Está en la página 1de 300

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD

Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente


Contenido didctico del curso Viveros

UNIVERSIDAD NACIONAL ABIERTA Y A


DISTANCIA
ESCUELA DE CIENCIAS AGRICOLAS, PECUARIAS

Y DEL MEDIO AMBIENTE

303020 SISTEMAS DE PRODUCCION EQUINA.

Gabriel Santiago Alarcn Gil.

Director Nacional

Danilo Bonilla.
Acreditador

NEIVA
2013.

1
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

CONTENIDOS

UNIDAD 1.
ASPECTOS ZOOTECNICOS DE LOS EQUINOS

UNIDAD 1 ......................................................................................................... 7
ASPECTOS ZOOTECNICOS DE LOS EQUINOS. ............................................... 7
CAPITULO I CONSIDERACIONES GENERALES ............................................... 7
LECCION 1. GENERALIDADES DE EQUINOS.................................................... 7
HISTORIA DEL EQUINO .................................................................................... 7
LECCION 2. CLASIFICACIN DE LOS EQUINOS. .............................................11
LECCION 3. BIOLOGIA DEL CABALLO ............................................................ 12
LECCION 4. CLASIFICACION ZOOLOGICA DE LOS CABALLO ........................ 13
LECCION 5. CRONOMETRIA EQUINA ..............................................................15
SALIDA O NACIMIENTO DE LOS MOLARES O MUELAS ..................................23
CAPITULO 2 .....................................................................................................27
LECCION 6. DETERMINACIN DE LAS PRINCIPALES CAPAS O PELAJES EN
LOS EQUINOS. ................................................................................................27
CAPAS COMPUESTAS .....................................................................................32
BLANCOS DE LA CABEZA. ..............................................................................35
ESPIGAS O REMOLINOS. ................................................................................40
LECCION 7. PARTICULARIDADES DE LAS CAPAS ......................................... 40
LECCION 8. TIPOS DE CABEZAS EN EQUINOS. ..............................................41
LECCION 9. TIPOS DE CUELLOS EN EQUINOS. ..............................................42
LECCION 10. APLOMOS. .................................................................................44
APLOMOS DE LA EXTREMIDAD ANTERIOR. ...................................................44
APLOMOS DE LA EXTREMIDAD POSTERIOR. .................................................47
CAPITULO 3 .....................................................................................................49
LECCION 11. RAZAS EQUINAS. .......................................................................49
LECCION 12. DIVERSIDAD EQUINA. ................................................................49
LECCION 13. RAZAS DE SILLA Y DE TIRO LIVIANO ........................................52
LECCION 14. RAZAS DE TIRO PESADO .........................................................62
LECCION 15. PONIS ....................................................................................... 72

UNIDAD 2 ........................................................................................................78
MANEJO DE LA PRODUCCION EQUINA .........................................................78
CAPITULO 4. NUTRICIN Y ALIMENTACIN DEL EQUINO .............................78
LECCION 16. ANATOMIA Y FISIOLOGIA DEL APARATO DIGESTIVO
EQUINO .......................................................................................................... 79
LECCION 17.SELECCION DE FORRAJES Y NUTRIENTES ..............................85
DIGESTIBILIDAD ..............................................................................................91
LECCION 18. PRINCIPIOS GENERALES DE LA ALIMENTACIN EQUINA ......103
ABREVAMIENTO. ...........................................................................................105
LECCION 19. CANTIDAD DE ALIMENTO SUMINISTRADO ..............................111
LECCION 20. CONDICIN CORPORAL ..........................................................115
CAPTULO 5. .................................................................................................118
REPRODUCCIN DE LOS EQUINOS .............................................................118
LECCION 21. ANATOMIA Y FISIOLOGIA DE LA REPRODUCCION .................120
APARATO REPRODUCTOR DEL MACHO ......................................................125
LECCION 22. TIPOS DE SERVICIOS MS UTILIZADOS..................................136

2
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

TCNICAS DE REPRODUCCIN ASISTIDA. ..................................................137


FACTORES ADVERSOS PARA LA REPRODUCCIN EN EQUINOS ...............140
INSEMINACIN ARTIFICIAL EN EQUINOS. ....................................................144
Tcnica de inseminacin histeroscpica ........................................................... 150
Tcnicas de inseminacin intrauterina profunda. ............................................... 152
TRANSPLANTE DE EMBRIONES. ..................................................................154
LECCION 23. GESTACION ............................................................................ 157
ALIMENTACIN DE LA HEMBRA DURANTE LA GESTACIN .........................162
Diagnstico de preez ..................................................................................... 164
LECCION 24. EL PARTO 166
LECCION 25. SELECCIN Y MEJORAMIENTO ..............................................179
CONCEPTOS GENERALES DE BIOLOGA Y GENTICA ................................180
HERENCIA Y MECANISMOS RELACIONADOS ...............................................184
HEREDABILIDAD DE ALGUNOS RASGOS EN EQUINOS ...............................188
MEJORAMIENTO ...........................................................................................193
INBREEDING .................................................................................................203
TENDENCIA DE TRANSMISIN DEL COLOR DEL PELAJE A LA
DESCENDENCIA. ...........................................................................................205
APLICACIONES DE LA GENETICA MOLECULAR A LA INDUSTRIA EQUINA .209
CAPITULO 6. .................................................................................................214
SANIDAD EN LOS PLANTELES EQUINOS .....................................................214
LECCION 26. CABALLO ENFERMOS VERSUS CABALLOS SANOS ................215
ENFERMEDADES BACTERIANAS ..................................................................219
ENFERMEDADES MICTICAS O PRODUCIDAS POR HONGOS. ...................221
LECCION 27. PROGRAMA GENERAL DE SANIDAD EQUINA..........................226
EMPLEO RACIONAL DE MEDICAMENTOS .....................................................228
PROGRAMA DE VACUNACIN. .....................................................................233
CONTROL DE PARSITOS INTERNOS Y EXTERNOS DEL CABALLO. ...........236
LECCION 28. CLICO EQUINO. .....................................................................241
LECCION 29. ENFERMEDADES DE LOS MIEMBROS DEL EQUINO ...............248
Cmo proceder en todos los casos de cojera .................................................... 250
LECCION 30. DESINFECTANTES Y DESINFECCIN ......................................256

UNIDAD 3 ......................................................................................................261
ACTIVIDADES COMPLEMENTARIAS EN EQUINOS .......................................261
CAPITULO 7...261
MANEJO Y ADIESTRAMIENTO DEL EQUINO ...............................................261
LECCION 31. MANEJO Y ADIESTRAMIENTO DEL CABALLO ..........................261
LECCION 32. COMPORTAMIENTO SOCIAL DEL CABALLO ............................263
Sus sentidos. .................................................................................................. 267
Alteraciones del comportamiento ...................................................................... 270
LECCION 33. DESTETE DEL POTRILLO .........................................................270
Forma brusca o sbita ..................................................................................... 272
Forma lenta o Gradual ..................................................................................... 273
LECCION 34. DOMA, ADIESTRAMIENTO Y EJERCICIO EN LOS EQUINOS ....274
LECCION 35. MANEJO. ..................................................................................278
IDENTIFICACIN Y MARCACIN DE CABALLOS ........................................... 278
Hierros Candentes.279
Tatuaje indeleble debajo del labio...279
Marcacin con Hierro Fro...279
Identificacin por espejuelos....280
CUIDADO DE LOS CASCOS Y COLOCACIN DE HERRAJES.....283
PRINCIPIOS DE LA HERRADA......285

3
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Material y mtodos291
LA PICADA DE LA COLA. ...............................................................................295
QU EXPRESA EL CABALLO CON LA COLA.296
ODONTOLOGA EQUINA ...............................................................................298
SIGNOS DE PROBLEMAS DENTALES...298
PROBLEMAS DEL DESEMPEO DEL CABALLO RELACIONADOS CON
PROBLEMAS DENTALES..299
SUJECIN Y DERRIBO DEL EQUINO. ...........................................................301
EQUIPOS Y UTENSILIOS PARA UN CORRECTO MANEJO DEL CABALLO. ....302
LECCION 36. LIMPIEZA DE LOS EQUINOS. ...................................................303
CAPTULO 8 ..................................................................................................308
ALOJAMIENTO Y TRANSPORTE DE LOS EQUINOS ....................................308
LECCION 37. ALOJAMIENTO .........................................................................308
LECCION 38. TRANSPORTE ..........................................................................314
LECCION 39. PRODUCCIN DE ASNALES Y MULARES ...............................316
ORIGEN DE LOS ASNALES............................................................................317
LECCION 40. PRINCIPALES RAZAS DE ASNOS. ............................................ 319
LECCION 41. ORIGEN DE LOS MULARES......................................................322
PRODUCCIN DE MULAS ............................................................................. 323
LECCION 42. ALIMENTACIN, CUIDADOS Y MANEJO DE ASNALES Y
MULARES ......................................................................................................325
CAPITULO 9. .................................................................................................327
LECCION 43. JUZGAMIENTO DE EQUINOS ...................................................327
LECCION 44. JUZGAMIENTO EQUINO EN COLOMBIA ...................................331
LECCION 45. SISTEMA DE JUZGAMIENTO SPECTRUM INTERNACIONAL ... .340
GLOSARIO DE TRMINOS ECUESTRES .......................................................344
BIBLIOGRAFA ..............................................................................................370
CIBERGRAFA ...............................................................................................373

4
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

LISTA DE CUADROS

Pgina

Tabla 1. Constantes Fisiolgicas Reproductivas 11

Tabla 2. Oscilaciones De La Temperatura 11

Tabla 3. Respiraciones Por Minuto 11

Tabla 4. Frecuencia Cardiaca Por Minuto 11

Tabla 5. Dientes Temporales 18

Tabla 6 Rasamiento De Los Dientes Temporales 18

Tabla 7. Muda O Cambio De Dientes Temporales 18

Tabla 8. Rasamiento De Dientes Permanentes 19

Tabla 9. Tracto Digestivo Del Caballo Comparado Con El Del


Buey 74
Tabla 10. Diferentes Segmentos Del Tubo Digestivo Del Caballo 74

Tabla 11. Necesidades De Calcio Y Fsforo En El Caballo 91

Tabla 12. Necesidades De Oligoelementos 93

Tabla 13. Necesidades Mnimas En Vitamina A 95

Tabla 14. Racin En Kg. De Concentrado Y Heno O Su


Equivalente En Pasto De Corte O Pasto Fresco Para Una Yegua 105
Parida De 370 Kg. En Dos Etapas Diferentes

Tabla 15. Racin En Kg. De Concentrado Y Heno O Su 106


Equivalente En Pasto Fresco Para Potros En Distintas Etapas

Tabla 16. Evaluacin De La Condicin Corporal Del Equino


109
Tabla 17. Requerimientos Nutricionales Para Hembras Lactantes
172

Tabla 18. Rasgos y Grado de Heredabilidad en los Equinos 183

Tabla 19. Genotipos y Fenotipos de las Distintas Capas Equinas 202

Tabla 20. Enfermedades Causadas Por Virus 213

Tabla 21. Enfermedades Causadas Por Bacterias 215

Tabla 22. Enfermedades Causadas Por Hongos 216

5
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tabla 23. Enfermedades Causadas Por Protozoarios 218

Tabla 24. Enfermedades Causadas Por Helmintos 219

Tabla 25. Enfermedades Causadas Por Artrpodos 220

6
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

LISTA DE IMGENES

Pgina
Figura 1. Nomenclatura De Los Incisivos 15
Figura 2. Mandbula Del Equino 16
Figura 3. Dentadura De Los Equinos Segn La Edad 22
Figura 4. Tipos De Cabeza Segn El Perfil 38
Figura 5. Tipos De Cuello 40
Figura 6. Aplomos Y Defectos Del Tren Anterior, Vista De Frente 42
Figura 7. Aplomos Y Defectos Del Tren Anterior, Vista De Perfil 43
Figura 8. Aplomos Y Defectos Del Tren Posterior, Vista Posterior 44
Figura 9. Aplomos Y Defectos Del Tren Posterior, Vista Lateral 45

Figura 10. Condicin Corporal Segn El Sistema Henneke 111


Figura 11. Disposicin del Esqueleto Con Relacin al Casco 277
Figura 12. Herraje Corriente 282

7
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

ASPECTOS DE PROPIEDAD INTELECTUAL Y VERSIONAMIENTO


.

El contenido didctico del curso acadmico: Sistemas de Produccin Equina, fue


diseado en el ao 2007 por el medico veterinario zootecnista Gabriel Santiago Alarcon Gil,
docente de la
UNAD, ubicado en el CCAV de Neiva.

Quien desde la fecha hasta la actualidad se ha desempeado como director nacional y tutor virtual
del curso

La versin del contenido didctico que actualmente se presenta tiene


como caractersticas:

1) Desarrolla los contenidos a partir de dos enfoques actuales y La investigacin relacionada con
las Ciencias de la vida.

2)
Enfatiza en las diferencias entre los diferentes mtodos de crianza y manejo teniendo siempre
presente el bienestar animal.

3) Desarrolla las
bases que han de servir de apoyo tanto para el desarrollo del curso de
Sistemas de Produccin Equina como para la formulacin de proyectos de
productivos.

8
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

INTRODUCCIN

Los equinos han tenido mucha trascendencia a lo largo de toda la historia de la humanidad, en la
antigedad era uno de los pocos, por no decir que nico, medios de transporte y de carga siendo
adems una importante herramienta de combate. A medida que el mundo fue evolucionando y el
avance tecnolgico se hizo cada vez ms evidente para poder dar respuesta a las crecientes
demandas de la sociedad, esta herramienta que hasta entonces era tan importante, fue perdiendo
su implementacin como animal de trabajo, hasta llegar al punto que en la actualidad es un animal
ms de actividades deportivas y recreacionales que como animal de trabajo, exento en aquellas
zonas ms marginales donde el acceso hace que la tecnologa sea algo casi que imposible.

Sobre su origen se ha especulado mucho, sobresaliendo dos grandes teoras, y son las que ms
se acercan a la posible realidad. La primera de ella es la de Hamilton Smith, que dice que los
equinos procedan de una especie salvaje cuya diferenciacin racial radicaba en el color de la
capa, lo que explicara la amplia variedad de pelajes actuales.

Posteriormente Darwin propuso la teora de la evolucin y el origen de las especies por seleccin
natural dando a entender que todos los equinos descienden de un antecesor en comn (el caballo
de Przewalski, descubierto en 1881, y reconocido como el nico antecesor de los caballos
domsticos).

Su domesticacin, segn se cree, fue obra de las tribus que habitaban las orillas del mar Caspio
hace unos 5000 a 6000 aos; inicialmente se utilizaba como fuente de protena para el consumo y
piel para la manufactura, pero con el paso del tiempo fue tomando gran importancia para el
transporte y sobre todo la conquista.

Ya domesticado, se desarrolla fundamentalmente en el Oriente Medio, en tierras de la


Mesopotamia, cuna de la humanidad, y penetra al frica por el mediterrneo, con las culturas
egipcia y griega. Y a Europa con los distintos invasores, entre los que se encuentran los rabes y
germanos.

Con respecto a la llegada de los caballos a Amrica podemos asegurar que esta se produjo a
travs de los conquistadores espaoles, a partir de 1493 en el segundo viaje de Cristbal Coln.

9
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

UNIDAD 1

Nombre de la Unidad ASPECTOS ZOOTECNICOS DE LOS


EQUINOS
Introduccin Los equinos han tenido mucha
trascendencia a lo largo de toda la historia
de la humanidad, en la antigedad era uno
de los pocos, por no decir que nico, medios
de transporte y de carga siendo adems una
importante herramienta de combate. A
medida que el mundo fue evolucionando y el
avance tecnolgico se hizo cada vez ms
evidente para poder dar respuesta a las
crecientes demandas de la sociedad, esta
herramienta que hasta entonces era tan
importante, fue perdiendo su
implementacin como animal de trabajo,
hasta llegar al punto que en la actualidad es
un animal ms de actividades deportivas y
recreacionales que como animal de trabajo,
exento en aquellas zonas ms marginales
donde el acceso hace que la tecnologa sea
algo casi que imposible.

Justificacin Esta unidad recoge las nociones de lo que

es la produccin equina, los enfoques


tericos en que se sustentan los principios
de este sistema de explotacin pecuario.
Intencionalidades Formativas Familiarizar al estudiante con las
principales generalidades del mundo
equino, buscando intelectualizarlo es las
principales caractersticas tanto genotpicas
como fenotpicas de esta especie.
Denominacin de captulo 1 Consideraciones generales.
Denominacin de Leccin 1 Generalidades de los equinos.
Denominacin de Leccin 2 Clasificacin de los equinos.
Denominacin de Leccin 3 Biologa del caballo.
Denominacin de Leccin 4 Clasificacin zoolgica del caballo.
Denominacin de Leccin 5 Cronometra equina.
Denominacin de captulo 2 Fenotipo equino.
Denominacin de Leccin 6 Determinacin de las principales capas.
Denominacin de Leccin 7 Particularidades de las capas.
Denominacin de Leccin 8 Tipos de cabezas en los equinos.

10
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Denominacin de Leccin 9 Tipos de cuellos en los equinos.


Denominacin de Leccin 10 Aplomos.
Denominacin de captulo 3 Grupos raciales.
Denominacin de Leccin 11 Razas equinas.
Denominacin de Leccin 12 Diversidad equina.
Denominacin de Leccin 13 Razas de silla y tiro liviano.
Denominacin de Leccin 14 Razas de tiro pesado.
Denominacin de Leccin 15 Ponis.

UNIDAD 2

Nombre de la Unidad MANEJO DE LA PRODUCCION EQUINA.


Introduccin La nutricin implica diversas reacciones tpicas y
procesos fisiolgicos que trasforman los alimentos en
tejidos corporales y est comprendida por la
ingestin, digestin y absorcin de los diferentes
nutrientes, su transporte hacia todas las clulas del
cuerpo, as como la eliminacin de elementos no
utilizables y productos de desecho del metabolismo.
Justificacin Esta unidad recoge las nociones de lo que

es la produccin equina, los enfoques


tericos en que se sustentan los principios
de este sistema de explotacin pecuario.
Intencionalidades Formativas Familiarizar al estudiante con las
principales generalidades del mundo
equino, buscando intelectualizarlo es las
principales caractersticas tanto genotpicas
como fenotpicas de esta especie.
Denominacin de captulo 4. Nutricin y Alimentacin del Equino.
Denominacin de Leccin 16 Anatoma y Fisiologa del aparato digestivo
equino.
Denominacin de Leccin 17 Seleccin de Forrajes y Nutrientes.
Denominacin de Leccin 18 Principios Generales de la Alimentacin.
Denominacin de Leccin 19 Cantidad de Alimento Suministrado.
Denominacin de Leccin 20 Condicin Corporal.
Denominacin de captulo 5 Reproduccin de los Equinos.
Denominacin de Leccin 21 Anatoma y Fisiologa de la Reproduccin.
Denominacin de Leccin 22 Tipos de Servicios ms Utilizados.
Denominacin de Leccin 23 Gestacin.

11
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Denominacin de Leccin 24 Parto.


Denominacin de Leccin 25 Seleccin y Mejoramiento.
Denominacin de captulo 6 Sanidad en los Planteles Equinos.
Denominacin de Leccin 26 Caballos enfermos versus caballos sanos.
Denominacin de Leccin 27 Programa General de Sanidad Equina.
Denominacin de Leccin 28 Clico Equino.
Denominacin de Leccin 29 Enfermedades de los Miembros del Equino.
Denominacin de Leccin 30 Desinfectantes y Desinfeccin.

UNIDAD 3

Nombre de la Unidad ACTIVIDADES COMPLEMENTRIAS DE LOS


EQUINOS.
Introduccin Para entender de manera ms clara y precisa
algunos de los procesos que se comentaran en este
captulo, se considera de gran importancia conocer
primero el fenmeno fisiolgico del crecimiento, ya
que este nos determinara la hora de realizar ciertas
faenas propias en el manejo de los equinos, como es
el caso de el destete, el adiestramiento, la castracin
y otras ms que comentaremos a continuacin, al
igual de cmo es el comportamiento social de los
caballos.
Justificacin En el equino, la nutricin inadecuada, el sobrepeso,
el estado fisiolgico de las hembras (preez), as
como mltiples factores de manejo, incluidos la
aplicacin de esquemas de ejercicio fsico
inadecuados, tales como la cuerda muy corta y a
poca edad o el inicio del proceso de doma y
adiestramiento muy pronto en la vida (generan
excesos de presin articular, con irritacin de las fisis
y posterior mineralizacin) pueden contribuir a la
formacin del equino.
Intencionalidades Formativas Familiarizar al estudiante con las
principales Generalidades del mundo
equino, buscando intelectualizarlo es las
principales caractersticas tanto genotpicas
como fenotpicas de esta especie.
Denominacin de captulo 7 Manejo y Adiestramiento Equino.
Denominacin de Leccin 31 Manejo y Adiestramiento del caballo.
Denominacin de Leccin 32 Comportamiento Social del Caballo.
Denominacin de Leccin 33 Destete del Potrillo.g

12
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Denominacin de Leccin 34 Doma, Adiestramiento y ejercicio Equino.


Denominacin de Leccin 35 Manejo.
Denominacin de captulo 8 Alojamiento y Trasporte Equino.
Denominacin de Leccin 36 Alojamiento.
Denominacin de Leccin 37 Trasporte.
Denominacin de Leccin 38 Produccin de Asnales y Mulares.
Denominacin de Leccin 39 Principales Razas de Asnos.
Denominacin de Leccin 40 Origen de los Mulares.
Denominacin de captulo 9 Juzgamiento.
Denominacin de Leccin 41 Juzgamiento de equinos.
Denominacin de Leccin 42 Juzgamiento de Equinos en Colombia.
Denominacin de Leccin 43 Sistema de Juzgamiento Spectrum.
Denominacin de Leccin 44 Terminologa Ecuestre.
Denominacin de Leccin 45 Juzgamiento de mulares.

13
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

CAPITULO 1

CONSIDERACIONES GENERALES.

Fuerza, velocidad, suavidad, estampa, bro y nobleza, son segn la federacin colombiana de
asociaciones equinas (fedequinas) las cualidades que mejor describen al caballo colombiano.

Como se menciona anteriormente el primer embarque de equinos, hacia Amrica se realiz en


1493, determinndose como primer punto de cra la Repblica Dominicana, de all se distribuyen
hacia Cuba, Puerto Rico y Colombia.

En el ao de 1525 llegaron los primeros equinos a lo que hoy es Colombia, trados por don Rodrigo
de Bastidas. Posteriormente en 1533 don Pedro de Heredia y en 1535 Pedro Fernndez de Lugo,
volvieron a introducir equinos para ser utilizados como animales de silla y carga en su empresa de
expansin y colonizacin a travs del pas.

La mayora de estos ejemplares, posean un andar suave que debido a las condiciones geogrficas
de la zona, fueron modificando hasta producir los diferentes andares caractersticos de nuestros
equinos, las regiones de Cundinamarca, Valle y Antioquia son los departamentos donde mejor se
desarroll el caballo criollo colombiano.

De Antioquia el caballo se extendi a los departamentos de Caldas, Quindo y Risaralda, hoy por
hoy el eje cafetero es la zona del pas donde mayor aficin existe al mundo equino.

Actualmente nuestro caballo, al igual que el caf y la esmeraldas, es un smbolo de Colombia,


exportndose a pases como Brasil, Puerto Rico Venezuela, Ecuador, Republica Dominicana, y
Estados Unidos, donde viven cerca de 38000 equinos colombianos.

Se calcula que las divisas que se generaron con la explotacin equina, es igual a la procedente de
las esmeraldas y que en Colombia generan cerca de 150000 empleos.

En las venas de nuestros caballos corre sangre berberisca, rabe y andaluza, cuya mezcla y la
interaccin con la geografa nacional, origin un animal de caractersticas nicas en el mundo,
resaltando entre otras lo siguiente:

Elegancia de sus movimientos posiblemente del andaluz, el bro y la perfeccin de sus formas del
rabe y la calidad y resistencia del berberisco.

En un principio estos animales debieron mezclar su propio andar con el necesario para la
topografa nacional, poco a poco esta informacin paso a ser gentica y as fue como con los aos
se perfecciono, con la ayuda de la seleccin, la tecnologa y el adiestramiento.

La poblacin equina nacional se encuentra distribuida especialmente en los departamentos de


Antioquia, Cundinamarca, Santander, Tolima, Huila, Caldas, Quindo, Risaralda, Meta, Cauca,
Boyac, y Atlntico entre otros.

Esta poblacin est representada por ejemplares cuyo gnero de servicio se puede resumir as:

14
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

DE SILLA Y/O TIRO LIVIANO:

Salto de obstculo.

Polo.

Carreras.

Para transporte y recreacin.

TIRO PESADO

PONIES

Leccin 1 GENERALIDADES DE EQUINOS


HISTORIA DEL EQUINO

Los equinos han sido y sern por siempre el mejor acompaante del hombre en la mayora de sus
actividades.

Sobre su origen se ha especulado mucho, sobresaliendo dos grandes teoras, y son las que ms
se acercan a la posible realidad. La primera de ella es la de Hamilton Smith, que dice que los
equinos procedan de una especie salvaje cuya diferenciacin racial radicaba en el color de la
capa, lo que explicara la amplia variedad de pelajes actuales.

Posteriormente Darwin propuso la teora de la evolucin y el origen de las especies por seleccin
natural dando a entender que todos los equinos descienden de un antecesor en comn (el caballo
de Przewalski, descubierto en 1881, y reconocido como el nico antecesor de los caballos
domsticos).

http://yegua.tripod.com/historia.htm

Hoy en da se ha comprobado que el caballo es originario de Amrica. Su primer antepasado era


del tamao de un perro Fox Terrier y vivi hace mas o menos 55 millones de aos en Amrica. Se
le denomino EOHIPPUS y la prueba de su existencia la obtuvieron los paleontlogos en fsiles

15
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

encontrados al sur de Estados Unidos. Sus miembros anteriores terminaban en cuatro dedos y su
dentadura era similar a la de un roedor no apto para alimentarse de pastos. El dorso era arqueado
y la cabeza pequea.

A este le sigui el MESOHIPPUS de un tamao un poco superior al anterior, con tres dedos en sus
extremidades anteriores, y de mayor desarrollo del central que de los laterales, vivi hasta hace
ms o menos 26 millones de aos. Y con posterioridad, el MERYCHIPPUS, ltimo caballo con tres
dedos en sus miembros anteriores, con avanzada atrofia de los dos laterales. Igual que el
MESOHIPPUS, se alimentaba de hierbas blandas por su avanzada transformacin dentaria y
mostraba mayor largo de la cabeza pareciendo cada vez ms al equino actual, este existi hasta
hace ms o menos 7 millones de aos.
Posteriormente encontramos al PLIOHIPPUS que existi hasta hace 2.5 millones de aos
aproximadamente. En este ya se encuentra un solo dedo en los miembros anteriores y se observa
la atrofia total de los laterales. El dedo central termina en un casco y presentaba importantes
transformaciones en los molares, su crneo aparece ms largo en relacin a los anteriores.

Entre hace 2.6 millones de aos y un milln de aos aparece el EQUUS CABALLUS, antecesor
ms cercano del caballo actual, que emigra del continente Americano al Asitico a travs del
estrecho de Bering y llega hasta el occidente de Europa.

A partir del EQUUS se inicia en Asia la formacin de las razas de los primeros caballos de tiro y de
silla que se van agrupando bajo os distintos tipos, paralelamente a la evolucin de la corteza
terrestre y a su cubrimiento forestal, desde el Pony o raza miniatura de 0.90 metros de alzada,
hasta los grandes caballos de tiro pesado de la poca moderna como el Shire ingls, que llegan
hasta los 2 metros de alzada.

http://www.veterinaria.org/asociaciones/vet-
uy/articulos/artic_eq/001/eq_001.htm

Su domesticacin, segn se cree, fue obra de las tribus que habitaban las orillas del mar Caspio
hace unos 5000 a 6000 aos; inicialmente se utilizaba como fuente de protena para el consumo y
piel para la manufactura, pero con el paso del tiempo fue tomando gran importancia para el
transporte y sobre todo la conquista.

Ya domesticado, se desarrolla fundamentalmente en el Oriente Medio, en tierras de la


Mesopotamia, cuna de la humanidad, y penetra al frica por el mediterrneo, con las culturas
egipcia y griega. Y a Europa con los distintos invasores, entre los que se encuentran los rabes y
germanos.

Con respecto a la llegada de los caballos a Amrica podemos asegurar que esta se produjo a
travs de los conquistadores espaoles, a partir de 1493 en el segundo viaje de Cristbal Coln.

Segn la historia, los reyes Fernando e Isabel se preocuparon principalmente de que fueran
transportados al nuevo mundo, varios ejemplares equinos; la orden real era embarcar 25 de los
mejores ejemplares de tan noble especie, pero la verdad es que al continente americano

16
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

desembarcaron de inferior calidad, de esta forma podemos deducir, sin temor a equivocarnos, que
nuestro caballo colombiano ni siquiera desciende de los mejores caballos espaoles, es as como
a nuestro pas le corresponde el privilegio de haber sido el primero de Sudamrica que utilizo este
noble animal.

Los equinos llegados a Colombia eran animales de andar lateral descendientes del Berberisco
africano que ya ejecutaban cuatro tiempos laterales en andoneo, y caballos de trote y galope,
posiblemente de origen Celta-Berberisco, que sirvieron de semilla a las importantes razas de
Amrica del sur entre las cuales se encuentran, en orden de antigedad, cuatro alternativas en
Colombia: la de Paso Fino, la de Trote y Galope, la de Trocha sola y la de Trocha y Galope.

Los diversos usos que el hombre ha dado al caballo a travs de los tiempos en orden cronolgico
son:

Como medio de alimentacin.


Para fines militares (en las guerras)
Pasatiempo y diversin en las diferentes culturas.
Mano de obra en empresas agrcolas y comerciales. Para recreo y
deporte.

Leccin 2 CLASIFICACIN DE LOS EQUINOS.

Los equinos se clasifican desde el punto de vista de la conformacin o tamao, peso o perfil de la
cabeza, as pues tenemos:

POR VOLUMEN O PESO.


Hipermtricos: peso superior a 500 Kg.
Eumtricos: peso medio entre 350y 500 kg.
Elipomtricos: peso inferior a 350 kg.

POR SUS PROPORCIONES O TAMAO.


Brevilneos o Braquiomorfos: animales de formas cortas.
Mediolneos o mesomorfos: formas promedio es decir ni cortas ni largas. Longilneos o
dolicomorfos: animales de formas alargadas.

POR EL PERFIL DE CABEZA.


Rectilneos: huesos casi planos.
Concavilneos: huesos hundidos especialmente.
Convexilneos: huesos abombados.

17
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Leccin 3 BIOLOGA DEL CABALLO.


CONSTANTES FISIOLGICAS:

Son todas aquellas manifestaciones de la actividad vital del organismo animal que pueden
ser medidos en un examen clnico y que ponen en evidencia el estado del mismo.

Tabla 1. Constantes fisiolgicas reproductivas.


PRIMER
ESPECIE DURACIN DURACIN REAPARICIN CELO AL NO HABER
GESTACIN DEL CELO DEL CELO POSTPARTO FECUNDACIN
YEGUA 340 das 6-8 das Cada 21 das 7-10 das 12-16 semanas
promedio.
BURRA 365 das 6-8 das Cada 9-8 das 42-56 das 3 semanas
promedio.
Tomado de diccionario veterinario ECTA

Tabla 2. Oscilaciones de la Temperatura.


Individuo Temperatura
CABALLO Y MULO 37.5-38.2 C
POTRO 37.5-39 C
ASNO 37.5-39 C
Tomado de diccionario veterinario ECTA

Tabla 3. Respiraciones por minuto


Individuo Nmero de Respiraciones por minuto
CABALLO Y YEGUA DE 8-20
POTROS DE UN AO DE 10-15
ASNO Y MULO DE 10-30
Tomado de diccionario veterinario ECTA

Tabla 4. Frecuencia cardiaca por minuto


Individuo Nmero de pulsaciones por minuto
CABALLOS EN GENERAL 36-40
CABALLOS CASTRADOS Y YEGUAS 34-40
POTROS HASTA 14 DAS HASTA 100
POTROS HASTA UN MES HASTA 70
POTROS DE 6-12 MESES 60-45
POTROS DE 2-3 AOS DE 50-40
ASNO Y MULO 42-50

18
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Leccin 4 CLASIFICACIN ZOOLGICA DE LOS CABALLOS.

REINO: Animal (seres vivos diferentes a las plantas). PHYLUM:


Chordata (cordados).

SUBPHYLUM: Vertebrata (presencia de columna vertebral).


CLASE: Mamalia (animales de sangre caliente que paren a sus cras vivas y los amamantan por un
periodo de tiempo determinado con una secrecin de sus glndulas mamarias).
ORDEN: Ungulata (mamferos con cascos, no rumiantes).
SUBORDEN: Perisodatila (un dedo en cada extremidad solpedos protegidos por una fuerte ua
denominada casco).
FAMILIA: Equidae (equinos con pequeos pezones en ambos sacos, piel rica en glndulas,
presencia de crin, constitucin gil y ligera).
GENERO: Equus (incluye los caballos, asnos mulas y cebras).
ESPECIE: Caballos (caballos domsticos, se diferencias de los asnos y las cebras por el pelo mas
largo en las crines y la cola, presencia de espejuelos en la parte interna de las manos, cabeza de
menor tamao, orejas ms cortas, entre otras).
NOMBRE CIENTFICO: Equus caballus. NOMBRE
COMN: Caballo.

Los equinos son animales vivparos herbvoros, de reproduccin sexual, alcanzando la pubertad
alrededor de 24 a 36 meses, tiempo en el cual tanto el caballo como la yegua ya pueden aparearse
pero solo es aconsejable permitir la monta en caballos a los cuatro aos cuando ya ha alcanzado
su completa capacidad y a los cinco aos en yeguas cuando la osificacin se encuentra totalmente
terminada. En general es deseable y prudente servirla cuando su estado general, su tamao, peso
y su salud sea excelente, pero nunca antes de los dos aos y medio. Se acostumbra a ser servicio
entre los 30 a 36 meses, siempre y cuando la alimentacin sea de buena calidad.

Normalmente nace una o dos cras (algo excepcional) despus de una gestacin de once meses;
una yegua puede llegar a tener de cinco a seis cras, en su vida reproductiva, los equinos poseen
64 cromosomas.

La duracin media de la vida del caballo es de unos quince aos pero muchos animales pueden
pasar de los 20 aos. El caballo crece muy rpidamente y al ao de edad ya tiene el tamao de un
adulto. Sin embargo su desarrollo cesa hasta los dos aos. Desde su nacimiento hasta los cinco
aos los machos reciben el nombre de potros, las hembras el de potrancas, de los cinco aos en
adelante se llaman respectivamente caballo y yegua.

Viven en casi todo tipo de ecosistemas excepto en los polos, donde el clima es muy fro y la
mayora de las especies se desarrollan en temperaturas templadas, son de fcil adaptacin a
climas diferentes al que nacieron.

La evolucin del equino le ha permitido desarrollar patas y remos altamente especializados en los
que ha fundamentado su velocidad, ha reducido al mnimo el nmero de huesos en sus
extremidades para que el punto de apoyo sean los extremos de cuatro dedos. Simultneamente a
este fenmeno, se ha producido la desaparicin de los msculos situados por debajo de la rodilla y
el corvejn, dado que esto junto con los otros huesos de los que el caballo carece son los que
permiten a otros animales agarrar y manipular con sus extremidades. El caballo solo puede mover
los remos hacia adelante o hacia atrs, lo que le proporciona un mtodo ptimo de propulsin.

La fuerza se la dan los msculos altamente desarrollados que se insertan en los huesos del
antebrazo, cuya superficies seas se han ensanchado para cumplir esta misin.

19
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Su estructura sea consta de 205 huesos, distribuidos de la siguiente forma:

Columna Vertebral 54
Costillas 36
Esternn 1
Crneo (incluyendo huesos del odo) 34
Extremidades anteriores 40
Extremidades posteriores 40
TOTAL 205 Huesos

El esqueleto proporciona sostn a los msculos, proteccin a los rganos internos y sus
componentes poseen la movilidad necesaria para que el animal se desplace a diferentes
velocidades.

Los diferentes tipos de articulacin proporcionan diversos grados de movilidad; los huesos estn
recubiertos de cartlago que pueden compensar los efectos de desgaste en la superficie. La
articulacin se completa con una cpsula y produce sinovia (liquido articular) cuyo fin es lubricar las
superficies articulares. Todo esto se refuerza por medio de ligamentos que unen los huesos de
ambos lados de la articulacin.

http://www.3caballos.com/modules.php?name=Content&pa=showpage&pid=53

20
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Leccin 5 CRONOMETRIA EQUINA.

El sistema ms empleado para determinar la edad, ha sido el examen de su sistema dentario


encontrndose que a diferencia de los bovinos, ac si es una prctica bastante aproximada con
relacin a la edad verdadera.

Los equinos son heterodontos completos es decir, que se encuentran todos los tipos de piezas
dentales (I, Ca, Pm y Mo).

En las hembras y solo en casos espordicos se encuentran algunos rudimentos de los caninos,
nicamente en la mandbula.

Tanto los incisivos como los premolares de los equinos son difiodontos esto quiere decir que en un
momento dado de la vida del ejemplar son reemplazados por piezas permanentes, mientras que
los caninos y molares salen una sola vez, es decir son permanentes desde su brote.

En los caballos de 5 aos, basta simplemente observar el nmero de piezas definitivas y


temporales que poseen. Desde los 6 a los 12 aos se toma en cuenta el rozamiento o desgaste de
los incisivos. La mejor manera de aprender cmo se reconoce la edad de un equino es examinar
los dientes de caballos de edades conocidas (verificar con el registro de nacimiento). En contraste
los incisivos permanentes son de mayor tamao que los temporales, su color es opaco amarillento
y toman una direccin curva de arriba hacia abajo.

NOMENCLATURA DE LOS INCISIVOS.

Los incisivos en los equinos son 12 en total, son 6 en el maxilar y 6 en la mandbula.


Los dos centrales tanto superiores como inferiores reciben el nombre de palas o pinzas, los que
sigue a cada lado: medios o medianos y los ms laterales: extremos o angulares. Presentan una
invaginacin en la superficie de masticacin, esto es infundbulo o tintero que es ms profundo en
los incisivos inferiores y que sirve de gua para determinar la edad, por el mayor o menor desgaste
que sufran o su desaparicin total a lo cual se conoce como rasamiento.

Figura 1. Nomenclatura de los incisivos

1. Palas o Pinzas
2. Primeros Medios
3. Segundos Medios
4. Extremos o Angulares
Tomado de Zootecnia General de la UNAD

21
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

CANINOS O COLMILLOS.
Son 4 en el macho; en la hembra faltan o son rudimentarios. Interrumpen el espacio nter dentario,
llamado barra o asiento, dividindola en dos partes desiguales. Los inferiores estn ms prximos
al incisivo angular.
Los caninos salen una sola vez, es decir no se mudan. Generalmente en los animales jvenes son
blancos y puntiagudos, pequeos comparados con los incisivos en los animales viejos son
amarillentos y su punta aparece desgastada es decir que se manifiesta redondeada y roma.
MOLARES.
Son 24 en total; 12 en maxilar superior y 12 en la mandbula. Sin embargo el nmero puede estar
aumentado por la presencia en el maxilar superior de un pequeo diente, llamado diente de lobo
que est situado delante del verdadero primer premolar. Esta pequea pieza dentaria es ms o
menos frecuente tanto en los machos como en las hembras.

Espordicamente puede aparecer en algunos equinos este pequeo diente en la mandbula


inferior, pero estos casos son aislados.

Los tres primeros molares de cada lado tanto del maxilar como de la mandbula, reciben el nombre
de premolares, son ms grandes y el tamao de las coronas es apreciable.

La superficie bucal, es lo que se dirige hacia las mejillas, presenta una cresta central dirigida
longitudinalmente, separando dos surcos. La superficie masticatoria presenta dos infundbulos uno
anterior y otro posterior, no tan profundos como los de los incisivos y mucho ms manifiesto en los
molares. Adems presenta numerosos pliegues o crestas que hacen las veces de molinos para
triturar los alimentos. Generalmente presentan tres races. Los premolares inferiores o
mandibulares tienen una longitud similar a las de los superiores. Su superficie masticatoria es ms
angosta y oblicua. Presentan dos races.

Los molares propiamente dichos presentan una corona desarrollados (casi cuadrada) con
excepcin del ltimo que presenta seccin prismtico triangular. Presentan dos infundbulos y los
respectivos pliegues o crestas en la superficie masticatoria. Tiene generalmente tres races con
excepcin del ltimo que puede presentar cuatro, esto es vlido para los molares superiores o
maxilares.

Los molares inferiores o mandbulas, son ms anchos que los superiores, los dos primeros
presentan dos races, mientras que el tercero o ltimo molar presenta comnmente tres.

Aunque los premolares y molares raramente son tenidos en cuenta para la determinacin de la
edad, por la dificultad misma para su inspeccin, sin embargo en las pocas de erupcin o salida
coinciden con determinadas edades que en un momento dado sirven de gua.

22
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Figura 2. Mandbula del Equino

Maxilar Superior Maxilar Inferior


Tomado de Zootecnia General de la UNAD

FORMULAS DENTARIAS

Los dientes temporales son ms pequeos que los permanentes y su nmero es igualmente
menor.

Frmula dentaria temporal: I 6/6 C 0/0 PM 6/6 = 24 Piezas dentarias.

La frmula de Permanente, tanto para machos como para hembras es la siguiente:

HEMBRAS: I 6/6 C 0/0 PM 6/6 M 6/6=36 o 38. Piezas dentarias. MACHOS: I 6/6 C
2/2 PM 6/6 M 6/6= 40 o 42 Piezas dentarias.

PERIODOS DE VIDA DEL EQUINO:

Se considera que existen tres periodos fundamentales en la vida de un equino:

El primero corresponde desde el nacimiento hasta los 5 aos y durante este periodo el ejemplar
recibe la denominacin de potro o potranca segn el sexo. El segundo va desde los 5 a los 13
aos y entonces el ejemplar es adulto.
El tercero va desde los 14 en adelante y el animal se resea como viejo.

En la determinacin de la edad de los equinos se tiene en cuenta ciertos periodos de su denticin


as:

Nacimiento o salida de los dientes de leche o temporales.

23
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Rasamiento de los dientes de leche.

El proceso de denticin tiene las siguientes fases:

Erupcin de los dientes temporales.


Muda o cambio de los dientes temporales a permanentes.
Erupcin de los caninos o colmillos.
Rasamiento de los dientes permanentes.
Cambio de forma de la superficie libre o de masticacin a:

o Forma redondeada.
o Forma triangular.
o Forma biangular.

CARACTERES QUE PRESENTAN LAS PIEZAS DENTARIAS DE UN EQUINO EN LAS


DIFERENTES EDADES.

Tabla 5. Dientes Temporales


DIENTES TEMPORALES O DE LECHE
EDADES SALIDA O REEMPLAZO CARACTERSTICAS
5-12. hasta 30 das Nacen las palas, casi Son pequeos, blancos,
siempre primero las Brillantes y presentan
superiores. corona y cuello.
30-40 das Nacen los medios
Del 3 al 9 o 10 mes Nacen los extremos (braquiodontos)

Tabla 6. Rasamiento De Los Dientes Temporales.


RASAMIENTO
A los 10 meses Las pinzas Blancos, pequeos, se
desgastan (va
desapareciendo el
infundbulo)
A los 12 meses Los medios
De los 15-20 meses Los extremos

Aproximadamente a los 2 aos todos los incisivos estn rasados y comienzan a descarnar, esto
es que se aflojan o se mueven para iniciarse as la muda de los mismos.

Tabla 7. Muda O Cambio De Dientes Temporales.


MUDA O CAMBIO
De los 2 a 3 aos Mudan las palas o pinzas Gruesos, amarillentos, sin
corona y cuello.
De los 3 a 4 aos Mudan los medios
De los 4 a 5 aos Mudan los extremos

Alrededor de los 5 aos de edad un equino debe presentar todos los incisivos permanentes, se

24
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

dice entonces que el animal esta parejo.

SALIDA DE LOS CANINOS O COLMILLOS.


Los colmillos hacen su aparicin en los equinos machos entre los 3 a los 4 aos y como ya
se dijo son 4 en total, dos en el maxilar y dos la mandbula.

CAMBIOS DE FORMA DE LOS DIENTES.

A medida que el animal envejece, (esto es que ha rasado todos los incisivos) se dice que el animal
esta fuera de marca o fuera de edad y empieza a notarse un cambio en la forma de la superficie de
masticacin (corona) que como se ha dicho presenta hasta este momento forma oval (alongada
transversalmente).

a) FORMA REDONDEADA.
A los 9 aos presentan forma redondeada en las palas inferiores o mandibulares y los extremos
inferiores o mandibulares, adems es posibles observar a partir de los 9 aos que las palas o
pinzas inferiores presentan la denominada estrella dentaria que es una lnea transversa opaca
amarillo marrn, ubicada en la dentina, colocada entre el borde labial (anterior) de los dientes y el
esmalte central.

A los 12 aos las palas superiores o maxilares aparecen redondeados. A los 13 aos
los medios superiores son redondos.
A los 14 aos los extremos superiores son redondos.
Esta forma puede aparecer hasta los15 o 16 aos, especialmente a nivel de extremos.

b) FORMA TRIANGULAR.
Por el desgaste sufrido, los incisivos van tomando una forma ms o menos triangular cuyo vrtice
esta hacia la regin lingual. As se puede presentar dicha forma a las siguientes edades:
A los 15 aos las palas inferiores o mandibulares. A los 16 aos los
medios inferiores o mandibulares.
A los 17 aos los extremos inferiores o mandibulares.
Para los superiores: 18 a 23 aos respectivamente para palas, medios y extremos.

c) FORMA BIANGULAR.
En este momento el equino es bastante viejo y sus incisivos toman cierta direccin de manera que
observados los superiores y los inferiores forman hacia la cavidad bucal un ngulo agudo, la
posicin esta muy distinta a la de los incisivos del animal joven en que es prcticamente vertical.
Igualmente en la superficie de masticacin, se aprecia como que el diente se hubiera invertido,
esto es, que es angosto en el sentido antero posterior, conocindose a esta forma como
biangular.

Esta se presenta en las siguientes edades: 18 aos:


biangulares las palas inferiores.
19 aos: biangulares los medios inferiores.
20 aos: biangulares los extremos inferiores.

Para los incisivos superiores, la biangularidad aparece de los 21 a los 23 aos respectivamente
para cada uno de los tipos de incisivos.

25
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

d) SURCO DE GALVAYNE.
Es posible determinar la edad de los equinos, mediante la observacin de los extremos superiores
en su cara lateral, externa o labial, ya que ella suele parecer un surco o depresin partir de la unin
de la enca y hacia su parte central, prolongndose verticalmente hacia la superficie de masticacin
(borde libre) que recibe la denominacin de surco de Galvayne.

Es bueno para lograr identificarlo, limpiar un poco el diente para separar el sarro o residuos de
comida que pueden ocultar el mencionado surco.

Este surco o depresin aparece as:

- Se observan en la parte superior y media del extremo superior.


A los 15 aos el surco se ha extendido ms o menos hasta la mitad vertical del incisivo.

En el ejemplar adulto, a los 20 aos el surco es completo y ha llegado hasta el borde libre del
diente, parece como si el incisivo se hubiera partido en dos porciones: una anterior y otra posterior.

SALIDA DE LOS PREMOLARES.

TEMPORALES O DE LECHE.
Los premolares 1: aparecen al nacimiento del ejemplar o durante la primera semana de vida.
Los premolares 2: aparecen en la segunda semana. Los premolares
3: aparecen entre las 3 4 semanas

PERMANENTES.
Los primeros premolares mudan entre lo 2 a 3 aos.
Los segundos premolares mudan entre los 3 y 4 aos.
Los terceros premolares mudan entre los 4y 5 aos.

SALIDA O NACIMIENTO DE LOS MOLARES O MUELAS

Los molares son 12 en total: (6 arriba y 6 abajo). Son permanentes esto es que nacen una sola vez
y no son remplazados.

El primer par de molar nace entre los 9 y los12 meses.

El segundo par molar nace ms o menos a los 12 aos.

El tercer par molar nace entre los 3 y medio a los 4 aos.

Nota: como se dijo anteriormente, en algunos casos puede aparecer un pequeo premolar
adicional en el maxilar superior denominado diente lobo, el cual nace entre los 5 y 6 meses de
edad del equino y es de carcter permanente.

En este caso se hablar entonces de 4 pares de premolares en el maxilar superior y la numeracin


de adelante hacia atrs ser en ese orden, esto es primero a cuarto premolar.

En los equinos suelen presentarse irregularidades o deformaciones de la superficie masticatoria, lo


cual hace que el equino mantenga la boca sucia, esto es con residuos de forraje, no se tritura

26
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

bien este y por consiguiente haya desperdicio y el animal se vea en mal estado nutricional.

En otros casos los premolares y molares, especialmente los del maxilar pueden presentar
posiciones anormales o ectopias (fuera de su sitio natural) que traen como consecuencia
problemas en la masticacin o an dificultades respiratorias.

Figura 3. Dentadura De Los Equinos Segn La Edad

27
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

28
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

29
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

30
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

CAPITULO 2.

FENOTIPO EQUINO.

Leccin 6 DETERMINACIN DE LAS PRINCIPALES CAPAS O PELAJES EN


LOS EQUINOS.

Se entiende por capas o pelajes no solamente al conjunto de pelos y crines que recubren el cuerpo
y el de sus cabos (los cabos son el hocico, la punta de las orejas, las crines, la cola y las
extremidades), sino a las caractersticas que estos presentan en cuanto a su calidad, naturaleza,
densidad, disposicin, desarrollo, ondulacin y de manera especial su coloracin, permitiendo all
diferenciarlo y reconocerlo entre los dems caballos de manera fenotpica.

El color del pelaje, corresponde genticamente a la manifestacin externa de los melanocitos


(clulas embriolgicamente de origen nervioso), clulas epiteliales un poco mviles en la capa
profunda de la epidermis, encargadas de dar origen a los diferentes colores, produciendo
bsicamente dos tipos de melanina: la eumelanina (negro) y la feomelanina (marrn). Dependiendo
de la mayor o menor cantidad de una de las dos, se generan tonos oscuros o claros.

De acuerdo al grosor, resistencia, longitud, regin corporal del cuerpo que ocupan, elasticidad,
entre otras caractersticas del pelo, se pueden distinguir las siguientes caractersticas:

Pelos de cubierta: son la parte principal de revestimiento externo.


Pelos largos: son aquellas de gran dimetro colocado en las crines, tupe, cola, y menudillo.
Pelos vellos o lana: finos cortos o largos, ligeramente ondulados.
Cerdas: son aquellos pelos burdos, groseros y presentes en la cara interna del odo ollares y
pestaas.
Pelos tctiles o sinusales: de constitucin rgida, largos y gruesos presentes en los labios, cabeza y
nariz.

Al nacer el potro se halla cubierto por una especie de lanosidad que generalmente desaparece
alrededor de los 5-8 meses, siendo reemplazado por una capa diferente a la capa original. La
cabeza puede ser un punto de referencia sobre el color definitivo del cuerpo del caballo.

Para un mejor entendimiento de las capas tomaremos como base la descripcin tomada por el
mdico veterinario zootecnista Julio Mario Rodrigues Pea.

Los pelajes se clasifican en dos grandes grupos:

CAPAS SIMPLES.

Son todas aquellas capas que estn constituidas en su mayora por pelos de un solo color
presentndose uniformidad en el cuerpo con excepcin de las cerdas de la crin de la cola o cierto
color en los remos.

Estos pelajes a su vez se dividen en:

Simples totales: en ella tanto el cuerpo como la crin y cola son del mismo color.

31
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Simples parciales: en ella el color de la crin, la cola y los remos son diferentes a la capa
general del cuerpo.
Entre las capas simples totales o bsicas encontramos tres grupos con sus respectivos subgrupos
as:
BLANCO: capa de poca incidencia donde la mayora de los pelos que cubre el cuerpo del animal
son blancos presenta las siguientes variedades:

http://www.ansi.okstate.edu/breeds/horses/

Blanco Albino: la piel es de pigmentacin rosada y el pelo es blanco, presenta problemas de


dermatitis.
Blanco Plateado: el pelo es blanco generando reflejos metlicos.
Blanco Mate: el pelo es blanco pero en esta ocasin no genera ningn reflejo es decir es un blanco
opaco.
Blanco Porcelana: presenta un color azuloso ya que el color oscuro de la piel se percibe a travs
del pelo blanco.
Blanco Amarillento: en el se genera un color cremoso denominado tambin blanco sucio.
NEGRO: capa donde casi todos los pelos del animal son de color negro presentan las siguientes
variedades:

Tomada Pesebrera El Puente - Neiva

Negro Azabache: es cuando el color es lustroso, brillante. Negro Morcillo:


ligeramente violceo.
Negro Peceo: negro desteido en algunas regiones del exterior

ALAZN: pelajes de color rojo amarillento, con crines y cola del mismo color. Presenta las
siguientes variedades

32
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tomada Pesebrera El Puente - Neiva

Alazn Plido: es un pelaje casi amarillento. Alazn Tostado:


color similar al color tostado.
Alazn Dorado: pelaje brillante, similar al matiz del oro.
Alazn Bronceado: es ms oscuro que el tostado, presentando zonas bronceadas especialmente
en los ijares, muslos y anca.
Alazn Vinoso: capa ligeramente rojiza, similar al vino de cereza.
En el pelaje alazn se puede presentar caballos con crines claras o casi blancas pero nunca ms
oscuras que el resto del pelaje y mucho menos negros.

Las capas simples parciales presentan sus grupos as:

BAYO: pelaje amarillento (mezcla de pelos amarillos y blancos predominando los pelos amarillos)
presenta raya de mula y acebraduras, con cabos oscuros, se presentan las siguientes tonalidades.

http://uco.es

Bayo Claro: color amarillento claro.


Bayo Oscuro: tono subido con relacin a la anterior (quemadura).
Bayo Naranja o Naranjuelo: pelos similares al color de la cscara de la naranja madura.
Bayo Cervuno: similar al color de los ciervos: es decir fondo bayo o amarillento con la punta de los
pelos negros generando pelajes ligeramente oscuro.

CASTAO: color rojizo oscuro parecido al color de la cscara de la costea o de avellana madura
(mezcla de pelos rojos y negros predominando los pelos rojos), presenta crines, cola y remos
negros. Es el pelaje de mayor incidencia. Presenta las siguientes tonalidades:

Tomada Pesebrera El Puente - Neiva

Castao Claro: matiz apagada, como desteida.


Castao Oscuro: ligera, parecido al zaino o al negro peceo. Las regiones de las axilas, pecho,

33
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

vientre, ijares entre otras son rojizas.


Castao Dorado o Boyuno: color rojo encendido, llamado tambin castao sangre de toro o coral,
sus cabos son negros.

ISABELA: pelaje habano o caf en leche, la cola y los remos son ms oscuros que el resto del
cuerpo. Presentndose tambin animales con remos crines y cola claras denominndose a esta
variedad Isabela dorada o palomino (mezcla de pelos blancos y amarillos predominando los pelos
blancos), sus tonalidades son:

www.3caballos.com

Isabela Claro: color amarillo plido, con cabos ms claros.


Isabela Oscuro: color amarillo oscuro con crin, cola y cabos ms oscuros.

RATONERO RUCIO O CISNE: compuesto de pelos grises cenizos con extremidades y crines
negras suele presentar raya de mula y remos asegurados. Sus variedades son:

http://www.ansi.okstate.edu/breeds/horses/

Ratonero Claro blanquecino plida.


Ratonero Oscuro: tono negrusco.
Ratonero Ordinario o Comn: similar al color de los ratones.

CAPAS COMPUESTAS.

Son aquellas capas compuestas por pelos de dos o ms colores, en que estos pueden aparecer
revueltos o bien distribuidos por reas o zonas perfectamente delimitadas. Las capas compuestas
se dividen as:

Capas compuestas combinadas o entre mezcladas.


Capas compuestas a manchas.

Las capas compuestas combinadas son aquellos pelajes entre mezclados con mayor, igual o
menor proporcin de cualquiera de los colores estos son:

TORDO O TORDILLO: capa integrada por pelos blancos y negros entre mezclados. Denominado

34
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

tambin como moro.

Tomada Pesebrera El Puente - Neiva

Tordo Claro: mayor proporcin de pelos blancos.


Tordo Ordinario: igual proporcin de pelos blancos y negros
Tordo Oscuro: predomina los pelos negros, suele presentarse la particularidad oscura en la
cabeza, cuello, y tren posterior, denominndose entonces moro.

A su vez el moro presenta las siguientes variedades:


Moro Azul: piel morena y dentro de la combinacin de blanco y negro, da visos azules llamndose
moro apizarrado.
Moro Pajizo: color similar a la paja seca.
Moro Rozado (melado): presenta visos rojizos especialmente en el anca, muslos y costillares.
Moro Verbeno: cabeza oscura o negra y capa blanca rojiza.
Moro Pataconeado: en esta capa los pelos negros de la mezcla se agrupan o arremolinan en reas
pequeas ms o menos en las costillas, anca y muslos, asimilando rodajas o patacones.

RUANO O ROANO: capa entre mezclada compuesta por pelos blancos, negros y rojos (bayos),
remos oscuros o negros. Encontramos las siguientes variedades:

www.3caballos.com

Ruano Claro: predominan los pelos blancos.


Ruano Oscuro: predomina los pelos negros.
Ruano Azcar o Canela: predominan los pelos rojos.
Ruano Ordinario: igual proporcin de los tres colores.

35
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

ZAINO: es un pelaje entre mezclado de pelos negros y rojos con predominio de los pelos negros
dando visos rojos en el ijar y en el anca.

Tomada Pesebrera El Puente - Neiva

Rocillo: capa integrada por pelos blancos y rojos o ligeramente castaos, conocido por los
caballistas como color rozado.

CAPAS COMPUESTAS A MANCHAS.

Son aquellas integradas por pelos de dos o ms colores, pero estos se hayan dispuestos en
manchas perfectas, delimitadas o definidas.

En equinos tenemos la capa pinto o pi:


Capa cuyo fondo son las manchas blancas, alternadas con manchas de otro color. Esta capa no es
aceptada en nuestros caballos de paso

http://www.ansi.okstate.edu/breeds/horses/

Leccin 7 PARTICULARIDADES DE LAS CAPAS.


Entre las particularidades ms frecuentes en los equinos encontramos:

Rubicana: consiste a que ciertas capas oscuras como el castao, alazn, zaino, negro etc.
Presentan numerosos pelos blancos por todo el cuerpo a manera de crines.
Rabicanos: presencia de cerdas claras o blancas en cola.
Lavado: equino con axilas, vientre, ijares y bragada de un matiz ms apagado que el resto del
cuerpo.
Acebrado: es cuando se presentan, fajas negras transversales, especialmente en los remos,
semejantes a las de las cebras.
Raya de mula: franja caf u oscura, que se extiende desde la cruz hasta la raz de la cola.
Banda crucial: raya oscura que partiendo de la cruz se dirige lateralmente y hacia abajo sobre el

36
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

remo anterior, llegando en ocasiones hasta el antebrazo. Remendado: pelajes con reas de
distintos tamaos y limites irregulares. Enladrillado: se presentan figuras de pelos oscuros en forma
de ladrillo los cuales se ven en la regin del dorso, lomo y en ocasiones en la grupa.
Aleopardado: en capas claras presencia de capas negras parecidas a la del leopardo.
Carbonaduras o atizonaduras: seales oscuras o negras prolongadas.
Atruchado: sobre pelajes claros se observan pequeas manchas rojizas o marrones. Comn en
equinos tordillos y moros.
Mosqueado: en capas claras, presentan pequeas manchitas negras. Caractersticas propias de
moros y tordillos.
Nevado: en capas oscuras y negras presentan pequeas manchas blancas. Hosco: el pelaje se
oscurece ms en algunas regiones del exterior, como la cabeza el cuello, el tren posterior y los
remos.

BLANCOS DE LA CABEZA.
Estrella: pequeo grupo de pelos blancos de forma irregular localizada en la frente.

Tomada Pesebrera El Puente Neiva

Lucero: mancha blanca de mayor tamao que la estrella y de forma regular o irregular. Cuando el
lucero es prolongado hacia abajo se denomina lucero o listn corrido o cordn corrido si llega al
extremo de la nariz se denomina listn corrido y prolongados, si el listn es interrumpido se
denomina listn interrumpido.

Tomada Pesebrera El Puente Neiva

Careto: en el prcticamente, dos terceras partes de la cara son blancas la piel generalmente es
rosada o despigmentada; estos equinos pueden tener problemas de fotosensibilizacin que
ocasiona dermatitis.

37
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tomada Pesebrera El Puente Neiva

Listn: banda de pelos blancos sobre fondo diferente que va desde la crines pasando por el medio
de los ojos a los ollares.

Tomada Pesebrera El Puente Neiva

Malacara o lucero listn ancho: mancha blanca muy grande.

Tomada Pesebrera El Puente Neiva

Recorte: mancha blanca entre los ollares.

Tomada Pesebrera El Puente Neiva

Cara blanca: equino de otro color y la cara blanca.

38
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Listn corrido: cuando toca el labio superior o toca ambos labios.


Cuando el blanco de la cabeza toca el labio superior se denomina que el equino bebe con el labio
superior o que bebe blanco

Tomada Pesebrera El Puente Neiva

Si la mancha abarca el labio inferior bebe con el labio inferior, si ambos labios son blancos se
denomina que el equino bebe con ambos labios.

De igual manera suelen encontrarse equinos con manchas rosadas entre los ollares cubiertos por
una vellosidad fina, resendose este como liso de narices.

BLANCO DE LOS REMOS.

Cuando el pelaje se presenta blanco y con despigmentacin de la piel, en la parte inferior de los
remos o extremidades en zonas o reas de diferentes longitud se dice que el equino es calzado.

En caballos colombianos de exposicin se aceptan manchas blancas o de pigmentaciones, solo,


hasta ms debajo de los carpos pero no hasta los corvejones. Tales manchas no ocasionan un
cambio en el nombre que se le da al color del equino as:
Cuando un caballo posee:

- Una extremidad blanca se le denomina monoalba

39
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tomada Pesebrera El Puente Neiva

- Dos extremidades blancas se le denominan dialbo o bialbo.

Tomada Pesebrera El Puente Neiva

Tres extremidades blancas se le denominan trialbo

Tomada Pesebrera El Puente Neiva

- Cuatro extremidades blancas se le denominan polialbo o cuatrialbo.

40
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tomado Pesebrera El Puente Neiva

En la prctica el factor calzado al igual que el careto, predispone al ejemplar que lo posee a
padecer dermatitis, que con el tiempo merma el rendimiento del ejemplar.
Segn la extensin de la mancha blanca en el factor calzado los equinos se clasifican como:

Lunar o corona: pequea mancha blanca que rodea parcialmente el borde coronario del casco.

Calzado bajo: mancha blanca desde el casco, pasando por la cuartilla sin tocar el menudillo.

Calzado: mancha blanca desde el casco hasta el menudillo.

Calzado alto: cuando la mancha blanca cubre el remo hasta tocar la caa.

Calzada muy alta o entero: si la mancha blanca llega al corvejn o la rodilla segn el caso o
sobrepasa estas regiones.

Taln externo blanco: mancha blanca en la corona y la cuartilla nicamente del lado externo.

Taln interno blanco: mancha blanca en corona y cuartilla nicamente del lodo interno.

Igualmente se puede utilizar esta particularidad del calzado para diferenciar a los diferentes
equinos as:

Calzado de la brida: calzado solo en la mano izquierda.


Calzado de la lanza: calzado del anterior derecho.
Calzado del sable: calzado del remo posterior izquierdo.
Calzado de la fusta: calzado del remo posterior derecho.

Cuando se trata de ejemplares calzados es comn or el trmino trabado refirindose al caballo


que es calzado de los remos anteriores, o bien si es calzado de la mano. Y la pata del mismo lado
se dir entonces: trabado lateral izquierdo o derecho segn el caso; si es calzado de los dos
posteriores o en diagonal, esto es mano y pata opuesta, se le denomina trastrabado.

ESPIGAS O REMOLINOS.

Son aquellos pelos que nacieron en direccin diferente a los del resto de la regin en que se
encuentran. Pueden ser:

Ordinario: son aquellos que presentan todos los equinos en la frente, garganta, pecho e ijar.
Extraordinarios: son aquellos remolinos presentes en cualquier otra parte del cuerpo.

Leccin 8 TIPOS DE CABEZAS EN EQUINOS.

La cabeza del animal puede presentar diferentes formas siendo la ms comn la rectangular
descarnada, con buena irrigacin e inervacin.
De acuerdo a la forma del perfil, considerado en toda su extensin o por partes, se pueden
encontrar los siguientes tipos de cabeza:

1.5.1 Cabeza de liebre: Cuando es convexa en el frontal y el resto es ligeramente plana. Este tipo
de cabeza es propia de los potros.

41
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

1.5.2 Cabeza Acarnerada: Es cuando casi en su totalidad el frontal es convexo.

1.5.3 Cabeza de Rinoceronte: En ella encontramos un frontal cncavo. Este tipo de cabeza hace
que el animal genere una mala presentacin, demostrando en algunos casos dificultad al respirar
debido a la estrechez de sus fosas nasales.

1.5.4 Cabeza cuadrada: En esta encontramos un perfil rectilneo y su longitud es mediana con
buena anchura y profundidad. Este tipo de crneo hace ver al equino con cierta gracia; es una
caracterstica propia de razas orientales como es el caso de la Berberisca.

Figura 4. Tipos de cabeza Segn el Perfil


Tomado de Zootecnia General de la UNAD

Cabeza Acarnerada Cabeza de Liebre Cabeza Normal

Cabeza de Rinoceronte Cabeza Cuadrada

Leccin 9 TIPOS DE CUELLOS EN EQUINOS.

Por lo general la forma del cuello es ligeramente piramidal, en donde su borde superior tiene
especial atraccin en la estampa del animal.
Su morfologa depende de cada animal, el cuello debe guardar armona entre la cabeza y el cuero.
Se puede dividir en cuatro partes:

Lnea dorsal. Lnea ventral.


Lado lateral derecho. Lado lateral
izquierdo.

De acuerdo con la forma, se conocen las siguientes variedades, algunas de las cuales son propias
y tpicas de ciertas razas; otras en cambio se constituyen en defectos, as pues, tenemos:

*Cuello de gallo o pichn: Es aquel cuello que presenta una convexidad o un ligero arqueamiento

42
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

en el borde superior.

*Cuello de cisne: Es aquel que presenta un arqueamiento ms pronunciado en la uni de la cabeza


y el cuello y el resto del borde es ms o menos recto.

*Cuello de ciervo o invertido: Aqu el borde superior se presenta cncavo y el inferior ligeramente
redondeado o contorneado. Es comn encontrarlo en animales viejos o desnutridos. Desde luego
este tipo de cuello es considerado defecto, aunque en algunos caballos esto favorece la velocidad
y puede aceptarse as, siempre y cuando no sea exagerado.

*Cuello dbil: Por lo general se presenta largo, muy descarnado, estrecho, poco profundo
especialmente en su parte anterior. Este cuello se presenta en animales en mal estado nutricional
y de salud, desmeritando de esta manera el buen desempeo y resistencia ya que casi siempre un
cuello delgado corresponde a un pecho angosto y dbil.

*Cuello golpe de hacha: En este tipo de cuello se presenta en su borde superior en el punto de
unin con la cruz una hendidura o depresin marcada.

*Cuello comn o piramidal: Es el ms comn, debe ser largo y recto.

Cuando el borde superior del cuello es muy grueso, se dice que el animal presenta GATILLO y
desde luego constituye defecto en especial en caballos de competencia y en los de silla.
Equinos dotados de un cuello corto y macizo son poco manejables, carecen de elegancia y son
denominados como CUELLO DE TORO. Otros ejemplares pueden presentar una depresin en la
tabla del cuello, especialmente hacia su parte posterior e inferior, cerca de la espalda y brazuelo,
que se conoce con el nombre de LANZADA, que es considerada por algunos caballistas como
signo de clase, aunque esto no tiene ningn fundamento.

Es de aclarar que las personas encargadas del adiestramiento y en general el manejo de los
equinos, deben saber, que la posicin, longitud y caractersticas del cuello corresponden a su
constitucin anatmica determinada por la herencia y por lo tanto no se debe forzar al animal a
tomar posiciones o a quebrar o voltear la cabeza en forma brusca, ya que con ello solo se causa
dolor y traumatismos a nivel de las vrtebras o inserciones musculares (luxaciones o esguinces)
que pueden producir merma en el rendimiento del animal y aun inhabilitarlo por temporal o
permanentemente segn la gravedad de la lesin.

El borde superior del cuello encontramos la crin o crinera que en cuanto sea ms larga, espesa o
abundante y brillante, mayor es la vistosidad del equino.

La crin debe ir hacia un solo lado, cuando se presenta a un lado y al otro se dice que la crin es
iguanera.

43
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Figura 5. Tipos de cuello

Cuello de Cisne
Cuello de Gallo o de Pichn Cuello Normal o Corriente

Cuello de Golpe de Hacha o hachazo Cuello de Ciervo o al Revs Cuello Dbil

Tomado de Zootecnia General de la UNAD

Leccin 10 APLOMOS.
Los aplomos son la direccin ms conveniente de los miembros locomotores en toda su longitud o
de las diferentes regiones por separado, con relacin al suelo o base de sustentacin, de manera
que pueda sostener bien el cuerpo para desplazarse de manera segura y fcil. Para poder
observar bien los aplomos es necesario que el animal se encuentre bien parado sobre sus cuatro
remos y posteriormente hacerlo desplazar al paso o corriendo.

Se determinan mediante lneas imaginarias trazadas desde diversas partes del exterior del equino
hasta el suelo, tomando como punto de referencia entre otras, algunas articulaciones.

Los defectos en los aplomos pueden ser congnitos o adquiridos. As pues los analizaremos de la
siguiente manera:

APLOMOS DE LA EXTREMIDAD ANTERIOR.

Vista de frente.
En ella, la lnea imaginaria sale de la parte media o delantera del encuentro, debe caer al suelo
dividiendo en dos partes iguales el resto del miembro anterior que recorre. Este se toma desde la
punta de la espalda.

Se denomina abierto de adelante cuando la lnea imaginaria o plomada queda por dentro y el
miembro por fuera, pudiendo ser unilateral o bilateral.

Es cerrado de adelante cuando la plomada queda por fuera y el miembro por dentro.

El animal cerrado de adelante posee una base de sustentacin menos firme y puede originar un
movimiento hacia los lados denominado cuneo.

44
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Otra lnea imaginaria o plomada se toma desde el antebrazo, partiendo de la parte superior y
anterior y ms estrecha del antebrazo, debe dividir el resto del miembro que recorre en dos partes
iguales.

Si la plomada queda por dentro y la rodilla por fuera, se dice que el animal es hueco de rodillas.

Si las rodillas quedan por dentro y la plomada por fuera, se dice que el animal es zambo o de
rodillas boyunas. En ambos casos son defectos de rotacin, donde
el miembro se rota quedando las lumbres hacia adentro y el codo hacia afuera; cuando las lumbres
se aproximan se dice que el animal es estebado. Pero si por el contrario al rotar el miembro las
lumbres quedan hacia afuera y el codo se dirige a los costillares, se dice que el animal es
izquierdo.

Figura 6. Aplomos y Defectos del Tren Anterior, vista de frente

Normal Abierto de adelante Rodillas boyunas

Cerrado de adelante Zambo o Chueco Hacia Patizambo o Chueco Hacia


Adentro fuera

Izquierdo
Chapn o Estevado
Tomado de Zootecnia General de la UNAD

Vista de lado (lateral) o de perfil.


La plomada parte desde la parte media y ms anterior del encuentro, debe caer aproximadamente
unos diez centmetros por delante de las lumbres del casco.

45
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Se denomina plantado de adelante cuando la distancia entre las lumbres del casco y la lnea
imaginaria es muy corta. Si por el contrario la lnea imaginaria queda muy distante (a mas de diez
centmetros) se dice que el animal es remetido de adelante.

Puede suceder que el aplomo del encuentro hasta el menudillo sea normal, pero que del menudillo
a la cuartilla haya mucha distancia lo cual ocasiona el animal pando o largo de cuartilla.

Si por el contrario, del menudillo a la cuartilla la distancia es muy corta el animal se llama
estaquillado o emballestado, y puede ocasionar el topino que es cuando el miembro
correspondiente se est apoyando en las lumbres del casco.

Cuando la plomada o lnea imaginaria parte desde la parte superior, media y externa del
antebrazo, debiendo tocar el suelo un poco por detrs de los talones del casco y dividir en dos
partes iguales la rodilla, caa y menudillo.

Si las rodillas quedan por delante y la lnea imaginaria por detrs se dice que el animal es corvo o
bracicorvo. Si la rodilla queda por detrs y la plomada por delante se dice que el equino es
trascorvo o de rodillas de carnero. Este se considera un defecto grave debido por mala nutricin
en las primeras etapas de vida o por defectos genticos.

Figura 7. Aplomos y Defectos del Tren Anterior, vista de perfil

Normal Plantado Remetido

Tomado de Zootecnia General de la UNAD

APLOMOS DE LA EXTREMIDAD POSTERIOR.

Vista posterior.
Cuando la plomada se inicia de la parte media del isquion, debe dividir el miembro que recorre, en
dos partes ms o menos iguales siendo un poco ms ancha la parte de la nalga externa y debe
tocar la punta del corvejn dividindolo en dos partes iguales hasta el suelo.
Si la plomada queda por dentro y la extremidad por fuera, se dice que el animal es abierto de
atrs; lo contrario se denomina cerrado de atrs.

46
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Si la punta del corvejn queda por dentro de la plomada se dice que el equino es zancajoso, en
general todos los caballos son zancajosos.
Si los corvejones quedan por fuera y la plomada por dentro se dice que el animal es hueco de
atrs o de los posteriores.

Si la lnea imaginaria que partiendo de la punta del corvejn dividiendo el miembro en dos partes
iguales, queda por dentro y el miembro por fuera se dice que el caballo es abierto de caas y por
el contrario, si la lnea queda por fuera y el miembro queda por dentro se dice que el caballo es
cerrado de caas.

Figura 8. Aplomos y Defectos del Tren Posterior, vista posterior

Normal Abierto de Atrs Cerrado de Atrs

Cerrado de Corvejones e Izquierdo Abierto de Corvejones y Chapn


Tomado de Zootecnia General de la UNAD

Vista de lateral o de perfil.


Desde la articulacin coxofemoral, la lnea sale de la parte media y ms saliente de la
articulacin coxal, debe caer dividiendo en dos partes mas o menos iguales los cascos, dejando
por detrs las caas y al menudillo, siendo paralelas a estos. Si no divide el casco en dos partes
iguales, quedando el miembro por detrs de la plomada se dice que el animal es plantado de
atrs, si la plomada que da por detrs y el resto del miembro por delante se dice que el animal
es remetido de atrs o sentado de las posteriores. De igual manera puede suceder que la
caa y el menudillo sean normales y que la lnea imaginaria caiga por detrs de la parte media
del casco, se dice entonces que el animal es pando de atrs, largo de cuartillas o
emballestado de atrs.

Puede suceder que de este mismo aplomo la planicie del corvejn pierda el ngulo, se dice que
el caballo es enzancado o patas de riel o de poste, generalmente este defecto es gentico.

47
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Figura 9 Aplomos y Defectos del Tren Posterior. Vista lateral

Normal Remetido de Atrs Plantado de Atrs


Tomado de Zootecnia General de la UNAD

48
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

CAPITULO 3

RAZAS EQUINAS

Introduccin

Leccin 11 CONCEPTO DE RAZA.

Se define raza como un conjunto de individuos que poseen caracteres morfolgicos y fisiolgicos
llamados etnolgicos o raciales semejantes, o que estn identificados en cuanto a su origen,
dinmica o esttica, es decir que proviniendo de una misma cepa de origen se asemejan en su
aspecto fsico y cualidades fisiolgicas y productivas. Estas caractersticas adems son
transmitidas a sus descendientes como caracteres hereditarios comunes.

Entre estas razas describiremos las de mayor importancia en el pas, tanto en animales de silla o
tiro liviano como de animales de tiro pesado y ponis.

Leccin 12. DIVERSIDAD EQUINA.

www.elrincondelascuatropatas.com

Segn la doctora Monica Menjalbert dentro de la misma especie, los hay pequeos, algunos con
cabezas que parecen talladas a mano y los colores de sus pelajes son tan diversos que nos
quedamos maravillados al verlos en algn acontecimiento ecuestre.

Esta diversidad encuentra su respuesta si nos trasladamos a una llanura en medio de una tropilla
de caballos, podremos observar que si nos encontramos en una regin de clima fro, las cabezas
de los mismos tendr una caa nasal convexa, lo cual es esencial para sobrevivir al aire helado del
invierno. En cambio, si nos encontramos en un desierto, las cabezas sern ms pequeas, con un
perfil cncavo con ollares grandes y bien abiertos, dado que el aire que respiran es ms clido.

Por lo que la adaptacin al ambiente en el que viven, producir cambios en la morfologa de sus
cuerpos. Encontrndonos aqu con un tem importantsimo en la evolucin de la especie equina.
Adems, hay que sumarle la mano del hombre en la formacin de las diferentes razas equinas,
basndose en el uso que les daran a sus caballos, recordemos que hasta principios del siglo
pasado, nuestro amigo equino era el principal medio de transporte terrestre. Teniendo en cuenta la
mano del hombre, encontramos la explicacin de porqu hay tanta diversidad en los tamaos de
los caballos.

Con respecto a la diversidad en los colores de sus pelajes, tenemos que tener en cuenta que en

49
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

estado salvaje, en las llanuras, deban mimetizarse con el medio ambiente para no ser presa fcil
de sus depredadores, por lo que se dice que el caballo con pelaje color bayo (caf con leche) es
el ms puro, dado que con este pelaje podan confundirse fcilmente con las pasturas de los
llanos.

Pero con la domesticacin el caballo, seguida por la formacin de diversas razas, nos encontramos
con una amplia gama de colores en los pelajes, desde el negro azabache, pasando por los
diferentes tonos de zainos (marrones) hasta llegar al blanco. En este punto quisiera comentar un
hecho muy particular: hay potrillos que nacen totalmente negros, pero con el pasar de los aos, su
pelaje se vuelve tordillo (gris) y en la madurez su pelaje va a ser completamente blanco, pero
conservara el color negro de su piel. Es un hecho que encuentra una explicacin en el campo de la
gentica.

Hasta aqu nos encontramos con los siguientes ejemplos de la diversidad en la especie equina:
Caractersticas morfolgicas (alzada, caractersticas en la cabeza: ojos, orejas, ollares, caa
nasal), las cuales se han afianzado en relacin al medio ambiente que rodea a cada caballo con
la intervencin de los seres humanos que moldearon a sus necesidades creando razas
especificas equinas.
Caractersticas en los pelajes, en este punto y continuando con lo dicho anteriormente, les quera
comentar que la gentica juega un papel importantsimo, a pesar que hay razas que deben tener
un color de pelaje especifico, siempre nacer algn individuo que este fuera del standard de cada
raza, porque esta caracterstica es manejada por los genes.
Para entrar en el campo de las razas equinas, les comento que se han separado, segn la
utilizacin de los mismos en dos grupos:
Animales de sangre caliente: caballos deportivos, giles, livianos, elegantes y aqu nos
encontraremos con los rabes, los cuales constituyen la raza ms pura, antigua y base para la
creacin de todas las razas deportivas, como por ejemplo, el archiconocido pura sangre de
carreras, el caballo espaol, el cuarto de milla, el criollo y todas las razas destinadas al salto de
obstculos (trakhener, silla
argentino, angloaraba, silla francs, etc.).

Animales de sangre fra: caballos utilizados para tareas de transporte de personas, para trabajos
rurales y todo lo relacionado con el uso de la fuerza motriz proporcionada por estos equinos,
caracterizados por ser de gran alzada, con pesos que oscilaban entre los 600kg y 1200kg, de
carcter muy tranquilos. Dentro de este grupo tenemos a los percherones, al caballo de tiro
argentino, el norfolk, etc.), en general podemos decir que cada pas europeo tena su raza de
caballo de tiro, actualmente, al no ser utilizados, quedan muy pocos criadores, estos animales se
usan en ocasiones especiales para fiestas tradicionales o para trabajos especficos en lugares
montaosos que no pueden ser realizados con vehculos.

Debemos aclarar que muchas razas actuales, se han formado a partir de realizar cruzas entre
estos dos grupos, lo cual ha sido muy beneficioso, dado que se han combinado cualidades de
ambos formando animales excelentes.

50
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.hormiga.or
g.c

Leccin 13 RAZAS DESILLA Y DE TIRO LIVIANO RABE

www.caballomania.com

Origen: Arabia (Egipto especialmente)


Clasificacin: Eumtrico por peso, mesomorfo por proporciones y rectilneo o ligeramente cncavo
por perfil.
Alzada: 1.40 1.50 m.
Cabeza cincelada, con frente ancha, en ocasiones ligeramente chata, ojos salientes, grandes y
brillantes, sealando inteligencia y buen carcter, orejas cortas y erguidas.
Tupe de crines sedosas.
El cuello es piramidal, ligeramente arqueado, largo, presentando una crin larga y fina. Pecho
robusto y ancho. Cuerpo compacto y musculoso con lnea dorsal casi horizontal, grupa ancha y
casi nivelada. Extremidades fuertes, estilizadas y largas en sus caas. Cola corta, de implantacin
alta (llevada en arco).
Colores de la capa: tordillo, negro, moro, alazn, y castao entre otros. Peso: 400

51
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

450kg.

La raza rabe es una de las ms antiguas que ha influido ms que en ninguna otra en la poblacin
y en el mejoramiento de otras razas de todo el mundo.

La impresin general es la de un animal fogoso y alegre que, no obstante posee un temperamento


dcil. Es excelente para soportar grandes distancias sin cansancio, aun desplazndose a veloz
carrera.

Del caballo rabe se ha dicho que posee:


Cuatro cosas anchas: la frente, el pecho, la grupa y las articulaciones. Cuatro cosas
largas: el cuello, las caas, el anca y el vientre.
Cuatro cosas cortas: el lomo (riones) las cuartillas, las orejas y la cola. Es considerado el padre de
todas las razas por su influencia ms que ningn otro, en la formacin de buen nmero de razas de
todo el mundo.

ANGLO RABE.

www.mascotamigos.com

Se le conoce como pura sangre francesa fue el resultado de cruzar ejemplares rabes y pura
sangre ingls (P.S.I.). Combina por lo tanto la entereza y resistencia tpica del rabe. Con la
velocidad y resistencia tambin del P.S.I.
Alzada: de 1.60 1.63 m. Peso: 450kg.
Colores de la capa: castao, alazn y bayo.
Se utilizan para concursos hpicos en el ejrcito, polica y aficionados particulares. Son ejemplares
de mucha velocidad y algo de fondo.

52
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

BERBERISCA

www.mascotamigos.com

Origen: Costa de Berberia.


Se cra principalmente en Libia, Argelia y Marruecos. Tambin en algunos pases de Europa.
Clasificacin: Eumtrico, mesomorfo y sub convexilneo por perfil. Alzada: 1.40
1.50 m.
Cabeza larga, sub convexilnea, cuello recto, fuerte, redondeado y provisto de crin larga y
sedosa. La cruz algo mas saliente que en el rabe, hace ver entonces el lomo ligeramente
hundido. La grupa es a menudo cortante, ligeramente cada y corta. La cola de implantacin baja,
con muchas crines y poco elegante. Extremidades medianas, de caas delgadas y finas,
espejuelos pequeos que pueden faltar en ocasiones en los remos posteriores.
Colores de la capa predominante: bayo, alazn, negro, tordillo y blanco. Peso: 430 kg.
Sin ser el ms elegante de los equinos, es inmensamente sufrido y combina una considerable
velocidad en distancias cortas con una gran resistencia de fondo. La actitud general es la silla y
como caballo de tropa, adems de transicin de carruajes liviano.

THOROUGHDREED O P.S.I. (PURA SANGRE INGLESA)

http://blogs.sawebsos.com/index.php/mascotas/2007/02/13/el_caballo

Origen: Inglaterra.
Clasificacin: Eumtrico, longilneo. Sub-convexilneo. (Intervinieron en su formacin caballos

53
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

rabes y posiblemente berberiscos).


Alzada: 1.60 1.70 m.
Cabeza aristocrtica, pequea y de frente ancha de perfil ligeramente ondulado, orejas medianas,
finas y bien puestas .cuello recto, largo, delgado y flexible; trax alto y profundo. Cruz elevada,
dorso recto. Grupa larga y casi horizontal. Cola con excelentes crines. Vientre recogido (de galgo).
Extremidades largas finas, sin exceso de musculatura. Piel delgada y flexible, recubierta de pelo
corto, de crines de cuello gruesas no muy abundantes.
Peso: 400 450 kg.
Colores de la capa: alazn castao, zaino, negro, moro tordillo.
El P.S.I; ha sido igual que su progenitor el rabe, mejorado de otras razas equinas en diferentes
partes del mundo, tanto de equinos de silla como de los ponis. Su actitud es la velocidad y por lo
tanto dentro del grupo de caballo de silla es el prototipo de carreras por excelencia.

QUARTER HORSE.

www.relinchando.com

ORIGEN: norteamericano - sur de estados unidos - Texas (King Ranch). Clasificacin: Eumtrico,
hipermtrico, longilneo y de perfil, ms o menos plano o ligeramente sub- convexilneo.
Es el producto de un cruzamiento Inter-recurrente entre razas americanas criollas (de ascendencia
espaola), la raza rabe, la P.S.I. y la percherona.
Alzada: 1.52 1.55 m.
Cabeza cuadrada con orejas cortas.
Posee un fuerte esqueleto, con macizos y poderosos cuartos traseros, hombros y brazos fuertes,
lomo corto y musculoso. Debe su nombre a las carreras de cuartos de milla en la que compite y
para los cuales es especialista.
Colores de la capa: se aceptan cualquier capa predominando, alazn, castao y zaino.
Su inteligencia y enorme agilidad hace de una montura acta para la conduccin del ganado o para
todo tipo de actividades ecuestres de recreo.

54
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Peso: 550 650kg.


Dentro del grupo de equinos de silla se le considera el tpico caballo de vaquera, y de los
campesinos que viven y mueren montados en sus cabalgaduras.

TRAKEHNER.

www.solocaballo.com.ar

Origen: alemn, desarrollada por el rey Federico Guillermo I (de Prusia). Clasificacin: Eumtrico
hipermtrico, mediolneo y perfil rectilneo o ligeramente cncavo.
Se obtuvo mediante el cruzamiento del antiguo caballo pequeo lituano, con padrillos rabes y
berberiscos, a cuya descendencia se les agrego sangre P.S.I. Alzada: de 1.60 1.62 m.
Cabeza de tamao mediana, con orejas pequeas. Cuello largo algo arqueado, un poco
descarnado, tronco mediano, de Lnea dorsal fuerte; grupa ancha, musculatura fuerte, con cola de
desprendimiento alto. Extremidades largas y finas. De bajo peso: 450 600 kg.
Dentro del grupo de equinos para silla se reutiliza como caballo de salto, en tanto que los de
menor alzada son utilizados como caballos de polo.

PALOMINO.

http://www.ansi.okstate.edu/breeds/horses/

55
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Origen: estados unidos.


Clasificacin: Eumtrico, mediolneo y de perfil ms o menos planos. Alzada de 1.55
1.60 m.
El fenotipo de estos equinos es muy parecido al del quarter horse y algo al del rabe.
La caracterstica principal es la de su pelaje Isabela o alazn, pero con crines y cola largos. Sus
ojos son claros (zarcos), se admiten seales blancas en las patas y cara. Los potrillos tienden a
oscurecer con la edad.
Se utilizan tambin como caballos de salto o de polo. Peso: 500 kg.

MORGAN

http://www.ansi.okstate.edu/breeds/horses/

Origen: Estados unidos.


Clasificacin: eumetrico, mediolineo y de perfil ligeramente sub-concabilineo. Alzada: 1.52
1.55 m.
Es un pequeo caballo de enorme vigor fsico, elegante, dcil, ligero y de gran fondo. Posee buena
conformacin dotado de hombros fuertes y extremidades cortas y musculosas, y con cascos duros.
Colores de la capa: zaino, castao, alazn y bayo
Se utiliza tanto como caballo de silla (recreo) as como para tiro liviano. Peso: mas o menos 500
Kg.

56
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

HOLSTEIN

http://www.ansi.okstate.edu/breeds/horses/

Origen: Alemania.
Clasificacin: Eumtrico hipermtrico, longilneo y rectilneo por perfil. Alzada: 1.53
1.62 m.
Cabeza larga y fina orejas pequeas y vivaces. Es de constitucin vigorosa, con amplia cavidad
torxica y fuertes cuartos traseros. Extremidades cortas delgadas pero finas.
Colores de la capa: negro, castao y bayo. Peso: 60 Kg.
Es un caballo de buen temperamento, inteligente y voluntarioso para el trabajo, se le emplea como
animal de tiro ligero, velocidad y de paseo.

TENNESSEE.

http://www.ansi.okstate.edu/breeds/horses/

57
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Origen: estados unidos.


Clasificacin: Eumtrico, longilneo y de perfil casi plano. Alzada: de
1.50 1.52 m.
Cabeza esbelta y orejas medianas y alertas. Cuello fuerte y de gran estampa (de gallo). Crin larga
sedosa, abundante, tronco largo, tren posterior vigoroso. Cola llevada en arco o en trompa lo que
le da una atractiva estampa. Extremidades largas, de mediano grosor pero bien aplomadas.
Colores de la capa: negro, alzan, bayo y zaino.
Es una excelente raza para silla con una modalidad de movimiento entre el paso y el trote, de
desplazamiento rtmico y suave. Su temperamento es tranquilo, hombros particularmente
poderosos y patas fuertes.

HANNOVERIANO.

http://www.ansi.okstate.edu/breeds/horses/

Origen: Alemania.
Clasificacin: hipermtrico longilneo rectilneo por perfil. Alzada: 1.60
1.70 m.
Cabeza larga y esbelta, con orejas cortas. Cuello largo, robusto, con crines densas y finas. Anca
fuerte, Cola larga con abundantes cerdas, alta en su nacimiento. Extremidades largas y finas.
Colores de la capa: castao, alazn, bayo y negro. Peso: 480
600 Kg.
Es una raza de gran talla, fuerte, erguida. Valiente y trabajador, el caballo hannoveriano es
utilizado como caballo de salto y para ceremonias, ya que su marcha, es muy elegante, con
movimientos largos, algo saltados. (Como trote corto).

58
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

PASO COLOMBIANO.

Tomada Pesebrera El Puente Neiva

Origen: Formacin colombiana, pero con ancestro ante todo espaol. Clasificacin:
Eumtrico, mediolneo, rectilneo o ligeramente convexilineo. Alzada: 1.46 1.48 m.
Su formacin gentica se basa en sus ancestros rabes, berberisco y andaluza, razn por la cual
se encuentran hoy en da, diferencias marcadas en los llamados caballos criollos.
Su cabeza es esbelta, parecida a la del rabe o del berberisco, con frente ancha y orejas cortas
bien colocadas. Cuello esbelto bien del tipo gallo o del tipo cisne, con una crin abundante, larga y
sedosa. Tronco mediano, con masas musculares aceptables, de buena profundidad y amplitud,
anca redonda, ligeramente inclinada. Cola llevada como en pluma o llamada tambin partida con
cerdas largas, finas, sedosas y ligeramente onduladas.
Extremidades medianas, fuertes y bien aplomadas.
Colores de la capa: castao, moro, zaino, bayo, alazn, negro, bayo cervuno, tordillo rocillo, roano
y rucio.
Peso: 450 Kg.

Teniendo en cuenta el origen del caballo de paso fino, parece haber heredado cualidades fsicas,
de trabajo y de comportamiento as:
La elegancia de sus movimientos la pudo haber heredado del andaluz; el bro y la perfeccin de las
lneas del rabe y la calidad y resistencia (fondo) del berberisco. Dentro de los caballos de silla, se
les utiliza como ejemplares de recreo y transporte, en las modalidades de paso, trocha pura, trote y
galope, trocha y galope. Los aires de nuestros equinos son reconocidos en todo el mundo por su
elasticidad y suavidad, por la exactitud de sus movimientos, su buen ritmo, su cadencia y por su
elegancia.

En los pasos de nuestro pas se destacan cuatro modalidades.

El paso fino Colombiano es un aire de marcha corta, en el que el equino se desplaza por bpedos
laterales, esto es mano y pata del mismo lado, en sucesivas batidas de sus remos, pudindose
or en pistas sonoras o piso duro cuatro golpes seguidos correspondientes a la colocacin
alternante de sus remos en el suelo. Los movimientos rtmicos, flexionando sus articulaciones y
levantando muy poco las extremidades del piso, por lo cual es el movimiento ms seguro y suave.

Este paso es un poco complejo de entender por lo que se realiza en 8 tiempos, as:

59
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

En el primer tiempo la mano derecha esta en el aire y las tres extremidades restantes en el piso.
En el segundo tiempo mano derecha y pata izquierda en el aire, extremidades restantes en el piso.
En el tercer tiempo la pata izquierda esta en el aire y las extremidades restantes en el piso.
En el cuarto tiempo la mano izquierda y pata izquierda en el aire, extremidades restantes en el
piso.
En el quinto tiempo la mano derecha e izquierda en el aire, y las extremidades posteriores en el
piso.
En el sexto tiempo la mano izquierda y la pata derecha en el aire y las extremidades restantes en
el suelo.
En el sptimo tiempo la pata derecha en el aire y las extremidades restantes en el piso.
En el octavo tiempo la mano y pata derecha en el aire y las extremidades restantes en el suelo.
Los equinos de paso fino Colombiano poseen una gran elasticidad en su tren posterior lo que da
una suavidad y tranquilidad en su anca.

El trote y galope es un aire de marcha alta en el que el equino se desplaza por diagonales esto
es mano y pata opuesta, pudindose or en suelo duro dos golpes o tiempos seguidos
correspondientes a la colocacin simultanea de sus bpedos (mano y pata opuestas) en el primer
tiempo encontramos mano izquierda y pata derecha y el segundo tiempo mano derecha y pata
izquierda. El movimiento es igualmente suave, rtmico, el avance es mayor comparado con el paso
fino en la pista suena TAS, TAS, TAS, TAS.
En cuanto al galope es un movimiento de tres tiempos con apoyo posterior, marcando el primer
tiempo en una de los miembros posteriores, el segundo tiempo con la otra pata y mano opuesta y
el tercer tiempo con la mano contraria. Con sus remos posteriores se impulsa y con los anteriores
avanza, escuchndose en la pista un sonido similar a CATORCE, CATORCE, CATORCE,
CATORCE.

La trocha y galope tambin es en aire de marcha alta, parecido al trote, pero algo descompuesto,
ac tambin se desplazan por diagonales pero se demora mas en colocar en el suelo la mano
que la pata opuesta y por esa razn tambin se pueden or cuatro golpes al tocar el piso, uno por
cada remo colocado.
La trocha la realiza en cuatro tiempos en la cual el equino mueve en forma alterna mano y pata
opuestas, pero el animal asienta primero la mano derecha primer tiempo, luego la pata izquierda
segund tiempo, mano izquierda tercer tiempo y pata derecha el cuarto tiempo, generando un
sonido similar a TRAS, TRAS, TRAS, TRAS.
El galope es un movimiento de tres tiempos con apoyo posterior, se marca el primer tiempo con
uno de los remos posteriores el segundo con el otro remo posterior y mano opuesta y el tercer
tiempo con la mano contraria, se genera un sonido similar a CATORCE, CATORCE, CATORCE,
CATORCE.

La trocha pura es un ritmo cuyos movimientos son diagonales en 4 tiempos en el cual el caballo
mueve en forma alterna mano y pata opuestas, mano derecha, pata izquierda, mano izquierda,
pata derecha; pero el animal asienta primero la mano derecha (primer tiempo), luego pata
izquierda (segundo tiempo), mano izquierda (tercer tiempo), pata derecha (cuarto tiempo).Posee
mas velocidad que los trotones.

En la pista suena TRAS, TRAS, TRAS, TRAS, TRAS.


Esta modalidad solo ejecuta el ritmo de la trocha ms no el del galope.

Del caballo se ha dicho que debe tener algunas cualidades tanto del hombre como de algunos
animales, as:

Del zorro: agilidad, ligeraza, cola al aire. Del gallo: ojo vivo,
pecho ancho y elegancia.
Del buey: pisada firme, fortaleza y mansedumbre. Del cura: nuca
gruesa, testculo largo, buen apetito.

60
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

De la mujer: nalga redonda, buenos movimientos, manso al montar.

Leccin 14 RAZAS DE TIRO PESADO.

PERCHERONA

http://ar.geocities.com

Origen: Regin de perche en Francia. Clasificacin: Hipermtrica,


mesomorfa y rectilnea.
Alzada: 1.52 1.70 m. (variedad mediana y grande).
Cabeza cuadrada, pesada, de frente plana y corta, orejas pequeas, boca grande, cuello robusto,
con el borde superior convexo y el inferior recto. Tronco cilndrico, poderosamente musculado, con
pecho y lomo ancho, grupa muy potente, apenas ligeramente inclinado. Extremidades de largo a
mediano, cascos generalmente grandes y muy apreciable la cerneja.
Color de la capa: predominan los tordillos y los moros en ocasiones pataconeados, as mismo
pelajes negro y zainos.
Peso: flucta entre 600 900 kg. Segn el tipo que se considere.
Es una raza fuerte, pesada bien proporcionada. Se le utiliza como trotador de tiro pesado.

61
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

BELGA (variedad brabanzn).

http://agronomia.uchile.cl

Origen: Blgica.
Clasificacin: Hipermtrica, braquimorfa y de perfil prximo al tipo rinoceronte. Alzada: 1.65
1.75m.
Cabeza cuadrada ancha, musculosa, con perfil de rinoceronte (ligeramente hundido el nasal)
orejas pequeas. Labios gruesos, cuello corto, musculoso, con borde superior ligeramente
arqueado y crin abundante y doble (le cae a lado y lado) con crines largas gruesas y rizadas. La
cruz es ancha carnosa y baja. Tronco ms o menos corto cilndrico grueso, lnea dorsal ancha y
hundida, grupa ancha, doble, redondeada, y musculosa, con la cola de insercin baja y poco
poblada. Extremidades largas. Muy desarrolladas muscularmente, especialmente en las regiones
del muslo y d la pierna. Cerneja desarrollada, que abarca parte de las caas.
Color de la capa: zaino, alazn, castao, bayo. Peso: puede
sobrepasar los 1000 Kg.
Constituye un caballo de tiro apacible (lento) con paso firme extraordinario poder de arrastre. Es
algo voluntarioso.

62
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

SHIIRE.

http://www.ansi.okstate.edu/breeds/horses/

Origen: condados centrales (Shires) de Inglaterra. Desciende del antiguo caballo negro irlands,
cuyos antepasados fueron los grandes caballos medievales. Clasificacin: hipermtrica,
braquimorfa, convexilneo.
Alzada: hasta 1.80 m. es una de las razas ms corpulentas del mundo.
Cabeza grande larga, acarnerada, orejas cortas. Cuello largo y grueso, profundo a nivel de la
insercin con el tronco. Cruz alta, dorso corto, ancho musculoso. Grupa larga y ancha, musculada
y casi horizontal.
Cola de insercin baja. Extremidades largas, fuertes con pelos largos que se manifiestan
principalmente en la rodilla y el corvejn hacia abajo, determinando las rodillas patas peludas con
polainas. Casco grande.
Colores de la capa: negro, castao, moro pataconeado, zaino, tordo y bayo.
Peso: oscila entre 800 1000 Kg. Pero hay ejemplares que llegan hasta los 1200 Kg.
Raza excelente para desplazar cargas de varias toneladas, excelente para labores agrcolas y
como animal de tiro urbano.

CLYDESDALE.

63
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

http://www.ansi.okstate.edu/breeds/horses/

Origen: Gran Bretaa (valle del clyde). Clasificacin:


hipermetrica, mesomorfa, rectilneo. Alzada: 1.62 1.70 m.
Cabeza grande de perfil recto, orejas grandes, mviles algo cadas. Cuello fuerte macizo, de
longitud mediana, cruz algo alta, ancha y musculada. Lnea dorsal fuerte. Grupa ancha casi
nivelada. Vientre recogido. Extremidades largas y gruesas. Cascos grandes y slidos. Sus remos
son igual que los del SHIIRE, peludos del carpo y el tarso hacia abajo (enzamarrados).
Colores de la capa: zaino, castao, tordo, alazn y negro. Suele presentar el factor calzado en
sus cuatro patas lo mismo que la cara blanca (listn corrido).
Peso: oscila entre 750 900 Kg.
Es una raza famosa por su gran actividad, bondadosa, desenvuelta, con sus movimientos
musculares de gran agilidad. Es un excelente animal de tiro.

SUFFOLK

www.mascotamigos.com

Origen: regin de East Anglia al Este de Inglaterra. Clasificacin:


hipermetrica, mediolneo longilneo, rectilneo. Alzada: 1.60 1.62 m.
Cabeza proporcional en longitud y anchura, orejas cortas y abiertas. Cuello corto profundo, algo
musculado crin fina. Tronco largo robusto. Sin exceso de musculatura. Lnea dorsal ancha y fuerte.
Grupa larga y redonda. Pecho ancho desarrollado muscularmente. Extremidades gruesas,
redondeadas, con pelos nicamente en la regin de la cerneja. Casco slido y ms o menos
grande piel fina y pelo corto.
Color del pelaje: alazn desde el tostado hasta el crema plido. Peso: 750
850 Kg.
Una raza activa excelente para trabajos agrcolas. Longeva, dcil, de disposicin constante para
sus labores, ya que tiene buen fondo.

ARDENES.

64
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

http://www.ansi.okstate.edu/breeds/horses/

Origen: regin de las Ardens (frontera Francia Blgica). Clasificacin:


hipermtrico, mesomorfa y sub concavilnea. Alzada: 1.55 1.60 m.
Cabeza ancha algo descarnada no muy larga. Orejas cortas. Cuello corto con excelentes crines
que en ocasiones se le peinan a manera de moo o trenza. Tronco largo, macizo, grupa ancha,
redonda musculosa. Cola de insercin baja y poblada de cerdas largas. Extremidades con
msculos fuertes, desarrollados. Cascos grandes. Presenta tambin pelos largos en la parte ms
distal de sus patas.

Color de la capa: alazn, zaino, rocillo, ruano y bayo. Peso: 500


600 Kg.
Es una raza extraordinariamente dcil y paciente idnea para labores de tiro en actividades
agrcolas y urbanas, ya que es resistente al cansancio y muy rustica.

BRETN.

http://uco.es

Origen: regin de bretaa, al noroeste de Francia.

65
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Clasificacin: hipermtrica, mesomorfa y sub concavilnea por perfil. Alzada: 1.60 m.


Cabeza corta y ancha con orejas medianas. Cuello corto, profundo, macizo y con crinera larga.
Tronco mediano y cilndrico. Grupa ancha, algo inclinada, extremidades musculosas, fuertes con
buena cerneja.
Color de la capa: bayo, alazn, ruana y hasta zaino. Peso: 500
600 kg.
Se distinguen el bretn de tiro, cuya sangre es una mezcla de perchern, ardenes y boulones; el
portier caballo de de trote por cuyas venas corre sangre del trotador de Norfolk y de Hacckney, y el
corlay (hoy escaso) animal mas ligero de silla y de tiro que lleva sangre rabe y P.S.I. Esta raza es
activa y de buen temperamento.

Leccin 15 PONIS.

De los caballos primitivos TARPAN, de las estepas rusas, del caballo salvaje de Mongolia, llamado
tambin de PRZEWALKI, se han derivado la mayora de las actuales razas y variedades de
equinos ponis que se encuentran en los diferentes pases del mundo, algunas de ellas son:

SHETLAND.

http://www.ansi.okstate.edu/breeds/horses/

Origen: Islas del Shetland en gran Bretaa.


Clasificacin: Elipomtrica. Braquimorfa mesomorfa y concavilnea por perfil.
Alzada: 0.90 1.05 m.
Cabeza pequea y ancha, armoniosa e inteligente, con ojos muy vivos. Orejas pequeas. Tupe
largo, desarrollado que le tapa la frente y parte de la cara. Crindensa y larga. Tronco mediano, con
lnea dorsal ms o menos hundida. Trax amplio. Cola descendida y poblada de cerdas largas,
remos cortos.
Colores de la capa: negro, zaino, castao, y pos.
Peso: 180 200 kg.
Inicialmente la raza fue utilizada por los hacendados para trabajar la tierra y como bestia de carga
y aun como equino de silla. La mecanizacin lo ha desplazado de estas labores, en cambio ha
ganado popularidad en montura para nios. La raza es fuerte, resistente y longeva.

66
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

WELSH PONY.

http://www.ansi.okstate.edu/breeds/horses/

Origen: Gales (Gran Bretaa).


Clasificacin: Elipomtrica, Mesomorfa, Concavilnea. Alzada: 1.25
1.32 m.
Cabeza pequea y muy viva (menuda), con tupe fino de mediana longitud. Cuello mediano, fuerte,
sin exceso de musculatura, con larga y sedosa crinera. Cola de insercin de mediana a alta, con
cerdas abundantes y largas, de movimientos graciosos. Remos de longitud mediana, finos y
fuertes.
Color de la capa: cualquier color, excepto los pos. Peso: 250
350 kg.
El equino Welsh es un animal valiente e inteligente. Se le emplea como caballo de silla
especialmente para nios; tambin como ejemplar de tiro de coches.
Existen otras variedades de ponis tales como: PONY de las montaas de Gales, el tipo Cob y el
pony de polo; todos ellos de ascendencia Britnica.

67
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

NEW FOREST.

http://www.ansi.okstate.edu/breeds/horses/

Origen: rgion de New Forest en Hampshire, Inglaterra. Clasificacin:


Elipometrica, Medialnea y rectilnea por perfil. Alzada: 1.22 1.40 m.
La cabeza tiende a ser grande con tupe corto y sedoso. Orejas medianas y alertas. Cuello corto,
crin fina. Tronco medido con masas musculares suaves. Grupa redonda. Remos finos. Cola
poblada y suelta.
Color de la capa: negro. Bayo, Isabela, castao. No se aceptan pos. Peso: 300
330 kg.
La raza se destaca por la firmeza del paso y de su adaptabilidad, y en general se mueven bien con
la silla, gracias a la adecuada cada de la espalda. En su mayora tienen una slida osamenta,
resistiendo el peso de su cabalgadura sin denotar cansancio; su carcter dcil facilita su manejo
por parte de los nios.

68
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

EXMOOR.

http://www.ansi.okstate.edu/breeds/horses/

Origen: condados de Devon y Somerset en Inglaterra. Clasificacin:


elipometrica, mesomorfa y rectilnea por perfil. Alzada: 1.20 1.25 m.
Cabeza corta y gruesa con tupe revuelto y spero, orejas cortas y puntiagudas. Cuello corto de
crines densas. Sus ojos prominentes con pesados parpados superiores, le confieren una mirada
desviada, tpica de esta raza. Lomo corto. Poderosos cuartos traseros extremidades cortas y
huesudas el pelaje es corto y pegado al cuerpo prcticamente impermeable.
Colores del pelaje: bayo, zaino, castao, colores que tienden a aclararse en la parte anterior de la
cabeza, alrededor de los ojos, parte posterior del vientre y en las bragadas.
Peso: 230 300 kg.
Es un pony excepcionalmente recio, vigoroso, resistente y muy sufrido. Inteligente e independiente.
Se utiliza para silla de nios y traccin de carruajes.

69
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

FALABELLA.

http://www.ansi.okstate.edu/breeds/horses/

Origen: Argentina.
Clasificacin: elipomtrico, braquimorfo y sub concavilnea por perfil. Alzada: 0.70 m.
Cabeza pequea con tupe abundante. Orejas cortas, tronco corto y poco musculado, cola larga
remos muy cortos y huesudos.
Color de la capa: cualquier color.
l ha recibido influencia de pequeos pura sangre ingleses con menudos ponis Shetland. Se utiliza
para tiro especialmente y trabajos domsticos. Tienen carcter amistoso y es inteligente. Es el
pony ms pequeo del mundo.

Actividades de Autoevaluacin de la Unidad 1

Preguntas sobre la Unidad

Actividades prcticas relacionadas con la unidad

Fuentes Documentales de la Unidad 1

70
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

71
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

UNIDAD 2

Nombre de la Unidad
Introduccin

Justificacin
Intencionalidades Formativas
Denominacin de captulo 4
Denominacin de Leccin 16
Denominacin de Leccin 17
Denominacin de Leccin 18
Denominacin de Leccin 19
Denominacin de Leccin 20
Denominacin de captulo 5
Denominacin de Leccin 21
Denominacin de Leccin 22
Denominacin de Leccin 23
Denominacin de Leccin 24
Denominacin de Leccin 25
Denominacin de captulo 6
Denominacin de Leccin 26
Denominacin de Leccin 27
Denominacin de Leccin 28
Denominacin de Leccin 29
Denominacin de Leccin 30

72
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

UNIDAD 2.
MANEJO DE LA PRODUCCION EQUINA

CAPITULO 4: NUTRICIN Y ALIMENTACIN DEL EQUINO

Tomada en Pesebrera El Puente - Neiva

Introduccin
La nutricin implica diversas reacciones tpicas y procesos fisiolgicos que trasforman los
alimentos en tejidos corporales y esta comprendida por la ingestin, digestin y absorcin de los
diferentes nutrientes, su transporte hacia todas las clulas del cuerpo, as como la eliminacin de
elementos no utilizables y productos de desecho del metabolismo.

En los equinos es mas importante an comparado con otros animales, que alimento sea de buena
calidad que no estn enmohecidos, alterados o mezclados con polvo, pues los caballos estn mas
expuestos que otros animales a ingerir alimentos alterados, y el heno u otro forraje polvoriento
aumenta el riesgo de enfermedades por vas respiratorias.
Desde el punto de vista digestivo, se reconoce que el caballo es un animal muy frgil, son muchas
las razones que se invocan para explicarlo, entre las cuales diremos inicialmente que las
particularidades de su anatoma y fisiologa adems de la gran variedad de regmenes a los que
est sometido, contribuyen o son el origen de bastantes problemas en esta especie.
La digestin de los equinos se caracteriza por ser a la vez una digestin microbiana (que se realiza
en intestino grueso), en los caballos hay dos tipos de necesidades las de mantenimiento y las de
utilizacin. Las necesidades de mantenimiento, corresponden a los gastos de la vida en
condiciones normales y las de utilizacin que corresponden a aquellas que se producen a causas
de la utilizacin del caballo determinando as que las necesidades de energa, protenas, lpidos,
fibra, minerales y vitaminas sern distintas para cada animal de acuerdo a su funcin y estado
fisiolgico entre otras.

73
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Leccin 16 ANATOMA Y FISIOLOGA DEL APARATO


DIGESTIVO DEL EQUINO.

www.3caballos.com

El caballo es un herbvoro monogstrico con un tubo digestivo que se caracteriza por poseer un
estmago relativamente pequeo y un intestino grueso que por el contrario es muy desarrollado. El
sistema digestivo consta de rganos a los que concierne directamente la recepcin y digestin de
los alimentos, su paso a travs del cuerpo y la expulsin de la parte no absorbida. Este conjunto de
rganos podra dividirse en dos grupos principales:

- Conducto Alimentario.
- rganos Accesorios.

El conducto alimentario es tubular y msculo-membranoso y se extiende desde los labios hasta el


ano. El conducto consta de los siguientes segmentos consecutivos:
- Boca
- Faringe
- Esfago
- Estmago
- Intestino delgado
- Intestino grueso

Los rganos accesorios son:


- Dientes
- Lengua
- Glndulas salivales
- Hgado
- Pncreas

En el Cuadro se presenta una comparacin entre el tracto digestivo del caballo y del buey. En el
Cuadro siguiente se muestra la relacin entre longitud y capacidad de los diferentes segmentos
del tracto gastrointestinal del equino.

74
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tabla 9. Tracto digestivo del caballo comparado con el del buey.


Longitud en metros Volumen (Litros) Volumen de las diferentes
partes (litros)
En total Relacin con la TOTAL Por 100 kg Estmag Intestinos Ciego
Longitud del peso vivo o
Cuerpo
Caballo: 30 20/1 230 40 15 190 30
Buey: 50 30/1 320 50 200 110 10

Tabla 10. Diferentes segmentos del tubo digestivo del caballo.


Longitud Longitud Capacidad Capacidad
media m. relativa p.100 media 1 relativa p. 100
Estmago 15 - 18 8,5
Intestino delgado 22 75 64 30
Ciego 1 4 30-35 16
Colon grueso 3-4 11 80-90 38
Colon pequeo 3 10
Colon pequeo y 15 7
Recto
30 200-220

Conducto Alimentario.

Boca: El trmino boca se usa comnmente para significar cavidad u orificio de entrada del
alimento. Es, en el caballo, una larga cavidad cilndrica que, cuando est cerrada, se halla casi
enteramente llena por las formaciones que aloja en su interior y comprende: los labios, las mejillas,
las encas, el paladar duro, el paladar blando, el suelo de la boca (formado por el cuerpo de la
mandbula) y el istmo de las fauces que es el orificio de comunicacin entre la boca y la faringe.
Las funciones de la cavidad bucal y sus anexos comprenden aprehensin, masticacin,
insalivacin y formacin del bolo alimenticio.

La digestin comienza con el ingreso del alimento en la cavidad bucal, tras haber sido apreciada su
calidad por los rganos de los sentidos. La forma de aprehensin de los alimentos est en
consonancia con su naturaleza y constitucin, en los que los dientes, los labios, la lengua, y la
cabeza y a veces las extremidades anteriores participan en diversa proporcin. Los quidos utilizan
sobre todo sus labios, que son fuertes, mviles, y sensibles. La aprehensin de los alimentos
slidos est asegurada por el labio superior muy vigoroso y capaz de efectuar una excelente
seleccin alimenticia; las hierbas una vez cogidas con los labios, son introducidas entre los
incisivos y trituradas; un ligero movimiento oscilatorio de la cabeza hacia abajo, o de lado, ayuda a
arrancar los bocados. Para la aprehensin de las briznas de forraje, granos y heno, se sirve de
los labios y de la lengua. En el caso de races carnosas los quidos arrancan bocados de ellas
mediante los incisivos. El labio superior es igualmente indispensable para el mantenimiento de los
alimentos en la boca durante la masticacin.

El abreviamiento se hace por absorcin como los herbvoros en general, gracias a la lengua que
funciona como un pistn en el interior de la boca hermticamente cerrada; la integridad de la
cerrazn de los labios es por consiguiente necesaria. Para beber los caballos introducen solamente
la parte media de su abertura labial en el lquido. Mediante descenso del maxilar inferior y
retroceso de la lengua, se produce una presin negativa en la cavidad oral, lo que provoca la

75
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

succin del lquido a travs de la abertura labial. Por otra parte, hay que sealar que con
frecuencia el caballo sopla sobre su comida antes de consumirla. El polvo que se puede
desprender por este motivo, puede irritar las vas respiratorias hasta provocar una tenaz tos de
pesebrera. La humidificacin de los forrajes algo polvorientos es sin duda un buen paliativo.

Faringe: La faringe es un conducto para el paso comn de alimentos y del aire inspirado, tapizado
de mucosa y rodeado de msculos (saco msculo membranoso). Es algo infundibuliforme; su
porcin anterior ancha, se une con la bota y con la cavidad nasal, mientras su pequea extremidad
posterior se contina con el esfago. La faringe puede dividirse un tanto arbitrariamente en
porciones oral, nasal y larngea. Mide en el caballo aproximadamente 15 centmetros de longitud y
toma importancia cuando en ella se asientan procesos inflamatorios e infecciosos que se extienden
con facilidad por las tubas auditivas o de Eustaquio hasta las bolsas guturales y el odo medio
provocando trastornos agudos o crnicos de difcil solucin.

Esfago. El esfago es un tubo msculo membranoso, de 125 a 150 centmetros de longitud,


que se extiende desde la faringe hasta el estmago, posee porciones cervical, torcico y
abdominal y una vez atraviesa el hiato esofgico del diafragma termina inmediatamente en el
orificio cardinal del estomago.

Es importante tener en cuenta que el tono muscular del esfago cerca al estomago no permite que
el caballo vomite, por lo cual en caso de que el caballo tenga una distensin, este se rompe antes
de vomitar. Esta situacin exige el suministro de alimentos de buena calidad y con un balance
adecuado.

Estmago. El estomago es la gran dilatacin del tubo digestivo cuya capacidad es de


aproximadamente el 8 % del total que tiene el aparato digestivo. Se halla detrs del diagrama del
tal forma que se interpone entre el esfago y el intestino delgado. El estmago se encuentra
completamente intraabdominal y por eso la exploracin clnica desde el exterior es totalmente
imposible (excepto la exploracin mediante la sonda nasoesofgica).

El estmago de los equinos es un saco en forma de U relativamente pequeo, variando su


capacidad entre 8 y 15 litros; su tamao, forma y posicin se hallan sujetos a variaciones
considerables. En el potro lactante la proporcin del estmago con respecto a la capacidad total
del canal digestivo es bastante mayor que en el caballo adulto. El vomito verdadero (aquel que se
acompaa de arcadas) es supremamente raro en el caballo como en otros herbvoros y cuando se
presenta, se considera un signo grave que revela lesiones importantes del aparato digestivo. El
caballo no puede vomitar, en general, y por lo tanto no puede librarse de una sobrecarga del
estmago. Esto obedece, por una parte, al mayor alejamiento entre la pared abdominal y el
estmago, por lo que la prensa abdominal no puede actuar directamente sobre aquel durante el
acto del vmito y, por otra parte, a que la musculatura cardial cierra la desembocadura esofgica
en el caballo de una forma notablemente fuerte. Esta oclusin es ordinariamente tan completa que
la distensin del estmago por medio de aire o fluido introducido a presin a travs del ploro
puede ser llevado a tal extremo, que se produzca la rotura del estmago sin necesidad de ligar
previamente el esfago. Por la misma causa puede producirse ruptura del estmago si se
introducen lquidos desde el exterior a travs de sonda y simultneamente existe una parlisis
intestinal con espasmo del ploro. La situacin del cardias en inmediata proximidad al ploro y la
desembocadura en ngulo agudo del esfago en el estmago, impiden tambin la falta de un
centro del vmito, o su desarrollo rudimentario, como causa de la incapacidad para vomitar. Para
prevenir los accidentes favorecidos por los espasmos del ploro, se recomendar ante todo el
abrevar los animales moderada y progresivamente para evitar los clicos de agua, cuyo peligro
aumenta cuando el agua es muy fra. El consumo de agua deber hacerse antes de la toma de
alimentos concentrados secos, ya que de otra manera estos correran el riesgo de hincharse en el
estmago y provocar indigestiones.

Se aconsejar igualmente el dividir las raciones de alimentos, sobre todo si se trata de alimentos

76
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

muy leosos o por los contrarios muy harinosos susceptibles de empastarse en el estmago.

Al pasar los alimentos por el estomago, se produce una fermentacin lctica de los carbohidratos,
realizada por bacterias. La otra funcin importante del estomago es regular el paso de los
alimentos hacia el intestino delgado.

Intestino Delgado: El intestino delgado es el tubo que pone en conexin el estmago con el
intestino grueso, su capacidad es del 30% del total que tiene el aparato digestivo. Comienza en el
ploro y acaba en la curvatura mayor del ciego; su longitud media es de aproximadamente 22
metros y cuando est distendido su dimetro vara de 7,5 a 10 centmetros. Su capacidad es de 40
a 60 litros aproximadamente. Se divide claramente en una porcin fija y otra mesentrica. La
porcin fija se denomina duodeno, mientras la porcin mesentrica est dividida en forma arbitraria
en dos partes denominadas yeyuno e leon.

Realmente no existe una lnea natural de demarcacin, pero se observa aqu un aumento
acentuado del grosor de la pared hacia la parte terminal. El intestino delgado tiene una capacidad 4
veces mayor a la del estmago; la pared muy musculosa y ricamente inervada es el asiento de
contracciones muy vigorosas que producen un trnsito muy rpido. La violencia de las
contracciones intestinales en el caballo predispone a lo espasmos que conducen a los
taponamientos y a las invaginaciones, responsables de clicos muy graves.

Los espasmos desencadenan un vivo dolor que por reflejo, crea las condiciones para ser an ms
doloroso. En esta parte del tubo digestivo del caballo se encuentra tejido linfoide en forma de
ndulos distintos que estn esparcidos o en grupos. En el primer caso se denominan ndulos
solitarios; en el ltimo, ndulos agregados o placas de Peyer. Hay que anotar tambin que el
dimetro del intestino delgado es pequeo cuando se compara con el dimetro mucho ms grande
del ciego y del colon componentes estos ltimos del intestino grueso.

All hay gran secrecin de enzimas: carbohidrasas, proteasas y tambin de sales biliares, cuya
funcin es fraccionar los carbohidratos solubles, las protenas y las grasas respectivamente, en
estructuras mas pequeas y fciles de absorber por las paredes intestinales.
En el intestino delgado es donde se realiza la mayor absorcin de nutrientes as: Carbohidratos
solubles (65-75 %), protenas (60-70 %), grasas (100%), fibra (15-25%), vitaminas (100 %); la
absorcin de los minerales depende de cada uno especficamente (calcio y magnesio 90-99 %,
fosforo 20-50%).

Intestino Grueso: El intestino grueso se extiende desde la terminacin del leon hasta el ano. Su
longitud es aproximadamente de 7.5 a 8 metros. Difiere del intestino delgado por su mayor tamao,
ser en su mayor parte saculado, poseer cintillas longitudinales y tener una posicin ms fija. Se
divide en ciego, colon mayor, colon menor y recto. l ciego es un gran fondo de saco cuyo tamao,
forma y posicin son notables en el caballo. Se intercala entre el intestino delgado y el colon con
una longitud media de aproximadamente 1.25 metros y con capacidad de 25 a 30 litros. El ciego es
cnico y est incurvado a modo de coma. Su base es objeto de una de las prcticas Mdico-
quirrgicas ms comunes en la especie equina, la cecocentesis o puncin de la base del ciego, la
cual se realiza en pleno centro de la fosa paralumbar del lado derecho, o sea, en el punto
equidistante de la serie de apfisis transversas lumbares, de la tuberosidad coxal y de la ltima
costilla, teniendo en cuenta que es precisamente en este sitio donde la base del ciego contacta
directamente con la pared de la fosa derecha; la trocarizacin (introducir una aguja o trocar) de la
base del ciego en este punto, es muy valiosa en trastornos digestivos que se acompaan con
abundante produccin de gas (timpanizacin).
En el ciego habitan millones de bacterias y protozoos, cuya funcin es realizar la fermentacin de
fibra y de los carbohidratos solubles que sobrepasaron el intestino delgado sin ser digeridos y
absorbidos. Con la fermentacin se producen cidos grasos voltiles (actico, propionico y butrico)
que se absorben all mismo y son utilizados como fuente de energa. En el ciego tambin se da la
mayor absorcin del agua del tracto gastrointestinal, seguido por el colon.

77
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

El colon mayor empieza en el orificio cecoclico y termina juntndose con el colon menor detrs del
saco ciego del estmago. Mide de 3 a 3.7 metros de largo y su dimetro medio es de 20 a 25
centmetros. Su capacidad es ms del doble de la del ciego. El colon menor empieza en la
terminacin del colon mayor, detrs del saco cecal del estmago y por debajo del rin izquierdo y
se contina con el recto en el estrecho anterior de la pelvis. Mide aproximadamente 3.5 metros de
largo y 7.5 a 10 centmetros de dimetro. El recto es la porcin terminal del intestino y se extiende
desde el estrecho anterior de la pelvis hasta el ano. Su longitud es de 30 centmetros
aproximadamente y su direccin puede ser recta u oblicua. El ano es la porcin terminal del
conducto alimentario. Est situado debajo de la raz de la cola, donde forma una proyeccin
redondeada, con una depresin central cuando est contrado.
Su capacidad es del 40 a 50 % del total que tiene el aparato digestivo, por lo cual tiene una gran
carga de trabajo. La absorcin de nutrientes es: protenas (30-40%), fibra (78-85 %), minerales
depende de cada uno (calcio y magnesio 1-10 %, fosforo 50-80%) y agua (100%). El intestino
grueso esta conformado al principio por el ciego y posteriormente por el colon.

rganos accesorios.

Dientes: La frmula dentaria como la mayora de las porciones anteriores del tubo digestivo
aproxima mucho al caballo a un monogstrico verdadero como el cerdo, por ejemplo. Por el
contrario los grandes reservorios del intestino grueso recuerdan el rumen de los poligstricos y su
papel fermentativo con relacin al rgimen propio para el herbvoro.

Los dientes morfolgicamente son papilas intensamente calcificadas. Funcionalmente son rganos
de aprehensin y masticacin y pueden servir como medios de defensa y de ataque. El caballo
como otros mamferos domsticos posee dos series de dientes: los temporales o caducos,
llamados tambin vulgarmente dientes de leche, porque son reemplazados durante la poca del
crecimiento por los dientes permanentes. Se clasifican segn su forma y posicin, como sigue:
- Incisivos
- Caninos
- Premolares
- Molares

Los premolares aparecen en ambas series mientras que los molares Aparecen slo en la denticin
permanente. El intervalo entre los incisivos y los premolares es el espacio interalveolar o
interdentario. Como los dientes de los dos lados de las quijadas son normalmente iguales, lo
mismo en nmero que en carcter, la denticin completa puede indicarse brevemente por una
frmula dentaria, no sin antes anotar que los dientes temporales o caducos son ms pequeos que
los permanentes y su nmero es igualmente menor.

Lengua: La lengua es un rgano muscular cubierto de mucosa que posee una parte posterior o
raz, una parte media o cuerpo y un vrtice o punta que es libre y en forma de esptula. La lengua
posee muchos vasos sanguneos y numerosas papilas. En el caballo las ramas superficiales de la
vena lingual pueden utilizarse para inyecciones intravenosas o tomas de muestra de sangre en
casos extremos (cadas sbitas, colapsos o shocks). En relacin con este rgano, algunos caballos
muy jvenes adquieren el hbito nocivo y deplorable de pasar la lengua por arriba del freno.
Los especialistas aconsejan escoger un freno de filete con caones gruesos, no demasiado ancho
con el fin de no desbordar en forma exagerada de uno y otro lado los labios. La rama ascendente
del freno deber ajustarse y ser ms bien corta de manera que levante muy poco la comisura de
los labios. El freno estando as confortable y bastante levantado ser menos temido por el
caballo, tomando y manteniendo en forma voluntaria el bocado o contacto y no tendr la idea de
pasar su lengua por arriba ocasionndose heridas en el frenillo.

78
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Glndulas Salivales: Este trmino se aplica generalmente slo a tres pares de glndulas muy
grandes situadas a los lados de la cara y partes adyacentes del cuello, a saber: la partida, la
mandibular y la sublingual. La glndula partida llamada as por su proximidad a la oreja, es la ms
grande de las glndulas salivares del caballo. La mandibular o submaxilar es mucho ms pequea
que la partida y es larga, estrecha e incubada. La sublingual se sita debajo de la mucosa de la
boca, entre el cuerpo de la lengua y la rama de la mandbula. Se cree que la intensidad de la
secrecin salivar de la partida est relacionada en un 70%, con la duracin de la masticacin, y
por lo tanto, con la naturaleza fsica del alimento; su misin esencial es la de humedecer
abundantemente los alimentos secos lo que exalta verdaderamente el sentido del gusto y por este
hecho, hace que el caballo sea particularmente sensible al sabor de sus alimentos, y sobre todo
sirve para preparar la deglucin.

Hgado: Es la glndula de mayor tamao del cuerpo del equino. La mayor parte de este rgano se
halla a la derecha del plano medio. Su color es rojo pardo con un peso aproximado de 5 Kg., pero
en caballos de tiro puede llegar a pesar casi el doble; posee tres lbulos principales (derecho,
medio e izquierdo) y un lbulo caudal. Su consistencia permite que se lesione fcilmente. Varios
ligamentos lo mantienen fijo en su posicin. El tejido que compone el rgano se halla constituido
por lobulillos poligonales de aproximadamente 1.5 milmetros de dimetro, que estn mantenidos
juntos por una cantidad pequea de tejido conectivo. Los lobulillos estn compuestos de clulas
hepticas, pequeos vasos sanguneos y biliares (capilares) y una vena central, todo sostenido por
una delicada red de tejido especializado. Aqu cabe anotar la ausencia de Vejiga o Vescula Biliar
quizs asociada a la necesidad de abastecer continuamente de Bilis a un animal que se alimenta
sin cesar.

Pncreas: En el caballo el pncreas es un rgano alargado situado en la pared dorsal del


abdomen casi todo a la derecha del plano medio; en estado fresco es de color rojizo. Su aspecto
es parecido al de las glndulas salivales, pero es ms blando. Su peso medio es de
aproximadamente 350 gramos.

Es una glndula mixta o sea posee una porcin de secrecin interna (endocrina) y otra de
secrecin externa (exocrina). Esta ltima elabora jugos digestivos que por el conducto pancretico
desembocan en el duodeno junto al conducto biliar (coldoco). La porcin endocrina produce
insulina una hormona importante en la regulacin de los azcares de la sangre.

Principales Procesos Digestivos del Caballo.

La fisiologa digestiva del caballo tiene por rasgos dominantes los siguientes: una masticacin
concienzuda, una gran rapidez del trnsito por el estmago, una digestin por enzimas, breve pero
intensa en el intestino delgado, y una accin microbiana prolongada a nivel de los grandes
reservorios del intestino grueso.

En el equino al contrario de lo que sucede en el rumiante, la digestin por microbios se desarrolla

79
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

esencialmente a nivel del intestino grueso o sea con posterioridad a la digestin por enzimas, y a
continuacin de las zonas de intensa reabsorcin intestinal.

Dentro de los actos preparatorios para la digestin, la aprehensin de los alimentos, la masticacin
y la deglucin en el equino, dan lugar a recomendaciones muy provechosas para una mejor
alimentacin.

Aprehensin: Para la aprehensin de los alimentos slidos el caballo utiliza el labio superior el
cual es vigoroso, sensible y muy mvil, capaz de realizar una buena seleccin del alimento. Si
existen lesiones que lo afecten se compromete seriamente el mantener los alimentos en la boca
durante la masticacin lo cual es particularmente grave en el equino, como se describi
anteriormente.

El abrevamiento lo realiza el caballo por absorcin como los herbvoros en general, utilizando la
lengua a manera de pistn en el interior de la boca hermticamente cerrada. Por lo tanto, la
integridad de este cierre de los labios es necesaria.

Masticacin: El caballo posee un aparato masticador muy potente; la dentadura forma tablas
extensas erizadas de mltiples crestas de esmalte que por aplastamientos, trituracin y frotamiento
aseguran una divisin completa de los alimentos.

El triturarlos muy bien, es condicin esencial para una buena utilizacin digestiva posterior.

La masticacin es larga, metdica y muy compleja, lo que determina que el equino coma con
lentitud, tanto ms, si la racin contiene muchos forrajes ricos en celulosa. Por lo tanto, es
conveniente no acosar al caballo y ms bien procurarle tranquilidad y tiempo cuando se est
alimentando.

Es importante anotar aqu, que es muy conveniente para el equino el humedecerle y ms todava
triturarle los alimentos leosos para facilitarle su digestin. Los alimentos insuficientemente
masticados sern mal digeridos y corrern el riesgo de favorecer el desarrollo de clicos. Tambin
es muy importante en el caballo controlar la perfecta integridad de los dientes; ser conveniente
usar escofinas, limas y cortadientes para mejorar el enfrentamiento e igualar las superficies
masticatorias y sobretodo para eliminar los sobredientes, que pueden lesionar las encas y los
labios, por sus caractersticas irregulares y traumticas.

Insalivacin y Deglucin: La secrecin de saliva tiene por objeto humedecer fuertemente los
alimentos secos. Es ideal un abrevamiento abundante en relacin con las caractersticas fsicas del
alimento. La saliva posee un pH del orden de 7.4 a 7.6 contiene una enzima para romper
almidones; se cree que est enzima no tiene suficiente tiempo de actuar por lo tanto la accin
qumica antes del estmago es despreciable.

La intensidad de la secrecin de saliva de la glndula partida est relacionada en un 70% con la


duracin de la masticacin lo que favorece y prepara la deglucin; sta se facilita por la
insalivacin abundante durante la masticacin prolongada de la racin. En el equino la deglucin
es irreversible ya que el velo del paladar impide todo retroceso del bolo alimenticio desde el
esfago hacia la boca no permitiendo que los alimentos sean expulsados por la va nasal: si esto
ltimo sucede (es muy raro) o bien existe una dilatacin del esfago o se ha roto el cardias evento
que ocasiona la muerte rpida del animal.

Digestin en el Estmago: La capacidad mxima del estmago del equino es del orden de 15 a 18
litros. Sin embargo no se llena ms que hasta sus 2/3 partes de tal forma que su contenido prctico

80
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

es de alrededor de los 10 litros. La masa de alimento deglutido en un da puede alcanzar hasta 50


e incluso 70 litros. Si a esto aadimos los 10 30 litros de secrecin gstrica tenemos un volumen
muy grande lo que provoca que el estmago tenga que desocuparse de 6 8 veces por da. En
una misma comida suceden entonces 2 vaciadas por lo que solamente 1/3 de los bolos
alimenticios son los que se benefician de una permanencia prolongada (6 8 horas) en tanto que
un nuevo consumo no conlleve a un trnsito anticipado hacia el duodeno. En consecuencia la
digestin en el estmago posee efectos sensibles apenas sobre los ltimos 10 Litros del bolo
deglutido, ms o menos el equivalente a 2 kilos de salvado o 4 kilos de concentrado, mientras el
resto no se retiene ms de una hora en el estmago. Este paso rpido por el estmago limita la
accin mecnica y enzimtica aunque no impide un leve ataque fermentativo a este nivel.
La imposibilidad del vmito en razn de los dispositivos anatmicos especialmente del cardias en
los caballos agrava las consecuencias de una sobrecarga gstrica, a la cual el caballo est
predispuesto por la pequea capacidad de su estmago.

En el plano estrictamente digestivo tiene lugar en el estmago, una degradacin del almidn ya
que la enzima de la saliva parece ser no tiene tiempo de actuar. Interviene en este proceso las
diastasas contenidas en el alimento y enzimas bacterianas. Mediante la actividad bacteriana
(regin cardial) se producen cidos orgnicos predominando el cido lctico con pequeas
cantidades de cidos actico, propinico y butrico. Estos cidos ms el cido clorhdrico generado
algo despus, acidifican el contenido del estmago (hasta un pH de 5.4 en la zona fndica y 2.6 en
la regin pilrica. La cada del valor del pH disminuye cada vez ms la actividad bacterial. Las
protenas son descompuestas ya, en gran parte, en el estmago del caballo bajo la accin de la
pepsina. En el antro pilrico tiene lugar probablemente una ms intensa digestin proteica, que en
las restantes regiones gstricas hecho que se explica por los valores de pH muy adecuados para la
actividad de la pepsina. El nuevo alimento ingerido sufre inmediatamente desdoblamientos por
accin del agua (hidrlisis) en hidratos de carbono mientras el resto de la comida anterior se
encuentra entonces sometida a desdoblamiento de protenas (proteolisis). Las degradaciones de
almidones y protenas varan segn las regiones gstricas y el tiempo transcurrido desde la
ingestin del alimento deglutido, pero en el caballo predomina la degradacin de los hidratos de
carbono a este nivel.

DIGESTIN EN EL INTESTINO DELGADO.

El intestino delgado representa el segmento primordial de la digestin en l caballo. La duracin


del trnsito de los alimentos no excede de 2 3 horas.

Las principales secreciones digestivas a este nivel son la biliar, la pancretica y la intestinal
propiamente dicha, estimuladas claramente por la presencia del alimento y a continuacin de la
excitacin de la pared gstrica,

Sus contenidos son ricos en las enzimas: amilasa, maltasa, lactasa, proteasas, pptidas y
sacarosa sin reconocerse claramente la presencia de lipasa. Todas las enzimas encuentran un pH
propicio a este nivel (6.7 6.9 en yeyuno y 7.5 en el leon terminal).

La digestin en este punto es esencialmente enzimtica y no afecta prcticamente a la celulosa


pero es muy eficaz cuando se trata de materias grasas, protenas, minerales o vitaminas y
especialmente del almidn, la insulina, sacarosa, lactosa o sea, lo que se conoce como Extracto
No Nitrogenado (ENN) los cuales son convertidos en glucosa u otros azcares sencillos de fcil
absorcin y metabolismo. Esta glucosa es particularmente importante para el trabajo muscular.

Las materias grasas son muy bien toleradas por el caballo que soporta un contenido de 15 al 18%
en la dieta.

Las protenas son digeridas y absorbidas principalmente en el intestino delgado y la tasa de

81
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

aminocidos indispensables en la sangre se eleva inmediatamente luego de la ingestin de


alimento y alcanza su mximo dos horas despus de esto.

Se cree que el desdoblamiento de protenas es 10 a 100 veces ms activo en el intestino delgado


que en el ciego y alcanza por lo menos al 60 70% de las protenas del alimento cualesquiera que
sern las proporciones de forrajes y de concentrados en la racin.

La Lisina (aminocido indispensable) es el factor limitante para el aprovechamiento eficiente del


Nitrgeno; su suplementacin se aconseja especialmente en potros.

Los minerales en conjunto, son absorbidos en el intestino delgado incluyendo al calcio y al


magnesio, siendo la nica excepcin el fsforo cuya absorcin pura no sucede sino a nivel de
colon.

Las vitaminas, tanto las hidrosolubles como las liposolubles, tienen verdaderamente su sitio de
absorcin en el intestino delgado. El rpido trnsito de los forrajes ricos en carotenos por el
intestino delgado, explica la mala conversin en vitamina A por parte de los caballos.

DIGESTIN EN EL INTESTINO GRUESO.

El trnsito de los alimentos en el equino es muy lento. Los alimentos son retenidos en promedio 36
horas en el tubo digestivo y por lo menos 2/3 de este tiempo (24 horas) deben pertenecer a la
permanencia en el intestino grueso.

Lo esencial de la digestin a este nivel, es realizado por las fermentaciones microbianas, muy
dinmicas en el ciego y en el colon replegado.

La poblacin de microbios del intestino grueso parece comparable a la que est presente en el
rumen de los poligstricos tanto en caractersticas como en su metabolismo. Entra los principales
representantes de esta poblacin dominan las bacterias gramnegativas. Los principales tipos
identificados pertenecen a los gneros: Estreptococos (bobis y equinus), Bacteroides y
3
Lactobadlllus. Los protozoarios son mucho ms raros (4 a 6 x 10 /gramo) que los encontrados en
el rumen bovino.

Las fermentaciones microbianas muy activas en este punto, atacan el sustrato alimentario,
degradando la celulosa con produccin de cidos grasos voltiles, resintetizando las protenas
bacterianas de alto valor biolgico y elaborando las vitaminas del complejo B. Desafortunadamente
el organismo aprovecha muy poco estas transformaciones tardas que suceden despus de las
zonas de absorcin intensa (intestino delgado). En el intestino grueso se favorece la digestin de
forrajes ricos en celulosa y se desfavorece la de los cereales, especialmente la avena, por lo que la
posibilidad de carencias proteicas y de vitaminas del complejo B es muy acentuada en los caballos
jvenes, reproductores y en entrenamiento, alimentados con regmenes intensivos tradicionales.

En forma breve podramos resumir los rasgos ms sobresalientes de la digestin del caballo as:
- Masticacin larga, metdica y compleja.
- Paso rpido por el estmago
- Digestin por enzimas intensa (aunque breve) en el intestino delgado.
- Fermentacin microbiana prolongada en el intestino grueso.

DIGESTIBILIDAD.

En nutricin este trmino designa de modo general la eficacia de la digestin de los diversos

82
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

alimentos en una especie con relacin a otra y es una forma de expresar el resultado del trnsito
digestivo sufrido por uno o varios alimentos. En el caballo como en las otras especies, la
digestibilidad es sobre todo una funcin de la naturaleza y del porcentaje de celulosa que un
alimento contiene ya que sta estimula la motilidad intestinal y disminuye de esa manera, la
duracin de las acciones digestivas para el conjunto de la racin. Es por eso que la digestibilidad
de los diferentes constituyentes del alimento es un poco paralela a la de la celulosa. Con relacin a
este tema en el caballo se puede delimitar claramente las siguientes caractersticas:

- La aptitud para degradar la celulosa es ms dbil en el caballo con relacin al rumiante.


- Esta inferioridad es tanto ms notoria si esta celulosa est ms lignificada (textura o
consistencia leosa)
- La utilizacin digestiva de protenas es ms elevada en el caballo quizs en razn de la
mayor absorcin desde el intestino delgado.
- Entre los forrajes, las leguminosas son mejor aprovechadas por el caballo que las
gramneas, gracias a la mayor digestibilidad de las materias proteicas y del extracto no
nitrogenado, a pesar de una menor digestibilidad de la celulosa y de las grasas.
La coccin no mejora la digestibilidad en s, pero puede ser provechosa

No todos los nutrientes de un alimento son digeridos y absorbidos por el caballo, aun as, en los
asimilados su digestin vara de acuerdo a dos factores:

Factores del alimento: los granos quebrados favorecen la digestibilidad; su coccin la


mejora, solo en animales cuya denticin no permite una adecuada trituracin; los alimentos
muy fibrosos la limitan y pueden causar clicos.

Factores del caballo: el mal estado de la denticin causa mala digestibilidad (ausencia de
premolares o molares, o la presencia de filos, tambin llamados remolones en dichos dientes); el
trabajo fuerte tambin la disminuye, pero el trabajo moderado la aumenta; la frecuencia de
consumo la aumenta ya que el equino come lento pero constante; tambin depende de las
particularidades de cada individuo en su capacidad para digerir los alimentos.

Leccin 17 SELECCIN DE FORRAJES Y NUTRIENTES.


Consideraciones Generales.
En trminos generales, podemos decir que un alimento es una mezcla o combinacin de principios
alimenticios.

Para cubrir las necesidades nutritivas mediante los aportes de alimento en proporciones
equilibradas y suficientes, la dieta al menos debe suministrar los siguientes principios alimenticios:
protenas, hidratos de carbono (carbohidratos), grasas, sales inorgnicas, aguas y vitaminas.

Nmero Clase de alimento.


1 Forrajes secos y alimentos fibrosos.
2 Pasturas, plantas de pastizales y forrajes verdes.
3 Ensilaje.
4 Alimentos energticos.
5 Suplementos proteicos.
6 Minerales.
7 Vitaminas.
8 Aditivos.

83
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Forrajes y Nutrientes para la Alimentacin del Equino.

Aunque todos los nutrientes son muy importantes, de manera general hay un incremento en el
requerimiento de algunos, dependiendo del estado fisiolgico, as pues:
Protena: necesaria en especial en potros en crecimiento, yeguas en el ltimo tercio de la
gestacin, yeguas en lactancia y sementales en temporada de servicio

Fibra: caballos adultos y yeguas con baja intensidad de trabajo.


Grasa: yeguas en lactancia, yeguas en reproduccin mayores de 16 aos, caballos y
yeguas bajo entrenamiento intenso, caballos y yeguas en ganancia de peso.
Carbohidratos solubles: para potros en crecimiento rpido, yeguas en preparacin para
reproduccin, yeguas preadas en el ltimo tercio de la gestacin, yeguas muy productoras
de leche, padrillos en temporada de servicio, caballos y yeguas bajo entrenamiento.
Vitaminas: para potros en crecimiento moderado o acelerado, caballos y yeguas bajo
entrenamiento o sometidos a estrs y sobre todo en equinos que no consuman forrajes
verdes.
Minerales: en potros en crecimiento, yeguas preadas o en lactancia, equinos en
entrenamiento, padrillos en temporada de montas.
Agua: es requerida en todas las etapas pero en especial en yeguas en lactancia, equinos
bajo entrenamiento, animales que consumen alimentos deshidratados como henos, pastos
peletizados y concentrados.

Los alimentos y sustancias de que disponemos para la nutricin del caballo son muy variados ya
que son a la vez los utilizados para rumiantes y los que empleamos para alimentar monogstricos;
para ser prcticos, se les puede agrupar en siete categoras principales:
Forrajes
Granos y sus derivados Materias Primas Suculentas y/o Azucaradas Fuentes Proteicas de
Complementacin Aditivos Alimentarios
Minerales y Oligoelementos Vitaminas.

Forrajes: Deben ser:

Los de menor contenido en Celulosa


- Mayor Digestibilidad
- Mayor consumo

Los de mejor calidad, determinado por su Estado de Desarrollo.

- En fase de Floracin (para gramneas)


- Desde la aparicin de los Botones florales para leguminosas). Son de varias
clases:
Gramneas: (Pastos), los ms comunes: Kikuyo, Ray grass Ingls, Ray grass anual, Imperial,
Festuca roja.

Leguminosas: Las ms comunes: Trbol blanco, Trbol rojo (violeta), Alfalfa.

Henos: Sobresalen en la alimentacin del caballo:


- De Gramneas: kikuyo, Ray grass Ingls (poseen menos moho y polvo)
- De leguminosas (ms digestibles para el caballo): Sobresalen la alfalfa y el trbol blanco.
Debe limitarse su ingestin.

84
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Paja: Forraje de relleno: De avena (contiene menos celulosa), de Trigo (ms corriente). Deficientes
en energa, protenas y minerales.

Ensilajes: Empleo Moderado y de Buena calidad.


- De Gramneas (el ms usado)
- De Leguminosas (debe ser perfectamente conservado o de lo contrario debe rechazarse).
- De maz (para engorde)

Forrajes condicionados: tiles en reas urbanas


- Deshidratados industrialmente
- Triturados
- Granulados
Un buen ejemplo son los grnulos de harina de alfalfa deshidratada, los cuales son ricos en
protena (de excelente calidad), Calcio, Carotenos, Vitaminas.

Granos y sus subproductos.

Son importantes a medida que se aumentan las necesidades energticas del caballo,
principalmente en funcin del trabajo.
Los cereales ms usados son:
- La avena: (tradicionalmente l de mayor uso)
- La cebada: (la alternativa ms econmica para reemplazar la anterior)
- El maz
- El trigo

Los tres ltimos pueden sustituir muy bien a la avena; el menos usado es el trigo (rico en gluten) ya
que forma cmulos en el tubo digestivo.

Los subproductos. De los granos son principalmente residuos de molinera y algunas veces,
subproductos de cervecera. Los ms comunes:

El salvado de trigo: (emoliente en el tubo digestivo, lo que facilita el trnsito a travs de l. Es rico
en celulosa).

Las haninillas, moyuelos y cabezuelas tienen indicaciones parecidas a las del salvado.

Los Residuos de Cervecera: o de destileras, en forma seca, se aproximan al salvado por su


riqueza en celulosa. Son fuente importante de vitaminas del complejo B.

Alimentos suculentos y/o azucarados.

Son muy apetecidos por los caballos. Son ligeramente emolientes y tienen sobre todo por misin,
excitar el apetito y refrescar a aquellos caballos privados de verdura y sometidos a regmenes ms
o menos constipantes (intensivos) de los que el animal termina por cansarse. Los ms comunes
son:
- Las zanahorias (excelente fuente de carotenos)
- Las remolachas (no muy usadas en nuestro medio)
- Las papas o patatas (de poco uso)
- Las pulpas de remolacha azucarera frescas o ensiladas (de muy buena calidad)
- Las melazas, de caa o de remolachas ricas en azcar (casi 45- 50%).

85
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

- Residuos secos de Manzana (alimentos econmicos de relleno 24% y energticos muy


usados en otros pases).
- El Azcar al natural, como fuente energtica ideal para el trabajo muscular, aunque an muy
costosa para la alimentacin del caballo en nuestro medio.

FUENTES PROTEICAS DE SUPLEMENTACIN.

Las fuentes disponibles son diversas y pueden proceder enteramente de protenas de origen
vegetal, pueden ser:

Habas, Guisantes, Lentejas y Vza: De muy poca disponibilidad en el pas y de poco uso.
Requieren coccin previa para evitar irritaciones del tubo digestivo.

Torta de Lino: (Linaza) Rica en muclagos, sustancias calmantes y ligeramente laxantes, muy tiles
para tubos digestivos fatigados (caballos enfermos y convalecientes).

Torta de Soya: Compite para la alimentacin de aves y puede no ser econmica en un momento
dado.

Protenas de origen animal: Se usan los productos derivados de la leche, la harina de pescado,
desperdicios de carne o residuos de las grasas que rara vez se usan debido a su alto costo.

ADITIVOS ALIMENTARIOS.

Los antibiticos han sido utilizados a veces, en algunos casos particulares, especialmente para
estimular el crecimiento de potros dbiles. Se usan a razn de 20 mg/kg de accin como mximo.
Si se adicionan antibiticos en los alimentos para caballos, debe vigilarse cuidadosamente las
cantidades introducidas y su reparto en el alimento; algunas de estas sustancias an a dosis
teraputicas, son el origen de proliferaciones de Clostridium perfringes en el intestino, un
microorganismo sumamente peligroso ya que ocasiona toxiinfecciones casi siempre mortales. Se
debe insistir sobre el hecho de que la buena calidad de los cereales, sumado a las adecuadas
cantidades de protena y excelente forraje, configura una dieta completa y torna innecesaria o
elimina por completo la suplementacin.

Ningn aditivo puede balancear o equilibrar una dieta pobre, ni se debe enfocar energas en la
bsqueda de polvos milagrosos o pociones mgicas que muchas veces no son sino cebos con
afanes comerciales. Cualquier sustancia que se agregue a las raciones para caballos debe ser
estrechamente vigilada y cuidadosamente evaluada.

MINERALES Y OLIGOELEMENTOS.

Los minerales de suma importancia en el caballo como el calcio y el fsforo, que determinan el
desarrollo y la robustez del esqueleto, el cloruro de sodio (sal comn) cuyas prdidas se aumentan
por la sudoracin durante el trabajo y los oligoelementos (elementos menores) que influyen
significativamente sobre la fertilidad, merecen una consideracin especial.

El calcio y el Fsforo: condicionan un esqueleto:


Bien desarrollado
Slido
Resistente

Los trastornos del metabolismo seo deben evitarse ya que pueden provocar
Alteraciones en el desarrollo y solidez del esqueleto.

86
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Retrasos en la consolidacin corporal, no permitiendo la total expresin de las cualidades


genticas.
Consecuencias graves en potros jvenes sometidos a trabajo y entrenamiento prematuras
(fracturas, etc.)

El crecimiento, la gestacin, la lactacin y el trabajo aumentan netamente las necesidades de


calcio y fsforo.

La relacin fosfoclcica es de 1.6 1.7 en los jvenes y de 1.3 - 1.4 en los adultos.

Por lo menos esta relacin debe permanecer superior a 1 para prevenir la sensibilidad a las
fracturas.

Los excesos de calcio bloquean o entorpecen la absorcin de atrs minerales como el Magnesio,
manganeso, zinc, hierro y cobre.

Las gramneas son, relativamente dbiles en calcio, la alfalfa deshidratada es una buena fuente
de calcio.

Los granos se caracterizan por su exceso de fsforo en relacin al calcio, lo cual se debe vigilar
estrechamente.

Tabla 11. Necesidades de calcio y fsforo en el caballo.


Mg/kg de P.V./da P. 100 de la racin
Ca P Ca P
Potro 150 180 90-110 0.7 0.4
Yearling 110 130 65 - 75 0.6 0.35
Adulto en entretenimiento 35 60 20 - 40 0.35 0.25
Adulto con trabajo ligero 60 75 35 - 45 0.4 0.3
Yegua en gestacin 60 85 35 - 55 0.4 0.3
Yegua en lactacin 115 140 55 - 75 0.6 0.35

Necesidades en calcio y fsforo


Calcio Fsforo
Potro de 6 meses 35 - 40 20 - 25
Yearling 50 - 55 30 - 35
2 aos 40 - 50 25 - 30
Caballo adulto en entretenimiento 25 - 30 15 - 20
Caballo en trabajo 30 - 40 20 - 25
Yegua en gestacin 35 - 45 25 - 30
Yegua en lactacin 65 - 80 35 - 45
Semental 60 - 70 30 - 40

La mayora de raciones usuales son incompletas en los aportes mnimos de calcio y fsforo, as
como en la relacin fosfoclcica.

Por lo tanto no sorprende que los quidos sufran de: Raquitismo, Osteomalacia, Osteodistrofia
fibrosa (osteofibrosis)

El Raquitismo: Es la manifestacin de un defecto en la mineralizacin del hueso en crecimiento y


resulta de una carencia en calcio y fsforo, asociada a una deficiencia en vitamina D; provoca lo
que se conoce como crisis del crecimiento en los potros.

La Osteomalacia: Tiene las mismas causas del raquitismo pero aplicadas al hueso que ha

87
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

completado su crecimiento y que acusa un dficit de mineralizacin sin deformaciones importantes.


Afecta principalmente a hembras lactantes, que pierden grandes cantidades de minerales a travs
de la leche, y las cuales no son compensadas adecuadamente.

La Osteodistrofia proviene de un exceso de fsforo en el alimento que conlleva a. un aumento del


mismo en la sangre y por consecuencia una hipocalcemia. Este es el origen de un
hiperparatiroidismo secundario que provoca la desmineralizacin del hueso y su transformacin en
tejido fibroso. Actualmente la osteofibrosis reviste, con frecuencia, formas crnicas mucho ms
severas y que se expresan en la aparicin de sobrehuesos, conchas, esparavanes, tendinitis,
desgarros, fracturas y otros trastornos mecnicos y dolores funcionales causantes de un gran
numero de cojeras.

Cloruro de sodio. Los caballos pierden con relativa facilidad sal por la orina y por el sudor; esto es
ms cierto en caso de un trabajo intenso sobre todo en clima clido. Las prdidas salinas son del
orden 100 gramos/da de los cuales 35 40 son por la orina y 60 - 65 por el sudor, a razn de 4.5
gramos/litro. Se necesita entonces complementar ante una situacin as, para evitar que aparezcan
signos de fatiga y de menor resistencia al calor. Las carencias ms prolongadas se manifiestan por
alteraciones del apetito, jugosidad del pelo, reduccin en el crecimiento y en la secrecin lctea.
Los aportes de al se reforzarn adems cada vez que la emisin de orine (diuresis) se exagere,
bien por consumo forzado de agua o por la necesidad de excretar restos nitrogenados abundantes
en raciones ricas en protenas ms an, si estas son de baja calidad.

El sobreconsumo de sal es tan perjudicial como las carencias y ms an, si no se compensa por un
suficiente abrevamiento. Puede ser responsable de trastornos de la digestin, calambres
musculares e incluso accidentes cardiacos con fibrilacin ventricular. La intoxicacin es
excepcional cuando el agua se deja para consumo a voluntad y a dosis letal sera entonces. Tan
elevada como 1 kilo de sal por da.

Potasio, Magnesio y Azufre.

El Potasio, es particularmente til en caballos de deporte ya que previene los signos de astenia
(falta de tono) nerviosa y muscular, aumentando la excitabilidad neuromuscular. Su exceso
inducira gran fatiga muscular y trastornos cardiacos similares a los producidos por el sodio,
acelerando la prdida de ste por la orina y entorpeciendo la asimilacin del magnesio.

El manganeso. Es un sedante del sistema nervioso tanto central como perifrico. Su deficiencia
se caracteriza por un aumento marcado en la excitabilidad muscular, marcha incierta, sudoracin
profusa, aceleracin del ritmo respiratorio y colapso final. Su digestibilidad se disminuye por los
excesos de calcio, fsforo y potasio. En razn a que contrarresta la toxicidad del amoniaco
sanguneo, las necesidades aumentan con las raciones muy ricas en nitrgeno.

En condiciones normales estas necesidades son valoradas en 13 mg/kg de peso vivo que
pueden ser cubiertas tanto con magnesia. Esta ltima sal tiene la ventaja aportar azufre.

El azufre. Interviene en la elaboracin de los estuches crneos, del crneo y de los cascos,
condicionando la calidad del pelo, junto con el cobre y la vitamina A. Su carencia no ha sido
identificada en el caballo ya que los alimentos por lo menos cubren ampliamente las necesidades
(0.15%) de la dieta. Su exceso dificulta la asimilacin de los oligoelementos.

Oligoelementos o elementos menores.

Las necesidades de estos elementos son poco o mal conocidas en el equino y se deducen de

88
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

normas admitidas para otras especies.

Tabla 12. Necesidades de oligoelementos.


Necesidades segn el N.C.R. Recomendaciones segn
1973 Concha 1969
Hierro Cobre Cobalto 50.5 a 8 0.05 - - 0.1 100 8 0.1 100 a 150 20
Zinc Manganeso Yodo 0.2

Las necesidades de hierro serian de 50 p.p.m. (partes por milln = mg/kg de alimento) en periodo
de crecimiento y de 40 p.p.m. en el caballo adulto.

Las necesidades pueden ser mayores en caballos productores de suero, en razn a las sangras
abundantes y frecuentes, para evitar anemia, dao en las clulas del hgado y trastornos de su
metabolismo.

El cobre es un factor antianmico, junto con el hierro y el cobalto. Sus necesidades estn valorada
en 8 p.p.m. en el potro y 5 - 8 p.p.m. en el adulto. Es uno de los oligoelementos mas importantes
ya que intervienen en numerosas situaciones fisiolgicas entre las que se destacan: estimulo a la
formacin de colgeno, intervencin en la sntesis de elastina y favorecimiento de las sntesis de
melanina entre otros, con lo que indirectamente aumentara la resistencia a las fracturas, aliviara el
trabajo cardiaco y mejorara la calidad del pelaje y del casco.
El cobalto. Hace parte de la vitamina B-12 o cianocobalamina y permite su sntesis por los
microorganismos del tubo digestivo.

El zinc. Es necesario para la osificacin, el crecimiento y la reproduccin. Las necesidades en el


equino se sitan alrededor de 50 p.p.m. por termino medio. Se requiere tomar en cuenta las
posibles fallas en la asimilacin ligadas a excesos de calcio, fsforo total, cido ftico o protena de
soya por lo cual se aconsejara suplementar las raciones a 100p.p.m.
El Manganeso es indispensable para el desarrollo seo y para la fertilidad. Su carencia puede
significar sobrehuesos o corvejones derechos y retrasos en la osificacin en los jvenes,
mientras que en reproductores puede afectar la libido, la espermatogenesis y el ciclo estral. Los
aportes pueden ser del orden de 50 a 100 p.p.m. especialmente en suelos muy calcificados o con
forrajes de leguminosas.

El yodo estimula tambin la funcin reproductiva, su carencia lleva al nacimiento de potros muertos
o muy dbiles. En algunas yeguas favorece la entrada en calor cuando se administran 5 mg
diariamente en forma de yoduro de potasio, quizs por un aumento de la actividad ovrica.

El Selenio es importante para prevenir la distrofia muscular o enfermedad del msculo blanco,
especialmente en los potros en los que su carencia provoca rigidez progresiva en la marcha,
dificultades en el sistema cardiorrespiratorio e incluso muerte.

En la prctica, la racin debera llevar 0.10 a 0.15 p.p.m. de selenio, es decir, 6 mg. por 60 a 70 kg.
De materia seca.

El flor, el plomo y el cadmio son los restantes oligoelementos presentes en las dietas para
equinos y que poseen relativa importancia nutricional.

Resumiendo, las necesidades de estos elementos son cuantitativamente muy escasas (por
definicin) y su importancia fisiolgica concierne especialmente a la osificaci6n y la fertilidad y ya
que son bien tolerados, es norma practicar suplementacin en forma conjunta y sinrgica con las
vitaminas.

Vitaminas.

89
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Las vitaminas pueden ser: liposolubles o hidrosolubles.,


Vitaminas Liposolubles. Que se pueden disolver en las grasas, son: Vitamina A, Vitamina O,
Vitamina E y Vitamina K. Entre ellas la Vitamina A se coloca en primer lugar por su papel fisiolgico
fundamental. En el equino sin embargo. La Vitamina D, por su intervencin en la mineralizacin del
esqueleto y la E por su funcin en el trabajo muscular, merecen atencin especial.
La carencia de Vitamina .A, frecuente en la prctica, afecta en forma selectiva la reproduccin
entorpeciendo la produccin de espermatozoides, la ovulacin, la nidacin y la gestacin o
conduciendo al nacimiento de potros dbiles, sin vigor para alimentarse y muy sensibles a las
enfermedades pulmonares, digestivas, renales, articulares, del ombligo, ya las infestaciones
parasitarias.

La utilizacin de forrajes deshidratados (harina de alfalfa y de zanahoria picada), de ensilaje de


excelente calidad contrarresta en forma importante el dficit de vitamina A. Un aporte
suplementario se justificara como prevencin de la infertilidad en planteles de reproduccin. Las
necesidades mnimas de vitamina A son.

Tabla 13. Necesidades mnimas en vitamina A (en unidades internacionales).


TIPO DE ANIMAL Por animal y por da Por kg de Alimento
Potro (6 meses) 9000 10600 1600 1700
Yearling (12 - 18 meses) 14000 17500 2250 2500
Adulto en entretenimiento 12500 15000 2250 2200
Adulto en trabajo ligero 12500 15000 1600 1650
Adulto en trabajo medio 12500 15000 1200 1250
Yegua en gestacin 24000 30000 4000 4200
Yegua en lactacin 25000 30000 2500 2750

La Vitamina E aumenta la estabilidad de los glbulos rojos en los caballos e interviene en la


integridad de ha clula muscular, protege contra la enfermedad de la grasa amarilla, un
desorden del metabolismo de las grasas, comn en ciertas razas de caballos.

Las necesidades seran del orden de 10 mg. por 100 kg. De peso vivo y su accin es sinrgica
con el selenio.

La Vitamina K o vitamina de la coagulacin se sintetiza abundantemente en el tubo digestivo, lo


que permite recuperarla en forma suficiente. Las necesidades no exceden de 1 mg. de vitamina K
por caballo /da.

Los alimentos enmohecidos o contaminados por toxinas de hongos (aflatxinas), las cuales poseen
propiedades antivitamina K, pueden provocar carencias subclnicas. El empleo teraputico se
justifica con ocasin de un tratamiento antibitico intensivo por va oral que perturbe la sntesis de
vitamina K por la microflora, o en caso de una operacin quirrgica, pero no tiene sentido para
prevenir el sangrado por la nariz (epistaxis) en el caballo de carreras, como es usual observar en
ciertos planteles.
Vitaminas Hidrosolubles. Vitaminas del complejo B y Vitamina C.

Normalmente un caballo adulto sometido a trabajo moderado no sufre de ninguna carencia de


vitaminas hidrosolubles, bien sea porque su dieta las aporta suficientemente o porque la sntesis
intestinal y tisular las provea en forma adecuada. Quizs el potro cuya flora digestiva es poco
activa o el caballo sometido a trabajo intenso (de vaquera y de carreras) multiplican sus
necesidades hasta diez veces.

90
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Las vitaminas del Complejo B, son importantes en el caballo de deporte, especialmente las
vitaminas B1, B2 o B12.

La Vitamina B1 o Tiamina es importante para el trabajo muscular, controlando la utilizacin de los


azucares y los lpidos aumentando la reserva energtica a nivel tisular. Las necesidades pueden
ser cercanas a 3 mg/Kg. Se sintetiza en el intestino y su deficiencia produce perdida del apetito,
descoordinacin nerviosa de las extremidades, perdida de peso y debilidad.

La Vitamina B2 o Riboflavina s relaciona tambin con la oxidacin de los azcares y lpidos como
fuentes de energa de la actividad muscular y evita en el caballo afecciones oculares como
inflamacin de la conjuntiva, lagrimeo, fobia a la luz, lesiones del cristalino, de los humores
oculares y de la retina. Las necesidades en vitamina B2 han sido calculadas en 2.2 mg/Kg. de
alimento en el caballo normal pudindose aumentar por el trabajo muscular. Se produce por
sntesis intestinal, su deficiencia produce oftalmia peridica.

La Vitamina B-12 o Cianocobalamina es famosa por su accin contra la anemia y se emplea en el


caballo de carreras buscando elevar los porcentajes de hemoglobina y la resistencia al esfuerzo
fsico, tcnica por lo general ineficiente si la racin lleva suficiente cobalto a no ser que el animal
padezca de una anemia de origen patolgico. Es sintetizada en el tracto digestivo.

La Niacina, el Acido pantotnico y la Piridoxina poseen papeles fisiolgicos muy ligados a la


Riboflavina y su utilizacin corre pareja al aumento de los gastos de energa.

Pueden tener inters en los animales jvenes en crecimiento y en las yeguas en lactacin.

Se resalta aqu que es preferible utilizar levaduras secas o residuos de cervecera como fuentes de
vitaminas del complejo B, en vez de usar estas en estado puro ya que son poco apetecidas y
tienden a reducir el consumo de alimentos.

La Vitamina C no es indispensable en el caballo y ms bien su uso incontrolado estimula la


formacin de clculos urinarios y menoscaba la funcin renal.

Leccin 18 PRINCIPIOS GENERALES DE LA ALIMENTACIN


EQUINA.

PRINCIPIOS BSICOS.

El xito en la alimentacin de los caballos depende en gran medida del buen juicio y la habilidad de
su cuidador o propietario. Se puede afirmar sin exagerar que la destreza y en sentido comn en la
alimentacin de los equinos suele ser tan ms importante que con otra clase de ganado, aunque
siempre lo sea en la alimentacin de cualquier animal. Cabe recordar que como animal de trabajo
se debe alimentar de acuerdo con la clase y la intensidad de la labor que realiza. Particularmente,
la alimentacin debe adaptarse a las condiciones especiales de cada regin sin apartarse sin
embargo, de las normas modernas de la nutricin equina asegurando eso si, los mejores
resultados en materia de salud, fecundidad y rentabilidad.

La alimentacin del caballo tendr en cuenta las necesidades propias de los equinos y las
exigencias particulares de cada especializacin mas an si se trata de caballos de gran valor o
aptitud deportiva, recordando que a medida que se eleva la intensidad del trabajo el nivel de
seleccin (en otras palabras, a medida que el caballo es ms fino) las exigencias alimenticias
aumentan; stas tendrn que ser satisfechas en aras de conservar la salud y obtener mejores
resultados, sin exagerar no obstante, los costos econmicos. Aqu conviene sealar que el

91
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

potencial o la precocidad gentica no se manifestaran plenamente a menos que la alimentacin


adecuada lo permita, en otras palabras la raza entra por la boca.

En lo concerniente a la salud, los problemas nutricionales abarcan un campo muy amplio.


Cualquier descuido, error, negligencia o desconocimiento de tales necesidades provocara
desrdenes graves entre los que cabe recordar, los clicos, problemas del casco (infosura)
intoxicacin muscular (Mioglobinuria), afecciones seas y trastornos de la reproduccin entre otros.
Son muchos los caballos pura sangre de alto precio que ven disminuida su capacidad o han
muerto a consecuencia de lesiones de sus miembros (fisuras, fracturas, infosura, etc.),
estrechamente relacionadas con la alimentacin.

NORMAS PRCTICAS DE ALIMENTACIN DEL EQUINO.

Racionar consiste en balancear, o compensar las necesidades nutritivas mediante los aportes
alimentarios suficientes, equilibrados y adaptados (a la especie, edad, produccin, etc.) palatables
(apetentes) y al mismo tiempo, en lo posible, econmicos. La alimentacin de los caballos podr
realizarse por tres sistemas a saber:

- Pastoreo (en potrero).


- Mixto (combina pastoreo y pesebrera).
- Estabulacin (el alimento se consume en la cuadra o establo).

Dependiendo del nivel de especializacin y de las necesidades particulares el cuidador podr


escoger uno cualquiera de los sistemas anteriores. Cabe recordar entonces que:

Para conducir en forma adecuada la alimentacin del equino es imperativo tener en cuenta la
Fisiologa digestiva lo que permite mejorar la utilizacin del alimento y sobre todo para evitar
trastornos de origen gastrointestinal, a los que el caballo es parcialmente sensible.

La ausencia de sustancias txicas que alteraran el valor higinico del alimento, as como el
adecuado equilibrio nutricional permite asegurar la calidad de la racin como un factor esencial.

La alimentacin deber ajustarse en forma individual en funcin de los gustos, apetito, facultades
digestivas, metabolismo y consumo. El ajuste de la alimentacin de cada caballo es primordial y
requiere el conocimiento, el control, la atencin y la destreza de un cuidador o propietario
competente lo que garantizar el xito final.

Tales normas generales sumadas a ciertas reglas sencillas son de importancia primordial y se
refieren al abrevamiento, control de la cantidad de alimento, reparto de las comidas, presentacin
de la racin y calidad higinica de los alimentos utilizados:

ABREVAMIENTO.

92
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

http://uco.es

Aunque propiamente un nutriente, el agua es tan importante o mas que el alimento, ya que es el
medio en que se diluyen todos los solutos en el metabolismo del caballo y es el 68-72 % del peso
corporal del animal. El suministro de agua debe ser constante o por lo menos peridico durante el
da ya que permite la recuperacin de los lquidos que el caballo pierde en la orina, las heces, el
sudor y la respiracin.

El agua debe ser de buena calidad (potable) sin contaminantes qumicos ni biolgicos, apetente
con una temperatura media. En lo posible se procurara un abrevamiento completo y frecuente lo
que se asegura mediante el uso de bebederos individuales. Aquellos caballos sedientos por un
trabajo intenso, durante el verano o los de hipdromo que recin terminan una carrera extenuante
y desean beber, se les permitira reposar inicialmente para luego ofrecerles agua impidindoles
que consuman exageradamente para prevenir los clicos de agua, ocasionados al llegar gran
cantidad de agua fra al estomago en forma sbita.

Una buena prctica para que el caballo pueda refrescarse, es hacerlo galopar lentamente en el
ltimo kilmetro y posteriormente pasearlo a la marcha durante diez o quince minutos, para luego
ofrecerle agua fresca.

La cantidad de agua que necesita un caballo depende de las condiciones climticas y de la


intensidad del trabajo realizado. En trmino medio, un caballo necesita diariamente alrededor de 55
litros de agua. Es tambin til en el plano nutricional que en el caballo beba DESPUS del
consumo de forraje (Para facilitar el trnsito de los mismos) pero ANTES de la ingestin de los
alimentos concentrados. Practicndolo as se evitaran las indigestiones estomacales y se
impedirn las bajas de digestibilidad que afecta a los concentrados cuando se evacuan muy rpido
del estomago bajo el efecto del flujo de agua. Puede ser til, en algunos casos, para mejorar la
palatabilidad del agua agregar cloruro de sodio, te, heno o yerbas aromticas particularmente si
tenemos en cuenta aqu, la importancia de la integridad del cierre de los labios y la funcin de la
lengua en el proceso de abrevamiento.

Leccin 19 CANTIDAD DE ALIMENTO SUMINISTRADO.

En lo posible y con el fin de evitar los excesos y ser preciso, se recomienda medir las cantidades
que se distribuyen as como las que los animales rechazan o rehsan. Es preferible expresarse en
trminos de peso mas que en trminos de volumen, ya que este ultimo cambia mucho de acuerdo
con la presentacin del alimento, ya sean granos enteros, machacados, partidos, etc., o forrajes
largos o aglomerados. Etc.

La cantidad de alimento ser siempre ajustada a las necesidades y principalmente el dar


concentrado variara constantemente segn la intensidad del trabajo muscular. Toda sobrecarga
nutritiva es peligrosa. Predispone a los clicos y a los accidentes de tipo congestivo (inflamacin de
la lmina de los cascos, golpe de sangre (mioglobinuria), etc. Por eso, siempre que sea posible,
esta indicado agregar a las raciones en donde la avena es el componente principal, una cierta
cantidad de forrajes (pasto), zanahorias o cualquier otra materia prima suculenta, igualmente
puede suministrarse salvado, linaza o sulfato de magnesio ya que los tres son favorables por su
accin laxante.

Cuando el caballo deba entrar en periodo de descanso o reposo se debe reducir simultneamente
y en forma proporcionada de cantidad de alimento. Si se esta dando concentrado este deber
reducirse prioritariamente y se podr sustituir por alimentos que refresque tales como zanahoria u
otros. Los caballos en descanso tienen necesidades energticas, proteicas, vitamnicas y

93
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

minerales bastante bajas, y podrn ser mantenidos econmicamente con alimentos de bajo valor
energticos que les proporciones las caloras necesarias para mantener la temperatura de su
cuerpo, lo cual es requisito en la inactividad.

El mismo cuidado se debe tener en cuenta para prevenir trastorno digestivo con sus
complicaciones graves, se debe tener cuando el animal regresa del descanso y deba aumentarse
la cantidad de alimento o cuando se requiere colocarlo en tratamiento intensivo. Tales cambios de
rgimen debern efectuarse en forma progresiva y cuidadosa para lograr conseguir una nueva
adaptacin de la motilidad intestinal, de las secreciones y sobre todo de las fermentaciones
digestivas. Cualquier cambio brusco provocara liberacin de sustancias toxicas responsables de
trastornos circulatorios y sobrecargas en hgado y riones.

Reparto de comidas.

Como norma, es conveniente que los alimentos los consuma el caballo en un ambiente tranquilo,
de calma y quietud con lo que se asegura un consumo mximo, una masticacin completa y un
buen desarrollo de los procesos digestivos. De igual manera, la regularidad en la distribucin de las
comidas propiciara la buena utilizacin digestiva as como el equilibrio nervioso del caballo. Lo ms
conveniente, es que las comidas sean pequeas, tan numerosas como sea posible y bien repartida
en el tiempo, siempre en funcin de las horas de trabajo. Lo anterior evitara sobrecargar el
estomago innecesariamente y le permitir consumir enteramente su comida, a un ritmo normal e
incluso avanzar su digestin antes de ser sometido a un trabajo fuerte.

Es aconsejable entonces repartir la cantidad de alimento total del da, en por lo menos tres
comidas para los caballos en actividad, pudiendo aumentarse segn la intensidad y clase de
trabajo. Los concentrado, se repartirn a lo largo del da ya que se consumen rpidamente y su
digestin se acomoda mejor a cortos periodos de descanso. En cambio, los forrajes debern
suministrarse en la tarde, ya que las horas de reposo de la noche permite una masticacin y una
digestin ms lenta evitando tambin el aburrimiento y el peligro de la aparicin de pica y de tic
en los caballos nerviosos.

Como ejemplo podra utilizarse el modelo propuesto por el profesor Wolter como sigue:

- Maana: Una tercera parte de los granos (1/3) y una parte (1/4) del forraje
- Medioda: Lo mismo de la maana, 1/3 y .
- Tarde: Una tercera parte de los granos y la mitad del forraje; 1/3 y .

PRESENTACIN, HIGIENE Y CALIDAD DEL ALIMENTO.

La forma de presentacin de la racin acta en muchas ocasiones sobre de salud del caballo. Los
alimentos muy pulverizados o los henos polvorientos favorecen la aparicin de enfermedades
respiratorias.

Los alimentos se podrn presentar en su forma natural y corriente o podrn ser sometidos a varios
procesos buscando siempre mejorar su utilizacin y eficacia nutritiva. Los alimentos pueden ser
triturados, como suceden con los granos pequeos como el sorgo y el trigo o aplastados en el caso
de los granos duros (cebada, maz). La avena comnmente es machacada (chancada) y
humedecida antes de su distribucin. La cebada muchas veces es sometida a coccin buscando
mejorar su digestin a travs del ablandamiento. El picado de los forrajes e incluso su granulacin,
despus de triturarlos, eleva la indigestin, aumenta su nivel energtico y economiza energa en
proceso digestivo.

Cualquier mtodo que se use, beneficiara al caballo en por lo menos tres de las cuatro

94
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

posibilidades siguientes:

Asegura una buena manifestacin.

Asegura la velocidad de ingestin.


Reducir el gasto del transito digestivo. Acelerara la velocidad
de digestin.

Es de inters tambin a la hora de alimentar los equinos utilizar fuetes energticas de rpida
asimilacin como es el caso de la melaza, la panela molida o el azcar natural, de gran valor para
el esfuerzo muscular.

En lo posible se evitara consumir alimentos de psima calidad, sucios o de escasa o nula eficacia
nutritiva. Los alimentos no sern:

Polvorientos (henos) o muy pulverizados (gramos). Fermentados o


rancios (maz).
Mohosos: o contaminados por toxinas de hongos. Cabe recordar el peligro de la contaminacin por
cualquiera de las siguientes clases de hongos y toxinas. Toxina T2 de Fusarium trcinctum.
Aflatoxina de Aspergillus flavus (hemorragias). Cladosporium
herbaram (encefalitis). Fusarium graminearum (diarreas).
Fusarium monoliforme (encefalomalacia). Ocratoxinas,
Rubratoxinas, etc.

Contaminados por semillas o plantas venenosas; son fuente de intoxicacin: el helecho guila, el
sorgo en hierba, la cola de caballo, el cornezuelo de centeno, la arveja silvestre entre otros.
Contaminados por huevos, larvas o adultos de parsitos gastrointestinales: hace mencin a los
forrajes recolectados de praderas hmedas, potreros no rotados, rastrojos, potreros con mal
drenaje y zonas verdes de reas urbanas infestadas por perros y otros mamferos (incluso el
hombre).

ALIMENTACIN DEL CABALLO EN LAS DIFERENTES ETAPAS DE LA VIDA.

Alimentacin del caballo adulto en reposo.

Durante los periodos de descanso o de baja produccin de los caballos solo necesitan alimento
suficiente para su mantenimiento, aunque el animal no utilice energa, los procesos normales de su
organismo continan en actividad.

Los forrajes pueden constituir la mayora o incluso la totalidad de la racin, si son de buena
calidad. Un buen pasto, o un aporte de heno a razn de 7 Kg para un caballo de 475 Kilos de peso
vivo, bastan para cubrir las necesidades de un caballo adulto en reposo. Segn la disponibilidad,
podrn usarse algunas races (zanahorias, papas, remolachas, etc.) y se mantendrn permanente
y libre

disposicin de un complemento mineral, ms o menos vitaminado que corrija las eventuales


carencias especialmente en sal, fsforo y oligoelementos. Si se trata del mantenimiento de una
cierta actividad o de una fase de recuperacin puede justificarse un cierto grado de
complementacin a esta racin. Puede usarse concentrando en cantidad acorde al aumento de los
gastos de energa, y de calidad segn la funcin implicada.

95
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Alimentacin de los equinos destinados a la reproduccin.

En periodo de cubriciones: El padrillo debe recibir una alimenticia adecuada acorde con su edad,
su individualidad, su raza, su trabajo y fundamentalmente segn el ritmo de sus montas o
cubriciones. Muchas veces se exageran las necesidades cuantitativas en esta etapa, y entonces
formamos reproductores cebados pero no musculados. La gordura es perjudicial para la fertilidad y
la longevidad del semental.

Un excelente estado de salud que reflejaran en el vigor, la libido o deseo sexual y la calidad del
semen, aspectos que se expresan en una mejor fertilidad. De tal manera que los sementales sean
alimentados con racin compuesta, equilibrada en protena, energa, minerales y vitaminas.
Durante la poca de montas, las necesidades nitrogenadas y energticas del semental aumentan
paralelamente a la frecuencia del servicio. En forma inversa algunos sementales muy excitados
pierden el apetito. Es entonces es necesario, aumentar la distribucin de alimento y modificar
adecuadamente la racin. Los concentrados, como alimentos compuestos y completos, juegan un
papel importante. El germen de trigo aportara un buen tenor de vitamina E, mientras que los
forrajes condicionados (alfalfa deshidratada), son excelentes fuentes de protena, calcio, carotenos
y vitaminas.

A manera de ejemplo, podra usarse una racin que contenga por lo menos los siguientes
elementos distribuidos en tres comidas, para un reproductor de 600 u 880 kilos de peso vivo.

Avena = 5 kg.
Maiz = 1 kg.
Heno = 2 Kg.
Pasto = 2 kg.
Zanahoria = 1. Kg.
Salvado de trigo = 1 kg.
Alfalfa deshidratada = 2 Kg.

Comienzo de la gestacin (yegua gestante).

La gestacin en si, no produce un aumento exagerado de las necesidades, en cambio es necesario


cubrir estas en forma adecuada teniendo en cuenta la lactancia por una parte y la sucesin rpida
de posibles gestaciones por otra.
La yegua deber entrar en gestacin en el mes siguiente al parto, para que se pueda esperar un
potro cada ao en nuestro pas, solo la mitad de las yeguas destinadas a reproduccin produce
una cra cada ao, siendo uno de los niveles reproductivos mas bajos de los animales domsticos.
Esta pobre produccin se debe a muchos factores tales como la herencia, factores fisiolgicos,
enfermedades, manejo incorrecto durante la crianza, y el alto grado, condicin y nutricin
deficientes,

La entrada en gestacin corresponde a la fase de acenso incluso al pico de la secrecin de la


leche la cual capta el mximo de los elementos nutritivos. La yegua se ve obligada a echar mano
de sus reservas para responder a su secrecin Lctea. Si alimentamos insuficientemente a la
yegua al final de gestacin, reduciremos las reservas corporales disponibles. Un defisis al
comienzo de la lactacin, desplaza la prioridad vaca de la secrecin de leche en desprecio de la
funcin reproductiva. Los calores se harn mas dbiles (silentes) y mas espacios (anestros). El
xito de las cubriciones no se garantizara, bien por dificultades en la detencin del celo, o bien por
fallas en la ovulacin o en la nidacin. El intervalo entre las gestiones se prolonga y as algunas
yeguas no dan cra sino cada 2 aos.

96
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Durante la gestacin.

Se considera que una yegua que ha sido cubierta se encuentra posiblemente preada, si no entra
nuevamente en calo tres semanas despus del ltimo acoplamiento. Esto no es normal para todas
hembras equinas y por esta razn debe ser observada cuidadosamente hasta confirmar el estado
de preez.

Cuando esto es as, debe colocarse junto con otras hembras en un potrero limpio y con buen
aporte de pasto nutritivo, un pasto de buena calidad le proporcionar todos los elementos
necesarios para su alimentacin durante los primeros cuatro meses. Si el potrero es pequeo y
existe mucha competencia por el pasto ser necesaria una alimentacin suplementaria que puede
ser cubierta suministrndole 1 Kg. de avena o cebada y hasta 2 Kg. de heno de buena calidad.
Cuando sea dudosa la calidad del alimento que se ofrece a la yegua puede recurrirse al uso de
concentrado (1 - 1.5 Kg/da) el cual estar provisto de minerales y vitaminas.

Al final de la gestacin, el aumento de las necesidades no es perceptible, sino al sptimo mes de


gestacin y progresa poco a poco hasta el onceavo mes, en razn a que la yegua desarrolla las
dos terceras partes de su cra durante los ltimos 3.5 - 4 meses antes de parir. Sin embargo, la
complementacin correspondiente ser un poco mayor para alcanzar los siguientes beneficios:

Compensar la reduccin del apetito, que declina casi 1 Kg. de materia seca/100 Kg. de
peso vivo.
Obtener un potro ms fuerte en el nacimiento, ms pesado, ms vigoroso para mamar y
ms resistente a las enfermedades.
En el caso que la yegua estuviera delgada se podr ganar un retorno ms rpido a una
nueva gestacin y una lactancia persistente y sostenida.

En todo caso la justificacin de esta complementacin y su nivel dependen del es-tado de


conservacin de la yegua. Esta complementacin puede ser de 1 despus 2 y como mximo 3 Kg.
de concentrado por animal diariamente, as como adecuado forraje y emolientes como el salvado
o la linaza para prevenir el estreimiento. En todo caso, la complementacin no debe sustituir la
racin base que deber permanecer constante en su nivel de protenas (un tercio del total de la
racin) y de energa. Teniendo en cuenta la reduccin del apetito se buscarn los forrajes ms
apetitosos y digestibles que no aumenten de volumen en el intestino grueso y aporten ms
elementos nutritivos. En la medida que se pueda prever el parto con precisin la racin se debe
reducir los ltimos das para liberar todava ms el abdomen. El grano se debe omitir cuando
haya parido la yegua por lo menos durante los primeros 3 o 4 das para ir reintroducindolo
paulatinamente; a manera de control sirve vigilar el estircol el cual debe ser relativamente blando.

Durante la lactancia.

La secrecin lctea implica gastos muy importantes que se evalan segn la velocidad de
crecimiento del potro. Por cada kilo de ganancia del potrillo se requiere el consumo de unos 15
litros de leche que corresponden a 4 5 kilos de forraje suplementario de excelente calidad, ms
unos 4 a 5 Kg. de concentrado por yegua/da, en periodo de produccin mxima, (2 - 3 mes) para
ir descendiendo rpidamente segn la persistencia de la secrecin de leche y el estado corporal
de la yegua. La salida progresiva al pasto de la yegua con su potro se debe vigilar
cuidadosamente, para evitar los excesos de nitrgeno de las praderas tiernas que provocan
clicos y diarreas en el potro lactante. Por el contrario, si se recurre a una complementacin
suficiente y adaptada, la salida progresiva a la pradera trae grandes beneficios sobre la
produccin de leche, sin contar con lo que representa el aire libre para el potrillo.

97
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tabla 14. Racin En Kg. Concentrado Y Heno O Su Equivalente En Pasto De Corte O Pasto
Fresco, Para Una Yegua Parida De 370 Kg. En 2 Etapas Diferentes.

ETAPA CONCENTRADO HENO PASTO DE PASTO

CORTE FRESCO
Hasta 3 meses 5 - 5.5. 5 - 5.5 15 - 16.5 22 - 25
De 3 meses al 3.5 - 4 6.5 - 7 19.5 - 21 28 - 33
destete
Tomado de solla.

Alimentacin del potro en crecimiento.

Los potros en desarrollo, al igual que otros animales requieren una buena nutricin, para
satisfacer la demanda de los huesos en crecimiento, los msculos y los tejidos del cuerpo. El
potro en crecimiento adquiere la mitad de su peso adulto en su primer ao. Es en este estado
donde mayor prevencin se debe prestar a la nutricin del potro ya que los errores y descuidos
son graves, frecuentes y costosos y determinarn todo el porvenir del animal.

La norma ser la siguiente: Preparar cuidadosamente el destete durante la lactacin,


complementando adecuadamente. Despus alimentar equilibrada y en forma generosa
alternando los forrajes de buena calidad con los granos y el concentrado, garantizado as el
mejor desarrollo seo y muscular, permitiendo la expresin gentica y la mayor precocidad.

Tabla 15. Racin En Kg De Concentrado Y Heno O Su Equivalente Pasto Fresco Para Potros En
Distintas Etapas.
ETAPA CONCENTRADO HENO PASTO DE PASTO
CORTE FRESCO
Hasta el 2 - 2.5 0.85 - 1.1 2.5 - 3.3 3.5 - 5
destete
Del destete a 2.7 - 3 1.8 - 2 5.5 - 6 8-9
los 12 meses
De 12 - 18 3 - 3.5 3.5 - 4 10.5 - 12 15.75 - 18
meses
Tomado de solla.

Lactancia.

La lactancia puede ser natural o artificial. La lactancia natural plantea pocos problemas puesto
que el potro dispone de toda la leche de su madre y porque la lactacin es larga y le permite
adaptarse paulatinamente a los alimentos secos.

La importancia de la lactacin natural radica en el calostro el cual posee una triple misin prctica:
laxante, de proteccin (inmunitaria) y nutricional.

Por su accin laxante, el calostro activa la evacuacin del meconio. Y mientras ms rpido tome el
calostro el potro menos necesario ser el uso de purgantes o enemas.

El calostro es muy rico en defensas (anticuerpos) que se transmiten de la madre a su cra y que lo

98
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

protegern contra los microorganismos presentes en el medio ambiente. El calostro es muy


nutritivo, especialmente en energa y vitaminas. Constituye el alimento ideal para aumentar las
reservas en vitaminas y glucosa, asegurando un mayor vigor y resistencia a las diversas
agresiones.

En la yegua cada tetada debe desocupar la glndula mamaria. La retencin de leche favorece la
aparicin de mastitis (inflamacin de la glndula mamaria) lo cual reducir la produccin en
perjuicio del recin nacido.

La lactancia artificial se impone por razones sanitarias bien sea por muerte de la yegua, nula
produccin de leche, mastitis, etc. Es exitosa si el potrillo ha tomado el calostro previamente, caso
contrario se puede intentar ayudar con vitaminas, suero y antibiticos.

El potro puede alimentarse con leche de vaca corregida especialmente del siguiente modo:

Leche de vaca 700 ml.


Agua hervida 260 ml.
Lactosa o Glucosa 30 gr.
Carbonato de Calcio 5 gr.
Levadura 5 gr.
Azcar o panela 2 3 cucharadas

Se puede dar 500 cc de esta mezcla cada seis horas mediante bibern para despus
acostumbrar al potro a beber en un balde, teniendo en cuenta el controlar las cantidades
consumidas y las sobras para ir adaptando el consumo.

Destete.

El destete se hace por lo general en forma tarda entre los 5 y 10 meses. El potro tiene tiempo para
ir adaptndose a los alimentos secos y antes de realizar un destete completo se le debe preparar
ofrecindole un alimento complementario de la leche, especialmente concebido para l, adems de
heno y agua.
El alimento complementario debe atraer al potro y excitar su apetito al mximo. Tendr un 14 - 15%
de protena, 0.7% de calcio, 05% de fsforo, suficientes cantidades d vitamina A y D y estar en
un lugar de libre acceso para el animal.
El destete se retrasar para potros dbiles (enclenques) o poco desarrollados y es preferible fijar
este momento cuando el potro logre un peso mnimo de 220 kilos

aproximadamente, o cuando el nivel de consumo fijado de forma arbitraria en 3 - 4 kilos de


alimento por da se logre, lo que toma en consideracin el desarrollo fisiolgico del potro y su
verdadera aptitud para ser privado de la leche.

Cuando los forrajes que constituyen la base de la racin son muy nitrogenados, los cereales son
suficientes para complementar adecuadamente al caballo sometido a un trabajo muscular. Basta
solo con asociar un complemento mineral rico en sodio y calcio. Si los forrajes cubren las
necesidades de entretencin en un trabajo de ligero a moderado, se necesita un aporte de 4 litros
de avena por da (o sea 2 Kg.), o bien de 2 Kg. de cebada y uno de maz: si el trabajo es ms
intenso exigira aumentar a 6.5 kilogramos de avena o 5 kg. de cebada, o bien 4.5 kg. de maz.

Es tambin posible y recomendable si el bolsillo lo permite, usar alimentos concentrados


aumentando los aportes paralelamente al aumento de los gastos energticos, comenzando a
manera de ejemplo con 1 kg/da para ir aumentando segn la calidad e intensidad del trabajo
realizado.

99
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Por ltimo, es preciso admitir que la apreciacin cuantitativa de un esfuerzo muscular es muy
subjetiva, de ah que la observacin atenta del comportamiento de cada individuo resulta
indispensable para realizar las correcciones adecuadas.

FASES DE LA DIGESTIN EN LOS EQUINOS.

Ceflica: es cuando el cerebro del animal prepara el sistema digestivo para recibir el
alimento, despus de verlo, olerlo, escucharlo (sonido del concentrado al caer a un balde) o
por ser la hora acostumbrada de alimentarse diariamente (reloj biolgico).
Oral: es la entrada del alimento en la boca, seguida de la masticacin, la salivacin y la
deglucin (accin de tragar).
Fermentacin del estomago: las bacterias hacen una fermentacin lctica de los
carbohidratos que pasan por el estomago.
Enzimtica: se inicia en el intestino delgado por la accin de diferentes enzimas que
descomponen los nutrientes en fracciones ms simples, capases de ser absorbidos por las
paredes intestinales.
Fermentativa del ciego: es la fermentacin de la fibra que realizan las bacterias y los
protozoos en el ciego y que produce cidos grasos voltiles. Tales bacterias tambin hacen
un aporte en aminocidos que se absorben en el colon.
Absorcin final: en el ciego y en el colon se hace una absorcin del resto de los nutrientes
y de agua.
Excrecin: la parte del alimento no absorbido se acumula en el recto para ser excretado como
estircol en forma de bolas a travs del ano, cuya textura depende del contenido de fibra y agua.

El tiempo que dura un alimento en pasar a travs del sistema digestivo desde la boca hasta que los
desechos son excretados del organismo, depende del contenido de fibra y agua de estos. Los
alimentos muy fibrosos pueden tardar hasta 65 o 75 horas.

Leccin 20 CONDICIN CORPORAL.

El peso en kilogramos no es el factor ms importante para determinar si un caballo se encuentra


en el estado de carnes apropiado, pues depende de cmo se observa su condicin corporal, es
decir, la distribucin de la grasa de reserva en su figura exterior.

Se ha presentado el sistema de valoracin corporal del caballo, diseado por el Doctor Henneke de
la Universidad de Texas A. & M., como una gua para poder reconocer el grado en que se
encuentra cada caballo; sin embargo, pueden haber mnimas variaciones en su aplicacin,
dependiendo de la temperatura, humedad, y otros factores medio ambientales; al igual que la raza
y el estado fisiolgico del equino pueden presentar algunas variaciones.

Tabla 16. Evaluacin de la Condicin Corporal del Equino


VALOR CLASE DESCRIPCIN
Extremadamente flaco: el hueso es muy prominente
en las apfisis espinosas, costillas, base de la cola,
punta del anca y punta de la nalga. La estructura
1 Pobre sea de la cruz, hombros y cuellos es fcilmente
visible.
No se siente tejido graso al tacto.

100
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Capa de grasa delgada, cubriendo las apfisis


espinales; las apfisis transversales de las vrtebras
lumbares se palpan redondeadas. Costillas, base de
2 Muy Flaco la cola, punta del anca y punta de la nalga son
prominentes. Cruz, hombro y cuello levemente
notables.
Un poco de grasa entre las apfisis espinales, las
3 Flaco apfisis transversales de las vrtebras lumbares no
se palpan al tacto. Una capa de grasa delgada recubre las costillas
pero an as tanto las apfisis espinales como las costillas se notan
visualmente. La base de la cola es prominente, pero cada vrtebra
individual no se identifica visualmente. La punta del anca aparece
redondeada pero fcilmente notable. Punta de la nalga no se distingue
y tanto la cruz, los hombros y el cuello se encuentran acentuados.

Apenas visible la lnea externa de las costillas. Base


de la cola prominente dependiendo de la conformacin
del caballo, pero la grasa se puede sentir al tacto
4 Moderadamente alrededor de ella. La punta del anca no es notable.
Flaco Cruz, hombros y cuello no tan delgados.
Lomo nivelado o aplanado. Las costillas no se pueden distinguir
visualmente pero si al tacto. Grasa alrededor de la base de la cola
comenzando a sentirse esponjosa al tacto. La cruz se ve redondeada por
encima de las apfisis espinales. Hombros y cuello se observan bien
5 Moderado fusionados entre si.
Musculoso La grasa sobre las costillas se siente esponjosa. La grasa alrededor de la
Moderado base de la cola se siente suave. Se comienza a depositar grasa a los
6 lados de la cruz, detrs de los hombros y a los lados del cuello.
Puede verse pliegue en el lomo. Las costillas se pueden sentir
individualmente al tacto pero se percibe grasa entre ellas. La grasa
alrededor de la base de la cola es suave. Hay grasa alrededor de la cruz,
7 Musculoso detrs de los hombros y a lo largo del cuello.
Pliegues en el hombro. Las costillas difcilmente se distinguen al tacto.
Grasa alrededor de la base de la cola muy suave. La cruz y detrs de los
hombros se encuentran llenos con grasa. El cuello se percibe ms
8 Gordo grueso. Se deposita grasa a lo largo de los msculos en su cara interna.
Pliegues en el lomo. Sobre las costillas se observan parches de grasa
como montaitas. Grasa sobresaliente alrededor de la base de la cola, a
lo largo de la cruz, detrs de los hombros y a lo largo del cuello. La grasa
Extremadamente depositada a lo largo de los muslos en su cara interna causa friccin
Gordo entre s. Los flancos estn llenos con grasa.
9

101
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Figura 10 Condicin Corporal Segn el Sistema Henneke

Condicin Corporal 1 Condicin Corporal 2


| Condicin Corporal 3

Condicin Corporal 4 Condicin Corporal 6


Condicin Corporal 5

102
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Condicin Corporal 8
Condicin Corporal 9
Condicin Corporal 7
http://uco.es

CAPITULO 5

REPRODUCCIN DE LOS EQUINOS

Tomada en Pesebrera El Puente - Neiva

Introduccin

La reproduccin de los animales guarda especial significado para la perpetuacin de todas y cada
una de las especies, los equinos no escapan a este patrn de comportamiento reproductivo. La
interaccin de los gametos producidos por ambos sexos constituye la base del proceso

103
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

reproductivo y por tanto, de la perpetuidad de las especies. Si bien en el macho la gametognesis


se produce de forma continua, en la hembra, la formacin y liberacin de las clulas germinales es
un proceso cclico debido a las interacciones endocrinas que se producen entre el hipotlamo, la
hipfisis y los ovarios .La vida reproductiva se caracteriza en general por la gametognesis y por
un deseo sexual denominado libido, se hace posible en la pubertad y continua en gran parte de la
vida media hasta la vejez de los animales. La mayor parte de los machos tienen capacidad para
una vida reproductiva durante todo el ao, mientras que las hembras presentan una vida sexual
regida por los ciclos estrales.

En algunas especies la primera ovulacin se presenta durante un estro silencioso ya que durante
este la hembra no presenta el comportamiento sintomtico del estro. Para que el periodo de estro
transcurra con receptividad sexual, es necesario que las hormonas esteroides circulen por el
torrente sanguneo.

El desarrollo ovrico comprende periodos o etapas que se inician con la oognesis o desarrollo de
ovulo derivado de una clula sexual primitiva, la ovulacin y la formacin del cuerpo lteo. Estos
procesos a su vez influyen sobre otras partes del sistema reproductor en sucesin cclica que se
denomina como ciclo estral.

De todos los animales domsticos la yegua es la mas difcil de manejar reproductivamente, es un


animal polistrico, con un ciclo estral de 21 das en promedio.

La yegua reproductora es aquella que ha alcanzando su completa constitucin anatmica y


nerviosa para criar animales propios de la raza a la que pertenece.

La pubertad en las hembras se alcanza entre los 18 16 meses dependiendo del estado de
nutricin, desarrollo corporal y raza, la osificacin completa termina a los 5 aos, motivo por el cual
seria ideal servir las hembra ha esta edad.

En cuanto el macho reproductor o padrillo la pubertad y produccin de espermatozoide los alcanza


entre los 13 14 meses, la madures sexual la alcanza a los dos aos y medio y tiene completa
capacidad a los 4 aos considerndose adulto a los 5 aos.
Leccin 21 ANATOMA Y FISIOLOGA DE LA REPRODUCCION.

APARATO REPRODUCTOR DE LA HEMBRA.

Los rganos reproductivos de la yegua estn constituidos por dos ovarios y el sistema de
conductos femeninos que incluye los oviductos, tero, crvix, vagina, vestbulo vaginal y labios
vulvares.
Los genitales internos estn sostenidos por el ligamento ancho el cual se subdivide tericamente
en mesovario porque sostiene los ovarios, mesosalpinx porque sostiene los salpinges u oviductos y
mesometrio porque sostiene el tero Los genitales externos estn constituidos por los labios
mayores que posee la vulva, cuya posicin es vertical pero con la edad cambia a horizontal, lo cual
tambin puede ocurrir en hembras preadas por la traccin que ejerce el tero grvido.

As pues tenemos:

Ovarios

Son los rganos reproductores primarios en la hembra; son de forma arrionada debido a la
presencia de la fosa ovulatoria, 2 a 3 veces ms grandes que los de la vaca. Mide

104
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

aproximadamente 7.0 x 3.5 x 2.5, producen los gametos femeninos (el vulo) y las hormonas
sexuales femeninas (estrgenos y progestgenos). La yegua es un animal MONOTOCO y paren
normalmente un producto en cada periodo gestacional, por lo tanto se produce un vulo en cada
ciclo estral.

El ovario est compuesto por la mdula y la corteza, en la yegua estas se encuentran invertidas, la
medula externa constituye el tejido estructural mientras que los folculos se producen en la corteza
central. La mdula est compuesta de vasos sanguneos, nervios y tejido conjuntivo. La corteza
tiene las clulas y capas de tejido asociadas con el vulo y la produccin de hormonas; el
parnquima, es conocido como la capa funcional porque contiene los folculos ovricos y las
clulas que producen hormonas ovricas.

Un folculo primario es una clula germinal rodeada de una capa simple de clulas, algunos de
stos alcanzan la madurez y son liberados dentro del sistema de conductos para su posible
fertilizacin y desarrollo del producto. La mayora inician el desarrollo y no lo completan tomndose
atrsicos (degenerados).

El folculo primario est en constante estado de crecimiento y maduracin. Las clulas del folculo
rodean al huevo potencial, dando origen al folculo secundario, cuando el folculo logra acumular
lquido entre sus clulas se clasifica como terciario. Este, ya maduro, ejerce presin sobre la tnica
albugnea tomando la apariencia de una vejiga llena de lquido en la superficie del ovario que se
llama folculo de Graaf. El lquido en el antro del folculo terciario es rico en estrgenos y se llama
lquido folicular. El cmulos oophorus, es un montecillo de clulas, se localiza en un lado del antro.
El huevo potencial descansa sobre los cmulos oophorus protegido por la corona radiada.
Al final del crecimiento folicular; el folculo dominante que es el que contiene una mayor cantidad
de estrgenos que actuaran como indicador de la maduracin; una secrecin masiva de
gonadotropina LH, conocida como pico de LH, activa la maduracin final y la ovulacin del folculo
dominante; los folculos restantes son eliminados por atresia folicular, esto en animales montonos
como es el caso de la yeguas.
Una vez se ha producido la ovulacin, los elementos residuales del folculo se reorganizan para
formar un cuerpo lteo con la funcin endocrina de secrecin de progesterona. Como
consecuencia de la ovulacin, la lamina basal se rompe originando una pequea hemorragia en la
cavidad, producida por la ruptura de los vasos sanguneos. El coagulo formado se denomina
cuerpo hemorrgico.

Las clulas epiteliales que revisten la cavidad folicular, comienzan a multiplicarse bajo el influjo de
la LH, desarrollando as el cuerpo amarillo o cuerpo lteo que se proyecta a la superficie del ovario.

Si el ovulo ha sido fecundado y sigue el proceso de gestacin, el cuerpo lteo perdura, actuando
como una glndula endocrina que secreta progesterona, esencial para mantener la gestacin.
Por el contrario si la fecundacin no se realiza, el cuerpo lteo, involuciona y desaparece,
desarrollndose en su lugar un proceso cicatrizal llamado cuerpo blanco.

Oviductos

Los oviductos (llamados tambin trompas de Falopio o salpinx) son un par de tubos enrollados que
se extienden desde cerca de los ovarios hasta las puntas de los cuerpos uterinos, con los que se
continan, y estn suspendidos por el mesosalpinx, pliegue peritoneal derivado del ligamento
ancho, su longitud es de 25 cm. En sus funciones se incluye, el transporte de huevos y
espermatozoides, adems, son el sitio de fertilizacin y el lugar de las divisiones celulares
primarias del embrin. Consta de tres capas: tnica serosa, tnica muscular y tnica mucosa.

El oviducto, se divide en tres segmentos. La abertura en forma de embudo cerca de los ovarios es

105
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

el infundbulo. En la yegua, el infundbulo est separado del ovario, con numerosos pliegues en la
mucosa. El mpula es el segmento medio, tiene de 3 a 5 mm. de dimetro y forma casi la mitad de
la longitud total del oviducto. El revestimiento mucoso del mpula tiene de 20 a 40 pliegues
longitudinales, lo cual aumenta considerablemente el rea de la luz. El mpula se une al istmo, el
tercer segmento, a nivel de la unin ampular stmica. Esta unin es difcil de situar
anatmicamente, y se ha descrito como una estructura que retrasa al vulo varias horas durante el
transporte. La fertilizacin ocurre en esta unin. El istmo es ms pequeo que el mpula, con un
dimetro de 0.5 a 1 mm. El istmo se une con la punta del cuerno uterino a nivel de la unin
uterotubaria. En general, la actividad del oviducto es estimulada por los estrgenos e inhibida por
los progestgenos.

El mpula es el sitio donde ocurre la capacitacin del espermatozoide y la fecundacin del ovulo.
El ovulo permanece en el oviducto durante varios das, siendo regulado su transporte por los
movimientos peristlticos y antiperistlticos del oviducto.
El o9viducto posee un fluido oviductal que favorece la capacitacin del espermatozoide, dicho
fluido esta constituido por trasudados del suero sanguneo y productos de secrecin de los
grnulos de las clulas secretoras del epitelio oviductal. Contiene glucoproteinas como la albmina
y la prealbmina.

tero
Es el sitio donde se desarrolla la placenta para la nutricin hematotrfica del feto permanece en
reposo en la gestacin y en el parto sufre contraccin peristlticas que inducen la expulsin del feto
y sus membranas, se extiende desde la unin uterotubaria del crvix. En la yegua la longitud total
vara de 35 a 50 cm. La principal funcin del tero es retener y nutrir al embrin o feto. Antes que el
embrin se adhiera al tero, la alimentacin proviene del vitelo que contiene el embrin y de la
leche uterina secretada por las glndulas de la capa mucosa del tero. Despus de adherirse al
tero, los nutrientes y productos de deshecho son conducidos por la red de circulacin materno-
fetal, a travs de la placenta. La yegua posee un tero bipartido. Tiene un cuerpo uterino
prominente anterior al conducto cervical y dos cuernos uterinos.

Como en el oviducto, la tnica serosa es la capa externa del tero. El miometrio, la capa
intermedia, est compuesto de dos capas longitudinales delgadas de msculo liso, con una capa
circular ms gruesa comprimida entre ellas. Los estrgenos aumentan el tono del miometrio,
proporcionando al tero una consistencia erecta Los progestgenos disminuyen el tono del
miometrio causando que el tero se torne ms flcido. El endometrio, es la mucosa que recubre al
tero, es ms complejo que el resto del sistema de conductos y posee glndulas simples. Los
estrgenos aumentan la irrigacin causando engrosamiento del endometrio y estimulan el
crecimiento de las glndulas endometriales. Los progestgenos causan que las glndulas
endometriales se enrosquen, se ramifiquen y secreten la leche uterina. Las acciones sinergistas de
los estrgenos y progestgenos en el endometrio preparan al tero para la preez.

El endometrio proporciona un mecanismo para la adhesin de las membranas extraembrionarias o


fetales. Esta unin forma la placenta, y al proceso se le denomina placentacin. Con la formacin
de la placenta, los nutrientes de la sangre materna pueden ser transferidos a la sangre embrionaria
o fetal y los productos de deshecho de la sangre embrionaria se pueden eliminar a travs de los
sistemas maternos. La yegua posee una adhesin placentaria difusa superficial, clasificndose
como epiteliocorinica. Esto significa que no ocurre erosin de los tejidos de las membranas
extraembrionarias ni en el endometrio durante la formacin de la placenta. Los nutrientes y gases
de la sangre materna deben pasar a travs de las capas de tejidos maternos, extraembrionarios
para alcanzar la sangre embrionaria y viceversa.
Sus funciones son:

Por las contracciones del miometrio durante el estro, se facilita el transporte de los
espermatozoides desde el cuerpo uterino hasta el oviducto.

106
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Produce las secreciones necesarias para iniciar la capacitacin espermtica.

Interviene en la regulacin de la vida funcional del cuerpo lote.


Secreta los carbohidratos y las protenas necesarias para la nutricin histotrfica del embrin y los
factores y los factores para la subsecuente implantacin.
Es el sitio donde se desarrolla la placenta para la nutricin hemetotrfica del feto.
Cambia de tamao, estructura y posicin para acomodar al prenato a medida que este
crece.
Permanece en reposo durante la gestacin, y en el parto sufre contracciones peristlticas
que inducen a la expulsin del feto y sus membranas.

Crvix o cuello uterino.

Es una estructura esfinteriana que se proyecta caudalmente en la vagina Aunque tcnicamente es


una parte del tero, el crvix se describe como un rgano distinto. Posee una pared gruesa y
rgida, la terminacin anterior se contina con el cuerpo del tero, en tanto que la Terminal
posterior se orienta hacia la vagina. La longitud vara de 5 a 10 cm., con un dimetro externo de 2
a 5 cm. Se define como un conducto que se abre en el tero. La funcin primaria del crvix es
prevenir la contaminacin microbiana del tero; sin embargo, tambin puede servir como reservorio
para el esperma despus del apareamiento. El semen se deposita en el crvix durante la monta
natural en las yeguas.

Altos niveles de estrgenos hacen que el conducto cervical se dilate durante el estro (cel). El
sinergismo entre los grandes niveles de estrgenos y la relaxina causa una mayor dilatacin un
poco antes del parto. Esta dilatacin del conducto al parecer hace al tero ms vulnerable a los
organismos invasores. Sin embargo, los estrgenos causan que las clulas epiteliales del crvix
secreten moco, el cual posee propiedades antibacterianas, con lo cual se protege al tero. Durante
la preez, el moco se engruesa y forma un tapn gelatinoso que sella y protege al tero. La
eliminacin del tapn mucoso incrementa las posibilidades de aborto.
El tapn mucoso o moco cervical varia en su composicin con el ciclo estral de la yegua y esta
formado por macromolculas de mucina de origen epitelial, o sea compuesto de glicoproteinas que
contienen cerca del 25 % de protenas y 75 % de carbohidratos. Tambin contiene enzimas como
la glucoronidasa, amilasa, fosforilasa, fosfatasa y esteraza.

Vagina

La vagina es un rgano muscular dilatable que facilita la copula y el paso del feto durante el parto,
tiene forma tubular, es de paredes delgadas y completamente elstica, es un rgano muscular
dilatable que facilita la copula y el paso del feto durante el parto adems de ser el conducto
escretor de las secreciones del cervix, del endometrio y del oviducto Tiene 25 a 30 cm. de longitud.
Es el rgano femenino para la cpula.
Las clulas epiteliales de la vagina se cornifican (se vuelven clulas sin ncleo) bajo la influencia
de los estrgenos. En la yegua no observan cambios notorios en le epitelio a travs den ciclo estral
los frotis vaginales se pueden utilizar como ayuda para detectar el estro, aunque este
procedimiento es ms til en animales de laboratorio, no obstante durante el diestro y el anestro el
epitelio vaginal esta cubierto por una secrecin de color pardo pegajosa bajo la influencia de la
progesterona, la cubierta epitelial se regenera.
La vagina sirve como conducto excretor de las secreciones del cervix, del endometrio y del
oviducto. Tambin es el canal del nacimiento durante el parto. Durante el diestro y el anestro el
epitelio vaginal esta cubierto por una secrecin de color pardo, pegajosa.

Vulva

107
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

La vulva u rgano genital externo consta del vestbulo con sus anexos y labios. El vestbulo es la
parte del sistema de conductos femeninos que es comn tanto al sistema reproductor como al
urinario. Tiene 10 a 12 cm. de longitud, unindose a la vagina en el orificio uretral externo. En este
punto el himen se encuentra bien definido en la yegua. Posterior al orificio uretral externo, se
localiza el divertculo suburetral (bolsa cerrada). El labio consta de labio menor, pliegues internos o
labios de la vulva y labio mayor, pliegues externos o labios de la vulva.

El cltoris, homlogo del glande del pene en el macho, se localiza ventralmente un cm. dentro del
labio. Contiene tejido erctil con abundantes nervios sensoriales y se le encuentra erecto durante
el estro. En la yegua es la excepcin. Durante el estro en la yegua, las contracciones frecuentes
del labio exponen al cltoris erecto. Las glndulas vestibulares, localizadas en la parte posterior del
vestbulo, son activas durante el estro y secretan un moco lubricante para la cpula.
Aunque el sistema reproductor femenino descansa parcialmente en el piso de la pelvis, el
ligamento ancho se considera como la principal estructura de sostn. Este ligamento sostiene a
los-ovarios, oviductos y tero de ambos lados de la pared dorsal de la pelvis. Los vasos
sanguneos y nervios pasan a travs del ligamento ancho del sistema reproductor femenino. Este
sistema est inervado principalmente por nervios autnomos, sin embargo, se encuentran nervios
sensoriales en la regin de la vulva, en especial en la regin del cltoris.

Las arterias ovricas, tambin llamadas arterias uteroovricas, se ramifican e irrigan a los ovarios,
oviductos y parte de los cuernos uterinos. Estas arterias son ms grandes en el lado del ovario que
posee un cuerpo lteo activo. La arteria uterina media proporciona sangre al resto de los cuernos
uterinos y al cuerpo del tero. Este aumenta durante las fases media y final de la preez y se
puede palpar como ayuda en el diagnstico de preez en yeguas. La arteria hipogstrica se
ramifica para irrigar el cervix, la vagina y la vulva.
Glndula mamaria.

Se encuentra ubicada en la regin inguinal, en la parte ms alta entre las extremidades traseras,
rozando con el borde interno de estas. Consta de dos complejos glandulares independientes que
se unen externamente, cada uno de los cuales terminando en un pezn proyectado hacia abajo y
levemente hacia delante. Cada pezn posee entre 2 y 5 agujeros por donde se secreta la leche por
el reflejo de la succin producida por el potro al momento de alimentarse.

APARATO REPRODUCTOR DEL MACHO.


El aparato reproductor masculino consta de escroto, cordones espermticos, testculos, glndulas
accesorias, pene, prepucio y sistema de conductos masculinos. El sistema de conductos incluye
los vasos eferentes, los conductos deferentes y la uretra externa.

Testculos

Son rganos pares situados en la cavidad escrotal y orientados horizontalmente los testculos son
los principales rganos de la reproduccin en los machos, ya que producen gametos masculinos
(espermatozoides) y hormonas sexuales masculinas (andrgenos).

En el caballo los testculos durante su vida fetal se encuentran en la cavidad abdominal, cerca de
los mesonefrones o riones embrionarios y descienden al escroto poco antes del nacimiento. Los
testculos en su vida adulta tienen una longitud de 10-12 cm. y aproximadamente de 5 cm. de
ancho, aunque en la mayora de las ocasiones el izquierdo es de mayores proporciones que el
derecho, su peso individual es de 225-300 gr. En algunos casos uno o los dos testculos no
descienden debido a una falla en su desarrollo; si ninguno desciende, el animal recibe el nombre
de criptorqudeo bilateral. Los criptorqudeos bilaterales son estriles. Si slo un testculo no
desciende, ser un criptorqudeo unilateral. Por lo general, ste es frtil, pero se recomienda no

108
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

mantenerlo en la explotacin como reproductora ya que esta condicin anormal es de carcter


hereditario.

Los testculos estn cubiertos por la tnica vaginal, tejido seroso extensin del peritoneo. Esta
capa serosa se obtiene a medida que los testculos descienden al escroto y est adherida a lo
largo de l. La capa externa de los testculos es la tnica albugnea testicular, membrana delgada
blanquecina de tejido conectivo elstico. Por debajo de la tnica albugnea testicular est el
parnquima, la capa funcional de los testculos, es de color amarillento y est dividido en
segmentos por tabiques incompletos de tejido conectivo. Dentro de estos segmentos estn los
tubulos seminferos. Bajo la estimulacin de FSH, las clulas de Sertoli (de nutricin) producen
protena fijadora de andrgenos e inhibina. Los tubulos seminferos son los sitios de produccin de
espermatozoides. Representan el 80% del peso de los testculos. Los tubulos seminferos se unen
a una red de tubulos, la rete testis, que se conectan a 12 o 15 pequeos conductos, los conductos
eferentes, que convergen en la cabeza del epiddimo.

Las clulas de Leydig (intersticiales) se encuentran en el parnquima de los testculos, entre los
tubulos seminferos. La LH estimula a las clulas de Leydig para producir testosterona en
pequeas cantidades u otros andrgenos.

La testosterona se necesita para el desarrollo de las caractersticas sexuales secundarias y para el


comportamiento normal de la cpula.

Escroto y cordn espermtico

El escroto es un saco bilobulado que envuelve a los testculos, asimtrico sin pelos ni vellosidades,
en la mayora de las especies se localiza en la regin inguinal entre los miembros posteriores. Est
compuesto de una capa externa de piel gruesa con numerosas glndulas grandes sudorparas y
sebceas, la tnica dartos, divide al escroto en dos bolsas y se adhiere a la tnica vaginal en el
fondo de cada una de ellas.

El cordn espermtico conecta a los testculos con un sistema de nutricin de las arterias
(enrolladas sobre s) testiculares y plexo venoso asociado y los troncos nerviosos. Adems, el
cordn espermtico est compuesto de fibras musculares lisas, tejido conectivo y una porcin del
conducto deferente. Tanto el cordn espermtico como el escroto contribuyen al sostn de los
testculos, igualmente poseen la funcin conjunta de mantener la temperatura testicular. Esto
incluye el acercar los testculos al cuerpo cuando la temperatura ambiente es muy baja o dejarlos
colgar alejados del cuerpo cuando sta aumenta. Dos msculos lisos participan en esto: La tnica
dartos, y el cremster, un msculo liso ubicado alrededor del cordn espermtico, ambos
termosensibles.

El plexo pampiniforme, lleva sangre ms fra de regreso al organismo, as ocurrir cierto grado de
enfriamiento de la sangre arterial antes de que llegue a los testculos. Igualmente el alargamiento
del cordn espermtico frente a temperaturas elevadas provoca que haya una superficie mayor
para el intercambio de calor.

Epiddimo

El epiddimo, es el primer conducto externo que sale de los testculos, est unido longitudinalmente
a la superficie de los testculos, y junto con stos est encerrado en la tnica vaginal. La cabeza
del epiddimo se localiza en la punta del testculo, donde los conductos eferentes (de 12 a 15
pequeos conductos) se unen para salir como un solo tubo. El cuerpo del epiddimo se extiende a
lo largo del eje longitudinal del testculo y se contina con la cauda o cola.

109
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

El epiddimo transporta los espermatozoides desde el testculo; varios factores contribuyen a este
movimiento. Un factor es la presin de los nuevos espermatozoides que se estn produciendo,
este movimiento es ayudado por la presin externa creada por el efecto de masaje que ocurre
sobre los testculos y el epiddimo durante el ejercicio normal. Durante la eyaculacin, las
contracciones de la capa muscular lisa del epiddimo y una ligera presin negativa (accin de
succin) creada por las contracciones del conducto deferente y la uretra, desplazan en forma
activa a los espermatozoides del epiddimo al conducto deferente y a la uretra.

Almacenamiento
La mayor parte se almacena en la cola del epiddimo, donde los espermatozoides concentrados
son retenidos en su luz. All, las condiciones son ptimas para preservar la viabilidad de
espermatozoides por un tiempo prolongado. El pH bajo, una alta viscosidad, la gran concentracin
de bixido de carbono, la mayor proporcin de potasio a sodio, la influencia de la testosterona y
probablemente otros factores, se combinan para producir un bajo ndice metablico y as lograr
una vida ms prolongada a la clula espermtica.

Maduracin
Cuando los espermatozoides recientemente formados entran a la cabeza a partir de los conductos
eferentes, no tienen la capacidad de motilidad ni fertilidad. Durante su paso por el epiddimo,
adquieren capacidad para moverse y se tornan frtiles.

En el paso por el epiddimo, los espermatozoides pierden la gota citoplasmtica que se forma en el
cuello de cada espermatozoide durante la espermatognesis, dicha gota es un indicador de
maduracin de los espermatozoides en el epiddimo. Si un porcentaje elevado de los
espermatozoides recin eyaculados tienen gotas citoplasmticas, se les considera inmaduros y
tienen una fertilidad reducida.

La actividad secretora del aumenta la viabilidad de los espermatozoides durante su


almacenamiento.

Conducto deferente y uretra

El conducto deferente es un tubo que sale del extremo distal de la cola de cada epiddimo, pasa a
lo largo del cordn espermtico, a travs del conducto inguinal haca la regin plvica, donde se
une a la uretra en su origen, cerca de la apertura de la vejiga. Su extremo agrandado cerca de la
uretra es el mpula. Este conducto tiene una capa muscular lisa gruesa en su pared y parece tener
como funcin nica la del transporte de los espermatozoides. Algunos autores sugieren que el
mpula sirve como almacenamiento de corto tiempo para el semen. Sin embargo, los
espermatozoides envejecen rpidamente en el mpula.

La uretra es un conducto nico que se extiende desde su unin con el mpula hasta la porcin
Terminal del pene. Sirve de conducto excretor tanto para la orina como para el semen.

Glndulas accesorias
Las glndulas accesorias se localizan a lo largo de la porcin plvica de la uretra con conductos
que vacan sus secreciones en su interior. Estas son las glndulas vesicales, la prstata y las
glndulas bulbouretrales. Contribuyen en gran medida a proporcionar mayor volumen al semen.
Adems, sus secreciones son amortiguadoras y nutrientes, aseguran una motilidad ptima y una
buena fertilidad del semen.

Glndulas Vesicales

110
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Son un par de glndulas lobulares que se identifican fcilmente debido a su abultada apariencia
similar a un racimo de uvas. Sus conductos excretores desembocan cerca a donde se unen la
uretra y el mpula. Contribuyen sustancialmente en el volumen total del semen, con varios
compuestos orgnicos tales como la fructosa, fuente de energa para los espermatozoides.

Prstata
Es una glndula nica localizada a lo largo y alrededor de la uretra, posterior a los
conductos excretores de las glndulas vesicales, esta formado por dos lbulos formados por
un istmo El cuerpo prosttico es visible en sistemas genitales aislados y se puede palpar en
el caballo. Contribuye en pequea medida al volumen del semen. Las secreciones de la
prstata son ricas en iones inorgnicos, como sodio, cloro, calcio y magnesio.

Glndulas Bulbouretrales
Son un par de glndulas localizadas a lo largo de la uretra, cerca del punto donde sta sale
de la pelvis. Contribuyen muy poco al volumen del lquido seminal. Sus secreciones lavan de
residuos de orina en la uretra antes de la eyaculacin.

Pene
Es el rgano de la cpula de los machos. No tiene flexura sigmoidea Se forma alrededor de la
uretra a partir del lugar donde sta sale de la pelvis; el caballo tiene msculos retractores del pene,
son msculos lisos que se relajan para permitir la extensin del pene y se contraen para regresar
el pene hacia el cuerpo.

El glande del caballo contiene mucho ms tejido erctil del que se encuentra en toros, cerdos o
borregos, es redondeado y la parte anterior presenta una superficie cncava (fosa del glande),
partir de la cual se proyecta la uretra de cuatro a seis cm.

El tejido erctil es cavernoso (como esponja) y se localiza en dos regiones del pene. El cuerpo
esponjoso del pene es el tejido cavernoso situado alrededor de la uretra. El cuerpo cavernoso del
pene es un rea ms grande de tejido cavernoso localizada dorsalment al cuerpo esponjoso del
pene. Estas reas cavernosas se llenan de sangre durante la excitacin sexual, lo que causa la
extensin. Del pene (ereccin) y facilita la expulsin final del semen durante la eyaculacin.

Cuando el pene del padrillo esta relajado, tiene una longitud aproximada de 50 cm. desde el inicio
del msculo retractor del pene que se encuentra en la cavidad abdominal, hasta el glande. Durante
la ereccin el pene aumenta su tamao al doble o un poco mas.
Se extiende desde la parte anterior del escroto y continua hacia el vientre 5 a 7 cm. Antes del
ombligo. En el momento de la miccin, el equino saca un poco el pene del prepucio, pero durante
la ereccin sale unos 50 a 60 cm.

Prepucio

El prepucio es una invaginacin de la piel que encierra por completo el extremo libre del pene. Se
le puede dividir en una porcin prepeniana, o pliegue externo y porcin penil o pliegues internos. El
orificio prepucial est rodeado de pelos largos y fuertes.

CICLO ESTRAL.

Por ciclo estral se entiende una serie de cambios hormonales que se traducen en un
comportamiento corporal que tiene su momento culminante cuando la hembra permite ser
copulada por el macho.

111
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Fases o etapas del ciclo estral:

Proestro (precelo), Estro (celo o calor), postestro (metaestro o diestro).

En el precelo son perceptibles, en los genitales externos, ciertas alteraciones tales como
edematizacin y enrojecimiento de los labios vulvares, las hembras muestran cierta inquietud y
comportamiento alterado, pero rechazan el macho.

El perodo de celo se caracteriza sobre todo por disposicin para permitir el acercamiento y monta
por parte de el macho, hay secrecin de feromonas en la orina

Sntomas del celo o calor:


Alteraciones en los genitales externos:
Se manifiestan, sobre todo, como enrojecimiento (hiperemia), edematizacin y secrecin
mucosa, proveniente de los fluidos cervicales producidos durante el celo, as como de
secreciones de las glndulas vaginales.

Sntomas de comportamiento:
Durante el celo muestran las yeguas un comportamiento distinto del habitual, que es tpico
de la especie.
Llama la atencin, en primer lugar, una alteracin de la expresin corporal total,
acompaada por determinadas formas de expresin postural. Adems se puede observar
gran inquietud, junto con una continua bsqueda de contacto con sus compaeros, otros
animales o incluso el hombre. La ingestin de alimentos frecuentemente est perturbada
(tiende a disminuir) La actividad sexual durante el celo se manifiesta sobre todo por
simulacin de monta sobre otras hembras o machos. Tambin llama la atencin los
relinchos u otros sonidos caractersticos. En la yegua el signo tpico de celo, lo produce la
contraccin fuerte y continua de los msculos de la vagina, dicho movimiento se llama
vulgarmente Guio vulvar con l se exhibe el cltoris, invitando al macho para la cpula.

Sntomas biolgicos acompaantes del celo


Las alteraciones hormonales responsables del celo dan lugar a una serie de reacciones del
organismo que se manifiestan de una manera ms o menos tpica en dependencia del ciclo
y por tanto tambin del celo. Las principales son:
Variaciones de la temperatura corporal.
Evolucin cclica en el epitelio de la mucosa vaginal. Variaciones en la
consistencia y el aspecto del moco cervical. La apertura del canal cervical.
La secrecin de sustancias olorosas.

Control hormonal

El ciclo estral est regulado principalmente por un balance entre las hormonas esteroides del
ovario y las hormonas protenicas gonadotropinas de la hipfisis anterior. As mismo, la
progesterona tiene un efecto dominante en la regulacin del ciclo estral. Durante el diestro, cuando
las concentraciones de progesterona son altas; las concentraciones de FSH, LH y los estrgenos
totales permanecen bajos. En el ovario, se puede detectar cierto crecimiento folicular y se asocia
con pequeas elevaciones de FSH, LH y estrgenos a la mitad del diestro, pero sin ser tan
evidente como el crecimiento folicular tpico del da 2 o 3 antes de la ovulacin. De la misma
manera, durante la prees, las grandes concentraciones de progesterona evitan la liberacin de
hormonas gonadotrpicas que iniciaran el comportamiento de estro.

Al final del diestro, la PGF (Prostaglandina F2-alfa) uterina provoca la regresin del cuerpo lteo, lo
que ocasiona una marcada disminucin de las concentraciones sanguneas de progesterona.

112
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Estas bajas concentraciones de progesterona pueden servir como estmulo lo que ocasionar
liberacin de FSH, LH y prolactina por la hipfisis.

Existe elevacin de estrgenos al empezar el estro de las yeguas, disminuyendo cerca del final del
estro; igualmente se pueden observar elevaciones de FSH y LH que tienen una duracin de 8 a 10
horas durante el estro y se presentan 24 horas antes de la ovulacin; la prolactina se eleva cerca
del comienzo del estro, permaneciendo as durante todo el mismo. La FSI-1 estimula el crecimiento
folicular durante el inicio del proestro y directa o indirectamente provoca elevacin de los
estrgenos ovricos. La rpida elevacin de LH y FS lI-l durante el estro parece ser requisito
necesario para el crecimiento y maduracin d los folculos de Graaf, necesarios para la ovulacin.

Junto con el crecimiento folicular hay una elevacin de estrgenos; estos se producen por las
clulas del folculo de Graaf, estos estrgenos causan los signos fisiolgicos y de comportamiento
e inician la liberacin de LH. Despus de la ovulacin se formar un cuerpo lteo en cada sitio de
esta (folculo que liber el vulo). La formacin ocurre rpidamente, y para el da 4 o 5 del ciclo
estral, ya est completamente formado y un incremento detectable de progesterona en sangre
indicar la fase de diestro. Le LH tiene influencia dominante en la formacin del cuerpo lteo. La
LH es lteo-trpica, y junto con la prolactina mantiene la funcin del cuerpo lteo. En forma
opuesta la Prostaglandina F2-alfa al suspender el flujo sanguneo de metabolitos necesarios para
la sntesis de progestgenos, acta as como agente lteo-ltico.

Ovulacin

La ovulacin, o liberacin del vulo, se produce como consecuencia de la ruptura del folculo de
Graaf. Constituye, as la terminacin del proceso de maduracin del folculo y del vulo. La
ovulacin depende especialmente de la hormona LH. Producida la ovulacin, el cuerpo lteo se
desarrolla en el interior del folculo roto, comenzando a segregar la progesterona necesaria para el
desarrollo inicial del huevo y el mantenimiento de la gestacin, si es que ha tenido lugar la
fecundacin, o para la regulacin del ciclo, si esta no se ha producido.

En la yegua la ovulacin tiene lugar 24 a 48 horas antes de terminar los signos externos de calor;
este momento puede ser precisado mediante exploracin rectal, efectuada por un Mdico
Veterinario prctico en la gineco-obstetricia equina; el folculo maduro se identifica mejor por su
consistencia que por su volumen; al tacto se aprecia que es fluctuante y de paredes delgadas,
mientras que el folculo inmaduro se encuentra provisto de una pared densa. El folculo maduro
tiene un dimetro de 15cm. aproximadamente.

En las yeguas la ovulacin se lleva a cabo en la fosa de la ovulacin, rea definida del ovario y no
en cualquier zona, como ocurre en otras especies.

Fecundacin
La fecundacin es el resultado de la penetracin del espermatozoide en el vulo, seguida de la
fusin de los elementos nucleares y citoplasmticos de los 2 gametos. Es, pues, la terminacin
normal de una larga serie de fenmenos durante los cuales estos elementos adquieren sus
propiedades y sus caracteres como clulas germinales masculinas o femeninas. Cada uno de ellos
interviene con arreglo a sus propias caractersticas genticas y estructurales.

Transporte del esperma


La ascensin espermtica a travs del tracto genital es relativamente rpida, el tramo que separa
el cuello uterino de la parte superior de los oviductos se halla representado esencialmente por el
tero, siendo normal considerar a la actividad de este ltimo como la causa principal del
desplazamiento de los espermatozoides; en cambio, la participacin de los movimientos propios de
los espermatozoides y de la actividad de las clulas ciliadas aparentemente es de importancia
menor en el proceso.

113
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Viabilidad y capacidad fertilizante


Tiene una gran importancia el conocer la duracin de la motilidad y de la aptitud fecundante de los
espermatozoides en el tracto genital femenino despus del salto natural o de la inseminacin
artificial. Para el caso de la especie equina la duracin mxima de la fertilidad es de 144 horas y la
duracin mxima de la motilidad es de solo 44 horas.

Salida del vulo.

La ruptura folicular libera una masa gelatinosa constituida por el lquido folicular y el vulo, los
cuales pasan al oviducto en virtud de un mecanismo an no determinado, pero en el cual parece
que intervienen los movimientos ciliares y la actividad muscular del infundbulo. La permanencia
del vulo en las trompas es independiente del tamao del animal, siendo para la yegua el paso por
la zona tubrica de aproximadamente 96 horas. La migracin est asegurada por el movimiento de
las secreciones tubricas hacia el tero, que a su vez est condicionado a los movimientos de los
cilios vibrtiles del epitelio y a las contracciones de la1 musculatura tubrica.
As mismo la migracin ovular depende del equilibrio hormonal estrgeno-progesterona; los
estrgenos retardan la travesa tubrica; un desequilibrio de estas hormonas podr, pues, disminuir
o acelerar esta migracin, encontrndose en este hecho el origen de algunas formas de esterilidad.

Duracin de la fertilidad del vulo.


La supervivencia del vulo es relativamente corta, dependiendo de esta circunstancia el tiempo de
fertilizacin. El perodo de fecundabilidad del huevo de la yegua todava no est medido con
exactitud, pero se estima entre 36-48 horas como mximo.

Caractersticas del eyaculado.


El PH del semen es de vital importancia, este debe ser de 7.5 aproximadamente, esta constituido
por plasme seminal y espermatozoides. En el momento de la eyaculacin el semen es expulsado
en una especie de bombeo entre 5 y 10 pulsaciones sucesivos, es de tener en cuenta que la
primera mitad del eyaculado contiene el 80% de los espermatozoides de este.
Cuando se va a realizar una valoracin del semen se debe tener en cuenta los siguientes
parmetros de evaluacin.

La recoleccin del semen se hace con una vagina artificial, dos veces con intervalo de una hora,
para luego si ser evaluado.
El volumen del eyaculado, que debe ser entre 50 y 70 ml en lo normal pero puede llegar a 150 o
170 ml.
La concentracin espermtica, de 30 a 800 millones por milmetro.
Motilidad progresiva, esta va desde 0% a 90%, pero un 70% es considerado como buena, otro
detalle ha tener en cuenta es el tipo de movimiento que desarrollan los espermatozoides equinos,
este es el lnea recta y no en zigzag como en la mayora de las especies.
La morfologa debe presentar una normalidad de un 70 a 80%.
Si se va a realizar conservacin de semen, se debe mirar su resistencia a la congelacin, su
conteo y su motilidad durante y despus del proceso ya que algunos padrillos producen semen
intolerante al proceso de refrigeracin y mucho menos al posterior congelamiento.
La fertilidad del caballo se considera dudosa cuando al valorar el semen este presenta menos del
50% de los espermatozoides con buena motilidad progresiva y morfologa normal.

Lugar de la fecundacin
El encuentro gamtico se realiza en la ampolla tubrica en un ambiente lquido de cualidades
apropiadas y especialmente destinado para esta funcin. La dispersin de las clulas foliculares
que rodean al vulo depende de un factor tubrico que presenta caractersticas bioqumicas
especiales, en efecto, estas clulas han desaparecido cuando el vulo se encuentra en la zona
tubrica de la yegua. Sin embargo, la fecundacin no depende esencialmente de que las clulas

114
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

de la granulosa hayan desaparecido y de que el vulo se presente desnudo, ya que la penetracin


de ste por los espermatozoides puede realizarse sin que esta dispersin se haya producido, se
conoce que las clulas brindan proteccin mecnica al vulo y a su vez aportan elementos
nutritivos a la clula germinal femenina.

Fertilizacin
La finalidad de la divisin sexuada es la de preparar los gametos para que pueda realizarse la
fertilizacin, es decir, la penetracin del gameto femenino por el masculino para constituir una sola
clula: el cigoto o huevo, cuyo desarrollo ulterior debe terminar con la formacin del embrin y
posteriormente un nuevo ser. El proceso de fertilizacin comprende dos aspectos: mecnico y
gentico.

Despus de que el espermatozoide ha penetrado mecnicamente en el vulo (atravesando la zona


pelcida y la corona radiata), lo incita a dividirse y a desarrollarse embriolgicamente.
Genticamente, la fertilizacin tiene por efecto el introducir en el vulo el aporte hereditario del
macho. La penetracin se produce gracias a la motilidad propia del espermatozoide y a la
intervencin de algunos procesos enzimticos aportados por l, especialmente aquellos en los que
interviene la acrosina.

VARIACIONES DEL CICLO ESTRAL DE LA YEGUA.

1) Clasificacin de la conducta receptiva de la yegua:


a) Muy receptiva (celo fuerte).
b) Receptiva (celo moderado).
c) Poco receptiva (celo dbil).
d) Flemtica.
e) Pasivamente resistente.
f) Medianamente resistente.
g) Activamente resistente.
2) Manifestaciones externas de celo:
a) Busca el padrillo.
b) Adopta "posicin caracterstica".
c) Levanta y tuerce la cola.
d) Clitorea (guio o centelleo vulvar).
e) Orina escasa y repetitivamente.
f) Se deja montar.
3) Manifestaciones externas de no celo:
a) Amaina las orejas.
b) Aprieta o revolea la cola.
c) Patea.
d) Relincha.
e) Muerde.
f) No se deja montar.

4) Caractersticas de la yegua en estro y en no estro.

RGANO ESTRO NO ESTRO


OVARIO Folculo al tacto Sin folculo
UTERO Laxo al tacto Tenso al tacto
Abierto y rojo Cerrado y plido
CERVIX
Laxo al tacto Prieto al tacto

115
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Hmeda y congestionada Plida y seca


VAGINA
Moco fluido filamentoso Mucus como cera
VULVA Tumefacta Normal

Leccin 22 TIPOS DE SERVICIOS MS UTILIZADOS EN EQUINOS.


1) Servicio de campo:
Consiste en colocar al padrillo en un potrero con varias yeguas. Lamentablemente con este
sistema se pierde el control de los servicios, se desgasta mucho el padrillo pero es el ideal para
yeguas "difciles" o repetitivas. Se recuperan hembras con disfunciones que, por otros mtodos,
son ms difciles de prear.

2) Servicio de corral:
Se lleva la hembra en celo a un corral donde se encuentra el padrillo. Una vez realizada la copula,
vuelve a su potrero y el padrillo a su pesebrera.

3) Servicio a mano:
Se lleva la yegua en celo a un picadero cerrado (o un lugar determinado al aire libre), se la manea
e higieniza y se la presenta al padrillo para la monta. Con este sistema, se protege a la yegua y al
padrillo, al evitar coses y mordiscos, entre otros, tanto para el uno como para el otro.

4) Inseminacin artificial:

Similar al anterior, pero en vez de dejarlo servir, se le desva el pene hacia la vagina artificial para
recolectar el semen.

Luego se lo analiza, se diluye y se fracciona para inseminar las yeguas que se encuentren en celo.
Ms adelante ahondaremos un poco ms sobre el tema.

En nuestro medio el sistema ms utilizado es el de monta natural, para que este se lleva a buen
trmino se deben tener en cuenta algunas normas como son las siguientes:

Verificacin del momento adecuado para la copula.


Lavar con jabn la parte perineal de la yegua incluyendo la vulva.

En lo posible vendar la cola de la yegua para evitar laceraciones en el glande del pene al momento
de la monta con las crines de esta.

Ensueltar la yegua en los remos posteriores, sin que esta quede incomoda pero, incapaz de cocear
al padrillo, provocando accidentes.

El pene del caballo tambin debe ser lavado pero sin jabn y en lo posible con abundante agua
tibia.

Se debe acercar el padrillo a la yegua, sujetado por una jaquita que nos permita su dominio.

Antes de permitir la monta debemos asegurarnos de que el pene este en completa ereccin.

Se debe separar la cola de la yegua una vez el padrillo se ha montado en ella, para facilitar la
copula.

Una vez el caballo ha eyaculado, su cola hace un leve movimiento de balanceo, de adelante hacia

116
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

atrs.
Con el fin de evitar accidentes y facilitar la bajada del reproductor de la yagua se recomienda
mover hacia delante la yegua.

www.caballomania.com

TCNICAS DE REPRODUCCIN ASISTIDA.

1) Organizacin de los lotes de retajeo:


a) Clasificar y separar hembras preadas y vacas.
b) Armar lotes no muy numerosos, tales que permitan al personal
encargado del retajeo, el control individual de las yeguas.
c) Utilizar personal idneo. El retajeo es una actividad sumamente importante ya que nos
indicara que hembras estn aptas para la fecundacin.
d) Utilizar siempre el mismo retajo y el mismo personal. Se apreciaran mejor los cambios de
conducta.

2) Manejo de la yegua en celo:

La yegua en celo se lleva a revisin por tacto rectal.

b) Se puede seguir la evolucin de los folculos e inseminar da por medio o cuando se


aprecie la presencia de folculo maduro hasta la ovulacin.
c) Tambin se puede empezar a inseminar a partir del 2 o 3 da, da por medio, hasta el fin
del celo.
d) Luego, la yegua regresa a su lote de retajeo.
Si no vuelve a ser marcada por el retajo despus de 20 das hay un 92 % de probabilidad de
que este preada.
e) Los datos obtenidos se registran en una planilla especialmente diseada.
f) Se pueden utilizar hormonales para el manejo reproductivo, siendo las herramientas ms
comunes y practicas:
Gonadotropina corinica humana (actividad gonadotrpica con predominio luteinizante) en
dosis de 5000 UI por yegua va IM.
Ejerce su efecto sobre el folculo maduro provocando la ovulacin. Prostaglandina F 2alfa
(efecto lteo-ltico), en dosis de 800 Mg. /yegua, va IM. Ejerce su efecto sobre el cuerpo
lteo provocando su lisis.

3) Manejo de los padrillos:


a) Los padrillos se mantienen estabulados, permitindoles salir 1 vez por da a un potrero

117
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

de aproximadamente 5000 metros cuadrados.


b) Sirven 1 vez por da, aunque cuando las circunstancias lo exigen, pueden hacer dos
saltos (1 a la maana y 1 a la tarde), eventualmente 3 (1 a la maana temprano, 1 al
medioda y 1 a la tarde a ltima hora).
c) Se puede dar un da por semana de descanso.
d) Se le presenta la yegua en celo, maneada y con trabones.
e) Realiza el servicio a mano, o bien se recoge el semen con vagina artificial.

4) Manejo del semen:

a) Evaluacin rpida: Los datos se registran en una planilla especialmente diseada.


Aspectos Macroscpicos Aspectos Microscpicos
Volumen. Movilidad general.
Presencia de gel. Coloracin vital (eosina - nigrosina).
Color. Recuento rpido (cmara de recuento
Opacidad. de glbulos)
Consistencia. La evaluacin rpida debe completarse,
Olor. cuando el tiempo lo permita, con una
Ph. evaluacin detallada de la muestra
(recuento espermtico, tinciones,
conformacin, supervivencia etc.)

b) Dilucin y fraccionamiento

Se utiliza diluyente por dos causas fundamentales:

Aumentar el volumen para facilitar el fraccionamiento. Proteger a los


espermatozoides.
Uno de los diluyentes mas utilizados es la lactosa-yema (80 partes de lactosa al 11 % en agua
destilada y 20 partes de yema de huevo, con el agregado de penicilina y estreptomicina).
Se utiliza una dosis de 500 millones de espermatozoides vivos y con motilidad progresiva.
Eventualmente, ante una gran cascada de celos puede reducirse la dosis inseminante a un
mnimo 100 millones tratando de evitar dosis tan bajas en yeguas prximas a la ovulacin.

El volumen a utilizar por yegua puede variar entre 15 y 50 ml.

c) Clculos: Un ejemplo
practico:
Un padrillo eyacula 100 ml de semen con una concentracin de 50 millones de
espermatozoides por ml.
Tener en cuenta los datos que manejamos: volumen y concentracin. Sabemos, entonces,
que el total de espermatozoides es de 5000 millones.
Apreciamos que hay un 5 % de espermatozoides muertos y un 15 % sin motilidad progresiva.
Nosotros necesitamos espermatozoides vivos y con motilidad progresiva.
Descontamos el 20 % y determinamos de esta manera que disponemos de 4000 millones de
espermatozoides vivos y con motilidad progresiva.
Tenemos 8 yeguas para inseminar:
Podemos darle una dosis de 500 millones de espermatozoides a cada una (es una dosis
adecuada), pero el volumen que es de 100 ml es insuficiente. Decidimos darle 20 ml a cada
una, por lo tanto necesitamos un volumen total de 160 ml. Simplemente debemos agregar
60 ml de diluyente al eyaculado.

d) Inseminacin Higiene de las

118
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

yeguas:
Lavar con agua y jabn.
Envolver la cola (venda o guante de nylon con el fin de evitar contaminaciones).
Desinfectar con solucin desinfectante (con algodn) abarcando primero toda la zona genital
y luego el interior de la vulva y la fosa clitoriana.
Inseminacin propiamente dicha:
Se insemina en forma intrauterina.
Tener presente que se debe pasar el pliego vulvo-vaginal que cubre el orificio uretral
externo.
Masaje posterior:

Se realiza un masaje con el brazo primero vaginal y luego rectal para expulsar el aire de la vagina.

FACTORES ADVERSOS PARA LA REPRODUCCIN EN EQUINOS

De todos los animales domsticos, la yegua es la ms difcil de manejar reproductivamente,


destacndose los siguientes factores adversos para su reproduccin:

1) Las yeguas tienen celos estacionados. La falta de luz natural bloquea a travs de la
glndula pineal, la actividad ovrica.
2) El periodo de celo de la yegua es largo (7 das), por lo que requiere una adecuada
deteccin del momento de la ovulacin.
3) Es muy comn en las yeguas, los ciclos irregulares, muy diferentes del estndar terico,
especialmente al inicio de la temporada de servicios, tales como:
a) Ciclos largos o cortos.
b) Celos largos, cortos, interrumpidos o silenciosos.
c) Ovulaciones adelantadas, retrasadas o ausentes.
4) La seleccin de reproductores no se hace por fertilidad sino por fenotipo, pedigr y aptitud
deportiva.
5) El semen equino tiene una reputacin bien ganada de "difcil de congelar".
6) No se ha logrado aun, a nivel mundial, un mtodo eficiente para hacer superovular a las
yeguas, caracterstica fundamental para un programa de transferencia embrionaria.
7) Muchas yeguas deportivas reciben tratamientos hormonales para aumentar su
rendimiento fsico que, paralelamente, bloquean y alteran su fisiologa reproductiva.

Fecundacin y mortalidad embrionaria.


En las especies domsticas las principales prdidas reproductivas se deben a problemas en la
fecundacin o en las etapas tempranas de la gestacin (el primer tercio de esta), en comparacin,
las perdidas por abortos y muertes neonatales son mucho menores.

Fallas en la fecundacin.
La fecundacin puede fallar por problemas en el tracto reproductivo de la hembra, por deficiencias
en la calidad de los gametos masculino y femenino o por una mala tcnica de inseminacin
artificial, si este es el caso.

Barreras fsicas en el tracto reproductivo de la hembra:


Defectos anatmicos congnitos o adquiridos del tracto reproductivo de la hembra. Fallas en el
desarrollo embrionario del tracto reproductivo de la hembra, que dan como resultado hipoplasias o
aplacas de la vagina, cervix, tero y oviductos, esta ltima puede ser unilateral, en cuyo caso se
puede intentar la fecundacin cuando haya ovulacin en el lado normal.
Entre las anormalidades adquiridas, en el tracto reproductivo se encuentran la inflamacin del
oviducto: salpingitis, que es generalmente secuela de metritis puerperal. Las adherencias en los
ovarios, fimbria y oviductos que pueden ser secuelas de inflamacin, manipulacin inadecuada del

119
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

ovario, tratamientos uterinos agresivos o infecciones invasivas.

Imposibilidad para la unin entre gametos


Esta puede ser causada por los oocitos, por los espermatozoides o por otros factores que les
impiden fusionarse.

Gametos anormales:
Existen varios tipos de anormalidades morfolgicas y funcionales de los oocitos: entre las que se
cuentan el gigantismo, forma irregular, rotura de la zona pelcida. Anormalidades cromosmicas (el
alto grado de consanguinidad incrementa las posibilidades)
vulos diploides. Estos poseen el doble de material gentico de lo que normalmente debe
contener un vulo. Suele deberse a la supresin de la formacin del 2o. cuerpo polar. En estos
casos es difcil diferenciar si en realidad hay una falla en la fertilizacin o una muerte embrionaria
temprana pues en algunos casos de desbalances genticos en realidad s hay fertilizacin pero el
embrin que se genera no es viable.
Las anormalidades morfolgicas y funcionales de los espermatozoides son frecuentes en ciertos
rangos considerados fisiolgicos. Por encima de estos disminuye la capacidad fecundante. Pueden
encontrarse fallas genticas en espermatozoides aparentemente normales.
Gametos envejecidos o con poca capacidad fecundante:
Cuando la inseminacin se efecta demasiado tarde, los oocitos estn "viejos" al momento de
la llegada de los espermatozoides y las probabilidades de fertilizacin disminuyen. Adems, si
son fecundados, los oocitos envejecidos tienen mayor probabilidad de sufrir poliespermia.
Cuando la inseminacin se efecta prematuramente, los espermatozoides pueden encontrarse
muertos al momento de la ovulacin, o bien haber perdido su capacidad fecundante. En
ocasiones los espermatozoides envejecidos sufren reaccin acrosmica espontnea, lo que
impide la fecundacin.

Anticuerpos contra los espermatozoides


Es causa de controversia ya que se han encontrado anticuerpos contra los espermatozoides en
yeguas as como en hembras multparas que logran concebir sin problema. Algunos estudios
demuestran que no hay relacin entre la presencia de anticuerpos antiespermatozoides en el
suero o en el moco cervical y el "status" de fertilidad de la hembra. Otros estudios proponen que
estos anticuerpos ocasionen algunos casos de "yeguas repetidoras". Resulta benfico el uso de
semen de otro padrillo o mejor an, de otra especie.

Mortalidad embrionaria.
Es la muerte del embrin durante la fase inicial de la gestacin, antes de que se formen los
huesos. Como resultado se presenta la reabsorcin embrionaria sin aborto. Entre el 25 a 50% de
las gestaciones en las especies domsticas termina en muerte embrionaria y esta se da entre los
das 1 y 60 en los equinos, entre los das 1 y 35 en porcinos, felinos y caninos. Despus de estas
fechas ocurre muerte fetal que produce aborto o momificacin.
Si el embrin muere antes de que la madre "reconozca" la presencia de la gestacin se conoce
como Muerte Embrionaria Temprana. Es la ms comn en todas las especies. Si la muerte del
embrin ocurre despus del reconocimiento materno de la gestacin, se considera Muerte
Embrionaria Tarda.
Las causas de muerte embrionaria, tanto temprana como tarda, son muy diversas y pueden
deberse a factores de la madre, del ambiente o del embrin. Una consideracin importante para
establecer causas y efectos de mortalidad embrionaria es determinar si la muerte embrionaria es
anterior o posterior a la regresin del cuerpo lteo.

Factores maternos.

120
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

a. Edad avanzada de la hembra


Las hembras muy jvenes o mayores suelen tener problemas tanto para lograr la fertilizacin del
vulo como para mantener vivo al embrin. Estudios sobre el ambiente uterino han demostrado
variaciones en algunos componentes de los fluidos del endometrio uterino con variaciones en la
cantidad de protena, sodio, fsforo, glucosa, calcio, potasio y magnesio. Adems la produccin
hormonal disminuye en las hembras de mayor edad.

b. Poca produccin de progesterona por el cuerpo lteo


Los niveles de progesterona en los das subsiguientes a la ovulacin son crticos para el desarrollo
del embrin y para su trnsito a travs del oviducto hacia el cuerno uterino. El desarrollo del
embrin se ve comprometido cuando hay concentraciones bajas de progesterona, de tal forma
que, aunque se logre el reconocimiento de la gestacin, la preez no lograr mantenerse mucho
tiempo.

c. Asincrona entre el desarrollo del embrin y el ambiente uterino.

Si hay un desequilibrio en los niveles de estrgenos y progesterona, el embrin puede llegar al


tero en forma prematura o tarda, ocasionndose una "asincrona" entre el ambiente uterino y el
grado de desarrollo del embrin. Algunos estudios sugieren que el embrin es especialmente
sensible al entorno en la transicin entre mrula y blastocito.

d. Inflamaciones uterinas.
Esta impide la implantacin y desarrollo del embrin siendo una de las principales causas de
muerte embrionaria en equinos, en el caso de las "yeguas sucias"

Factores Ambientales.

a) Nutricin: La disponibilidad de nutrientes en la dieta pueden influir en la muerte embrionaria,


particularmente durante la implantacin. La mala condicin corporal disminuye las tasas de
fecundacin y eleva la mortalidad embrionaria en todas las especies, mientras que la
elevada ingestin calrica aumenta la tasa de ovulacin aumentando tambin la mortalidad
embrionaria.
b) Estrs calrico: Las altas temperaturas ambientales pueden disminuir la fertilidad, con una
alta incidencia de muertes embrionarias. Cuando se conjugan altas temperaturas con una
alta humedad relativa, se aumenta la muerte embrionaria.
c) Es importante un manejo adecuado del estrs calrico por medio de mayor rea de sombra,
aspersores, ventiladores, etc. as como raciones apropiadas para generar menos calor
corporal.
d) Diagnstico de gestacin temprano: La palpacin rectal entre los das 28 y 35 es una de las
causas de mortalidad embrionaria. Se calcula que la mortalidad embrionaria causada por
palpacin es de 3%, pudiendo ser mucho mayor cuando la palpacin es realizada por
inexpertos.
e) Factores qumicos: se han identificado algunos que incrementan la probabilidad de muerte
embrionaria: Nitratos, Micotoxinas, Exceso de nitrgeno ureico en sangre, Endotoxemias
(pueden causar liberacin de prostaglandinas y luteolsis), Tratamientos contraindicados
(prostaglandinas).

f) Agentes infecciosos especficos.

Factores embrionarios

Dentro de los factores embrionarios causantes de la muerte embrionaria se han encontrado los

121
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

siguientes:

a. Poliespermia si el vulo es fecundado por ms de un espermatozoide, el cigoto formado


muere en las primeras horas o das.
b. Consanguinidad: Pueden incrementar las probabilidades homocigocis para determinados
genes recesivos que pueden ser letales para el embrin.
Anormalidades cromosmicas: aneuploidas, translocaciones son causantes de fallas en el
desarrollo que pueden ser letales para el embrin, en especial aquellas que involucran al
trofoblasto y las hormonas y factores que permiten el reconocimiento materno de la
gestacin.

En la actualidad existen mtodos diferentes al de la monta natural para perpetuar la existencia de


las especies, en equinos las ms usadas son:

INSEMINACIN ARTIFICIAL EN EQUINOS.

La Inseminacin Artificial es el procedimiento de fecundacin mediante la introduccin, por medios


artificiales, del semen extrado de un caballo en una determinada yegua. Este sistema ha sido de
gran ayuda en diversas especies domsticas, especialmente en vacunos, donde ha permitido un
gran progreso gentico tanto en produccin de leche como de carne. En los ltimos aos se ha
perfeccionado y simplificado para usarse en caballos y, es as, que numerosas razas lo han
adoptado en todo el mundo. La principal ventaja, de esta tcnica, es el mejor aprovechamiento de
los buenos sementales, en su detrimento, debemos de decir que si se abusa de algunos
supersementales perderamos en diversidad gentica y acabaramos con ms problemas que
ventajas. Tambin debemos de decir, que gracias a la inseminacin artificial, esta mucho ms
asequible, para cualquier ganadero el cubrir sus yeguas con los mejores sementales del mundo. La
influencia en el precio de los caballos es relativa, si bien es cierto que los sementales
verdaderamente buenos, subirn sus precios, y los mediocres perdern su funcin como
sementales, ya que podemos acceder a cualquier semental y en cualquier parte del mundo.

La inseminacin artificial en yeguas se puede realizar utilizando:


- Semen fresco
- Semen refrigerado
- Semen congelado

En caso de compra de semen congelado, el manejo del semen es algo distinto, lo que requiere los
conocimientos necesarios para alcanzar gestaciones.
Para inseminar yeguas se debe proceder a un examen exhaustivo del aparato reproductor de la
misma, incluyendo las siguientes operaciones:
- Exploracin del aparto reproductor manual, va rectal
- Examinacin ecografica, va rectal
- Citologas vaginales
- Biopsias uterinas
- Lavados uterinos

Tratamientos hormonales.

En 1957 se logr el primer embarazo con semen congelado equino. Poco a poco se investigado
ms a fondo esta tcnica y se ha mejorado en todas sus etapas, concibindose recin en la
dcada de los setenta la comercializacin de las primeras dosis de semen equinas congeladas.

122
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Hoy en da en casi todo el mundo se cuenta con semen congelado de los principales sementales.
En Europa el semen congelado es usado extensamente y en Norteamrica hay ms de una
veintena de instalaciones que ofrecen servicios de congelamiento y el nmero aumenta
rpidamente. Adems hay numerosos sitios que importan y exportan el semen congelado. Chile no
es la excepcin, y ya en nuestro pas existe una empresa dedicada a este rubro.
Con respecto a los resultados obtenidos en el mundo, es aceptando que las tarifas de preez
media por celo con semen congelado estn alrededor del 30 - 40 %, comparado con el 65 % o ms
con el semen fresco o enfriado. Adems, hay variacin considerable en las tarifas de preez
alcanzadas con semen congelado (de 0 - 75 %) atribuible tanto al potro como a la experiencia de la
persona que maneja el semen e insemina las yeguas.

Ventajas De La Inseminacin Artificial

1. Cuesta menos que mantener un padrillo en la finca.


2. Mejoramiento gentico, pues de usar padrillos probados aportando genes deseados, que
inciden en un aumento de los caracteres deseados.
3. Mayor flexibilidad al emplear semen de diferentes padrillos sin costo adicional, y as se evita
la consanguinidad.
4. Control efectivo de enfermedades genitales, eliminando el peligro de propagacin de las
mismas.
5. Evita el trabajo de cuidado y manejo del reproductor.
6. La inversin es mucho menor que comprarse un padrillo reconocido.
7. El semen se puede mantener congelado por varios aos.
8. Se intensifica el uso del semen de los mejores padrillos.
9. Se pueden utilizar semen de razas especializadas de acuerdo al fin de cada criadero.
10. Mejor control productivo del lote de yeguas para cra, ya que con el uso de inseminacin
artificial, se llevar el control de cada animal (nmero de servicio, preez, fecha de parto,
etc.) y se pueden eliminar animales con problemas reproductivos.
11. Permite la utilizacin de toros de alto valor gentico que, por su costo, no se podra utilizar
en monta natural.
12. Con la inseminacin artificial se hace posible la continuidad en el servicio de los
reproductores valiosos que por lesiones, ya no pueden fecundar naturalmente a las yeguas.

Desventajas de la inseminacin artificial


1. Se puede diseminar caractersticas indeseables de un equino de inferior calidad,
ocasionando un retroceso en el mejoramiento gentico.
2. Si no se compra semen de diferentes padrillos, se puede causar una consaguinidad en el
criadero.
3. Si las condiciones y calidad sanitaria en el proceso de recoleccin e inseminacin, no son
las ms idneas, pueden convertirse stas prcticas en un medio de propagacin de
enfermedades.
4. El instrumental requerido y la adquisicin del semen, inicialmente puede ser algo costoso si
no se adquiere en cooperativas, clubes cabalsticos o asociaciones a fin.
5. Se requiere de un personal tcnico para la deteccin del celo, inseminacin y diagnstico de
preez.

PASOS PARA LA COLECCIN DEL SEMEN

Coleccin de Semen.
La mayor parte de los sementales fcilmente pueden ser entrenados para la coleccin de semen.
El mtodo ms simple es utilizar un maniqu en presencia de una yegua en calor. El semen ser

123
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

colectado por la desviacin del pene hacia una vagina artificial en donde el semental eyacular.
Por regla general, los sementales producirn el semen suficiente en cada coleccin para 8 - 12
dosis de semen congelado.

Coleccin de semen (Tomado de http://201.238.246.21/)

Examen in Vitro con microscopio

Despus de que es colectado el semen fresco es evaluado para ver su calidad, en este examen se
evala la motilidad, concentracin, y ph entre otros. Esta evaluacin inicial es importante para
determinar si el semen es congelable.

Examen in Vitro con microscopio. (Tomado de http://201.238.246.21/)

Congelacin del semen


El semen entonces es diluido, refrescado y envasado en pajuelas de 0,5cc. Estas pajuelas pueden
ser etiquetadas con el nombre del semental, la fecha en que se congel el semen y el criadero al
que pertenece.

Seguidamente se procede a la carga de las pajuelas estriles y previamente identificadas con el


nombre del semental, el da de congelacin y el centro de reproduccin. Gracias a la mquina
empajueladora automtica este proceso sucede automticamente y de manera estril. Tambin es
posible la carga manual de las pajuelas, debiendo poner especial atencin a no incluir burbujas de
aire. El sellado de las mismas, en la mquina, se produce mediante presin/calor, mientras que en
la carga manual es factible mediante la insercin de una bola de acero inoxidable diseada para tal
objeto.

A continuacin tiene lugar la refrigeracin de las pajuelas preparadas con el semen desde la
temperatura ambiente hasta alcanzar 5C a una tasa de -0,2C El proceso de congelacin debe
efectuarse en forma gradual y controlada, ya que la membrana espermtica equina es muy frgil.
Es por esto que el sistema ptimo es el congelamiento computarizado, en donde el semen es

124
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

enfriado gradualmente con vapor de nitrgeno para luego ser almacenado indefinidamente en el
nitrgeno lquido.

Laboratorio con sistema de congelamiento computarizado. (Tomado de http://201.238.246.21/)

Empajuelado (Tomado de http://201.238.246.21/)

Almacenaje.
Las alternativas para el almacenaje de semen congelado son: el centro reproductivo o clnica
veterinaria que congel el semen, o el mismo criadero o dueo del semental. Esta ltima
alternativa requerir de la compra de tanques de almacenaje de semen y un suministro de
nitrgeno lquido mensual, lo que puede ser ms costoso e inseguro si el semen no es manipulado
minuciosamente.

Almacenaje (Tomado de http://201.238.246.21/)


Aspectos a considerar antes de utilizar semen congelado para inseminar sus yeguas

Hay varios factores para considerar y decidir si se desea usar el semen congelado para inseminar
las yeguas. En primer lugar, los dueos deberan consultar las regulaciones y normas de las
sociedades y federaciones de criadores de distintas razas en cuanto al empleo de semen
congelado y la inseminacin artificial.

125
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Para alcanzar resultados satisfactorios usando semen congelado, su yegua debera ser joven (4 -
15 aos), frtil y tener una historia reproductiva normal. Un examen reproductivo completo
realizado por veterinarios expertos en el tema es aconsejable antes de utilizar semen congelado.

Inseminacin
El seguimiento ecogrfico reproductivo es fundamental para inseminar yeguas con semen
congelado. Es reconocido que el semen congelado tiene una vida frtil ms corta dentro de la
yegua que el semen fresco o enfriado. Lo mejor sera que la yegua estuviera residente en una
clnica veterinaria o centro reproductivo.

Los propietarios tienen poca influencia sobre la calidad del semen una vez que ellos han
seleccionado el semental. Sin embargo, ellos pueden mejorar su xito si manejan el semen
congelado con veterinarios especialistas, expertos en el manejo, seguimiento de las yeguas y la
inseminacin con semen congelado.

Para dueos de sementales, el semen congelado puede suministrar un medio muy acertado y
conveniente de comercializar y dar a conocer su semental mientras est en la alta competicin,
adems de conservar el patrimonio gentico una vez que este ya no exista. Por otro lado, para los
dueos de las yeguas, el semen congelado aumenta enormemente la disponibilidad de
sementales. Con la preparacin adecuada y la seleccin de semen de calidad y un operador
experimentado, excelentes resultados pueden ser alcanzados usando semen congelado.

Inseminacin histeroscpica versus Intrauterina profunda.


Aunque los reportes iniciales sobre tcnicas de inseminacin con dosis bajas en la yegua
estuvieron basados en procedimientos guiados endoscpicamente para depositar el semen en la
UUT, en otros trabajos se ha usado una tcnica de enhebrado transrectal para dirigir un catter de
inseminacin flexible hasta el extremo del cuerno uterino del folculo preovulatorio. En un reporte
de Brinsko y col, los porcentajes de preez fueron similares despus de la inseminacin, ya sea
con catter o por endoscopio, de 5 x 106 espermatozoides mviles en el extremo del cuerno
uterino. En otros trabajos en los que se deposit un nmero similar de espermatozoides en el
extremo del cuerno uterino usando el catter, las tasas de preez variaron entre el 35 y 50%. Estos
estudios sugieren que dosis de inseminacin de aproximadamente 5 x 106 espermatozoides
mviles pueden lograr tasas de preez aceptables utilizando la tcnica intrauterina profunda sin
necesidad de procedimientos endoscopios. En el equino, la UUT representa el orificio del oviducto
que se proyecta dentro de la luz uterina en el extremo del cuerno uterino. La morfologa de la unin
uterotubrica vara de una yegua a otra pero generalmente se observa como una pequea papila
que se proyecta aproximadamente 3 a 5 mm dentro de la luz uterina. En este punto la luz del
oviducto es extremadamente pequea y provee una barrera muy efectiva entre el tero y el
oviducto. Inicialmente la inseminacin con dosis baja se intent mediante canulacin de la porcin
inicial del oviducto previo a la deposicin de semen. Esto se abandon rpidamente debido a la
dificultad para sondear el oviducto y se insemin depositando el semen sobre la superficie uterina
de la UUT.

Otros investigadores han intentado mejorar el trnsito espermtico hacia adentro del oviducto
mediante la administracin local de prostaglandina E2 (PGE2). La prostaglandina E2 induce la
relajacin del msculo liso circular del oviducto y acta facilitando el transporte del embrin al
tero. El pretratamiento tpico con PGE2 (250 g) increment la tasa de preez en yeguas
inseminadas con 25 x 106 espermatozoides (13/18 vs. 7/16) dentro del cuerno o el cuerpo uterino.

Tcnica de inseminacin histeroscpica


La seleccin apropiada de yeguas candidatas para la inseminacin con dosis baja as como la
fertilidad del semental influye en el xito de este procedimiento. Las candidatas ptimas son las

126
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

yeguas jvenes y frtiles sin historia previa de endometritis post-servicio. Las yeguas ms viejas,
con evacuacin uterina disminuida, sern candidatas menos deseables y son ms propensas a
presentar acumulacin intrauterina de lquido despus de la inseminacin histeroscpica. En los
estudios reportados vara la incidencia de la acumulacin de lquido intrauterino.

Sitio de inseminacin
Aunque el mayor esfuerzo en la inseminacin con dosis baja ha sido dirigido a la deposicin de
semen sobre o cerca de la unin uterotubrica, al menos un estudio indica que la inseminacin con
dosis baja en el cuerpo uterino puede tambin resultar en fertilidad aceptables comparo la fertilidad
despus de inseminar con 14 x 106 espermatozoides mviles descongelados en el cuerpo uterino
con catter o en la UUT con endoscopio. Las tasas de preez logradas con estas dos tcnicas
fueron similares. Los porcentajes de preez fueron significativamente ms bajos cuando se
depositaron, con endoscopio dentro del cuerpo uterino, 3 x 106 espermatozoides mviles
descongelados comparados con el depsito en la UUT. Probablemente haya efectos importantes
del semental relacionados con el nmero mnimo de espermatozoides necesarios para lograr tasas
de fertilidad aceptables con estas tcnicas. No obstante, la posibilidad de lograr tasas de fertilidad
razonables despus del depsito de 14 x 106 espermatozoides mviles en el cuerpo uterino ofrece
posibilidades interesantes de mejorar la eficiencia del semen equino congelado.

Equipo
El uso de un video endoscopio de 1.6 M con un canal de operacin facilita la visualizacin de la
unin uterotubrica en la mayora de las yeguas. Se pueden usar endoscopios ms cortos; sin
embargo, la longitud del endoscopio puede limitar el acceso fcil al canal de operacin y a los
controles del endoscopio en yeguas de mayor tamao. Es importante el cuidado del canal de
operacin del endoscopio para asegurarse que no permanezcan detritos en el mismo despus del
procedimiento y que sea removido el desinfectante qumico usado en la limpieza del endoscopio.
Los pequeos volmenes de inseminacin usados en este proceso son extremadamente
susceptibles a los contaminantes que quedan en el canal de biopsia del endoscopio.
En el procedimiento de inseminacin, generalmente es usado un catter de doble va. La doble va
ayuda a prevenir la contaminacin del semen durante el pasaje a travs del canal de biopsia del
endoscopio. La longitud del catter debera ser al menos 20 cm. ms larga que el canal de biopsia
con el objeto de proveer una longitud adecuada para el trabajo de inseminacin. Generalmente son
necesarias un mnimo de tres personas para completar el procedimiento.

Preparacin de la yegua
Lo ideal es que las yeguas destinadas a inseminacin endoscopica sean sujetadas en un brete. De
acuerdo al temperamento de la yegua, puede requerirse sedacin. Se evacua el recto de la yegua,
y se confirma la presencia del folculo preovulatorio. Se debe llevar a cabo una cuidadosa
preparacin de la vulva y perin para el procedimiento vaginal.

Pueden usarse dos mtodos de introduccin del endoscopio dentro del tero. En la aproximacin
histeroscpica estndar, el endoscopio es introducido a travs del cerviz, el tero es localizado y el
endoscopio es dirigido visualmente al cuerno uterino que presenta el folculo preovulatorio. Otra
alternativa puede ser introducir el endoscopio a travs del cerviz y guiarlo mediante manipulacin
rectal hasta el cuerno uterino. Usando el primer mtodo, es importante confirmar la ubicacin del
endoscopio al folculo preovulatorio, ya que con gua visual es fcil desorientarse en relacin a los
cuernos uterinos derecho o izquierdo. Una vez que la UUT es identificada, el catter de
inseminacin debe pasarse a travs del canal de biopsia y se deposita el semen directamente en la
UUT. No se debe hacer ningn intento de canular el oviducto durante el procedimiento. Algunos
autores consideran conveniente la introduccin de burbujas de aire durante la deposicin del
semen para mantener un mayor contacto por tensin superficial en la regin de la UUT. Una vez
que se completa la inseminacin, el aire que fue introducido durante el procedimiento debera ser
eliminado mediante aspiracin a medida que el endoscopio es retirado del tero

127
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

En este procedimiento se requieren un manejo y carga del semen mucho ms cuidadosos debido
al bajo nmero de espermatozoides as como al pequeo volumen de lo inseminado. Esto es
particularmente cierto si se usa semen criopreservado ya que estas clulas son mucho ms
susceptibles al choque fro y los pequeos volmenes usados hacen que la transferencia de calor y
el choque trmico sean ms probables. Antes de la inseminacin, los catteres y el material de
laboratorio usados para el manejo de semen deben ser precalentados a temperatura corporal. Una
vez que el endoscopio est en su lugar y se identifica la UUT, el semen diluido se carga dentro del
extremo distal del catter de inseminacin aspirndolo cuidadosamente como un embrin sera
aspirado dentro de una pipeta de transferencia. Luego de cargar el catter, la inseminacin se
debe realizar rpidamente.

Tcnicas de inseminacin intrauterina profunda.

La preparacin de la yegua es similar a la usada para la inseminacin endoscpica, aunque con


este procedimiento la necesidad de sedacin suele ser menos frecuente. Se evacuan las heces por
palpacin rectal y se confirma la presencia del folculo preovulatorio. Despus de la preparacin
para el procedimiento vaginal, se realiza la inseminacin pasando el catter de inseminacin a
travs del cervix. Luego de que el catter es introducido dentro del cervix, es guiado por recto
hasta el extremo del cuerno uterino l al folculo preovulatorio. La entrada al cuerno uterino puede
ser facilitada tomando la base del cuerno uterino contralateral y realizando una traccin caudal.
Esta maniobra tiende a enderezar el cuerno uterino opuesto y facilitar el pasaje del catter hacia el
extremo del cuerno.

Volumen de inseminacin
El volumen a inseminar en la unin uterotubrica por histeroscopa vara entre 20 y 200 l. Cuando
se insemina directamente con semen congelado, se deposita un volumen de 250 a 500 l
(correspondiente a una nica pajuela de 0.25 o 0.5 ml).

Los reservorios de espermatozoides.


Aunque un nmero relativamente grande de espermatozoides es depositado en el tero de la
yegua en el momento del servicio natural o en la inseminacin artificial, relativamente pocos
alcanzan el sitio de fertilizacin en la unin istmo-ampular del oviducto. La progresin de los
espermatozoides a travs del tracto reproductivo de la hembra est asociada a una marcada
reduccin en el nmero de los mismos, as como con una mejora importante en el porcentaje de
espermatozoides mviles y morfolgicamente normales. Se cree que tanto la unin uterotubrica
como la porcin inicial del istmo oviductal juegan un papel importante en la seleccin de
espermatozoides y en la formacin de un reservorio de semen efectivo. El secuestro de
espermatozoides en este sitio se produce rpidamente despus del servicio o de la inseminacin
de tal forma que los espermatozoides son efectivamente aislados del ambiente uterino dentro de
las 4 horas posteriores a la inseminacin.

La formacin de un reservorio efectivo de semen dentro de la porcin inicial del istmo oviductal
parece depender de la adhesin clula-clula entre los espermatozoides y las clulas epiteliales
oviductales y es capaz de mantener la fertilidad del espermatozoide equino durante varios das del
estro de las yeguas. Los espermatozoides que estn adheridos al epitelio oviductal son bloqueados
para impedir que sufran los cambios de capacitacin previos a la fertilizacin y poder mantener as
una poblacin viable e intacta para participar en la fertilizacin en el momento de la ovulacin. La
adhesin de los espermatozoides al epitelio oviductal mantiene bajos sus niveles intracelulares de
calcio. En el momento de la ovulacin, los espermatozoides son liberados de este reservorio y
sufren los cambios previos a la fertilizacin necesarios para la unin exitosa a la zona pelcida y
fertilizacin.

128
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

EL TCNICO INSEMINADOR

Es toda persona tcnicamente capacitada para el manejo, cuido y siembra del material
espermtico en los rganos genitales de una hembra apta para la reproduccin.

El inseminador es indudablemente la persona ms importante que garantiza el xito, o en muchos


casos, seala las fallas o anormalidades en un programa de inseminacin artificial. El xito o
fracaso depende en un alto grado de la responsabilidad y habilidad, no slo para inseminar, sino
tambin en el reconocimiento del celo de las yeguas y manejo del semen.

OBLIGACIONES DEL PRCTICO INSEMINADOR:

Los inseminadores estarn obligados a:

1. Hacer una revisin minuciosa de todas las yeguas, con el fin de observar su
comportamiento, secreciones vaginales y algunas otras caractersticas anormales que
comprometan su reproductividad.

Estar pendiente de la aparicin de celos, determinar el momento apropiado de la inseminacin y


efectuar la misma.

3. Limitarse estrictamente al ejercicio de la inseminacin artificial. En ningn momento podr


intervenir en los campos de competencia del Mdico Veterinario.
4. Tener en su bolsillo una libreta para anotar el nmero de la yegua, caractersticas, hora, etc.,
de todos los eventos que suceden a diario en el programa de inseminacin artificial que se le
entreg.
5. Notificar obligatoriamente todos y cada una de las observaciones vistas y anotarlas al
Mdico Veterinario, supervisor del programa de inseminacin artificial.
6. Realizar los tratamientos a las yeguas, segn prescripcin del Mdico Veterinario.

TRANSPLANTE DE EMBRIONES.

El primer transplante embrionario en equinos realizado con xito fue comunicado por Oguri y
Tsutsumi en 1972, pero no fue aceptado como procedimiento en la industria equina hasta
comienzos de los aos 80. En 1984 se realiza el 1 Simposio Internacional Equino en la
Universidad de Cornell (USA.), el 2 en Canad en el ao 1989, y el 3 en Argentina en 1992.
Actualmente, a 11 aos de este evento, se nos plantea un gran desafo pues por diferentes
motivos, an no se ha podido realizar exitosamente ningn transplante embrionario en equinos en
nuestro pas.

Hoy da esta tcnica es considerada a nivel mundial, como una de las tcnicas de Reproduccin
Asistida mas utilizada.

Uno de los mayores beneficios de la transferencia embrionaria es la posibilidad de obtener potrillos


de hembras genticamente superiores, de avanzada edad, que luego de quedar preadas les es
difcil mantener la gestacin, que tienen antecedentes de reabsorciones embrionarias y/o abortos.
Otra de las posibilidades que nos ofrece esta tcnica es el poder usar yeguas de 2 aos como

129
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

donantes, un ao antes de llegar a su madurez sexual, y as poder obtener un potrillo antes de que
puedan llevar una gestacin a trmino. Tambin nos permite mantener en competencia y participar
en exposiciones, a ejemplares genticamente superiores, al mismo tiempo que obtenemos varios
potrillos que son gestados por yeguas receptoras.

La transferencia embrionaria en el equino no ha tenido el mismo xito que en el bovino, ya que no


existe un mtodo seguro de superovulacin en la yegua, esto implica que solo se puede obtener un
embrin por ciclo si la yegua es gestada. De todas formas con la tecnologa existente actualmente,
se podran obtener de 6 a 8 potrillos por yegua durante una estacin reproductiva.

Ventajas del trasplante de embriones

- Obtencin de gestaciones de hembras que no pueden llevar a trmino embarazos por


lesiones o enfermedades uterinas.
- Obtencin de mltiples gestaciones por estacin reproductiva.
- Obtencin de gestaciones de yeguas de dos y tres aos de edad y nacimiento de potros de
madres en competicin.
- Nacimiento de potros obtenidos tardamente en la estacin reproductora pero permitiendo
que se obtenga otro nacimiento en la estacin siguiente.

Las desventajas de la tcnica son las siguientes:

- El costo elevado de la tcnica.


- La cualificacin profesional del equipo veterinario que lo vaya a llevar a cabo, que es difcil
de adquirir en nuestro medio.
- Imposibilidad que muestra la yegua de reaccionar a una superovulacin, lo que ayudara
mucho ms a rentabilizar la tcnica.

Dentro de las desventajas que debemos enfrentar, una de las de mayor importancia es, que es
muy difcil mantener en un mismo establecimiento yeguas y padrillos de alta calidad gentica y
yeguas receptoras. Adems algunas asociaciones de criadores limitan reglamentariamente el
nmero de potrillos por yegua al ao.

Yeguas Receptoras

Uno de los factores ms importantes a tener en cuenta para el xito del programa es la seleccin y
el manejo de las hembras receptoras. La edad de las receptoras (entre 3 y 10 aos) es uno de los
puntos ms importantes. Tambin una buena conformacin, y tener igual o mayor peso y tamao
corporal que las yeguas donantes para poder llevar a trmino en excelentes condiciones la
gestacin.
Usualmente se eligen yeguas de razas pesadas o sus cruzas para aprovechar rusticidad, tamao,
temperamento y aptitudes maternas que facilitaran la cra de ese potro genticamente superior.
A estos animales se les realiza un minucioso examen reproductivo, con evaluacin ecogrfica
diaria por lo menos de dos ciclos consecutivos, para determinar las caractersticas del ciclo de
cada yegua en particular(receptoras y donantes), actividad folicular durante el celo y caractersticas
de la ovulacin, adems se los somete a un exigente plan sanitario que comprende vacunaciones
contra enfermedades como Ttanos, Influenza, Adenitis Rinoneumonitis, etc., tratamientos
antiparasitarios tcticos y estratgicos y sobre todo un buen nivel alimenticio para que ganen peso

130
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

luego de la transferencia.

Yeguas donantes

Al igual que a las receptoras se les realiza un completo examen reproductivo que incluye tamao,
tono y forma del tero. El cervix, se examina por va vaginal y se realiza un cultivo cervical para
obtener informacin del estado del mismo, si se identifican anormalidades deben ser tratadas antes
de su introduccin al programa de transplante. Se las evala adems para conocer su
comportamiento reproductivo frente al padrillo (retajeo),
Antes de comenzar un programa de transplante se debe escoger un mtodo de Sincronizacin de
Celos adecuado para sincronizar donantes con receptoras. Existen varias alternativas, las ms
utilizadas son la sincronizacin mediante 2 inyecciones de Prostaglandina F2 y Progestgenos
orales durante 12 a 14 das. Estos tratamientos pueden usarse solos o combinados con luz artificial
para estimular la ovulacin sobre todo al inicio de la temporada de servicios (invierno) y combatir
as los celos anovulatorios. Cuando tenemos celos normales y sincronizados entre donantes y
receptoras, y libres de anormalidades uterinas y ovricas estamos en condiciones de iniciar un
programa de Transferencia Embrionaria.
Durante el celo de la yegua donante se la observa por ecografa para conocer el momento ptimo
de servicio o inseminacin artificial. Luego de ste se procede a la seleccin, tambin mediante
ecografa, de 2 o ms yeguas receptoras (de acuerdo a la disponibilidad de las mismas), y de stas
se elige una, que de acuerdo al crecimiento folicular y ovulacin se encuentre mas sincronizada
con la donante. Al sptimo u octavo da post ovulacin de la donante se realiza la recoleccin del
embrin mediante lavado uterino transcervical. Se coloca la yegua donante en un brete se venda la
cola y se lava la regin perineal con abundante agua y un detergente suave, se enjuaga y seca. El
operador se coloca un guante de tacto estril, con gel lubricante tambin estril, y procede a la
introduccin de un catter (sonda Foley) a travs del cervix, ubicando en el cuerpo del tero el
baln del catter, que una vez all es inflado con aire o suero. Se comprueba que est en el sitio
adecuado traccionando hacia atrs para que no haya reflujo de lquido. Se lava el tero
introduciendo por el catter 3 lts de PBS o PBS modificado tibio a 30 a 35 C. Luego se permite al
lquido salir y pasar a travs de un filtro para embriones. Mediante masajeo del tero va rectal se
logra obtener el 80% del total del lquido prefundido el cual si la yegua no tiene problemas uterinos
debera ser claro, libre de restos celulares y sangre. La recuperacin de lquido turbio indica
endometritis. Al finalizar el lavado el contenido del filtro se vaca en una placa de petri para buscar
el embrin bajo lupa estereoscpica con un aumento de 15X. Luego de localizado el embrin se
lava 3 o 4 veces con lquido de enriquecimiento y se observa a mayor aumento para clasificarlo de
acuerdo a una escala que va de 1 (excelente) a 4 (pobre) de acuerdo a las caractersticas de
viabilidad embrionaria.

Se introduce en una pajuela 0.5 o 0.25, (mediante aspiracin a travs de una pipeta dosificadora
para embriones o una pajuela adosada a una jeringa) con medio de enriquecimiento y se mantiene
a temperatura de 37 C hasta el momento de la transferencia, preferentemente antes de 2 horas de
su recoleccin. Se coloca la pajuela dentro de un inyector de Inseminacin Artificial descartable, se
protege ste con una camisa sanitaria estril para evitar la contaminacin durante el pasaje de la
misma por la vagina. El operador, con un guante de tacto estril, con lubricante tambin estril,
previo lavado y secado de los genitales de la yegua receptora, introduce la mano en la vagina con
la punta del inyector protegida en la palma de la mano, rompe la camisa sanitaria y lo introduce a
travs del cervix en el cuerpo uterino. Se deposita el embrin lentamente.
Es imprescindible siempre administrarle a la yegua donante Prostaglandina F2 para que esta
retorne al estro,
Y asegurarnos que no se establezca la preez en aquellas yeguas en la que no se pudo recolectar
embrin.
A los 7 das de realizado el transplante, se realizan ecografas en las receptoras para diagnosticar

131
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

preez, que se repiten a los 20, 35, 50 y 60 das. La muerte embrionaria entre los das 15 y 60 de
la gestacin, segn los investigadores, no parece ser mayor en yeguas receptoras de embriones
transferidos que en yeguas inseminadas con semen fresco.
Al igual que en los bovinos, la habilidad del tcnico puede ser el factor ms importante que afecte
la tasa de preez cuando los embriones son transferidos. Se debe tener especial cuidado con la
manipulacin tanto en el laboratorio cuando se localiza el embrin, como en la recoleccin y
transferencia del mismo.

ww.3caballos.com

Leccin 23 GESTACIN

www.3caballos.com

La gestacin de las yeguas tiene una duracin de 320 a 360 das, los alumbramientos en tiempos
inferiores entre los 320 y los 300 das son considerados como prematuros, ya que los productos
presentan pequeez, debilidad y dificultades para sobrevivir. Los que nacen con menos de 300
das son considerados abortos y sus posibilidades de sobrevivir son mnimas. En la yegua, que es
una especie unpara (es decir pare por lo general una cra por parto), un 10 a 15% de sus
gestaciones parten siendo gemelares, debido a que durante el celo algunas presentan ms de una
ovulacin. Estas gestaciones gemelares bivitelinas tienen el siguiente destino: puede reabsorberse
espontneamente una de las vesculas embrionarias, sin afectarse la otra; morir precozmente
ambas, reabsorbindose; producirse aborto de ambos fetos al final de la gestacin, o llegar a parir
mellizos.
Si a los antecedentes antes mencionados, agregamos que existe un porcentaje importante de
yeguas que presentan abortos nicos sin una causa clnica aparente, sumado a muertes de
potrillos durante y despus del parto por mala atencin de este, explican el porqu, en condiciones
de manejo tradicional, es difcil obtener en las yeguas, resultados de fertilidad, medidos sobre cras
nacidas vivas/ao superiores a un 70%.
El mayor nmero de reabsorciones embrionarias en la yegua se produce alrededor de los 25-30
das de gestacin. En este perodo es posible ver el embrin pequeo en la parte inferior de la
vescula, el que va paulatinamente ascendiendo. Por ecografa y de acuerdo con el porte del
embrin e intensidad de los latidos de su corazn, podemos darnos cuenta del grado de su
vitalidad

132
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Durante las primeras etapas de la gestacin, el embrin flota libremente, primero en el oviducto y
despus en el tero. Sus nutrientes son aquellos que se almacenan en su propio citoplasma y los
que pueden ser absorbidos de la leche uterina. Solo despus de la placentacin, proceso por el
cual el embrin se adhiere al tero, ste puede obtener sus nutrientes y transferir sus productos de
desecho a travs de la sangre materna. Se sabe que el tiempo de placentacin despus de la
fertilizacin se inicia de 50 a 60 das en la yegua. Este perodo es difcil de estimar por el tipo de
placentacin difusa. Antes que el embrin pueda lograr beneficios de la placentacin, ocurrir
desarrollo orgnico completo, incluso el sistema circulatorio del embrin es funcional, con lo que se
permite el correcto intercambio de nutrientes y gases a travs de la circulacin materno-fetal. En la
yegua, los embriones tambin migran libremente, encontrndose el feto con frecuencia en el lado
opuesto al del cuerpo lteo que se form al producirse la ovulacin.

Existen tres distintos perodos durante el desarrollo de la concepcin. Estos son: Segmentacin,
Diferenciacin y Crecimiento.

La segmentacin
Despus de la fertilizacin el cigoto se divide muchas veces sin aumento del citoplasma. El tamao
total puede aumentar debido a la absorcin de agua. Este proceso de divisin celular sin aumento
de citoplasma es la segmentacin. La primera segmentacin ocasiona la formacin de un embrin
de 2 clulas. Luego se contina con segmentaciones adicionales as el embrin aumenta de 4, 8,
16 a 32 clulas, cuando ste pasa del oviducto hacia el tero, se encontrar una masa de 16 a 32
clulas protegidas por la zona pelcida. Esta estructura se denomina mrula. Durante los
siguientes das, el liquido colectado en los espacios intercelulares se acumular en el centro,
formando el blastocisto, cavidad llena de lquido (el blastocele) rodeado por una capa de clulas.
Se puede identificar la masa celular interna, montculo de clulas en un lado del blastocisto, la cual
formar el cuerpo del embrin. Hasta este momento las clulas del blastocisto no estn an
diferenciadas. Por lo tanto, no es posible identificar a las clulas que formarn un rgano particular
del cuerpo. Cerca del trmino del perodo de segmentacin, la zona pelcida se debilita y
desintegra, permitiendo que el blastocisto se alargue, inicindose la segunda fase.

El amnios es la membrana extraembrionaria ms interna, contiene lquidos que suspenden al


embrin protegindolo y permitiendo su libre crecimiento. El lquido amnitico continuar baando
y suspendiendo al feto a lo largo de la gestacin.

La capa ms externa de las membranas extraembrionarias se denomina corion; El alantocorion, se


forma por la fusin del corion con la alantoides, contiene lquido con gran cantidad de productos de
desecho. Conforme la alantoides va creciendo, se une con el corion hasta que la membrana
corioalantoidea envuelve por completo el amnios. La membrana corioalantoidea se une al
endometrio durante la placentacin y forma la placenta. Despus de la placentacin, el oxgeno y
los nutrientes de la sangre materna pasan a travs de las uniones placentarias a la circulacin del
embrin; los productos de desecho, incluyendo el amoniaco y el bixido de carbono del embrin,
son transportados desde la sangre embrionaria a travs de las uniones placentarias a la sangre
materna para su eliminacin a travs del sistema materno, Si la membrana corioalantoidea no se
desarrolla apropiadamente, el embrin morira pronto debido a la falta de oxgeno y nutrientes, por
exceso de productos txicos o por ambas causas.

Formacin de los rganos


Conforme progresa la formacin de las membranas extraembrionarias, se forma una placa
nerviosa a partir de las clulas ectodrmicas como principio del sistema nervioso central. El
cerebro y la mdula espinal primitivos pronto son discernibles. El aparato circulatorio se desarrolla
rpidamente a partir de las clulas mesodrmicas; luego pueden identificarse el hgado, pncreas,

133
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

pulmones y sistema digestivo conforme se diferencian de las clulas endodrmicas. A los pocos
das se observan los inicios de los miembros, el origen de la cola y los cristalinos de los ojos. En
este estado de desarrollo, los embriones de la mayora de las especies son tan semejantes en
apariencia, que no pueden ser diferenciados.

Durante el perodo en que se desarrollan otros rganos, tambin se forma el sistema reproductor.
Los rganos primitivos que aparecen muy temprano en el perodo de diferenciacin estarn
completamente formados al final del perodo. El embrin al final de este perodo aparecer como
un caballo en miniatura. La cabeza estar completamente llena y los rasgos faciales bien
diferenciados. Piernas, cascos y cola estarn ya formados. En el macho puede identificarse el
escroto. En la hembra ya pueden observarse los botones mamarios y la vulva. La funcin de los
rganos es limitada al final de la diferenciacin, aunque todo lo necesario para el desarrollo
funcional estar ya presente. El perodo de diferenciacin es crtico, nada que impida la
diferenciacin normal podr corregirse posteriormente en la gestacin. Las drogas que impiden la
diferenciacin normal de piernas u ojos producirn defectos en el nuevo ser, que solo sern
evidentes al nacimiento. Asimismo, la teraputica con hormonas sexuales puede impedir la
diferenciacin sexual normal.

Crecimiento fetal
Despus que se ha completado la diferenciacin, el producto de la concepcin se llama feto en vez
de embrin. Esta parte de la gestacin entre la diferenciacin completa y el parto se ha
denominado perodo del feto El acontecimiento principal en este perodo es el crecimiento fetal.

Hormonas importantes en la gestacin

El mantenimiento de la gestacin depende en gran parte de un equilibrio apropiado de las


hormonas. Esto se confirma por el hecho de que cualquier trastorno del equilibrio hormonal
conduce frecuentemente al aborto. El mantenimiento de un equilibrio apropiado de hormonas a
travs de toda la gestacin depende de una interrelacin entre la madre, la placenta y
posiblemente el feto.

Se ha identificado a la progesterona como la hormona que posee el papel ms importante en el


mantenimiento de la gestacin. Altos niveles de progesterona disminuirn el tono del miometrio e
inhibirn las contracciones uterinas. Igualmente altas concentraciones de progesterona detienen el
ciclo estral evitando la liberacin de gonadotropinas. La progesterona es producida por el cuerpo
lteo y por la placenta. El cuerpo lteo formado en el sitio de la ovulacin es activo por 150 a 180
das, posteriormente se forman cuerpos lteos accesorios en los ovarios cuando la gonadotropina
srica de la yegua gestante (PMSG) estimula la formacin y luteinizacin de los folculos terciarios
pequeos. Estos se forman entre 35 y 40 das despus de la fertilizacin y secretan activamente
progesterona entre los 150 y 180 das. Despus de los 150 a 180 das post-fertilizacin, la
progesterona necesaria para el mantenimiento de la gestacin en la yegua parece producirse en la
placenta, o al menos en un alto porcentaje de la progesterona circulante; todos los cuerpos lteos
involucionan en este momento. Tambin una cada del nivel de progesterona por este tiempo
corresponde a un aumento del nivel de estrgenos. Si la sntesis de progesterona se detiene en
cualquier especie, por lo general la gestacin termina a los pocos das.

La relaxina, un polipptido producido por el cuerpo lteo y la placenta, es importante durante la


gestacin. Durante sta aumenta su concentracin. Los niveles son mucho ms altos durante la
ltima parte de la gestacin que al principio de la misma. Primariamente, la relaxina parece regular
el tejido conjuntivo, lo cual permite a los msculos uterinos estirarse para acomodar al feto en
crecimiento.

Las concentraciones de estrgenos son bajas durante la primera parte de la gestacin pero

134
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

aumentan a la mitad y ltima parte de la misma. En yeguas, los niveles de estrgenos son muy
altos durante la segunda mitad de la gestacin. La fuente primaria de estos estrgenos es la
placenta. La funcin principal de los estrgenos durante la gestacin parece ser un sinergismo con
la progesterona al desarrollar y preparar la glndula mamaria para la sntesis de leche despus del
parto.

Otras hormonas primarias de la reproduccin no parecen jugar un papel dominante durante la


gestacin. Se les encuentra en la sangre en bajas concentraciones. La funcin normal de la
glndula tiroides, paratiroides y otras glndulas endocrinas que producen hormonas secundarias
de la reproduccin, son importantes en el mantenimiento de un ptimo estado metablico en la
madre lo que permite un desarrollo embrionario y fetal adecuado.

ALIMENTACIN DE LA HEMBRA DURANTE LA GESTACIN

La condicin corporal de la yegua dictar el nivel de alimentacin al cual se le deber someter.


Yeguas gestantes que se encuentran en buena condicin corporal en general: lomo plano o con
leve cresta de grasa, que no se note grasa alrededor de la cola y sobre las costillas. En esta
condicin corporal en general pueden ser alimentadas con el mismo nivel nutricional que yeguas
no-gestantes/vacas hasta el octavo mes de gestacin. Yeguas que se encuentren con una
condicin corporal inferior notndose ya las costillas y espina dorsal y sin poder palpar nada de
grasa, debern ser suplementadas hasta en un 15% adicional al nivel de energa para el
mantenimiento, al objeto de recuperar la condicin que les falta.

Durante los ltimos 3 meses de gestacin el requerimiento energtico de la yegua aumenta


significativamente a causa del desarrollo fetal. Esto se puede observar en la siguiente tabla:

Durante los ltimos 3 meses de gestacin el requerimiento energtico de la yegua aumenta


significativamente a causa del desarrollo fetal.

En situaciones donde la yegua no recibe el soporte energtico adecuado durante los ltimos 3
meses de gestacin, el feto toma prioridad por lo que se observa una cada en la condicin
corporal de la yegua a expensas del desarrollo fetal. La yegua por lo general, tiende a perder su
apetito durante los ltimos 3 meses de gestacin. La causa se debe bsicamente a la presin fsica
que aplica el feto al tracto gastrointestinal de la yegua. Esta presin inhibe el consumo de la yegua,
lo cual puede resultar fcilmente en una disminucin de la condicin corporal. Para conseguir evitar
este tipo de problemas se recomienda la suplementacin de raciones con mayor densidad
energtica durante los ltimos 3 meses de gestacin.

Esta prctica puede minimizar el riesgo de clicos o laminitis que resulten de un intento de
aumentar el consumo de alimento muchas veces a base de carbohidratos, sobre todo almidones y
azcares que fermentarn en el ciego provocando endotoxemias.

135
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

As utilizando productos adecuados para yeguas en gestacin y lactacin tambin nos permitir
optimizar la eficiencia reproductora de la yegua.

Es comn observar que yeguas a las cuales no se les proporciona una alimentacin equilibrada
durante la gestacin tengan cras no solamente ms pequeas, sino que tambin sufran de
algunos de los problemas que se describen
a continuacin:

- anormalidades del sistema seo, principalmente por problemas de niveles inadecuados


de calcio y fsforo
- sistemas inmunolgicos dbiles
- aumento de la incidencia de enfermedades osteoarticulares
- disminucin del desarrollo del cerebro
- disminucin de capacidad de supervivencia

En el pasado se crea que se poda tener yeguas en condicin corporal alta, es decir; con crestas
de grasa a lo largo del lomo. Relleno de grasa entre las costillas, grasa blanda que rodea la cabeza
de la cola, grasa en el cuello, interior de muslos y hombros al momento del parto y no se tendran
problemas de distocia o dificultad de parto. Vale la pena comentar que yeguas gordas son ms
susceptibles a padecer problemas de laminitis y producir menos leche que yeguas en condicin
corporal normal.

A continuacin se puede observar la forma en que los requerimientos nutricionales DIARIOS de


una yegua, peso adulto de 500 Kg., varan conforme avanza su perodo de gestacin; no solo para
energa y protena sino tambin para lisina y algunos minerales, en base a los parmetros del
N.R.C.

Destacar el papel del cobre en la alimentacin de la yegua, numerosos estudios apuntan a


suplementar a la yegua en cobre para disminuir la incidencia de procesos de enfermedades del
desarrollo en potros.

Diagnstico de preez
El diagnstico de gestacin en la yegua, por el mtodo de palpacin rectal, necesi-ta por parte del
tcnico un perfecto conocimiento de la situacin y las caractersticas de los rganos genitales de la
yegua vaca. Este examen debe practicarse con prudencia y tomando las precauciones necesarias,
es aconsejable que slo lo efecte un Mdico Veterinario familiarizado con este tipo de actividad.

En las yeguas primparas como en aquellas cuya fecundacin ha tenido lugar un cierto tiempo
despus del parto, el diagnostico de gestacin es posible desde el trigsimo da; es ms difcil en

136
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

este momento, en las yeguas fecundadas en el celo de potro, recin parida pues, en estas ltimas,
el tero no ha sufrido la involucin complete antes de instaurarse una nueva gestacin.

El diagnstico est menor sujeto a dificultades cuando la exploracin rectal se practica entre el da
45 a 60 de gestacin.

Al trigsimo da, el cuerno gestante, Generalmente el derecho, est turgente, rgido y contrasta con
la flacidez del cuerpo del tero y del cuerno no gestante. El embrin en este momento del grosor
de un huevo de gallina, puede ser percibido adelante de la bifurcacin de los cuernos.

La mucosa vaginal est plida y blanquecina; sus paredes estn cubiertas de un moco espeso,
gelatinoso que hace difcil la introduccin de un especulo. El cuello, generalmente prominente, est
cerrado por espeso tapn gelatinoso.

De los cuarenta y cinco a cincuenta das, la ampolla fetal, del grosor de un huevo de ganso, ocupa
la parte anterior del cuerno; la dilatacin presenta una forma ms bien oval que esfrica puede
medir alrededor de 6 CMS.

A los sesenta das, la dilatacin cornual es de unos 8 CMS, da la impresin de una naranja grande,
relativamente blanda al tacto, a este nivel es posible reconocer, por presin entre los dedos, la
presencia de las membranas fetales.

Al tercer mes, la distensin llega a el cuerpo del tero y al cuerno uterino gestante; alcanza 12.5
cm. de dimetro y se sita transversalmente frente a la circunferencia pelviana. Es importante en
esta poca no confundir el tero gestante con la vejiga moderadamente llena.

Entre tres meses y medio y cinco meses, es fcil palpar al feto situado por delante de la
circunferencia pelviana. A partir del da 200 es posible palpar uno u otro rgano del feto (cabeza,
miembros) salvo si el tero se hunde demasiado profundamente en la cavidad abdominal. Pero en
este caso los elementos siguientes pueden considerarse en favor de una gestacin: el hecho de no
encontrar un tero en reposo, la dificultad de prehensin de los rganos, y su cambio de posicin.

Como se ha sealado antes, y a pesar de que se haya admitido que el Ovario izquierdo funciona
ms que el derecho, la gestacin tiene lugar corrientemente en el cuerno derecho. El desarrollo
mamario se manifiesta en el curso de las tres ltimas semanas de la gestacin; es ms marcado
en las multparas que en las primparas. En los das que preceden al parto, la secrecin mamaria
es evidente a nivel de los pezones, y forma un cogulo denominado corrientemente candelas.
Estas estn generalmente consideradas como un elemento indicativo de la proximidad del porto.

Hay otros mtodos de diagnstico de preez en yeguas, como son:

a. Determinaciones hormonales: -Determinacin del nivel


progesternico. -Determinacin del nivel de PMSG -
Determinacin de sulfato de estrona en orina.

b. Pruebas Biolgicas: Reaccin de Ascheim-


Zondeck Test de Friedman
Test de Galli-Mainini
Mtodo inmunolgico (Inhibicin de la Hemoaglutinacin para PMSG). Mtodo
lnmunoqumico (inmune-electroforesis para PMSG).
Pruebas de Apreciacin de Estrgenos. Mtodo
Biolgico (Test de Allen-Doisy) Mtodo Qumico
(Reaccin de Cuboni)

137
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Su empleo tiene diferentes porcentajes de confiabilidad, su costo muchas veces es elevado y los
laboratorios que los efectan no siempre estn en todas las zonas geogrficas del pas, sino que
se agrupan alrededor de las grandes ciudades, haciendo poco comn su empleo en forma
rutinaria.

Leccin 24 EL PARTO.

http://riie.com.ar/?a=47975

El parto requiere de vigilancia permanente, pero desde una distancia prudente que no moleste a la
yegua y de las mejores condiciones medioambientales posibles como lo son: la comodidad para la
futura madre, asepsia, espacio suficiente y buen suministro de agua limpia y fresca.

Los primeros sntomas del parto son: dilatacin vulvar, presencia de leche en la ubre, conformacin
del anca que nos demuestra una relajacin plvica y dilatacin del canal del parto, esto se
presenta pocas horas antes del parto.

http://riie.com.ar/?a=47975

Por lo general las yeguas no presentan ningn tipo de problema en el parto como sucede en otras
especies domesticas, cuando se presentan suelen ser por mala presentacin del potro.
El parto se desarrolla en varias fases que comprenden principalmente:

Desencadenamiento de las contracciones uterinas y apertura del cuello.


Expulsin del producto.
Expulsin de las envolturas fetales
Modificaciones puerperales.

Contracciones Uterinas y Dilatacin del Cuello.


El parto parece estar determinado por la evolucin cclica de la placenta que origina un descenso
hormonal armoniosamente equilibrado entre las hormonas fetales (corticoides fetales) y las

138
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

hormonas de origen materno.

Cualquiera que sea el mecanismo exacto del desencadenamiento del parto, ste se exterioriza por
contracciones rtmicas fuertes y crecientes de la musculatura uterina. Estas contracciones
aparecen solamente unas horas antes del parto; su duracin es de 50 a 60 segundos con intervalo
de 3 a 4 minutos hacindose ms continuas y prolongadas. En las grandes especies las
contracciones comienzan en lo alto del cuerno uterino, recorren stos en toda su longitud y se
agotan a nivel del cuello.

Es en curso de este perodo cuando el feto modifica su posicin uterina para tomar la posicin de
salida

El tero y su producto, que hasta entonces reposan sobre la pared abdominal, deben sufrir un
movimiento de desplazamiento hacia las regiones superiores de forma tal que el tero, el cuello y
la vagina constituyen un canal rectilneo fcil de franquear por el feto; a esta rectificacin del
canal del parto ayudan las contracciones de los ligamentos anchos y las contracciones combinadas
del tero, del abdomen y del diafragma (prensa abdominal).

El potro sufre una rotacin progresiva que lo acomoda para un parto rpido y exitoso.
La duracin de la preparacin del parto es mayor en las primparas que en las primparas.
A las contracciones uterinas se asocian pronto contracciones abdominales, que se repiten cada 2 a
3 minutos, intensificndose a medida que la cabeza y los miembros se introducen a travs de la
cerviz.

Expulsin del Feto


Bajo el efecto de las contracciones uterinas y musculares el feto se introduce en el canal cervical la
bolsa formada por el corin hace tas veces de cua ejerciendo una presin continua por toda la
superficie. La tensin interna es tal que la bolsa alantoidea se rompe, dando as salida a las
primeras aguas.

Este ltimo fenmeno va a menudo seguido de un perodo de tranquilidad. A consecuencia de


nuevos dolores (a causa de las contracciones) el amnios se introduce a su vez acompaado del
feto cuya cabeza y cascos anteriores franquean el cuello uterino completamente dilatado, la
progresin en el canal plvico se encuentra facilitada por las modificaciones sufridas por est
rgano; reblandecimiento de los tejidos blandos, distensin aumentada de las articulaciones
sacroilacas, y alargamiento de los dimetros sacro pubiano y sacroilaco; todos estos procesos
estimulados por la accin de la relaxina.

Al cabo de algunos Instantes la bolsa amnitica que aparece entre los labios vulvares, acaba por
romperse bajo el efecto de los esfuerzos expulsivos. Puede ocurrir que el amnios no se desgarre y
que el feto sea expulsado recubierto por el amnios; pudiendo ser la consecuencia de a asfixia del
producto; esto es un hecho ms o menos frecuente en la yegua, por lo cual el parto de stas debe
ser celosamente vigilado.

Desde que el feto ha franqueado el cuello y se ha introducido en el estrecho pelviano, las


contracciones uterinas y las contracciones abdominales se hacen ms intensas y se suceden a un
mayor ritmo.

La cabeza llega a nivel de la abertura vulvar que se dilata progresivamente, despus la franquea
mientras el tronco del feto, introducido en el estrecho pelviano, se adapta a las dimensiones de
este conducto.

139
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

http://riie.com.ar/?a=47975

Esta fase es muy penosa y dolorosa, exige de la madre esfuerzos expulsivos intensos. Habiendo
franqueado el pecho el estrecho pelviano, algunas contracciones llevan a la salida total del
producto y de una oleada de lquido que representa el resto de los lquidos amnitico y alantoideo.
Durante esta etapa se serrara la vlvula sangunea natural, que evita que salga sangre del cuerpo
del potro, pero que a la vez le permite extraer la mayor cantidad posible de la placenta.

http://caballospastoreo.galeon.com/productos766741.html

La yegua a veces permanece acostada una vez a expulsado al potro, por un periodo de hasta
media hora, recuperando fuerzas. Es probable que relinche y resople para estimular al neonato a
pararse, en poco tiempo ella se levantara y comenzara a lamerlo para estimular la circulacin
perifrica y el ritmo respiratorio.

http://caballospastoreo.galeon.com/productos766741.html

En esta etapa aun quedan colgando membranas fetales sobresaliendo a travez del canal del parto,

140
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

estas sern expulsadas tras nuevas contracciones. Este proceso Dura entre una y dos horas, no
es aconsejable tirar de ellas, ya que podran romperse, quedndose retenida parte de los anexos
fetales, provocndose complicaciones mayores. La yegua debe eliminarlas tras las primeras 8
horas posparto.

http://caballospastoreo.galeon.com/productos766741.html

El potro debe intentar levantarse despus de aproximadamente media hora de nacido, cayendo al
suelo en repetidas ocasiones hasta que lo consigue. S i no consigue permanecer de pie el tiempo
suficiente para que inicie el proceso de lactancia, tras media hora de intentos se le debe ayudar un
poco guindolo hacia la ubre de la yagua ya que es de vital importancia que el potro ingiera el
calostro materno en las primeras dos horas de vida que es cuando su organismo presenta la mayor
absorcin de inmunoglobulinas.

Duracin del Parto.

http://caballospastoreo.galeon.com/productos766741.html

Es generalmente corto en la yegua; raramente ms de 5 a 15 minutos. La yegua se mantiene


habitualmente acostada algunos minutos despus del parto y el cordn umbilical se rompe en el
momento de pararse. Una ruptura demasiado precoz del cordn umbilical puede ser perjudicial a la
vida del feto que no ha podido almacenar toda la sangre placentaria antes de que se instauren los
mecanismos reguladores de su vida autnoma.

La yegua se sita normalmente en decbito lateral total, con los miembros extendidos, y los partos
se producen con mayor frecuencia en periodo nocturno. Expulsin de las Membranas.
El hipoman es una masa que se mantiene en la boca del potro hasta el momento del nacimiento.
Su funcin, al parecer es evitar que entren lquidos amniticos durante la gestacin.

La separacin placentaria y su expulsin no estn claramente establecidas. Es verosmil que las


modificaciones del equilibrio hormonal que ocurren en el momento del parto descenso de los
niveles de progesterona, aumento-de los estrgenos circulantes, secrecin de oxitcica, etc.), no

141
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

sean totalmente extraas a estos fenmenos, pero ni la importancia ni el mecanismo de su


intervencin han sido precisados. Una madurez determinada de la placenta, ligada al equilibrio
hormonal, debe ciertamente alcanzarse para que tenga lugar el desprendimiento y expulsin
placentaria.

En los ltimos das de la gestacin, el epitelio placentario se degenera, las vellosidades se reducen
y los vasos tienen tendencia estrecharse. Las contracciones uterinas tienen ciertamente un papel
importante: muy activas en el curso de la expulsin se mantienen despus de sta, producindose
en olas peristlticas que comienzan en la parte apical del cuerno en direccin a la cerviz.

Estas contracciones tienen por efecto provocar una inversin del corin, la constriccin vascular,
la isquemia y en consecuencia la disociacin de las vellosidades cotiledonarias. Como ya
mencionamos, normalmente, en la yegua, las secundinas son expulsadas en un trmino de 30
minutos a 3 horas.

La retencin de las secundinas ms all de los lmites de tiempo indicados debe considerarse
como anormal y necesita intervencin para prevenir diversas complicaciones como la infosura
puerperal.

PUERPERIO

Terminado el parto, los rganos genitales vuelven progresivamente a su estado normal: el tero
entra en involucin, el endometrio se regenera y finalmente las manifestaciones estrales
reaparecen. Estas modificaciones van precedidas del flujo loquial.

Los lquidos son secreciones de importancia y color variable, formadas por una mezcla de exudado
y de restos endometriales y carunculares, siendo eliminados en los das que siguen al parto. Son
ligeros, mucosos y de color amarillento, en la yegua duran 4 a 5 das. El olor nauseabundo de los
loquios, su aspecto granuloso y hemorrgico, su abundancia y persistencia traducen una metritis
en evolucin o declarada.

La involucin uterina est favorecida por el rgano en s, por la reduccin de la vascularizacin, por
las modificaciones hormonales y neuronales que acompaan al parto, por la descomposicin
enzimtica de los polisacridos miometriales, pero sobre todo por la persistencia durante algn
tiempo de las contracciones miometriales a pesar de que estas estn reducidas en frecuencia e
intensidad.

El conjunto de estos factores condiciona la fusin de la capa serosa intersticial, y la reduccin de


volumen de las fibras musculares hipertrofiadas en el curso de la gestacin y la nueva
transformacin en fibras conjuntivas de las fibras musculares recin formadas. Mientras que el
Otero se reduce de volumen, el cuello uterino se consolida, se vuelve netamente perceptible y se
cierra progresivamente de la parte craneal hacia la parte distal.

La involucin es completa en la yegua despus de 12 das, poca en la cual puede a veces ser de
nuevo fecundada, pero no es completa histolgicamente sino despus de tres semanas. Los estros
(calores> reaparecen entre 6 a 15 das post-parto en las yeguas sometidas a buen manejo y que
gocen de aceptable sanidad.

Cuidados a dar a la madre y al neonato

Las yeguas que acaban de parir sern mantenidas en un local con buena temperatura y con buena
cama. La yegua en transpiracin intensa ser considerablemente friccionada y se le administrar
alimento hmedo, bastante ligero. Si los esfuerzos expulsivos persisten, interesa efectuar una

142
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

exploracin uterina para asegurarse que no hay un segundo feto, ni anomala alguna. Una
exploracin as debe por otra parte hacerse normalmente despus de cada parto. Los esfuerzos
expulsivos que persistan sern calmados, ya por una anestesia epidural, o por tranquilizantes o
analgsicos suministrados por personal competente.

Recin Nacido

La vida y el desarrollo del feto estn asegurados por la circulacin de la sangre oxigenada de
origen placentario ya que la circulacin pulmonar es extremadamente reducida, pues este rgano
est completamente colapsado.

Al nacimiento, la circulacin umbilical se detiene. El canal arterial y el agujero de Botal se cierran


funcionalmente primero, y anatmicamente ms tarde, y la circulacin toma rpidamente en el
recin nacido los caracteres que conservar en el adulto.

El intestino del potro se encuentra lleno de excrementos que se acumulan durante la vida fetal. Si
no se vaca el intestino dentro de las 4-12 horas siguientes al nacimiento, se puede producir un
clico.

Por otra parte, el recin nacido nace normalmente anxico y la respiracin se vuelve en l una
necesidad absoluta desde que los lazos vasculares que le unan a la madre se han roto. La
primera inspiracin est gobernada por el centro respiratorio, excitado por las modificaciones
sanguneas consecutivas a la anoxia fisiolgica que le acompaa en el nacimiento. Es el acumulo
de gas carbnico en la sangre lo que induce la respiracin en el recin nacido de la misma forma
que en el adulto. Los cambios gaseosos se hacen rpidos y activos, a pesar de que la ampliacin
pulmonar no sea completa de golpe; algunos minutos despus del nacimiento, el contenido en
oxgeno se hace normal.

http://caballospastoreo.galeon.com/productos766741.html

Si el parto se ha detenido o demorado, si la placenta se desprendi antes de la expulsin del feto,


o si el cordn umbilical ha estado demasiado tiempo comprimido, el feto, privado de sangre arterial
y de oxgeno, acaba por asfixiarse. As cuando el feto nace en estado de muerte aparente, es
indispensable detener rpidamente vas areas libres y practicar la respiracin artificial hasta el
momento en los movimientos respiratorios espontneos se hayan reanudado y adquirido un ritmo
normal. Se puede ayudar a ello, masajeando la regin precordial, ejerciendo tracciones rtmicas de
la lengua, insuflando en los ollares humo de tabaco o tocando la mucosa con ayuda de una
solucin de vinagre.

143
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Igualmente, se recomienda suspender el recin nacido por las extremidades posteriores durante
algunos segundos; la sangre venosa fluye al cerebro y el gas carbnico tacita as el centro
respiratorio.

El cordn umbilical es el mayor sitio para invasin de bacterias en el neonato, por ello debe ser
desinfectado cuidadosamente con una solucin de yodo al 2 %, evitando as la septicemia del
recin nacido.
Tanto madre como hijo se deben dejar solos lo mas pronto posible, para que se establezca la
relacin madre-hijo que es de suma importancia para el resto de la vida del neonato.
Entre los das 30 y 45 antes del parto la yegua debe haberse vacunado contra el ttano si esto no
fue as, se debe vacunar al potro con la antitoxina del ttano de 1.500 unidades.
El calostro es la primera leche producida por la madre para su cra, esta es rica en energa,
protena, vitamina A, minerales e inmunoglobulinas, al igual que tiene una funcin laxante que
ayuda a eliminar al meconio. El calostro es secretado en las primeras 24 48 horas despus del
parto y debe ser consumido `por el potro en las primeras dos o tres horas despus del nacimiento.

Cuidados a dar al cordn umbilical.

El cordn no roto ser seccionado bajo tensin de forma que permita el enrollamiento y la
retraccin de la arteria. La herida umbilical constituye en todos los jvenes un punto vulnerable por
donde se establece la infeccin, debe ser convenientemente desinfectado con tintura de yodo o por
otro antisptico no irritante y eventualmente recubierto por un polvo astringente y mosquicida.
Generalmente, el mun se desprende despus de dos o tres das, dejando una herida umbilical
perfectamente cicatrizada. En el potro, es til administrar una dosis profilctica de suero
antitetnico, especialmente en climas clidos y hmedos.

LACTACIN.

El recin nacido ser colocado cerca de la madre quien lamindolo, le quitar las mucosidades de
que est cubierto; pudiendo igualmente eliminrselas con fricciones secas. Ser acercado a la
madre durante la fase de somnolencia de sta, quien le acepta generalmente bien al despertar;
este ser, sin embargo, vigilado en caso de que no haya sido obtenido el efecto buscado. Uno de
los primeros cuidados es igualmente asegurar la toma del calostro; que suministrar los
anticuerpos que no pueden traspasar la barrera placentaria, proporcionando un adecuado nivel de
defensas al recin nacido, lo que garantizar un ndice mayor de sobre vivencia del nuevo ser.

http://caballospastoreo.galeon.com/productos766741.html

144
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

La fase de lactancia es la fase de ms alto requerimiento nutricional (especialmente energtico) en


la vida productiva de la yegua, excluyendo los perodos de crecimiento y de trabajo intenso. Es por
muchos tambin la fase de produccin ms descuidada. Despus del parto, los requerimientos
nutricionales de la yegua aumentan hasta en un 75% por arriba de los requerimientos de
mantenimiento. Este aumento es resultado de las necesidades de produccin lctea y de la
ineficiencia intrnseca del proceso de conversin de nutrientes digestible a leche. Los
requerimientos de energa, protena, minerales y vitaminas son satisfechos cuando se tiene a las
yeguas y los potrillos en pastos de muy alta calidad y se les suplementa con raciones de alta
densidad energtica.

La suplementacin de la yegua debe tambin estar enfocada a mejorar la calidad de la leche que
sta produce, aspecto que se puede hacer a travs del uso de ingredientes y nutrientes
especficos. Con esto se puede lograr que el consumo energtico y nutricional del potro sea mayor
y por lo tanto su desarrollo mejore.
El pico de lactacin ocurre en las fases iniciales y posteriormente disminuye la produccin de leche
gradualmente hasta llegar al destete. Durante esta fase es que la condicin corporal de la yegua
juega un papel muy importante. Yeguas que se encuentran en condicin corporal correcta, han
almacenado reservas de grasa en el cuerpo. Esta grasa puede ser utilizada por la yegua para
ayudarle a complementar los requisitos energticos que ella tiene para producir leche. Estos
requisitos son bastante elevados, por lo que s cuenta con buenas reservas corporales, la
demanda de suplementacin alimenticia puede disminuir y las prdidas de peso y condicin
corporal tambin son menos drsticas.

Es importante que no se le permita a la yegua que pierda mucha condicin corporal, pues esto le
afectar su rendimiento reproductivo. Yeguas que llegan al parto con baja condicin corporal o que
pierden mucho peso durante los meses iniciales de la lactancia ven su comportamiento
reproductivo seriamente afectado.

Yeguas que son mal alimentadas o con raciones mal equilibradas suelen presentar sntomas
tpicos a los que muestras animales bajo condiciones de limitacin de alimento hambre. Los
sntomas pueden ser: mareos, espasmos musculares, diarreas, retencin abdominal de lquidos y
posiblemente muerte.

Otro sntoma que debe ser controlado en las yeguas es la defecacin, para identificar
oportunamente a animales con estreimiento. Por lo general, el ejercicio es el mejor preventivo,
aunque en casos especficos ingredientes de tipo laxante pueden ser utilizados como es el caso
del aceite de linaza.

Hay que tener en cuenta que la produccin de leche va a ser del 2,5-3% del peso vivo en el
perodo de mxima produccin, la leche de la yegua es bastante pobre tiene menos materia seca
protena y grasa que la de vaca, aunque paradjicamente contiene cidos grasos insaturados
omega 3, que se les relaciona con el desarrollo del cerebro del potro (La leche de la yegua es
utilizada en pases como Rusia para la cosmtica humana).

Es de resaltar que teniendo en cuenta que no hay transferencia de anticuerpos de la placenta al


feto durante la preez, el potro nace sin ninguna proteccin contra las enfermedades, por lo cual es
necesario que el potro mame el calostro lo ms rpido posible, para protegerse de ellas, pues su
sistema inmunolgico comienza a funcionar a los 3 meses aproximadamente, esto es conocido
como transferencia pasiva.

145
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tomada en Pesebrera El Puente - Neiva

El consumo de leche para un potro ser de un 25 % de su peso corporal. Por tal motivo es que los
potros maman a intervalos de tiempo muy corto, aproximadamente veinte minutos entre una y otra,
tomando poca cantidad cada vez.
Los requerimientos nutricionales para yeguas lactantes se contemplan en la siguiente tabla
Estos estndares son los niveles que se consideran promedio para una yegua con peso
adulto de 500 kg. Existe cierta discusin en relacin al nivel exacto de protena, y muchos
asesores nutricionales utilizan estos valores como base, formulando raciones con un 10 a
otras con un 16% ms de protena y algunos minerales. El objetivo de este aumento tiene
que ver con el nivel de produccin de leche, el pico de lactancia, la concentracin de
nutrientes en la leche, la reposicin de tejido post-parto y el futuro comportamiento
reproductivo.

Tabla 17. Requerimientos Nutricionales Para Hembras Lactantes


Protena Vit. A
Energa
Fase Bruta Lisina Calcio Fsforo Magnesio Potasio (UI x
Digestible
Productiva (Gr) (Gr) (Gr) (Gr) (Gr) (Gr) 10,000)
(Mcal) (3)
Lactacin
temprana o 28.3 1.427 50 56 36 10.9 46 30
inicial (1)
Lactacin
tarda o final 24.3 1.048 37 36 22 8.6 33 30
(2)
Mantenimiento 16.4 656 23 20 14 7.5 25 15

(1): Se considera Lactacin temprana o inicial al periodo del nacimiento a los 3 meses post-parto
(2): Se considera Lactacin tarda o final al periodo de los 3 meses post-parto al destete
(3): El requerimiento de protena en % de la dieta recomendado por la N.R.C es de 10 a 12% y el que
recomiendan otros investigadores vara entre los 12 y 16%

A partir del 3er mes de lactacin la cantidad y calidad de leche secretada es cada vez
menor y de inferior calidad, mientras que las necesidades del potro lactante van
aumentando, as por ejemplo el balance entre los nutrientes secretados por la leche y los
requeridos por el potro es negativo.

SERVICIO DESPUS DEL PARTO

La yegua presenta un celo entre los 8 12 das despus del parto.

Muchos ganaderos prefieren cubrir a la yegua en este celo porque es un celo siempre
visible, en ocasiones luego no muestran sntomas de celo durante la crianza del potro (la
lactancia y la presencia del potro pueden alterar el ciclo estral). Si no hay lesiones tras el
parto se pueden cubrir en el primer celo, pero es aconsejable no realizarlo por las
siguientes razones:

Bajo ndice de fertilidad.

146
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Bajo porcentaje de abortos.


Alto porcentaje de reabsorciones fetales.
Alto porcentaje de cras dbiles.
Mayor numero de placentas retenidas.

Las cras son ms susceptibles a enfermedades.

Aun as si se ha decidido realizar el servicio se debe tener en cuenta que este no debe realizarse si
hubo retencin placentaria de ms de tres horas, desgarraduras que no han curado plenamente,
traumatismos en el tracto genital, presencia de exudados u orina en la vagina, mucosa descolorida
o congestionada y falta de tono en tero o vagina. En estos casos hay que esperar a los siguientes
celos, una vez que hayan desaparecido estas lesiones, de los contrario se pueden provocar
infecciones en el tero.

En los das que siguen a la cubricin la yegua debe estar tranquila, evitando cualquier esfuerzo o
excitacin. Hay que facilitar la nidacin del embrin en el tero.

Un suplemento, ser necesario si existe alguna carencia en especifico esto depende del tipo de
alimentacin, que come y en que cantidad? o si est en una mala condicin corporal, una yegua
en reproduccin debera estar en una condicin corporal de 5 a 6.

La segunda alternativa, es realizar la monta en el segundo celo que presenta la yegua que
generalmente se presenta en le da 28 despus del parto, pero debe recordarse que el ndice
fecundidad es bajo, en contraste con el servicio pos destete.

Leccin 25. SELECCIN Y MEJORAMIENTO

Tomada en Pesebrera El Puente - Neiva

La cra satisfactoria de los animales depende ante todo de la adecuada eleccin de lo progenitores
para cada generacin sucesiva.
Es lgico que para el logro de mejores individuos que debamos conocer algunos principios bsicos
acerca de la divisin celular, los cromosomas y los genes para poder entender el mecanismo de la

147
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

herencia para posteriormente comprender los conceptos sobre seleccin y mejoramiento.

Todos los que cran animales por gusto (caballistas criadores de animales de paso fino, salto o
polo), como los que lo hacen por negocio, procuran moldear la forma externa de sus animales, con
arreglo a un plan preconcebido, y completar esa forma exterior con una combinacin de caracteres
que d a los animales un elevado valor comercial o esttico. As, los criadores de caballos desean
obtener velocidad, temperamento, energa y resistencia, adems que el animal sea simtrico,
hermoso y con alto grado de afecto por su amo.

Pueden reunirse estas diversas combinaciones en un mismo animal la respuesta es sin duda
afirmativa, puesto que mediante rigurosos procesos de seleccin y mejoramiento podemos
obtenerlos. Lograremos criar nuestros animales de tal modo que no slo posean las deseadas
combinaciones de caracteres, sino que puedan transmitirlas a sus descendientes. Seguro que si,
ya que mediante los conocimientos modernos sobre reproduccin y gentica estos campos del
conocimiento da a da son ms asequibles a todas las personas vinculadas con la actividad
pecuaria, quienes buscan de adecuada manera mejorar a la especie equina.

CONCEPTOS GENERALES DE BIOLOGA Y GENTICA.

http://www.phpwebquest.org/wq25/webquest/soporte_tablon_w.php?id_actividad=18773&id_pagina=1

La clula es el componente bsico de toda estructura viva, desde hace ms de 300 aos Hooke
llam clula a las cavidades regulares que conformaban el corcho, desde entonces, es mucho lo
que se ha descubierto acerca de esta estructura y sus componentes; pero para nuestro s objetivos
nos limitaremos a recordar algunos conceptos bsicos que nos permitan profundizar en nuestro
tema.

Toda clula se compone de un ncleo, de citoplasma en el cual se encuentran los organelos


subcelulares (mitocondrias, retculo endoplsmico, Cuerpo de Golgi), todo esto rodeado por la
membrana celular.

Los conceptos sobre funcin y estructura celular corresponden .a la biologa. La especializacin

148
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

celular y el agrupamiento de las mismas originan los tejidos corporales los cuales a su vez se
agrupan para dar lugar a los rganos, quienes sern los encargados de efectuar las funciones
fisiolgicas y cuya integracin permite al individuo sobrevivir en el medio ambiente

De la clula, la porcin ms importante la constituye el ncleo, en l se encuentran los


cromosomas, cuyo nmero es especfico para las especies, en el caso de los equinos ste es de
64 para el caballo, 62 para el asno y 63 en los mulares.

El Nmero de cromosomas que posea una clula nos permite clasificarlas en dos grandes grupos:

Clulas somticas o diploides: cuyo nmero cromosmico es el del total para la especie, constituye
el mayor porcentaje de las clulas del individuo; la divisin de stas se desarrolla por el proceso
conocido como mitosis; al final del cual se originarn dos clulas idnticas a la primaria.

Clulas sexuales o Haploide: el nmero de cromosomas en stas es la mitad del de las somticas.
Se conocen a estas clulas igualmente como gametos femeninos o masculinos (vulos o
espermatozoides); la divisin en ellas se denomina Meiosis. Mediante el aporte parcial de
cromosomas (la mitad por cada sexo) se posibilita que al producirse la fecundacin (unin del
gameto femenino con el masculino) se origine un individuo nuevo, con el nmero total de
cromosomas (nmero diploide), tpico para cada especie.

Cromosomas
Son filamentos compuestos por cido Desoxirribonucleico (DNA) y protena; estas estructuras
lineales contienen el material gentico compuesto por genes. Los cromosomas estn formados por
cromatina, la cual toma un color ms intenso en la divisin celular, en ella, los bastones
(cromosomas) se distribuyen en nmeros exactamente iguales en ambas clulas hijas; cada
individuo segn la especie a que pertenece contiene en sus clulas un nmero definido y
caracterstico de cromosomas, los individuos que exhiben reproduccin sexual poseen gametos o
clulas sexuales las cuales contendrn un nmero de cromosomas que corresponde exactamente
a la mitad de los que tienen las clulas somticas o corporales.

Genes

Son los factores responsables de los caracteres hereditarios, cada uno de ellos difiere de los
restantes, cada uno posee la misin de controlar uno o ms caracteres hereditarios. Cada gen es
una molcula de DNA, en la cual se halla almacenada la informacin biolgica en forma de un
cdigo de tripletas de nucletidos constituyendo una doble hlice, para conformar la estructura
tpica del DNA; la informacin de cada gen es leda y, en consecuencia, se sintetiza una protena
especfica, esta-constituye la base qumica del carcter externo o interno del individuo.

Un animal con dos genes exactamente iguales, a manera de ejemplo dos genes NN que darn el
color negro o dos nn que darn el color pardo, se dice que son homocigticos para el carcter del
color, si en la clula sexual queda un gen N al producirse la fecundacin y la unin con el alelo
diferente, es decir, el n correspondiente al otro gameto sexual, el producto ser Nn, ste se
considera heterocigtico; pero si el color predominante es el negro (NN) este se considerar
dominante frente al otro gen (n) el cual ser recesivo para dicha caracterstica.

Los genes dominantes siempre se expresan (aparecen) cada vez que estn presentes, si el gene
es recesivo solo aparecer cuando se encuentre con un similar (nn), es por esto que algunas
caractersticas no aparecen generacin tras generacin, sino lo hacen espordicamente. Los
genes dominantes usualmente se expresan con una letra mayscula y los recesivos con la misma
letra pero en minscula. Actualmente se considera como sinnimo de gen el trmino alelo.

Divisin celular.

149
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Las clulas somticas se dividen por mitosis, en ellas el nmero de cromosomas corresponde al
total para la especie, las clulas hijas contendrn el mismo nmero y por tanto sern idnticas a la
que las origin.

Las clulas sexuales se dividen inicialmente por mitosis y posteriormente por meiosis, al final las
clulas hijas contendrn la mitad de los cromosomas de la especie, as el vulo o el
espermatozoide contendrn un nmero de cromosomas que permite que al producirse el
apareamiento el nmero bsico de cromosomas volver a su nmero bsico inicial.

En las clulas sexuales se da una caracterstica fundamental en la transmisin del sexo, el macho
porta en sus espermatozoides los cromosomas conocidos como XY o sexuales, el vulo por su
parte porta los llamados XX. EI producto (hijo, podr ser XY (macho) o XX (hembra), como
producto de la unin de un X o un Y del macho y un X de la hembra, con esto queda claro que
quien define el sexo del hijo es el macho.

Fenotipo y Genotipo.

Fenotipo: La configuracin externa de un individuo con respecto a cierto rasgo heredado y su


interaccin con el medio ambiente que lo rodea.

Genotipo: La constitucin gentica (interna) de un organismo generalmente expresado con


smbolos, se llama su GENOTIPO.

http://es.wikipedia.org

En sntesis, el fenotipo es lo visible: el color, la altura (alzada); el genotipo es la conformacin


gentica (NN, Nn, nn) que da tal o cual caracterstica, ac debemos tener en cuenta lo aprendido
acerca de DOMINANCIA y RECESIVIDAD, ya que un animal puede ser fenotpicamente blanco,
pero genotpicamente no; as en su descendencia puede producir un hijo negro an cuando se
halla cruzado con otro individuo blanco, en ste caso ambos eran blancos recesivos, es decir,
genotpicamente eran recesivos y al unirse produjeron un animal puro recesivo.

Blanco puro dominante BB


Blanco puro recesivo Bb
Negro puro recesivo bb

PADRE MADRE
XY XX

150
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Bb Bb

HIJOS
B b
B BB Bb
b Bb bb

Estas diferentes posibles combinaciones que dan como resultado distintas caractersticas en los
descendientes, se rigen por las leyes de la probabilidad; esto indica que no siempre es exacto que
un hijo tenga ciertas caractersticas de uno de sus padres, sino que esto puede variar y es por esto
que los hijos no exhiben siempre todas las caractersticas de sus padres, a veces presenta las de
ancestros ms lejanos (abuelos, etc.).

HERENCIA Y MECANISMOS RELACIONADOS

Alosomas
As se denomina al cromosoma relacionado con la determinacin del sexo, ms conocidos como X
y Y; las hembras tienen dos alosomas XX; el macho XY.

Autosomas
O cromosomas somticas, son todo los restantes cromosomas no relacionados con la
determinacin del sexo.

Gentica
Se define como la disciplina que estudia los fenmenos de la herencia y las causas de las
variaciones entre organismos, a travs de ella podemos dilucidar porqu un caballo PSI (de
carreras) difiere de un perchern o de un caballo de vaquera, an cuando todos son equinos; as
al final podremos aclarar porque no hay dos organismos idnticos an dentro de la misma especie,
raza o tipo.

http://www.icampus.ucl.ac.be

Herencia.
Por herencia entendemos la semejanza, derivada de los antecesores, entre organismos
emparentados de distinta generacin. Se dice que los cromosomas son el vehculo de la
herencia, puesto que constituyen el nico lazo que une a dos generaciones sucesivas. Las ltimas
unidades indivisibles de la herencia son los genes.

Es usual asociar todo lo referente a la herencia, con los trabajos efectuados por el monje austriaco
Gregorio Mendel, a l se considera el padre de la gentica, ya que fue quien sent las bases

151
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

cientficas de los mecanismos involucrados en la herencia y elabor una teora slida acerca de la
misma, dicha teora se conoce como Herencia Mendeliana, en sta bsicamente se delinea los
patrones probables de cruces monohbridos, dihbridos y trihbridos para caractersticas
gobernadas por cromosomas especficos; pero no es til para estudios de gentica ms
avanzados, como lo es la gentica de poblaciones o cuantitativa.

Alelos Mltiples
Definir este concepto es importante, ya que a travs de este mecanismo gentico, se da la
coloracin del pelaje entre otras muchas caractersticas. Por alelos mltiples se conoce al grupo de
genes que determinarn una caracterstica fenotpica; ya no ser el par d genes solos, sino que
sern un grupo de pares de genes sobre quienes recaer la responsabilidad de dicha
caracterstica, entre ellos igualmente habr dominancia y recesividad.

Herencia ligada al sexo


Cuando vimos como se lograba la determinacin del sexo gentico (XX, hembra y XY, Macho)
apreciamos que quien define el sexo finalmente es el cromosoma Y, aportado por el macho.
Existen algunas caractersticas (color de los ojos en algunas especies) ligadas a dicho cromosoma
Y, y por tanto solo se expresarn en los machos, ya que las hembras no portan en su material
gentico dicho cromosoma. Por otra parte, en la mayora de casos de caractersticas ligadas al
sexo, estas solo se harn evidentes si se transmiten a travs de los cromosomas XX
correspondientes a la hembra.

Variacin
Por ser los genes y sus combinaciones relativamente estables, se han mantenido a travs del
tiempo los progresos conseguidos por la evolucin. Sin embargo, es necesario que acte la
variacin para que las especies progresen y se adapten a los cambios medio ambiental es.

Se ha dicho con razn, que: La variacin es a la vez la esperanza y la desesperacin del


mejorador; la esperanza, porque gracias a ella (la variacin), pueden mejorar las razas; la
desesperacin, porque los animales despus de mejorados notablemente, pueden variar hacia la
mediocridad perdiendo caractersticas tiles ya logradas.

La variacin es uno de los medios de que disponen los caballistas, stos estn siempre en busca
de variaciones convenientes. Las variaciones puedan ser:
Germinales: recombinaciones, mutaciones genticas y cromosmicas.
Somticas: modificaciones corporales o de comportamiento (docilidad, temperamento).

Sabemos que las especies o las razas varan en alzada, tipo, ritmo de crecimiento, eficiencia en la
conversin alimenticia, velocidad, resistencia, docilidad, fertilidad, longevidad, etc. Estas
variaciones son las que se deben tener en cuenta al instituir programas de seleccin y
mejoramiento, saber cules debemos mantener o cules podemos ir desechando.

Ascendencia y descendencia

Ascendencia: Igualmente conocida como pedigree; es el conocimiento de los ancestros (padres,


abuelos), de sus caractersticas tanto fenotpicas como genotpicas. El conocimiento de sta,
favorece en grado sumo la futura seleccin.

Descendencia: o progenie,- es el conocimiento de sus hijos y nietos. Algunas van pareciendo ms


y ms a los puros, se comportan como ellos y llegan a ser casi indistinguibles.

152
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

El medio
La herencia

Es posible que cada padre careciese de algunos genes necesarios para esa calidad superior, pero
que al juntarse la suma de ellos (genes recesivos) produjera el resultado encontrado.

Dominancia, Recesividad y Segregacin

Dominancia: As se definen aquellos caracteres unitarios que se manifiestan en la primera


generacin, obtenida de un cruce entre organismos que exhiben formas alternas para una misma
caracterstica.

Recesividad: Son aquellos caracteres que no se manifiestan en la primera generacin, pero que si
pueden manifestarse en la segunda generacin.

Dominancia y Recesividad constituyen una de las leyes de la teora mendeliana de la gentica.

Segregacin: Con ste trmino se conoce a los genes que ocupan una misma posicin en
cromosomas homlogos y que se separan durante la gametognesis, yendo cada gen a formar
parte de un gameto diferente; por tanto cada progenitor contribuye con uno de cada dos genes que
ocupan el mismo sitio en los cromosomas homlogos en la constitucin gentica del hijo. Este
principio constituye-la segunda ley de Mendel.

Seleccin.
La seleccin natural es el mtodo que tiene la naturaleza para asegurarse el mantenimiento de los
buenos genes y la excelente descendencia. Estimula la supervivencia de los genticamente ms
aptos y asegura la eliminacin de los errores de la naturaleza. Con los animales domsticos, los
continuos progresos en la tecnologa veterinaria y la seleccin artificial permiten a los criadores
desordenar a la Madre Naturaleza a veces para mejor, a veces para peor. En el mundo de los
equinos de raza, muchos animales individuales y sus problemas genticos son artificialmente
creados o corregidos, mantenidos y propagados por la intervencin humana. En nuestros das, la
responsabilidad de mantener una carga gentica saludable y la prevencin de los efectos
indeseables en la lnea y la raza, recaen principalmente en la integridad de los criadores.
El propsito de la seleccin artificial es mejorar la carga gentica en determinadas lneas criando
equinos de lneas paralelas pero similares. De cualquier forma, una seleccin extremadamente
unilateral para determinadas caractersticas, mientras que puede mejorar la estructura, la
apariencia o la habilidad para el trabajo, es a menudo a expensas de otros atributos. Los criadores
deben comparar los beneficios potenciales para la raza (como la tipicidad) con las potenciales y
especialmente las probables prdidas para la especie, como son, los defectos estructurales y
funcionales, la decreciente expectativa de vida.

Desde que el hombre descubri en el caballo una herramienta de trabajo y posteriormente de


diversin, ha tratado de mejorarlo; al principio lo hizo empricamente observando las
descendencias y tratando de efectuar apareamientos entre los animales que segn su criterio,
presentaban mejores habilidades o caractersticas sobresalientes. En este proceso fue ayudado
por la Seleccin Natural la cual permita que las descendencias fueran superiores a los padres,
adems que pudieran interrelacionar positivamente con su medio ambiente.

La seleccin es la clave de la mejora animal. La seleccin y los mtodos de reproduccin estn


ligados tan ntimamente, que es imposible pretender separarlos.

El hombre, producto de la ms elaborada evolucin, logr crear la Seleccin Artificial, mucho ms

153
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

activa y casi siempre ms til; un ejemplo de esta situacin lo podemos encontrar en el cambio
logrado en el caballo primitivo o Przhewalski, silo comparamos con un perchern moderno.

A la seleccin ha ayudado en alto porcentaje las mejores condiciones nutricionales y de manejo,


pero, no solo estos factores han tenido influencia; desde hace ms de 60 aos se conocen los
mecanismos de la transmisin hereditaria y desde entonces han jugado un importante papel en la
creacin de animales mejores, ya no solo se emplea el fenotipo como patrn de seleccin,
actualmente se utilizan mtodos ms racionales y modernos, lo que ha asegurado la permanencia
y/o creacin de razas con excelentes cualidades segn el fin que se persiga.

Uno de estos mtodos modernos es la Heredabilidad, es decir, la forma y permanencia de ciertas


caractersticas en la descendencia, segn que el carcter sea heredablemente alto o bajo,
podremos predecir en qu porcentaje se transmite este a la descendencia y as disear
convenientemente nuestros programas de cruces.

En el siguiente Cuadro podemos ver algunos ejemplos de rasgos y su proporcin de


heredabilidad en los equinos.

Tabla No 18 Rasgos y grado de heredabilidad en los equinos.


RASGO GRADO DE HEREDABILIDAD
Fertilidad y vigor al destete Bajo
Tamao adulto Medio alto
Rata de crecimiento despus del destete Medio alto
Tipo y conformacin fsica Medio
Velocidad Medio alto
Inteligencia Medio alto

HEREDABILIDAD DE ALGUNOS RASGOS EN EQUINOS


(Tomado de LASLEY, J. Genetic Principies in Horse breeding).

Segn la caracterstica que buscamos o deseamos mejorar debemos emplear sementales o


madres que posean dichas caractersticas, esto lo podemos conocer a travs del pedigr y las
pruebas de progenie, es decir, veremos como se han transmitido en los padres, y si estos ya han
tenido experiencia reproductiva, como los transfirieron a sus hijos.

La herencia y el medio en relacin con la seleccin.

Estos dos componentes de la seleccin son importantes en alto grado, uno no puede expresarse
suficientemente sin la participacin del otro; ambos poseen igual importancia, ni genes
convenientes en un medio desfavorable, ni genes deficientes con un buen medio pueden dar una
seleccin provechosa.

En nuestro medio, las condiciones medioambientales distan mucho de ser las ideales, por las
adversas condiciones climticas, el irregular aporte de forrajes y alimento por las fluctuaciones en
los perodos secos y lluviosos; las variaciones topogrficas en las diferentes zonas del pas, la
presencia de insectos hematfagos que: o bien, transmiten enfermedades a los equinos, o los
mantienen en constante stress por sus picaduras; todos estos factores hacen que los animales
que se deban o piensen seleccionar para nuestras condiciones debern poseer grandes
caractersticas de vigor, de resistencia, en sntesis de gran capacidad de adaptacin a las
condiciones medioambientales en las cuales se vern obligados a desarrollar sus labores. Sera
ilgico por dar un ejemplo, un animal de gran belleza, apreciable alzada, pelaje fino, extremidades

154
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

delgadas que pretenda ser el prototipo de seleccin para animales cuya funcin ser el transporte
de carga por las agrestes montaas santandereanas; para este caso sera mejor, ms rentable y
de mayor beneficio seleccionar un animal robusto, de alzada media y resistente.

Un factor primordial a tener en cuenta, en lo referente al medio ambiente, es el factor relacionado


con el aporte de forrajes y nutrientes; nunca debemos olvidar que podrn ser envidiables las
caractersticas genticas en un individuo, pero que estas nunca podrn expresarse en toda su
magnitud en un equino sub o desnutrido.

Criterios de seleccin

Existen diversos puntos de vista sobre los cuales se pueden realizar programas de seleccin; en
s, todos deben satisfacer una aficin personal del propietario de la explotacin o pueden llenar un
vaco en el mercado, o podrn efectuarse cruces y/o apareamientos cuyo fin busque acentuar
ciertas caractersticas de tipo o de raza de los especimenes cruzados; o buscan la perpetuacin de
componentes genticos de gran valor para la especie.

De la claridad de los objetivos buscados, de la seriedad y continuidad de los programas y de la


experiencia de los caballistas depende el xito del o los programas de seleccin.

Definir metas a alcanzar a corto plazo, en programas genticos no solo es ilgico, sino, irrealizable
ya que mucho tiempo ha de pasar (3 - 5 aos) para que se logre apreciar la capacidad de transmitir
las caractersticas buscadas; esto de por s nos indica que los programas de seleccin se deben
planear a largo plazo, la definicin de lo buscado (objetivo) debe permanecer a lo largo del
programa y no se debe cambiar de idea u objetivo cada 2 - 3 aos, pues esto solo ocasiona el
fracaso rotundo, adems se deben tener en cuenta los costos inherentes al proceso, ya que no
siempre los altos costos pueden ser sufragados por la mayor parte de propietarios vinculados a los
quidos.

Lo usual en la definicin de los criterios de seleccin es pensar, si se busca perpetuar


caractersticas exhibidas por un individuo (fenotipo), se busque solidificar un tipo o una raza, o se
piense en producir individuos cuya demanda en el mercado asegure el xito de la inversin (por
ejemplo, crear ejemplares excelentes de paso fino o caballos pony).

Qu debe conservarse y qu mejorarse

http://www.mundodecaballos.com

155
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Las diferencias que existen entre nuestras razas de caballos, proceden, de que sus creadores
persiguieron ideales distintos al practicar la seleccin y durante algn tiempo influyeron de un
modo apreciable sobre la frecuencia de determinados genes, este proceso fue lento y laborioso y
no se puede arruinar por decisiones tomadas a la ligera. A pesar de que los caballos se han
seleccionado durante mucho tiempo conforme a un fenotipo caracterizado por la eficiencia de su
rendimiento para determinada actividad o trabajo, estn lejos todava de ser homocigticos (puros),
ya sean dominantes o recesivos para los genes convenientes. La yegua de mejor apariencia no
produce el mejor potro cuando se aparea con el semental X, pero puede originario al ser cubierta
con el semental.

Y Solo cuando el caballista haya efectuado un estudio concienzudo de las yeguas que posee,
basndose en registros adecuados y valorando los caracteres favorables y adversos, est en
condiciones de buscar un semental para aparearlo con ellas. Cuando se trata de seleccionar
yeguas o potros, dentro de la explotacin o fuera de ella, debe adoptarse como criterio primordial la
posesin de un tipo aceptable para la clase de caballo de que se trate, no obstante el hecho de
que los descendientes de una yegua no siempre exhiben el mismo tipo y conformacin que ella.

En sntesis, es ms probable obtener un potro con las caractersticas tpicas del caballo de paso
fino colombiano de una yegua de esta clase, que de una hembra pura sangre y viceversa.

Las yeguas elegidas, adems de tener un tipo aceptable, deben pertenecer a lneas o familias
femeninas de buena calidad, en las que haya figurado el mayor nmero posible de animales
dotados (progenies, descendencia) de una conformacin convenientes.

Pero, la verdadera apreciacin de la calidad de un animal como reproductor reside, claro est, en
su capacidad para transmitir sus buenas cualidades. Esta capacidad se aprecia mediante la
comprobacin del rendimiento de la descendencia.

Al seleccionar yeguas de vientre, debe tenerse en cuenta, de un modo especial, la capacidad de


producir cras durante un largo nmero de aos (fecundidad y longevidad), la mejor manera de
juzgar tal capacidad es el estudio de la genealoga completa del individuo (antecesores directos y
colaterales), es decir, las hembras deben seleccionarse exclusivamente en familias de gran
fertilidad.

Finalmente, al seleccionar yeguas o potros debe prestarse mucha atencin a los caracteres que
definen la feminidad del animal, esto es, lo que suele llamarse la calidad de la hembra, que se
manifiesta en la finura del esqueleto (variable, como es lgico de un tipo de caballo a otro) y la
finura de la piel y el pelo, unidas a cierta vivacidad e inteligencia y a una cierta nobleza; toda yegua
debe exhibir un equilibrio general de lneas, con la parte media del cuerpo fuerte y una amplia
anchura de caderas y de grupa, as como poseer una ubre bien desarrollada y conformada.

Las caractersticas pobres o mal definidas, o las que se deban mejorar sern los puntos que se
buscar adicionar, y que debern ser aportados por el semental con miras a lograr en el producto,
la mayora de caractersticas aceptables, a fin de que el individuo resulte con un fenotipo acorde a
la raza y al tipo producto de la cruza, adems que mantenga en su genotipo, los genes necesarios
para la expresin y transmisin de dichos caracteres.

Seleccin del semental o padrillo.

156
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Lo ms conveniente, cuando se trata de obtener un semental, es adquirir o alquilar para el salto


(monta controlada), un animal que haya demostrado ya su capacidad como reproductor y
transmisor del tipo y rendimiento deseados, es decir, un caballo de calidad probada. Adems, el
animal deber poseer un registro sanitario en el que se pueda constatar que el mismo se
encuentra libre de enfermedades infecciosas de transmisin directa, especialmente aquellas de
ndole reproductiva, para este efecto es til la asesora de un Mdico Veterinario con suficiente
experiencia en la materia.

Desafortunadamente, estos animales no son siempre fciles de conseguir; por tanto la mayora de
caballistas tratan de rotar sus padrotes o alquilarlos, pero a un costo elevado no siempre fcil de
cubrir.

El macho elegido debe ser sano, poseer el tipo y la aptitud deseados y pertenecer a una familia de
fertilidad conocida. Debe preferirse el hijo de un semental de calidad probada cuya descendencia
haya sido, en su mayor parte, de buena calidad, tambin debe procurarse que la madre sea hija de
un semental de calidad comprobada y haya demostrado su capacidad para transmitir buenas
cualidades a sus descendientes. Hay que reconocer que los animales que renen las anteriores
condiciones son escasos, pues no se dispone casi siempre de registros completos; pero, a medida
que la exigencia de stos vaya en aumento todos los caballistas tendrn que disponer de ellos
facilitando el mejoramiento de la especie. Es preciso, que el macho exhiba caracteres propios de
masculinidad, convenientemente acusados. El macho debe ser un poco ms macizo que la
hembra, de esqueleto ms fuerte que ella y con el pecho y el cuarto anterior bien desarrollados.
Debe mostrar temperamento y masculinidad, pero de un tipo tal que pueda ser dominado en la
doma para que el animal resulte dcil.

http://www.mundodecaballos.com

Los principios que rigen la herencia en los caballos son anlogos a los que presiden sta en otras
especies. Un caballo es el producto de sus genes y del medio en que se desarrolla, pero el medio,
en la forma de ejercicio dirigido desempea un papel mucho ms importante que en cualquier otra
especie, adems es importante una adecuada alimentacin. En el caballo se necesita tambin,
ms que en ninguna otra especie, un equilibrio adecuado-entre las diversas partes del cuerpo y
entre la constitucin fsica y mental.

La seleccin de los caballos ms veloces cre gradualmente el tipo de caballos de carrera; la


seleccin basada en la energa cre poco a poco el caballo de tiro pesado. Los tipos de caballos
de carrera y de silla estn hoy establecidos de un modo fundamental. La labor futura con estos
tipos se orientar hacia un mayor rendimiento, para mejorar su velocidad, simetra, equilibrio,
capacidad y conducta.

La calidad de la descendencia los har cada vez ms homocigoticos para los caracteres
favorables.

157
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Eficiencia reproductiva
Para que el caballista pueda tener una idea clara de la eficiencia reproductora de sus caballos
sementales y de los lotes de yeguas de vientre debe llevar cuidadosos registros de los perodos de
celo de stas ltimas, del nmero de montas necesarias para que conciba cada una, del porcentaje
de yeguas preadas por cada semental, del peso de los potros al nacer, de la duracin de las
gestaciones, etc.

El manejo correcto de la eficiencia reproductiva favorece en grado sumo la seleccin de los


animales que con mayor seguridad brindarn beneficios en los programas de cra, y proporcionar
elementos de juicio ms slidos en cuanto al manejo de la explotacin en si.

MEJORAMIENTO

Los sistemas de reproduccin y seleccin son los nicos instrumentos con que cuenta el
propietario para mejorar sus animales, puesto que no podemos crear nuevos genes, sino
solamente partir de los que existen para agruparlos en formas ms ventajosas.

Cada raza equina, tal y como est constituida, posee como capital gentico el conjunto de genes
que existen en los distintos miembros vivos que la forman. Cada raza posee un cierto nmero de
genes buenos y un cierto nmero de genes malos. Si se puede hacer crecer el nmero de genes
buenos a expensas de los genes malos (dado que el nmero de cromosomas quienes portan los
genes es invariable para la especie) la raza mejorar. Si por desgracia ocurre lo contrario, la raza
ir degenerando.

Una raza no puede por s sola, obtener nuevos genes. No puede esperar un progreso rpido de la
aparicin natural de mutaciones (cambios) gnicas favorables, y no se conoce hasta hoy ningn
mtodo de crear mutaciones tiles por medios artificiales. El progreso de las razas, depende por lo
tanto, del aumento relativo en la frecuencia de los genes ms favorables y posiblemente de su
recombinacin en agrupaciones ms convenientes (mediante las cuales se pueden expresar
caractersticas superiores). Tambin pueden crearse nuevas razas cuando sea conveniente o
necesario, mediante la combinacin de caracteres que existan en razas distintas por mtodos de
cruzamiento selectivo seguido de la cra consangunea.

La seleccin y los mtodos de reproduccin pueden emplearse para influir sobre la frecuencia de
determinados genes, y son los nicos medios de que dispone el caballista para tal fin constituyen
esto el arte de la mejora.

158
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

http://www.mundodecaballos.com

Los sistemas de reproduccin pueden agruparse en dos clases: cruzamiento y consanguinidad; el


cruzamiento es el apareamiento de animales no emparentados, la consanguinidad el apareamiento
de animales emparentados.

Para establecer en forma prctica el lmite claro en la definicin del parentesco, diremos que si dos
animales de sexo contrario no tienen ningn antepasado en cuatro o cinco generaciones
anteriores, no estn emparentados y su descendencia ser cruzada. En cambio, si el macho y la
hembra tienen antepasados prximos comunes, su descendencia ser consangunea.

Heterosis.
Se ha observado desde hace mucho tiempo que el apareamiento de animales no emparentados
suele dar origen a descendencias de mayor vigor. Este fenmeno se conoce con los nombres de
Heterosis o Vigor Hbrido, la explicacin de este hecho, se debe a que las especies y las razas
poseen grupos algo distintos de genes favorables (dominantes) y todas ellas poseen algunos
genes desfavorables (recesivos). Cuando se cruzan dos especies o dos razas, un progenitor puede
aportar un gene dominante que oculte un gen recesivo desfavorable aportado por el otro progenitor
y viceversa. El descendiente, por lo tanto, tiene mayor nmero de genes dominantes que
cualquiera de sus progenitores, y es probable que sea ms vigoroso.

Sin embargo, como los animales hbridos o cruzados son ms heterocigticos, no pueden
esperarse que transmitan sus caracteres tan uniformemente como los animales de raza pura.

Hibridacin

El tipo de cruzamiento en que los progenitores estn ms alejados, es el apareamiento de


individuos pertenecientes a dos especies distintas y un buen ejemplo de ella es el apareamiento de
las especies caballar y asnal para producir un mular. Parece probable que el caballo y el asno
tengan un antepasado comn en un pasado lejano. La seleccin natural, basndose en la variacin
empez a separarlos en especies distintas; las divergencias progresaron tanto que en la actualidad
el caballo y el asno son especies distintas. Todava tienen muchos genes en comn, pero poseen
tambin suficientes genes distintos para que se les considere como especies diferentes. Sin
embargo, hasta ahora sus diferencias genticas, aunque suficientes para clasificarlos como
especies distintas, no son lo bastante grandes para impedir que los vulos de una sean
fecundados por los1espermatozoides de otra; de esta unin nacen los mulos, de estos
descendientes, los machos son siempre estriles y las hembras lo son en la gran mayora de los
casos.

Es indudable, que la naturaleza ha usado la hibridacin para producir nuevas especies. Ni la


hibridacin, ni ninguna otra forma de reproduccin, puedo producir nuevos genes, lo nico que
hace cualquier sistema de reproduccin es reagrupar en nuevas combinaciones los genes
existentes.

Hbridos comerciales

159
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.folkloredelnorte.com.ar

El mayor hbrido conocido en la actualidad, es el mulo, que es hijo del asno y de la yegua, cruza
muy apreciada en nuestro pas, y sobre cuyos lomos se transport gran parte del desarrollo
antioqueo. Se han registrado algunos casos de mulas frtiles, pero nunca se pudo prolongar
estas lneas genticas. La mula se acerca ms al asno que el burdgano o macho romo quien se
acerca ms al caballo en sus caracteres generales, este ltimo, es hijo de la burra y el caballo; el
burdgano ha gozado de muy poca aceptacin.

El cebroide, hbrido de la cebra y el caballo, es bastante popular en frica, no as en nuestro


medio, y slo, lo registramos como conocimiento complementario, este hbrido es dcil en grado
sumo y resistente al calor y a las enfermedades.

http://www.phpwebquest.org/wq25/webquest/soporte_tablon_w.php?id_actividad=18773&id_pagina=1

En la mayora de estos programas se buscan tres aspectos fundamentales:


Mantener las caractersticas de pureza (homocigosis) para el fenotipo de la raza.

Mejorar el vigor (heterosis) para aumentar la resistencia del individuo al medio.

Crear hbridos (hibridacin) por sus especiales caractersticas de fortaleza y rendimiento.

Pero sobre todos los conceptos, los cruces deben ser rentables, estarn enfocados a satisfacer el
mercado y el tipo de ejemplar equino que ms demanda tenga segn la regin en que el productor
se encuentre ubicado.

Cruzamiento para la creacin de nuevas razas.

160
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Para la creacin de nuevas razas, se ha empleado el cruzamiento, seguido de seleccin en la


descendencia y de cruzas consanguneas.

En lo que se refiere a la creacin de nuevas razas hay que tener en cuenta dos hechos. Uno es
que si dos criadores parten de dos razas A y B para cruzarlas y obtener una nueva raza C,
llegando as a resultados diferentes, como ninguna de nuestras razas es completamente
homocigtica, ambos mejoradores iniciaron con seguridad su trabajo con diferente material
gentico. Adems, la distribucin al azar del material hereditario y los diferentes ideales que se
haya forjado cada uno, conducirn generalmente a dos formas distintas de la nueva raza, que ser
llamada C, integrada con genes diferentes y, por tanto, dotada de caracteres y capacidades
productivas muy distintas.

El segundo punto respecto a la formacin de nuevas razas, es el tiempo empleado para ello. No
existe un criterio fijo para determinar si hacen falta seis generaciones 16 60 para llegar a decir
que el resultado del cruzamiento y de la seleccin posterior amerita considerarse como una raza
pura.

Muchas de las llamadas razas nuevas presentan todava una gran variacin despus de 25 30
aos de cuidadosa seleccin, y hasta las ms antiguas de nuestras razas puras son todava
relativamente heterocigticas.

Consanguinidad.

Los mtodos de reproduccin que se han estudiado en los anteriores encisos (Heterosis,
Hibridacin, cruzamientos), suponen el apareamiento de animales no emparentados, que no
pertenecen a la misma raza; es decir, suponen la reunin de porciones de germoplasma (genes)
muy diferentes; tambin puede practicarse el cruzamiento entre animales pertenecientes a la
misma raza y con relacin de parentesco en las ltimas tres a cuatro generaciones.

Si se cruzan animales emparentados, que posean uno o ms antecesores comunes en las ltimas
cuatro o seis generaciones y que, por lo tanto, tienen en comn probablemente un nmero de
genes mayor que el de genes comunes en dos animales no emparentados, se llega a la
consanguinidad.

Existen diversas opiniones respecto a la prctica de la consanguinidad. En general, tiene mala


reputacin porque se cree que conduce a degeneracin de la descendencia. Mas adelante
abordaremos este tema un poco mas a fondo con el objeto de aclarar dudas y desarrollar nuevos
conceptos.

EL CABALLO TIL EN NUESTRO MEDIO

En nuestro medio, con excepcin hecha de algunos yeguerizos de lujo, explotados principalmente
con el nimo de obtener caballos de salto, carreras, o para el deporte ecuestre denominado polo,
y otros que seleccionan el caballo de paso fino; la cra de caballos es limitada y ocupa un lugar
secundario en las actividades ganaderas. En la mayora de fincas en las zonas ganaderas (costa,
llanos orientales) producen animales destinados a los servicios de vaquera y se practica la
hibridacin a fin de obtener productos (mulas) destinadas a silla o carga.
Dado las condiciones de manejo extensivo de nuestras ganaderas, el caballo de vaquera, rpido,
resistente y fuerte seguir teniendo gran mercado, adems que ser un elemento imprescindible
en dicha actividad, es as como nuestros esfuerzos de mejoramiento y seleccin debern estar
encaminados a ste tipo de equino.

161
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

La produccin de mulas sigue siendo importante, tanto por la topografa de nuestras zonas de
ladera, como por las caractersticas socioeconmicas de sus habitantes, para quienes ste hbrido
es elemento de transporte, carga y de tiro; por tanto su produccin tendr mercado asegurado en
los prximos aos.

El descubrimiento del ADN Mitocondrial (ADNmt) ha sido uno de los hallazgos ms relevantes
sucedidos en la historia reciente de la gentica. Mediante su estudio, los cientficos han sido
capaces de rastrear el origen de los seres vivos hasta sus primeros ancestros, viajando millones
de aos en el pasado. Como ha sucedido en otras oportunidades, estos avances cientficos
trascienden y son aplicables a otras disciplinas. En el caso especfico de la industria equina el
descubrimiento de estos genes de origen mitocondrial ha cobrado importancia por la influencia que
los mismos parecieran tener sobre la transmisin de caracteres que estn ntimamente ligados al
performance o a la capacidad atltica. De igual forma, se han hecho observaciones importantes
que han permitido conocer ms sobre los orgenes de los equinos, sugiriendo correcciones en la
informacin o base de datos hasta ahora incuestionables que manejan los registros genealgicos
(Stud Book) a nivel mundial. Su descubrimientos tambin ha tenido especial importancia al darle un
soporte cientfico a algunas de las teoras utilizadas para establecer cruces, las cuales hasta
ahora haban gozado de popularidad solo gracias a la observacin que en su momento hizo algn
entusiasta analista de pedigres.

El pelaje, la forma y el tamao del cuerpo, la libido, la precocidad, la velocidad, el carcter, etc.,
son caractersticas cuya presencia o manifestacin en un caballo estn regidas por la informacin
contenida en los genes. Estos genes que constituirn el patrn o molde para la formacin de un
nuevo ser, provienen del material gentico aportado por el ncleo de las clulas sexuales, es decir
vulo y espermatozoide provenientes de la madre y del padre respectivamente, que luego de
unirse al momento de la fecundacin darn origen a un nuevo individuo. En pocas palabras, ambos
padres transmiten a su descendencia genes especficos para contribuir con la apariencia y virtudes
del nuevo ser. Sin embargo, el descubrimiento del ADNmt implica la transmisin de un material
gentico que pasa a la descendencia sin estar sujeto a cambio y que es exclusivamente de origen
materno, lo que indica que una parte de la herencia o ciertas caractersticas de un ser vivo son
solamente producto de la influencia gentica materna.

TIPIFICACION DEL ADN O GENOTIFICACION.

Este examen consiste en realizar una comparacin gentica del DNA, en la raz de la crin de los
caballos que nos permite obtener un archivo permanente de los marcadores genticos de un
ejemplar y hacer la verificacin de parentesco de un equino con sus respectivos padres.

La tecnologa inicial de la tipificacin sangunea se hizo obsoleta, sus reactivos comenzaron a


dejar de producirse y fue superada por una nueva tecnologa, ms simple, certera y barata. Esta
tecnologa fue la genotipificacion de ADN a partir del pelo y bulbo capilar.

La Tipificacin Sangunea ha sido reemplazada a nivel internacional por las Tcnicas de ADN por:

Mayor eficiencia (hasta el 99.99%) analizando el tro: producto, padre y madre Versatilidad en
el Tipo de Muestras a Analizar (pelo, sangre, semen, orina,
huesos, dientes, etc.).
Cumplimiento de Requisitos Internacionales para Importacin y Exportacin de Animales,
semen y embriones.

162
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Estandarizacin de los Resultados segn Organismos Internacionales (ISAG, ISBC).

Tomar una muestra de cabello es sencillo, permite el muestreo de un gran nmero de sujetos en
menor tiempo, con un mnimo de afliccin causada. Sin embargo extraer un cabello (junto con el
bulbo capilar) puede ser doloroso en algunas situaciones.

INSTRUCCIONES PARA LA EXTRACCIN DE PELO PARA EL ANLISIS DE ADN.

La extraccin de la muestra deber ser realizada por personal tcnico responsable,


siguiendo las siguientes instrucciones:

1. Identificar correctamente al animal en base a la ficha filiatoria.

2. Lavar las manos con agua y jabn.

3. Limpiar el peine o rasqueta para eliminar de los mismos pelos u otros residuos si se va a sacar
muestras de varios animales, esta operacin deber repetirla con cada animal.

4. Pasar el peine o rasqueta por la crin o por la cola del animal segn elija una u otra para la
toma de muestra- a fin de eliminar residuos que puedan contaminar la muestra a extraer.

5. Separe un mechn de aproximadamente 30 a 40 pelos del nacimiento de la crin o del


nacimiento de la cola del animal, enrllelo en el dedo ndice y tire firmemente del mismo hasta
arrancarlo de raz, verificando la presencia de los bulbos pilosos imprescindibles para el anlisis de
ADN.

6. Coloque el mechn de pelo extrado en el sobre, completando los datos requeridos.


Cierre el sobre utilizando el adhesivo.

7. Ante cualquier duda comunquese con el laboratorio.

Y por ltimo pero no de menor importancia, se debe tener en cuenta estos consejos para
garantizar la veracidad de los resultados.
E mechn de pelo no debe cortarse sino arrancarse desde la raz Evite la mezcla
de pelos de diferentes animales.
La cantidad de pelo enviada no deber ser menor a la cantidad solicitada y el mismo
deber encontrarse limpio y seco.

Histricamente los criterios de identificacin fueron caractersticas externas de ndole fenotpica (lo
que se expresa, lo que se ve). Si bien el criador a los pocos das de nacido el potrillo crea una ficha
individual, siempre surgen inconvenientes pues muchas de las caractersticas externas anotadas
pueden desaparecer y aparecer nuevas, con lo cual es esta una identificacin poco confiable. La
aplicacin de los grupos sanguneos, si bien tiene mas precisin e inmutabilidad que los registros
antes mencionados, requiere de muestras de sangre del animal para su elaboracin y solo permite
obtener una identificacin final, incierta sobre todo cuando se quiere incluir la paternidad lo cual
obliga agregar numerosos marcadores bioqumicos como enzimas, protenas etc. y aun as la
posibilidad de incluir una paternidad tiene margen de error.

La confiabilidad es del 99.99 % En los test de paternidad los marcadores genticos que se
seleccionan se heredan de a pares, unos provienen de la madre y otros del padre. A partir de este
principio es posible poder determinar con una certeza casi absoluta quienes son los padres
biolgicos del animal investigado.

163
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Estos estudios se basan en la presencia de variaciones gnicas (marcadores) propias de cada


caballo llamados STRs (Short Tandem Repeats) Se estudian entre 9 a 12 de estos marcadores
distribuidos al azar a lo largo de todo el ADN. Los mismos tienen entre 5-12 variantes reconocidas.
Estas variantes se hallan asignadas por letras y nmeros y estn aceptadas en la nomenclatura
internacional. Por ej. AHT4, AHT5, HMS3 etc. Estos marcadores se heredan segn los principios
genticos Mendelianos. La identificacin de los mismos otorga un altsimo nivel de precisin para
la identificacin de los caballos analizados. Esto se debe a que es altamente improbable que en la
poblacin mundial equina existan dos caballos con la misma combinacin de estos 9 o 12
marcadores. El anlisis compara el patrn de picos presentes en el hijo con los patrones de picos
presentes en los presuntos padres. Si se tratara de un estudio de paternidad con un presunto
padre, el patrn de picos de este debe coincidir en un 50 % con el del hijo en estudio, de ser as
estaremos frente a una probabilidad de paternidad del 99, 99 %. Si el caso fuese que el patrn de
picos NO COINCIDE con el 50 % del hijo estaremos frente a una EXCLUSIN y una probabilidad
de paternidad del 0,00%.

Como lo mencionamos anteriormente el estudio se puede realizar a partir de unos pelos o crines
ARRANCADOS (no cortados), con presencia del bulbo piloso, siendo este el mas utilizado en la
actualidad por nuestros criadores o en muestras de sangre, semen, biopsias de tejidos, huesos
dientes etc.

Existen otros estudios genticos adems de las pruebas de ADN, se puede realizar el cariotipo o
mapa cromosmico. Normalmente el nmero de cromosomas en el caballo es de 64. Las
anormalidades de los mismos pueden ocasionar detencin de la preez, o eventualmente luego de
los nacimientos aparicin de malformaciones, alteraciones en el crecimiento o futuros trastornos en
la reproduccin. Estos anlisis pueden ahorrar a los criadores tiempo y dinero en relacin a la cra
de animales defectuosos. Un ejemplo es la anomala cromosmica denominada XO que puede
hallarse en el cariotipo de yeguas estriles con tamao pequeo y con ovarios inactivos. Este
sndrome se ha diagnosticado en yeguas pura sangre, rabe, potro Gales, belga y otros.

Para la realizacin de estos estudios es necesario personal especializado en tcnicas de ADN as


como de la interpretacin de los resultados obtenidos. Estos estudios requieren de equipamiento
especializado que incluye termocicladores para la amplificacin gnica y secuenciadores
automticos.

Ventajas generales de las pruebas de ADN.

1) Mayor poder de exclusin e inclusin de la paternidad que la que otorgan los mtodos
convencionales. (Superior a un 99.9%). Como los animales relacionados comparten numerosos
aleles la prueba del ADN es el mtodo mas poderoso y confiable para distinguir entre diversos
animales.

2) Posibilidad de mejorar las cruzas al identificar correctamente a los animales.

3) Simplicidad en la obtencin de las muestras para realizar estos estudios del ADN.

4) Seguridad del material gentico comprado en la adquisicin de un ejemplar para la cra.

5) Los marcadores de ADN tienen la ventaja de que se puede obtener resultados a partir de
muestras muy pequeas y muy fciles de extraer.

6) Este sistema no genera indeterminaciones porque se accede directamente al genotipo de los


individuos y, por tanto, no se ve afectado por las relaciones de dominancia ni por las variaciones de

164
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

penetrancia o expresividad.

7) El ADN no cambia con el tiempo.

8) No hay posibilidad de que dos individuos tengan el mismo perfil en la prueba de ADN.

Ventajas especificas de acuerdo a la prueba de ADN practicada.

Ventajas de la muestra de pelo (material no perecedero):

El criador no necesita solicitar turno ni tubos al laboratorio (menor costo).


No necesita la intervencin de un profesional para la extraccin de la muestra (menor costo).

Se pueden enviar por correo normal (menor costo).

Puede extraer muestras de pelo de sus animales, guardarlas en su establecimiento remitirlas


al laboratorio para almacenar en el Banco de muestras y ser analizadas, de ser necesario, en el
futuro.

Ventajas de la Tipificacin del ADN sobre semen:

Analizando una dosis de semen podr verificar si la pajilla corresponde al animal del cual
supuestamente proviene, siempre y cuando el reproductor posea anlisis de ADN registrado.
Permite determinar el perfil de ADN en animales muertos con existencia de semen.

Ventaja de la Tipificacin del ADN sobre muestras de suero (Equinos).

1- Cuando se cuenta con muestras de suero de la mayora de los ejemplares equinos


analizados por Tip.Sangunea en su Laboratorio, sobre las que es factible extraer y analizar
el ADN, permitiendo determinar el perfil, an en casos de reproductores muertos. Si bien el
suero no es la muestra ideal para analizar por la escasa cantidad de clulas que contiene,
es otro tipo de muestra a la cual se puede recurrir para los casos de animales muertos.

Teniendo en cuenta lo antes explicado, es de gran importancia para los aficionados y criadores de
caballos conocer algunos de los avances en gentica equina que estn marcando pautas en la
seleccin y mejora de tan noble especie, para ello se resaltaran los siguientes artculos que han
sido tomados de la revista de la Federacin Nacional Colombiana de Asociaciones Equinas
FEDEQUINAS.

INBREEDING

La seleccin y cra por este mtodo puede ser un instrumento mediante el cual los criadores
obtengan equinos cuyos cromosomas contengan genes similares, es decir, animales que
genticamente sean muy parecidos. Si todo criador de caballos tiene en su pensamiento un ideal
bien definido y se atiene a l al seleccionar sus animales puede lograr progresos notables, sobre
todo si utiliza la consanguinidad como recurso para fijar un material hereditario prepotente.

En el mundo de los caballos los cientficos han dividido la consanguinidad en dos tipos:

165
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

consanguinidad estrecha (closebreeding) que es el apareamiento de animales con parentesco


cercanos como padre con hija, hijo con madre, y hermanos completos. En cambio la
consanguinidad lateral (linebreeding) es el apareamiento de animales con parentesco mas lejanos,
como abuelo con nieta, to con sobrina, hermanos medios y primos entre s.

Closebreeding o Consanguinidad estrecha:

Este tipo de cruzamientos se efecta raramente en la actualidad, ya que la experiencia ha indicado


que tiene como resultado un menor vigor hbrido en los animales producidos, existen factores en
pro y en contra.

Razones en pro:

1. Aumento del grado de pureza de los animales.


2. Permite una eliminacin selectiva rgida, ya que es un mtodo selectivo seguro y rpido para
fijar y perpetuar un carcter o grupo de caracteres.
3. Tiende en el futuro a formar lneas o grupos de animales uniformes en conformacin.
4. Genera animales con una prepotencia muy acentuada, es decir, equinos transmisores de
genes muy especficos.

Razones en contra:

1. Aumenta las probabilidades de que aparezcan caracteres recesivos, incluso afectados por
factores degenerativos como lo es la disminucin del tamao, de la fertilidad y del vigor en
general.
2. Al haber un alto grado de selectividad se necesita de una enorme capacidad de capital de
trabajo para poder soportar durante un largo periodo de tiempo esta seleccin.
3. No debe ser practicado con animales mediocres o inferiores al trmino
medio, ya que los productos presentaran una elevada proporcin de caracteres indeseados.
4.

Linebreeding Consanguinidad lateral.

Es considerada fundamental para lograr animales excepcionales, ya que se tiende a mantener una
descendencia emparentada, con algn antecesor muy destacado y el cual tiene caracteres de
calidad superior.

Razones en pro:

Es un tipo de programa ms prudente y seguro, el cual puede ser encarado tanto por grandes
como por medianos y pequeos criadores.

2. Se tiene un grado ms elevado de caracteres deseables que indeseables.

3. Se realiza mejor mediante el cruce con un semental sobresaliente que con una yegua de
mrito, a causa de la mayor cantidad de descendientes del primero.

4. Permite recurrir a cruces externos, sangre de otros sementales o de otras yeguas para
corregir los defectos comunes.

5. Permite al propietario de uno o varias yeguas de calidad superior, cruzarlas con padrillos de

166
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

criaderos dedicados al linebreeding y que tengan caractersticas bien definidas.

Razones en contra:

1. Igual que en el cruce por consanguinidad estrecha, la consanguinidad lateral no debe ser
practicada con animales de calidad mediana, ya que en estos animales, hay una
preponderancia a acentuar caracteres desfavorables.

Como vemos en principio, debemos manifestar que no existe un mtodo de reproduccin equina
que sea nico y mejor para todas y cada una de las circunstancias. Cada programa de cra es un
caso particular que requiere un pormenorizado y cuidadoso estudio. La eleccin del mtodo
depende principalmente del tamao y calidad de la manada, del aspecto financiero, de la habilidad
del administrador y especialmente del objetivo previsto por su propietario.

TENDENCIA DE TRANSMISIN DEL COLOR DEL PELAJE A LA


DESCENDENCIA.

Diversos conceptos han surgido a travs de los tiempos respecto a la transmisin del color en los
caballos criollos colombianos. La creencia generalmente concepta que el color se transmite
directamente de padres a hijos. Sin embargo, los estudios genticos realizados hasta el momento,
amparados en los conceptos de la heredabilidad y transmisin de caracteres demuestran que
existen diferentes frmulas genticas que condiciona la expresin fenotpica del color del pelaje
dependiendo de su composicin y de la dominancia y recesividad de los genes que la conforman.

Determinacin de las Capas o Pelajes:

Se entiende por capas o pelaje no solamente al conjunto de pelos que cubren el cuerpo del animal
sino las caractersticas que estos presentan en cuanto a su calidad, naturaleza, mayor o menor
abundancia (densidad), disposicin, desarrollo, ondulacin y especialmente su coloracin, as
como la forma en la que estos se hallan dispuestos.

El color de la piel (dermis) y mucosas en el caballo corresponde a la manifestacin externa de los


llamados melanocitos, clulas epiteliales en forma de grnulos un poco mviles, se encuentran en
la capa profunda de la epidermis (sub.-dermis), en el iris y algunos rganos internos siendo las
encargadas de dar origen a los tonos o colores, produciendo bsicamente dos tipos de melanina:
Eumelanina (negro) y Feomelanina (marrn). Dependiendo de la mayor o menor cantidad de una
de las dos, da tonos claros u oscuros.

Los melanocitos son clulas embriolgicamente de origen nervioso. Los pelos son formaciones
filamentosas, diferentes segn la especie animal y la regin corporal considerada empotradas en la
sub.-dermis. En el extremo proximal (raz) del pelo se halla el bulbo piloso, a partir del cual el pelo
se desarrolla, se nutre y regenera. La mayor parte del pelo consta de clulas crneas.

El reconocimiento del color del pelaje es de suma importancia para determinar el grado de pureza
de la mayor parte de las razas. Hay que tener en cuenta que ciertos factores o causas pueden
modificar el color o tono de los pelajes, tales como la edad del animal. Al nacer el potro se halla
cubierto por una especie de lanosidad que generalmente desaparece entre los 5 8 meses siendo
entonces remplazada por una capa estable de color diferente al pelo original. La cabeza, sin
embargo, puede ser un punto del exterior del animal que proporciona algn indicio del color

167
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

definitivo que presentar en lo sucesivo el cuerpo del ejemplar.

El color del pelaje en nuestro medio si tiene influencia en cuanto a la comercializacin y posible
utilizacin y mritos de determinado equino; en ocasiones con algunas razones vlidas como por
ejemplo el factor careto y los calzados de los remos, o la adaptacin o aclimatacin a determinados
pisos trmicos (colores claros vs. colores oscuros).

Prediccin del Color de la Capa en Caballos.

Es posible conocer la coloracin de la capa que tendr un potro? La respuesta es afirmativa para
las coloraciones bsicas ms importantes.

La naturaleza de la coloracin de las capas es conocida desde hace muchos aos, aunque los
genes concretos que intervienen y su modo de accin es algo que corresponde a la era de la
gentica molecular. Los genes que intervienen se pueden agrupar en dos categoras: la primera
sera de aquellos que actan sobre el desarrollo, diferenciacin, proliferacin o migracin de los
melanocitos y la segunda incluira genes que actan sobre la sntesis de melanina.

Los sistemas genticos ms importantes en las coloraciones bsicas del caballo pueden ser
agrupados segn muestra la tabla 19.

Tabla 19. Genotipos y fenotipos de las distintas capas equinas.

Genotipos y Fenotipos de las distintas capas equinas

Frmulas Genticas Color de la Capa

W Blanco
G Moro
Rn Ruano
E, A, CC, dd, gg, ww, pp Castao
E, aa, CC, dd, gg, ww, pp Negro
Ee, CCcr, dd, gg, ww, pp Isabela
Ee, CC, dd, gg, ww, pp Alazn
E, A, CCcr, dd, gg, ww, pp Bayo
E, aa, CC, D, gg, ww, pp Ratonero o cisne
ee, CC, D, gg, ww, pp. Cervuno

Genes Responsables de la Coloracin Bsica:

La interaccin entre los genes de cinco loci (los genes C, B, A, E y D) determina la mayora de los
colores principales del caballo. Otros loci enmascaran, manchan o transforman en moros o ruanos
esos colores.

El gen Extensin (Ee): Responsable de las coloraciones negras y alazanas en combinacin con el
Agut que condiciona la expresin de la eumelanina originando las capas castaas.
El gen Extensin es el MCIR (Receptor de la melanocortina), la variante E se diferencia de la
variante e por una mutacin que da lugar al cambio de un nico aminocido, la serina pasa a ser
una fenilalanina. Este cambio puntual transforma un receptor sobreactivo (E) responsable de la
pigmentacin negra en un receptor no funcional (e) no responsable de la coloracin rojiza
El gen Extensin es dominante porque la presencia de una de sus variantes, la denominada E,

168
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

productora de la eumelanina, y por lo tanto del pigmento negro, impide que se exprese la otra
variante denominada e, productora de feonomelanina y por lo tanto de la coloracin roja. Para que
el animal pueda presentar la capa negra o, al menos, extremos y cabos negros, es necesario que
el caballo sea portador de una dosis de la variante E del gen Extensin. Si el caballo es portador
de dos dosis de la otra variante del gen, es decir, ee, el caballo presentar una capa alazana,
independientemente de la composicin que tenga el gen Agut.

El gen Agut (Aa): Resulta ser un sistema dominante en el que una de las variantes, la denominada
A, permite a un animal portador de al menos una variante E que la pigmentacin negra aparezca
solo en los extremos y cabos dando lugar a la capa castaa. Sin embargo, la otra variante,
denominada a, que se comporta como presente en doble dosis, aa, origina la capa negra siempre
que en el gen Extensin exista al menos una variante E.
Del gen Agut tambin se tiene el conocimiento molecular de los cambios que se producen en la
cadena de ADN y que dan lugar a las dos variantes del gen. El gen responsable se denomina ASIP
(Agut Signalling Protein) y la variante recesiva (a) se diferencia de la (A) porque le faltan 11
nucletidos.

Genes que provocan la dilucin del color:


El gen Cream (C). El gen Dun (D)
Genes responsables de las capas pintas:
El gen Tobiano (TO)

Genes modificadores.

Son genes que enmascaran el efecto de otros genes implicados. Estos genes con efectos
relativamente pequeos determinan muchas de las variaciones que experimentan los colores
bsicos. La acumulacin de estos genes modificadores menos importantes puede producir que
algunos genotipos diferentes posean la misma apariencia.

El gen White (Ww): W se refiere a una variante del gen y w a la otra; genes responsables del color
blanco puro.

El gen Grey (Gg): Responsable del color moro. Este gen tiene un comportamiento dominante, es
decir, la variante del gen que da lugar a la capa mora, simbolizada por la letra G, domina sobre la
variante del gen que no da lugar a la capa mora. Adems este gen enmascara la accin del resto
de los genes Extensin o Agut, de tal manera que la variante G impide que se manifieste la accin
de esos genes. En gentica esta accin de interaccin de un gen sobre otro u otros recibe el
nombre de efecto episttico.

Cuando un animal es portador de la variante G, independientemente de cual sea la otra variable de


que es portador, presentar la capa caracterstica Moro, esta es la caracterstica denominada
dominancia. Slo los animales portadores de las dos dosis de la variante g no sern moros y
podrn, por lo tanto, expresar la composicin gentica que lleve en los otros genes, el Extensin y
el Agut.

Cualquier caballo que en el gen Grey sea portador nicamente de la variante g podr expresar la
capa negra, alazana o castaa de la que son responsables, por un lado el gen denominado
Extensin (E) modulado por el gen Agut.

El gen Rn: Responsable del color Ruano. Todos estos genes modificadores son mucho ms
fuertes que los bsicos, puesto que dominan sobre el fenotipo. Sin embargo es desconocido lo que
ocurre genticamente cuando compiten para definir color ms de un gen modificador.

A partir de una pequea muestra de sangre o pelos se conocen las variantes genticas de que es

169
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

portador un caballo, lo cual puede resultar de gran utilidad para combinar adecuadamente los
apareamientos con el fin de maximizar las probabilidades de obtener el potro con la capa deseada.

APLICACIONES DE LA GENETICA MOLECULAR A LA INDUSTRIA EQUINA

Aspectos Bsicos de Gentica.


Cada individuo tiene las instrucciones para su funcionamiento en unas unidades llamadas genes,
desde las bacterias hasta el hombre, por ahora no es posible ver los genes directamente, pero si
se puede reconocer su presencia gracias a su funcionamiento (fenotipo) y adems, en muchas
ocasiones podemos medirlo.

Los organismos estn compuestos por clulas y cada clula tiene dos genes, de los cuales, de los
cuales uno es derivado del padre y el otro de la madre, como se explico anteriormente, cada uno
de los cuales tiene informacin similar en la relacin con la caracterstica que codifican, pero no
necesariamente idntica. Es as como cada gen puede tener la informacin para la existencia de
pelo y uno lo puede tener liso y el otro gen rugoso, entonces podemos hablar que en cada gen
existen por lo menos dos alelos, cuando estos son iguales se dice que el animal es homocigoto,
cuando son diferentes heterocigoto.

En el caso de los 7 genes para el color de los equinos, es necesario recordar que cada animal
posee dos alelos, uno de los ejemplos ms interesantes tiene que ver con el color del pelaje, cuya
expresin es el resultado de la interaccin de 7 genes, las diferencias observadas son encontradas
por personas entrenadas para la observacin, para muchos de los alelos uno no puede saber
mediante la observacin del animal si es o no homocigoto para la presentacin de un color.

Los genes Estonia localizados en los cromosomas del ncleo celular, son visibles solamente en la
metafase de la mitosis, gracias a ello podemos saber con certeza dnde estn los genes en los
cuales tenemos inters. Estos cromosomas estn compuestos de cido desoxirribonucleico (ADN)
que es la molcula universal de la herencia, ste a su vez est compuesto por nucletidos que
tienen como identidad la base nitrogenada que los compone. As pues el material gentico de un
individuo es la sucesin de Guanina (G), Citosina (C), Timina (T), Adenina (A). Devolvindonos, los
cromosomas tienen millones de pares de bases, localizadas linealmente y de esta secuencia
depende el funcionamiento de los individuos, solamente el 5% corresponde a genes que podemos
ver en forma de fenotipo, el resto no tiene funcin al menos por ahora conocida, pero no quiere
decir que no tengan funcin o que no puedan ser usadas, existen algunas secuencias muy
importantes que son repeticiones especficas llamadas microsatlites que son utilizadas para la
identificacin de los individuos, la mayora de ellos son repeticiones de dos bases como en el
ejemplo: (TCAGGTCTACACACACACACACACACACATGCTTATGACT), se puede observar
que CA se repite alrededor de 10 veces.

Los genomas de mamferos contienen miles de estos marcadores, que gracias a su gran variacin
permiten identificar los individuos lo que le da gran potencial de uso entre ellos: paternidad,
ciencias forenses, diagnstico de enfermedades hereditarias e infecciosas.

La identificacin de los marcadores moleculares estn basados en la utilizacin de la tcnica de la


reaccin en cadena de la polimerasa (PCR) y la digestin de los mismos mediante el uso de
endonucleasas separando posteriormente los fragmentos mediante la electrofresis, esta
metodologa que aqu planteamos para produccin animal tambin se utiliza para el estudio de la
distancia gentica y variacin poblacional, patrones de historia biogeogrfica y pruebas de
paternidad.

170
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Dentro de los aspectos de la cra de animales como industria se debe tener en cuenta que cada
da, los productos (animales) han de satisfacer las necesidades de los clientes, para el caso el
andar, el pelaje, la certeza de la filiacin, la salud de los animales. Es en este contexto, donde el
mejoramiento debe ser entendido, as pues debemos estar seguros que un animal tiene un paso
definido y si esto es cuantificable mucho mejor, que tiene una capa de pelaje especfica que es hijo
de quien queremos. Es slo, con objetivos que se puede lograr, cada instante se tienen muchas
posibilidades, el criador escoge una de ellas y se ayuda de las herramientas existentes.

Hasta hoy, los programas de cra animal se han basado en la recoleccin cuidadosa de
observaciones de caractersticas relacionadas con la produccin (leche, carne, huevos, protena,
peso al nacimiento, ganancia diaria, etc.). Estos registros son analizados mediante sistemas
estadsticos y biomtricos con el nimo de identificar los animales con efecto positivo o negativo
sobre estas caractersticas de importancia econmica en los sistemas de produccin dentro de una
poblacin. Este sistema que se ha usado por aos ha permitido avances insospechados en
seleccin, especialmente en los machos; hoy en el inicio del siglo XXI, urge el desarrollo y
aplicacin de nuevos sistemas de seleccin que ayuden a complementar los existentes.

Para mejorar los equinos colombianos es necesario utilizar nuevos sistemas que complementen los
mtodos de crianza existentes. Los adelantos en gentica molecular han desarrollado tcnicas
tiles en mejoramiento, una de stas es la Seleccin Asistida por Marcadores Genticos (MAS) la
cual permite evaluar caractersticas deseadas directamente sobre el material gentico de animales
nacidos y por nacer; esta tcnica se perfila como la opcin para la seleccin de animales de este
siglo. La utilizacin de esta tcnica, adicionada al uso de nuevas tcnicas de reproduccin
(transferencia de embriones, inseminacin artificial, clonaje, transgnesis) permite que rpidamente
se puedan producir hatos enteros con caractersticas genticas de produccin deseables.

El mejoramiento gentico en la cra de animales, se ha dado gracias al desarrollo de sistemas


estadsticos sofisticados que analizan la informacin sobre caractersticas productivas de inters.
Estas tcnicas han sido de gran ayuda, en el rpido cambio de las tazas de mejoramiento gentico
en las poblaciones. Estas son consideradas formas de acercamiento al material gentico, en lo que
se pudiera considerar una caja negra, ya que no se basan en el anlisis directo de los genes que
controlan las caractersticas. Los rpidos desarrollos han permitido salir de esta caja y entrar al
conocimiento directo de los genes. De los 70000 genes existentes, el 95% no tienen funcin
conocida. Para algunas caractersticas relacionadas con variacin gentica, es complicado
identificar a los genes responsables pues usualmente es ms de uno. Algunas veces, para
acercarse a estos genes se han utilizado los marcadores genticos llamados microsatlites. Otro
concepto desarrollado, y descubierto en los ltimos aos, fue el de los polimorfismos, en los que
dentro del mismo gen o marcador existen diferencias identificables en sus secuencias, en las 7
diferentes formas de la hemoglobina o 6 formas de almidn.

La mayora de las caractersticas de importancia en seleccin de animales domsticos para


produccin de alimento son cuantitativas, como consecuencia del fenotipo observado es el
resultado de la accin de los genes responsables con el medio ambiente. El mapeo de estos genes
o locus de caractersticas cuantitativas (QTL), est asociado al desarrollo de los marcadores
genticos que faciliten su localizacin. Una alternativa para hacer este tipo de anlisis es explotar
la asociacin que puede existir entre algunas caractersticas monognicas y su asociacin con el
QTL sobre el que se hace la seleccin. Esta asociacin puede venir de la estratificacin de la
poblacin en donde se observe el efecto pleiotrpico del gen sobre ambas caractersticas. Algunos
ejemplos de ello son la asociacin observada entre la hipercalcemia paraltica peridica y el
desarrollo muscular en los caballos cuarto de milla, hipertermia maligna y el sndrome de stress
porcino y la melo encefalopata degenerativa proliferativa (enfermedad de weaver) y la produccin
lctea.

171
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

La produccin lctea, es el resultado de la accin de varios genes, esto significa que los fenotipos
tienen una distribucin continua como resultado del funcionamiento de varios QTL que en
ocasiones se confunden con los factores medioambientales. Esta produccin tiene una alta
heredabilidad (25 50%). Se conoce adems los mecanismos de regulacin de su expresin tales
como tejido, sexo, estado y edad.

La informacin gentica recopilada acerca de los caballos podra permitir a los criadores
seleccionar caractersticas que estn ligadas a un gen o caractersticas mltiples genes como la
fertilidad y las caractersticas de desempeo, como un andar determinado, el color, el bro y la
alzada, las cuales hacen parte de la seleccin gentica de un ejemplar ideal para cualquier criador.

Gentica del Paso.

Muchas razas de caballos son distinguidas por determinadas caractersticas, ejemplo de ello son
las razas seleccionadas por su habilidad para cabalgar, como es el caso de nuestro paso fino
colombiano. Estas caractersticas son transmitidas genticamente, pero parecen no estar
codificadas por un nico gen. La herencia del andar no se ha establecido todava, pero se conocen
dos hiptesis: El andar esta enmarcado en la herencia polignica donde una caracterstica est
influida por ms de un gen; en este tipo de herencia, un carcter puede ser controlado por genes
de diferentes locus actuando en forma aditiva; esto es mesurable y esta influido por la gentica,
pero tambin por el medio ambiente. La comprensin de las caractersticas de desempeo
depende de la capacidad para identificar y medir los efectos genticos y ambientales por separado.

Otros autores han sugerido que existen dos genes que producen los diferentes tipos de andares
conocidos, un gen del paso con su gen modificador cuya herencia es similar a la de los alelos
mltiples.

En la herencia del paso fino, algunos autores basados en la crianza de caballos, han afirmado que
este aire es heredado y no aprendido, ya que se distingue de otras razas, adems porque los
ejemplares exhiben desde potro el andar y no necesitan implementos artificiales o de
entrenamiento para realizarlos.

Es as como la evaluacin cuidadosa de los marcadores genticos permitirn proveer informacin


sobre la existencia de marcadores que estn asociados a uno u otro andar para ser utilizados en
seleccin.

Las pruebas de paternidad nacieron en la evaluacin de los grupos sanguneos de los animales,
dado el gran polimorfismo existente en ellos.

Estas pruebas se hacen mediante evaluacin del ADN de los individuos, y se basan en la
comparacin de las secuencias de los microsatlites, de los padres con las de los hijos. De las
muestras se extrae el ADN, que se amplifica y se obtiene un perfil electrofortico de la muestra que
se quiere analizar y esta se compara con el perfil existente de los padres, bien sea porque se tom
la muestra al tiempo o por la existencia del dato en el banco de ADN, y de esta comparacin se da
una respuesta sobre la filiacin, que es 100% segura en cuanto a la exclusin y 99.9% segura en
cuanto a la inclusin, es por esto que se deben comparar. Las pruebas han sido diseadas, en
nmero de marcadores y en calidad de los mismos para que lleguen al 100%.

As pues, la prueba se basa en la comparacin de los resultados anteriormente mostrados con los
del padre, y gracias a la combinacin de todos los marcadores, el conocimiento de su frecuencia
en la poblacin se pueden asignar los valores de exactitud anteriormente mencionados.

172
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Enfermedades.

Existe una prueba para la Parlisis por Hipercalcemia Peridica en los animales. Esta enfermedad
ha sido reportada en algunas lneas de caballos cuarto de milla y apaloosa, los animales
usualmente muestran una musculatura bien desarrollada, est caracterizada por ataques de
contracciones musculares, con complicaciones de las vas areas que pueden eventualmente
causar la muerte. Se ha identificado la mutacin en el gen que regula los niveles musculares de
sodio y potasio que produce la protena anormal, as que se pueden identificar los animales que la
posean y tomar decisiones frente a la seleccin de los mismos.

CAPITULO 6

SANIDAD EN LOS PLANTELES EQUINOS

Tomada en Pesebrera El Puente - Neiva

Introduccin
Las enfermedades de los equinos son tanto mas fciles recombatir cuando ms rpido se
reconocen una buena salud, enmarcada en un programa estricto de sanidad, prevencin de
enfermedades y control de parsitos, es algo que se considera fundamental para obtener del
caballo un rendimiento acorde con su trabajo.

Adems, de seguir un estricto programa que abarque una buena crianza, un excelente manejo y
una alimentacin racional y cientfica.

Un caballo sano es aquel que trabaja bien y a la inversa, es enfermo aquel que no produce o cuya
utilidad se ha disminuido en forma temporal o permanente a causa de una enfermedad o cualquier
otra situacin nociva.

173
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

El programa de salud ser diferente segn se trate, de la regin o rea involucrada y ser diferente
de una finca a otra. Sin embargo, los principios sern los mismos.

Cuando por cualquier razn bien sea mecnica, fsica, qumica, infecciosa, parasi-taria, etc., se
rompe el equilibrio normal del funcionamiento orgnico del animal, se produce el estado de
enfermedad o no produccin, que no es ms que la alteracin ms o menos grave de la salud y el
bienestar del caballo.

El estado de incompetencia o de no produccin muchas veces no es absoluto ya que por ejemplo,


un caballo puede padecer una enfermedad, como una infeccin leve o una afeccin sea (artritis
crnica) y ser capaz de realizar una funcin til.

Las alteraciones de la salud del equino tienen una causa (etiologa), un curso de solucin y
reestablecimiento (patogenia), un desenlace probable (pronstico) y unos medios de control y
tratamiento.

Leccin 26 CABALLOS ENFERMOS VERSUS CABALLOS SANOS.

Descripcin:

Existen numerosos determinantes que nos ayudarn a saber si nuestro caballo est padeciendo
cualquier tipo de enfermedad, algo que podremos llegar a saber realizando un sencillo examen del
animal.
Hay dolencias como las heridas, que resultan muy fciles de localizar y tratar, pero existen otras
que son de carcter interno y por lo tanto es mucho ms difcil llegar a saber de su existencia. A
continuacin le sealamos una serie de elementos que le ayudarn a diferenciar entre un caballo
sano y otro que presenta alguna enfermedad.

CABALLO SANO

Ojos limpios y brillantes.


Capa brillante, sin cada de pelo.
A la hora de comer lo har bien, mascando con facilidad. Orina casi
transparente o de color amarillo plido.
Sus extremidades y cascos debern estar fros, sin ningn tipo de inflamaciones.
Al andar, repartir el peso uniformemente entre sus cuatro extremidades (sin embargo,
tenga en cuenta que el cambio constante del peso de una extremidad a otra, sobre todo en
las delanteras, no es un buen sntoma.
Su temperatura correcta se sita alrededor de los 38C.

Su pulso, en reposo, oscilar entre las 36 y 42 pulsaciones por minuto.


Su respiracin, tambin en reposo, variar entre las 8 y las 12 inspiraciones por minuto,
debiendo hacerse con suavidad y sin esfuerzo. CABALLO ENFERMO:

El aspecto general de un caballo enfermo es de abatimiento y tristeza.


Las orejas estarn cadas hacia atrs, la cabeza baja y los ojos se mostrarn inexpresivos y
apagados (incluso en ocasiones presentaran secrecin).

Su pelo habr perdido el aspecto brillante y se mostrar opaco.


En caso de que se observe que se echa sin un motivo claro, se debe tener en cuenta que es

174
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

un sntoma de enfermedad.
Si se observa que escarba, que suda mucho y que se muestra inquieto, se har ver por un
veterinario, puesto que todos ellos son sntomas de un clico.
Para determinar la existencia de una contusin, se palpara la zona, sta existir si
observamos calor (en ocasiones vendr acompaada de una clara inflamacin).

Aunque las cojeras pueden resultar evidentes, en ocasiones resulta difcil concluir en qu
extremidades se encuentra la dolencia, para poder ponerle solucin. Una forma de saberlo es la
siguiente:

o En primer lugar miraremos los cascos, tratando de ver si alguno est caliente o si existe
alguna herida o piedra encajada.
o Despus se palpara toda la extremidad.
o A continuacin, haremos que el caballo trote, teniendo en cuenta lo siguiente: si la cojera
se encuentra en los anteriores, bajar la cabeza al cargar el peso en la mano buena y la
levantar al pisar con la mano que le produce dolor. En caso de que la cojera se
encuentre en las extremidades posteriores, el corvejn y la cadera del pie afectado
parecern levantarse ms al pisar.

Para obtener un mejor conocimiento del tema y con fines prcticos y descriptivos las enfermedades
de los caballos se pueden clasificar segn los agentes que las producen. Las enfermedades del
equino pueden ser:

Infecciosas.
No infecciosas

Las enfermedades infecciosas son las causadas por microorganismos o grmenes. Existen tres
grupos principales de microorganismos:

Virus.
Bacterias.
Hongos.

Las Enfermedades No infecciosas son las causadas por agentes diferentes a los anteriores o por
trastornos del metabolismo normal del caballo, lo que incluye las enfermedades carenciales o
nutricionales. Las enfermedades parasitarias son un buen ejemplo. Los parsitos son organismos
que viven a costa de otros, sin que necesariamente les perjudiquen ni por lo general les ocasionen
la muerte. En este sentido, se diferencian de los microbios, aunque algunos producen efectos
graves que pueden tener consecuencias fatales, en casos extremos.

Dentro de este grupo de enfermedades podemos ubicar tambin las ocasionadas por sustancias y
plantas txicas que causan envenenamiento y cambios corporales al ser ingeridas por los animales
o sea, administradas voluntaria o involuntariamente por el hombre.

ENFERMEDADES INFECCIOSAS..
Son aquellas provocadas por microorganismos nocivos (grmenes o microbios) que ante
situaciones favorables ingresan al organismo desde el exterior o estando en l se multiplican e
invaden el cuerpo hasta causar daos en la estructura de clulas y tejidos.

Esta propiedad de invadir y multiplicarse se conoce con el nombre de virulencia y se aprecia en la


prctica por la gravedad de la enfermedad que produce y la facilidad con que esta se Propaga y se
establece en la poblacin equina.

175
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

La resistencia que el organismo opone ante la agresin de los agentes infecciosos se conoce como
inmunidad, y se establece mediante la capacidad de algunas clulas especiales del cuerpo para
producir, por un lado, sustancias protectoras (anticuerpos) que neutralizan al microbio invasor, y
por otro atacarlo ellas mismas, englobndolo y destruyndolo.

Esta resistencia o inmunidad se puede desarrollar asimismo mediante vacunas. En este caso es
inmunidad artificial, pero su modo de actuar es similar al de la inmunidad natural.

Las vacunas son fabricadas contra virus estrictamente. Las bacterianas se preparan contra
bacterias.

Independientemente de la resistencia o inmunidad, los caballos y dems animales varan en su


respuesta a la infeccin debido a muchos factores que hacen al organismo susceptible (factores
predisponentes).

ENFERMEDADES VIRALES.

Equinos enfermos de Anemia Infecciosa Equina


www.viarural.com.ar

En el siguiente cuadro se resumen las principales enfermedades ocasionadas por virus, sus
principales sntomas y el agente causal identificado hasta el momento.

Tabla 20. Enfermedades Causadas por virus.


ENFERMEDAD SINTOMAS VIRUS CAUSAL
PRINCIPALES
Anemia Infecciosa Fiebre, anemia, edemas Retrovirus (lentivirus)
en las piernas y regiones
declives
Encefalitis Equina Depresin, fiebre, Togavirus
Venezolana incoordinacin,
comportamientos
anormales 50- 90% de
mortalidad.
Encefalitis Equina del Este Mismos de la anterior Togavirus
Estomatitis Vesicular Salivacin excesiva, Rhabdovirus
fiebre, vesculas en
lengua, boca y labios.
Rabia Comportamiento agresivo, Rhabdovirus

176
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Parlisis.
Influenza Equina Tos seca continua, fiebre, Orthomyxovirus
depresin
Linfosarcoma Depresin del sistema o Retrovirus (Oncovirus C)
sistemas involucrados.

Las anteriores son las enfermedades virales equinas que se consideran prevalentes o sea que su
presencia en nuestro pas se mantiene en el tiempo, habindose aislado el agente causal en
alguna oportunidad en animales nativos. La Encefalitis Equina Venezolana y la Rabia se
consideran adems enfermedades zoonticas o sea que se pueden transmitir al hombre por el
contacto con los animales. Existen campaas de vacunacin en las zonas en donde se ha
comprobado su presencia, para Encefalitis Equina Venezolana, Influenza y Rabia.

Adems de las anteriores existe sospecha (por algunas evidencias) de la presencia en Colombia
de otras enfermedades virales como:

Encefalitis Equina del Oeste.


Bronquitis Infecciosa y Traque bronquitis.
Parainfluenza 3.
Aborto equino por Herpes virus
Papilomatosis
Diarreas ocasionadas por Reovirus y Rotavirus

ENFERMEDADES BACTERIANAS.

Equino con ttano


www.apaelrefugio.com

En el siguiente cuadro se resumen las principales enfermedades ocasionadas por bacterias, sus
sntomas y el agente causal identificado hasta el momento.

Tabla 21. Enfermedades Causadas por Bacterias.


ENFERMEDAD SINTOMAS PRINCIPALES AGENTE CAUSAL
Adenitis Infecciosa, Fiebre, catarro nasal, descargas de Streptococcus
Distemper o moco y pus, engrosamiento de (zooepidermicus, y
Papera glndula submaxilar y partida equi)
Abscesos.
Shigelosis Fiebre, somnolencia, postracin, Shigela equirulis.
(Actinobacilosis). dificultad para amamantarse, debilidad

177
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

en potros.
Salmonelosis Fiebre, Inflamacin del intestino Salmonella
(Paratifosis) (enteritis), diarrea sanguinolenta, (thyphmurium,
deshidratacin, alta mortalidad, artritis, enteridis, branderis,
aborto, neumona. abortus)
Enterotoxemia Fiebre, signos de clico, intoxicacin, Clostridium
(sndrome postracin, muerte (perfringens y
complejo) welchi).
Edema Maligno Edema subcutneo en glande y Clostridium septicum
regiones bajas, fiebre, inapetencia.
Brucellosis (Talpa) Rigidez, cojeras, procesos supurativos Brucella (abortus y
en cruz y cabeza, abortos (son raros) suis)
Necrobacilosis Cojeras, inflamacin de la suela del Spherophorus
casco, postracin, inapetencia. necrophorus
Ttanos Mortalidad alta, signos nerviosos, Clostridium tetani
rigidez.
Prpura Edemas en cabeza y miembros, Streptococcus
Hemorrgica postracin, anasarca, fiebre. Estreptolisinas.
(autoinmune)
Leptospirosis Fiebre, ictericia, anemia. Leptospira (pomona,
icterohemorrgica)

Las anteriores son enfermedades bacterianas prevalentes en los equinos de nuestro medio. La
salmonelosis, la Leptospirosis y la Brucelosis se consideran asimismo enfermedades zoonticas.
Existe sospecha que en el pas existen otras enfermedades bacterianas tales como:

o Tuberculosis (Mycobacterium tuberculoso). o Linfangitis


ulcerativa (Corynebacterium equi) o Botulismo (Clostridium
botulium)
o Metritis contagiosa (Haemophilus equigenitalis).

Es de aclarar, que los nombres listados corresponden al nombre tcnico de la enfermedad, y que
el mismo proceso patolgico puede conocerse bajo diversos nombres regionales, por ejemplo:
Necrobacilosis, panadizo mazamorra etc.

ENFERMEDADES MICTICAS O PRODUCIDAS POR HONGOS.

En el siguiente cuadro se presentan las principales enfermedades producidas por hongos


(micosis), sus principales sntomas y el agente causal identificado hasta el momento.

Tabla 22. Enfermedades Causadas por Hongos


ENFERMEDAD SINTOMAS AGENTE CAUSAL
PRINCIPALES
Rhinosporidiosis Masas blandas y Rhinosporidium seeberi.
sangrantes en mucosa
nasal, plipos
Mucormicosis Lesiones en piel de los Mucor
miembros costras,
necrosis, rasquia.
Ficomicosis (Espundia) Masas tumorales de mal Hyphomyces
olor, exudados, necrosis,

178
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

rasquia.
Dermatofitosis (Tia) Lesiones circulares Microsporum Trichofyton
cubiertas de costras que equinus, mentagrofites,
descaman y ulceran verrucosum

ENFERMEDADES MICOTICAS DEL EQUINO

Las anteriores son las que se consideran prevalentes y pueden transmitirse, por contacto al ser
humano (zoonosis), adems se sospecha que en el pas existen otras enfermedades micticas
tales como:

Diarrea mictica por Aspergillus (flavus, fumigatus).


Streptotricosis cutnea (Dermatofilus)
Candidiasis o Moniliasis (Candida albicans)

Linfangitis epizotica (Histoplasma).

ENFERMEDADES PARASITARIAS.

Strongylus vulgaris
http://uy.merial.com

Los parsitos son organismos que pueden pasar parte de su desarrollo en estado de vida libre,
esto es, sin estar asociados al husped. Su existencia como parsitos transcurre dentro del cuerpo
del husped (endoparsitos) o en la superficie del cuerpo (ectoparsitos).

Los endoparsitos ms comunes son:

- Helmintos (Pluricelulares)
- Protozoarios (Unicelulares).

Los Helmintos a su vez pueden ser:


Nematodos
Trematodos
Cestodos

Los ectoparsitos o parsitos externos son estudiados y clasificados por la parasitologa y adems

179
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

de ser organismos pluricelulares poseen caractersticas que los diferencian claramente de los
dems como son:

Exoesqueleto (cutcula)
Cabeza, Trax y Abdomen definidos.

Los parsitos externos pueden ser:

caros
Garrapatas
Piojos
Dpteros (moscas)

A continuacin se presentan las principales enfermedades producidas por parsitos internos y


externos de los equinos en Colombia, con sus sntomas principales y el agente causal identificado
hasta el momento. Como en los cuadros anteriores se presentan solamente las parasitosis que se
consideran prevalentes y luego se listan las que se sospecha existen en el pas.

ENFERMEDADES PARASITARIAS INTERNAS: PROTOZOARIOS

Tabla 23. Enfermedades Causadas por Protozoarios


SINTOMAS
ENFERMEDAD PRINCIPALES AGENTE CAUSAL
Trichomoniasis Diarreas crnicas.

Giardiasis Diarreas en potros, Giardia


postracin,
deshidratacin.

Amebiasis Diarreas sbitas, clico Entamoeba

Coccidiosis Diarreas crnicas, clico Eimeria

Babesiosis Depresin, ictericia, Babesia Natalia


edema de los miembros,
anemia, anorexia.

Trypanosomiasis Fiebre, edema de los Trypanosoma


genitales y de las
extremidades.

Sarcosistosis Ninguna apreciable Sarcocystis

Toxoplasmosis Fiebre en algunos casos, Toxoplasma


la mayora de veces nada
apreciable.

ENFERMEDADES PARASITARIAS INTERNAS: HELMINTOS (NEMATODOS CESTODOS)

180
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tabla 24. Enfermedades Causadas por Helmintos


ENFERMEDAD SINTOMAS PRINCIPALES AGENTE CAUSAL
Ascariasis Diarrea en potros, clico Parascaris
perforacin del intestino,
bronconeumona.

Habronemiasis Dermatitis, heridas ulcerosas, Habronema


necrosis de la piel.
Granulomas, (tumores)

Strongylosis Disnea, adelgazamiento, clico Strongylus


(peritonitis)

Onchocercosis Dermatitis, rasquia, alopecia Onchocerca


(cada del pelo)

Oxyuriasis Rozaduras perianales Oxyuris

Dictyocaulosis Clicos, tos, disnea, catarro Dictyocaulus


intestinal.

Filariasis Conjuntivitis, lagrimeo Parafilaria, Setaria

Parasitismo Intestinal Clicos, diarreas, Triodontophorus


adelgazamiento, mal pelaje. Strongyloides,
Trichostrongylus
Cestodiasis Ulceraciones de la mucosa Anoplocephala,
intestinal inflamacin catarral. Paranoplocephala
Perforaciones del ciego.

Parasitosis Intestinal Clicos leves, adelgazamiento, Posteriostomun


catarro intestinal. Trichonema

ENFERMEDADES PARASITARIAS EXTERNAS: ARTROPODOS-

Garrapata
www.colvet.es

Tabla 25. Enfermedades Causadas por Artrpodos


ENFERMEDAD SINTOMAS PRINCIPALES AGENTE CAUSAL
Sarna ACAROS Engrosamiento de Psoroptes, Sarcoptes

181
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

la piel, prdida de pelo,


irritacin
Infestacin por GARRAPATAS Irritacin, Ixodes, Dermacentor,
Garrapatas inflamacin de la piel, anemia, Rhiphicephalus,
adelgazamiento, transmisin Amblyoma, Boophilus.
de otras enfermedades.
Infestacin por Piojos PIOJOS Irritacin, inflamacin Trombicola, Trichodectes,
de la piel, picor, prdida de Haematopinus, Damalinea.
Pelo
Infestacin por DIPTEROS Picaduras, Dermatobia, Stomoxys,
Moscas irritacin, inflamacin de la Tbanos.
piel, excitacin y malestar, son
vectores de otras
enfermedades.
Parasitismo Gstrico Adelgazamiento, clicos, Gastrophilus
(gastritis), perforacin del
estmago, Hemorragias del
estmago.

Algunos parasitismos que se consideran sospechosos de existir en el pas son:

Hypodermiosis (Hypoderma)
Schistosomiasis (Schistosoma)

Parasitismo ocular por Thelazia.

Leccin 27 PROGRAMA GENERAL DE SANIDAD EQUINA.

Las enfermedades que se presentan en los planteles equinos dependen en gran medida de la
forma en que los animales se manejen, se alojen, el trabajo que realicen y del programa de
prevencin de enfermedades que se lleve a cabo. El objetivo de toda medida de prevencin es el
mantenimiento de la salud animal. La seguridad en la conservacin de la salud depende en alto
grado, de la observacin cuidadosa de las normas de procedimiento (manejo) y de las normas de
higiene y es un error hacer recaer toda la responsabilidad en el programa de vacunacin para las
distintas enfermedades. Las vacunaciones son necesarias en los planteles equinos, pero la
anulacin de las infecciones y la proteccin ms eficaz se consigue primordialmente por las
medidas higinicas.

Todo buen cuidador de caballos deber cerciorarse peridicamente, como marcha su caballada
constatando a manera de ejemplo, algunas caractersticas o signos de salud que seran de gran
valor en la identificacin precoz de los problemas sanitarios. Se concentrar en:

Apreciar el estado del pelaje de sus caballos, lo cual le permitir conocer si est mudando o
si ste es suave, brillante, o por el contrario es spero, opaco, seco y grueso.
Observar si los ojos del caballo son brillantes y alertas o estn opacos, apagados, con
secreciones, lgrimas, parsitos externos, etc.
Constatar el estado de carnes de sus caballos y definir una posible carencia nutricional o
deficiencia en minerales y vitaminas, o cualquier otro tipo de deficiencia.
Apreciar las extremidades vindolo desplazar, observar si rehsa pararse en sus cuatro
patas o si cojea. Podr mirar si existen articulaciones inflamadas, cicatrices o heridas
regulares o mal curadas y se asegurar del buen estado y la conservacin de los cascos.
En relacin con sus rganos internos podr apreciar si sus caballos tosen cuando se

182
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

ejercitan o trabajan, la forma como respiran y si toleran o no el trabajo o el ejercicio.


Si sus caballos no comen bien puede ser que su sistema digestivo no funcione
correctamente. Observar el estircol en donde podr apreciar si existen parsitos adultos o
restos de comida sin digerir Har un examen rutinario de la boca y en ella podr ver si los
dientes estn causando problemas o si existen malos olores (caries) muchas veces
mediante el uso de escofinas o limas resolver la presencia de aristas cortantes o de
sobredientes que irritan e impiden la correcta masticacin.

Se preguntar si existen problemas reproductivos, baja fertilidad de su semental, abortos en sus


yeguas, muertes en los recin nacidos, etc.

Por ltimo revisar el calendario de vacunacin y los programas de vermifugacion y realizar


los ajustes pertinentes.

El tcnico encargado podr investigar estos puntos, adems de muchos otros y se asegurar que
toda la caballada est en ptima condicin fsica y en disponibilidad para las labores o trabajos
segn la funcin especfica.

CUARENTENA.

http://caballospastoreo.galeon.com/productos766741.html

La prctica de aislar y observar los individuos recin llegados a la finca, es de suma importancia
para evitar la entrada y diseminacin de enfermedades. En muchos casos esta prctica requiere de
instalaciones y equipos costosos y por lo tanto deja de realizarse sobre todo cuando los caballos
proceden de lugares cuya situacin sanitaria es conocida. En la medida en que se pueda realizar,
los animales nuevos (yeguas y sementales visitantes) debern aislarse por un perodo de tres
semanas antes de juntarlos al resto de caballos. Durante este lapso el Mdico Veterinario podr
observarlos, realizar exmenes de sangre, orina y heces, para investigar posibles parsitos,
vacunar aquellos que no lo estn con las mismas vacunas usadas en la finca husped, har un
buen examen general y genital de las yeguas de cra e instaurar tratamiento si es conveniente.
Igualmente, se exigir a los ejemplares visitantes (yeguas para ser servidas) un certificado de salud
realizado por un Mdico Veterinario.

EMPLEO RACIONAL DE MEDICAMENTOS

El empleo de medicamentos debe hacerse bajo indicacin y vigilancia del Mdico Veterinario, lo

183
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

cual es requisito fundamental. Sobre este aspecto hay que ser rigurosos. Muchos medicamentos
son potencialmente peligrosos si son sobre dosificados y otros provocan reacciones secundarias
impredecibles. Cabe decir aqu que el caballo, como ningn otro mamfero, es sumamente sensible
a los efectos colaterales de los distintos frmacos y puede morir como consecuencia de un rechazo
de su organismo a la droga, lo que se conoce como anafilaxis. Antes de abordar cualquier
tratamiento el especialista deber reflexionar sobre los siguientes aspectos:

Si el caso clnico planteado amerita o no tratamiento.


Si el tratamiento instaurado o por instaurar puede llegar a ser perjudicial y cules pueden
ser los efectos colaterales que ocasione.
Si el tratamiento es costoso y el estado del animal y las aspiraciones de su dueo justifican
ese costo.
Si los efectos benficos que se esperan justifican su uso.
Si en cambio de tratar es mejor sacrificar al animal (alto costo del tratamiento, mal
pronstico, etc.)

Los principios generales que gobiernan el uso de medicamentos deben basarse en la experiencia
diaria, como gua podramos sealar:

Evaluar cuidadosamente las ventajas de los productos a emplear, siendo objetivo y sin dejarse
abrumar y confundir por el mar de folletos que los fabricantes de productos farmacolgicos hacen
llegar o remiten por correo.
El tratamiento prescrito debe ser prctico, es decir, teniendo en cuenta su costo y la facilidad de su
administracin.
Definir si el tratamiento es realmente mdico o por el contrario es quirrgico. Por ejemplo, ante un
caso de parlisis larngea (hemiplejia) es intil el empleo de frmacos y la indicacin es el
tratamiento quirrgico.
Actuar decididamente bien sea tratando mediante medicamentos o sometiendo el animal a un
procedimiento quirrgico. El especialista debe evitar las situaciones que le hicieran desear no
haber iniciado el tratamiento, y que creen confusin y desconcierto en propietarios y manejadores.

En ningn caso se justifica el hacer sufrir al animal, ni gastos intiles a su propietario. Por lo tanto,
y aunque la norma es siempre intentar realizar un tratamiento, el especialista sopesar la situacin
y sin pretender formular reglas fijas al respecto, podr definirse por el sacrificio del animal cuando
la realidad as lo amerite. Cuando un animal se sacrifica por razones humanitarias se afirma que se
ha sometido a Eutanasia.

Cuando se vaya a utilizar cualquier medicamento, previamente se deben leer las instrucciones del
empaque y del medico veterinario que lo receto, para de esta forma determinar:

Dosis.
Frecuencia de administracin. Forma de
administracin.
Presentacin del frmaco.
Posibles respuestas adversas o efectos colaterales. Precauciones.
Antdotos.
Fecha de vencimiento del frmaco.
Tener en cuenta la medicacin preexistente.

En cuanto a los factores que influyen en el suministro del frmaco y su siguiente accin y efecto a
nivel del animal, se debe tener en cuenta los siguientes aspectos:

Estado fsico del animal. Peso del

184
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

equino.
Edad. Sexo.

A continuacin mencionaremos algunos de los medicamentos de mayor utilidad en un botiqun


veterinario especializado en equinos:

Antihistamnicos: utilizados para contrarrestar reacciones alrgicas.


Antibiticos: son para contrarrestar infecciones especficas, en especial los de amplio
espectro.
Antinflamatorios: se utilizan para disminuir la inflamacin los encontramos para aplicacin
tpica y endovenosa, se debe tener en cuenta la condicin del individuo antes de la
aplicacin.
Diurtico: contribuye a la eliminacin de lquidos retenidos.
Sueros hidratantes: son soluciones salinas tiles en la recuperacin de lquidos y electrolitos
en un animal deshidratado.
Analgsico: Para contrarrestar fiebre y dolor.
Tranquilizantes: con el objeto de aminorar grados de excitacin en los animales.
Anestsico: Para inhibir el dolor en un rea determinada o en forma general durante una
intervencin quirrgica, o actividad que as lo requiera.
Antdotos: Para impedir la muerte por envenenamiento, de acuerdo al agente toxico as
mismo es el tipo de antdoto.

Antidiarreico: Para detener la diarrea.

Vermfugos: Existen gran variedad de acuerdo al parasito infestante y su funcin es la


eliminacin de estos.
Insecticida: Su funcin es la eliminacin de ectoparsitos y la posible infestacion de otros.
Coagulantes: Ayuda al proceso de coagulacin sanguneo en heridas. El tiempo de
coagulacin de los equinos puede durar hasta:
a) Caballos de tipo pesado: 30 minutos.
b) Caballos de tipo liviano: 22 minutos.
c) Ponnis: 15 minutos.
Si se sobrepasa este tiempo se debe aplicar el coagulante para ayudar en el proceso.
Cicatrizante: Acelera el proceso de cicatrizacin de las heridas.
Desinfectantes: Se utiliza en la desinfeccin de heridas o superficies corporales adems de
usarse en la desinfeccin de implemento e instalaciones.

CMO ADMINISTRAR LOS MEDICAMENTOS.

Los medicamentos se pueden administrar a los caballos por distintas vas: Oral (bucal), Parenteral
(inyecciones), Vaginal y Uterina, Rectal y Externa (tpica).

Oral (bucal): Por lo general los caballos son reacios a ingerir alimentos en los que se haya
mezclado medicamentos. Cuando se tratan clicos, es necesario administrar grandes cantidades
de lquidos. Muchas veces las cantidades de lquidos son pequeas (vermfugos en jeringas
dosificadoras) la administracin es relativamente fcil, aprovechando las comisuras labiales
amplias y obrando con alguna rapidez. Los grandes volmenes sin embargo requieren el uso de un
tubo de plstico (sonda) que se hace pasar hasta el estmago a travs, del conducto del esfago.
Uno de los extremos puede tener una abertura lateral y el otro es de forma cnica con el objeto de
poder insertar en l embudos o botellas. Antes de emplear la sonda, esta se lubrica con aceite o
agua y se introduce por uno de los ollares. Un asistente debe sujetar al animal por el lado contrario
al que se site el operador que introduce la sonda. Esta maniobra es delicada y requiere un cierto

185
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

grado de destreza. El peligro radica en pasarla a la trquea y no al esfago e inadvertidamente


administrar los lquidos con resultados fatales pues se provocara una neumona por cuerpo
extrao.

Algunos medicamentos se pueden administrar en forma de polvo o triturados (pastas) mezclados


con alimentos, en cantidades pequeas para evitar el rechazo por parte del animal.

Parenteral (inyecciones): En los equinos las inyecciones pueden ser por puncin venosa
(intravenosa), o por puncin directa en la masa muscular (intramuscular), o por aplicacin directa
debajo de la piel (subcutnea).

Aplicacin intravenosa o endovenosa: Se utiliza comnmente la vena yugular la cual es fcil de


localizar en la tabla del cuello del caballo. En el punto elegido deber aplicarse, antes y despus de
realizarla, un antisptico (preferiblemente alcohol), incluso a pesar de la opinin de los que
sostienen su falta de efectividad frente a las posibles infecciones.

El calibre de la aguja debe ser 18 o 19 con una longitud entre 3 y 5 centmetros.

Ante las posibles reacciones del caballo es recomendable sujetar ste adecuadamente e impedir
que se mueva aplicando un torniquete en su labio superior y apretando suave pero firmemente,
utilizando el instrumento denominado axial.

La yugular se dilata ejerciendo presin en las proximidades del punto elegido para insertar la aguja.
Siempre hay que tener la precaucin de clavar la aguja y, luego introducir rpidamente la jeringa.
Es muy importante evitar que junto con el medicamento entren burbujas de aire en la vena.

Aplicacin intramuscular: Los puntos ms adecuados para la inyeccin intramuscular se sitan


por orden en: el cuello (tabla del cuello), la grupa y la espalda. En el caso concreto de los potros
puede usarse la masa muscular que forman el trceps o bceps femoral (miembro posterior). Una
vez insertada la aguja, sta no debe moverse ya que se favorece la presentacin de hemorragias.
Si despus de clavar la aguja, sale sangre a travs de sta, se aconseja retirarla e insertarla en
otro sitio de los indicados. La higiene en la aplicacin de las inyecciones intramusculares en el
anca y la tabla del cuello previene la entrada del Clostridium y otros grmenes que son causantes
de gangrena gaseosa y necrosis muscular. El uso de un antisptico en el sitio de puncin y el
empleo de agujas desechables elimina casi por completo esta posibilidad.

Inyecciones subcutneas: Son menos frecuentes en el caballo. De preferencia se inyecta en


sitios de piel floja y delgada (tabla del cuello, pecho) o detrs de la paleta. Las medidas higinicas
sealadas anteriormente son aplicables enteramente en este caso.

Intratraqueal: En casos de absoluta necesidad se puede emplear esta va intratraqueal o sea


colocando el medicamento directamente en la luz de la trquea o guargero con una jeringa y
agujas comn y corriente. El sitio indicado debe buscarse por debajo del cartlago de la laringe,
penetrando primero en la piel y procurando luego introducir la aguja en la unin o espacio entre
dos anillos traqueales. Solo en casos de urgencia (obstruccin de vas areas superiores)
debemos utilizar esta va.

Inyecciones lntramamarias: Aunque la inflamacin de la glndula mamaria en la yegua no es tan


frecuente como en el bovino, en ocasiones es necesario aplicar medicamentos en el interior de la
mama. Previa limpieza del rea se utiliza un medicamento Contra la mastitis que por lo general
viene empacado en una jeringa u otro envase provisto de una cnula, la cual se introduce en el
canal del pezn del cuarto o cuartos afectados. Es aconsejable desocupar en lo posible la mama
antes de introducir la cnula.

186
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Va vaginal y uterina: Cuando se comprueban infecciones vaginales o uterinas se recomienda


introducir los medicamentos directamente en el rgano afectado. En estos procedimientos se debe
aplicar la ms estricta higiene si no queremos agravar el problema. La cola de la yegua debe
sujetarse con una venda elstica limpia y sus cuartos traseros deben lavarse con agua y jabn y
luego se les debe aplicar un desinfectante (preferiblemente productos a base de yodo, diluidos). Se
pueden usar productos lquidos o slidos. Cuando se trata de infecciones uterinas, los
medicamentos se introducirn lo ms profundamente posible. Los medicamentos lquidos se
introducen por medio de una cnula o un tubo plstico (manguera) los cuales deben estar
previamente hervidos y desinfectados. Los medicamentos slidos se introducen con la mano la
cual estar asimismo bien lavada con agua y jabn y desinfectada. Por lo complejo del
procedimiento y los riesgos que conlleva este debe hacerse por un tcnico especializado o bajo
vigilancia directa del Mdico Veterinario, o de lo contrario debe destacarse esta opcin.

Va rectal: Cuando se introducen lquidos por un tubo plstico a travs del recto el procedimiento
se denomina Enema. Los lquidos pueden ser medicamentos o agua jabonosa solamente. Tambin
pueden introducirse medicamentos slidos como supositorios, bolos o tabletas con ayuda de una
mano. Para que el medicamento permanezca en el recto es conveniente limpiar o desocupar ste
previamente de la materia fecal acumulada sacndola con la mano.
La administracin de agua jabonosa y medicamentos lquidos por va rectal es muy usada en
casos de clico en el caballo.

Externa (tpica): Esta forma de aplicar medicamentos tiene diversos fines: Tratamiento
local de heridas.
Tratamiento local contra parsitos externos. Uso de
anestsicos locales
Uso de sustancias irritantes o rubefacientes.

Cuando se van a realizar muestreos de sangre se debe llevar a cabo los siguientes pasos para
evitar lastimar al equino y entorpecer la labor:

Presionar con el pulgar la vena yugular en su parte inferior.


Introducir la aguja de abajo hacia arriba en la piel hasta llegar a la vena.
Comprobar la ubicacin de la aguja, al salir sangre por el extremo de esta. Se conecta el
tubo de ensayo a la aguja y se deja llenar de sangre hasta
obtener dos tercias partes llenas.
Se retira la aguja de la vena del animal.
Se quita la aguja al tapon del tubo de ensayo y la muestra se deja reposar en posicion
inclinada de 60 grados, para favorecer la separacion del suero, si asi el tipo de examen lo
exige.
Una vez reposada la muestra esta debe ser refrigerada hasta ser llevada al laboratorio
clinico.

Los medicamentos a usar pueden aplicarse como polvos, lquidos, ungentos, pomadas o pastas.
Cuando se traten heridas en el caballo es conveniente lavarlas muy bien y aplicar un desinfectante
no irritante. Al colocar una venda debe hacerse de tal forma que no impida la circulacin sangunea
en la zona.

Un medicamento aplicado por cualquier va, se dice que tiene accin sistemtica cuando es
absorbido en la sangre y transportado por ella a todo el organismo y puede actuar en cualquier sitio
especfico en donde se le requiera.

187
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

PROGRAMA DE VACUNACIN.

http://uy.merial.com

Un programa de vacunacin se hace para, mediante el uso de unas series de productos biolgicos
(vacunas, bacterianas) prevenir a una poblacin de animales de las enfermedades presentes
(prevalentes) en la zona donde habita o habitar. En consecuencia se deben tener en cuenta
muchos factores entre los que destacaremos:

De diagnstico: Cules enfermedades realmente existen en la regin.


Epidemiolgicos: Animales afectados, edad, localizacin de la finca, poblacin en riesgo.
De Patogenia de las enfermedades: como se desarrollan, cul es su curso, etc.
Ecolgicos: Medio ambiente propicio o no al desarrollo de enfermedades.

Para la prevencin de una enfermedad mediante vacunas en una poblacin, se requiere


inicialmente la previa y absoluta comprobacin de su existencia en un rea determinada, lo que
incluye diagnsticos precisos (por patologa y microbiologa) positivos y ojala el aislamiento del
germen o microbio acusado de ser el causante y lograr la reproduccin de la enfermedad problema
con base en el patgeno aislado, Por lo tanto no podemos diagnosticar una enfermedad a la ligera
y vacunar ciegamente porque expondramos no solo a nuestros propios animales, sino a todos
aquellos susceptibles de la regin. Pero incluso teniendo un diagnstico preciso hay que entrar a
considerar Otros factores antes de emprender una vacunacin.

Cuntos animales son los afectados, cul es su edad?; podemos aislarlos de los dems?; es
posible sacrificar los enfermos en beneficio de los sanos? existen animales distintos a los caballos
tambin afectados?; Hay muchos animales silvestres en la regin donde habitan los caballos? hay
muchas moscas o mosquitos en la finca; etc.

Un programa tentativo de vacunacin para el territorio colombiano teniendo en cuenta la presencia


o no de las enfermedades mencionadas en las distintas regiones previa comprobacin como se
nombr antes) sera:

Encefalitis Equina Venezolana: vacunar a los cuatro meses y revacunar cada ao (Costa Atlntica)
pero en reas de de altas infestaciones de mosquitos repetir con mas frecuencia.

Ttano: Vacunar a partir de los 3 - 4 meses da edad y revacunar al ao (toxoide tetnico). Y al

188
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

nacer el potro, solo si la madre no fue vacunada contra ttano antes del parto.

Rabia: Vacunar a los cuatro meses y revacunar cada dos aos segn las necesidades de la regin
(zonas problema, costa).

Influenza Equina: Vacunar a los tres meses, repetir tres meses ms tarde, reforzar cada ao,
solamente en reas donde se ha comprobado su existencia (Sabana de Bogot).

Papera: Aplicar dos vacunas a intervalos de un mes solamente en reas de alta incidencia
(Sabana de Bogot, Valle de Aburra).

FACTORES A TENER EN CUENTA PARA OBTENER MEJORES RESULTADOS EN LA


VACUNACION.

Hay varios factores ha tener en cuenta en la eficacia de una vacuna como lo son la exposicin a
los agentes patgenos, la seleccin del mejor producto, la aplicacin de la vacuna en el momento
indicado de acuerdo a las condiciones fisiolgicas del animal.

Una vez aplicada la vacuna esta genera en el animal una respuesta inmune que puede durar
semanas o meses. Con algunas se puede requerir de revacunaciones para obtener el efecto
esperado.

Cada vacuna presenta su propio tiempo de inmunidad, por lo que se debe tener en cuenta la
duracin de su efecto, para saber cuando realizar la revacunacin.
Un equino que presenta los sntomas o que ya esta incubando la enfermedad no desarrollara los
efectos esperados de la vacuna contra esta. El tiempo ideal para vacunar un animal es cuando
este aun esta libre de la enfermedad, bajo relativo poco estrs y en buenas condiciones fsicas,
pues se ve incrementada su respuesta inmune y por mayor tiempo.

La vacuna debe haberse manejado de forma adecuada sobre todo con buena refrigeracin y en la
dosis recomendada por la casa farmacutica a la cual pertenece.

Si entre los 15 das de la aplicacin de la vacuna el animal padece una infeccin de cualquier tipo y
es necesario el tratamiento con antibiticos inyectados, no se puede esperar que la eficiencia de la
vacuna sea total, por lo cual conviene revacunar despus de que se haya terminado la accin del
antibitico en el metabolismo del equino.

CONTROL DE PARSITOS INTERNOS Y EXTERNOS DEL CABALLO.

189
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Ciclo de infestacion parasitaria.


Un buen propietario de caballos debe asumir decididamente un adecuado programa de
desparasitacin de sus animales, ojala en pocas especficas del ao, donde se presentan las
mayores incidencias parasitarias. En nuestro pas, por la gran variedad de climas y pisos trmicos
existen pocas definidas de invierno (perodo de lluvias) y de verano (temporada seca).

Por ejemplo, en la Costa Atlntica y la Hoya del Ro Magdalena normalmente los meses picos de
invierno son Abril y Octubre y los de ms intenso verano son Julio y Diciembre. La mayor
incidencia de parsitos se presenta por lo general en los meses de Mayo y Noviembre. En la
Sabana de Bogot la mayor carga parasitaria se presenta en Junio y en Diciembre y Enero, es
decir, despus de las lluvias de Abril y Mayo y de Octubre y Noviembre. La recomendacin sera
atacar los parsitos despus de las lluvias, lo anterior es simplemente para indicar solo uno de los
aspectos a contemplar en un programa de desparasitacin.

Normas generales de importancia en el control de parsitos.

Existen varias normas de aplicacin universal que se deben tener en cuenta cuando se utilizan
drogas antiparasitarias en el marco de un programa de control. Son las siguientes:

Todos los equinos de la finca deben incluirse en el programa. Muy poco conseguimos, si por
ejemplo-las yeguas infrtiles, los ponies (si se tienen), los asnos y las mulas no se vermfuga
simultneamente con el resto de caballos. Continuarn contaminando los pastos, establos y otras
reas pastoreadas por stos, con lo cual el programa de control es un fracaso.

Aquellos caballos que estn transitoriamente en la finca y todos los nuevos que ingresen deben ser
puestos en cuarentena o aislados y desparasitados antes de ser mezclados con los caballos
residentes. Muchos esfuerzos pueden desperdiciarse en pocos das por la introduccin de
animales no tratados dentro de una finca donde se administran regularmente las vermifugaciones.

Los potros deben ser protegidos contra una infestacin, particularmente por Strongylus tratando
regularmente a sus madres. El tratamiento del potro no tiene el mismo sentido en relacin con la
adquisicin y el dao causado por los grandes
Strongylus
Los exmenes de muestras fecales por el laboratorio deben realizarse peridicamente con el
objeto de mantener una estricta vigilancia de la efectividad de las drogas usadas en los programas.
La eficacia de la droga se puede determinar realizando un recuento de huevos de parsitos el da
del tratamiento antes de administrar este y comparndolo con otro recuento dos semanas despus.
El recuento antes del tratamiento es el mejor ndice de la efectividad del programa en general. Un
antiparasitario efectivo se espera que reduzca los recuentos de huevos de Strongylus, por ejemplo,
a niveles muy bajos (0 a 20 por gramo de heces) y que los mantenga en esa forma durante cinco
semanas post-tratamiento, como mnimo.

Es recomendable no utilizar el mismo compuesto antiparasitario repetidamente en los programas


de control. Se cree que cepas de parsitos y poblaciones de estos se tornan resistentes al
producto. Si demarcamos muy bien las generaciones de parsitos que afectan los equinos en una

190
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

finca en particular, podramos utilizar el mismo compuesto para cada generacin de parsitos y
cambiarlo entre generaciones. El uso regular y alternado de varios tipos de antihelminticos se
compensa por las diferencias en actividad entre uno y otro y por los efectos benficos
complementarios a juzgar por los resultados medidos a travs de los recuentos de huevos.

La administracin de antiparasitarios en la comida, es efectiva, solamente si la comida medicada


es consumida por el caballo. Con la llegada de nuevos productos este mtodo se usa con
frecuencia ya que los compuestos son menos desagradables y pequeas cantidades configuran la
dosis total necesaria. Sin embargo, el cuidador o el mismo Mdico Veterinario debern chequear
cuidadosamente que a comida se consuma totalmente sin confiarse demasiado del encargado de
alimentar los caballos.

Las etiquetas o rtulos que acompaan los productos debern leerse y entenderse completamente
antes de administrar el antiparasitario. Todas las recomendaciones sobre la dosis y los
procedimientos para preparar el producto deben seguirse cuidadosamente, as como las
precauciones y las contraindicaciones impresas en la etiqueta. El desconocer estas simplezas
puede acarrear situaciones desagradables. Son muchos los accidentes por sobre dosificacin a
causa del capricho del dueo o el desconocimiento de las normas elementales acerca del
producto.

El encargado de los caballos o su propietario debern prestar atento cuidado e identificar las
condiciones que pueden favorecer el desarrollo de los parsitos y eliminarlas cuanto antes.
Algunas condiciones que favorecen la propagacin de los parsitos son las aguas estancadas en
los potreros mal drenados, convivencia de caballos de diferentes edades, la mala alimentacin, las
fallas en el manejo y los factores ambientales como temperatura y humedad muy difciles de
controlar en nuestro medio.

En la medida que las condiciones lo permitan, los animales debern separarse en grupos
por edades. Luego de la separacin de sus madres los potros debern crecer juntos hasta
que sean yearlings (tengan un ao). Las hembras en gestacin podrn estar con las vacas
sanas y los machos adultos tendrn su propio potrero.
Cuando en un potrero se encuentran charcas o aguas estancadas, stas debern drenarse
y secarse.

La rotacin de potreros es una prctica de manejo muy antigua que favorece el control del
parasitismo, pues la poca permanencia del caballo en un potrero y el tiempo que est desocupado,
interrumpen el ciclo evolutivo de los parsitos impidiendo as su proliferacin. En el mismo sentido
se puede afirmar que un potrero densamente poblado de caballos es ms propenso para el
desarrollo de parsitos y por lo tanto requiere una mayor atencin. En algunas ocasiones la
rotacin de los pastizales es imprctica ya que el perodo de retirada puede coincidir con una
poca en que los pastos alcanzan un valor nutritivo ptimo para los animales. Esto se refuerza an
ms por el prolongado periodo de supervivencia de las larvas de los parsitos.

Los corrales, las cuadras o establos, las pesebreras y las instalaciones en general, deben
ser ventiladas y con acceso de sol para mantenerlas secas. La cama debe permanecer seca
y se cambiar con frecuencia. Los bebederos en los potreros se deben instalar de tal
manera que no se formen charcas y que los caballos no los ensucien con la materia fecal. El
agua debe ser limpia y se chequear peridicamente para larvas y gusanos de parsitos.

Las buenas costumbres sanitarias y un alto nivel de nutricin asegurarn el xito en los programas
de control de parsitos internos.

Mtodos de administracin de antiparasitarios.

191
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Por un buen nmero de aos los antihelmnticos se administraban a los caballos por va oral
usando una sonda plstica que se haca pasar hasta el estmago. Esto era as, .por la naturaleza
fsica de los compuestos disponibles, por el gran volumen de las dosis teraputicas o por la poca
palatabilidad (apetencia) de los medicamentos. De todas formas, este tipo de administracin
aseguraba la dosis deseada. Por el desarrollo y la evolucin de nuevos productos, los agentes
teraputicos ms activos requieren niveles de dosificacin ms bajos y son tambin ms
palatables. Algunos productos usados para desparasitar caballos (Diclorvos, Febantel,
Mebendazol, Oxibendazol, Pyrantel y Tiabendazol) pueden darse en la comida. Ms
recientemente, aparecieron las formulaciones tipo pasta para administracin oral las cuales son
fciles de manejar sin prdida alguna de su actividad antihelmntica. Estn disponibles como
pastas el Tiabendazol el Mebendazol, el Febantel entre otros. Con el reciente advenimiento de las
Ivermectinas (productos derivados de Streptomyces avermitidis) la ruta parenteral de
administracin se ha revivido. El levamisole tambin podra usarse por esta ruta pero se ha
mostrado deficiente en actividad y adems induce una reaccin de los tejidos musculares en el
sitio de aplicacin. Solo la experiencia clnica determinar si la administracin parenteral de las
lvermectinas es posible para uso rutinario en el control de parsitos en el caballo.

Control de parsitos externos.

Los parsitos externos del caballo (ectoparsitos) incluyen caros, garrapatas, piojos, moscas y
mosquitos. Cuando estn presentes en nmero abundante estas plagas ocasionan anemia, falta
de apetito (anorexia) clico, inflamacin de la piel (dermatitis), adelgazamiento, prdida de pelo,
frotamiento o roce de la cola, mal aspecto general, debilidad y si no se tratan o hay descuido
incluso ocasionan la muerte. Algunas especies de ectoparsitos pueden ser vectores de
enfermedades graves en animales y humanos.

El propietario de caballos es responsable de aplicar buenos mtodos de sanidad y manejo que


prevengan el desarrollo y presencia de estas plagas. Los productos qumicos usados para el
control y la eliminacin de ectoparsitos deben manejarse con cuidado para evitar intoxicaciones
del operario. Todos los productos comerciales son efectivos cuando se usan a una concentracin
apropiada, en la dosis requerida y mediante su aplicacin adecuada. Si se aplican en la piel, bien
sea en spray, aerosoles o cremas, se deben probar primero en una pequea rea de piel, en
algunas razas de caballos (las rabes y los palominos especialmente) pueden causar reacciones
de sensibilidad en la piel, especialmente los productos derivados del petrleo, usados en diferentes
formulaciones.

Cuando se utilicen insecticidas por aspersin o fumigacin se debe tener precaucin de no


contaminar el agua y el alimento de los caballos. Si se hace en recintos cerrados se deben sacar
los caballos de las pesebreras antes de la fumigacin y devolverlos una vez el roco ha cado. Los
caballos no deben fumigarse directamente. Las aplicaciones de los productos deben coincidir con
el patrn diario de actividad de los insectos. Para controlar las garrapatas de las orejas se usarn
aerosoles y cremas colocndolos bien profundo en ambos pabellones. Las moscas, piojos,
garrapatas, mosquitos, etc., se pueden eliminar del cuerpo del caballo lavando manualmente con
esponja o aplicando directamente en aerosol pero a presiones bajas. Se procurar cubrir la
cabeza, nuca, pecho, abdomen, perin, entrepierna y miembros.

Es comn tambin hallar caros dentro de las orejas del caballo, por lo que ste sacude
bruscamente la cabeza; en este caso se pueden instalar gotas en el odo que contengan un
producto que elimine estos parsitos (acaricida). La sarna coriptica, producida por el Chorioptes
equia manera de ejemplo, se asienta preferiblemente por debajo del corvejn y de la rodilla
(carpo), por lo que los animales afectados se muestran inquietos y patean contra objetos fijos. El

192
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

colocar cremas acaricidas constantemente en los sitios afectados contribuye a solucionar estos
problemas.

Es importante tambin observar cuidadosamente las etiquetas de los preparados en relacin con
las dosis y las contraindicaciones, para evitar riesgos de toxicidad en los animales.

Leccin 28 CLICO EQUINO.

www.asdesilla.com

El trmino clico se refiere a un tipo especial de dolor que se origina en vsceras que contienen en
su estructura msculo liso, por lo comn de la cavidad abdominal. En los equinos, los clicos
biliares y los urinarios son poco frecuentes, de manera que el trmino se limita a las afecciones
dolorosas del aparato digestivo tubular.

Causas primarias y secundarias del clico.

Las causas primarias y secundarias del clico comprenden:

Factores de Nutricin: Como por ejemplo el bajo contenido de agua y alto de fibra de la racin,
alimentos de baja calidad (zanahorias daadas, cebada fermentada, maz mohoso).o dietas no
balanceadas; manejo incorrecto de la nutricin.

Masticacin Anormal: Provocada por puntas de muelas y lesiones en la boca, lengua o faringe.

Enfermedades Corporales: (Sistmicas) especialmente aquellas que cursan con elevacin de la


temperatura (fiebre) o disminucin en el consumo de alimentos (anorexia).

Parasitismo Adulto o Larvario: especialmente en potros.

Trastornos de los Vasos Sanguneos: Relacionados con el intestino, especial-mente


taponamientos, ausencia de circulacin (infarto) o intoxicacin masiva (toxemia).

193
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Infecciones del Tracto Digestivo: Con bacterias patgenas y alteraciones de la flora bacteriana del
ciego y colon que determinan formacin excesiva de gas.

Vlvulos y Torsiones (nudo intestinal): el vlvulo es un atrapamiento del intestino por s mismo y la
torsin un enrollamiento del tubo sobre su eje. Ambos determinan dolor y malestares profundos en
el caballo que casi siempre se resuelven por mtodos quirrgicos.

Lesiones del Mesenterio: Que es la tela que sostiene el tubo digestivo. Es un tejido muy delicado
y puede irritarse fcilmente provocando que sus capas se unan entre s o con otros rganos
digestivos (adherencias) y se inflamen causando dolor y fiebre (peritonitis).

Obstrucciones: Al paso de los alimentos por materias fecales resecas y duras o por un cuerpo
extrao ingerido o desarrollado en el animal (bola de pelo, piedra, tumor).

Espasmos o Contracciones: violentas en uno o varios puntos del tubo digestivo. Este se halla
hiperactivo y se contrae vigorosamente estimulando los receptores del dolor ubicados en su pared
(agua fra o alimentos contaminados).

Ulceras de la Mucosa: digestiva del estmago e intestino: La capa que tapiza el estmago y el
intestino se inflama y luego se desprende dejando verdaderas heridas o lesiones que suelen ser
dolorosas y pueden sangrar. Esto suele suceder luego de las cirugas y de los tratamientos con
drogas que irritan el estmago (antiinflamatorios)

Parlisis: De un segmento intestinal debido a prdida de la funcin (leo paraltico) o a lesiones


nerviosas, luego de procedimientos quirrgicos.

Tipos de clico.

En relacin con las causas primarias y secundarias se pueden distinguir varios tipos diferentes de
clico, segn los sntomas y con base en los resultados del examen de los sonidos abdominales
(Borborigmos) resultantes del movimiento intestinal (peristaltismo), del examen de la sangre, la
temperatura rectal, la palpacin a travs del recto del ciego y colon, el contenido fecal, el grado de
distensin abdominal y del examen, si es posible, del lquido peritoneal obtenido por puncin con
aguja a travs de los msculos del vientre.

Los tipos principales de clico son:

Obstruccin Mecnica Simple. Por taponamiento (oclusin): causada por acumulacin de alimento,
parcialmente digerido, en el intestino o por cuerpos extraos como se dijo antes. Los sitios donde
ms corrientemente se tapona el tubo digestivo son la flexura plvica del colon mayor, en el ciego y
en el leon.

Timpanismo: Por distensin gaseosa del intestino (fermentacin o produccin excesiva de gas por
Bacterias)

Espasmdico: Hiperactividad que se traduce en espasmos dolorosos o sea con-tracciones


vigorosas de la pared intestinal.

Tromboartertico: Por bloqueo de una rama pequea o grande de las arterias que suministran
sangre a la pared intestinal. Estas arterias discurren por los mesenterios de los que est
suspendido el intestino en la cavidad. Abdominal. La lesin la causan las formas larvarias del
parsito Strongylus vulgaris. La gravedad depende del tamao del rea de intestino privada de
irrigacin sangunea. La zona sin aporte de sangre muere en un estado parecido a la gangrena.

194
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

La inflamacin del revestimiento intestinal externo (peritonitis) causa dolor agudo y puede dar lugar
a que cesen los movimientos que impulsan el alimento al llegar al punto muerto, provocando por
extensin, una parlisis de tramos considerables de intestino. Estos clicos son muy graves y casi
siempre conducen a la muerte por insuficiencia del corazn.

Obstruccin Aguda: Por mal posicin anatmica. Es provocado por torsin y vlvulo intestinal, que
causan obstruccin aguda y fuertes dolores que no ceden a los medicamentos. Las porciones
intestinales quedan atadas en un nudo o enredadas en desgarros del mesenterio con
consecuencias anlogas a las de los casos de bloqueo arterial por trombos (gangrena).

Cualquier tipo de clico puede producir como secuela una rotura de intestino, aunque esta
complicacin es ms frecuente en los casos de timpanismo y en los provocados por lesiones de
parsitos. El estmago se rompe por timpanismo o sobrecarga slida o lquida, mientras que el
colon y ciego son ms propicios a sufrir las consecuencias de las lesiones parasitarias.

Factores que predisponen a sufrir clico.

Como se haba discutido en el captulo II (Alimentacin y nutricin del equino), la disposicin


anatmica del esfago, estmago e intestinos del equino lo predisponen a sufrir accidentes
digestivos. El esfago penetra profundamente en el estmago y posee un msculo constrictor que
impide la evacuacin de la sobrecarga gstrica, es decir hace imposible el vmito verdadero. Por
otra parte, el estmago es pequeo (poca capacidad) lo que obliga a los alimentos a pasar muy
rpido a los intestinos, debiendo entonces stos asumir gran parte de la digestin. El mesenterio
es largo y el intestino grueso queda muy libre, adems de ser muy desarrollado en proporcin con
el delgado lo que facilita los cambios frecuentes de posicin (estrangulaciones, nudos, etc.) los
casos de indigestin, obstruccin y constipacin adems de provocar los clicos, se complican con
la retencin de orina.

Algunos caballos son susceptibles a sufrir clicos mientras que otros no. Cada sujeto posee un
equilibrio nervioso propio, el cual desempea un papel importante en la generacin y persistencia
del clico, as como en su complicacin. Estos caballos desequilibrados reaccionan con la menor
causa (tormenta, cuando se les molesta, por cambios en el rgimen alimenticio, transporte, etc.).
La expresin de esta reaccin es un dolor abdominal, que una vez generado va a aumentar el
desequilibrio. Es muy frecuente observar esto en caballos pura sangre y Anglorabes.

El parasitismo es el origen de clicos que se repiten a menudo y con mucha frecuencia en los
potros, y en los adultos (trombos).

Aquellos caballos con vicios denominados redhibiditorios (que anulan una operacin de compra-
venta si son detectados) son por lo general tragadores de aire o poseen perversiones del gusto
(pica). Los tragadores de aire absorben aire apoyando la boca abierta sobre la puerta o rejilla de su
pesebrera y distienden sus reservorios digestivos lo cual les causa dolor agudo. Aquellos que
poseen perversiones del gusto una vez terminan de consumir su alimento o en las horas de la
noche comen su propio estircol o el de los otros caballos, o prefieren comer pajas del suelo,
arena, se comen las crines de los compaeros, los cueros de los arneses y monturas, mordisquean
las puertas de madera, lamen las paredes, etc.

Ciertos caballos carecen de Tripas segn el lenguaje popular. Su abdomen est recogido
(semejante a un perro galgo), son caballos con apetito caprichoso, de digestin difcil, seguramente
son caballos problema

Los caballos viejos, con dientes gastados, con intestinos perezosos se obstruyen con facilidad y
son animales susceptibles a sufrir clicos.

195
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Cmo se reconocen los clicos en el caballo.

Los clicos se ponen de manifiesto porque el animal se echa y se levanta a menudo revolcndose
en el suelo; se niega a comer o expulsa excrementos en cantidad anormal (generalmente
disminuida) o de calidad anormal (duros, cubiertos de moco, blandos, malolientes o diarreicos).
Tambin efecta esfuerzos repetidos por orinar, sin conseguirlo, y otras veces se patea los flancos,
se los mira repetidamente y agita la cola. Si los dolores son fuertes suda copiosamente, el pulso se
acelera y la respiracin se torna ms agitada. Segn el tipo de clico

pueden orse ruidos intestinales (clico espasmdico) o no orse ningn sonido (clico sordo,
parlisis, vlvulo, torsin). Tambin puede haber torsin abdominal (timpanismo) en los caballos en
donde hay produccin excesiva de gas. En los casos de obstruccin aguda, el recto puede
encontrarse vaco de materia fecal. Al comenzar los sntomas, las heces detenidas en la parte del
tracto digestivo posterior a la obstruccin pueden ser eliminadas y dar una falsa impresin de
normalidad. Segn la gravedad del caso, la temperatura puede ser inferior a la normal o por el
contrario, febril. Un clico en el caballo siempre debe considerarse de suma gravedad y requerir la
mayor atencin posible. Ciertos clicos no son curables. Otros, si bien no ponen en peligro la vida
del animal (a condicin de que sean tratados a tiempo), si son perjudiciales ya que dejan secuelas
en el tubo digestivo y debilitan la condicin fsica del animal. En todos los casos, el regreso al
trabajo deber ser considerado de acuerdo con las repercusiones en el estado general. Un clico
digestivo no se debe confundir con otros procesos que provocan tambin dolor y signos de
malestar como son:

Obstruccin aguda del esfago, por masas de alimento o cuerpo extrao.


Azoturia o intoxicacin muscular (mioglobinuria) asociada con carencia de ejercicio.
Miocitis o inflamacin muscular por exceso de trabajo sobre todo en ambientes muy fros.
Clculo urinario (urolitiasis) o clculo vesical.
Peritonitis (inflamacin del Peritoneo) por ciruga, cuerpos extraos, punciones
(trocanterizacin), etc.
Infosura o Laminitis un trastorno grave de la circulacin en el pie del equino. Los cascos
estn calientes al tacto.
Inminencia de parto en las yeguas.
Inflamacin articular severa (artritis) que provoca cojera y dolor agudo.
Envenenamiento por metales pesados (arsnico, plomo y mercurio).
Inflamacin de la pleura (pleuritis) que es el rgano que recubre los pulmones y la caja
torcica interna.
Trauma agudo bien sea por fracturas de las extremidades o de la columna. Enteritis aguda
en potros (diarrea profusa y clico).
Intoxicacin sangunea (toxemia) ocasionada por Salmonella, enfermedad del hgado,
inflamacin del colon.

Manejo del clico en el equino.

Una crisis de clico debe ser considerada como un estado de urgencia, lo que no significa que hay
que asustarse, y si exponerle al Mdico Veterinario encargado, con claridad los hechos observados
mediante una buena descripcin. Durante la presentacin de la crisis, el cuidador deber prestar
atencin a los siguientes hechos:

Deber coger al caballo, embozalarlo o ponerle la Jquima.

196
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Lo pondr en libertad en una pesebrera grande, abrigada y provista de una buena cama.
Podr colocar pacas de heno o paja y/o llantas de caucho a lo largo de los muros. Si el
comportamiento del animal es violento lo que lleva a golpearse contra los muros
inmediatamente lo sacar de all y lo llevar a una manga o potrero pequeo al aire libre.
Podr protegerlo con rodilleras y polainas y tambin protegerle la cabeza, en lo posible.
Podr cepillarlo o pasarle el trapo (limpindolo) para tranquilizarlo y distraerlo.
Podr pasearlo lentamente sin agitarlo y no pararlo bruscamente. Al hacerlo deber
colocarle una capa que le cubra el cuerpo.
Si el caballo permanece acostado y descansa, tanto mejor.
En caso de crisis violentas, debe abstenerse de riesgos intiles. Un caballo que sufre Pierde
la conciencia de su medio ambiente y puede ser peligroso.
Cuando las yeguas que estn amamantando padecen un clico es necesario tomar medidas
especiales. Lo ideal es colocarlas en un rea amplia con lo cual se reducen las
Posibilidades de que lleguen a herir al potro.

No debe administrarle ningn medicamento hasta tanto el proceso no sea supervisado por
un Mdico Veterinario.

El Mdico Veterinario encargado del caso, diagnosticar y determinar el origen del clico para
poder prescribir un tratamiento adecuado. Para ello es aconsejable tener en cuenta lo siguiente:

Observar el comportamiento para valorar en forma subjetiva los signos de dolor (dolor leve o
dolor agudo-grave).

Apreciar la temperatura de la piel (piel fra o pastosa puede ser signo de shock o ruptura
del intestino).

Valorar la frecuencia y calidad del pulso (buen o mal pronstico).

Valorar los ruidos abdominales (borborigmos). Son una gula muy importante del diagnstico
y el pronstico.

Palpar el recto. Es aconsejable realizar palpaciones rctales peridicas durante el curso de


la afeccin para establecer la diferencia entre las heces que se hallan presentes desde el
principio y las que aparecen despus. Al palpar las estructuras se debe tener precaucin en
la interpretacin de los resultados.

Tomar muestras de sangre al comienza-de la afeccin y durante el curso de esta para


valorar cuidadosamente la concentracin de glbulos rojos (hematocrito), el estado de
deshidratacin y la calidad de los elementos del plasma.

Realizar una puncin abdominal (paracentesis) si el caso lo amerita. El obtener lquido


peritoneal suministrar datos muy tiles para el diagnstico y el pronstico.

Apreciar la respuesta del animal a la administracin de drogas analgsicas. Los clicos


simples responden bien.

Definir si el caso es para tratamiento mdico conservador, o por el contrario requiere ciruga
para lo cual dispondr de inmediato las condiciones de su realizacin.

197
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

En todos los casos es fundamental controlar el dolor, para lo cual dispondr de suficiente cantidad
de analgsicos (Dipirona, Meperidina, Flunixin meglumine, butil bromuro de N-hioscina, etc.).
Tambin puede hacer uso de tranquilizantes menores y relajantes musculares (Acetil promazina).
Las obstrucciones simples se pueden combatir por medio de la administracin de purgantes, aceite
mineral, sales laxantes, absorbentes de toxinas (carbn vegetal), etc.

En todos los casos en que se produce una elevacin del hematocrito es aconsejable administrar
lquidos por va venosa. En un caballo adulto se requieren 15- 20 litros en el lapso de una hora.

En los clicos espasmdicos, timpnicos o diarreicos se pueden administrar antibiticos orales con
sonda naso esofgico.

En los casos graves de clico, torsin o trombosis es imprescindible recurrir a la ciruga. Que el
animal se mejore o no, depender de la naturaleza y extensin de la lesin, as como del tiempo
transcurrido hasta llegar a establecer el diagnstico, la instauracin del tratamiento y la respuesta
del individuo al mismo.

ENFERMEDADES DE LOS MIEMBROS DEL EQUINO.

Laminitis en equinos.
www.asdesilla.com

Los miembros del equino sirven para sostener y transportar al animal; los anteriores, ms cercanos
al centro de gravedad, son sobretodo sustentadores, los posteriores son propulsores. Un caballo
con una cabeza bien hecha, un magnfico cuello y tronco, pero con extremidades con aplomos
defectuosos o que tengan entorpecido su juego y paralizados sus movimientos, realmente no sirve
para nada. Las extremidades son para el equino, lo que las ruedas son para el carro.

Las cojeras en los caballos merecen una atencin especial dada la frecuencia con que se
producen. En un sentido general se pueden definir como un sntoma de dolor con manifestaciones
que varan en funcin del lugar en que aquel se produzca. Lo primero es localizar ese lugar para; a
continuacin, determinar el tipo de lesin que lo produce.

La cojera es una irregularidad del movimiento, marcada por un defecto de sincronizacin en el


desplazamiento de los miembros entre dos apoyos o en sus apoyos en el piso. Esto toma en
consideracin no solamente las cojeras que se manifiestan en el momento en que el miembro toca

198
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

el suelo, sino tambin aquellas (ms raras) que se exteriorizan durante el perodo de sostn.

Tanto en uno como en otro caso, el caballo que cojea manifiesta su molestia ms o menos
acompaada de dolor. En otras oportunidades un caballo puede tener una lesin sea importante,
una micro fractura del carpo, por ejemplo, y no manifestar cojera alguna. Su lesin se hace
evidente al palpar la articulacin cuidadosamente hasta encontrar el sitio de la fractura; al presionar
el Sitio afectado, el caballo retirar bruscamente el miembro rechazando la maniobra. Existen
caballos delicados que exageran el dolor (caso frecuente en los pura sangre); pero tambin
existen caballos que pueden trabajar, o correr teniendo artritis o pequeas fracturas en sus
miembros. No se puede pues, en forma general, establecer una relacin significativa y exacta entre
la manifestacin y la gravedad de la afeccin a excepcin de un reducido nmero de casos.

Las causas de las cojeras pueden ser:

a) Predisponentes
b) Excitantes

Entre las causas predisponentes pueden mencionarse.

Inmadurez o mal estado nutricional


Conformacin defectuosa.
Enfermedad sistmica.
Mal herraje.
Descuido en el estado de los cascos Desequilibrios minerales.

Entre las causas excitantes se pueden enumerar:

Los traumas repetidos directos e indirectos


Incoordinacin muscular (animales cansados)

Infeccin bacteriana (vainas tendinosas y articulaciones).

Cmo proceder en todos los casos de cojera.

199
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.mascotanet.com

Cuando un animal comienza a cojear y va montado por su jinete, ste deber enseguida bajarse
de su cabalgadura, para apreciar mejor el comportamiento del animal.

Observar al caballo para ver si manifiesta signos de un fuerte dolor (dolor agudo), sudoracin
abundante, temblores, supresin parcial o total del apoyo del pie, movimientos bruscos del pie
(punzadas), etc.

Levantar y verificar los cuatro pies. Podr apreciar si las herraduras estn implantadas en forma
correcta (slidamente); si no existe algn cuerpo extrao visible o escondido bien sea entre la
herradura y la suela o entre las lagunas (surcos) de la ranilla.

De acuerdo con la gravedad de la cojera, podr adoptar tres actitudes al respecto:

Tratar la cojera en el lugar mismo si es un caso benigno.

Trasladar si el animal lo permite, a un sitio cercano donde se le brinde la mejor atencin posible.

No mover al animal del lugar del accidente y esperar auxilio de vehculo y personas.

Los casos de cojeras simples, de solucin rpida son frecuentes. Al suplir la causa, desaparece la
molestia, en estos casos pueden ubicarse situaciones como:

Caballos a los que se les ha cado una Herradura: Si el desprendimiento es incompleto, debe
quitarse la herradura completamente y volver a herrar, respetando en todos los puntos a la
herradura que le precedi.

Cuerpo extrao bajo la suela: Las herraduras mal ajustadas y con poca cobertura permiten
que se alojen cuerpos extraos bajo la suela. Descubierto a tiempo el incidente no existen
complicaciones pero la repeticin del traumatismo puede dar origen a sobresaltos por
compresin de los tejidos blandos subyacentes.

Clavo Halladizo: La penetracin de un cuerpo extrao puntiagudo o cortante en la cara


plantar del pie, hace cojear instantneamente al caballo y por tanto es posible reaccionar
rpido. Si la clavadura es poco profunda (menor de 2 centmetros) y situada en reas de
menor gravedad, la cojera se atena de inmediato cuando el caballo se trata. Esta mejora,
no importando lo espectacular que sea, no debe hacer olvidar los riesgos de
complicaciones. Es necesario consultar al profesional inmediatamente.

Cojeras debidas a herraje defectuoso: Entre estas se puede citar:

Pie picado: El clavo ha penetrado los tejidos blandos subcornea les pero ha sido extrado
rpidamente.

Pie enclavado: El clavo ha sido remachado despus de penetrar en regiones sensibles


algunas veces por divisin longitudinal del clavo en dos, durante el martilleo (clavo pajizo).
Una parte del clavo penetra en los tejidos blandos, la otra sale y se remacha normalmente.

Pie apretado: Por clavos martillados muy recogidamente. Sucede cuando un herrero
distrado coloca una herradura izquierda en un pie derecho o viceversa.

200
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Las cojeras graves: merecen atencin especial y deben ser resueltas por un tcnico especialista
que decidir el camino a seguir. Exceptuando los casos de Laminitis (un trastorno grave de la
circulacin del pie), la mioglobinuria (intoxicacin muscular) y las fracturas ms o menos graves,
los cuales requieren y obligan a un tratamiento inmediato, las dems lesiones de los miembros que
causan cojera, o imposibilidad del movimiento pueden necesitar de mayor tiempo para su completa
evaluacin y resolucin. Las lesiones de las extremidades en los caballos pueden ser de muchas y
diferentes clases. Algunas de las ms importantes aparecen a continuacin:

Laminitis: Es un problema del metabolismo con causas multifactoriales que lleva a la inflamacin,
degeneracin y destruccin de la unin entre las lminas crnea y sensible del casco. El problema
le ocasiono mucho dolor al caballo en los pies afectados, le impide mantenerse en pie y le
ocasiona otros trastornos al animal (inapetencia, fiebre, temblones, respiracin aumentada, etc.)
una de las secuelas graves de este trastorno es la rotacin del tejuelo (tercera falange). Si el
problema se resuelve a tiempo pueden persistir una cojera crnica y ataques sucesivos y
recurrentes. Muchos ejemplares valiosos han muerto debido a complicaciones de casos de
laminitas.

Mioglobinuria o Azoturia: Trastorno caracterizado por degeneracin muscular y parlisis o


amarra miento asociado con el ejercicio. Denominada tambin Enfermedad de os Lunes
que por lo general aparece a los pocos minutos que el animal comienza a trabajar despus
de un fin de semana o de varios das de descanso con una alimentacin por encima de lo
normal (sobrealimentacin). De hecho, se puede evitar reduciendo la alimentacin en los
perodos de descanso o ejercitando moderadamente al animal una vez retorna al trabajo
luego de descansar.

Fracturas: Cualquier hueso del cuerpo del caballo puede sufrir una fractura, pero los ms
frgiles son la cuartilla, el tejuelo o tercera falange, los sesamoideos, y los del carpo, la caa
y la pelvis.

Las fracturas pueden ser simples o compuestas y los fragmentos fracturados pueden encontrarse
muy separados o bien se asoman a travs de la piel (fracturas conminutas y abiertas). No es
necesario insistir sobre la extrema gravedad de toda fractura en los miembros del caballo. La
formacin de callosidad sea importante es alterada por el gran peso que soporta el miembro
afectado, as como la dificultad en la reduccin de la fractura durante el tiempo necesario. Sin
embargo, es necesario saber que en todas las pocas se han tratado de curar las fracturas. El
progreso actual de la ciruga ortopdica equina permite reparaciones satisfactorias. El que se
realice o no el tratamiento depender del tipo de animal, el servicio que presta, la naturaleza de la
fractura, as como las consideraciones econmicas importantes en estos casos.

Las fracturas de los huesos del carpo, los sesamoides y las de la tercera falange (tejuelo) pueden
ser operables dependiendo de su naturaleza; las que suceden en los huesos de la pelvis o las de
la columna vertebral determinan casi siempre el sacrificio del animal.

Esparavanes: Los esparavanes son afecciones de la articulacin del corvejn (tibiotarsal).


Algunos tratadistas los clasifican como esparavn blando (esparavn falso) y esparavn
seo. Estos trastornos se explican muchas veces por la conformacin defectuosa del
corvejn, el traumatismo (concusin, esguince) repetido y los desequilibrios minerales. En la
mayora de los casos la accin del corvejn est disminuida; la cojera muy a menudo
desaparece con el ejercicio y vuelve una vez que el caballo ha descansado. Para realizar el
diagnstico se acude a la famosa prueba del esparavn que consiste en levantar la pata
afectada sosteniendo el corvejn flexionando en ngulo agudo durante unos pocos minutos;
para soltarlo luego y hacer desplazar al animal; la cojera quedar acentuada en los primeros
pasos despus de soltar la pata. Las cojeras por inflamacin de la babilla (gonitis) y por
desplazamiento de la rtula tambin se acentan por la misma prueba.

201
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Enfermedades de Navicular: Se le suele ubicar como una enfermedad de los pies anteriores,
pero en raras ocasiones puede aparecer en tos posteriores. Afecta al hueso navicular y a las
estructuras que conforman su articulacin con la tercera falange. La enfermedad del
navicular (sesamoideo distal), es una de las causas ms comunes de cojera intermitente en
caballos mayores de cuatro aos de edad. Definitivamente los defectos en la conformacin
del pie y el trauma repetido (concusin) favorecido por esta conformacin, son factores
determinantes en su desarrollo y exacerbacin. El herraje correctivo y diversos
procedimientos quirrgicos (neurectoma) pueden ayudar a sobrellevar el padecimiento que
siempre se considera de pronstico reservado.

Artritis: Significa inflamacin de una articulacin y sus sntomas caractersticos son hinchazn,
calor y dolor al movilizarla. Las articulaciones se componen de diversas estructuras, pudiendo estar
daadas una o varias de ellas; a veces los sntomas que se producen son los propios de una
torcedura articular, por lo que se hace necesaria una investigacin veterinaria para determinar la
naturaleza exacta del trastorno. Por ejemplo, la aparicin de una tumefaccin o hinchazn a nivel
de la articulacin del menudillo (nudo) puede deberse a un dao de la cpsula articular, o a una
lesin del ligamento de sustentacin o de las superficies articulares. La superficie de los huesos
que forman una articulacin est revestida d cartlago, un tejido ms blando que el hueso.
Cualquier proceso traumtico o infeccioso daa esta superficie articular provocando una reaccin
inflamatoria, es decir, una artritis. La hinchazn en la artritis est producida por un aumento de la
cantidad de aceite articular (lquido sinovial) que hace que la cpsula se abombe. Suele ser de
consistencia blanda y puede detectarse en ciertos puntos alrededor de la articulacin. El rea
artrtica de la superficie articular es similar a una lcera. O se cura, o se va haciendo cada vez ms
profunda, hasta que alcanza el hueso que se encuentra por debajo, el cual a veces reacciona
produciendo nuevo hueso, en un esfuerzo por reparar la lesin.

Sin embargo, este nuevo hueso a menudo resulta demasiado frgil o demasiado abundante, de
forma que no sirve para que se realice una reparacin funcional de la articulacin. Se aprecian las
consecuencias en forma de erupciones o excrecencias seas que parten de la superficie articular.

De estas se desprenden pequeos fragmentos, que quedan libres en la cavidad articular y se


denominan ratones articulares (chips), nicamente visibles por radiografas.

Las artritis se denominan segn el rea anatmica en donde estn ubicadas, por ejemplo:

Carpitis: Inflamacin aguda o crnica de la cpsula articular y estructuras asociadas al


carpo.
Coxitis: Inflamacin de la articulacin coxofemoral.
Gonitis: Inflamacin de la articulacin femoro-tibio-rotuliana (babilla o gordetillo)
Omartritis: Inflamacin de la articulacin del hombro.
Bursitis: Las bursitis son inflamaciones agudas o crnicas de las bolsas o vainas articulares.

Las bolsas afectadas ms frecuentemente son aquellas que son superficiales y estn localizadas
sobre prominencias seas o entre tendones. Algunas bursitis importantes en el caballo son:

Bursitis de la Tuberosidad isquitica magullamiento del coche. Bursitis del


tarso (agrin o chepelet)
Bursitis de la apfisis olecraniana (cordillera, codo) Bursitis
Trocantrica (trocanter mayor)
Bursitis intertubular (cavidad bicipital) Bursitis
navicular (Hueso navicular)

Las bursitis se caracterizan por poseer derrame seroso que provoca una rpida hinchazn con

202
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

calor local y dolor. Se pueden infectar por procedimientos qu tienden a drenar ese derrame.
Conforme la bursitis se vuelve crnica, la hinchazn local y el calor ceden, pero el rea contina
dolorosa a la palpacin o al movimiento. Las bolsas infectadas requieren tratamientos vigorosos
con antibiticos y drenaje en condiciones aspticas. Las secuelas son serias y la recuperacin
lenta.

Tendinitis: Tambin denominada tendn arqueado o jalado. Es una inflamacin aguda o crnica
de un tendn. Se observa con mucha frecuencia en caballos sometidos a ejercicios rpidos,
especialmente los de carreras, polo o salto. Los tendones flexores se afectan ms frecuentemente
que los tendones extensores, y los de las extremidades anteriores ms que los de las
extremidades posteriores. De ests, el flexor superficial est ms implicado en el tendn
arqueado corriente del caballo de carreras.

Las causas ms comunes comprenden la sobre extensin o hiperextensin del tendn sin un
apropiado entrenamiento, la continuacin del trabajo o el entrenamiento despus de haber
aparecido los primeros signos de dolor del tendn, la fatiga y el trabajo rpido en superficies
duras o speras o en pistas con barro, el herraje inapropiado que recarga el esfuerzo a los
tendones flexores. La conformacin defectuosa y el trabajar o correr los caballos a edades muy
tempranas son causas predisponentes que pro-vocan tendinitis.

- Linfangitis: Es la inflamacin de los vasos y ganglios linfticos, casi siempre secundaria a


infeccin diseminada de la piel (celulitis) y que suele afectar a los miembros posteriores. Se
desarrolla tras infeccin por bacterias que producen pus (estreptococos y estafilococos). Estos
grmenes patgenos penetran la piel y se extienden a lo largo de la circulacin linftica
provocando una hinchazn caliente y dolorosa de todo el miembro con salida (exudacin) de
lquido claro (seroso) en diversas zonas, en particular el corvejn y a lo largo de la cara interna
del muslo.
La falta de ejercicio regular puede ser un factor que contribuya a la presentacin, casi siempre
se presenta en caballos en buen estado. El animal se torna febril, no come y se le aumenta el
pulso y la respiracin. Una cojera grave acompaa la tumefaccin. El tratamiento debe ser
vigoroso, persiguiendo el combate y erradicacin de los microbios y la reduccin de la
hinchazn (antiinflamatorios). Se indica un ejercicio moderado y compresas tibias para aliviar
las molestias, la alimentacin con granos debe reducirse siquiera a la mitad.

- Hormiguillo: En el caballo, es un trastorno que afecta a la pared del casco y a su superficie


plantar (suela). Se caracteriza por prdida de sustancia y cambios en las caractersticas
normales del estuche crneo (capa crnea). En algunos casos se cree es secuela de laminitis
crnica leve. La cojera es muy frecuente. Al inspeccionar la suela, se aprecia un aspecto blando
y pastoso de la superficie interna de la pared. Se puede formar una cavidad debida a la prdida
de sustancia crnea. Al golpear se aprecia un sonido hueco en la parte afectada. Algunos lo
denominan mazamorra, mal de casco, pododermatitis o necrobacilosis y la asocian con un
grmen de los barrizales y terrenos pantanosos (Spherophorus necrophorus). El adecuado
cuidado de los cascos (higiene y desinfeccin), el establecimiento de lavapatas y el drenaje de
pantanos y barrizales contribuyen a evitar este trastorno limitante del caballo.

Periostitis (Osteitis): El periostio es una fina membrana que recubre la superficie de los huesos. En
la prctica, apreciamos trastornos seos en forma de bultos, pequeos o grandes, dolorosos o no,
que pueden producir cojera. Algunos los denominan huesos en anillo espigones, osculos,

mataduras o protuberancias de la caa (el metacarpo y el metatarso) o en trminos

203
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

veterinarios, exostosis o excrescencia sea. De hecho, no slo aparecen en los huesos de


la caa. En conjunto estas alteraciones se deben a la inflamacin y crecimiento anormal del
periostio. La reaccin suele extenderse a los tejidos vecinos, produciendo una hinchazn
fibrosa (dura). Muchas veces los espigones o protuberancias estn producidos por
fracturas muy tenues, difciles de ver por Rayos X. Sobre estas microfracturas se establece
un callo que provoca inflamacin del periostio y un agrandamiento doloroso en la zona
donde se encuentran. Puede daarse tambin el periostio cuando hay desgarros de
ligamentos o cpsulas articulares en el lugar donde se insertan en el revestimiento externo
del hueso. Se debe a este fenmeno, por ejemplo la aparicin de Los osculos y de
sesamoiditis. En estos casos, la reaccin es la misma: calor, dolor e hinchazn locales. Una
de las osteitis de mayor significado es la que se presenta en el tejuelo (tercera falange) la
cual provoca cojera crnica.
Leccin 30 DESINFECTANTES Y DESINFECCIN.

Un desinfectante es todo agente capaz de destruir a los microbios que causan enfermedad; el
trmino se reserva generalmente a las sustancias utilizadas para objetos y cosas inanimadas. Se
diferencian de los antispticos, porque stos impiden el crecimiento y el desarrollo de las bacterias
cuando se aplicacin a los tejidos vivos.

En las condiciones corrientes, la higiene y la limpieza adecuada de los establos elimina la mayora
de los microorganismos; sin embargo, los que permanecen pueden dar origen a un brote de
enfermedad infecciosa. De ah que el usar adecuadamente un buen desinfectante constituye una
medida de prevencin necesaria. Su empleo es ms urgente y necesario en el caso que se
manifieste en los caballos una enfermedad transmisible caso en el cual todas las instalaciones y
utensilios sern desinfectados minuciosamente.

La eficacia de la desinfeccin depende, fundamentalmente de los siguientes factores:

- Una buena limpieza con abundante agua y jabn detergente germicida.


- Estricto cumplimiento de las indicaciones del fabricante para su uso, especialmente en
relacin con las diluciones empleadas.
- La temperatura, puesto que muchos de los desinfectantes son ms efectivos cuando se
aplican tibios o calientes.
- La forma de aplicacin y el tiempo que dure el contacto.
La minuciosidad de la desinfeccin, puesto que cualquier zona que no sea sometida a la
accin del agente puede guardar microbios que causen enfermedad.
- La luz solar posee propiedades para matar grmenes, pero su accin es variable y
superficial.

El calor y algunos productos qumicos son ms efectivos. La aplicacin de calor por medio de
vapor o agua en ebullicin es un mtodo eficaz. Quizs el mejor de todos es el flameo o llama para
paredes, pisos y otras superficies, seguido de aplicacin de un buen desinfectante, ojala caliente.
Hay que recordar que la simple aplicacin de agua hirviendo sobre una superficie, no asegura ni
significa que necesariamente haya sido desinfectada, cuando se elija un desinfectante se debe
tener en cuenta que no todos los microbios son sensibles a los mismos agentes qumicos. De
todos los desinfectantes disponibles hoy por hoy quizs los productos a base de yodo y el
formaldehdo (formol al 10%) se consideran los ms prcticos y efectivos, seguidos del amonio
cuaternario, los cresoles (creolina), los fenoles sintticos y los hipocloritos.

EL BOTIQUN DE PRIMEROS AUXILIOS.

204
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Como se dijo oportunamente, la administracin de medicamentos debe hacerse bajo control y


vigilancia del Mdico Veterinario, so pena de incurrir en errores costosos. No obstante en toda
caballeriza hay que hacer frente a una seri de necesidades bsicas para lo cual se debe disponer
de un botiqun con los elementos indispensables, algunos de los cuales pueden ser:

- Desinfectantes y antispticos Lquidos. Como se dijo en la parte anterior los desinfectantes


se limitarn para su uso en instalaciones y equipos. El caballo tiene una piel muy sensible y
slo se usarn antispticos suaves y ojala diluidos correctamente si se requiere lavar cortes
y heridas. Los productos a base de yodo (yodo-polivinil-pirrolidona) son usados con mucha
frecuencia en este tipo de casos. El agua oxigenada (perxido de hidrgeno) es muy eficaz
tambin para lavar cortes y heridas. Si no hay nin-guno a mano, el agua tibia (luego de
hervirla) con sal, es muy eficaz.

- Polvos antispticos. Muy importantes, ya que los cortes pequeos (rasguos) curan mejor,
una vez limpios, mantenindolos secos y protegindolos de la suciedad con estos polvos.
Algunos de estos, vienen asociados con repelentes de insectos para evitar gusaneras. Use
el que le recomiende el Mdico Veterinario.

Ungento antisptico. Un buen ungento suave, a base de zinc o sales de titanio, ayudar a
prevenir la formacin de tejido cicatrizal (granulacin) y favorecer en cambio la
regeneracin a partir de los bordes sanos, una vez curada la herida. Tambin estimule el
crecimiento del pelo.

- Emplasto de caoln. Tiene muchos usos: aplicado caliente, en forma de cataplasma bajo una
venda, alivia las distensiones y torceduras; si se aplica en una herida abierta o punzante
(incisa) y difcil de limpiar, chupar la suciedad que se ver en forma de pus o manchada la
compresa con el caoln. Al ser una sustancia natural y no un medicamento, el caoln no
perjudica la cicatrizacin ni infecta y de hecho, a menudo beneficiara la recuperacin.

- Linimento. Son productos de muchas marcas, unas ms fuertes que otras a base de aceites,
esencias, contrairritantes y antiinflamatorios muy tiles para aliviar torceduras y
distensiones. Se usarn siguiendo las instrucciones del fabricante.

- Ungento oftlmico. Las partculas de polvo, los catarros, los araazos, los golpes con la
fusta o los dedos del jinete, etc., pueden perjudicar los ojos y por ende la visin del animal.
En estos casos, se debe baar el ojo con un antisptico suave en solucin dbil con agua y
aplicarse un ungento oftlmico para aliviar la irritacin.

- Glicerina neutra. Muy eficaz para lubricar e impregnar las torundas en el momento de hacer
limpieza en los pabellones de las orejas. Debe usarse para lubricar la sonda nasolagrimal; la
sonda nasogstrica y el termmetro a la hora de realizar los procedimientos pertinentes.

- Jarabe para la tos. Lo debe administrar el Mdico Veterinario, pero es conveniente tenerlo
siempre a mano. A veces, la tos es simplemente el resultado de comer heno muy aprisa.

- Pocin para clicos. En la mayora de casos de clico, salvo que se tenga mucha
experiencia, conviene llamar al Mdico Veterinario. No obstante, por si ste no puede
desplazarse inmediatamente, se puede ganar tiempo, siempre y cuando ste as lo indique,
teniendo a mano alguna pocin recetada en otras ocasiones. Un ejemplo tpico es el empleo
de las sustancias que contrarrestan la produccin excesiva de gases (antifermentativos,
antiflatulentos).

205
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

- Sal de Higuera. Es buena para los caballos sometidos a dietas muy acalricas. Un puado
semanal les sienta bien.

- Sulfato de Magnesia. Muy til para caballos sometidos a raciones de grano y forraje seco.
Dos a tres cucharadas grandes en la comida provee un ligero efecto laxante.
- Sal y Agua. Es refrescante y sirve para endurecer la piel. Aplicacin con esponja en el
lomo y detrs por debajo de la paleta (hombro) o donde se aplica la cincha, contribuye a
prevenir las mataduras y las llagas.

- Antiparasitarios. De dos clases: Para erradicar parsitos internos y externos. Dentro del
programa de control de parsitos expuesto antes, se programar la administracin segn
sean los recuentos de huevos, peridicamente (mnimo cada tres meses). Es conveniente
no comprar una sola marca o un solo producto si no disponer varias clases y en varias
presentaciones.

- Vendas para cubrir heridas. Se pueden fabricar con gasa y algodn hidrfilo, colocando
ste por debajo de la gasa y recubriendo nuevamente con gasa, o comprarlas listas para
usar.

- Vendas de Yeso. Se deben aplicar bajo indicacin profesional y en los casos


expresamente sealados por l siguiendo las instrucciones del fabricante.

Instrumental quirrgico. Lo ms importante es poseer como mnimo tijeras y pinzas. Las tijeras (un
par) estarn afiladas pero de puntas romas, para cortar el pelo de los bordes de las heridas o
cortes que necesiten vendajes. Adems es til disponer de trozos de tela como apsitos o
compresas, tiras largas de tela para cubrir y vendar heridas, un paquete grande de gasa y otro de
algodn hidrfilo y uno o dos pares de vendas de crep. Si se es un experto, tambin se dispondr
de una jeringa hipodrmica y agujas de varios calibres, pero slo debern poner inyecciones los
que realmente saben lo que hacen, no es en realidad difcil, pero hay que saber donde clavar la
aguja y cmo usar con destreza y rapidez la jeringa.

BOTIQUN VETERINARIO

Toda finca debe contar con un botiqun para primeros auxilios que consten de los siguientes
objetos.
Jeringas (30 20 10cm) con sus correspondientes repuestos (mbolos, empaques, tubos
de vidrio, agujas etc.).

Linimento para golpes, a utilizar para endurecer la piel que ha sufrido una rozadura o
mataduras que han sido ocasionadas por la cincha, una vez ha sido curada la herida

Bolsa de fro instantneo

206
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Gasas estriles.

Toalla

Agujas para sutura y para jeringa, de diferentes dimetros y tamaos.

Seda para hacer suturas (de uso veterinario).

Termmetro clnico.

Bistur, pinzas y tijeras.

Equipo para aplicaron de sueros.

Tela adhesiva

Productos veterinarios tales como:


Antibiticos.
Sulfamidas
Antispticos, bactericidas, fungicidas, etc.
Hormonas (oxitocina)
Vermfugos internos y externos

Pomadas desinflamantes, repelentes y cicatrizantes.

Actividades de autoevaluacin unidad 2

Preguntas sobre la Unidad

Actividades prcticas relacionadas con la unidad

Fuentes documentales de la Unidad 2

207
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

UNIDAD 3

Nombre de la Unidad
Introduccin

Justificacin
Intencionalidades Formativas
Denominacin de captulo 7
Denominacin de Leccin 31
Denominacin de Leccin 32
Denominacin de Leccin 33
Denominacin de Leccin 34
Denominacin de Leccin 35
Denominacin de captulo 8
Denominacin de Leccin 36
Denominacin de Leccin 37
Denominacin de Leccin 38
Denominacin de Leccin 39
Denominacin de Leccin 40
Denominacin de captulo 9
Denominacin de Leccin 41
Denominacin de Leccin 42
Denominacin de Leccin 43
Denominacin de Leccin 44
Denominacin de Leccin 45

208
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

UNIDAD 3.
ACTIVIDADES COMPLEMENTARIAS EN EQUINOS

CAPITULO 7 MANEJO Y ADIESTRAMIENTO DEL EQUINO

Introduccin

Leccin 31 MANEJO Y ADIESTRAMIENTO DEL CABALLO.

www.tierradecaballos.cl

Para entender de manera mas clara y precisa algunos de los procesos que se comentaran en este
capitulo, considero de gran importancia conocer primero el fenmeno fisiolgico del crecimiento, ya
que este nos determinara la hora de de realizar ciertas faenas propias en el manejo de los equinos,
como es el caso de el destete, el adiestramiento, la castracin y otras mas que comentaremos a
continuacin, al igual de cmo es el comportamiento social de los caballos. As pues tenemos:

COMO CRECEN LOS CABALLOS

209
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

De acuerdo a la informacin suministrada por el Doctor Lus Javier Otlvaro Cardona, MVD. U. de
A Asesor Tcnico Lnea Equina Finca S.A. segn los parmetros zootcnicos descritos en
diferentes publicaciones en el mundo, los potros al momento del nacimiento deben tener unos
valores normales de talla y peso, acordes con su tipo; por ejemplo, se espera que un potro de raza
liviana (como lo es el caballo criollo colombiano) debe medir el 61 64% de su talla adulta y debe
pesar 7.5 8.5% de su peso adulto. Los potros normalmente alcanzan el 90% de su alzada adulta
al ao de edad, mientras que, slo deben lograr el 60% de su peso adulto en este mismo tiempo,
debido a que un aumento exagerado de peso tiende a aumentar la incidencia de enfermedades
ortopdicas del desarrollo. Se sabe que al ao, el hueso de la caa ha alcanzado el 100% de su
longitud, pero slo tiene el 90% de su circunferencia adulta.
El contenido seo mineral y su resistencia tambin incrementan con la edad, aunque el contenido
mineral seo solo llega a su pico entre los 3 y 4 aos de edad (madurez sea). Anatmicamente,
un hueso largo consta de un cuerpo o difisis y dos extremos o epfisis, uno superior o proximal y
uno inferior o distal, separados ambos de la difisis por una placa de crecimiento o fisis (de tipo
cartilaginoso).

En el equino, la nutricin inadecuada, el sobrepeso, el estado fisiolgico de las hembras (preez),


as como mltiples factores de manejo, incluidos la aplicacin de esquemas de ejercicio fsico
inadecuados, tales como la cuerda muy corta y a poca edad o el inicio del proceso de doma y
adiestramiento muy pronto en la vida (generan excesos de presin articular, con irritacin de las
fisis y posterior mineralizacin) pueden contribuir al modelado, formas y apariencia final de los
huesos, as como a la desaparicin de la placa cartilaginosa epifisiaria.

Los huesos largos, generalmente, presentan uno o ms centros de osificacin, los cuales se
cierran en diferentes momentos de la vida; de la elongacin o estiramiento de ellos, depende el
que un individuo pueda crecer y alcanzar su talla. El crecimiento de un equino llega a su fin en el
momento en que las placas epifisiarias de los huesos se mineralizan y se cierran, con lo cual su
crecimiento longitudinal se detiene definitivamente. Esta fusin se produce normalmente en
perodos definidos para cada hueso. Por ejemplo, el hueso hmero cierra su fisis proximal entre los
26 y los 42 meses de edad y el extremo distal entre los 10 y los 17 meses; el radio cierra su fisis
proximal entre los 11 y los 18 meses, mientras que la fisis distal se cierra entre los 22 y los 42
meses; la fisis distal del gran metacarpiano (hueso grande de la caa en los miembros anteriores)
se cierra entre los 6 y los 18 meses; la primera falange cierra su fisis proximal entre los 6 y los 15
meses de edad, en igual forma, se comporta la falange media.

El hueso fmur (del miembro posterior) cierra su fisis proximal entre los 36 y los 42 meses,
mientras que la fisis distal se cierra de los 21 a los 42 meses; la tibia cierra su fisis distal
aproximadamente a los 24 meses, y la fisis proximal entre los 36 y los 42 meses; los huesos del
corvejn cierran su crecimiento entre los 19 y los 36 meses. Los huesos de la caa y las falanges
del miembro posterior se comportan igual que los del miembro anterior. De los pocos estudios
realizados en nuestro pas sobre cierre de fisis seas en equinos criollos, se ha encontrado que se
comportan en forma similar, como se pudo concluir de una evaluacin radiolgica del cierre de la
fisis distal del radio, realizada en el Criadero la J, donde encontraron que en promedio ocurri el
cierre a los 21 meses de edad (comunicacin personal, Dr. Juan C. Cabal), resultado este
compatible con los obtenidos en equinos de otras razas, en diferentes estudios hechos en el
mundo.

Como se puede observar, al analizar las edades en las que ocurren los cierres epifisiarios de la
mayora de los huesos largos del esqueleto equino, ninguno de estos huesos mantiene su
crecimiento por encima de los 42 meses de edad, lo que indica que el crecimiento vertical de un
equino alcanza su valor mximo a los 42 meses (talla o alzada adulta) y no a los 60 meses como
culturalmente est propuesto para nuestro caballo criollo colombiano. Vale la pena tener en cuenta

210
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

este reporte, como respaldo tcnico para revaluar la exigencia de alzada mnima hasta los 5 aos
para los caballos de pista, descrita en el reglamento de Fedequinas, ya que biolgicamente no
existe alguna posibilidad de que un equino contine creciendo hasta dicha edad, despus de los 42
meses, excepto por razones patolgicas (no descritas en el equino). Cualquier diferencia adicional
que se pueda observar en la alzada de un equino, despus de los 42 meses de edad, estar
sustentada en engrasamiento dorsal, longitud de pinzas o espesor de herraduras. Igualmente, es
importante recordar que la aplicacin de sistemas de ejercicio fsico inadecuados a edad temprana,
tales como la cuerda excesiva o el inicio del proceso de doma y adiestramiento, pueden provocar
el cierre temprano de las fisis seas debido al estrs que se genera a nivel fisiario y articular, con la
posterior mineralizacin de las placas y su cierre definitivo.

Con base en los reportes existentes en la zootecnia del mundo sobre parmetros de desarrollo y
crecimiento y en la observacin del comportamiento en el crecimiento de potros criollos
colombianos de diferentes zonas del pas, a los cuales se les haba corregido el esquema de
manejo nutricional y dietario, incluido el manejo de las yeguas de cra en el ltimo tercio de
gestacin (esquema de manejo nutricional similar en todos los ejemplares, para disminuir los
sesgos estadsticos), y teniendo en cuenta las expectativas mnimas de crecimiento descritas en el
reglamento de Fedequinas, planteamos una curva de crecimiento para potros criollos colombianos
que cumpliera con los parmetros zootcnicos ya descritos (61-62% de la talla adulta al momento
del nacimiento, 90% de la alzada a los 12 meses, 97% de la alzada adulta a los 24 meses y 100%
a los 42 meses); se sacaron los promedios reales de potros y potrancas de las distintas
modalidades de paso de diferentes edades y se obtuvo la curva real de crecimiento, la que
comparada contra la curva hecha con base en parmetros ideales, nos mostr que los
crecimientos reales eran superiores. Por tal razn, las curvas ideales fueron analizadas
estadsticamente para refrendar su validez; se les aplicaron regresiones estadsticas, las cuales
arrojaron confiabilidades del 97 y 98 % para la curva de alzada y la curva de peso,
respectivamente.

Estas curvas siguen siendo convalidadas actualmente en gran cantidad de explotaciones equinas
de todo el pas, y nos siguen demostrando su validez estadstica; igualmente, nos han permitido
hacer una crianza del caballo criollo ms objetiva, ya que nos define parmetros serios de
desarrollo para cualquier tipo de ejemplar. Adicionalmente, con base en los resultados obtenidos,
hemos logrado tumbar un paradigma de crianza muy generalizado en el pas, con el que
normalmente nos respondamos cuando los potros no crecan: la gentica. Aunque es cierto que la
gentica determinar tipos y tamaos, calidad, color, fenotipo, etc., tambin es cierto que la
expresin gentica es altamente alterable por factores de tipo ambiental y de manejo, y la nutricin
es uno de los que ms afecta. Por ejemplo, un potro con informacin gentica para que tenga
buena alzada adulta, puede quedarse pequeo porque nutricionalmente no se le permiti que
expresara todo su potencial.
Histricamente, el manejo nutricional del caballo criollo ha tenido muchos errores debido a la alta
tendencia que existe entre la sobre nutricin, la subnutricin de componentes importantes como la
protena o los minerales, y en el peor de los casos la desnutricin, impidiendo la verdadera
expresin gentica de la gran mayora de la poblacin equina criolla colombiana.

Leccin 32 Comportamiento social del caballo.

Si pretendemos domar a nuestro caballo, primero deberemos entender su comportamiento y cules


son sus necesidades.

La etologa es una ciencia muy apasionante que estudia el comportamiento de los animales, y muy
en especial, al tratarse de la conducta equina.

Un error muy comn que tienden a cometer los humanos en respecto a los equinos es pretender
que estos piensen y acten como ellos, ya que otras especies si se han sometido a un proceso de
humanizacin ms elevado, cosa que en los equinos no ha sido posible. Los caballos son animales

211
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

de instinto y no de razn que es una cualidad humana, sus demostraciones de la supuesta


inteligencia no son ms que el resultado de un adiestramiento basado en la repeticin que se
traduce en una diversidad de reflejos condicionados por el hombre.

Su mentalidad esta basada en instintos desarrollados en el estado salvaje como medio de


supervivencia contra los riesgos naturales del medio y de sus depredadores, es decir son el
resultado de sus instintos atvicos y el medio que lo rodea, debido a la domesticacin, algunas
conductas se fueron perdiendo y otras se modificaron.

El caballo es un animal instintivo que aprende a travs del reflejo condicionado, y lo fija en su
memoria retentiva. Tiene una gran capacidad de memoria. En general, no es un animal agresivo,
es, ms bien, temeroso y sensible al dolor. Posee la capacidad de huir a gran velocidad. Le es
propio un instinto gregario muy desarrollado expresado al vivir en estado salvaje formando
manadas. Dentro de este grupo organizado socialmente los ms jvenes aprenden de la
observacin del comportamiento de los adultos.

El temperamento es nervioso, lo que est muy relacionado con la gentica, con la raza y con el
orden social dentro de una manada.

El caballo es un animal con tendencia a vivir en manada, en un grupo social. Como cualquier
grupo, una manada de caballos se estructura a travs de unas reglas y una de las ms importantes
es la jerarqua.

Estructura social.

Instinto gregario natural: Forman grupos, generalmente de dos a veintin individuos (Harn)
comandados por un padrillo y el resto lo conforman las yeguas y las cras. El nmero de yeguas
que tiene cada padrillo est balanceado naturalmente por la capacidad de este ltimo para poder
aparearse con una cantidad determinada de hembras. Las hembras que no se reproducen a
menudo son expulsadas de la manada. Las cras permanecen en el grupo hasta los veinte y
veinticuatro meses de vida (madurez sexual), momento en que el padrillo los elimina de la manada
y forman una manada de machos jvenes y una manada de hembras. El grupo de machos est
liderado por el individuo ms dominante del grupo que, poco a poco, va expulsando a los
integrantes uno a uno, y estos se van incorporando a manadas de potrancas solas y as se van
formando nuevas manadas.

Aproximadamente, a un seis por ciento de los potrillos que nacen en un grupo se les permite
permanecer en el mismo, de esta forma se asegura que en la manada no exista consanguinidad.

La dominancia dentro de la manada se establece por factores sexuales, el padrillo domina sobre
las yeguas; las yeguas dominan sobre los individuos ms jvenes; y factores de tenor de
agresividad, los ms fuertes dominan sobre los ms dbiles, a veces, independientemente de la
edad.

Cuando hay enfrentamiento entre dos animales de la manada de la misma jerarqua, es ms


agresivo que si lo hacen dos individuos de diferente escalafn social.

212
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.20minutos.es

Los equinos no tienen hbitat exclusivo, lo comparten y, a veces, lo disputan con otras manadas, lo
que genera peleas entre padrillos de diferentes grupos. Existe en estas situaciones una actitud
muy caracterstica: el macho se ubica delante de sus yeguas y balancea el cuello como forma de
amenaza a su rival. Si el contrincante no se retira, el paso siguiente es la actitud de intentar a
morder a su rival, y si con esto tampoco se retira, generalmente, se muerden y se patean. Los
sitios ms comunes en que se lesionan son: el cuello, la parte costal, y la zona genital. Difcilmente
se maten en una pelea.

El padrillo reconoce a sus yeguas por el olor de la orina y la materia fecal y posee la actitud
instintiva de orinar y defecar sobre las sustancias excretadas de sus yeguas para que otros
padrillos no las puedan localizar por el sentido del olfato.
Cada caballo tiene una posicin dentro del grupo, que ser importante conocer para poder definir
las caractersticas de la doma que necesitaremos realizar:
Las yeguas heredan su rango, no tienen que pelear por l, por ello se pueden mostrar hostiles
entre ellas, ya que dos yeguas tienen siempre el mismo rango.

El macho debe luchar por alcanzar una posicin privilegiada en la manada: esto le da un carcter
mucho ms duro y agresivo, lo que implica unas caractersticas que deberemos tener en cuenta en
su doma:

El semental jefe y la yegua jefa conviven al mismo nivel, sin disputarse ambos rangos.

El caballo de rango mximo (lder) puede echar a cualquier otro caballo del sitio en donde estn,
sin ningn tipo de razn.

El caballo que tiene un rango inferior, no puede pasar por delante de otro con mayor rango. Ir por
detrs y lo har sin quejarse. Esto hace que, en situaciones de peligro, la manada no se disperse;
el caballo de rango superior marca la direccin y el resto le siguen.

El caballo de rango superior puede empujar a otros, lo hace con objeto de que la manada no se
separe y adems para rechazar a sementales jvenes que comienzan a imponerse. Esta es la
razn por la que el caballo obedece al jinete: ya que al quedar fuera de su espacio visual, para el
caballo es como si el jinete fuera el semental que le est empujando.

Esta jerarqua existe en cualquier raza de caballo y es aceptada por todos sus miembros.

Sus sentidos.

213
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.caballomania.com

Su visin:

La vista es un sentido que est muy desarrollado en el caballo, pero tiene lmites. Posee excelente
visin latero posterior, pero de frente ve correctamente a una distancia mnima de doce a catorce
metros por delante de sus ojos. Por eso, los caballos lateralizan la cabeza al observar algo de
repente que se halla a poca distancia.

El caballo tiene un campo de visin muy amplio, entre 340 y 360, con las siguientes
caractersticas:

Dispone de un campo ciego, que le impide ver en lnea recta delante suyo, sobre algo ms de un
metro.

La visin lateral con un slo ojo no le permite percibir el relieve, por eso deberemos permitirle girar
la cabeza. A pesar de que percibe mal los detalles, es muy sensible al movimiento.
Los equinos son animales capaces de ver de noche, con cierto grado de presicion, mucho mejor
que la del hombre.

Su odo:

El sentido del odo en el caballo est muy desarrollado:


Su odo es tan potente que puede escuchar sonidos imperceptibles para el hombre.

Sus orejas se orientan hacia el lugar en donde se ha producido el ruido.

Su olfato:

Tambin es un sentido que tiene muy desarrollado. Le es til para encontrar a grandes distancias
la presencia de alimentos y/o abrevaderos, para el reconocimiento de su especie, como por
ejemplo: de la madre al potrillo en el nacimiento. Asocia, generalmente, el olor a adrenalina y el
olor a sangre con el peligro.

El tacto:

Lo tiene desarrollado en las extremidades, los pelos del mentn y los pelos de los labios,
denominados estos como pelos tctiles.

214
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Sexto sentido:

Es la capacidad que tienen para detectar con anticipacin los cambios atmosfricos. Es comn
observar las corridas por un potrero en los das de mucho viento y el ubicarse de cola al viento y/o
a la lluvia en los das de temporal.

El equino duerme muy pocas horas por da y lo hace echado; parado slo suele dormitar y esto lo
hace varias veces al da, manteniendo un perfecto equilibrio sin realizar grandes esfuerzos, gracias
a la capacidad exclusiva que tiene para trabar las articulaciones de la rodilla de sus miembros
posteriores.

Sus lenguajes:

El caballo utiliza diferentes partes de su cuerpo junto con los sonidos para comunicarse, conviene
saber qu quiere decirnos con cada uno de estos lenguajes:

Orejas:
Son un indicativo del estado de nimo del animal:
Lnguidas y cadas: significa que el caballo no est a gusto o se encuentra enfermo. Tambin es
un sntoma de sumisin.

Las diferentes posiciones de las orejas tienen su propio significado, as pues:


Si las orejas apuntan hacia arriba significa que el caballo esta en alerta.
Si las dos orejas apuntan hacia delante significa que el caballo siente curiosidad.
Si las dos orejas apuntan hacia atrs significa que el equino esta disgustado.

Si una oreja apunta hacia delante y la otra hacia atrs, significa que su atencin esta
dividida.

Cola:
Smbolo de energa, sus movimientos tambin nos informan sobre el estado del caballo:
En alto: seal de alegra.
Entre las ancas: sugiere desconfianza.

La boca:
Los labios relajados indican tranquilidad.
Sacar la lengua como saborendose indica que el caballo tiene sed o en el caso de los
potros que estos desean mamar.
Si la tiene ubicada hacia un lado en la comisura labial y curvada hacia abajo, el caballo
siente dolor o incomodidad.
Si abre y cierra la boca con la comisura de los labios curvada hacia arriba nos indica que el
caballo esta miedoso o que esta sometido.
Si abre la boca y deja ver los insicivos nos demuestra que el animal esta una posicin de
agresividad por sentirse en peligro.

Sonidos que emite el caballo:


A pesar de que el caballo no emite muchos sonidos, deberemos saber qu significa cada uno de
ellos:

Bufido: cuando el caballo expulsa aire por su nariz, es smbolo de contento.

215
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Mugido: indica temor o desconfianza ante algo que no conoce.

Gruido: seal de dolor.

Chillido: normalmente es breve y agudo, y suelen ser las hembras quienes lo emitan, para
manifestar su mal humor (casi siempre cuando se encuentran delante de otra yegua).

Relinchos:
El relincho es la voz del caballo por el cual se comunica con otros congneres en especial entre
madre e hijo, entre el padrillo con cualquier otro ejemplar, y la hembra en celo para llamar la
atencin del padrillo.

Alteraciones del comportamiento


En muchas circunstancias el actual manejo de los equinos puede predisponer a situaciones de
comportamientos aberrantes o patolgicos. Estas alteraciones del comportamiento son ms
comunes de observar al privarlos de su libertad. Esto no slo les trae problemas de cambio del
comportamiento, sino tambin los predispone a diversas patologas de origen respiratorio,
locomotor, digestivo, reproductivo.

Leccin 33 DESTETE DEL POTRILLO.

Como todo individuo joven el potro en sus primeros meses de edad es arisco, miedoso y su
confianza se encuentra cimentada en su madre y en menor proporcin en su manada, por lo tanto
hay que empezar ha inspirarle confianza.

El destete es un periodo critico en la vida de un animal, consiste en un acostumbramiento del potro


a la separacin total de la madre o nodriza, esto debe ocurrir cuando las cras tienen un desarrollo
del tracto digestivo que ya es capaz de utilizar otros alimentos ms groseros en sustitucin del
alimento lcteo, en este proceso ayuda el grado de preparacin que se haya dado, Para evitar un
estrs excesivo en el potro trataremos de realizar el destete de la forma ms natural posible.

Lo ideal es acostumbrarlo a una dieta en la cual la leche de su madre tenga un lugar cada vez ms
secundario durante algunas semanas antes de que se produzca la separacin definitiva.

Es usual que muchos caballistas inicien un entrenamiento en los primeros das de edad del potrillo,
con el nimo de que ste se acostumbre ms rpido al contacto con su amansador.
Un buen sistema es encorralarlo con la madre, con la precaucin de que el piso sea de tierra o en
cama de viruta para evitar que un momento dado no se resbalen y se lastimen, tambin se debe
tener en cuenta que los comederos y bebederos estn a la altura del potro, que no tengan
esquinas ni puntas que permitan que se se hieran.

Una vez all se inicia intentando abrazarlo por el cuello, y luego que se tranquilice le ponemos una
mano en la cara a manera de bozal y la otra en el anca o en el cuello, el procurara defenderse y
librarse de quien lo tiene, pero al fin se rendir.

Al cabo de unas cuantas arremetidas hacia adelante y hacia atrs, cuando le tengamos ganada su
confianza le pondremos suavemente la jquima lo ms liviana posible para no maltratarlo, con el
pizador lo vamos halando suavemente hacia un lado y otro, sin hacerlo caer.

216
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Tomada en Pesebrera El Puente - Neiva

Estas prcticas siempre se efectan en los primeros meses en compaa de la yegua; pero a los 3
4 meses se har que el tiempo de sujecin, y el paseo con el cabestral se prolongue por 30 60
minutos, as el potro se va adaptando a progresivas separaciones de su madre.

Es aconsejable que el destete se lleve a cabo en la poca de verano ya que en el invierno los
potros estn sometidos a problemas podales por el reblandecimiento de los cascos, adems el
animal debe ser llevado a potreros con pasturas de muy buena calidad, agua limpia, fresca y
abundante, adems de un suministro diario de sal mineralizada.

La edad del destete esta determinada por 3 factores bsicamente:

La produccin Lctea de la yegua.


El periodo de gestacin en el que se encuentre. El estado
corporal del potro o de la yagua.

Si la medre se encuentra en una condicin corporal entre 1 y 4, se debe retirar el potro a los 6
meses de edad y a veces an, entre los 4 o 5 meses.

Si por el contrario la yegua esta en buena condicin corporal es decir entre 6 y 9, y su produccin
Lctea es an buena, se le puede permitir al potro permanecer con ella hasta los 8 meses.

La edad ideal o por lo menos la ms indicada para el destete est entre 6 a 8 meses. Si la yegua
se sirvi en el calor del potro, el destete se deber efectuar a los seis meses, salvo que la yegua
goce de un excelente estado general, en este caso se podr prolongar hasta los ocho meses.
Como se dijo anteriormente, para el destete el potro deber haberse adaptado al consumo de
grano o de algn tipo de suplemento, as ste no ocasionar mayores problemas, ni atraso en su
desarrollo.

Existen dos maneras de realizar el destete:


En forma brusca o sbita En forma lenta
o gradual.

Forma brusca o sbita


Se retira la yegua o el potro a otra rea, esta forma es la ms utilizada y causa mucho stress en
el potro, pero es menos costosa y requiere menor trabajo. Se puede desarrollar de la siguiente
manera:

Tomadas las prevenciones de rigor, la separacin se har total. Es indispensable que el potro no
pueda volver a ver, or u oler a la madre puesto que esto malograra el proceso de separacin. Si
los equinos estn estabulados, se deja el potro en el establo que comparta con la madre, y sta

217
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

ser llevada a otro establo suficientemente alejado; los establos, en especial el del potro debern
estar libres de obstculos y elementos traumticos con los que el potro pueda inferirse dao al
entrar en impaciencia por la separacin.

Si los animales estn en pradera, la yegua saldr del lote de yeguas paridas, en este caso tambin
deben prevenirse los riesgos de lastimaduras o cortadas en especial cuando hay presencia de
alambres de pas.

Forma lenta o Gradual


Se inicia a los 4 5 meses y semana a semana se va aumentando el nmero de horas en que se
separan madre e hijo, posteriormente el potro estar con la madre un da si, y otro no.

Habituado el potro a estos periodos de separacin es un buen momento para empezar a montar a
la madre dejando al potro en su corral. Paulatinamente los ratos de separacin se irn prolongando

.
Tomada en Pesebrera El Puente - Neiva

Cuando llega el momento del destete se coloca a la madre y potro separados por una valla en
corrales contiguos, se pueden ver y tocar pero el potro no puede mamar. As el potro no sufre tanto
estrs al tener contacto con su madre.

Los primeros das es recomendable dejarlo que se rena con su madre para que pueda mamar
tres veces al da, luego dos, una, y as progresivamente hasta que deja de mamar.

Desde mi punto de vista es la mejor forma para que la madre deje de dar leche sin estresarse, a la
vez que evitamos posibles problemas que puedan aparecer en las ubres (posible mastitis) si le
quitamos el potro de un da para otro. Adems se ha comprobado que la madre deja de producir
leche mucho antes si esta cerca a su potro, pues si los separamos totalmente el estrs que sufre la
yegua le dificulta el secado.

En ese momento podemos aprovechar para buscarle un compaero al potro que l acompaara y le
ayudara a integrarse luego en un grupo de potros.

Otro sistema habitual es llevarse al potro lejos, a la montaa e introducirlo en un grupo de potros.
Es una situacin muy estresante para el potro y para la madre. Para el potro se une la separacin
de su madre, un cambio brusco de alimentacin y el rechazo que al llegar recibir del grupo, lo que
har que su estrs aumente, dificultando aun ms su adaptacin a esta nueva etapa de su vida.

Algunas personas conocedoras del oficio aconsejan formar grupos de potros por sexo, esta

218
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

prctica es til cuando el nmero de potros es muy grande, para que los potros no se inquieten
podrn amadrinarse a un caballo viejo, castrado y manso el cual les comunica su calma.

El secado de la yegua puede efectuarse paralelamente con el destete del potro, tal vez la forma
prctica de hacerlo sea reduciendo la racin de la yegua aproximadamente a la mitad varios das
antes de la separacin, el retiro de la leche se producir sin dificultad.

Otro mtodo es masaje de la ubre, sin ordearla durante 5 7 das, as la ubre est llena no
deber vaciarse; al final del 7 da, cuando la glndula est blanda y flcida se ordea, extrayendo
la secrecin que an contenga.

En cualquiera de los mtodos de secado, se tendr especial cuidado, ya que prcticas


antihiginicas o traumticas se convertirn probablemente en mastitis, cuyas secuelas pueden
ocasionar la prdida de la glndula en su conjunto.

Leccin 34 DOMA, ADIESTRAMIENTO Y EJERCICIO EN LOS EQUINOS

www.caballosderaza.com

DEL DESTETE AL ADIESTRAMIENTO.

Durante esta poca es bueno proporcionar a los animales un pastoreo adecuado, ejercicio
obligado, estabulacin y suplementacin alimenticia adecuada. La exposicin a los rayos solares
es importantsima para la elaboracin de vitaminas y el aprovechamiento de minerales.

La mejor manera que el potro se ejercite es colocndolo en el potrero, con el comedero al extremo
contrario al bebedero.

La estabulacin es importante para acostumbrar a los animales a entrar en pesebreras y evitar que
se vuelvan indomables.
La obtencin de un buen adulto depende mucho del manejo de esta etapa del desarrollo del potro.
La alimentacin del potro es determinante; el objetivo debe ser llenar todos los requerimientos
alimenticios relacionados con protenas, carbohidratos, grasas, macro y micro elementos.

Aparte del ejercicio voluntario que los animales realizan en el potrero, se les debe someter a
ejercicios de cuerda; por lo menos de 3 a 4 veces por semana.
Estos ejercicios pueden tener una duracin de quince a treinta minutos.
El fin de estos ejercicios es obtener un animal ms dcil con ms bros y mejor desarrollo.

219
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

A partir de los 6 meses se debe medir la alzada y pesar el potro cada mes hasta el ao y luego
cada tres meses hasta los 2 aos. Esto con el fin de observar su crecimiento y desarrollo. Al ao y
medio, puede llevarse a ejercicio controlado, teniendo cuidado de no excederse.

Empezar con cinco minutos y terminar con 30 minutos es una buena medida para un potro en
buenas condiciones.

La doma es de suma importancia en el equino y muchas veces el hombre no la tiene presente, por
tanto ya a partir del primer mes de vida de la cra y por las mltiples actividades que debemos
realizar con ellas tales como arreglo de cascos, crines, cola, cura de parsitos etc. hay que realizar
labores preferentemente separados de las madres, que podemos resumir de la forma siguiente:

Poner jquima todos los das hasta que se acostumbre a ella.

Poner una cuerda de 2-3 MS. Atada a la jquima para que se adapten a ser manejadas por la
cabeza y a tener movimientos limitados, hay que evitar obstculos en los que se puedan enredar.

Amarrarlos en lugares altos para que no se enreden las extremidades y se adapten a estar
sujetos al lugar.
Como ltimo aspecto del amansamiento es ensearlos a cabestrear detrs del hombre o de
un caballo con jinete.

Las actividades de la doma deben ir encaminadas a que los animales adquieran las habilidades
acorde con la funcin que desarrollarn el trabajo en la ganadera, el deporte, el tiro o arrastre, el
paseo etc.

Independientemente de las actividades que desarrollar el equino la monta por el hombre siempre
debe ocurrir aunque se utilicen para la reproduccin y esta doma debe realizarse cuando los
equinos han adquirido un buen desarrollo (alrededor de 30 meses de edad) y estos deben estar
herrados de las cuatro extremidades.
Durante este proceso los animales se deben acariciar y cepillar para darles confianza, adems es
bueno proporcionar a los potros reas de pastoreo adecuadas.
El amansamiento incluye la aceptacin a levantar los remos, esto es bsico para posteriores
trabajos en los miembros tales como: herraje, exmenes, curaciones, etc.
La doma no puede constituir un trauma para el animal y esta enseanza debe hacerse con cario y
responsabilidad, pues un mal manejo puede ocasionar lesiones e incluso la muerte del animal.

El adiestramiento comprende doma de cabeza, luego de silla y finalmente se monta para


adiestramiento de lomo, esto se resumen en el siguiente cronograma de actividades:

Poner los arreos de la cabeza y el basto.


Poner montura sin apretar las cinchas y posteriormente se aprietan y se hace caminar.
Si el animal es muy brioso se camina con un peso (ej. Saco algo pesado encima). Algunos
recomiendan realizar esta actividad entierras aradas y sin obstculos.
Por ltimo se monta el jinete, al principio al cabresto detrs de otro caballo con jinete y al
final solo.
Esta actividad debe realizarse paulatinamente y sin atropellar los pasos a seguir; tenga presente
que todos los animales no son iguales y unos necesitan ms tiempo que otros, lo importante es
que lo haga bien y se obtengan los resultados deseados.

Las jornadas de adiestramiento deben ser graduales, se inician con 15 - 20 minutos al da, hasta
llegar a las dos horas.

El trabajo sobre el cuello, lo cual se conoce en trminos populares como quebrarlo se hace con el

220
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

fin de que el animal aprenda a voltear, parar, subir y bajar, esto se logra con el manejo de rienda
falsa o sea, un bozal sin freno, esta etapa puede durar unos 3 - 4 meses; una vez el potro se ha
acostumbrado a esta rienda falsa, el equino se puede herrar.

La siguiente fase de adiestramiento corresponde al freno suelto, ya no se emplear el bozal, sino


que el freno se adicionar a la rienda con el nimo de que el animal soporte el instrumento en su
cavidad bucal.

Como se dijo anteriormente es importante que en todas las fases de adiestramiento el potro est
acompaado de un equino adulto, el cual actuar como madrina transmitindole seguridad y
confianza al potro.

Si existe la posibilidad de estabulacin, el potro debe acostumbrarse a la pesebrera, en sta


deber tener tranquilidad y buena comida; la permanencia en el sitio de estabulacin no rebasar
las seis horas, para as eliminar posibles lesiones en los aplomos.
Los equinos destinados a trabajo tienen un ritmo de entrenamiento diferente, ya que la mayora de
ellos debern tirar carrozas o zorras; por tanto su plan de entrenamiento dar mayor importancia
a desarrollar la habilidad del equino para jalar diferentes pesos y objetos.

EJERCICIO.

El ejercicio peridico es esencial para la salud del animal y en especial para el desarrollo y vigor de
sus miembros. El pastoreo a voluntad es ideal para los potros, ya que adems de poder
desplazarse a voluntad reciben rayos solares necesarios para un completo desarrollo seo.
Todos los animales deben efectuar ejercicio diario durante 10 a 15 minutos.

Animales jvenes o en procesos de recuperacin en los cuales la monta no es aconsejable, el


ejercicio podr efectuarse por medio de una cuerda de 9 12 metros, el ejercicio consiste en que
el equino debe dar vueltas alrededor de quien sostiene la cuerda, en la

Los animales adultos se deben ejercitar montando los o hacindolos tirar de su vehculo al menos
durante una hora diaria.

La yegua recin parida puede realizar ejercicios uno o dos das despus del parto, estos debern
ser suaves y de corta duracin.

Leccin 35 MANEJO.

El trmino manejo resume por decir as el conjunto de aspectos tcnicos y actividades prcticas
encaminadas a proveer a los animales el mayor bienestar posible a un costo razonable buscando
siempre mantenerlos en constante produccin segn sea su nivel de especializacin y su funcin
especfica.

Partiendo de la base del valor econmico y de bienestar de un caballo, su propietario o cuidador


disear y cumplir un buen programa de manejo que en todo caso no ser absolutamente estricto
y le permitir acomodarlo segn las circunstancias y los imprevistos.

Pero la gua o normas bsicas que lo orientan y sustentan sern de riguroso cumplimiento.

221
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

MANEJO ADECUADO DE LA CABALLERA.

Como en todo sistema de explotacin, en los grandes y pequeos establecimientos de caballos,


las normas de manejo y su cumplimiento, les evitarn costosas inversiones o cuantiosas prdidas a
sus propietarios.

El saber proceder frente a las numerosas situaciones que se presentan a diario solo se adquiere
con la experiencia que otorgan los aos. No es gratuito que aquellas personas que han convivido
por muchos aos al lado de los equinos sean el patrimonio ms valioso para el propietario de una
cuadra de stos. Solamente el control de todos los aspectos a nivel de campo har la actividad
rentable y en donde el papel primordial que juega en la prctica el cuidador (capataz), es
irrefutable. Este debe conocer perfectamente el comportamiento de los animales de los cuales se
hace cargo y demostrar que tiene mucho y buen sentido y espritu de observacin, para detectar e
interpretar sus reacciones. El xito final depender tambin de los elementos y recursos fsicos y
tcnicos de que disponga para desarrollar su labor. En consecuencia, para que el cuidador pueda
enfrentarse a estas responsabilidades, no podr ocuparse ms que de un nmero determinado de
caballos.

IDENTIFICACIN Y MARCACIN DE CABALLOS.

Cualquiera que sea el nmero de efectivos en un plantel equino, necesitar de algn sistema
seguro y efectivo de identificar a cada uno de los individuos que componen la cuadra. En los
equinos, relativamente hay mayor facilidad de identificacin debido a las particularidades de su
pelaje; pero este no pasa de ser un sistema subjetivo de reconocimiento que no es til para efectos
de toma de registros e inscripciones en asociaciones especializadas las cuales son estrictas en
grado sumo en las identificaciones.

Hierros Candentes
El mtodo ms antiguo que existe para la identificacin de un caballo es la marca en caliente en
donde se identifica mediante un logo o las iniciales del criador o propietario o de su criadero.
Consiste en colocar al rojo vivo un hierro aplicndolo sobre la piel del animal causa durante su
aplicacin un fuerte dolor a ms de la tensin nerviosa y la posibilidad de un accidente en su
ejecucin.
Se emplean hierros de 5 8 CMS. de longitud, la marca se aplica usualmente a la altura del
humero, indistintamente en alguno de los miembros; este sistema de identificacin presenta el
inconveniente del dao irreversible ocasionado a la piel, lo cual para ciertos criadores es un
problema que afecta el conjunto esttico de su ejemplar. En campo, es el mtodo usado con mayor
frecuencia por lo econmico y seguro.

Tatuaje indeleble debajo del labio


El tatuaje consistente en la aplicacin de tintas en nmeros aplicados en la mucosa del labio
superior del caballo. Se usan cifras o cdigos que corresponden, o bien al orden interno de la
caballeriza, o al numero de registro proporcionado por la asociacin a la cual se encuentre inscrito
el ejemplar. Este mtodo es el nico reconocido por criadores de razas de caballos de carreras, ya
que garantiza que el ejemplar inscrito en una prueba sea en realidad l y no se preste a cambios
fraudulentos que de otra forma se podran dar con facilidad.
Fue el primer paso que se dio en la identificacin del caballo de una manera clara segura y
suficiente para obtener la credibilidad que se haba perdido en los registros, sistema este que con
los cambios tecnolgicos que hoy existen fueron cambiados a sistemas menos traumticos, giles
y sencillos de manejar adems de ser ms higinicos evitando contagios de enfermedades como la
anemia infecciosa.

222
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Marcacin con Hierro Fro.

La marca en base a fro o criomarca que al introducirse en nitrgeno lquido disminuye la


temperatura hasta casi 200C bajo cero en una mezcla de hielo seco y alcohol que la disminuyen
hasta menos 90C suficientes para disminuir las clulas pigmentarias de la piel tambin llamadas
melanocitos creciendo pelo de color blanco visible en unas seis semanas. Presenta alguna
dificultad de identificacin en los colores ms claros siendo sin embargo visible si se aplica en
ellos. Es este un mtodo menos doloroso para el animal, ms econmico y por dems vistoso y
agradable.
En el mercado se consiguen marcas fras elaboradas con base en sustancias custicas que al ser
aplicadas sobre la piel, producen una quemadura de menor intensidad que la ocasionada por el
hierro candente y con la ventaja adicional de ser reversible.
Este sistema de marcacin se aplica en el mismo lugar que el del hierro candente y presenta
idnticos inconvenientes.

Identificacin por espejuelos.

Investigadores en Estados Unidos encontraron que los espejuelos de los equinos mayores de un
ao, no cambian en el resto de su vida; y que no hay dos animales que presenten caractersticas
idnticas en sus espejuelos, por tanto seran en los caballos las huellas dactilares. Este sistema
no es muy prctico ya que necesita llevarse registros fotogrficos de los espejuelos y cada vez que
se necesite la identificacin deber confrontarse con la impresin original. Este mtodo es de
utilidad para ejemplares muy valiosos, pero no ser cmodo, ni rentable su empleo para la gran
mayora de caballistas.

Identificacin electrnica.

La marcacin electrnica conocida como el microchip, se impone como medio de marcacin en la


mayora de los animales pues es un mtodo poco traumtico asptico y gil para su colocacin
identificacin, obteniendo cada da ms relevancia hasta llegar a ser hoy un requisito indispensable
para el registro de un caballo. Consiste en una jeringa o pistola que contiene en su punta el
microchip de 3 por 15 mm, con su nmero mediante cdigo de barras para ser inoculado de forma
subcutnea en un lado de la tabla del cuello del equino sin producir efectos colaterales ni dolor, no
se mueve, se encapsula lo que no permite reutilizarlo o cambiarlo. Existe adems un lector o
trasponder que al colocarse por encima de la superficie donde se encuentra el microchip, capta el
nmero y permite su identificacin. El nmero de registro o microchip nos da la certeza sobre un
animal evitando que hacia el futuro no se de el tratamiento manipulado e inexacto que se dio en
otras pocas en donde se cambiaba el criador, los padres, el nombre del animal, volviendo a la
exactitud del registro. Permite adems un mayor seguimiento a travs de otros adelantos
tecnolgicos como el computador para hacer ciertas clases de seguimientos como control de peso,
alimentacin, reproduccin y parentesco que no slo facilitan si no que se convierten en una
herramienta importante para el criador actual.

Ventajas del sistema:

Control de manadas y organizacin ms eficiente. Imposibilitar los


cambios fraudulentos y/o hurtos. Seguridad en el manejo a distancia
de la cra.

223
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Genera valor agregado exportaciones equinas.


Posibilita la masificacin del seguro en caballos deportivos. Mejoras operativas
en inscripcin y registros.
Sistematizacin de las bases de datos de las asociaciones. Control de planes
sanitarios y registros epidemiolgicos.
Titularidad y procedencia del animal.

Microchi p Jeringa sanitaria des echable con micr ochi p

www.microchipavid.com

Protocolo De Aplicacin En Equinos.

1. Escaneo Del Paciente: El sitio en donde se inyectar el microchip ser recorrido varias
veces verificando que el animal no se encuentre identificado con anterioridad.

2. Escaneo Al Microchip: Antes de la inoculacin, se deber leer el microchip en su contenedor


estril para certificar el nmero y su funcionalidad.

3. Desinfeccin: El rea de implante deber desinfectarse nicamente con alcohol habindose


comprobado que otros elementos desinfectantes pueden ocasionar irritacin al tejido si se
inyectan accidentalmente con el microchip.

4. Lugar De Aplicacin: En el ligamento nucal del lado izquierdo, en la zona media entre la cruz
y la nuca.

5. Aplicacin: Insertar la aguja en su totalidad, hasta que la base del plstico entre en contacto
con la piel. Utilice criterio profesional en animales de pequeo tamao. Presione despacio el
embolo de la jeringa. Aplique presin durante 30 segundos sobre el sitio de inyeccin luego
de extraer la aguja.

6. Verificacin: Verifique la correcta lectura del microchip en el animal luego de la aplicacin.

7. Registro De Datos: Registrar los datos que solicita la documentacin que acompaa al
microchip.

224
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Pistola de aplicacin Lector de bolsillo


www.microchipavid.com

CUIDADO DE LOS CASCOS Y COLOCACIN DE HERRAJES.

El valor de los equinos reside principalmente en su sistema locomotor, un caballo con defectos en
sus aplomos carecer de valor; es por esto que se hace necesario que el ejemplar tenga buenas
piernas (remos) y buenos pies lo cual incluye el cuidado de los cascos, reas de contacto del
animal con el suelo y por tanto estn sujetas a mltiples factores agresivos.

Los cascos debern mantenerse limpios, impedir la resequedad, se deben recortar para que
conserven tanto su forma, como su longitud y disposicin adecuadas.

En la siguiente figura se observa cul debe ser la disposicin del esqueleto seo con relacin al
casco (figura a), en las figuras b y c se presentan conformaciones defectuosas, y su forma de
corregirlas mediante el corte del casco.

Figura 11 Disposicin del esqueleto con relacin al casco


Tomado de Zootecnia General UNAD

La inclinacin es normal cuando la punta del casco y la cuartilla siguen la misma lnea, este ngulo
debe mantenerse siempre y ser modificado solamente como medida correctiva. Antes de recortar
los cascos es preciso observar al caballo parado sobre una superficie dura y nivelada, luego se le
har caminar al paso y al trote.

Los cascos se deben recortar cada 4 6 semanas, no importa que el animal est herrado. Si se
deja crecer excesivamente el casco, ste se deforma afectando el equilibrio, lo cual provoca
esfuerzos excesivos de los tendones. Los cascos se recortan a nivel de la suela evitando cortes
ms altos por la posibilidad de que se rajen; la ranilla se debe cortar cuidadosamente eliminando
slo los bordes resquebrajados que permiten la acumulacin de detritus crendose as la

225
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

posibilidad de infecciones del casco lo cual ocasionar claudicacin (cojera o parlisis) muchas
veces costosas y difciles de tratar. La pared del casco nunca debe ser limada.

Se debe herrar porque siendo el casco un tejido del animal, su desgaste no guarda proporcin con
la velocidad con la cual es formado; entendidos estiman que el desgaste producido en el casco por
el trabajo sobre una superficie blanda (praderas) slo permitira la correcta utilizacin de una
tercera parte de las capacidades reales, igualmente si el trabajo es efectuado sobre superficies
duras (caminos pedregosos, carreteras, asfalto, etc.) solo podra utilizarse el casco en un dcimo
de su capacidad.

Otra buena razn por la cual es necesario herrar los caballos es que, la herradura protege el pie,
rgano en extremo sensible a las irregularidades del piso.

El tipo y frecuencia del trabajo determinan la frecuencia del herraje, cuando ste se efecta sobre
superficies blandas se deber herrar cada mes, si por el contrario, el caballo trabaja sobre
superficies duras el desgaste de la herradura ser lo que determine cuando sta debe ser
cambiada; la observacin del estado del herraje permite decidir, el momento en el cual deban ser
reemplazadas, en forma prctica, sabemos que la calidad de los herrajes rara vez permite su uso
por ms de tres semanas; una herradura desgastada se torna cortante y peligrosa para el caballo y
el jinete; es conocido, que las herraduras de los miembros anteriores sufren un mayor desgaste
que las de los miembros Posteriores.

Un juego de herrajes bien colocado no deber interferir las funciones fisiolgicas de las diferentes
estructuras del pie o con el andar del caballo.

Al igual que el recorte de los cascos, el herraje requiere de conocimientos bsicos sobre la
anatoma y fisiologa del casco, ya que ste se define como una corteza crnea especializada que
cubre huesos, nervios, vasos sanguneos y tejidos delicados, y un clavo de herraje colocado
incorrectamente (picar el casco) acarrear problemas que usualmente se complican, por el
contrario, clavos colocados muy superficialmente se soltaran con facilitad perdiendo el herraje.

PRINCIPIOS DE LA HERRADA

www.herrajesycaballos.com

Para herrar un caballo existen dos formas: herrar en caliente, modalidad esta que muchas
personas rechazan por desconocer su arte pero que en algunos casos tiene grandes ventajas y
aprovechamiento especialmente para aquellos caballos que trabajan en terrenos fangosos o muy

226
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

hmedos, implica adems el fabricar la herradura adecuada para cada casco.

Despus de forjada la herradura se calienta y se ajusta al casco lo que la asegura ms en sus


paredes y de una manera mas precisa. La otra forma es en fro, sistema tradicional y el ms usado
por todos. La herradura se ajusta generalmente a martillo buscando que se acomoden lo mejor
posible al casco.

Es importante antes de descalzar el animal observar cuidadosamente el estado de la herradura, el


casco y el estado general de la extremidad, con el fin de determinar cualquier anormalidad o
defecto corregible. Es all donde se detectan enfermedades o alteraciones que repercuten en la
forma de desplazarse el caballo. La herradura es un hierro templado que se coloca en los cascos
de los caballos con el fin de protegerlos del piso y de algunos golpes. Su tamao, longitud y
espesor depende del tipo de caballo y el trabajo que realice utilizando ramplones o pestaas.
Presenta dos caras, una superior plana que hace contacto con el casco y la inferior lleva las
claveras que se encuentran al centro de la herradura en las estampas, dos bordes el primero
convexo correspondiente a la parte externa y otro cncavo.

El espesor es fundamental en la herradura ya que debe combinar factores como la dureza y


elasticidad del material (hierro, acero, aluminio) de l depende la solidez de la herradura y el evitar
que se deforme o desgaste prematuramente, sin que su peso cause daos en los bpedos del
caballo.

Peso: generalmente las de hierro pesan aproximadamente entre 750 gramos y 2000 gramos para
caballos pesados, 400 a 500 gramos para el caballo de silla.
Si son elaboradas en aluminio su peso oxila entre 50 y 70 gramos.

Ancho: es la distancia existente entre el borde externo y el borde interno.

Existen pequeas diferencias entre el casco posterior y el anterior siendo las lumbres de los
primeros ms puntudas, adems de ser ms cncavos en su suela, posee 3 tipos de estructuras
en el casco del caballo a saber:

La sensible compuesta por la suela, que protege la estructura sensible del interior del casco,
no debe soportar peso, es seca y arenosa lo que se puede observar fcilmente al descollar
en la herrada, est compuesta por clulas muertas en la parte externa.

Ms adentro es hmeda denominada suela viva y en su parte ms interna esta irrigada por
vasos sanguneos y sensibles, su funcin es producir suela viva.

La elstica compuesta por la ranilla, se encarga de distribuir el impacto a travs de los


cartlagos laterales, colchn plantar y estructura elstica del casco, su funcin de soporte de
peso se suspende en la herrada, en los terrenos resbalosos ejerce la funcin de traccin. El
colchn plantar est ubicado debajo de la ranilla, absorbe el golpe de la pisada repartindolo
sobre los cartlagos laterales que se encargan de neutralizar dicho golpe siendo los
responsables de la expansin del casco, se extienden en la parte de arriba y la parte trasera
de la tercera falange callosa compuesta por la pared que soporta el peso siendo ms gruesa
en la lumbre que en la parte media o en los talones.

Las barras o extensiones de la pared paralelas a las comisuras, ayudan a soportar el peso
perdiendo su funcin con la herrada. La lnea clavera es extensin de las lminas callosas sirve al
herrero como principal gua para no chuzar el equino. La corona se encuentra en la parte superior
del casco unindolo con el cuerpo. El herrado no tiene porque causar ninguna molestia ni dolencia

227
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

al caballo, de all depende su vida til es la parte ms expuesta y es el aparato locomotor del
mismo.

El herraje se efecta de la siguiente manera:

1. Desmonte De Herraduras: Para comenzar a quitar las herraduras lo primero que debemos
hacer es cortar los clavos y extraerlos con la pinza observando detenidamente su desgaste.
Un animal bien aplomado debe presentar un desgaste parejo, si se encuentra un desgaste
anormal en la punta o en el taln se hace necesario hacer un chequeo ms minucioso en el
casco pues algo no est funcionando normalmente.

2. Tratamiento Al Casco: Se debe limpiar bien toda la superficie del casco recortando y
puliendo la parte muerta. Con la escofina se pulen las diferentes superficies dando adems
el ngulo adecuado para una pisada firme y aplomada. Es aconsejable adems si el casco
est muy reseco o con ranuras el tratarlo primero con agua y con algn producto que lo
reconstituya antes de proceder a un nuevo herraje.

3. Escogencia De La Herradura: No olvidemos que la herradura es el calzado del caballo, se


debe escoger aquella que su peso sea razonable y de una durabilidad suficiente al trabajo a
realizar con relacin al perodo mxime de herrada. Debe ser la que ms se adecue al tipo
de trabajo a realizar y del tamao que se ajuste a su casco.

4. Herrado Al Calor: La herradura se debe medir en el casco y una vez calentada a punto de
martillo sobre el yunque irla ajustando a la forma del casco. En el herrado al calor es muy
importante tener en cuenta el ajuste de la concavidad que evite presin sobre la suela del
casco, as como nivelar sus claveras sus topes y talones acomodndola dentro del casco.
Para lograr templarla se sumerge varias veces en agua corriente hasta lograr la dureza
deseada.

5. Herrado En Fro: Sobre el yunque la herradura se va ajustando a la horma del casco y al


tamao del mismo nunca al contrario hasta darle el ajuste necesario.

6. Ajustar La Herradura: Es importante el saber escoger los clavos apropiados a la herradura


que se va a fijar, los cuales se deben introducir sobre el borde exterior de la lnea exterior en
forma paralela a la pared.

7. Remache Y Ajuste Final: Los clavos se deben introducir en forma alternada y que entren
totalmente en la clavera para que den la tensin y el ajuste necesarios sobre las paredes del
casco manteniendo la herradura lo mas firme y ajustada posible, cortando y doblando las
superficies que vuelan ajustando sus puntas hacia fuera, despuntndolas y asegurndolas
hacia abajo contra el casco y apretndolas con el remachador.

8. Pulimento Y Ajuste Final: Una vez terminada esta operacin con la lima o escofina se pulen
las superficies que sobresalgan buscando el mayor ajuste y proporcionalidad posible entre
casco herradura y clavos.

228
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

En la figura se muestra un diagrama de una Herradura corriente.

Figura 12- Herradura Corriente


Tomado de Zootecnia General UNAD

Cuando se necesite quitar el herraje, ste no deber ser arrancado, se debe retirar clavo por
clavo, luego tomar la rama interna y despus la externa de la herradura con la tenaza y balancearla
hacia el suelo; luego se golpear la herradura para que aparezcan los clavos que se retiran con las
tenazas.

229
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

HERRAJES CORRECTIVOS.

Estos herrajes son usados para cambiar los andares y movimientos, para corregir la estructura o el
crecimiento defectuoso de los cascos y para proteger a stos de callosidades, contracciones o
fisuras. Los principales herrajes correctivos son:

- Herradura de Barra: Se emplea para ejercer presin sobre la ranilla o para aliviar la
presin sobre cualquier parte del pie.

- Herradura para pie Oscilante: Se emplea para caballos que tropiezan, que avanzan
con dificultad, que tienen sobrehuesos en la cuartilla o en la corona.

- Herradura de Punta Cuadrada en Prolongacin: para caballos cerrados de


corvejones

- Herradura con Extensin Lateral: Se emplea para caballos con los cascos desviados
hacia fuera o hacia adentro.

PRECAUCIONES AL HERRAR.

Se debe hacer correccin en de los aplomos en los potros y herraje de los caballos en
trabajo cada 30 45 das.
Para hacer la correccin del aplomo no solo se debe observar el ejemplar quieto sino que
tambin en la marcha, para observar cada extremidad ejecutando el paso.
La herradura se debe amoldar al tamao del casco no al contrario.
Colocar la herradura hasta 1 cm. mas larga de cada taln, ni mas corta ni mas larga.
Adems es posible que la herradura sobresalga de los bordes de la muralla hasta 1
milmetro.
No limar la muralla exterior del casco con la escofina, ya que esto genera una reduccin
progresiva de su espesor con respecto a la lnea blanca, lo cual har que las herraduras se
desprendan con facilidad llevndose consigo un trozo me casco.
Cortar la ranilla lo menos posible, es decir, retirar solo el material descompuesto.
No hacer ranuras en forma de lnea que una los puntos por donde irrumpen los clavos en la
muralla, ya que esto rompe las laminillas y debilita esa seccin del casco hacia abajo.
La herradura plana es decir sin tacn, se debe usar en pisos duros y la herradura con tacn
en suelos blandos.

CASTRACIN.

La extirpacin de los testculos en quidos (caballos, mulos y burros) debido a el deseo de inhibir
su reproduccin por no cumplir con los objetivos genticos deseados para la prxima generacin,
accidentes o patologas en el aparato genital o simplemente con el objeto de suavizar el carcter
del animal para un mejor manejo, sigue siendo una operacin requerida con frecuencia, para ello lo
ideal es recurrir a un medico veterinario con experiencia en esta intervencin quirrgica, ya que no
es fcil de efectuar, cualquiera sea la edad en la que se realiza.

La edad del animal a castrar vara mucho de regin en regin; en algunas partes, el potro puede
tener unos pocos das, pero es ms comn que la castracin se efecte pasado el ao de edad; si

230
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

la castracin se efecta a muy temprana edad, generalmente ocasiona un desarrollo incompleto de


los miembros anteriores; por el contrario, si es realizada al ao de edad del potrillo o un poco ms
sus caractersticas se evidenciarn mejor, tendr un mayor desarrollo muscular y un mejor
desarrollo de los miembros anteriores.

La prctica de esperar a que el potrillo haya cumplido un ao de edad, asegura que los testculos
se encuentren en el escroto, a una menor edad no es raro que se encuentren alojados an en la
cavidad abdominal.

Las diferentes modalidades para castrar el animal en decbito lateral, decbito dorsal o en pie y las
distintas tcnicas: abierta, cerrada, semicerrada, con uno o dos cortes escrotales estn bien
descritas por diferentes autores.

La tcnica ms usada para castracin, es testculo abierto; se debern practicar especiales


medidas de asepsia higiene. La operacin en si, es competencia del Mdico Veterinario, por los
riesgos que ofrece al ser efectuada por personal inexperto, aun as, la existencia de prcticos no
veterinarios que realizan castraciones en las zonas rurales genera grandes riesgos por sus
mtodos ortodoxos.
La poca en la que se debe castrar depende de la zona. Lo que se trata de evitar son moscas que
pueden infectar la herida posquirrgica.

Se recomienda la castracin por la maana para poder observar mejor la evolucin tras la
intervencin.

A continuacin trataremos de describir como se desarrolla esta ciruga, mas a manera de


informacin que de un instructivo para realizarla, ya que como lo hemos indicado anteriormente
esta debe ser ejecutada por un medico veterinario practico en esta actividad.

Material y mtodos.
La castracin slo se har en animales sanos con descenso testicular normal, lo ideal es que el
equino se encuentre entre los 3.5 a 6 aos de edad cuando ya tiene la apariencia de macho
(msculos masivos, carrillos prominentes, cuello grueso), con ambos testculos en el escroto, no
criptorquidos y sin hernia escrotal. Es importante, antes de castrar un quido, someter al
propietario y cuidador a una detenida indagacin en lo que se refiere a padecimientos anteriores,
de hinchazones en escroto y testculos, laminitis o episodios de dolores como los clicos, a la vez
que se realiza una evaluacin clnica preoperatorio con palpacin de los anillos inguinales
superficiales e internos, descartndose para esta tcnica cualquier animal sospechoso o de ms
de 10 aos de edad.

Instalaciones
Aunque a veces se debe operar a cielo abierto, en mitad del campo, el lugar de eleccin suele ser
la propia cuadra del animal, previamente sacado el estircol, desinsectada y con una cama de
aserrn o paja limpia y humedecida para no levantar polvo que con los movimientos del equino y
los operarios, penetre a la herida abierta, causando infecciones posteriores que dificultaran la
sanacin de la ciruga.
El no tener que desplazar al animal de su hbitat influye favorablemente en el ambiente de
tranquilidad recomendado en cualquier actuacin.

Preparacin del paciente

Ayuno de 24 horas.
Duchado y limpieza el da anterior, especialmente de la zona perineal. Personal
auxiliar, capacitado en esta actividad.

231
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Un ayudante no especializado, que ha de ser persona que conozca el animal, a ser posible
el propio cuidador.
El animal debe estar tranquilo antes de ser sometido a la sedacin.

Material y medicacin.
- Bistur
- Tijeras de punta roma
- Emasculador.
- Pinzas de hemostasis
- Porta agujas
- Jeringas
- Agujas del calibre 11 mm x 40mm
- Rompn.
- Lidocana.
- Vitamina K
- Cloranfenicol spray
- Suero antitetnico
- Analgsicos
- Antibiticos

Tcnica operatoria.

Sedacin
- Se efecta la intervencin con sedacin y anestesia local.
- El ayudante sujeta al paciente con un acial y se le inyecta en la vena yugular: atropina ms
xilacina ms guayacolato de glicerilo ms un gramo de pentotal, la dosificacin de estos
frmacos depende de el peso del equino a castrar.
- En tanto la medicacin va surtiendo efecto, puesto de manifiesto por la protusin y la relajacin
peniana, se dispone todo el material de forma ordenada.

- Se prepara la zona quirrgica y alrededores (escroto, regin inguinal, cara interna de las
piernas y pene) con una concienzuda limpieza con agua y jabn, seguida de una desinfeccin a
base de un compuesto yodado apropiado.

Anestesia
La anestesia local la hacemos con cinco inyecciones: infiltracin directa dentro del parnquima
testicular, ambos cordones espermticos (infiltracin del cordn espermtico a nivel de los anillos
superficiales) e infiltracin subcutnea en el lugar de la incisin. Se emplea lidocana al 2%
(Xilocaina) la dosis de 10 a 20 ml por cada testculo.
En lo posible es recomendable el uso de guantes o bien desinfectarnos las manos en caso de no
utilizarlos. La zona a operar estar bien anestesiada.

Descripcin del acto quirrgico.


Con la mano izquierda se sujeta el escroto de tal manera que los testculos estn fijos y tirantes.
Con un corte rpido y seguro del bistur se hace una incisin cutnea amplia, de
aproximadamente 10 cm. de longitud, en el rafe medio, que interese la piel del escroto y la
tnica dartos hasta llegar al septo escrotal.
Un segundo corte cuidadoso atraviesa las fascias superficial y profunda del escroto y la tnica

232
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

vaginal del testculo derecho.


Con los dedos se hace diseccin roma hasta exteriorizar por completo el testculo y el epiddimo.
Se perfora el mesorquio en su unin con la tnica vaginal parietal entre el plexo pampiniforme y
el mesofuniculum y se separa para proceder a la emasculacin y corte en dos fases.

Se emascula alrededor del cordn msculo-fibroso y se corta.


Se coloca el emasculador alrededor del cordn vascular.
Se quita y en la zona aplastada se aplica una ligadura de catgut cromado nmero 2 con doble
nudo. Se secciona de dos a cuatro cm. distal a la ligadura.
La emasculacin de la porcin msculo-fibrosa no es imprescindible en los animales jvenes en
los cuales puede ser cortada simplemente, pero por seguridad debe realizarse.
La fascia escrotal laxa que sobresale de los bordes de la herida cutnea se corta con tijeras con
objeto de que no obstaculice la cicatrizacin.
El testculo izquierdo se extirpa de la misma forma.
Se termina la intervencin con la aplicacin tpica de antibiticos en polvo dentro de la herida y
de spray antibitico y de repelente de moscas en las zonas de alrededor.

Cuidados postoperatorios.
Como medicacin postoperatoria inyectamos subcutneamente 25 UI de suero antitetnico y
damos una proteccin profilctica mediante la administracin intramuscular de un compuesto
antibitico - antiinflamatorio durante tres das.
En condiciones higinicas y de manejo adecuadas cuando el animal est a cargo directo de un
propietario capacitado, esa prevencin no es imprescindible y es suficiente con el ejercicio
controlado.
Una vez finalizado el acto quirrgico y mientras se recoge el equipo, se riega con una manguera
las partes bajas de las patas para limpiarlas de sangre y se pasea lentamente al animal durante
media hora con objeto de observar cualquier complicacin.
Se recomienda que el paciente permanezca amarrado sin que se pueda acostar durante las
primeras 24 horas y que despus de ese tiempo realice ejercicio libremente en un picadero o
corral.
Se debe observar con frecuencia el animal en las primeras 48 horas, para detectar con rapidez
cualquier problema que se genere en el postoperatorio.
A partir de los quince das el caballo se puede montar y el burro o mulo o puede trabajar, sin
excederse en sus funciones ya que aun no se encuentra recuperado del todo, hay que tener en
cuenta que es un ser vivo y no una maquina para nuestra comodidad.
No se ha encontrado ninguna diferencia entre la modalidad de una sola herida escrotal en rafe
medio o las dos incisiones cutneas paralelas tpicas sobre cada testculo, salvo en el caso de los
burros donde el drenaje por este segundo mtodo es mejor.

Las complicaciones pueden ser: hemorragias, edema, infecciones, miasis o parlisis peniana.
Hemorragias.
En ocasiones en que se presenta este fenmeno, se puede solucionar mediante taponamiento con
gasa en el escroto e inyeccin parenteral de coagulante.
Segn los distintos autores esta complicacin se debe normalmente a un emasculador inadecuado
(mala calidad, falta de limpieza, mal ajuste o demasiado afilado), a su incorrecta colocacin
(inversin del borde cortante, colocacin oblicua en vez de transversa, abertura parcial de la
quijada, corte de los vasos sanguneos en extensin) o a, la emasculacin en conjunto de las
proporciones vasculares y msculo-fibrosa.
El empleo correcto de un emasculador Reimer o Serra, unido a la doble precaucin de ligadura de
vasos, previa a la emasculacin y corte en dos fases influye en la no presentacin de hemorragias.

Edema.
El edema inflamatorio de la herida escrotal y el edema gravitacional del prepucio se pueden
considerar normal, pero no dejaremos de controlarlo mediante un manejo en ejercicio adecuado,
sobre todo en los mulos y asnos a los que se les deber obligar a trotar para reducirlo ya que as a

233
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

la vez se facilita un correcto drenaje.

Infecciones y miasis.
No se presentan con mucha frecuencia en heridas correctamente tratadas como lo es el cuidado
de aplicar una tcnica quirrgica lo ms asptica posible en las condiciones prcticas de campo
donde se acta, a la medicacin preventiva postoperatoria y al asesoramiento y educacin dirigida
al cuidador, sobre todo en lo que respecta a la aplicacin de spray antibitico y repelentes de
insectos alrededor de la zona operatoria durante el periodo de cicatrizacin.

Otras posibles complicaciones tras la castracin como hidrocele, comportamiento de caballo entero
o parlisis peniana descritas por diferentes autores no se presentan con mucha frecuencia, por ello
no se hace mayor relacin sobre ellas.

Por supuesto que si el quido es de carcter rebelde, no tiene un descenso testicular adecuado,
padece de hernia escrotal, es de edad avanzada o existe sospecha de alguna otra posible
contraindicacin para la castracin en pie, es preferible realizar una castracin clsica en decbito
(lateral o dorsal).

Cambios morfolgicos tras la castracin.


Los cambios morfolgicos en el caballo castrado son bien conocidos por la disminucin de los
efectos de la testosterona. El caballo entero tiene mayor musculatura y una distribucin diferente
de la masa corporal y de la grasa, si bien es verdad que la musculatura del caballo castrado es
ms que suficiente para poder acometer sus retos deportivos y laborales.
De hecho hay muchas hembras que son tan buenas o mejores que muchos caballos y tambin, por
supuesto, esto ocurre con los caballos castrados.
Por otra parte podemos decir que el msculo pesa ms que la grasa y caballos excesivamente
pesados por tener gran musculatura pueden no ser indicados para aquellas disciplinas en que
prima la resistencia. La castracin aumenta la talla por el efecto de la testosterona sobre la epfisis
sea.

Cambios de comportamiento.
Las caractersticas ms importantes que distinguen al caballo entero son de carcter: es ms
agresivo, ms distrado, a veces menos obediente, necesita ms entretenimiento, cuidados
diferentes, atencin en la estabulacin y en los viajes, debe evitarse el contacto con yeguas y
tambin con machos castrado o enteros.
Estas caractersticas estn ligadas a la secrecin hormonal del testculo. De todas formas los
caballos que han cubierto yeguas antes de la castracin pueden subirse en yeguas aunque como
es lgico son estriles.
El uso de hormonas en los caballos castrados, que es muy frecuente aunque es doping,
fundamentalmente aumenta la musculatura, retiene agua y produce unos efectos de
comportamiento similares a los del caballo entero. De hecho los caballos castrados tratados con
este tipo de hormonas tienden a montar a las yeguas e incluso la yeguas as tratadas tienen
comportamientos masculinos.

LA PICADA DE LA COLA.

234
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.asdesilla.com

Antes de intentar una aproximacin seria sobre el debatido tema del coleo en el caballo criollo
colombiano y de evaluar las razones por las cuales se hace necesaria su sancin, es importante
hacer dos precisiones fundamentales respecto del comportamiento general de todo caballo, y en
especial del nuestro, por su gran temperamento y valenta: el caballo expresa su estado de nimo
con las orejas y protesta con la cola.

De todos es conocido que cuando al montarlo inclina sus orejas hacia los lados, manifiesta
desinters y pocos deseos de trabajar, en cambio, cuando las inclina hacia adelante, adems de
embellecer su figura, manifiesta con ello alegra, conformidad y deseo de agradar a su jinete,
haciendo las cosas lo mejor posible, pero si las coloca hacia atrs es seal inequvoca de irritacin
y enfurecimiento.

En cambio, el caballo colea, generalmente, por alguna de las siguientes causas: por falta de bro,
por mal temperamento, por cojeras, por problemas en su rienda, por lesiones en la piel, por
razones sexuales, por mal quebrado, por incompleta recuperacin despus de enfermedades, por
errores en la ensillada, por ruidos extraos que le incomodan, por efecto de ciertos productos para
peinarlo, por arenilla entre capones, entre otros problemas.

QU EXPRESA EL CABALLO CON LA COLA.

El caballo levanta y baja la cola como si se tratara de un pndulo que registra excitacin. Una cola
parada significa que el caballo est alerta, indica actividad y exhuberancia. Una cola cada indica
sueo, cansancio, dolor, miedo intenso o sumisin. El motivo es que cuando ms rpido avanza el
caballo ms entra en accin su sistema muscular antigravedad. Estos msculos ayudan al animal
a elevarse y a correr, y levantar la cola forma parte del proceso. Cuando el caballo disminuye la
velocidad, cuando frena, ocurre lo contrario, y la cola cae. Adems el caballo puede levantar o
bajar la cola simplemente como seal, sin mover siquiera el cuerpo. Por ejemplo, un caballo joven,
alborotado puede acercarse a otro y demostrar sus ganas de jugar levantando la cola por sobre el
lomo tan alta como su anatoma le permita. A veces, al iniciar el juego, la intensidad con la que
levanta la cola es tal que la enrosca por sobre el lomo. Esta invitacin es inmediatamente
comprendida por el otro potrillo y enseguida empieza el juego.

De la misma manera, un caballo que est parado puede bajar la cola para expresar: Estoy
cansado y dbil, me someto a ti, t eres el jefe. De la misma manera, si le teme a otro caballo,
puede llegar a apretar la cola contra la grupa, casi como el perro que intenta meter la cola entre
las patas.

En los encuentros sexuales, tanto el padrillo como la yegua paran la cola debido a la excitacin del
momento. Aparte de las seales que el caballo emite levantando y bajando la cola, puede realizar
tambin algunos rpidos movimientos en distintas direcciones.

PICADA DE LA COLA

235
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.asdesilla.com

Esta tenebrosa intervencin busca que los animales no coleen en el marco de un juzgamiento para
evitar las sanciones que acarrea, las cuales a veces, llegan hasta la descalificacin de la
competencia.

Es el mtodo ms conocido y aplicado porque permite, aparte de la inmovilizacin de la cola, un


efecto esttico que agrada al pblico, sin embargo, es una tcnica que se debera eliminar porque
la mayora de las veces se practica de manera antihiginica, sin anestesia y en forma, por dems,
emprica, exponiendo al caballo a contingencias adversas como: fracturas en la tumbada del
animal. Tambin arterias, nervios, venas y vasos linfticos deterioran el normal funcionamiento del
rgano. Ttano u otras infecciones que puedan degenerar en septicemia que manifestada
clnicamente es difcil de tratar y puede dejar secuelas irreversibles en el ejemplar colimocho.

De igual manera, desviaciones causadas por neuritis crnicas o miositis crnicas o presentar una
asociacin de las dos. Hematomas, necrosis y gangrenas: al cortar los vasos sanguneos se
presentan hemorragias internas de intensidad variable que pueden evolucionar en forma
desfavorable y pueden empezar a necrosarce los tejidos a su alrededor y generar en una
gangrena.

El procedimiento es torturante para el ejemplar, incluso puede ocurrir su muerte. Para picar la cola
toman la base de la raz de la misma, miden cuatro dedos y en este punto se clava la navaja a
ambos lados y se seccionan los msculos. De ah se miden otros cuatro dedos y se repite la
operacin; si el animal tiene el msculo de la cola muy largo se repite por tercera vez.
GENTICA VS MANEJO

Existe la creencia de que el coleo es hereditario. Sin embargo, la experiencia demuestra que es el
resultado del mal manejo. Genticamente los caballos transmiten el malgenio, el exceso de
temperamento, lo cual exige una persona que canalice de manera adecuada estos factores. De no
ser as, tendremos un ejemplar coleador. Se habla de lneas de caballos coleadores, pero si las
analizamos detenidamente, nos encontramos con caballos bravos, en manos de brbaros
amansadores. Estos animales se defienden de los oprobios a los cuales se les somete; su defensa
natural es colear.

ODONTOLOGA EQUINA.

236
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.asdesilla.com
El tema de odontologa equina nos genera bastantes interrogantes que trataremos de resolver con
el siguiente articulo del doctor Miguel A. Echavarria B.
Odontlogo Universidad de Antioquia, publicado en ASDESILLAS.

SIGNOS DE PROBLEMAS DENTALES.


Inhabilidad para ganar o mantener el peso.
Seleccionar el alimento; consumir solo la comida blanda y dejar los alimentos duros en la
canoa.
Dificultad para masticar los alimentos.
Dejar caer el alimento al tratar de masticarlo.
Empaquetamiento de alimento en los carrillos.
Remojar el heno antes de comerlo.
"Remarcar" el pasto.
Mal olor por boca y/o nariz.
Movimientos irregulares de la mandbula.
Carrillos sensibles cuando se presionan contra los molares.
Reaccin con movimiento brusco de la cabeza al palpar la articulacin temporomandibular.
Reaccin con movimiento brusco de la cabeza al palpar los msculos masticatorios.
Salivacin abundante.
Partculas grandes de alimento en el estircol.
Episodios frecuentes de indigestin o clico.
Indocilidad.

PROBLEMAS DEL DESEMPEO DEL CABALLO RELACIONADOS CON PROBLEMAS


DENTALES.
Sacudir la cabeza hacia los lados o desplazarse con la cabeza "destapada".
Rehusar a la colocacin del freno.
Rehusar a cambiar de direccin durante el desplazamiento.
"Enredar" el paso durante la ejecucin.
Tirarse hacia fuera en las esquinas o en los giros.
Perder el centro durante el desplazamiento.
"Tablearse" el cuello.
"Botar" la cola o corcovear durante la ejecucin.
"Botar" la cola o "destaparse" cuando se "planta".
Indocilidad.

VENTAJAS DE UN ADECUADO MANTENIMIENTO DENTAL DE LA BOCA DE LOS CABALLOS


Piezas dentales suaves, mordida balanceada y equilibrada.
Mejora la trituracin de los alimentos.
Incrementa la utilizacin de los nutrientes.
Disminucin de la cantidad de alimento concentrado.
Disminucin de costos de alimentacin.
Previene la aparicin de clicos por partculas grandes.
Mejoramiento del pelaje.
Incrementa la habilidad para la concentracin.
Disposicin para trabajar y actitud obediente.
Proceso de adiestramiento uniforme y contino.

237
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Disminuye el tiempo de adiestramiento.


Mejora el desempeo del caballo.

Las bacterias carignicas de la boca de los caballos son similares a la que causan la caries dental
en humanos.
Como se explico en la primera parte del escrito el infundbulo es una cavidad normal que se
encuentra en la superficie masticatoria de los dientes incisivos y de los premolares y molares
superiores. El infundbulo va desapareciendo con la edad por el rasamiento y es uno de los
parmetros usados como referencia para determinar la edad de los caballos.
La caries dental debe ser tratada porque de lo contrario se produce destruccin masiva de los
tejidos duros del diente y los hace ms susceptibles a la fractura. Si la caries no se trata a tiempo,
puede producir dolor y causar inflamacin de la pulpa dental hasta la muerte de sta, lo que
conlleva a la inflamacin de los tejidos blandos.
Recordemos que a los caballos no se les limpian los dientes y el infundbulo es una trampa
mecnica para la acumulacin de los alimentos principalmente harinas y azcares como la melaza
y la panela que se fermentan fcilmente y favorecen la formacin agresiva de la caries.
El tratamiento de endodoncia se hace necesario cuando hay problemas con la pulpa dental
originado por la caries o por fracturas dentales accidentales o cuando no hay suficiente estructura
dentaria para hacer una prtesis fija o una corona individual.
Los caballos son muy susceptibles de sufrir accidentes dentro y fuera de la pesebrera cuando
pelean con sus congneres o cuando muerden objetos y halan bruscamente. Algunos accidentes
causan fracturas de los maxilares que deben ser reducidas en el menor tiempo posible para evitar
secuelas. Es a este nivel en donde la ciruga tiene su campo de accin.
Las maloclusiones dentales en los caballos como los "picudos" y los "belfos" tienen gran influencia
gentica pero no hay que desconocer la influencia ambiental en la que los potros crecen hoy en
da... La pesebrera! all los potros no desarrollan los msculos masticatorios, no usan
adecuadamente sus dientes y siempre los comederos no estn ubicados a nivel del piso. Algunas
maloclusiones se generan por discrepancia en el tamao de las piezas dentarias; por ejemplo si los
premolares y los molares superiores son ms largos de adelante hacia atrs en sentido horizontal
que sus oponentes inferiores se desarrollar ms fcilmente un "picudo" por atrapamiento de la
mandbula al no permitir un crecimiento normal de sta.

En la actualidad, si diagnosticamos tempranamente las maloclusiones dentales podemos


corregirlas con xito mediante tratamientos de ortopedia funcional combinada con tratamientos
ortodnticos en potros. Intervenimos el crecimiento de manera que donde falte lo estimulamos y en
donde se vea exagerado lo frenamos. As no se tiene que recurrir a la ciruga ortogntica que
implica cortar el hueso y slo se puede hacer cuando el potro termine su crecimiento.

El tratamiento no impide el proceso de adiestramiento ni la alimentacin del potro. El


mantenimiento dental adecuado y peridico, al menos una vez por ao aumenta la expectativa de
vida de los caballos; ellos viven mejor, su desempeo alcanza un gran nivel y se valoriza el precio
de los equinos.

No podemos cerrar los ojos frente a los grandes avances de la odontologa en la industria equina.
Hoy quien no aproveche esta ayuda est dando ventajas para que otros caballos se desempeen
cada da mejor en las diferentes competencias de acuerdo a la modalidad en que se presentan .
SUJECIN Y DERRIBO DEL EQUINO.

Los equinos son nerviosos, poseen gran fuerza y velocidad; esto los hace potencialmente
peligrosos, adems su agudeza auditiva obliga a quien los maneje a estar seguro de la prctica
que va a ejecutar, realizarla con la mxima seguridad tanto para l como para el animal, esto
evitar accidentes graves para cualquiera de los dos.

Es imprescindible el buen trato al animal, ya que ste ser fcil de manejar si quien lo maneja

238
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

demuestra seguridad, firmeza y ante todo inspire confianza al animal, el acercamiento directo, de
frente proporcionar calma al equino.

Bsicamente se conocen tres mtodos para la sujecin:

Mtodos Benignos: No producen molestias significativas al animal, la ms comn es la


sujecin de la cabeza bien sea a un botaln, o simplemente sujetando firmemente el
cabezal. Otro mtodo benigno son las caricias, palmadas suaves en el cuello, silbidos y el
hablarle al animal

Mtodos Derivativos: Son ms crueles, pues se busca producir cierto grado de dolor en un
sitio determinado, con dichos mtodos se busca dominar y distraer el animal, los ms
comunes son:
Acial en el labio superior. Acial en la
oreja
Bozal alemn

Los dos primeros se ejecutan mediante el acial instrumento conformado por un palo y una
cuerda, la cuerda ser la parte que hace contacto con la regin anatmica del animal, con el palo
se maneja girndola, para as acortar la longitud de la cuerda, al reducirse sta presiona la oreja o
el labio, y el dolor que genera inmovilizar al animal, se debe tener cuidado de no apretar en
exceso el torniquete, ni prolongar por demasiado tiempo la sujecin por este mtodo, ya que o bien
puede fracturar la oreja, lesionar el labio o causar prdida de irrigacin igualmente grave para la
zona sometida a presin.

El bozal alemn, es un lazo que va por detrs de las orejas y luego por las comisuras labiales por
encima de la lengua. As ubicado, funciona al girarlo sobre un eje central para producir un
torniquete; se debe tener cuidado de no apretar en exceso pues se pueden romper las comisuras
labiales.

Mtodos Mecnicos: La mayora son tiles y prcticos, con ellos se busca inmovilizar un
miembro, el conjunto lateral de los miembros anteriores o posteriores, y algunas veces las
cuatro extremidades.

Mediante el Hipolazo se reduce en un 50% la potencia de los miembros posteriores; el mtodo


consiste en efectuar una llave en el cuello con un nudo fino (no corredizo), con una de las puntas
del lazo, se da la vuelta por detrs de los miembros posteriores para regresar al cuello y anudarse
a la llave hecha con la otra punta del lazo.

Para el derribo de equinos existen mtodos fsicos por medio de sogas y trabones; mtodos
qumicos aplicando frmacos relajantes y an anestsicos generales aplicados por va oral o
intravenosa. El lugar en que se piense derribar el equino deber estar libre de cualquier elemento
traumtico, el cual pueda ocasionar lesiones al animal.

Los trabones son los ms seguros para el derribo, el nico inconveniente radica en poner los
brazaletes en las extremidades. El derribo mediante sogas es algo ms complicado y exige pericia
y cierta fortaleza fsica del operario, adems se debe asegurar que la cada se producir
suavemente, de lo contrario habr grave riesgo de fracturas o ruptura de vsceras.

EQUIPOS Y UTENSILIOS PARA UN CORRECTO MANEJO DEL CABALLO.

Los utensilios y equipos empleados son tan variados como: un equipo de herraje, un botiqun, una

239
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

manta, vendas o una almohaza (cepillo), algunos sern imprescindibles, otros por el contrario
pueden ser de uso electivo.

La cantidad y el diseo de los equipos dependen muchas veces del gusto y la capacidad
econmica de los propietarios. El equipo deber ser sencillo, prctico y de fcil manejo.

Otro factor a tener en cuenta al momento de la consecucin del equipo, ser el tipo de caballos, el
objetivo para el cual se posean, ya que los equinos de silla (paso fino, de carreras, de deporte)
tienen un manejo diferente a los quidos empleados en vaquera o trabajo.

Los caballos estabulados se deben asear a diario, para favorecer su aspecto y para mantener en
estado saludable su pelaje y su piel, esto lo consiguen por sus propios medios los equinos que
estn en pastoreo libre.

El equipo para aseo debe tener como mnimo un cepillo superficial, uno de cuerpo; almohaza,
peines para crines, gancho de cascos, aceite para cascos.

Leccin 36 LIMPIEZA DE LOS EQUINOS.

Una limpieza correcta de nuestro caballo no slo conseguir mejorar notablemente su aspecto,
sino que adems le ayudar a mantenerle sano.

EQUIPO DE LIMPIEZA

Un equipo completo de limpieza deber estar formado fundamentalmente por los siguientes
elementos:

Cepillo de races: cuyas cerdas pueden ser naturales o de plstico. Muy til para eliminar
las manchas propias de la cuadra (barro seco, estircol...) el cepillo de cuerpo elimina la
grasa, sta se retira del cepillo con la almohaza y es la nica finalidad de este instrumento;
el cepillo o peine para crines se emplea para peinar la cola y la crin sin romper las fibras de
las mismas

Cepillo de Races

Bruza: elemento ms cmodo que el cepillo ya que se adapta a nuestra mano y es ms


ligera; sus cerdas adems son ms cortas y suaves, con lo cual evitamos hacer dao al
animal si accidentalmente le golpeamos con ella. Se utiliza para eliminar la suciedad en
general (grasa, caspa...) no slo del pelo sino de la piel en general. Muy recomendable para
la cola y la crin.

240
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Bruza

Almohaza: para quitar el polvo que se ha pegado en las zonas mas profundas de la piel y
tambin vlida para la limpieza de la grupa, debe usarse con suavidad.

Almohaza
Limpia sudor: para eliminar el exceso de agua lluvia, ducha o de sudor.

Limpia sudor

Tijeras: para arreglar cola, tup, crin y pelos que sobresalen en las orejas.

Tijeras

Esquiladora: que podr ser manual o mecnica, cualquiera de ellas nos ser de gran ayuda a la
hora de cortar el pelo al caballo.

DUCHA CON AGUA Y JABN.

Se trata de una forma de limpieza nicamente aconsejable en caso de que el caballo est sucio de

241
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

grasa, ya que el exceso de jabn reseca la piel del animal, llegando a producirle prurito e incluso
dejndola sin brillo (si no es ms conveniente lavarlo nicamente con agua).Para duchar al caballo
con agua y jabn es recomendable seguir estas pautas:

Utilizar jabones especiales.


Aplicar el jabn una nica vez (no hay que aclarar y volver a enjabonar).
Utilizar agua al clima.
En invierno conviene lavar al animal por partes, utilizando una manta para cubrir el lugar del
cuerpo que no estamos limpiando. Si estamos a baja temperatura conviene ser rpidos en el
bao y, una vez terminemos, secar y cubrir de inmediato al caballo para que no coja fro.
Existen esponjas especiales, le recomienda utilizar una para el enjabonado y otra para el
enjuague.
Para enjabonar realice movimientos circulares sobre el cuerpo del animal.
No enjabone la cabeza del caballo pero al igual que el resto del cuerpo debe ser lavada.

LIMPIAR CON TOALLAS CALIENTES.

Mtodo adecuado para la limpieza del caballo en los climas o das fros, con el que evitaremos
posibles resfriados.
Para limpiar al caballo de esta forma necesitaremos un balde con agua muy caliente, una toalla lo
ms grande posible y un champ especial (slo en caso de que exista mucha suciedad o que sta
sea de grasa); tambin le recomendamos que utilice guantes de goma (para aguantar el agua
caliente).
La forma de hacerlo es como sigue:

Aadimos un poco de champ al agua caliente que tenemos en el balde. Introducimos la


toalla en el agua hasta empaparla.
Escurrimos y desplegamos la toalla para pasarla por el pelo del caballo, durante slo unos
segundos (de esta forma ablandaremos la suciedad).
Envolvemos la toalla y frotamos con ella el pelo.
Pasamos la toalla suavemente en el sentido del pelo.
Repetiremos toda la operacin por cada parte del caballo, cuidando de que el agua est
siempre caliente.

Para finalizar limpiamos con otra toalla paro en esta ocasin empapada de agua caliente pero sin
jabn, hasta que quede sin ningn residuo del mismo.

LIMPIEZA DE LOS CASCOS.

Se trata de una parte del caballo que siempre deber permanecer limpia. Aunque no dispongamos
de tiempo para lavar al caballo por completo, por lo menos una vez al da deberemos dedicar unos
minutos a la limpieza de sus cascos. Para ello utilizaremos simplemente un limpia cascos o un
jabn suave.

Es una zona en la que pueden clavarse diferentes objetos, produciendo heridas de considerable
peligro; adems en ellos se suele acumular estircol, lo que los convierte tambin en un foco de
infeccin si no estn perfectamente limpios.

A esto se suma el hecho de que los caballos con cascos blandos suelen tener el problema de que
se desgastan con enorme facilidad y rapidez, especialmente por la parte de los talones; por lo que
la revisin diaria es ineludible. En esta revisin deberemos adems analizar el estado de las
herraduras, su asentamiento, los clavos. La limpieza diaria de los cascos puede evitarnos

242
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

numerosos contratiempos.

Adems del nombrado limpia cascos, es aconsejable utilizar otros dos productos, que son:

Pomada para cascos: refuerza y favorece su desarrollo natural, evitando el agrietamiento y


favoreciendo su elasticidad).

Alquitrn para cascos: que nos ayudar a eliminar las bacterias, los grmenes y el mal olor.

El aceite se necesita para mantener el casco lubricado y hmedo, evitando que este se
resquebraje.

LIMPIEZA COMPLETA.

Es la limpieza que conviene realizar al caballo una vez haya finalizado su trabajo ya que en ese
momento su cuerpo estar caliente, lo que favorece que la suciedad se suelte mucho ms
fcilmente y le resultara mucho mas agradable.

Primero deberemos eliminar los restos de barro y de sudor utilizando el cepillo de races que
pasaremos sobre la piel del caballo con suavidad para no molestarle. Hay que prestar
especial cuidado a las zonas sensibles: cabeza, vientre y parte interior de las extremidades.

Despus cogeremos la bruza y la pasaremos enrgicamente por cada parte del caballo.
Conviene realizar alrededor de seis pasadas en cada lugar, sin golpear al animal con la
bruza sino ms bien apoyndola de forma suave pero firmemente de modo que las cerdas
penetren en su pelo y limpien la piel.

Despus de cada pasada es conveniente limpiar la bruza, para lo cual la frotaremos contra
la almohaza.

Limpie siempre hacia abajo y hacia atrs. Despus se


limpiarn los cascos.

La cara y el tercio superior se lavarn con unas esponjas suficientemente humedecidas.

Por ltimo peinar la cola y la crin con un cepillo de races para que quede desenredada y
suelta.

El aseo es bsico para prevenir enfermedades de la piel (dermatitis, eczemas, etc.) cuya
presentacin es ms frecuente en animales sin las prcticas de aseo convenientes, en los cuales
la acumulacin de barro, detritus y sudor crear el ambiente propicio para que se desarrolle la
dermatitis.

El equipo para el bienestar del equino consta de mantas, arneses, monturas y bridas, stas
debern ser cmodas y diseadas de tal forma que respeten la conformacin anatmica del
equino; de cada uno de dichos elementos hay infinidad de modelos, las caractersticas de cada
uno vara segn el tipo de equino.

243
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

CAPITULO 8 ALOJAMIENTO Y TRANSPORTE DE LOS EQUINOS

Introduccin

Leccin 37 ALOJAMIENTO.

www.caballomania.com

Una caballeriza bien iluminada y con acceso a un corral de ejercicio es deseable para que los
caballos se mantengan en condiciones ptimas de salud y tono muscular. El alojamiento debe
permitir un espacio adecuado en los pasillos para permitir el movimiento seguro de los caballos y
sus cuidadores. En las caballerizas no debe existir ningn objeto saliente que pueda lastimar a los

244
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

animales. Las paredes debern ser lo suficientemente altas para prevenir las interacciones con los
caballos alojados a los lados. Las paredes, puertas, ventanas, comederos y bebederos,
independientemente de los materiales utilizados, no deben presentar superficies angulares o
formas que puedan causar dao fsico a los animales. Es recomendable disear las puertas de 1,6
a 2 m de ancho y de 3 m de alto, aproximadamente, para facilitar el movimiento de los animales,
sin riesgo ni lesiones. Los techos tambin debern tener una altura adecuada, de 3 m para permitir
al caballo asumir una postura normal y evitar lesiones en la cabeza. Los pisos debern tener una
superficie durable, no resbalosa. Bajo condiciones de laboratorio o en instituciones educativas, se
deber proporcionar un cuarto o rea separada de la zona de las caballerizas para realizar
procedimientos de preferencia con una manga de manejo.

El alojamiento del potrillo, ser amplio y deber poseer puerta que abra directamente hacia la
manga de pastoreo, por seguridad deber estar separado de los alojamientos de los caballos
adultos. La puerta debe permanecer abierta, esto brinda la posibilidad de que el potrillo disfrute de
aire fresco, luz solar y ejercicio adicional.

Las yeguas gestantes tendrn un rea de alojamiento similar, con la excepcin de que no tendrn
libre acceso a la pradera; las yeguas vacas (no gestantes) se mantendrn en campo, alejadas del
resto del yeguerizo dado que stas estn ms dispuestas a correr y cocear a las dems.

Segn la zona la zona geogrfica, se debe procurar que las construcciones queden ubicadas en
direccin este-oeste para climas clidos, buscando que su interior permanezca fresco la mayor
parte del da. Para climas fros debe estar en direccin norte-sur buscando un ambiente tibio dentro
de la construccin. Para zonas con vientos muy fuertes y fros, se recomienda tener barreras vivas,
aproximadamente a unos 10 metros de las caballerizas.

Hay tres tipos bsicos de alojamientos:

a) Establo. Los caballos permanecen atados en los establos, aunque existe controversia
respecto a su uso. Informacin objetiva en relacin con el uso de los establos an no se
encuentra disponible, pero se debe tener en cuenta el bienestar animal antes que la
comodidad humana.
b) Pesebreras abiertas. Estn construidas tpicamente en hileras. Un techo saliente encima
del frente de las pesebreras puede proveer refugio a los caballos y ayudar en los climas
inclementes. La mitad superior abierta de la puerta de la pesebrera les permite a los
caballos disfrutar del aire fresco y de un ambiente estimulante. Las pesebreras abiertas
tambin pueden ser construidas alrededor del diseo de un patio.
Caballeriza. Las caballerizas se construyen en muchas formas y tamaos que varan desde
bajas y largas, para ocupar hasta con 100 caballos, hasta mini caballerizas, que se ocupan
con una docena de caballos. Las caballerizas tienen ventajas y algunas desventajas: entre
las primeras, hay un costo adecuado para su construccin, facilitan un excelente ambiente
de trabajo y usan el espacio abierto; es decir, las trancas abiertas entre las pesebreras
dentro de la caballeriza, ayudan a suplir las necesidades de comportamiento de los
caballos. La desventaja principal est asociada con las grandes caballerizas de baja altura,
en las cuales puede ser difcil lograr una adecuada mezcla del aire.

Las dimensiones ideales son 3.50m x 3.50m x 3m para el caballo, para el pony 3m x 3m, ya que se
les debe proporcionar la facilidad de moverse sin que tenga un percance con alguna pared al
momento de acostarse o levantarse.

El espacio debe estar acondicionado para la comodidad del animal como es la luz ya que la
oscuridad artificial puede afectarlos en su visin, debe contar con una excelente ventilacin de lo
contrario puede presentar diversos trastornos bronquiales.

245
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Algunos pases han construido pesebreras individuales dentro de un corral o cobertizo grande, los
cuales pueden encontrarse en el pasillo central que posee puertas en sus extremos, este tipo de
construccin se adopta principalmente en las regiones fras, y puede ser adoptada en todo tipo de
regiones ya que tiene gran facilidad de transformacin.

No importando el tipo de construccin es importante que estos cuenten con pesebres para los
alimentos concentrados, el recipiente para el heno y un anillo para atar tanto el fardo de heno o
que puede ser utilizada para atar al caballo mientras se le cuida. Los bebederos pueden ser
automticos, esto es recomendable, ya que el caballo como hemos explicado es de costumbres y
pronto se acostumbrara, tambin puede ser en cubos, los cuales deben ser fijos y seguros
evitando que se volteen, tienen que estar siempre limpios ya que al momento de beber, el caballo
suelta babas y con frecuencia se forma el limo, por este motivo deben fregarse con frecuencia.

El agua debe estar siempre limpia y disponible a libre acceso o proporcionrselas por lo menos dos
veces al da. Los requerimientos de agua dependen de varios factores, tales como la temperatura
ambiental, la funcin del animal y la composicin de la dieta. Sin embargo un caballo en general
requiere de 2 a 4 L de agua por cada Kg. de materia seca.
Un caballo con dieta de mantenimiento en un ambiente termo neutral puede requerir de 15 a 35 L,
pero uno que est trabajando y sudando o lactando puede requerir de 50 a 80 L.

Los caballos en confinamiento deben ser alimentados por lo menos dos veces al da. Cuando no
tienen acceso al pastoreo se les debe proporcionar forraje en la forma de paja u otros materiales
fibrosos para disminuir la incidencia de clicos y problemas de comportamiento tales como morder
la puerta o el borde del pesebre, masticar madera o comerse su cama.
As es que el fondo del pesebre o comedero debe estar a 60 cm., del suelo, aunque depende de la
estatura del caballo, algunos prefieren utilizar ste en el suelo pero no es recomendable ya que
existe la posibilidad de que el agua y el traste de alimentos se contamine con residuos de la paja u
otros y el caballo es demasiado meticuloso para alimentarse, al igual que el ser humano disfruta de
un plato limpio, los caballos encuentran el alimento de mayor agrado cuando ste se les presenta
en buenas condiciones. El tipo de comedero ms til es del tipo movible ya que facilita la limpieza,
debemos recordar que despus de cada alimento el resto de este que quede dentro de los
comederos debe ser retirado, de lo contrario puede llegar a fermentarse y causar daos o
infecciones.

Tenemos tambin los comedores de heno, los ms cmodos de utilizar son del tipo triangular
curvo, los cuales deben colocarse a 120 cm. del suelo evitando algn contratiempo con el caballo
al momento de levantarse. Al utilizarse las argollas para colgar el heno y los arrendaderos debe
estar aproximadamente a 1.60 m, stos sujetos con un nudo corredizo que facilite el correr de la
red sin caerse a medida que el caballo come y evitando que se le enreden las extremidades.

Existen distintos tipos de caballerizas, las que son aisladas y las colectivas, las aisladas deben ser
de dos piezas, inferior y superior, el de tipo inferior se debe conformar por dos piezas con dos
cerrojos exteriores en la parte de arriba y otro en la parte de abajo, facilitndole al mozo el cierre
inferior. La parte superior de este tipo de caballeriza, debe estar siempre abierta de tal manera que
le d libertad al caballo de saber lo que pasa a su alrededor y slo se cerrar cuando ocurran
malos tiempos. El techo debe sobresalir aproximadamente 1 m. delante de la fachada de esta
manera en tiempo de lluvia el animal puede asomarse y puede ser alimentado sin ningn riesgo a
mojarse. Las de tipo colectivo son ventiladas por las ventanas y puertas del lugar, siendo la puerta
de una sola pieza.

Como hemos mencionado anteriormente todos los tipos de caballeriza deben tener ventilacin,
iluminacin y otros factores que sern tratados ms adelante, todo con el debido cuidado, ya que el
animal puede recibir percances si estuvieran colocados de una forma inadecuada.

246
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Los animales estabulados que no reciben suficiente ejercicio se aburren y como consecuencia
pueden presentar ciertos problemas de comportamiento tales como: bamboleo, morder el borde del
pesebre o de la puerta, tragar aire, masticar madera o caminar en crculo por la caballeriza.

La higiene y el ambiente fsico de un establo pueden afectar la seguridad y el bienestar del caballo
mediante:

a) El incremento en la magnitud de las oportunidades de microorganismos infecciosos,


parsitos, gases nocivos y partculas irritantes o alergnicas.

b) La alteracin de la resistencia local o sistmica (orgnica) del caballo.

c) El incremento del riesgo de dao fsico.

d) Fallas para llenar las necesidades de comportamiento del caballo.

El diseo y el manejo de un establo dependen lgicamente de la evaluacin de estos efectos.

Se debe tener en cuenta las siguientes consideraciones al momento de construir o seleccionar una
caballeriza para los caballos:

1. Temperatura.
La temperatura interna de las instalaciones y la ventilacin dependen en gran parte del clima, del
nmero de animales alojados y de los materiales empleados en la construccin de las mismas. Los
caballos pueden tolerar bajas temperaturas siempre y cuando exista suficiente proteccin de los
vientos y lluvias extremas. De igual manera pueden tolerar temperaturas altas siempre y cuando se
les proporcione sombra en praderas y una ventilacin y humedad apropiadas en las caballerizas.
Debe existir suficiente agua potable y fresca disponible en todo momento., especialmente en
climas calurosos. La temperatura ptima se encuentra entre 10 y 15C, aunque pueden tolerar de -
7 a 29C si se alojan en caballerizas secas y libres de corrientes de aire.

2. Ventilacin.
La temperatura, los niveles de vapor de agua, las concentraciones de gases nocivos, el polvo y los
microbios son afectados por la ventilacin. As mismo, ayuda al control de la condensacin,
disminuye el nivel de patgenos transportados en el aire, los cuales no pueden ser controlados por
otros medios, y ayudan a prevenir el enmohecimiento de los materiales de la cama.
Una construccin bien planeada debe permitir un adecuado intercambio de aire, que ayude a
reducir la humedad, concentracin de amonaco y polvo en su interior. Es ideal poder utilizar
techos con respiraderos en forma de campana, ventanas grandes o acoplar extractores de aire en
3
las paredes. La capacidad de ventilacin debe ser de por lo menos 2.8 m /min. Por cada 450 Kg.
de caballo a temperaturas de -1 a 10C y deber incrementarse a medida que aumente la
temperatura.

3. Humedad.

La humedad relativa en alojamientos para caballos deber estar entre 50 y 80%.

4. Luz.
La cantidad de luz deber permitir el examen adecuado del caballo y de su caballeriza. Se debe
evitar la oscuridad total, por lo que deber existir luz artificial durante la noche. Se recomiendan por
lo menos 200 lux para los pasillos y reas de alimentacin y manejo.

247
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

5. Cama.
Se debe proporcionar suficiente cama en la forma de aserrn, paja, cascarilla de arroz o algn otro
material adecuado. Deber existir un drenaje adecuado para evitar problemas en los cascos y que
el animal se ensucie innecesariamente, pero su funcin principal es la de absorber la humedad
causada por el estircol y la orina. El mantenimiento de la cama debe ser diario, y preferiblemente
cuando el animal no est en la pesebrera. Procurando as animales limpios y secos, y el medio
ambiente libre de olores. Los animales no debern tener acceso al estercolero para evitar
infestaciones de parsitos.

6. Densidad de poblacin.
Idealmente los caballos debern alojarse en caballerizas individuales de por lo menos 3.5 x 3.5 m x
3.0 m y tener acceso a un corral de ejercicio de 10 x 27.5 m mayor. Despus del destete es
conveniente que cada animal tenga una caballeriza separada. En el corral de ejercicio se debe
mantener una separacin por edad y compatibilidad.

7. Pisos.
Los pisos deben ser antirresbaladizos y de superficie dura; no deben generar fro; se debe adecuar
un buen drenaje. Existe un tipo de ladrillo especial para las cuadras, el concreto que es el material
ms usado hoy en da, hay otras alternativas posibles como ladrillo, pavimento, cemento rugoso,
caliza o tablillas. Los pisos, independientemente del material con el que se construyan, deben tener
una pendiente del 2%, para facilitar un adecuado drenaje, esta inclinacin debe quedar lo ms
alejado de la puerta, formando la alcantarilla para facilitar la limpieza del mismo.

Finalmente es de aclarar que la mayora de la poblacin equina en nuestro medio, permanece en


pastoreo libre y no goza de ningn tipo de alojamiento especial.

Leccin 38 TRANSPORTE.

Los equinos suelen ser transportados con relativa frecuencia, ya sea a competencias o a
exposiciones, los medios de transporte son tan variados como remolques, camiones, barcos o
aviones, cualquiera que sea el medio empleado para el traslado deber ser seguro y cmodo,
adems se buscar que sea econmico.

Para asegurar que el traslado sea exitoso deber estar precedido de una correcta preparacin de
los equinos.

A continuacin expondremos algunas consideraciones de importancia para el transporte de


ejemplares equinos:

Los caballos se deben acostumbrar a ser transportados desde temprana edad; el animal
estar menos excitado cuando ha tenido experiencias previas de transporte.

Los certificados de sanidad y propiedad deben ser enviados junto con el animal; en cuanto
al certificado de sanidad se refiere, ste deber ir firmado por un Mdico Veterinario,
adems por las autoridades sanitarias de la regin (ICA), trasladar caballos enfermos es
riesgoso tanto para el animal (soportan muy mal el transporte), como para los restantes
animales en el evento, o en la explotacin a donde vaya a llegar el animal transportado.

Los horarios de traslado se deben planificar con anticipacin, con el fin de que los equinos
lleguen con suficiente antelacin a la fecha del certamen.

248
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Descanso, los caballos viajan ms cmodos cuando se transportan cmodamente y


descansados, por tanto, no deben ser ejercitados excesivamente o trabajados hasta la
fatiga, antes del embarque.

El medio de transporte deber ser lavado y desinfectado, esta es una forma de prevencin
contra enfermedades infecciosas.

Disposicin de cama adecuada, el piso debe cubrirse con arena seca para que los
animales no se resbalen, sobre la arena se colocar paja limpia y blanda, sta contribuir a
que el caballo est ms limpio y goce de un buen reposo; adems la cama absorbe la orina
y evita humedades excesivas.

Ventilacin, el sitio deber tener buena ventilacin, pero sin que se formen corrientes de
aire.

El transporte debe encargarse a una persona con experiencia, dado el alto costo de los
ejemplares el traslado de los mismos no puede encomendarse a cualquier persona, en lo
posible es mejor contar en la explotacin con el equipo y personal necesario para el
transporte, cuando ste se efecte por carretera.

Agua: se suministrar con frecuencia agua limpia y fresca, se debe evitar que beban en exceso.

El interior del cubculo de transporte, esto previene traumatismos en caso de paradas sbitas o de
sacudidas extremas especialmente en carreteras que presenten irregularidades en su superficie.

La rampa de ascenso y descenso debe ser resistente, segura, el animal debe pisarla sin riesgo, de
lo contrario se rechazar a ingresar en la misma.

El caballo no debe viajar con herraduras de tacn, se le debe herrar con herraduras planas, en lo
posible quitar todos los herrajes, o al. Menos los de los miembros posteriores,

Los caballos de salto, polo o de carreras deben viajar con las patas vendadas para evitar
Contusiones en las cuartillas o en los tendones, las vendas se deben soltar y ponerla nuevamente
cuando el recorrido es demasiado largo.

Si el tipo de transporte es muy abierto (camin de estacas) los caballos deben protegerce con
mantas adecuadas.

Si en el transporte viajan ms de dos equinos, deben agruparse de tal forma que queden juntos los
animales que estn acostumbrados a trabajar o pastar en compaa.

Se deber levar equipo de emergencia, el cual incluye botiqun, cabrestos, herramientas para
herraje, elementos de aseo.

El manejo del equino en el transporte lo har la persona que lo atiende a diario, esto le inspirar
confianza; si por algn motivo el caballo se excita hasta el extremo de poder infringirse dao se
deber tranquilizar con frmacos si los mtodos populares no han producido resultados
satisfactorios.

249
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Leccin 39 PRODUCCIN DE ASNALES Y MULARES

Asno Mula
http://es.wikipedia.org

Tanto los caballos como los asnos eran nativos de Asia y posiblemente de frica, es muy probable
que los primeros mulares surgieran en donde los caballos y los asnos existan juntos en su estado
salvaje. O podra ser que algunas de las tribus nmadas, tentadas por la curiosidad, hicieron la
cruza y al ver que hacan buenas bestias de trabajo, continuaron con la produccin de mulas.

Lo que si es seguro, es que desde hace mucho tiempo la mula tiene fama por su resistencia, su
seguridad del paso en el trabajo, y como animal de carga.

Quizs como consecuencia de las malas condiciones en que se desarrollan en nuestro medio, la
mala alimentacin, el exceso de trabajo, estos animales no exhiban todo su potencial, en general,
los asnales y mulares son muy rsticos y de gran resistencia para el trabajo.

En nuestro pas, estos animales han gozado de gran aceptacin, especialmente en ncleos de
Poblacin de escasos recursos econmicos; es lgico por tanto que en un texto de Produccin
Equina se deban analizar los principales aspectos concernientes a ellos.

ORIGEN DE LOS ASNALES

250
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.rac.uab.es

Nuestro asno desciende del mestizaje entre el cataln, Poitou y el andaluz; es de tamao pequeo,
color rucio ms o menos oscuro. Es indudable que los primeros asnos llegaron a nuestro pas
trados en la conquista por los espaoles.

El asno soporta el fro y la humedad en menor proporcin que el caballo por ello los mejores
ejemplares se encuentran en Persia, Siria, Egipto, Berbera y en Europa meridional. Los de inferior
categora son los que viven en frica central, o bien en los lmites de su rea de dispersin de las
regiones europeas.

Los sentidos del asno domstico estn bastante desarrollados: en primer lugar figura el odo,
despus la vista y luego el olfato; parece ser que el tacto no es muy fino, ni tampoco el gusto. Las
facultades intelectivas de este quido no son tan pobres como generalmente se cree: de hecho
tiene una memoria excelente y sabe encontrar cualquier sendero, aunque lo haya recorrido una
sola vez. Adems, aunque parezca estpido, es sagaz y listo, y sobre todo completamente
pacfico.

El burro es un animal territorial, le gusta estar en compaa siempre, aunque en situaciones lmites
donde la comida es escasa son animales ms solitarios que solo se emparejan para aparearse. En
grupos, no parece mantenerse una jerarqua establecida.

El burro tiene el doble de la cantidad de glbulos rojos en la sangre que otras especies, incluido el
caballo, lo que les permite alcanzar un comportamiento fisiolgico ptimo.

El asno muestra una personalidad entera por lo que si se le trata bien pero con dominio, se
consigue su eterna colaboracin. De no ser as mostrar testarudez resistindose a las rdenes del
amo ya que no confa en el.

En casos as conviene relajarse y sobretodo no pegarle, hacerle dar tres vueltas en circulo
cerradas seguidas y probar de nuevo, posiblemente acceda a hacer lo que hasta entonces se
negaba.

Un burro bebe tres veces menos agua que un caballo y come cuatro veces menos que un caballo,
aparte de que en comida es muchsimo menos exigente.

Las razas de asnos criadas en la actualidad no son muy numerosas, presentando una notable
heterogeneidad, sobre todo en lo que se refiere a la alzada que, medida en la cruz, vara desde
menos de un metro a 1,60 m. La cra del asno se efecta hoy da siguiendo criterios racionales en
centros de seleccin especializados, cuyo primordial objetivo es la cra de sementales, elegidos
para utilizarlos en la produccin del mulo, que, como ya se sabe, es un hbrido resultante del cruce
entre el asno y la yegua.

En la especie asnal, el macho se destina a la reproduccin a los treinta y seis meses y la hembra a
los cuarenta y ocho. A un asno se le asignan, anualmente, de cincuenta a noventa hembras. La
gestacin dura trescientos sesenta das y en cada parto nace un pollino, que pesa unos 30 Kg. y
es amamantado durante ciento cincuenta das, completando su desarrollo somtico a los sesenta
meses. Estos animales tienen un promedio de vida de unos veinticinco aos.

Actualmente se estima la poblacin asnal en 400.000 ejemplares, la mayora de estos,


corresponde a ejemplares mestizos o criollos y slo un nmero reducido de ejemplares puros de
razas definidas.

El asno pertenece al gnero Equus y a la especie asinus. Las principales diferencias con el caballo

251
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

(Equus caballus) son:

El asno es de menor alzada, tamao y peso.


La cabeza del asno es mayor en proporcin al cuerpo.
Las orejas son muy largas, de ac el adagio orejas de burro. El labio
superior es puntiagudo y ligeramente colgante.
Cara ancha y plana, lo que le confiere un aspecto de rudeza. El borde
superior del cuello es recto y provisto de poca crin. Grupa cada.
Los cascos son ms altos, estrechos y ms duros que los de los equinos. En la regin
dorsal, muestra siempre raya de mula.

Su longevidad es mayor a la del caballo, presta utilidad fcilmente durante 20- 25 aos.

Leccin 40 PRINCIPALES RAZAS DE ASNOS.

La especie asnal es de naturaleza mucho menos polimorfa (variable) que la equina; sus
variaciones son apenas mnimas y por ello las razas son poco numerosas.

Teniendo en cuenta tamao y peso describiremos las principales razas.

CATALANA

www.rac.uab.es

Se origina en la regin de Catalua (Espaa), parece derivar de asnos tipo africano. Su alzada
est entre 1.40 1.45 metros, pesa +/- 350 Kilos. Orejas largas y derechas, cascos oscuros,
costillas bien arqueadas. Temperamento activo, pelaje zaino oscuro. Raza muy precoz y potente.

POITOU

252
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.viarural.com.ar

Origen en el centro y sur de Francia. Alzada entre 1.5 1.6 metros; se le considera el ms grande
de todos los asnales. Cabeza grande, orejas anchas y gruesas, cuello corto y musculoso, trax
amplio, remos aplomados y slidos, cascos duros, estrechos y altos de talones, pelo largo y rizado,
pelajes marrn oscuro o zaino en ocasiones casi negro.

Raza excelente para hibridar con equinos de tiro pesado ya que se obtienen mulares de gran peso
y tamao. Su principal caracterstica es la de ser una de las razas ms potentes y rsticas dentro
de los asnales.

ANDALUZA

http://www.ansi.okstate.edu/breeds/

Originaria de Andaluca (Sur de Espaa). Alzada entre 1.40 - 1.45 metros, pesa entre 230 - 300
kilos, cuello mediano, excelentes aplomos, pelaje gris claro o blanquecino.

Se aconseja para hibridar con equinos semipesados, son animales sobrios, rsticos y vigorosos
para todo tipo de trabajo.

NORTEAMERICANA

253
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.rac.uab.es

Mestizo de las razas Andaluza, Catalana, Poitou, Malts e Italiana; los cruces y seleccin se
efectuaron en los estados de Kentucky, Tennese y Missouri en los Estados Unidos. Su
conformacin es muy parecida a la de los caballos de tiro pesado, logra 540 kilos, es el ms
pesado de la especie su alzada va de 1.55 a 1.60 metros. Cabeza erguida, orejas largas y erectas,
dorso recto, grupa corta, pecho ancho y profundo, costillar bien arqueado, buenos aplomos, cascos
altos, redondos y grandes, pelaje negro u oscuro.

Esta raza se emplea con frecuencia para la produccin de mulares. Se desempea muy bien como
animal de carga y traccin, aunque por su peso y tamao son algo lentos.

Leccin 41 ORIGEN DE LOS MULARES.

http://www.ansi.okstate.edu/breeds/

Los primeros reportes escritos acerca de los mulares se encuentran en el Antiguo Testamento, en
la poca del Rey David; esto indicara que su uso se inici mucho antes.

En Amrica, a finales del siglo XVIII, en el estado de Virginia en Estados Unidos los asnales
mestizos catalanes y andaluces se aparearon con yeguas de tiro liviano y semipesado, as se
produjeron mulares de excelente calidad para faenas de tiro y labores agrcolas:

Si el cruzamiento se efecta entre un macho asnal y la hembra equina se logra la mula (hembra) o
el muleto (macho); si el cruzamiento se realiza entre un macho equino padrillo y una hembra
asnal se llega al burdgano o romo de menor aceptacin que el mular; tanto unos como otros se
parecen ms a la madre que al padre.
Como regla general, los productos hbridos son estriles, aunque si bien, se conocen excepciones,
los reportes de estas no son numerosos.

La mula en su aspecto externo es ms parecida al asno que a la yegua, pero anatmicamente


ocurre todo lo contrario.

254
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Las orejas tienen un aspecto intermedio a los dos progenitores; el cuello es recto y delgado, cruz
baja, dorso recto o convexo. El pelaje suele ser negro, bayo, castao o tordo, la raz de la cola
suele estar recubierta de cortos pelos y las ancas ms robustas, los cascos son ms estrechos con
talones altos y duros ms parecidos por lo tanto a las de los asnos y rebuznan como el padre. La
presencia de raya de mula es general al mular.

En cuanto a fisiologa el mular es ms parecido a la especie asnal que a la equina, son duros,
resistentes a la fatiga, longevos, poco aptos para la carrera, se desarrollan muy bien para tiro y se
adaptan a toda clase de faenas y terrenos.
El mulo pesa, en el momento del nacimiento, entre 35 y 40 Kg., es amamantado durante
doscientos cuarenta das y completa su desarrollo fsico a los sesenta meses. La duracin de la
vida es, aproximadamente, de unos veinte aos.

El burdgano o romo, se parece ms en su exterior al equino (su padre) y en su esqueleto a la


burra. Posee menor alzada que la mula; la cabeza es ms fina y proporcionada, la crin y la cola
son casi idnticas a las del caballo. Los miembros son descarnados, los cascos son ms anchos
que los del asno, los genitales poseen apreciable desarrollo. Presenta el clsico relincho del padre.

Su pelaje puede ser castao, zaino o negro retinto.

El burdgano, al igual que la mula presenta esterilidad absoluta del macho y fertilidad relativa de la
hembra.

En cuanto a comportamiento, el burdgano es ms indmito y menos resistente a la fatiga que los


mulares.

PRODUCCIN DE MULAS.

Los mulares son muy apreciados por ser en extremo rsticos y resistentes, es ms fuerte que sus
progenitores. El gran valor que alcanzan en el mercado se debe a su aptitud para el trabajo, su
resistencia a: el calor, los insectos, las largas jornadas, su capacidad digestiva y sus hbitos
alimenticios (no son glotonas, comen estrictamente lo necesario) las hace menos vulnerables a
problemas digestivos (clicos, etc.), su extraordinario instinto para evitar accidentes, su
constitucin flexible, vigorosa y resistente; en especial los mulares gozan de gran aprecio en
regiones clidas, regiones cafeteras y zonas de topografa quebrada.

Aunque los equipos modernos las han desplazado su aceptacin en el mercado es muy buena y
por tanto se debe fomentar su produccin.

Hay consideraciones acerca de la produccin: El primero, es la cra de garaones para su empleo


como sementales; la segunda, la cra de yeguas seleccionadas por tamao y rusticidad; la tercera
el apareamiento en s.

Siendo un hbrido, es usual creer que la nica forma de producir el mular es mediante la cruza del
garan y la yegua; pero es factible que las mulas produzcan descendencia ya que estas no
exhiben defectos de conformacin anatmica en el aparato genital, la anormalidad fisiolgica
(vulos inmaduros) no es constante, o no afectan a todos los individuos; esto implica que la
esterilidad no es absoluta, mientras que, en el macho debido a su disfuncin anatmica (tbulos
seminferos no formados) ser estril inevitablemente, ya que su clula sexual nunca podr pasar
de espermatogonia.

Aclarado lo anterior, un buen manejo de la hembra mular, la observacin de sus celos o calores si
los hay, y la monta por parte del garan no consanguneo podrn finalizar en una gestacin, con

255
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

lo cual la posibilidad de criar hijos de mulas no es inaudita.

Escogencia y manejo del garan.

Despus de muchos cruces, parece que las mejores razas asnales productoras de garaones son
la andaluza y la norteamericana, tambin llamada Black-Spanish.

Una buena seleccin y manejo del garan comprende:

La edad en que el garan entre al servicio debe ser entre los 2.5 - 3 aos. El lote de
yeguas a servir no deber sobrepasar las 15 hembras.

Manejar el ejemplar como asnal y no como equino, ya que el vigor del garan es menor
que el del caballo.

Continuo contacto con animales de la especie equina, ocasionan estimulacin en la


atraccin sexual por las yeguas.

Lo ideal es que desde joven est aislado de las hembras de su especie.

Si ha tenido contacto con hembras adultas de su misma especie, es conveniente que luego
del servicio a las yeguas sirva burras de lo contrario su libido decaer.

El nmero de montas mximo ser de una cada tres das o 80 montas en el ao, de lo
contrario sufrir agotamiento con prdida de vigor.

El comportamiento del garan es ms rudo que el del equino, por tanto las yeguas tienden
a no aceptarlo fcilmente, cocean al macho, para protegerlo, se deben emplear maneas o
trabones en la yegua.

Los cambios de clima fri a clido afectan significativamente al garan. Si es necesario


efectuar el traslado deber tenerse en cuenta un tiempo prudencial para su adaptacin o
aclimatacin antes de que ingrese al servicio.

La dieta para el garan deber ser balanceada, rica en granos, minerales y vitaminas.

Las yeguas a montar, debern tener alzadas acordes a las de l.

Leccin 42 ALIMENTACIN, CUIDADOS Y MANEJO DE ASNALES Y


MULARES.

Una grave equivocacin que se ha venido cometiendo en el manejo de os asnales y mulares, es


pretender que debido a su resistencia y rusticidad natural, estos pueden ser mantenidos casi en
abandono, dicha situacin genera que estos animales no puedan expresar la totalidad de sus
condiciones genticas. Esta situacin deber entrar a corregir-se si queremos asnales y mulares
eficientes y realmente productivos.

Si bien es cierto, que mulares y asnales son ms resistentes a las enfermedades, no por esto

256
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

debemos excluirlos de los programas de sanidad y prevencin. Los mulares exhiben un


temperamento especial, deben ser manejados con suavidad y cuidado, es muy dcil a su criador o
manejador, pero, esquivos y prevenidos frente a extraos, por esto cuando no se est familiarizado
con el animal es mejor actuar con prevencin, ya que su reaccin es inesperada y algo violenta,
cocean con facilidad y son especialmente hbiles pateando con sus miembros posteriores. Los
manejos rudos la tornan terca y arisca, de ac el adagio popular terco como mula; como
cualquier animal responde al buen trato.

Respecto a la alimentacin se debe suministrar los mismos alimentos que a los equinos, especial
atencin se debe prestar al suministro de suplemento (concentrado, grano) cuando estn
sometidas a trabajos intensos o extenuantes; en esta situacin se debe dar 1 1.5 kilos de
concentrado al da por cada 100 kilos de peso vivo, 1.300 2.500 gramos de melaza por animal.

Su manejo puede hacerse en grupos con pesebreras comunes, esto hace que el manejo sea ms
sencillo y econmico que en los caballos.

En general, asnales y mulares deben ser mantenidos y manejados como si de equinos se tratara,
esto redundar en mejores animales, ms productivos y por ende ms rentables.

Con respecto a la fecundidad de los mulares se incluyen en el grupo de los paragensicos


parciales, es decir, esterilidad absoluta del macho y fertilidad relativa de la hembra.

Por estudios se ha podido concluir que:

o Los macho mulares son 100% infrtiles.


o Numerosa es la estadstica de hembras mulares fecundas. o El cruce
mula-caballo da productos caballares tpicos.
o El cruce mula-asno da productos mulares tpicos. o Los hijos de
mula y caballo son siempre frtiles. o Los hijos de mula y asno son
siempre estriles.

La esterilidad en el macho mular se debe a que el tejido seminfero se muestra incompleto ya que
sus tubos seminferos se hallan dispersos en las mallas de una red fibrosa. La clula germinal llega
solo a la forma de espermatogonia y al no pasar por la meiosis no resulta apta para la fecundacin
es decir se produce semen pero sin gametos maduros, capaces de fecundar al ovulo.

La hembra mular no posee defecto anatmico en su aparato genital pero si existen anormalidades
en la parte fisiolgica (vulos inmaduros), que por no ser constante, o no afectar a todas las mulas,
hace que la esterilidad no sea absoluta.

CAPITULO 9

JUZGAMIENTO DE EQUINOS

257
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.fedequinas.org

Introduccin

Leccin 43 JUZGAMIENTO EQUINO.

La estructura orgnica que a nivel nacional orienta y es responsable del fomento, la exposicin y el
juzgamiento de equinos criollos colombianos, es la Federacin Nacional Colombiana de
Asociaciones Equinas (FEDEQUINAS).

FEDEQUINAS es la entidad que en el orden nacional agrupa y representa las asociaciones


equinas colombianas, y dirige, coordina, rige y controla sus actividades tcnicas de crianza,
exhibicin, fomento, desarrollo, competencia y promocin deportiva.

En la Ley 427 de enero 16 de 1998, fue tcitamente reconocida como la entidad rectora del gremio
equino colombiano y comisionada para que en conjunto con el Ministerio de Agricultura y
Desarrollo Rural, a travs de la entidad adscrita correspondiente, y el Fondo Nacional del Ganado,
diseara y pusiera en marcha planes y programas sanitarios de aplicacin inmediata, con el fin de
disminuir hasta la erradicacin final las enfermedades que afectan el subsector pecuario y equino,
para conservar y propagar estas razas puras y as cumplir las exigencias sanitarias internacionales
para poder participar en estos mercados con competitividad.

En marzo 16 de 1998 y obrando acorde con el articulo 4, de la Ley 427, fue delegada por el
Ministerio de Agricultura y Desarrollo Rural mediante Resolucin no.00053 para abrir, registrar y
llevar los libros genealgicos de la raza del "Caballo Criollo Colombiano", con carcter oficial.

Objeto social de FEDEQUINAS.

El fomento, mejoramiento, desarrollo y fortalecimiento de todas las actividades vinculadas


con el enaltecimiento y promocin tanto a nivel nacional como internacional del caballo
criollo colombiano de paso, como el mejor caballo de silla del mundo, en sus diferentes aires
o andares criollos: el paso fino, el trote y galope reunido colombiano, la trocha pura
colombiana, la trocha y galope colombianos.

Velar por la conservacin, fomento y promocin de los asnales y mulares criollos desde su
crianza, exhibicin y utilizacin deportiva, y de la actividad equina en todas sus expresiones
y modalidades.

258
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Autorizar, supervisar y controlar la realizacin de los eventos equinos (deportivos y de


exhibicin), en el territorio colombiano y la participacin de delegaciones colombianas a
eventos en pases extranjeros.

Asignar la categora o grado que corresponda a cada evento segn su importancia.

Regir y regular los eventos mediante la adopcin y expedicin de reglamentos que


contengan las normas disciplinarias y tcnicas de obligatorio cumplimiento por parte de sus
afiliados.

Ejercer como organismo consultivo del gobierno nacional, departamental y municipal, as


como de las autoridades judiciales en todo lo relacionado con el caballo criollo colombiano
de paso.

En cumplimiento de sus objetivos, Fedequinas tiene como finalidades principales entre


otras, las siguientes actividades:

1. Es el vocero y representante nico entre los estamentos oficiales y privados, de las asociaciones
regionales de caballistas de Colombia.

2. Expide y reforma los reglamentos para las exposiciones y juzgamiento de equinos criollos en
Colombia.
3. Elabora el calendario nacional de exposiciones equinas internacionales, nacionales, grados "a"
y "b" que se celebran en el pas.

4. Elabora el calendario nacional de concursos de chalanera que se celebran en el pas.

5. Autoriza las sedes y los grados para los eventos feriales equinos que se realizan en Colombia.

6. Dicta las normas disciplinarias que deben observar las personas naturales y jurdicas que
participan en una exposicin equina.

7. Es el notario de las certificaciones sobre genealogas que se expidan por parte de las
asociaciones regionales a los equinos criollos colombianos.

8. Es la entidad delegada por el ministerio de agricultura y desarrollo rural, para que con carcter
de oficial, abra, registre y maneje los libros genealgicos de la raza del caballo criollo colombiano
de paso.

9. Sirve de organismo asesor y de consulta al sector oficial en todos los relacionados con el
equino criollo colombiano.

10. Asesora a las asociaciones en software, hardware y manejo de informacin.

11. Realiza conjuntamente con las asociaciones o independientemente; seminarios, ferias y


eventos equinos, tcnicos y cientficos, y cursos de homologacin.

12. Dicta cursos de actualizacin a veterinarios, directores tcnicos y locutores tcnicos.

13. Dicta cursos de actualizacin sobre las normas vigentes a las asociaciones y sus socios.

14. Dicta cursos a las personas encargadas de manejar los registros en las asociaciones sobre el
procedimiento de expedicin de los registros, el manejo de esos documentos y las normas que

259
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

rigen para ellos.

15. Asesora a todos los investigadores y criadores sobre lneas genticas, cruces,
etc.
16. Es el ente consultor a nivel internacional de CONFEPASO, sus afiliados y otros organismos.
17. Es el encargado de salvaguardar la propiedad de los caballos criollos colombianos de paso.

18. Es la entidad encargada de llevar la informacin sobre las exposiciones equinas que se
efectan en Colombia y las estadsticas sobre sus resultados y los campeonatos de los ejemplares
que en ellas participan.
19. Es la encargada de establecer y poner en marcha campaas y programas
orientados a proteger y conservar la raza del caballo criollo de paso. De igual manera que est
enfocado a buscar una seleccin gentica que nos permita obtener un producto de mejor calidad.

20. Fedequinas es la nica entidad en Colombia que desde 1995, hace el examen de
genotipificacin a sus caballos. Este examen consiste, en hacer un examen gentico del DNA, en
la raz de la crin de los caballos que nos permite obtener un archivo permanente de los marcadores
genticos de un ejemplar y hacer la verificacin de parentesco de un equino con sus respectivos
padres. Incluye este programa un servicio de toma de muestras de crin a los ejemplares de todos
los criaderos de la sabana de Bogot y sus alrededores. Este servicio lo presta Fedequinas a
travs de un mdico veterinario zootecnista.

21. Desde 1997, la Federacin a travs de un convenio firmado con el Instituto Colombiano
Agropecuario ICA, puso en marcha una campaa para la prevencin y control de la anemia
infecciosa equina. Todos los ejemplares para participar en una exposicin equina de la estructura
de Fedequinas, deben presentar resultado negativos al examen de AIE, efectuado en cualquier
centro de diagnstico del ICA. La muestra de sangre, debe ser tomada por un veterinario adscrito a
Fedequinas o del ICA. La Federacin a travs de su veterinario oficial presta el servicio de toma de
muestras en los diferentes criaderos de la sabana de Bogot y sus alrededores.

22. A travs de sus departamento de sistemas y estadsticas, Fedequinas suministra informacin


a todos los caballistas del pas sobre: registros de equinos y genealogas; rcord de grandes
campeonatos; puntaje acumulado por los ejemplares por participacin en exposiciones equinas;
puntaje acumulado por criadores y expositores participantes en exposiciones equinas;
programacin de exposiciones equinas; equinos ganadores de premios especiales tales como:
ejemplar del ao o capn del ao.

23. Fedequinas mantiene informado y actualizado al gremio equino nacional a travs de su rgano
informativo oficial la revista Fedequinas por este mismo medio los criadores pueden promocionar
sus ejemplares.
24. Fomentar la reproduccin, el mejoramiento equino y la utilizacin del caballo para la recreacin
y el deporte entre las nuevas generaciones tanto en el mbito nacional como internacional.
25. Servir de representante para llevar la vocera de las asociaciones y comits del gremio
caballstico nacional ante las entidades pblicas y privadas, nacionales y extranjeras, en defensa
de sus intereses.
26. Coadyuvar con el gobierno y el ente privado en el estudio de los problemas tcnicos y
econmicos que sean de inters y beneficio del gremio equino.
27. Mantener los registros y archivos con mtodos de reconocido valor tcnico, de las actividades
equinas, sus caractersticas y calificacin en las exposiciones.
28. Elaborar los "reglamentos para las exposiciones y el juzgamiento de equinos en Colombia",
hacerlos cumplir y adoptar las medidas que en el futuro se consideren necesarias para el bien de la
ganadera equina.
29. Promover reuniones con jueces, directores tcnicos de exposiciones, juntas directivas, a
efectos de unificar criterios tcnicos sobre juzgamiento de ejemplares y procedimientos para las

260
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

exposiciones y en general realizar congresos, conferencias sobre tpicos ilustrativos de los


objetivos de la Federacin y promover eventos nacionales, regionales e internacionales que
estimulen el fomento equino nacional.
Leccin 44 JUZGAMIENTO EQUINO EN COLOMBIA.

Segn la doctora ngela Ochoa de Mejia, el juzgamiento de caballos colombianos mejorar en la


medida que criadores, expositores y jueces unifiquemos criterios. Para esto es necesario ponerse
de acuerdo sobre cual es el prototipo ideal de caballo que se desea en cada andar para la pista y
por supuesto para la reproduccin. Si adicionalmente a la observacin cualitativa podemos
cuantificar a cada caballo tendremos un diagnstico real de cada uno de ellos.

Fedequinas tiene establecida una tabla de puntuacin a la que se le ha adaptado un formato. En


l se da el valor en puntos y porcentaje oficial para evaluar cada cualidad, el espacio para el
ejemplar a examinar, ms una tercera casilla para dejar las observaciones correspondientes.
Originalmente est diseada para juzgar competencias pero es de gran utilidad en la seleccin de
yeguas y reproductores por que ofrece una manera desapasionada para elegir el pie de cra de
un criadero.

La primera parte habla sobre fenotipo. Para la aplicacin de este agregado es importante hacer
un paralelo de conformacin versus modalidad. Es muy evidente la diferencia del fenotipo aun
dentro de los mismos caballos colombianos; debera ser fcil diferenciar a simple vista un
ejemplar de andar compuesto de uno simple porque los caballos verdaderamente galoperos
tienen entre otras caractersticas una insercin diferente de la cabeza y el cuello, tambin el anca,
el pecho incluso el mismo reglamento considera que la alzada mnima de los trochadores
galoperos y trotones galoperos es mayor que para la trocha pura y el paso fino. Sucesivamente
las caractersticas fsicas cabeza, cuello, pecho, vientre dorso, etc. se van valorando para obtener
el primer subtotal. Esta primera parte es fundamental para elegir ejemplares de cra por que a
diferencia del segundo agregado todas estas caractersticas son hereditarias.

La segunda parte o agregado por manejo, valora el adiestramiento, rienda, posicin de cabeza,
sostenimiento y armona. En los ejemplares de pista es fundamental que el puntaje aqu sea alto
por que es a travs del buen arreglo y disciplina que un caballo puede mostrar en la pista todas
sus bondades. Muchos caballos que podran tener alto puntaje por fenotipo y movimiento se
pierden por el deficiente manejo que se les da, se creo que por esta causa terminan
prematuramente su carrera en la pista, o ni siquiera llegan a ella, gran cantidad de potros y
caballos de buena calidad.

La posicin de cabeza depende del arreglo pero tambin de la conformacin del caballo. En la
seleccin de ejemplares de cra se debera reemplazar el agregado por manejo por el anlisis
concienzudo del pedrigree.

Por ltimo se evalan los movimientos: Ritmo, cadencia, suavidad, tren posterior y anterior,
quietud de anca y adicionalmente bro y temperamento. Hoy en da los movimientos de cada
andar estn completamente definidos con caractersticas individuales que hacen cada modalidad
inconfundible. El buen temperamento y el bro son caractersticos de los caballos criollos
colombianos. Tambin los componentes del agregado por movimiento se heredan.

Los beneficios del empleo de la tabla pueden ser mltiples, para los jueces un ejemplar en la pista
necesita un puntaje mnimo para permanecer en competencia (lo dice el reglamento), con ms
razn lo debe tener para aspirar a un lugar en el marcador y por supuesto para ser campen. No
podemos olvidar que una de las funciones de los jueces es orientar la cra a travs de sus fallos y
explicaciones, por eso el compromiso al premiar los ejemplares cualquiera que sea el grado de la

261
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

exposicin. Igualmente el criador aplicado puede, utilizando la tabla, en su criadero hacer una
auto-evaluacin a conciencia de sus yeguas y reproductores.

La accin de juzgar corresponde al anlisis detallado, mediante comparacin o analoga de


ejemplares pertenecientes a una misma especie animal, raza, sexo y edad, con el fin de
catalogarlos de acuerdo a sus propias caractersticas fenotipicas y de produccin y as otorgarles
el puesto que se merece en el momento de ser analizados este es un proceso tcnico y ordenado.
En otras palabras, juzgar es sopesar cualidades y defectos para llegar a un balance justo.

El juzgamiento debe ser realizado por personas calificadas denominadas JUECES que deben
actualizarse permanentemente sobre la evolucin de la raza y de la de sus gneros.

La fecha para realizar las exposiciones nacionales deben ser fijadas en los meses de febrero o
marzo de cada ao para que la junta directiva seleccione a las personas y ejemplares merecedores
de los ttulos especiales, de acuerdo con los puntajes obtenidos por los candidatos en el ao
anterior.

El juzgamiento en la especie equina se realiza tanto en la etapa joven del animal (Sin adiestrar),
como en la etapa adulta (Adiestrado o amansado), preparado para participar en Eventos
denominados Exposiciones, que pueden tener el carcter de Internacionales o de Nacionales.
La organizacin de la feria debe estar a cargo de la junta organizadora esta a su vez nombrara un
director tcnico, quien ser la autoridad dirigente del evento.

La junta organizadora y el director tcnico harn los nombramientos de esta manera:

Personal administrativo:
Secretario- tesorero
Auxiliar del secretario - tesorero
Personal del servicio Varios

Cargos honorarios de la junta (presidente, vicepresidente, fiscal, etc.)

Personal tcnico:
Jueces.
Ejecutivos.
Asesores.
Comisiones.
Coordinadores
Director de prensa y propaganda
Locutor o anunciador oficial.
El director tcnico es la mxima autoridad dirigente.

Las llamadas ferias internacionales deben cumplir como mnimo los siguientes requisitos:

- Que intervenga por lo menos cinco ejemplares procedentes de pases extranjeros.


- Que se celebren en ciudades autorizadas para Exposiciones Grado A.

Para que una, ciudad pueda ser sede de Exposiciones Grado A, debe reunir las siguientes
condiciones:

- Tener un coliseo que cumpla las exigencias de capacidad, sanidad y seguridad, a juicio de

262
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

una comisin que para el efecto designa la Junta Directiva de la Federacin


Colombiana de asociaciones Equinas FEDEQUINAS.
- Tener un mnimo de 100 pesebreras.
- Disponer de suficiente capacidad hotelera.
- Integrar una Junta o Comit Organizador, el cual nombrar un Director Tcnico y ste a su
vez designara un Medico Veterinario quien estar a cargo del servicio de sanidad.

Se considera Exposicin Grado B, Aquellas que se realice en el pas y que no cumpla las normas
establecidas para las Grado A.

El Director Tcnico, debe ser una persona de reconocida experiencia y trayectoria en el campo de
la organizacin de certmenes agropecuarios y ser la mxima autoridad del evento.

Como normas generales, la Junta Organizadora o el Director Tcnico deben suministrar el pasto
necesario para la manutencin de los animales durante los das de la Feria.
El elemento adicional (Concentrado, drogas, etc.) ser por cuenta de cada expositor.

Las personas encargadas de seleccionar o juzgar a los distintos animales inscritos y presentes en
la exposicin, tiene el carcter de Jueces, quienes deben llenar los siguientes requisitos:

- Ser ciudadanos Colombianos.


- Ser personas de recocida honorabilidad.
- No tener como principal ocupacin el adiestramiento, manejo o negocio de equinos.
- Ser capaces de conducir adecuadamente algn ejemplar en la pista de juzgamiento para
afianzar algn fallo.
- Ser nombrados oficialmente por Fedequinas.

NOTA: Debido a la complejidad en el arte de juzgar equinos, normalmente son designados dos (2)
jueces para las distintas modalidades que participen en la Exposicin.

Los jueces tendrn en cuenta las siguientes circunstancias al realizar su trabajo en la pista:

- Fenotipo (alzada, aplomos, conformacin, pelaje, esbeltez, tipo racial, etc.).

- Armona, elegancia y sostenimiento en el movimiento o andar que se juzga.

- Suavidad y facilidad de conduccin.

- Temperamento y mansedumbre (bro y docilidad).

Para poder conocer mejor a los ejemplares que tienen a la vista, los Jueces pueden elegir algunas
pruebas especficas para equinos, siguiendo el orden que a continuacin se detalla:

Previa acicalada o preparacin del animal (bao, cepillado, etc.) fuera de la pista, ya dentro de ella,
se observa la APERADA , esto es la colocacin de la silla o galpago, bozal, y los aperos de
cabeza usuales para la modalidad que se juzga.

263
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Se ordena la MONTADA de cada ejemplar, que desde luego debe ser por el lado izquierdo. El
Jinete o Chaln debe presentarse con sombrero y zamarros; se exceptan de esta norma a las
Amazonas.

TRABAJO EN CRCULO. Se ordena el movimiento de los ejemplares alrededor de la pista uno tras
otro, para que estos se familiaricen con ella y con el pblico. Debe observase la seguridad de la
pista, el resorte de sus remos, la postura de la cabeza y de la cola, el bro que es sinnimo de
garbo, de pujanza, de fogosidad; el temperamento o carcter, si es vivo, alegre, dcil, etc.

TRABAJO EN OCHO. Para esta prueba los jueces se ayudan de dos personas que colocadas
frente a frente a una distancia de tres (3) metros una de la otra, hacen las veces de postes u
obstculos entre los cuales cada equino debe pasar realizando el desplazamiento en el sentido del
Ocho. Esta prueba se realiza para determinar lo que se reconoce como Ajust de boca o prueba
de docilidad, determinando con ello la facilidad de conduccin (Quiebre de cabeza).

BATIDAS. Se observa la modalidad de paso que se juzga, bien sea por laterales (Paso fino) o por
diagonales (Trote o Trocha).

SERPENTINAS. Se ordena que cada equino se desplace marchando en forma ondulante hacia la
izquierda y hacia la derecha.

CEJAR O RETROCEDRE. Cada ejemplar a la orden de los jueces y a la accin del jinete debe dar
marcha atrs, sin ponerse de manos o encabritarse.

PROVOCACION O EXIGIDA POR EL BRIO. Se ordena arrancar bruscamente a cada animal,


luego que se detenga e inicie nuevamente la modalidad de paso que se juzga.
El bro debe ser espontneo, sin malicia ni pereza. Se puede hacer manifestar de las siguientes
maneras:
Con la rienda: Voluntad o agilidad a cualquier movimiento de ella, sin ser exigido. De odo:
Responde a cualquier sonido o voz que emita el jinete (est alerta).
De pierna: Responde al ms leve ajustamiento de las piernas del jinete.

PASO POR PISO DURO: Como un recurso ltimo, se ordena que el animal pase por un corredor o
calzada en concreto (ojala con micrfonos incorporados), para determinar segn el tipo de paso
que se juzga, los cuatro golpes correspondiente al Paso fino cuya onomatopeya se acerca a un
sonido parecido a: ta ca.ta ca.ta ca.ta ca.; o a los ritmos diagonales cuyo sonido
caracterstico es para el trote: tas.tas.tas.tas. o los tres tiempos para el Galope cuyo
sonido se acerca a: ca tor ce.ca tor ce.ca tor ce .ca tor ce.

Los jueces pueden excluir o no dejar participar en el juzgamiento a los ejemplares que:

- Su aire de marcha o andar no corresponde a la modalidad que se juzga.

- Muestre indocilidad en el momento de recibir el freno, la montura, al ser montado o al


desplazarse con el jinete.

- No responde a la prueba de cejar o dar paso atrs.

- No cumple con los requisitos mnimos de alzada.

- Para equinos de tres a cinco aos: Machos: 1.36 m. Hembras: 1.34 m.

264
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

- Cumplidos los cinco aos deben tener como mnimo: Macho 1.38 m.
Hembras 1.36 m.

- Coleen en ms de cinco (5) oportunidades.

- Ingresen a la pista ensillados.

Siendo adiestrados se presenten con herrajes incompletos o no los presenten.

- Presenten sus remos calzado muy alto, es decir por encima de la rodilla y/o corvejn.

- Presente el factor careto, es decir que la mancha blanca incluya la regin de los ojos
adems del listn corrido.

- Corresponde a la categora de caballos castrados y no usen baticola.

- Sean montados por jinetes que no usen sombrero ni zamarros.

- Sean caballos ciclanes.

A juicio del Medico Veterinario, hayan sido alterados en su presentacin (edad, pelaje etc.), o
hayan ingerido sustancias con el fin de alterar su normal desempeo.

NOTA: Al dar a reconocer el fallo o resultado de las competencias, los jueces deben hacer resaltar
los mritos de un equino sobre cada uno de los otros, justificando as el puesto asignado.

Para realizar las pruebas de juzgamiento en equinos se tienen establecidos los siguientes
concursos:

Competencias por categoras o por edades.


Premios o competencias especiales.

Las competencias por categoras a la vez se subdivide en:

Equinos sin adiestrar mostrados en pelo portando jquima para su fcil manejo. Equinos
adiestrados, los cuales deben entrar a la pista desensillados y luego con la ayuda del palafrenero
procede a aperarlos delante de los jueces.

Antes de entrar a la pista de juzgamiento, los ejemplares deben ser revisados por un Comisario en
cuanto a su edad, determinando por detencin; en los machos se comprueba la presencia de sus
dos testculos, adems explorar posibles prcticas dolosas, como ejemplo la colocacin de bandas
elsticas en los muslos de la cola para evitar el defecto del coleo; as mismo se har caminar un
poco al animal para detectar cojeras o claudicaciones en algunos de los remos, que desde luego
inhabilitan al equino para su participacin.

Para la competencia del Caballo castrados adiestratos, los jinetes deben ser aficionados.

265
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Al ensillar al equino, solo pueden intervenir el jinete o montador y el palafrenero, este ltimo
abandonara la pista cumplida su labor.

Los ejemplares al entrar a la pista deben portar el numeracin que corresponde a su inscripcin en
el Catalogo, la cual llevara el jinete durante la competencia en una parte visible, generalmente
colgada de un bolsillo de los zamarros.

Por separado se juzgarn los equinos cuya modalidad de movimiento este enmarcada en uno de
los siguientes andares:

- Paso fino colombiano.


- Trote.
- Trote y Galope.
- Trocha.
- Trocha y Galope.

Las competencias por categoras o edades, realizadas separadas por sexo, para las diferentes
modalidades son las siguientes:

Equinos de1 a 2 aos sin adiestrar (18 - 24 meses mostrados en la cuerda). Equinos de 2 - 2
aos sin adiestrar (25 - 30 meses en la cuerda).

Terminadas estas dos competencias, se procede a otorgar el premio de Campen(a) joven entre
los ejemplares que obtuvieron el primer puesto en su edad y que recibieron Cinta Azul; el
seleccionado recibe como distintivo una Cinta Violeta; luego se procede a otorgar el premio de
Campen(a), joven reservado(a), para el cual participan el ejemplar que por el anterior premio
compiti y no gano y el ejemplar 2 puesto de la edad o categora de la cual salio el ejemplar
declarado Campen Joven. Al equino declarado Campen(a) Joven Reservado(a) se le distingue
con una Cinta Violeta que lleva inscrito el nombre del respectivo premio.

Se procede luego a juzgar a los animales adiestrados o amasandos en las siguientes categoras o
edades:

- De 2 - 3 adiestrados (31 - 42 meses).


- De 3 - 5 aos adiestrados (43 - 60 meses).
- Mayores de cinco (5) aos adiestrados (de 61 meses en adelante).
-

Al terminar estas competencias, se realiza a diferencias de lo que se hace en la especie bovina, la


participacin directamente por el premio de Gran Campen(a) en su modalidad, de los ejemplares
que obtuvieron el primer puesto en su edad o categora en las competencias de adiestrados. Al
ejemplar seleccionado como Gran Campen(a) se le distingue por una Cinta Tricolor y un
Estandarte o Gallardete Violeta. Tambin se otorga el premio de Gran Campen(a) Reservado(a)
por lo cual participan los ejemplares que compitieron por el Gran Campeonato y que no ganaron y
el ejemplar 2. Puesto de la categora de la cual salio el ejemplar declarado Gran Campen.

En cada categora se puede no otorgar varios puestos hasta un quinto, cada uno de los cuales se
distingue as:

266
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

- Primer puesto: Cinta Azul.


- Segundo puesto: Cinta Roja.
- Tercer puesto: Cinta Amarrilla.
- Cuarto puesto: Cinta Verde.
- Quinto puesto: Cinta Rosada.

Para cada modalidad de paso o movimiento se realizarn las competencias separadas por sexos y
de ejemplares no adiestrados y adiestrados, siguiendo el orden establecido anteriormente. Como
ejemplo veamos lo que serian las competencias en la modalidad de Paso Fino:

Potros Reproductores (enteros) de Paso Fino de 18 - 24 meses sin adiestrar. Potros


Reproductores de Paso Fino de 25 - 30 meses sin adiestrar. Campen(a) joven de Paso
Fino.
Campen(a) joven Reservado (a) de Paso Fino.
Caballos Reproductores de Paso Fino de 31 - 42 meses adiestrados. Caballos
Reproductores de Paso Fino de 43 - 60 meses adiestrados. Caballos Reproductores
de Paso Fino de 60 meses.

Gran Campen (a) de Paso Fino.


Gran Campen (a) Reservado (a) de Paso Fino.

NOTA: La edad del ejemplar ser la que tenga a la fecha de iniciacin de la exposicin (da de
entrada de ejemplares).

En las mismas edades compiten las hembras, teniendo en cuenta que en la poca joven de no
adiestradas reciben la denominacin de Potrancas y en la edad adulta la de yeguas.

Terminando las competencias por Categoras y las de Campeonatos, se realizan los llamados
concursos para Premios Especiales en cada modalidad, entre los cuales se pueden describir los
siguientes:

JEFE DE RAZA. Participan por estos premios los reproductores equinos, que tengan cuatro (4)
hijos, de los cuales necesariamente dos (2) deben estar adiestrados; as mismo ser necesario que
estn representados los dos sexos y tener la totalidad de descendientes presentados, la misma
modalidad de Paso que la del padre.

Distintivos que se otorga: Estandarte Azul.

NOTA: El ejemplar que pretenda ser calificado como Jefe de Raza, debe estar presente en el
momento de juzgarse la competencia.

As mismo debe tenerse en cuenta que este Premio de Jefe de Raza, no se otorga en la modalidad
de Trocha y Galope.

GRUPO DE YEGUAS PARA CRIAS. Deben presentarse tras (3) ejemplares de la misma
modalidad de movimiento y de un mismo propietario.
Distintivo: Estandarte o Gallarte Rojo.

267
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

GRUPO DE YEGUAS CON CRIA. Deben presentarse dos (2) ejemplares de la misma modalidad
de movimiento y las cras deben ser de la misma modalidad de paso de la madre. (Deben estar en
lactancia)
Distintivo: Estandarte o Gallarte Rojo.
NOTA: No se juzgan Grupos de yeguas con Cra en la modalidad de Trocha y Galope.

MEJOR DESENDENCIA DE UNA MISMA YEGUA. Deben presentarse dos ejemplares hijos de la
misma yegua, de cualquier sexo y edad, que hayan competido en las competencias por categoras,
y que sean de la misma modalidad de paso de la madre.
Distintivo: Estandarte Rojo.

FUERA DE CONCURSO. Se declarar as al ejemplar mayor de cinco (5) aos, que hubiere
obtenido en cualquier momento el Premio de Gran Campen(a) en diez (10) oportunidades, en
exposiciones Internacionales o Nacionales Grado A.
Distintivo: Estandarte Blanco con Ribetes Rojos.
La asociacin que organiza la Exposicin otorgar adems un pergamino al propietario del
ejemplar.
NOTA: No hay Fuera de Concurso para Caballos Castrados, Ponies, Asnales, Mulares y otras
razas equinas.

CAMPEN(A) DE CAMPEONES(AS). Se determina entre los ejemplares declarados


Fuera de Concurso de acuerdo a la modalidad de Paso y sexo, que hayan obtenido
la ratificacin del titulo en la exposicin que se juzga. Distintivo: Estandarte: Violeta.

EJEMPLARES DEL AO. Sern los caballos reproductores que tenga titulo de Jefe de Raza y las
yeguas que obtengan el titulo como madres de la Mejor Descendencia en cada modalidad, premio
este que se otorga solo en la llamada Exposicin Nacional que se realiza una vez cada ao, en
diferentes ciudad que tenga carcter de Grado A.
Distintivo: Estandarte cuyo color queda a eleccin de la Junta organizadora.

MEJOR CRIADOR Y/O MEJOR EXPOSITOR. Ser aquel caballista que obtenga el mayor puntaje
de acuerdo con la tabla de valores establecida para cada uno de los premios, tanto de categoras
como especiales.

Mejor Criador: Distintivo: Estandarte Violeta.


Mejor Expositor: Distintivo: Estandarte Verde.

Tabla de Puntaje para Otorgar cada uno de los dos Anteriores Premios

Jefe de Raza 20 Puntos


Ejemplar del Ao 18 Puntos
Grupo de Yeguas con Cra 18 Puntos
Gran Campen (a) 17 Puntos
Grupo de Yeguas para Cras 15 Puntos
Gran Campen (a) Reservado(a) 13 Puntos
Campen(a) de Campeones(as) 12 Puntos
Mejor Descendencia de una Yegua 11 Puntos
Fuera de Concurso 10 Puntos
Campen(a) Joven 9 Puntos
Campen(a) Joven Reservado (a) 8 Puntos
Primer Puesto 5 Puntos

268
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Segundo Puesto 4 Puntos


Tercer Puesto 3 Puntos
Cuarto Puesto 2 Puntos
Quinto Puesto 1 Punto

Por separado se juzgan los caballos Castrados en cada modalidad, pudindose presentar
ejemplares de cualquier edad (deben presentarse con Baticola).

Titulo: Mejor Ejemplar Castrado Distintivo: Estandarte Azul

NOTA: Los ejemplares Pos o Pintos, solo se juzgan en la modalidad Trote.

Una vez finalizado todas las competencias segn modalidad de paso, se procede a realizar los
juzgamientos de otras especies de Equinos y Razas especializadas. Siguiendo las pautas que a
continuacin se mencionan.

COMO SE JUZGAN LOS ASNALES

Asnales reproductores o reproductoras hasta de cinco (5) aos.


Asnales reproductores o reproductoras mayores de cinco (5) aos.(De61 meses en
adelante).

Titulo: Campen(a) Asnal - Distintivo: Cinta Tricolor.


Campen(a) Asnal Reservado(a) Cinta Violenta.

Luego se juzgan la competencia Mular adiestrada de cualquier edad para la cual los ejemplares
deben presentarse con baticola.
Premio. Mejor Mular - Distintivo: Estandarte Azul.

Los ejemplares Ponies se juzgan en categoras as:

Ponies reproductores o reproductoras hasta de cinco (5) aos.(60 meses) Ponies


reproductores o reproductoras mayores de cinco (5) aos. (61 meses en adelante).

Premio: Campen (a) Pony - Distintivo: Cinta Violeta.

Los equinos pertenecientes a razas pesadas y denominadas como Tiro Pesado, tales como
Perchern, Clydesdale, Belga y Shire, se pueden juzgar teniendo en cuenta primero su Fenotipo
(alzada, caractersticas raciales, etc.) y luego realizando competencias para determinar fuerza de
arrastre o traccin para lo cual se les puede colocar carruajes, maquinaria agrcola o cilindros -
rodillos cuyo peso sea conocido, para desplazarlo en un rea determinada.

Premio: Gallardete y Trofeo.

Leccin 45 Sistema De Juzgamiento Spectrum Internacional.

269
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

www.fedequinas.org

En un esfuerzo mas del B.O.D de la FloridaPFHA por mejorar el sistema de juzgamiento. Este ao
el Spectrum International a celebrarce por vez primera en la ciudad de Miami, se implementara el
sistema rutinario obligatorio que se describe a continuacin.

Sistema de juzgamiento para caballos de paso fino de 5 Jueces.

Proceso del juzgamiento

Introduccin:

Los requisitos de competencia de cada divisin estn listados en el reglamento de la PFHA bajo
los procedimientos individuales de cada division para Classic Fino, Performance, Pleasure, Country
Pleasure, etc. Los Directivos de la Feria Spectrum International, se reservan el derecho de
determinar el orden del Juez cabeza para cada competencia, antes del comienzo de la feria,
solamente para el propsito del manejo del recorrido de cada una de ellas y no por razones de
cmputos finales que determinen el resultado final.

Los cinco jueces evaluaran todas las fases de la competencia y el puntaje alto y bajo de cada
ejemplar sera eliminado al final de la competencia o despus de un desempate.

Los resultados de cada uno de los cinco jueces sern proyectados en la pantalla dentro del
Coliseo. Los cuales sern enviados electrnicamente por medio de un Palm Pilot o PC
personal a la mesa de computo. El resultado final sera anunciado por el locutor de la competencia.

Responsabilidad del Director de Pista (Ringmaster).

La responsabilidad del Director de Pista es:

1; Comunicarle con el locutor cuando el Juez cabeza pida cambio en el recorrido.

270
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

2; Informarle a los jueces de su posicin a tomar dentro de la pista y ayudarle a los directores de la
feria que los jueces cumplan con ese requisito.

3; Asistir a cualquier juez que tenga dificultad tcnica con el instrumento de PC personal.

4; Dirigir a los caballos a alinearse en el rea establecida por los directores de la feria.

Responsabilidad de los Jueces.

La responsabilidad de cada uno de los jueces es:

1; Juzgar cada competencia a su mejor nivel de habilidad siguiendo las direcciones y


criterio establecido por el reglamento de la PFHA/USEF.
2; Cumplir con las reglas establecidas en el sistema de juzgamiento de 5 jueces para caballos de
Paso Fino.
3; Mantenerse en el rea asignada dentro de la pista, por medio de los directores de la feria.
4; Separarse de cualquier tipo de comunicacin con cualquier otro Juez acerca de la competencia
o expositor hasta que el resultado final se haya anunciado.

5; Comunicarse con el director de concurso acerca de cualquier problema durante el curso de la


competencia, para recibir solucin inmediata.

6; Seguir el procedimiento predeterminado y escrito para los requisitos de las competencias


para el Spectrum Internacional del 2009, en acuerdo con PFHA/USEF, por cada divisin sin
desviacin.

Responsabilidad del Juez Cabeza (Call Judge).

Las responsabilidades del Juez cabeza son:

1; Comunicarse con el director de concurso y pedir la prxima etapa de cada competencia


dentro de un tiempo considerado.

271
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

2; Seguir el procedimiento predeterminado y escrito para los requisitos de la competencias


para el Spectrum Internacional del 2009 sin desviacin.

3; Siempre usar el primer caballo que entro a la competencia como un punto de referencia, para
poder administrar la competencia en un tiempo adecuado.

Procedimiento de Competencia.

1. Los caballos entraran a la pista cuando la persona encargada de la entrada los llame a
entrar, uno por uno. El locutor identificara cada ejemplar por el nombre del caballo, padre,
madre, propietario y montador. Tambin se incluir la informacin de la edad del caballo, si
esta disponible.

2. Los caballos cumplirn con los requisitos de competencia como lo describe las reglas de
cada divisin que se encuentran dentro de los captulos por divisin en el reglamento de
PFHA/USEF.

3. Los procedimientos de cada competencia y predeterminados para cada competencia dentro


de las diferentes divisiones, sern publicadas en las paginas del Spectrum #150;
www.miamispectrum.com and www.floridapfha.org; y sern publicados en el programa del
Spectrum Internacional del 2009. Solo los procedimientos y pruebas descritos en este
programa sern los utilizadas con el sistema de 5 Jueces durante el Spectrum Internacional
del 2009.

4. Solo los procedimientos predeterminados por escrito sern ejecutados por todos los
expositores en cada competencia. Ninguna prueba, fuera de esas escritas y
predeterminadas en el procedimiento de cada competencia, pueden ser exigidas en ningn
otro momento.

5. Los caballos que se excusen de la pista, sern solo al final de la primera seleccin por los
jueces y al final de la competencia.

6. Un caballo puede ser excusado por razones de seguridad o si el montador(a) del caballo
pide permiso de ser excusado(a); y el permiso se le ha dado.

272
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

7. Despus de cumplir con los requisitos de cada competencia, los cinco jueces seleccionaran
cualquier caballo que ellos deseen, para que pasen por la tabla de resonancia una
segunda vez. Para que esta seleccin se ejecute; por medio del aparato de CP; cada
caballo debe ser seleccionado por en mnimo de 3 jueces para poder pasar por la tabla una
vez mas.

8. Despus de que terminen con la segunda pasada por la tabla de resonancia, si algn
caballo lo tiene que hacer, cada uno de los jueces tienen que seleccionar los caballos que
continuaran dentro de la competencia. Cada juez seleccionara un mnimo de 7 caballos.
Si son menos de 7 caballos en la competencia, los jueces pueden proceder a la ultima
fase de la competencia o dar su veredicto final en ese momento. Esto sera por medio del
aparato de comp***cion.

9. Los caballos que queden en la pista sern considerados como finalistas de esa
competencia. Ellos tendrn que cumplir trabajo adicional o el resto de pruebas
predeterminadas para cada divisin.

10. Un caballo debe ser escogido por un mnimo de 3 jueces para seguir en la competencia, y
entrar a la segunda fase de la competencia.

11. Los resultados de los jueces sern mandados directamente a la mesa de comp***cin por
medio del aparato de comp***dor (Palm Pilot) La comp***dora calculara la lista de finalistas
que quedaran en la competencia para la prxima fase de la misma. El resto de los
participantes sern excusados de la competencia.

12. Despus de que los finalistas completen el resto de los requisitos predeterminados de la
competencia; los jueces darn su veredicto para los 7 mejores caballos que quedaron
dentro de la competencia.

13. Los puestos disponibles son basados en seis posiciones con galardn disponible, siendo
colocados consecutivamente de 1ro. a 6o.; y una mencin honorable como el 7. Puesto.
En las competencias de los Campeonatos se otorgaran 4 galardones de 1ro a 4 puesto, y
una posicin de mencin honorable como el 5. Puesto.
14. Cada puesto tendr un puntaje especifico para propsito del sistema. Estos puntos son para
propsito de comp***cion solamente. Esos puntos no sern reflexin hacia los puntos que
cada caballo recibe hacia los premios de fin de ao o para la clasificacin a la feria Nacional
de PFHA.

Los puntos dados a cada posicin son los siguientes:

Posicin Otorgada Valor de Puntaje

1st place 1 2nd


place 2 3rd place 3
4th place 4 5th
place 5 6th place 6
7th place 7

273
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

15. El sistema eliminara la posicin mas alta y mas baja de cada finalista. Por ejemplo:
Caballo #1 recibe 1o, 2o, 2o, 1o, 2o. Un primer puesto y un segundo puesto sern
eliminados.

16. Despus de la eliminacin del alto y el bajo, el programa de comp***dor sumara las
posiciones que cada caballo mantiene para llegar al resultado final.

17. El mejor resultado posible en cualquier competencia sera de 3 puntos, que significa que
los 3 puestos que quedan sumaran no mas de 3. Tres primeros puestos quedaron despus
de la eliminacin del alto y el bajo. (1+1+1= 3). Este finalista automticamente gana el
primer puesto sin duda ninguna.

18. Si despus de que la posicin alta y la baja son eliminadas de cada caballo, y la suma de
las posiciones de 2 o 3 caballos tienen el mismo total, se crea un empate. El prximo
proceso tomara efecto para desempatar.

19. Los finalistas que tengan el mismo numero total de la suma de las 3 posiciones, se le
eliminaran nuevamente la posicin mas alta y mas baja de los puestos que quedan
contando. Si el numero o posicin que quedan contando no es el mismo numero para cada
finalista, los caballos son colocados consecutivamente determinado por el puntaje final.
Por ejemplo:

Juez ID A B C D E
Caballo#1 2 2 3 4 5
Caballo #2 5 5 2 2 2

Despus de eliminar la posicin alta y la baja:


Puntaje Posicin Puntaje Total
Caballo #l 2 - 3 - 4 9
Caballo #2 5 - 2 - 2 9

Cuando se elimina la alta y baja nuevamente, el resultado es:


Puntaje Total
Caballo#l 3
Caballo#2 2

El Caballo# 2 el puntaje mas bajo y queda sobre el caballo #1. No hay necesidad de trabajo
adicional.

20. Si despus de eliminar las posiciones altas y bajas, y los finalistas siguen empatados, los
caballos tendrn que trabajar mas. Este trabajo adicional es predeterminado. Este trabajo

274
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

adicional solo afectara los caballos incluidos en el desempate. Ninguna otra posicin sera
afectada tampoco.

Por ejemplo:
Juez ID A B C D E
Caballo #1 3 4 5 1 6
Caballo #2 4 5 3 6 2
Caballo #3 6 3 4 5 1

Despus de eliminar la posicin alta y baja:

Puntaje por Posicin Pontaje Total

Caballo #l 3 4 5 12
Caballo#2 4 5 3 12
Caballo #3 3 4 5 12

Cuando la segunda posicin alta y baja es eliminada, el resultado es:

Total Points
Caballo #l 4
Caballo #2 4
Caballo #3 4

Los finalistas siguen empatados y trabajo adicional para desempate es requerido. Este
desempate sera para las posiciones afectadas.

Las otras posiciones no sern afectadas. Las posiciones del desempate sern anunciadas
por el locutor para informarle al publico que esta pasando.

21. Despus del desempate, los cinco jueces darn veredicto de esta etapa y el sistema de
comp***cion eliminara la posicin alta y baja de cada caballo en el desempate.

22. Si continua un empate, esa etapa y trabajo adicional se repetir nuevamente


hasta que no haya mas empate.

23. Uno de los jueces y/o el traductor explicara el resultado final y razones en ambos idiomas,
ingles y espaol.

24. Los cinco jueces evaluaran todas las etapas de la competencia. La eliminacin de la
posicin alta y baja sera ejecutada despus de la etapa final y en caso de empates.

25. Los resultados finales sern traspasados por medio de la comp***dora a la pantalla dentro
del coliseo para ser proyectados. Los resultados de cada juez quedaran debajo de las
iniciales de cada uno de ellos(as). El resultado final sera anunciado por el locutor de la
feria.

275
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

26.
Actividad de autoevaluacin de la Unidad 3

Preguntas sobre la Unidad

Actividades prcticas relacionadas con la unidad

Fuentes Documentales Unidad 3

276
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

GLOSARIO DE TRMINOS ECUESTRES


Abrevar. Dar agua al caballo para beber.

Acey Deucey. Monta con una estribera de cuero ms larga que la otra; disposicin adoptada a
veces por los jockeys en Estados Unidos para ayudarse a mantener el equilibrio en las curvas
cerradas.

Acin. Correa adaptable con la que el estribo va unido a la silla.

Acial. Instrumento en que se mete el labio o una oreja de un equino y que sirve para sujetarlo e
inmovilizarlo.

Acting Master (Cazador mayor en funciones). Persona encargada provisionalmente de organizar


una cacera, bien por un da o bien por un perodo ms largo, mientras se espera el nombramiento
de alguien con carcter permanente.

Aerofagia. Dolencia causada por la costumbre que tienen algunos caballos de ingerir y tragar aire,
lo que produce indigestin.

Agrin. Hinchazn entumecida y elstica en la rodilla de un caballo o en las articulaciones del


espoln, originada por una secrecin excesiva de lquido sinovial.

Ahogadero. Correa que forma parte de la cabezada de la brida. Se abrocha bajo la garganta del
caballo para evitar que la brida se deslice sobre la cabeza.

277
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Aires por encima del suelo. Diversos movimientos de alta escuela realizados con las manos, o
con las manos y las patas, levantadas del suelo. Vase balotada, cabriola, corveta, grupada y
levantada.

A las rdenes del juez de salida. Los caballos estn a las rdenes del juez de salida cuando ste
ha comprobado que todos los participantes estn presentes y preparados para correr. Se iza una
bandera para indicarlo.

Alazn. Caballo de pelaje entre color oro y rojizo pardo oscuro, normalmente con crin y cola
similares o ligeramente ms claras o ms oscuras, o, a veces, con crin y cola de color muy rubio.

Albino. Dcese del caballo de pelaje completamente blanco, piel plida y ojos claros y traslcidos.
Almohaza. Pieza del instrumental del mozo de cuadra utilizada para quitar la suciedad y la caspa
del cepillo. Tiene la parte de atrs plana y la delantera consta de varias filas de pequeos dientes
de metal.

Alta escuela. Arte clsico de equitacin.

Altura (de un caballo). Lnea perpendicular imaginaria que va desde el punto ms alto de la cruz o
crucero hasta el suelo.

Alzada. Distancia que hay entre el punto ms alto de la cruz y el borde ventral del casco.

Amadrinar. Acompaar a un caballo con otro.

Amansador. Se le dice a quien amansa un equino, lo doma y lo ensea a obedecer por la rienda.

Amateur. Jinete de carreras no profesional.

Amazona. Mujer que monta a caballo.

Ambladura. Paso lento, en dos tiempos, en el cual el caballo mueve a la vez las patas delantera y
trasera de un mismo lado.

Ancas. Caderas y posaderas del caballo.

Anteojeras o blinkers. Par de defensas oculares de cuero adosadas a la brida o a una pieza
colocada sobre la cabeza y que se utilizan para que el caballo slo mire al frente.

Apostar. Jugar dinero por un caballo.

Apear. Bajar del caballo.

Apero. Conjunto de elementos que se colocan al equino, tanto en la cabeza como en el dorso,
para la equitacin.

Apostante. Persona que juega dinero por un caballo.

Aprendiz. Joven que se entrena para ser jockey; en Gran Bretaa el perodo de aprendizaje
comprende entre cinco y siete aos.

Apuesta. Totalidad de dinero apostado por un caballo en una carrera.

Arreos. Piezas de guarnicionera que se le ponen a un caballo.

278
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Asideros del bocado. Piezas laterales del bocado a las que van enganchadas las riendas.

Asiento. Acanaladura de la mandbula inferior del caballo, justo detrs del labio inferior.

Asientos o barras. Espacio interdentario de la mandbula o maxilar inferior.

Autorisation Spciale. Tarjeta de color rosa, expedida a un jinete por la federacin nacional hpica
de su pas, que le autoriza a participar en pruebas internacionales de doma, de saltos o en
concursos completos de equitacin.

Autumn Dotible. Nombre de dos carreras, la Cesarewitch Stakes y la Cambridgeshire Stakes, que
se celebran anualmente en Newinarket (Inglaterra), en el otoo.

Avena. Cereal utilizado como parte de la alimentacin de un caballo. Se puede administrar entero,
machacado o hervido.

Avo o mantasilla. Almohadilla colocada bajo la silla para evitar una presin excesiva sobre el
lomo del caballo. Es algo mayor que la silla y de igual forma, y puede ser de fieltro, badana o de
goma espuma cubierta de tela.

Ayudas. Medios empleados por un jinete para dar instrucciones a su caballo. Vase tambin
ayudas artificiales y ayudas naturales.

Ayudas artificiales. Medios tales como ltigos, espuelas y martingalas, utilizados por el jinete para
dar instrucciones a su caballo.

Ayudas naturales. El cuerpo, las manos, las piernas y la voz del jinete, utilizados por ste para dar
instrucciones al caballo.

Bajar. Sinnimo de desmontar.

Balotada. Andadura alta consistente en que el caballo se pone de manos y salta hacia adelante
levantando las patas traseras bajo los cuartos, antes de posarse en el suelo sobre las cuatro patas.

Bandera blanca. Seal utilizada en los deportes hpicos para indicar el extremo izquierdo de un
obstculo. Tambin se emplea para sealar una pista establecida y se debe pasar siempre por la
derecha

Bandera roja. Marca utilizada en deportes hpicos para sealar el extremo derecho de los
obstculos. Tambin se emplea para indicar la pista establecida y siempre debe pasarse por el
lado izquierdo.
Barbada. Cadena de metal que va enganchada en los asideros de un bocado de freno y se apoya
en el asiento.

Bareback Riding. (Monta a pelo.) Una de las pruebas habituales en un rodeo. Consiste en montar
a pelo al caballo.

Barras. Tipo de obstculo empleado en concursos de saltos y en pistas de campo a travs,


consistente en unos palos verticales entre los cuales se colocan otros en posicin horizontal. En
las pruebas de saltos, los horizontales estn simplemente apoyados sobre los verticales, mientras
que, en las de campo a travs, estn fijados a ellos.

Barras paralelas. Obstculo extendido, utilizado en pistas de saltos y de campo a travs, que est
compuesto por dos grupos de palos y barreras.

279
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Barrage. En concursos de saltos, recorrido que se celebra, para decidir el ganador de una
competicin, entre participantes que han empatado para el primer puesto en el recorrido
precedente.

Barrera. Obstculo vertical utilizado con frecuencia en concursos de saltos.

Bayo. Caballo de piel oscura, pelaje entre pardo oscuro y rojizo brillante o amarillento parduzco, de
crin y cola negras, y normalmente con pintas negras en las patas.

Belfo. Caballo que tiene ms largo el labio inferior, o la dentadura y la mandbula superior es mas
corta que la inferior.

Bloques de peso. Lingotes normalmente de plomo, que se colocan en la mantilla del peso,
cuando el jinete es demasiado ligero para el caballo que ha de llevar en una prueba.

Bocado. Instrumento, normalmente hecho de metal o de caucho, que va unido a la brida y se


coloca en la boca del caballo para regular la posicin de la cabeza y ayudar a controlar el paso y la
direccin. Se maneja por medio de las riendas.

Bog Rider. Vaquero cuyo trabajo consiste en rescatar el ganado atrapado en barro o terrenos
cenagosos.

Bookie. Trmino abreviado de book-maker o corredor de apuestas.

Boomaker. Corredor de apuestas profesional, autorizado a aceptar las apuestas sobre carreras de
caballos hechas por otras personas.

Borrn. Parte alta, delantera y trasera, de las sillas de montar


Botaln. Palo largo y generalmente de horqueta en la punta.

Boundary Rider. En Australia, se le denomina as al encargado de reparar los cercados en los


ranchos ganaderos.

Bozal. Es la parte que va sobre la nariz del equino.

Brazo. Nombre que recibe la parte superior de la pata delantera del caballo.

Braceador. Cuando el caballo en su marcha saca las manos hacia el lado en demasa.

Brida. Parte de los arreos de un caballo que se coloca sobre la cabeza.

Brida sin bocado. Cuando carece de bocado, la presin se ejerce sobre el asiento y sobre la
boca, no sobre el bocado.

Bridn. Brida simple que consta de un filete, la cabezada y dos riendas.

Bro. Fogosidad, nimo, garbo, aliento, arranque, decisin. Disposicin natural para obedecer
pronto las ordenes del jinete.

Bronce. Conocido como caballo salvaje, sin domar o mal domado.

Bronc Riding. Nombre de una de las pruebas de rodeo habituales. El nico arreo que lleva el
caballo es una banda ancha de cuero alrededor del tronco, de la que sobresale un asidero tambin
de cuero.

280
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Brumby. Nombre dado al caballo australiano salvaje.

Buena boca. Boca suave y sensible.

Bull Riding. Nombre de una de las pruebas habituales en un rodeo; el participante tiene que
montar a un novillo o toro equipado slo con una cuerda alrededor del tronco, a la que el jinete slo
puede asirse con una mano.

Bruza. Cepillo de crines o cerdas de jabal, fuerte, para quitar el polvo y las materias extraas que
se removieron al pasar la almohaza.

Caballeriza de alquiler. Local donde se guardan caballos de propietarios particulares, a la vez que
son entrenados y cuidados en general, por un precio estipulado.

Caballista o jinete. Persona que monta a caballo, as como la que es experta en el entrenamiento
y cuidado de estos animales.

Caballo. Trmino general para referirse indistintamente al semental, la yegua y los castrados.
Tambin se emplea en el sentido de semental o caballo no castrado.

Caballo de carreras: El criado y preparado para correr, bien en liso, en vallas o en obstculos de
steeplechase.

Caballo cazador. El criado y preparado para ser montado en caceras. Tambin se le llama hunter

Caballo de competicin especial. Es el que toma parte, o puede hacerlo, en un concurso


completo de equitacin.

Caballo de paseo. El que est criado, preparado, o se utiliza para paseos por el campo.

Cabeza. Una de las medidas empleadas para expresar la distancia por la que un caballo gana uno
carrera: la longitud de la cabeza de un caballo.

Cabezn. Parte de la brida que cruza por el hocico del caballo; est compuesta por una banda de
cuero sobre una cabezada independiente que se pone bajo los carrillos o cachetes, y por encima
del bocado.

Cabriola. Andadura alta en la que el caballo se pone de manos, con los corvejones doblados;
despus salta hacia adelante y se eleva en el aire, a la vez que cocea con los remos posteriores
con las plantas de los pies vueltas hacia arriba, antes de posarse en el suelo sobre las cuatro patas
a la vez.

Caerse. Se considera que un caballo ha cado, cuando los hombros y las nalgas de un mismo lado
tocan el suelo. Asimismo, en lo que respecta a un jinete, se considera que ha cado cuando se
separa del caballo y necesita volver a montarlo.

Calf Horse. Especialmente en Amrica, caballo preparado y utilizado para el lazado de becerros.

Caif-Roping. Nombre de una de las pruebas habituales en un rodeo; el jinete debe lazar a un
becerro y, despus, desmontar de su caballo rpidamente para atarle tres patas.

Callo. Magullamiento de la planta del pie en el ngulo entre la pared del casco y el taln.

Calzado. Dcese del caballo cuyas patas son blancas desde el casco hasta la cerneja.

Campana. En concursos de saltos, seal que indica a los participantes el comienzo de la prueba,

281
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

su reanudacin o el final, as como la eliminacin de algn participante.

Camp Drafling. Modalidad de rodeo australiano en el que un jinete separa a un gran ejemplar de
un rebao de ganado y lo conduce al galope por un recorrido sealado con postes.

Cantidad de sangre. La existente en el cuerpo de un caballo es aproximadamente una


decimoctava parte de su peso total.

Caa. Nombre que recibe la parte de las patas del caballo correspondientes a los huesos meta
carpianos y metatarsianos

Candelear. Pegarse con los menudillos traseros, cuando el equino esta en marcha.

Capa. Conjuntos de pelos que cubren el cuerpo del equino, incluyendo el color.

Caprichoso. Equino indomable.

Careto. Es el caballo que tiene una mancha blanca en la cara que cubre su frente, el hocico y los
ojos.

Cargar. En polo, empujar con la propia cabalgadura la de un adversario, para impedirle que
alcance la pelota.

Carrera de caballos. Competicin de caballos, montados por jockey, que se celebra sobre terreno
liso o bien con obstculos, dentro de una zona determinada y sobre una distancia tambin
determinada, bajo el control de jueces o comisarios profesionales.

Carreras de vallas. Las que se celebran sobre una pista con vallas.

Carrera de venta. Carrera en la que, inmediatamente despus de celebrarse, cualquiera de los


caballos participantes, incluso los que no han ganado, pueden ser reclamados por un precio
establecido previamente, o, si se trata del ganador, debe ser ofrecido en subasta.

Castrado. Caballo al que se le han extirpado los testculos. Sinnimo: capado.

Castrar. Extirpar los testculos a un caballo o los rganos de la concepcin a una yegua.

Cavalletti. Saltos pequeos de madera utilizados en el entrenamiento bsico de un caballo de


monta para estimularle a aumentar su tronco, mejorar su equilibrio y relajar y fortalece sus
msculos.

Cayuso. Nombre dado a los caballos o ponies indios.

Cepillo. Objeto de cerdas cortas y muy apretadas que se utiliza para quitar el polvo y la caspa del
pelaje de un caballo.

Cepillo de agua. El utilizado para lavar los cascos del caballo y para humedecer la crin y la cola.

Certamen de los Tres Das. Competicin del Concurso completo de equitacin que se desarrolla
durante tres das consecutivos. Consta de doma, campo a travs (con pista de steeplechase, dos
circuitos de pistas, y otro de obstculos propios de campo a travs) y, por ltimo, concurso de
saltos.

Certamen de un da. Competicin del Concurso completo de equitacin; consta de dorna,

282
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

concurso de saltos y prueba de campo a travs, y se celebra todo en un da.

Cerrero. Potro sin domar.

Cincha. Banda normalmente de cuero o nylon, que pasa por la regin ventral del caballo para
sujetar la silla de montar.

Clsicas. Nombre de las cinco carreras lisas principales que se celebran en Inglaterra para
caballos de tres aos: Derby, Oaks, St. Leger, 1000 Guineas y 2000 Guineas.

Clavado o engatillado. Cuando el cuello y la cabeza van muy bajos.

Cob. Animal de patas cortas con una altura mxima de 15,1 palmos, con huesos y tejidos propios
de cazador duro y capaz de portar un peso considerable. Se trata de un tipo ms que de una raza.

Cofavorito. Dcese de los caballos igualmente considerados para ganar una carrera y que ofrecen
la misma baja cotizacin en las apuestas.

Cola. Parte del cuerpo del caballo que incluye el maslo junto con todo el pelo, que generalmente
se deja crecer unos 10 cm. por debajo del corvejn.

Coleador. Ejemplar que de una manera brusca mueve o azota la cola cuando ba en movimiento,
puede ser vertical o horizontal.

Clico. Dolencia abdominal aguda, a menudo con sntomas de flatulencia, consistente en una
obstruccin causada por una masa de alimento endurecido, o de excrementos en el intestino, y
que puede ocasionar un retorcimiento o inflamacin intestinales.

Colocado. En carreras, caballo ganador o que termina entre los tres primeros. Se pueden realizar
apuestas en o para colocado (es decir, sin especificar el puesto exacto de entrada del animal por el
que se apuesta).

Colocarse. En carreras, llegar entre los tres primeros.

Colores de la cuadra. Los caractersticos del propietario de los animales; la gorra de visera y la
chaquetilla de seda o de lana que llevan los jockey en una carrera, son de los colores de la cuadra
correspondiente.

Comisario de carreras. Persona encargada, en una reunin de carreras de caballos, de hacer que
todo se lleve a cabo segn las reglas.

Concurso completo de equitacin. Prueba amplia relativa al caballo y al jinete; consta de las tres
fases siguientes: doma, campo a travs y concurso de saltos, y se celebra a lo largo de un periodo
de uno, dos o tres das, segn el tipo de competicin.

Contrabarbada. Cadena pequea que pasa por la barbada y une las piernas del freno.

Conduccin a mano. Forma de exhibicin que consiste en llevar al animal con una cabezada de
exhibicin y sin ningn otro arreo (excepto en los caballos de tiro, que muchas veces se exhiben
con todos sus arneses), de manera que los jueces puedan valorar su constitucin y forma fsica.

Contacto. Lazo que debe existir entre las manos del jinete y la boca del caballo, realizado por
medio de las riendas.

283
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Contrarreloj. En concursos hpicos, pruebas que se resuelven por tiempo; resulta ganador el
participante que comete menor nmero de faltas y realiza antes el recorrido.

Control filmado (equipo de). El utilizado para filmar una carrera durante el desarrollo de la misma.

Copa de las Naciones. Competicin de saltos entre equipos internacionales, celebrada en un


recinto oficial internacional. Por cada equipo participan cuatro componentes, que saltan dos veces
cada uno, contabilizndose los tres mejores resultados en cada recorrido. En caso de empate,
despus de las dos vueltas, se procede a celebrar un barrage, en el que se cuentan las faltas y el
tiempo para dar el resultado final, y, como en los anteriores, slo se valoran los tres mejores
resultados y tiempos.

Corral. Cercado para animales, normalmente hecho de madera y siempre de forma circular para
que stos no se lastimen.

Corredor o jinete de brumbys. Nombre dado al que captura caballos salvajes en Australia.

Corvejn. Articulacin entre el hueso metatarsiano y el tarsiano en la pata posterior del caballo.

Corveta o gambeta. Andadura alta en la que el caballo se pone de manos, hasta llegar a una
posicin casi vertical, y a continuacin salta hacia adelante varias veces apoyndose sobre los
remos posteriores.

Cowboy. Hombre que vigila el ganado y lo lleva en manada en los ranchos, y realiza su trabajo
principalmente a caballo.

Criador. Propietario de una yegua que pare un potrillo; tambin se llama as al propietario de una
yeguada donde se cran caballos.

Crin. Pelaje largo que crece en la parte superior de la cabeza del caballo y a lo largo del cuello.

Cronmetro automtico. Aparato elctrico utilizado en concursos de saltos. Cuando el caballo


pasa por el punto de salida, intercepta un rayo electrnico, el cual dispara el mecanismo que pone
en funcionamiento el reloj. Cuando pasa por el punto de llegada, intercepta un artificio similar que
para el reloj.

Cruz. Parte ms alta del lomo de un caballo: la zona de la base del cuello entre los hombros.

Cruzado o mestizo. Caballo bien criado pero con algo de sangre comn (no de raza pura).

Cuadra. Conjunto de caballos que pertenecen a una persona, como un propietario de caballos de
carreras o de una escuela de equitacin, o que se albergan en el mismo sitio.

Cuarto de bsculas. Lugar, existente en los hipdromos, donde se pesa a los jinetes.

Cuartos. Parte del cuerpo de un caballo que se extiende desde la zona posterior del costado hasta
la raz de la cola (llamada maslo), y hacia abajo en ambos lados hasta la parte superior de la pata
(cuartos traseros).

Cubierta. Dcese de la yegua que est preada.

Cubricin. Inseminacin de una yegua por un semental. Sinnimo: acoplamiento, cpula.

Cuello. Una de las medidas empleadas para describir la distancia por la que un caballo gana una
carrera; es igual a la longitud de la cabeza y el cuello de un caballo.

284
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Cuerno de caza. Instrumento cilndrico, generalmente de 23 a 25 cm. de largo, hecho de cobre,


con una boquilla de nquel o de plata, utilizado por el encargado de los perros para dar seales a
stos y a los participantes.

Cuerpo. Una de las medidas utilizadas para dar la distancia por la que un caballo gana una
carrera; es igual a la longitud de la cabeza y el cuerpo de un caballo.

Cuartos. Parte del cuerpo del equino que incluye el anca, los muslos, la pierna y las nalgas, y que
recibe el nombre de cuartos traseros.

Chaln. Adiestrador y montador de caballos.

Chuparse. Cuando el ejemplar se recoge para corcovear de una manera rpida y brusca.

Chef d'quipe. Persona responsable de todos los preparativos, de dentro y fuera de la pista, de un
equipo nacional cuando compite fuera.

Chukka o tiempo en polo; perodo (le juego que, segn los pases, oscila entre siete minutos y
medio u ocho de duracin.

Declaracin o inscripcin. Afirmacin hecha por escrito, por un propietario, preparador o


representante, en un momento determinado antes de la carrera o prueba, en la que se declara que
un caballo participar en ella.

De dos a dos. Paso lateral en dos tiempos, en el que el caballo mueve, a la vez, los remos
traseros y delanteros de un mismo lado hacia adelante.

Delegado. Tcnico en una competicin internacional; persona responsable de que todo se lleve a
cabo segn las reglas internacionales y de que el circuito sea correcto. Normalmente, procede de
un pas distinto de aquel en que se celebra la prueba.

Desveno. Puente del bocado del freno que permite al animal una cierta libertad de lengua.

Denticin completa. La del caballo a los 6 aos, cuando ha echado todos los dientes.

Desaplomado. Cuando por deficiencia en los aplomos se observan los desperfectos de ellos,
estando en movimiento o parados.

Descargo de peso. En carreras, reduccin del peso a portar, solicitada por un jockey o aprendiz,
que no ha alcanzado un cierto nmero de victoria.

Difcil. Caballo que se pone de manos por nada y se va hacia cualquier sitio, cuando se le monta.

Dividendo. Cantidad pagada a una persona que ha apostado por un caballo ganador, o colocado.

Doma. Preparacin inicial de un caballo, cualquiera que sea el uso para el que se le requiere.

Dopar. Administrar drogas a un caballo, para mejorar su actuacin o para dificultarla en una
carrera o prueba. Es una prctica legal muy sancionada en todo tipo de deportes hpicos.

Dos a uno. En carreras, es el dividendo dado por un caballo cuando por la cantidad apostada se
puede ganar, o se gana, una cantidad igual.

Drower. En Australia, jinete que lleva ganado u ovejas en manada a lo largo de grandes
distancias.

285
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Ecuestre. Relativo a la equitacin.

Encoletado. Es el ejemplar que se resiste ha voltear por un lado y en ocasiones persiste en girar
sobre una sola rienda.

Endosado. Es el movimiento que hace el caballo de paso al descomponerse en su movimiento y


que anda nicamente por laterales, aun cuando se oyen 4 golpes.

Entero. Caballo no castrado.

Emparejar. Hacer que el caballo se sostenga en ele paso.

Eliminacin. Exclusin de un participante de una competicin.

Empate. Situacin en la que dos o ms caballos llegan a la meta igualados para alguno de los
puestos de honor de una carrera.

Enjaezar. Labor consistente en poner los arreos a un caballo para montarlo.

Enteritis. Inflamacin de la membrana mucosa de los intestinos, que puede ser originada por
bacterias, venenos qumicos o vegetales, o por alimentos mohosos o estropeados que contengan
hongos perjudiciales.

Espuela. Objeto puntiagudo que va unido con correas al taln de la bota del jinete y se usa para
estimular o picar el caballo ha seguir hacia delante

Estribos. Piezas que sirven para apoyar los pies del jinete

Equino. Relativo al caballo.

Excoriacin. Dermatitis que se da, generalmente, en caballos alrgicos a algn tipo de forraje y,
por consiguiente, aparece con ms frecuencia en los meses de primavera y verano. Afecta, sobre
todo, a la grupa y a la cruz, produciendo intensa irritacin y trozos de espesas escamas en la piel,
a veces ulcerosa, que el caballo, a menudo, se arranca tratando de encontrar alivio.

Exigir. Pedirle ha un caballo un ultimo esfuerzo cuando se encuentre casi al limite de sus fuerzas.

Escuela de equitacin. Centro donde se ensea a montar y se pueden alquilar caballos para dar
un paseo, o se pueden tener all para que los cuiden.

Espantarse. Girar un caballo bruscamente por miedo (o, a veces, por simple excitacin), a un
obstculo o ruido.

Establo. Edificio donde se alberga a uno o ms caballos.

Estabulado. Dcese del caballo que vive la mayor parte de su tiempo en una cuadra en vez de
estar suelto en un pastizal. Estos distintos modos de da requieren normas de mantenimiento y
alimentacin particulares.

Estado de la pista. Condiciones en que se encuentra una pista de carreras o cualquier otro tipo de
firme sobre el que camina un caballo.

Estrangol. Enfermedad infecciosa y fcilmente contagiosa, causada por el organismo conocido


como Streptococcus equi; se da con ms frecuencia en los caballos de poca edad. Los sntomas

286
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

incluyen aumento de la temperatura, espesa mucosidad e hinchazn de las glndulas


submaxilares y de otras glndulas linfticas de la cabeza, en donde, con el tiempo, se forman
abscesos.

Falsear. Cuando el ejemplar cojea o afloja de uno de sus miembros.

Falta. En concurso de saltos, unidad utilizada para contabilizar cualquier cada, rehse u otro error
cometido por un participante durante el recorrido.

Favorito. Dcese del caballo que probablemente gane una carrera. Es el que ofrece menores
dividendos.

Federacin Hpica Internacional. rgano rector de los deportes hpicos internacionales; fue
fundado en 1921 por el comandante francs G. Hctor. Tiene su sede en Brcelas y elabora las
reglas y reglamentos de los tres deportes hpicos de que constan los Juegos Olmpicos, en lo que
respecta a esta modalidad: concurso de saltos, prueba de los tres das y doma. Tambin se
encarga de las competiciones internacionales. Todas las federaciones nacionales estn obligadas
a cumplir estas reglas y reglamentos en cualquier prueba internacional.

Federacin Nacional. Organismo rector de los asuntos hpicos en cualquier pas afiliado a la
Federacin Hpica Internacional.

Fija. Apuesta en la que se predice el lugar exacto de entrada de un determinado caballo.

Filete. El ms antiguo y simple de los bocados; existen diversos tipos, pero consta principalmente
de una sola barra con un anillo en cada extremo a los que van unidas un par de riendas.

First Jockey. Jockey principal contratado por un propietario o preparador para llevar a sus
caballos.

Foto-finish. Resultado de una carrera, fotografiado por una cmara, con un campo de visin muy
estrecho, situada en la meta. La primera vez que se utiliz una cmara para reflejar una foto finish
fue en 1890 por John Heinment en Sheep-shead, en Estados Unidos.

Freno. Aparato que sirve para controlar a las cabalgaduras. Consta del bocado - barra de metal
que se asienta en la mandbula del bruto-, las piernas -barras metlicas unidas al bocado-, la
barbada y la contra barbada.

Freno filete. Bocado diseado para producir con una sola embocadura los efectos combinados
del filete y del freno. Normalmente est hecho de metal, vulcanita o caucho, y se utiliza con dos
riendas o con una sola, en cuyo caso se usa una tira de cuero para unir los dos anillos del bocado.
Frontalera. Parte de la brida que cruza la frente del caballo por debajo de las orejas.

Fusta. Ltigo largo y delgado que utilizan los jinetes de los caballos de carreras.

Fuste. Es el armazn de la montura.

Gabarro. Fstula purulenta del casco de los equinos.

Galpago. Cierta silla de montar inglesa.

Garrn. Cualquier pony nativo de Escocia o Irlanda.

Gemela. Apuesta consistente en apostar por dos caballos como ganadores en

287
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Gestacin. Perodo comprendido entre la concepcin y el nacimiento del potro, normalmente de


11 meses.

Grupa. Parte alta del extremo posterior del anca del equino.

Ground Money. En un rodeo, la cuota de entrada y dinero del premio que se reparten los
participantes cuando no hay un vencedor claro.

Grupo. Parte alta del extremo posterior del caballo.

Grupada. Andadura alta en la que el caballo se pone de manos, y a continuacin salta


verticalmente con los remos posteriores dirigidos hacia el vientre.

Gualdrapa. Cobertura larga que cubre las ancas del caballo.

Gymkhana. Conjunto de juegos realizados a caballo, casi siempre para nios menores de 16
aos, muchos de los cuales son adaptaciones de juegos infantiles.

Hndcap. Carrera en la que los pesos llevados por los caballos se establecen de modo que todos
tengan las mismas posibilidades de triunfo.

Heno. Hierba cortada y secada en una. poca concreta del ao para su uso como forraje.

Herradura. Banda de metal de forma caracterstica, que se clava en los cascos de caballos de silla
y de tiro, para protegrselos e impedir que se resquebrajen.

Herraje. Partes metlicas de la silla.

Herrar. Poner herraduras a un caballo. Normalmente, necesitan que les cambien las herraduras
cada cuatro u ocho semanas, segn el tipo de Ira bajo que hayan de realizar, de si se les ejercita
en suelo blando o duro y de la rapidez con que crezcan sus cascos.

Herrero. Persona que trabaja el hierro y, entre otras cosas, hace herraduras.

Higo. Enfermedad consistente en la inflamacin de la ranilla del pie del caballo y caracterizada por
el mal olor que desprende.

Hocico. La medida ms corta de distancia por la que un caballo puede ganar una carrera.

Hog's Back. En concursos de saltos, obstculo extendido en el que hay tres grupos de palos, el
primero muy cerca del suelo, el segundo en el punto ms alto del obstculo y el tercero
ligeramente ms bajo que el segundo.

Hogadera. Va colocada al lado de la cabeza y las patas de la jaquita y sirve para impedir que el
ejemplar se quite la jaquita fcilmente.

Hondn: plano del estribo donde se apoya el pie del jinete.

Hipdromo. Recinto de carreras, adecuadamente construido para carreras lisas y/o de vallas y de
steeplechase, junto con todas las dependencias pertinentes, tales como tribunas para los
espectadores, cuadras, paddock, edificios para oficinas, etc.; lo dirigen las personas nombradas al
efecto.

Hunting. Deporte consistente en seguir a distintos tipos de perros, a pie o a caballo, en

288
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

persecucin de una zorra, un ciervo, una fiebre o un seuelo de arrastre artificial.

Hunt Secretary. (Secretario de la cacera.) Persona que desarrolla las tareas habituales relativas a
la cacera; tambin es responsable de mantenerse en contacto con los granjeros y los propietarios
de tierras que se hallen dentro de la zona donde se celebra. y recoge las cuotas pagadas por los
asistentes.

Huntsman. (Encargado de la jaura.) Persona a cuyo cargo se hallan los perros durante una
cacera; puede ser el dueo o alguien empleado por ste.

Hunt Terrier. (Terrier de caza.) Terrier pequeo y de pata corto, utilizado para sacar a las zorras
de las madrigueras, las regueras y otros sitios inaccesibles a otros perros.

Hunter Trials. (Pruebas de caza.) Competiciones celebradas en Gran Bretaa por casi todos los
grupos de cazadores durante la temporada de caza, en las que los caballos son conducidos a lo
largo de una pista de obstculos construidos de la manera ms natural y parecida posible a los que
pueden encontrar en caceras. Tienen que completar el recorrido en un tiempo determinado.

Impulso: empuje, movimiento, fuerza, aceleracin del caballo que precede a cualquier aire.

Impulsin: actividad y equilibrio que crea el caballo con sus corvejones.

Inbreeding: Unin o apareamiento de animales emparentados.

Incensar: indica un movimiento alternante de la cabeza del caballo, de abajo arriba, por molestias
producidas por el bocado o por la accin pesada de la mano del jinete.

Incensar o despapar: vicio del caballo que consiste en alzar y bajar constantemente la cabeza.
Puede ser originada por excesiva sensibilidad de las "barre" o por vicio contrado.

Incisivos: son los dientes que se encuentran entre los incisivos medianos y los ltimos incisivos.
Tambin son los dientes de la arcada delantera que se encuentra antes de los colmillos.

Incurvacin: la curva ligera del cuello y el cuerpo del caballo que requieren ciertos movimientos y
ejercicios de doma.

Indisciplina: un caballo indisciplinado rechaza las indicaciones del jinete para que se mueva en la
direccin deseada. En lugar de obedecer, se queda quieto y a veces, corcovea o se encabrita.

Inflamacin: forma patolgica que interesa las partes cartilaginosas y tendones.

Infosura: inflamacin del tejido celular del pie del caballo, causada por excesos de trabajo, mala
alimentacin, golpes, cadas, que le obliga a pisar con cuidado y hasta con miedo.
Inferior a 2 a 1. Dcese del dividendo que supone una ganancia, para el apostante, inferior a la
cantidad jugada por l.

Intervenir: regular un caballo sobre un obstculo mediante una accin de las riendas para
determinar la exacta cadencia del aire. No es acto de buena equitacin.

Intruso o ringer. Caballo bueno que se matricula en una carrera con el nombre de otro inferior,
con intencin de ganar apuestas ilegalmente.
Ir al peso o a bsculas en ciertos deportes hpicos, como en carreras, saltos y en el Concurso
completo de equitacin, en los que los caballos han de portar un peso determinado, los jinetes van
al peso (se pesan), inmediatamente despus de la prueba, para asegurarse de que no sobrepasan
el peso correcto.

289
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Jquima. Cabezada sin bocado, generalmente de cuero, para conducir un caballo sin brida, o para
amarrarlo en el establo.

Jockey. Persona encargada de montar a un caballo en una carrera.

Jarrete. Corva del caballo. Taln.

Laminitis. Inflamacin de las lminas sensibles que se encuentran entre la pared crnea del casco
y el hueso del pie. Es muy dolorosa.

Legra. Instrumento de metal en forma de gancho que se utiliza para quitar las piedras y la
suciedad del pie de un caballo.

Levantada. Andadura de alta escuela en la que el caballo se pone de manos, con los pies delante
recogidos hacia dentro, mientras los cuartos traseros estn profundamente doblados en las ancas
y soportan todo el peso.

Ligerero. Se dice del caballo (salvo de los pura sangre), que se emplea o es apropiado para la
monta, como, por ejemplo, uno de alquiler o un cazador.

Linaza. Semilla del lino que, en forma de gelatina, aceite o t de linaza, se emplea como laxante y
tambin para mejorar el estado y el lustre del pelaje del caballo.

Lnea de salida. Punto de comienzo de una carrera.

Lucero. Dcese del caballo que tiene una pinta blanca en la frente.

Lunar. Dcese del caballo que tiene una pinta blanca en el hocico.

Llegar. Se dice que un caballo llega cuando cruza, montado por su jinete, el poste de llegada,
suponiendo, en el caso de carreras de vallas o en pruebas de steeplechase, que haya pasado
todos los obstculos con su jinete.

Manchado. Caballo cuyo pelaje presenta manchas grandes e irregulares, claramente definidas, de
blanco y de cualquier otro color, excepto negro.

Mandil. Prenda de cuero duro de caballo, utilizada por los herreros para protegerse la parte
delantera del cuerpo mientras ponen herraduras a un caballo.

Mano. Nombre que reciben las pezuas delanteras del caballo.

Mantilla del peso. Pedazo de tela que se lleva bajo la silla de un caballo. Va provisto de unos
bolsillos en los que se pueden introducir trozos de plomo para conseguir el peso correcto.

Martingala. Aparato utilizado para ayudar a mantener en posicin correcta la cabeza del caballo.
Est compuesto generalmente de una correa, o una serie de correas, enganchada a la cincha por
un lado, que pasa por entre los remos delanteros y, segn el tipo, por el otro extremo va unida a
las riendas, al cabezn o directamente al bocado.

Maslo. Inicio del rabo o cola del caballo.

Master. (Cazador mayor.) Persona encargada por un grupo de cazadores de la direccin y


organizacin de todos los aspectos de la cacera.

Matadura o rozadura. Herida en la piel del animal producida por la silla o la cincha.

290
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Medalla de Honor. Trofeo otorgado por la Federacin Hpica Internacional a los jinetes que
participan en pruebas del Premio de las Naciones. Los puntos se otorgan de la manera siguiente:
bronce 5, plata 25 y oro 50. La participacin en Juegos Olmpicos equivale a haber concursado
cinco veces en el Premio de las Naciones.

Medio galope. Paso en tres tiempos en el que las pezuas golpean el suelo en el siguiente orden:
la trasera izquierda, la delantera izquierda y la trasera derecha a la vez, la delantera derecha (pata
conductora); o bien, trasera derecha, delantera derecha y trasera izquierda juntas, delantera
izquierda (conductora).

Montar. Accin de subirse el lomo de un caballo.

Montar a pelo. Montar sin silla ni manta el lomo del caballo.

Montura. Caballo que puede ser montado y tambin, la silla.

Mount Money. En un rodeo, retribucin monetaria que recibe el jinete que realiza ejercicios de
exhibicin, sin entrar en competicin.

Mozo. Persona responsable de cuidar a un caballo.

Muro. En concursos de saltos, obstculo vertical hecho de trozos de madera huecos, pintados y
apilados como si fueran ladrillos. Tambin se llama as a un obstculo de campo a travs
construido con ladrillos, hormign, travesaos y piedras.

Mustang. Caballo salvaje.

Negro. Caballo de pelo, cola y crin negras, sin ningn otro presente, excepto, quizs, pintas
blancas en la cara y en las patas.

No colocados. En una carrera, caballos que no consiguen situarse entre los puestos de honor. A
veces, tambin se utiliza el trmino ingles also-ran.

No contrastado. Aquel caballo que no todava no ha tomado parte en una carrera.

Obstculo combinado. En concurso de saltos, el que implica realizar dos o mas saltos separados,
que se juzgan y contabilizan como uno.

Obstculo en extensin: en concurso de saltos y pruebas de campo a travs, cualquiera de los


que son anchos, opuestos a los simplemente verticales o de altura, tales como del hog's back, el
doble, el triple o la ra.

Obstculo vertical. En pistas de saltos y de campo traviesa, el que tiene todos sus componentes
en el mismo plano vertical, tales como el de tablones, el de palos y barreras.

Ollares. Nombre que reciben los orificios nasales del caballo.

Paddock: espacio cercado y con prado en el que los caballos gozan de una relativa libertad, o,
tambin, recinto en el que se renen los caballos antes de la carrera.

Palafrenero. Ayudante que tiene de la cabezada al equino para que el jinete se monte. Mozo de
las caballerizas.

291
UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD
Escuela de Ciencias Agrcolas, Pecuarias y del Medio Ambiente
Contenido didctico del curso Viveros

Palma: tejido de la planta del pie. Parte inferior del casco de forma semilunar.

Palomino: es un caballo alazn con crines y cola blancuzca, o bien, un caballo de pelaje
amarillento con crines y cola blancuzcas.

Paso: movimiento natural del caballo en cuatro tiempos. Es el menos veloz, el ms regular y el
ms cmodo. El paso, es un movimiento regular de cuatro tiempos bien marcados y sostenidos y el
caballo tiene siempre dos o tres cascos en el suelo. El animal levanta un solo casco cada vez: por
ejemplo: pie derecho; mano derecha; pie izquierdo; mano izquierda.

Paso espaol: aire de alta escuela; el caballo levanta alternativamente las patas delanteras,
llegando con las patas a la altura de la espalda media.

Paso lento: uno de los aires del caballo de silla americano. Es un movimiento en el que cada
casco se eleva y se sujeta momentneamente en el aire antes de tocar el suelo. (Es similar al
rack).

Paso atrs: hacer que el caballo camine hacia atrs ya sea montado o enganchado.
Paso de andadura: un aire por bpedos diagonales en dos tiempos en el que la mano y el pie del
mismo lado se mueven a la vez.

Passage: uno de los aires de alta escuela. Es un trote espectacular muy elevado a cmara lenta.
El tiempo de suspensin esta bien definido al quedarse en el aire uno de los bpedos diagonales
cuando el opuesto esta en el suelo.

Pasto/ Prado: un cercado de hierba que sirve de pasto a los caballos.

Patizambo. Animal que tiene sus pies desviados o chuecos hacia fuera.

Pecho petral: pieza que se abrocha a la montura para impedir que se deslice hacia atrs.

Pedigr: certificado genealgico de un caballo de pura raza. Adems de su ascendencia paterna y


materna, figuran sus datos caractersticos.

Penalidad: puntos de desventaja que se asignan a los concursantes en los concursos hpicos.

Penco. Caballo de baja calidad.

Perfomance: resultados oficiales en las pruebas publicas de un caballo, conjunto de los ltimos
resultados obtenidos en las pistas por un caballo de carrera.

Pesaje: recinto del hipdromo en el que se realizan las operaciones de pesar a los yoquis antes y
despus de las carreras para asegurar que lleva durante toda la competicin el peso apropiado.

Pessage: aire de alta escuela, trote muy elstico y sealado. Sala donde se pesan los jockeys. Por
extensin, el recinto externo.

Peso: equivalente en kilogramos que debe llevar en una carrera.

Piafar: trote muy reunido sobre un mismo punto, propio de las pruebas de alta escuela. El lomo del
caballo debe ser muy elstico y vibrante y los cor