


Cuando por cualquier razón bien sea mecánica, física, química, infecciosa, parasi-
taria, etc., se rompe el equilibrio normal del funcionamiento orgánico del animal, se
produce el estado de enfermedad o no producción, que no es más que la
alteración más o menos grave de la salud y el bienestar del caballo.

El estado de incompetencia o de no producción muchas veces no es absoluto ya
que por ejemplo, un caballo puede padecer una enfermedad, como una infección
leve o una afección ósea (artritis crónica) y ser capaz de realizar una función útil.

Las alteraciones de la salud del equino tienen una causa (etiología), un curso de
solución y reestablecimiento (patogenia), un desenlace probable (pronóstico) y
unos medios de control y tratamiento.


LECCION 26. CABALLOS ENFERMOS VERSUS CABALLOS SANOS.


Descripción:

Existen numerosos determinantes que nos ayudarán a saber si nuestro caballo
está padeciendo cualquier tipo de enfermedad, algo que podremos llegar a saber
realizando un sencillo examen del animal.
Hay dolencias como las heridas, que resultan muy fáciles de localizar y tratar, pero
existen otras que son de carácter interno y por lo tanto es mucho más difícil llegar
a saber de su existencia. A continuación le señalamos una serie de elementos que
le ayudarán a diferenciar entre un caballo sano y otro que presenta alguna
enfermedad.

CABALLO SANO
- Ojos limpios y brillantes.
- Capa brillante, sin caída de pelo.
- A la hora de comer lo hará bien, mascando con facilidad.
- Orina casi transparente o de color amarillo pálido.
- Sus extremidades y cascos deberán estar fríos, sin ningún tipo de
inflamaciones.
- Al andar, repartirá el peso uniformemente entre sus cuatro extremidades
(sin embargo, tenga en cuenta que el cambio constante del peso de una
extremidad a otra, sobre todo en las delanteras, no es un buen síntoma.
- Su temperatura correcta se sitúa alrededor de los 38ºC.
- Su pulso, en reposo, oscilará entre las 36 y 42 pulsaciones por minuto.
- Su respiración, también en reposo, variará entre las 8 y las 12 inspiraciones
por minuto, debiendo hacerse con suavidad y sin esfuerzo. CABALLO
ENFERMO:
- El aspecto general de un caballo enfermo es de abatimiento y tristeza.
- Las orejas estarán caídas hacia atrás, la cabeza baja y los ojos se
mostrarán inexpresivos y apagados (incluso en ocasiones presentaran
secreción).
- Su pelo habrá perdido el aspecto brillante y se mostrará opaco.
- En caso de que se observe que se echa sin un motivo claro, se debe tener
en cuenta que es un síntoma de enfermedad.
- Si se observa que escarba, que suda mucho y que se muestra inquieto, se
hará ver por un veterinario, puesto que todos ellos son síntomas de un
cólico.
- Para determinar la existencia de una contusión, se palpara la zona, ésta
existirá si observamos calor (en ocasiones vendrá acompañada de una
clara inflamación).
Aunque las cojeras pueden resultar evidentes, en ocasiones resulta difícil concluir
en qué extremidades se encuentra la dolencia, para poder ponerle solución. Una
forma de saberlo es la siguiente:
o En primer lugar miraremos los cascos, tratando de ver si alguno está
caliente o si existe alguna herida o piedra encajada.
o Después se palpara toda la extremidad.
o A continuación, haremos que el caballo trote, teniendo en cuenta lo
siguiente: si la cojera se encuentra en los anteriores, bajará la cabeza al
cargar el peso en la mano buena y la levantará al pisar con la mano que
le produce dolor. En caso de que la cojera se encuentre en las
extremidades posteriores, el corvejón y la cadera del pie afectado
parecerán levantarse más al pisar.
Para obtener un mejor conocimiento del tema y con fines prácticos y descriptivos
las enfermedades de los caballos se pueden clasificar según los agentes que las
producen. Las enfermedades del equino pueden ser:

 Infecciosas.
 No infecciosas

Las enfermedades infecciosas son las causadas por microorganismos o
gérmenes. Existen tres grupos principales de microorganismos:

• Virus.
• Bacterias.
• Hongos.

Las Enfermedades No infecciosas son las causadas por agentes diferentes a los
anteriores o por trastornos del metabolismo normal del caballo, lo que incluye las
enfermedades carenciales o nutricionales. Las enfermedades parasitarias son un
buen ejemplo. Los parásitos son organismos que viven a costa de otros, sin que
necesariamente les perjudiquen ni por lo general les ocasionen la muerte. En este
sentido, se diferencian de los microbios, aunque algunos producen efectos graves
que pueden tener consecuencias fatales, en casos extremos.

Dentro de este grupo de enfermedades podemos ubicar también las ocasionadas
por sustancias y plantas tóxicas que causan envenenamiento y cambios
corporales al ser ingeridas por los animales o sea, administradas voluntaria o
involuntariamente por el hombre.


ENFERMEDADES INFECCIOSAS..

Son aquellas provocadas por microorganismos nocivos (gérmenes o microbios)
que ante situaciones favorables ingresan al organismo desde el exterior o estando
en él se multiplican e invaden el cuerpo hasta causar daños en la estructura de
células y tejidos.

Esta propiedad de invadir y multiplicarse se conoce con el nombre de virulencia y
se aprecia en la práctica por la gravedad de la enfermedad que produce y la
facilidad con que esta se Propaga y se establece en la población equina.

La resistencia que el organismo opone ante la agresión de los agentes infecciosos
se conoce como inmunidad, y se establece mediante la capacidad de algunas
células especiales del cuerpo para producir, por un lado, sustancias protectoras
(anticuerpos) que neutralizan al microbio invasor, y por otro atacarlo ellas mismas,
englobándolo y destruyéndolo.

Esta resistencia o inmunidad se puede desarrollar asimismo mediante vacunas.
En este caso es inmunidad artificial, pero su modo de actuar es similar al de la
inmunidad natural.

Las vacunas son fabricadas contra virus estrictamente. Las bacterianas se
preparan contra bacterias.

Independientemente de la resistencia o inmunidad, los caballos y demás animales
varían en su respuesta a la infección debido a muchos factores que hacen al
organismo susceptible (factores predisponentes).
ENFERMEDADES VIRALES.


Equinos enfermos de Anemia Infecciosa Equina
www.viarural.com.ar

En el siguiente cuadro se resumen las principales enfermedades ocasionadas por
virus, sus principales síntomas y el agente causal identificado hasta el momento.

Tabla 20. Enfermedades Causadas por virus.
ENFERMEDAD SINTOMAS
PRINCIPALES
VIRUS CAUSAL
Anemia Infecciosa Fiebre, anemia, edemas
en las piernas y regiones
declives
Retrovirus (lentivirus)
Encefalitis Equina
Venezolana
Depresión, fiebre,
incoordinación,
comportamientos
anormales 50- 90% de
mortalidad.
Togavirus
Encefalitis Equina del Este Mismos de la anterior Togavirus
Estomatitis Vesicular Salivación excesiva,
fiebre, vesículas en
lengua, boca y labios.
Rhabdovirus
Rabia Comportamiento agresivo,
Parálisis.
Rhabdovirus
Influenza Equina Tos seca continua, fiebre,
depresión
Orthomyxovirus
Linfosarcoma Depresión del sistema o
sistemas involucrados.
Retrovirus (Oncovirus C)
Las anteriores son las enfermedades virales equinas que se consideran
prevalentes o sea que su presencia en nuestro país se mantiene en el tiempo,
habiéndose aislado el agente causal en alguna oportunidad en animales nativos.
La Encefalitis Equina Venezolana y la Rabia se consideran además enfermedades
zoonóticas o sea que se pueden transmitir al hombre por el contacto con los
animales. Existen campañas de vacunación en las zonas en donde se ha
comprobado su presencia, para Encefalitis Equina Venezolana, Influenza y Rabia.

Además de las anteriores existe sospecha (por algunas evidencias) de la
presencia en Colombia de otras enfermedades virales como:

• Encefalitis Equina del Oeste.
• Bronquitis Infecciosa y Traqueó bronquitis.
• Parainfluenza 3.
• Aborto equino por Herpes virus
• Papilomatosis
• Diarreas ocasionadas por Reovirus y Rotavirus


ENFERMEDADES BACTERIANAS.

Equino con tétano
www.apaelrefugio.com

En el siguiente cuadro se resumen las principales enfermedades ocasionadas por
bacterias, sus síntomas y el agente causal identificado hasta el momento.

Tabla 21. Enfermedades Causadas por Bacterias.
ENFERMEDAD SINTOMAS PRINCIPALES AGENTE CAUSAL
Adenitis Infecciosa,
Distemper o
Papera
Fiebre, catarro nasal, descargas de
moco y pus, engrosamiento de
glándula submaxilar y parótida
Abscesos.
Streptococcus
(zooepidermicus, y
equi)
Shigelosis
(Actinobacilosis).
Fiebre, somnolencia, postración,
dificultad para amamantarse, debilidad
en potros.
Shigela equirulis.
Salmonelosis
(Paratifosis)
Fiebre, Inflamación del intestino
(enteritis), diarrea sanguinolenta,
deshidratación, alta mortalidad, artritis,
aborto, neumonía.
Salmonella
(thyphmurium,
enteridis, branderis,
abortus)
Enterotoxemia
(síndrome
complejo)
Fiebre, signos de cólico, intoxicación,
postración, muerte
Clostridium
(perfringens y
welchi).
Edema Maligno Edema subcutáneo en glande y
regiones bajas, fiebre, inapetencia.
Clostridium septicum
Brucellosis (Talpa) Rigidez, cojeras, procesos supurativos
en cruz y cabeza, abortos (son raros)
Brucella (abortus y
suis)
Necrobacilosis Cojeras, inflamación de la suela del
casco, postración, inapetencia.
Spherophorus
necrophorus
Tétanos Mortalidad alta, signos nerviosos,
rigidez.
Clostridium tetani
Púrpura
Hemorrágica
(autoinmune)
Edemas en cabeza y miembros,
postración, anasarca, fiebre.
Streptococcus
Estreptolisinas.
Leptospirosis Fiebre, ictericia, anemia. Leptospira (pomona,
icterohemorrágica)

Las anteriores son enfermedades bacterianas prevalentes en los equinos de
nuestro medio. La salmonelosis, la Leptospirosis y la Brucelosis se consideran
asimismo enfermedades zoonóticas.
Existe sospecha que en el país existen otras enfermedades bacterianas tales
como:
o Tuberculosis (Mycobacterium tuberculoso).
o Linfangitis ulcerativa (Corynebacterium equi)
o Botulismo (Clostridium botulium)
o Metritis contagiosa (Haemophilus equigenitalis).

Es de aclarar, que los nombres listados corresponden al nombre técnico de la
enfermedad, y que el mismo proceso patológico puede conocerse bajo diversos
nombres regionales, por ejemplo: Necrobacilosis, “panadizo” “mazamorra” etc.
ENFERMEDADES MICÓTICAS O PRODUCIDAS POR HONGOS.


En el siguiente cuadro se presentan las principales enfermedades producidas por
hongos (micosis), sus principales síntomas y el agente causal identificado hasta el
momento.


Tabla 22. Enfermedades Causadas por Hongos
ENFERMEDAD SINTOMAS
PRINCIPALES
AGENTE CAUSAL
Rhinosporidiosis Masas blandas y
sangrantes en mucosa
nasal, pólipos
Rhinosporidium seeberi.
Mucormicosis Lesiones en piel de los
miembros costras,
necrosis, rasquiña.
Mucor
Ficomicosis (Espundia) Masas tumorales de mal
olor, exudados, necrosis,
rasquiña.
Hyphomyces
Dermatofitosis (Tiña) Lesiones circulares
cubiertas de costras que
descaman y ulceran
Microsporum Trichofyton
equinus, mentagrofites,
verrucosum


ENFERMEDADES MICOTICAS DEL EQUINO

Las anteriores son las que se consideran prevalentes y pueden transmitirse, por
contacto al ser humano (zoonosis), además se sospecha que en el país existen
otras enfermedades micóticas tales como:

Diarrea micótica por Aspergillus (flavus, fumigatus).
Streptotricosis cutánea (Dermatofilus)
Candidiasis o Moniliasis (Candida albicans)
Linfangitis epizoótica (Histoplasma).

ENFERMEDADES PARASITARIAS.


Strongylus vulgaris
http://uy.merial.com

Los parásitos son organismos que pueden pasar parte de su desarrollo en estado
de vida libre, esto es, sin estar asociados al huésped. Su existencia como
parásitos transcurre dentro del cuerpo del huésped (endoparásitos) o en la
superficie del cuerpo (ectoparásitos).

Los endoparásitos más comunes son:

- Helmintos (Pluricelulares)
- Protozoarios (Unicelulares).

Los Helmintos a su vez pueden ser:
• Nematodos
• Trematodos
• Cestodos

Los ectoparásitos o parásitos externos son estudiados y clasificados por la
parasitología y además de ser organismos pluricelulares poseen características
que los diferencian claramente de los demás como son:

• Exoesqueleto (cutícula)
• Cabeza, Tórax y Abdomen definidos.

Los parásitos externos pueden ser:
• Ácaros
• Garrapatas
• Piojos
• Dípteros (moscas)


A continuación se presentan las principales enfermedades producidas por
parásitos internos y externos de los equinos en Colombia, con sus síntomas
principales y el agente causal identificado hasta el momento. Como en los cuadros
anteriores se presentan solamente las parasitosis que se consideran prevalentes y
luego se listan las que se sospecha existen en el país.


ENFERMEDADES PARASITARIAS INTERNAS: PROTOZOARIOS


Tabla 23. Enfermedades Causadas por Protozoarios
ENFERMEDAD
SINTOMAS
PRINCIPALES
AGENTE CAUSAL
Trichomoniasis

Diarreas crónicas.
Giardiasis

Diarreas en potros,
postración,
deshidratación.

Giardia
Amebiasis

Diarreas súbitas, cólico Entamoeba
Coccidiosis

Diarreas crónicas, cólico Eimeria
Babesiosis Depresión, ictericia,
edema de los miembros,
anemia, anorexia.

Babesia Natalia
Trypanosomiasis Fiebre, edema de los
genitales y de las
extremidades.

Trypanosoma
Sarcosistosis Ninguna apreciable

Sarcocystis
Toxoplasmosis Fiebre en algunos casos,
la mayoría de veces nada
apreciable.
Toxoplasma

ENFERMEDADES PARASITARIAS INTERNAS: HELMINTOS (NEMATODOS –
CESTODOS)


Tabla 24. Enfermedades Causadas por Helmintos
ENFERMEDAD SINTOMAS PRINCIPALES AGENTE CAUSAL
Ascariasis Diarrea en potros, cólico
perforación del intestino,
bronconeumonía.

Parascaris
Habronemiasis Dermatitis, heridas ulcerosas,
necrosis de la piel.
Granulomas, (tumores)

Habronema
Strongylosis Disnea, adelgazamiento, cólico
(peritonitis)

Strongylus
Onchocercosis Dermatitis, rasquiña, alopecia
(caída del pelo)

Onchocerca
Oxyuriasis Rozaduras perianales

Oxyuris
Dictyocaulosis Cólicos, tos, disnea, catarro
intestinal.

Dictyocaulus
Filariasis Conjuntivitis, lagrimeo

Parafilaria, Setaria
Parasitismo Intestinal Cólicos, diarreas,
adelgazamiento, mal pelaje.
Triodontophorus
Strongyloides,
Trichostrongylus
Cestodiasis Ulceraciones de la mucosa
intestinal inflamación catarral.
Perforaciones del ciego.

Anoplocephala,
Paranoplocephala
Parasitosis Intestinal Cólicos leves, adelgazamiento,
catarro intestinal.

Posteriostomun
Trichonema


ENFERMEDADES PARASITARIAS EXTERNAS: ARTROPODOS-


Garrapata
www.colvet.es

Tabla 25. Enfermedades Causadas por Artrópodos
ENFERMEDAD SINTOMAS PRINCIPALES AGENTE CAUSAL
Sarna ACAROS Engrosamiento de
la piel, pérdida de pelo,
irritación
Psoroptes, Sarcoptes
Infestación por
Garrapatas
GARRAPATAS Irritación,
inflamación de la piel, anemia,
adelgazamiento, transmisión
de otras enfermedades.
Ixodes, Dermacentor,
Rhiphicephalus,
Amblyoma, Boophilus.
Infestación por Piojos PIOJ OS Irritación, inflamación
de la piel, picor, pérdida de
pelo
Trombicola, Trichodectes,
Haematopinus, Damalinea.
Infestación por
Moscas
DIPTEROS Picaduras,
irritación, inflamación de la
piel, excitación y malestar, son
vectores de otras
enfermedades.
Dermatobia, Stomoxys,
Tábanos.
Parasitismo Gástrico Adelgazamiento, cólicos,
(gastritis), perforación del
estómago, Hemorragias del
estómago.
Gastrophilus

Algunos parasitismos que se consideran sospechosos de existir en el país son:

• Hypodermiosis (Hypoderma)
• Schistosomiasis (Schistosoma)
• Parasitismo ocular por Thelazia.
LECCION 27. PROGRAMA GENERAL DE SANIDAD EQUINA.

Las enfermedades que se presentan en los planteles equinos dependen en gran
medida de la forma en que los animales se manejen, se alojen, el trabajo que
realicen y del programa de prevención de enfermedades que se lleve a cabo. El
objetivo de toda medida de prevención es el mantenimiento de la salud animal. La
seguridad en la conservación de la salud depende en alto grado, de la observación
cuidadosa de las normas de procedimiento (manejo) y de las normas de higiene y
es un error hacer recaer toda la responsabilidad en el programa de vacunación
para las distintas enfermedades. Las vacunaciones son necesarias en los
planteles equinos, pero la anulación de las infecciones y la protección más eficaz
se consigue primordialmente por las medidas higiénicas.


Todo buen cuidador de caballos deberá cerciorarse periódicamente, como marcha
su caballada constatando a manera de ejemplo, algunas características o signos
de salud que serían de gran valor en la identificación precoz de los problemas
sanitarios. Se concentrará en:

- Apreciar el estado del pelaje de sus caballos, lo cual le permitirá conocer si
está mudando o si éste es suave, brillante, o por el contrario es áspero,
opaco, seco y grueso.
- Observar si los ojos del caballo son brillantes y alertas o están opacos,
apagados, con secreciones, lágrimas, parásitos externos, etc.
- Constatar el estado de carnes de sus caballos y definir una posible carencia
nutricional o deficiencia en minerales y vitaminas, o cualquier otro tipo de
deficiencia.
- Apreciar las extremidades viéndolo desplazar, observará si rehúsa pararse
en sus cuatro patas o si cojea. Podrá mirar si existen articulaciones
inflamadas, cicatrices o heridas regulares o mal curadas y se asegurará del
buen estado y la conservación de los cascos.
- En relación con sus órganos internos podrá apreciar si sus caballos tosen
cuando se ejercitan o trabajan, la forma como respiran y si toleran o no el
trabajo o el ejercicio.
- Si sus caballos no comen bien puede ser que su sistema digestivo no
funcione correctamente. Observará el estiércol en donde podrá apreciar si
existen parásitos adultos o restos de comida sin digerir Hará un examen
rutinario de la boca y en ella podrá ver si los dientes están causando
problemas o si existen malos olores (caries) muchas veces mediante el uso
de escofinas o limas resolverá la presencia de aristas cortantes o de
sobredientes que irritan e impiden la correcta masticación.
- Se preguntará si existen problemas reproductivos, baja fertilidad de su
semental, abortos en sus yeguas, muertes en los recién nacidos, etc.
- Por último revisará el calendario de vacunación y los programas de
vermifugacion y realizará los ajustes pertinentes.

El técnico encargado podrá investigar estos puntos, además de muchos otros y se
asegurará que toda la caballada esté en óptima condición física y en disponibilidad
para las labores o trabajos según la función específica.


CUARENTENA.



http://caballospastoreo.galeon.com/productos766741.html


La práctica de aislar y observar los individuos recién llegados a la finca, es de
suma importancia para evitar la entrada y diseminación de enfermedades. En
muchos casos esta práctica requiere de instalaciones y equipos costosos y por lo
tanto deja de realizarse sobre todo cuando los caballos proceden de lugares cuya
situación sanitaria es conocida. En la medida en que se pueda realizar, los
animales nuevos (yeguas y sementales visitantes) deberán aislarse por un período
de tres semanas antes de juntarlos al resto de caballos. Durante este lapso el
Médico Veterinario podrá observarlos, realizar exámenes de sangre, orina y
heces, para investigar posibles parásitos, vacunará aquellos que no lo estén con
las mismas vacunas usadas en la finca huésped, hará un buen examen general y
genital de las yeguas de cría e instaurará tratamiento si es conveniente.
Igualmente, se exigirá a los ejemplares visitantes (yeguas para ser servidas) un
certificado de salud realizado por un Médico Veterinario.




EMPLEO RACIONAL DE MEDICAMENTOS

El empleo de medicamentos debe hacerse bajo indicación y vigilancia del Médico
Veterinario, lo cual es requisito fundamental. Sobre este aspecto hay que ser
rigurosos. Muchos medicamentos son potencialmente peligrosos si son sobre
dosificados y otros provocan reacciones secundarias impredecibles. Cabe decir
aquí que el caballo, como ningún otro mamífero, es sumamente sensible a los
efectos colaterales de los distintos fármacos y puede morir como consecuencia de
un rechazo de su organismo a la droga, lo que se conoce como anafilaxis. Antes
de abordar cualquier tratamiento el especialista deberá reflexionar sobre los
siguientes aspectos:

- Si el caso clínico planteado amerita o no tratamiento.
- Si el tratamiento instaurado o por instaurar puede llegar a ser perjudicial y
cuáles pueden ser los efectos colaterales que ocasione.
- Si el tratamiento es costoso y el estado del animal y las aspiraciones de su
dueño justifican ese costo.
- Si los efectos benéficos que se esperan justifican su uso.
- Si en cambio de tratar es mejor sacrificar al animal (alto costo del
tratamiento, mal pronóstico, etc.)

Los principios generales que gobiernan el uso de medicamentos deben basarse
en la experiencia diaria, como guía podríamos señalar:

Evaluar cuidadosamente las ventajas de los productos a emplear, siendo objetivo
y sin dejarse abrumar y confundir por el mar de folletos que los fabricantes de
productos farmacológicos hacen llegar o remiten por correo.
El tratamiento prescrito debe ser práctico, es decir, teniendo en cuenta su costo y
la facilidad de su administración.
Definir si el tratamiento es realmente médico o por el contrario es quirúrgico. Por
ejemplo, ante un caso de parálisis laríngea (hemiplejia) es inútil el empleo de
fármacos y la indicación es el tratamiento quirúrgico.
Actuar decididamente bien sea tratando mediante medicamentos o sometiendo el
animal a un procedimiento quirúrgico. El especialista debe evitar las situaciones
que le hicieran desear no haber iniciado el tratamiento, y que creen confusión y
desconcierto en propietarios y manejadores.
En ningún caso se justifica el hacer sufrir al animal, ni gastos inútiles a su
propietario. Por lo tanto, y aunque la norma es siempre intentar realizar un
tratamiento, el especialista sopesará la situación y sin pretender formular reglas
fijas al respecto, podrá definirse por el sacrificio del animal cuando la realidad así
lo amerite. Cuando un animal se sacrifica por razones humanitarias se afirma que
se ha sometido a Eutanasia.
Cuando se vaya a utilizar cualquier medicamento, previamente se deben leer las
instrucciones del empaque y del medico veterinario que lo receto, para de esta
forma determinar:

- Dosis.
- Frecuencia de administración.
- Forma de administración.
- Presentación del fármaco.
- Posibles respuestas adversas o efectos colaterales.
- Precauciones.
- Antídotos.
- Fecha de vencimiento del fármaco.
- Tener en cuenta la medicación preexistente.

En cuanto a los factores que influyen en el suministro del fármaco y su siguiente
acción y efecto a nivel del animal, se debe tener en cuenta los siguientes
aspectos:

- Estado físico del animal.
- Peso del equino.
- Edad.
- Sexo.


A continuación mencionaremos algunos de los medicamentos de mayor utilidad en
un botiquín veterinario especializado en equinos:

- Antihistamínicos: utilizados para contrarrestar reacciones alérgicas.
- Antibióticos: son para contrarrestar infecciones específicas, en especial los
de amplio espectro.
- Antinflamatorios: se utilizan para disminuir la inflamación los encontramos
para aplicación tópica y endovenosa, se debe tener en cuenta la condición
del individuo antes de la aplicación.
- Diurético: contribuye a la eliminación de líquidos retenidos.
- Sueros hidratantes: son soluciones salinas útiles en la recuperación de
líquidos y electrolitos en un animal deshidratado.
- Analgésico: Para contrarrestar fiebre y dolor.
- Tranquilizantes: con el objeto de aminorar grados de excitación en los
animales.
- Anestésico: Para inhibir el dolor en un área determinada o en forma general
durante una intervención quirúrgica, o actividad que así lo requiera.
- Antídotos: Para impedir la muerte por envenenamiento, de acuerdo al
agente toxico así mismo es el tipo de antídoto.
- Antidiarreico: Para detener la diarrea.
- Vermífugos: Existen gran variedad de acuerdo al parasito infestante y su
función es la eliminación de estos.
- Insecticida: Su función es la eliminación de ectoparásitos y la posible
infestacion de otros.
- Coagulantes: Ayuda al proceso de coagulación sanguíneo en heridas.
El tiempo de coagulación de los equinos puede durar hasta:
a) Caballos de tipo pesado: 30 minutos.
b) Caballos de tipo liviano: 22 minutos.
c) Ponnis: 15 minutos.
Si se sobrepasa este tiempo se debe aplicar el coagulante para ayudar en
el proceso.
- Cicatrizante: Acelera el proceso de cicatrización de las heridas.
- Desinfectantes: Se utiliza en la desinfección de heridas o superficies
corporales además de usarse en la desinfección de implemento e
instalaciones.


CÓMO ADMINISTRAR LOS MEDICAMENTOS.

Los medicamentos se pueden administrar a los caballos por distintas vías: Oral
(bucal), Parenteral (inyecciones), Vaginal y Uterina, Rectal y Externa (tópica).

Oral (bucal): Por lo general los caballos son reacios a ingerir alimentos en los que
se haya mezclado medicamentos. Cuando se tratan cólicos, es necesario
administrar grandes cantidades de líquidos. Muchas veces las cantidades de
líquidos son pequeñas (vermífugos en jeringas dosificadoras) la administración es
relativamente

fácil, aprovechando las comisuras labiales amplias y obrando con
alguna rapidez. Los grandes volúmenes sin embargo requieren el uso de un tubo
de plástico (sonda) que se hace pasar hasta el estómago a través, del conducto
del esófago. Uno de los extremos puede tener una abertura lateral y el otro es de
forma cónica con el objeto de poder insertar en él embudos o botellas. Antes de
emplear la sonda, esta se lubrica con aceite o agua y se introduce por uno de los
ollares. Un asistente debe sujetar al animal por el lado contrario al que se sitúe el
operador que introduce la sonda. Esta maniobra es delicada y requiere un cierto
grado de destreza. El peligro radica en pasarla a la tráquea y no al esófago e
inadvertidamente administrar los líquidos con resultados fatales pues se
provocaría una neumonía por cuerpo extraño.

Algunos medicamentos se pueden administrar en forma de polvo o triturados
(pastas) mezclados con alimentos, en cantidades pequeñas para evitar el rechazo
por parte del animal.

Parenteral (inyecciones): En los equinos las inyecciones pueden ser por punción
venosa (intravenosa), o por punción directa en la masa muscular (intramuscular), o
por aplicación directa debajo de la piel (subcutánea).

Aplicación intravenosa o endovenosa: Se utiliza comúnmente la vena yugular la
cual es fácil de localizar en la tabla del cuello del caballo. En el punto elegido
deberá aplicarse, antes y después de realizarla, un antiséptico (preferiblemente
alcohol), incluso a pesar de la opinión de los que sostienen su falta de efectividad
frente a las posibles infecciones.

El calibre de la aguja debe ser 18 o 19 con una longitud entre 3 y 5 centímetros.

Ante las posibles reacciones del caballo es recomendable sujetar éste
adecuadamente e impedir que se mueva aplicando un torniquete en su labio
superior y apretando suave pero firmemente, utilizando el instrumento denominado
axial.

La yugular se dilata ejerciendo presión en las proximidades del punto elegido para
insertar la aguja. Siempre hay que tener la precaución de clavar la aguja y, luego
introducir rápidamente la jeringa. Es muy importante evitar que junto con el
medicamento entren burbujas de aire en la vena.

Aplicación intramuscular: Los puntos más adecuados para la inyección
intramuscular se sitúan por orden en: el cuello (tabla del cuello), la grupa y la
espalda. En el caso concreto de los potros puede usarse la masa muscular que
forman el tríceps o bíceps femoral (miembro posterior). Una vez insertada la aguja,
ésta no debe moverse ya que se favorece la presentación de hemorragias. Si
después de clavar la aguja, sale sangre a través de ésta, se aconseja retirarla e
insertarla en otro sitio de los indicados. La higiene en la aplicación de las
inyecciones intramusculares en el anca y la tabla del cuello previene la entrada del
Clostridium y otros gérmenes que son causantes de gangrena gaseosa y necrosis
muscular. El uso de un antiséptico en el sitio de punción y el empleo de agujas
desechables elimina casi por completo esta posibilidad.

Inyecciones subcutáneas: Son menos frecuentes en el caballo. De preferencia
se inyecta en sitios de piel floja y delgada (tabla del cuello, pecho) o detrás de la
paleta. Las medidas higiénicas señaladas anteriormente son aplicables
enteramente en este caso.

Intratraqueal: En casos de absoluta necesidad se puede emplear esta vía
intratraqueal o sea colocando el medicamento directamente en la luz de la tráquea
o “guargüero” con una jeringa y agujas común y corriente. El sitio indicado debe
buscarse por debajo del cartílago de la laringe, penetrando primero en la piel y
procurando luego introducir la aguja en la unión o espacio entre dos anillos
traqueales. Solo en casos de urgencia (obstrucción de vías aéreas superiores)
debemos utilizar esta vía.

Inyecciones lntramamarias: Aunque la inflamación de la glándula mamaria en la
yegua no es tan frecuente como en el bovino, en ocasiones es necesario aplicar
medicamentos en el interior de la mama. Previa limpieza del área se utiliza un
medicamento Contra la mastitis que por lo general viene empacado en una jeringa
u otro envase provisto de una cánula, la cual se introduce en el canal del pezón
del cuarto o cuartos afectados. Es aconsejable desocupar en lo posible la mama
antes de introducir la cánula.

Vía vaginal y uterina: Cuando se comprueban infecciones vaginales o uterinas se
recomienda introducir los medicamentos directamente en el órgano afectado. En
estos procedimientos se debe aplicar la más estricta higiene si no queremos
agravar el problema. La cola de la yegua debe sujetarse con una venda elástica
limpia y sus cuartos traseros deben lavarse con agua y jabón y luego se les debe
aplicar un desinfectante (preferiblemente productos a base de yodo, diluidos). Se
pueden usar productos líquidos o sólidos. Cuando se trata de infecciones uterinas,
los medicamentos se introducirán lo más profundamente posible. Los
medicamentos líquidos se introducen por medio de una cánula o un tubo plástico
(manguera) los cuales deben estar previamente hervidos y desinfectados. Los
medicamentos sólidos se introducen con la mano la cual estará asimismo bien
lavada con agua y jabón y desinfectada. Por lo complejo del procedimiento y los
riesgos que conlleva este debe hacerse por un técnico especializado o bajo
vigilancia directa del Médico Veterinario, o de lo contrario debe destacarse esta
opción.

Vía rectal: Cuando se introducen líquidos por un tubo plástico a través del recto el
procedimiento se denomina Enema. Los líquidos pueden ser medicamentos o
agua jabonosa solamente. También pueden introducirse medicamentos sólidos
como supositorios, bolos o tabletas con ayuda de una mano. Para que el
medicamento permanezca en el recto es conveniente limpiar o desocupar éste
previamente de la materia fecal acumulada sacándola con la mano.
La administración de agua jabonosa y medicamentos líquidos por vía rectal es
muy usada en casos de cólico en el caballo.

Externa (tópica): Esta forma de aplicar medicamentos tiene diversos fines:
Tratamiento local de heridas.
Tratamiento local contra parásitos externos.
Uso de anestésicos locales
Uso de sustancias irritantes o rubefacientes.

Cuando se van a realizar muestreos de sangre se debe llevar a cabo los
siguientes pasos para evitar lastimar al equino y entorpecer la labor:

- Presionar con el pulgar la vena yugular en su parte inferior.
- Introducir la aguja de abajo hacia arriba en la piel hasta llegar a la vena.
- Comprobar la ubicación de la aguja, al salir sangre por el extremo de esta.
- Se conecta el tubo de ensayo a la aguja y se deja llenar de sangre hasta
obtener dos tercias partes llenas.
- Se retira la aguja de la vena del animal.
- Se quita la aguja al tapon del tubo de ensayo y la muestra se deja reposar
en posicion inclinada de 60 grados, para favorecer la separacion del suero,
si asi el tipo de examen lo exige.
- Una vez reposada la muestra esta debe ser refrigerada hasta ser llevada al
laboratorio clinico.

Los medicamentos a usar pueden aplicarse como polvos, líquidos, ungüentos,
pomadas o pastas. Cuando se traten heridas en el caballo es conveniente lavarlas
muy bien y aplicar un desinfectante no irritante. Al colocar una venda debe
hacerse de tal forma que no impida la circulación sanguínea en la zona.

Un medicamento aplicado por cualquier vía, se dice que tiene acción sistemática
cuando es absorbido en la sangre y transportado por ella a todo el organismo y
puede actuar en cualquier sitio específico en donde se le requiera.


PROGRAMA DE VACUNACIÓN.


http://uy.merial.com
Un programa de vacunación se hace para, mediante el uso de unas series de
productos biológicos (vacunas, bacterianas) prevenir a una población de animales
de las enfermedades presentes (prevalentes) en la zona donde habita o habitará.
En consecuencia se deben tener en cuenta muchos factores entre los que
destacaremos:

- De diagnóstico: Cuáles enfermedades realmente existen en la región.
- Epidemiológicos: Animales afectados, edad, localización de la finca,
población en riesgo.
- De Patogenia de las enfermedades: como se desarrollan, cuál es su curso,
etc.
- Ecológicos: Medio ambiente propicio o no al desarrollo de enfermedades.

Para la prevención de una enfermedad mediante vacunas en una población, se
requiere inicialmente la previa y absoluta comprobación de su existencia en un
área determinada, lo que incluye diagnósticos precisos (por patología y
microbiología) positivos y ojala el aislamiento del germen o microbio acusado de
ser el causante y lograr la reproducción de la enfermedad problema con base en el
patógeno aislado, Por lo tanto no podemos diagnosticar una enfermedad a la
ligera y vacunar ciegamente porque expondríamos no solo a nuestros propios
animales, sino a todos aquellos susceptibles de la región. Pero incluso teniendo un
diagnóstico preciso hay que entrar a considerar Otros factores antes de
emprender una vacunación.

Cuántos animales son los afectados, cuál es su edad?; podemos aislarlos de los
demás?; es posible sacrificar los enfermos en beneficio de los sanos? existen
animales distintos a los caballos también afectados?; Hay muchos animales
silvestres en la región donde habitan los caballos? hay muchas moscas o
mosquitos en la finca; etc.

Un programa tentativo de vacunación para el territorio colombiano teniendo en
cuenta la presencia o no de las enfermedades mencionadas en las distintas
regiones previa comprobación como se nombró antes) sería:

Encefalitis Equina Venezolana: vacunar a los cuatro meses y revacunar cada año
(Costa Atlántica) pero en áreas de de altas infestaciones de mosquitos repetir con
mas frecuencia.

Tétano: Vacunar a partir de los 3 - 4 meses da edad y revacunar al año (toxoide
tetánico). Y al nacer el potro, solo si la madre no fue vacunada contra tétano antes
del parto.

Rabia: Vacunar a los cuatro meses y revacunar cada dos años según las
necesidades de la región (zonas problema, costa).

Influenza Equina: Vacunar a los tres meses, repetir tres meses más tarde, reforzar
cada año, solamente en áreas donde se ha comprobado su existencia (Sabana de
Bogotá).

Papera: Aplicar dos vacunas a intervalos de un mes solamente en áreas de alta
incidencia (Sabana de Bogotá, Valle de Aburra).



FACTORES A TENER EN CUENTA PARA OBTENER MEJORES RESULTADOS
EN LA VACUNACION.


Hay varios factores ha tener en cuenta en la eficacia de una vacuna como lo son
la exposición a los agentes patógenos, la selección del mejor producto, la
aplicación de la vacuna en el momento indicado de acuerdo a las condiciones
fisiológicas del animal.

Una vez aplicada la vacuna esta genera en el animal una respuesta inmune que
puede durar semanas o meses. Con algunas se puede requerir de revacunaciones
para obtener el efecto esperado.

Cada vacuna presenta su propio tiempo de inmunidad, por lo que se debe tener en
cuenta la duración de su efecto, para saber cuando realizar la revacunación.
Un equino que presenta los síntomas o que ya esta incubando la enfermedad no
desarrollara los efectos esperados de la vacuna contra esta. El tiempo ideal para
vacunar un animal es cuando este aun esta libre de la enfermedad, bajo relativo
poco estrés y en buenas condiciones físicas, pues se ve incrementada su
respuesta inmune y por mayor tiempo.

La vacuna debe haberse manejado de forma adecuada sobre todo con buena
refrigeración y en la dosis recomendada por la casa farmacéutica a la cual
pertenece.

Si entre los 15 días de la aplicación de la vacuna el animal padece una infección
de cualquier tipo y es necesario el tratamiento con antibióticos inyectados, no se
puede esperar que la eficiencia de la vacuna sea total, por lo cual conviene
revacunar después de que se haya terminado la acción del antibiótico en el
metabolismo del equino.



CONTROL DE PARÁSITOS INTERNOS Y EXTERNOS DEL CABALLO.


Ciclo de infestacion parasitaria.


Un buen propietario de caballos debe asumir decididamente un adecuado
programa de desparasitación de sus animales, ojala en épocas específicas del
año, donde se presentan las mayores incidencias parasitarias. En nuestro país,
por la gran variedad de climas y pisos térmicos existen épocas definidas de
invierno (período de lluvias) y de verano (temporada seca).

Por ejemplo, en la Costa Atlántica y la Hoya del Río Magdalena normalmente los
meses picos de invierno son Abril y Octubre y los de más intenso verano son J ulio
y Diciembre. La mayor incidencia de parásitos se presenta por lo general en los
meses de Mayo y Noviembre. En la Sabana de Bogotá la mayor carga parasitaria
se presenta en J unio y en Diciembre y Enero, es decir, después de las lluvias de
Abril y Mayo y de Octubre y Noviembre. La recomendación sería atacar los
parásitos después de las lluvias, lo anterior es simplemente para indicar solo uno
de los aspectos a contemplar en un programa de desparasitación.

Normas generales de importancia en el control de parásitos.

Existen varias normas de aplicación universal que se deben tener en cuenta
cuando se utilizan drogas antiparasitarias en el marco de un programa de control.
Son las siguientes:

Todos los equinos de la finca deben incluirse en el programa. Muy poco
conseguimos, si por ejemplo-las yeguas infértiles, los ponies (si se tienen), los
asnos y las mulas no se vermífuga simultáneamente con el resto de caballos.
Continuarán contaminando los pastos, establos y otras áreas pastoreadas por
éstos, con lo cual el programa de control es un fracaso.

Aquellos caballos que están transitoriamente en la finca y todos los nuevos que
ingresen deben ser puestos en cuarentena o aislados y desparasitados antes de
ser mezclados con los caballos residentes. Muchos esfuerzos pueden
desperdiciarse en pocos días por la introducción de animales no tratados dentro
de una finca donde se administran regularmente las vermifugaciones.

Los potros deben ser protegidos contra una infestación, particularmente por
Strongylus tratando regularmente a sus madres. El tratamiento del potro no tiene
el mismo sentido en relación con la adquisición y el daño causado por los grandes
Strongylus
Los exámenes de muestras fecales por el laboratorio deben realizarse
periódicamente con el objeto de mantener una estricta vigilancia de la efectividad
de las drogas usadas en los programas. La eficacia de la droga se puede
determinar realizando un recuento de huevos de parásitos el día del tratamiento
antes de administrar este y comparándolo con otro recuento dos semanas
después. El recuento antes del tratamiento es el mejor Índice de la efectividad del
programa en general. Un antiparasitario efectivo se espera que reduzca los
recuentos de huevos de Strongylus, por ejemplo, a niveles muy bajos (0 a 20 por
gramo de heces) y que los mantenga en esa forma durante cinco semanas post-
tratamiento, como mínimo.

Es recomendable no utilizar el mismo compuesto antiparasitario repetidamente en
los programas de control. Se cree que cepas de parásitos y poblaciones de estos
se tornan resistentes al producto. Si demarcamos muy bien las generaciones de
parásitos que afectan los equinos en una finca en particular, podríamos utilizar el
mismo compuesto para cada generación de parásitos y cambiarlo entre
generaciones. El uso regular y alternado’ de varios tipos de antihelminticos se
compensa por las diferencias en actividad entre uno y otro y por los efectos
benéficos complementarios a juzgar por los resultados medidos a través de los
recuentos de huevos.

La administración de antiparasitarios en la comida, es efectiva, solamente si la
comida medicada es consumida por el caballo. Con la llegada de nuevos
productos este método se usa con frecuencia ya que los compuestos son menos
desagradables y pequeñas cantidades configuran la dosis total necesaria. Sin
embargo, el cuidador o el mismo Médico Veterinario deberán chequear
cuidadosamente que ¡a comida se consuma totalmente sin confiarse demasiado
del encargado de alimentar los caballos.

Las etiquetas o rótulos que acompañan los productos deberán leerse y entenderse
completamente antes de administrar el antiparasitario. Todas las
recomendaciones sobre la dosis y los procedimientos para preparar el producto
deben seguirse cuidadosamente, así como las precauciones y las
contraindicaciones impresas en la etiqueta. El desconocer estas simplezas puede
acarrear situaciones desagradables. Son muchos los accidentes por sobre
dosificación a causa del capricho del dueño o el desconocimiento de las normas
elementales acerca del producto.

El encargado de los caballos o su propietario deberán prestar atento cuidado e
identificar las condiciones que pueden favorecer el desarrollo de los parásitos y
eliminarlas cuanto antes. Algunas condiciones que favorecen la propagación de
los parásitos son las aguas estancadas en los potreros mal drenados, convivencia
de caballos de diferentes edades, la mala alimentación, las fallas en el manejo y
los factores ambientales como temperatura y humedad muy difíciles de controlar
en nuestro medio.

- En la medida que las condiciones lo permitan, los animales deberán
separarse en grupos por edades. Luego de la separación de sus madres los
potros deberán crecer juntos hasta que sean yearlings (tengan un año). Las
hembras en gestación podrán estar con las vacías sanas y los machos
adultos tendrán su propio potrero.
Cuando en un potrero se encuentran charcas o aguas estancadas, éstas
deberán drenarse y secarse.
La rotación de potreros es una práctica de manejo muy antigua que
favorece el control del parasitismo, pues la poca permanencia del caballo
en un potrero y el tiempo que esté desocupado, interrumpen el ciclo
evolutivo de los parásitos impidiendo así su proliferación. En el mismo
sentido se puede afirmar que un potrero densamente poblado de caballos
es más propenso para el desarrollo de parásitos y por lo tanto requiere una
mayor atención. En algunas ocasiones la rotación de los pastizales es
impráctica ya que el período de retirada puede coincidir con una época en
que los pastos alcanzan un valor nutritivo óptimo para los animales. Esto se
refuerza aún más por el prolongado periodo de supervivencia de las larvas
de los parásitos.

- Los corrales, las cuadras o establos, las pesebreras y las instalaciones en
general, deben ser ventiladas y con acceso de sol para mantenerlas secas.
La cama debe permanecer seca y se cambiará con frecuencia. Los
bebederos en los potreros se deben instalar de tal manera que no se
formen charcas y que los caballos no los ensucien con la materia fecal. El
agua debe ser limpia y se chequeará periódicamente para larvas y gusanos
de parásitos.

Las buenas costumbres sanitarias y un alto nivel de nutrición asegurarán el éxito
en los programas de control de parásitos internos.


Métodos de administración de antiparasitarios.

Por un buen número de años los antihelmínticos se administraban a los caballos
por vía oral usando una sonda plástica que se hacía pasar hasta el estómago.
Esto era así, .por la naturaleza física de los compuestos disponibles, por el gran
volumen de las dosis terapéuticas o por la poca palatabilidad (apetencia) de los
medicamentos. De todas formas, este tipo de administración aseguraba la dosis
deseada. Por el desarrollo y la evolución de nuevos productos, los agentes
terapéuticos más activos requieren niveles de dosificación más bajos y son
también más palatables. Algunos productos usados para desparasitar caballos
(Diclorvos, Febantel, Mebendazol, Oxibendazol, Pyrantel y Tiabendazol) pueden
darse en la comida. Más recientemente, aparecieron las formulaciones tipo pasta
para administración oral las cuales son fáciles de manejar sin pérdida alguna de
su actividad antihelmíntica. Están disponibles como pastas el Tiabendazol el
Mebendazol, el Febantel entre otros. Con el reciente advenimiento de las
Ivermectinas (productos derivados de Streptomyces avermitidis) la ruta parenteral
de administración se ha revivido. El levamisole también podría usarse por esta
ruta pero se ha mostrado deficiente en actividad y además induce una reacción de
los tejidos musculares en el sitio de aplicación. Solo la experiencia clínica
determinará si la administración parenteral de las lvermectinas es posible para uso
rutinario en el control de parásitos en el caballo.

Control de parásitos externos.

Los parásitos externos del caballo (ectoparásitos) incluyen ácaros, garrapatas,
piojos, moscas y mosquitos. Cuando están presentes en número abundante estas
plagas ocasionan anemia, falta de apetito (anorexia) cólico, inflamación de la piel
(dermatitis), adelgazamiento, pérdida de pelo, frotamiento o roce de la cola, mal
aspecto general, debilidad y si no se tratan o hay descuido incluso ocasionan la
muerte. Algunas especies de ectoparásitos pueden ser vectores de enfermedades
graves en animales y humanos.

El propietario de caballos es responsable de aplicar buenos métodos de sanidad y
manejo que prevengan el desarrollo y presencia de estas plagas. Los productos
químicos usados para el control y la eliminación de ectoparásitos deben
manejarse con cuidado para evitar intoxicaciones del operario. Todos los
productos comerciales son efectivos cuando se usan a una concentración
apropiada, en la dosis requerida y mediante su aplicación adecuada. Si se aplican
en la piel, bien sea en “spray”, aerosoles o cremas, se deben probar primero en
una pequeña área de piel, en algunas razas de caballos (las árabes y los
palominos especialmente) pueden causar reacciones de sensibilidad en la piel,
especialmente los productos derivados del petróleo, usados en diferentes
formulaciones.

Cuando se utilicen insecticidas por aspersión o fumigación se debe tener
precaución de no contaminar el agua y el alimento de los caballos. Si se hace en
recintos cerrados se deben sacar los caballos de las pesebreras antes de la
fumigación y devolverlos una vez el rocío ha caído. Los caballos no deben
fumigarse directamente. Las aplicaciones de los productos deben coincidir con el
patrón diario de actividad de los insectos. Para controlar las garrapatas de las
orejas se usarán aerosoles y cremas colocándolos bien profundo en ambos
pabellones. Las moscas, piojos, garrapatas, mosquitos, etc., se pueden eliminar
del cuerpo del caballo lavando manualmente con esponja o aplicando
directamente en aerosol pero a presiones bajas. Se procurará cubrir la cabeza,
nuca, pecho, abdomen, periné, entrepierna y miembros.

Es común también hallar ácaros dentro de las orejas del caballo, por lo que éste
sacude bruscamente la cabeza; en este caso se pueden instalar gotas en el oído
que contengan un producto que elimine estos parásitos (acaricida). La sarna
corióptica, producida por el Chorioptes equia manera de ejemplo, se asienta
preferiblemente por debajo del corvejón y de la rodilla (carpo), por lo que los
animales afectados se muestran inquietos y patean contra objetos fijos. El colocar
cremas acaricidas constantemente en los sitios afectados contribuye a solucionar
estos problemas.

Es importante también observar cuidadosamente las etiquetas de los preparados
en relación con las dosis y las contraindicaciones, para evitar riesgos de toxicidad
en los animales.








LECCION 28. CÓLICO EQUINO.


www.asdesilla.com

El término cólico se refiere a un tipo especial de dolor que se origina en vísceras
que contienen en su estructura músculo liso, por lo común de la cavidad
abdominal. En los equinos, los cólicos biliares y los urinarios son poco frecuentes,
de manera que el término se limita a las afecciones dolorosas del aparato
digestivo tubular.


Causas primarias y secundarias del cólico.

Las causas primarias y secundarias del cólico comprenden:

Factores de Nutrición: Como por ejemplo el bajo contenido de agua y alto de fibra
de la ración, alimentos de baja calidad (zanahorias dañadas, cebada fermentada,
maíz mohoso).o dietas no balanceadas; manejo incorrecto de la nutrición.

Masticación Anormal: Provocada por “puntas de muelas” y lesiones en la boca,
lengua o faringe.

Enfermedades Corporales: (Sistémicas) especialmente aquellas que cursan con
elevación de la temperatura (fiebre) o disminución en el consumo de alimentos
(anorexia).

Parasitismo Adulto o Larvario: especialmente en potros.
Trastornos de los Vasos Sanguíneos: Relacionados con el intestino, especial-
mente taponamientos, ausencia de circulación (infarto) o intoxicación masiva
(toxemia).

Infecciones del Tracto Digestivo: Con bacterias patógenas y alteraciones de la
flora bacteriana del ciego y colon que determinan formación excesiva de gas.

Vólvulos y Torsiones (nudo intestinal): el vólvulo es un atrapamiento del intestino
por sí mismo y la torsión un enrollamiento del tubo sobre su eje. Ambos
determinan dolor y malestares profundos en el caballo que casi siempre se
resuelven por métodos quirúrgicos.

Lesiones del Mesenterio: Que es la “tela” que sostiene el tubo digestivo. Es un
tejido muy delicado y puede irritarse fácilmente provocando que sus capas se
unan entre sí o con otros órganos digestivos (adherencias) y se inflamen
causando dolor y fiebre (peritonitis).

Obstrucciones: Al paso de los alimentos por materias fecales resecas y duras o
por un cuerpo extraño ingerido o desarrollado en el animal (bola de pelo, piedra,
tumor).

Espasmos o Contracciones: violentas en uno o varios puntos del tubo digestivo.
Este se halla hiperactivo y se contrae vigorosamente estimulando los receptores
del dolor ubicados en su pared (agua fría o alimentos contaminados).

Ulceras de la Mucosa: digestiva del estómago e intestino: La capa que tapiza el
estómago y el intestino se inflama y luego se “desprende” dejando verdaderas
“heridas” o lesiones que suelen ser dolorosas y pueden sangrar. Esto suele
suceder luego de las cirugías y de los tratamientos con drogas que irritan el
estómago (antiinflamatorios)

Parálisis: De un segmento intestinal debido a pérdida de la función (íleo paralítico)
o a lesiones nerviosas, luego de procedimientos quirúrgicos.

Tipos de cólico.

En relación con las causas primarias y secundarias se pueden distinguir varios
tipos diferentes de cólico, según los síntomas y con base en los resultados del
examen de los sonidos abdominales (Borborigmos) resultantes del movimiento
intestinal (peristaltismo), del examen de la sangre, la temperatura rectal, la
palpación a través del recto del ciego y colon, el contenido fecal, el grado de
distensión abdominal y del examen, si es posible, del líquido peritoneal obtenido
por punción con aguja a través de los músculos del vientre.
Los tipos principales de cólico son:
Obstrucción Mecánica Simple. Por taponamiento (oclusión): causada por
acumulación de alimento, parcialmente digerido, en el intestino o por cuerpos
extraños como se dijo antes. Los sitios donde más corrientemente se tapona el
tubo digestivo son la flexura pélvica del colon mayor, en el ciego y en el íleon.

Timpanismo: Por distensión gaseosa del intestino (fermentación o producción
excesiva de gas por Bacterias)

Espasmódico: Hiperactividad que se traduce en espasmos dolorosos o sea con-
tracciones vigorosas de la pared intestinal.

Tromboarterítico: Por bloqueo de una rama pequeña o grande de las arterias que
suministran sangre a la pared intestinal. Estas arterias discurren por los
mesenterios de los que está suspendido el intestino en la cavidad. Abdominal. La
lesión la causan las formas larvarias del parásito Strongylus vulgaris. La gravedad
depende del tamaño del área de intestino privada de irrigación sanguínea. La zona
sin aporte de sangre “muere” en un estado parecido a la gangrena. La inflamación
del revestimiento intestinal externo (peritonitis) causa dolor agudo y puede dar
lugar a que cesen los movimientos que impulsan el alimento al llegar al punto
muerto, provocando por extensión, una parálisis de tramos considerables de
intestino. Estos cólicos son muy graves y casi siempre conducen a la muerte por
insuficiencia del corazón.

Obstrucción Aguda: Por mal posición anatómica. Es provocado por torsión y
vólvulo intestinal, que causan obstrucción aguda y fuertes dolores que no ceden a
los medicamentos. Las porciones intestinales quedan “atadas” en un nudo o
enredadas en desgarros del mesenterio con consecuencias análogas a las de los
casos de bloqueo arterial por trombos (gangrena).

Cualquier tipo de cólico puede producir como secuela una rotura de intestino,
aunque esta complicación es más frecuente en los casos de timpanismo y en los
provocados por lesiones de parásitos. El estómago se rompe por timpanismo o
sobrecarga sólida o líquida, mientras que el colon y ciego son más propicios a
sufrir las consecuencias de las lesiones parasitarias.


Factores que predisponen a sufrir cólico.

Como se había discutido en el capítulo II (Alimentación y nutrición del equino), la
disposición anatómica del esófago, estómago e intestinos del equino lo
predisponen a sufrir accidentes digestivos. El esófago penetra profundamente en
el estómago y posee un músculo constrictor que impide la evacuación de la
sobrecarga gástrica, es decir hace imposible el vómito verdadero. Por otra parte,
el estómago es pequeño (poca capacidad) lo que obliga a los alimentos a pasar
muy rápido a los intestinos, debiendo entonces éstos asumir gran parte de la
digestión. El mesenterio es largo y el intestino grueso queda muy libre, además de
ser muy desarrollado en proporción con el delgado lo que facilita los cambios
frecuentes de posición (estrangulaciones, nudos, etc.) los casos de indigestión,
obstrucción y constipación además de provocar los cólicos, se complican con la
retención de orina.

Algunos caballos son susceptibles a sufrir cólicos mientras que otros no. Cada
sujeto posee un equilibrio nervioso propio, el cual desempeña un papel importante
en la generación y persistencia del célico, así como en su complicación. Estos
caballos “desequilibrados” reaccionan con la menor causa (tormenta, cuando se
les molesta, por cambios en el régimen alimenticio, transporte, etc.). La expresión
de esta reacción es un dolor abdominal, que una vez generado va a aumentar el
desequilibrio. Es muy frecuente observar esto en caballos pura sangre y
Angloárabes.

El parasitismo es el origen de cólicos que se repiten a menudo y con mucha
frecuencia en los potros, y en los adultos (trombos).

Aquellos caballos con vicios denominados “redhibiditorios” (que anulan una
operación de compra-venta si son detectados) son por lo general “tragadores de
aire” o poseen perversiones del gusto (pica). Los tragadores de aire absorben aire
apoyando la boca abierta sobre la puerta o rejilla de su pesebrera y distienden sus
reservorios digestivos lo cual les causa dolor agudo. Aquellos que poseen
perversiones del gusto una vez terminan de consumir su alimento o en las horas
de la noche comen su propio estiércol o el de los otros caballos, o prefieren comer
pajas del suelo, arena, se comen las crines de los compañeros, los cueros de los
arneses y monturas, mordisquean las puertas de madera, lamen las paredes, etc.

Ciertos caballos “carecen de Tripas” según el lenguaje popular. Su abdomen está
recogido (semejante a un perro galgo), son caballos con apetito caprichoso, de
digestión difícil, seguramente son “caballos problema”

Los caballos viejos, con dientes gastados, con intestinos “perezosos” se obstruyen
con facilidad y son animales susceptibles a sufrir cólicos.


Cómo se reconocen los cólicos en el caballo.

Los cólicos se ponen de manifiesto porque el animal se echa y se levanta a
menudo revolcándose en el suelo; se niega a comer o expulsa excrementos en
cantidad anormal (generalmente disminuida) o de calidad anormal (duros,
cubiertos de moco, blandos, malolientes o diarreicos). También efectúa esfuerzos
repetidos por orinar, sin conseguirlo, y otras veces se patea los flancos, se los
mira repetidamente y agita la cola. Si los dolores son fuertes suda copiosamente,
el pulso se acelera y la respiración se torna más agitada. Según el tipo de cólico
pueden oírse ruidos intestinales (célico espasmódico) o no oírse ningún sonido
(cólico sordo, parálisis, vólvulo, torsión). También puede haber torsión abdominal
(timpanismo) en los caballos en donde hay producción excesiva de gas. En los
casos de obstrucción aguda, el recto puede encontrarse vacío de materia fecal. Al
comenzar los síntomas, las heces detenidas en la parte del tracto digestivo
posterior a la obstrucción pueden ser eliminadas y dar una falsa impresión de
normalidad. Según la gravedad del caso, la temperatura puede ser inferior a la
normal o por el contrario, febril. Un célico en el caballo siempre debe considerarse
de suma gravedad y requerirá la mayor atención posible. Ciertos cólicos no son
curables. Otros, si bien no ponen en peligro la vida del animal (a condición de que
sean tratados a tiempo), si son perjudiciales ya que dejan secuelas en el tubo
digestivo y debilitan la condición física del animal. En todos los casos, el regreso al
trabajo deberá ser considerado de acuerdo con las repercusiones en el estado
general. Un célico digestivo no se debe confundir con otros procesos que
provocan también dolor y signos de malestar como son:

- Obstrucción aguda del esófago, por masas de alimento o cuerpo extraño.
- Azoturia o intoxicación muscular (mioglobinuria) asociada con carencia de
ejercicio.
- Miocitis o inflamación muscular por exceso de trabajo sobre todo en
ambientes muy fríos.
- Cálculo urinario (urolitiasis) o cálculo vesical.
- Peritonitis (inflamación del Peritoneo) por cirugía, cuerpos extraños,
punciones (trocanterización), etc.
- Infosura o Laminitis un trastorno grave de la circulación en el pie del equino.
Los cascos están calientes al tacto.
- Inminencia de parto en las yeguas.
- Inflamación articular severa (artritis) que provoca cojera y dolor agudo.
- Envenenamiento por metales pesados (arsénico, plomo y mercurio).
- Inflamación de la pleura (pleuritis) que es el órgano que recubre los
pulmones y la caja torácica interna.
- Trauma agudo bien sea por fracturas de las extremidades o de la columna.
- Enteritis aguda en potros (diarrea profusa y cólico).
- Intoxicación sanguínea (toxemia) ocasionada por Salmonella, enfermedad
del hígado, inflamación del colon.


Manejo del cólico en el equino.

Una crisis de cólico debe ser considerada como un estado de urgencia, lo que no
significa que hay que asustarse, y si exponerle al Médico Veterinario encargado,
con claridad los hechos observados mediante una buena descripción. Durante la
presentación de la crisis, el cuidador deberá prestar atención a los siguientes
hechos:
- Deberá “coger” al caballo, embozalarlo o ponerle la J áquima.
- Lo pondrá en libertad en una pesebrera grande, abrigada y provista de una
buena cama. Podrá colocar pacas de heno o paja y/o llantas de caucho a lo
largo de los muros. Si el comportamiento del animal es violento lo que lleva
a golpearse contra los muros inmediatamente lo sacará de allí y lo llevará a
una “manga” o potrero pequeño al aire libre.
- Podrá protegerlo con rodilleras y polainas y también protegerle la cabeza,
en lo posible.
- Podrá cepillarlo o pasarle el trapo (limpiándolo) para tranquilizarlo y
distraerlo.
- Podrá pasearlo lentamente sin agitarlo y no pararlo bruscamente. Al hacerlo
deberá colocarle una capa que le cubra el cuerpo.
- Si el caballo permanece acostado y descansa, tanto mejor.
- En caso de crisis violentas, debe abstenerse de riesgos inútiles. Un caballo
que sufre Pierde la conciencia de su medio ambiente y puede ser peligroso.
- Cuando las yeguas que están amamantando padecen un cólico es
necesario tomar medidas especiales. Lo ideal es colocarlas en un área
amplia con lo cual se reducen las Posibilidades de que lleguen a herir al
potro.
- No debe administrarle ningún medicamento hasta tanto el proceso no sea
supervisado por un Médico Veterinario.

El Médico Veterinario encargado del caso, diagnosticará y determinará el origen
del cólico para poder prescribir un tratamiento adecuado. Para ello es aconsejable
tener en cuenta lo siguiente:


 Observar el comportamiento para valorar en forma subjetiva los signos de
dolor (dolor leve o dolor agudo-grave).

 Apreciar la temperatura de la piel (piel fría o pastosa puede ser signo de
“shock” o ruptura del intestino).


 Valorar la frecuencia y calidad del pulso (buen o mal pronóstico).

 Valorar los ruidos abdominales (borborigmos). Son una gula muy
importante del diagnóstico y el pronóstico.


 Palpar el recto. Es aconsejable realizar palpaciones réctales periódicas
durante el curso de la afección para establecer la diferencia entre las heces
que se hallan presentes desde el principio y las que aparecen después. Al
palpar las estructuras se debe tener precaución en la interpretación de los
resultados.

 Tomar muestras de sangre al comienza-de la afección y durante el curso de
esta para valorar cuidadosamente la concentración de glóbulos rojos
(hematocrito), el estado de deshidratación y la calidad de los elementos del
plasma.


 Realizar una punción abdominal (paracentesis) si el caso lo amerita. El
obtener líquido peritoneal suministrará datos muy útiles para el diagnóstico
y el pronóstico.

 Apreciar la respuesta del animal a la administración de drogas analgésicas.
Los cólicos simples responden bien.


 Definir si el caso es para tratamiento médico conservador, o por el contrario
requiere cirugía para lo cual dispondrá de inmediato las condiciones de su
realización.


En todos los casos es fundamental controlar el dolor, para lo cual dispondrá de
suficiente cantidad de analgésicos (Dipirona, Meperidina, Flunixin meglumine, butil
bromuro de N-hioscina, etc.). También puede hacer uso de tranquilizantes
menores y relajantes musculares (Acetil promazina).
Las obstrucciones simples se pueden combatir por medio de la administración de
purgantes, aceite mineral, sales laxantes, absorbentes de toxinas (carbón vegetal),
etc.

En todos los casos en que se produce una elevación del hematocrito es
aconsejable administrar líquidos por vía venosa. En un caballo adulto se requieren
15- 20 litros en el lapso de una hora.

En los cólicos espasmódicos, timpánicos o diarreicos se pueden administrar
antibióticos orales con sonda naso esofágico.

En los casos graves de cólico, torsión o trombosis es imprescindible recurrir a la
cirugía. Que el animal se mejore o no, dependerá de la naturaleza y extensión de
la lesión, así como del tiempo transcurrido hasta llegar a establecer el diagnóstico,
la instauración del tratamiento y la respuesta del individuo al mismo.



LECCION 29. ENFERMEDADES DE LOS MIEMBROS DEL EQUINO.



Laminitis en equinos.
www.asdesilla.com

Los miembros del equino sirven para sostener y transportar al animal; los
anteriores, más cercanos al centro de gravedad, son sobretodo sustentadores, los
posteriores son propulsores. Un caballo con una cabeza bien hecha, un magnífico
cuello y tronco, pero con extremidades con aplomos defectuosos o que tengan
entorpecido su juego y paralizados sus movimientos, realmente no sirve para
nada. “Las extremidades son para el equino, lo que las ruedas son para el carro”.

Las cojeras en los caballos merecen una atención especial dada la frecuencia con
que se producen. En un sentido general se pueden definir como un síntoma de
dolor con manifestaciones que varían en función del lugar en que aquel se
produzca. Lo primero es localizar ese lugar para; a continuación, determinar el tipo
de lesión que lo produce.

La cojera es una irregularidad del movimiento, marcada por un defecto de
sincronización en el desplazamiento de los miembros entre dos apoyos o en sus
apoyos en el piso. Esto toma en consideración no solamente las cojeras que se
manifiestan en el momento en que el miembro toca el suelo, sino también aquellas
(más raras) que se exteriorizan durante el período de sostén.


Tanto en uno como en otro caso, el caballo que cojea manifiesta su molestia más
o menos acompañada de dolor. En otras oportunidades un caballo puede tener
una lesión ósea importante, una micro fractura del carpo, por ejemplo, y no
manifestar cojera alguna. Su lesión se hace evidente al palpar la articulación
cuidadosamente hasta encontrar el sitio de la fractura; al presionar el Sitio
afectado, el caballo retirará bruscamente el miembro rechazando la maniobra.
Existen caballos “delicados” que “exageran” el dolor (caso frecuente en los pura
sangre); pero también existen caballos que pueden trabajar, o correr teniendo
artritis o pequeñas fracturas en sus miembros. No se puede pues, en forma
general, establecer una relación significativa y exacta entre la manifestación y la
gravedad de la afección a excepción de un reducido número de casos.

Las causas de las cojeras pueden ser:


a) Predisponentes
b) Excitantes


Entre las causas predisponentes pueden mencionarse.

 Inmadurez o mal estado nutricional
 Conformación defectuosa.
 Enfermedad sistémica.
 Mal herraje.
 Descuido en el estado de los cascos Desequilibrios minerales.


Entre las causas excitantes se pueden enumerar:

 Los traumas repetidos directos e indirectos
 Incoordinación muscular (animales cansados)
 Infección bacteriana (vainas tendinosas y articulaciones).


Cómo proceder en todos los casos de cojera.


www.mascotanet.com

Cuando un animal comienza a cojear y va montado por su jinete, éste deberá
enseguida bajarse de su cabalgadura, para apreciar mejor el comportamiento del
animal.

Observará al caballo para ver si manifiesta signos de un fuerte dolor (dolor agudo),
sudoración abundante, temblores, supresión parcial o total del apoyo del pie,
movimientos bruscos del pie (punzadas), etc.

Levantará y verificará los cuatro pies. Podrá apreciar si las herraduras están
implantadas en forma correcta (sólidamente); si no existe algún cuerpo extraño
visible o escondido bien sea entre la herradura y la suela o entre las lagunas
(surcos) de la ranilla.

De acuerdo con la gravedad de la cojera, podrá adoptar tres actitudes al respecto:

Tratar la cojera en el lugar mismo si es un caso benigno.

Trasladar si el animal lo permite, a un sitio cercano donde se le brinde la mejor
atención posible.

No mover al animal del lugar del accidente y esperar auxilio de vehículo y
personas.
Los casos de cojeras simples, de solución rápida son frecuentes. Al suplir la
causa, desaparece la molestia, en estos casos pueden ubicarse situaciones como:

Caballos a los que se les ha caído una Herradura: Si el desprendimiento es
incompleto, debe quitarse la herradura completamente y volver a herrar,
respetando en todos los puntos a la herradura que le precedió.

 Cuerpo extraño bajo la suela: Las herraduras mal ajustadas y con poca
cobertura permiten que se alojen cuerpos extraños bajo la suela.
Descubierto a tiempo el incidente no existen complicaciones pero la
repetición del traumatismo puede dar origen a “sobresaltos” por compresión
de los tejidos blandos subyacentes.

 Clavo Halladizo: La penetración de un cuerpo extraño puntiagudo o cortante
en la cara plantar del pie, hace cojear instantáneamente al caballo y por
tanto es posible reaccionar rápido. Si la clavadura es poco profunda (menor
de 2 centímetros) y situada en áreas de menor gravedad, la cojera se
atenúa de inmediato cuando el caballo se trata. Esta mejoría, no
importando lo espectacular que sea, no debe hacer olvidar los riesgos de
complicaciones. Es necesario consultar al profesional inmediatamente.

Cojeras debidas a herraje defectuoso: Entre estas se puede citar:

 Pie picado: El clavo ha penetrado los tejidos blandos subcornea les pero ha
sido extraído rápidamente.

 Pie enclavado: El clavo ha sido remachado después de penetrar en
regiones sensibles algunas veces por división longitudinal del clavo en dos,
durante el martilleo (clavo pajizo). Una parte del clavo penetra en los tejidos
blandos, la otra sale y se remacha normalmente.

 Pie apretado: Por clavos martillados muy “recogidamente”. Sucede cuando
un herrero distraído coloca una herradura izquierda en un pie derecho o
viceversa.

Las cojeras graves: merecen atención especial y deben ser resueltas por un
técnico especialista que decidirá el camino a seguir. Exceptuando los casos de
Laminitis (un trastorno grave de la circulación del pie), la mioglobinuria
(intoxicación muscular) y las fracturas más o menos graves, los cuales requieren y
obligan a un tratamiento inmediato, las demás lesiones de los miembros que
causan cojera, o imposibilidad del movimiento pueden necesitar de mayor tiempo
para su completa evaluación y resolución. Las lesiones de las extremidades en los
caballos pueden ser de muchas y diferentes clases. Algunas de las más
importantes aparecen a continuación:

Laminitis: Es un problema del metabolismo con causas multifactoriales que lleva a
la inflamación, degeneración y destrucción de la unión entre las láminas córnea y
sensible del casco. El problema le ocasiono mucho dolor al caballo en los pies
afectados, le impide mantenerse en pie y le ocasiona otros trastornos al animal
(inapetencia, fiebre, temblones, respiración aumentada, etc.) una de las secuelas
graves de este trastorno es la rotación del tejuelo (tercera falange). Si el problema
se resuelve a tiempo pueden persistir una cojera crónica y ataques sucesivos y
recurrentes. Muchos ejemplares valiosos han muerto debido a complicaciones de
casos de laminitas.

 Mioglobinuria o Azoturia: Trastorno caracterizado por degeneración
muscular y parálisis o “amarra miento” asociado con el ejercicio.
Denominada también “Enfermedad de os Lunes” que por lo general
aparece a los pocos minutos que el animal comienza a trabajar después de
un fin de semana o de varios días de descanso con una alimentación por
encima de lo normal (sobrealimentación). De hecho, se puede evitar
reduciendo la alimentación en los períodos de descanso o ejercitando
moderadamente al animal una vez retorna al trabajo luego de descansar.

 Fracturas: Cualquier hueso del cuerpo del caballo puede sufrir una fractura,
pero los más frágiles son la cuartilla, el tejuelo o tercera falange, los
sesamoideos, y los del carpo, la caña y la pelvis.

Las fracturas pueden ser simples o compuestas y los fragmentos fracturados
pueden encontrarse muy separados o bien se asoman a través de la piel (fracturas
conminutas y abiertas). No es necesario insistir sobre la extrema gravedad de toda
fractura en los miembros del caballo. La formación de callosidad ósea importante
es alterada por el gran peso que soporta el miembro afectado, así como la
dificultad en la reducción de la fractura durante el tiempo necesario. Sin embargo,
es necesario saber que en todas las épocas se han tratado de curar las fracturas.
El progreso actual de la cirugía ortopédica equina permite reparaciones
satisfactorias. El que se realice o no el tratamiento dependerá del tipo de animal,
el servicio que presta, la naturaleza de la fractura, así como las consideraciones
económicas importantes en estos casos.

Las fracturas de los huesos del carpo, los sesamoides y las de la tercera falange
(tejuelo) pueden ser operables dependiendo de su naturaleza; las que suceden en
los huesos de la pelvis o las de la columna vertebral determinan casi siempre el
sacrificio del animal.

 Esparavanes: Los esparavanes son afecciones de la articulación del
corvejón (tibiotarsal). Algunos tratadistas los clasifican como esparaván
blando (esparaván falso) y esparaván óseo. Estos trastornos se explican
muchas veces por la conformación defectuosa del corvejón, el traumatismo
(concusión, esguince) repetido y los desequilibrios minerales. En la mayoría
de los casos la acción del corvejón está disminuida; la cojera muy a
menudo desaparece con el ejercicio y vuelve una vez que el caballo ha
descansado. Para realizar el diagnóstico se acude a la famosa “prueba del
esparaván” que consiste en levantar la pata afectada sosteniendo el
corvejón flexionando en ángulo agudo durante unos pocos minutos; para
soltarlo luego y hacer desplazar al animal; la cojera quedará acentuada en
los primeros pasos después de soltar la pata. Las cojeras por inflamación
de la babilla (gonitis) y por desplazamiento de la rótula también se acentúan
por la misma prueba.

 Enfermedades de Navicular: Se le suele ubicar como una enfermedad de
los pies anteriores, pero en raras ocasiones puede aparecer en tos
posteriores. Afecta al hueso navicular y a las estructuras que conforman su
articulación con la tercera falange. La enfermedad del navicular
(sesamoideo distal), es una de las causas más comunes de cojera
intermitente en caballos mayores de cuatro años de edad. Definitivamente
los defectos en la conformación del pie y el trauma repetido (concusión)
favorecido por esta conformación, son factores determinantes en su
desarrollo y exacerbación. El herraje correctivo y diversos procedimientos
quirúrgicos (neurectomía) pueden ayudar a sobrellevar el padecimiento que
siempre se considera de pronóstico reservado.

Artritis: Significa inflamación de una articulación y sus síntomas característicos son
hinchazón, calor y dolor al movilizarla. Las articulaciones se componen de
diversas estructuras, pudiendo estar dañadas una o varias de ellas; a veces los
síntomas que se producen son los propios de una torcedura articular, por lo que se
hace necesaria una investigación veterinaria para determinar la naturaleza exacta
del trastorno. Por ejemplo, la aparición de una tumefacción o hinchazón a nivel de
la articulación del menudillo (nudo) puede deberse a un daño de la cápsula
articular, o a una lesión del ligamento de sustentación o de las superficies
articulares. La superficie de los huesos que forman una articulación está revestida
dé cartílago, un tejido más blando que el hueso. Cualquier proceso traumático o
infeccioso daña esta superficie articular provocando una reacción inflamatoria, es
decir, una artritis. La hinchazón en la artritis está producida por un aumento de la
cantidad de “aceite articular” (líquido sinovial) que hace que la cápsula se abombe.
Suele ser de consistencia blanda y puede detectarse en ciertos puntos alrededor
de la articulación. El área artrítica de la superficie articular es similar a una úlcera.
O se cura, o se va haciendo cada vez más profunda, hasta que alcanza el hueso
que se encuentra por debajo, el cual a veces reacciona produciendo nuevo hueso,
en un esfuerzo por reparar la lesión.

Sin embargo, este nuevo hueso a menudo resulta demasiado frágil o demasiado
abundante, de forma que no sirve para que se realice una reparación funcional de
la articulación. Se aprecian las consecuencias en forma de erupciones o
excrecencias óseas que parten de la superficie articular.
De estas se desprenden pequeños fragmentos, que quedan libres en la cavidad
articular y se denominan “ratones articulares” (“chips”), únicamente visibles por
radiografías.

Las artritis se denominan según el área anatómica en donde están ubicadas, por
ejemplo:

- Carpitis: Inflamación aguda o crónica de la cápsula articular y estructuras
asociadas al carpo.
- Coxitis: Inflamación de la articulación coxofemoral.
- Gonitis: Inflamación de la articulación femoro-tibio-rotuliana (babilla o
gordetillo)
- Omartritis: Inflamación de la articulación del hombro.
- Bursitis: Las bursitis son inflamaciones agudas o crónicas de las bolsas o
vainas articulares.

Las bolsas afectadas más frecuentemente son aquellas que son superficiales y
están localizadas sobre prominencias óseas o entre tendones. Algunas bursitis
importantes en el caballo son:

- Bursitis de la Tuberosidad isquiática “magullamiento del coche”.
- Bursitis del tarso (agrión o chepelet)
- Bursitis de la apófisis olecraniana (cordillera, codo)
- Bursitis Trocantérica (trocanter mayor)
- Bursitis intertubular (cavidad bicipital)
- Bursitis navicular (Hueso navicular)

Las bursitis se caracterizan por poseer derrame seroso que provoca una rápida
hinchazón con calor local y dolor. Se pueden infectar por procedimientos qué
tienden a drenar ese derrame. Conforme la bursitis se vuelve crónica, la hinchazón
local y el calor ceden, pero el área continúa dolorosa a la palpación o al
movimiento. Las bolsas infectadas requieren tratamientos vigorosos con
antibióticos y drenaje en condiciones asépticas. Las secuelas son serias y la
recuperación lenta.

- Tendinitis: También denominada “tendón arqueado” o “jalado”. Es una
inflamación aguda o crónica de un tendón. Se observa con mucha
frecuencia en caballos sometidos a ejercicios rápidos, especialmente los de
carreras, polo o salto. Los tendones flexores se afectan más
frecuentemente que los tendones extensores, y los de las extremidades
anteriores más que los de las extremidades posteriores. De estás, el flexor
superficial está más implicado en el “tendón arqueado” corriente del caballo
de carreras.
Las causas más comunes comprenden la sobre extensión o hiperextensión
del tendón sin un apropiado entrenamiento, la continuación del trabajo o el
entrenamiento después de haber aparecido los primeros signos de dolor del
tendón, la fatiga y el trabajo rápido en superficies duras o ásperas o en
pistas con barro, el herraje inapropiado que recarga el esfuerzo a los
tendones flexores. La conformación defectuosa y el trabajar o correr los
caballos a edades muy tempranas son causas predisponentes que pro-
vocan tendinitis.


- Linfangitis: Es la inflamación de los vasos y ganglios linfáticos, casi siempre
secundaria a infección diseminada de la piel (celulitis) y que suele afectar a
los miembros posteriores. Se desarrolla tras infección por bacterias que
producen pus (estreptococos y estafilococos). Estos gérmenes patógenos
penetran la piel y se extienden a lo largo de la circulación linfática
provocando una hinchazón caliente y dolorosa de todo el miembro con
salida (exudación) de líquido claro (seroso) en diversas zonas, en particular
el corvejón y a lo largo de la cara interna del muslo.
La falta de ejercicio regular puede ser un factor que contribuya a la
presentación, casi siempre se presenta en caballos en buen estado. El
animal se torna febril, no come y se le aumenta el pulso y la respiración.
Una cojera grave acompaña la tumefacción. El tratamiento debe ser
vigoroso, persiguiendo el combate y erradicación de los microbios y la
reducción de la hinchazón (antiinflamatorios). Se indica un ejercicio
moderado y compresas tibias para aliviar las molestias, la alimentación con
granos debe reducirse siquiera a la mitad.

- Hormiguillo: En el caballo, es un trastorno que afecta a la pared del casco y
a su superficie plantar (suela). Se caracteriza por pérdida de sustancia y
cambios en las características normales del estuche córneo (capa córnea).
En algunos casos se cree es secuela de laminitis crónica leve. La cojera es
muy frecuente. Al inspeccionar la suela, se aprecia un aspecto blando y
pastoso de la superficie interna de la pared. Se puede formar una cavidad
debida a la pérdida de sustancia córnea. Al golpear se aprecia un sonido
hueco en la parte afectada. Algunos lo denominan “mazamorra”, “mal de
casco”, pododermatitis o necrobacilosis y la asocian con un gérmen de los
barrizales y terrenos pantanosos (Spherophorus necrophorus). El adecuado
cuidado de los cascos (higiene y desinfección), el establecimiento de
lavapatas y el drenaje de pantanos y barrizales contribuyen a evitar este
trastorno limitante del caballo.

- Periostitis (Osteitis): El periostio es una fina membrana que recubre la
superficie de los huesos. En la práctica, apreciamos trastornos óseos en
forma de bultos, pequeños o grandes, dolorosos o no, que pueden producir
cojera. Algunos los denominan huesos en anillo “espigones”, osículos,
mataduras o protuberancias de la “caña” (el metacarpo y el metatarso) o en
términos veterinarios, exostosis o excrescencia ósea. De hecho, no sólo
aparecen en los huesos de la caña. En conjunto estas alteraciones se
deben a la inflamación y crecimiento anormal del periostio. La reacción
suele extenderse a los tejidos vecinos, produciendo una hinchazón fibrosa
(dura). Muchas veces los “espigones” o protuberancias están producidos
por fracturas muy tenues, difíciles de ver por Rayos X. Sobre estas
“microfracturas” se establece un callo que provoca inflamación del periostio
y un agrandamiento doloroso en la zona donde se encuentran. Puede
dañarse también el periostio cuando hay desgarros de ligamentos o
cápsulas articulares en el lugar donde se insertan en el revestimiento
externo del hueso. Se debe a este fenómeno, por ejemplo la aparición de
Los osículos y de sesamoiditis. En estos casos, la reacción es la misma:
calor, dolor e hinchazón locales. Una de las osteitis de mayor significado es
la que se presenta en el tejuelo (tercera falange) la cual provoca cojera
crónica.

LECCION 30. DESINFECTANTES Y DESINFECCIÓN.

Un desinfectante es todo agente capaz de destruir a los microbios que causan
enfermedad; el término se reserva generalmente a las sustancias utilizadas para
objetos y cosas inanimadas. Se diferencian de los antisépticos, porque éstos
impiden el crecimiento y el desarrollo de las bacterias cuando se aplicación a los
tejidos vivos.

En las condiciones corrientes, la higiene y la limpieza adecuada de los establos
elimina la mayoría de los microorganismos; sin embargo, los que permanecen
pueden dar origen a un brote de enfermedad infecciosa. De ahí que el usar
adecuadamente un buen desinfectante constituye una medida de prevención
necesaria. Su empleo es más urgente y necesario en el caso que se manifieste en
los caballos una enfermedad transmisible caso en el cual todas las instalaciones y
utensilios serán desinfectados minuciosamente.

La eficacia de la desinfección depende, fundamentalmente de los siguientes
factores:

- Una buena limpieza con abundante agua y jabón detergente germicida.
- Estricto cumplimiento de las indicaciones del fabricante para su uso,
especialmente en relación con las diluciones empleadas.
- La temperatura, puesto que muchos de los desinfectantes son más
efectivos cuando se aplican tibios o calientes.
- La forma de aplicación y el tiempo que dure el contacto.
- La minuciosidad de la desinfección, puesto que cualquier zona que no sea
sometida a la acción del agente puede guardar microbios que causen
enfermedad.
- La luz solar posee propiedades para matar gérmenes, pero su acción es
variable y superficial.


El calor y algunos productos químicos son más efectivos. La aplicación de calor
por medio de vapor o agua en ebullición es un método eficaz. Quizás el mejor de
todos es el flameo o llama para paredes, pisos y otras superficies, seguido de
aplicación de un buen desinfectante, ojala caliente. Hay que recordar que la simple
aplicación de agua hirviendo sobre una superficie, no asegura ni significa que
necesariamente haya sido desinfectada, cuando se elija un desinfectante se debe
tener en cuenta que no todos los microbios son sensibles a los mismos agentes
químicos. De todos los desinfectantes disponibles hoy por hoy quizás los
productos a base de yodo y el formaldehído (formol al 10%) se consideran los más
prácticos y efectivos, seguidos del amonio cuaternario, los cresoles (creolina), los
fenoles sintéticos y los hipocloritos.


EL BOTIQUÍN DE PRIMEROS AUXILIOS.


Como se dijo oportunamente, la administración de medicamentos debe hacerse
bajo control y vigilancia del Médico Veterinario, so pena de incurrir en errores
costosos. No obstante en toda caballeriza hay que hacer frente a una serié de
necesidades básicas para lo cual se debe disponer de un botiquín con los
elementos indispensables, algunos de los cuales pueden ser:

- Desinfectantes y antisépticos Líquidos. Como se dijo en la parte anterior los
desinfectantes se limitarán para su uso en instalaciones y equipos. El
caballo tiene una piel muy sensible y sólo se usarán antisépticos suaves y
ojala diluidos correctamente si se requiere lavar cortes y heridas. Los
productos a base de yodo (yodo-polivinil-pirrolidona) son usados con mucha
frecuencia en este tipo de casos. El agua oxigenada (peróxido de
hidrógeno) es muy eficaz también para lavar cortes y heridas. Si no hay nin-
guno a mano, el agua tibia (luego de hervirla) con sal, es muy eficaz.

- Polvos antisépticos. Muy importantes, ya que los cortes pequeños
(rasguños) curan mejor, una vez limpios, manteniéndolos secos y
protegiéndolos de la suciedad con estos polvos. Algunos de estos, vienen
asociados con repelentes de insectos para evitar “gusaneras”. Use el que le
recomiende el Médico Veterinario.

- Ungüento antiséptico. Un buen ungüento suave, a base de zinc o sales de
titanio, ayudará a prevenir la formación de tejido cicatrizal (granulación) y
favorecerá en cambio la regeneración a partir de los bordes sanos, una vez
curada la herida. También estimule el crecimiento del pelo.

- Emplasto de caolín. Tiene muchos usos: aplicado caliente, en forma de
cataplasma bajo una venda, alivia las distensiones y torceduras; si se aplica
en una herida abierta o punzante (incisa) y difícil de limpiar, chupará la
suciedad que se verá en forma de pus o manchada la compresa con el
caolín. Al ser una sustancia natural y no un medicamento, el caolín no
perjudica la cicatrización ni infecta y de hecho, a menudo beneficiaría la
recuperación.

- Linimento. Son productos de muchas marcas, unas más fuertes que otras a
base de aceites, esencias, contrairritantes y antiinflamatorios muy útiles
para aliviar torceduras y distensiones. Se usarán siguiendo las instrucciones
del fabricante.

- Ungüento oftálmico. Las partículas de polvo, los catarros, los arañazos, los
golpes con la fusta o los dedos del jinete, etc., pueden perjudicar los ojos y
por ende la visión del animal. En estos casos, se debe bañar el ojo con un
antiséptico suave en solución débil con agua y aplicarse un ungüento
oftálmico para aliviar la irritación.

- Glicerina neutra. Muy eficaz para lubricar e impregnar las torundas en el
momento de hacer limpieza en los pabellones de las orejas. Debe usarse
para lubricar la sonda nasolagrimal; la sonda nasogástrica y el termómetro
a la hora de realizar los procedimientos pertinentes.

- J arabe para la tos. Lo debe administrar el Médico Veterinario, pero es
conveniente tenerlo siempre a mano. A veces, la tos es simplemente el
resultado de comer heno muy aprisa.

- Poción para cólicos. En la mayoría de casos de cólico, salvo que se tenga
mucha experiencia, conviene llamar al Médico Veterinario. No obstante, por
si éste no puede desplazarse inmediatamente, se puede ganar tiempo,
siempre y cuando éste así lo indique, teniendo a mano alguna poción
recetada en otras ocasiones. Un ejemplo típico es el empleo de las
sustancias que contrarrestan la producción excesiva de gases
(antifermentativos, antiflatulentos).

- Sal de Higuera. Es buena para los caballos sometidos a dietas muy
acalóricas. Un puñado semanal les sienta bien.

- Sulfato de Magnesia. Muy útil para caballos sometidos a raciones de grano
y forraje seco. Dos a tres cucharadas grandes en la comida provee un ligero
efecto laxante.


- Sal y Agua. Es refrescante y sirve para endurecer la piel. Aplicación con
esponja en el lomo y detrás por debajo de la paleta (hombro) o donde se
aplica la cincha, contribuye a prevenir las mataduras y las llagas.


- Antiparasitarios. De dos clases: Para erradicar parásitos internos y
externos. Dentro del programa de control de parásitos expuesto antes, se
programará la administración según sean los recuentos de huevos,
periódicamente (mínimo cada tres meses). Es conveniente no comprar una
sola marca o un solo producto si no disponer varias clases y en varias
presentaciones.


- Vendas para cubrir heridas. Se pueden fabricar con gasa y algodón
hidrófilo, colocando éste por debajo de la gasa y recubriendo nuevamente
con gasa, o comprarlas listas para usar.


- Vendas de Yeso. Se deben aplicar bajo indicación profesional y en los
casos expresamente señalados por él siguiendo las instrucciones del
fabricante.


- Instrumental quirúrgico. Lo más importante es poseer como mínimo tijeras y
pinzas. Las tijeras (un par) estarán afiladas pero de puntas romas, para
cortar el pelo de los bordes de las heridas o cortes que necesiten vendajes.
Además es útil disponer de trozos de tela como apósitos o compresas, tiras
largas de tela para cubrir y vendar heridas, un paquete grande de gasa y
otro de algodón hidrófilo y uno o dos pares de vendas de crepé. Si se es un
experto, también se dispondrá de una jeringa hipodérmica y agujas de
varios calibres, pero sólo deberán poner inyecciones los que realmente
saben lo que hacen, no es en realidad difícil, pero hay que saber donde
clavar la aguja y cómo usar con destreza y rapidez la jeringa.











BOTIQUÍN VETERINARIO

Toda finca debe contar con un botiquín para primeros auxilios que consten de los
siguientes objetos.
 J eringas (30 – 20 – 10cm) con sus correspondientes repuestos (émbolos,
empaques, tubos de vidrio, agujas etc.).

 Linimento para golpes, a utilizar para endurecer la piel que ha sufrido una
rozadura o mataduras que han sido ocasionadas por la cincha, una vez ha
sido curada la herida

 Bolsa de frío instantáneo

 Gasas estériles.

 Toalla

 Agujas para sutura y para jeringa, de diferentes diámetros y tamaños.

 Seda para hacer suturas (de uso veterinario).

 Termómetro clínico.

 Bisturí, pinzas y tijeras.

 Equipo para aplicaron de sueros.

 Tela adhesiva

 Productos veterinarios tales como:
 Antibióticos.
 Sulfamidas
 Antisépticos, bactericidas, fungicidas, etc.
 Hormonas (oxitocina)
 Vermífugos internos y externos
 Pomadas desinflamantes, repelentes y cicatrizantes.

UNIDAD 3.
ACTIVIDADES COMPLEMENTARIAS EN EQUINOS

CAPITULO 7.
MANEJO Y ADIESTRAMIENTO DEL EQUINO

LECCION 31. MANEJO Y ADIESTRAMIENTO DEL CABALLO.


www.tierradecaballos.cl

Para entender de manera mas clara y precisa algunos de los procesos que se
comentaran en este capitulo, considero de gran importancia conocer primero el
fenómeno fisiológico del crecimiento, ya que este nos determinara la hora de de
realizar ciertas faenas propias en el manejo de los equinos, como es el caso de el
destete, el adiestramiento, la castración y otras mas que comentaremos a
continuación, al igual de cómo es el comportamiento social de los caballos. Así
pues tenemos:


COMO CRECEN LOS CABALLOS

De acuerdo a la información suministrada por el Doctor Luís J avier Otálvaro
Cardona, MVD. U. de A Asesor Técnico Línea Equina Finca S.A. según los
parámetros zootécnicos descritos en diferentes publicaciones en el mundo, los
potros al momento del nacimiento deben tener unos valores normales de talla y
peso, acordes con su tipo; por ejemplo, se espera que un potro de raza liviana
(como lo es el caballo criollo colombiano) debe medir el 61 – 64% de su talla
adulta y debe pesar 7.5 – 8.5% de su peso adulto. Los potros normalmente
alcanzan el 90% de su alzada adulta al año de edad, mientras que, sólo deben
lograr el 60% de su peso adulto en este mismo tiempo, debido a que un aumento
exagerado de peso tiende a aumentar la incidencia de enfermedades ortopédicas
del desarrollo. Se sabe que al año, el hueso de la caña ha alcanzado el 100% de
su longitud, pero sólo tiene el 90% de su circunferencia adulta.
El contenido óseo mineral y su resistencia también incrementan con la edad,
aunque el contenido mineral óseo solo llega a su pico entre los 3 y 4 años de edad
(madurez ósea). Anatómicamente, un hueso largo consta de un cuerpo o diáfisis y
dos extremos o epífisis, uno superior o proximal y uno inferior o distal, separados
ambos de la diáfisis por una placa de crecimiento o fisis (de tipo cartilaginoso).

En el equino, la nutrición inadecuada, el sobrepeso, el estado fisiológico de las
hembras (preñez), así como múltiples factores de manejo, incluidos la aplicación
de esquemas de ejercicio físico inadecuados, tales como la cuerda muy corta y a
poca edad o el inicio del proceso de doma y adiestramiento muy pronto en la vida
(generan excesos de presión articular, con irritación de las fisis y posterior
mineralización) pueden contribuir al modelado, formas y apariencia final de los
huesos, así como a la desaparición de la placa cartilaginosa epifisiaria.

Los huesos largos, generalmente, presentan uno o más centros de osificación, los
cuales se cierran en diferentes momentos de la vida; de la elongación o
estiramiento de ellos, depende el que un individuo pueda crecer y alcanzar su
talla. El crecimiento de un equino llega a su fin en el momento en que las placas
epifisiarias de los huesos se mineralizan y se cierran, con lo cual su crecimiento
longitudinal se detiene definitivamente. Esta fusión se produce normalmente en
períodos definidos para cada hueso. Por ejemplo, el hueso húmero cierra su fisis
proximal entre los 26 y los 42 meses de edad y el extremo distal entre los 10 y los
17 meses; el radio cierra su fisis proximal entre los 11 y los 18 meses, mientras
que la fisis distal se cierra entre los 22 y los 42 meses; la fisis distal del gran
metacarpiano (hueso grande de la caña en los miembros anteriores) se cierra
entre los 6 y los 18 meses; la primera falange cierra su fisis proximal entre los 6 y
los 15 meses de edad, en igual forma, se comporta la falange media.

El hueso fémur (del miembro posterior) cierra su fisis proximal entre los 36 y los 42
meses, mientras que la fisis distal se cierra de los 21 a los 42 meses; la tibia cierra
su fisis distal aproximadamente a los 24 meses, y la fisis proximal entre los 36 y
los 42 meses; los huesos del corvejón cierran su crecimiento entre los 19 y los 36
meses. Los huesos de la caña y las falanges del miembro posterior se comportan
igual que los del miembro anterior. De los pocos estudios realizados en nuestro
país sobre cierre de fisis óseas en equinos criollos, se ha encontrado que se
comportan en forma similar, como se pudo concluir de una evaluación radiológica
del cierre de la fisis distal del radio, realizada en el Criadero la J , donde
encontraron que en promedio ocurrió el cierre a los 21 meses de edad
(comunicación personal, Dr. J uan C. Cabal), resultado este compatible con los
obtenidos en equinos de otras razas, en diferentes estudios hechos en el mundo.

Como se puede observar, al analizar las edades en las que ocurren los cierres
epifisiarios de la mayoría de los huesos largos del esqueleto equino, ninguno de
estos huesos mantiene su crecimiento por encima de los 42 meses de edad, lo
que indica que el crecimiento vertical de un equino alcanza su valor máximo a los
42 meses (talla o alzada adulta) y no a los 60 meses como culturalmente está
propuesto para nuestro caballo criollo colombiano. Vale la pena tener en cuenta
este reporte, como respaldo técnico para revaluar la exigencia de alzada mínima
hasta los 5 años para los caballos de pista, descrita en el reglamento de
Fedequinas, ya que biológicamente no existe alguna posibilidad de que un equino
continúe creciendo hasta dicha edad, después de los 42 meses, excepto por
razones patológicas (no descritas en el equino). Cualquier diferencia adicional que
se pueda observar en la alzada de un equino, después de los 42 meses de edad,
estará sustentada en engrasamiento dorsal, longitud de pinzas o espesor de
herraduras. Igualmente, es importante recordar que la aplicación de sistemas de
ejercicio físico inadecuados a edad temprana, tales como la cuerda excesiva o el
inicio del proceso de doma y adiestramiento, pueden provocar el cierre temprano
de las fisis óseas debido al estrés que se genera a nivel fisiario y articular, con la
posterior mineralización de las placas y su cierre definitivo.

Con base en los reportes existentes en la zootecnia del mundo sobre parámetros
de desarrollo y crecimiento y en la observación del comportamiento en el
crecimiento de potros criollos colombianos de diferentes zonas del país, a los
cuales se les había corregido el esquema de manejo nutricional y dietario, incluido
el manejo de las yeguas de cría en el último tercio de gestación (esquema de
manejo nutricional similar en todos los ejemplares, para disminuir los sesgos
estadísticos), y teniendo en cuenta las expectativas mínimas de crecimiento
descritas en el reglamento de Fedequinas, planteamos una curva de crecimiento
para potros criollos colombianos que cumpliera con los parámetros zootécnicos ya
descritos (61-62% de la talla adulta al momento del nacimiento, 90% de la alzada
a los 12 meses, 97% de la alzada adulta a los 24 meses y 100% a los 42 meses);
se sacaron los promedios reales de potros y potrancas de las distintas
modalidades de paso de diferentes edades y se obtuvo la curva real de
crecimiento, la que comparada contra la curva hecha con base en parámetros
ideales, nos mostró que los crecimientos reales eran superiores. Por tal razón, las
curvas ideales fueron analizadas estadísticamente para refrendar su validez; se
les aplicaron regresiones estadísticas, las cuales arrojaron confiabilidades del 97 y
98 % para la curva de alzada y la curva de peso, respectivamente.

Estas curvas siguen siendo convalidadas actualmente en gran cantidad de
explotaciones equinas de todo el país, y nos siguen demostrando su validez
estadística; igualmente, nos han permitido hacer una crianza del caballo criollo
más objetiva, ya que nos define parámetros serios de desarrollo para cualquier
tipo de ejemplar. Adicionalmente, con base en los resultados obtenidos, hemos
logrado tumbar un paradigma de crianza muy generalizado en el país, con el que
normalmente nos respondíamos cuando los potros no crecían: la genética.
Aunque es cierto que la genética determinará tipos y tamaños, calidad, color,
fenotipo, etc., también es cierto que la expresión genética es altamente alterable
por factores de tipo ambiental y de manejo, y la nutrición es uno de los que más
afecta. Por ejemplo, un potro con información genética para que tenga buena
alzada adulta, puede quedarse pequeño porque nutricionalmente no se le permitió
que expresara todo su potencial.
Históricamente, el manejo nutricional del caballo criollo ha tenido muchos errores
debido a la alta tendencia que existe entre la sobre nutrición, la subnutrición de
componentes importantes como la proteína o los minerales, y en el peor de los
casos la desnutrición, impidiendo la verdadera expresión genética de la gran
mayoría de la población equina criolla colombiana.

LECCION 32. Comportamiento social del caballo.
Si pretendemos domar a nuestro caballo, primero deberemos entender su
comportamiento y cuáles son sus necesidades.

La etología es una ciencia muy apasionante que estudia el comportamiento de los
animales, y muy en especial, al tratarse de la conducta equina.

Un error muy común que tienden a cometer los humanos en respecto a los
equinos es pretender que estos piensen y actúen como ellos, ya que otras
especies si se han sometido a un proceso de humanización más elevado, cosa
que en los equinos no ha sido posible. Los caballos son animales de instinto y no
de razón que es una cualidad humana, sus demostraciones de la supuesta
inteligencia no son más que el resultado de un adiestramiento basado en la
repetición que se traduce en una diversidad de reflejos condicionados por el
hombre.
Su mentalidad esta basada en instintos desarrollados en el estado salvaje como
medio de supervivencia contra los riesgos naturales del medio y de sus
depredadores, es decir son el resultado de sus instintos atávicos y el medio que lo
rodea, debido a la domesticación, algunas conductas se fueron perdiendo y otras
se modificaron.

El caballo es un animal instintivo que aprende a través del reflejo condicionado, y
lo fija en su memoria retentiva. Tiene una gran capacidad de memoria. En general,
no es un animal agresivo, es, más bien, temeroso y sensible al dolor. Posee la
capacidad de huir a gran velocidad. Le es propio un instinto gregario muy
desarrollado expresado al vivir en estado salvaje formando manadas. Dentro de
este grupo organizado socialmente los más jóvenes aprenden de la observación
del comportamiento de los adultos.

El temperamento es nervioso, lo que está muy relacionado con la genética, con la
raza y con el orden social dentro de una manada.
El caballo es un animal con tendencia a vivir en manada, en un grupo social.
Como cualquier grupo, una manada de caballos se estructura a través de unas
reglas y una de las más importantes es la jerarquía.
Estructura social.

Instinto gregario natural: Forman grupos, generalmente de dos a veintiún
individuos (Harén) comandados por un padrillo y el resto lo conforman las yeguas
y las crías. El número de yeguas que tiene cada padrillo está balanceado
naturalmente por la capacidad de este último para poder aparearse con una
cantidad determinada de hembras. Las hembras que no se reproducen a menudo
son expulsadas de la manada. Las crías permanecen en el grupo hasta los veinte
y veinticuatro meses de vida (madurez sexual), momento en que el padrillo los
elimina de la manada y forman una manada de machos jóvenes y una manada de
hembras. El grupo de machos está liderado por el individuo más dominante del
grupo que, poco a poco, va expulsando a los integrantes uno a uno, y estos se van
incorporando a manadas de potrancas solas y así se van formando nuevas
manadas.

Aproximadamente, a un seis por ciento de los potrillos que nacen en un grupo se
les permite permanecer en el mismo, de esta forma se asegura que en la manada
no exista consanguinidad.

La dominancia dentro de la manada se establece por factores sexuales, el padrillo
domina sobre las yeguas; las yeguas dominan sobre los individuos más jóvenes; y
factores de tenor de agresividad, los más fuertes dominan sobre los más débiles, a
veces, independientemente de la edad.

Cuando hay enfrentamiento entre dos animales de la manada de la misma
jerarquía, es más agresivo que si lo hacen dos individuos de diferente escalafón
social.



www.20minutos.es

Los equinos no tienen hábitat exclusivo, lo comparten y, a veces, lo disputan con
otras manadas, lo que genera peleas entre padrillos de diferentes grupos. Existe
en estas situaciones una actitud muy característica: el macho se ubica delante de
sus yeguas y balancea el cuello como forma de amenaza a su rival. Si el
contrincante no se retira, el paso siguiente es la actitud de intentar a morder a su
rival, y si con esto tampoco se retira, generalmente, se muerden y se patean. Los
sitios más comunes en que se lesionan son: el cuello, la parte costal, y la zona
genital. Difícilmente se maten en una pelea.

El padrillo reconoce a sus yeguas por el olor de la orina y la materia fecal y posee
la actitud instintiva de orinar y defecar sobre las sustancias excretadas de sus
yeguas para que otros padrillos no las puedan localizar por el sentido del olfato.
Cada caballo tiene una posición dentro del grupo, que será importante conocer
para poder definir las características de la doma que necesitaremos realizar:
Las yeguas heredan su rango, no tienen que pelear por él, por ello se pueden
mostrar hostiles entre ellas, ya que dos yeguas tienen siempre el mismo rango.

El macho debe luchar por alcanzar una posición privilegiada en la manada: esto le
da un carácter mucho más duro y agresivo, lo que implica unas características que
deberemos tener en cuenta en su doma:

El semental jefe y la yegua jefa conviven al mismo nivel, sin disputarse ambos
rangos.

El caballo de rango máximo (líder) puede echar a cualquier otro caballo del sitio en
donde estén, sin ningún tipo de razón.

El caballo que tiene un rango inferior, no puede pasar por delante de otro con
mayor rango. Irá por detrás y lo hará sin quejarse. Esto hace que, en situaciones
de peligro, la manada no se disperse; el caballo de rango superior marca la
dirección y el resto le siguen.

El caballo de rango superior puede empujar a otros, lo hace con objeto de que la
manada no se separe y además para rechazar a sementales jóvenes que
comienzan a imponerse. Esta es la razón por la que el caballo obedece al jinete:
ya que al quedar fuera de su espacio visual, para el caballo es como si el jinete
fuera el semental que le está empujando.

Esta jerarquía existe en cualquier raza de caballo y es aceptada por todos sus
miembros.

Sus sentidos.

www.caballomania.com

Su visión:

La vista es un sentido que está muy desarrollado en el caballo, pero tiene límites.
Posee excelente visión latero posterior, pero de frente ve correctamente a una
distancia mínima de doce a catorce metros por delante de sus ojos. Por eso, los
caballos lateralizan la cabeza al observar algo de repente que se halla a poca
distancia.

El caballo tiene un campo de visión muy amplio, entre 340º y 360º, con las
siguientes características:
Dispone de un campo ciego, que le impide ver en línea recta delante suyo, sobre
algo más de un metro.
La visión lateral con un sólo ojo no le permite percibir el relieve, por eso
deberemos permitirle girar la cabeza. A pesar de que percibe mal los detalles, es
muy sensible al movimiento.
Los equinos son animales capaces de ver de noche, con cierto grado de presicion,
mucho mejor que la del hombre.


Su oído:

El sentido del oído en el caballo está muy desarrollado:
Su oído es tan potente que puede escuchar sonidos imperceptibles para el
hombre.
Sus orejas se orientan hacia el lugar en donde se ha producido el ruido.


Su olfato:

También es un sentido que tiene muy desarrollado. Le es útil para encontrar a
grandes distancias la presencia de alimentos y/o abrevaderos, para el
reconocimiento de su especie, como por ejemplo: de la madre al potrillo en el
nacimiento. Asocia, generalmente, el olor a adrenalina y el olor a sangre con el
peligro.


El tacto:

Lo tiene desarrollado en las extremidades, los pelos del mentón y los pelos de los
labios, denominados estos como pelos táctiles.


Sexto sentido:

Es la capacidad que tienen para detectar con anticipación los cambios
atmosféricos. Es común observar las corridas por un potrero en los días de mucho
viento y el ubicarse de cola al viento y/o a la lluvia en los días de temporal.

El equino duerme muy pocas horas por día y lo hace echado; parado sólo suele
dormitar y esto lo hace varias veces al día, manteniendo un perfecto equilibrio sin
realizar grandes esfuerzos, gracias a la capacidad exclusiva que tiene para trabar
las articulaciones de la rodilla de sus miembros posteriores.








Sus lenguajes:

El caballo utiliza diferentes partes de su cuerpo junto con los sonidos para
comunicarse, conviene saber qué quiere decirnos con cada uno de estos
lenguajes:

Orejas:
Son un indicativo del estado de ánimo del animal:
Lánguidas y caídas: significa que el caballo no está a gusto o se encuentra
enfermo. También es un síntoma de sumisión.

Las diferentes posiciones de las orejas tienen su propio significado, así pues:
- Si las orejas apuntan hacia arriba significa que el caballo esta en alerta.
- Si las dos orejas apuntan hacia delante significa que el caballo siente
curiosidad.
- Si las dos orejas apuntan hacia atrás significa que el equino esta
disgustado.
- Si una oreja apunta hacia delante y la otra hacia atrás, significa que su
atención esta dividida.

Cola:
Símbolo de energía, sus movimientos también nos informan sobre el estado del
caballo:
- En alto: señal de alegría.
- Entre las ancas: sugiere desconfianza.

La boca:
- Los labios relajados indican tranquilidad.
- Sacar la lengua como saboreándose indica que el caballo tiene sed o en el
caso de los potros que estos desean mamar.
- Si la tiene ubicada hacia un lado en la comisura labial y curvada hacia
abajo, el caballo siente dolor o incomodidad.
- Si abre y cierra la boca con la comisura de los labios curvada hacia arriba
nos indica que el caballo esta miedoso o que esta sometido.
- Si abre la boca y deja ver los insicivos nos demuestra que el animal esta
una posición de agresividad por sentirse en peligro.

Sonidos que emite el caballo:
A pesar de que el caballo no emite muchos sonidos, deberemos saber qué
significa cada uno de ellos:
Bufido: cuando el caballo expulsa aire por su nariz, es símbolo de contento.

Mugido: indica temor o desconfianza ante algo que no conoce.

Gruñido: señal de dolor.

Chillido: normalmente es breve y agudo, y suelen ser las hembras quienes lo
emitan, para manifestar su mal humor (casi siempre cuando se encuentran delante
de otra yegua).

Relinchos:
El relincho es la voz del caballo por el cual se comunica con otros congéneres en
especial entre madre e hijo, entre el padrillo con cualquier otro ejemplar, y la
hembra en celo para llamar la atención del padrillo.

Alteraciones del comportamiento
En muchas circunstancias el actual manejo de los equinos puede predisponer a
situaciones de comportamientos aberrantes o patológicos. Estas alteraciones del
comportamiento son más comunes de observar al privarlos de su libertad. Esto no
sólo les trae problemas de cambio del comportamiento, sino también los
predispone a diversas patologías de origen respiratorio, locomotor, digestivo,
reproductivo.


LECCION 33. DESTETE DEL POTRILLO.

Como todo individuo joven el potro en sus primeros meses de edad es arisco,
miedoso y su confianza se encuentra cimentada en su madre y en menor
proporción en su manada, por lo tanto hay que empezar ha inspirarle confianza.

El destete es un periodo critico en la vida de un animal, consiste en un
acostumbramiento del potro a la separación total de la madre o nodriza, esto debe
ocurrir cuando las crías tienen un desarrollo del tracto digestivo que ya es capaz
de utilizar otros alimentos más groseros en sustitución del alimento lácteo, en este
proceso ayuda el grado de preparación que se haya dado, Para evitar un estrés
excesivo en el potro trataremos de realizar el destete de la forma más natural
posible.

Lo ideal es acostumbrarlo a una dieta en la cual la leche de su madre tenga un
lugar cada vez más secundario durante algunas semanas antes de que se
produzca la separación definitiva.

Es usual que muchos caballistas inicien un entrenamiento en los primeros días de
edad del potrillo, con el ánimo de que éste se acostumbre más rápido al contacto
con su amansador.
Un buen sistema es encorralarlo con la madre, con la precaución de que el piso
sea de tierra o en cama de viruta para evitar que un momento dado no se resbalen
y se lastimen, también se debe tener en cuenta que los comederos y bebederos
estén a la altura del potro, que no tengan esquinas ni puntas que permitan que se
se hieran.

Una vez allí se inicia intentando abrazarlo por el cuello, y luego que se tranquilice
le ponemos una mano en la cara a manera de bozal y la otra en el anca o en el
cuello, el procurara defenderse y librarse de quien lo tiene, pero al fin se rendirá.

Al cabo de unas cuantas arremetidas hacia adelante y hacia atrás, cuando le
tengamos ganada su confianza le pondremos suavemente la jáquima lo más
liviana posible para no maltratarlo, con el pizador lo vamos halando suavemente
hacia un lado y otro, sin hacerlo caer.



Tomada en Pesebrera El Puente - Neiva



Estas prácticas siempre se efectúan en los primeros meses en compañía de la
yegua; pero a los 3 – 4 meses se hará que el tiempo de sujeción, y el paseo con el
cabestral se prolongue por 30 – 60 minutos, así el potro se va adaptando a
progresivas separaciones de su madre.

Es aconsejable que el destete se lleve a cabo en la época de verano ya que en el
invierno los potros están sometidos a problemas podales por el reblandecimiento
de los cascos, además el animal debe ser llevado a potreros con pasturas de muy
buena calidad, agua limpia, fresca y abundante, además de un suministro diario de
sal mineralizada.

La edad del destete esta determinada por 3 factores básicamente:

- La producción Láctea de la yegua.
- El periodo de gestación en el que se encuentre.
- El estado corporal del potro o de la yagua.

Si la medre se encuentra en una condición corporal entre 1 y 4, se debe retirar el
potro a los 6 meses de edad y a veces aún, entre los 4 o 5 meses.

Si por el contrario la yegua esta en buena condición corporal es decir entre 6 y 9, y
su producción Láctea es aún buena, se le puede permitir al potro permanecer con
ella hasta los 8 meses.

La edad ideal o por lo menos la más indicada para el destete está entre 6 a 8
meses. Si la yegua se sirvió en el “calor del potro”, el destete se deberá efectuar a
los seis meses, salvo que la yegua goce de un excelente estado general, en este
caso se podrá prolongar hasta los ocho meses.
Como se dijo anteriormente, para el destete el potro deberá haberse adaptado al
consumo de grano o de algún tipo de suplemento, así éste no ocasionará mayores
problemas, ni atraso en su desarrollo.

Existen dos maneras de realizar el destete:
- En forma brusca o súbita
- En forma lenta o gradual.


Forma brusca o súbita
Se retira la yegua o el potro a otra área, esta forma es la más utilizada y causa
mucho “stress” en el potro, pero es menos costosa y requiere menor trabajo. Se
puede desarrollar de la siguiente manera:

Tomadas las prevenciones de rigor, la separación se hará total. Es indispensable
que el potro no pueda volver a ver, oír u oler a la madre puesto que esto
malograría el proceso de separación. Si los equinos están estabulados, se deja el
potro en el establo que compartía con la madre, y ésta será llevada a otro establo
suficientemente alejado; los establos, en especial el del potro deberán estar libres
de obstáculos y elementos traumáticos con los que el potro pueda inferirse daño al
entrar en impaciencia por la separación.

Si los animales están en pradera, la yegua saldrá del lote de yeguas paridas, en
este caso también deben prevenirse los riesgos de lastimaduras o cortadas en
especial cuando hay presencia de alambres de púas.

Forma lenta o Gradual
Se inicia a los 4 – 5 meses y semana a semana se va aumentando el número de
horas en que se separan madre e hijo, posteriormente el potro estará con la madre
un día si, y otro no.

Habituado el potro a estos periodos de separación es un buen momento para
empezar a montar a la madre dejando al potro en su corral. Paulatinamente los
ratos de separación se irán prolongando

.
Tomada en Pesebrera El Puente - Neiva
Cuando llega el momento del destete se coloca a la madre y potro separados por
una valla en corrales contiguos, se pueden ver y tocar pero el potro no puede
mamar. Así el potro no sufre tanto estrés al tener contacto con su madre.
Los primeros días es recomendable dejarlo que se reúna con su madre para que
pueda mamar tres veces al día, luego dos, una, y así progresivamente hasta que
deja de mamar.
Desde mi punto de vista es la mejor forma para que la madre deje de dar leche sin
estresarse, a la vez que evitamos posibles problemas que puedan aparecer en las
ubres (posible mastitis) si le quitamos el potro de un día para otro. Además se ha
comprobado que la madre deja de producir leche mucho antes si esta cerca a su
potro, pues si los separamos totalmente el estrés que sufre la yegua le dificulta el
secado.
En ese momento podemos aprovechar para buscarle un compañero al potro que l
acompañara y le ayudara a integrarse luego en un grupo de potros.
Otro sistema habitual es llevarse al potro lejos, a la montaña e introducirlo en un
grupo de potros. Es una situación muy estresante para el potro y para la madre.
Para el potro se une la separación de su madre, un cambio brusco de alimentación
y el rechazo que al llegar recibirá del grupo, lo que hará que su estrés aumente,
dificultando aun más su adaptación a esta nueva etapa de su vida.
Algunas personas conocedoras del oficio aconsejan formar grupos de potros por
sexo, esta práctica es útil cuando el número de potros es muy grande, para que
los potros no se inquieten podrán “amadrinarse” a un caballo viejo, castrado y
manso el cual les comunica su calma.

El secado de la yegua puede efectuarse paralelamente con el destete del potro, tal
vez la forma práctica de hacerlo sea reduciendo la ración de la yegua
aproximadamente a la mitad varios días antes de la separación, el retiro de la
leche se producirá sin dificultad.

Otro método es masaje de la ubre, sin ordeñarla durante 5 – 7 días, así la ubre
esté llena no deberá vaciarse; al final del 7 día, cuando la glándula esté blanda y
flácida se ordeña, extrayendo la secreción que aún contenga.

En cualquiera de los métodos de secado, se tendrá especial cuidado, ya que
prácticas antihigiénicas o traumáticas se convertirán probablemente en mastitis,
cuyas secuelas pueden ocasionar la pérdida de la glándula en su conjunto.

LECCION 34. DOMA, ADIESTRAMIENTO Y EJERCICIO EN LOS EQUINOS.





www.caballosderaza.com
DEL DESTETE AL ADIESTRAMIENTO.
Durante esta época es bueno proporcionar a los animales un pastoreo adecuado,
ejercicio obligado, estabulación y suplementación alimenticia adecuada. La
exposición a los rayos solares es importantísima para la elaboración de vitaminas
y el aprovechamiento de minerales.

La mejor manera que el potro se ejercite es colocándolo en el potrero, con el
comedero al extremo contrario al bebedero.

La estabulación es importante para acostumbrar a los animales a entrar en
pesebreras y evitar que se vuelvan indomables.
La obtención de un buen adulto depende mucho del manejo de esta etapa del
desarrollo del potro.
La alimentación del potro es determinante; el objetivo debe ser llenar todos los
requerimientos alimenticios relacionados con proteínas, carbohidratos, grasas,
macro y micro elementos.

Aparte del ejercicio voluntario que los animales realizan en el potrero, se les debe
someter a ejercicios de cuerda; por lo menos de 3 a 4 veces por semana.
Estos ejercicios pueden tener una duración de quince a treinta minutos.
El fin de estos ejercicios es obtener un animal más dócil con más bríos y mejor
desarrollo.

A partir de los 6 meses se debe medir la alzada y pesar el potro cada mes hasta el
año y luego cada tres meses hasta los 2 años. Esto con el fin de observar su
crecimiento y desarrollo. Al año y medio, puede llevarse a ejercicio controlado,
teniendo cuidado de no excederse.

Empezar con cinco minutos y terminar con 30 minutos es una buena medida para
un potro en buenas condiciones.

La doma es de suma importancia en el equino y muchas veces el hombre no la
tiene presente, por tanto ya a partir del primer mes de vida de la cría y por las
múltiples actividades que debemos realizar con ellas tales como arreglo de
cascos, crines, cola, cura de parásitos etc. hay que realizar labores
preferentemente separados de las madres, que podemos resumir de la forma
siguiente:
 Poner jáquima todos los días hasta que se acostumbre a ella.
 Poner una cuerda de 2-3 MS. Atada a la jáquima para que se adapten a ser
manejadas por la cabeza y a tener movimientos limitados, hay que evitar
obstáculos en los que se puedan enredar.
 Amarrarlos en lugares altos para que no se enreden las extremidades y se
adapten a estar sujetos al lugar.
 Como último aspecto del amansamiento es enseñarlos a cabestrear detrás
del hombre o de un caballo con jinete.

Las actividades de la doma deben ir encaminadas a que los animales adquieran
las habilidades acorde con la función que desarrollarán el trabajo en la ganadería,
el deporte, el tiro o arrastre, el paseo etc.

Independientemente de las actividades que desarrollará el equino la monta por el
hombre siempre debe ocurrir aunque se utilicen para la reproducción y esta doma
debe realizarse cuando los equinos han adquirido un buen desarrollo (alrededor
de 30 meses de edad) y estos deben estar herrados de las cuatro extremidades.
Durante este proceso los animales se deben acariciar y cepillar para darles
confianza, además es bueno proporcionar a los potros áreas de pastoreo
adecuadas.
El amansamiento incluye la aceptación a levantar los remos, esto es básico para
posteriores trabajos en los miembros tales como: herraje, exámenes, curaciones,
etc.
La doma no puede constituir un trauma para el animal y esta enseñanza debe
hacerse con cariño y responsabilidad, pues un mal manejo puede ocasionar
lesiones e incluso la muerte del animal.

El adiestramiento comprende doma de cabeza, luego de silla y finalmente se
monta para adiestramiento de lomo, esto se resumen en el siguiente cronograma
de actividades:

 Poner los arreos de la cabeza y el basto.
 Poner montura sin apretar las cinchas y posteriormente se aprietan y se
hace caminar.
 Si el animal es muy brioso se camina con un peso (ej. Saco algo pesado
encima). Algunos recomiendan realizar esta actividad entierras aradas y sin
obstáculos.
 Por último se monta el jinete, al principio al cabresto detrás de otro caballo
con jinete y al final solo.
Esta actividad debe realizarse paulatinamente y sin atropellar los pasos a seguir;
tenga presente que todos los animales no son iguales y unos necesitan más
tiempo que otros, lo importante es que lo haga bien y se obtengan los resultados
deseados.

Las jornadas de adiestramiento deben ser graduales, se inician con 15 - 20
minutos al día, hasta llegar a las dos horas.

El trabajo sobre el cuello, lo cual se conoce en términos populares como
“quebrarlo” se hace con el fin de que el animal aprenda a voltear, parar, subir y
bajar, esto se logra con el manejo de “rienda falsa” o sea, un bozal sin freno, esta
etapa puede durar unos 3 - 4 meses; una vez el potro se ha acostumbrado a esta
rienda falsa, el equino se puede herrar.

La siguiente fase de adiestramiento corresponde al “freno suelto”, ya no se
empleará el bozal, sino que el freno se adicionará a la rienda con el ánimo de que
el animal soporte el instrumento en su cavidad bucal.

Como se dijo anteriormente es importante que en todas las fases de
adiestramiento el potro esté acompañado de un equino adulto, el cual actuará
como “madrina” transmitiéndole seguridad y confianza al potro.

Si existe la posibilidad de estabulación, el potro debe acostumbrarse a la
pesebrera, en ésta deberá tener tranquilidad y buena comida; la permanencia en
el sitio de estabulación no rebasará las seis horas, para así eliminar posibles
lesiones en los aplomos.
Los equinos destinados a trabajo tienen un ritmo de entrenamiento diferente, ya
que la mayoría de ellos deberán tirar carrozas o “zorras”; por tanto su plan de
entrenamiento dará mayor importancia a desarrollar la habilidad del equino para
jalar diferentes pesos y objetos.



EJERCICIO.


El ejercicio periódico es esencial para la salud del animal y en especial para el
desarrollo y vigor de sus miembros. El pastoreo a voluntad es ideal para los
potros, ya que además de poder desplazarse a voluntad reciben rayos solares
necesarios para un completo desarrollo óseo.
Todos los animales deben efectuar ejercicio diario durante 10 a 15 minutos.

Animales jóvenes o en procesos de recuperación en los cuales la monta no es
aconsejable, el ejercicio podrá efectuarse por medio de una cuerda de 9 – 12
metros, el ejercicio consiste en que el equino debe dar vueltas alrededor de quien
sostiene la cuerda, en la

Los animales adultos se deben ejercitar montando los o haciéndolos tirar de su
vehículo al menos durante una hora diaria.

La yegua recién parida puede realizar ejercicios uno o dos días después del parto,
estos deberán ser suaves y de corta duración.




LECCION 35. MANEJO.

El término “manejo” resume por decir así el conjunto de aspectos técnicos y
actividades prácticas encaminadas a proveer a los animales el mayor bienestar
posible a un costo razonable buscando siempre mantenerlos en constante
producción según sea su nivel de especialización y su función específica.

Partiendo de la base del valor económico y de bienestar de un caballo, su
propietario o cuidador diseñará y cumplirá un buen programa de manejo que en
todo caso no será absolutamente estricto y le permitirá acomodarlo según las
circunstancias y los imprevistos.

Pero la guía o normas básicas que lo orientan y sustentan serán de riguroso
cumplimiento.


MANEJO ADECUADO DE LA CABALLERÍA.

Como en todo sistema de explotación, en los grandes y pequeños
establecimientos de caballos, las normas de manejo y su cumplimiento, les
evitarán costosas inversiones o cuantiosas pérdidas a sus propietarios.

El saber proceder frente a las numerosas situaciones que se presentan a diario
solo se adquiere con la experiencia que otorgan los años. No es gratuito que
aquellas personas que han convivido por muchos años al lado de los equinos sean
el patrimonio más valioso para el propietario de una cuadra de éstos. Solamente el
control de todos los aspectos a nivel de campo hará la actividad rentable y en
donde el papel primordial que juega en la práctica el cuidador (capataz), es
irrefutable. Este debe conocer perfectamente el comportamiento de los animales
de los cuales se hace cargo y demostrar que tiene mucho y buen sentido y espíritu
de observación, para detectar e interpretar sus reacciones. El éxito final
dependerá también de los elementos y recursos físicos y técnicos de que
disponga para desarrollar su labor. En consecuencia, para que el cuidador pueda
enfrentarse a estas responsabilidades, no podrá ocuparse más que de un número
determinado de caballos.

IDENTIFICACIÓN Y MARCACIÓN DE CABALLOS.

Cualquiera que sea el número de efectivos en un plantel equino, necesitará de
algún sistema seguro y efectivo de identificar a cada uno de los individuos que
componen la cuadra. En los equinos, relativamente hay mayor facilidad de
identificación debido a las particularidades de su pelaje; pero este no pasa de ser
un sistema subjetivo de reconocimiento que no es útil para efectos de toma de
registros e inscripciones en asociaciones especializadas las cuales son estrictas
en grado sumo en las identificaciones.

Hi erros Candentes
El método más antiguo que existe para la identificación de un caballo es la marca
en caliente en donde se identifica mediante un logo o las iniciales del criador o
propietario o de su criadero. Consiste en colocar al rojo vivo un hierro aplicándolo
sobre la piel del animal causa durante su aplicación un fuerte dolor a más de la
tensión nerviosa y la posibilidad de un accidente en su ejecución.
Se emplean hierros de 5 – 8 CMS. de longitud, la marca se aplica usualmente a la
altura del humero, indistintamente en alguno de los miembros; este sistema de
identificación presenta el inconveniente del daño irreversible ocasionado a la piel,
lo cual para ciertos criadores es un problema que afecta el conjunto estético de su
ejemplar. En campo, es el método usado con mayor frecuencia por lo económico y
seguro.
Tatuaje indeleble debajo del labio
El tatuaje consistente en la aplicación de tintas en números aplicados en la
mucosa del labio superior del caballo. Se usan cifras o códigos que corresponden,
o bien al orden interno de la caballeriza, o al numero de registro proporcionado por
la asociación a la cual se encuentre inscrito el ejemplar. Este método es el único
reconocido por criadores de razas de caballos de carreras, ya que garantiza que el
ejemplar inscrito en una prueba sea en realidad él y no se preste a cambios
fraudulentos que de otra forma se podrían dar con facilidad.
Fue el primer paso que se dio en la identificación del caballo de una manera clara
segura y suficiente para obtener la credibilidad que se había perdido en los
registros, sistema este que con los cambios tecnológicos que hoy existen fueron
cambiados a sistemas menos traumáticos, ágiles y sencillos de manejar además
de ser más higiénicos evitando contagios de enfermedades como la anemia
infecciosa.

Marcación con Hi erro Frío.


La marca en base a frío o criomarca que al introducirse en nitrógeno líquido
disminuye la temperatura hasta casi 200°C bajo cero ó en una mezcla de hielo
seco y alcohol que la disminuyen hasta menos 90°C suficientes para disminuir las
células pigmentarias de la piel también llamadas melanocitos creciendo pelo de
color blanco visible en unas seis semanas. Presenta alguna dificultad de
identificación en los colores más claros siendo sin embargo visible si se aplica en
ellos. Es este un método menos doloroso para el animal, más económico y por
demás vistoso y agradable.
En el mercado se consiguen marcas frías elaboradas con base en sustancias
cáusticas que al ser aplicadas sobre la piel, producen una “quemadura” de menor
intensidad que la ocasionada por el hierro candente y con la ventaja adicional de
ser reversible.
Este sistema de marcación se aplica en el mismo lugar que el del hierro candente
y presenta idénticos inconvenientes.

Identificación por espejuelos.

Investigadores en Estados Unidos encontraron que los espejuelos de los equinos
mayores de un año, no cambian en el resto de su vida; y que no hay dos animales
que presenten características idénticas en sus espejuelos, por tanto serían en los
caballos “las huellas dactilares”. Este sistema no es muy práctico ya que necesita
llevarse registros fotográficos de los espejuelos y cada vez que se necesite la
identificación deberá confrontarse con la impresión original. Este método es de
utilidad para ejemplares muy valiosos, pero no será cómodo, ni rentable su empleo
para la gran mayoría de caballistas.


Identificación electrónica.

La marcación electrónica conocida como el microchip, se impone como medio de
marcación en la mayoría de los animales pues es un método poco traumático
aséptico y ágil para su colocación ó identificación, obteniendo cada día más
relevancia hasta llegar a ser hoy un requisito indispensable para el registro de un
caballo. Consiste en una jeringa o pistola que contiene en su punta el microchip de
3 por 15 mm, con su número mediante código de barras para ser inoculado de
forma subcutánea en un lado de la tabla del cuello del equino sin producir efectos
colaterales ni dolor, no se mueve, se encapsula lo que no permite reutilizarlo o
cambiarlo. Existe además un lector o trasponder que al colocarse por encima de la
superficie donde se encuentra el microchip, capta el número y permite su
identificación. El número de registro o microchip nos da la certeza sobre un animal
evitando que hacia el futuro no se de el tratamiento manipulado e inexacto que se
dio en otras épocas en donde se cambiaba el criador, los padres, el nombre del
animal, volviendo a la exactitud del registro. Permite además un mayor
seguimiento a través de otros adelantos tecnológicos como el computador para
hacer ciertas clases de seguimientos como control de peso, alimentación,
reproducción y parentesco que no sólo facilitan si no que se convierten en una
herramienta importante para el criador actual.





Ventajas del sistema:

- Control de manadas y organización más eficiente.
- Imposibilitar los cambios fraudulentos y/o hurtos.
- Seguridad en el manejo a distancia de la cría.
- Genera valor agregado exportaciones equinas.
- Posibilita la masificación del seguro en caballos deportivos.
- Mejoras operativas en inscripción y registros.
- Sistematización de las bases de datos de las asociaciones.
- Control de planes sanitarios y registros epidemiológicos.
- Titularidad y procedencia del animal.










Microchip J eringa sanitaria desechable con microchip
www.microchipavid.com
Protocolo De Aplicación En Equinos.

1. Escaneo Del Paciente: El sitio en donde se inyectará el microchip será
recorrido varias veces verificando que el animal no se encuentre
identificado con anterioridad.

2. Escaneo Al Microchip: Antes de la inoculación, se deberá leer el microchip
en su contenedor estéril para certificar el número y su funcionalidad.

3. Desinfección: El área de implante deberá desinfectarse únicamente con
alcohol habiéndose comprobado que otros elementos desinfectantes
pueden ocasionar irritación al tejido si se inyectan accidentalmente con el
microchip.

4. Lugar De Aplicación: En el ligamento nucal del lado izquierdo, en la zona
media entre la cruz y la nuca.

5. Aplicación: Insertar la aguja en su totalidad, hasta que la base del plástico
entre en contacto con la piel. Utilice criterio profesional en animales de
pequeño tamaño. Presione despacio el embolo de la jeringa. Aplique
presión durante 30 segundos sobre el sitio de inyección luego de extraer la
aguja.

6. Verificación: Verifique la correcta lectura del microchip en el animal luego
de la aplicación.

7. Registro De Datos: Registrar los datos que solicita la documentación que
acompaña al microchip.


Pistola de aplicación Lector de bolsillo
www.microchipavid.com

CUIDADO DE LOS CASCOS Y COLOCACIÓN DE HERRAJES.


El valor de los equinos reside principalmente en su sistema locomotor, un caballo
con defectos en sus aplomos carecerá de valor; es por esto que se hace necesario
que el ejemplar tenga buenas piernas (remos) y buenos pies lo cual incluye el
cuidado de los cascos, áreas de contacto del animal con el suelo y por tanto están
sujetas a múltiples factores agresivos.


Los cascos deberán mantenerse limpios, impedir la resequedad, se deben recortar
para que conserven tanto su forma, como su longitud y disposición adecuadas.


En la siguiente figura se observa cuál debe ser la disposición del esqueleto óseo
con relación al casco (figura a), en las figuras b y c se presentan conformaciones
defectuosas, y su forma de corregirlas mediante el corte del casco.




Figura 11 Disposición del esqueleto con relación al casco
Tomado de Zootecnia General UNAD


La inclinación es normal cuando la punta del casco y la cuartilla siguen la misma
línea, este ángulo debe mantenerse siempre y será modificado solamente como
medida correctiva. Antes de recortar los cascos es preciso observar al caballo
parado sobre una superficie dura y nivelada, luego se le hará caminar al paso y al
trote.

Los cascos se deben recortar cada 4 – 6 semanas, no importa que el animal esté
herrado. Si se deja crecer excesivamente el casco, éste se deforma afectando el
equilibrio, lo cual provoca esfuerzos excesivos de los tendones. Los cascos se
recortan a nivel de la suela evitando cortes más altos por la posibilidad de que se
rajen; la ranilla se debe cortar cuidadosamente eliminando sólo los bordes
resquebrajados que permiten la acumulación de detritus creándose así la
posibilidad de infecciones del casco lo cual ocasionará claudicación (cojera o
parálisis) muchas veces costosas y difíciles de tratar. La pared del casco nunca
debe ser limada.


Se debe herrar porque siendo el casco un tejido del animal, su desgaste no
guarda proporción con la velocidad con la cual es formado; entendidos estiman
que el desgaste producido en el casco por el trabajo sobre una superficie blanda
(praderas) sólo permitiría la correcta utilización de una tercera parte de las
capacidades reales, igualmente si el trabajo es efectuado sobre superficies duras
(caminos pedregosos, carreteras, asfalto, etc.) solo podría utilizarse el casco en un
décimo de su capacidad.


Otra buena razón por la cual es necesario herrar los caballos es que, la herradura
protege el pie, órgano en extremo sensible a las irregularidades del piso.


El tipo y frecuencia del trabajo determinan la frecuencia del herraje, cuando éste
se efectúa sobre superficies blandas se deberá herrar cada mes, si por el
contrario, el caballo trabaja sobre superficies duras el desgaste de la herradura
será lo que determine cuando ésta debe ser cambiada; la observación del estado
del herraje permite decidir, el momento en el cual deban ser reemplazadas, en
forma práctica, sabemos que la calidad de los herrajes rara vez permite su uso por
más de tres semanas; una herradura desgastada se torna cortante y peligrosa
para el caballo y el jinete; es conocido, que las herraduras de los miembros
anteriores sufren un mayor desgaste que las de los miembros Posteriores.


Un juego de herrajes bien colocado no deberá interferir las funciones fisiológicas
de las diferentes estructuras del pie o con el andar del caballo.


Al igual que el recorte de los cascos, el herraje requiere de conocimientos básicos
sobre la anatomía y fisiología del casco, ya que éste se define como una corteza
córnea especializada que cubre huesos, nervios, vasos sanguíneos y tejidos
delicados, y un clavo de herraje colocado incorrectamente (picar el casco)
acarreará problemas que usualmente se complican, por el contrario, clavos
colocados muy superficialmente se soltaran con facilitad perdiendo el herraje.


PRINCIPIOS DE LA HERRADA


www.herrajesycaballos.com

Para herrar un caballo existen dos formas: herrar en caliente, modalidad esta que
muchas personas rechazan por desconocer su arte pero que en algunos casos
tiene grandes ventajas y aprovechamiento especialmente para aquellos caballos
que trabajan en terrenos fangosos o muy húmedos, implica además el fabricar la
herradura adecuada para cada casco.

Después de forjada la herradura se calienta y se ajusta al casco lo que la asegura
más en sus paredes y de una manera mas precisa. La otra forma es en frío,
sistema tradicional y el más usado por todos. La herradura se ajusta generalmente
a martillo buscando que se acomoden lo mejor posible al casco.

Es importante antes de descalzar el animal observar cuidadosamente el estado de
la herradura, el casco y el estado general de la extremidad, con el fin de
determinar cualquier anormalidad o defecto corregible. Es allí donde se detectan
enfermedades o alteraciones que repercuten en la forma de desplazarse el
caballo. La herradura es un hierro templado que se coloca en los cascos de los
caballos con el fin de protegerlos del piso y de algunos golpes. Su tamaño,
longitud y espesor depende del tipo de caballo y el trabajo que realice utilizando
ramplones o pestañas. Presenta dos caras, una superior plana que hace contacto
con el casco y la inferior lleva las claveras que se encuentran al centro de la
herradura en las estampas, dos bordes el primero convexo correspondiente a la
parte externa y otro cóncavo.

El espesor es fundamental en la herradura ya que debe combinar factores como la
dureza y elasticidad del material (hierro, acero, aluminio) de él depende la solidez
de la herradura y el evitar que se deforme o desgaste prematuramente, sin que su
peso cause daños en los bípedos del caballo.

Peso: generalmente las de hierro pesan aproximadamente entre 750 gramos y
2000 gramos para caballos pesados, 400 a 500 gramos para el caballo de silla.
Si son elaboradas en aluminio su peso oxila entre 50 y 70 gramos.

Ancho: es la distancia existente entre el borde externo y el borde interno.

Existen pequeñas diferencias entre el casco posterior y el anterior siendo las
lumbres de los primeros más puntudas, además de ser más cóncavos en su suela,
posee 3 tipos de estructuras en el casco del caballo a saber:

- La sensible compuesta por la suela, que protege la estructura sensible del
interior del casco, no debe soportar peso, es seca y arenosa lo que se
puede observar fácilmente al descollar en la herrada, está compuesta por
células muertas en la parte externa.

- Más adentro es húmeda denominada suela viva y en su parte más interna
esta irrigada por vasos sanguíneos y sensibles, su función es producir suela
viva.

- La elástica compuesta por la ranilla, se encarga de distribuir el impacto a
través de los cartílagos laterales, colchón plantar y estructura elástica del
casco, su función de soporte de peso se suspende en la herrada, en los
terrenos resbalosos ejerce la función de tracción. El colchón plantar está
ubicado debajo de la ranilla, absorbe el golpe de la pisada repartiéndolo
sobre los cartílagos laterales que se encargan de neutralizar dicho golpe
siendo los responsables de la expansión del casco, se extienden en la parte
de arriba y la parte trasera de la tercera falange callosa compuesta por la
pared que soporta el peso siendo más gruesa en la lumbre que en la parte
media o en los talones.



Las barras o extensiones de la pared paralelas a las comisuras, ayudan a soportar
el peso perdiendo su función con la herrada. La línea clavera es extensión de las
láminas callosas sirve al herrero como principal guía para no chuzar el equino. La
corona se encuentra en la parte superior del casco uniéndolo con el cuerpo. El
herrado no tiene porque causar ninguna molestia ni dolencia al caballo, de allí
depende su vida útil es la parte más expuesta y es el aparato locomotor del
mismo.


El herraje se efectúa de la siguiente manera:

1. Desmonte De Herraduras: Para comenzar a quitar las herraduras lo primero
que debemos hacer es cortar los clavos y extraerlos con la pinza
observando detenidamente su desgaste. Un animal bien aplomado debe
presentar un desgaste parejo, si se encuentra un desgaste anormal en la
punta o en el talón se hace necesario hacer un chequeo más minucioso en
el casco pues algo no está funcionando normalmente.

2. Tratamiento Al Casco: Se debe limpiar bien toda la superficie del casco
recortando y puliendo la parte muerta. Con la escofina se pulen las
diferentes superficies dando además el ángulo adecuado para una pisada
firme y aplomada. Es aconsejable además si el casco está muy reseco o
con ranuras el tratarlo primero con agua y con algún producto que lo
reconstituya antes de proceder a un nuevo herraje.

3. Escogencia De La Herradura: No olvidemos que la herradura es el calzado
del caballo, se debe escoger aquella que su peso sea razonable y de una
durabilidad suficiente al trabajo a realizar con relación al período máxime de
herrada. Debe ser la que más se adecue al tipo de trabajo a realizar y del
tamaño que se ajuste a su casco.


4. Herrado Al Calor: La herradura se debe medir en el casco y una vez
calentada a punto de martillo sobre el yunque irla ajustando a la forma del
casco. En el herrado al calor es muy importante tener en cuenta el ajuste de
la concavidad que evite presión sobre la suela del casco, así como nivelar
sus claveras sus topes y talones acomodándola dentro del casco. Para
lograr templarla se sumerge varias veces en agua corriente hasta lograr la
dureza deseada.

5. Herrado En Frío: Sobre el yunque la herradura se va ajustando a la horma
del casco y al tamaño del mismo nunca al contrario hasta darle el ajuste
necesario.

6. Ajustar La Herradura: Es importante el saber escoger los clavos apropiados
a la herradura que se va a fijar, los cuales se deben introducir sobre el
borde exterior de la línea exterior en forma paralela a la pared.

7. Remache Y Ajuste Final: Los clavos se deben introducir en forma alternada
y que entren totalmente en la clavera para que den la tensión y el ajuste
necesarios sobre las paredes del casco manteniendo la herradura lo mas
firme y ajustada posible, cortando y doblando las superficies que vuelan
ajustando sus puntas hacia fuera, despuntándolas y asegurándolas hacia
abajo contra el casco y apretándolas con el remachador.
8. Pulimento Y Ajuste Final: Una vez terminada esta operación con la lima o
escofina se pulen las superficies que sobresalgan buscando el mayor ajuste
y proporcionalidad posible entre casco herradura y clavos.

En la figura se muestra un diagrama de una Herradura corriente.

Figura 12- Herradura Corriente
Tomado de Zootecnia General UNAD

Cuando se necesite quitar el herraje, éste no deberá ser “arrancado”, se debe
retirar clavo por clavo, luego tomar la rama interna y después la externa de la
herradura con la tenaza y balancearla hacia el suelo; luego se golpeará la
herradura para que aparezcan los clavos que se retiran con las tenazas.



HERRAJES CORRECTIVOS.

Estos herrajes son usados para cambiar los andares y movimientos, para corregir
la estructura o el crecimiento defectuoso de los cascos y para proteger a éstos de
callosidades, contracciones o fisuras. Los principales herrajes correctivos son:

- Herradura de Barra: Se emplea para ejercer presión sobre la ranilla o
para aliviar la presión sobre cualquier parte del pie.

- Herradura para pie Oscilante: Se emplea para caballos que
tropiezan, que avanzan con dificultad, que tienen sobrehuesos en la
cuartilla o en la corona.

- Herradura de Punta Cuadrada en Prolongación: para caballos
cerrados de corvejones

- Herradura con Extensión Lateral: Se emplea para caballos con los
cascos desviados hacia fuera o hacia adentro.



PRECAUCIONES AL HERRAR.

- Se debe hacer corrección en de los aplomos en los potros y herraje de los
caballos en trabajo cada 30 – 45 días.
- Para hacer la corrección del aplomo no solo se debe observar el ejemplar
quieto sino que también en la marcha, para observar cada extremidad
ejecutando el paso.
- La herradura se debe amoldar al tamaño del casco no al contrario.
- Colocar la herradura hasta 1 cm. mas larga de cada talón, ni mas corta ni
mas larga. Además es posible que la herradura sobresalga de los bordes
de la muralla hasta 1 milímetro.
- No limar la muralla exterior del casco con la escofina, ya que esto genera
una reducción progresiva de su espesor con respecto a la línea blanca, lo
cual hará que las herraduras se desprendan con facilidad llevándose
consigo un trozo me casco.
- Cortar la ranilla lo menos posible, es decir, retirar solo el material
descompuesto.
- No hacer ranuras en forma de línea que una los puntos por donde irrumpen
los clavos en la muralla, ya que esto rompe las laminillas y debilita esa
sección del casco hacia abajo.
- La herradura plana es decir sin tacón, se debe usar en pisos duros y la
herradura con tacón en suelos blandos.


CASTRACIÓN.

La extirpación de los testículos en équidos (caballos, mulos y burros) debido a el
deseo de inhibir su reproducción por no cumplir con los objetivos genéticos
deseados para la próxima generación, accidentes o patologías en el aparato
genital o simplemente con el objeto de suavizar el carácter del animal para un
mejor manejo, sigue siendo una operación requerida con frecuencia, para ello lo
ideal es recurrir a un medico veterinario con experiencia en esta intervención
quirúrgica, ya que no es fácil de efectuar, cualquiera sea la edad en la que se
realiza.
La edad del animal a castrar varía mucho de región en región; en algunas partes,
el potro puede tener unos pocos días, pero es más común que la castración se
efectúe pasado el año de edad; si la castración se efectúa a muy temprana edad,
generalmente ocasiona un desarrollo incompleto de los miembros anteriores; por
el contrario, si es realizada al año de edad del potrillo o un poco más sus
características se evidenciarán mejor, tendrá un mayor desarrollo muscular y un
mejor desarrollo de los miembros anteriores.

La práctica de esperar a que el potrillo haya cumplido un año de edad, asegura
que los testículos se encuentren en el escroto, a una menor edad no es raro que
se encuentren alojados aún en la cavidad abdominal.

Las diferentes modalidades para castrar el animal en decúbito lateral, decúbito
dorsal o en pie y las distintas técnicas: abierta, cerrada, semicerrada, con uno o
dos cortes escrotales están bien descritas por diferentes autores.

La técnica más usada para castración, es testículo abierto; se deberán practicar
especiales medidas de asepsia higiene. La operación en si, es competencia del
Médico Veterinario, por los riesgos que ofrece al ser efectuada por personal
inexperto, aun así, la existencia de prácticos no veterinarios que realizan
castraciones en las zonas rurales genera grandes riesgos por sus métodos
ortodoxos.
La época en la que se debe castrar depende de la zona. Lo que se trata de evitar
son moscas que pueden infectar la herida posquirúrgica.

Se recomienda la castración por la mañana para poder observar mejor la
evolución tras la intervención.

A continuación trataremos de describir como se desarrolla esta cirugía, mas a
manera de información que de un instructivo para realizarla, ya que como lo
hemos indicado anteriormente esta debe ser ejecutada por un medico veterinario
practico en esta actividad.

Material y métodos.
La castración sólo se hará en animales sanos con descenso testicular normal, lo
ideal es que el equino se encuentre entre los 3.5 a 6 años de edad cuando ya
tiene la apariencia de macho (músculos masivos, carrillos prominentes, cuello
grueso), con ambos testículos en el escroto, no criptorquidos y sin hernia escrotal.
Es importante, antes de castrar un équido, someter al propietario y cuidador a una
detenida indagación en lo que se refiere a padecimientos anteriores, de
hinchazones en escroto y testículos, laminitis o episodios de dolores como los
cólicos, a la vez que se realiza una evaluación clínica preoperatorio con palpación
de los anillos inguinales superficiales e internos, descartándose para esta técnica
cualquier animal sospechoso o de más de 10 años de edad.

Instalaciones
Aunque a veces se debe operar a cielo abierto, en mitad del campo, el lugar de
elección suele ser la propia cuadra del animal, previamente sacado el estiércol,
desinsectada y con una cama de aserrín o paja limpia y humedecida para no
levantar polvo que con los movimientos del equino y los operarios, penetre a la
herida abierta, causando infecciones posteriores que dificultaran la sanación de la
cirugía.
El no tener que desplazar al animal de su hábitat influye favorablemente en el
ambiente de tranquilidad recomendado en cualquier actuación.

Preparación del paciente

- Ayuno de 24 horas.
- Duchado y limpieza el día anterior, especialmente de la zona perineal.
- Personal auxiliar, capacitado en esta actividad.
- Un ayudante no especializado, que ha de ser persona que conozca el
animal, a ser posible el propio cuidador.
- El animal debe estar tranquilo antes de ser sometido a la sedación.

Material y medicación.
- Bisturí
- Tijeras de punta roma
- Emasculador.
- Pinzas de hemostasis
- Porta agujas
- J eringas
- Agujas del calibre 1’1 mm x 40mm
- Rompún.
- Lidocaína.
- Vitamina K
- Cloranfenicol spray
- Suero antitetánico
- Analgésicos
- Antibióticos

Técnica operatoria.

Sedación
- Se efectúa la intervención con sedación y anestesia local.
- El ayudante sujeta al paciente con un acial y se le inyecta en la vena yugular:
atropina más xilacina más guayacolato de glicerilo más un gramo de pentotal,
la dosificación de estos fármacos depende de el peso del equino a castrar.
- En tanto la medicación va surtiendo efecto, puesto de manifiesto por la
protusión y la relajación peniana, se dispone todo el material de forma
ordenada.
- Se prepara la zona quirúrgica y alrededores (escroto, región inguinal, cara
interna de las piernas y pene) con una concienzuda limpieza con agua y jabón,
seguida de una desinfección a base de un compuesto yodado apropiado.

Anestesia
La anestesia local la hacemos con cinco inyecciones: infiltración directa dentro del
parénquima testicular, ambos cordones espermáticos (infiltración del cordón
espermático a nivel de los anillos superficiales) e infiltración subcutánea en el
lugar de la incisión. Se emplea lidocaína al 2% (Xilocaina) la dosis de 10 a 20 ml
por cada testículo.
En lo posible es recomendable el uso de guantes o bien desinfectarnos las manos
en caso de no utilizarlos. La zona a operar estará bien anestesiada.


Descripción del acto quirúrgico.
 Con la mano izquierda se sujeta el escroto de tal manera que los testículos
están fijos y tirantes.
 Con un corte rápido y seguro del bisturí se hace una incisión cutánea amplia,
de aproximadamente 10 cm. de longitud, en el rafe medio, que interese la piel
del escroto y la túnica dartos hasta llegar al septo escrotal.
 Un segundo corte cuidadoso atraviesa las fascias superficial y profunda del
escroto y la túnica vaginal del testículo derecho.
 Con los dedos se hace disección roma hasta exteriorizar por completo el
testículo y el epidídimo.
 Se perfora el mesorquio en su unión con la túnica vaginal parietal entre el plexo
pampiniforme y el mesofuniculum y se separa para proceder a la emasculación
y corte en dos fases.
 Se emascula alrededor del cordón músculo-fibroso y se corta.
 Se coloca el emasculador alrededor del cordón vascular.
 Se quita y en la zona aplastada se aplica una ligadura de catgut cromado
número 2 con doble nudo. Se secciona de dos a cuatro cm. distal a la ligadura.
 La emasculación de la porción músculo-fibrosa no es imprescindible en los
animales jóvenes en los cuales puede ser cortada simplemente, pero por
seguridad debe realizarse.
 La fascia escrotal laxa que sobresale de los bordes de la herida cutánea se
corta con tijeras con objeto de que no obstaculice la cicatrización.
 El testículo izquierdo se extirpa de la misma forma.
 Se termina la intervención con la aplicación tópica de antibióticos en polvo
dentro de la herida y de spray antibiótico y de repelente de moscas en las
zonas de alrededor.

Cuidados postoperatorios.
Como medicación postoperatoria inyectamos subcutáneamente 25 UI de suero
antitetánico y damos una protección profiláctica mediante la administración
intramuscular de un compuesto antibiótico - antiinflamatorio durante tres días.
En condiciones higiénicas y de manejo adecuadas cuando el animal está a cargo
directo de un propietario capacitado, esa prevención no es imprescindible y es
suficiente con el ejercicio controlado.
Una vez finalizado el acto quirúrgico y mientras se recoge el equipo, se riega con
una manguera las partes bajas de las patas para limpiarlas de sangre y se pasea
lentamente al animal durante media hora con objeto de observar cualquier
complicación.
Se recomienda que el paciente permanezca amarrado sin que se pueda acostar
durante las primeras 24 horas y que después de ese tiempo realice ejercicio
libremente en un picadero o corral.
Se debe observar con frecuencia el animal en las primeras 48 horas, para detectar
con rapidez cualquier problema que se genere en el postoperatorio.
A partir de los quince días el caballo se puede montar y el burro o mulo o puede
trabajar, sin excederse en sus funciones ya que aun no se encuentra recuperado
del todo, hay que tener en cuenta que es un ser vivo y no una maquina para
nuestra comodidad.
No se ha encontrado ninguna diferencia entre la modalidad de una sola herida
escrotal en rafe medio o las dos incisiones cutáneas paralelas típicas sobre cada
testículo, salvo en el caso de los burros donde el drenaje por este segundo
método es mejor.

Las complicaciones pueden ser: hemorragias, edema, infecciones, miasis o
parálisis peniana.

Hemorragias.
En ocasiones en que se presenta este fenómeno, se puede solucionar mediante
taponamiento con gasa en el escroto e inyección parenteral de coagulante.
Según los distintos autores esta complicación se debe normalmente a un
emasculador inadecuado (mala calidad, falta de limpieza, mal ajuste o demasiado
afilado), a su incorrecta colocación (inversión del borde cortante, colocación
oblicua en vez de transversa, abertura parcial de la quijada, corte de los vasos
sanguíneos en extensión) o a, la emasculación en conjunto de las proporciones
vasculares y músculo-fibrosa.
El empleo correcto de un emasculador Reimer o Serra, unido a la doble
precaución de ligadura de vasos, previa a la emasculación y corte en dos fases
influye en la no presentación de hemorragias.

Edema.
El edema inflamatorio de la herida escrotal y el edema gravitacional del prepucio
se pueden considerar normal, pero no dejaremos de controlarlo mediante un
manejo en ejercicio adecuado, sobre todo en los mulos y asnos a los que se les
deberá obligar a trotar para reducirlo ya que así a la vez se facilita un correcto
drenaje.

Infecciones y miasis.
No se presentan con mucha frecuencia en heridas correctamente tratadas como lo
es el cuidado de aplicar una técnica quirúrgica lo más aséptica posible en las
condiciones prácticas de campo donde se actúa, a la medicación preventiva
postoperatoria y al asesoramiento y educación dirigida al cuidador, sobre todo en
lo que respecta a la aplicación de spray antibiótico y repelentes de insectos
alrededor de la zona operatoria durante el periodo de cicatrización.

Otras posibles complicaciones tras la castración como hidrocele, comportamiento
de caballo entero o parálisis peniana descritas por diferentes autores no se
presentan con mucha frecuencia, por ello no se hace mayor relación sobre ellas.

Por supuesto que si el équido es de carácter rebelde, no tiene un descenso
testicular adecuado, padece de hernia escrotal, es de edad avanzada o existe
sospecha de alguna otra posible contraindicación para la castración en pie, es
preferible realizar una castración clásica en decúbito (lateral o dorsal).


Cambios morfológicos tras la castración.
Los cambios morfológicos en el caballo castrado son bien conocidos por la
disminución de los efectos de la testosterona. El caballo entero tiene mayor
musculatura y una distribución diferente de la masa corporal y de la grasa, si bien
es verdad que la musculatura del caballo castrado es más que suficiente para
poder acometer sus retos deportivos y laborales.
De hecho hay muchas hembras que son tan buenas o mejores que muchos
caballos y también, por supuesto, esto ocurre con los caballos castrados.
Por otra parte podemos decir que el músculo pesa más que la grasa y caballos
excesivamente pesados por tener gran musculatura pueden no ser indicados para
aquellas disciplinas en que prima la resistencia. La castración aumenta la talla por
el efecto de la testosterona sobre la epífisis ósea.


Cambios de comportamiento.
Las características más importantes que distinguen al caballo entero son de
carácter: es más agresivo, más distraído, a veces menos obediente, necesita más
entretenimiento, cuidados diferentes, atención en la estabulación y en los viajes,
debe evitarse el contacto con yeguas y también con machos castrado o enteros.
Estas características están ligadas a la secreción hormonal del testículo. De todas
formas los caballos que han cubierto yeguas antes de la castración pueden
subirse en yeguas aunque como es lógico son estériles.
El uso de hormonas en los caballos castrados, que es muy frecuente aunque es
doping, fundamentalmente aumenta la musculatura, retiene agua y produce unos
efectos de comportamiento similares a los del caballo entero. De hecho los
caballos castrados tratados con este tipo de hormonas tienden a montar a las
yeguas e incluso la yeguas así tratadas tienen comportamientos masculinos.


LA PICADA DE LA COLA.


www.asdesilla.com

Antes de intentar una aproximación seria sobre el debatido tema del coleo en el
caballo criollo colombiano y de evaluar las razones por las cuales se hace
necesaria su sanción, es importante hacer dos precisiones fundamentales
respecto del comportamiento general de todo caballo, y en especial del nuestro,
por su gran temperamento y valentía: el caballo expresa su estado de ánimo con
las orejas y protesta con la cola.

De todos es conocido que cuando al montarlo inclina sus orejas hacia los lados,
manifiesta desinterés y pocos deseos de trabajar, en cambio, cuando las inclina
hacia adelante, además de embellecer su figura, manifiesta con ello alegría,
conformidad y deseo de agradar a su jinete, haciendo las cosas lo mejor posible,
pero si las coloca hacia atrás es señal inequívoca de irritación y enfurecimiento.

En cambio, el caballo colea, generalmente, por alguna de las siguientes causas:
por falta de brío, por mal temperamento, por cojeras, por problemas en su rienda,
por lesiones en la piel, por razones sexuales, por mal “quebrado”, por incompleta
recuperación después de enfermedades, por errores en la ensillada, por ruidos
extraños que le incomodan, por efecto de ciertos productos para peinarlo, por
arenilla entre capones, entre otros problemas.


QUÉ EXPRESA EL CABALLO CON LA COLA.

El caballo levanta y baja la cola como si se tratara de un péndulo que registra
excitación. Una cola parada significa que el caballo está alerta, indica actividad y
exhuberancia. Una cola caída indica sueño, cansancio, dolor, miedo intenso o
sumisión. El motivo es que cuando más rápido avanza el caballo más entra en
acción su sistema muscular “antigravedad”. Estos músculos ayudan al animal a
elevarse y a correr, y levantar la cola forma parte del proceso. Cuando el caballo
disminuye la velocidad, cuando frena, ocurre lo contrario, y la cola cae. Además el
caballo puede levantar o bajar la cola simplemente como señal, sin mover siquiera
el cuerpo. Por ejemplo, un caballo joven, alborotado puede acercarse a otro y
demostrar sus ganas de jugar levantando la cola por sobre el lomo tan alta como
su anatomía le permita. A veces, al iniciar el juego, la intensidad con la que
levanta la cola es tal que la enrosca por sobre el lomo. Esta invitación es
inmediatamente comprendida por el otro potrillo y enseguida empieza el juego.

De la misma manera, un caballo que está parado puede bajar la cola para
expresar: “Estoy cansado y débil, me someto a ti, tú eres el jefe”. De la misma
manera, si le teme a otro caballo, puede llegar a apretar la cola contra la grupa,
casi como el perro que intenta “meter la cola entre las patas”.

En los encuentros sexuales, tanto el padrillo como la yegua paran la cola debido a
la excitación del momento. Aparte de las señales que el caballo emite levantando
y bajando la cola, puede realizar también algunos rápidos movimientos en distintas
direcciones.

PICADA DE LA COLA

www.asdesilla.com

Esta tenebrosa intervención busca que los animales no coleen en el marco de un
juzgamiento para evitar las sanciones que acarrea, las cuales a veces, llegan
hasta la descalificación de la competencia.

Es el método más conocido y aplicado porque permite, aparte de la inmovilización
de la cola, un efecto estético que agrada al público, sin embargo, es una técnica
que se debería eliminar porque la mayoría de las veces se practica de manera
antihigiénica, sin anestesia y en forma, por demás, empírica, exponiendo al
caballo a contingencias adversas como: fracturas en la tumbada del animal.
También arterias, nervios, venas y vasos linfáticos deterioran el normal
funcionamiento del órgano. Tétano u otras infecciones que puedan degenerar en
septicemia que manifestada clínicamente es difícil de tratar y puede dejar secuelas
irreversibles en el ejemplar colimocho.

De igual manera, desviaciones causadas por neuritis crónicas o miositis crónicas o
presentar una asociación de las dos. Hematomas, necrosis y gangrenas: al cortar
los vasos sanguíneos se presentan hemorragias internas de intensidad variable
que pueden evolucionar en forma desfavorable y pueden empezar a necrosarce
los tejidos a su alrededor y generar en una gangrena.

El procedimiento es torturante para el ejemplar, incluso puede ocurrir su muerte.
Para picar la cola toman la base de la raíz de la misma, miden cuatro dedos y en
este punto se clava la navaja a ambos lados y se seccionan los músculos. De ahí
se miden otros cuatro dedos y se repite la operación; si el animal tiene el músculo
de la cola muy largo se repite por tercera vez.



GENÉTICA VS MANEJO

Existe la creencia de que el coleo es hereditario. Sin embargo, la experiencia
demuestra que es el resultado del mal manejo. Genéticamente los caballos
transmiten el malgenio, el exceso de temperamento, lo cual exige una persona
que canalice de manera adecuada estos factores. De no ser así, tendremos un
ejemplar coleador. Se habla de líneas de caballos coleadores, pero si las
analizamos detenidamente, nos encontramos con caballos bravos, en manos de
bárbaros amansadores. Estos animales se defienden de los oprobios a los cuales
se les somete; su defensa natural es colear.

ODONTOLOGÍA EQUINA.

www.asdesilla.com
El tema de odontología equina nos genera bastantes interrogantes que trataremos
de resolver con el siguiente articulo del doctor Miguel A. Echavarria B.
Odontólogo Universidad de Antioquia, publicado en ASDESILLAS.
SIGNOS DE PROBLEMAS DENTALES.
 Inhabilidad para ganar o mantener el peso.
 Seleccionar el alimento; consumir solo la comida blanda y dejar los
alimentos duros en la canoa.
 Dificultad para masticar los alimentos.
 Dejar caer el alimento al tratar de masticarlo.
 Empaquetamiento de alimento en los carrillos.
 Remojar el heno antes de comerlo.
 "Remarcar" el pasto.
 Mal olor por boca y/o nariz.
 Movimientos irregulares de la mandíbula.
 Carrillos sensibles cuando se presionan contra los molares.
 Reacción con movimiento brusco de la cabeza al palpar la articulación
temporomandibular.
 Reacción con movimiento brusco de la cabeza al palpar los músculos
masticatorios.
 Salivación abundante.
 Partículas grandes de alimento en el estiércol.
 Episodios frecuentes de indigestión o cólico.
 Indocilidad.
PROBLEMAS DEL DESEMPEÑO DEL CABALLO RELACIONADOS CON
PROBLEMAS DENTALES.
 Sacudir la cabeza hacia los lados o desplazarse con la cabeza "destapada".
 Rehusar a la colocación del freno.
 Rehusar a cambiar de dirección durante el desplazamiento.
 "Enredar" el paso durante la ejecución.
 Tirarse hacia fuera en las esquinas o en los giros.
 Perder el centro durante el desplazamiento.
 "Tablearse" el cuello.
 "Botar" la cola o corcovear durante la ejecución.
 "Botar" la cola o "destaparse" cuando se "planta".
 Indocilidad.

VENTAJAS DE UN ADECUADO MANTENIMIENTO DENTAL DE LA BOCA DE
LOS CABALLOS
 Piezas dentales suaves, mordida balanceada y equilibrada.
 Mejora la trituración de los alimentos.
 Incrementa la utilización de los nutrientes.
 Disminución de la cantidad de alimento concentrado.
 Disminución de costos de alimentación.
 Previene la aparición de cólicos por partículas grandes.
 Mejoramiento del pelaje.
 Incrementa la habilidad para la concentración.
 Disposición para trabajar y actitud obediente.
 Proceso de adiestramiento uniforme y continúo.
 Disminuye el tiempo de adiestramiento.
 Mejora el desempeño del caballo.

Las bacterias carigénicas de la boca de los caballos son similares a la que causan
la caries dental en humanos.
Como se explico en la primera parte del escrito el infundíbulo es una cavidad
normal que se encuentra en la superficie masticatoria de los dientes incisivos y de
los premolares y molares superiores. El infundíbulo va desapareciendo con la
edad por el rasamiento y es uno de los parámetros usados como referencia para
determinar la edad de los caballos.
La caries dental debe ser tratada porque de lo contrario se produce destrucción
masiva de los tejidos duros del diente y los hace más susceptibles a la fractura. Si
la caries no se trata a tiempo, puede producir dolor y causar inflamación de la
pulpa dental hasta la muerte de ésta, lo que conlleva a la inflamación de los tejidos
blandos.
Recordemos que a los caballos no se les limpian los dientes y el infundíbulo es
una trampa mecánica para la acumulación de los alimentos principalmente harinas
y azúcares como la melaza y la panela que se fermentan fácilmente y favorecen la
formación agresiva de la caries.
El tratamiento de endodoncia se hace necesario cuando hay problemas con la
pulpa dental originado por la caries o por fracturas dentales accidentales o cuando
no hay suficiente estructura dentaria para hacer una prótesis fija o una corona
individual.
Los caballos son muy susceptibles de sufrir accidentes dentro y fuera de la
pesebrera cuando pelean con sus congéneres o cuando muerden objetos y halan
bruscamente. Algunos accidentes causan fracturas de los maxilares que deben
ser reducidas en el menor tiempo posible para evitar secuelas. Es a este nivel en
donde la cirugía tiene su campo de acción.
Las maloclusiones dentales en los caballos como los "picudos" y los "belfos"
tienen gran influencia genética pero no hay que desconocer la influencia ambiental
en la que los potros crecen hoy en día... ¡La pesebrera! allí los potros no
desarrollan los músculos masticatorios, no usan adecuadamente sus dientes y
siempre los comederos no están ubicados a nivel del piso. Algunas maloclusiones
se generan por discrepancia en el tamaño de las piezas dentarias; por ejemplo si
los premolares y los molares superiores son más largos de adelante hacia atrás en
sentido horizontal que sus oponentes inferiores se desarrollará más fácilmente un
"picudo" por atrapamiento de la mandíbula al no permitir un crecimiento normal de
ésta.

En la actualidad, si diagnosticamos tempranamente las maloclusiones dentales
podemos corregirlas con éxito mediante tratamientos de ortopedia funcional
combinada con tratamientos ortodónticos en potros. Intervenimos el crecimiento
de manera que donde falte lo estimulamos y en donde se vea exagerado lo
frenamos. Así no se tiene que recurrir a la cirugía ortognática que implica cortar el
hueso y sólo se puede hacer cuando el potro termine su crecimiento.

El tratamiento no impide el proceso de adiestramiento ni la alimentación del potro.
El mantenimiento dental adecuado y periódico, al menos una vez por año aumenta
la expectativa de vida de los caballos; ellos viven mejor, su desempeño alcanza un
gran nivel y se valoriza el precio de los equinos.

No podemos cerrar los ojos frente a los grandes avances de la odontología en la
industria equina. Hoy quien no aproveche esta ayuda está dando ventajas para
que otros caballos se desempeñen cada día mejor en las diferentes competencias
de acuerdo a la modalidad en que se presentan.

SUJECIÓN Y DERRIBO DEL EQUINO.

Los equinos son nerviosos, poseen gran fuerza y velocidad; esto los hace
potencialmente peligrosos, además su agudeza auditiva obliga a quien los maneje
a estar seguro de la práctica que va a ejecutar, realizarla con la máxima seguridad
tanto para él como para el animal, esto evitará accidentes graves para cualquiera
de los dos.

Es imprescindible el buen trato al animal, ya que éste será fácil de manejar si
quien lo maneja demuestra seguridad, firmeza y ante todo inspire confianza al
animal, el acercamiento directo, de frente proporcionará calma al equino.

Básicamente se conocen tres métodos para la sujeción:

 Métodos Benignos: No producen molestias significativas al animal, la más
común es la sujeción de la cabeza bien sea a un botalón, o simplemente
sujetando firmemente el cabezal. Otro método benigno son las caricias,
palmadas suaves en el cuello, silbidos y el hablarle al animal

 Métodos Derivativos: Son más crueles, pues se busca producir cierto grado
de dolor en un sitio determinado, con dichos métodos se busca dominar y
distraer el animal, los más comunes son:
- Acial en el labio superior.
- Acial en la oreja
- Bozal alemán

Los dos primeros se ejecutan mediante el “acial” instrumento conformado por un
palo y una cuerda, la cuerda será la parte que hace contacto con la región
anatómica del animal, con el palo se maneja girándola, para así acortar la longitud
de la cuerda, al reducirse ésta presiona la oreja o el labio, y el dolor que genera
inmovilizará al animal, se debe tener cuidado de no apretar en exceso el
torniquete, ni prolongar por demasiado tiempo la sujeción por este método, ya que
o bien puede fracturar la oreja, lesionar el labio o causar pérdida de irrigación
igualmente grave para la zona sometida a presión.

El bozal alemán, es un lazo que va por detrás de las orejas y luego por las
comisuras labiales por encima de la lengua. Así ubicado, funciona al girarlo sobre
un eje central para producir un torniquete; se debe tener cuidado de no apretar en
exceso pues se pueden romper las comisuras labiales.

- Métodos Mecánicos: La mayoría son útiles y prácticos, con ellos se busca
inmovilizar un miembro, el conjunto lateral de los miembros anteriores o
posteriores, y algunas veces las cuatro extremidades.
Mediante el “Hipolazo” se reduce en un 50% la potencia de los miembros
posteriores; el método consiste en efectuar una llave en el cuello con un nudo fino
(no corredizo), con una de las puntas del lazo, se da la vuelta por detrás de los
miembros posteriores para regresar al cuello y anudarse a la llave hecha con la
otra punta del lazo.

Para el derribo de equinos existen métodos físicos por medio de sogas y trabones;
métodos químicos aplicando fármacos relajantes y aún anestésicos generales
aplicados por vía oral o intravenosa. El lugar en que se piense derribar el equino
deberá estar libre de cualquier elemento traumático, el cual pueda ocasionar
lesiones al animal.

Los trabones son los más seguros para el derribo, el único inconveniente radica en
poner los brazaletes en las extremidades. El derribo mediante sogas es algo más
complicado y exige pericia y cierta fortaleza física del operario, además se debe
asegurar que la caída se producirá suavemente, de lo contrario habrá grave riesgo
de fracturas o ruptura de vísceras.


EQUIPOS Y UTENSILIOS PARA UN CORRECTO MANEJO DEL CABALLO.

Los utensilios y equipos empleados son tan variados como: un equipo de herraje,
un botiquín, una manta, vendas o una almohaza (cepillo), algunos serán
imprescindibles, otros por el contrario pueden ser de uso electivo.

La cantidad y el diseño de los equipos dependen muchas veces del gusto y la
capacidad económica de los propietarios. El equipo deberá ser sencillo, práctico y
de fácil manejo.

Otro factor a tener en cuenta al momento de la consecución del equipo, será el
tipo de caballos, el objetivo para el cual se posean, ya que los equinos de silla
(paso fino, de carreras, de deporte) tienen un manejo diferente a los équidos
empleados en vaquería o trabajo.

Los caballos estabulados se deben asear a diario, para favorecer su aspecto y
para mantener en estado saludable su pelaje y su piel, esto lo consiguen por sus
propios medios los equinos que están en pastoreo libre.

El equipo para aseo debe tener como mínimo un cepillo superficial, uno de cuerpo;
almohaza, peines para crines, gancho de cascos, aceite para cascos.
LECCION 36. LIMPIEZA DE LOS EQUINOS.

Una limpieza correcta de nuestro caballo no sólo conseguirá mejorar notablemente
su aspecto, sino que además le ayudará a mantenerle sano.

EQUIPO DE LIMPIEZA
Un equipo completo de limpieza deberá estar formado fundamentalmente por los
siguientes elementos:
- Cepillo de raíces: cuyas cerdas pueden ser naturales o de plástico. Muy
útil para eliminar las manchas propias de la cuadra (barro seco, estiércol...)
el cepillo de cuerpo elimina la grasa, ésta se retira del cepillo con la
almohaza y es la única finalidad de este instrumento; el cepillo o peine para
crines se emplea para peinar la cola y la crin sin romper las fibras de las
mismas

Cepillo de Raíces
- Bruza: elemento más cómodo que el cepillo ya que se adapta a nuestra
mano y es más ligera; sus cerdas además son más cortas y suaves, con lo
cual evitamos hacer daño al animal si accidentalmente le golpeamos con
ella. Se utiliza para eliminar la suciedad en general (grasa, caspa...) no sólo
del pelo sino de la piel en general. Muy recomendable para la cola y la crin.

Bruza
- Almohaza: para quitar el polvo que se ha pegado en las zonas mas
profundas de la piel y también válida para la limpieza de la grupa, debe
usarse con suavidad.


Almohaza

- Limpia sudor: para eliminar el exceso de agua lluvia, ducha o de sudor.

Limpia sudor

- Tijeras: para arreglar cola, tupé, crin y pelos que sobresalen en las orejas.

Tijeras

- Esquiladora: que podrá ser manual o mecánica, cualquiera de ellas nos
será de gran ayuda a la hora de cortar el pelo al caballo.

DUCHA CON AGUA Y JABÓN.

Se trata de una forma de limpieza únicamente aconsejable en caso de que el
caballo esté sucio de grasa, ya que el exceso de jabón reseca la piel del animal,
llegando a producirle prurito e incluso dejándola sin brillo (si no es más
conveniente lavarlo únicamente con agua).Para duchar al caballo con agua y
jabón es recomendable seguir estas pautas:

Θ Utilizar jabones especiales.
Θ Aplicar el jabón una única vez (no hay que aclarar y volver a enjabonar).
Θ Utilizar agua al clima.
Θ En invierno conviene lavar al animal por partes, utilizando una manta para
cubrir el lugar del cuerpo que no estamos limpiando. Si estamos a baja
temperatura conviene ser rápidos en el baño y, una vez terminemos, secar
y cubrir de inmediato al caballo para que no coja frío.
Θ Existen esponjas especiales, le recomienda utilizar una para el enjabonado
y otra para el enjuague.
Θ Para enjabonar realice movimientos circulares sobre el cuerpo del animal.
Θ No enjabone la cabeza del caballo pero al igual que el resto del cuerpo
debe ser lavada.


LIMPIAR CON TOALLAS CALIENTES.

Método adecuado para la limpieza del caballo en los climas o días fríos, con el que
evitaremos posibles resfriados.
Para limpiar al caballo de esta forma necesitaremos un balde con agua muy
caliente, una toalla lo más grande posible y un champú especial (sólo en caso de
que exista mucha suciedad o que ésta sea de grasa); también le recomendamos
que utilice guantes de goma (para aguantar el agua caliente).
La forma de hacerlo es como sigue:

- Añadimos un poco de champú al agua caliente que tenemos en el balde.
- Introducimos la toalla en el agua hasta empaparla.
- Escurrimos y desplegamos la toalla para pasarla por el pelo del caballo,
durante sólo unos segundos (de esta forma ablandaremos la suciedad).
- Envolvemos la toalla y frotamos con ella el pelo.
- Pasamos la toalla suavemente en el sentido del pelo.
- Repetiremos toda la operación por cada parte del caballo, cuidando de que
el agua esté siempre caliente.
- Para finalizar limpiamos con otra toalla paro en esta ocasión empapada de
agua caliente pero sin jabón, hasta que quede sin ningún residuo del
mismo.

LIMPIEZA DE LOS CASCOS.

Se trata de una parte del caballo que siempre deberá permanecer limpia. Aunque
no dispongamos de tiempo para lavar al caballo por completo, por lo menos una
vez al día deberemos dedicar unos minutos a la limpieza de sus cascos. Para ello
utilizaremos simplemente un limpia cascos o un jabón suave.

Es una zona en la que pueden clavarse diferentes objetos, produciendo heridas de
considerable peligro; además en ellos se suele acumular estiércol, lo que los
convierte también en un foco de infección si no están perfectamente limpios.

A esto se suma el hecho de que los caballos con cascos blandos suelen tener el
problema de que se desgastan con enorme facilidad y rapidez, especialmente por
la parte de los talones; por lo que la revisión diaria es ineludible. En esta revisión
deberemos además analizar el estado de las herraduras, su asentamiento, los
clavos. La limpieza diaria de los cascos puede evitarnos numerosos
contratiempos.
Además del nombrado limpia cascos, es aconsejable utilizar otros dos productos,
que son:

- Pomada para cascos: refuerza y favorece su desarrollo natural, evitando el
agrietamiento y favoreciendo su elasticidad).

- Alquitrán para cascos: que nos ayudará a eliminar las bacterias, los
gérmenes y el mal olor.

- El aceite se necesita para mantener el casco lubricado y húmedo, evitando
que este se resquebraje.


LIMPIEZA COMPLETA.

Es la limpieza que conviene realizar al caballo una vez haya finalizado su trabajo
ya que en ese momento su cuerpo estará caliente, lo que favorece que la
suciedad se suelte mucho más fácilmente y le resultara mucho mas agradable.

- Primero deberemos eliminar los restos de barro y de sudor utilizando el
cepillo de raíces que pasaremos sobre la piel del caballo con suavidad para
no molestarle. Hay que prestar especial cuidado a las zonas sensibles:
cabeza, vientre y parte interior de las extremidades.

- Después cogeremos la bruza y la pasaremos enérgicamente por cada parte
del caballo. Conviene realizar alrededor de seis pasadas en cada lugar, sin
golpear al animal con la bruza sino más bien apoyándola de forma suave
pero firmemente de modo que las cerdas penetren en su pelo y limpien la
piel.

- Después de cada pasada es conveniente limpiar la bruza, para lo cual la
frotaremos contra la almohaza.

- Limpie siempre hacia abajo y hacia atrás.

- Después se limpiarán los cascos.

- La cara y el tercio superior se lavarán con unas esponjas suficientemente
humedecidas.

- Por último peinar la cola y la crin con un cepillo de raíces para que quede
desenredada y suelta.

El aseo es básico para prevenir enfermedades de la piel (dermatitis, eczemas,
etc.) cuya presentación es más frecuente en animales sin las prácticas de aseo
convenientes, en los cuales la acumulación de barro, detritus y sudor creará el
ambiente propicio para que se desarrolle la dermatitis.

El equipo para el bienestar del equino consta de mantas, arneses, monturas y
bridas, éstas deberán ser cómodas y diseñadas de tal forma que respeten la
conformación anatómica del equino; de cada uno de dichos elementos hay
infinidad de modelos, las características de cada uno varía según el tipo de
equino.



CAPÍTULO 8.
ALOJAMIENTO Y TRANSPORTE DE LOS EQUINOS


LECCION 37. ALOJAMIENTO.

www.caballomania.com
Una caballeriza bien iluminada y con acceso a un corral de ejercicio es deseable
para que los caballos se mantengan en condiciones óptimas de salud y tono
muscular. El alojamiento debe permitir un espacio adecuado en los pasillos para
permitir el movimiento seguro de los caballos y sus cuidadores. En las caballerizas
no debe existir ningún objeto saliente que pueda lastimar a los animales. Las
paredes deberán ser lo suficientemente altas para prevenir las interacciones con
los caballos alojados a los lados. Las paredes, puertas, ventanas, comederos y
bebederos, independientemente de los materiales utilizados, no deben presentar
superficies angulares o formas que puedan causar daño físico a los animales. Es
recomendable diseñar las puertas de 1,6 a 2 m de ancho y de 3 m de alto,
aproximadamente, para facilitar el movimiento de los animales, sin riesgo ni
lesiones. Los techos también deberán tener una altura adecuada, de 3 m para
permitir al caballo asumir una postura normal y evitar lesiones en la cabeza. Los
pisos deberán tener una superficie durable, no resbalosa. Bajo condiciones de
laboratorio o en instituciones educativas, se deberá proporcionar un cuarto o área
separada de la zona de las caballerizas para realizar procedimientos de
preferencia con una manga de manejo.

El alojamiento del potrillo, será amplio y deberá poseer puerta que abra
directamente hacia la manga de pastoreo, por seguridad deberá estar separado de
los alojamientos de los caballos adultos. La puerta debe permanecer abierta, esto
brinda la posibilidad de que el potrillo disfrute de aire fresco, luz solar y ejercicio
adicional.

Las yeguas gestantes tendrán un área de alojamiento similar, con la excepción de
que no tendrán libre acceso a la pradera; las yeguas vacías (no gestantes) se
mantendrán en campo, alejadas del resto del yeguerizo dado que éstas están más
dispuestas a correr y cocear a las demás.
Según la zona la zona geográfica, se debe procurar que las construcciones
queden ubicadas en dirección este-oeste para climas cálidos, buscando que su
interior permanezca fresco la mayor parte del día. Para climas fríos debe estar en
dirección norte-sur buscando un ambiente tibio dentro de la construcción. Para
zonas con vientos muy fuertes y fríos, se recomienda tener barreras vivas,
aproximadamente a unos 10 metros de las caballerizas.
Hay tres tipos básicos de alojamientos:
a) Establo. Los caballos permanecen atados en los establos, aunque existe
controversia respecto a su uso. Información objetiva en relación con el uso
de los establos aún no se encuentra disponible, pero se debe tener en
cuenta el bienestar animal antes que la comodidad humana.
b) Pesebreras abiertas. Están construidas típicamente en hileras. Un techo
saliente encima del frente de las pesebreras puede proveer refugio a los
caballos y ayudar en los climas inclementes. La mitad superior abierta de la
puerta de la pesebrera les permite a los caballos disfrutar del aire fresco y
de un ambiente estimulante. Las pesebreras abiertas también pueden ser
construidas alrededor del diseño de un patio.
c) Caballeriza. Las caballerizas se construyen en muchas formas y tamaños
que varían desde bajas y largas, para ocupar hasta con 100 caballos, hasta
mini caballerizas, que se ocupan con una docena de caballos. Las
caballerizas tienen ventajas y algunas desventajas: entre las primeras, hay
un costo adecuado para su construcción, facilitan un excelente ambiente de
trabajo y usan el espacio abierto; es decir, las trancas abiertas entre las
pesebreras dentro de la caballeriza, ayudan a suplir las necesidades de
comportamiento de los caballos. La desventaja principal está asociada con
las grandes caballerizas de baja altura, en las cuales puede ser difícil lograr
una adecuada mezcla del aire.
Las dimensiones ideales son 3.50m x 3.50m x 3m para el caballo, para el pony 3m
x 3m, ya que se les debe proporcionar la facilidad de moverse sin que tenga un
percance con alguna pared al momento de acostarse o levantarse.
El espacio debe estar acondicionado para la comodidad del animal como es la luz
ya que la oscuridad artificial puede afectarlos en su visión, debe contar con una
excelente ventilación de lo contrario puede presentar diversos trastornos
bronquiales.
Algunos países han construido pesebreras individuales dentro de un corral o
cobertizo grande, los cuales pueden encontrarse en el pasillo central que posee
puertas en sus extremos, este tipo de construcción se adopta principalmente en
las regiones frías, y puede ser adoptada en todo tipo de regiones ya que tiene
gran facilidad de transformación.
No importando el tipo de construcción es importante que estos cuenten con
pesebres para los alimentos concentrados, el recipiente para el heno y un anillo
para atar tanto el fardo de heno o que puede ser utilizada para atar al caballo
mientras se le cuida. Los bebederos pueden ser automáticos, esto es
recomendable, ya que el caballo como hemos explicado es de costumbres y
pronto se acostumbrara, también puede ser en cubos, los cuales deben ser fijos y
seguros evitando que se volteen, tienen que estar siempre limpios ya que al
momento de beber, el caballo suelta babas y con frecuencia se forma el limo, por
este motivo deben fregarse con frecuencia.

El agua debe estar siempre limpia y disponible a libre acceso o proporcionárselas
por lo menos dos veces al día. Los requerimientos de agua dependen de varios
factores, tales como la temperatura ambiental, la función del animal y la
composición de la dieta. Sin embargo un caballo en general requiere de 2 a 4 L de
agua por cada Kg. de materia seca.
Un caballo con dieta de mantenimiento en un ambiente termo neutral puede
requerir de 15 a 35 L, pero uno que está trabajando y sudando o lactando puede
requerir de 50 a 80 L.
Los caballos en confinamiento deben ser alimentados por lo menos dos veces al
día. Cuando no tienen acceso al pastoreo se les debe proporcionar forraje en la
forma de paja u otros materiales fibrosos para disminuir la incidencia de cólicos y
problemas de comportamiento tales como morder la puerta o el borde del pesebre,
masticar madera o comerse su cama.
Así es que el fondo del pesebre o comedero debe estar a 60 cm., del suelo,
aunque depende de la estatura del caballo, algunos prefieren utilizar éste en el
suelo pero no es recomendable ya que existe la posibilidad de que el agua y el
traste de alimentos se contamine con residuos de la paja u otros y el caballo es
demasiado meticuloso para alimentarse, al igual que el ser humano disfruta de un
plato limpio, los caballos encuentran el alimento de mayor agrado cuando éste se
les presenta en buenas condiciones. El tipo de comedero más útil es del tipo
movible ya que facilita la limpieza, debemos recordar que después de cada
alimento el resto de este que quede dentro de los comederos debe ser retirado, de
lo contrario puede llegar a fermentarse y causar daños o infecciones.
Tenemos también los comedores de heno, los más cómodos de utilizar son del
tipo triangular curvo, los cuales deben colocarse a 120 cm. del suelo evitando
algún contratiempo con el caballo al momento de levantarse. Al utilizarse las
argollas para colgar el heno y los arrendaderos debe estar aproximadamente a
1.60 m, éstos sujetos con un nudo corredizo que facilite el correr de la red sin
caerse a medida que el caballo come y evitando que se le enreden las
extremidades.
Existen distintos tipos de caballerizas, las que son aisladas y las colectivas, las
aisladas deben ser de dos piezas, inferior y superior, el de tipo inferior se debe
conformar por dos piezas con dos cerrojos exteriores en la parte de arriba y otro
en la parte de abajo, facilitándole al mozo el cierre inferior. La parte superior de
este tipo de caballeriza, debe estar siempre abierta de tal manera que le dé
libertad al caballo de saber lo que pasa a su alrededor y sólo se cerrará cuando
ocurran malos tiempos. El techo debe sobresalir aproximadamente 1 m. delante
de la fachada de esta manera en tiempo de lluvia el animal puede asomarse y
puede ser alimentado sin ningún riesgo a mojarse. Las de tipo colectivo son
ventiladas por las ventanas y puertas del lugar, siendo la puerta de una sola pieza.
Como hemos mencionado anteriormente todos los tipos de caballeriza deben
tener ventilación, iluminación y otros factores que serán tratados más adelante,
todo con el debido cuidado, ya que el animal puede recibir percances si estuvieran
colocados de una forma inadecuada.

Los animales estabulados que no reciben suficiente ejercicio se aburren y como
consecuencia pueden presentar ciertos problemas de comportamiento tales como:
bamboleo, morder el borde del pesebre o de la puerta, tragar aire, masticar
madera o caminar en círculo por la caballeriza.
La higiene y el ambiente físico de un establo pueden afectar la seguridad y el
bienestar del caballo mediante:
a) El incremento en la magnitud de las oportunidades de microorganismos
infecciosos, parásitos, gases nocivos y partículas irritantes o alergénicas.

b) La alteración de la resistencia local o sistémica (orgánica) del caballo.

c) El incremento del riesgo de daño físico.

d) Fallas para llenar las necesidades de comportamiento del caballo.
El diseño y el manejo de un establo dependen lógicamente de la evaluación de
estos efectos.
Se debe tener en cuenta las siguientes consideraciones al momento de construir o
seleccionar una caballeriza para los caballos:


1. Temperatura.
La temperatura interna de las instalaciones y la ventilación dependen en gran
parte del clima, del número de animales alojados y de los materiales empleados
en la construcción de las mismas. Los caballos pueden tolerar bajas temperaturas
siempre y cuando exista suficiente protección de los vientos y lluvias extremas. De
igual manera pueden tolerar temperaturas altas siempre y cuando se les
proporcione sombra en praderas y una ventilación y humedad apropiadas en las
caballerizas. Debe existir suficiente agua potable y fresca disponible en todo
momento., especialmente en climas calurosos. La temperatura óptima se
encuentra entre 10 y 15ºC, aunque pueden tolerar de -7 a 29ºC si se alojan en
caballerizas secas y libres de corrientes de aire.

2. Ventilación.
La temperatura, los niveles de vapor de agua, las concentraciones de gases
nocivos, el polvo y los microbios son afectados por la ventilación. Así mismo,
ayuda al control de la condensación, disminuye el nivel de patógenos
transportados en el aire, los cuales no pueden ser controlados por otros medios, y
ayudan a prevenir el enmohecimiento de los materiales de la cama.
Una construcción bien planeada debe permitir un adecuado intercambio de aire,
que ayude a reducir la humedad, concentración de amoníaco y polvo en su
interior. Es ideal poder utilizar techos con respiraderos en forma de campana,
ventanas grandes o acoplar extractores de aire en las paredes. La capacidad de
ventilación debe ser de por lo menos 2.8 m
3
/min. Por cada 450 Kg. de caballo a
temperaturas de -1 a 10ºC y deberá incrementarse a medida que aumente la
temperatura.

3. Humedad.
La humedad relativa en alojamientos para caballos deberá estar entre 50 y 80%.



4. Luz.
La cantidad de luz deberá permitir el examen adecuado del caballo y de su
caballeriza. Se debe evitar la oscuridad total, por lo que deberá existir luz artificial
durante la noche. Se recomiendan por lo menos 200 lux para los pasillos y áreas
de alimentación y manejo.

5. Cama.
Se debe proporcionar suficiente cama en la forma de aserrín, paja, cascarilla de
arroz o algún otro material adecuado. Deberá existir un drenaje adecuado para
evitar problemas en los cascos y que el animal se ensucie innecesariamente, pero
su función principal es la de absorber la humedad causada por el estiércol y la
orina. El mantenimiento de la cama debe ser diario, y preferiblemente cuando el
animal no esté en la pesebrera. Procurando así animales limpios y secos, y el
medio ambiente libre de olores. Los animales no deberán tener acceso al
estercolero para evitar infestaciones de parásitos.

6. Densidad de población.
Idealmente los caballos deberán alojarse en caballerizas individuales de por lo
menos 3.5 x 3.5 m x 3.0 m y tener acceso a un corral de ejercicio de 10 x 27.5 m ó
mayor. Después del destete es conveniente que cada animal tenga una
caballeriza separada. En el corral de ejercicio se debe mantener una separación
por edad y compatibilidad.

7. Pisos.
Los pisos deben ser antirresbaladizos y de superficie dura; no deben generar frío;
se debe adecuar un buen drenaje. Existe un tipo de ladrillo especial para las
cuadras, el concreto que es el material más usado hoy en día, hay otras
alternativas posibles como ladrillo, pavimento, cemento rugoso, caliza o tablillas.
Los pisos, independientemente del material con el que se construyan, deben tener
una pendiente del 2%, para facilitar un adecuado drenaje, esta inclinación debe
quedar lo más alejado de la puerta, formando la alcantarilla para facilitar la
limpieza del mismo.

Finalmente es de aclarar que la mayoría de la población equina en nuestro medio,
permanece en pastoreo libre y no goza de ningún tipo de alojamiento especial.

LECCION 38. TRANSPORTE.

Los equinos suelen ser transportados con relativa frecuencia, ya sea a
competencias o a exposiciones, los medios de transporte son tan variados como
remolques, camiones, barcos o aviones, cualquiera que sea el medio empleado
para el traslado deberá ser “seguro y cómodo”, además se buscará que sea
económico.

Para asegurar que el traslado sea exitoso deberá estar precedido de una correcta
preparación de los equinos.

A continuación expondremos algunas consideraciones de importancia para el
transporte de ejemplares equinos:

• Los caballos se deben acostumbrar a ser transportados desde
temprana edad; el animal estará menos excitado cuando ha tenido
experiencias previas de transporte.

• Los certificados de sanidad y propiedad deben ser enviados junto
con el animal; en cuanto al certificado de sanidad se refiere, éste deberá ir
firmado por un Médico Veterinario, además por las autoridades sanitarias
de la región (ICA), trasladar caballos enfermos es riesgoso tanto para el
animal (soportan muy mal el transporte), como para los restantes animales
en el evento, o en la explotación a donde vaya a llegar el animal
transportado.

• Los horarios de traslado se deben planificar con anticipación, con el
fin de que los equinos lleguen con suficiente antelación a la fecha del
certamen.

• Descanso, los caballos viajan más cómodos cuando se transportan
cómodamente y descansados, por tanto, no deben ser ejercitados
excesivamente o trabajados hasta la fatiga, antes del embarque.

• El medio de transporte deberá ser lavado y desinfectado, esta es una
forma de prevención contra enfermedades infecciosas.

• Disposición de cama adecuada, el piso debe cubrirse con arena seca
para que los animales no se resbalen, sobre la arena se colocará paja
limpia y blanda, ésta contribuirá a que el caballo esté más limpio y goce de
un buen reposo; además la cama absorbe la orina y evita humedades
excesivas.
• Ventilación, el sitio deberá tener buena ventilación, pero sin que se
formen corrientes de aire.

• El transporte debe encargarse a una persona con experiencia, dado
el alto costo de los ejemplares el traslado de los mismos no puede
encomendarse a cualquier persona, en lo posible es mejor contar en la
explotación con el equipo y personal necesario para el transporte, cuando
éste se efectúe por carretera.

Agua: se suministrará con frecuencia agua limpia y fresca, se debe evitar que
beban en exceso.

El interior del cubículo de transporte, esto previene traumatismos en caso de
paradas súbitas o de sacudidas extremas especialmente en carreteras que
presenten irregularidades en su superficie.

La rampa de ascenso y descenso debe ser resistente, segura, el animal debe
pisarla sin riesgo, de lo contrario se rechazará a ingresar en la misma.

El caballo no debe viajar con herraduras de tacón, se le debe herrar con
herraduras planas, en lo posible quitar todos los herrajes, o al. Menos los de los
miembros posteriores,

Los caballos de salto, polo o de carreras deben viajar con las patas vendadas para
evitar Contusiones en las cuartillas o en los tendones, las vendas se deben soltar
y ponerla nuevamente cuando el recorrido es demasiado largo.

Si el tipo de transporte es muy abierto (camión de estacas) los caballos deben
protegerce con mantas adecuadas.

Si en el transporte viajan más de dos equinos, deben agruparse de tal forma que
queden juntos los animales que están acostumbrados a trabajar o pastar en
compañía.

Se deberá levar equipo de emergencia, el cual incluye botiquín, cabrestos,
herramientas para herraje, elementos de aseo.

El manejo del equino

en el transporte lo hará la persona que lo atiende a diario,
esto le inspirará confianza; si por algún motivo el caballo se excita hasta el
extremo de poder infringirse daño se deberá tranquilizar con fármacos si los
métodos populares no han producido resultados satisfactorios.


LECCION 39. PRODUCCIÓN DE ASNALES Y MULARES




Asno Mula
http://es.wikipedia.org


Tanto los caballos como los asnos eran nativos de Asia y posiblemente de África,
es muy probable que los primeros mulares surgieran en donde los caballos y los
asnos existían juntos en su estado salvaje. O podría ser que algunas de las tribus
nómadas, tentadas por la curiosidad, hicieron la cruza y al ver que hacían buenas
bestias de trabajo, continuaron con la producción de mulas.

Lo que si es seguro, es que desde hace mucho tiempo la mula tiene fama por su
resistencia, su seguridad del paso en el trabajo, y como animal de carga.

Quizás como consecuencia de las malas condiciones en que se desarrollan en
nuestro medio, la mala alimentación, el exceso de trabajo, estos animales no
exhiban todo su potencial, en general, los asnales y mulares son muy rústicos y de
gran resistencia para el trabajo.

En nuestro país, estos animales han gozado de gran aceptación, especialmente
en núcleos de Población de escasos recursos económicos; es lógico por tanto que
en un texto de “Producción Equina” se deban analizar los principales aspectos
concernientes a ellos.

ORIGEN DE LOS ASNALES


www.rac.uab.es

Nuestro asno desciende del mestizaje entre el catalán, Poitou y el andaluz; es de
tamaño pequeño, color rucio más o menos oscuro. Es indudable que los primeros
asnos llegaron a nuestro país traídos en la conquista por los españoles.
El asno soporta el frío y la humedad en menor proporción que el caballo por ello
los mejores ejemplares se encuentran en Persia, Siria, Egipto, Berbería y en
Europa meridional. Los de inferior categoría son los que viven en África central, o
bien en los límites de su área de dispersión de las regiones europeas.
Los sentidos del asno doméstico están bastante desarrollados: en primer lugar
figura el oído, después la vista y luego el olfato; parece ser que el tacto no es muy
fino, ni tampoco el gusto. Las facultades intelectivas de este équido no son tan
pobres como generalmente se cree: de hecho tiene una memoria excelente y sabe
encontrar cualquier sendero, aunque lo haya recorrido una sola vez. Además,
aunque parezca estúpido, es sagaz y listo, y sobre todo completamente pacífico.
El burro es un animal territorial, le gusta estar en compañía siempre, aunque en
situaciones límites donde la comida es escasa son animales más solitarios que
solo se emparejan para aparearse. En grupos, no parece mantenerse una
jerarquía establecida.
El burro tiene el doble de la cantidad de glóbulos rojos en la sangre que otras
especies, incluido el caballo, lo que les permite alcanzar un comportamiento
fisiológico óptimo.
El asno muestra una personalidad entera por lo que si se le trata bien pero con
dominio, se consigue su eterna colaboración. De no ser así mostrará testarudez
resistiéndose a las órdenes del amo ya que no confía en el.

En casos así conviene relajarse y sobretodo no pegarle, hacerle dar tres vueltas
en circulo cerradas seguidas y probar de nuevo, posiblemente acceda a hacer lo
que hasta entonces se negaba.

Un burro bebe tres veces menos agua que un caballo y come cuatro veces menos
que un caballo, aparte de que en comida es muchísimo menos exigente.
Las razas de asnos criadas en la actualidad no son muy numerosas, presentando
una notable heterogeneidad, sobre todo en lo que se refiere a la alzada que,
medida en la cruz, varía desde menos de un metro a 1,60 m. La cría del asno se
efectúa hoy día siguiendo criterios racionales en centros de selección
especializados, cuyo primordial objetivo es la cría de sementales, elegidos para
utilizarlos en la producción del mulo, que, como ya se sabe, es un híbrido
resultante del cruce entre el asno y la yegua.
En la especie asnal, el macho se destina a la reproducción a los treinta y seis
meses y la hembra a los cuarenta y ocho. A un asno se le asignan, anualmente,
de cincuenta a noventa hembras. La gestación dura trescientos sesenta días y en
cada parto nace un pollino, que pesa unos 30 Kg. y es amamantado durante
ciento cincuenta días, completando su desarrollo somático a los sesenta meses.
Estos animales tienen un promedio de vida de unos veinticinco años.
Actualmente se estima la población asnal en 400.000 ejemplares, la mayoría de
estos, corresponde a ejemplares mestizos o criollos y sólo un número reducido de
ejemplares puros de razas definidas.

El asno pertenece al género Equus y a la especie asinus. Las principales
diferencias con el caballo (Equus caballus) son:

- El asno es de menor alzada, tamaño y peso.
- La cabeza del asno es mayor en proporción al cuerpo.
- Las orejas son muy largas, de acá el adagio “orejas de burro”.
- El labio superior es puntiagudo y ligeramente colgante.
- Cara ancha y plana, lo que le confiere un aspecto de rudeza.
- El borde superior del cuello es recto y provisto de poca crin.
- Grupa caída.
- Los cascos son más altos, estrechos y más duros que los de los equinos.
- En la región dorsal, muestra siempre “raya de mula”.
- Su longevidad es mayor a la del caballo, presta utilidad fácilmente durante
20- 25 años.
LECCION 40. PRINCIPALES RAZAS DE ASNOS.

La especie asnal es de naturaleza mucho menos polimorfa (variable) que la
equina; sus variaciones son apenas mínimas y por ello las razas son poco
numerosas.

Teniendo en cuenta tamaño y peso describiremos las principales razas.

CATALANA



www.rac.uab.es

Se origina en la región de Cataluña (España), parece derivar de asnos tipo
africano. Su alzada está entre 1.40 – 1.45 metros, pesa +/- 350 Kilos. Orejas
largas y derechas, cascos oscuros, costillas bien arqueadas. Temperamento
activo, pelaje zaino oscuro. Raza muy precoz y potente.
POITOU



www.viarural.com.ar

Origen en el centro y sur de Francia. Alzada entre 1.5 – 1.6 metros; se le
considera el más grande de todos los asnales. Cabeza grande, orejas anchas y
gruesas, cuello corto y musculoso, tórax amplio, remos aplomados y sólidos,
cascos duros, estrechos y altos de talones, pelo largo y rizado, pelajes marrón
oscuro o zaino en ocasiones casi negro.

Raza excelente para hibridar con equinos de tiro pesado ya que se obtienen
mulares de gran peso y tamaño. Su principal característica es la de ser una de las
razas más potentes y rústicas dentro de los asnales.

ANDALUZA


http://www.ansi.okstate.edu/breeds/

Originaria de Andalucía (Sur de España). Alzada entre 1.40 - 1.45 metros, pesa
entre 230 - 300 kilos, cuello mediano, excelentes aplomos, pelaje gris claro o
blanquecino.

Se aconseja para hibridar con equinos semipesados, son animales sobrios,
rústicos y vigorosos para todo tipo de trabajo.


NORTEAMERICANA


www.rac.uab.es

Mestizo de las razas Andaluza, Catalana, Poitou, Maltés e Italiana; los cruces y
selección se efectuaron en los estados de Kentucky, Tennese y Missouri en los
Estados Unidos. Su conformación es muy parecida a la de los caballos de tiro
pesado, logra 540 kilos, es el más pesado de la especie su alzada va de 1.55 a
1.60 metros. Cabeza erguida, orejas largas y erectas, dorso recto, grupa corta,
pecho ancho y profundo, costillar bien arqueado, buenos aplomos, cascos altos,
redondos y grandes, pelaje negro u oscuro.

Esta raza se emplea con frecuencia para la producción de mulares. Se
desempeña muy bien como animal de carga y tracción, aunque por su peso y
tamaño son algo lentos.
LECCION 41. ORIGEN DE LOS MULARES.


http://www.ansi.okstate.edu/breeds/
Los primeros reportes escritos acerca de los mulares se encuentran en el Antiguo
Testamento, en la época del Rey David; esto indicaría que su uso se inició mucho
antes.

En América, a finales del siglo XVIII, en el estado de Virginia en Estados Unidos
los asnales mestizos catalanes y andaluces se aparearon con yeguas de tiro
liviano y semipesado, así se produjeron mulares de excelente calidad para faenas
de tiro y labores agrícolas:

Si el cruzamiento se efectúa entre un macho asnal y la hembra equina se logra la
mula (hembra) o el muleto (macho); si el cruzamiento se realiza entre un macho
equino “padrillo” y una hembra asnal se llega al burdégano o “romo” de menor
aceptación que el mular; tanto unos como otros se parecen más a la madre que al
padre.
Como regla general, los productos híbridos son estériles, aunque si bien, se
conocen excepciones, los reportes de estas no son numerosos.

La mula en su aspecto externo es más parecida al asno que a la yegua, pero
anatómicamente ocurre todo lo contrario.

Las orejas tienen un aspecto intermedio a los dos progenitores; el cuello es recto y
delgado, cruz baja, dorso recto o convexo. El pelaje suele ser negro, bayo,
castaño o tordo, la raíz de la cola suele estar recubierta de cortos pelos y las
ancas más robustas, los cascos son más estrechos con talones altos y duros más
parecidos por lo tanto a las de los asnos y rebuznan como el padre. La presencia
de “raya de mula” es general al mular.

En cuanto a fisiología el mular es más parecido a la especie asnal que a la equina,
son duros, resistentes a la fatiga, longevos, poco aptos para la carrera, se
desarrollan muy bien para tiro y se adaptan a toda clase de faenas y terrenos.
El mulo pesa, en el momento del nacimiento, entre 35 y 40 Kg., es amamantado
durante doscientos cuarenta días y completa su desarrollo físico a los sesenta
meses. La duración de la vida es, aproximadamente, de unos veinte años.

El burdégano o “romo”, se parece más en su exterior al equino (su padre) y en su
esqueleto a la burra. Posee menor alzada que la mula; la cabeza es más fina y
proporcionada, la crin y la cola son casi idénticas a las del caballo. Los miembros
son descarnados, los cascos son más anchos que los del asno, los genitales
poseen apreciable desarrollo. Presenta el clásico relincho del padre.

Su pelaje puede ser castaño, zaino o negro retinto.

El burdégano, al igual que la mula presenta esterilidad absoluta del macho y
fertilidad relativa de la hembra.

En cuanto a comportamiento, el burdégano es más indómito y menos resistente a
la fatiga que los mulares.


PRODUCCIÓN DE MULAS.

Los mulares son muy apreciados por ser en extremo rústicos y resistentes, es más
fuerte que sus progenitores. El gran valor que alcanzan en el mercado se debe a
su aptitud para el trabajo, su resistencia a: el calor, los insectos, las largas
jornadas, su capacidad digestiva y sus hábitos alimenticios (no son “glotonas”,
comen estrictamente lo necesario) las hace menos vulnerables a problemas
digestivos (cólicos, etc.), su extraordinario instinto para evitar accidentes, su
constitución flexible, vigorosa y resistente; en especial los mulares gozan de gran
aprecio en regiones cálidas, regiones cafeteras y zonas de topografía quebrada.

Aunque los equipos modernos las han desplazado su aceptación en el mercado es
muy buena y por tanto se debe fomentar su producción.

Hay consideraciones acerca de la producción: El primero, es la cría de garañones
para su empleo como sementales; la segunda, la cría de yeguas seleccionadas
por tamaño y rusticidad; la tercera el apareamiento en sí.

Siendo un híbrido, es usual creer que la única forma de producir el mular es
mediante la cruza del garañón y la yegua; pero es factible que las mulas
produzcan descendencia ya que estas no exhiben defectos de conformación
anatómica en el aparato genital, la anormalidad fisiológica (óvulos inmaduros) no
es constante, o no afectan a todos los individuos; esto implica que la esterilidad no
es absoluta, mientras que, en el macho debido a su disfunción anatómica (túbulos
seminíferos no formados) será estéril inevitablemente, ya que su célula sexual
nunca podrá pasar de espermatogonia.

Aclarado lo anterior, un buen manejo de la hembra mular, la observación de sus
celos o calores si los hay, y la monta por parte del garañón no consanguíneo
podrán finalizar en una gestación, con lo cual la posibilidad de criar hijos de mulas
no es inaudita.



Escogencia y manejo del garañón.


Después de muchos cruces, parece que las mejores razas asnales productoras de
garañones son la andaluza y la norteamericana, también llamada “Black-Spanish”.

Una buena selección y manejo del garañón comprende:

- La edad en que el garañón entre al servicio debe ser entre los 2.5 - 3 años.

- El lote de yeguas a servir no deberá sobrepasar las 15 hembras.

- Manejar el ejemplar como asnal y no como equino, ya que el vigor del
garañón es menor que el del caballo.

- Continuo contacto con animales de la especie equina, ocasionan
estimulación en la atracción sexual por las yeguas.

- Lo ideal es que desde joven esté aislado de las hembras de su especie.

- Si ha tenido contacto con hembras adultas de su misma especie, es
conveniente que luego del servicio a las yeguas sirva burras de lo contrario
su libido decaerá.

- El número de montas máximo será de una cada tres días o 80 montas en el
año, de lo contrario sufrirá agotamiento con pérdida de vigor.

- El comportamiento del garañón es más rudo que el del equino, por tanto las
yeguas tienden a no aceptarlo fácilmente, cocean al macho, para
protegerlo, se deben emplear “maneas o trabones” en la yegua.

- Los cambios de clima frió a cálido afectan significativamente al garañón. Si
es necesario efectuar el traslado deberá tenerse en cuenta un tiempo
prudencial para su adaptación o “aclimatación” antes de que ingrese al
servicio.

- La dieta para el garañón deberá ser balanceada, rica en granos, minerales
y vitaminas.

- Las yeguas a montar, deberán tener alzadas acordes a las de él.




LECCION 42. ALIMENTACIÓN, CUIDADOS Y MANEJO DE
ASNALES Y MULARES.


Una grave equivocación que se ha venido cometiendo en el manejo de ¡os
asnales y mulares, es pretender que debido a su resistencia y rusticidad natural,
estos pueden ser mantenidos casi en abandono, dicha situación genera que estos
animales no puedan expresar la totalidad de sus condiciones genéticas. Esta
situación deberá entrar a corregir-se si queremos asnales y mulares eficientes y
realmente productivos.

Si bien es cierto, que mulares y asnales son más resistentes a las enfermedades,
no por esto debemos excluirlos de los programas de sanidad y prevención. Los
mulares exhiben un temperamento especial, deben ser manejados con suavidad y
cuidado, es muy dócil a su criador o manejador, pero, esquivos y prevenidos frente
a extraños, por esto cuando no se esté familiarizado con el animal es mejor actuar
con prevención, ya que su reacción es inesperada y algo violenta, cocean con
facilidad y son especialmente hábiles pateando con sus miembros posteriores. Los
manejos rudos la tornan “terca y arisca”, de acá el adagio popular “terco como
mula”; como cualquier animal responde al buen trato.

Respecto a la alimentación se debe suministrar los mismos alimentos que a los
equinos, especial atención se debe prestar al suministro de suplemento
(concentrado, grano) cuando estén sometidas a trabajos intensos o extenuantes;
en esta situación se debe dar 1 – 1.5 kilos de concentrado al día por cada 100
kilos de peso vivo, ó 1.300 – 2.500 gramos de melaza por animal.

Su manejo puede hacerse en grupos con pesebreras comunes, esto hace que el
manejo sea más sencillo y económico que en los caballos.

En general, asnales y mulares deben ser mantenidos y manejados como si de
equinos se tratara, esto redundará en mejores animales, más productivos y por
ende más rentables.


Con respecto a la fecundidad de los mulares se incluyen en el grupo de los
“paragenésicos parciales”, es decir, esterilidad absoluta del macho y fertilidad
relativa de la hembra.


Por estudios se ha podido concluir que:

o Los macho mulares son 100% infértiles.
o Numerosa es la estadística de hembras mulares fecundas.
o El cruce mula-caballo da productos caballares típicos.
o El cruce mula-asno da productos mulares típicos.
o Los hijos de mula y caballo son siempre fértiles.
o Los hijos de mula y asno son siempre estériles.


La esterilidad en el macho mular se debe a que el tejido seminífero se muestra
incompleto ya que sus tubos seminíferos se hallan dispersos en las mallas de una
red fibrosa. La célula germinal llega solo a la forma de espermatogonia y al no
pasar por la meiosis no resulta apta para la fecundación es decir se produce
semen pero sin gametos maduros, capaces de fecundar al ovulo.

La hembra mular no posee defecto anatómico en su aparato genital pero si existen
anormalidades en la parte fisiológica (óvulos inmaduros), que por no ser
constante, o no afectar a todas las mulas, hace que la esterilidad no sea absoluta.
















CAPITULO 9.
JUZGAMIENTO DE EQUINOS


www.fedequinas.org


LECCION 43. J UZGAMIENTO EQUINO.


La estructura orgánica que a nivel nacional orienta y es responsable del fomento,
la exposición y el juzgamiento de equinos criollos colombianos, es la Federación
Nacional Colombiana de Asociaciones Equinas (FEDEQUINAS).

FEDEQUINAS es la entidad que en el orden nacional agrupa y representa las
asociaciones equinas colombianas, y dirige, coordina, rige y controla sus
actividades técnicas de crianza, exhibición, fomento, desarrollo, competencia y
promoción deportiva.
En la Ley 427 de enero 16 de 1998, fue tácitamente reconocida como la entidad
rectora del gremio equino colombiano y comisionada para que en conjunto con el
Ministerio de Agricultura y Desarrollo Rural, a través de la entidad adscrita
correspondiente, y el Fondo Nacional del Ganado, diseñara y pusiera en marcha
planes y programas sanitarios de aplicación inmediata, con el fin de disminuir
hasta la erradicación final las enfermedades que afectan el subsector pecuario y
equino, para conservar y propagar estas razas puras y así cumplir las exigencias
sanitarias internacionales para poder participar en estos mercados con
competitividad.
En marzo 16 de 1998 y obrando acorde con el articulo 4, de la Ley 427, fue
delegada por el Ministerio de Agricultura y Desarrollo Rural mediante Resolución
no.00053 para abrir, registrar y llevar los libros genealógicos de la raza del
"Caballo Criollo Colombiano", con carácter oficial.
Objeto social de FEDEQUINAS.
1. El fomento, mejoramiento, desarrollo y fortalecimiento de todas las
actividades vinculadas con el enaltecimiento y promoción tanto a nivel
nacional como internacional del caballo criollo colombiano de paso, como el
mejor caballo de silla del mundo, en sus diferentes aires o andares criollos:
el paso fino, el trote y galope reunido colombiano, la trocha pura
colombiana, la trocha y galope colombianos.

2. Velar por la conservación, fomento y promoción de los asnales y mulares
criollos desde su crianza, exhibición y utilización deportiva, y de la actividad
equina en todas sus expresiones y modalidades.

3. Autorizar, supervisar y controlar la realización de los eventos equinos
(deportivos y de exhibición), en el territorio colombiano y la participación de
delegaciones colombianas a eventos en países extranjeros.

4. Asignar la categoría o grado que corresponda a cada evento según su
importancia.

5. Regir y regular los eventos mediante la adopción y expedición de
reglamentos que contengan las normas disciplinarias y técnicas de
obligatorio cumplimiento por parte de sus afiliados.

6. Ejercer como organismo consultivo del gobierno nacional, departamental y
municipal, así como de las autoridades judiciales en todo lo relacionado con
el caballo criollo colombiano de paso.

7. En cumplimiento de sus objetivos, Fedequinas tiene como finalidades
principales entre otras, las siguientes actividades:


1. Es el vocero y representante único entre los estamentos oficiales y privados, de
las asociaciones regionales de caballistas de Colombia.

2. Expide y reforma los reglamentos para las exposiciones y juzgamiento de
equinos criollos en Colombia.

3. Elabora el calendario nacional de exposiciones equinas internacionales,
nacionales, grados "a" y "b" que se celebran en el país.

4. Elabora el calendario nacional de concursos de chalanería que se celebran en
el país.

5. Autoriza las sedes y los grados para los eventos feriales equinos que se
realizan en Colombia.

6. Dicta las normas disciplinarias que deben observar las personas naturales y
jurídicas que participan en una exposición equina.

7. Es el notario de las certificaciones sobre genealogías que se expidan por parte
de las asociaciones regionales a los equinos criollos colombianos.

8. Es la entidad delegada por el ministerio de agricultura y desarrollo rural, para
que con carácter de oficial, abra, registre y maneje los libros genealógicos de la
raza del caballo criollo colombiano de paso.

9. Sirve de organismo asesor y de consulta al sector oficial en todos los
relacionados con el equino criollo colombiano.

10. Asesora a las asociaciones en software, hardware y manejo de información.

11. Realiza conjuntamente con las asociaciones o independientemente;
seminarios, ferias y eventos equinos, técnicos y científicos, y cursos de
homologación.

12. Dicta cursos de actualización a veterinarios, directores técnicos y locutores
técnicos.

13. Dicta cursos de actualización sobre las normas vigentes a las asociaciones y
sus socios.

14. Dicta cursos a las personas encargadas de manejar los registros en las
asociaciones sobre el procedimiento de expedición de los registros, el manejo de
esos documentos y las normas que rigen para ellos.

15. Asesora a todos los investigadores y criadores sobre líneas genéticas, cruces,
etc.

16. Es el ente consultor a nivel internacional de CONFEPASO, sus afiliados y
otros organismos.

17. Es el encargado de salvaguardar la propiedad de los caballos criollos
colombianos de paso.

18. Es la entidad encargada de llevar la información sobre las exposiciones
equinas que se efectúan en Colombia y las estadísticas sobre sus resultados y los
campeonatos de los ejemplares que en ellas participan.
19. Es la encargada de establecer y poner en marcha campañas y programas
orientados a proteger y conservar la raza del caballo criollo de paso. De igual
manera que esté enfocado a buscar una selección genética que nos permita
obtener un producto de mejor calidad.

20. Fedequinas es la única entidad en Colombia que desde 1995, hace el examen
de genotipificación a sus caballos. Este examen consiste, en hacer un examen
genético del DNA, en la raíz de la crin de los caballos que nos permite obtener un
archivo permanente de los marcadores genéticos de un ejemplar y hacer la
verificación de parentesco de un equino con sus respectivos padres.
Incluye este programa un servicio de toma de muestras de crin a los ejemplares
de todos los criaderos de la sabana de Bogotá y sus alrededores. Este servicio lo
presta Fedequinas a través de un médico veterinario zootecnista.

21. Desde 1997, la Federación a través de un convenio firmado con el Instituto
Colombiano Agropecuario ICA, puso en marcha una campaña para la prevención
y control de la anemia infecciosa equina. Todos los ejemplares para participar en
una exposición equina de la estructura de Fedequinas, deben presentar resultado
negativos al examen de AIE, efectuado en cualquier centro de diagnóstico del ICA.
La muestra de sangre, debe ser tomada por un veterinario adscrito a Fedequinas o
del ICA. La Federación a través de su veterinario oficial presta el servicio de toma
de muestras en los diferentes criaderos de la sabana de Bogotá y sus alrededores.

22. A través de sus departamento de sistemas y estadísticas, Fedequinas
suministra información a todos los caballistas del país sobre: registros de equinos
y genealogías; récord de grandes campeonatos; puntaje acumulado por los
ejemplares por participación en exposiciones equinas; puntaje acumulado por
criadores y expositores participantes en exposiciones equinas; programación de
exposiciones equinas; equinos ganadores de premios especiales tales como:
ejemplar del año o capón del año.

23. Fedequinas mantiene informado y actualizado al gremio equino nacional a
través de su órgano informativo oficial la revista Fedequinas por este mismo medio
los criadores pueden promocionar sus ejemplares.

24. Fomentar la reproducción, el mejoramiento equino y la utilización del caballo
para la recreación y el deporte entre las nuevas generaciones tanto en el ámbito
nacional como internacional.

25. Servir de representante para llevar la vocería de las asociaciones y comités del
gremio caballístico nacional ante las entidades públicas y privadas, nacionales y
extranjeras, en defensa de sus intereses.

26. Coadyuvar con el gobierno y el ente privado en el estudio de los problemas
técnicos y económicos que sean de interés y beneficio del gremio equino.
27. Mantener los registros y archivos con métodos de reconocido valor técnico, de
las actividades equinas, sus características y calificación en las exposiciones.

28. Elaborar los "reglamentos para las exposiciones y el juzgamiento de equinos
en Colombia", hacerlos cumplir y adoptar las medidas que en el futuro se
consideren necesarias para el bien de la ganadería equina.

28. Promover reuniones con jueces, directores técnicos de exposiciones, juntas
directivas, a efectos de unificar criterios técnicos sobre juzgamiento de ejemplares
y procedimientos para las exposiciones y en general realizar congresos,
conferencias sobre tópicos ilustrativos de los objetivos de la Federación y
promover eventos nacionales, regionales e internacionales que estimulen el
fomento equino nacional.

LECCION 44. JUZGAMIENTO EQUINO EN COLOMBIA.


Según la doctora Ángela Ochoa de Mejia, el juzgamiento de caballos colombianos
mejorará en la medida que criadores, expositores y jueces unifiquemos criterios.
Para esto es necesario ponerse de acuerdo sobre cual es el prototipo ideal de
caballo que se desea en cada andar para la pista y por supuesto para la
reproducción. Si adicionalmente a la observación cualitativa podemos cuantificar a
cada caballo tendremos un diagnóstico real de cada uno de ellos.

Fedequinas tiene establecida una tabla de puntuación a la que se le ha adaptado
un formato. En él se da el valor en puntos y porcentaje oficial para evaluar cada
cualidad, el espacio para el ejemplar a examinar, más una tercera casilla para
dejar las observaciones correspondientes. Originalmente está diseñada para
juzgar competencias pero es de gran utilidad en la selección de yeguas y
reproductores por que ofrece una manera “desapasionada” para elegir el pie de
cría de un criadero.

La primera parte habla sobre fenotipo. Para la aplicación de este agregado es
importante hacer un paralelo de conformación versus modalidad. Es muy
evidente la diferencia del fenotipo aun dentro de los mismos caballos
colombianos; debería ser fácil diferenciar a simple vista un ejemplar de andar
compuesto de uno simple porque los caballos verdaderamente galoperos tienen
entre otras características una inserción diferente de la cabeza y el cuello,
también el anca, el pecho incluso el mismo reglamento considera que la alzada
mínima de los trochadores galoperos y trotones galoperos es mayor que para la
trocha pura y el paso fino. Sucesivamente las características físicas cabeza,
cuello, pecho, vientre dorso, etc. se van valorando para obtener el primer
subtotal. Esta primera parte es fundamental para elegir ejemplares de cría por
que a diferencia del segundo agregado todas estas características son
hereditarias.

La segunda parte o agregado por manejo, valora el adiestramiento, rienda,
posición de cabeza, sostenimiento y armonía. En los ejemplares de pista es
fundamental que el puntaje aquí sea alto por que es a través del buen arreglo y
disciplina que un caballo puede mostrar en la pista todas sus bondades. Muchos
caballos que podrían tener alto puntaje por fenotipo y movimiento se pierden por
el deficiente manejo que se les da, se creo que por esta causa terminan
prematuramente su carrera en la pista, o ni siquiera llegan a ella, gran cantidad
de potros y caballos de buena calidad.

La posición de cabeza depende del arreglo pero también de la conformación del
caballo. En la selección de ejemplares de cría se debería reemplazar el
agregado por manejo por el análisis concienzudo del pedrigree.

Por último se evalúan los movimientos: Ritmo, cadencia, suavidad, tren posterior
y anterior, quietud de anca y adicionalmente brío y temperamento. Hoy en día los
movimientos de cada andar están completamente definidos con características
individuales que hacen cada modalidad inconfundible. El buen temperamento y el
brío son característicos de los caballos criollos colombianos. También los
componentes del agregado por movimiento se heredan.

Los beneficios del empleo de la tabla pueden ser múltiples, para los jueces un
ejemplar en la pista necesita un puntaje mínimo para permanecer en
competencia (lo dice el reglamento), con más razón lo debe tener para aspirar a
un lugar en el marcador y por supuesto para ser campeón. No podemos olvidar
que una de las funciones de los jueces es orientar la cría a través de sus fallos y
explicaciones, por eso el compromiso al premiar los ejemplares cualquiera que
sea el grado de la exposición. Igualmente el criador aplicado puede, utilizando la
tabla, en su criadero hacer una auto-evaluación a conciencia de sus yeguas y
reproductores.

La acción de ¨ juzgar ¨ corresponde al análisis detallado, mediante comparación o
analogía de ejemplares pertenecientes a una misma especie animal, raza, sexo y
edad, con el fin de catalogarlos de acuerdo a sus propias características
fenotipicas y de producción y así otorgarles el puesto que se merece en el
momento de ser analizados este es un proceso técnico y ordenado. En otras
palabras, juzgar es sopesar cualidades y defectos para llegar a un balance justo.
El juzgamiento debe ser realizado por personas calificadas denominadas J UECES
que deben actualizarse permanentemente sobre la evolución de la raza y de la de
sus géneros.

La fecha para realizar las exposiciones nacionales deben ser fijadas en los meses
de febrero o marzo de cada año para que la junta directiva seleccione a las
personas y ejemplares merecedores de los títulos especiales, de acuerdo con los
puntajes obtenidos por los candidatos en el año anterior.

El juzgamiento en la especie equina se realiza tanto en la etapa joven del animal
(Sin adiestrar), como en la etapa adulta (Adiestrado o amansado), preparado para
participar en Eventos denominados Exposiciones, que pueden tener el carácter de
Internacionales o de Nacionales.
La organización de la feria debe estar a cargo de la junta organizadora esta a su
vez nombrara un director técnico, quien será la autoridad dirigente del evento.

La junta organizadora y el director técnico harán los nombramientos de esta
manera:

Personal administrativo:
Secretario- tesorero
Auxiliar del secretario - tesorero
Personal del servicio Varios

Cargos honorarios de la junta (presidente, vicepresidente, fiscal, etc.)

Personal técnico:
J ueces.
Ejecutivos.
Asesores.
Comisiones.
Coordinadores
Director de prensa y propaganda
Locutor o anunciador oficial.
El director técnico es la máxima autoridad dirigente.

Las llamadas ferias internacionales deben cumplir como mínimo los siguientes
requisitos:

- Que intervenga por lo menos cinco ejemplares procedentes de países
extranjeros.
- Que se celebren en ciudades autorizadas para Exposiciones Grado A.

Para que una, ciudad pueda ser sede de Exposiciones Grado A, debe reunir las
siguientes condiciones:

- Tener un coliseo que cumpla las exigencias de capacidad, sanidad y
seguridad, a juicio de una comisión que para el efecto designa la
J unta Directiva de la Federación Colombiana de asociaciones
Equinas ¨FEDEQUINAS¨.
- Tener un mínimo de 100 pesebreras.
- Disponer de suficiente capacidad hotelera.
- Integrar una J unta o Comité Organizador, el cual nombrará un
Director Técnico y éste a su vez designara un Medico Veterinario
quien estará a cargo del servicio de sanidad.

Se considera Exposición Grado B, Aquellas que se realice en el país y que no
cumpla las normas establecidas para las Grado A.

El Director Técnico, debe ser una persona de reconocida experiencia y trayectoria
en el campo de la organización de certámenes agropecuarios y será la máxima
autoridad del evento.

Como normas generales, la J unta Organizadora o el Director Técnico deben
suministrar el pasto necesario para la manutención de los animales durante los
días de la Feria.
El elemento adicional (Concentrado, drogas, etc.) será por cuenta de cada
expositor.

Las personas encargadas de seleccionar o juzgar a los distintos animales inscritos
y presentes en la exposición, tiene el carácter de J ueces, quienes deben llenar los
siguientes requisitos:


- Ser ciudadanos Colombianos.
- Ser personas de recocida honorabilidad.
- No tener como principal ocupación el adiestramiento, manejo o
negocio de equinos.
- Ser capaces de conducir adecuadamente algún ejemplar en la pista
de juzgamiento para afianzar algún fallo.
- Ser nombrados oficialmente por Fedequinas.



NOTA: Debido a la complejidad en el arte de juzgar equinos, normalmente son
designados dos (2) jueces para las distintas modalidades que participen en la
Exposición.




Los jueces tendrán en cuenta las siguientes circunstancias al realizar su trabajo en
la pista:

- Fenotipo (alzada, aplomos, conformación, pelaje, esbeltez, tipo racial, etc.).

- Armonía, elegancia y sostenimiento en el movimiento o andar que se juzga.

- Suavidad y facilidad de conducción.

- Temperamento y mansedumbre (brío y docilidad).


Para poder conocer mejor a los ejemplares que tienen a la vista, los J ueces
pueden elegir algunas pruebas específicas para equinos, siguiendo el orden que a
continuación se detalla:

Previa acicalada o preparación del animal (baño, cepillado, etc.) fuera de la pista,
ya dentro de ella, se observa la ¨APERADA¨ , esto es la colocación de la silla o
galápago, bozal, y los aperos de cabeza usuales para la modalidad que se juzga.

Se ordena la ¨MONTADA¨ de cada ejemplar, que desde luego debe ser por el lado
izquierdo. El J inete o Chalán debe presentarse con sombrero y zamarros; se
exceptúan de esta norma a las Amazonas.

TRABAJ O EN CÍRCULO. Se ordena el movimiento de los ejemplares alrededor de
la pista uno tras otro, para que estos se familiaricen con ella y con el público. Debe
observase la seguridad de la pista, el resorte de sus remos, la postura de la
cabeza y de la cola, el brío que es sinónimo de garbo, de pujanza, de fogosidad; el
temperamento o carácter, si es vivo, alegre, dócil, etc.

TRABAJ O EN OCHO. Para esta prueba los jueces se ayudan de dos personas
que colocadas frente a frente a una distancia de tres (3) metros una de la otra,
hacen las veces de postes u obstáculos entre los cuales cada equino debe pasar
realizando el desplazamiento en el sentido del ¨Ocho¨. Esta prueba se realiza para
determinar lo que se reconoce como Ajusté de boca o prueba de docilidad,
determinando con ello la facilidad de conducción (Quiebre de cabeza).

BATIDAS. Se observa la modalidad de paso que se juzga, bien sea por ¨laterales¨
(Paso fino) o por ¨diagonales¨ (Trote o Trocha).

SERPENTINAS. Se ordena que cada equino se desplace marchando en forma
ondulante hacia la izquierda y hacia la derecha.

CEJ AR O RETROCEDRE. Cada ejemplar a la orden de los jueces y a la acción
del jinete debe dar marcha atrás, sin ponerse de manos o encabritarse.

PROVOCACION O EXIGIDA POR EL BRIO. Se ordena arrancar bruscamente a
cada animal, luego que se detenga e inicie nuevamente la modalidad de paso que
se juzga.
El brío debe ser espontáneo, sin malicia ni pereza. Se puede hacer manifestar de
las siguientes maneras:
Con la rienda: Voluntad o agilidad a cualquier movimiento de ella, sin ser exigido.
De oído: Responde a cualquier sonido o voz que emita el jinete (está alerta).
De pierna: Responde al más leve ajustamiento de las piernas del jinete.

PASO POR PISO DURO: Como un recurso último, se ordena que el animal pase
por un corredor o calzada en concreto (ojala con micrófonos incorporados), para
determinar según el tipo de paso que se juzga, los cuatro golpes correspondiente
al Paso fino cuya onomatopeya se acerca a un sonido parecido a: ta ca….ta
ca….ta ca….ta ca….; o a los ritmos diagonales cuyo sonido característico es para
el trote: tas….tas….tas….tas…. o los tres tiempos para el Galope cuyo sonido se
acerca a: ca tor ce….ca tor ce….ca tor ce ….ca tor ce….



Los jueces pueden excluir o no dejar participar en el juzgamiento a los ejemplares
que:

- Su aire de marcha o andar no corresponde a la modalidad que se juzga.

- Muestre indocilidad en el momento de recibir el freno, la montura, al ser
montado o al desplazarse con el jinete.

- No responde a la prueba de cejar o dar paso atrás.

- No cumple con los requisitos mínimos de alzada.

- Para equinos de tres a cinco años: Machos: 1.36 m. Hembras: 1.34 m.

- Cumplidos los cinco años deben tener como mínimo: Macho 1.38 m.
Hembras 1.36 m.

- Coleen en más de cinco (5) oportunidades.

- Ingresen a la pista ensillados.

- Siendo adiestrados se presenten con herrajes incompletos o no los
presenten.

- Presenten sus remos calzado muy alto, es decir por encima de la rodilla y/o
corvejón.

- Presente el factor ¨careto¨, es decir que la mancha blanca incluya la región
de los ojos además del listón corrido.

- Corresponde a la categoría de caballos castrados y no usen baticola.

- Sean montados por jinetes que no usen sombrero ni zamarros.

- Sean caballos ciclanes.



A juicio del Medico Veterinario, hayan sido alterados en su presentación (edad,
pelaje etc.), o hayan ingerido sustancias con el fin de alterar su normal
desempeño.

NOTA: Al dar a reconocer el fallo o resultado de las competencias, los jueces
deben hacer resaltar los méritos de un equino sobre cada uno de los otros,
justificando así el puesto asignado.

Para realizar las pruebas de juzgamiento en equinos se tienen establecidos los
siguientes concursos:

Competencias por categorías o por edades.
Premios o competencias especiales.

Las competencias por categorías a la vez se subdivide en:

Equinos sin adiestrar mostrados en ¨pelo¨ portando jáquima para su fácil manejo.
Equinos adiestrados, los cuales deben entrar a la pista desensillados y luego con
la ayuda del palafrenero procede a aperarlos delante de los jueces.

Antes de entrar a la pista de juzgamiento, los ejemplares deben ser revisados por
un Comisario en cuanto a su edad, determinando por detención; en los machos se
comprueba la presencia de sus dos testículos, además explorar posibles prácticas
dolosas, como ejemplo la colocación de bandas elásticas en los muslos de la cola
para evitar el defecto del coleo; así mismo se hará caminar un poco al animal para
detectar cojeras o claudicaciones en algunos de los remos, que desde luego
inhabilitan al equino para su participación.

Para la competencia del Caballo castrados adiestratos, los jinetes deben ser
aficionados.

Al ensillar al equino, solo pueden intervenir el jinete o montador y el palafrenero,
este último abandonara la pista cumplida su labor.

Los ejemplares al entrar a la pista deben portar el numeración que corresponde a
su inscripción en el Catalogo, la cual llevara el jinete durante la competencia en
una parte visible, generalmente colgada de un bolsillo de los zamarros.


Por separado se juzgarán los equinos cuya modalidad de movimiento este
enmarcada en uno de los siguientes andares:

- Paso fino colombiano.
- Trote.
- Trote y Galope.
- Trocha.
- Trocha y Galope.

Las competencias por categorías o edades, realizadas separadas por sexo, para
las diferentes modalidades son las siguientes:

Equinos de1 ½ a 2 años sin adiestrar (18 - 24 meses mostrados en la cuerda).
Equinos de 2 - 2 ½ años sin adiestrar (25 - 30 meses en la cuerda).

Terminadas estas dos competencias, se procede a otorgar el premio de
Campeón(a) joven entre los ejemplares que obtuvieron el primer puesto en su
edad y que recibieron Cinta Azul; el seleccionado recibe como distintivo una Cinta
Violeta; luego se procede a otorgar el premio de Campeón(a), joven reservado(a),
para el cual participan el ejemplar que por el anterior premio compitió y no gano y
el ejemplar 2º puesto de la edad o categoría de la cual salio el ejemplar declarado
Campeón J oven. Al equino declarado Campeón(a) J oven Reservado(a) se le
distingue con una Cinta Violeta que lleva inscrito el nombre del respectivo premio.


Se procede luego a juzgar a los animales adiestrados o amasandos en las
siguientes categorías o edades:

- De 2 ½ - 3 ½ adiestrados (31 - 42 meses).
- De 3 ½ - 5 años adiestrados (43 - 60 meses).
- Mayores de cinco (5) años adiestrados (de 61 meses en adelante).
-

Al terminar estas competencias, se realiza a diferencias de lo que se hace en la
especie bovina, la participación directamente por el premio de ¨ Gran Campeón(a)
en su modalidad, de los ejemplares que obtuvieron el primer puesto en su edad o
categoría en las competencias de adiestrados. Al ejemplar seleccionado como
Gran Campeón(a) se le distingue por una Cinta Tricolor y un Estandarte o
Gallardete Violeta. También se otorga el premio de Gran Campeón(a)
Reservado(a) por lo cual participan los ejemplares que compitieron por el Gran
Campeonato y que no ganaron y el ejemplar 2º. Puesto de la categoría de la cual
salio el ejemplar declarado Gran Campeón.



En cada categoría se puede no otorgar varios puestos hasta un quinto, cada uno
de los cuales se distingue así:

- Primer puesto: Cinta Azul.
- Segundo puesto: Cinta Roja.
- Tercer puesto: Cinta Amarrilla.
- Cuarto puesto: Cinta Verde.
- Quinto puesto: Cinta Rosada.


Para cada modalidad de paso o movimiento se realizarán las competencias
separadas por sexos y de ejemplares no adiestrados y adiestrados, siguiendo el
orden establecido anteriormente. Como ejemplo veamos lo que serian las
competencias en la modalidad de Paso Fino:

Potros Reproductores (enteros) de Paso Fino de 18 - 24 meses sin adiestrar.
Potros Reproductores de Paso Fino de 25 - 30 meses sin adiestrar.
Campeón(a) joven de Paso Fino.
Campeón(a) joven Reservado (a) de Paso Fino.
Caballos Reproductores de Paso Fino de 31 - 42 meses adiestrados.
Caballos Reproductores de Paso Fino de 43 - 60 meses adiestrados.
Caballos Reproductores de Paso Fino de 60 meses.

Gran Campeón (a) de Paso Fino.
Gran Campeón (a) Reservado (a) de Paso Fino.

NOTA: La edad del ejemplar será la que tenga a la fecha de iniciación de la
exposición (día de entrada de ejemplares).

En las mismas edades compiten las hembras, teniendo en cuenta que en la época
joven de no adiestradas reciben la denominación de Potrancas y en la edad adulta
la de yeguas.

Terminando las competencias por Categorías y las de Campeonatos, se realizan
los llamados concursos para Premios Especiales en cada modalidad, entre los
cuales se pueden describir los siguientes:

J EFE DE RAZA. Participan por estos premios los reproductores equinos, que
tengan cuatro (4) hijos, de los cuales necesariamente dos (2) deben estar
adiestrados; así mismo será necesario que estén representados los dos sexos y
tener la totalidad de descendientes presentados, la misma modalidad de Paso que
la del padre.

Distintivos que se otorga: Estandarte Azul.


NOTA: El ejemplar que pretenda ser calificado como J efe de Raza, debe estar
presente en el momento de juzgarse la competencia.


Así mismo debe tenerse en cuenta que este Premio de J efe de Raza, no se otorga
en la modalidad de Trocha y Galope.

GRUPO DE YEGUAS PARA CRIAS. Deben presentarse tras (3) ejemplares de la
misma modalidad de movimiento y de un mismo propietario.
Distintivo: Estandarte o Gallarte Rojo.

GRUPO DE YEGUAS CON CRIA. Deben presentarse dos (2) ejemplares de la
misma modalidad de movimiento y las crías deben ser de la misma modalidad de
paso de la madre. (Deben estar en lactancia)
Distintivo: Estandarte o Gallarte Rojo.
NOTA: No se juzgan Grupos de yeguas con Cría en la modalidad de Trocha y
Galope.

MEJ OR DESENDENCIA DE UNA MISMA YEGUA. Deben presentarse dos
ejemplares hijos de la misma yegua, de cualquier sexo y edad, que hayan
competido en las competencias por categorías, y que sean de la misma modalidad
de paso de la madre.
Distintivo: Estandarte Rojo.


FUERA DE CONCURSO. Se declarará así al ejemplar mayor de cinco (5) años,
que hubiere obtenido en cualquier momento el Premio de Gran Campeón(a) en
diez (10) oportunidades, en exposiciones Internacionales o Nacionales Grado A.
Distintivo: Estandarte Blanco con Ribetes Rojos.
La asociación que organiza la Exposición otorgará además un pergamino al
propietario del ejemplar.
NOTA: No hay Fuera de Concurso para Caballos Castrados, Ponies, Asnales,
Mulares y otras razas equinas.

CAMPEÓN(A) DE CAMPEONES(AS). Se determina entre los ejemplares
declarados Fuera de Concurso de acuerdo a la modalidad de Paso y sexo, que
hayan obtenido la ratificación del titulo en la exposición que se juzga.
Distintivo: Estandarte: Violeta.

EJ EMPLARES DEL AÑO. Serán los caballos reproductores que tenga titulo de
J efe de Raza y las yeguas que obtengan el titulo como madres de la Mejor
Descendencia en cada modalidad, premio este que se otorga solo en la llamada
“Exposición Nacional” que se realiza una vez cada año, en diferentes ciudad que
tenga carácter de Grado A.
Distintivo: Estandarte cuyo color queda a elección de la J unta organizadora.


MEJ OR CRIADOR Y/O MEJ OR EXPOSITOR. Será aquel caballista que obtenga
el mayor puntaje de acuerdo con la tabla de valores establecida para cada uno de
los premios, tanto de categorías como especiales.

Mejor Criador: Distintivo: Estandarte Violeta.
Mejor Expositor: Distintivo: Estandarte Verde.



Tabla de Puntaje para Otorgar cada uno de los dos Anteriores Premios

J efe de Raza 20 Puntos
Ejemplar del Año 18 Puntos
Grupo de Yeguas con Cría 18 Puntos
Gran Campeón (a) 17 Puntos
Grupo de Yeguas para Crías 15 Puntos
Gran Campeón (a) Reservado(a) 13 Puntos
Campeón(a) de Campeones(as) 12 Puntos
Mejor Descendencia de una Yegua 11 Puntos
Fuera de Concurso 10 Puntos
Campeón(a) J oven 9 Puntos
Campeón(a) J oven Reservado (a) 8 Puntos
Primer Puesto 5 Puntos
Segundo Puesto 4 Puntos
Tercer Puesto 3 Puntos
Cuarto Puesto 2 Puntos
Quinto Puesto 1 Punto


Por separado se juzgan los caballos Castrados en cada modalidad, pudiéndose
presentar ejemplares de cualquier edad (deben presentarse con Baticola).
Titulo: Mejor Ejemplar Castrado
Distintivo: Estandarte Azul

NOTA: Los ejemplares Píos o Pintos, solo se juzgan en la modalidad Trote.

Una vez finalizado todas las competencias según modalidad de paso, se procede
a realizar los juzgamientos de otras especies de Equinos y Razas especializadas.
Siguiendo las pautas que a continuación se mencionan.





COMO SE J UZGAN LOS ASNALES

Asnales reproductores o reproductoras hasta de cinco (5) años.
Asnales reproductores o reproductoras mayores de cinco (5) años.(De61
meses en adelante).

Titulo: Campeón(a) Asnal - Distintivo: Cinta Tricolor.
Campeón(a) Asnal Reservado(a) Cinta Violenta.

Luego se juzgan la competencia Mular adiestrada de cualquier edad para la cual
los ejemplares deben presentarse con baticola.
Premio. Mejor Mular - Distintivo: Estandarte Azul.


Los ejemplares Ponies se juzgan en categorías así:

Ponies reproductores o reproductoras hasta de cinco (5) años.(60 meses)
Ponies reproductores o reproductoras mayores de cinco (5) años. (61
meses en adelante).

Premio: Campeón (a) Pony - Distintivo: Cinta Violeta.

Los equinos pertenecientes a razas pesadas y denominadas como Tiro Pesado,
tales como Percherón, Clydesdale, Belga y Shire, se pueden juzgar teniendo en
cuenta primero su Fenotipo (alzada, características raciales, etc.) y luego
realizando competencias para determinar fuerza de arrastre o tracción para lo cual
se les puede colocar carruajes, maquinaria agrícola o cilindros - rodillos cuyo peso
sea conocido, para desplazarlo en un área determinada.

Premio: Gallardete y Trofeo.



LECCION 45. Sistema De Juzgami ento Spectrum Internacional .











www.fedequinas.org


En un esfuerzo mas del B.O.D de la FloridaPFHA por mejorar el sistema de
juzgamiento. Este año el Spectrum International a celebrarce por vez primera en la
ciudad de Miami, se implementara el sistema rutinario obligatorio que se describe
a continuación.


Sistema de juzgamiento para caballos de paso fino de 5 Jueces.

Proceso del juzgamiento


Introducción:





Los requisitos de competencia de cada división están listados en el reglamento de
la PFHA bajo los procedimientos individuales de cada division para Classic Fino,
Performance, Pleasure, Country Pleasure, etc. Los Directivos de la Feria Spectrum
International, se reservan el derecho de determinar el orden del J uez cabeza para
cada competencia, antes del comienzo de la feria, solamente para el propósito del
manejo del recorrido de cada una de ellas y no por razones de cómputos finales
que determinen el resultado final.
Los cinco jueces evaluaran todas las fases de la competencia y el puntaje alto y
bajo de cada ejemplar sera eliminado al final de la competencia o después de un
desempate.

Los resultados de cada uno de los cinco jueces serán proyectados en la pantalla
dentro del Coliseo. Los cuales serán enviados electrónicamente por medio de un
Palm Pilot o PC
personal a la mesa de computo. El resultado final sera anunciado por el locutor de
la competencia.

Responsabilidad del Director de Pista (Ringmaster).

La responsabilidad del Director de Pista es:

1; Comunicarle con el locutor cuando el J uez cabeza pida cambio en el recorrido.

2; Informarle a los jueces de su posición a tomar dentro de la pista y ayudarle a los
directores de la feria que los jueces cumplan con ese requisito.

3; Asistir a cualquier juez que tenga dificultad técnica con el instrumento de PC
personal.

4; Dirigir a los caballos a alinearse en el área establecida por los directores de la
feria.

Responsabilidad de los Jueces.









La responsabilidad de cada uno de los jueces es:

1; J uzgar cada competencia a su mejor nivel de habilidad siguiendo las
direcciones y criterio establecido por el reglamento de la PFHA/USEF.
2; Cumplir con las reglas establecidas en el sistema de juzgamiento de 5 jueces
para caballos de Paso Fino.
3; Mantenerse en el área asignada dentro de la pista, por medio de los directores
de la feria.
4; Separarse de cualquier tipo de comunicación con cualquier otro J uez acerca de
la competencia o expositor hasta que el resultado final se haya anunciado.

5; Comunicarse con el director de concurso acerca de cualquier problema durante
el curso de la competencia, para recibir solución inmediata.

6; Seguir el procedimiento predeterminado y escrito para los requisitos de las
competencias para el Spectrum Internacional del 2009, en acuerdo con
PFHA/USEF, por cada división sin desviación.



Responsabilidad del Juez Cabeza (Call Judge).

Las responsabilidades del J uez cabeza son:

1; Comunicarse con el director de concurso y pedir la próxima etapa de cada
competencia dentro de un tiempo considerado.

2; Seguir el procedimiento predeterminado y escrito para los requisitos de la
competencias para el Spectrum Internacional del 2009 sin desviación.

3; Siempre usar el primer caballo que entro a la competencia como un punto de
referencia, para poder administrar la competencia en un tiempo adecuado.



Procedimiento de Competencia.








1. Los caballos entraran a la pista cuando la persona encargada de la entrada
los llame a entrar, uno por uno. El locutor identificara cada ejemplar por el
nombre del caballo, padre, madre, propietario y montador. También se
incluirá la información de la edad del caballo, si esta disponible.

2. Los caballos cumplirán con los requisitos de competencia como lo describe
las reglas de cada división que se encuentran dentro de los capítulos por
división en el reglamento de PFHA/USEF.

3. Los procedimientos de cada competencia y predeterminados para cada
competencia dentro de las diferentes divisiones, serán publicadas en las
paginas del Spectrum #150; www.miamispectrum.com and
www.floridapfha.org; y serán publicados en el programa del Spectrum
Internacional del 2009. Solo los procedimientos y pruebas descritos en este
programa serán los utilizadas con el sistema de 5 J ueces durante el
Spectrum Internacional del 2009.


4. Solo los procedimientos predeterminados por escrito serán ejecutados por
todos los expositores en cada competencia. Ninguna prueba, fuera de esas
escritas y predeterminadas en el procedimiento de cada competencia,
pueden ser exigidas en ningún otro momento.

5. Los caballos que se excusen de la pista, serán solo al final de la primera
selección por los jueces y al final de la competencia.

6.un caballo puede ser excusado por razones de seguridad o si el montador(a) del
caballo pide permiso de ser excusado(a); y el permiso se le ha dado.

7. Después de cumplir con los requisitos de cada competencia, los cinco
jueces seleccionaran cualquier caballo que ellos deseen, para que pasen
por la tabla de resonancia una segunda vez. Para que esta selección se
ejecute; por medio del aparato de CP; cada caballo debe ser seleccionado
por en mínimo de 3 jueces para poder pasar por la tabla una vez mas.

8. Después de que terminen con la segunda pasada por la tabla de
resonancia, si algún caballo lo tiene que hacer, cada uno de los jueces
tienen que seleccionar los caballos que continuaran dentro de la
competencia. Cada juez seleccionara un mínimo de 7 caballos. Si son
menos de 7 caballos en la competencia, los jueces pueden proceder a la
ultima fase de la competencia o dar su veredicto final en ese momento.
Esto sera por medio del aparato de comp***cion.

9. Los caballos que queden en la pista serán considerados como finalistas de
esa competencia. Ellos tendrán que cumplir trabajo adicional o el resto de
pruebas predeterminadas para cada división.

10. Un caballo debe ser escogido por un mínimo de 3 jueces para seguir en la
competencia, y entrar a la segunda fase de la competencia.

11. Los resultados de los jueces serán mandados directamente a la mesa de
comp***ción por medio del aparato de comp***dor (Palm Pilot) La
comp***dora calculara la lista de finalistas que quedaran en la competencia
para la próxima fase de la misma. El resto de los participantes serán
excusados de la competencia.

12. Después de que los finalistas completen el resto de los requisitos
predeterminados de la competencia; los jueces darán su veredicto para los
7 mejores caballos que quedaron dentro de la competencia.
13. Los puestos disponibles son basados en seis posiciones con galardón
disponible, siendo colocados consecutivamente de 1ro. a 6o.; y una
mención honorable como el 7º. Puesto. En las competencias de los
Campeonatos se otorgaran 4 galardones de 1ro a 4º puesto, y una posición
de mención honorable como el 5º. Puesto.

14. Cada puesto tendrá un puntaje especifico para propósito del sistema. Estos
puntos son para propósito de comp***cion solamente. Esos puntos no serán
reflexión hacia los puntos que cada caballo recibe hacia los premios de fin
de año o para la clasificación a la feria Nacional de PFHA.

Los puntos dados a cada posición son los siguientes:

Posición Otorgada Valor de Puntaje

1st place 1
2nd place 2
3rd place 3
4th place 4
5th place 5
6th place 6
7th place 7

15. El sistema eliminara la posición mas alta y mas baja de cada finalista. Por
ejemplo:
Caballo #1 recibe 1o, 2o, 2o, 1o, 2o. Un primer puesto y un segundo puesto
serán eliminados.

16. Después de la eliminación del alto y el bajo, el programa de comp***dor
sumara las posiciones que cada caballo mantiene para llegar al resultado
final.

17. El mejor resultado posible en cualquier competencia sera de 3 puntos, que
significa que los 3 puestos que quedan sumaran no mas de 3. Tres
primeros puestos quedaron después de la eliminación del alto y el bajo.
(1+1+1=3). Este finalista automáticamente gana el primer puesto sin duda
ninguna.

18. Si después de que la posición alta y la baja son eliminadas de cada caballo,
y la suma de las posiciones de 2 o 3 caballos tienen el mismo total, se crea
un empate. El próximo proceso tomara efecto para desempatar.

19. Los finalistas que tengan el mismo numero total de la suma de las 3
posiciones, se le eliminaran nuevamente la posición mas alta y mas baja de
los puestos que quedan contando. Si el numero o posición que quedan
contando no es el mismo numero para cada finalista, los caballos son
colocados consecutivamente determinado por el puntaje final.


Por ejemplo:

J uez ID A B C D E
Caballo#1 2 2 3 4 5
Caballo #2 5 5 2 2 2

Después de eliminar la posición alta y la baja:
Puntaje Posición Puntaje Total
Caballo #l 2 - 3 - 4 9
Caballo #2 5 - 2 - 2 9

Cuando se elimina la alta y baja nuevamente, el resultado es:
Puntaje Total
Caballo#l 3
Caballo#2 2

El Caballo#2 el puntaje mas bajo y queda sobre el caballo #1. No hay necesidad
de trabajo adicional.

20. Si después de eliminar las posiciones altas y bajas, y los finalistas siguen
empatados, los caballos tendrán que trabajar mas. Este trabajo adicional es
predeterminado. Este trabajo adicional solo afectara los caballos incluidos
en el desempate. Ninguna otra posición sera afectada tampoco.

Por ejemplo:
J uez ID A B C D E
Caballo #1 3 4 5 1 6
Caballo #2 4 5 3 6 2
Caballo #3 6 3 4 5 1


Después de eliminar la posición alta y baja:

Puntaje por Posición Pontaje Total

Caballo #l 3 4 5 12
Caballo#2 4 5 3 12
Caballo #3 3 4 5 12


Cuando la segunda posición alta y baja es eliminada, el resultado es:

Total Points
Caballo #l 4
Caballo #2 4
Caballo #3 4


Los finalistas siguen empatados y trabajo adicional para desempate es requerido.
Este desempate sera para las posiciones afectadas.

Las otras posiciones no serán afectadas. Las posiciones del desempate serán
anunciadas por el locutor para informarle al publico que esta pasando.

21. Después del desempate, los cinco jueces darán veredicto de esta etapa y el
sistema de comp***cion eliminara la posición alta y baja de cada caballo en
el desempate.

22. Si continua un empate, esa etapa y trabajo adicional se repetirá
nuevamente hasta que no haya mas empate.

23. Uno de los jueces y/o el traductor explicara el resultado final y razones en
ambos idiomas, ingles y español.

24. Los cinco jueces evaluaran todas las etapas de la competencia. La
eliminación de la posición alta y baja sera ejecutada después de la etapa
final y en caso de empates.

25. Los resultados finales serán traspasados por medio de la comp***dora a la
pantalla dentro del coliseo para ser proyectados. Los resultados de cada juez
quedaran
debajo de las iniciales de cada uno de ellos(as). El resultado final sera anunciado
por el locutor de la feria.




GLOSARIO DE TÉRMINOS ECUESTRES

Abrevar. Dar agua al caballo para beber.

Acey Deucey. Monta con una estribera de cuero más larga que la otra;
disposición adoptada a veces por los jockeys en Estados Unidos para ayudarse a
mantener el equilibrio en las curvas cerradas.

Ación. Correa adaptable con la que el estribo va unido a la silla.

Acial. Instrumento en que se mete el labio o una oreja de un equino y que sirve
para sujetarlo e inmovilizarlo.

Acting Master (Cazador mayor en funciones). Persona encargada
provisionalmente de organizar una cacería, bien por un día o bien por un período
más largo, mientras se espera el nombramiento de alguien con carácter
permanente.

Aerofagia. Dolencia causada por la costumbre que tienen algunos caballos de
ingerir y tragar aire, lo que produce indigestión.

Agrión. Hinchazón entumecida y elástica en la rodilla de un caballo o en las
articulaciones del espolón, originada por una secreción excesiva de líquido
sinovial.

Ahogadero. Correa que forma parte de la cabezada de la brida. Se abrocha bajo
la garganta del caballo para evitar que la brida se deslice sobre la cabeza.

Aires por encima del suelo. Diversos movimientos de alta escuela realizados con
las manos, o con las manos y las patas, levantadas del suelo. Véase balotada,
cabriola, corveta, grupada y levantada.

A las órdenes del juez de salida. Los caballos están a las órdenes del juez de
salida cuando éste ha comprobado que todos los participantes están presentes y
preparados para correr. Se iza una bandera para indicarlo.

Alazán. Caballo de pelaje entre color oro y rojizo – pardo oscuro, normalmente
con crin y cola similares o ligeramente más claras o más oscuras, o, a veces, con
crin y cola de color muy rubio.

Albino. Dícese del caballo de pelaje completamente blanco, piel pálida y ojos
claros y traslúcidos.

Almohaza. Pieza del instrumental del mozo de cuadra utilizada para quitar la
suciedad y la caspa del cepillo. Tiene la parte de atrás plana y la delantera consta
de varias filas de pequeños dientes de metal.

Alta escuela. Arte clásico de equitación.

Altura (de un caballo). Línea perpendicular imaginaria que va desde el punto más
alto de la cruz o crucero hasta el suelo.

Alzada. Distancia que hay entre el punto más alto de la cruz y el borde ventral del
casco.

Amadrinar. Acompañar a un caballo con otro.

Amansador. Se le dice a quien amansa un equino, lo doma y lo enseña a
obedecer por la rienda.

Amateur. J inete de carreras no profesional.

Amazona. Mujer que monta a caballo.

Ambladura. Paso lento, en dos tiempos, en el cual el caballo mueve a la vez las
patas delantera y trasera de un mismo lado.

Ancas. Caderas y posaderas del caballo.

Anteojeras o blinkers. Par de defensas oculares de cuero adosadas a la brida o
a una pieza colocada sobre la cabeza y que se utilizan para que el caballo sólo
mire al frente.

Apostar. J ugar dinero por un caballo.

Apear. Bajar del caballo.

Apero. Conjunto de elementos que se colocan al equino, tanto en la cabeza como
en el dorso, para la equitación.

Apostante. Persona que juega dinero por un caballo.

Aprendiz. J oven que se entrena para ser jockey; en Gran Bretaña el período de
aprendizaje comprende entre cinco y siete años.

Apuesta. Totalidad de dinero apostado por un caballo en una carrera.

Arreos. Piezas de guarnicionería que se le ponen a un caballo.
Asideros del bocado. Piezas laterales del bocado a las que van enganchadas las
riendas.

Asiento. Acanaladura de la mandíbula inferior del caballo, justo detrás del labio
inferior.

Asientos o barras. Espacio interdentario de la mandíbula o maxilar inferior.

Autorisation Spéciale. Tarjeta de color rosa, expedida a un jinete por la
federación nacional hípica de su país, que le autoriza a participar en pruebas
internacionales de doma, de saltos o en concursos completos de equitación.

Autumn Dotible. Nombre de dos carreras, la Cesarewitch Stakes y la
Cambridgeshire Stakes, que se celebran anualmente en Newinarket (Inglaterra),
en el otoño.

Avena. Cereal utilizado como parte de la alimentación de un caballo. Se puede
administrar entero, machacado o hervido.

Avío o mantasilla. Almohadilla colocada bajo la silla para evitar una presión
excesiva sobre el lomo del caballo. Es algo mayor que la silla y de igual forma, y
puede ser de fieltro, badana o de goma espuma cubierta de tela.

Ayudas. Medios empleados por un jinete para dar instrucciones a su caballo.
Véase también ayudas artificiales y ayudas naturales.

Ayudas artificiales. Medios tales como látigos, espuelas y martingalas, utilizados
por el jinete para dar instrucciones a su caballo.

Ayudas naturales. El cuerpo, las manos, las piernas y la voz del jinete, utilizados
por éste para dar instrucciones al caballo.

Bajar. Sinónimo de desmontar.

Balotada. Andadura alta consistente en que el caballo se pone de manos y salta
hacia adelante levantando las patas traseras bajo los cuartos, antes de posarse en
el suelo sobre las cuatro patas.

Bandera blanca. Señal utilizada en los deportes hípicos para indicar el extremo
izquierdo de un obstáculo. También se emplea para señalar una pista establecida
y se debe pasar siempre por la derecha

Bandera roja. Marca utilizada en deportes hípicos para señalar el extremo
derecho de los obstáculos. También se emplea para indicar la pista establecida y
siempre debe pasarse por el lado izquierdo.
Barbada. Cadena de metal que va enganchada en los asideros de un bocado de
freno y se apoya en el asiento.

Bareback Riding. (Monta a pelo.) Una de las pruebas habituales en un rodeo.
Consiste en montar a pelo al caballo.

Barras. Tipo de obstáculo empleado en concursos de saltos y en pistas de campo
a través, consistente en unos palos verticales entre los cuales se colocan otros en
posición horizontal. En las pruebas de saltos, los horizontales están simplemente
apoyados sobre los verticales, mientras que, en las de campo a través, están
fijados a ellos.

Barras paralelas. Obstáculo extendido, utilizado en pistas de saltos y de campo a
través, que está compuesto por dos grupos de palos y barreras.

Barrage. En concursos de saltos, recorrido que se celebra, para decidir el ganador
de una competición, entre participantes que han empatado para el primer puesto
en el recorrido precedente.

Barrera. Obstáculo vertical utilizado con frecuencia en concursos de saltos.

Bayo. Caballo de piel oscura, pelaje entre pardo oscuro y rojizo brillante o
amarillento parduzco, de crin y cola negras, y normalmente con pintas negras en
las patas.

Belfo. Caballo que tiene más largo el labio inferior, o la dentadura y la mandíbula
superior es mas corta que la inferior.

Bloques de peso. Lingotes normalmente de plomo, que se colocan en la mantilla
del peso, cuando el jinete es demasiado ligero para el caballo que ha de llevar en
una prueba.

Bocado. Instrumento, normalmente hecho de metal o de caucho, que va unido a
la brida y se coloca en la boca del caballo para regular la posición de la cabeza y
ayudar a controlar el paso y la dirección. Se maneja por medio de las riendas.

Bog Rider. Vaquero cuyo trabajo consiste en rescatar el ganado atrapado en
barro o terrenos cenagosos.

Bookie. Término abreviado de book-maker o corredor de apuestas.

Boomaker. Corredor de apuestas profesional, autorizado a aceptar las apuestas
sobre carreras de caballos hechas por otras personas.

Borrón. Parte alta, delantera y trasera, de las sillas de montar
Botalón. Palo largo y generalmente de horqueta en la punta.

Boundary Rider. En Australia, se le denomina así al encargado de reparar los
cercados en los ranchos ganaderos.

Bozal. Es la parte que va sobre la nariz del equino.

Brazo. Nombre que recibe la parte superior de la pata delantera del caballo.

Braceador. Cuando el caballo en su marcha saca las manos hacia el lado en
demasía.

Brida. Parte de los arreos de un caballo que se coloca sobre la cabeza.

Brida sin bocado. Cuando carece de bocado, la presión se ejerce sobre el
asiento y sobre la boca, no sobre el bocado.

Bridón. Brida simple que consta de un filete, la cabezada y dos riendas.

Brío. Fogosidad, ánimo, garbo, aliento, arranque, decisión. Disposición natural
para obedecer pronto las ordenes del jinete.

Bronce. Conocido como caballo salvaje, sin domar o mal domado.

Bronc Riding. Nombre de una de las pruebas de rodeo habituales. El único arreo
que lleva el caballo es una banda ancha de cuero alrededor del tronco, de la que
sobresale un asidero también de cuero.

Brumby. Nombre dado al caballo australiano salvaje.

Buena boca. Boca suave y sensible.

Bull Riding. Nombre de una de las pruebas habituales en un rodeo; el participante
tiene que montar a un novillo o toro equipado sólo con una cuerda alrededor del
tronco, a la que el jinete sólo puede asirse con una mano.

Bruza. Cepillo de crines o cerdas de jabalí, fuerte, para quitar el polvo y las
materias extrañas que se removieron al pasar la almohaza.

Caballeriza de alquiler. Local donde se guardan caballos de propietarios
particulares, a la vez que son entrenados y cuidados en general, por un precio
estipulado.

Caballista o jinete. Persona que monta a caballo, así como la que es experta en
el entrenamiento y cuidado de estos animales.
Caballo. Término general para referirse indistintamente al semental, la yegua y los
castrados. También se emplea en el sentido de semental o caballo no castrado.

Caballo de carreras: El criado y preparado para correr, bien en liso, en vallas o
en obstáculos de steeplechase.

Caballo cazador. El criado y preparado para ser montado en cacerías. También
se le llama hunter

Caballo de competición especial. Es el que toma parte, o puede hacerlo, en un
concurso completo de equitación.

Caballo de paseo. El que está criado, preparado, o se utiliza para paseos por el
campo.

Cabeza. Una de las medidas empleadas para expresar la distancia por la que un
caballo gana uno carrera: la longitud de la cabeza de un caballo.

Cabezón. Parte de la brida que cruza por el hocico del caballo; está compuesta
por una banda de cuero sobre una cabezada independiente que se pone bajo los
carrillos o cachetes, y por encima del bocado.

Cabriola. Andadura alta en la que el caballo se pone de manos, con los
corvejones doblados; después salta hacia adelante y se eleva en el aire, a la vez
que cocea con los remos posteriores con las plantas de los pies vueltas hacia
arriba, antes de posarse en el suelo sobre las cuatro patas a la vez.

Caerse. Se considera que un caballo ha caído, cuando los hombros y las nalgas
de un mismo lado tocan el suelo. Asimismo, en lo que respecta a un jinete, se
considera que ha caído cuando se separa del caballo y necesita volver a montarlo.

Calf Horse. Especialmente en América, caballo preparado y utilizado para el
lazado de becerros.

Caif-Roping. Nombre de una de las pruebas habituales en un rodeo; el jinete
debe lazar a un becerro y, después, desmontar de su caballo rápidamente para
atarle tres patas.

Callo. Magullamiento de la planta del pie en el ángulo entre la pared del casco y el
talón.

Calzado. Dícese del caballo cuyas patas son blancas desde el casco hasta la
cerneja.

Campana. En concursos de saltos, señal que indica a los participantes el
comienzo de la prueba, su reanudación o el final, así como la eliminación de algún
participante.

Camp Drafling. Modalidad de rodeo australiano en el que un jinete separa a un
gran ejemplar de un rebaño de ganado y lo conduce al galope por un recorrido
señalado con postes.

Cantidad de sangre. La existente en el cuerpo de un caballo es
aproximadamente una decimoctava parte de su peso total.

Caña. Nombre que recibe la parte de las patas del caballo correspondientes a los
huesos meta carpianos y metatarsianos

Candelear. Pegarse con los menudillos traseros, cuando el equino esta en
marcha.

Capa. Conjuntos de pelos que cubren el cuerpo del equino, incluyendo el color.

Caprichoso. Equino indomable.

Careto. Es el caballo que tiene una mancha blanca en la cara que cubre su frente,
el hocico y los ojos.

Cargar. En polo, empujar con la propia cabalgadura la de un adversario, para
impedirle que alcance la pelota.

Carrera de caballos. Competición de caballos, montados por jockey, que se
celebra sobre terreno liso o bien con obstáculos, dentro de una zona determinada
y sobre una distancia también determinada, bajo el control de jueces o comisarios
profesionales.

Carreras de vallas. Las que se celebran sobre una pista con vallas.

Carrera de venta. Carrera en la que, inmediatamente después de celebrarse,
cualquiera de los caballos participantes, incluso los que no han ganado, pueden
ser reclamados por un precio establecido previamente, o, si se trata del ganador,
debe ser ofrecido en subasta.

Castrado. Caballo al que se le han extirpado los testículos. Sinónimo: capado.

Castrar. Extirpar los testículos a un caballo o los órganos de la concepción a una
yegua.
Cavalletti. Saltos pequeños de madera utilizados en el entrenamiento básico de
un caballo de monta para estimularle a aumentar su tronco, mejorar su equilibrio y
relajar y fortalece sus músculos.

Cayuso. Nombre dado a los caballos o ponies indios.

Cepillo. Objeto de cerdas cortas y muy apretadas que se utiliza para quitar el
polvo y la caspa del pelaje de un caballo.

Cepillo de agua. El utilizado para lavar los cascos del caballo y para humedecer
la crin y la cola.

Certamen de los Tres Días. Competición del Concurso completo de equitación
que se desarrolla durante tres días consecutivos. Consta de doma, campo a través
(con pista de steeplechase, dos circuitos de pistas, y otro de obstáculos propios de
campo a través) y, por último, concurso de saltos.

Certamen de un día. Competición del Concurso completo de equitación; consta
de dorna, concurso de saltos y prueba de campo a través, y se celebra todo en un
día.

Cerrero. Potro sin domar.

Cincha. Banda normalmente de cuero o nylon, que pasa por la región ventral del
caballo para sujetar la silla de montar.

Clásicas. Nombre de las cinco carreras lisas principales que se celebran en
Inglaterra para caballos de tres años: Derby, Oaks, St. Leger, 1000 Guineas y
2000 Guineas.

Clavado o engatillado. Cuando el cuello y la cabeza van muy bajos.

Cob. Animal de patas cortas con una altura máxima de 15,1 palmos, con huesos y
tejidos propios de cazador duro y capaz de portar un peso considerable. Se trata
de un tipo más que de una raza.

Cofavorito. Dícese de los caballos igualmente considerados para ganar una
carrera y que ofrecen la misma baja cotización en las apuestas.

Cola. Parte del cuerpo del caballo que incluye el maslo junto con todo el pelo, que
generalmente se deja crecer unos 10 cm. por debajo del corvejón.

Coleador. Ejemplar que de una manera brusca mueve o azota la cola cuando ba
en movimiento, puede ser vertical o horizontal.
Cólico. Dolencia abdominal aguda, a menudo con síntomas de flatulencia,
consistente en una obstrucción causada por una masa de alimento endurecido, o
de excrementos en el intestino, y que puede ocasionar un retorcimiento o
inflamación intestinales.

Colocado. En carreras, caballo ganador o que termina entre los tres primeros. Se
pueden realizar apuestas en o para colocado (es decir, sin especificar el puesto
exacto de entrada del animal por el que se apuesta).

Colocarse. En carreras, llegar entre los tres primeros.

Colores de la cuadra. Los característicos del propietario de los animales; la gorra
de visera y la chaquetilla de seda o de lana que llevan los jockey en una carrera,
son de los colores de la cuadra correspondiente.

Comisario de carreras. Persona encargada, en una reunión de carreras de
caballos, de hacer que todo se lleve a cabo según las reglas.

Concurso completo de equitación. Prueba amplia relativa al caballo y al jinete;
consta de las tres fases siguientes: doma, campo a través y concurso de saltos, y
se celebra a lo largo de un periodo de uno, dos o tres días, según el tipo de
competición.

Contrabarbada. Cadena pequeña que pasa por la barbada y une las piernas del
freno.

Conducción a mano. Forma de exhibición que consiste en llevar al animal con
una cabezada de exhibición y sin ningún otro arreo (excepto en los caballos de
tiro, que muchas veces se exhiben con todos sus arneses), de manera que los
jueces puedan valorar su constitución y forma física.

Contacto. Lazo que debe existir entre las manos del jinete y la boca del caballo,
realizado por medio de las riendas.

Contrarreloj. En concursos hípicos, pruebas que se resuelven por tiempo; resulta
ganador el participante que comete menor número de faltas y realiza antes el
recorrido.

Control filmado (equipo de). El utilizado para filmar una carrera durante el
desarrollo de la misma.

Copa de las Naciones. Competición de saltos entre equipos internacionales,
celebrada en un recinto oficial internacional. Por cada equipo participan cuatro
componentes, que saltan dos veces cada uno, contabilizándose los tres mejores
resultados en cada recorrido. En caso de empate, después de las dos vueltas, se
procede a celebrar un barrage, en el que se cuentan las faltas y el tiempo para dar
el resultado final, y, como en los anteriores, sólo se valoran los tres mejores
resultados y tiempos.

Corral. Cercado para animales, normalmente hecho de madera y siempre de
forma circular para que éstos no se lastimen.

Corredor o jinete de brumbys. Nombre dado al que captura caballos salvajes en
Australia.

Corvejón. Articulación entre el hueso metatarsiano y el tarsiano en la pata
posterior del caballo.

Corveta o gambeta. Andadura alta en la que el caballo se pone de manos, hasta
llegar a una posición casi vertical, y a continuación salta hacia adelante varias
veces apoyándose sobre los remos posteriores.

Cowboy. Hombre que vigila el ganado y lo lleva en manada en los ranchos, y
realiza su trabajo principalmente a caballo.

Criador. Propietario de una yegua que pare un potrillo; también se llama así al
propietario de una yeguada donde se crían caballos.

Crin. Pelaje largo que crece en la parte superior de la cabeza del caballo y a lo
largo del cuello.

Cronómetro automático. Aparato eléctrico utilizado en concursos de saltos.
Cuando el caballo pasa por el punto de salida, intercepta un rayo electrónico, el
cual dispara el mecanismo que pone en funcionamiento el reloj. Cuando pasa por
el punto de llegada, intercepta un artificio similar que para el reloj.

Cruz. Parte más alta del lomo de un caballo: la zona de la base del cuello entre los
hombros.

Cruzado o mestizo. Caballo bien criado pero con algo de sangre común (no de
raza pura).

Cuadra. Conjunto de caballos que pertenecen a una persona, como un propietario
de caballos de carreras o de una escuela de equitación, o que se albergan en el
mismo sitio.

Cuarto de básculas. Lugar, existente en los hipódromos, donde se pesa a los
jinetes.
Cuartos. Parte del cuerpo de un caballo que se extiende desde la zona posterior
del costado hasta la raíz de la cola (llamada maslo), y hacia abajo en ambos lados
hasta la parte superior de la pata (cuartos traseros).

Cubierta. Dícese de la yegua que está preñada.

Cubrición. Inseminación de una yegua por un semental. Sinónimo: acoplamiento,
cópula.

Cuello. Una de las medidas empleadas para describir la distancia por la que un
caballo gana una carrera; es igual a la longitud de la cabeza y el cuello de un
caballo.

Cuerno de caza. Instrumento cilíndrico, generalmente de 23 a 25 cm. de largo,
hecho de cobre, con una boquilla de níquel o de plata, utilizado por el encargado
de los perros para dar señales a éstos y a los participantes.

Cuerpo. Una de las medidas utilizadas para dar la distancia por la que un caballo
gana una carrera; es igual a la longitud de la cabeza y el cuerpo de un caballo.

Cuartos. Parte del cuerpo del equino que incluye el anca, los muslos, la pierna y
las nalgas, y que recibe el nombre de cuartos traseros.

Chalán. Adiestrador y montador de caballos.

Chuparse. Cuando el ejemplar se recoge para corcovear de una manera rápida y
brusca.

Chef d'équipe. Persona responsable de todos los preparativos, de dentro y fuera
de la pista, de un equipo nacional cuando compite fuera.

Chukka o tiempo en polo; período (le juego que, según los países, oscila entre
siete minutos y medio u ocho de duración.

Declaración o inscripción. Afirmación hecha por escrito, por un propietario,
preparador o representante, en un momento determinado antes de la carrera o
prueba, en la que se declara que un caballo participará en ella.

De dos a dos. Paso lateral en dos tiempos, en el que el caballo mueve, a la vez,
los remos traseros y delanteros de un mismo lado hacia adelante.

Delegado. Técnico en una competición internacional; persona responsable de que
todo se lleve a cabo según las reglas internacionales y de que el circuito sea
correcto. Normalmente, procede de un país distinto de aquel en que se celebra la
prueba.
Desveno. Puente del bocado del freno que permite al animal una cierta libertad de
lengua.

Dentición completa. La del caballo a los 6 años, cuando ha echado todos los
dientes.

Desaplomado. Cuando por deficiencia en los aplomos se observan los
desperfectos de ellos, estando en movimiento o parados.

Descargo de peso. En carreras, reducción del peso a portar, solicitada por un
jockey o aprendiz, que no ha alcanzado un cierto número de victoria.

Difícil. Caballo que se pone de manos por nada y se va hacia cualquier sitio,
cuando se le monta.

Dividendo. Cantidad pagada a una persona que ha apostado por un caballo
ganador, o colocado.

Doma. Preparación inicial de un caballo, cualquiera que sea el uso para el que se
le requiere.

Dopar. Administrar drogas a un caballo, para mejorar su actuación o para
dificultarla en una carrera o prueba. Es una práctica ¡legal muy sancionada en
todo tipo de deportes hípicos.

Dos a uno. En carreras, es el dividendo dado por un caballo cuando por la
cantidad apostada se puede ganar, o se gana, una cantidad igual.

Drower. En Australia, jinete que lleva ganado u ovejas en manada a lo largo de
grandes distancias.

Ecuestre. Relativo a la equitación.

Encoletado. Es el ejemplar que se resiste ha voltear por un lado y en ocasiones
persiste en girar sobre una sola rienda.

Endosado. Es el movimiento que hace el caballo de paso al descomponerse en
su movimiento y que anda únicamente por laterales, aun cuando se oyen 4
golpes.

Entero. Caballo no castrado.

Emparejar. Hacer que el caballo se sostenga en ele paso.

Eliminación. Exclusión de un participante de una competición.
Empate. Situación en la que dos o más caballos llegan a la meta igualados para
alguno de los puestos de honor de una carrera.

Enjaezar. Labor consistente en poner los arreos a un caballo para montarlo.

Enteritis. Inflamación de la membrana mucosa de los intestinos, que puede ser
originada por bacterias, venenos químicos o vegetales, o por alimentos mohosos o
estropeados que contengan hongos perjudiciales.

Espuela. Objeto puntiagudo que va unido con correas al talón de la bota del jinete
y se usa para estimular o picar el caballo ha seguir hacia delante

Estribos. Piezas que sirven para apoyar los pies del jinete

Equino. Relativo al caballo.

Excoriación. Dermatitis que se da, generalmente, en caballos alérgicos a algún
tipo de forraje y, por consiguiente, aparece con más frecuencia en los meses de
primavera y verano. Afecta, sobre todo, a la grupa y a la cruz, produciendo intensa
irritación y trozos de espesas escamas en la piel, a veces ulcerosa, que el caballo,
a menudo, se arranca tratando de encontrar alivio.

Exigir. Pedirle ha un caballo un ultimo esfuerzo cuando se encuentre casi al limite
de sus fuerzas.

Escuela de equitación. Centro donde se enseña a montar y se pueden alquilar
caballos para dar un paseo, o se pueden tener allí para que los cuiden.

Espantarse. Girar un caballo bruscamente por miedo (o, a veces, por simple
excitación), a un obstáculo o ruido.

Establo. Edificio donde se alberga a uno o más caballos.

Estabulado. Dícese del caballo que vive la mayor parte de su tiempo en una
cuadra en vez de estar suelto en un pastizal. Estos distintos modos de ¡da
requieren normas de mantenimiento y alimentación particulares.

Estado de la pista. Condiciones en que se encuentra una pista de carreras o
cualquier otro tipo de firme sobre el que camina un caballo.

Estrangol. Enfermedad infecciosa y fácilmente contagiosa, causada por el
organismo conocido como Streptococcus equi; se da con más frecuencia en los
caballos de poca edad. Los síntomas incluyen aumento de la temperatura, espesa
mucosidad e hinchazón de las glándulas submaxilares y de otras glándulas
linfáticas de la cabeza, en donde, con el tiempo, se forman abscesos.
Falsear. Cuando el ejemplar cojea o afloja de uno de sus miembros.

Falta. En concurso de saltos, unidad utilizada para contabilizar cualquier caída,
rehúse u otro error cometido por un participante durante el recorrido.

Favorito. Dícese del caballo que probablemente gane una carrera. Es el que
ofrece menores dividendos.

Federación Hípica Internacional. Órgano rector de los deportes hípicos
internacionales; fue fundado en 1921 por el comandante francés G. Héctor. Tiene
su sede en Brúcelas y elabora las reglas y reglamentos de los tres deportes
hípicos de que constan los J uegos Olímpicos, en lo que respecta a esta
modalidad: concurso de saltos, prueba de los tres días y doma. También se
encarga de las competiciones internacionales. Todas las federaciones nacionales
están obligadas a cumplir estas reglas y reglamentos en cualquier prueba
internacional.

Federación Nacional. Organismo rector de los asuntos hípicos en cualquier país
afiliado a la Federación Hípica Internacional.

Fija. Apuesta en la que se predice el lugar exacto de entrada de un determinado
caballo.

Filete. El más antiguo y simple de los bocados; existen diversos tipos, pero consta
principalmente de una sola barra con un anillo en cada extremo a los que van
unidas un par de riendas.

First Jockey. J ockey principal contratado por un propietario o preparador para
llevar a sus caballos.

Foto-finish. Resultado de una carrera, fotografiado por una cámara, con un
campo de visión muy estrecho, situada en la meta. La primera vez que se utilizó
una cámara para reflejar una foto finish fue en 1890 por J ohn Heinment en Sheep-
shead, en Estados Unidos.

Freno. Aparato que sirve para controlar a las cabalgaduras. Consta del bocado -
barra de metal que se asienta en la mandíbula del bruto-, las piernas -barras
metálicas unidas al bocado-, la barbada y la contra barbada.

Freno – filete. Bocado diseñado para producir con una sola embocadura los
efectos combinados del filete y del freno. Normalmente está hecho de metal,
vulcanita o caucho, y se utiliza con dos riendas o con una sola, en cuyo caso se
usa una tira de cuero para unir los dos anillos del bocado.
Frontalera. Parte de la brida que cruza la frente del caballo por debajo de las
orejas.

Fusta. Látigo largo y delgado que utilizan los jinetes de los caballos de carreras.

Fuste. Es el armazón de la montura.

Gabarro. Fístula purulenta del casco de los equinos.

Galápago. Cierta silla de montar inglesa.

Garrón. Cualquier pony nativo de Escocia o Irlanda.

Gemela. Apuesta consistente en apostar por dos caballos como ganadores en

Gestación. Período comprendido entre la concepción y el nacimiento del potro,
normalmente de 11 meses.

Grupa. Parte alta del extremo posterior del anca del equino.

Ground Money. En un rodeo, la cuota de entrada y dinero del premio que se
reparten los participantes cuando no hay un vencedor claro.

Grupo. Parte alta del extremo posterior del caballo.

Grupada. Andadura alta en la que el caballo se pone de manos, y a continuación
salta verticalmente con los remos posteriores dirigidos hacia el vientre.

Gualdrapa. Cobertura larga que cubre las ancas del caballo.

Gymkhana. Conjunto de juegos realizados a caballo, casi siempre para niños
menores de 16 años, muchos de los cuales son adaptaciones de juegos infantiles.

Hándícap. Carrera en la que los pesos llevados por los caballos se establecen de
modo que todos tengan las mismas posibilidades de triunfo.

Heno. Hierba cortada y secada en una. poca concreta del año para su uso como
forraje.

Herradura. Banda de metal de forma característica, que se clava en los cascos de
caballos de silla y de tiro, para protegérselos e impedir que se resquebrajen.

Herraje. Partes metálicas de la silla.
Herrar. Poner herraduras a un caballo. Normalmente, necesitan que les cambien
las herraduras cada cuatro u ocho semanas, según el tipo de Ira bajo que hayan
de realizar, de si se les ejercita en suelo blando o duro y de la rapidez con que
crezcan sus cascos.

Herrero. Persona que trabaja el hierro y, entre otras cosas, hace herraduras.

Higo. Enfermedad consistente en la inflamación de la ranilla del pie del caballo y
caracterizada por el mal olor que desprende.

Hocico. La medida más corta de distancia por la que un caballo puede ganar una
carrera.

Hog's Back. En concursos de saltos, obstáculo extendido en el que hay tres
grupos de palos, el primero muy cerca del suelo, el segundo en el punto más alto
del obstáculo y el tercero ligeramente más bajo que el segundo.

Hogadera. Va colocada al lado de la cabeza y las patas de la jaquita y sirve para
impedir que el ejemplar se quite la jaquita fácilmente.

Hondón: plano del estribo donde se apoya el pie del jinete.

Hipódromo. Recinto de carreras, adecuadamente construido para carreras lisas
y/o de vallas y de steeplechase, junto con todas las dependencias pertinentes,
tales como tribunas para los espectadores, cuadras, paddock, edificios para
oficinas, etc.; lo dirigen las personas nombradas al efecto.

Hunting. Deporte consistente en seguir a distintos tipos de perros, a pie o a
caballo, en persecución de una zorra, un ciervo, una fiebre o un señuelo de
arrastre artificial.

Hunt Secretary. (Secretario de la cacería.) Persona que desarrolla las tareas
habituales relativas a la cacería; también es responsable de mantenerse en
contacto con los granjeros y los propietarios de tierras que se hallen dentro de la
zona donde se celebra. y recoge las cuotas pagadas por los asistentes.

Huntsman. (Encargado de la jauría.) Persona a cuyo cargo se hallan los perros
durante una cacería; puede ser el dueño o alguien empleado por éste.

Hunt Terrier. (Terrier de caza.) Terrier pequeño y de pata corto, utilizado para
sacar a las zorras de las madrigueras, las regueras y otros sitios inaccesibles a
otros perros.
Hunter Trials. (Pruebas de caza.) Competiciones celebradas en Gran Bretaña por
casi todos los grupos de cazadores durante la temporada de caza, en las que los
caballos son conducidos a lo largo de una pista de obstáculos construidos de la
manera más natural y parecida posible a los que pueden encontrar en cacerías.
Tienen que completar el recorrido en un tiempo determinado.

Impulso: empuje, movimiento, fuerza, aceleración del caballo que precede a
cualquier aire.

Impulsión: actividad y equilibrio que crea el caballo con sus corvejones.

Inbreeding: Unión o apareamiento de animales emparentados.

Incensar: indica un movimiento alternante de la cabeza del caballo, de abajo
arriba, por molestias producidas por el bocado o por la acción pesada de la mano
del jinete.

Incensar o despapar: vicio del caballo que consiste en alzar y bajar
constantemente la cabeza. Puede ser originada por excesiva sensibilidad de las
"barre" o por vicio contraído.

Incisi vos: son los dientes que se encuentran entre los incisivos medianos y los
últimos incisivos. También son los dientes de la arcada delantera que se
encuentra antes de los colmillos.

Incurvación: la curva ligera del cuello y el cuerpo del caballo que requieren ciertos
movimientos y ejercicios de doma.

Indisciplina: un caballo indisciplinado rechaza las indicaciones del jinete para que
se mueva en la dirección deseada. En lugar de obedecer, se queda quieto y a
veces, corcovea o se encabrita.

Inflamación: forma patológica que interesa las partes cartilaginosas y tendones.

Infosura: inflamación del tejido celular del pie del caballo, causada por excesos de
trabajo, mala alimentación, golpes, caídas, que le obliga a pisar con cuidado y
hasta con miedo.
Inferior a 2 a 1. Dícese del dividendo que supone una ganancia, para el apostante,
inferior a la cantidad jugada por él.

Interveni r: regular un caballo sobre un obstáculo mediante una acción de las
riendas para determinar la exacta cadencia del aire. No es acto de buena
equitación.
Intruso o ringer. Caballo bueno que se matricula en una carrera con el nombre de
otro inferior, con intención de ganar apuestas ilegalmente.
Ir al peso o a básculas en ciertos deportes hípicos, como en carreras, saltos y en
el Concurso completo de equitación, en los que los caballos han de portar un peso
determinado, los jinetes van al peso (se pesan), inmediatamente después de la
prueba, para asegurarse de que no sobrepasan el peso correcto.

Jáquima. Cabezada sin bocado, generalmente de cuero, para conducir un caballo
sin brida, o para amarrarlo en el establo.

Jockey. Persona encargada de montar a un caballo en una carrera.

Jarrete. Corva del caballo. Talón.

Laminitis. Inflamación de las láminas sensibles que se encuentran entre la pared
córnea del casco y el hueso del pie. Es muy dolorosa.

Legra. Instrumento de metal en forma de gancho que se utiliza para quitar las
piedras y la suciedad del pie de un caballo.

Levantada. Andadura de alta escuela en la que el caballo se pone de manos, con
los pies delante recogidos hacia dentro, mientras los cuartos traseros están
profundamente doblados en las ancas y soportan todo el peso.

Ligerero. Se dice del caballo (salvo de los pura sangre), que se emplea o es
apropiado para la monta, como, por ejemplo, uno de alquiler o un cazador.

Linaza. Semilla del lino que, en forma de gelatina, aceite o té de linaza, se emplea
como laxante y también para mejorar el estado y el lustre del pelaje del caballo.

Línea de salida. Punto de comienzo de una carrera.

Lucero. Dícese del caballo que tiene una pinta blanca en la frente.

Lunar. Dícese del caballo que tiene una pinta blanca en el hocico.

Llegar. Se dice que un caballo llega cuando cruza, montado por su jinete, el poste
de llegada, suponiendo, en el caso de carreras de vallas o en pruebas de
steeplechase, que haya pasado todos los obstáculos con su jinete.

Manchado. Caballo cuyo pelaje presenta manchas grandes e irregulares,
claramente definidas, de blanco y de cualquier otro color, excepto negro.

Mandil. Prenda de cuero duro de caballo, utilizada por los herreros para
protegerse la parte delantera del cuerpo mientras ponen herraduras a un caballo.
Mano. Nombre que reciben las pezuñas delanteras del caballo.

Mantilla del peso. Pedazo de tela que se lleva bajo la silla de un caballo. Va
provisto de unos bolsillos en los que se pueden introducir trozos de plomo para
conseguir el peso correcto.

Martingala. Aparato utilizado para ayudar a mantener en posición correcta la
cabeza del caballo. Está compuesto generalmente de una correa, o una serie de
correas, enganchada a la cincha por un lado, que pasa por entre los remos
delanteros y, según el tipo, por el otro extremo va unida a las riendas, al cabezón
o directamente al bocado.

Maslo. Inicio del rabo o cola del caballo.

Master. (Cazador mayor.) Persona encargada por un grupo de cazadores de la
dirección y organización de todos los aspectos de la cacería.

Matadura o rozadura. Herida en la piel del animal producida por la silla o la
cincha.

Medalla de Honor. Trofeo otorgado por la Federación Hípica Internacional a los
jinetes que participan en pruebas del Premio de las Naciones. Los puntos se
otorgan de la manera siguiente: bronce 5, plata 25 y oro 50. La participación en
J uegos Olímpicos equivale a haber concursado cinco veces en el Premio de las
Naciones.

Medio galope. Paso en tres tiempos en el que las pezuñas golpean el suelo en el
siguiente orden: la trasera izquierda, la delantera izquierda y la trasera derecha a
la vez, la delantera derecha (pata conductora); o bien, trasera derecha, delantera
derecha y trasera izquierda juntas, delantera izquierda (conductora).

Montar. Acción de subirse el lomo de un caballo.

Montar a pelo. Montar sin silla ni manta el lomo del caballo.

Montura. Caballo que puede ser montado y también, la silla.

Mount Money. En un rodeo, retribución monetaria que recibe el jinete que realiza
ejercicios de exhibición, sin entrar en competición.

Mozo. Persona responsable de cuidar a un caballo.

Muro. En concursos de saltos, obstáculo vertical hecho de trozos de madera
huecos, pintados y apilados como si fueran ladrillos. También se llama así a un
obstáculo de campo a través construido con ladrillos, hormigón, travesaños y
piedras.

Mustang. Caballo salvaje.

Negro. Caballo de pelo, cola y crin negras, sin ningún otro presente, excepto,
quizás, pintas blancas en la cara y en las patas.

No colocados. En una carrera, caballos que no consiguen situarse entre los
puestos de honor. A veces, también se utiliza el término ingles also-ran.

No contrastado. Aquel caballo que no todavía no ha tomado parte en una carrera.

Obstáculo combinado. En concurso de saltos, el que implica realizar dos o mas
saltos separados, que se juzgan y contabilizan como uno.

Obstáculo en extensión: en concurso de saltos y pruebas de campo a través,
cualquiera de los que son anchos, opuestos a los simplemente verticales o de
altura, tales como del hog's back, el doble, el triple o la ría.

Obstáculo vertical. En pistas de saltos y de campo traviesa, el que tiene todos
sus componentes en el mismo plano vertical, tales como el de tablones, el de
palos y barreras.

Ollares. Nombre que reciben los orificios nasales del caballo.

Paddock: espacio cercado y con prado en el que los caballos gozan de una
relativa libertad, o, también, recinto en el que se reúnen los caballos antes de la
carrera.

Palafrenero. Ayudante que tiene de la cabezada al equino para que el jinete se
monte. Mozo de las caballerizas.

Palma: tejido de la planta del pie. Parte inferior del casco de forma semilunar.

Palomino: es un caballo alazán con crines y cola blancuzca, o bien, un caballo de
pelaje amarillento con crines y cola blancuzcas.

Paso: movimiento natural del caballo en cuatro tiempos. Es el menos veloz, el
más regular y el más cómodo. El paso, es un movimiento regular de cuatro
tiempos bien marcados y sostenidos y el caballo tiene siempre dos o tres cascos
en el suelo. El animal levanta un solo casco cada vez: por ejemplo: pie derecho;
mano derecha; pie izquierdo; mano izquierda.

Paso español: aire de alta escuela; el caballo levanta alternativamente las patas
delanteras, llegando con las patas a la altura de la espalda media.
Paso lento: uno de los aires del caballo de silla americano. Es un movimiento en
el que cada casco se eleva y se sujeta momentáneamente en el aire antes de
tocar el suelo. (Es similar al rack).

Paso atrás: hacer que el caballo camine hacia atrás ya sea montado o
enganchado.
Paso de andadura: un aire por bípedos diagonales en dos tiempos en el que la
mano y el pie del mismo lado se mueven a la vez.

Passage: uno de los aires de alta escuela. Es un trote espectacular muy elevado
a cámara lenta. El tiempo de suspensión esta bien definido al quedarse en el aire
uno de los bípedos diagonales cuando el opuesto esta en el suelo.

Pasto/ Prado: un cercado de hierba que sirve de pasto a los caballos.

Patizambo. Animal que tiene sus pies desviados o chuecos hacia fuera.

Pecho petral: pieza que se abrocha a la montura para impedir que se deslice
hacia atrás.

Pedigrí: certificado genealógico de un caballo de pura raza. Además de su
ascendencia paterna y materna, figuran sus datos característicos.

Penalidad: puntos de desventaja que se asignan a los concursantes en los
concursos hípicos.

Penco. Caballo de baja calidad.

Perfomance: resultados oficiales en las pruebas publicas de un caballo, conjunto
de los últimos resultados obtenidos en las pistas por un caballo de carrera.

Pesaje: recinto del hipódromo en el que se realizan las operaciones de pesar a los
yoquis antes y después de las carreras para asegurar que lleva durante toda la
competición el peso apropiado.

Pessage: aire de alta escuela, trote muy elástico y señalado. Sala donde se pesan
los jockeys. Por extensión, el recinto externo.

Peso: equivalente en kilogramos que debe llevar en una carrera.

Piafar: trote muy reunido sobre un mismo punto, propio de las pruebas de alta
escuela. El lomo del caballo debe ser muy elástico y vibrante y los corvejones se
han de recoger bien para permitir una gran libertad de movimiento y ligereza de
acción a los cuartos delanteros.
Piafé: aire de alta escuela. Es como el paseo, pero hecho en el sitio, sin impulso
hacia adelante. Trote muy elevado y cadenciado en el que el caballo no avanza.

Picadero. Zona cercada al aire libre o techado, donde se puede preparar o
ejercitar un caballo.

Pie: palo de madera que sostiene las barreras.

Pie a tierra: castigo impuesto a un yoqui o a un conductor por incorrecciones
durante la carrera y que consiste en la suspensión temporal de participar en
carreras.

Pirueta: aire de alta escuela. Consiste en una vuelta rápida al galope, haciendo
soporte de una de las extremidades exteriores. En doma, el giro más pequeño que
se puede ejecutar, el caballo vuelve sobre sí mismo.

Pisado. Caballo perteneciente a una de las razas de los grandes caballos de tiro,
tales como Clydesdales, Percheron, Shire o Suffolk Punch.

Pista de ceniza. Pista de carreras cuya superficie es una mezcla de arena y tierra.

Pista: serie de huellas de un caballo, señales de los cascos, rastro. El perímetro
de carrera a lo largo de la valla.

Plantarse: caballo que "se planta", o sea, que persiste en rebelarse a las órdenes
del jinete.

Polo: juego a caballo, parecido al jockey, entre dos equipos de cuatro jinetes.

Poste: palo o "starting", o punto de salida del grupo de caballos participantes en
una carrera. También existe el "palo" de llegada.

Potranca: yegua de menos de cuatro años.

Potrillo. Macho equino menor de 12 meses.

Potro: el potrillo bajo la madre, el potro recién nacido. El caballo joven hasta los
seis años. También se le considera a los que tienen menos de cuatro años.

Prado: sistema de cría que excluye el empleo de ningún refugio. Los caballos se
encuentran en absoluta libertad y viven del pasto. "Semiprado" cuando los
caballos pueden refugiarse en cuadras y reciben un suplemento de alimentación.

Pretal: correa que pasa por el pecho del caballo, sujeta por dos puntosa la cincha.
Tiene la finalidad de asegurar la silla al tronco.
Pruebas combinadas: examen completo de caballo y jinete que consiste de las
tres.

Pruebas siguientes: doma, cross y salto, repartidas en uno, dos o tres días,
según el tipo de prueba. También se conoce como "Concurso completo".

Puesto: caballo dispuesto para el trabajo especifico para el que se ha destinado.
Caballo que tiene una buena preparación, que se halla en perfecta forma y
eficiencia.

Pujavante: instrumento muy afilado para cortar la uña del casco. Instrumento
cortante con mango que sirve para cortar la uña e igualar los cascos.

Pupilaje: manutención de caballos privados a cambio de un precio.

Recular. Hacer marchar hacia atrás a un caballo.

Remetido: se dice del caballo que tiene las patas demasiado dobladas hacia el
abdomen, fuera del aplomo normal.

Reparo: una de las parejas de soportes sobre los que se apoyan y suspenden las
barras en un salto de pista.

Retajeo: técnica que consiste en acercar el padrillo a la yegua para determinar por
su reacción si esta receptiva al macho o no.

Ría: superficie de agua precedida por un pequeño obstáculo de envite.

Rienda: tira de cuero con la que se sostiene y guía al caballo.

Riendas de atar: pueden ir unidas a la cabezada. Estimulan al caballo a mantener
una correcta posición de la cabeza, lo cual se traduce en que no se pone a pastar
o a mover hacia arriba la cabeza y mientras tengan la misma longitud, evitan que
se tuerza más hacia un lado que hacia el otro.

Rienda de dirección: rienda fijada a la cincha que va desde los aros del bocado
hasta las manos del jinete.

Riendas largas: método de entrenamiento en el que se utilizan dos cuerdas
largas para enseñar al caballo a salir hacia adelante, girar y parar sin llevar
montado al jinete.

Riendas laterales: parte del equipo de desbrave. Se enganchan al caballo del
bocado a la silla o cinchuelo.
Rig: caballo con uno o ambos testículos retenidos en el abdomen. Mediante una
intervención, se hacen descender; después de la operación, el animal debe ser
castrado porque suele ser un defecto hereditario.

Riñón: región del caballo, situada entre el dorso y la grupa.

Roano: manto fundamentalmente blanco, con grandes manchas negras, oscuras
o pardas. Pelaje mezclado de pelos rojizos, blancos y negros.

Romper: lacerar o distensionar los tendones y ligamentos de las extremidades de
un caballo.

Ronzal de adiestramiento: correa de unos 12 metros que se sujeta de la brida.
Permite hacer trabajar al caballo en círculos alrededor del preparador, sin
necesidad de montarlo.

Rozamiento del menudillo: distensión sinovial en la región de la articulación del
menudillo. Suele ser la consecuencia de hacer trabajar excesivamente a caballos
jóvenes sobre terreno duro.

Rusticidad: es la condición de un caballo que se adapta a los trabajos pesados,
con alimentación barata e incomodidades ambientales.

Rústico: obstáculo formado por troncos de árbol o leña aserrada, colocados en
forma de paralelepípedos.

Salvado: subproducto del trigo que cuando es fresco y se humedece, actúa como
suave laxante y ayuda a la digestión.

Sangre: en zootecnia, indica el conjunto de caracteres transmisibles; un
porcentaje de sangre indica, en cambio, en qué medida los ascendientes han
participado en la producción del ejemplar y también se refiere a la sangre
mejoradota. Se dice de un caballo que tiene sangre, cuando, sometido a pruebas
de cansancio y trabajos agotadores, demuestra valor y resistencia.

Seto: obstáculo formado por una hilera de escobas de zahína (seto seco); si esta
formado por plantas verdes, se llama seto vivo.

Silla: pieza de cuero, madera y hierro, con sus accesorios (estriberas, estribos,
cincha, cubresilla, etc.) que se adapta al caballo para sentarse cómodamente.
Guiarlo y mandarlo. Existen muchos tipos de silla (inglesa, de caza, concurso,
carrera, media carrera, steeple, de tropa, albalda, húngara, árabe, berebere,
andaluza, camerguenne, tejana, etc.

Tapa: pared. Parte que reviste todo el contorno del pie, excepto la planta.
Tarado: caballo con las patas en malas condiciones.

Tascar el hierro: cuando el caballo muerde el freno espumea por la boca.

Tiro: tic. Vicio de tipo nervioso que obliga al caballo a repetir incesantemente
movimientos perjudiciales para su salud.

Trabas: ligamento, cuerda o correa para sujetar a los caballos e impedirles que se
alejen excesivamente.

Tragar aire: vicio en el que el caballo succiona y traga aire y que provoca
indigestión y pérdida de peso. Se debe advertir al comprador.

Triple: en el salto en pista, una combinación que consiste de tres esfuerzos.

Trote: forma de correr el caballo, alternando de manera uniforme las patas en
diagonal. Consta de dos trancos, seguidos de un momento de suspensión, por lo
que resulta más cómodo para el jinete y también para el caballo.

Tipos:
- Trote duro: áspero, rígido, de desagradable reacción para el que monta.
- Trote dulce: elástico, suave, pastoso, grato al jinete cuando monta.
- Trote largo: con ritmo veloz, acelerado, rápido.
- Trote corto: contenido, regulado, recogido, redondo, rítmico, breve.
Es un aire en dos tiempos separados por un tiempo de suspensión.
El caballo marcha por bípedos diagonales:
Por ejemplo: mano derecha - pie izquierdo; mano izquierda - pie derecho.
Trotinar: marcha presurosa entre el paso y el trote.

Tumefacción: primera manifestación de tumor óseo que interesa la cara interna
inferior del jarrete.

Vendas: largas tiras de lana, franela, lino, etc., para proteger las canillas de los
caballos, tanto en el trabajo como en el reposo.

Verde: caballo inmaduro, al principio del adiestramiento; incompleto, desbravado,
sin mucho entrenamiento, inexperto.

Volcado: caballo que gravita con el peso de la cabeza o del cuello sobre el freno,
con molestias para el que no monta.

Yearling: potro cuya edad oscila entre los 15 y 18 meses.

Yegua: la hembra del caballo.

Yugular: vena que atraviesa el cuello del caballo.

Yunque: bloque pesado de hierro con la superficie lisa, normalmente de acero, en
el que se da forma a las herraduras.

Zahones: delantal de protección, hecho de cuero fuerte, que utilizan los
herradores y en algunas disciplinas.

Zaino. Color de la capa, castaño oscuro. Se dan las variedades zaino con motas
blancas, zaino azulado y zaino dorado.

Zamarros. Pantalones anchos de cuero, que utiliza el jinete en su cabalgadura.

Zambo. Desviación de los remos hacia adentro.

Zancajoso. Dicese del equino que presenta los corvejones próximos o unidos y el
resto del pie torcido y vuelto hacia fuera.
BIBLIOGRAFÍA


- ARENAS BONILLA J AIME, Exterior y Razas, Santa fe de Bogota,
Universidad Nacional de Colombia, 1965.

- ESCOBAR MEJ IA J AIME y SAAVEDRA CAMILO, El Caballo de Paso
Colombiano, Editores Beatriz Malo de Mejia.

- HARTLEY ELWIN, Enciclopedia del Caballo, Ed BLUME, Barcelona
España,1981.

- PEREZ ACERO J OSE J OAQUIN, Instalaciones Agropecuarias, Ed USTA,
Santa fe de Bogota, 1985.

- BELLO J OSE SIGIFREDO, Zootecnia General, Ed USTA, Santa fe de
Bogota 1984.

- RAMOS DUEÑAS J OSE IGNACIO. Reproducción I, Ed. La SALLE, Santa
fe de Bogota, 1993.

- USECHE ORJ UELA J AIRO, Producción Equina, UNAD, Santa fe de
Bogota 1999.

- BRAVO DUQUE DIEGO, Cabalo Colombiano Ciencia Y Arte, Ediciones
graficas Ltda., Medellín 2001.

- GEOFFREY WEST, Diccionario Enciclopédico de Veterinaria, Versión
española de la 16 Edición del BLACK VETERINARY DICTIONARY. Ed.
IATROS Ediciones Ltda., España 2002.

- El Potro, SOLLA.

- MERCK Y CO. Inc., Manual MERCK de Medicina Veterinaria, Ed
Océano/Centrum, Barcelona España, 1993.

- VACCHETTA, Diccionario Práctico de Veterinaria, Ed Milán, Milán 1911.

- GORDON WATSON MARY, MONTGOMERY SUE Y WATERS AMANDA.
Guía Completa de Caballos, Ed Libsa, España, 2004.

- CABRERA ANGEL. Caballos de Colombia, Ed Sudamericana, Buenos
Aires Argentina, 1945.
- MENDIGAÑA PAEZ CLAUDIA TERESA, Reproducción Avanzada, UNAD,
Santa fe de Bogota, 1998. GALINA, C., SALTIEL, A., VALENCIA, J .
BECERRIL, J ., ZARCO, L., y FERNANDEZ, C. 1991. Reproducción de
animales domésticos. III Edición. ED Limusa, Ciudad de México, México,
374pp.

- RODRIGUEZ J . M. Conferencia de Zootecnia General. Facultad de
Medicina Veterinaria y de Zootecnia. Universidad Nacional de Colombia.
Santa fe de Bogota, 1984.

- HOECHST. Manual Producción Animal. Edición Hoechst Colombia S.A.
Santa fe de Bogota, 2000.

- MULLER, D. ROBERTO. Técnica de la Explotación Equina. Ed AGRO,
Buenos aires Argentina, 1984.

- ALZATE LUIS ANGEL. Nuestros Equinos (caballos, asnos y mulas), Ed
Dos mil, España 1999.

- MORRISON FRANK B. Compendio de Alimentación del Ganado. Ed
Hispano- Americana, México D.F., 1987.

- J ACKSON, Enciclopedia Practica, tomo quinto.

- MAYNARD LEONARD A. y LOOSLI J OHN K. Nutricion Animal, Ed
McGRAW-HILL, Mexico D.F.1981.

- WOLTER, R. Alimentación del Caballo. Ed Acribia, Zaragoza, 1987.

- Manual Practico para Cría, Mejoramiento y Explotación del Caballo y
Especies Afines, Temas de Orientación Agropecuaria No 1110, Santa fe
de Bogota, 1975.

- LEAL QUIROZ HECTOR RODRIGO, Zootecnia General, UNAD, Santa fe
de Bogota 1992.

- SISSON, S AND GROSSMAN, J .D. Anatomía de los Animales
Domésticos. Salvat Editores S. A. Barcelona España 1977.

- CORREA MUÑOZ FERNANDO, Vuelven los Caballos, Editor Rene
Caballero, Santa fe de Bogota, 1976.

- SORENSEN J r A. M. reproducción Animal. Principios y Prácticas.
McGraw-Hill MEXICO, 1982.
- TABORDA LUBIAN, Manual de Instrucciones de Caballos de Alta
Escuela, Ed DIANA, México, 1988.

- STOLLA, R y OLIVERA, M. Curso Teórico Practico sobre Reproducción
Equina. Facultad de Medicina Veterinaria y de Zootecnia. Universidad
Nacional de Colombia, Santa fe de Bogota, 1987.

- FALSINA GIOVANNI, El Pony, Ed De Vecchi S.A .Barcelona España,
1994.

- GARCIA, G. ARGEMIRO. Manejo, Derribo y Sujeción de Animales
Domésticos. Universidad Nacional de Colombia, Facultad de Medicina
Veterinaria y de Zootecnia, Santa fe de Bogota, 1985.

- MESA, M. C. Minerales y Vitaminas en los Equinos, Revista ACOVEZ.
Vol. 13, No 3, sep. 1989.

- FEDEQUINAS, Revista Fedequinas, No 4, 18,21, 24, 29, 31 y 43.

- Revista EL Mundo del Caballo, No 47 y 48, España.

- M. J . FRAGA FERNANDEZ-CUEVAS. Alimentación de los Animales
Monogastricos. Ediciones Mundi-Prensa, Madrid España, 1985.

- J OVY PHILIPPE, Equitación, Ed TIKAL, Gerona España, 1998.

- RAVAZZI GIANNI, Curso Básico Ilustrado de Equitación, Ed Milán,
Barcelona España, 1990.

- VOGEL COLIN, Manual del Cuidado del Caballo, J avier Vergara Editores
S.A. Gran Bretaña, 1996.

- VARGAS RICAUTE, Exterior, Razas y J uzgamiento, Universidad del
Tolima, Ibagué, 1978.

- RODRIGUEZ PEÑA J ULIO MARIO, Zootecnia General, Exterior del
Bovino y del Equino, Universidad Nacional de Colombia, 1994.

- ESTRADA LONDOÑO RAUL, Chalaneria Colombiana 1ra edición, Ed
VIECO, Medellín Colombia, 1990.

- SANTACOLOMA VARON LUZ ELENA, Nutrición de Monogastricos,
UNAD, Santa fe de Bogota, 1995.
- RODRIGUEZ PEÑA J ULIO MARIO, Anotaciones Sobre las Especies
Asnal, Equina y Mular, Universidad Nacional de Colombia, 1995.


CIBERGRAFÍA


- www.naturalhipic.com.
- www.mascotanet.com.
- www.unr.edu.ar.
- www.mascotasyhogar.com.
- www.tejasverdes.cl.
- www.mundoequinocolombia.com.
- www.cavahorse.com.
- www.cipav.org.co.
- www.agapea.com.
- www.euskalhorse.net.
- www.rejoneo.org.
- www.agrobit.com.
- www.engormix.com.
- www.loscaballistas.com.
- www.nague.com.
- www.asdesilla.com.
- www.pasopedigreetv.com
- www.caballospastoreo.galeon.com.
- www.caballoyrodeo.cl.
- www.fedequinas.org.
- www.solocaballos.com.
- www.mailxmail.com.
- www.unaga.org.co.
- www.equinos.com.ar.
- www.proyectogeo.com.
- www.colanta.com.co.
- www.vet-uy.com.
- www.cuencarural.com.
- www.animalesgrandes.com.ar.
- www.ejercito.mil.co.
- www.ammvee.org.mx.
- www.caequinos.edu.co.
- www.zoetecnocampo.com.
- www.buscagro.com.
- www.solla.com.
- www.animalplanet.com.co/equinos.
- www.libros.vet-uy.com/CATEGORIAS/agrovet/equinos/index.htm.
- www.esceq.mil.co.
- www.proquivet.com.
- www.veterinaria.uchile.cl.
- www.viarural.com.ve.
- www.webequina.galeon.com.
- www.finca.com.
- www.patologiaveterinaria.cl.
- www.monografias.com.
- www.galeon.com.
- www.relinchando.com.
- www.caballomania.com.
- www.saudeanimal.com.
- www.3caballos.com.
- www.euskalhorse.net.
- www.infoequus.net.
- www.infoecuestre.com.
- www.horse.cl.
- www.unipamplona.edu.co.
- www.pampaequina.com.
- www.osteopatiaequina.com.
- www.millanveterinarios.com.
- www.yeguadaaragon.com.
- www.clinicadeanimales.com.
- www.sementalesalmonte.com.
- www.ecuestreonline.com.
- www.emagister.com.
- www.hospitalcaballos.com.
- www.odontologiaequina.cl.
- www.caballoyrodeo.cl.
- www.hvsmveterinario.com.
- www.masdecaballos.com.
- www.trofeocaballo.wanadoo.es.
- www.cgrbiotecnologia.com.
- www.jerezhoy.com.
- www.mascotanet.com.
- www.millanveterinarios.com.
- www.amasvet.com.
- www.elsitioagricola.com.
- www.agroinformacion.com.
- www.monografiasveterinaria.uchile.cl.
- www.grupanorcercampo.com.
- www.quintaconrado.com.
- www.bioplanet.net.
- www.herrajesycaballos.com.
- www.hipica-catalana.com.
- www.laboratorioszoo.com.
- www.guiaweb.org.
- www.tierradecaballos.cl.
- www.eki-tienda.com.
- www.cundinamarca.gov.co.
- www.chicoramirez.com.
- www.caballosminiatura.com
- http://riie.com.ar/?a=47975
- http://201.238.246.21/Rodeo/controlador/controlador/control.jsp?ACCION
=contenido/reportajes&SUBACCION=reportaje&id_articulo=117

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->