Está en la página 1de 1375

Agradecimientos.

Los apuntes mostrados a continuacin, han sido cedidos, muy


amablemente, por mi alumna:
M Jess Ballesteros Panes(Cuso 2013-14).
Espero que, gracias a ellos, las prximas promociones de mis
alumnos, dispongan de un material que les facilite su estudio.

MUCHAS GRACIAS
M JESS.

BLOQUE I.
LA MATERIA VIVA

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/2bachillerato/biomol/contenidos1.htm

LA MATERIA VIVA
A) Bioelemento:

son los elementos que forman parte de la vida, estos se unen

formando molculas, son los elementos qumicos que se encuentran en los seres vivos.
i. CLASIFICACIN:
1. -PRIMARIOS: son aquellos que se encuentran en las biomolculas. Son
carbono, hidrgeno, oxgeno, nitrgeno, fsforo y azufre.
2. -SECUNDARIOS: son aquellos que estn asociados a los bioelementos
primarios y que se encuentran en una proporcin superior al 0,1%. Son
calcio, sodio, potasio, cloro y hierro.
3. -OLIGOELEMENTOS: son los elementos qumicos que estn en
cantidades muy pequeas menos del 0,1%. Son cobalto, cobre, cinc y
nquel.

B) Biomolculas o principios inmediatos:

: es el conjunto de

molculas inorgnicas y orgnicas que hay en todos los seres vivos


a. INORGNICAS: son las molculas que no tienen combinaciones o a lo sumo solo un
tomo de carbono. No desprenden calor, no se pueden quemar.
i. CLASIFICACIN:
1. AGUA: 65% de nuestro cuerpo H2O
2.

SALES MINERALES: CaCO3

b. ORGNICAS:Son las molculas que contienen 2 o ms tomos de carbono. Nos


aportan energa. Se pueden quemar.
i. Las biomolculas orgnicas atendiendo a su longitud y complejidad de su cadena
se clasifican en:

1. Monmeros que son molculas pequeas que forman parte de una


molcula mayor.
2. Polmeros que son agrupaciones de monmeros para componer una
molcula de mayor tamao.
ii. CLASIFICACIN:
1. -GLCIDOS O HIDRATOS DE CARBONO: Carbohidratos. Ejemplo
(azcar, simple ; almidn, complejo). C6H12O6->glucosa
2. -LPIDOS O GRASAS: Ejemplo (aceite vegetal, monosaturado; grasa
animal, polisaturado
3. -PRTIDOS O PROTENAS: Ejemplo (carnes, derivados, pescado,
legumbres)
4. -CIDOS NUCLEICOS (ADN): Ejemplo (vitaminas)

COMPUESTOS INORGNICOS
AGUA (Pag. 70)-> El agua es dipolar.
-EXTRACELULAR o fuera de nuestras clulas (Sangre, linfa, jugos gstricos, saliva)
-INTRACELULAR, se encuentra dentro de nuestras clulas y es el ms abundante.
PROPIEDAS FSICAS Y QUMICAS DEL AGUA
1 CARACTERSTICA:

-Forma una molcula muy estable por tener enlaces covalentes (es muy difcil que se
rompan).

2 CARACTERSTICA:

-Presenta zonas con diferente carga elctrica. Es una molcula muy polar (presenta polos
elctricos positivos y negativos), gracias a la polaridad el agua es el mejor disolvente
para que se realicen las numerosas reacciones qumicas de nuestro cuerpo.

Solo hay unas biomolculas no polares que no se disuelven en agua y son los lpidos o
grasas. Por ello las grasas no reaccionan bien en nuestro cuerpo.

3 CARACTERSTICA:

-El agua es neutra, es decir, no es ni cida ni bsica. Gracias a ello las biomolculas
orgnicas no se estropean en el agua, por tanto el agua no destruye las biomolculas de
nuestro organismo.

4 CARACTERSTICA:

-El agua es un buen reactivo qumico. Cuando se descompone por accin de unas protenas
llamadas enzimas forman gran cantidad de H y OH que son muy reactivos y hacen que las
molculas reaccionen unas con otras. A estas reacciones se llaman

HIDROLIXIS-

>ruptura con agua.

SALES MINERALES
Es el conjunto de tomos o molculas que presentan iones (cargas positivas o negativas) en
su composicin. Las sustancias que saben de sabor salado deben ser sales minerales. Por
ejemplo la sal de mesa o sal comn.
CLASIFICACIN (Pg. 73):
-Sales precipitadas: No solubles en agua (conchas de los bivalvos o los esqueletos que son
sales de calcio-> (sales de fosfato Ca3 (PO4)2)

Los huesos por tanto necesitan calcio o iones clcicos si queremos formarlos (derivados
lcteos). Cuando falta calcio en nuestra alimentacin se producen dos enfermedades
tpicas:
-El raquitismo. Es muy tpico de nios mal alimentados. Sntomas del raquitismo:
escasa estatura y huesos muy frgiles.
-Osteoporosis. Es la enfermedad tpica de la tercera edad debida a la falta de
depsito en los huesos al reducirse las hormonas responsables de su depsito
(estrgenos, hormonas femeninas).

-Sales disueltas: Se encuentran dispersas en los lquidos biolgicos. Las sales disueltas ms
importantes de nuestro cuerpo son:

-La sal comn (Na Cl), su concentracin debe ser exactamente del 0,9% y tiene dos
funciones bsicas en nuestro cuerpo.

La sal comn es qumicamente (cloruro sdico-Na Cl). Con la combinacin del


agua salen los iones positivos del sodio y negativo del cloro. Las sales junto
con el agua no se destruyen con el calor, por ello son las nicas biomolculas
que aparecen despus de la descomposicin de los cuerpos.
Tenemos 0,9% de Na Cl en el ser humano los lquidos corporales (sudor, sangre,
lgrimas,

saliva)

de

concentracin

salina

fisiolgica.

Es

una

sal

osmticamente activa, es capaz de retener el agua dentro de nuestro cuerpo.


La sal retiene el agua en nuestros lquidos biolgicos por ello nuestras clulas
estn muy hidratadas. Si perdemos sal en nuestros rganos estos se
deshidratan. Todas las sales tienen un efecto osmtico en nuestro cuerpo
(osmosis es el flujo o el movimiento del agua a donde haya ms sales en el
organismo).Interviene en el impulso nervioso. Cuando nuestras neuronas
funcionan supone la entrada de potasio y la salida de sodio de nuestras
neuronas. Por ello es necesario tomar sales minerales de sodio y de potasio en
forma de frutas y verduras.

Sales de yodo:(I Cl) El Yodo es necesario para el funcionamiento de la hormona tiroidea


(responsable de nuestra actividad fsica).

Sales de hierro: (Fe Cl2) Frutas y verduras, lentejas, marisco con concha, carnes rojas.
Su carencia produce la anemia ferropnica (con bajo contenido en hierro). Sntomas son
el cansancio, palidez, malestar general.

Sales de cobalto: Es necesaria para la formacin de nuestros glbulos rojos. La vitamina


B12 no se puede formar en los vegetales si no tienen cobalto.
-----------------------------

COMPUESTOS ORGNICOS
GLCIDOS: Son combinaciones de dos o ms monosacridos o azcares
simples. Los monosacridos son dulces y solubles en agua.
CLASIFICACIN:
-Monosacridos o azucares simples o sencillos
Son aquellos que son dulces y que se pueden disolver en agua o en
compuestos acuosos polares. Por ejemplo no se pueden disolver en
disolventes apolares como el aceite de oliva. Todos los monosacridos
son energticos (presentan 4 Kcal).

-Oligosacridos
Son glcidos formados por un nmero pequeo de monosacridos entre 2
y 10, se denominan disacridos ,trisacridos, etc.

-Polisacridos o azucares complejos


Son azucares que han perdido su sabor dulce (inspidos) y adems
insolubles en agua. Los azucares complejos ms habituales en nuestra
alimentacin son el almidn /Ej. Patatas, derivados de la harina de trigo,
cereales, legumbres)
El almidn es en realidad miles de molculas del monosacrido ms
abundante LA GLUCOSA>C6H12O6. Todos los polisacridos estn unidos
entre s por unos enlaces tpicos o caractersticos estn unidos entre s
por unos enlaces glucosdicos. Miles de monosacridos (ms de 100000
molculas de glucosa)

Glucgeno:es un polisacrido constituido solo por molculas de glucosa y


que se encuentra en el ser humano en el hgado y en nuestros msculos
como reserva energtica. Esta reserva es muy escasa en nuestro cuerpo y
se agota a los pocos minutos de un ejercicio intenso (como un deportista de
lite). Se forma el glucgeno a partir de cualquier alimento energtico.
Celulosa: es otro polisacrido que contiene glucosa. Sin embargo los enlaces
entre estos polisacridos son difciles de digerir. Solo los herbvoros son
capaces de digerir y obtener energa de la celulosa. Todas las verduras
(lechugas, acelgas, espinacas son ricos en celulosa o fibra alimentaria). La
fibra es necesaria tomarla a diario puesto que evita el estreimiento. A

largo plazo evita los cnceres de colon o de intestino grueso.El enlace O


Glucosdico puede ser o . El est en el almidn, en el glucgeno. El
est en la celulosa.

Funciones de los Glcidos:


-Reserva energtica (almidn, glucgeno)
-Formador de estructuras (celulosa)

-------------------------------

LOS LPIDOS: son sustancias insolubles en agua, pero solubles en


disolventes o lquidos orgnicos o apolares (acetona, gasolina, aguarrs,
benceno y cloroformo). Adems son sustancias que flotan en el agua y sin
son slidos se funden a moderadas temperaturas. Ej. De lpidos (todos los
aceites, la mantequilla)
CLASIFICACIN:
Los cidos grasos: Son un tipo de lpidos que presentan una larga
cadena de carbonos e hidrgenos o hidrocarbonados. (caracter
apolar o insolubles en agua). Termina en un grupo cido o
carboxhlico (COOH) que es soluble en agua por ser polar
(Anfipatidos).
Hay dos tipos de cidos grasos:
-Los cidos grasos saturados, denominados as porque estn rellenos o
saturados de enlaces sencillos. Se presentan en los lpidos de origen
animal. (Tocino, nata, mantequilla, queso). Dichos cidos grasos se
transforman fcilmente en colesterol que aunque es necesario para el
cuerpo en grandes cantidades se deposita en nuestras arterias
taponndolas y producen infartos.
-Acidos grasos insaturados, son aquellos que tienen, al menos, un enlace
doble en la larga cadena hidrocarbonada.
Importancia de los insaturados: Generalmente se forman por los
vegetales, los alimentos de origen animal no suelen llevar estos
cidos. Sin embargo los pescados azules (salmn, etc.) presentan
cidos grasos omega 3. Los cidos grasos insaturados generan
muy poco colesterol en nuestro cuerpo. Por ello, es ms saludable
tomar grasas de origen vegetal que animal salvo pescados azules.

Triglicridos: Es la unin o esterificacin de la glicerina con 1,2 o 3


cidos grasos. Los ms frecuentes son los triglicridos
denominados comnmente grasa.
Si los triglicridos son de aspecto slido (sebos) indican que
los cidos grasos que contienen son de tipo saturado o animal
y por tanto van a formar mucho colesterol en el hgado.
Por el contrario los triglicridos de aspecto lquido se
denominan aceites y contienen abundantes cidos grasos
insaturados que no generan tanto colesterol en el hgado.
La funcin de los triglicridos es de reserva energtica 9 a 10
Kcal por gr. De grasa (1 Kg. Grasa=10 horas de bicicleta). La

segunda funcin de los triglicridos es de aislante trmico, es


decir, evita un enfriamiento excesivo en climas fros.
Cridos: Tambin llamados ceras, est formado por una molcula
completamente apolar, esta caracterstica permite que la funcin
tpica de las ceras consiste en servir de impermeabilizante.
Fosfolpidos o fosfoglicridos: Son lpidos que contienen un
diglicrido unido a tomos de fsforo y otras sustancias polares (o
solubles en agua). Estos lpidos son los componentes bsicos de
todas las membranas celulares. Por tanto, su falta en nuestro
organismo produce muerte celular y la muerte en las personas. Por
tanto su papel no es energtico sino que es exclusivamente
estructural (formar membranas celulares).
Esteroides: Los esteroides son derivados qumicos de un compuesto
llamado esterano (ciclopentano-perhidrofenantreno).

Ejemplos de esteroides:

COLESTEROL: es un esteroide esencial para formar nuestras


membranas celulares y las de todos los animales. Sin colesterol no se
puede vivir porque nuestras clulas no se formaran. Adems el
colesterol es la molcula de partida de otros esteroides (hormonas
sexuales, vitamina D, cidos biliares). El colesterol se puede obtener
directamente de algunos alimentos (huevo, hgado, bollera). Tambin se
puede formar en nuestro hgado a partir de grasa de origen animal
(mantequilla, tocino, etc.) Al ser una molcula insoluble en sangre, se
deposita progresivamente en nuestras arterias produciendo una
enfermedad caracterstica (ateroesclerosis). El resultado a largo plazo
es un alto riesgo de infartos de miocardio (paradas del corazn) o ictus.
El denominado colesterol bueno (HDL), es en realidad una protena que
transporta correctamente el colesterol, desde el hgado, donde se
forma, hasta el resto de nuestras clulas, donde se deposita. Quien
tenga estas protenas en buenas condiciones tiene bajo riesgo de
ateroesclerosis. Por el contrario existen protenas que transportan
deficientemente el colesterol en sangre y se denominan colesterol malo
(VDL). Quien tenga altos niveles de esta protena tiene altos riesgos de
enfermedades cardiovasculares.
ESTRADIOL U HORMONA FEMENINA: Es un derivado del colesterol
que se forma solo en los ovarios mientras la mujer es frtil. Es la
hormona responsable de formar vulos. Adems el estradiol es la
hormona responsable de los caracteres sexuales secundarios femeninos.
TESTOSTERONA O ANDRGENOS: es otro derivado del colesterol
que solo se forma en los testculos. Tambin la corteza renal forma

pequesimas cantidades de esta hormona. Su funcin es formar los


espermatozoides y adems es responsable de los caracteres sexuales
secundarios masculinos. Cuando una mujer forma testosterona en
exceso presenta una vellosidad ms acusada.
ALDOSTERONA:es otra hormona derivada del colesterol y se fabrica
tambin en la corteza renal. Su funcin es la de regular los niveles de
sal en nuestra sangre; nuestro rin forma esta hormona que es capaz
de recuperar dicha sal de nuestra orina y devolverla a nuestra sangre.
CORTICOSTERONA O CORTISONA:es otra hormona fabricada en el
rin y derivada del colesterol y cuya funcin es generar un estado de
nerviosismo ante situaciones de peligro. Tiene efectos similares a la
adrenalina (vasodilatacin de las arterias, aumento de la actividad
cerebral o muscular), se llama hormona del estrs y es necesaria en
cortos periodos de tiempo. Esta hormona la cortisona tiene un segundo
efecto en nuestro cuerpo y es la de reducir nuestras defensas. Cuando
hay un estado de nerviosismo prolongado disminuyen nuestras defensas
y pueden aparecer enfermedades infecciosas incluso el cncer.
VITAMINA D o antirraqutica, tambin es un derivado del colesterol.
Nuestro cuerpo en realidad obtiene vitamina D gracias a la luz
ultravioleta del sol cuando incide en nuestra piel, estos rayos solares
transforman la provitamina en una vitamina activa. Se puede tomar
vitamina D directamente de la leche, mantequilla, huevos y aceite. Esta
vitamina facilita la absorcin de calcio y fsforo desde el intestino
hasta la sangre. Tambin facilita el depsito de calcio y fsforo en los
huesos. Su falta ocasiona raquitismo en los nios y osteoporosis en
personas de la tercera edad.
SALES BILIARES. La bilis o sales biliares son tambin esteroides
derivados del colesterol. Se forma en el hgado y se almacena en la
vescula biliar. Esta bilis se segrega al duodeno (primer tramo del
aparato del intestino delgado), especialmente despus de una comida
rica en triglicridos (grasas). La bilis acta como un disolvente de
grasas. Gracias a ella los jugos digestivos pueden digerir a los
triglicridos.

Isoprenoides: Son lpidos que contienen varias molculas de


isopreno (una molcula de cuatro carbonos). Los isoprenoides ms
importantes son vitaminas (vitamina A, vitamina E y vitamina K).
VITAMINA A O ANTIXEROFTLMICA: evita la prdida de visin
especialmente cuando hay poca luz. Para evitar esta ceguera hay que tomar
frutas y verduras de tonalidades rojizas o al menos verdes. Adems es
importante en el mantenimiento de nuestra piel.
VITAMINA E O TOCOFEROL: Tiene una doble funcin en nuestro cuerpo.
Por un lado es antioxidante, reduce los efectos negativos de los radicales
libres, (son sustancias ricas en oxgeno que se forman espontneamente en

nuestras clulas y destruyen el ADN). Adems su falta prolongada produce


infertilidad femenina. Se encuentra en los frutos secos.
VITAMINA K O PROCOAGULANTE: Su funcin es favorecer una rpida
cicatrizacin de las heridas. Cuando falta, una pequea herida, produce una
hemorragia prolongada. Afortunadamente la forman nuestras bacterias
intestinales, pero cuando hay un problema de diarreas intensas
desaparecen dichas bacterias y durante das podemos sentir estos efectos
indeseables.
Prostaglndinas: Se encuentran en gran cantidad de tejidos aunque su
nombre se debe a que las primeras las encontraron en la prstata, cumplen
funciones relacionadas con procesos inflamatorios.

PROTENAS o PRTIDOS: son polmeros o unidades repetitivas de


molculas sencillas llamadas aminocidos.
Un aminocido es una molcula que tiene un carbono central con cuatro grupos
qumicos caractersticas.

Uno de ellos es un grupo cido muy parecido al de los cidos grasos.

Tambin tienen un grupo amino (NH2).

El tercer grupo es un hidrgeno

El cuarto grupo o radical es muy variable y da nombre al aminocido. Hay veinte


aminocidos diferentes y una protena contiene ms de cien aminocidos en un
orden caracterstico.

Las protenas son combinaciones de mas de 100 aminicidos.


Hay unas 30.000 protenas en nuestro cuerpo y cada una de ellas tiene una
funcin determinada.
Los aminocidos se unen entre s por enlaces peptdicos, en la unin se
libera agua.
En esta unin el cido del primer aminocido se une con el grupo amino del
segundo aminocido desprendiendo agua.
Una protena tiene que tener ms de cien enlaces peptdicos y cada
protena tiene un orden de aminocidos concreto llamado estructura
primaria.
Hay nueve aminocidos esenciales que no se pueden formar en nuestro
cuerpo y que debemos consumir en ciertos alimentos. Las protenas
animales son de alta calidad porque tienen estos aminocidos bsicos. En los
vegetales las protenas suelen presentar algn aminocido deficitario por
ello hay que variar mucho una dieta vegetariana.

Funciones de las protenas:

Funcin estructural: Forma parte de la caracterstica de nuestro cuerpo, forman


estructuras capaces de soportar gran tensin continuada como un tendn.
Protena de la piel: -QUERATINA, sirve para que no entren microbios en nuestra sangre.
Forma parte de nuestras uas, pelos y la epidermis, evita la entrada de grmenes a
nuestro cuerpo.
-El COLAGENO es otra protena de la piel que sirve para hidratarla, tiene un papel
protector que permite que se filtre los rayos del sol de una forma adecuada. El colgeno
se encuentra en la dermis. Es la protena ms abundante de nuestro cuerpo.
Tambin pueden soportar tensin de forma intermitente como la ELASTINA de la piel o
de un pulmn.
Funcin de contraccin: Forman estructuras que producen movimiento. Mueven los msculos
estriados y lisos. Est constituido por la ACTINA y la MIOSINA (constituye un 25 o un 30%
de nuestro cuerpo).

Funcin de transporte: Algunas protenas tienen la capacidad de transportar sustancias,


como oxgeno, lpidos o electrones. Los glbulos rojos, tambin llamados eritrocitos o

hemates estn en la sangre, estas clulas contienen centenares de protenas llamadas


HEMOGLOBINAS que son las responsables de transportar oxgeno desde los pulmones hasta
cualquier rgano de nuestro cuerpo.
Funcin homeosttica: Esta funcin es aquella que permite mantener al cuerpo dentro de
unas condiciones ms o menos constantes. La ALBMINA presente en la sangre es una
protena que junto con el cloruro de sodio contribuye a mantener el volumen de sangre en su
cantidad adecuada.
Funcin defensiva: En nuestra sangre circulan unas protenas denominadas defensa o
inmunoglobulinas. Estas se forman por ciertos glbulos blancos llamados linfocitos B. Cuando
llega un microorganismo estos linfocitos tardan unos diez das en generar
INMONOGLOBULINAS o anticuerpos frente a este germen. A partir de este momento se
dice que estamos inmunizados frente a esta enfermedad. Adems hay otros glbulos blancos
que liberan toxinas proteicas que destruyen a clulas cancerosas.
Funcin hormonal: Algunas hormonas no son de naturaleza lipdica (Vitamina A, D, E, K) si no
de naturaleza proteica son protenas. Como todas las hormonas se forma en alguna glndula
llamada endocrina. Ejemplos de hormonas proteicas son las siguientes:
1. La insulina: Es una hormona que se forma en el pncreas. La funcin de la insulina es
controlar o regular los niveles de glucosa en sangre (glucemia). Cuando no se forma
suficiente insulina la glucemia se eleva a valores patolgicos. Se produce la enfermedad
llamada diabetes que presenta los siguientes sntomas (ceguera, posibles infartos de
miocardio, artrosis, dificultad en coagular la sangre. Esta enfermedad puede ser de
origen gentico o bien se puede adquirir por un consumo excesivo de alimentos muy
dulces.
2. Hormona de crecimiento: Se produce en la glndula denominada hipfisis situada en la
base de nuestra cabeza en el encfalo. Cuando falta durante la infancia se produce el
enanismo, afortunadamente se puede tratar durante la infancia, con hormona del
crecimiento sinttica.
3. Hormona tiroidea: Esta hormona se produce de la glndula tiroides y es la responsable de
nuestra actividad diaria. Cuando existe hipotiroidismo, es decir, poca hormona en nuestra
sangre la persona se encuentra aptica con un bajo metabolismo y tiende a engordar. Por
el contrario el hipertiroidismo o exceso de hormona le hace muy nerviosa, presenta una
delgadez extrema y una sudoracin excesiva.
Funcin enzimtica: Una enzima son biocatalizadores, es decir, molculas de naturaleza
proteica que aceleran las reacciones qumicas que hay en nuestro organismo.
Ejemplo de las reacciones enzimticas son la digestin de los alimentos y el metabolismo
de nuestras clulas por ejemplo, los alimentos que tomamos son digeridos por nuestros
jugos digestivos. El jugo gstrico (estmago) tiene enzimas dedicadas a la digestin o
hidrlixis de las protenas o aminocidos. Concretamente es la TRIPSINA la que
transforma cualquier protena en sus aminocidos correspondientes. Otra enzima
proteoltica (que digiere las protenas) es la QUIMOTRPSINA. En este caso se segrega
en el jugo pancretico. Ayuda a terminar la digestin de las protenas en el intestino
delgado.
La AMILASA es la enzima que hidroliza o digiere al almidn y lo transforma en molculas
de glucosa que puede pasar del intestino a nuestra sangre. Esta enzima se encuentra
tanto en la saliva como en el jugo pancretico.
Las enzimas que atacan o digieren a los lpidos, especialmente los triglicridos, son las
LIPASAS del jugo pancretico las que realizan esta digestin.

Tambin todas las reacciones qumicas de nuestras clulas son aceleradas por enzimas
determinadas. Cuando falte alguna enzima celular no se podr obtener energa ni formar
nuevas molculas a partir de los nuevos alimentos que tomemos.

CIDOS NUCLEICOS:es el material gentico que se encuentra dentro de nuestros


ncleos (en forma de ADN) o aquel material gentico que se encuentra fuera de
nuestros ncleos en forma de ARN.

ADN o DNA es el cido desoxirribonucleico.

El ADN se encuentra en el ncleo formando parte de los cromosomas. Por


tanto, es la molcula portadora de la informacin gentica de un individuo (color
del pelo, estatura, inteligencia, metabolismo o cualquier carcter heredable). Hay
46 cromosomas en el ser humano normal y todos ellos presentan unos 30.000
genes o caracteres heredables.

ARN o RNA es el cido ribonucleico.


El ARN es el segundo cido nuclico y se denomina

cido cido ribonucleico (molcula


cida que contiene un azcar llamado ribosa y que se forma en el ncleo). Estos ARN
salen del ncleo y realizan su funcin dentro del citoplasma de la clula. Sin los ARN no
se pueden fabricar las protenas, son una fbrica de ellas.Concretamente se dirigen a los
ribosomas en donde se van a formar las protenas. En realidad el ADN contiene la
informacin de unos 30.000 genes cada uno de los cuales tiene por funcin formar una
sola protena.

Hay tres tipos de ARN:


El llamado ARN Ribosmico (ARNr) es el responsable de formar los ribosomas (lugares
en donde se forman las protenas).
Los ARN transferentes (ARNt) son aquellos que transportan los aminocidos hacia los
ribosomas.
Por ltimo los ARN mensajeros (ARNm) son aquellos que llevan el mensaje gentico del
ADN (el orden de los aminocidos en una protena) desde el ncleo hasta los ribosomas.
Cuando se leen los mensajeros se forman las protenas correspondientes.
Los cidos nuclicos son en realidad polmeros o unidades repetitivas de unas molculas ms
sencillas llamadas nucletidos. Cada nucletido es la unin de tres molculas an ms sencillas.
La primera molcula es una base nitrogenada que tiene cuatro posibles nombres:
ADENINA, GUANINA, CITOSINA, TIMINA. El URACILO es una base nitrogenada que sustituye
a la Timina en los ADN. La base nitrogenada o desoxirribosa (el azcar) se une al cido fosfrico
(H3PO4). Este enlace se denomina fosfoester. Una persona tiene en cada ADN 3.000 millones de
nucletidos, segn el orden de los nucletidos en el ADN, las caractersticas de unas personas son
diferentes a otras (nadie tiene un orden de nucletidos igual a otros), las molculas del ADN solo se
encuentran en el ncleo de las clulas.
El ADN en realidad son dos cadenas de polinucleotidos que forman la llamada doble hlice.
Adenina siempre se enfrenta a la Timina
Guanina siempre se enfrenta a la Citosina
Finalmente se pueden esquematizar las diferencias entre el ADN y el ARN:
El ADN presenta Timina y el ARN Uracilo
El azcar desoxirribosa en el ADN y ribosa en el ARN
El ADN es doble cadena, pero los ARN son de una cadena (monocadenario).
El ADN es el que almacena la informacin gentica, mientras que los ARN son las molculas
que expresan esa informacin. (FORMAN PROTENAS). Paso de ADN a ARN, paso de ARN a
Protena.

BLOQUE IV:
GENTICA

Gentica
Conceptos bsicos de gentica:
Carcter: Es cualquier rasgo o manifestacin visible en una persona que se puede transmitir a
la siguiente generacin, (el color de la piel, color del pelo, color de los ojos, estatura).
Gen: Es un fragmento de ADN que va a ser responsable de contener un determinado carcter.
Locus: Lugar dnde se encuentra un gen Fenotipo: Es la expresin fsica o visible de un gen. Es casi equivalente al concepto carcter.
Genotipo: Es el conjunto de alelos o genes que tiene un determinado individuo.

Fenotipo= Genotipo + Ambiente


El Genotipo siempre es idntico en una persona, pero el ambiente (los factores ambientales, luz
solar, etc.) puede hacer que se manifieste un fenotipo u otro.
Ejemplo: Una persona que tenga un gen que de piel blanca, puede ser ms o menos morena segn la
cantidad de sol que reciba.
Alelo: Son las posibles alternativas que puede presentar un determinado gen. Por lo general un
gen presenta o suele presentar dos alelos o posibilidades. Uno de ellos se dice que es
dominante y el otro se dice que es recesivo. El alelo dominante se simboliza con una letra
mayscula y el recesivo con una letra minscula. Una persona tiene, para cada carcter un alelo
que ha recibido de la madre y otro que ha recibido del padre.
Homocigoto o raza pura, un individuo homocigoto es aquel que presenta los dos alelos iguales.
AA->homocigoto dominante; aa->homocigoto recesivo
Heterocigoto: O hbrido, es aquel individuo que presenta los dos alelos distintos,
Aa->heterocigoto
En los individuos hbridos el fenotipo que aparece es el del alelo dominante, mientras que el
alelo recesivo no se manifiesta.
Ejemplo: A->ojos asiticos; a->ojos occidentales
Un hombre asitico con una mujer occidental ser Aa por lo tanto tendr los ojos asiticos

Herencia polignica: Es cuando un carcter est determinado por varios genes. Por ejemplo el
color de la piel est determinado por 3 4 genes.

Leyes de Mendel (1859)

1 Ley de Mendel. Ley de la uniformidad ( de la 1 generacin filial) o F1


Cuando se crucen dos razas puras (homocigotos para un carcter, la 1 generacin F1 o los
descendientes de los progenitores), sern todos genotpica y fenotpicamente iguales (tendrn
todos los mismos alelos y tambin el mismo aspecto fsico).
2 Ley de Mendel. Ley de la segregacin independiente de los alelos en un

carcter:

Si tenemos un individuo homocigoto los gametos que puede formar solo son de un tipo, en los
individuos hbridos la mitad de los gametos son alelo dominantes y la otra mitad presentan el
alelo recesivo.

1. Ejercicio:
Mendel descubri que el color amarillo de la semilla de los guisantes es dominante
sobre el color verde. En los siguientes experimentos, plantas con fenotipos
conocidos,

pero

con

genotipos

desconocidos,

dieron

lugar

la

siguiente

descendencia:
i. A->amarillo a->verde
ii. Verde x Verde= 50 verdes, segn la proporcin de los descendientes
indquese los genotipos ms probables de cada progenitor.
iii. Amarilla x Amarilla= 90 Amarillas
iv. Amarilla x Verde= 82 Amarillas + 78 Verdes
v. Amarilla x Verde= 74 Amarillas
vi. Amarilla x Amarilla= 118 Amarillas y 39 Verdes

2. Ejercicio:
En el hombre el color pardo de los ojos A domina sobre el color azul de los ojos a. Una
pareja en la que el hombre tiene los ojos pardos y la mujer ojos azules tienen dos hijos, uno
de ellos con los ojos pardos y el otro de ojos azules. Averiguar: El genotipo del padre y La
probabilidad de que el tercer hijo sea de ojos azules

3. Ejercicio:
Un varn de ojos azules se casa con una mujer de ojos pardos. La madre de la mujer era de
ojos azules, el padre de ojos pardos y tena un hermano de ojos azules. Del matrimonio
naci un hijo con ojos pardos.
Razonar cmo sera el genotipo de todos ellos, sabiendo que el color pardo domina sobre el
color azul.

4. Ejercicio:
El albinismo es un carcter recesivo con respecto a la pigmentacin normal. Cul sera la
descendencia de un hombre albino en los siguientes casos?:
a) Si se casa con una mujer sin antecedentes familiares de albinismo
b) Si se casa con una mujer normal cuya madre era albina

c) Si se casa con una prima hermana de pigmentacin normal, pero cuyos abuelos
comunes eran albinos.

5. Ejercicio:
La Corea de Huntington es una enfermedad rara, mortal, que aparece normalmente a
mediana edad. Se debe a un alelo dominante. Un hombre fenotpicamente normal, de poco
ms de 20 aos, advierte que su padre ha desarrollado la enfermedad.
Cul sera la probabilidad de que ms tarde l mismo desarrolle la enfermedad? Cul es la
probabilidad de que la desarrolle su hijo al cabo del tiempo?

6. Ejercicio:
Al cruzar dos moscas negras se obtiene una descendencia formada por 216 moscas negras
y 72 blancas. Representando por NN el color negro y por el color blanco, raznese:
El cruzamiento y cul sera el fenotipo de las moscas que se cruzan y de la descendencia
obtenida.

Deducir el tipo de herencia


7. Ejercicio:
Se cruzan dos plantas de flores de color de rosa. Se obtiene una descendencia compuesta
por 110 plantas blancas, 111 plantas rojas y 223 plantas rosas.
Deducir el tipo de herencia de que se trata.
En el enunciado se observan 3 fenotipos (Blancas, rojas, rosas). Uno de ellos el rosa parece
que es una mezcla de los dos restantes. Por ello, probablemente, se trata de una herencia
intermedia. En estos casos no hay alelos ni dominantes ni recesivos, por ello, podemos
proponer los siguientes alelos:
Como no domina ningn color se ponen letras maysculas en los tres casos,
AA->color rojo
AA->color blanco
AA->color rosa
8. Ejercicio:
Dos plantas de dondiego (mirabilis jalapa) son homocigotas para el color de las flores. Una
de ellas produce flores de color blanco marfil y la otra, flores rojas.

Seale los genotipos y fenotipos de los dondiegos originados del cruce de ambas plantas,
sabiendo que B es el gen responsable del color marfil y R es el gen que condiciona el color
rojo y que los genes R y B son equipotentes (herencia intermedia).
A partir del enunciado nos dicen que hay herencia intermedia con dos alelos que son
equipotentes, es decir, cuando estn juntos en un hbrido se manifiestan los dos. Por ello
los genotipos posibles son los siguientes:
BB=color marfil; RR=color rojo; BR=color rosa
Por tanto, el cruce entre flores marfiles y rojas es el siguiente:

9. Ejercicio:
El color negro del cuerpo de Drosophila lo produce un alelo recesivo mientras que el color
gris est determinado por el alelo dominante del mismo gen. Se tuvieron 400 moscas en la
F2 del cruzamiento de una mosca de cuerpo gris por otra de cuerpo negro, ambas
homocigticas.
Dense el nmero de moscas que se espera que sean grises, el nmero de negras, el de las
heterocigticas y el de las homocigticas.

3 Ley de Mendel. Ley de la segregacin independiente de dos caracteres distintos:


Cuando tenemos dos genes o caracteres distintos en un mismo individuo, los alelos
correspondientes se combinan aleatoriamente en sus gametos.
El caso ms complejo de todos es el cruce entre dos dihibridos Aa Bb, es decir un individuo
que es heterocigoto para ambos genes.

Los gametos en este caso son los siguientes:


CUADRO DE PUNNET:

AB

Ab

aB

ab

AB

AABB

AABb

AaBB

AaBb

Ab

AABb

AAbb

AaBb

Aabb

aB

AaBB

AaBb

aaBB

aaBb

ab

AaBb

Aabb

aaBb

aabb

Cuando se crucen dos dihibridos las proporciones fenotpicas son de 9:3:3:1. Habr 9 individuos de
16 que sean de fenotipo dominante para los dos genes; habr 3 de 16 que sean dominante para el
primer gen y recesivo para el 2 gen; otros tres al contrario. Y uno de 16 tendr fenotipo recesivo
para el primer y 2 gen.
Fenotipos:
AABB-AABb-AaBB-AaBb-AA-Bb-AABb-AaBb-AaBB-AaBb-AaBb-Aa-BB(los dos dominantes)
Aabb-Aabb-AAbb(dominante primer gen)
aaBB-aaBb-aaBb(dominante segundo gen)
aabb(recesivo los dos genes)
10. Ejercicio:
En las plantas de guisante, el alelo L, que indica semillas lisas, es dominante sobre el alelo l,
que indica semillas rugosas, y el alelo A que indica color amarillo, es dominante sobre el
alelo a que indica color verde. Si se cruza una variedad pura lisa de color amarillo con una
variedad pura rugosa de color verde.
a) Cul es el genotipo y el fenotipo de la primera generacin filial F1?
b) Indicar los fenotipos de la 2 generacin F2 y la proporcin de cada uno de
ellos que resulta de la autofecundacin de las plantas de la F1.

Solucin para el ejercicio anterior:


A partir del enunciado se observan dos caracteres o genes diferentes que presentan
dominancia y recesividad. Se nos proponen los siguientes alelos:
1 carcter->L=semilla lisa-l=semilla rugosa
2 carcter-> A=color amarillo-a=color
verde
Respuesta 7, se cruzara el genotipo que nos ha salido en la F1 LlAa consigo mismo por lo
que tendramos el siguiente cuadro de Punnet.
A partir de la 3 ley de Mendel cuando se cruzan dos dihibridos las proporciones
fenotpicas se ajustan al 9:3:3:1; es decir 9/16 dominantes para el primer carcter y
recesivas para el 2 carcter; 3/16 van a ser recesivos para el primer carcter y dominante
para el 2;1/16 para los caracteres van a ser recesivos.

11. Ejercicio:
El pelo oscuro y el color marrn de los ojos se consideran dominantes sobre el pelo claro y
ojos azules. Un varn de estas caractersticas tiene dos hijos con una mujer de pelo claro y
ojos azules; uno de los hijos tiene pelo claro y ojos marrones, y el otro ojos azules y el pelo
oscuro.
Cul es la probabilidad de que un tercer hijo tenga el pelo claro y los ojos marrones?
Razona la respuesta.

12. Ejercicio:

Dos condiciones anormales en el hombre que son las cataratas y la fragilidad de los huesos
son debidas a alelos dominantes. Un hombre con cataratas y huesos normales cuyo padre
tena ojos normales, se cas con una mujer sin cataratas pero con huesos frgiles, cuyo
padre tena huesos normales. Cul es la probabilidad de?
Tener un hijo completamente normal
Que tenga cataratas y huesos normales
Que tenga ojos normales y huesos frgiles
Que padezca ambas enfermedades

13. Ejercicio:
En el cruce de D. melanogaster de alas curvadas y quetas en forma de maza dihibridas
consigo mismas se obtuvieron 590 con alas curvadas y quetas en maza, 180 con alas
curvadas y quetas normales, 160 con alas normales y quetas en maza y 60 normales para
ambos caracteres.

14. Ejercicio:
Una planta de jardn presenta dos variedades: una de flores rojas y hojas alargadas y otra
de flores blancas y hojas pequeas. El carcter color de las flores sigue una herencia
intermedia, y el carcter tamao de la hoja dominancia del carcter alargado. Si se cruzan
ambas variedades:
Qu proporciones genotpicas y fenotpicas aparecern en la F2?

15. Ejercicio:
Razona la veracidad o falsedad de la siguiente afirmacin:
El color de tipo comn del cuerpo de Drosophila est determinado por el gen dominante N,
su alelo recesivo n produce cuerpo de color negro. Cuando una mosca tipo comn de raza
pura se cruza con otra de cuerpo negro, la fraccin de la 2 generacin que se espera que
sea heterocigota es ?

16. Ejercicio:
Tenemos dos hijos el primero presenta un carcter con alelo dominantes y raza pura, el 2
es de raza pura tambin, perlo con los caracteres recesivos. Qu probabilidad hay de
tener un cuarto de homocigotos dominantes y un cuarto de homocigotos recesivos?.
Qu probabilidad habr de que se tengan dos hijos uno AA y el otro aa, sin que importen
el orden en el que nazcan?

Grupos sanguneos.
A-B son codominantes ninguno es ms fuerte que el otro; O es recesivo
Los grupos sanguneos en la especie humana estn determinados por 3 alelos:
Los alelos A y B son codominantes y ambos son dominantes respecto al O que es recesivo.

17. Ejercicio:
Razone como podrn ser los hijos de un hombre del grupo A, cuya madre era del grupo O y
de una mujer del grupo B, cuyo padre era del grupo O y realiza un esquema del cruzamiento.

Conceptos de repaso:
Herencia polignica:

Es aquel carcter que est determinado por 2 o ms alelos en solo un gen.El caso ms
conocido es el de los grupos sanguneos. El alelo A es codominante junto con el alelo B y
ambos son dominantes sobre el alelo O.

18. Ejercicio:
Indicar si son posibles los siguientes descendientes:
a) Hijo del grupo O de dos padres ambos del grupo AB. Indicar losgrupos sanguneos
posibles:
b) Hijos AB de progenitores de grupo O:
c) Hijos del grupo A sabiendo que su madre es del grupo O con un ascendiente del
grupo AB
d) Hijos del tipo B a partir de un matrimonio cuya madre Ab y el padre del grupo B
sabiendo que los progenitores de este ltimo individuo eran del grupo B. Es posible
y con qu probabilidad?
e) Probabilidades de que salgan hijos de tipo A en un matrimonio donde la madre es A y
sus progenitores son del grupo O y del grupo A el otro. El padre de este hijo es del
grupo Ab.
19. Ejercicio:
Cmo sern los genotipos de un matrimonio en el que el padre es del grupo A y la madre
del grupo B, si su hijo mayor es del grupo O?

Herencia ligada al sexo

Sobre 1930 un cientfico denominado T. Morgan estableci la llamada teora cromosmica


de la herencia. Postulaba que los caracteres o genes de Mendel se encontraban fsicamente
situados en los cromosomas. (Son estructuras en forma de filamentos que se encuentran
dentro del ncleo de las clulas y que bsicamente es ADN). El ser humano tiene 46
cromosomas salvo excepciones como el sndrome de down con 47 cromosomas. Estos 46

cromosomas proceden 23 de origen materno y los otros 23 de nuestro padre. De los 46


cromosomas hay dos que son responsables de determinar el sexo del individuo. Se llaman
cromosomas sexuales y en la mujer se denominan XX. Un hombre presenta X e Y. Los 44
cromosomas restantes no intervienen en la formacin del sexo y se llaman cromosomas
autosmicos o no sexuales.
Cuando dos genes distintos se encuentran situados en el mismo cromosoma se dice que
estn ligados y no cumplen las leyes de Mendel.
Un buen ejemplo de genes ligados son el daltonismo y la hemofilia que son dos
enfermedades recesivas y que estn ligadas al cromosoma X, nunca aparecen en el
cromosoma Y.
20. Ejercicio:
En una especie animal se cruza un macho normal con una hembra portadora de una
enfermedad normal. Indicar los genotipos de los siguientes individuos:
a) Una mujer daltnica tiene dos hijos con un varn normal. Determinar la posible
descendencia:

21. Ejercicio:
Indicar la posible descendencia de un hombre daltnico con una mujer no daltnica, pero
que tena un padre con esta enfermedad.

Alelo dominante: Es el que se manifiesta cuando el individuo es heterocigoto. Ejemplo Grupo


sanguneo A dominante sobre O.
Alelo codominante: Es cuando el individuo es heterocigoto, pero no domina ningn alelo.
Ejemplo Grupo sanguneo A y B.
Alelo recesivo: En el individuo heterocigoto es el gen que no se manifiesta. Ejemplo O ante A
y B en los grupos sanguneos.
Genotipo: Conjunto de alelos que tiene un individuo para cada carcter.

22. Ejercicio:

El color de pelo negro domina sobre el blanco. Al cruzar dos cobayas, uno negro y otra
blanca se obtuvieron unos descendientes de color negro y otros de color blanco. Seala el
genotipo de los padres:

23. Ejercicio:
En la especie humana, el color pardo de los ojos domina sobre el color azul. Un varn de
ojos pardos, cuya madre tena ojos azules, se casa con una mujer de ojos azules. Cul ser
la probabilidad de que su primer hijo tenga ojos azules?
24. Ejercicio:
Determinar los genotipos de una mujer portadora del daltonismo y de un hombre no
daltnico que tena una madre no daltnica y un padre daltnico. Calcular las siguientes
probabilidades:
a)
b)
c)
d)
e)

Que el primer hijo sea varn daltnico.


Que el primer hijo sea mujer normal.
Que los tres primeros hijos sea varones y daltnicos.
Que teniendo dos hijos (macho o hembra) alguno sea daltnico.
Probabilidad de que salga los tres primeros varones daltnicos o que los tres
primeros sean mujeres normales.
f) Probabilidad de tener dos hijos normales sean varones o hembras.

BLOQUE III:
ANATOMA Y FISIOLOGA
HUMANA.

NUTRICIN.

Aparatos que intervienen en la nutricin humana


Conceptos bsicos de anatoma humana.
Tejido: Es un conjunto de clulas iguales en su forma y en su funcin (tejido muscular,
nervioso, epitelial, sanguneo, conjuntivo o conectivo (que une un tejido con otro))
rgano: Es un conjunto de tejidos que se agrupan para hacer una funcin determinada
(CORAZN formado por tejido muscular, tejido sanguneo, tejido nervioso, tejido
epidrmico, tejido conjuntivo) (PIEL formado por los siguientes tejidos epidermis, dermis
(tiene tejido conectivo, nervioso, sanguneo) hipodermis (zona grasa que sirve como
almohadilla y aislante trmico) y msculos)
Aparato: Conjunto de rganos, muy diferentes en aspecto y funcin que se agrupan para
hacer un determinado proceso fisiolgico.
Sistema: Es un conjunto de rganos, muy similares en aspecto y funcin que se agrupan para
hacer un determinado proceso fisiolgico (sistema circulatorio, sistema endocrino
(hormonas), sistema seo, sistema muscular, sistema inmunolgico)

Funciones vitales.
Nutricin
Es la utilizacin de los alimentos para obtener energa o formar parte de nuestros rganos.
Aparatos de esta funcin: Digestivo, respiratorio, circulatorio y excretor.

Aparato digestivo: Es un conjunto de rganos que tienen como funcin digerir y asimilar los
alimentos que tomemos.
Digestin: Es la descomposicin de molculas complejas o grandes (polmeros) en
molculas sencillas (monmeros). Son tres los polmeros o macromolculas.
Polmeros: Protenas que se transforman en el monmero aminocidos. Lpidos que se
transforman en los monmeros cidos grasos. Polisacridos que se transforman tras su
digestin en la monmero glucosa.

Aparato bucal, anatoma y funcin


Presenta los siguientes rganos:
Subaparato bucal
Lengua: rgano musculoso que nos permite degustar los alimentos gracias a sus propias
papilas gustativas (dulce, salado, cido y amargo). Sirve para formar el bolo alimenticio al
presionar los alimentos sobre el paladar. Sirve para la fonacin (el habla).
Glndulas salivales: Segn su localizacin son sublinguales, submaxilares y glndulas
partidas. Su funcin es la lubricacin del bolo alimenticio por su carcter acuoso o viscoso.

Presenta la ptialina o amilasa salival (la enzima que digiere nicamente el almidn en molculas
de glucosa). Adems favorece o incrementa el sabor de los alimentos.
Paladar: Parte superior de la boca que por su carcter rgido permite deformar el bolo
alimenticio antes de deglutirlo.
Dientes: Una hemimandibula presenta la siguiente frmula dental 2:1:2:3=8+4
hemimandibulas es igual a 32 dientes en un adulto. La infantil ser 2:1:2=5*4 es igual a 20
dientes en los nios.
Incisivo, su funcin es cortar; canino su funcin es desgarrar; premolares y molares su
funcin es triturar.
Dentro del subaparato bucal por tanto, en la boca se realizan dos tipos de digestin:
Por un lado, se inicia la digestin qumica del almidn (ruptura de enlace gracias a la
amilasa bucal que hay en el polisacrido almidn), enlace O Glucosdico, liberando glucosas.
Tambin hay una digestin mecnica, es decir, al cortar, triturar cualquier trozo de
alimento este se hace ms pequeo y se va a hacer ms fcil digerible, pero an no cambia
su composicin.
Esfago: Es un tubo de unos 30 cm. Que discurre por el cuello y parte del trax hasta la
parte central del abdomen. Presenta una capa muscular que se contrae involuntariamente al
llegar el bolo alimenticio y produce un movimiento llamado peristltico que permite el
desplazamiento del alimento haca el estomago. En su parte inicial se encuentra la epiglotis o
membrana que tapa la laringe y trquea cuando estamos deglutiendo. En su parte terminal se
encuentra con el cardias o esfnter circular que impide el reflujo del jugo gstrico hacia el
esfago y laringe. Cuando esto ocurre (vmitos), el esfago puede sufrir quemaduras al no
tener mucosa protectora.
Estmago:
Anatoma: Es un rgano en forma de gaita invertida. Empieza en el cardias y termina en un
esfnter o vlvula musculosa llamada ploro.

Sus paredes internas son rugosas para incrementar la superficie digestiva. Presenta
una capa mucosa (mucus o moco gstrico) que tiene funcin protectora frente al cido
clorhdrico extremadamente cido (H Cl). El estmago tiene como funcin:

Produccin de cido clorhdrico que tiene efecto germicida (mata a los microbios).
Activa a enzimas inactivas del jugo gstrico, adems ataca por s mismo a los enlaces
peptdicos (propios de las protenas).

La segunda funcin del estmago es el inicio de la digestin de las protenas. Los


alimentos ricos en carne y pescado son ricos en protenas y se digieren parcialmente
en el estmago gracias a proteasas como la pepsina.

Tambin hay una digestin mecnica en el estmago gracias a los intensos movimientos
peristlticos del estmago. Las digestiones ms pesadas suelen durar 2 horas y el
producto final es un lquido llamado quimo o papilla nutritiva. Cuando el mucus gstrico
del estmago se deteriora por el estrs, etc. Puede formarse una lcera gstrica por
el efecto del cido clorhdrico.

Intestino delgado: Siguiente rgano situado despus del estmago y comunicado con este
por el ploro o esfnter pilrico. En su parte opuesta, se encuentra el esfnter liocecal que
viene de leon y cecal que significa ciego que comunica con el intestino grueso. Es un tubo de
unos 6 o 7 metros de longitud y unos 5,7 cm de grosor. Presenta tres zonas (duodeno, yeyuno
e leon).
Presenta una importante funcin digestiva y asimilativa o de absorcin de alimentos.
Cuando el quimo del estmago pasa a este rgano durante unas doce horas se digieren
todas las protenas, almidn y lpidos que estn sin digerir. Tambin se absorben casi
todos los monmeros sencillos (glucosas, cidos grasos y glicerinas, aminocidos, sales
minerales, vitaminas y gran parte del agua). Al final el quimo o papilla nutritiva se ha
transformado en el quilo o lquido sin nutrientes.
La superficie del intestino delgado no es lisa sino que presenta las denominadas
vellosidades intestinales que son repliegues de la pared, en forma de dedos que aumentan
20 veces la superficie del intestino. Dentro de ellas se encuentran capilares sanguneos y
vasos linfticos responsable de la absorcin de los nutrientes. En los vasos linfticos y
quilferos se absorben los cidos grasos y la glicerina resultante de la digestin de lpidos.
Por los capilares se absorben el resto de los nutrientes. El movimiento del quimo se
facilita por los movimientos peristlticos.
La digestin de este rgano se debe a tres jugos digestivos denominados:

Jugo pancretico: Lquido digestivo formado en el pncreas, glndula aneja, (prxima


a) en forma de hoja y situada debajo del estmago que forma el jugo pancretico
que contiene todas las enzimas digestivas de tipo proteasas, lipasas y amilasas.
Tambin contiene bicarbonato que neutraliza la fuerte acidez del quimo. Sin
bicarbonato el jugo pancretico no puede actuar. Este jugo se vierte al duodeno
(primer tramo de 30 cm. En forma curvada)

Bilis o jugo biliar: Es un lquido oscuro y de sabor amargo, presenta sales biliares
(son derivados del colesterol que tienen carcter jabonoso, es decir, capaces de
emulsionar o disolver las grasas en agua). Sin la bilis las grasas no se podran digerir
en cidos grasos o glicerina. La bilis tambin contiene bilirrubina que es la hemoglobina
de los glbulos rojos descompuesta para ser eliminada, tiene un color marrn que da el
color de las heces.

El jugo intestinal: A lo largo de los 6 metros de intestino delgado se segregan unos 5


litros de jugo intestinal que contiene proteasas, lipasas y amilasas que completan la
accin del jugo pancretico.

La digestin ocurre preferentemente en el yeyuno y la absorcin en el leon.


Intestino grueso: Tubo de un metro y medio de longitud y unos 12 a 15 cm. De grosor. Su
funcin nica es la formacin de heces y por tanto solo se absorben gran cantidad de agua,
algunas sales minerales y algunas vitaminas como la K que se forman por la flora intestinal
autctona (bacterias no patgenas que viven en nuestro intestino). Presenta una llamada diego
del que parte una apndice que puede inflamarse (apendicitis).

Aparato respiratorio, anatoma y fisiologa


Tenemos dos aparatos:
1. Vas respiratorias superiores, constan de unas fosas nasales situadas detrs del pabelln
nasal. Contiene en su interior los repliegues internos de las fosas (cornetes), su funcin es
humedecer, calentar y filtrar el aire que les llegue. En su interior tiene muchos vasos
sanguneos que aporta calor y humedad procedente de la sangre. Conectados a las fosas
nasales hay varios huecos o senos que segregan abundante mucosidad, (seno frontal, seno
esfenoidal, seno maxilar). Gracias a esta mucosidad se retiene gran parte del polvo y de
los microbios que llegan a estas fosas nasales. En su parte posterior se encuentra la
nasofaringe que comunica con la cavidad bucal u orofaringe. Este conducto se cierra,
cuando hay un vomito por la vula o campanilla. Debajo de la orofaringe se encuentra la
hipofaringe que enseguida se bifurca en esfago (posterior) o laringe (anterior).
2. Vas respiratorias inferiores, comienza con la trquea que est cubierta por otro
cartlago (epiglotis) que se cierra nicamente cuando comemos o bebemos. La laringe
presenta las cuerdas vocales que permite la produccin de sonidos. La laringe est
protegida por el primer cartlago traqueal que est muy desarrollado (tiroides) su funcin
es proteger de golpes a la laringe y la de hacer de caja de resonancia. Son dos
rectngulos con cierto ngulo entre ellos. En los varones es un ngulo recto y en la mujer
es de 120 y es menos pronunciado, los tonos agudos son propios de mujeres y los graves
de hombres. Los dems anillos traqueales suelen tener el mismo dimetro y se introducen
en el mediastino o espacio entre los dos pulmones. La naturaleza de la trquea es
cartilaginosa (dura y flexible). Este conducto se ramifica en dos bronquios principales y
estos a su vez en bronquios secundarios, puede haber hasta ms de 20 niveles o
ramificaciones. Estos cada vez son menos rgidos, pero nunca se pueden dilatar o
contraer. Le siguen los bronquiolos que presentan una capa muscular que permite abrir o
cerrar dichos bronquiolos (broncoconstruccin-> cierre de los bronquios,
broncodilatacin-> dilata los bronquios). Al final de estos se encuentran numerosos sacos
alveolares, cada uno de los cuales tiene una decena aproximadamente de alveolos
pulmonares. Hay unos 300 millones de alveolos que estn rodeados por capilares
sanguneos en ellos que realiza el intercambio gaseoso, entra oxgeno de los alveolos a la
sangre procedente de la arteria pulmonar y pasa dixido de carbono de la sangre a los
alveolos pulmonares. Una persona normal puede inspirar hasta 6 litros de aire en una
inspiracin forzada. En condiciones normales apenas respira un litro y medio y siempre
hay un aire residual que no entra ni sale de los pulmones. Los movimientos respiratorios de
los dos lbulos pulmonares tiene por objeto comprimir y distender a los sacos alveolares
para conseguir la renovacin del aire que hay en un saco alveolar.
La ventilacin pulmonar normal es de 12 a 18 respiraciones por minutos (en adultos). Se denomina
hiperventilacin o taquipnea a un ritmo superior a 20 respiraciones por minuto. La
hiperventilacin permite aumentar los niveles de oxgeno, pero si se mantiene reduce demasiado
los niveles de dixido de carbono en sangre y esto produce alcalosis (sangre muy alcalina o
bsica).

Ritmo respiratorio:
Los msculos respiratorios son los msculos intercostales y especialmente el diafragma. Dichos
msculos estn pegados a las pleuras o cupas externas del pulmn y cuando hay una inspiracin
(entrada de aire nuevo) estos msculos se contraen, el diafragma se aplana y la caja torcica se
expande tirando de las pleuras u succionando aire hacia los pulmones. Por el contrario, en la
espiracin o salida de aire, el diafragma se relaja (adquiere aspecto curvado) y los msculos
intercostales tambin se relajan. La caja torcica tambin se reduce en volumen y los pulmones
se comprimen y expulsan el aire.
El ritmo respiratorio se controla en el bulbo raqudeo (ensanchamiento de la mdula espinal justo
antes de entrar al cerebro muy cerca de la nuca). En dicho bulbo se encuentra el centro
respiratorio que es el que realmente activa o inhibe la respiracin, dicho centro respiratorio se
puede controlar por dos factores:

Control nervioso o voluntario. En estados de nerviosismo, miedo, ansiedad, el cerebro


manda seales al centro respiratorio y este aumenta nuestra respiracin (taquipnea o
hiperventilacin). Por el contrario en estados de relajacin el ritmo cardiaco se reduce y
puede ser muy bajo (bradipnea o hipoventilacin).

Control por niveles de dixido de carbono sanguneo. En nuestros vasos sanguneos hay
quimioreceptores (clulas sensibles a sustancias qumicas). Algunas son sensibles al
dixido de carbono y cuando los niveles de este gas se eleva mucho en sangre (ejercicio
intenso, buceo) activan el centro respiratorio y este nuestra respiracin pulmonar. Hay
casos como en la hiperventilacin en estado de nerviosismo que reducen mucho los niveles
de CO2 en sangre y cuando falta dicho gas el PH sanguneo se eleva demasiado. Se produce
una alcalosis que conlleva vmitos, malestar, temblores y prdida de conocimiento, la
solucin es respirar en una bolsa de plstico.

El oxgeno pasa de los alveolos pulmonares a los glbulos rojos donde est la hemoglobina al
mismo tiempo el dixido de carbono viaja en el plasma sanguneo hacia los alveolos pulmonares.

Es un conjunto de rganos (corazn, arterias, venas capilares) que son muy parecidos en su
anatoma y en su funcin o fisiologa puesto que estn destinados a hacer el transporte de
sangre, que circule sangre por ellos.
Las arterias se definen como vasos sanguneos que parten o salen siempre del corazn hacia
otros rganos. Adems presenta una gruesa capa muscular (tnicas) que permite su
vasodilatacin o vaso constriccin.
Las venas llevan sangre al corazn, pero no se pueden contraer ni dilatar puesto que sus tnicas
son muy delgadas.
Los capilares son vasos microscpicos que solo tienen una capa de tejido epitelial (endotelio).
Dicha capa es muy fina que permite el intercambio de sustancias entre la sangre y los rganos en
donde se encuentre.

Adems, las venas presentan vlvulas (en forma de nidos de golondrina) que impiden el retroceso
de la sangre. Si la sangre se estanca por falta de movimiento muscular se producen las varices.

La circulacin sangunea
En el ser humano hay dos circulaciones o circuitos sanguneos:
a) Circulacin menor o pulmonar. Tiene por objeto oxigenar la sangre en los pulmones y
devolverla al corazn para que sea utilizado por el cuerpo. (corazn, pulmn, corazn). La
sangre pobre en oxgeno sale del ventrculo derecho, pasa a la arteria pulmonar (izquierda
y derecha), se oxigena en los alveolos pulmonares y vuelve al corazn por las venas
pulmonares con sangre rica en oxgeno. Entra a la aurcula izquierda y a travs de la
vlvula mitral o bicspide esta sangre pasa al ventrculo izquierdo.
b) Circulacin mayor o sistmica. Parte la sangre rica en oxgeno izquierdo del ventrculo
izquierdo por una sstole ventricular, pasa por las vlvulas semilunares aorticas y sale del
corazn por la arteria aorta. Esta enseguida se ramifica en arterias ms pequeas que van
a oxigenar a todos los rganos de nuestro cuerpo. La primera ramificacin de la aorta so
las arterias coronarias que rodean y oxigenan al corazn. Si se obstruyen las coronarias,
el corazn no se oxigena y se producen paros cardiacos o infartos de miocardio. Las
arterias que salen de la aorta oxigenan los diferentes rganos del cuerpo. Primero se
ramifican en arteriolas (arterias pequeas) y finalmente en capilares sanguneos que es
donde se intercambian gases, nutrientes y los desechos, etc. A partir de los capilares se
van formando vnulas (pequeas venas) y venas mayores que salen de los rganos con
sangre pobre en oxgeno y se unen finalmente en la vena cava inferior (recoge toda la
sangre venosa del tronco y de las extremidades). Y la vena cava superior (recoge la sangre
sin oxgeno de brazos, cuello y cabeza). Las dos venas llegan a la aurcula derecha y a
travs de la vlvula tricspide pasa al ventrculo derecho para iniciar la circulacin menor
o pulmonar.
Arterias ms importantes:
1. Arteria aorta, sale del ventrculo izquierdo con sangre rica en oxgeno y nutrientes
hacia todos los rganos del cuerpo (cerebro, hgado, extremidades, etc.)
2. Arterias coronarias, primera ramificacin de la aorta que oxigena al corazn. Cuando
se obstruye se producen infartos de miocardio o paradas cardiacas. La arteria
cartida izquierda oxigena la parte izquierda de nuestra cabeza.
La arteria subclavia izquierda oxigena el brazo izquierdo. La arteria braquioceflica es una
arteria con sangre oxigenada que enseguida se bifurca en la arteria subclavia derecha
(oxigena el brazo derecho) y la arteria cartida derecha (oxigena la parte derecha de la
cabeza).
3. Arteria renal, ramificacin de la arteria aorta torcica que entra a los riones
(derecha e izquierda).
4. Arterias mesentricas, bifurcacin de la aorta abdominal que se dirige al aparato
digestivo.
5. Arterias gonadales, son las que entran procedentes de la aorta abdominal, a los
ovarios o testculos.
6. Arterias ilacas, son las que se dirigen a nuestras piernas (izquierda o derecha).

7. Arteria femoral, es la continuacin de la ilaca. Al llegar a la rodilla se ramifica en


popltea, en la tibiar y la arteria peritoneal.
8. Arteria axilar, es la continuacin de la subclavia, oxigena al hombro y las axilas.
9. Arteria braquial, es la que oxigena todo el brazo. Al llegar al codo se ramifica en la
arteria radial y la arteria cubital. La arteria radial y braquial son dos zonas de toma de
tensin sangunea.
10. Arteria cartida, sale de la subclavia derecha o del cayado artico y se dirige hacia la
cabeza pasando `por el cuello, es un punto de toma de pulso sanguneo. En las venas no
hay pulso sanguneo.
11. Arteria basilar, est en la zona de la nuca, oxigena al bulbo raqudeo. Pasa por las
vlvulas semilunares aorticas y sale del corazn por la arteria aorta.
Venas ms importante:
1. Venas pulmonares, son cuatro venas dos izquierdas y dos derechas que provienen de
los pulmones izquierdo y derecho. Llevan sangre rica en oxigeno y entran a la aurcula
izquierda. Las otras dos venas que entran al corazn se llaman venas cavas, son la
superior y la inferior que recogen la sangre del tronco y de la zona ceflica de la cava
superior.
2. Vena safena interna o mayor (magna), recorre toda la pierna desde los pies hasta
las ingles. Es la que suele ensancharse y formar varices. Puede ser eliminada
fcilmente o utilizada para by-pass. Vena safena menor o interna, vena popltea, vena
femoral llega a la zona de las caderas hasta la vena ilaca, las venas ilacas interna y
externa se juntan en la vena cava inferior.
3. Vena renal, tambin desemboca en la vena cava inferior junto con las venas gonadales.
4.

Hay una vena llamada porta que es la que sale del aparato digestivo rica en nutrientes
pero pobre en oxgeno. Se dirige hacia el hgado y all su sangre se purifica de posibles
toxinas y microbios (esta es la nica vena inferior que no llega a la vena cava inferior)

5. Vena heptica, es la que sale del hgado con sangre purificada en este rgano y
desemboca en la vena cava inferior.
6. Venas del arco venoso metacarpiano (venas de la mano). Suben al antebrazo y brazo
por la vena ceflica.
7. Vena ceflica, recoge toda la sangre de la mano y la sube por el antebrazo, el brazo y
desemboca en la subclavia derecha o izquierda.
8. Vena cubital media, situada en la parte central del codo que se utiliza para extraer
sangre y se contina por el brazo por la vena baslica (tambin utilizada para la
venopuccin). Esta ltima desemboca en la vena subclavia izquierda o derecha y
termina en la vena cava superior que desemboca en la aurcula derecha.
9. Vena yugular, recoge la sangre de toda la cabeza. Pasa por el cuello y alcanza la
subclavia derecha o izquierda.

La sangre
La sangre es un tejido que contiene clulas sanguneas (eritrocitos; leucocitos; plaquetas o
trombocitos) y tambin la otra mitad de la sangre es un lquido llamado plasma sanguneo de
color amarillento que contiene sales minerales, nutrientes, el CO2 producto de nuestra
respiracin y cualquier producto de desecho. Tenemos cinco litros de sangre que recorre
todo el circuito sanguneo en un minuto ms o menos, por tanto la sangre tiene funciones de
transporte de nutrientes, gases respiratorios, productos de desecho, hormonas que regulan
nuestro comportamiento (insulina, hormonas sexuales, hormonas del estrs) y tambin tiene
una funcin defensiva e inmunolgica (evita las infecciones en nuestro cuerpo). Finalmente
tambin tiene un efecto termorregulador (lleva el calor del interior de nuestro cuerpo a la
piel para refrigerarnos).
Valores normales en un anlisis de sangre:

Hemates, valor medio en mujeres 45 millones de glbulos rojos (45.106/mm3). En los


hombres 5.10 6/mm3.Si son muy bajos estos valores se habla de anemia (palidez,
cansancio, desvanecimiento y malestar general). Las causas ms habituales en la falta
de hierro (anemia ferropnica) o falta de vitamina B12 (anemia megaloblstica).

Leucocitos, 10.000 glbulos blancos/mm3, generalmente los valores aumentan hasta


15.000 cuando estamos con una enfermedad infecciosa (gripe, bronquitis, etc.), debido
a que se multiplican para combatir la infeccin. Unos glbulos blancos producen
anticuerpos en el plasma sanguneo que reconocen a los grmenes y los destruyen.
Valores muy por debajo de 10.000 indican un estado de inmunodeficiencia
generalmente por falta de vitaminas.

Plaquetas, 200.000 trombocitos/mm3. Valores bajos de estos fragmentos celulares


producen hemorragias o dificultad en la coagulacin de la sangre ya que las plaquetas
se unen y taponan un vaso que est roto. La hemofilia es una enfermedad en donde la
sangre no coagula o cicatriza debido a unas protenas sanguneas (factores de
coagulacin) que ayudan a las plaquetas a formar el trombo o tapn.

Glucosa, tiene unos valores mximos de 120 mg/100ml. Valores altos se denominan
hiperglucemia y son tpicos de los diabticos. La solucin es la administracin de
insulina a hormonas que les falta a estos enfermos. Si no se trata la hiperglucemia se
produce cegueras, hemorragias en rodillas o infartos de miocardios. La hipoglucemia
son niveles muy bajos de azcar en sangre y generalmente conducen a una baja presin
sangunea con desmayos, desvanecimientos, lipotimias, etc.

Triglicridos, inferior a 150mg/100ml. Valores prolongados de estas grasas producen


problemas circulatorios (infartos de miocardio, cerebrales, hemorragias e isquemia,
hipertensin arterial, arterosclerosis que es un endurecimiento de las arterias). Las
comidas ricas en sangres animales y vegetales elevan rpidamente los triglicridos
sanguneos, sin embargo, al cabo de ocho horas de ayunas debera bajar por debajo de
estas cifras. Si no lo hace el posible problema ser al arterioesclerosis
(endurecimiento de nuestras arterias), hipertensin arterial y finalmente infartos
(infartos de miocardio, infartos cerebrales o ictus, infartos pulmonares, infartos
renales).

Colesterol, es un tipo de grasa absolutamente insoluble en nuestra sangre. No debe


superar 200 mg/100ml de sangre, cuando se mantienen los niveles altos de colesterol
durante aos, la arterioesclerosis es muy probable. El colesterol suele depositarse en
las arterias impidiendo la circulacin sangunea y produciendo sntomas idnticos a la

arterioesclerosis. Sin embargo, como la causa es distinta a este depsito de colesterol


masivo se le llama ateroesclerosis (deposito de colesterol). Trombosis es la formacin
de unos cogulos de sangre producidos por el colesterol.
HDL-> colesterol bueno>50mg/100ml sangre
LDL->colesterol malo> 150mg/100ml sangre
El ejercicio sube las HDL y baja las LDL.

cido rico, <7mg/100ml. Sus niveles muy elevados producen gota (dolores punzantes
en los dedos del pie que le imposibilita andar). Se debe al consumo excesivo de
protenas (carnes rojas, marisco).

Excrecin: Es la eliminacin de productos de desecho que se han producido en nuestros rganos


(metabolismo celular). No se debe confundir con la egestin (expulsin de heces) por el aparato
digestivo. La orina contiene muchas sustancias txicas como la urea, restos de medicamentos,
drogas como el alcohol, sales minerales como las del calcio, etc. Tambin tiene una segunda
funcin que es la de controlar la volemia (volumen constante de sangre en nuestro cuerpo (cinco
litros).
Presenta cuatro rganos:
a) Dos riones: Destinados a la filtracin de nuestra sangre (arteria renal con sangre sucia y
vena renal que sale con sangre filtrada limpia).
b) Urteres: Son dos conductos que transportan la orina desde los riones a la vejiga
urinaria.
c) Vejiga urinaria: rgano globoso y musculoso que se puede dilatar para retener 500 cm3
de orina.
d) Uretra: Es el conducto por donde sale la orina al exterior. Tiene diferente longitud en
hombres y mujeres. En el hombre forma parte del aparato reproductor y en la mujer es
independiente con su aparato reproductor.
La unidad filtradora de un rin son las nefronas microscpicas.
La corteza renal (3,4 mm de la superficie del rin) se encuentra una zona de la nefrona
llamado glomrulo de Malpigio, que est constituido por un montn de capilares
sanguneos en forma de ovillo por donde la sangre circula a enorme presin. En este
glomrulo sale el plasma sanguneo (sangre sin clulas) y es recogido por una estructura en
forma de copa llamada cpsula de Bowman. A continuacin, el plasma sanguneo es
recogido por un tubo de la nefrona llamado tbulo contorneado proximal. Dicho tbulo
est rodeado por numerosos capilares sanguneos que van a reabsorber las sustancias
nutritivas que no se deben perder por la orina (glucosa, aminocidos, sales minerales y
agua). Al final de este tbulo el plasma se ha transformado en una orina an ms acuosa o
diluida, pero que presenta todas las sustancias txicas que deben ser eliminadas. Este
tbulo desciende hacia la mdula renal (zona central del rin) por un tubo en forma de U
o asa denominada asa de Henle. ste asa est rodeada por capilares que recuperan sales
minerales segn sea la necesidad del cuerpo. Al final del asa la orina est prcticamente
formada. Tubo contorneado distal, la orina que llega a esta zona est prcticamente
formada (no tiene ninguna sustancia interesante que podramos perder), pero a esta zona
le llegan a travs de la sangre dos hormonas que completan la concentracin final de la
orina. La ms importante se llama vasopresina u hormona antidiurtica (ADH), dicha
hormona se forma en la hipfisis (glndula situada en la base del cerebro), esta hormona
se produce cuando hay baja presin sangunea por escaso volumen de sangre. Existen en el
cayado artico y en la arteria cartida los baroreceptores (receptores sensibles a la
presin sangunea). Cuando la presin sangunea es baja (sudoracin excesiva, hemorragias
abundantes, sed prolongada, estos receptores mandan una seal a la hipfisis y esta
forma ADH. Pasa a la sangre y acta sobre el tbulo contorneado distal reabsorbiendo
agua de la orina hacia los capilares y de esta forma aumenta el volumen de sangre en
nuestro cuerpo (volemia). Tambin la aldosterona es otra hormona que acta sobre el
tbulo contorneado distal. Su accin es reabsorber sales de la orina hacia los capilares
sanguneos. Tambin se liberan cuando la presin sangunea es baja, pero su formacin
est en las cpsulas suprarrenales. Tbulo conector, es la parte final de la nefrona y se
encuentra en la mdula renal. Es muy gruesa y se localiza en las denominadas pirmides
renales constantemente gotea orina a la cavidad hueca del rin denominada clices
renales.

La orina continua por la pelvis renal o embudo situado en la parte central de cada rin. El
siguiente rgano es el urter (derecho o izquierdo) que desemboca en la vejiga urinaria. La
vejiga recibe la orina de los urteres. Es un rgano musculoso y dilatable que puede
almacenar hasta 500 cm3 de orina. Est comunicado con la uretra, pero presenta dos
esfnteres (vesicales). El interno est a la salida de la vejiga y no tiene control voluntario. El
externo, situado a pocos centmetros del anterior si tiene control voluntario aunque en
condiciones de miedo extremo el sistema nervioso simptico (sistema de alerta) puede
relajarlo y producir una miccin involuntaria.
La uretra es el conducto de salida de la orina y que tiene diferente longitud en hombres y
mujeres.

Anomalas en el aparato excretor

Cistitis: Todas las palabras en medicina que acaban en itis significa inflamacin, la cistitis
por lo tanto es una infeccin en la vejiga urinaria sobre todo se da en mujeres.
Clico nefrtico: Acumulacin por piedras o clculos en el rin.
Insuficiencia renal: No funciona ningn rin. La solucin definitiva es un trasplante y si no la
dilisis.
Diabetes inspida: Es la ausencia de vasopresina o de ADH (hormona antidiurtica) se
caracteriza por poliurea (mucha orina ms de tres litros al da). No se debe confundir con la
diabetes sacarina (presencia de glucosa en la orina) que se debe a la falta de la hormona de
la insulina.

BLOQUE III:
ANATOMA Y FISIOLOGA
HUMANA.
RELACIN ( S. NERVIOSO).

Sistema nervioso
Conjunto de rganos (encfalo, mdula espinal, nervios) encargados de recibir estmulos (luz,
sabores, sonidos, olores, tacto)y elaborar una respuesta adecuada en nuestros msculos o
glndulas.
El sistema nervioso consta de clulas especializadas llamadas NEURONAS que estn formadas
por:
a) Dendritas, largas y ramificadas prolongaciones que suelen rodear el centro de la clula.
Reciben los estmulos nerviosos de otras neuronas vecinas.
b) Neurosoma o cuerpo neuronal, contiene el ncleo de la clula y es donde se interpreta la
seal que viene de las dendritas.
c) Axn, larga prolongacin del neurosoma que transmite la respuesta que ha sido formada.
d) Mielina o clula de Schwann, son clulas de aspecto blanquecino que rodean el axn de la
neurona. Cuando estn presentes permiten que el impulso nervioso viaje a gran velocidad.
Cuando estas clulas se aproximan unas a otras dan una tonalidad blanquecina a nuestro

sistema nervioso (sustancia blanca). La sustancia gris es la tonalidad que presenta el


sistema nervioso cuando se acumulan muchos cuerpos neuronales. La corteza cerebral es
la parte ms externa del encfalo (2cm de grosor) y se llama sustancia gris. La parte
central del cerebro apenas tiene sustancia gris y son sustancia blanca o zona de
transmisin de la informacin nerviosa.
e) Botn sinptico: Es el extremo final del axn, se abulta, se ensancha y en su interior
presenta neurotransmisores que al salir del botn sinptico activan o inhiben las neuronas
vecinas. Se llaman sinapsis al hueco que existe entre el botn sinptico y la dendrita
prxima.
Acompaando a las neuronas se encuentran las clulas gliales que nutren y limpian a las
neuronas constantemente.

Sistema nervioso central-Encfalo

(SNC), consta de dos hemisferios cada uno de los cuales presenta protuberancias o salientes ms
o menos visibles (lbulos). Son cuatro zonas con diferentes funciones:
a) Cerebro, la zona ms voluminosa del encfalo con dos grandes surcos o cisuras (cisura de
Silvio y cisura de Rolando), que lo dividen en cuatro lbulos. El lbulo frontal se encuentra
detrs del hueso frontal, es la zona responsable de la inteligencia, de la personalidad, del
razonamiento, de la memoria a corto plazo. El lbulo temporal (situado detrs del hueso
temporal) es el encargado de recibir los sonidos, el gusto, el olfato, el equilibrio y tambin
la memoria a largo plazo. Lbulo parietal (situado detrs de este hueso) presenta la zona
sensitiva responsable del tacto, del dolor y de la zona motora responsable de los
movimientos voluntarios. Lbulo occipital, situado en la zona de la nuca responsable de la
interpretacin de las imgenes.
b) Cerebelo, es una estructura en forma triangular situada debajo del lbulo occipital. A l
entran numerosas fibras nerviosas (sustancia blanca) que tienen forma de rbol
denominado rbol de la vida. Esta zona es la encargada de coordinar los movimientos
repetitivos (andar, nadar, montar en bici, hablar, escribir, etc.).
c) Bulbo raqudeo, es la zona que conecta la mdula espinal con el resto del encfalo. Es un
ensanchamiento de la mdula especialmente en la zona basal del encfalo. Tiene localizado
en l el centro respiratorio y el latido cardiaco, por ello es responsable de que nuestra
respiracin y nuestro corazn aumente o disminuya su frecuencia. Tambin en esta zona
se encuentran los doce pares de nervios faciales responsables del tacto, de la movilidad
de la lengua, la deglucin y de todas las sensaciones tctiles de la cara.
d) Tlamo o tronco cerebral, est situado en la zona o base interna del encfalo, es el
responsable del comportamiento instintivo de cada especie. Tambin se localiza la sed, el
hambre, la vigilia, el sueo, el comportamiento sexual y los estados de alegra o tristeza,
las preferencias alimenticias. En la base del tlamo se encuentran la zona de regulacin
endocrina u hormonal denominada hipotlamos o hipfisis. Estas dos zonas endocrinas u
hormonales son las que activan o inhiben el resto de las glndulas endocrinas distribuidas
por el cuerpo (tiroides, las cpsulas suprarrenales, las gnadas masculinas y femeninas el
pncreas).

Sistema nervioso perifrico o somtico (voluntario raqudeo)

A los nervios que salen de la columna de la mdula espinal se llaman nervios raqudeos o
sistema nervioso perifrico (SNP). Estos nervios son nervios sensitivos que recogen estmulos
tctiles o mecnicos de la piel y tambin hay nervios motores que producen respuestas de
movimientos voluntarios. Segn la posicin se distinguen nervios cervicales, dorsales,
lumbares y sacros.

Sistema nervioso autnomo o visceral

Es el conjunto de nervios que van a activar o inhibir la funcin de los rganos bsicos del
funcionamiento de nuestro cuerpo (sistema circulatorio, aparato respiratorio, aparato
digestivo, y excretor).
Se diferencian en dos sistemas:
a) Sistema nervioso simptico o de alerta, se activa cuando estamos en situaciones de
nerviosismo, actividad fsica y concentracin cerebral. Por ello activa casi todas las
funciones vitales menos la digestiva y la excretora. Activa el latido cardiaco, aumenta la
frecuencia respiratoria, la hormona del estrs o cortisol (cpsulas suprarrenales) se
libera y nuestra pupila se dilata.
b) Sistema nervioso parasimptico, tambin se denomina de relajacin o recuperacin de
esfuerzos. Se activa despus de un estado de alerta o estrs prolongado y se anulan las
funciones del simptico. Por ello las funciones de recuperacin de energa o limpieza de
desecho estn activadas.

Actos reflejos

Un acto reflejo es un movimiento rpido o involuntario que tiene su base en la mdula espinal
o en los ganglios cerebrales situados en el tlamo.
A veces se denomina arcos reflejos a estos actos por la predisposicin semicircular de las
neuronas implicadas. Este movimiento comienza con una neurona sensitiva que recibe
sensaciones tctiles, trmicas, pticas, olfativas, etc que transmite el estmulo a la mdula o
ganglio cerebral. En la sustancia gris de estas zonas se produce la conexin o sinapsis con una
segunda neurona denominada motora que produce una respuesta, generalmente la contraccin
de un msculo que conlleva el acto reflejo correspondiente. Tambin en la sustancia gris
existen neuronas intercalares que reciben el impulso nervioso de las sustancias sensitivas y lo
transmiten al encfalo para que este identifique el estmulo que se est recibiendo. Hay un
retraso y por ello la persona se da cuenta del estmulo despus de producirse el acto reflejo.
Los reflejos ms frecuentes son el reflejo del pinchazo, reflejo rotulario, reflejo palpar o el
reflejo salivar.

Receptores u rganos sensitivos

Globo ocular.
Consta de las siguientes partes:
Esclertica: Capa externa, rgida y blanquecina que da forma al globo ocular. Por su parte
anterior se contina con la cornea que se hace transparente y se curva con el fin de
concentrar los rayos luminosos que le llegue, acta como una lente ptica. En sus zonas
prximas al iris, est recubierta por una capa transparente y mucosa que se denomina
conjuntiva; al estar vascularizada, se puede inflamar por agentes qumicos o infecciones y
producir conjuntivitis.
La coroides: Capa intermedia del globo ocular sumamente vascularizada para poder nutrir
y oxigenar a las dos capas prximas (esclertica y retina)
La retina: Capa interna del globo ocular, que est pegada a la coroides gracias al humor
vtreo o lquido del globo ocular. Presenta en toda su superficie fotorreceptores o clulas
especializadas en captar la luz. Hay dos tipos de clulas los conos (de aspecto triangular)
captan los colores de la luz. Los bastones (clulas alargadas) captan las imgenes en
blanco y negro. A mayor nmero de bastones ms agudeza visual. Hay una zona

especialmente rica en fotorreceptores se sita por encima del nervio ptico y se


denomina fvea. Es la zona de mayor agudeza visual en el ojo. Por el contrario el llamado
punto ciego es la zona de la retina que se curva hacia el nervio ptico y es la zona incapaz
de percibir o captar imgenes. La retina, en su parte posterior termina formando el
nervio ptico que se dirige hacia la zona del lbulo occipital para que las imgenes sean
interpretadas.
El cristalino: Es una estructura ovaidal de naturaleza proteica, elstica y transparente.
Se puede deformar alargndose (visin de lejos) o achatarse (visin de cerca). Los
responsables de esta deformacin son los msculos ciliares que en realidad son una
prolongacin de la coroides. Asociado a estos msculos se encuentra el msculo del iris
que presenta una zona de crculo y que est perforada en su zona central (pupila). Este
msculo presenta diferentes coloraciones que dan las tonalidades al ojo.
Humor acuoso: Es un lquido situado en la cmara anterior del ojo entre el cristalino y la
cornea. Es un lquido en constante renovacin ya que se forma en el cuerpo ciliar situado
en la base del iris. Su funcin es contribuir a la concentracin de los rayos luminosos que
pasan por la cornea.

El Odo.

Cconsta de las siguientes partes:


Odo externo: Es la parte inicial del odo que capta las seales acsticas. Presenta un
pabelln auditivo de naturaleza cartilaginosa que conduce el sonido hacia el canal auditivo
externo de unos 2 a 3 centmetros de longitud. Sus paredes segregan el cerumen o cera
que retiene polvo y microorganismos. En su parte final se encuentra el tmpano o
membrana circular semitransparente y vibrtil que se activa cuando llega una onda
acstica.
Odo medio: Se encuentra dentro del hueso temporal. Comienza justo despus de la
membrana timpnica y presenta una cavidad central en donde se encuentra una cadena
de huesecillos (martillo, yunque y estribo). En su parte posterior se contina por una
conducto llamado trompa de Eustaquio por donde se alivia la tensin de las ondas
acsticas que se dirigen hacia la faringe. El tmpano al moverse activa la cadena de
huesecillos y el estribo termina impactando en la ventana oval del odo interno. Presenta
una doble estructura con una doble funcin:
Por un lado existen tres canales semicirculares (laberinto) por donde circula un lquido
denominado endofila. Segn la posicin del cuerpo este lquido circula a mayor
velocidad por alguno de estos tres canales y en su movimiento desplaza a clulas
ciliadas que producen un impulso nervioso que se recoge por el nervio vestibular que se
dirige al lbulo temporal para determinar la posicin del cuerpo. Por ello estos canales
son responsables de nuestro equilibrio. Los mareos se deben por un movimiento
excesivo de la endofila y una activacin exagerada del nervio vestibular.
La segunda funcin es la auditiva que se debe a la cclea o caracol. Tambin esta
estructura sea presenta endofila que se mueve tras el golpeo del estribo a la
estructura oval. El movimiento del lquido tambin mueve a clulas ciliadas que
producen un impulso nervioso que se recogen por el nervio auditivo para que sea
interpretado como un sonido por el lbulo temporal.

La piel

Es un rgano de unos 2 m de superficie que presenta diferentes funciones principalmente la


de regulacin de la temperatura corporal (sudoracin) y la funcin tctil y por tanto sensible
a diferentes estmulos externos (tacto, sensibilidad al fro o al calor) mecanorreceptores,
(fro y calor) termorreceptores.
Los mecanorreceptores ms importantes son:
Los discos de Merkel que se encuentran en la parte superior de la dermis (tejido muy
vascularizado lleno de fibrobastos o clulas que forman colgeno y que gracias a ella se
nutren las capas superiores (epidermis) o tambin nutre a la capa inferior llamada
hipodermis o tejido subcutneo. Es en la dermis donde se encuentran el resto de los
mecanorreceptores, estos discos o terminaciones libres son las responsables del dolor en
la piel ante objetos punzantes. Estas terminaciones nerviosas se agrupan poco a poco en
nervios sensitivos que llevan el estmulo mecnico hacia la mdula. La neurona intercalar,
manda la sensacin dolorosa a la corteza cerebral (lbulo parietal). El rea sensitiva de
esta zona interpreta el dolor y produce una respuesta motora voluntaria que a travs de
la mdula y los nervios raqudeos contraen el msculo de la zona afectada.
Otras terminaciones drmicas son:
Corpsculos de Paccini, determinan la presin o peso del cuerpo. Estn en la planta del pie
y de las manos y gracias a ellos detectamos la posicin de nuestro cuerpo.
Terminaciones de Ruffini, son termorreceptores al calor, se encuentran en toda la dermis
y detectan el calor. En el lbulo parietal se interpreta este estmulo y manda una
respuesta a la zona. Se produce una vasodilatacin y una activacin de las glndulas
sudorparas.
Corpsculo de krause, son termorreceptores al fro.
Corpsculo de Meissner, estos receptores son siempre muy superficiales puesto que
detectan pequeos roces o vibraciones de la piel (son los responsables del cosquilleo)
estn muy desarrolladas en las yemas de los dedos o zonas ms sensibles de nuestra piel.

El Gusto
Se encuentra fundamentalmente en la lengua aunque tambin en el paladar. Se basa en la
presencia de papilas gustativas que son repliegues fungiformes (en forma de champin) de la
epidermis que presenta de forma discontina numerosos botones gustativos, estos presentan
neuronas especializadas para los cinco sabores. Estas neuronas son ciliadas (pelos
microscpicos) y estn expuestos a los alimentos si estos estn disueltos en saliva se produce
un estmulo nervioso que lleva el sabor al nervio glosofarngeo, a la mdula y finalmente a la
base del cerebro (centro de la degustacin o del sabor) en donde se interpreta realmente el
sabor del alimento.

El Olfato
Presenta quimiorreceptores sensibles a molculas gaseosas. Se considera que hay siete
olores bsicos (floral, mentol, picante, antipolillas). El olfato se encuentra en la zona
superior de las fosas nasales en la pituitaria amarilla, esta presenta una abundante mucosidad
que retiene los gases para permitir que sean detectados por las neuronas olfativas sensibles
a estos olores bsicos. Las clulas olfativas atraviesan al hueso etmoides en la base del
cerebro (placa cribosa), al final llegan a un ensanchamiento de un nervio llamado bulbo
olfatorio situado en la base del cerebro. All otras neuronas reciben la seal de las anteriores
y a travs del nervio olfatorio llegan a la base del encfalo para que se interprete el olor
correspondiente.

BLOQUE III:
ANATOMA Y FISIOLOGA HUMANA.
RELACIN ( S. ENDOCRINO).

Sistema endocrino

Conjunto de glndulas u rganos que segregan hormonas que van a la sangre que se llaman
endocrinas. Las exocrinas, forman sustancias que se vierten al exterior o a un rgano que
puede estar en contacto con el aire (glndulas salivares, glndulas gstricas, glndulas
intestinales). El pncreas es una glndula mixta porque vierte el jugo pancretico al duodeno
(exocrina) y tambin es endocrina porque forma la hormona de la insulina que vierte en
cambio a la sangre.
La hormona es una sustancia qumica; las hay de dos clases, de naturaleza proteica como la
insulina, ADH o vasopresina, hormona del crecimiento y de naturaleza lipdica o
estoroidea (tetosterona en los hombres y estrgenos u hormonas femeninas y la
aldosterona). En cualquier caso las hormonas viajan por la sangre y producen una respuesta

en algn rgano diana (es aquel que es sensible a la hormona), la respuesta aunque muy lenta
es muy duradera.

Tipos y ejemplos de glndulas:


Glndulas endocrinas:

El hipotlamo, es una zona del encfalo justo debajo del tlamo o tallo cerebral. Es la zona
endocrina que regula el funcionamiento de casi todas las dems glndulas endocrinas, segn el
estado del individuo manda sustancias qumicas (factores de liberacin) que van destinadas a
la hipfisis y all se produce su activacin o inactivacin. No fabrica hormonas, pero s
controla su liberacin.
Hipofisis o pituitaria (no tiene nada que ver con la amarilla de la nariz), es una pequea
glndula esfrica situada debajo del hipotlamo y protegida por el hueso etmoides en una
cavidad llamada silla turca. Presenta dos zonas el lbulo anterior o adenohipfisis y el lbulo
posterior o neurohipfisis.
La neurohipfisis segrega cuando es activada por el hipotlamo dos hormonas la ADH
o vasopresina, esta a travs de la sangre llega al rin, y en los tubos contorneados
distales de las nefronas reabsorbe agua de la orina para evitar una deshidratacin, la
oxitocina, se dice que es la hormona del parto porque se produce en grandes
cantidades en los ltimos minutos del parto. Su accin es incrementar las
contracciones del tero e inducen al parto, tambin favorece la produccin de leche en
la lactancia aunque en el hombre est muy reducida tambin genera un estado de
bienestar sus pequeas secrecciones.
Lbulo anterior de la hipfisis (Adenohipofisis), forma las siguientes hormonas.
la hormona del crecimiento o somatostacina (GH o STH), estimula el
crecimiento de los huesos y msculos especialmente hasta el fin de la adolescencia.
A partir de este periodo tambin influye en la regeneracin de estos rganos, la
falta de esta hormona ocasiona enanismo, sin embargo el exceso provoca
gigantismo. Si se produce un exceso despus de la adolescencia produce
acromegalia (desarrollo excesivo de las manos, pies y barbilla).
La prolactina, hormona de la leche solo se produce despus del parto y su
presencia favorece el desarrollo de las glndulas mamarias y la formacin de
leche.
Hormonas trpicas, se denominan as a las hormonas de la hipfisis que van a
activar a otras glndulas que en principio estn inactivas, las ms importantes
son las siguientes:
ACTH (hormona estimulante de la corteza suprarrenal).
TSH (hormona estimulante del tiroides), su funcin es activar esta glndula,
el tiroides.
LH (hormona luteica), estimula las gnadas masculinas o femeninas y es
responsable de la formacin de los gametos correspondientes. Su falta
provoca esterilidad y adems presentan bajos niveles LH.
FSH (hormona estimulante del folculo), es la hormona que provoca la ovulacin
y la hormona progesterona necesaria durante la gestacin, si no hay esta
hormona no hay ovulacin y tambin la placenta no se desarrolla y hay
abortos. En el hombre favorece la formacin de hormonas masculinas, estas
son tambin importantes para el desarrollo de sus rganos reproductores.

Glndulas tiroideas:
Es una glndula situada en la base del cuello rodeando a la nuez (Cartilago cricoides). Tiene
forma de alas de mariposa y se activa por la TSH, forma dos hormonas esenciales:
Tiroxina (T4), su funcin es aumentar el metabolismo basal, cuando una persona tiene
niveles altos de tiroxina se encuentra muy activa, desprende mucho calor y est muy
concentrada, suele ocurrir a las pocas horas de levantarnos. Las personas sedentarias o
de edad media avanzada presentan niveles bajos y suelen ser de comportamiento poco
activo.
Calcitonina, reduce los niveles de calcio en sangre, se libera despus de una comida rica
en este mineral. Su efecto consiste en almacenar el calcio en los huesos, con la edad esta
hormona se reduce mucho y los huesos se vuelven porosos y muy frgiles.
Glndulas paratiroides:
Son cuatro pequeas glndulas incrustadas en la glndula tiroides, su nica funcin es
formar la paratohormona que tiene un efecto antagnico (opuesto a la calcitonina). Su
falta no permite que haya unos niveles adecuados de calcio en sangre y se produce la
tetania (contraccin involuntaria y brusca de nuestras manos y brazos).
Pncreas:
Glndula mixta situada debajo del estmago y con forma de hoja, forma dos hormonas que
controlan la glucemia en sangre. La insulina disminuye los niveles de glucosa cando estos
son muy altos (despus de una comida o un dulce), permite que todas nuestras clulas
capten la glucosa sanguinea, su falta provoca la diabetes (cegueras, articulaciones
dolorosas y posibles infartos). Tambin segrega una hormona antagnica denominada
glucagn. El glucagn se libera la sangre en estados de ayunas o cuando los niveles de
azcar estn bajos, por ello su presencia eleva la glucemia en sangre.

Cpsulas suprarrenales:
Son unas glndulas situadas encima de cada rin y con forma piramidal, tiene dos zonas,
la zona central se denomina mdula y est formando neurotransmisores (adrenalina), que
activa el sistema visceral o autnomo de tipo simptico. En la parte ms superficial se
presenta la corteza que se activa por una hormona de la hipfisis (ACTH). Lo hace en
estados de estrs y la hormona que se genera se llama cortisol (hormona del estrs) y
tiene un efecto muy parecido a la adrenalina, pero tiene una duracin ms prolongada
(horas). Tambin la corteza forma la aldosterona, cuando el rin detecta bajos niveles
de sal en sangre, la hormona acta sobre los tbulos contorneados distales de la nefrona y
recupera sal de la orina aumentando la presin sangunea de la sangre.
Gnadas masculinas y femeninas:
Ovarios, son dos glndulas ovaidales que generan dos tipos de hormonas femeninas,
los estrgenos (durante la primera mitad del ciclo ovrico), predominan estos
estrgenos (desarrollo del vulo) y son los responsables de los caracteres sexuales
secundarios. Durante la segunda mitad del ciclo bajan los estrgenos y aumentan los
niveles de progesterona que desarrolla el endometrio (la capa muscular del tero). Al
final del ciclo ovrico baja mucho esta hormona y se produce la menstruacin femenina
en cambio, si ha habido embarazo aumenta mucho la progesterona y favorece la
formacin y desarrollo de la placenta, tambin inhibe la produccin de leche.

Testculos, rganos ovoidales que segregan andrgenos donde predominan tetosterona,


es la responsable de los caracteres sexuales secundarios del varn y tambin es
necesaria para la formacin de espermatozoides.
Retroalimentacin o feedback, ante un estmulo se inicia la produccin de una hormona,
esta viaja por la sangre hasta el rgano correspondiente y ejerce su accin

BLOQUE III:
ANATOMA Y FISIOLOGA HUMANA.
RELACIN ( Apto. LOCOMOTOR).

Sistema seo

Tipos de huesos
Presenta cuatro tipos de huesos:
a) Huesos largos, son de gran longitud y de seccin cilndrica, (humero, cbito, tibia,
peron, fmur), son los huesos de las extremidades.
b) Huesos cortos, tienen forma cbica, (huesos de la mano o carpianos y huesos del pie o
tarsianos).
c) Huesos planos, son de escaso o pequeo espesor, (huesos del crneo-frontal, temporal,
occipital, parietal, maxilares superior e inferior, son tambin los huesos de las
costillas y los de la cadera que estn compuestos de el ilen, isquen y pubis.
d) Huesos irregulares, tienen ( siete vertebras, cervicales, doce vertebras dorsales y
siete vertebras lumbares ms el hueso sacro y el coxis).
Funciones:
a) Soporte mecnico del cuerpo, permite que el cuerpo no se desplome bajo su peso.
b) Proteccin de rganos (el crneo protege el encfalo, la columna vertebral, la mdula
espinal y los rganos torcicos por las costillas).
c) Motora, las extremidades superiores e inferiores son las encargadas del movimiento.
d) Almacenamiento de calcio, para los huesos y para el organismo. Este mineral no solo forma
parte de los huesos sino tambin para la contraccin muscular.
e) Hematopoytica, o formadora de sangre. La sangre (glbulos rojos, glbulos blancos,
plaquetas o trombocitos se forma ntegramente en los huesos planos y en la epfisis de los
huesos largos.
Parte de un hueso largo:
a) Caa o difisis (Zona central o cilndrica de un hueso largo), tiene una forma central
semi-hueca denominada tutano o mdula sea amarilla (con abundante tejido adiposo o
graso). Presenta tejido seo compacto (sin huesos u oquedades), su capa superior se llama
perirtio y la capa inferior o interna endostio.
b) Epfisis o cabeza del hueso, son las dos zonas extremas del hueso, estn ensanchadas y en
su interior el tejido seo o esponjoso (est lleno de oquedades con clulas
hematopoyticas formando la sangre).
c) Metfisis, zona de transicin entre la parte superior (epfisis) y la parte central
(difisis). Es de naturaleza cartilaginosa hasta que el hueso deja de crecer (final de la
adolescencia). En estos momentos se osidifica y ya no aumenta o crece su longitud.
El hueso contiene muy poca agua (20%) y el resto a partes iguales lo constituye el colgeno
(40%) y las sales de calcio (40%).
d) Apfisis, saliente de la epfisis en ella se insertan los tendones (es la parte final del
msculo) y los ligamentos.
Tipos de articulaciones.
Articulacin, es la zona de unin entre dos o ms huesos, entre ellas se sita una zona de
cartlago ms o menos gruesa. Las articulaciones son de tres tipos:
Sinartrosis, es la unin estrecha o prxima entre dos huesos. Ambos huesos no pueden
moverse entre s, estn soldados. Ejemplo son las suturas o zonas de unin de los huesos
craneales (FIJAS). El ilen, isqueon y pubis tambin son ejemplos.
Anfiartrosis, son las articulaciones semi-mviles puesto que el cartlago es relativamente
ancho. Ejemplo las vertebras de la columna vertebral. Estos huesos cortos o discoidales
tienen una almohadilla para reducir el peso y friccin entre las vertebras. (SEMIMOVILES).

Diartrosis, (MVILES), entre los dos huesos articulados siempre hay una cpsula
cartilaginosa que contiene un lquido llamado sinovial que reduce la friccin. Dentro de la
articulacin tambin se encuentra una almohadilla cartilaginosa que va a reducir la
friccin entre los huesos, se encuentran en codos, rodillas, hombros, caderas o en general
en el escletoapendicular (brazos y piernas).

Las diartrosis ms importantes son:


Flexin-Extensin (bisagra o trocleada). La separacin entre los huesos se dirige en el
mismo eje del cuerpo. Ejemplos la rodilla, el codo, dedos o falanges.
Pronacin-Supinacin (o de deslizamiento o artrodias), se sitan solo en las muecas o
en el tobillo y permiten girar a izquierda o derecha en el pie y arriba y abajo en la
palma de la mano.
La supinacin supone que la palma de la mano mira hacia arriba, la pronacin es la
posicin normal de la mano.
Abduccin-Aduccin (rotacin o enartrosis), la presentan hombros y caderas y la
posicin normal del brazo o de la pierna es la de estar pegado al cuerpo.

Ejercicio: Indica el tipo de hueso y en donde se localiza

Hueso frontal, Es un hueso plano y est en el crneo.


Hmero, es un hueso largo y se localiza en la extremidad superior, en el primer tramo.
Costillas flotantes, es un hueso plano y se localiza en la caja torcica.
Coxis, hueso irregular situado en el extremo final de la columna vertebral.
Clavcula, hueso plano de la columna vertebral situado en la caja torcica.
Escpula u omoplato, hueso plano situado en el hombro.
Pelvis, hueso plano situado en el pubis.
Sacro, hueso irregular situado en la columna vertebral.
Falanges, huesos largos situados en manos y pies.
Una formacin de huesos es una osteognesis.
Osteocitos son unas clulas que se localizan en la metfisis ms abundantemente, pero
tambin pueden estar en cualquier parte del hueso que fabrican los huesos (osteognesis).

Sistema muscular

Es un conjunto de rganos muy similares en forma y funcin. Intervienen sobre todo en la


locomocin aunque tambin estn presentes en otras funciones como la respiracin con los
msculos intercostales y el diafragma, la digestin con los msculos peristlticos, en la excrecin
de la orina, en la circulacin sangunea y en la produccin de calor.
Formas de msculos
a) Msculos largos o fusiformes, estn ensanchados en la parte central y son ms
estrechos en los extremos terminando en tendones blancos, duros y elsticos. Ejemplos el
bceps (humeral y femoral), trceps y gemelos.
b) Msculos planos, son largos, anchos, pero tambin bastante finos, en forma de hoja,
suelen estar asociados a los huesos planos y tienen generalmente una funcin protectora
de estos huesos. Ejemplo msculo frontal, temporal, occipital, parietal y los abdominales.
c) Msculos en abanico, estn muy ensanchados en un extremo y estrechados en el otro.
Ejemplo el deltoides y los pectorales.
d) Msculos orbiculares, son de forma ovaidal. Ejemplo orbicular de los ojos o de la boca.
e) Esfnteres, son msculos ms o menos circulares y huecos en su centro. Cuando se
contraen se cierra el canal interno que presentan, si est relajado se abre. Ejemplo el
ploro, esfnter anal, esfnter uretral, cardias.
Tipo de msculos
a) Msculo esqueltico, siempre asociado o unido a nuestros huesos a travs de tendones
o aponeurosis (tendones planos unidos entre s como el palmar, plantar o dorsal),
tambin se llama msculo voluntario puesto que nuestro SNC (Sistema nervioso
central) puede controlar a voluntad, llamado tambin msculo estriado puesto que sus
fibras o clulas musculares presentan estras o lneas perpendiculares visibles al
microscopio. Estos msculos estn rodeados por una fina capa de tejido conectivo o
conjuntivo (rico en una protena elstica llamada colgeno). En la parte de los
extremos este epinisio se enriquece an ms de colgeno y forma una estructura
blanquecina llamada tendn por la que se une al hueso. El perimisio es tambin un
tejido conectivo que rodea a cada haz muscular (un conjunto de fibras musculares
rodeadas por este perimisio). Cuando se rompe un haz muscular se habla de rotura
muscular y el msculo est reducido en unas 3 o 4 semanas en su forma contrctil.
Cada fibra muscular est rodeada por una ltima capa de tejido conectivo llamada
endomisio. Debajo de este tejido conectivo se encuentra la membrana plasmtica de
esta clula muscular llamada sarcolema. En el interior del sarcolema se encuentran
miles de microfibrillas de actina y miosina que son las responsables de la contraccin
muscular.
Para que un msculo se pueda mover es necesario el calcio en el sacoplasma o lquido
de la clula muscular y adems una neurona motora que haga contacto con el msculo.
b) Msculo liso como el del estmago.
c) Msculo estriado como el del corazn.

BLOQUE III:
ANATOMA Y FISIOLOGA HUMANA.
REPRODUCCIN.

Reproduccin humana

Aparato reproductor femenino

Anatoma y fisiologa.
Ciclo ovrico o menstrual:
Consta de unos 28 das y se empieza a numerar desde el primer da de menstruacin
(desgarro del endometrio o cubierta uterina) hasta la siguiente menstruacin.
Presenta dos fases claramente diferentes:
a) Fase folicular, comprende los primeros trece a quince das del ciclo ovrico. Se debe a
la accin de la FSH (Hormona estimulante del folculo) segregada por la hipfisis
anterior y que a travs de la sangre llega a los ovarios e induce la maduracin de uno
de los 400.000 vulos inmaduros (ovogonia). Esta hormona estimula el llamado folculo
de Graaf que contiene la ovogonia u vulo inmaduro. Dicho folculo empieza a acumular
sustancias de reserva para el futuro embrin cuando sea fecundado. Durante esta
etapa la ovogonia al sufrir una meiosis que permite reducir a la mitad el nmero de

cromosomas iniciales (46:2=23) (22+ X), 22 cromosomas (contienen la informacin


gentica) no son sexuales y el ltimo es sexual del tipo X.
El folculo se va agrandando y genera la hormona femenina denominada estradiol
(responsable de los caracteres sexuales femeninos secundarios). En el da nmero 14 se
produce la ovulacin o salida del vulo del folculo de Graaf. Tambin este vulo sale del
ovario hacia la trompa de Falopio. El folculo de Graaf degenera y en su interior aparece
un cuerpo amarillo denominado cuerpolteo.
b) Fase ltea, dentro del folculo de Graaf degenerado se empieza a producir una
segunda hormona femenina, la progesterona. Este cuerpo lteo crece gracias a otra
hormona hipofisaria denominada LH (lutena). Esta hormona es necesaria para que el
cuerpo lteo forme progesterona, la progesterona desarrolla el endometrio durante
los prximos 14 das, si el vulo no es fecundado disminuye y se produce una nueva
menstruacin, si es fecundado la progesterona continua en accin durante los nueve
meses de gestacin, forma placenta que nutre al embrin a travs del cordn
umbilical.

Aparato reproductor masculino

Los espermatozoides o gametos masculinos se forman en los dos testculos situados en el


escroto en un proceso denominado espermatognesis debido a dos hormonas hipofisarias
(FSH) hormona estimulante del folculo y la (LH) hormona lutenica. Este proceso tiene lugar
en los denominados tubos seminferos. Una vez formados se almacenan en una cpsula
alargada situada encima de cada testculo (epiddimo). Esta estructura est conectada con el
conducto deferente que asciende hasta alcanzar la parte inferior de la vejiga urinaria y la
rodea por su parte superior. All se aade un lquido rico en azucares que da energa a los
espermatozoides (la vescula seminal) y ambas vesculas conectan sus canales en la glndula
prosttica que es un rgano impar del tamao y forma de una castaa. El conducto que sale de
dicha glndula se denomina uretra y recoge no solamente el semen sino la orina. Justo a su
salida se encuentran dos glndulas de Cowper que aade una sustancia que aumenta la
durabilidad de los espermatozoides en la vagina. La uretra se contina por el pene u rgano
copulador que tiene un tejido muscular esponjoso que cuando se rellena de sangre posibilita la
ereccin. En su parte terminal, se ensancha la parte final del pene llamado glande que est
recubierto por una piel llamado prepucio.

Ovognesis
Es la formacin de vulos en el ovario, se calcula que hay unos 400.000 vulos inmaduros que
presentan el nmero normal de cromosomas humanos (46) por lo general cada ovogonia est
encerrada en una cpsula llamada folcono de Graaf. Por la accin de la FSH despus de la
menstruacin solo una ovogonia se activa de todas las inmaduras y empieza a realizar una
divisin celular llamada meiosis que va a reducir a la mitad el nmero de cromosomas de la
ovogonia (23). La meiosis consiste en dos divisiones consecutivas de la ovogonia. En la primera
divisin se forma un ovocito (I) u ovocito de primer orden y una pequea clula que degenera
(primer corpsculo polar). La segunda divisin del ovocito (I) forma el ovocito (II) u vulo casi
maduro con 23 cromosomas. Tambin se forma un segundo corpsculo polar que tambin
muere. Este ovocito (II) termina su maduracin poco antes de la ovulacin (aproximadamente
dcimo cuarto da despus de la menstruacin.

Espermatognesis
Formacin de los gametos masculinos, tiene lugar constantemente en los tubos seminferos en
donde se encuentran las espermatogonias u espermatozoides inmaduros (44 + XY). A diario
los millones de espermatogonias pasan por meiosis o divisin celular que reduce a la mitad el
nmero de cromosomas. En la primera divisin se forman 2 espermatocitos de primer orden
cada uno de los cuales sufre otra divisin que va a formar en total 4 espermatocitos de
segundo orden con sola la mitad de 46 cromosomas. Unos llevarn el cromosoma X y la otra
mitad el cromosoma Y. Son an inmaduros y carecen de flagelo. El flagelo se desarrolla
rpidamente al final de los tubos seminferos y en el epiddimo cada flagelo presenta tres
zonas: un extremo abultado denominado cabeza que contiene un ncleo donde estn los 23
cromosomas. En su parte posterior ms extrema se encuentra el cromosoma o sculo que
contiene enzimas digestivas para disolver la cubierta del vulo.

BLOQUE II:
LA ESTRUCTURA Y EL
FUNCIONAMIENTO DE LA
CLULA

Clulas animales (EUCARIOTAS)

Las clulas eucariotas (eu= autntico o verdadero; cario= ncleo) son las que presentan un
autntico ncleo en su composicin. Estas clulas tienen tres zonas caractersticas:
a) Membrana plasmtica o celular, qumicamente est constituido por fosfolpidos y
protenas a partes iguales. Gracias a las protenas las sustancias beneficiosas (glucosa,
aminocidos, sales minerales, etc.)pueden entrar. Por el contrario tambin permiten la
salida de las sustancias txicas (urea) y permite salir tambin a hormonas de diferente
funcin (insulina, tiroxina, calcitonina, estrgenos), acta como una barrera selectiva.
b) Citoplasma, es agua con sales minerales y enzimas (protenas que aceleran las reacciones
qumicas del metabolismo). Tambin dentro del citoplasma se encuentran unas estructuras
u orgnulos que son caractersticos de estas clulas animales (mitocondrias, centriolos,
aparato de golgi, ribosomas,etc.)
c) Ncleo, est rodeado por una segunda membrana llamada nuclear de composicin muy
similar a la plasmtica (fosfolpidos y protenas a partes iguales). Dentro se encuentra el
ncleo plasma o jugo nuclear que contiene agua, sales y enzimas exclusivas destinadas a
almacenar la informacin gentica (ADN 0 cromosomas). En la especie humana hay 46
cromosomas. En el varn hay dos cromosomas sexuales diferentes (XY); en la mujer hay

dos cromosomas sexuales iguales (XX). Finalmente hay un nuclolo (zona ms oscura del
ncleo) que es el lugar donde se forman los ribosomas que tendrn que salir
posteriormente por los poros nucleares hasta el citoplasma. Todas las clulas tienen la
misma informacin gentica, hay unos 30.000 genes cada uno de los cuales forman una
protena (hemoglobina, colgeno, queratina, hormona del crecimiento), pero cada clula
solo activa algunos de ellos y otros quedan inactivados. Por ejemplo un eritrocito o glbulo
rojo si tiene activado el gen de la hemoglobina, pero tiene inactivado el gen de la
queratina.

Orgnulos citoplasmticos
Mitocondrias, orgnulo de forma ovaidal (en forma de huevo). Presenta dos membranas
(bimembranal), la interna se repliega formando las crestas mitocondriales. Es un orgnulo
energtico que est constantemente formando ATP (Adenosin trifosfato), molcula que
forma energa. Esta molcula funciona de la siguiente forma:

ATP-----ADP (Adenosin difosfato)+P (Fsforo inorgnico)+E (energa)

Por tanto cuando el ATP se hidroliza en el citoplasma se libera energa que es


utilizada para el funcionamiento celular (contraccin muscular, formacin de
protenas, formacin de hormonas). Las mitocondrias son centrales energticas
(de ATP), son de color rojo.
Ribosomas, son orgnulos citoplasmticos amembranales de aspecto esfrico y
tamao muy pequeo. Las clulas se miden en micras o micrmetros.
1 clula= 10 micras

1 micra=1/1000 mm

0,1 micra= tamao de un ribosoma

Se encuentran dispersos en el citoplasma, pero tambin asociados al RER (Retculo


endoplasmtico rugoso). Su funcin es la sntesis o formacin de todas las protenas y
enzimas u hormonas de naturaleza proteica. En los ribosomas se traduce la
informacin gentica que se almacena en el ADN. En estos cromosomas hay unos
30.000 genes en la especie humana, cada uno de los cuales va a formar (transcripcin)
los ARNm (mensajeros) que saldr del ncleo y ser ledo o traducido en los ribosomas
en forma de protenas:

ADN-----------------ARNm ----------------------------------------PROTEINA
(TRANSCRIPCIN)

(Ribosomas, TRADUCCIN)

RER, es un conjunto de membranas aplanadas comunicadas entre s y que se


disponen en forma concntrica rodeando al ncleo. Se llama rugoso porque en su

cara externa lleva asociado ribosomas, Es el almacn de las protenas que se estn
formando en los ribosomas que lleva asociados.
-EL, (Retculo endoplasmtico liso), es un conjunto de membranas sin ribosomas
asociados que estn rodeando al RER. Su funcin biolgica es doble, por un lado
maduran o mejoran en su calidad las protenas que estaban almacenadas en el RER.
Por ejemplo la hormona insulina se almacena como hormona inmadura o pro-insulina
cuando pasa al liso pierde unos pocos aminocidos y se activa, la segunda funcin
es formar todas las membranas presentes en la clula (membrana plasmtica,
membranas mitocondriales).
Aparato de Golgi, conjunto de membranas semicirculares que no estn conectadas
entre ellas pero situadas prximas al ncleo de la clula. Recibe a travs de
pequeas vesculas procedentes del REL, protenas que sern procesadas o
maduradas en su interior para que sean perfectamente viables (glicoxidacin). Por
ejemplo los anticuerpos son protenas que llevan azucares aadidos en este
aparato. Los grupos sanguneos son azucares formados en este aparato, adems el
aparato de golgi est segregando constantemente vesculas que pueden salir hacia
el exterior y contienen sustancias beneficiosas (enzimas digestivas, mucosidad,
hormonas), la tercera funcin ser lisosomas.
Lisosomas, son vesculas segregadas por el aparato de golgi. Contienen enzimas
digestivas (proteasas, lipasas, amilasas, nucleasas). Dichas enzimas digieren a la
materia orgnica con la que se encuentren (protenas, lpidos, azcares, cidos
nuclicos) y terminan por descomponer completamente en sus monmeros bsicos
(aminocidos, cidos grasos, glucosa, nucletidos). El proceso se llama digestin
celular para distinguirlo de la digestin extracelular que tiene lugar en el aparato
digestivo.
La materia orgnica procede tanto del exterior como del interior. Esta materia
orgnica se suele empaquetar dentro de unas membranas celulares que forman
vacuolas o grandes vesculas llamadas vacuolas digestivas que se van a fusionar con
los lisosomas del aparato de golgi. Generalmente se forman las vacuolas digestivas
por la nutricin de la clula o fagocitosis que son repliegues de la membrana
plasmtica.
Centriolos, (citosoma o citocentro), son dos estructuras amembranales o sin
membrana plasmtica que tienen aspecto cilndrico y que se disponen en nmero
par perpendiculares entre s. Se sitan prximos al ncleo y solo se presentan en
clulas animales nunca en clulas vegetales.
Los centriolos tienen dos funciones:
a) La divisin celular, la mitosis y la meiosis (divisin que da lugar a gametos) solo
tiene lugar si los centriolos forman los filamentos del uso acromtico o
mittico se forman a partir de ellos. La mitosis es la reproduccin de la clula
para regenerar tejidos, las nicas clulas que no se regeneran son las neuronas.
b) Formacin de cilios y flagelos, las clulas humanas no suelen presentar ni cilios
(numerosos y cortos filamentos de la membrana plasmtica) ni flagelos (largos

y escasos filamentos de la membrana). Cuando estn presentes se han formado


a partir de los centriolos.
Celulosa, tambin se llama pared celular vegetal y es una cubierta gruesa, espesa,
de naturaleza celulsica que se encuentra recubriendo la membrana plasmtica de
las clulas vegetales. Es justo con los cloroplastos (orgnulos verdes donde se
hace la fotosntesis) los dos orgnulos que no presentan las clulas animales y
tambin humanas.

CLULA BACTERIANA (PROCARIOTA)

A) Membrana plasmtica o celular, es similar en estructura y funcin a la membrana


plasmtica de las clulas eucariotas. Hay un 50% de fosfolpidos que se disponen en forma
de una bicapa lipdica o de fosfolpidos que la hace impermeable a la entrada de sustancias
(agua, sales minerales, glcidos, aminocidos). Sin embargo hay otro 50% de protenas que
permiten un paso selectivo de sustancias, entran nutrientes energticos a travs de las
protenas (glucosas, aminocidos, lpidos o grasas y tambin salen sustancias txicas,
amoniaco urea).
B) Pared celular bacteriana, tambin es llamada pptido glicano o murena. Se sita por
encima o hacia el exterior de la membrana plasmtica bacteriana, es gruesa o rgida y
protege de golpes mecnicos a la clula evitando su lisis (ruptura). Dicha pared da
distintas formas a la bacteria (si tienen forma cilndrica o de bastnes se llaman bacilos),
ejemplo de bacteria de bacilo es la enfermedad del ttanos o lactobacilos.
Si tienen forma esfrica o redondeada se llaman cocos que crean enfermedades como los
neumococos o meningococos.
Las que tienen forma de vibrios dan enfermedades como el clera, estas tienen forma de
coma.
La pared celular bacteriana es sensible a los antibiticos, estos medicamentos impiden su
formacin y las bacterias se lisan o destruyen.
C) Citoplasma, es el jugo o lquido interno de la bacteria donde se encuentran suspendidos o
flotando el resto de los orgnulos citoplasmticos. Adems contiene agua, sales minerales
y enzimas que son diferentes segn la bacteria.
D) Los Orgnulos bacterianos ms caractersticos son:

-Nucleoide o cromosoma bacteriano, es el ADN de la bacteria que no est aislado del


citoplasma por una membrana nuclear por eso estas clulas se llaman procariotas o
clulas sin ncleo. Este cromosoma bacteriano tiene muy poca informacin respecto a
una clula eucariota (una dcima parte 3000 genes) forman 3000 enzimas,
constantemente est formando ARNm (transcripcin, formacin de mensajeros), que
van a ser ledos en los numerosos ribosomas citoplasmtico (traduccin). Cada
mensajero lleva unos 3 o 4 genes que formarn 3 o 4 protenas o enzimas.

-Los ribosomas leen los mensajeros y forman protenas.

-Plsmido es un pequeo fragmento de ADN de aspecto tambin circular, pero mucho


ms pequeo que el nucleoide. Por lo general no siempre est presente, pero lleva
algunos genes adicionales que le proporcionan una mayor supervivencia a la bacteria,
normalmente los plsmidos llevan genes que destruyen a los antibiticos y son inmunes
a estos. A estas bacterias resistentes a los antibiticos se les llama superbacterias.

-Mesosomas, son repliegues de la membrana plasmtica y que presentan dos funciones:


Presentan enzimas relacionados con el metabolismo de la clula. Algunos
realizan la fotosntesis, otros realizan fermentaciones por descomposicin
de la materia.
Estn relacionados con la divisin bacteriana. Las bacterias no tienen
mitosis (filamentos de uso acromtico). Al inicio de la escisin el cromosoma
bacteriano se duplica y forma dos cromosomas idnticos. Un cromosoma se
fija a un mesosoma y el otro cromosoma a otro mesosoma situado en la cara

opuesta. Ambos mesosomas se desplazan hacia polos opuestos de la


bacteria y arrastran el cromosoma que llevan, finalmente se produce un
tabique central que divide a la clula madre en dos clulas hijas idnticas,
pero ms pequeas. Su pared celular es an joven y no rgida todava. La
bacteria crece rpidamente y adquiere el tamao normal. Entre cada
escisin de cada bacteria apenas transcurren 30 minutos.

-Fmbria, son prolongaciones del citoplasma en forma filamentosa y huecas que


permiten el intercambio de pequeas molculas con el exterior. Una de ellas es el
intercambio de plsmidos (estas pequeas molculas de ADN) pueden pasar por las
fimbrias y transmitirse a otra bacteria prxima que haya conectado sus fimbrias. A
este proceso de intercambio de plsmidos o de material gentico se llama
transformacin bacteriana y es frecuente en los procesos de resistencia a los
antibiticos.

-Flagelo procaritico, es un largo filamento con movimiento ondulatorio y que


proporciona movilidad a las bacterias que lo contengan. Es muy propia de bacterias que
viven en medios acuosos. Sin embargo no se forman a partir de los centriolos puesto
que las bacterias no son centriolos.

-Cpsula, es una cubierta de aspecto mucoso, (contiene azcares o polisacridos)


siempre se encuentra recubriendo a toda la bacteria y no siempre est presente.
Cuando s lo est (hay cpsula) estas bacterias no son fcilmente identificables por
nuestras defensas o glbulos blancos y por tanto son patgenos y se multiplican ms
fcilmente.

Metabolismo o Reacciones Metablicas

Metabolismo

Conjunto de reacciones qumicas que se dan exclusivamente en el interior de las clulas. Estn
destinadas a la obtencin de energa y a la fabricacin o sntesis de nuestras propias
biomolculas (protenas, lpidos, glcidos, cidos nuclicos).
Catabolismo, conjunto de reacciones qumicas o metablicas de carcter destructivo. A
partir de las biomolculas orgnicas complejas (alimentos) se obtiene energa qumica
(ATP) poder reductor o de hidrgenos (molculas hidrogenadas)(NADH) (FADH2) y
molculas orgnicas ms sencillas (CO2-acetil CoA). Es la primera etapa del metabolismo y
necesaria para iniciar el anabolismo.
Anabolismo, son las reacciones qumicas inversas al catabolismo. Las molculas sencillas
producidas en este se van a unir para formar molculas complejas que formen parte de la
energa y poder reductor previamente formado en el catabolismo.
Metabolito, molcula que forma parte de las reacciones metablicas.

Reacciones qumicas o metablicas ms frecuentes:

Gluclisis: Reacciones enzimticas que tienen lugar en el citoplasma de todas las clulas y
que catabolizan los gcidos como la glucosa (C6H12O6) en cido pirvico y ATP.
Ciclo de Krebs: Reacciones enzimticas de tipo catablico donde a partir del Acetil-CoA
se obtiene ATP y poder reductor.
Fermentacin: Son reacciones catablicas anaerbicas (en ausencia de oxgeno) que
terminan formando compuestos orgnicos solo parcialmente degradados formando
pequeas cantidades de ATP.

Tipo de catabolismos
Las biomolculas que llegan a nuestra clula a travs de la sangre (glcidos, protenas y
lpidos), van a sufrir reacciones catablicas o reacciones de descomposicin de compuestos
complejos a sencillos con produccin de ATP van a sufrir dos tipos de reacciones:
a) Reacciones o rutas fermentativas, son aquellas que descomponen solo parcialmente la
materia orgnica, en ausencia de oxgeno y con poca formacin de energa (ATP). En
los seres vivos suelen producir olores desagradables (putrefacciones). En el ser
humano la fermentacin ms conocida es la fermentacin lctica con la siguiente
reaccin global o bsica.
C6H12O6CH3-CHOH-COOH+2ATP (cido lctico)
Las molculas ms complejas son las que tienen ms tomos de carbono por lo que la
molcula solo se ha metabolizado parcialmente.
La fermentacin lctica se produce solo en los msculos y en el hgado o con ejercicios
muy intensos (anaerbicos).
b) Respiracin celular, es un tipo de catabolismo que necesita oxgeno para realizarse. La
materia orgnica compleja se va a descomponer completamente en molculas sencillas
(CO2+H2O). En el proceso se producen grandes cantidades de energa (38
ATP/molcula de glucosa). Parte de esta respiracin se inicia en el citoplasma, pero en
su mayor parte se realiza en las mitocondrias. (ciclo de Krebs)(cadena respiratoria
mitocondrial).

Las biomolculas orgnicas antes de sufrir un proceso fermentativo o respiratorio


deben descomponerse en el citoplasma en sus monmeros o molculas bsicas. El
proceso se llama digestin intracelular y se realiza por las enzimas hidrolticas
presentes en los lisosomas. Por tanto gracias a los lisosomas el almidn se hidroliza en
glucosas, los lpidos en glicerina y cidos grasos, las protenas en aminocidos.

Etapas bsicas de la respiracin de la glucosa


La glucosa durante el proceso de respiracin celular sufre un catabolismo completo mediante
3 rutas o reacciones enzimticas:

1 ruta o gluclisis, es una reaccin citoplasmtica y que a partir de la glucosa y en ausencia


de oxgeno se descompone parcialmente en cido pirvico.
cido pirvico->CH3COCOOH+2ATP->Acetil-CoA+CO2
Como se realiza sin oxgeno, se produce muy poco ATP y se descompone solo parcialmente, se
dice que la gluclisis es un proceso fermentativo.
2 ruta descarboxidacin del cido pirvico. El cido pirvico en ausencia de oxgeno y
dentro de las mitocondrias se une con la coenzima denominada A (CoA) y forma acetil-CoA
(ayuda la enzima que esta sea capaz de realizar su funcin) liberando CO2.
Esta molcula es comn al metabolismo de los glcidos, lpidos y protenas.
3 ruta Ciclo de Krebs, es un conjunto de reacciones enzimticas en donde entra acetil CoA
formado en el catabolismo de glcidos, lpidos y aminocidos y se descompone completamente
en CO2 que es eliminado en la respiracin celular. Adems se forma poder reductor, tiene dos
finalidades, por un lado seguir catabolizndose para obtener ms ATP (respiracin
mitocondrial o cadena transportadora de electrones o fosforilizacin oxidativa):

2H+1/2 02>H2O+ATP

Respuesta de examen
Respiracin celular:
Es un proceso catablico en donde se parte de molculas orgnicas complejas (glucosa,
aminocidos, cidos grasos) se obtiene energa en forma de ATP y molculas muy sencillas que
en el caso de la respiracin son CO2 y H2O. Como en estas reacciones catablicas se necesita
O2 se dice que hay un catabolismo aerbico. La reaccin global de la respiracin de la glucosa
es la siguiente:
C6H12O6+O2--6CO2+6H2O+38ATP
Gracias a la respiracin se consiguen dos objetivos obtener la energa que necesitamos para
nuestras actividades vitales y se obtienen metabolitos o sustancias qumicas que son el punto
de partida para las reacciones anablicas o de formacin de molculas orgnicas
(generalmente estas molculas son acetil CoA).
La diferencia entre la respiracin aerbica y anaerbica es el oxgeno (la primera lo tiene la
segunda no). En la anaerbica solo podemos obtener pequeas cantidades de ATP mediante la
fermentacin lctea (el cido pirvico de la gluclisis pasa a ser cido lctico).
En la mitocondrial se realiza la respiracin celular eucariota tanto en la matriz (jugo de la
mitocondria) como en las crestas mitocondriales (fosforilizacin oxidativa).

BLOQUE V:
MICROBIOLOGA

Microbiologa

Ciencia que estudia los seres vivos invisibles o microscpicos. Se necesita un microscpico que
es capaz de ver formas inferiores a la dcima parte de un milmetro (bacterias, virus, protozoos,
hongos microscpicos).
Virus, no son seres vivos, son estructuras (sin membrana, citoplasma, no tienen informacin
gentica), carecen de metabolismo por eso no son seres vivos. Sin embargo, tienen funcin de
relacin y reproduccin. Son capaces de reconocer a las clulas que infectan y reproducirse,
pero sin metabolismo propio.
Clasificacin de virus, se clasifican en diferentes formas:
a) Segn quien te haya infectado,
En virus animales (virus del sida humano VIH) (virus de la gripe humana) (virus de
la peste porcina) (virus de la gripe aviar)(virus de la hepatitis)(virus del
herpes)(virus del sarampin)(virus de la rabia).
En virus vegetales (virus del mosaico del tabaco VMT).
Los virus que infectan a bacterias se llaman bacterifagos.
b) Segn la forma que presentan, todos los virus tienen dos componentes bsicos, por
un lado un material gentico muy pequeo que puede ser ADN o ARN. Dicho
material se encuentra encerrado o protegido por una envuelta proteica llamada
cpside que puede tener tres formas:

Virus con cpside esfrica o icosadrica (virus del herpes, virus de la gripe o
virus de la poliomielitis).
Existen virus helicoidales o cilndricos (virus del mosaico del tabaco o virus de la
rabia).
Virus mixtos o complejos, son una mezcla de los dos anteriores y presentan una
cabeza icosadrica o esfrica donde est el material gentico y un cuerpo
helecoidal, solo son los bacterifagos.

Todos los virus son muy pequeos (la dcima parte del tamao de una bacteria)
1 micra=0,001mm/clula humana=10 micras/clula bacteriana= 1 micra/virus=0,1 micra
Los antibiticos no son efectivos frente al virus puesto que estos medicamentos solo
actan sobre la pared celular bacteriana.

Ciclo reproductivo del virus del sida:

1 la fusin del virus con la membrana celular que infecta: Todos los virus tienen
en su superficie protenas que reconocen a las clulas que van a infectar. Por ello cada
virus solo va a infectar un tipo de clulas en el ser humano. En el caso del VIH estos
virus solo infectan a los linfocitos B (un tipo de glbulo blanco).
2 paso, liberacin del material gentico. El virus entra al citoplasma de la clula,
rompe su cpside gentica liberando su material gentico. En el caso del VIH es de
tipo ARN (gripe) ADN (hepatitis, poleo, herpes).
3 Integracin en el cromosoma celular. El material gentico viral pasar al ncleo
de la zona que infecta para fusionarse o integrarse con el cromosoma humano
(provirus o virus sin cpside). En el caso del VIH existe una enzima viral llamada
transcriptasa inversa o retrotranscriptasa que permite transforma el ARN viral en
ADN viral. Los retrovirales o medicamentos antisida destruyen estas enzimas y
reducen la multiplicacin del virus en el paciente.
Gracias a la integracin del provirus el paciente puede estar meses o aos sin padecer
la enfermedad.
4 activacin y transcripcin del virus. Bajo ciertas circunstancias como mala
alimentacin, otras enfermedades contagiosas, el provirus se activa y manda a ARNm a
los ribosomas en donde se forman las protenas de la cpside que van a envolver a las
mltiples copias del material gentico formado en el ncleo de la clula.
5 liberacin de partculas virales. Se suelen formar decenas o centenares de virus
en una clula que terminar por agotar todo el ATP de ella, la infectan y causan su
muerte. Los virus suelen liberarse llevando parte de la membrana celular de la clula
que infectan y es donde se encuentran los receptores que van a reconocer una nueva
clula sana.

Enfermedades bacterianas

Bacteria del clera: Se transmite por aguas contaminadas por heces o aguas fecales, es
caracterstico de los pases del tercer mundo. Es una enfermedad diarrica y tiene un alto
ndice de mortalidad.

Salmonelosis: Se produce por la bacteria salmonella, es otra enfermedad transmitida por los
alimentos mal refrigerados sobre todo si contienen mahonesa ya que estos alimentos llevan
excremento de aves y tambin producen diarreas.
Neumococos: Bacteria productora de una enfermedad llamada neumona, se transmite a
travs de las personas infectadas que tosen alrededor de nosotros.

Enfermedades virales

VIH: Se transmite va parenteral, a travs de la sangre, jeringuillas, tambin es una


enfermedad de transmisin sexual semen, mucosas, pueden contener ese virus y transmitir
dicha enfermedad.
Hepatitis B y C: Se transmite de la misma forma que el virus del sida, va parenteral. La
hepatitis A se transmite por agua contaminada. La hepatitis produce inflamacin del hgado y
los sntomas es cansancio generalizado e ictericia.

Hongos o micosis:

Son clulas u organismos celulares eucariotas que tienen una pared celular quitinosa parecida
a la celulosa de los vegetales. Produce queratitis o infecciones de la piel con sntomas de
prurito o escozor y decoloracin de la pigmentacin de la piel. Los ejemplos ms conocidos son
la candidiasis que afecta a la mucosa nasal, bucal o genital y el pie de atleta que produce
escozor en los dedos de los pies e incluso decoloracin de las uas.

Parasitosis o enfermedades debidas a parsitos:

Organismos que viven a expensas del hospedador o persona enferma producindole


molestias, pero sin causarle la muerte. Un buen ejemplo de parsito es la tenia o solitaria que
es un gusano plano de gran longitud unos 7 metros que vive en el intestino delgado
alimentndose de los nutrientes y produciendo un cuadro de anemia y debilitamiento en el
paciente. Una enfermedad parasitaria es debida a un protozoo llamado malaria o paludismo. El
protozoo o clula eucariota que vive en medios acuosos se llama plasmodium y se encuentra
dentro de los glbulos rojos de las personas enfermas. La enfermedad se transmite a travs
de un vector (animal que no sufre la enfermedad, pero si la transmite a un germen o
microbio), la picadura del mosquito a una persona sana le puede contaminar cuando este
vector le pica. Produce ms de dos millones de muertes al ao y presenta un cuadro de
fiebres muy altas y anemia severa.

BLOQUE VI:
INMUNOLOGA

Inmunologa

Es la ciencia que estudia el sistema inmune o conjunto de mecanismos, clulas y molculas que
presenta nuestro cuerpo (grmenes, tumores).

Tipos de mecanismos inmunolgicos:

a) Innatos o mecanismos que presentamos nada ms nacer y que actan en forma


inespecfica sobre cualquier patgeno o germen.
b) Mecanismo adquirido que se presenta y se desarrolla durante la vida de las personas. Es
especfica y por tanto varia de un germen a otro, es mucho ms efectivo que el anterior.

Inmunidad innata externa:

Es el conjunto de defensas de naturaleza celular y molecular que tenemos en nuestro rgano


y especialmente la sangre. Sus actuaciones siempre conllevan un problema asociado que se
denomina inflamacin (otitis, rinitis, conjuntivitis, hepatitis).
En una inflamacin siempre hay cuatro sntomas caractersticos, enrojecimiento de la zona,
dolor, tumefaccin o edema, cuadro febril o calentamiento de la zona. El origen de estos
sntomas bsicamente se encuentra en los mastocitos o clulas guardianas de todo nuestro
cuerpo. Estas clulas presentan histaminas, esta sustancia la histamina es la causante de los
sntomas de inflamacin, pero gracias a ella se atrae a la zona con glbulos blancos con
capacidad fagocitaria (se comen los microbios causantes de la inflamacin). Entre estos

destacan los neutrfilos y los monocitos (un 60% de todos los glbulos blancos). Ambos salen
de la sangre atrados por los mastocitos que estn liberando la histamina y destruyen a las
clulas infecciosas. Seguramente la infeccin se va a terminar con pus que es todos los
leucocitos que han muerto durante la infeccin.
Adems de las clulas anteriores hay molculas que actan directamente contra los
grmenes, entre ellas, destacan las molculas sanguneas que se denominan sistema del
complemento. El complemento, es un conjunto de molculas inactivas que se encuentran en la
sangre y que cuando se ponen en contacto con los grmenes se activan y por su capacidad
hidroltica destruye a los grmenes presentes en sangre.
Despus de superar los grmenes, los mecanismos innatos externos o internos, existe un
segundo tipo de mecanismos llamado adquiridos puesto que se desarrollan durante la vida de
las personas. A estos procesos se dice que producen inmunizacin. Por ejemplo la gripe
generalmente supera por primera vez los mecanismos innatos produciendo la enfermedad
correspondiente. Sin embargo se desarrollan mecanismos adquiridos que van a evitar que el
mismo virus nos ataque por segunda vez (inmunizacin).

Los mecanismos adquiridos que se desarrollan despus de una primera


infeccin son:

a) Inmunidad adquirida de tipo humoral (molculas qumicas que est en los humores). En la
sangre y en los vasos linfticos se encuentra los macrfagos que en realidad son los
monocitos activados en los tejidos por la liberacin de la histamina. Estos previamente
haban digerido por fagocitosis a los grmenes y son capaces de presentar fragmentos de
estos organismos a los linfocitos B.
Los macrfagos presentan los restos del germen a los linfocitos B que est n tanto en
sangre como en los vasos y ganglios linfticos. Una vez que se activan se transforman en
clulas plasmticas que liberan los llamados anticuerpos o inmunoglobulina que actan
como el complemento, pero son mucho ms especficos y activos al germen que haba
llegado.
Los anticuerpos (molcula propia de nuestro cuerpo) se denomina as porque reconocen a
los antgenos o partes de los grmenes que son extraos a nuestro organismo.
b) Por otro lado hay una respuesta adquirida celular en donde los protagonistas (las clulas
fundamentales son los linfocitos T presentes en tejidos, sangre y en el sistema linftico.
Estos estn inactivos, pero cuando los macrfagos les presentan los restos del germen
fagocitado (se activan) y al hacerlo liberan sustancias qumicas llamadas citotxicas que
se dirigen a las clulas infectadas y las destruyen, pero tambin al germen que est
infectando a estas clulas.

Formas de inmunizacin

Pueden ser de dos tipos:


a) Inmunizacin natural: Se adquiere sin la intervencin de mdicos o medicamentos. Se
distingue entre inmunizacin natural activa si la hemos desarrollado nosotros por los dos
mecanismos innatos y adquiridos (por ejemplo la inmunizacin frente a la gripe). Puede ser
tambin inmunizacin natural pasiva si recibimos anticuerpos de nuestra madre (durante
la gestacin o la lactancia).
b) Inmunizacin artificial: Se debe a que mediante los medicamentos las personas
conseguimos mejorar nuestra inmunizacin frente a los grmenes. Puede ser artificial,
activa cuando los mdicos nos aplican una vacuna (organismo atenuado o inactivado

mediante tratamientos qumicos o por el calor). Esta vacuna al aplicarse a un paciente


produce una inmunidad humoral o celular previamente explicada y evita que cuando llegue
el organismo activo ya estemos inmunizados frente al germen (vacuna de la gripe).
Finalmente existe una inmunidad artificial pasiva gracias a la administracin de sueros
sanguneos (sangre sin glbulos rojos con gran cantidad de anticuerpos frente a un
germen que previamente se ha producido en un animal generalmente un caballo. Por
ejemplo es muy tpico el suero antiguin tetnico que se administra a personas que se
hayan clavado un metal, para evitar la tetania o contraccin de los msculos este suero
por sus anticuerpos destruye inmediatamente al germen. Es ms rpido que una vacuna,
pero su efecto no es duradero.

"#

"

' ''

& "

% ! "

+ %,
$ !

"
)

!
'(

&

"

"

& ) ) %

' *+ ,

"
*

! "

"

$ !
"

$ $

! "

! -

'

$
$

$
! %

#
# !.

. /0 12 %

$ %

/
*

* !
#

&

"

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
# ' *+ , %

&

. /0 12 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'*

4 ,

. /0 5 2 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'*

6 . /0 5 2 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'*

! 4

7 6 !

!!

! 8 !

.'

! '/0 12 %

! 3'

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
OPCIN C - GS
5/12

2%, !

*
" !1
" $

'

!3
$

!
"

0
!

"

&

' /0 12 %

! 3

/
$

"

4%5

&

6
$

+ 7 8 9%
! & $

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
#'

&

' /0 5 2 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'

&

' /0 5 2 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'*

. /0 5 2 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'*

! .*

! . /0 12 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''

OPCIN C - GS
6/12

9%,

"!
<
"

#
!-

!
"

! " $
$ $ 0 ! )1 $

*! $ !
/
!=% /: 12 % ! 3

! -

$ $

:*
#

:<

- )
- #

- "
;
0 !

1 $

;,!

<

; &

# !

&

&

% ! -

> % !! #

>

6!

; =

>%,

'
!3

"
'

!
!86

' /0 12 %

/
) %

$
!

$
$ /

$
#

"
$

?
!

$
$

& #
$

?$
!! @

3! !
" $

"

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
#'

% ' /0 12 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
OPCIN C - GS
7/12

'

' /0 12 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''

'> %

&

' 0 12 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
'

' /0 12 %

! 3

''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''

OPCIN C - GS
8/12

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es


correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1.- Indica de qu orgnulo celular se trata (0,25 puntos) y los criterios en los que te has basado para deducirlo
(0,5 puntos).
a. Menciona los componentes sealados (0,75 puntos).
b. Comenta el proceso celular, de gran importancia para la obtencin de ATP (energa qumica utilizable
por la clula), que ocurre en dicho orgnulo (1 punto).

2.- Durante la profase mittica, una clula humana presenta:


a. 92 molculas de ADN (46 cromosomas de 2 cromtidas cada uno).
b. 46 molculas de ADN (46 cromosomas de 1 cromtida cada uno).
c. 46 molculas de ADN (23 cromosomas de 2 cromtidas cada uno).
d. 23 molculas de ADN (23 cromosomas de 1 cromtidas cada uno).
Indica la respuesta correcta (1 punto) y argumenta tus razones (1,5 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

3.-Observa el dibujo e identifica si se trata de una respuesta humoral o celular. Razona tu respuesta (1 punto).
Respecto del proceso representado:
a. Cmo actan las clulas presentadoras de antgenos? Se trata de que comentes lo que ocurre en 1, 2
y 3 (0,5 puntos). Cita un ejemplo de clula presentadora de antgenos (0,25 puntos).
b. Qu son las linfoquinas? (0,25 puntos)
c. Qu diferencia hay entre una clula B y una clula plasmtica? (0,5 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

4.- Haz corresponder los conceptos a sus definiciones:


CONCEPTO

DEFINICIN

Nucletido

Molcula que es la base de las membranas celulares. Presenta una parte


hidrfila y otra hidrfoba
..

Meiosis

Cada uno de los monmeros que forma un cido nucleico. Est


formado por una pentosa, una base nitrogenada y una molcula de
cido fosfrico

Fosfolpido

Proceso de divisin celular en el que de una clula madre


diploide, se obtienen cuatro clulas hijas con un nmero de
cromosomas haploide
..

Esterilizacin

Conjunto de genes que posee un individuo


..

Genotipo

Es la eliminacin total de los microorganismos de los medios de


cultivo, del material y de los utensilios de laboratorio
..

(Cada respuesta correcta vale 0,5 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es


correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1.- La molcula representada se llama tambin adenosn monofosfato o AMP.


a. Puedes decir de qu tipo de biomolculas forma parte y por qu? (0,5 puntos).
b. Reconoce cada uno de sus componentes (0,5 puntos), y los enlaces mediante los que se unen (0,5
puntos).
c. Representa una macromolcula de la que pueda formar parte el AMP (1 punto).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2.- Completa el siguiente dibujo, rellenando toda la informacin que se ha eliminado (1 punto).
Define los procesos representados mediante flechas (1punto), y el que tiene lugar en el citoplasma
(0,5 puntos), mediante el que se obtiene la ltima molcula sealada.

3.- De qu ciclo vrico se trata? (0,25 puntos), por qu? (0,25 puntos).
a. Qu tipos de virus describen este ciclo? (0,25 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

Cita algn ejemplo (0,25 puntos).


b. Indica a qu fase del ciclo corresponde cada nmero (0,75 puntos), y comenta los hechos ms
relevantes que ocurren en dicha fase (0,75 puntos).

4.- Haz corresponder los conceptos a sus definiciones:


CONCEPTO

DEFINICIN

Micosis

Son clulas del sistema inmunitario que se localizan en los


tejidos, procedentes de la emigracin desde la sangre a partir
de un tipo de leucocito llamado monocito .

Priones

Son protenas que disminuyen la energa de activacin


necesaria para que se produzca una reaccin qumica en un
ser vivo
.

Anabolismo

Infeccin producida por hongos

Enzima

Partcula subviral, constituida exclusivamente por protenas. Se


asocian a enfermedades degenerativas del sistema nervioso
Central de desarrollo lento
.

Macrfago

..

Es el conjunto de reacciones qumicas de sntesis que tienen


lugar en la clula

(Cada respuesta correcta vale 0,5 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es


correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1.- Describe la estructura de una de las dos molculas representadas en el dibujo (0,75 puntos).
a. Menciona el tipo de enlace que une las dos molculas representadas y comenta las caractersticas
de dicho enlace (0,75 puntos).
b. Describe a qu se debe la capacidad de esta molcula como disolvente de compuestos inicos,
como el cloruro sdico o sal comn (1 punto).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2.- La grfica representa la variacin del contenido de ADN durante el ciclo celular. Responde a las preguntas
que se formulan a continuacin:
a. La grfica corresponde a un ciclo meitico o mittico? por qu?
(0,75 puntos).
b. Cmo se denomina a la fase que transcurre entre 4 y 5?
(0,5 puntos).
c. Si la cantidad de ADN no se ha modificado al final del ciclo, qu utilidad tiene este proceso? (0,5
puntos).
d. Cules son las diferencias fundamentales entre mitosis y meiosis?
(0,75 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

3.- Reconoce de qu tipo de ciclo vrico se trata, en qu te basas? (0,5 puntos).


a. Indica cmo se llama cada una de las etapas representadas (0,5 puntos).
b. Nombra los componentes que aparecen en cada una de ellas (0,75 puntos).
c. Comenta los sucesos ms relevantes que se producen en cada etapa (0,75 puntos).

4.- La lactancia Materna proporciona al beb inmunidad natural pasiva.


a. Distingue en qu consiste, en este caso, este tipo de inmunidad (0,75 puntos).
b. Pon otro ejemplo diferente de inmunidad natural pasiva (0,75 puntos).
c. Distingue en qu consiste la inmunidad artificial pasiva y cundo debe utilizarse
(1 punto).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.

La puntuacin mxima de cada pregunta est indicada en cada enunciado.

En las preguntas donde se proponen varias soluciones, slo una es


correcta.

Revisa cuidadosamente la prueba antes de entregarla.

1.- A la vista del siguiente dibujo, deduce si se trata de una clula procariota o eucariota
(0,5 puntos).
a. Comenta las razones por las que has llegado a una conclusin (0,5 puntos).
b. Indica el nombre de las estructuras sealadas (0,75 puntos), y la funcin que realizan dichas
estructuras (0,75 puntos).
.

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2.- Los hijos varones de una pareja cuya madre es daltnica y padre no daltnico, sern:
a. Todos daltnicos
b. El 50% daltnicos y el otro 50% normales
c. El 50% daltnicos y el otro 50% portadores
- Indica la respuesta correcta (0,5 puntos).
- Justifica la respuesta realizando el cruzamiento (2 puntos).

3.- Reconoce y explica el proceso representado (1 punto).


a. Qu es un alrgeno? Cita algn ejemplo (0,5 puntos)
b. Qu efectos producen la histamina y las prostaglandinas? (0,5 puntos).
c. Qu son mastocitos? Dnde se encuentran? (0,5 puntos)

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

4.- Haz corresponder los conceptos a sus definiciones:


CONCEPTO

DEFINICIN

Catabolismo

Proceso de transferencia de un plsmido de una bacteria a otra


mediante un pelo sexual o pili
..

Replicacin
del ADN

Enfermedad autoinmune, que afecta al sistema nervioso central


y ocasiona la prdida de mielina en las fibras nerviosas
.

Conjugacin

Trmino que indica colonizacin de un organismo husped


por microorganismos patgenos .

Esclerosis
mltiple

Proceso de obtencin de dos nuevas hebras de cido nucleico


a partir de dos hebras que actan como molde ..

Infeccin

Conjunto de reacciones degradativas que ocurren en la clula y


en las que se obtiene ATP

(Cada respuesta correcta vale 0,5 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente el texto y las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
En las preguntas donde se proponen varias soluciones, slo una es correcta.
Revisa cuidadosamente la prueba antes de entregarla.

1- En el siguiente dibujo aparece una clula tipo con algunos de los principales componentes que la forman. La
tabla adjunta muestra las funciones que desempean estos componentes celulares.

CLOROPL

NCLEO

MITOCONDR

CITOPLASMA

a)Completa la tabla, asignando a cada componente su funcin. Escribe los nombres completos de los
componentes.(1 punto)
Proporciona la energa que necesita la
clula para desarrollar sus funciones.
Contiene todas las instrucciones
necesarias para mantener viva a la
clula
Permite a las clulas que lo poseen
realizar el proceso de la fotosntesis.
Es medio en que alberga todos las
estructuras internas de la clula.
b)Para finalizar, responde a las siguientes preguntas:
-Qu componente se debera eliminar si esta clula fuese del tipo animal? (0,75 puntos)

-Qu componente, que mantiene la forma de la clula, se debera aadir para que sta fuese la de un
vegetal?(0,75 puntos)

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2- En la purificacin de un fragmento de ADN se ha perdido una porcin de una de las dos hebras, quedando la
secuencia de bases nitrogenadas como se indica a continuacin. Reconstruye la porcin que falta (1,25 puntos)
y explica en qu te basas para reconstruirla (1,25 puntos).

3ATTACCC.................
5TAATGGGCCGAATTCGGCTAAGCT 3

3- En la industria alimentaria existen procesos en los que se utilizan levaduras.


a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen
levaduras e indica cmo se denomina el proceso metablico que tiene lugar (1,25 puntos)
b) Realiza un esquema de la organizacin celular de las levaduras (1,25 puntos)

4- La grfica siguiente representa la produccin de anticuerpos (unidades arbitrarias) a lo largo de casi dos
meses de haber inyectado a un animal dos antgenos. El antgeno 1 se inyecta en los das 0 y 28. El antgeno 2
slo el da 28.

a) Interpreta las curvas A y B. A qu tipo de respuesta inmunitaria se refieren? (1 punto)


b) Qu es la memoria inmunolgica? Est representada en la grfica? (0,75 puntos).
c) Si el animal hubiese estado vacunado frente a un virus portador del antgeno 2, cmo habra
sido la evolucin de la curva B? Por qu? (0,75 puntos).

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1.- Todos los seres vivos, desde los ms sencillos organismos unicelulares hasta los organismos
superiores complejos, estamos constituidos por clulas; unidades bsicas funcionales y
estructurales de la vida. La mayor parte de los tipos celulares sigue un ciclo vital comn,
aunque no todas ellas llevan a cabo los mismos procesos metablicos
A.- Observa el siguiente esquema del ciclo celular y rellena el cuadro que se te proporciona a continuacin
indicando en cules de las fases del ciclo se producen los fenmenos descritos en la tabla. (1 punto)

Proceso

Fase

Desaparece de la membrana nuclear


Aparecen de nuevo los nucleolos
Se duplica el par de centriolos
El ADN, ya duplicado, empieza a condensarse
Se produce la duplicacin del ADN
Se repara el ADN
El nucleolo desaparece paulatinamente
Comienzan a desespiralizarse los cromosomas
Se separan los centrmeros llevando unidas sus correspondientes cromtidas
Los cromosomas, en su mximo grado de empaquetamiento, se disponen en el
plano ecuatorial

OPCIN C - GS
5/12

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B. Escribe el concepto correspondiente a cada una de las definiciones sobre distintos procesos
metablicos que se hacen a continuacin. (1 punto)
El conjunto de reacciones metablicas cuya finalidad consiste en
proporcionar a la clula ATP, poder reductor y precursores metablicos se
llama
El conjunto de procesos bioqumicos mediante los cuales las clulas
sintetizan la mayora de las sustancias que lo constituyen se denomina
El orgnulo responsable de la respiracin celular se llama
El orgnulo directamente implicado en la fotosntesis se denomina
La fijacin del CO2 en la fotosntesis se lleva a cabo en la fase

2.- Los cidos nucleicos son las molculas que contienen la informacin sobre las caractersticas
biolgicas de los seres vivos. Para la transmisin y manifestacin de esta informacin, son
necesarios varios procesos celulares, en los cuales, a veces se producen errores.

A. Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F). Reconstruye correctamente en
la casilla inferior las que estn mal formuladas. (1 punto)

VoF
El proceso de transcripcin consiste en copiar una parte del mensaje gentico desde su forma
original (ADN) a otra (ARN) que se pueda utilizar para la sntesis de protenas.

La recombinacin gentica tiene lugar en las primeras etapas de la meiosis.

Las clulas de cada especie tienen su propio cdigo gentico

Una caracterstica del cdigo gentico es que existe el mismo nmero de seales codificadoras
en el ARN que aminocidos van a ser codificados.

B. Una mutacin en el gen que controla el tipo de alas en una raza de pollos de granja provoca atrofia de las
alas. Un pollo con las alas atrofiadas es hijo de una pareja de animales de alas normales. Responde a las
preguntas que se realizan a continuacin:

OPCIN C - GS
6/12

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

- Cul es el modo de herencia de la mutacin? Justifica tu respuesta. (1 punto)


....................................................................................................................................................................
....................................................................................................................................................................
....................................................................................................................................................................
- Cules seran los genotipos para ese carcter del pollo mutante y de ambos progenitores? Dibuja el
esquema correspondiente. (1,5 puntos)

3.- El zologo y fisilogo britnico Peter B. Medawar, Premio Nobel de Fisiologa y Medicina de
1960, defini los virus como un fragmento de malas noticias envuelto en una protena
A. Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F). Reconstruye correctamente en
la casilla inferior, las que estn mal formuladas. (1 punto)
VoF
Los virus son las formas celulares ms pequeas que existen.

Los virus slo pueden ser parsitos de animales.

Todos los virus contienen ADN.

La cpsida de los virus est constituida por ADN.

B. Describe brevemente el ciclo ltico de un virus. (1,5 puntos)

OPCIN C - GS
7/12

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

4.- La inmunologa estudia los procesos implicados en el rechazo de los organismos a las
sustancias extraas o potencialmente dainas. Este rechazo se lleva a cabo gracias a la accin
del sistema inmunitario. En algunas ocasiones se producen inmunodeficiencias, siendo uno de
los casos ms graves el SIDA.
A.- Define inmunidad humoral. (0,5 puntos)
....................................................................................................................................................................
....................................................................................................................................................................
....................................................................................................................................................................
....................................................................................................................................................................
B.- Define antgeno. (0,5 puntos)
....................................................................................................................................................................
....................................................................................................................................................................
....................................................................................................................................................................
....................................................................................................................................................................
C.- Enumera y describe las vas de contagio del VIH. (1 punto)
....................................................................................................................................................................
....................................................................................................................................................................

......................................................................................................................................................
......................................................................................................................................................
......................................................................................................................................................
......................................................................................................................................................
......................................................................................................................................................

OPCIN C - GS
8/12

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

Junio 2011
OPCIN C: BIOLOGA

DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. Completa la siguiente tabla sobre las molculas constituyentes de las biomolculas y sus principales
funciones. (1 punto)
Biomolcula

Molcula

Nombre de la molcula:
Biomolcula de la que es subunidad:
Principal funcin:

Nombre de la molcula:
Biomolcula de la que es subunidad:
Principal funcin:

Nombre de la molcula:
Principal funcin:

Nombre de la molcula:
Biomolcula de la que es subunidad:
Principal funcin:

OPCIN C - GS
3/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2. La siguiente grfica representa la variacin en la cantidad de ADN durante el ciclo celular. Completa la tabla
con las fases del ciclo celular a la que corresponde cada intervalo de la grfica, y con la descripcin de los
sucesos principales que ocurren en cada una de estas fases. (1 punto)

Intervalo

Fase del ciclo celular

Sucesos ms importantes

12

2-3

3-4

4-5

3. El siguiente esquema representa a un cloroplasto. Responde a las siguientes cuestiones:

A. En qu tipo celular podemos encontrar este orgnulo y qu importante proceso realiza en dichas
clulas? (0,5 puntos)

OPCIN C - GS
4/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B. Nombra cada una de las estructuras sealadas con nmeros: (1,6 puntos)

C. En cul de las anteriores estructuras se realiza la fase luminosa y en cul la fase oscura? (0,4 puntos)

Fase luminosa
Fase oscura

4. En relacin con el esquema, contesta las siguientes cuestiones:

A. Nombra los procesos sealados con las letras A, B y C, indicando, adems, dnde ocurre cada uno
dentro de la clula eucariota. Descrbelos brevemente. (1,5 puntos)
Nombre del proceso

Lugar donde ocurre

Breve descripcin del proceso

B. Un investigador encuentra que entre los ratones de su laboratorio se ha producido una mutacin
espontnea en un macho. Tras cruzarlo con una hembra normal, comprueba que en la descendencia
ningn macho presenta la mutacin, pero en cambio s la presentan todas las hembras. Indica qu
OPCIN C - GS
5/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

tipo de mutacin ha podido producirse (0,5 puntos). Qu porcentaje de individuos mutantes cabra
esperar en la descendencia si se cruza una hembra mutante (del cruce anterior) con un macho normal?
(0,5 puntos) Razona las respuestas.
Tipo de mutacin:
% de individuos mutantes:
Razonamiento:

5. La microbiologa estudia los organismos microscpicos. Muchos microorganismos son perjudiciales para el
ser humano, sin embargo hay otros que nos proporcionan beneficios. Redacta un texto de unas 10 lneas
(150 palabras aproximadamente) en el que expongas el concepto de Biotecnologa, as como la importancia
de los microorganismos en sectores como el de la agricultura, farmacia, sanidad y alimentacin. Debers
precisar, al menos, dos procesos industriales donde intervengan microorganismos. (1,5 puntos)

OPCIN C - GS
6/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

6. Todos los organismos presentan unos mecanismos de defensa orgnica, que aseguran su integridad
funcional y de los que se encarga el sistema inmune. Algunas veces el sistema inmunitario no funciona
correctamente.
A. Responde a las siguiente cuestin: En qu consiste la inmunidad celular y qu clulas estn
implicadas? (1 punto)

B. Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F). (0,5 puntos)

[ ] El sistema inmunitario no est capacitado para eliminar clulas propias, lesionadas o enfermas,
como las cancergenas, sino que slo destruye clulas extraas al organismo.

[ ] Nuestro organismo cuenta con barreras especficas ante la entrada de cualquier agente patgeno,
como son la piel y el proceso de fagocitosis, realizado por glbulos rojos.

[ ] Cualquier molcula ajena al organismo se conoce con el nombre de anticuerpo, y puede


desencadenar la respuesta inmunitaria.

[ ] Los sntomas caractersticos de la respuesta inflamatoria son: rubor, tumor, dolor, sudor y calor.

OPCIN C - GS
7/10

CONSEJERA DE EDUCACIN

Direccin General de Formacin Profesional


y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

Junio 2012
OPCIN C: BIOLOGA

DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. La clula y la base fsico-qumica de la vida. Fisiologa celular.


A. Relaciona las imgenes que se representan, con las funciones de las biomolculas correspondientes;
indicando su importancia biolgica en la clula (1 punto; 0.25 por imagen):
Imagen

Biomolcula y funcin representada

Archivo libre de wikimedia commons

Archivo libre de wikimedia commons

Archivo libre de wikimedia commons

OPCIN C - GS
3/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

Archivo libre de wikimedia commons


B. La fotosntesis es un proceso fundamental para la vida que se lleva a cabo en el orgnulo que se
representa a continuacin. Responde con una palabra o frase corta a las cuestiones que se hacen en relacin
a dicho proceso (1 punto):

Archivo libre de wikimedia commons


La fotosntesis se lleva a cabo en el orgnulo denominado ___________________ y se divide en dos fases:

Fase clara: en ella la luz solar acta sobre el ___________________ y se produce


___________________ y __________ ____________, liberndose oxgeno. Esta fase se lleva a
cabo en los _________________Indicados en el dibujo con los nmeros:
_________________________
Fase oscura: los productos obtenidos de la fase anterior salen de las estructuras anteriores para
dirigirse al _________________, sealado con el nmero _____. All, tiene lugar un conjunto de
reacciones conocido como _________________________, mediante el que el
_________________ se fija y se convierte en _______________, ________________________
y __________ ______________________, que son fuente de materia y energa para todos los
seres vivos.

* (Ms de 10 aciertos: 1 punto. Entre 5 y 10 aciertos: 0,5 puntos. Menos de 5 aciertos: 0 puntos)

OPCIN C - GS
4/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2. La base de la herencia. Gentica molecular.

A. En el siguiente texto sobre el material gentico, se han cometido varios errores. Subraya las frases
incorrectas y justifica por qu crees que lo son (2 puntos):

El ADN en eucariotas, es una molcula que se encuentra en el ncleo celular hasta que llega el momento de la
transcripcin. Llegados a ese punto, tiene que salir al citoplasma para poder copiar su mensaje y pasarlo a
ARN mensajero. El proceso de duplicacin de la cadena de ADN se denomina replicacin, y tiene lugar en el
ncleo celular. A partir de una molcula de ADN de doble cadena, se producen dos dobles cadenas que
conservan una hebra de la molcula antigua y otra de la nueva; por ello se dice que es semiconservativa.
Antes de que la informacin contenida en el ADN se exprese en forma de protenas, es necesaria la
transcripcin, por la que el mensaje pasa primero a una cadena de ARN ribosmico. Este ARN, es ledo en los
ribosomas y traducido a lenguaje de protenas. Cada triplete de nuclotidos del ARN, lleva informacin para un
solo aminocido, y cada aminocido, es codificado por un solo triplete de nucletidos. .
Frase errnea:

Razonamiento correcto:

Frase errnea:

Razonamiento correcto:

Frase errnea:

Razonamiento correcto:

OPCIN C - GS
5/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B. En una raza de perros, el color negro del pelaje (N) domina sobre el color marrn (n). Calcula los
genotipos y fenotipos de la F1 y F2 entre un ratn negro y una hembra gris, ambos puros para dichos
caracteres. (1 punto).

3. Microbiologa y biotecnologa.
A. Define microorganismo (1 punto):
..........................................................................................................................................................................
..........................................................................................................................................................................
..........................................................................................................................................................................
..........................................................................................................................................................................
..........................................................................................................................................................................
..........................................................................................................................................................................
..........................................................................................................................................................................

B. Completa la tabla (1 punto).:


Tipo de microorganismo

Acelular o celular

Eucariota o procariota

OPCIN C - GS
6/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

C. Las bacterias intercambian material gentico entre ellas por tres procesos diferentes, completa la
tabla que aparece a continuacin describiendo dichos procesos (1 punto):
Proceso

Descripcin

4. Inmunologa.
A. Indica si las siguientes afirmaciones son verdaderas o falsas e indica la respuesta correcta en su caso (1
punto; 0.2 cada frase correctamente contestada):
Afirmaciones
El proceso inflamatorio es un mecanismo de defensa inespecfico en el que el aumento de
temperatura de la zona no tiene ningn fin propiamente dicho, es slo una consecuencia.

VoF

El interfern es un mecanismo de respuesta especfico para un tipo concreto de virus.

La respuesta celular es un tipo de mecanismo de defensa inespecfico, porque el linfocito T


requiere de la presentacin del patgeno por parte del macrfago.

Aunque la reaccin del complemento no es especfica, se puede activar con la unin del
antgeno bacteriano al anticuerpo.

Las inmunoglobulinas implicadas en los procesos alrgicos son las IgM

OPCIN C - GS
7/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B. Interpreta la siguiente grfica en relacin a la respuesta inmune a lo largo del tiempo (1 punto):

Archivo libre de wikimedia commons

OPCIN C - GS
8/10

CONSEJERA DE EDUCACIN

Direccin General de Formacin Profesional


y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

Junio 2013
OPCIN C: BIOLOGA

DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. Enumere y analice brevemente las funciones de las protenas. (2 puntos, 0.25 por funcin)

OPCIN C - GS
3/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2. La siguiente figura representa un orgnulo celular. (1.5 punto)

A. Qu orgnulo representa? (0.25)


B. Qu proceso se representa en la ilustracin? (0.25)
C. Qu fases del proceso representan los nmeros 1 y 2? (0.5)

D. En una de las fases de este proceso se libera O2. De dnde sale el O2 liberado? (0.5)

3. Las dos clulas de las ilustraciones pertenecen al mismo individuo. En ambos casos la clula se encuentra
en un proceso de divisin celular. (1.5 puntos)

A. A qu tipo de divisin celular pertenece cada diagrama? (0.5)


B. A qu fase de la divisin celular corresponde cada dibujo? (0.5)

OPCIN C - GS
4/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

C. Indica si cada una de las clulas son haploides o diploides razonando tu respuesta. (0.25)

D. Explica los acontecimientos ms importantes que ocurren durante la profase I de la Meiosis. (0.25)

4. Un granjero ha cruzado dos lneas puras de gallinas, unas de plumaje marrn (M) y cresta sencilla (s) y
otras de plumaje blanco (m) y cresta en roseta (S). Los caracteres marrn y cresta roseta son dominantes
sobre plumaje blanco y cresta sencilla, adems de ser genes independientes. Qu proporciones fenotpicas se
obtendrn en la segunda generacin filial (F2)? (1 punto)

5. Elabora un esquema o un texto corto en el que: menciones todos los distintos tipos de microorganismos de
forma celular que existen, indiques el tipo de organizacin celular (procariota/eucariota) de todos ellos y hagas
referencia al tipo de nutricin (auttrofa/hetertrofa) de cada uno. (2 puntos)

OPCIN C - GS
5/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

6. La autoinmunidad, la hipersensibilidad y la inmunodeficiencia son anomalas del sistema inmunitario.


Completa el siguiente texto relacionado con la hipersensibilidad. (2 puntos)
El alrgeno que entra en el organismo es interceptado por el ______________.
El ____________ ingiere el alrgeno y presenta sus fragmentos en la superficie con el fin de activar los
linfocitos T.
Los linfocitos T identifican al alrgeno y envan una seal a los ______________, que se transforman en
_______________ ____________.
Las _______________ ____________ producen ______ , contra el alrgeno. La _____ se une a la
superficie de los _______________. El sistema inmune est ahora _____________ frente a un alrgeno
concreto.
Tras una segunda exposicin al alrgeno, el __________ se activa y libera mediadores como __________ y
_______________ que son los causantes de los sntomas de la alergia.

OPCIN C - GS
6/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


OPCIN C: BIOLOGA
DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1.- Todos los seres vivos, desde los ms sencillos organismos unicelulares hasta los organismos
superiores complejos, estamos constituidos por los mismos tipos de molculas. Cada uno de
estos tipos de molculas tiene funciones especficas en la clula; unidad funcional y
estructural de los seres vivos. (2,5 puntos).
A. Completa la siguiente tabla sobre las biomolculas y sus funciones, siguiendo el ejemplo que se
proporciona (0,1 punto cada item):

Tipo de biomolcula:
Grupo del que es subunidad:
Principal funcin:

Tipo de biomolcula:
Principal funcin:

Tipo de biomolcula:
Principal funcin:

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

Tipo de biomolcula:
Grupo del que es subunidad:

B.- Completa los nombres que faltan en la representacin del ciclo celular (0,2 puntos cada concepto):

2.- La molcula que contiene la informacin de las caractersticas biolgicas de los seres vivos es
el ADN. A continuacin, se representa un fragmento de cadena de ADN simple. Realiza los
ejercicios que se proponen sobre ella: (2,5 puntos)
A-T-A-C-G-C-G-T-C-G-C-T-G-C-C-G-G-T-A-A-C-C-A-T-T-C-A-A-C-G-T-T-G-
A. Escribe la secuencia de su cadena complementaria (ADN) (0,5 puntos):

B. Escribe la cadena resultante del proceso de transcripcin del fragmento del enunciado. (0,5
puntos) De qu tipo de molcula se trata? (0,5 puntos)

Tipo de molcula:

C. Usando la tabla que se aporta a continuacin, escribe la secuencia resultante de la traduccin


del fragmento del apartado B (0,5 puntos) De qu tipo de molcula se trata? (0,5 puntos)

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

Las abreviaturas usadas en el cuadro significan lo siguiente: Phe=Fenilalanina, Leu=Leucina,


Ile=Isoleucina, Met=Metionina, Val=Valina, Ser=Serina, Pro=Prolina, Thr=Treonina, Ala=Alanina,
Tyr=Tirosina, His=Histidina, Gln=Glutamina, Asn=Asparagina, Lys=Lisina, Asp=cido Asprtico,
Glu=cido Glutmico, Cys=Cistena, Trp=Triptfano, Arg=Arginina y Gly=Glicina.
SECUENCIA:

3.- Los microorganismos componen un grupo muy heterogneo, algunos poseen una estructura
tpicamente procariota, otros tienen una organizacin eucariota y otros una organizacin
acelular. (2,5 puntos)
A.- En la tabla que aparece a continuacin, responde las cuestiones que se realizan acerca de los
microorganismos que aparecen en las imgenes (1 punto):
Tipo de microorganismo:
Tipo de organizacin celular:
Alguna enfermedad provocada por microorganismos de este
grupo:

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

Tipo de microorganismo:
Subtipo segn su estructura:
Tipo de organizacin celular:
Alguna enfermedad provocada por microorganismos de este
grupo:
Tipo de microorganismo:
Tipo de organizacin celular:
Alguna enfermedad provocada por microorganismos de este
grupo:

B. Define brevemente el ciclo lisognico de los virus atemperados (1,5 puntos).

4.- La inmunologa estudia los procesos implicados en el rechazo de los organismos a las
sustancias extraas o potencialmente dainas. Este rechazo se lleva a cabo gracias a la accin
del sistema inmunitario. En algunas ocasiones, se producen inmunodeficiencias; uno de los
casos ms graves lo constituye el SIDA. (2,5 puntos).
A. Describe brevemente las barreras externas o defensas pasivas (1 punto):
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B.- Enumera y distingue los distintos tipos de inmunidad (1 punto).


..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
C.- Explica brevemente en qu consiste el SIDA (0,5 puntos).
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................
..................................................................................................................................................................

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

Septiembre 2011
OPCIN C: BIOLOGA

DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. Todos los seres vivos comparten una composicin qumica similar, desde los organismos unicelulares ms
sencillos hasta los organismos pluricelulares superiores ms complejos; igualmente compartimos un mismo
nivel de organizacin, el celular, si bien con importantes diferencias segn el tipo celular al que pertenezca.
Tambin encontramos diferencias en cmo obtienen materia y energa, es decir, no todas las clulas llevan
a cabo los mismos procesos metablicos. (4 puntos)
A. Lee en la siguiente tabla las propiedades y/o caractersticas que aparecen en relacin con las biomolculas
que forman parte de los seres vivos. Tendrs que rellenar en la columna de la derecha el nombre de la
biomolcula que se corresponde con cada una de ellas. (1 punto)
Propiedades o caractersticas

Biomolcula

A este grupo pertenecen molculas de naturaleza qumica muy heterognea.


Se clasifican en saponificables e insaponificables.
Formadas por Carbono, Hidrgeno y Oxgeno. Son molculas energticas,
es decir, son utilizadas por los seres vivos para obtener energa, aunque
tambin forman estructuras resistentes como el exoesqueleto de artrpodos
o la pared de clulas vegetales.
Estn formadas por monmeros o unidades que presentan una estructura
bsica comn: un grupo amino, un grupo cido, una molcula distinta para
cada tipo de monmero llamado R y un hidrgeno.
Es la biomolcula ms abundante en los seres vivos, y entre sus
propiedades fsico-qumicas destacan: la elevada fuerza de cohesin entre
sus molculas, elevado calor especfico, elevado calor de vaporizacin o
gran poder disolvente.

OPCIN C - GS
3/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B. Identifica 8 de los orgnulos de la siguiente clula, indicando a qu tipo celular corresponde:


eucariota animal, eucariota vegetal o procariota. No olvides justificar tu eleccin. (1,5 puntos)

Orgnulo

La imagen corresponde a una clula________________


Justificacin:

C. Indica si las siguientes afirmaciones son verdaderas (V) o falsas (F). Transforma las afirmaciones

errneas en verdaderas utilizando la casilla inferior. (1,5 puntos)

OPCIN C - GS
4/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

VoF
La fotosntesis es un proceso catablico que ocurre en la mitocondria
El metabolismo comprende el conjunto de reacciones qumicas que ocurren en la clula
El orgnulo responsable de la respiracin celular se llama cloroplasto

La nutricin auttrofa implica que no se puede fabricar materia orgnica


Un ejemplo de proceso anablico es la respiracin celular y consiste en la combustin de
glucosa para obtener energa.

2. En el ncleo de nuestras clulas se almacena la informacin gentica, transmitindose a las clulas hijas
mediante la divisin celular, y gracias a otras molculas parecidas, esta informacin se expresa en cada ser
vivo, ayudndose de determinados orgnulos celulares y utilizando parte de la maquinaria celular. (3puntos)
A.- Supongamos que la sonda espacial Rosetta ha enviado una serie de datos a la Agencia Espacial Europea
(ESA) sobre molculas encontradas en un cometa de nuestro Sistema Solar. Al analizar estos datos las
molculas se corresponden con: ADN, ARNr, ARNm, ARNt, aminocidos y protenas. Con esta informacin la
Agencia Espacial Europea (ESA) est elaborando unas conclusiones sobre actividad vital en algn lugar de
nuestro Sistema Solar. Podras ayudar a la ESA respondiendo a las preguntas que se realizan a
continuacin?: (2 puntos)
-

Qu orgnulo no membranoso debe estar implicado para que puedan encontrarse todas estas
molculas a la vez? Qu procesos estn involucrados en la transferencia y expresin de la informacin
gentica? (0,75 puntos)

En cul de estas molculas se almacena la informacin gentica? (0,5 puntos)

Qu es el cdigo gentico? (0,5 puntos) El cdigo gentico es universal, degenerado y no presenta


solapamiento, podras explicar cada una de estas caractersticas? (0,75 puntos)

OPCIN C - GS
5/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

B.- Relaciona los conceptos de la primera columna con los de la segunda. (1 punto)
1. Haploide

a. Anafase I

2. Separacin de cromosomas

b. Profase I

3. Recombinacin gentica

c. Gameto

4. Separacin de cromtidas

d. Fecundacin

5. Fusin de gametos

e. Anafase II

3. La microbiologa estudia los organismos microscpicos. Dentro de esta ciencia pueden encontrarse a los
virus, aunque tambin pueden estudiarse como una ciencia independiente, la virologa. Muchos
microorganismos son perjudiciales para el ser humano, sin embargo hay otros que nos proporcionan
beneficios.
Los virus presentan dos formas de ciclos de reproduccin o ciclos vitales. En esta imagen aparece
representado uno de ellos.

Completa la tabla con las fases del ciclo de vida del virus que representa la imagen, indicando el nmero
correspondiente. (1 punto)
N

Fase del ciclo de vida

Liberacin cido nucleico

4b

Sntesis de protenas vricas

OPCIN C - GS
6/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

4. En relacin con el esquema, contesta las siguientes cuestiones: El funcionamiento del sistema inmunitario se
basa en su capacidad para reconocer molculas extraas al propio organismo y poner en marcha los
mecanismos necesarios para eliminarlas o neutralizar su accin. Algunas veces el sistema inmunitario no
funciona correctamente. (2 puntos)
A.- Completa las frases que se proponen a continuacin: (0,5 puntos)

Una ___________________ es la invasin de un ser vivo por patgenos capaces de causar dao en
el husped.

La inflamacin es un mecanismo de defensa ____________________________, puesto que acta


frente a cualquier agente extrao que invada el organismo.

Los ____________________ son clulas responsables del reconocimiento especfico de los agentes
patgenos, iniciando las respuestas inmunitarias adaptativas.

Las clulas plasmticas sintetizan los _______________, tras un proceso de activacin y


diferenciacin.

La inmunidad __________________ especfica se lleva a cabo por los linfocitos T, que reconocen al
antgeno mediante su receptor antignico especfico (TCR).

B.- Redacta un texto de unas 10 lneas (150 palabras aproximadamente) en el que expongas en qu consiste
el SIDA, cules son sus sntomas, y cules las vas de transmisin y prevencin de la enfermedad, adems de
distinguir entre seropositivos y enfermos. (1,5 puntos)

OPCIN C - GS
7/10

CONSEJERA DE EDUCACIN

Direccin General de Formacin Profesional


y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

Septiembre 2012
OPCIN C: BIOLOGA

DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:
Lee atentamente las preguntas antes de contestar.
La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. Relaciona las imgenes que se representan con orgnulos celulares, indicando la funcin que desempea
cada uno y en qu tipo celular -animal o vegetal- pueden encontrarse (2 puntos; 0.5 por imagen):
Nombre del
orgnulo

Funcin que
desempea

Tipo celular donde se


encuentra

Recurso propio

Imagen modificada de Wikimedia


Commons bajo CC

Imagen en Educared bajo CC

Imagen modificada de Wikimedia


Commons bajo CC.

OPCIN C - GS
3/8

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2. La base de la herencia. Gentica molecular: (3,5 puntos)


A. La siguiente imagen representa un tipo de divisin celular. Responde a las siguientes cuestiones (2 puntos;
0,25 el apartado a; 1,5 el apartado b; y 0,25 el apartado c).

Imagen de dominio pblico

a) De qu divisin se trata? _______________________


b) Qu ocurre en 1, 2 y 3?

c) Qu diferencias hay entre la clula de la izquierda y las cuatro clulas de la derecha?

B. Un hombre de grupo sanguneo A, cuyo padre era de grupo 0, se casa con una mujer de grupo sanguneo
B, cuyos padres eran ambos del grupo AB.
Determina el genotipo de ambas personas. Qu grupo sanguneo heredaran sus posibles hijos? Realiza el
cruce. (1,5 punto).

OPCIN C - GS
4/8

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

3. Microbiologa y biotecnologa. (2,5 puntos)


A. Describe el ciclo lisognico de un virus (1,5 punto).

B. Completa la siguiente tabla sobre los tipos de microorganismos y algunas de sus principales caractersticas
(1 punto).
Bacterias

Hongos

Protozoos

Algas

Tipo de organizacin celular


(eucariota/procariota)
Tipo de nutricin
(auttrofa/hetertrofa)
Fotosntesis
(SI/NO)

OPCIN C - GS
5/8

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

4. En el siguiente texto sobre inmunologa se han cometido varios errores. Copia en la tabla las frases
incorrectas y justifica por qu crees que lo son: (2 puntos)

Las inmunodeficiencias son situaciones patolgicas producidas como resultado del exceso de la funcin normal
de uno o ms elementos del sistema inmunitario. Entre las inmunodeficiencias secundarias se puede citar la
producida por el virus de la inmunodeficiencia en simios (VIH), causante del SIDA. Las vas de transmisin del
virus son: por contacto con sangre infectada, mediante relaciones sexuales, de la placenta de la madre
infectada al hijo y por besar a una persona infectada. A los dos meses de la transmisin se pueden detectar en
el suero sanguneo los anticuerpos producidos frente al virus; se dice entonces que el individuo es enfermo de
SIDA.
Frase errnea:
Razonamiento correcto:

Frase errnea:
Razonamiento correcto:

Frase errnea:
Razonamiento correcto:

Frase errnea:
Razonamiento correcto:

OPCIN C - GS
6/8

CONSEJERA DE EDUCACIN

Direccin General de Formacin Profesional


y Educacin Permanente

PRUEBA ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

Septiembre 2013
OPCIN C: BIOLOGA

DATOS DEL ASPIRANTE

CALIFICACIN PRUEBA

Apellidos:

Nombre:

D.N.I. o Pasaporte:

Fecha de nacimiento:

Instrucciones:

Lee atentamente las preguntas antes de contestar.


La puntuacin mxima de cada pregunta est indicada en cada enunciado.
Revisa cuidadosamente la prueba antes de entregarla.

1. Las biomolculas orgnicas son molculas exclusivas de los seres vivos. Indica si las siguientes
afirmaciones relacionadas con las biomolculas orgnicas son verdaderas (V) o falsas (F) y corrige las falsas: (2
puntos)
A. [ ] Las protenas estn constituidas por aminocidos.
B. [

] Los nucletidos estn constituidos por glicerina y tres cidos grasos.

C. [

] La ribosa y la desoxirribosa son monosacridos.

D. [

] El colesterol es un lpido.

E. [ ] Los glcidos estn formados carbono, hidrgeno y oxgeno, tienen al menos un grupo carbonilo y
presentan grupos hidroxilo.

F. [

] El almidn es una protena abundante en plantas.

G. [

] Los lpidos saponificables no contienen cidos grasos.

H. [

] Los fosfolpidos son anfipticos, es decir, tienen una regin hidrfila y otra hidrfoba.

I. [

] Los triglicridos estn formados por una pentosa, un grupo fosfato y una base nitrogenada.

J. [ ] Una de las diferencias entre las molculas de ADN y ARN es que el ADN contiene Uracilo, mientras
que el ADN contiene Timina.

OPCIN C - GS
3/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

2. El siguiente diagrama representa el ciclo celular, formado por la interfase y la fase M. La Interfase, a su vez,
se divide en 3 etapas, que se representan en el diagrama como A, B y C. La fase M tambin se subdivide en
una serie de fases, indicadas como 1, 2, 3, 4 y 5. (2 puntos)
5
1

A. Indica en el cuadro el nombre de cada una las fases de la Interfase (A, B, C) y los principales procesos que
ocurren durante ellas. (1.2 puntos)
Interfase:
Nombre de la fase

Procesos que ocurren durante esta fase

A
B
C

B. Indica en el cuadro el nombre de las fases 1, 2, 3 y 4. (0.8 puntos)


Fase M
1

5
Citocinesis
OPCIN C - GS
4/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

3. Se cuzaron plantas puras de guisante de tallo largo (L) y flores blancas (r) con otras de tallo enano (l) y
flores rojas (R). Sabiendo que el carcter tallo largo es dominante sobre el tallo enano y que la flor de color
blanco es recesiva respecto a la de color rojo. Explica tus respuestas. (1.5 puntos)
A. cul sern los genotipos y fenotipos de los individuos de la F1?

B. cul ser la proporcin de plantas de tallo largo y flores rojas en la F2?

C. cul ser la proporcin de dobles heterocigotos esperado en la F2?

4. Los microorganismos son un grupo muy diverso de seres vivos cuyo punto en comn es su pequesimo
tamao. Hay microorganismos que pertenecen a los grupos indicados en la tabla. Completa la tabla indicando
si estos microorganismos son procariotas o eucariotas y si son auttrofos o hetertrofos. (1.5 puntos)
Bacterias
Procariota
o Eucariota

Algas

Hongos

Protozoos

Eucariotas

Auttrofo o
Hetertrofo

Ambos
(mayormente
hetertrofos)

5. Tanto los sueros como las vacunas proporcionan inmunidad al organismo. Redacta un texto corto en el que
expliques cmo actan los sueros, contestando, al menos, a las siguientes preguntas: (1.5 puntos)
A. cul es la naturaleza de los sueros? es decir, qu contienen?

B. son una forma de inmunidad natural o artificial? por qu?

C. su uso proporciona un mtodo pasivo o activo de defensa? por qu?

OPCIN C - GS
5/10

CONSEJERA DE EDUCACIN
Direccin General de Formacin Profesional
y Educacin Permanente

D. son preventivos o curativos? generan memoria? Razona tus respuestas.

E. Cita un ejemplo de enfermedad para la que pueda usarse un suero.

6. A veces nuestro sistema inmune comete errores pudiendo provocarnos tres tipos diferentes de
enfermedades dependiendo de la naturaleza del fallo: hipersensibilidad, autoinmunidad o inmunodeficiencia.
Responde a las siguientes cuestiones relacionadas con este tema: (1,5 puntos)
A. qu es un alrgeno?

B. qu son las histaminas?

C. qu tipo de anomala provoca el virus del SIDA: hipersensibilidad, enfermedad autoinmune o


inmunodeficiencia?

D. Cita un ejemplo de un tipo de inmunodeficiencia congnita y heredable.

E. Explica qu es una enfermedad autoinmune.

F. Cita un ejemplo de enfermedad autoinmune.

OPCIN C - GS
6/10

Direccin General de Formacin Profesional


y Educacin Permanente

DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _______________________________________________
Nombre: _________________________ DNI: __________________
I.E.S. ___________________________________________________

Numrica de 0 a 10,
con dos decimales

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 19 de junio de 2009 (Orden de 8 de abril de 2009, BOA de 13/04/2009)

PARTE ESPECFICA: OPCIN 1 (BIOLOGA)

Conteste a cinco de las seis preguntas siguientes:


1. Las protenas: definicin, estructura y funciones.
2. Defina los siguientes trminos: ATP, enzima, genotipo, virus, cido graso.
3. Explique en que consiste la fotosntesis e indique las estructuras celulares en las que se
produce el proceso. Qu seres la realizan y qu importancia tiene a nivel global.
4. Defina qu es un antgeno. Qu molculas pueden desempear la funcin de antgeno?
Qu es un anticuerpo? Cite alguna clase de anticuerpos. Comente la reaccin Antgeno
- Anticuerpo.
5. Explique el funcionamiento bsico del aparato respiratorio humano.
6. Diferencias bsicas entre mitosis y meiosis.

CRITERIOS DE CALIFICACIN
- La valoracin total de la prueba es de 10 puntos.
- Cada una de las cinco preguntas contestadas se valorar hasta 2 puntos.
- En ningn caso se calificarn ms de 5 preguntas. En caso de responder total o
parcialmente todas las preguntas y no indicando cul es la no vlida, se calificarn
nicamente las cinco primeras respuestas.

1/1

Direccin General de Formacin Profesional


y Educacin Permanente

DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _______________________________________________
Nombre: _________________________ DNI: __________________
I.E.S. ___________________________________________________

Numrica de 0 a 10,
con dos decimales

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 22 y 23 de junio de 2010 (Resolucin de 12 de febrero de 2010, BOA 04/03/2010)

PARTE ESPECFICA: BIOLOGA (Opcin 1)

Conteste a cinco de las seis preguntas siguientes:


1. El agua en los seres vivos: Estructura, propiedades y funciones relacionadas.

2. La clula eucariota:
a) Estructura y orgnulos.
b) Funcin de los orgnulos.
c) Responda razonadamente: qu orgnulos y estructuras son exclusivos de las clulas
vegetales?
3. Las protenas: definicin, estructura y funciones.

4. Defina mitosis y explique sus fases.

5. Explique el funcionamiento del aparato circulatorio en el ser humano.

6. Defina brevemente los trminos: antgeno, gen, eritrocito, cadena trfica, anticuerpo, cido
graso, enlace peptdico, plaqueta, vitamina y hormona.

CRITERIOS DE CALIFICACIN:
La valoracin total de la prueba es de 10 puntos.
Cada una de las cinco preguntas contestadas se valorar hasta 2 puntos.
En ningn caso se calificarn ms de 5 preguntas. En caso de responder total o parcialmente
todas las preguntas y no indicando cul es la no vlida, se calificarn nicamente las cinco
primeras respuestas.

1/1

Direccin General de Formacin Profesional


y Educacin Permanente

DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _______________________________________________
Nombre: _________________________ DNI: __________________
I.E.S. ___________________________________________________

Numrica de 0 a 10,
con dos decimales

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 22 y 23 de junio de 2011 (Resolucin de 3 de marzo de 2011, BOA 15/03/2011)

PARTE ESPECFICA: OPCIN 1 (BIOLOGA)

Contesta a cinco de las seis preguntas siguientes:


1.- Indica las diferencias entre las clulas eucariotas animales y las clulas eucariotas vegetales.
Explica las funciones de los siguientes orgnulos: retculo endoplasmtico, aparato de Golgi,
mitocondrias y lisosomas.

2.- La fotosntesis: en qu consiste, qu procesos tienen lugar en cada una de sus fases, en que
estructuras celulares se lleva a cabo, que productos se obtienen y qu importancia tiene a nivel
global.
3.- Diferencias bsicas entre mitosis y meiosis.

4.- El aparato digestivo del ser humano: explica los mecanismos bsicos de la ingestin y digestin
de alimentos y de su asimilacin.

5.- El balance hdrico y el ciclo del agua.

6.- Define los siguientes conceptos: protena, gen, hormona, vacuna, inmunidad, virus, enzima, cido
nucleico.

CRITERIOS DE CALIFICACIN


La valoracin total de la prueba es de 10 puntos.

Cada una de las cinco preguntas contestadas se valorar hasta 2 puntos.

En ningn caso se calificarn ms de 5 preguntas. En caso de responder total o parcialmente


todas las preguntas y no indicando cul es la no vlida, se calificarn nicamente las cinco
primeras respuestas.

1/1

Direccin General de Ordenacin Acadmica

DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _______________________________________________
Nombre: _________________________ DNI: __________________
I.E.S. ___________________________________________________

Numrica de 0 a 10,
con dos decimales

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 18 y 19 de junio de 2012 (Resolucin de 21 de marzo de 2012, BOA 09/04/2012)

PARTE ESPECFICA: OPCIN 1 (BIOLOGA)


1. Funciones biolgicas de las protenas.
2. Seale las diferencias ms significativas entre los dos grandes grupos de cidos
nucleicos (ADN y ARN).
3. Respecto a los rganos celulares :
A) Qu es una mitocondria ?
B) Qu un ribosoma ?, qu papel desempea ?
C) Qu es un cloroplasto ?, en qu tipos de clulas se encuentran ?
D) Qu papel desempea el retculo endoplasmtico en una clula ?
4. Los virus estn implicados en numerosas enfermedades.
A) Qu son los virus ?
B) Cita los criterios empleados para la clasificacin de los virus.
C) Explica el ciclo ltico de los virus bacterifagos.
D) Cita enfermedades producidas por los virus.
5. Mendel cruz plantas altas y bajas. Todos los ejemplares de la primera generacin
F1 fueron altos.
A) Puede explicarnos estos resultados en trminos cientficos?
B) Qu resultado piensa que obtuvo cuando se autofecundaron los individuos de F1 ?
Exprese en ambos casos las proporciones fenotpicas y genotpicas obtenidas.
CRITERIOS DE CALIFICACIN :
 Se valorar positivamente la capacidad del alumno para sintetizar y exponer limpia y
ordenadamente el contenido de cada respuesta, as como el uso de vocabulario y la notacin
cientfica.
 Sern desetimadas las contestaciones no centradas en el mbito de la cuestin planteada.
 La valoracin total de la prueba es de 10 puntos.
 Cada pregunta tendr una calificacin que oscilar entre 0 y 10 puntos (los apartados
sern equipuntuables). La nota final del ejercicio ser la media aritmtica de las calificaciones
obtenidas de las cinco preguntas.

1/1

Direccin General de Ordenacin Acadmica

DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _______________________________________________
Nombre: _________________________ DNI: __________________
I.E.S.: ___________________________________________________

Numrica de 0 a 10,
con dos decimales

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 17 y 18 de junio de 2013 (Resolucin de 11 de febrero de 2013, BOA 27/02/2013)
PARTE ESPECFICA: OPCIN 1 (BIOLOGA)
1. Funciones biolgicas de los lpidos.
2. Fermentacin lctica.
3. Respecto a los rganos celulares :
a) Qu es un cloroplasto?
b) Qu es el Aparato de Golgi?, qu papel desempea?
c) Funciones de las vacuolas.
d) Qu papel desempea la membrana plasmtica?
4. Inmunidad artificial o adquirida.
5. En las cobayas existen tres variedades para el pelaje : amarillo, crema y blanco. Al cruzar dos
cobayas de color crema se obtienen descendientes de las tres variedades.
Qu tipo de herencia presenta el carcter planteando el cruce?

CRITERIOS DE CALIFICACIN :
 Se valorar positivamente la capacidad del alumno para sintetizar y exponer limpia y
ordenadamente el contenido de cada respuesta, as como el uso de vocabulario y la notacin
cientfica.
 Sern desetimadas las contestaciones no centradas en el mbito de la cuestin planteada.
 La valoracin total de la prueba es de 10 puntos.
 Cada pregunta tendr una calificacin que oscilar entre 0 y 10 puntos (los apartados sern
equipuntuables). La nota final del ejercicio ser la media aritmtica de las calificaciones obtenidas de
las cinco preguntas.

1/1

DIRECCIN GENERAL DE POLTICAS EDUCATIVAS Y ORDENCIN ACADMICA

PRUEBA DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR DE LA FORMACIN
PROFESIONAL ESPECFICA

19 de junio de 2008
Centro donde se realiza la prueba:

Localidad del centro:

IES/CIFP
DATOS DEL ASPIRANTE
Apellidos:
Nombre:

DNI/NIE/Otro:

PARTE ESPECFICA
BIOLOGA

Puntuacin total

El/la Interesado/a

El/La corrector/a del ejercicio

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa

INSTRUCCIONES GENERALES PARA EL USO DEL CUADERNILLO DE EXAMEN

Escriba con letras maysculas los datos que se le piden en la portada.


No escriba en los espacios sombreados.
Para las respuestas, use los espacios en blanco existentes previstos al efecto.
Escriba las respuestas con letra clara.
Si se equivoca, tache el error con una lnea: sta respuesta es un ejemplo.

ESTRUCTURA DE LA PRUEBA
La prueba se compone de cuatro bloques y en cada uno de ellos hay cuatro apartados (a, b, c y
d). Los dos primeros apartados (a y b) son obligatorios y la puntuacin parcial de cada uno de
ellos es de 1 punto. De los restantes apartados (c y d) slo se podr contestar a uno de ellos,
siendo su puntuacin parcial de 0,5 puntos.

CRITERIOS GENERALES DE PUNTUACIN Y CALIFICACIN

Lea atentamente las instrucciones para la realizacin de cada ejercicio y los criterios de
puntuacin y calificacin de cada pregunta o apartado.
La puntuacin mxima de cada bloque es de 2,5 puntos, siendo la calificacin mxima total de
10 puntos. Al final de cada pregunta se indica su puntuacin parcial.

LOS ENCARGADOS DE LA APLICACIN DE LA PRUEBA LES ADVERTIRN DEL TIEMPO


DE FINALIZACIN DE LA MISMA 5 MINUTOS ANTES DEL FINAL.
DISPONE DE DOS HORAS PARA LA REALIZACIN DE TODOS LOS EJERCICIOS DE ESTA
PARTE.

Pgina 2

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa

Bloque 1. La base fsico-qumica de la vida. La clula.


a) Qu son los glcidos o hidratos de carbono? Y los monosacridos? Mencionar algunas de
sus propiedades y citar al menos un ejemplo. (1 punto).

b) Relacione las siguientes funciones de cada uno de los siguientes orgnulos celulares
asignando a cada nmero la letra correspondiente. (1 punto)
Funciones
1/
2/
3/
4/
5/

1 Secrecin
2 Respiracin
3 Fotosntesis
4 Sntesis de protenas
5 Movimiento de las clulas

Orgnulos
A Mitocondrias
B Cloroplastos
C Ribosomas
D Aparato de Golgi
E Centrosoma

(Contestar slo uno de los siguientes apartados: c y d).


c) Los cidos grasos son molculas bipolares que tienen una zona hidrfila y una zona hidrfoba.
Debido a esta propiedad, si echamos unas gotas de cido graso en un vaso con agua, cul
ser el comportamiento de sus molculas? (0,5 puntos)

Pgina 3

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa
d) Los cidos nucleicos son polmeros de los nucletidos que a su vez estn formados por tres
molculas Cules son esas tres molculas? Cite a modo de ejemplo la estructura de un
nucletido que forme parte del ADN (0,5 puntos).

Bloque 2. Fisiologa celular.


a) Las membranas biolgicas son semipermeables y a travs de ellas se produce la difusin simple
y la smosis. Explica su diferencia. (1 punto).

b) Expn la reaccin global de la fotosntesis. Qu factores limitan o afectan al rendimiento


fotosinttico? (1 punto)

(Contestar slo uno de los siguientes apartados: c y d).


c) Se dice que hay seres vivos auttrofos y hetertrofos. Explica su diferencia y pon algn ejemplo
de cada uno de ellos. (0,5 puntos)

d) En qu consiste la replicacin del ADN y en qu fase del ciclo celular se produce? (0,5
puntos).

Pgina 4

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa

Bloque 3. La base de la herencia. Aspectos qumicos y gentica molecular.


a) Suponiendo que un animal tiene un nmero cromosmico diploide de doce (1 punto):
1. Cuntos cromosomas tendr una clula drmica?
2. Cuntos cromosomas habr en un gameto?
3. Si se produce la fecundacin, cuntos cromosomas habr en la clula huevo o zigoto?
4. Cuntas ttradas se formarn en la profase de la primera divisin meitica?

b).El sistema de grupos sanguneos est determinado por tres alelos: A, B y O. Indique las
proporciones fenotpicas que se espera obtener en la descendencia del cruzamiento siguiente: AA
x AB. (1 punto)

(Contestar slo uno de los siguientes apartados: c y d).


c) Explique la primera ley de Mendel basndose este esquema, siendo (A) el alelo dominante (color
negro de las cobayas) y (a) el alelo recesivo (color blanco de las cobayas). (0,5 puntos).
GAMETOS
A

Aa

Aa

Aa

Aa

d) Por qu se dice que la herencia ligada al sexo del cromosoma X es cruzada? (0,5 puntos)

Pgina 5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa

Bloque 4. Microbiologa, biotecnologa e inmunologa.


a) Qu entiendes por biotecnologa? Cite al menos dos ejemplos de su aplicacin en la
fabricacin de productos alimenticios (1 punto).

b) Aunque nuestro organismo responde contra las infecciones de una manera natural y
espontnea, en ciertas ocasiones conviene reforzar esa respuesta artificialmente mediante la
aplicacin de sueros y vacunas. Cul es la diferencia bsica entre ambos procesos? (1 punto).

(Contestar slo uno de los siguientes apartados: c y d).


c) Por qu motivo los virus son parsitos obligados? (0,5 puntos)

d) La respuesta inmune es una reaccin defensiva especfica que se desata en respuesta a la


entrada de un organismo extrao, por ejemplo, en respuesta a la infeccin de una bacteria. Cmo
es la respuesta inmune que se produce en un organismo la segunda vez que es infectado por el
mismo tipo de bacteria? Razona la respuesta. (0,5 puntos)

Pgina 6

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa

Enhorabuena por haber terminado la prueba!

Pgina 7

DIRECCIN GENERAL DE POLTICAS EDUCATIVAS Y ORDENCIN ACADMICA

PRUEBA DE ACCESO A CICLOS


FORMATIVOS DE GRADO SUPERIOR DE LA
FORMACIN PROFESIONAL ESPECFICA

18 de junio de 2009
Centro donde se realiza la prueba:

Localidad del centro:

IES/CIFP

DATOS ASPIRANTE
Apellidos:
Nombre:

DNI/NIE/Otro:

PARTE ESPECFICA
BIOLOGA

Puntuacin total

El/la interesado/a

El/la corrector/a del ejercicio

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa.

INSTRUCCIONES GENERALES

Escriba con letras maysculas los datos que se le piden en la portada.


No escriba en los espacios sombreados.
Escriba las respuestas con letra clara.
Si se equivoca, tache el error con una lnea: sta respuesta es un ejemplo
Lea con atencin los enunciados de las preguntas antes de responder.

ESTRUCTURA DE LA PRUEBA
La prueba se compone de cuatro bloques y en cada uno de ellos hay cuatro apartados (a, b,
c y d). Los dos primeros apartados (a y b) son obligatorios y la puntuacin parcial de cada
uno de ellos es de 1 punto. De los restantes apartados (c y d) slo se podr contestar a uno
de ellos, siendo su puntuacin parcial de 0,5 puntos.

CRITERIOS GENERALES DE PUNTUACIN Y CALIFICACIN


La puntuacin mxima de cada bloque es de 2,5 puntos, siendo la calificacin mxima total de
10 puntos. Al final de cada pregunta se indica su puntuacin parcial.

LAS PERSONAS ENCARGADAS DE LA APLICACIN DE LA PRUEBA LES ADVERTIRN DEL


TIEMPO DE FINALIZACIN DE LA MISMA 10 MINUTOS ANTES DEL FINAL.
DISPONE DE DOS HORAS PARA LA REALIZACIN DE TODOS LOS EJERCICIOS DE ESTA
PRUEBA.

Pgina 2

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa.

Bloque 1
A la derecha tenemos tres aminocidos que
podemos encontrar formando parte de casi todas
las protenas.
a) Recordando que para formar las protenas
los aminocidos se unen por sus grupos
amino y carboxlico, forme con ellos el
tripptido siguiente. (1 punto)
NH2-c. glutmico-glicina-cistena-COOH.
b) A qu llamamos radical de un
aminocido? Identifique los radicales de cada uno de los tres aminocidos de la
imagen. (1 punto)
c) Uno de estos tres aminocidos es especialmente importante para la conformacin
terciaria de las protenas, de cul se trata y cul es el porqu de esa importancia? (0,5
puntos)
d) Explique someramente en qu consiste la llamada estructura terciaria de las protenas
y cul es el enlace ms directamente relacionado con dicha estructura. (0,5 puntos)

Bloque 2
A la derecha puede observar el idiograma de un
determinado cariotipo humano anmalo.
a) En qu consiste la anomala y cmo ha podido
producirse? (1 punto)
b) Con qu nombre se conocen este tipo de
anomalas y concretamente cul es el fenotipo y
el nombre de la representada en este
idiograma? (1 punto)
c) Qu son los cromosomas? De qu estn
formados?, describa someramente su
composicin qumica y su estructura
ayudndose con un esquema. (0,5 puntos)
d) Qu relacin tienen los cromosomas con la cromatina? Describa someramente la estructura
de la cromatina ayudndose con algn esquema. (0,5 puntos)

Pgina 3

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Parte especfica. Biologa.

Bloque 3
Al margen tiene la fotografa de lo que
podemos observar, con el microscopio ptico,
en un corte del meristemo apical de una
determinada raz donde se estn
reproduciendo las clulas de una manera muy
activa.
a) En qu fase est cada una de las
clulas sealadas con una a) y con una
c)? Qu est ocurriendo en cada
caso? Enumere las caractersticas de
cada una de esas fases. (1 punto)
b) Si estas clulas pertenecieran a una
especie 2n = 12, cuntas molculas de ADN podramos encontrar en cada uno de estos
casos?: interfase G1, metafase mitosis, anafase I meiosis y metafase II meiosis.
(1 punto)
c) Los centrolos son orgnulos tan pequeos que no pueden verse al microscopio ptico;
pero si estuviramos observando estas mismas clulas con un microscopio electrnico,
podramos verlos con detalle? Razone su respuesta. (0,5 puntos)
d) La mitosis es una de las etapas del ciclo celular, cules son el resto de las etapas?
Dibuje un esquema donde se reflejen todas las etapas del ciclo celular y cada una de sus
fases. (0,5 puntos)

Bloque 4
El diagrama representa el pedigr de una familia
afectada por de una determinada anomala metablica
que depende de un solo gen (con sus dos alelos, por
supuesto). En oscuro se representan los individuos
afectados, los crculos son mujeres y los cuadraditos
hombres.
a) Razone qu tipo de herencia es la ms probable para este carcter (si es dominante o
recesivo y si es autosmico o est ligado al sexo). (1 punto)
b) Utilizando la letra A para indicar el alelo dominante y a para indicar el recesivo,
escriba el genotipo ms probable de todos los individuos que aparecen en el pedigr.
(1 punto)
c) Si el hombre III3 tuviera un hijo con una mujer genotpicamente igual a su hermana,
cul sera la probabilidad de que su primer descendiente padeciera la anomala
metablica? (0,5 puntos)
d) Si la pareja II5-II6 tuviera otro hijo (no importa el sexo), cul sera la probabilidad de
que tuviera la anomala metablica? (0,5 puntos)

Pgina 4

DIRECCIN GENERAL DE POLTICAS EDUCATIVAS , ORDENACIN ACADMICA Y


FORMACIN PROFESIONAL

PRUEBA DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR DE LA FORMACIN
PROFESIONAL ESPECFICA

21 de junio de 2010
Centro donde se realiza la prueba:

Localidad del centro:

IES/CIFP
DATOS DE LA PERSONA ASPIRANTE
Apellidos:
Nombre:

DNI/NIE/Otro:

PARTE ESPECFICA
BIOLOGA

Puntuacin total

El/la Interesado/a

El/La corrector/a del ejercicio

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

INSTRUCCIONES GENERALES PARA EL USO DEL CUADERNILLO DE EXAMEN


-

Escriba con letras maysculas los datos que se le piden en la portada.

No escriba en los espacios sombreados.

Lea atentamente las instrucciones para la realizacin de cada ejercicio y los criterios de
puntuacin y calificacin de cada pregunta o apartado.

Para las respuestas, use los espacios en blanco existentes previstos al efecto.

Escriba las respuestas con letra clara.

Si se equivoca, tache el error con una lnea: esta respuesta es un ejemplo.

ESTRUCTURA DE LA PRUEBA
La prueba se compone de 6 bloques de preguntas de los que la persona aspirante deber elegir
4 y responder a TODAS sus preguntas.

CRITERIOS GENERALES DE PUNTUACIN Y CALIFICACIN


La prueba se valorar de 0 a 10 puntos, con arreglo a la siguiente distribucin:
Cada bloque tendr un valor de 2,5 puntos y constar de 3 apartados denominados a), b) y c).
Los apartados a) y b) tendrn un valor de 1 punto cada uno de ellos mientras que el valor del
apartado c) ser de 0,5 puntos.

LAS PERSONAS ENCARGADAS DE LA APLICACIN DE LA PRUEBA LES ADVERTIRN


DEL MOMENTO DE FINALIZACIN DE LA MISMA CON 5 MINUTOS DE ANTELACIN.
DISPONE DE DOS HORAS PARA LA REALIZACIN DE TODOS LOS EJERCICIOS DE ESTA
PARTE.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

DEBE CONTESTAR A CUATRO BLOQUES ELEGIDOS ENTRE LOS SEIS QUE SE PROPONEN.

BLOQUE 1 (TOTAL: 2,5 puntos)

Al margen tiene el esquema de una determinada clula en la


que se sealan con nmeros sus orgnulos ms importantes.
a) Identifique cada uno de los nmeros del 1 al 10 (1 p.).
b) Cul es la funcin biolgica de las estructuras
sealadas con los nmeros 3, 4, 8 y 10? (1 p.).
c) Analizando el esquema usted tiene que ser capaz de
deducir de qu tipo de clula se trata: procariota?
eucariota animal? eucariota vegetal? Conteste
exponiendo al menos tres razones en las que se ha
basado para llegar a una conclusin (0,5 p.).

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

BLOQUE 2 (TOTAL: 2,5 puntos)


Al margen podemos ver la frmula esquematizada de
una importante molcula, un cerebrsido, que se
encuentra formando parte de las membranas
biolgicas.
a) A qu familia de biomolculas pertenece?
Especifique lo ms posible (1 p.).
b) Esta molcula est formada por la unin de
tres molculas ms sencillas; la esfingosina,
la galactosa y el cido oleico, que se
mantienen unidas por un par de enlaces.
De qu tipo de enlaces se trata? Nmbrelos y diga muy resumidamente cmo se forman cada uno
de ellos (1 p.).
c) Cul es la propiedad que permite a los cerebrsidos y a otras muchas molculas similares formar
parte de las membranas biolgicas? Dibuje un esquema de la estructura de una membrana biolgica
indicando dnde se situaran los cerebrsidos y molculas afines (0,5 p.).

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

BLOQUE 3 (TOTAL: 2,5 puntos)


La maana de un aciago lunes, el
enfermero en prcticas Resa Cona
Pinchavenas prepara cuatro bolsas de
suero fisiolgico para administrar a cuatro
pacientes distintos. Al cabo de muy poco
tiempo tres de los pacientes sufren serios
trastornos hematolgicos y se decide
observar al microscopio un frotis
sanguneo de cada uno de ellos. Los
resultados son los que puede observar en el esquema al margen.
Sabiendo que la forma normal de los glbulos rojos es la que se puede ver en la preparacin A y
analizando detenidamente el esquema responda:
a) Cules fueron los tres sueros fisiolgicos causantes de los problemas hematolgicos y cul el
motivo de esos problemas? (1 p.).
b) Cul de los cuatro sueros era el ms hipertnico (ms concentrado) y cul el ms hipotnico
(menos concentrado)? Ordene de mayor a menor concentracin los cuatro sueros (1 p.).
c) Los glbulos rojos (o eritrocitos) contienen una gran cantidad de hemoglobina. A qu grupo de
principios inmediatos pertenece la hemoglobina y cul es su funcin biolgica? (0,5 p.).

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

BLOQUE 4 (TOTAL: 2,5 puntos)


En la tabla se presenta el nmero de
cromosomas (o molculas de DNA) de dos
diferentes tipos de clulas pertenecientes a tres
especies diferentes: gato, humano y maz.
Analizando atentamente la tabla responda a las siguientes cuestiones:
a) Cul es el valor numrico de las letras A, B y C? (1 p.).
b) Cul es la dotacin cromosmica (2n) de cada una de las especies? (1 p.).
c) En el ciclo biolgico de estas especies, cuntas molculas de DNA encontraramos, en cada una de
las tres, durante la etapa G2 de la interfase? (0,5 p.).
Tipo de clula / especie
Clula somtica
Gameto

Gato
38
A

Humano
B
23

Maz
C
10

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

BLOQUE 5 (TOTAL: 2,5 puntos)


En el pedigr al margen se puede estudiar la herencia de un
determinado carcter que se representa con un fondo oscuro.
Los crculos son mujeres y los cuadrados son hombres.
Observndolo
detenidamente
resuelva
las
siguientes
cuestiones:
a) Qu tipo de herencia presenta dicho carcter?
Dominante, recesivo, ligado al sexo? Justifique la
respuesta y seale el genotipo ms probable de cada
uno de los individuos (1 p.).
b) Si la mujer III2 (la segunda empezando por la izquierda de la tercera fila) se casara con un hombre
de genotipo igual al de su padre, cul es la probabilidad de que su primer o primera descendiente
manifieste el carcter en estudio? (1 p.).
c) Defina y diferencie con claridad los conceptos de gen y alelo (0,5 p.).

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2010


Parte especfica. Biologa

BLOQUE 6 (TOTAL: 2,5 puntos)


En la figura se muestra el esquema clsico de un
anticuerpo en el que se aprecian sus diferentes zonas.
a) Relacione cada uno de los nmeros con las
siguientes palabras (1 p.):
Zona constante,
Zona variable,
Enlaces disulfuro,
Cadena ligera,
Cadena pesada,
Glcido,
Zona de unin con el antgeno
b) Cul es la naturaleza molecular de los
anticuerpos y qu significan los grupos NH2 y
COOH que aparecen en el esquema? (1p.)
c) En qu clulas concretas se sintetizan o
fabrican estas molculas tambin llamadas
inmunoglobulinas? (0,5 p.)

Enhorabuena por haber terminado este ejercicio!

Direccin General de Polticas Educativas,


Ordenacin Acadmica y Formacin Profesional

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

20 de junio de 2011
Centro donde se realiza la prueba:

Localidad del centro:

IES/CIFP
DATOS DE LA PERSONA ASPIRANTE
Apellidos:
Nombre:

DNI/NIE:

PARTE ESPECFICA
BIOLOGA

Puntuacin total:

El/la interesado/a

El/la corrector/a del ejercicio

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

INSTRUCCIONES GENERALES PARA EL USO DEL CUADERNILLO DE EXAMEN

Escriba con letras maysculas los datos que se le piden en la portada.


No escriba en el espacio sombreado.
Para las respuestas use los espacios en blanco existentes previstos al efecto.
Escriba las respuestas con letra clara.
Si se equivoca, tache el error con una lnea: sta respuesta es un ejemplo.

ESTRUCTURA DE LA PRUEBA
La prueba se compone de cuatro ejercicios y en cada uno de ellos hay cuatro apartados.
Los dos primeros apartados de cada ejercicio deben hacerse obligatoriamente y la puntuacin parcial en cada uno de ellos ser de 1 punto.
De los dos ltimos apartados de cada ejercicio solamente se contestar a uno de ellos, a eleccin
de la persona aspirante. La puntuacin parcial de estos dos ltimos apartados ser de 0,5 puntos.

CRITERIOS GENERALES DE PUNTUACIN Y CALIFICACIN

Lea atentamente el texto y las preguntas antes de responder.

La puntuacin mxima de cada ejercicio es de 2,5 puntos.

La calificacin mxima total de la prueba de Biologa es de 10 puntos. Al final de cada pregunta se indica la mxima puntuacin posible.

Revise cuidadosamente la prueba antes de entregarla.

LAS PERSONAS ENCARGADAS DE LA APLICACIN DE LA PRUEBA LES ADVERTIRN


DEL TIEMPO DE FINALIZACIN DE LA MISMA 5 MINUTOS ANTES DE SU CONCLUSIN.
DISPONE DE DOS HORAS PARA LA REALIZACIN DE TODOS LOS EJERCICIOS DE ESTA
PARTE.

Pgina 2

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

EJERCICIO 1
En el esquema aparece un orgnulo citoplsmico muy importante en el metabolismo celular:

1.1.- De qu orgnulo celular se trata? Escriba, al lado de cada nmero, el nombre


que corresponde a la parte sealada. (1 punto)

1.2.- Qu vas metablicas se realizan en este orgnulo? Comntelas brevemente e


indique la localizacin de cada va o fase (1 punto)

Pgina 3

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.
(De los dos apartados siguientes responda solo uno)

1.3.- Indique si este orgnulo es caracterstico de la clula animal o de la clula vegetal. Razone la respuesta. (0,5 puntos)

1.4.- Este orgnulo celular presenta unas caractersticas estructurales y un origen,


que se corresponden con otro orgnulo citoplsmico. Nmbrelo e indique dichas
caractersticas. (0,5 puntos)

EJERCICIO 2

En el esquema aparece la estructura de una biomolcula orgnica


presente en los seres vivos y que
se caracteriza por su especificidad.

2.1.- De que tipo de molcula se trata? Cmo se denominan las unidades estructurales que aparecen representadas por crculos en el dibujo? Indique el nombre completo de dos de esas unidades (1 punto)

Pgina 4

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.
2.2.- La siguiente figura representa la biomolcula CELULOSA:

2.2.1.- Qu tipo de biomolcula es? (0,25 puntos)

2.2.2.- Qu unidades estructurales la forman? (0,25 puntos)

2.2.3.- En que estructuras celulares podra encontrarla? (0,25 puntos)

2.2.4.- Cul sera su funcin? (0,25 puntos)

(De los dos apartados siguientes responda solo uno)

2.3.- La molcula de agua se dice que es polar, qu significa este concepto? Enumere una funcin de importancia biolgica del agua relacionada con dicha polaridad
(0,5 puntos).

2.4.- Qu es un bioelemento? Y un oligoelemento? Cite al menos dos ejemplos de


cada tipo (0,5 puntos)

Pgina 5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

EJERCICIO 3
3.1.- Haga corresponder los conceptos con sus definiciones correspondientes ( 0,20
puntos por cada respuesta acertada)
CONCEPTO
Nucletido

Fosfolpido

Macrfago

Enzima

Linfocito B

DEFINICIN
Molculas de naturaleza proteica, que regulan las reacciones
qumicas en los seres vivos, disminuyendo su energa de
activacin.
Tipo de glbulo blanco que se origina y madura en la mdula
sea aunque luego se ubica en los ganglios linfticos y es el
responsable de la formacin de anticuerpos y clulas de memoria.
Cada uno de los monmeros (unidades) que constituyen un
cido nucleico. Est formado por una pentosa, una base nitrogenada y una molcula de cido fosfrico.
Clulas con gran capacidad fagoctica que se encuentran en
los tejidos; derivan de los monocitos y son clulas presentadoras de antgeno.
Molculas de naturaleza orgnica que constituyen las membranas celulares. Presentan una cabeza polar hidrfila- y
dos colas apolares hidrfobas-.
B

3.2.- En la figura aparece una clula en una fase de la divisin celular de qu fase
se trata? Raznese la respuesta. (0,5 puntos)

Sabiendo que se trata de una clula con 2n 4, explquese si se tratara de una fase
mittica o de una fase meitica (0,5 puntos)

Pgina 6

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

(De los dos apartados siguientes responda solo uno)

3.3.- Por qu se dice que la replicacin del ADN es semiconservativa? En qu


fase del ciclo celular se produce? (0,5 puntos)

3.4.- Despus del terremoto de Japn y de las explosiones de las centrales nucleares de Fukusima los expertos han dicho que los trabajadores de la Central tienen el
ADN mutado Qu significa ese concepto? Qu es una mutacin? Cul puede ser
la causa de una mutacin ? (0,5 puntos)

Pgina 7

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

EJERCICIO 4
Los escarabajos carroeros ponen sus huevos en los animales muertos y los entierran en el suelo hasta que eclosionan. Supongamos que la preferencia por la carne
fresca (F) es dominante a la preferencia por la carne podrida y que la tendencia a enterrar a poca profundidad la carne (S) es dominante sobre la tendencia a enterrar la
carne a gran profundidad. Una hembra de escarabajo, homocigtica dominante para
ambos caracteres se cruza con un macho homocigtico recesivo.
4.1.- Cul ser el genotipo de la generacin F1? Cul ser su fenotipo? (1 punto)

4.2.- El escarabajo carroero tiene una dotacin cromosmica diploide 2n= 20


4.2.1.- El escarabajo tiene pues 10 parejas de cromosomas homlogos son iguales los
cromosomas homlogos? Razone la respuesta. (0,25 puntos)

4.2.2.- Cuntos cromosomas tendr una clula somtica? (0,25 puntos)

Pgina 8

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

4.2.3.- Cuntos cromosomas tendr una clula germinal o gameto? (0,25 puntos)

4.2.4.- En la fecundacin, cuando se forme el zigoto, cuntos cromosomas habr?


(0,25 puntos)

4.3.- Sabiendo que el daltonismo, en la especie humana, es un carcter recesivo ligado


al sexo (cromosoma X ), explicar si la siguiente frase es verdadera o falsa: Todos los
hijos varones de una mujer daltnica sern daltnicos (0,5 puntos)

Pgina 9

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

4.4.- Explicar el concepto de cromosomas sexuales y autosomas en la especie humana


(0,5 puntos)

Pgina 10

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

Enhorabuena por haber terminado la prueba!

Pgina 11

D.L.: AS-3031-2011

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2011


Parte especfica. Biologa.

Pgina 12

DIRECCIN GENERAL DE FORMACIN PROFESIONAL

PRUEBA DE ACCESO A CICLOS


FORMATIVOS DE GRADO SUPERIOR
DE FORMACIN PROFESIONAL

19 de junio de 2012
Centro donde se realiza la prueba:

IES/CIFP

Localidad del centro:

DATOS DEL/DE LA ASPIRANTE


Apellidos:
Nombre:

DNI/NIE:

PARTE ESPECFICA
BIOLOGA
Puntuacin total

El/la interesado/a

El/La corrector/a del ejercicio

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

INSTRUCCIONES GENERALES PARA EL USO DEL CUADERNILLO DE EXAMEN

Escriba con letras maysculas los datos que se le piden en la portada. No escriba en el espacio
sombreado que se encuentra en la misma.

Para las respuestas, use los espacios en blanco existentes previstos al efecto.

Escriba las respuestas con letra clara.

Si se equivoca, tache el error con una lnea: esta respuesta es un ejemplo.

ESTRUCTURA DE LA PRUEBA
La prueba se compone de 6 bloques de preguntas, de los cuales el aspirante deber elegir 4 y contestar a
sus preguntas. Si contesta a ms de cuatro bloques, el tribunal slo valorar los cuatro primeros.

CRITERIOS GENERALES DE PUNTUACIN Y CALIFICACIN


La prueba se valorar de 0 a 10 puntos, con arreglo a la siguiente distribucin:
Cada bloque tiene un valor de 2,5 puntos y consta de 3 apartados denominados a), b) y c).
Los apartados a) y b) tienen un valor de 1 punto cada uno, mientras que el valor del apartado c) es
de 0,5 puntos.

LAS PERSONAS ENCARGADAS DE LA APLICACIN DE LA PRUEBA LE ADVERTIRN DEL


MOMENTO DE FINALIZACIN DE LA MISMA 5 MINUTOS ANTES DE SU CONCLUSIN.
DISPONE DE DOS HORAS PARA LA REALIZACIN DE TODOS LOS EJERCICIOS DE ESTA PARTE.

Pgina 2

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

DEBE CONTESTAR A CUATRO BLOQUES ELEGIDOS DE ENTRE LOS SEIS QUE SE PROPONEN
BLOQUE 1 (TOTAL: 2,5 puntos)

Al margen tiene el esquema de un determinado orgnulo celular. Se trata del


ncleo cuando la clula est en interfase.
a) Identifique cada uno de los nmeros del 1 al 10. (1 punto)
b) Cul es la funcin biolgica de las estructuras sealadas con el
nmero 8? (1 punto)
c) Entre la estructura 10 y la sntesis de protenas existe una estrecha
relacin En qu consiste esa relacin? (0,5 puntos)

Pgina 3

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

BLOQUE 2 (TOTAL: 2,5 puntos)

En el grfico al margen se muestra el ciclo


biolgico de un animal.
Analizndolo detenidamente debe contestar a
las siguientes preguntas:
a) Se trata de un animal haplonte,
diplonte o diplohaplonte? Razone la
respuesta. (1 punto)
b) Si la constitucin cromosmica de
este animal fuera 2n=6, cuntos
cromosomas y cuntas molculas de
DNA tendran sus gametos? Razone
la respuesta. (1 punto)
c) Qu entiende por anafase? Realice un dibujo de una clula de este animal (2n=6) cuando est en
la anafase de mitosis. (0,5 puntos)

Pgina 4

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

Pgina 5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

BLOQUE 3 (TOTAL: 2,5 puntos)


Nios/nias
0
A
AB
B

Padres/madres
AB x 0
Ax0
A x AB
0x0

En un centro de maternidad se ha producido un incendio en la


planta de recin nacidos. Se salvan todos los nios y nias pero
cuando, lleno de alegra, el personal sanitario est haciendo
carantoas a las criaturitas, se dan cuenta de que se ha
extraviado la pulsera que identificaba a cuatro de los recin
nacidos. Se sabe que los grupos sanguneos AB0 de los nios y
de las cuatro parejas de progenitores son los reflejados en el

cuadro al margen.
Recordando que la herencia de los grupos sanguneos del sistema AB0 est determinada por la serie allica
A B
0
A
B
0
I , I y I de tal manera que I e I son codominantes entre s y dominantes sobre I , conteste a las siguientes
cuestiones.
a) Determine, razonando por escrito, qu nio o nia pertenece a cada pareja. (1 punto)
b) El hombre del grupo A que est casado con la mujer del grupo AB, es hijo de una mujer del grupo 0.
Cul es la probabilidad de que su prximo hijo o hija sea del grupo B? Razone por escrito la
respuesta. (1 punto)
c) Puede un hombre del grupo AB tener hijos del grupo 0? Razone la respuesta. (0,5 puntos)

Pgina 6

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

BLOQUE 4 (TOTAL: 2,5 puntos)


Este esquema muestra los principales mecanismos
de intercambio de sustancias con el medio a travs
de la membrana celular.
a) Defina transporte pasivo y transporte activo
destacando las diferencias en cuanto a
concentracin
de
las
molculas
transportadas y en cuanto a coste
energtico. (1 punto)
b) A qu tipo de energa se refiere la que
aparece en el esquema?, con qu
molcula se corresponde? (1 punto)
c) En el esquema tambin aparece una bicapa lipdica Cmo son las molculas que forman esta
bicapa y cul es su caracterstica estructural ms importante gracias a la cual forman la base
estructural de todas las membranas biolgicas? (0,5 puntos)

Pgina 7

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

Pgina 8

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

BLOQUE 5 (TOTAL: 2,5 puntos)


Al margen se representa la estructura de las molculas de
agua. Estas molculas se mantienen unidas entre s por un
determinado tipo de enlace.
a) Qu nombre recibe dicho enlace y a qu es debida
su formacin? (1 punto)
b) Cite tres propiedades del agua que se deban a la
existencia de este tipo de enlace. (1 punto)
c) Adems de ser muy importante para explicar el
comportamiento del agua, este enlace es
determinante en la estructura de otras muchas
molculas biolgicas y est presente, por ejemplo, en
la estructura del DNA. Explique la presencia de estos
enlaces en las molculas de DNA diciendo dnde se
encuentran y resaltando su importancia. (0,5 puntos)

Pgina 9

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

BLOQUE 6 (TOTAL: 2,5 puntos)


Al margen tiene la frmula de la maltosa, un importante
componente de la materia viva.
a) A qu grupo de principios inmediatos pertenece?
Clasifique esta molcula de la forma ms precisa
que pueda. (1 punto)
b) Como puede apreciar, la maltosa est formada por
la unin mediante el enlace 1, de dos molculas.
Cmo se llaman estas molculas y el enlace que las une? Cmo se forman este tipo de enlaces?
(1 punto)
c) La polimerizacin de la maltosa da lugar a dos polisacridos importantes: el almidn y el glucgeno.
Seale dos diferencias de estos polisacridos en cuanto a su origen y estructura. (0,5 puntos)

Pgina 10

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL 2012

Parte especfica. Biologa

Enhorabuena por haber terminado la prueba!

Pgina 11

EDICIN: Consejera de Educacin y Universidades. Direccin General de Formacin Profesional.


IMPRESIN: Imprenta Noval S.L.
D.L.: AS-1352-2012.
Copyright: 2012 Consejera de Educacin y Universidades. Direccin General de Formacin Profesional. Todos los derechos reservados.
La reproduccin de fragmentos de los documentos que se utilizan en las diferentes pruebas de acceso a los ciclos formativos de grado
medio y de grado superior de formacin profesional correspondientes al ao 2012, se acoge a lo establecido en el artculo 32 (citas y
reseas) del Real Decreto Legislativo 1/1996 de 12 de abril, modificado por la Ley 23/2006, de 7 de julio, Cita e ilustracin de la
enseanza, puesto que se trata de obras de naturaleza escrita, sonora o audiovisual que han sido extradas de documentos ya
divulgados por va comercial o por Internet, se hace a ttulo de cita, anlisis o comentario crtico y se utilizan solamente con fines
docentes. Estos materiales tienen fines exclusivamente educativos, se realizan sin nimo de lucro y se distribuyen gratuitamente a
todas las sedes de realizacin de las pruebas de acceso en el Principado de Asturias.

PRUEBA DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR DE LA FORMACIN
PROFESIONAL
DIRECCIN GENERAL DE FORMACIN PROFESIONAL, DESARROLLO CURRICULAR
E INNOVACIN EDUCATIVA

18 de junio de 2013
Centro donde se realiza la prueba:

Localidad del centro:

IES/CIFP
DATOS DE LA PERSONA ASPIRANTE
Apellidos:
Nombre:

DNI/NIE:

PARTE ESPECFICA
BIOLOGA

Puntuacin total

El/la interesado/a

El/La corrector/a del ejercicio

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

INSTRUCCIONES GENERALES PARA EL USO DEL CUADERNILLO DE EXAMEN

Escriba con letras maysculas los datos que se le piden en la portada.


No escriba en los espacios sombreados.
Para las respuestas, use los espacios en blanco existentes previstos al efecto.
Escriba las respuestas con letra clara.
Si se equivoca, tache el error con una lnea: esta respuesta es un ejemplo.
Las personas encargadas de la aplicacin de la prueba les advertirn del tiempo de
finalizacin de la misma 5 minutos antes del final.
Dispone de DOS HORAS para la realizacin de todos los ejercicios de esta parte.

ESTRUCTURA DE LA PRUEBA
La prueba se compone de 4 ejercicios con 3 apartados cada uno (A, B, C). Los apartados Ay B
de cada ejercicio son obligatorios. El apartado C ofrece dos opciones (C1, C2) de los que hay
que elegir solo uno. Si se responden los dos se tendr en cuenta nicamente el primero que se
conteste.

CRITERIOS GENERALES DE PUNTUACIN Y CALIFICACIN


La prueba se valorar de 0 a 10 puntos, con arreglo a la siguiente distribucin: Cada ejercicio
punta 2,5 puntos en total. Los apartados A y B valen un punto cada uno. Los apartados C1 y
C2 valen 0.5 puntos pero solo se puede contestar a uno.
Es importante cuidar la redaccin y el uso del vocabulario especfico de la materia.

Pgina 2

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

Ejercicio 1 (2.5 ptos)


A. Nombre los componentes de la membrana
sealados en la imagen. (1 pto.)

1.
2.
3.
4.
5.
6.
B. Indique qu componente es el ms
abundante en las membranas y qu propiedades qumicas le permiten ser la molcula
ms adecuada para ese fin. (1 pto.)

Elija uno entre los dos apartados siguientes:


C.1. Qu orgnulos intervienen en la sntesis de la membrana plasmtica? (0,5 ptos)

C.2. Explique qu es el transporte activo y en qu condiciones se realiza. (0,5 ptos)

Pgina 3

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

Ejercicio 2 (2.5 ptos)


A. Relacione cada estructura con su funcin. (1 pto)

Estructura

Solucin

Funcin

Mitocondria

Modificacin de protenas (glicosilacin)

Lisosoma

Produccin de Energa para la clula

Retculo endoplasmtico
liso

Replicacin del ADN

Cloroplasto

Sntesis de protenas

Aparato de Golgi

Sntesis de lpidos

Ncleo

Motilidad celular

Cilios

Forma de la clula

Ribosoma

Digestin intracelular

Pared celular

Medio en el que tienen lugar reacciones


metablicas

10

Hialoplasma

Fotosntesis

4
5
6

B. Indique en que tipo o tipos celulares pueden encontrarse las estructuras listadas en el apartado
anterior. (1 pto)

Clula eucariota animal

Clula eucariota vegetal

Clula procariota

Pgina 4

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

Elija uno entre los dos apartados siguientes:


C.1. Explique cmo se produce la digestin intracelular. (0.5 ptos)

C.2. Indique en qu parte de la clula tienen lugar las siguientes rutas metablicas: (0.5 ptos)
Glucolisis

Fermentacin

Ciclo de Krebs

Ciclo de Calvin

Ejercicio 3 (2.5 ptos)

Pgina 5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

A. En la imagen se muestran dos procesos muy importantes relacionados con la transmisin de la


informacin en la clula. Indique de qu procesos se trata y que molculas son las que estn
rotuladas con la letra D y R. Indique tambin la composicin de esta molculas. (1 pto.)
Proceso 1:
Proceso 2:
Molcula D:

Molcula R:
B. Sabiendo que los pentgonos rotulados con la letra M son aminocidos indique qu estructura
es Y. Indique qu funcin tiene F, cul es su naturaleza qumica y que zonas de la molcula son
ms importantes para su funcin. (1 pto.)

Elija uno entre los dos apartados siguientes:


C.1. Complete el mensaje e indique la secuencia de aminocidos que formara. (0.5 ptos)

Cys

Pgina 6

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

C.2. Indique qu enlaces mantienen unidos los aminocidos en esta molcula recin formada y qu
caractersticas tiene ese tipo de enlace. (0.5 ptos.)

Ejercicio 4

(2.5 ptos)

A. Identifique la estructura de la imagen y nombre las estructuras sealadas. (1 pto)

a)
b)
c)
d)
e)
f)
B. El daltonismo es un trastorno ligado al cromosoma X. Qu proporcin de hijos varones sanos
puede tener una mujer portadora que tiene descendencia con un hombre sano? Justifique la
respuesta e indique los genotipos. (1 pto)

Pgina 7

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR 2013

Parte especfica. Biologa

Elija uno entre los dos apartados siguientes:


C.1. En qu fase del ciclo celular podemos observar con claridad la estructura de la imagen. Cul
es su naturaleza qumica? (0.5 pto)

C.2. Explique qu es un alelo autosmico recesivo. (0.5)

Enhorabuena por haber terminado la prueba!


EDICIN: Consejera de Educacin, Cultura y Deporte. Direccin General de Formacin Profesional, Desarrollo Curricular e Innovacin Educativa. IMPRESIN: BOPA. D.L.: AS-2612013.
Copyright: 2013 Consejera de Educacin, Cultura y Deporte. Direccin General de Formacin Profesional, Desarrollo Curricular e Innovacin Educativa. Todos los derechos reservados.
La reproduccin de fragmentos de los documentos que se utilizan en las diferentes pruebas de acceso a los ciclos formativos de grado medio y de grado superior de formacin profesional correspondientes al ao 2013, se acoge a lo establecido en el artculo 32 (citas y reseas) del Real Decreto Legislativo 1/1996 de 12 de abril, modificado por la Ley 23/2006, de 7 de
julio, Cita e ilustracin de la enseanza, puesto que se trata de obras de naturaleza escrita, sonora o audiovisual que han sido extradas de documentos ya divulgados por va comercial o por Internet, se hace a ttulo de cita, anlisis o comentario crtico y se utilizan solamente con fines docentes. Estos materiales tienen fines exclusivamente educativos, se realizan
sin nimo de lucro y se distribuyen gratuitamente a todas las sedes de realizacin de las pruebas de acceso en el Principado de Asturias.

Pgina 8

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 25 de marzo de 2011


BOC 2011/068 lunes 4 de abril de 2011

PRUEBA

CFGS

BIOLOGA

CDIGO: GS_______

CRITERIOS DE CALIFICACIN
- Cada respuesta correcta se valorar con 0,5
puntos.
- Las respuestas en blanco o incorrectas no
puntan ni penalizan.

DNI:

INSTRUCCIONES
- Marcar con una X la respuesta correcta.
- Salvo que se especifique lo contrario, cada
cuestin tiene una sola respuesta correcta.
5. El AMPc juega un
metabolismo porque:

1. Las biomolculas inorgnicas son:

papel

central

en

el

a. Desactiva una serie de enzimas y la expresin


de algunos genes.

a. Lpidos y protenas.
b. Glcidos y cidos nucleicos.

b. No influye en el control endocrino del


organismo.

c. Glcidos, lpidos, protenas y cidos nucleicos.


d. Agua, sales minerales y gases.

c. Acta como segundo mensajero en la


recepcin de seales por la clula.
d. Es un nuclesido.

2. La vida, depende para su existencia de la


presencia de agua. Qu quiere decir que la
molcula de agua es dipolar?

6. El citoesqueleto es propio de:


a. Las clulas vegetales.

a. Que est formada por hidrgeno y oxgeno.

b. Las clulas animales.

b. Que los hidrgenos se unen con los


hidrgenos por enlaces covalentes.

c. Las bacterias.
d. Las clulas eucariotas.

c. Que la molcula posee una regin


electropositiva y otra electronegativa.

7. La difusin facilitada es un ejemplo de:

d. Que las molculas de agua se repelen.

a. Transporte de pequeas molculas.


b. Transporte pasivo.
c. Transporte activo.

3. El enlace O-glucosdico se forma entre:

d. Endocitosis.

a. Dos grupos hidroxilos de dos monosacridos.

8. Los centriolos son unos orgnulos que se


encuentran en:

b. Dos bases nitrogenadas.


c. Dos tomos de carbono de cualquier molcula.

a. Todas las clulas eucariticas.

d. Dos grupos amino de dos aminocidos.

b. Todas las clulas procariticas.


c. Slo en las clulas vegetales.
d. Todas las eucariotas excepto las vegetales.

4. El mensaje gentico contenido en el DNA es


capaz de sintetizar una molcula de RNA. Cmo
se llama este proceso?

9. Los acontecimientos que tienen lugar a lo largo


de la vida de una clula se producen en:

a. Estructura del RNA.


b. Replicacin del DNA.

a. Interfase.

c. Traduccin.

b. Mitosis.

d. Transcripcin.

c. Ciclo celular.
d. Meiosis.
1

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 25 de marzo de 2011


BOC 2011/068 lunes 4 de abril de 2011

15. Si cruzamos dos individuos con el mismo


genotipo Aa, los hijos resultantes sern:

10. La capacidad de ceder y captar energa del


sistema ATP-ADP se debe a:

a. 100% Aa
b. 50% AA y 50% aa

a. La repulsin entre las cargas negativas de los


grupos fosfatos.

c. 75% AA y 25% aa

b. La repulsin entre las cargas positivas de los


grupos fosfatos.

d. 25% AA, 50% Aa y 25% aa

c. Los grupos fosfatos no tienen carga.


16. Un virus est formado por:

d. La atraccin entre cargas positivas y


negativas.

a. Glcidos y protenas.
b. cidos nucleicos y protenas.

11. La clorofila transforma la luz en energa qumica


durante la fotosntesis. En qu fase se produce
este hecho?

c. Lpidos y protenas.
d. Slo cidos nucleicos.

a. Fase biosinttica.
17. Los medicamentos ms importantes producidos
por microorganismos son:

b. Fase lumnica.
c. En ambas fases.

a. Antiinflamatorios.

d. En ninguna.

b. Las vacunas.
c. Los antibiticos.

12. El conjunto de genes de un organismo es:

d. Las vitaminas.

a. El cariotipo.
b. El heterocigtico.

18. Las molculas que marcan y paralizan a los


invasores son:

c. El genotipo.
d. El fenotipo.

a. Los antgenos.
b. Los anticuerpos.

13. La prueba de retrocruzamiento consiste en


hacer:

c. Las histaminas.
d. Los lpidos.

a. Un cruzamiento entre el individuo problema y


otro homocigtico recesivo.
19. Los alrgenos son:

b. Un cruzamiento entre el individuo problema y


un homocigtico dominante.

a. Anticuerpos que provocan las alergias.

c. Un cruzamiento entre el individuo problema y


un heterocigtico.

b. Glcidos que provocan las alergias.

d. Un cruzamiento entre dos individuos


problemas.

d. El sistema del complemento.

c. Antgenos que provocan las alergias.

20. El sida es un conjunto de desrdenes que


suceden a una infeccin por:

14. Las clulas haploides de nuestro organismo son:


a. Todas.

a. La bacteria VIH.

b. Las que tienen 46 cromosomas.

b. La protena VIH.

c. Las que tiene 26 parejas de cromosomas.

c. El anticuerpo VIH.

d. Las clulas sexuales.

d. El virus VIH.
2

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 26 de marzo de 2012


BOC 2012/066 martes 3 de abril de 2012

PRUEBA

CFGS

BIOLOGA

CDIGO: GS_______

CRITERIOS DE CALIFICACIN
- Cada respuesta correcta se valorar con 0,5
puntos.
- Las respuestas en blanco o incorrectas no
puntan ni penalizan.
1.

2.

De la especie de organismo que se trate y de


su edad.

b.

De su estructura fsica.

c.

Del grupo al que pertenezca.

d.

De la cantidad de sangre.

a.

Su baja densidad en estado slido.

b.

Elevada fuerza de cohesin-adhesin y


elevado calor especfico.

d.

4.

5.

6.

7.

De qu propiedad o propiedades del agua


depende el fenmeno de capilaridad?

c.

3.

INSTRUCCIONES
- Salvo que se especifique lo contrario, cada
cuestin tiene una sola respuesta correcta.

De qu depende el contenido hdrico de los seres


vivos?
a.

DNI:

Elevado calor de vaporizacin y elevada


fuerza de cohesin-adhesin.
8.

Elevada fuerza de cohesin-adhesin y


elevada tensin superficial.

Un sistema tampn es:

Qu modalidad de RNA presenta las molculas


ms grandes?
a.

El mRNA.

b.

El rRNA.

c.

El tRNA.

d.

Todos son del mismo tamao.

Indica que orgnulos de una clula eucaritica son


especficos de las clulas animales:
a.

Mitocondrias y vacuolas.

b.

RE liso y vacuolas.

c.

Los centrolos que forman parte del


centrosoma.

d.

Lisosomas, mitocondrias y centrolos.

Por qu se considera transporte activo el


transporte de glucosa que se realiza con los iones
+
Na al interior de las clulas?
a.

Porque el transporte de glucosa se realiza a


favor de un gradiente.

a.

Es una disolucin de un cido fuerte.

b.

b.

Es una disolucin de un cido dbil y de su


base conjugada.

Porque se realiza con protenas


transportadoras especficas.

c.

c.

Es una disolucin de un cido dbil.

Es una difusin facilitada que necesita


protenas.

d.

Es una disolucin de un cido fuerte y de su


base conjugada.

d.

Porque se realiza en contra de su gradiente


de concentracin.

La molcula de almidn pertenece a:


a.

Los disacridos.

b.

Oligosacridos.

c.

Heteropolisacridos.

d.

Homopolisacridos.

9.

Cuando una protena se desnaturaliza pierde:


a.

La estructura cuaternaria.

b.

La terciaria y la cuaternaria.

c.

La estructura secundaria y cuaternaria.

d.

La estructura secundaria, terciaria y


cuaternaria.

Qu quiere decir que un cncer ha producido


metstasis?

a.

Que clulas malignas se separan del tumor y


se desplazan por el cuerpo.

b.

Que hay pequeos tumores por todo el


cuerpo.

c.

Que las clulas malignas solo estn en el


tumor.

d.

Que el tumor ha crecido considerablemente.

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 26 de marzo de 2012


BOC 2012/066 martes 3 de abril de 2012

10. Qu es la ATP-sintetasa?

a.

15. Qu caracterstica de la estructura celular es


comn a todos los organismos del Reino Monera?

Es una enzima que cataliza la formacin de


ADP.

b.

Es un complejo enzimtico que cataliza la


formacin de ATP.

c.

Es una coenzima que cataliza la formacin


de ADP.

d.

Es un nuclesido.

a. Cuando se encuentra aislado.


b. Cuando se est expresando.
c. En su estado normal en la clula.
d. Cuando en l se estn transcribiendo genes.

b.

En la neurona hay ms que en la clula


epitelial.

c.

S, ya que ambas se han formado por


mitosis.

d.

En la clula epitelial hay ms que en la


neurona.

b.

Poseer mitocondrias.

c.

Poseen ncleo bien diferenciado.

d.

Poseen ncleo pero no orgnulos.

a.

Cuatro nucletidos.

b.

Dos nucletidos.

c.

Tres nucletidos.

d.

Un nucletido.

17. En la fabricacin del pan se produce una subida de


masa gracias a una fermentacin alcohlica. De
qu producto se trata?

12. En los ncleos de una neurona y de una clula


epitelial de un individuo, existen los mismos
genes?

Depende de la especie de individuo.

Carecer de ncleo bien diferenciado.

16. El cdigo gentico traduce la informacin de los


cidos nucleicos a las protenas. Cuntos
nucletidos codifican un aminocido de una
protena?

11. Qu significa que un ncleo es activo?

a.

a.

a.

Microorganismos.

b.

CO.

c.

CO2.

d.

NO.

18. Los anticuerpos son:

13. El anabolismo es:

a.

Oligosacridos.

b.

Protenas sintetizadas por los linfocitos B.

c.

Inmunoglobulinas sintetizadas por los linfocitos


T.

d.

Lpidos de membranas.

a.

Conjunto de reacciones que degradan


biomolculas.

b.

Conjunto de procesos metablicos para


formar macromolculas.

a.

Una aglutinacin.

b.

Una reaccin inflamatoria leve.

c.

La obtencin de energa til para la clula.

c.

Una reaccin alrgica moderada.

d.

Degradacin.

d.

Una reaccin alrgica de elevada intensidad.

19. El shock anafilctico se debe a:

14. Cmo ser el genotipo de los padres, cuya


descendencia es 50%AA y 50% Aa?

20. Qu es un antgeno?
a.

Molcula que induce la produccin de


anticuerpos.

b. Igual que uno de los padres.

b.

Una sustancia elaborada por los linfocitos Tc.

c. Aa y aa.

c.

Molcula producida por el organismo.

d. AA y Aa.

d. Una sustancia producida por los granulocitos.

a. Aa los dos.

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de la Direccin General de Formacin


Profesional y Educacin de Adultos de 24 de marzo de
2008 BOC 2008/073 jueves 10 de abril de 2008.

PARTE ESPECFICA, OPCIN C


MATERIA

BIOLOGA

CFGS
CDIGO: GS_______

CRITERIOS DE CALIFICACIN
- Cada respuesta correcta se valorar con 0,5
puntos.
- Las respuestas en blanco o incorrectas no
puntan ni penalizan.
1. Seala cul de las siguientes propiedades
del agua est relacionada con la regulacin
de la temperatura en los seres vivos:

DNI:

INSTRUCCIONES
- Salvo que se especifique lo contrario, cada
cuestin tiene una sola respuesta correcta.

5. El par NADH/NADH+ juega un papel central


en el metabolismo porque:

a. Elevada fuerza de cohesin.

a. Son nucletidos que intervienen en los


procesos de transferencia de energa.

b. Elevada constante dielctrica.

b. Son mensajeros intracelulares.

c. Elevado calor especfico.

c. Son coenzimas que intervienen en los


procesos de oxidacin-reduccin.

d. Bajo grado de ionizacin.

d. Son enzimas que catalizan las reacciones


qumicas.

2. El enlace O-glucosdico se forma entre:


a. Dos grupos amino de dos aminocidos.
b. Dos grupos OH de dos monosacridos.
c. Dos tomos de carbono de cualquier
molcula.
d. Dos bases nitrogenadas.

6. Seala la afirmacin correcta:


a. Las clulas animales poseen cloroplastos
pero no poseen mitocondrias.
b. Las clulas vegetales poseen cloroplastos
pero no poseen mitocondrias.

3. Las unidades bsicas que se enlazan para


construir las protenas se llaman:
a. Aminocidos.

c. Las clulas vegetales poseen cloroplastos y


mitocondrias.
d. Las clulas vegetales poseen cloroplastos y
centriolos.

b. Monosacridos.
c. Nucletidos.
d. Nuclesidos.
4. El ADN y el ARN guardan la informacin
codificada por la variacin de:

7. La bomba de sodio-potasio es un ejemplo


de:
a. Difusin simple.

a. La desoxirribosa.

b. Transporte pasivo.

b. Las pentosas.

c. Transporte activo.

c. Las bases nitrogenadas.

d. Difusin facilitada.

d. Los puentes de hidrgeno de las bases.

Opcin C: Biologa - 1

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de la Direccin General de Formacin


Profesional y Educacin de Adultos de 24 de marzo de
2008 BOC 2008/073 jueves 10 de abril de 2008.

8. La finalidad del anabolismo es:

13. La manifestacin externa del genotipo se


llama:

a. La produccin de materia orgnica.


b. La obtencin de energa.

a. Dotacin cromosmica.

c. La degradacin de la materia orgnica.

b. Fenotipo.

d. La transformacin de energa qumica en


ATP.
9. Slo una de estas caractersticas es propia
de las reacciones anablicas:
a. Son reacciones de sntesis.

c. Gametos.
d. Genotipo propiamente dicho.
14. Si cruzamos un individuo cuyo genotipo es
aa con otro cuyo genotipo es Aa, los hijos
resultantes sern:
a. 50 % Aa y 50 % aa.

b. Son reacciones de degradacin.

b. 25 % AA, 50 % Aa y 25 % aa.

c. Son reacciones de oxidacin.

c. 75 % Aa y 25 % aa.

d. Desprenden energa.

d. 25 % Aa y 75 % aa.
10. El centro activo de una enzima es:
a. El lugar por donde se une la enzima al
sustrato.

15. . Cmo se llama el lugar que ocupa un gen


en un cromosoma?
a. Locus.

b. Una parte cualquiera de la enzima.


c. Una parte muy grande del volumen de toda
la enzima.
d. Ninguna de las respuestas anteriores es
correcta.

b. Alelo.
c. Cromtida.
d. Centrmero.
16. El cdigo gentico traduce la informacin de
los cidos nucleicos a las protenas.
Cuntos
nucletidos
codifican
un
aminocido de una protena?

11. El objetivo de la fotosntesis es:


a. La respiracin de la planta.
b. La obtencin de oxgeno.

a. Dos nucletidos.

c. La obtencin de agua.

b. Tres nucletidos.

d. La fabricacin de compuestos orgnicos a


partir de compuestos inorgnicos.

c. Cuatro nucletidos.
d. Ninguna es correcta.

12. Tras la meiosis se obtienen:


a. Dos clulas con idntica
gentica que la clula madre.

informacin

b. Dos clulas con la mitad de informacin


gentica que la clula madre.
c. Cuatro clulas con idntica informacin
gentica que la clula madre.
d. Cuatro clulas con la mitad de informacin
gentica que la clula madre.

17. El ADN est formado por:


a. Una sola hebra de nucletidos que va en
sentido 3 a 5.
b. Dos hebras de nucletidos complementarias
y antiparalelas.
c. Una hebra de nucletidos dispuestos
circularmente.
d. Una molcula de nucletidos dispuestos en
espiral.

Opcin C: Biologa - 2

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de la Direccin General de Formacin


Profesional y Educacin de Adultos de 24 de marzo de
2008 BOC 2008/073 jueves 10 de abril de 2008.

18. La estructura bsica de un virus est


formada por:
a. cido nucleico y protenas.
b. Protenas y glcidos.
c. cido nucleicos, glcidos y lpidos.
d. Membrana, citoplasma y ncleo.
19. Un antgeno es:
a. Una sustancia sintetizada por el organismo
para luchar contra una enfermedad.
b. Una protena formada por clulas defensivas.
c. Parte de un patgeno que produce la
activacin del sistema inmune.
d. Una inmunoglobulina.
20. Un macrfago es:
a. Una clula productora de plaquetas.
b. Una clula fagoctica.
c. Un linfocito.
d. Una clula que no pertenece al sistema
inmune.

Opcin C: Biologa - 3

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 10 de marzo de 2009


BOC 2009/062 martes 31 de marzo de 2009

CFGS

SOLUCIONARIO

CDIGO: GS_______

BIOLOGA

CRITERIOS DE CALIFICACIN
- Cada respuesta correcta se valorar con 0,5
puntos.
- Las respuestas en blanco o incorrectas no
puntan ni penalizan.

DNI:

INSTRUCCIONES
- Salvo que se especifique lo contrario, cada
cuestin tiene una sola respuesta correcta.

5. La composicin qumica de los ribosomas es:


1. De qu tipo son las membranas celulares:

a. ADN.

a. Son membranas selectivas que dejan pasar


iones.

b. ARN y protenas.

b. Son membranas de permeabilidad selectiva que


dejan pasar agua, iones y pequeas molculas.

d. ARN y ADN.

c.

c.

Son membranas que dejan pasar solo agua.


6. Indica la afirmacin correcta:

d. Son membranas selectivas que dejan pasar


pequeas molculas.

a. La fagocitosis es la ingestin de pequeas


partculas.
b. La fagocitosis es la ingestin de grandes
partculas.

2. Seala cul es la expresin verdadera:


a. Los monosacridos tienen un sabor ms dulce
que los disacridos.

c.

Los homopolisacridos son la hemicelulosa, el


agar-agar y los mucopolisacridos.

7. La finalidad del catabolismo es:

d. Los monosacridos son glcidos capaces de


oxidarse frente a otras sustancias.

a. La produccin de materia orgnica.


b. La degradacin de materia orgnica.
c.

3. El enlace peptdico se establece entre:

Obtencin de energa.

d. La produccin de materia inorgnica.

a. El grupo carboxilo de un aminocido y el grupo


amino del siguiente.

8. El ATP es:
a. Una protena.

b. Dos grupos carboxilos.


c.

La fagocitosis es la ingestin de lquidos.

d. La fagocitosis es la ingestin de lquidos y de


grandes partculas.

b. La solubilidad de los oligosacridos es


independiente del nmero de sus monmeros.
c.

Protenas y monosacridos.

b. Un triglicrido.

Dos grupos OH de dos monosacridos.

c.

d. Dos cidos grasos.

Un nucletido.

d. Un polisacrido.
4. El colesterol es:
9. El objetivo de la fotosntesis es:

a. Un lpido saponificable.
b. Un lpido insaponificable
isoprenoides.
c.

tipo

terpeno

a. La obtencin de agua.

b. La obtencin de oxgeno.

Un cido graso saturado.

c.

d. Un lpido insaponificable tipo esteroides.

La fabricacin de compuestos orgnicos a partir


de compuestos inorgnicos.

d. La respiracin de la planta.

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 10 de marzo de 2009


BOC 2009/062 martes 31 de marzo de 2009

10. Indica cul de las siguientes frases es la


verdadera:
a. En los humanos las nicas clulas
experimentan meiosis son las sexuales.

15. Los anticuerpos son:


a. Molculas proteicas producidas por los linfocitos
B.

que

b. Parte de un patgeno que produce la activacin


del sistema inmune.

b. Las nicas clulas que experimentan meiosis


son las clulas madres de gametos.
c.

c.

Las esporas son clulas propias de reproduccin


asexual.

Sustancias que desencadenan una respuesta


inmunitaria.

d. Sustancias lipdicas producidas por los linfocitos


B.

d. Una cromtida es portadora del mismo mensaje


gentico que el cromosoma del que procede.

16. Seala la afirmacin correcta:


a. La alergia es una reaccin de hipersensibilidad.

11. Las clulas diploides son:

b. La alergia es producida por anticuerpos.

a. Las que tienen una dotacin cromosmica.

c.

b. Las que se obtienen de la meiosis.


c.

d. Los linfocitos T se forman en la mdula sea.

Son las clulas sexuales.

d. Las que tienen dos dotaciones cromosmicas.

17. Una vacuna consiste en:


a. Inocular en el paciente anticuerpos del microbio
contra el que se quiere proteger.

12. El conjunto de genes de un organismo es:


a. El fenotipo.

b. Inocular en el paciente antgeno del microbio


contra el que se quiere proteger.

b. El cariotipo.
c.

El asma no est producido por una alergia.

c.

El genotipo.

Inocular en el paciente inmunoglobulinas.

d. Un tipo de inmunidad congnita.

d. El homocigtico.

18. Si cruzamos un individuo cuyo genotipo es Aa


con otro del mismo genotipo, los hijos
resultantes sern:

13. El ADN est formado por:


a. Una cadena de nucletidos de adenina, guanina,
citosina y uracilo.

a. 25% AA 75% Aa

b. Dos cadenas de nucletidos


guanina, citosina y uracilo.

c.

c.

de

b. 100% Aa

adenina,

d. 25% Aa 50% AA 25% aa

Una cadena de nucletidos de adenina, guanina,


citosina y timina.

d. Dos cadenas de nucletidos


guanina, timina y citosina.

de

25% AA 50% Aa 25% aa

19. El retrocruzamiento o cruzamiento prueba se


realiza para averiguar:

adenina,

a. El fenotipo de un individuo.
14. Los principales componentes estructurales de
las bacterias son:

b. Si la herencia es codominante.
c.

a. Pared, membrana y citoplasma.

d. Si el individuo con fenotipo dominante puede ser


homocigtico AA o heterocigtico Aa.

b. Pared, ADN, membrana y orgnulos.


c.

Cpsula
bacteriana,
pared,
citoplasma y ADN bacteriano.

Si el individuo es homocigtico recesivo.

20. Las clulas humanas contienen:

membrana,

a. 23 cromosomas.

d. Cpsula bacteriana, membrana, citoplasma y


ADN bacteriano.

b. 22 cromosomas y 2 cromosomas sexuales.


c.

46 cromosomas agrupados en 23 parejas.

d. 26 parejas de cromosomas.

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 23 de marzo de 2010


BOC 2010/066 martes 6 de abril de 2010

PRUEBA

CFGS

BIOLOGA

CDIGO: GS_______

CRITERIOS DE CALIFICACIN
- Cada respuesta correcta se valorar con 0,5
puntos.
- Las respuestas en blanco o incorrectas no
puntan ni penalizan.

DNI:

INSTRUCCIONES
- Salvo que se especifique lo contrario, cada
cuestin tiene una sola respuesta correcta.

1. De las siguientes propiedades del agua seala


cul es la que permite a los insectos deslizarse
por su superficie sin hundirse:

5. La finalidad del anabolismo es:


a. La produccin de materia orgnica.

a. Elevado calor de vaporizacin.

b. La degradacin de materia orgnica.

b. Elevado calor especfico.

c.

c.

d. Controlar el metabolismo.

Elevada fuerza de cohesin-adhesin.

Obtener NADH.

d. Baja densidad en estado slido.


6. Indica cul de las siguientes relaciones es
incorrecta.

2. Qu tienen en comn el pelo de los mamferos y


la seda de una telaraa?

a. Cromatina ADN.

a. Estn formados por celulosa.

b. Mitocondria ATP.

b. Estn formados por almidn.

c. Lisosoma Clorofila.

c.

d. Retculo endoplasmtico rugoso Ribosoma.

Estn formados por glucgeno.

d. Estn formados por una protena estructural.


7. Se cruzaron dos individuos de pelo rizado y
tuvieron dos hijos: uno de pelo rizado y otro de
pelo liso. Cmo sern los genotipos de toda su
descendencia?

3. Los nucletidos pertenecen a:


a. Las protenas.
b. Los biocatalizadores.

a. 75% Rr 25% rr

c.

b. 50% RR 25% Rr 25% rr

Los lpidos.

c.

d. Los cidos nucleicos.

25% RR 50% Rr 25% rr

d. 25% RR 25% Rr 50% rr


4. Indica la afirmacin correcta:
8. El cariotipo es la foto
cromosomas de una clula:

a. Las clulas vegetales poseen cloroplastos y


centrosoma.
b. Las clulas
centrosoma.
c.

animales

vegetales

a. Metafsica ordenados.

poseen

b. Anafsica ordenados.

Las clulas vegetales poseen cloroplastos pero


no poseen mitocondrias.

c. Profsica ordenados.
d. Sexual.

d. Las clulas vegetales poseen cloroplastos pero


no poseen centrosoma.

dibujo

de

los

PRUEBA DE ACCESO A LOS CICLOS FORMATIVOS


DE GRADO SUPERIOR. PARTE ESPECFICA

Resolucin de 23 de marzo de 2010


BOC 2010/066 martes 6 de abril de 2010

15. Indica la frase correcta:

9. Un grupo de microorganismos muertos o


atenuados pero que todava tienen la capaciadad
antignica, es:

a. Los sueros son defensas activas.


b. Los sueros tienen una composicin glucdica.

a. Un suero.

c.

b. Un virin.
c.

Los sueros son un tipo de defensa pasiva.

d. Los sueros es un tipo de inmunidad adquirida.

Una vacuna.

d. Un anticuerpo.
16. El enlace fosfodister se establece entre:
a. El grupo carboxilo de un aminocido y el grupo
amino del siguiente.

10. Indica la frase correcta:


a. El catabolismo es un proceso degradativo.

b. Dos cidos grasos.

b. El catabolismo es un proceso de sntesis.


c.

c.

El catabolismo es la produccin de materia


orgnica.

d. El catabolismo
anabolismo.

es

un

proceso

similar

d. Dos grupos OH de dos monosacridos.

al
17. La desnaturalizacin de las protenas consiste
en:
a. La prdida solo de la estructura cuaternaria.

11. El ciclo celular es:

b. La prdida solo de la estructura terciaria.

a. La secuencia de acontecimientos que tiene lugar


a lo largo de la vida de la clula.

c.

Un cambio en sus aminocidos.

d. Un cambio
filamentosa.

b. La etapa de duplicacin de sus orgnulos.


c.

Dos nucletidos.

La interfase.

de

conformacin

globular

d. Mitosis y cotocinesis.
18. Las clulas haploides son:
a. Las que tienen dos dotaciones cromosmicas.

12. Los plsmidos son:

b. Las que se obtienen de la mitosis.

a. Bacterias.

c.

b. Virus.
c.

Todas las clulas de nuestro cuerpo.

d. Las que se obtienen de la meiosis.

Cadenas circulares de ADN.

d. Orgnulos especiales.
19. Las plantas y los animales que tienen ADN
modificado o derivado de otras especies se
denominan:

13. Si en una cadena de ADN la secuencia es


AGTCCA, qu secuencia encontraramos en su
cadena complementaria?

a. Plsmidos.
b. Transgnicos.

a. TCAGGT.

c. Clones.

b. AGTCCA

d. Recesivos.

c. UCUGGU
d. No se puede determinar por tener carcter
aleatorio.

20. Un linfocito B es:


a. Un macrfago.

14. Un alrgeno es:


a. Un antgeno que provoca una reaccin alrgica.

b. Una clula productora de antgenos.

b. Un anticuerpo.

c.

c.

d. Una clula
inmunitario.

Una alergia.

d. Un microorganismo.
2

Una clula productora de anticuerpos.


que

no

pertenece

al

sistema

GOBIERNO
DE
CANTABRIA

SEG

CONSEJERA DE EDUCACIN

PRUEBAS DE ACCESO A LOS CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 17 de junio de 2010 (Orden de 26 de febrero de 2010)
DATOS DEL ASPIRANTE

Apellidos:
Nombre

D.N.I.

CALIFICACIN FINAL

No Apto
APTO

(Cifra)

GRADO SUPERIOR - PARTE ESPECFICA

OPCIN 3 - BIOLOGA
Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados de las cuestiones.
Cuide la presentacin y escriba la solucin o el proceso de forma ordenada.
Empiece por los ejercicios en los que est ms seguro.
Duracin: 2 horas.
ATENCIN!! Elija y conteste tan slo 4 de las preguntas que se ofrecen
PREGUNTAS:
Cuestin 1)
- La clula eucariota animal: realiza un dibujo indicando los diferentes orgnulos que
presenta. Seala en dos o tres lneas las funciones que realizan dentro de la clula
cada uno de ellos.
- Explica el concepto de respiracin celular y su significado biolgico.
Cuestin 2)
- Haz un dibujo de una neurona indicando sus componentes. Explica el mecanismo de
transmisin del impulso nervioso.
- Explica desde el punto de vista funcional los siguientes conceptos referidos a la
reproduccin humana: placenta, tero, conductos deferentes, vescula seminal,
fecundacin y trompas de Falopio.
Cuestin 3)
- Resuelve este problema gentico: El color de pelo negro de los cobayas domina sobre el

color de pelo blanco. Al cruzar dos cobayas, uno de pelo negro y otro de pelo blanco, se
obtuvieron unos descendientes de color negro y otros de color blanco.
a) Seala el genotipo de los padres.
b) Seala las proporciones genotpicas y fenotpicas que se daran al cruzar dos
cobayas de pelaje blanco.
- Estructura del ADN: componentes, enlaces y dibujo representativo.
1

Cuestin 4)
- Explica la importancia de los microorganismos en los ciclos biogeoqumicos.
- Define qu es un microorganismo. Nombra todos los tipos o grupos de
microorganismos que existen en la naturaleza. Nombra ejemplos de microorganismos
de cada uno de esos grupos que tengan importancia para la salud y las enfermedades
que originan.
Cuestin 5)
- Explica la respuesta humoral ante la invasin de un microorganismo.
- Cmo se fabrican las vacunas? Explica esta frase: Las vacunas generan inmunidad
en las personas a las que se administran

CRITERIOS DE CALIFICACIN:
Debe usted responder un mximo de cuatro preguntas completas de las cinco que se
plantean.
Cada pregunta contestada est calificada con un mximo de 2,50 puntos sobre 10. (Cada una
de ellas tiene dos apartados valorados en 1,25 puntos)
Las repuestas deben ceirse al mbito de la pregunta. Los dibujos o esquemas grficos deben
ser claros y que respondan a lo preguntado.
La caligrafa debe ser legible y cuidadosa. Del mismo modo, se exige una correccin
ortogrfica en las repuestas.

GOBIERNO
DE
CANTABRIA

SEG

CONSEJERA DE EDUCACIN

PRUEBAS DE ACCESO A LOS CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 17 de junio de 2010 (Orden de 26 de febrero de 2010)
DATOS DEL ASPIRANTE

Apellidos:
Nombre

D.N.I.

CALIFICACIN FINAL

No Apto
APTO

(Cifra)

GRADO SUPERIOR - PARTE ESPECFICA

OPCIN 3 - BIOLOGA
Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados de las cuestiones.
Cuide la presentacin y escriba la solucin o el proceso de forma ordenada.
Empiece por los ejercicios en los que est ms seguro.
Duracin: 2 horas.
ATENCIN!! Elija y conteste tan slo 4 de las preguntas que se ofrecen
PREGUNTAS:
Cuestin 1)
- La clula eucariota animal: realiza un dibujo indicando los diferentes orgnulos que
presenta. Seala en dos o tres lneas las funciones que realizan dentro de la clula
cada uno de ellos.
- Explica el concepto de respiracin celular y su significado biolgico.
Cuestin 2)
- Haz un dibujo de una neurona indicando sus componentes. Explica el mecanismo de
transmisin del impulso nervioso.
- Explica desde el punto de vista funcional los siguientes conceptos referidos a la
reproduccin humana: placenta, tero, conductos deferentes, vescula seminal,
fecundacin y trompas de Falopio.
Cuestin 3)
- Resuelve este problema gentico: El color de pelo negro de los cobayas domina sobre el

color de pelo blanco. Al cruzar dos cobayas, uno de pelo negro y otro de pelo blanco, se
obtuvieron unos descendientes de color negro y otros de color blanco.
a) Seala el genotipo de los padres.
b) Seala las proporciones genotpicas y fenotpicas que se daran al cruzar dos
cobayas de pelaje blanco.
- Estructura del ADN: componentes, enlaces y dibujo representativo.
1

Cuestin 4)
- Explica la importancia de los microorganismos en los ciclos biogeoqumicos.
- Define qu es un microorganismo. Nombra todos los tipos o grupos de
microorganismos que existen en la naturaleza. Nombra ejemplos de microorganismos
de cada uno de esos grupos que tengan importancia para la salud y las enfermedades
que originan.
Cuestin 5)
- Explica la respuesta humoral ante la invasin de un microorganismo.
- Cmo se fabrican las vacunas? Explica esta frase: Las vacunas generan inmunidad
en las personas a las que se administran

CRITERIOS DE CALIFICACIN:
Debe usted responder un mximo de cuatro preguntas completas de las cinco que se
plantean.
Cada pregunta contestada est calificada con un mximo de 2,50 puntos sobre 10. (Cada una
de ellas tiene dos apartados valorados en 1,25 puntos)
Las repuestas deben ceirse al mbito de la pregunta. Los dibujos o esquemas grficos deben
ser claros y que respondan a lo preguntado.
La caligrafa debe ser legible y cuidadosa. Del mismo modo, se exige una correccin
ortogrfica en las repuestas.

GOBIERNO
DE
CANTABRIA
CONSEJERA DE EDUCACIN

PRUEBAS DE ACCESO A LOS CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 16 de junio de 2011 (Resolucin de 28 de marzo de 2011)
DATOS DEL ASPIRANTE

Apellidos:
Nombre

D.N.I.

CALIFICACIN FINAL

No Apto
APTO

(Cifra)

GRADO SUPERIOR - PARTE ESPECFICA

OPCIN 3 - BIOLOGA
Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados de las cuestiones.
Cuide la presentacin y escriba la solucin o el proceso de forma ordenada.
Empiece por los ejercicios en los que est ms seguro.
Duracin: 2 horas.
.

PREGUNTAS:
Cuestin 1:
- Identifique el orgnulo celular representado, seale sus componentes fundamentales y explique la funcin
principal que realiza en la clula.

- Explique los conceptos de endocitosis y exocitosis. Ponga un ejemplo de cada uno de ellos en algn tipo de
clula.
Cuestin 2:
- Caractersticas del cdigo gentico y su importancia en la expresin de los genes.
- El color de la semilla en guisantes puede ser verde o amarilla. Sabemos que los heterocigticos presentan la
semilla amarilla. Haz el cruce de un homocigtico de semilla verde y un heterocigtico de semilla amarilla. Da
las proporciones genotpicas y fenotpicas de la descendencia. Define qu es un gen alelo dominante y un gen
alelo recesivo, cul de los genes alelos amarillo/verde es dominante o recesivo en los guisantes?

Cuestin 3:
- Anatoma del aparato respiratorio: esquema de sus componentes. Explique cmo se produce el intercambio
gaseoso en los pulmones.
- Identifique los componentes del ojo en este esquema.

Cuestin 4:
-

Explique la importancia de los microorganismos en los ciclos biogeoqumicos.


Existen microorganismos simbiticos, explica en qu consiste este modo de vida. Pon tres ejemplos
comentados de microorganismos simbiticos.

Cuestin 5:
-

Explique la respuesta humoral ante la entrada de un microorganismo: clulas que participan, mecanismo
de actuacin y eliminacin del microorganismo causante de la enfermedad.

Comenta la funcin de los linfocitos T en el control de clulas cancerosas y/o clulas infectadas por virus.

CRITERIOS DE CALIFICACIN:
Debe usted responder un mximo de cuatro preguntas completas de las cinco que se
plantean.
Cada pregunta contestada est calificada con un mximo de 2,50 puntos sobre 10.
(Cada una de ellas tiene dos apartados valorados en 1,25 puntos)
Las repuestas deben ceirse al mbito de la pregunta.
La caligrafa debe ser legible y cuidadosa. Del mismo modo, se exige una correccin
ortogrfica en las repuestas.

GOBIERNO
DE
CANTABRIA
CONSEJERA DE EDUCACIN,
CULTURA Y DEPORTE

PRUEBAS DE ACCESO A LOS CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 14 de junio de 2012 (Resolucin de 28 de febrero de 2012)**
DATOS DEL ASPIRANTE

Apellidos:
Nombre:

D.N.I.:

Si ha superado un Ciclo Formativo de Grado Medio, indique el


nombre:

CALIFICACIN FINAL

No Apto
APTO

(Cifra)

GRADO SUPERIOR - PARTE ESPECFICA

OPCIN 3 - BIOLOGA
Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados de las cuestiones.
Cuide la presentacin y escriba la solucin o el proceso de forma ordenada.
Empiece por los ejercicios en los que est ms seguro.
Duracin: 2 horas.
.

EJERCICIO:
1.- Explica la estructura del ADN y sus componentes moleculares. Haz un dibujo o
esquema de cmo es la molcula de ADN y cmo se distribuyen las subunidades que
lo componen.
2.- Explica la mitosis de una clula eucariota animal. Haz dibujos que representen
cada una de sus etapas.
3.- Explica la anatoma del corazn en los humanos. Qu es la circulacin general o
mayor? Explcala e indica qu funcin tiene.
4.- Explica cmo se reproduce un virus que posee un ciclo ltico.
5.- Una pareja que ambos poseen de grupo sanguneo A tienen dos hijos uno de grupo
A y el segundo de grupo 0 (cero) Explica cmo es esto posible.
6.- Los microorganismos pueden producir enfermedades en otros seres vivos.
Comenta por qu infectan y producen enfermedades. Pon dos ejemplos de virus, de
bacterias y de hongos que produzcan enfermedades en los humanos.

7.- Explica cmo se produce una vacuna y cmo logra que la persona quede
inmunizada ante cierta enfermedad.
8.- Explica la estructura bsica de un anticuerpo o inmunoglubilina. Qu regiones son
las que interactan con los antgenos?

CRITERIOS DE CALIFICACIN:
El examen se valorar sobre 10 puntos. Cada pregunta contestada est calificada con
un mximo de 1,25 puntos.

Las repuestas deben ceirse al mbito de la pregunta.


La caligrafa debe ser legible y cuidadosa. Del mismo modo, se exige una correccin
ortogrfica en las repuestas.

GOBIERNO
DE
CANTABRIA
CONSEJERA DE EDUCACIN,
CULTURA Y DEPORTE

PRUEBAS DE ACCESO A LOS CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 13 de junio de 2013 (Resolucin de 14 de febrero de 2013)
DATOS DEL ASPIRANTE

Apellidos:
Nombre:

D.N.I.:

Si ha superado un Ciclo Formativo de Grado Medio, indique el


nombre:

CALIFICACIN FINAL

No Apto
APTO

(Cifra)

GRADO SUPERIOR - PARTE ESPECFICA

OPCIN 3 - BIOLOGIA
Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados de las cuestiones.
Cuide la presentacin y escriba la solucin o el proceso de forma ordenada.
Empiece por los ejercicios en los que est ms seguro.
Duracin: 2 horas.

EJERCICIO:
Cuestin 1:
Explica la estructura terciaria de una protena y explica con ejemplos las funciones
fundamentales que realizan en los seres vivos.

Cuestin 2:
Indica cinco diferencias estructurales y/o metablicas entre una clula eucariota animal y una
clula procariota.
Cuestin3:
Nombra los diferentes aparatos que componen el cuerpo humano que intervienen en la
nutricin y describe brevemente sus funciones fundamentales.

Cuestin 4:
Explica qu es la sinapsis, qu clulas intervienen y cul es su funcin en el ser vivo. Aydate
de un dibujo.

Cuestin 5:
Explica dos ejemplos de la utilizacin de microorganismos en los procesos alimentarios y/o
sanitarios.
Cuestin 6:
Qu es una mutacin? Cules son las causas que las originan? Por qu las mutaciones
son generalmente perjudiciales en los seres vivos? Razona por qu ciertas mutaciones son
importantes en la Seleccin Natural de los seres vivos.
Cuestin 7:
El color rojo domina sobre el blanco en los claveles. Escribe el genotipo de un clavel blanco,
un clavel rojo homocigtico y un clavel heterocigtico. De qu color sern los claveles
heterocigticos? Cmo sern las proporciones genotpicas y fenotpicas de un cruce de dos
claveles que son heterocigticos?
Cuestin 8:
Explica qu funcin realizan los linfocitos B en el sistema inmunitario: respuesta humoral.

CRITERIOS DE CALIFICACIN:

Cada cuestin contestada ser calificada con un mximo de 1,25 puntos. Siendo el valor total
de la prueba 10 puntos. Para obtener la calificacin de apto debe tener una puntuacin de 5 o
ms puntos.
Las repuestas deben ceirse al mbito de la pregunta. Los dibujos o esquemas grficos deben
ser claros y que respondan a lo preguntado.
La caligrafa debe ser legible y cuidadosa. Del mismo modo, se exige una correccin
ortogrfica en las repuestas.

CALIFICACIN:___________________
Consejera de Educacin, Cultura y Deportes.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE


FORMACIN PROFESIONAL
JUNIO 2013
Resolucin de 02/04/2013, de la Viceconsejera de Educacin, Universidades e
Investigacin (DOCM 17 de abril de 2013)

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen_______________________________________________________________________________________

PARTE ESPECFICA- OPCIN C


MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 3 horas, conjuntamente con la otra materia elegida


Mantenga su DNI en lugar visible durante la realizacin de la prueba.
Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y
entregue este cuadernillo completo al finalizar la prueba.
Lea detenidamente los textos, cuestiones o enunciados.
Cuide la presentacin y, una vez terminada la prueba, revsela antes de
entregarla.

Criterios de calificacin:
Esta prueba consta de dos bloques. En el primero encontrars dos temas, debes escoger
uno de ellos y hacer todas las preguntas, no se pueden mezclar preguntas de los temas.
En el segundo bloque debes hacer cinco de las ocho preguntas propuestas.

BLOQUE 1 (5 puntos, cada pregunta vale un punto)


BLOQUE 2 (5 puntos, cada pregunta vale un punto).

La nota de la parte especfica, ser la media aritmtica de las calificaciones


obtenidas en cada una de las materias elegidas por el aspirante, siempre que se
obtenga, al menos, una puntuacin de cuatro en cada una de ellas. Esta nota media
deber ser igual o superior a cuatro puntos para que haga media con la parte
comn.

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

BLOQUE 1.
Tema 1: Alimentacin y nutricin.
a. Nombra las estructuras correspondientes en la imagen n1.
b.
Enumera los procesos que se producen, en condiciones normales, desde la
entrada de un alimento en tu cuerpo hasta su salida.
c.

Qu es el metabolismo? Diferencias entre anabolismo y catabolismo.

d.

Dnde se produce la respiracin celular? Describe en que consiste.

e.

Explica que es la diabetes, sus distintos tipos y cmo prevenirla.

Imagen n1: Aparato Digestivo. Fuente: Proyecto Biosfera Ministerio de Educacin y Cultura.
URL: http://recursostic.educacion.es/ciencias/biosfera/web/profesor/index.htm
Licencia: Creative Commons

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

Tema 2. La clula.
a. Nombra las estructuras correspondientes en la imagen n2.

Imagen n2: Clula animal. Fuente: Proyecto Biosfera Ministerio de Educacin y Cultura.
URL: http://recursostic.educacion.es/ciencias/biosfera/web/profesor/index.htm
Licencia: Creative Commons

b. Qu dice la teora celular?


c. Diferencias entre mitosis y meiosis.
d. Cmo almacena la informacin gentica una clula eucariota? Define los
siguientes conceptos: Replicacin, transcripcin y traduccin.
e. Qu son los productos transgnicos?

BLOQUE 2. Escoge cinco preguntas de las


pregunta vale un punto)

ocho propuestas (5 puntos, cada

1. Relaciona los elementos de la siguiente tabla


Regin corporal
Hueso
Mano
Frontal
Antebrazo
Cubito
Pierna
Metacarpo
Cabeza
Calcneo
Espalda
Peron
Pie
Iliaco
Pelvis
Escapula

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

2.

Explica el ciclo cardiaco.

3.

Describe la estructura de las neuronas. Qu es la sinapsis?

4.

Enumera los diferentes tipos de tejidos que forman el cuerpo humano y su


funcin principal.

5.

Explica los distintos tipos de barreras defensivas que posee nuestro organismo.

6.

Qu es un bioelemento? Define todos los tipos que conozcas y pon ejemplos


de cada uno.

7.
8.

Define los siguientes conceptos: Excrecin, secrecin y defecacin.


Qu es una hormona? Cita tres ejemplos de hormonas indicando donde se
originan y cul es su funcin.

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

CALIFICACIN:___________________
Consejera de Educacin, Cultura y Deportes.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE


FORMACIN PROFESIONAL
SEPTIEMBRE 2013
Resolucin de 02/04/2013, de la Viceconsejera de Educacin, Universidades e
Investigacin (DOCM 17 de abril de 2013)

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen_______________________________________________________________________________________

PARTE ESPECFICA- OPCIN C


MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 3 horas, conjuntamente con la otra materia elegida


Mantenga su DNI en lugar visible durante la realizacin de la prueba.
Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y
entregue este cuadernillo completo al finalizar la prueba.
Lea detenidamente los textos, cuestiones o enunciados.
Cuide la presentacin y, una vez terminada la prueba, revsela antes de entregarla.

Criterios de calificacin:
Esta prueba consta de dos bloques:

En el primero encontrar dos temas, debe escoger uno de ellos y contestar todas las
preguntas, no se pueden mezclar preguntas de los dos temas.

En el segundo bloque debe contestar cinco de las ocho preguntas propuestas.

Esta prueba se calificar numricamente entre 0 y 10 puntos, en funcin de los siguientes


criterios:

Primer bloque....... 5 puntos (1 punto cada pregunta).

Segundo bloque.... 5 puntos (1 punto cada pregunta).

Se valorar el orden, la limpieza y la claridad en la presentacin.

La nota de la parte especfica, ser la media aritmtica de las calificaciones obtenidas en


cada una de las materias elegidas por el aspirante, siempre que se obtenga, al menos, una
puntuacin de cuatro en cada una de ellas. Esta nota media deber ser igual o superior a
cuatro puntos para que haga media con la parte comn.

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

Bloque 1. Escoge un tema de los dos propuestos


Tema 1. Acerca de los procesos digestivos en la especie humana.
a. Relaciona los elementos de la siguiente tabla:
rgano

Funcin

1. Boca

a. Digestin de lpidos

2. Faringe

b. Entrada al estmago

3. Estmago

c. Formacin del quimo

4. Intestino delgado

d. Formacin del bolo


alimenticio

5. Intestino grueso

e. Divide las grasas en finas


gotas

6. Cardias

f. Pertenece a los aparatos


digestivo y respiratorio

7. Bilis

g. Absorcin de agua

8. Lipasas

h. Absorcin de nutrientes

b. En qu consiste la digestin? Cules son las glndulas anejas al tubo


digestivo? Indica cual es la secrecin de cada una de ellas.
c. En qu se diferencia la digestin mecnica de la digestin qumica?
d. Qu son los movimientos peristlticos? Explica su funcin
e. En qu consiste la absorcin? Donde tiene lugar?

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

Tema 2. Acerca de los microorganismos.


a. Explica la estructura de una bacteria. (Puedes hacer un esquema indicando los
componentes estructurales ms importantes de la misma, tambin puedes hacer
un dibujo)
b. Son los microorganismos siempre perjudiciales para el hombre? Razona tu
respuesta exponiendo dos casos que la confirmen.
c. De la siguiente relacin de microorganismos cules presentan organizacin
procariota y cules organizacin eucariota.
Escherichia coli (bacteria)
Entamoeba hystolitica (protozoo)
Penicillium notatum (hongo)
Plasmodium falciparum (protozoo)
d.
En qu consiste la ingeniera gentica? Cul es su relacin con los
microorganismos? Indica una aplicacin de la misma.
e.
Qu entiendes por virus?. Qu diferencias encuentras entre virus y bacterias?
BLOQUE 2. Escoge cinco preguntas de las ocho propuestas
1. En qu consiste la mitosis? Explica sus fases.
2. Cules son las principales diferencias entre las clulas procariotas y las clulas
eucariotas?
3. Qu entiendes por bioelemento? Cules son los bioelementos mayoritarios de la
materia viva?
4. Qu es una protena? Cita las funciones biolgicas de estas biomolculas.
5. En el hombre, la falta de pigmentacin denominada albinismo es el resultado de la
accin de un alelo.Dos progenitores normales tuvieron 2 hijos albinos y 1 hijo
normal. Es el albinismo un carcter dominante o recesivo? Cul es el genotipo
de los progenitores? Cul es la probabilidad de que el prximo hijo sea normal?
6. Explica las diferencias entre el sistema nervioso y el endocrino.
7. En qu consiste la vacunacin? Cul es su objetivo?
8. Relaciona los elementos de la siguiente tabla:
Reaccin metablica

Caractersticas

1. Respiracin celular

a. Se obtiene muy poca energa. La


oxidacin es incompleta.

2. Fotosntesis

b. Se forman dos molculas de cido


pirvico.

3. Fermentacin

c. Se produce en las mitocondrias,


genera energa

4. Gluclisis

d. Genera materia orgnica.


produce en los cloroplastos

Se

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes.

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Consejera de Educacin y Ciencia

CALIFICACIN:___________

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE


FORMACIN PROFESIONAL
Resolucin de 27 de marzo de 2008 (DOCM del da 4 de abril)

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen_______________________________________________________________________________________

PARTE ESPECFICA. OPCIN C


MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 4 horas, conjuntamente con la otra materia elegida (16 a 20 horas)
Mantenga su DNI en lugar visible durante la realizacin de la prueba.
Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y
entregue este cuadernillo completo al finalizar la prueba.
Lea detenidamente los textos, cuestiones o enunciados.
Cuide la presentacin y, una vez terminada la prueba, revsela antes de entregarla.

Criterios de calificacin

Este ejercicio consta de DOS partes:


o
o

Este ejercicio se calificar numricamente entre 0 y 10, segn los siguientes criterios:
o

Un tema a elegir de entre dos propuestos


Tres cuestiones breves a elegir de entre seis propuestas

El tema elegido en el bloque 1 se puntuar con cuatro puntos mximo y las tres
cuestiones del bloque 2 con dos puntos cada una. Las respuestas deben limitarse
a la cuestin que se formula, de manera que cualquier informacin adicional que
exceda de lo planteado por la cuestin no debe evaluarse.
Se valorar positivamente:
- El conocimiento concreto del contenido de cada pregunta y el desarrollo adecuado
del mismo.
- La claridad en la exposicin de los diferentes conceptos y capacidad de sntesis.
- La utilizacin de forma correcta de un lenguaje cientfico-biolgico.

La nota de la parte especfica ser la media aritmtica de las calificaciones obtenidas en cada
una de las materias elegidas por el aspirante. Esta nota media de la parte especfica deber
ser igual o superior a cuatro puntos para que haga media con la parte comn.

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

EJERCICIOS
BLOQUE 1 (ELEGIR UN TEMA DE LOS DOS PROPUESTOS)
1.- El siguiente esquema representa un rgano humano:
a) A qu rgano corresponde?
b) Cul es su funcin?
c) Cmo se llaman los vasos sanguneos que entran y salen de el?
d) Nombre las estructuras rotuladas con un nmero

2.- La meiosis:
a) Definicin.
b) Fases de que costa y acontecimientos que tienen lugar en cada una de ellas.
c) Qu clulas se obtienen como consecuencia de ella? Qu caractersticas especiales
tienen?
d) Significado biolgico.
CUESTIONES BREVES (ELEGIR TRES DE LAS 6 PROPUESTAS)
1.- Cul es la diferencia entre anabolismo y catabolismo? Pon un ejemplo de una reaccin
anablica y de una reaccin catablica.
2.- A qu grupo de molculas pertenece la glucosa? Cul es su funcin?
3.- En el intestino grueso de la especie humana existen poblaciones de bacterias. De qu
bacterias se trata? Qu funcin tienen?
4.- Cul es la molcula que contiene la informacin gentica? Dnde se encuentra? Cmo se
llaman las unidades que la conforman? Cul es su estructura?
5.- El cruce de dos variedades de guisantes, una verde y una amarilla, produce una primera
generacin filial formada toda ella por guisantes amarillos. Cmo es el color amarillo con
respecto al color verde? Describe el genotipo y fenotipo de los guisantes que se cruzan y de los
que se obtienen como resultado del cruzamiento.
6.- Seala las diferencias entre la clula animal y la clula vegetal.

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

Consejera de Educacin y Ciencia

Apellidos______________________________________________________________Nombre__________________________
DNI / NIE ________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE


FORMACIN PROFESIONAL

PARTE ESPECFICA. OPCIN C


MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 4 horas, conjuntamente con la otra materia elegida (16 a 20 horas)
Mantenga su DNI en lugar visible durante la realizacin de la prueba.
Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y
entregue este cuadernillo completo al finalizar la prueba.
Lea detenidamente los textos, cuestiones o enunciados.
Cuide la presentacin y, una vez terminada la prueba, revsela antes de entregarla.

Criterios de calificacin

Este ejercicio consta de DOS bloques:


o
o

BLOQUE 1: Dos preguntas que el aspirante debe elegir entre las tres propuestas.
Cada una se calificar hasta un mximo de 3 puntos
BLOQUE 2. Cuatro cuestiones breves a elegir de entre siete propuestas. Cada una se
calificar con un punto

Este ejercicio se calificar numricamente entre 0 y 10, segn los siguientes criterios:

La nota de la parte especfica ser la media aritmtica de las calificaciones obtenidas en cada
una de las materias elegidas por el aspirante. Esta nota deber ser igual o superior a cuatro
puntos para que haga media con la parte comn.

EJERCICIOS
BLOQUE 1: (ELEGIR DOS TEMAS DE LOS TRES PROPUESTOS)
1. Observa los siguientes dibujos y contesta
a) Qu dibujo representa una clula procariota? Cual la eucariota? Justifica la
respuesta.
b) Pon el nombre de las estructuras rotuladas con un nmero.
c) De las siguiente relacin de seres vivos indica cules presentan organizacin
celular procariota y cules eucariota:





Salmonella sp. (bacteria)


Rhizopus sp. (moho)
Sacharomyces cerevisiae (levadura)
Glbulo blanco

B
1

2
3

4
8

Tipo de Clula
A.
1.2.3.4.-

B .
5.6.7.8.-

2. Con respecto al siguiente esquema, indica:


a) Qu estructura es la representada?

b) Sealar las funciones principales de esta estructura


c) Identificar las molculas sealadas con un cuadro y un nmero
d) Cmo se llama el modelo de estructura que aparece en el dibujo?

1
2
5
3

3. La mitosis:
a) Definicin.
b) Fases de las que consta y acontecimientos que tienen lugar en cada una de ellas.
c) Significado biolgico.

BLOQUE 2. CUESTIONES
PROPUESTAS)

BREVES

(ELEGIR

CUATRO

DE

LAS

SIETE

1.- Qu son los glcidos o hidratos de carbono? Y los monosacridos? Mencione


algunas de las funciones de los glcidos y citar al menos un ejemplo.
2.- Diferencia ADN y ARN. Qu es la traduccin? Y la transcripcin?

3. Qu entiendes por biotecnologa? qu es un organismo transgnico? Indica


algunos aspectos beneficiosos y negativos en los que estn implicados
microorganismos.
4. Define los siguientes conceptos: Antgeno - Anticuerpo - Vacuna

- Alergia

5. Relacione las siguientes funciones de cada uno de los


sistemas/aparatos/rganos asignando a cada nmero la letra correspondiente
Funciones
1/
2/
3/
4/
5/

1 Absorcin de nutrientes
2 Transporte del oxgeno, nutrientes,
hormonas
3 Transmisin del impulso nervioso
4 Produccin de hormonas
5 Produccin de espermatozoides/vulos

siguientes

sistema/aparato/rgano/
clulas
A Gnadas
B Aparato digestivo
C Neuronas
D Sistema endocrino
E Sistema circulatorio

6. Relacione las siguientes funciones de cada uno de los siguientes orgnulos asignando
a cada nmero la letra correspondiente

1/
2/
3/
4/
5/

Funciones
1 Secrecin
2 Respiracin
3 Fotosntesis
4 Sntesis de protenas
5 Movimientos de las clulas

Orgnulos
A Mitocondrias
B Cloroplastos
C Ribosomas
D Aparato de Golgi
E
Centrosoma

7. Se dice que hay seres vivos auttrofos y hetertrofos. Explica su diferencia y pon algn
ejemplo de cada uno de ellos.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE


FORMACIN PROFESIONAL

PARTE ESPECFICA. OPCIN C


MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 4 horas, conjuntamente con la otra materia elegida (16 a 20 horas)
Mantenga su DNI en lugar visible durante la realizacin de la prueba.
Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y
entregue este cuadernillo completo al finalizar la prueba.
Lea detenidamente los textos, cuestiones o enunciados.
Cuide la presentacin y, una vez terminada la prueba, revsela antes de entregarla.

Criterios de calificacin

Este ejercicio consta de DOS bloques:


o
o

BLOQUE 1: Dos preguntas que el aspirante debe elegir entre las tres propuestas.
Cada una se calificar hasta un mximo de 3 puntos
BLOQUE 2. Cuatro cuestiones breves a elegir de entre siete propuestas. Cada una se
calificar con un punto

Este ejercicio se calificar numricamente entre 0 y 10, segn los siguientes criterios:

La nota de la parte especfica ser la media aritmtica de las calificaciones obtenidas en cada
una de las materias elegidas por el aspirante. Esta nota deber ser igual o superior a cuatro
puntos para que haga media con la parte comn.

EJERCICIOS
BLOQUE 1: (ELEGIR DOS TEMAS DE LOS TRES PROPUESTOS)
1. Observa los siguientes dibujos y contesta
a) Qu dibujo representa una clula procariota? Cual la eucariota? Justifica la
respuesta.
b) Pon el nombre de las estructuras rotuladas con un nmero.
c) De las siguiente relacin de seres vivos indica cules presentan organizacin
celular procariota y cules eucariota:





Salmonella sp. (bacteria)


Rhizopus sp. (moho)
Sacharomyces cerevisiae (levadura)
Glbulo blanco

B
1

2
3

4
8

Tipo de Clula
A.
1.2.3.4.-

B .
5.6.7.8.-

2. Con respecto al siguiente esquema, indica:


a) Qu estructura es la representada?

b) Sealar las funciones principales de esta estructura


c) Identificar las molculas sealadas con un cuadro y un nmero
d) Cmo se llama el modelo de estructura que aparece en el dibujo?

1
2
5
3

3. La mitosis:
a) Definicin.
b) Fases de las que consta y acontecimientos que tienen lugar en cada una de ellas.
c) Significado biolgico.

BLOQUE 2. CUESTIONES
PROPUESTAS)

BREVES

(ELEGIR

CUATRO

DE

LAS

SIETE

1.- Qu son los glcidos o hidratos de carbono? Y los monosacridos? Mencione


algunas de las funciones de los glcidos y citar al menos un ejemplo.
2.- Diferencia ADN y ARN. Qu es la traduccin? Y la transcripcin?

3. Qu entiendes por biotecnologa? qu es un organismo transgnico? Indica


algunos aspectos beneficiosos y negativos en los que estn implicados
microorganismos.
4. Define los siguientes conceptos: Antgeno - Anticuerpo - Vacuna

- Alergia

5. Relacione las siguientes funciones de cada uno de los


sistemas/aparatos/rganos asignando a cada nmero la letra correspondiente
Funciones
1/
2/
3/
4/
5/

1 Absorcin de nutrientes
2 Transporte del oxgeno, nutrientes,
hormonas
3 Transmisin del impulso nervioso
4 Produccin de hormonas
5 Produccin de espermatozoides/vulos

siguientes

sistema/aparato/rgano/
clulas
A Gnadas
B Aparato digestivo
C Neuronas
D Sistema endocrino
E Sistema circulatorio

6. Relacione las siguientes funciones de cada uno de los siguientes orgnulos asignando
a cada nmero la letra correspondiente

1/
2/
3/
4/
5/

Funciones
1 Secrecin
2 Respiracin
3 Fotosntesis
4 Sntesis de protenas
5 Movimientos de las clulas

Orgnulos
A Mitocondrias
B Cloroplastos
C Ribosomas
D Aparato de Golgi
E
Centrosoma

7. Se dice que hay seres vivos auttrofos y hetertrofos. Explica su diferencia y pon algn
ejemplo de cada uno de ellos.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE


FORMACIN PROFESIONAL

PARTE ESPECFICA. OPCIN C


MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 4 horas, conjuntamente con la otra materia elegida (16 a 20 horas)
Mantenga su DNI en lugar visible durante la realizacin de la prueba.
Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y
entregue este cuadernillo completo al finalizar la prueba.
Lea detenidamente los textos, cuestiones o enunciados.
Cuide la presentacin y, una vez terminada la prueba, revsela antes de entregarla.

Criterios de calificacin

Este ejercicio consta de DOS bloques:


o
o

BLOQUE 1: Dos preguntas que el aspirante debe elegir entre las tres propuestas.
Cada una se calificar hasta un mximo de 3 puntos
BLOQUE 2. Cuatro cuestiones breves a elegir de entre siete propuestas. Cada una se
calificar con un punto

Este ejercicio se calificar numricamente entre 0 y 10, segn los siguientes criterios:

La nota de la parte especfica ser la media aritmtica de las calificaciones obtenidas en cada
una de las materias elegidas por el aspirante. Esta nota deber ser igual o superior a cuatro
puntos para que haga media con la parte comn.

EJERCICIOS
BLOQUE 1: (ELEGIR DOS TEMAS DE LOS TRES PROPUESTOS)
1. Observa los siguientes dibujos y contesta
a) Qu dibujo representa una clula procariota? Cual la eucariota? Justifica la
respuesta.
b) Pon el nombre de las estructuras rotuladas con un nmero.
c) De las siguiente relacin de seres vivos indica cules presentan organizacin
celular procariota y cules eucariota:





Salmonella sp. (bacteria)


Rhizopus sp. (moho)
Sacharomyces cerevisiae (levadura)
Glbulo blanco

B
1

2
3

4
8

Tipo de Clula
A.
1.2.3.4.-

B .
5.6.7.8.-

2. Con respecto al siguiente esquema, indica:


a) Qu estructura es la representada?

b) Sealar las funciones principales de esta estructura


c) Identificar las molculas sealadas con un cuadro y un nmero
d) Cmo se llama el modelo de estructura que aparece en el dibujo?

1
2
5
3

3. La mitosis:
a) Definicin.
b) Fases de las que consta y acontecimientos que tienen lugar en cada una de ellas.
c) Significado biolgico.

BLOQUE 2. CUESTIONES
PROPUESTAS)

BREVES

(ELEGIR

CUATRO

DE

LAS

SIETE

1.- Qu son los glcidos o hidratos de carbono? Y los monosacridos? Mencione


algunas de las funciones de los glcidos y citar al menos un ejemplo.
2.- Diferencia ADN y ARN. Qu es la traduccin? Y la transcripcin?

3. Qu entiendes por biotecnologa? qu es un organismo transgnico? Indica


algunos aspectos beneficiosos y negativos en los que estn implicados
microorganismos.
4. Define los siguientes conceptos: Antgeno - Anticuerpo - Vacuna

- Alergia

5. Relacione las siguientes funciones de cada uno de los


sistemas/aparatos/rganos asignando a cada nmero la letra correspondiente
Funciones
1/
2/
3/
4/
5/

1 Absorcin de nutrientes
2 Transporte del oxgeno, nutrientes,
hormonas
3 Transmisin del impulso nervioso
4 Produccin de hormonas
5 Produccin de espermatozoides/vulos

siguientes

sistema/aparato/rgano/
clulas
A Gnadas
B Aparato digestivo
C Neuronas
D Sistema endocrino
E Sistema circulatorio

6. Relacione las siguientes funciones de cada uno de los siguientes orgnulos asignando
a cada nmero la letra correspondiente

1/
2/
3/
4/
5/

Funciones
1 Secrecin
2 Respiracin
3 Fotosntesis
4 Sntesis de protenas
5 Movimientos de las clulas

Orgnulos
A Mitocondrias
B Cloroplastos
C Ribosomas
D Aparato de Golgi
E
Centrosoma

7. Se dice que hay seres vivos auttrofos y hetertrofos. Explica su diferencia y pon algn
ejemplo de cada uno de ellos.

CALIFICACIN: ___________________
Consejera de Educacin, Cultura y Deportes

PRUEBAS DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR DE FORMACIN PROFESIONAL
JUNIO DE 2012
Resolucin de 27 de abril de 2012 (DOCM de 30 de abril)

Apellidos___________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen____________________________________________________________

PARTE ESPECFICA
MATERIA: BIOLOGA
Instrucciones Generales

Duracin del ejercicio: 4 horas, conjuntamente con la otra materia elegida (de 16 a 20 horas)

Mantenga su DNI en lugar visible durante la realizacin de la prueba.

Realice el ejercicio en las hojas de respuestas entregadas al final de este documento y


entregue este cuadernillo completo al finalizar la prueba.

Lea detenidamente los textos, cuestiones o enunciados.

Cuide la presentacin y, una vez terminada la prueba, revsela antes de entregarla.

Criterios de calificacin

Esta prueba consta de dos bloques:

En el primero encontrar dos temas, debe escoger uno de ellos y contestar todas las
preguntas, no se pueden mezclar preguntas de los dos temas.

En el segundo bloque debe contestar cinco de las ocho preguntas propuestas.

Esta prueba se calificar numricamente entre 0 y 10 puntos, en funcin de los siguientes


criterios:

Primer bloque ....... 5 puntos (1 punto cada pregunta).

Segundo bloque .... 5 puntos (1 punto cada pregunta).

Se valorar el orden, la limpieza y la claridad en la presentacin.

La nota de la parte especfica ser la media aritmtica de las calificaciones obtenidas


en cada una de las materias elegidas por el aspirante, siempre que se obtenga al
menos una calificacin de cuatro puntos en cada una de ellas. Esta nota media deber
ser igual o superior a cuatro puntos para que haga media con la parte comn.

Consejera de Educacin, Cultura y Deportes


Apellidos_______________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen________________________________________________________________________

EJERCICIOS
Bloque 1. Escoge un tema de los dos propuestos.
Tema 1. Acerca de la base molecular y fsico-qumica de la vida.

a)
b)
c)
d)

Qu molcula representa la imagen?


Qu funcin desempea esta molcula?
Por qu decimos que la duplicacin de esta molcula es semiconservativa?
La siguiente tabla representa una serie de biomolculas y sus funciones.
Relaciona con una lnea, cada biomolcula con su funcin especfica.
Biomolcula
1. Colesterol
2. Glucgeno
3. Aminocidos
4. Hemoglobina
5. ARN

Funcin
a. Transporta oxgeno en la
sangre
b. Forman parte de las protenas
c. Forma parte de la membrana
plasmtica
d. Interviene en la sntesis de
protenas
e. Almacn de energa

e) En qu consiste la desnaturalizacin de las protenas? Cita dos agentes que


produzcan la desnaturalizacin de estas molculas.

Consejera de Educacin, Cultura y Deportes


Apellidos_______________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen________________________________________________________________________

Tema 2. Acerca de los procesos inmunolgicos en el ser humano.

a) A qu elemento del sistema inmunitario corresponde la imagen?


b) Define los conceptos de: inmunidad, antgeno y anticuerpo.
c) Qu es la inmunidad humoral? Qu clulas la llevan a cabo?
d) Qu entiendes por alergias? Por qu se producen? Todas las alergias tienen
relacin con la primavera? Cules?
e) En qu consiste la vacunacin? Cul es su objetivo?

Bloque 2. Escoge cinco preguntas de las ocho propuestas.


1. Qu diferencias encuentras entre las clulas animales y las clulas vegetales?
2. En la siguiente tabla, relaciona con una lnea, cada orgnulo celular con su funcin o
caracterstica especifica.
Orgnulos celulares
Microtbulos
Ribosomas
Huso mittico o acromtico
Membrana plasmtica
Ncleo
Vacuolas

Funcin o caractersticas
Participa en los procesos de divisin
celular
Almacenan sustancias variadas
En su interior se encuentra el
material gentico
Forman parte del citoesqueleto
Posee permeabilidad selectiva
Llevan a cabo la sntesis de
protenas

3. Explica las diferencias entre mitosis y meiosis.


4. En los guisantes, el tallo alto (T) es dominante sobre el tallo enano (t). Como ves,
este carcter est regido por un gen que determina la altura del tallo y que tiene dos
alelos: T y t. Una planta alta cruzada con otra enana produce descendientes
aproximadamente la mitad altos y la mitad enanos. Cules son los genotipos de los
padres? Razona la respuesta.

Consejera de Educacin, Cultura y Deportes


Apellidos_______________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen________________________________________________________________________

5. Explica las partes y las funciones del aparato reproductor femenino.


6. La siguiente imagen representa un tipo de clula. Sabras decir si es procariota o
eucariota? Razona la respuesta y nombra las estructuras sealadas.

7. Explica dos mtodos de conservacin de los alimentos.


8. Cul es el agente causante del SIDA? Qu efectos produce sobre nuestro
organismo?

Consejera de Educacin, Cultura y Deportes


Apellidos_______________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen________________________________________________________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes


Apellidos_______________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen________________________________________________________________________

HOJA DE RESPUESTAS

Consejera de Educacin, Cultura y Deportes


Apellidos_______________________________________________Nombre__________________________
DNI / NIE ________________________
Centro de examen________________________________________________________________________

HOJA DE RESPUESTAS

Direccin General de Formacin Profesional

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 23 de junio (ORDEN EDU/528/2009, de 5 de marzo, B.O.C. y L. 11 de marzo)

PARTE ESPECFICA. OPCIN: OP3


DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:
DNI:
Instituto de Educacin Secundaria:
EJERCICIO DE BIOLOGA
Responda a las siguientes preguntas:
1.

a) Defina bioelemento y cite los ms abundantes.


b) Haga una clasificacin de las biomolculas.
c) Explique las funciones de la molcula de agua en los seres vivos.
d) Defina que son los biocatalizadores.

2.

a) Dibuje un esquema de clula animal en el que estn representados los siguientes


orgnulos: Centriolo, Aparato de Golgi, retculo endoplsmatico rugoso, mitocondria y
ncleo.
b) Indique la funcin de los orgnulos del apartado anterior.
c) Si la clula pertenece a la especie humana, con 2n= 46. Cuntos cromosomas
tendrn sus gametos? Justifique la respuesta.

3.

a) La siguiente reaccin es un proceso anablico o catablico? Razone la respuesta:


6 CO2 + 6 H2O + energa

C6H12O6 + 6 O2

b) Defina respiracin aerobia.


c) Cite las etapas de la fotosntesis y en qu orgnulos celulares ocurre.

4.

a) Enuncie las dos primeras leyes de Mendel.


b) Explique las leyes anteriores aplicando la cromosmica de la herencia.

5.

a) Por qu en el tratamiento de enfermedades producidas por microorganismos se utilizan


en unos casos antibiticos y en otros no? Qu problemas causa el uso indiscriminado
de los antibiticos en la lucha contra los microorganismos? Razone las respuestas.
b) Defina los siguientes trminos: Infeccin, epidemia, pandemia, enfermedad endmica.

Direccin General de Formacin Profesional

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:
DNI:
Instituto de Educacin Secundaria:

CRITERIOS DE EVALUACIN Y CALIFICACIN


Se evaluar la comprensin de los conceptos bsicos, capacidad de sntesis y el dominio de la
terminologa de Biologa. Tambin se valorar la presentacin y la redaccin de la pregunta, as
como el dominio de la ortografa.
- Pregunta 1: 2 puntos. Cada apartado 0.5 puntos.
- Pregunta 2: 2 puntos. Apartados a) y c) 0,5 puntos cada uno.
Apartado b) 1 punto.
- Pregunta 3: 2 puntos. Apartados a) y b) 0,5 puntos cada uno.
Apartado c) 1 punto.
- Pregunta 4: 2 puntos. Cada apartado 1 punto.
- Pregunta 5: 2 puntos. Cada apartado 1 punto.

Direccin General de Formacin Profesional

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 28 de junio (ORDEN EDU/468/2010, de 7 de abril, B.O.C. y L. 16 de abril)

PARTE ESPECFICA. OPCIN: OP3


DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
EJERCICIO DE BIOLOGA
Responda a las siguientes preguntas:
1. a) Explique las caractersticas generales de los lpidos, sealando los grandes grupos en los
que se clasifican.
b) Ponga cuatro ejemplos de protenas indicando la funcin de cada una.
c) Qu tipos de cidos nucleicos conoce? Indique las principales diferencias entre ellos.
2. a) Enumere los tipos de microorganismos que pueden ser agentes causantes de
enfermedades poniendo un ejemplo.
b) Diferencie entre inmunidad natural e inmunidad artificial.
c) Explique algn proceso por el que pueda conseguirse inmunidad artificial.
d) Concepto de alergia.
3. a) Diferencie entre anabolismo y catabolismo.
b) Ejemplos de procesos anablicos y catablicos.
c) Concepto de respiracin celular. Explique los principales procesos que ocurren en ella.
4. Responda a las siguientes preguntas relacionadas con la fotosntesis:
a) Concepto de fotosntesis.
b) Localizacin de la fase luminosa y de la fase oscura en el interior de los cloroplastos de
las clulas eucariotas.
c) Cul es el donador de protones y electrones en la fase luminosa de la fotosntesis
vegetal?
d) Productos finales de la fase lumnica de una clula vegetal.
e) Utilizacin de los productos de la fase luminosa en la fase oscura.
5. Con respecto al cdigo gentico:
a) Defina cdigo gentico.
b) Cite las caractersticas del cdigo gentico.
c) Explique qu importancia tiene que el cdigo gentico sea degenerado.
d) Defina el concepto de anticodn.
e) Explique razonadamente por qu el orden de los nucletidos en el ADN determina
caracteres de los organismos como el color de los ojos.

Direccin General de Formacin Profesional

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
CRITERIOS DE EVALUACIN Y CALIFICACIN
Se evaluar la comprensin de los conceptos bsicos, capacidad de sntesis y el dominio de la
terminologa de Biologa. Tambin se valorar la presentacin y la redaccin de la pregunta, as como
el dominio de la ortografa.
- Pregunta 1: 2 puntos. Apartados a) y b) 0,50 puntos cada uno.
Apartado c) 1 punto.
- Pregunta 2: 2 puntos. Cada apartado 0,50 puntos.
- Pregunta 3: 2 puntos. Apartados a) y b) 0,50 puntos cada uno.
Apartado c) 1 punto.
- Pregunta 4: 2 puntos. Cada apartado 0,40 puntos.
- Pregunta 5: 2 puntos. Cada apartado 0,40 puntos.

Direccin General de Formacin Profesional

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 21 de septiembre (ORDEN EDU/528/2009, 5 de marzo, B.O.C. y L. 11 de marzo)

PARTE ESPECFICA. OPCIN: OP3


DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
EJERCICIO DE BIOLOGA
Responda a las siguientes preguntas:
1. a) Defina oligoelemento y cite dos ejemplos.
b) Haga una clasificacin de las biomolculas.
c) Explique las funciones de las sales minerales en los organismos.
d) Estructura y funcin de las protenas.
2. a) Diferencias entre clula procaritica y eucaritica.
b) Cite las diferencias entre clula animal y vegetal.
c) Indique la funcin de: mitocondrias
cloroplastos
centriolo
membrana plasmtica
3. a) Defina la meiosis.
b) Cules son sus consecuencias biolgicas?
c) Indique cuatro diferencias entre mitosis y meiosis.
4. a) Composicin qumica del ADN.
b) Estructura del ADN.
c) Explique los conceptos de trascripcin y traduccin gnica.

5. a) Estructura de una bacteria.


b) Describa el uso de bacterias en algn proceso de la industria alimentaria y su fundamento.

Direccin General de Formacin Profesional

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:
DNI:
Instituto de Educacin Secundaria:
CRITERIOS DE EVALUACIN Y CALIFICACIN
Se evaluar la comprensin de los conceptos bsicos, capacidad de sntesis y el dominio de la
terminologa de Biologa. Tambin se valorar la presentacin y la redaccin de la pregunta, as
como el dominio de la ortografa.
- Pregunta 1: 2 puntos. Cada apartado 0.5 puntos.
- Pregunta 2: 2 puntos. Apartados a) y b) 0,5 puntos cada uno.
Apartado c) 1 punto.
- Pregunta 3: 2 puntos. Apartados a) y b) 0,5 puntos cada uno.
Apartado c) 1 punto.
- Pregunta 4: 2 puntos. Apartados a) y b) 0,5 puntos cada uno.
Apartado c) 1 punto.
- Pregunta 5: 2 puntos. Cada apartado 1 punto.

Direccin General de Formacin Profesional

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 10 de septiembre (ORDEN EDU/468/2010, de 7 de abril, B.O.C. y L. 16 de abril)

PARTE ESPECFICA. OPCIN: OP3


DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
EJERCICIO DE BIOLOGA
Responda a las siguientes preguntas:
1. a)
b)
c)
2. a)
b)
c)

Dibuje un esquema de una clula bacteriana marcando sus principales componentes.


Justifique a qu tipo de clula pertenece.
Qu entiende por VIH? y por SIDA?
Enumere las vas de transmisin del virus del SIDA.
Enumere las diferencias entre clula animal y vegetal.
Explique los conceptos de cromosoma y cromatina.
Indique la funcin de: mitocondrias, Aparato de Golgi, retculo endoplasmtico rugoso y
membrana plasmtica.

3. Con respecto a los cidos nucleicos:


a)
b)
c)
d)
e)

Qu es un nuclesido?
Qu es un nucletido?
Diferencias en la composicin qumica del ARN y del ADN.
Funcin del ARNm.
Funcin del ARNt.

4. Con respecto a la inmunidad:


a)
b)
c)
d)
e)

Cmo acta la vacunacin?


En qu se diferencia la vacunacin de la sueroterapia?
En qu ocasiones deben usarse sueros? Por qu?
Por qu no son eficaces las mismas vacunas de la gripe de un ao para otro?
Proporciona la lactancia materna memoria inmunolgica? Razone la respuesta.

5. Responda a las siguientes preguntas relativas a las protenas:


a)
b)
c)
d)
e)

Qu monmeros las forman? Cmo se llama el enlace que une estos monmeros?
En qu orgnulos se forman las protenas?
Qu es la estructura primaria de una protena?
Escriba dos funciones de estas macromolculas poniendo un ejemplo de una protena
concreta en cada caso.
En qu consiste la desnaturalizacin de una protena? Cite dos causas de
desnaturalizacin proteica.

Direccin General de Formacin Profesional

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
CRITERIOS DE EVALUACIN Y CALIFICACIN
Se evaluar la comprensin de los conceptos bsicos, capacidad de sntesis y el dominio de la
terminologa de Biologa. Tambin se valorar la presentacin y la redaccin de la pregunta, as
como el dominio de la ortografa.
- Pregunta 1: 2 puntos.

Apartado a) 1 punto.
Apartados b) y c) 0,50 puntos cada uno.

- Pregunta 2: 2 puntos. Apartados a) y b) 0,50 puntos cada uno.


Apartado c) 1 punto.
- Pregunta 3: 2 puntos. Cada apartado 0,40 puntos
- Pregunta 4: 2 puntos. Cada apartado 0,40 puntos.
- Pregunta 5: 2 puntos. Cada apartado 0,40 puntos.

Direccin General de Formacin Profesional y Rgimen Especial

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 27 de junio (ORDEN EDU/340/2012, de 17 de mayo, B.O.C. y L. 22 de mayo)

PARTE ESPECFICA. OPCIN: OP3


DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
EJERCICIO DE BIOLOGA
Responda a las siguientes preguntas:
1.

a) Represente, mediante esquemas, las etapas de la mitosis de una clula cuyo nmero
diploide 2n= 4
b) Represente, mediante esquemas, la meiosis de la clula del apartado anterior.

2.

a) Diferencias entre virus y bacterias.


b) Explique el concepto de antgeno y anticuerpo.
c) Explique el concepto de vacuna.
d) Qu es un linfocito y qu funcin tiene?

3.

a)
b)
c)
d)

4.

5.

Diferencias entre bioelemento y oligoelemento.


Haga una clasificacin de las biomolculas.
Explique la smosis.
Estructura y funcin de los polisacridos.

Seale las semejanzas y diferencias entre el retculo endoplasmtico liso y el retculo


endoplasmtico rugoso en cuanto a:
a) Localizacin
b) Estructura
c) Funcin
a) La siguiente reaccin es un proceso anablico o catablico? Razone la respuesta.
C 6H12O6 + 6 O2
b) Defina fermentacin anaerobia.

6 CO 2 + 6H2O + energa

Direccin General de Formacin Profesional y Rgimen Especial

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
CRITERIOS DE EVALUACIN Y CALIFICACIN
Se evaluar la comprensin de los conceptos bsicos, capacidad de sntesis y el dominio de la
terminologa de Biologa. Tambin se valorar la presentacin y la redaccin de la pregunta, as
como el dominio de la ortografa.
- Pregunta 1: 2 puntos. Cada apartado 1 punto
- Pregunta 2: 2 puntos. Cada apartado 0,5 puntos
- Pregunta 3: 2 puntos. Cada apartado 0,5 puntos
- Pregunta 4: 2 puntos. Apartados a) y b) 0,5 puntos cada uno
Apartado c) 1 punto

Pregunta 5: 2 puntos. Cada apartado 1 punto

Direccin General de Formacin Profesional y Rgimen Especial

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 19 de junio (ORDEN EDU/304/2013, de 2 de mayo, B.O.C. y L. 10 de mayo)

PARTE ESPECFICA. OPCIN: OP3


DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
EJERCICIO DE BIOLOGA
PREGUNTA 1
a)

Referido a los glcidos, describa los siguientes trminos:

Enlace O-glucosdico
Disacrido
Polisacrido

b) Compare la estructura del ADN y del ARN indicando, en total, cinco semejanzas y diferencias.
PREGUNTA 2
a)

Indique la localizacin y la funcin de los siguientes orgnulos:

b)

Ribosoma
Lisosoma
Mitocondria

Indique brevemente en qu tipos de clulas y en qu lugar de estas se desarrollan los siguientes


procesos:

Gluclisis
Fase luminosa de la fotosntesis

PREGUNTA 3
Respecto al cdigo gentico indique en qu consiste y cules son sus caractersticas principales.
PREGUNTA 4
a) Qu significan las siglas: SIDA y VIH?
b) Cules son las vas de transmisin del VIH?
c) Diferencia entre seropositivo, seronegativo y enfermo de SIDA
PREGUNTA 5
Mecanismos de defensa externos e internos frente a los agentes infecciosos.

Direccin General de Formacin Profesional y Rgimen Especial

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:
DNI:
CENTRO EDUCATIVO:
CRITERIOS DE EVALUACIN Y CALIFICACIN
Se evaluar la comprensin de los conceptos bsicos, capacidad de sntesis y el dominio de la
terminologa de Biologa. Tambin se valorar la presentacin y la redaccin de la pregunta, as
como el dominio de la ortografa.
- PREGUNTA 1: 2,50 puntos. Apartados a) 1,50 puntos b) 1 punto
- PREGUNTA 2: 2,50 puntos. Apartados a) 1,50 puntos b) 1 punto
- PREGUNTA 3: 1,50 puntos.
- PREGUNTA 4: 2 puntos. Apartados a) 0,5 puntos b) y c) 0,75 puntos cada uno
- PREGUNTA 5: 1,50 puntos.

Proves daccs a cicles formatius de grau superior de formaci professional inicial,


densenyaments darts plstiques i disseny, i densenyaments esportius 2011

Biologia
Srie 1

SOLUCIONS,
CRITERIS DE CORRECCI
I PUNTUACI

Instruccions
Trieu i resoleu CINC dels set exercicis que es proposen.
Indiqueu clarament quins heu triat. Noms se navaluaran cinc.
Cada exercici val 2 punts.

S1 21 3 BIOLOGIA GS SOLUCIONS 11

Exercici 1
1.1.Indiqueu a quin regne pertanyen els organismes segents:
[1 punt]

Organisme

Regne

Ocell

Animal o metazous

Pi

Plantes, vegetals o metfits

Bacteri

Moneres

Alga

Protists o protoctists

Llevat

Fongs

Adjudiqueu 0,2 punts per cada resposta correcta.


1.2.Responeu a les preguntes segents:
a) Quin tipus de cllules tenen els organismes del regne de les moneres?
[0,25 punts]

Cllules procariotes.
b) Don obtenen lenergia els ssers vius que pertanyen al regne de les plantes?
[0,25 punts]

De lenergia de les radiacions solars (del Sol).


c) Quina s la font de carboni dels organismes del regne dels fongs?
[0,25 punts]

La matria orgnica que hi ha en el medi.


d) Qu significa que un organisme s quimiosinttic?
[0,25 punts]

Que obt lenergia a partir de reaccions qumiques.

Exercici 2
2.1.El dibuix segent mostra una cllula. Completeu la taula amb el nom de les estructures
senyalades:
[1 punt]

Nmero

Nom

Membrana cellular o membrana citoplasmtica

Mitocondri

Aparell o complex de Golgi, o dictiosoma

Reticle endoplasmtic rugs

Nucli o cromatina

Adjudiqueu 0,2 punts per cada resposta correcta.


2.2.Anomeneu les funcions de les estructures cellulars segents:
a) Ribosoma: sntesi de protenes.
[0,25 punts]

b) Cloroplast: fotosntesi.
[0,25 punts]

c) Lisosoma: digesti.
[0,25 punts]

d) Reticle endoplasmtic llis: sntesi de lpids.


[0,25 punts]

Exercici 3
El pedigr segent correspon a larbre genealgic duna famlia que presenta miopia. Els cercles
representen dones i els quadrats, homes; els individus afectats de miopia sindiquen en negre.

3.1.A partir del pedigr, determineu si la miopia s un carcter dominant o recessiu.


Justifiqueu la resposta.
[0,5 punts]

s un carcter recessiu: la parella I-1I-2 no mostra el carcter (no presenta miopia),


per t una filla que s que el mostra (s miop).
3.2.La miopia no s un carcter lligat al sexe (cromosoma X). A partir del pedigr, demostreu
per qu.
[0,5 punts]

La senyora II-3 s miop; aix significa que els seus dos cromosomes X tenen el gen
de la miopia, el qual passa a la descendncia. Per tant, els seus fills de sexe mascul
haurien de presentar el carcter, ja que sn hemizigots (XY).
3.3.Completeu la taula amb els genotips dels individus segents:
[0,75 punts]

Individu

Genotip

I-1

Aa

II-3

aa

III-3

Aa

Adjudiqueu 0,25 punts per cada resposta correcta.


4

3.4.Pot ser portadora del gen de la miopia la dona II-1? Justifiqueu la resposta.
[0,25 punts]

Els seus pares sn heterozigots per al carcter miopia (Aa). Per tant, si fem lencreuament Aa Aa, la descendncia pot ser:
A

AA

Aa

Aa

aa

Genotip no portador del gen de la miopia: AA


Genotips portadors del gen de la miopia: Aa i aa
Per tant, la dona II-1 pot ser no miop i heterozigota per al gen de la miopia.

Exercici 4
4.1.En la fotografia segent, feta amb un microscopi ptic, sobserva una cllula vegetal
que sest dividint per mitosi.

a) A quina fase de la mitosi correspon?


[0,25 punts]

Correspon a lanafase.

b) Quina caracterstica us permet identificar la fase?


[0,5 punts]

Aquesta fase es caracteritza per la separaci de les cromtides germanes.

c) Q
 uina estructura cellular, composta per protenes, es forma noms al llarg de la
divisi nuclear?
[0,25 punts]

El fus acromtic. / Les fibres del fus acromtic (o tamb es pot considerar correcte
les fibres cinetocriques).

4.2. Indiqueu si les frases segents corresponen a la mitosi o a la meiosi:


[1 punt]

a) s una divisi que experimenten totes les cllules de lorganisme, excepte les reproductores.
Meiosi.

b) A partir duna cllula mare es formen quatre cllules filla.


Meiosi.

c) Sesdev laparellament de cromosomes homlegs.


Meiosi.

d) Les cllules filla tenen el mateix nombre de cromosomes que la cllula mare.
Mitosi.

e) s una divisi que es dna en la reproducci sexual.


Meiosi.

Adjudiqueu 0,2 punts per cada resposta correcta.

Exercici 5
Lesquema segent representa dos processos cellulars:
1

DNA

mRNA

protena

5.1. De quins processos es tracta?


[0,5 punts]

Nmero

Nom del procs

Transcripci

Traducci

Adjudiqueu 0,25 punts per cada resposta correcta.

5.2. Q
 uina molcula de lesquema constitueix la base molecular de lherncia? Com sanomena el procs en el qual es generen cpies daquesta molcula?
[0,5 punts]

El DNA.
Duplicaci o replicaci.

5.3. La seqncia dun fragment de DNA s ACGTACGTTTT.


a) Quina seqncia tindr el seu filament complementari?
[0,5 punts]

TGCATGCAAAA.
b) Quina seqncia tindr lRNA missatger codificat per aquest fragment de DNA?
[0,5 punts]

ACGUACGUUUU.

Exercici 6
La imatge segent mostra el cicle biolgic dun mosquit:

Ous
Adult

Larva
Pupa

6.1. Quin tipus de cicle biolgic s?


[0,25 punts]

Cicle diploide.

6.2. Completeu la frase segent amb la resposta correcta.


[0,25 punts]

Aquest cicle es caracteritza perqu


a) els organismes pluricellulars sn diploides.
b) hi alternen individus adults diploides amb individus adults haploides.
c) la meiosi produeix el creixement dels individus.
d) hi predomina la fase haploide.

6.3. Indiqueu en quin moment del cicle es donen els processos segents:
[0,5 punts]

Mitosi: en el creixement de la larva, de la pupa i de lorganisme adult.


Meiosi: en la formaci dels gmetes.

6.4. E
 n la traducci dun article sobre el mosquit tigre, publicat a El Pas el 12 de maig de
2010, podem llegir el segent:
Va arribar dsia i ja es troba a cent vint municipis catalans, trenta-tres ms que lany passat. El mosquit tigre (Aedes albopictus) est en expansi, segons que revela un estudi de la Conselleria de Medi
Ambient i Habitatge de la Generalitat.
[]
Medi Ambient va assenyalar, aix mateix, que el ms efectiu per a frenar-ne la proliferaci s evitar que
ponguin ous i que creixin les larves []

Qu sha de fer per a seguir les recomanacions de la Conselleria de Medi Ambient?


Justifiqueu la resposta.
[0,5 punts]

La posta dels ous i el creixement de les larves sesdevenen en el medi aqutic. Per
tant, cal buidar laigua dels recipients (testos, galledes, etc.) que hi ha a lexterior
de les cases, en els patis, en les terrasses, etc.

6.5. C
 om sanomena el conjunt de transformacions que experimenta lorganisme des de
leclosi o sortida de lou fins que esdev adult?
[0,25 punts]

Metamorfosi.

6.6. E
 smenteu un altre organisme que en el seu cicle biolgic presenti tamb un desenvolupament indirecte i que no sigui un insecte.
[0,25 punts]

Granota.

Exercici 7
El dibuix segent mostra el fragment duna macromolcula que es troba exclusivament en les
cllules animals:

7.1. De quina molcula es tracta?


[0,25 punts]

Glucogen o glicogen.

7.2. Quina funci t?


[0,25 punts]

Reserva energtica.

7.3. En quines zones de lorganisme es troba?


[0,5 punts]

Fetge i musculatura.

7.4. E
 l cos hum pot emmagatzemar fins a un mxim de 0,450kg daquesta molcula. Si cada
gram ens aporta 4,2kcal, quantes kilocalories ens pot aportar en total?
[0,5 punts]

450g 4,2kcal/g=1890kcal

10

7.5. A
 questa macromolcula s formada per la uni de moltes molcules dun monosacrid.
De quin monosacrid es tracta?
[0,25 punts]

Glucosa.

7.6. Quina macromolcula, molt similar a aquesta, es troba en les plantes?


[0,25 punts]

Mid.

11

LInstitut dEstudis Catalans ha tingut cura de la correcci lingstica i de ledici daquesta prova daccs

Prova daccs a Cicles formatius de grau superior de formaci professional,


Ensenyaments desports i Ensenyaments darts plstiques i disseny 2009

Biologia
Srie 3

Dades de la persona aspirant

Qualificaci

Cognoms i nom

DNI

Instruccions
La prova consta de set preguntes.
Cada pregunta t dos apartats, que valen 1 punt cadascun.
Trieu CINC preguntes i feu-ne els dos apartats. Cal, doncs, que deixeu sense respondre
dues de les set preguntes.

S3_21_1 BIOLOGIA GS V.CAT 09

S3_21_1 BIOLOGIA GS V.CAT 09.indd 1

25/03/09 17:00

Pregunta 1
1.1. La illustraci segent mostra una cadena trfica dun ecosistema. En un ecosistema
estable, en el pas dun nivell trfic a un altre noms es transfereix un percentatge petit
de lenergia, perqu aquesta es transforma en activitat vital, es dissipa en forma de calor
i en els excrements, etc. Observeu la illustraci i responeu a les qestions segents:

a) Quina s la font inicial denergia de la cadena representada?


[0,25 punts]

b)

Quin percentatge de lenergia dun nivell trfic pot ser assimilat pel nivell trfic
superior?
[0,25 punts]

c)

Completeu la taula segent:


[0,5 punts: 0,1 punts per cada resposta correcta]

ssers vius que produeixen matria


orgnica nova a partir de matria
inorgnica.
Poblaci que pertany al nivell trfic
de consumidor secundari.
Gasela de Thomson.

Poblaci de

ssers vius que degraden les restes dels


altres ssers que constitueixen la xarxa
trfica.
Dues poblacions de la comunitat a
la qual correspon la cadena trfica
representada.
2

S3_21_1 BIOLOGIA GS V.CAT 09.indd 2

25/03/09 17:00

1.2. En un aquari, hem cultivat una poblaci dun organisme A al qual hem anat subministrant aliment. El grfic segent indica les variacions daquesta poblaci. Al cap dunes
quantes setmanes vam introduir una nova poblaci (B) a laquari. Observeu el grfic i
responeu a les qestions segents:

a) En quin moment vam introduir la poblaci B i quina s la relaci interespecfica


ms probable entre els organismes A i B?
[0,5 punts]

b)

Justifiqueu els canvis en el nombre dindividus.


[0,5 punts]

S3_21_1 BIOLOGIA GS V.CAT 09.indd 3

25/03/09 17:00

Pregunta 2
Larbre genealgic (o pedigr) segent mostra cinc generacions duna famlia amb dos individus afectats de fibrosi qustica, una malaltia que es caracteritza per la producci de mucositat
espessa que afavoreix les infeccions respiratries i tamb origina alteracions digestives.

2.1.

Observeu larbre genealgic i responeu a les qestions segents:


a) Digueu quin patr dherncia segueix aquesta malaltia. Expliqueu com ho heu dedut.
[0,5 punts]

b)

Digueu en quin punt de larbre genealgic sobserva una consanguinitat o endogmia


que pot explicar la presncia dels dos individus afectats.
[0,5 punts]

S3_21_1 BIOLOGIA GS V.CAT 09.indd 4

25/03/09 17:00

2.2. Utilitzant la nomenclatura habitual i considerant que f+ indica lallel normal i f lallel
anormal, completeu la taula segent:
[1 punt: 0,1 punts per cada resposta correcta]

Individu

Genotip

Justificaci

III-4

III-5

IV-1

V-2

II-2 i II-5

S3_21_1 BIOLOGIA GS V.CAT 09.indd 5

25/03/09 17:00

Pregunta 3
La illustraci segent mostra el procs de reproducci dun bacteri.

3.1.

Contesteu aquestes dues preguntes relacionades amb la reproducci bacteriana:


a) Quina s la forma de reproducci dels bacteris?
[0,5 punts]

b)

Un bacteri, en un medi adequat, norigina dos cada trenta minuts. Quants sen formen
en quatre hores?
[0,5 punts]

3.2. Expliqueu quina molcula constitueix el genoma bacteri i justifiqueu per qu no podem
parlar de nucli en el cas dels bacteris.
[1 punt]

S3_21_1 BIOLOGIA GS V.CAT 09.indd 6

25/03/09 17:00

Pregunta 4
La illustraci segent representa lamilopectina, un dels components del mid.

4.1.

Observeu la illustraci i responeu a les qestions segents:


a) Quin s el monmer que constitueix lamilopectina i quina frmula emprica t?
[0,5 punts]

b)

Quin enlla uneix aquests monmers? Qu diem que s lamilopectina pel fet destar
formada per la uni daquests monmers?
[0,5 punts]

4.2. En el procs de digesti del mid:


a) Quin enzim interv en les reaccions digestives?
[0,5 punts]

b)

En aquestes reaccions, es consumeix aigua o sen desprn? Quin nom reben aquestes
reaccions?
[0,5 punts]

S3_21_1 BIOLOGIA GS V.CAT 09.indd 7

25/03/09 17:00

Pregunta 5
La illustraci segent representa una cllula vegetal.

5.1. Quins orgnuls de la illustraci sn especfics de les cllules vegetals i quina funci fan?
[1 punt]

5.2.

Completeu la taula segent:


[1 punt: 0,2 punts per cada resposta correcta]

Definici

Nom

Polisacrid que constitueix la paret cellular de les


plantes.
Substncia que contenen els cloroplasts i capta
energia de la llum.
Molcules ms abundants que constitueixen la
membrana cellular.
Orgnuls que contenen lquid i sn grans en les
cllules vegetals.
Regnes que agrupen ssers vius amb cllules que
tenen cloroplasts.
8

S3_21_1 BIOLOGIA GS V.CAT 09.indd 8

25/03/09 17:00

Pregunta 6
Les illustracions segents mostren cllules en qu sest produint la divisi dels cromosomes.

6.1.

Indiqueu quina daquestes cllules est en la profase I de la meiosi i justifiqueu la resposta.


[1 punt]

6.2.

En quina o en quines divisions del nucli es produeix la separaci de cromosomes homlegs i quina finalitat t tal separaci?
[1 punt]

S3_21_1 BIOLOGIA GS V.CAT 09.indd 9

25/03/09 17:00

Pregunta 7
Les illustracions segents representen el procs dautoduplicaci del DNA.

7.1. Responeu a les qestions segents relacionades amb aquest procs:


[1 punt: 0,2 punts per cada resposta correcta]

A quina zona de les cllules eucariotes t


lloc el procs dautoduplicaci del DNA?
Com que cada doble hlix nova t una
cadena vella i una de nova, diem que
lautoduplicaci s
Quan t lloc el procs? Durant la mitosi,
la citocinesi o la interfase?
Com sanomenen els errors que es poden
produir en lautoduplicaci?
Quins enllaos uneixen les dues cadenes
de la doble hlix de DNA?

10

S3_21_1 BIOLOGIA GS V.CAT 09.indd 10

25/03/09 17:00

7.2. Quan les cllules finalitzen la divisi cellular, per a crixer i fer les funcions vitals duen
a terme processos de sntesi de protenes. Completeu la taula segent amb els elements
corresponents a cada etapa del procs de sntesi.
[1 punt]

DNA codificador

TTA

GCG

ACT

DNA motlle

RNA missatger

RNA de transferncia

Aminocid

Segona lletra
U

Primera lletra

CUU
CUC
CUA
CUG
AUU
AUC
AUA
AUG
GUU
GUC
GUA
GUG

Phe
Leu

Leu

Ile
Met

Val

UCU
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG

Ser

UAU
UAC
UAA
UAG

Pro

CAU
CAC
CAA
CAG

Thr

Ala

AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG

G
Tyr

Parada
Parada
His
Gln
Asn
Lys
Asp
Glu

UGU
UGC
UGA
UGG
CGU
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG

Cys
Parada
Trp

Arg

Ser
Arg

Gly

U
C
A
G

Tercera lletra

UUU
UUC
UUA
UUG

U
C
A
G
U
C
A
G
U
C
A
G

11

S3_21_1 BIOLOGIA GS V.CAT 09.indd 11

25/03/09 17:00

LInstitut dEstudis Catalans ha tingut cura de la correcci lingstica i de ledici daquesta prova daccs

S3_21_1 BIOLOGIA GS V.CAT 09.indd 12

25/03/09 17:00

Prova daccs a Cicles formatius de grau superior de formaci professional,


Ensenyaments desports i Ensenyaments darts plstiques i disseny 2009

Biologia
Srie 4

Dades de la persona aspirant

Qualificaci

Cognoms i nom

DNI

Instruccions
La prova consta de set preguntes.
Cada pregunta t dos apartats, que valen 1 punt cadascun.
Trieu CINC preguntes i feu-ne els dos apartats. Cal, doncs, que deixeu sense respondre
dues de les set preguntes.

S4_21_1 BIOLOGIA GS V.CAT GS 09

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 1

25/03/09 16:59

Pregunta 1
La illustraci segent representa un arbre i les seves cllules i orgnuls.

1.1. En el cicle biogeoqumic del carboni hi ha un procs pel qual el carboni inorgnic del
dixid de carboni de laire es transforma en carboni orgnic. Expliqueu el procs al qual
ens referim.
[1 punt]

1.2. Completeu la taula segent:


[1 punt: 0,2 punts per cada resposta correcta]

Quin nom rep lorgnul del qual es representa


la funci en la illustraci?
Esmenteu un factor que pot accelerar la velocitat
de la reacci que t lloc en aquests orgnuls.
Quin nom reben els sacs aplanats, plens de
clorofilla, que cont lorgnul?
Com sanomenen les obertures de lepidermis
de les fulles que permeten la transpiraci?
Els bacteris fotosinttics tenen aquests orgnuls?

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 2

25/03/09 16:59

Pregunta 2
Podria semblar que aquest arbre genealgic t un patr dherncia XR.

2.1. Analitzant larbre genealgic, demostreu que el patr no pot ser lligat al cromosoma X
i recessiu.
[1 punt]

2.2. Considerant que m+ indica lallel normal i m lallel causant de la patologia, completeu
la taula segent:
[1 punt]

Individu

Genotip

Justificaci

IV-2

III-1

III-2

II-3

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 3

25/03/09 16:59

Pregunta 3
La illustraci segent mostra el cicle biolgic duna molsa o brifit.

3.1.

Observeu la illustraci i completeu la taula segent:


[1 punt: 0,2 punts per cada resposta correcta]

Definici

Nom

Individu o part de la molsa que produeix gmetes.


Individu o part de la molsa que produeix espores.
Cicle biolgic caracterstic de les plantes.
Part de la planta o individu que s diploide.
Part de la planta o individu que s haploide.

3.2. Expliqueu en quin moment i on es produeix la meiosi.


[1 punt]

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 4

25/03/09 16:59

Pregunta 4
Les estructures segents corresponen a molcules orgniques.

4.1. Observeu les molcules i completeu la taula segent:


[1 punt: 0,2 punts per cada resposta correcta]

Quin tipus de molcules sn?

Se les considera glcids, lpids o protenes?

Sn molcules liposolubles o hidrosolubles?

Exemple de funci que porta a terme el


colesterol en els ssers vius.
Exemple de funci que porta a terme la
testosterona en els ssers vius.

4.2.

Completeu la taula segent:


[1 punt: 0,1 punts per cada resposta correcta]

Polmers

Components o monmers

Exemple de funci

Protenes
Cellulosa
DNA
Triglicrids
Sacarosa

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 5

25/03/09 16:59

Pregunta 5
La illustraci segent representa una xarxa trfica.

5.1. Observeu la illustraci i completeu la taula segent en relaci amb aquesta xarxa trfica:
[1 punt: 0,2 punts per cada resposta correcta]

Hi sn representats els productors primaris?


Quins serien?
Esmenteu un sser viu que sigui consumidor
primari.
Quin sser viu pot ser considerat
consumidor quaternari?
Quins ssers vius sn metazous vertebrats?

La illustraci representa el bitop o la


comunitat?

5.2.

Les lletres e i f de la illustraci representen fongs microscpics i bacteris, respectivament.


Completeu la taula segent:
[1 punt]

Fongs microscpics

Bacteris

Tipus de nutrici
Regne al qual pertanyen
Tipus de cllules
Tenen nucli?
Es divideixen per mitosi?

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 6

25/03/09 16:59

Pregunta 6
Les illustracions segents representen etapes del cicle cellular duna cllula vegetal.

6.1.

Expliqueu les dues caracterstiques de la mitosi que permeten dir que es tracta duna
cllula vegetal.
[1 punt]

6.2.

Observeu les illustracions i completeu la taula segent:


[1 punt: 0,2 punts per cada resposta correcta]

Quina illustraci correspon al procs de citocinesi?

Quina illustraci correspon al procs de metafase?

Quina illustraci correspon a una anafase?

A quina illustraci es veu la placa equatorial?

Sabem que s una mitosi perqu shi produeix una


separaci de

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 7

25/03/09 16:59

Pregunta 7
La gentica molecular es basa en lestudi del DNA, representat en aquesta illustraci.

7.1. En la illustraci saprecien algunes caracterstiques del DNA. Observeu-la i completeu


la taula segent:
[1 punt]

Com sanomenen els monmers que


constitueixen el DNA?
Qu representa S?

Quines molcules sn representades amb les


lletres T, A, C i G?
Quins enllaos hi ha entre T i A i entre C i G?

Quins enllaos hi ha entre els monmers?

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 8

25/03/09 16:59

7.2. Observeu les seqncies de nucletids segents, corresponents a RNA missatger. Consulteu
la taula del codi gentic i indiqueu quin pptid sobtindria a partir de cadascuna de les
dues seqncies dRNA missatger.
a)

5AGAGGAGAU3

b)

5AGGGGAGAC3

A partir del resultat, digueu si el fet que hi hagi ms dun cod que codifiqui cada aminocid s un avantatge o un inconvenient, i expliqueu per qu.
[1 punt]

Segona lletra
U

Primera lletra

CUU
CUC
CUA
CUG
AUU
AUC
AUA
AUG
GUU
GUC
GUA
GUG

Phe
Leu

Leu

Ile
Met

Val

UCU
UCC
UCA
UCG
CCU
CCC
CCA
CCG
ACU
ACC
ACA
ACG
GCU
GCC
GCA
GCG

Ser

UAU
UAC
UAA
UAG

Pro

CAU
CAC
CAA
CAG

Thr

Ala

AAU
AAC
AAA
AAG
GAU
GAC
GAA
GAG

G
Tyr

Parada
Parada
His
Gln
Asn
Lys
Asp
Glu

UGU
UGC
UGA
UGG
CGU
CGC
CGA
CGG
AGU
AGC
AGA
AGG
GGU
GGC
GGA
GGG

Cys
Parada
Trp

Arg

Ser
Arg

Gly

U
C
A
G

Tercera lletra

UUU
UUC
UUA
UUG

U
C
A
G
U
C
A
G
U
C
A
G

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 9

25/03/09 16:59

10

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 10

25/03/09 16:59

11

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 11

25/03/09 16:59

LInstitut dEstudis Catalans ha tingut cura de la correcci lingstica i de ledici daquesta prova daccs

S4_21_1 BIOLOGIA GS V.CAT GS 09.indd 12

25/03/09 16:59

Prova daccs a Cicles formatius de grau superior de formaci professional,


Ensenyaments desports i Ensenyaments darts plstiques i disseny 2010

Biologia
Srie 1

Dades de la persona aspirant

Qualificaci

Cognoms i nom

DNI

Instruccions
La prova consta de set preguntes, que valen 2 punts cada una.
Trieu CINC preguntes i feu-ne tots els apartats. Cal, doncs, que deixeu sense respondre
dues de les set preguntes.

S1 21 1 BIOLOGIA GS V.CAT 10

S1 21 1 BIOLOGIA GS V.CAT 10.indd 1

20/04/10 10:16

Pregunta 1
1.1. Relacioneu cada un dels quatre grups de biomolcules orgniques amb una de les funcions segents:
a) Proporcionen energia per als processos vitals.
[0,2 punts]

b)

Formen la bicapa de les membranes cellulars.


[0,2 punts]

c)

Contenen la informaci gentica.


[0,2 punts]

d) Acceleren les reaccions qumiques que es produeixen en els ssers vius.


[0,2 punts]

e)

Emmagatzemen energia i tamb sanomenen greixos, olis, mantegues, etc.


[0,2 punts]

1.2. Les frases segents sn falses. Modifiqueu-les per a fer-les vertaderes.


a) Una de les estructures secundries de les protenes s lhlix , que sestabilitza
mitjanant enllaos covalents.
[0,25 punts]

b)

El mid s un polisacrid de reserva energtica que es troba en les cllules animals.


[0,25 punts]

S1 21 1 BIOLOGIA GS V.CAT 10.indd 2

20/04/10 10:16

c)

Laigua s un bon dissolvent; pot dissoldre totes les biomolcules.


[0,25 punts]

d) Un dels teixits animals s el teixit adips, les cllules del qual emmagatzemen una
gran quantitat de fosfolpids.
[0,25 punts]

Pregunta 2
2.1. Digueu si les frases segents sn aplicables a les cllules procariotes, a les cllules
eucariotes, a totes dues o a cap.
a) Tenen mitocondris.
[0,2 punts]

b)

No tenen nucli diferenciat.


[0,2 punts]

c)

Tenen membrana cellular o plasmtica.


[0,2 punts]

d) No tenen DNA.
[0,2 punts]

e)

Sn les ms simples estructuralment.


[0,2 punts]

S1 21 1 BIOLOGIA GS V.CAT 10.indd 3

20/04/10 10:16

2.2. Observeu el dibuix segent:

a) Quin orgnul cellular representa el dibuix?


[0,2 punts]

b)

Identifiqueu les estructures assenyalades amb nmeros.


[0,8 punts; 0,2 punts per cada resposta]

Nmero

Nom

1
2
3
4

S1 21 1 BIOLOGIA GS V.CAT 10.indd 4

20/04/10 10:16

Pregunta 3
Lacondroplsia, en lespcie humana, s una anomalia determinada per un gen autosmic
que causa un tipus de nanisme. Suposem que dos nans amb acondroplsia tenen dos fills, lun
amb nanisme i laltre dalada normal.
3.1.

Lacondroplsia s un carcter dominant o recessiu? Justifiqueu la resposta.


[0,25 punts]

3.2. Quin s el genotip dels progenitors (P) i dels descendents (F1)? Empleneu la taula segent:
[0,5 punts]

Fenotip

Nanisme acondroplstic

Nanisme acondroplstic

P
Genotip
Fenotip

Alada normal

Nanisme acondroplstic

F1
Genotip

3.3. Quina probabilitat t el fill amb nanisme acondroplstic de ser heterozigot? Justifiqueu
la resposta.
[0,25 punts]

S1 21 1 BIOLOGIA GS V.CAT 10.indd 5

20/04/10 10:16

3.4. Quina s la probabilitat que el proper descendent de la parella tingui una alada normal?
Empleneu les taules segents.
[1 punt]

Gmetes paterns

Gmetes materns

Descendncia
Genotips possibles

Proporci

Descendncia
Fenotips possibles

Proporci

Pregunta 4
Observeu la fotografia segent, feta amb un microscopi ptic, que mostra diverses cllules
vegetals que sestan dividint per mitosi.

S1 21 1 BIOLOGIA GS V.CAT 10.indd 6

20/04/10 10:16

4.1.

Indiqueu en quina fase de la mitosi es troben les cllules assenyalades en la imatge.


[0,8 punts; 0,2 punts per cada resposta]

Cllules

Fase de la mitosi

A
B
C
D

4.2. Com s'anomena la divisi cellular que es produeix per a formar cllules reproductores?
[0,2 punts]

4.3. Indiqueu la fase daquesta divisi que correspon a cadascuna de les caracterstiques
segents. Cal que especifiqueu si la fase pertany a la primera (I) o a la segona etapa de
la divisi (II).
a) Saparellen els cromosomes homlegs.
[0,25 punts]

b)

Se separen les cromtides germanes.


[0,25 punts]

c)

Es formen quatre nuclis que contenen la meitat de material gentic que la cllula
mare.
[0,25 punts]

d) Els cromosomes homlegs se situen en el pla equatorial de la cllula (shi poden


observar les ttrades).
[0,25 punts]

S1 21 1 BIOLOGIA GS V.CAT 10.indd 7

20/04/10 10:16

Pregunta 5
5.1. Els ssers vius que habiten un ecosistema poden crear diferents tipus de relacions entre
ells. Indiqueu quin tipus de relaci estableixen els organismes segents.
a) Els lquens estan formats per una alga, que aprofita la llum del sol per a obtenir
energia i fabricar matria orgnica, i un fong, que s'alimenta del que produeix l'alga
i, alhora, proporciona humitat i suport fsic a lalga.
[0,2 punts]

Relaci:

b)

El vesc s una planta que no t arrels fixades a terra, sin que sintrodueix en les
branques dels arbres (pollancres, pins, pomeres, etc.) i nabsorbeix laigua i els nutrients que necessita per a viure.
[0,2 punts]

Relaci:

c)

Algunes formigues utilitzen determinades espcies de pugons per a obtenir una


secreci rica en glcids que fan servir per a alimentar les larves; a canvi, les formigues
protegeixen els pugons dels depredadors.
[0,2 punts]

Relaci:

d) El peix rmora sadhereix amb una ventosa a la panxa del taur i aprofita les restes
danimals que cauen de la boca del taur. Aix, la rmora obt aliment i un mitj
de transport, mentre que el taur no sen beneficia ni en surt perjudicat.
[0,2 punts]

Relaci:

S1 21 1 BIOLOGIA GS V.CAT 10.indd 8

20/04/10 10:16

5.2.

La taula mostra la biomassa i la producci neta dalguns organismes en una zona daflorament dun ecosistema mar.

Biomassa (g/m2)

Producci neta ([g/m2]/any)

Fitoplncton

10

1 820

Zooplncton herbvor

18

108

Grup dorganismes

Zooplncton carnvor

5,5

Peixos

10
1

a) A quin nivell trfic pertany cada grup d'organismes?


[0,8 punts]

Grup
dorganismes

b)

Nivell trfic

Grup
dorganismes

Fitoplncton

Zooplncton
carnvor

Zooplncton
herbvor

Peixos

Nivell trfic

En la quadrcula segent, representeu en forma de pirmide la biomassa de cada


nivell trfic.
[0,4 punts]

S1 21 1 BIOLOGIA GS V.CAT 10.indd 9

20/04/10 10:16

Pregunta 6
Lesquema segent representa de manera simplificada un dels cicles biolgics dels ssers vius.

D
adult
n

gmeta
n

zigot
2n

E
D

gmeta
n

6.1. Quin tipus de cicle biolgic s?


[0,25 punts]

6.2. Qu el caracteritza?
[0,25 punts]

a)
b)
c)
d)

Els organismes pluricellulars sn diploides.


Hi alternen individus adults diploides amb individus adults haploides.
La meiosi produeix el creixement dels individus.
Hi predomina la fase haploide.

6.3. Indiqueu en quin moment del cicle es produeixen les fases (escriviu la lletra que les
representa en lesquema).
[0,75 punts]

Mitosi:
Meiosi:
Fecundaci:
6.4. Anomeneu un organisme que tingui aquest tipus de cicle.
[0,25 punts]

6.5. Expliqueu un avantatge i un desavantatge de la reproducci sexual.


[0,5 punts]

10

S1 21 1 BIOLOGIA GS V.CAT 10.indd 10

20/04/10 10:16

Pregunta 7
Recentment sha descobert un gen relacionat amb la trisomia del cromosoma 21, el gen DSCR
(Down syndrome critical region). Sabem que la seqncia de DNA de la cadena que transcriu
entre les posicions 490 i 510 s la segent:
3GAAGATCAACAGTATCAGTGG5
7.1. Escriviu la seqncia de la cadena complementria de DNA.
[0,25 punts]

7.2. Escriviu la seqncia dmRNA que correspon a aquest fragment de DNA.


[0,25 punts]

7.3. Com sanomena el procs de formaci dRNA?


[0,25 punts]

7.4. En quin compartiment cellular es produeix?


[0,25 punts]

7.5. Aquest fragment dmRNA es tradueix a una seqncia daminocids. Quants aminocids
tindr el pptid com a mxim?
[0,25 punts]

7.6. En quin orgnul cellular t lloc el procs de traducci?


[0,25 punts]

7.7. Identifiqueu lerrada del text segent i justifiqueu la resposta.


[0,5 punts]

Desprs de lsser hum i del ratol, la rata de laboratori s el tercer mamfer del qual
sha desxifrat la seqncia del codi gentic.

11

S1 21 1 BIOLOGIA GS V.CAT 10.indd 11

20/04/10 10:16

LInstitut dEstudis Catalans ha tingut cura de la correcci lingstica i de ledici daquesta prova daccs

S1 21 1 BIOLOGIA GS V.CAT 10.indd 12

20/04/10 10:16

Prova daccs a Cicles formatius de grau superior de formaci professional,


Ensenyaments desports i Ensenyaments darts plstiques i disseny 2010

Biologia
Srie 2

Dades de la persona aspirant

Qualificaci

Cognoms i nom

DNI

Instruccions
La prova consta de set preguntes, que valen 2 punts cada una.
Trieu CINC preguntes i feu-ne tots els apartats. Cal, doncs, que deixeu sense respondre
dues de les set preguntes.

S2 21 1 BIOLOGIA GS V.CAT 10

S2 21 1 BIOLOGIA GS V.CAT 10.indd 1

16/04/10 13:01

Pregunta 1
1.1. El teixit adips s un teixit animal format per unes cllules anomenades adipcits, que
emmagatzemen lpids en el citoplasma.
a) Com sanomenen aquests lpids?
[0,25 punts]

b)

Quina funci tenen?


[0,25 punts]

c)

A vegades, les persones que es volen aprimar fan dietes riques en glcids i molt pobres en lpids, ja que creuen que aix no emmagatzemaran lpids i, per tant, el seu
teixit adips no augmentar. Penseu que tenen ra? Justifiqueu la resposta.
[0,5 punts]

1.2. Llegiu el text segent i contesteu les qestions.


Les protenes sn indispensables com a nutrients plstics, per la qual cosa no poden ser
substitudes per cap altra biomolcula. Sn constitudes per cadenes daminocids, alguns
dels quals sn aminocids essencials. Les proporcions daminocids essencials que hi ha
en les protenes de la llet materna sn tan equilibrades que es considera que tenen un
valor biolgic del 100 %. En canvi, en laltre extrem, les protenes de la gelatina tenen
un valor biolgic igual a zero.
a) Qu significa que les protenes sn nutrients plstics?
[0,25 punts]

S2 21 1 BIOLOGIA GS V.CAT 10.indd 2

16/04/10 13:01

b)

Feu un dibuix esquemtic dun aminocid i assenyaleu-ne els grups funcionals.


[0,5 punts]

c)

Qu sn els aminocids essencials?


[0,25 punts]

Pregunta 2
2.1. Observeu la illustraci segent:

6 m

a) Com sanomenen els orgnuls assenyalats amb nmeros?


[0,4 punts; 0,2 punts per cada apartat]

1.
2.
3

S2 21 1 BIOLOGIA GS V.CAT 10.indd 3

16/04/10 13:01

b)

Quina funci t lorgnul assenyalat amb el nmero 1?


[0,2 punts]

c)

Esmenteu dues caracterstiques daquest orgnul que avalin el seu origen com a organisme procariota (teoria endosimbitica de Lynn Margulis).
[0,4 punts; 0,2 punts per cada caracterstica]

2.2. Relacioneu les definicions de la columna A amb els elements corresponents de la columna B. Escriviu la lletra adequada en les caselles de sota.
[1 punt; 0,2 punts per cada definici]

1. Estructura cellular formada


per dictiosomes.

a. Ribosoma

2. Orgnul on es produeix la sntesi


de protenes.

b. Lisosoma

3. A les cllules eucariotes, orgnul


on es produeix la fotosntesi.

c. Aparell o complex de Golgi

4. Orgnul on t lloc la digesti cellular.

d. Membrana nuclear

5. Estructura cellular que protegeix


el DNA.

e. Cloroplast

1.

2.

3.

4.

5.

S2 21 1 BIOLOGIA GS V.CAT 10.indd 4

16/04/10 13:01

Pregunta 3
El pedigr segent correspon a una famlia afectada dhemoflia, una anomalia en la coagulaci de
la sang determinada per un allel recessiu lligat al cromosoma X. Els individus marcats en negre
representen persones afectades dhemoflia, els cercles representen dones i els quadrats, homes.

3.1. Indiqueu, amb la nomenclatura adient, els genotips dels individus segents:
[1 punt]

Individu

Genotip

I-1
I-2
II-2
II-3

3.2. Quina probabilitat presenta la parella II-1 II-2 de tenir un fill mascle no afectat
dhemoflia? Indiqueu lencreuament i la possible descendncia.
[0,5 punts]

S2 21 1 BIOLOGIA GS V.CAT 10.indd 5

16/04/10 13:01

3.3. Quina probabilitat t la dona II-4 de ser portadora del gen de lhemoflia? s a dir, quina
probabilitat t de ser heterozigota? Raoneu la resposta.
[0,5 punts]

Pregunta 4
4.1. Els dibuixos segents corresponen a dues cllules dun organisme que es troben en
lanafase mittica i en lanafase I meitica. Indiqueu el nombre de cromosomes que t
aquest organisme, identifiqueu cada fase i justifiqueu la resposta.
[1 punt]

Nombre de cromosomes

Fase A

Fase B

S2 21 1 BIOLOGIA GS V.CAT 10.indd 6

16/04/10 13:01

4.2.

Completeu les frases segents amb la resposta correcta.


[1 punt]

En
a)
b)
c)
d)

la fase S del cicle cellular t lloc


la duplicaci del DNA.
la duplicaci dels centrols.
la desaparici de la membrana nuclear.
la formaci del fus acromtic.

La
a)
b)
c)
d)

cromatina s el material gentic que


es troba en el nucli i en els ribosomes.
est format per protenes i DNA.
est format per un sol filament de DNA.
Cap de les anteriors.

El nombre de cromosomes dels gmetes dun organisme amb 2n = 12 s


a) sis cromosomes iguals.
b) sis cromosomes diferents.
c) sis cromosomes iguals dos a dos.
d) dotze cromosomes.

Els
a)
b)
c)
d)

cromosomes sn unes estructures que


estan formades per RNA i protenes.
es fan visibles durant la mitosi.
sintetitzen protenes.
sidentifiquen durant la interfase.

S2 21 1 BIOLOGIA GS V.CAT 10.indd 7

16/04/10 13:01

Pregunta 5
5.1. Per mitj dun esquema de fletxes, establiu la xarxa trfica dun ecosistema integrat pels
organismes segents, els hbits alimentaris dels quals sindiquen entre parntesis: cucs
anllids (algues), crancs (cucs anllids), estrelles de mar (molluscs bivalves i cucs anllids), gavines (crancs i peixos), molluscs bivalves (fitoplncton), peixos (zooplncton),
spies (peixos) i zooplncton (fitoplncton).
[1 punt]

5.2. Indiqueu a quin nivell trfic pertany cadascun dels organismes de lecosistema anterior.
[1 punt; 0,1 punts per cada apartat]

Organisme

Nivell trfic

Organisme

Cucs anllids

Gavines

Crancs

Peixos

Estrelles de mar

Spies

Molluscs bivalves

Zooplncton

Fitoplncton

Algues

Nivell trfic

S2 21 1 BIOLOGIA GS V.CAT 10.indd 8

16/04/10 13:01

Pregunta 6
Lesquema segent representa de manera simplificada un dels cicles biolgics dels ssers vius.

adult
2n

gmeta
n

zigot
2n

B
adult
2n

gmeta
n

6.1. Quin tipus de cicle biolgic s?


[0,25 punts]

6.2. Qu el caracteritza?
[0,25 punts]

a)
b)
c)
d)

Hi predomina la fase diploide.


Hi alternen individus adults diploides amb individus adults haploides.
La meiosi produeix el creixement dels individus.
Els adults, en condicions adverses, tamb poden produir espores.

6.3. Indiqueu en quin moment del cicle es donen els processos segents (escriviu la lletra
corresponent de lesquema).
[0,75 punts]

Mitosi:
Meiosi:
Fecundaci:
6.4. Digueu un exemple dun organisme que segueix aquest tipus de cicle.
[0,25 punts]

6.5. Expliqueu un avantatge i un desavantatge de la reproducci sexual.


[0,5 punts]

S2 21 1 BIOLOGIA GS V.CAT 10.indd 9

16/04/10 13:01

Pregunta 7
A continuaci es descriuen diverses activitats humanes. Indiqueu en cada cas el problema mediambiental que es produeix i una de les conseqncies que sen deriven. Escriviu les respostes
en les caselles corresponents de la taula.
[2 punts; 0,5 punts per cada activitat]

a)

Les activitats industrials augmenten la producci i lemissi a latmosfera de gasos com


el dixid de carboni.
b) A causa de la necessitat de fusta per a obtenir pasta de paper, combustible, materials de
construcci, etc., se sobreexploten els boscos.
c) Quan es cremen combustibles fssils per a les calefaccions, els autombils, el transport
aeri, etc., la combusti allibera gasos com el dixid de sofre i el dixid de nitrogen que,
en contacte amb loxigen i el vapor daigua de latmosfera, es transformen en cid sulfric
i cid ntric, respectivament.
d) La producci de compostos clorofluorocarbonats (CFC), que es fan servir en nombrosos
aerosols i en aparells de refrigeraci, s una amenaa greu per al planeta.

Activitat

Problema ambiental

Conseqncia

a)

b)

c)

d)

10

S2 21 1 BIOLOGIA GS V.CAT 10.indd 10

16/04/10 13:01

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente.

Gr.Superior-Junio: BIOLOGA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR.


Orden de 15 de ABRIL de 2010, (DOE. 26 de ABRIL) Fecha: 1 de junio de 2010

DATOS DEL ASPIRANTE


Apellidos: __________________________________________________
Nombre: _________________________________ DNI: _____________
I.E.S. de inscripcin: ___________________________________________
I.E.S. de realizacin: ___________________________________________

CALIFICACIN

Dos decimales

Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Grape todas las hojas de respuestas que correspondan a esta prueba junto a esta hoja u hojas de
examen.
Lea detenidamente los enunciados de los ejercicios antes de comenzar su resolucin.
Duracin 85 minutos.
PRUEBA DE BIOLOGA
HAGA 5 DE LAS 6 PREGUNTAS
1-Haga una relacin de los orgnulos celulares con membrana e indique brevemente la funcin de
cada uno de ellos.
2- Diferencia entre lpidos saponificables e insaponificables. Poner un ejemplo de cada uno,
indicando su localizacin y funcin en la naturaleza.
3- Los anticuerpos y la reaccin antgeno/anticuerpo. Qu diferencias hay entre un suero y una
vacuna?
4- Explique la funcin de los distintos tipos de ARN en la expresin del mensaje gentico. Explique
la estructura primaria y secundaria de las protenas.
5- Describa el recorrido que realiza una molcula de oxgeno desde que es inspirada hasta que
llega a la sangre.
6- Defina los siguientes conceptos:
A.- Biotecnologa.
B.- Especies transgnicas.
C.- ADN recombinante.
D.- Organismo clnico.

Pgina 1 de 2

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente.

Gr.Superior-Junio: BIOLOGA

Criterios de calificacin:
La puntuacin total de los cinco ejercicios ser de 10 puntos. Cada uno se valorar con un
mximo de 2 puntos.
Se tendrn en cuenta la ortografa, la expresin, el estilo y la presentacin.

Pgina 2 de 2

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente. Gr.Superior-Septiembre:

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR.


Orden de 18 de mayo de 2009, (DOE. 22 de mayo)

Fecha: 2 de septiembre de 2009

DATOS DEL ASPIRANTE


Apellidos: __________________________________________________
Nombre: _________________________________ DNI: _____________
I.E.S. de inscripcin: ___________________________________________
I.E.S. de realizacin: ___________________________________________

CALIFICACIN

Dos decimales

Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Grape todas las hojas de respuestas que correspondan a esta prueba junto a esta hoja u hojas de
examen.
Lea detenidamente los enunciados de los ejercicios antes de comenzar su resolucin. Cada
pregunta tiene el mismo valor (2 puntos). Dentro de cada pregunta, cada apartado tiene el mismo
valor.
Duracin 85 minutos.
PRUEBA DE BIOLOGA
1. Define los siguientes conceptos: Nucletido, Fenotipo, Anticuerpo, Respiracin celular y Nutricin.
2. Ordena cronolgicamente las etapas del ciclo celular: Metafase. Profase. Fase S. Telofase. Fase G2.
Anafase. Fase G1, indicando los principales acontecimientos que suceden en cada una de ellas.
Cules de las etapas pertenecen a la Mitosis y cules a la Interfase?.
Diferencia mitosis de
meiosis.
3. Explica la composicin de la sangre y describe las principales funciones que realiza, indicando cules
de sus componentes las realizan.
4. Un virus puede producir una determinada enfermedad. Responde a las siguientes preguntas:
a) Cmo denominaras genricamente este tipo de enfermedad?
b) Qu componentes tiene un virus?
c) Cmo sera una vacuna para esta enfermedad y que tipo de inmunidad nos proporciona?
d) Seala tres ejemplos de enfermedades producidas por virus.
e) Qu tipo de clulas pueden producir anticuerpos contra el virus?
5. Respecto al ADN, responde a las siguientes preguntas:
a) Qu es un gen?
b) Qu es genotipo?
c) Define Transcripcin y seala dnde se produce?
d) En qu consiste un organismo transgnico?
e) Qu es la recombinacin gentica, qu consecuencias tiene, dnde y cundo se produce?

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente.

Grado Superior-Septiembre: BIOLOGA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR.


Orden de 15 de ABRIL de 2010, (DOE. 26 de ABRIL) Fecha: 2 de septiembre de 2010

DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: __________________________________________________
Nombre: _________________________________ DNI: _____________
I.E.S. de inscripcin: ___________________________________________
I.E.S. de realizacin: ___________________________________________

Dos decimales

Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Grape todas las hojas de respuestas que correspondan a esta prueba junto a esta hoja u hojas de
examen.
Lea detenidamente los enunciados de los ejercicios antes de comenzar su resolucin.
Duracin 85 minutos.
PRUEBA DE BIOLOGA
HAGA 5 DE LAS 6 PREGUNTAS
1- Estructura de la membrana plasmtica: modelo del mosaico fluido.
2- Desarrolle, de forma concisa, el concepto de nucletido. Establezca las diferencias ms
significativas entre ADN y ARN.
3- Una clula adulta somtica contiene 8 cromosomas. Cuntos cromosomas tendrn las clulas
hijas tras la mitosis? Y tras la meiosis? Indique la dotacin cromosmica de cada una de las
clulas resultantes. Defina los conceptos de diploide y haploide.
4- Explique cmo se genera y transmite el impulso nervioso.
5- Defina e indique dos ejemplos de mtodos anticonceptivos quirrgicos, de barrera y qumicos.
6- Defina los siguientes conceptos:
A.
B.
C.
D.

Anabolismo.
Catabolismo.
Respiracin aerobia.
Fermentacin.

Pgina 1 de 2

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente.

Grado Superior-Septiembre: BIOLOGA

Criterios de calificacin:
La puntuacin total de los cinco ejercicios ser de 10 puntos. Cada uno se valorar con un
mximo de 2 puntos.
Se tendrn en cuenta la ortografa, la expresin, el estilo y la presentacin.

Pgina 2 de 2

GOBIERNO DE EXTREMADURA
Consejera de Educacin y Cultura
Direccin General de Formacin Profesional y Educacin de Adultos.

Gr.Superior: BIOLOGA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE


GRADO SUPERIOR.
Orden de 9 de abril de 2012, (DOE. 13 de abril)

Fecha: 30 de mayo de 2012

DATOS DEL ASPIRANTE


Apellidos: __________________________________________________
Nombre: _________________________________ DNI: _____________
I.E.S. de inscripcin: ___________________________________________
I.E.S. de realizacin: ___________________________________________

CALIFICACIN

Dos decimales

Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Grape todas las hojas de respuestas que correspondan a esta prueba junto a esta hoja u hojas de
examen.
Lea detenidamente los enunciados de los ejercicios antes de comenzar su resolucin.
Duracin 85 minutos.
PRUEBA DE BIOLOGA
PREGUNTAS
1- Defina los siguientes trminos:
a) Reproduccin (0,5 puntos)
b) Metabolismo (0,5)
c) Fotosntesis (0,5)
d) Respiracin aerobia (0,5)

2- Conteste a las siguientes cuestiones sobre la clula:


a) Estructura de una mitocondria (1 punto)
b) Funciones del retculo endoplasmtico (1)

3- Diferencias fundamentales entre mitosis y meiosis (2 puntos)

4- Explique la estructura y funcin del ADN (2 puntos)


BIOLOGA -- Pgina 1 de 2

GOBIERNO DE EXTREMADURA
Consejera de Educacin y Cultura
Direccin General de Formacin Profesional y Educacin de Adultos.

Gr.Superior: BIOLOGA

5- Dibuje una neurona, indicando cada una de sus partes (2 puntos)

Criterios de calificacin:
Cada pregunta se valorar con un mximo de 2 puntos.
Los apartados de las preguntas 1 y 2 se valorarn con la puntuacin indicada en
cada uno de ellos.

Se valorar la claridad de la exposicin, la concrecin, el orden, la correcta


expresin escrita y la presentacin.

BIOLOGA -- Pgina 2 de 2

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente.

Gr.Superior-Junio

BIOLOGA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE


GRADO SUPERIOR.
Orden de 26 de abril de 2011, (DOE. 5 de mayo)

Fecha: 7 de junio de 2011

DATOS DEL ASPIRANTE


Apellidos: __________________________________________________
Nombre: _________________________________ DNI: _____________
I.E.S. de inscripcin: ___________________________________________
I.E.S. de realizacin: ___________________________________________

CALIFICACIN

Dos decimales

Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Grape todas las hojas de respuestas que correspondan a esta prueba junto a esta hoja u hojas de
examen.
Lea detenidamente los enunciados de los ejercicios antes de comenzar su resolucin.
Duracin 85 minutos.
PRUEBA DE BIOLOGA

1.- Indique las funciones principales de las tres partes de una clula eucaritica.
2.- Seale el significado biolgico de la MITOSIS y sus fases.
3.- Explique las partes y sus funciones del aparato reproductor femenino
4.- Defina:
a) Gen
b) Transcripcin en la sntesis de protenas
c) Traduccin en la sntesis de protenas
d) Replicacin o autoduplicacin del ADN

5.- Diferencie la inmunidad natural de la adquirida.


Criterios de calificacin: Cada ejercicio tiene un valor mximo de 2 puntos.

BIOLOGA -- Pgina 1 de 1

JUNTA DE EXTREMADURA
Consejera de Educacin
Direccin General de Formacin Profesional y Aprendizaje Permanente.

Gr.Superior- Septiembre BIOLOGA

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE


GRADO SUPERIOR.
Orden de 26 de abril de 2011, (DOE. 5 de mayo)

Fecha: 1 de septiembre de 2011

DATOS DEL ASPIRANTE


Apellidos: __________________________________________________
Nombre: _________________________________ DNI: _____________
I.E.S. de inscripcin: ___________________________________________
I.E.S. de realizacin: ___________________________________________

CALIFICACIN

Dos decimales

Instrucciones:
Mantenga su DNI en lugar visible durante la realizacin del ejercicio.
Grape todas las hojas de respuestas que correspondan a esta prueba junto a esta hoja u hojas de
examen.
Lea detenidamente los enunciados de los ejercicios antes de comenzar su resolucin.
Duracin 85 minutos.
PRUEBA DE BIOLOGA

1.- Defina el concepto de biomolcula y clasifique sus tipos.


2.- Seale las diferencias ms significativas entre vas aerobia y anaerobia de la
respiracin celular.
3.- Explique cmo se produce la transmisin del impulso nervioso entre neuronas.
4.- Defina:
a) Virus
b) Microorganismo
c) Clula procariotica
d) Enfermedad infecciosa
5.- SIDA: Estructura del virus y efectos sobre el sistema inmune.
Criterios de calificacin: Cada ejercicio tiene un valor mximo de 2 puntos.

BIOLOGA -- Pgina 1 de 1

Probas de acceso a ciclos


formativos de grao superior
Cdigo

Proba de

Bioloxa

pxina 1 de 10

CSPEC03

Parte especfica
BIOLOXA

[CS.PE.C03]

1.

Formato da proba
Formato

A proba consta de vinte cuestins tipo test.


As cuestins tipo test teen tres posibles respostas das que soamente unha correcta.
Puntuacin

Puntuacin: 050 puntos por cuestin tipo test correctamente contestada.


Cada cuestin tipo test incorrecta restar 0125 puntos.
As respostas en branco non descontarn puntuacin.
Duracin

Este exercicio ter unha duracin mxima de: 60 minutos.


Materiais e instrumentos que se poden empregar durante a proba

Bolgrafo con tinta negra ou azul.

Parte especfica
BIOLOXA

[CS.PE.C03]

2.

Exercicio
1.

A orixe da vida foi un tema que preocupou ao longo da historia aos seres humanos. Cal dos seguintes naturalistas demostrou que a hiptese da xeracin espontnea non se poda considerar
cientificamente correcta, xa que os organismos s poden orixinarse a partir de outros?
El origen de la vida fue un tema que preocup a lo largo de la historia a los seres humanos. Cul de los
siguientes naturalistas demostr que la hiptesis de la generacin espontnea no se poda considerar cientficamente correcta, ya que los organismos slo pueden originarse a partir de otros?

A Darwin.
B Pasteur.
C Lamarck.
2.

Probablemente os homnidos chegaran a Europa desde Turqua, Grecia e Bulgaria. A especie de


homnidos europea mis antiga atopouse na serra de Atapuerca (Burgos) en 1997. Cal das seguintes?
Probablemente los homnidos hayan llegado a Europa desde Turqua, Grecia y Bulgaria. La especie de
homnidos europea ms antigua se ha encontrado en la sierra de Atapuerca (Burgos) en 1997. Cul es de
las siguientes?

A Australopitecus afarensis.
B Homo sapiens.
C Homo antecessor.
3.

Indique a resposta na que se citan tdolos bioelementos primarios.


Indique la respuesta en la que se citan todos los bioelementos primarios.

A C, H, O.
B C, H, N, O, P, S.
C C, H, N, O.

Parte especfica
BIOLOXA

[CS.PE.C03]

4.

Os lpidos constiten un tipo de molculas moi heteroxneas canto sa estrutura, pero realizan
unha funcin biolxica moi importante, que :
Los lpidos constituyen un tipo de molculas muy heterogneas en cuanto a su estructura, pero realizan una
funcin biolgica muy importante, que es:

A Encimtica.
Enzimtica.

B Anticoagulante.
Anticoagulante.

C Enerxtica.
Energtica.

5.

Os seres vivos estn constitudos por clulas. As clulas vexetais diferncianse das animais en
que:
Los seres vivos estn constituidos por clulas. Las clulas vegetales se diferenciane de las animales en que:

A Carecen de centrolo.
Carecen de centriolo.

B Realizan a fotosntese e non presentan ribosomas.


Realizan la fotosntesis y no presentan ribosomas.

C Non presentan parede celular.


No presentan pared celular.

6.

O tamao das clulas procariotas est entre 0,3 e 0,5 micras. As clulas procariotas diferncianse
das eucariotas por:
El tamao de las clulas procariotas est entre 0,3 y 0,5 micras. Las clulas procariotas se diferencian de
las eucariotas por:

A Presentan centrolo.
Presentan cnetriolo.

B Presentan mitocondrias.
Presentan mitocondrias.

C Non presentan membrana nuclear.


No presentan membrana nuclear.

Parte especfica
BIOLOXA

[CS.PE.C03]

7.

As clulas eucariotas somticas e reprodutoras utilizan a mitose ou a meiose para dividirse. Daquela a meiose ten a finalidade de:
Las clulas eucariotas somticas y reproductoras utilizan la mitosis o la meiosis para dividirse. As, la
meiosis tienen la finalidad de:

A Xerar clulas diploides a partir de gametos.


Generar clulas diploides a partir de gametos.

B Xerar clulas haploides.


Generar clulas haploides.

C Permitir aumentar os cromosomas.


Permitir aumentar los cromosomas.

8.

O conxunto de reaccins qumicas mediante as cales un organismo consegue enerxa e rompe


estruturas complexas en sinxelas denomnase:
El conjunto de reacciones qumicas mediante las cuales un organismo consigue energa y rompe estructuras
complejas en sencillas se denomina:

A Catabolismo.
Catabolismo.

B Anabolismo.
Anabolismo.

C Glicolise.
Glucolisis.

9.

A bile axuda dixestin dos lpidos, xa que fai que emulsionen e formen pequenas pingas para
facilitar a degradacin. Esa funcin da bile levarase a cabo dentro dun dos seguintes rganos:
La bilis ayuda a la digestin de los lpidos, ya que hace que se emulsionen y formen pequeas gotas para
facilitar la degradacin. Esa funcin de la bilis se llevar a cabo dentro de uno de los siguientes rganos:

A Vescula biliar.
Vescula biliar.

B Intestino delgado.
Intestino delgado.

C Fgado.
Hgado.

Parte especfica
BIOLOXA

[CS.PE.C03]

10.

O impulso nervioso transmtese a travs das neuronas. As ramificacins que reciben os impulsos
nerviosos doutras neuronas chmanse:
El impulso nervioso se transmite a travs de las neuronas. Las ramificaciones que reciben los impulsos nerviosos de otras neuronas se llaman:

A Dendritas.
Dendritas.

B Sinapse.
Sinapsis.

C Axns.
Axones.

11.

Hai tres tipos de vasos sanguneos: arterias, capilares e veas. Cales son os vasos polos que retorna o sangue ao corazn?
Hay tres tipos de vasos sanguneos: arterias, capilares y venas. Cules son los vasos por los que retorna la
sangre al corazn?

A Capilares.
Capilares.

B Veas.
Venas.

C Arterias.
Arterias.

12.

Os rganos xenitais internos do aparello reprodutor masculino teen a funcin de producir seme e
hormonas. Os espermatozoides formados almacnanse nun dos seguintes lugares:
Los rganos genitales internos del aparato reproductor masculino tienen la funcin de producir semen y
hormonas. Los espermatozoides formados se almacenan en uno de los siguientes lugares:

A Epiddimo.
B Vescula seminal.
C Escroto.

Parte especfica
BIOLOXA

[CS.PE.C03]

13.

As mutacins son alteracins ao azar do material xentico. Cal das afirmacins correcta?
Las mutaciones son alteraciones al azar del material gentico. Cul de las afirmaciones es correcta?

A Sempre producen efectos negativos.


Siempre producen efectos negativos.

B Son unha fonte de variabilidade das especies.


Son una fuente de variabilidad de las especies.

C Cando se producen frmase un hbrido.


Cuando se producen se forma un hbrido.

14.

A hemofilia un carcter ligado ao sexo. Se unha muller san, cuxo pai era hemoflico, ten descendencia cun varn san, que proporcin da descendencia ter o xene para a hemofilia?
La hemofilia es un carcter ligado al sexo. Si una mujer sana, cuyo padre era hemoflico, tiene descendencia con un varn sano, qu proporcin de la descendencia tendr el gen para la hemofilia?

A 25 %.
25 %.

B Todas as fillas.
Todas las hijas.

C 50 %.
50 %.

15.

Se un home do grupo sanguneo AB ten descendencia cunha muller do grupo A, cuxo pai era do
grupo O, que proporcin de fillos ser do grupo sanguneo A?
Si un hombre del grupo sanguneo AB tiene descendencia con una mujer del grupo A, cuyo padre era del
grupo O, qu proporcin de hijos ser del grupo sanguneo A?

A 50 % grupo A.
B 25 % grupo A.
C 75 % grupo A.
16.

O ADN asciase s protenas para formar o material xentico. Cando o material xentico no interior do ncleo se condensa recibe o nome de:
El ADN se asocia a las protenas para formar el material gentico. Cuando el material gentico en el interior del ncleo se condensa recibe el nombre de:

A Cromatina.
B Cromosoma.
C Cromtida.

Parte especfica
BIOLOXA

[CS.PE.C03]

17.

Os estudos con xemelgos poen de manifesto a influencia que exerce o ambiente sobre os caracteres. Os nacementos de xemelgos monocigticos e bicigticos teen lugar con frecuencia. Como
se orixinan os xemelgos monocigticos?
Los estudios con gemelos ponen de manifiesto la influencia que ejerce el ambiente sobre los caracteres. Los
nacimientos de gemelos monocigticos y bicigticos (mellizos) tienen lugar con frecuencia. Como se originan los gemelos monocigticos?

A Os xemelgos monocigticos proceden de dous vulos fecundados por dous espermatozoides.


Los gemelos monocigticos proceden de dos vulos fecundados por dos espermatozoides.

B Os xemelgos bicigticos son clons dun dos proxenitores.


Los gemelos bicigticos son clones de uno de los progenitores.

C Os xemelgos monocigticos proceden do mesmo vulo fecundado polo mesmo espermatozoide, o cigoto divdese en das partes que seguen camios separados.
Los gemelos monocigticos proceden del mismo vulo fecundado por el mismo espermatozoide, el zigoto se divide en dos partes que siguen caminos separados.

18.

A reproducin asistida incle un procedemento, que se utiliza na actualidade con bastante eficacia para a obtencin dos embrins: indique a resposta correcta.
La reproduccin asistida incluye un procedimiento, que se utiliza en la actualidad con bastante eficacia para la obtencin de los embriones: indique la respuesta correcta.

A Fecundacin in vitro.
Fecundacin in vitro.

B Terapia xnica.
Terapia gnica.

C Amniocentese.
Amniocentesis.

19.

As doenzas infecciosas son as causadas por microorganismos patxenos: bacterias, virus, fungos
ou protozoos. Os antibiticos sanse para curar as doenzas provocadas por:
Las enfermedades infecciosas son las causadas por microorganismos patgenos: bacterias, virus, hongos o
protozoos. Los antibiticos se usan para curar las enfermedades provocadas por:

A Virus.
Virus.

B Bacterias.
Bacterias.

C Fungos.
Hongos.

Parte especfica
BIOLOXA

[CS.PE.C03]

20.

A inmunidade o estado de resistencia que presenta un organismo fronte infeccin. Son exemplos de inmunidade artificial activa:
La inmunidad es el estado de resistencia que presenta un organismo frente a la infeccin. Son ejemplos de
inmunidad artificial activa:

A Vacinas.
Vacunas.

B Soros.
Sueros.

C Antibiticos.
Antibiticos.

Probas de acceso a ciclos


formativos de grao superior
Cdigo

Proba de

Bioloxa

Pxina 1 de 9

CSPEC03

Parte especfica
BIOLOXA

[CS.PE.C03]

1.

Formato da proba
Formato

A proba constar de 20 cuestins tipo test.


As cuestins tipo test teen tres posibles respostas das que soamente unha correcta.
Puntuacin

Puntuacin: 05 puntos por cuestin tipo test correctamente contestada.


Cada cuestin tipo test incorrecta restar 0125 puntos.
As respostas en branco non descontarn puntuacin.
Duracin

Este exercicio ter unha duracin mxima de: 60 minutos.

Parte especfica
BIOLOXA

[CS.PE.C03]

2.

Exercicio
1.

Despois de 1900 o campo da xentica experimentou un rpido desenvolvemento ao engadir novas dimensins teora da seleccin natural. Cal dos seguintes naturalistas demostrou esta teora?
Despus de 1900 el campo de la gentica experiment un rpido desarrollo al aadir nuevas dimensiones a
la teora de la seleccin natural. Cul de los siguientes naturalistas demostr esta teora?

A Oparin.
B Darwin.
C Linneo.
2.

O aumento cerebral dos homnidos est en relacin cunha dieta de elevado contido enerxtico.
Cal das seguintes especies do xnero Homo tera o cerebro mis grande?
El aumento cerebral de los homnidos est en relacin con una dieta de elevado contenido energtico.
Cul de las siguientes especies del gnero Homo tendra el cerebro ms grande?

A Homo habilis.
B Homo erectus.
C Homo sapiens.
3.

A importancia da auga deriva da sa abundancia e das propiedades fisicoqumicas. Sinale a propiedade causante de que a auga sexa o disolvente universal.
La importancia da agua deriva de su abundancia y de las propiedades fisicoqumicas. Seale la propiedad
causante de que el agua sea el disolvente universal.

A Natureza dipolar.
Naturaleza dipolar.

B Elevada calor especfica.


Elevado calor especfico.

C Elevada cohesin.

Parte especfica
BIOLOXA

[CS.PE.C03]

4.

Todos os seres vivos estn constitudos por clulas que, atendendo sa estrutura, poden ser
procariotas ou eucariotas. Que organismos dos seguintes presentan a organizacin procariota?
Todos los seres vivos estn constituidos por clulas que, atendiendo a su estructura, pueden ser procariotas
o eucariotas. Qu organismos de los siguientes presentan la organizacin procariota?

A Virus.
B Protistas.
C Bacterias.
5.

Na clula hai orgnulos encargados de recibir as instrucins xenticas contidas no ARN mensaxeiro e posteriormente traducilas en protenas. Cales dos seguintes son estes orgnulos?
En la clula hay orgnulos encargados de recibir las instrucciones genticas contenidas en el ARN mensajero y posteriormente traducirlas en protenas. Cules de los siguientes son estos orgnulos?

A Mitocondrias.
B Ribosomas.
C Aparello de Golgi.
Aparato de Golgi.

6.

A membrana plasmtica unha delgada lmina que envolve completamente a clula separndoa
do medio externo. Cales das seguintes biomolculas forman parte da estrutura da membrana?
La membrana plasmtica es una delgada lmina que envuelve completamente a la clula separndola del
medio externo. Cules de las siguientes biomolculas forman parte de la estructura de la membrana?

A S lpidos.
Slo lpidos.

B ARN e ADN.
ARN y ADN.

C Lpidos e protenas.
Lpidos y protenas.

7.

A maior parte das clulas eucariotas reprodcese a intervalos regulares para xerar novas clulas
fillas. Que nome recibe o proceso que transforma clulas diploides en haploides?
La mayor parte de las clulas eucariotas se reproduce a intervalos regulares para generar nuevas clulas
hijas. Qu nombre recibe el proceso que transforma clulas diploides en haploides?

A Meiose.
Meiosis.

B Mitose.
Mitosis.

C Citocinese.
Citocinesis.

Parte especfica
BIOLOXA

[CS.PE.C03]

8.

A fotosntese un proceso anablico propio dos seres auttrofos. Cal dos seguintes o obxectivo
da fotosntese?
La fotosntesis es un proceso anablico propio de los seres auttrofos. Cul de los siguientes es el objetivo
de la fotosntesis?

A A respiracin da planta.
La respiracin de la planta.

B A obtencin da auga.
La obtencin del agua.

C A sntese de compostos orgnicos.


La sntesis de cumpuestos orgnicos.

9.

O ciclo de Krebs est constitudo por unha serie de reaccins nas que se produce a oxidacin de
monosacridos, cidos graxos e aminocidos. En que lugar da clula se leva a cabo o proceso?
El ciclo de Krebs est constituido por una serie de reacciones en las que se produce la oxidacin de monosacridos, cidos grasos y aminocidos. En qu lugar de la clula se lleva a cabo el proceso?

A Retculo endoplasmtico.
B Citoplasma.
C Mitocondria.
10.

A fermentacin lctica realzana as bacterias do xnero Lactobacillus. Como produto final desa
fermentacin obtense o cido lctico. En cal destes procesos se producir esa fermentacin?
La fermentacin lctica la realizan las bacterias del gnero Lactobacillus. Como producto final de esa fermentacin se obtiene el cido lctico. En cul de estos procesos se producir esa fermentacin?

A No msculo, se dispn de osxeno.


En el msculo, si dispone de oxgeno.

B Na elaboracin do pan.
En la elaboracin del pan.

C No msculo, se non dispn de osxeno.


En el msculo, si no dispone de oxgeno.

Parte especfica
BIOLOXA

[CS.PE.C03]

11.

O cariotipo o conxunto de cromosomas dunha especie ordenados por tamao e forma. Cal das
seguintes respostas pertence especie humana?
El cariotipo es el conjunto de cromosomas de una especie ordenados por tamao y forma. Cul de las siguientes respuestas pertenece a la especie humana?

A 22 pares de autosomas e un par de cromosomas sexuais.


22 pares de autosomas y un par de cromosomas sexuales.

B 22 pares de autosomas e un cromosoma sexual.


22 pares de autosomas y un cromosoma sexual.

C 23 pares de cromosomas sexuais.


23 pares de cromosomas sexuales.

12.

Segundo un enfoque mendeliano un xene a unidade de herdanza que produce a expresin dunha caracterstica observable nun ser vivo ou nos seus descendentes. Segundo a xentica molecular, que tipo de molcula forma os devanditos xenes?
Segn un enfoque mendeliano un gen es la unidad de herencia que produce la expresin de una caracterstica observable en un ser vivo o en sus descendientes. Segn la gentica molecular, qu tipo de molcula
forma dichos genes?

A ARN.
B Protenas.
C ADN.
13.

O cdigo xentico a correspondencia entre as bases nucleotdicas dun polinucletido e os aminocidos dunha protena. Indique unha das sas caractersticas.
El cdigo gentico es la correspondencia entre las bases nucleotdicas de un polinucletido y los aminocidos de una protena. Indique una de sus caractersticas.

A Ser universal.
B Ser concreto.
C Ser numerario.
14.

O 14 de abril de 2003 obtvose o mapa completo do xenoma humano. Indique o nmero de xenes
que contn este xenoma.
El 14 de abril de 2003 se obtuvo el mapa completo del genoma humano. Indique el nmero de genes que
contiene este genoma.

A 100.000
B 3.000.000
C 30.000

Parte especfica
BIOLOXA

[CS.PE.C03]

15.

Unha parella tivo catro fillos dos cales tres tian visin normal e un miope. Sabendo que os pais
tian visin normal. Cal das seguintes respostas ser o xenotipo dos pais?
Una pareja tuvo cuatro hijos de los cuales tres tenan visin normal y uno miope. Sabiendo que los padres
tenan visin normal. Cul de las siguientes respuestas ser el genotipo de los padres?

A AA
B Aa
C aa
16.

Normalmente o sistema inmune recoece as propias clulas; en determinadas ocasins pode


formar anticorpos contra os seus propios tecidos producndose doenzas autoinmunes. Cal das
seguintes doenzas autoinmune?
Normalmente el sistema inmune reconoce las propias clulas; en determinadas ocasiones puede formar anticuerpos contra sus propios tejidos producindose enfermedades autoinmunes. Cul de las siguientes enfermedades es autoinmune?

A Hepatite B.
Hepatitis B.

B Tuberculose.
Tuberculosis.

C Esclerose mltiple.
Esclerosis mltiple.

17.

Un enfermo de SIDA experimenta un descenso nas sas defensas. Cal dos seguintes compoentes do sangue ter reducido de forma considerable o seu nmero?
Un enfermo de SIDA experimenta un descenso en sus defensas. Cul de los siguientes componentes de la
sangre habr reducido de forma considerable su nmero?

A Eritrocitos.
B Linfocitos.
C Plaquetas.
18.

As verteduras de petrleo e os seus derivados convertronse nun dos problemas ambientais mis
graves xerados pola actividade humana. Que organismos se usan para degradar hidrocarburos?
Los vertidos de petrleo y sus derivados se han convertido en uno de los problemas ambientales ms graves
generados por las actividades humanas. Qu organismos se utilizan para degradar hidrocarburos?

A Algas.
B Mofos.
Mohos.

C Bacterias.

Parte especfica
BIOLOXA

[CS.PE.C03]

19.

A enxeara xentica abrangue grande variedade de tcnicas de manipulacin do material xentico. Cal das seguintes tcnicas permite conseguir mltiples copias de ADN en poucos minutos?
La ingeniera gentica incluye gran variedad de tcnicas de manipulacin del material gentico. Cul de
las siguientes tcnicas permite conseguir mltiples copias de ADN en pocos minutos?

A PCR
B CMH
C ATP
20.

A fecundacin in vitro consiste en realizar a fecundacin no laboratorio. Indique o lugar onde se


implanta o embrin.
La fecundacin in vitro consiste en realizar la fecundacin en el laboratorio. Indique el lugar en donde se
implanta el embrin.

A Ovario.
B Trompas de Falopio.
C tero.

Probas de acceso a ciclos


formativos de grao superior
Cdigo

Proba de

Bioloxa

Pxina 1 de 7

CSPEC03

Parte especfica
BIOLOXA

[CS.PE.C03]

1.

Formato da proba
Formato

A proba constar de 20 cuestins tipo test.


As cuestins tipo test teen tres posibles respostas, das que soamente unha correcta.
Puntuacin

Puntuacin: 0,50 puntos por cuestin tipo test correctamente contestada.


Cada cuestin tipo test incorrectamente contestada restar 0,125 puntos.
As respostas en branco non descontarn puntuacin.
Duracin

Este exercicio ter unha duracin mxima de 60 minutos.

Pxina 2 de 7

Parte especfica
BIOLOXA

[CS.PE.C03]

2.

Exercicio
1.

A producin industrial de antibiticos medrou moito desde a dcada dos cincuenta, e tivo unha
grande importancia na rea da medicina. Cal das seguintes doenzas se combate con antibiticos?
La produccin industrial creci mucho desde la dcada de los aos cincuenta, y tuvo una gran importancia
en el rea de la medicina. Cul de las siguientes enfermedades se combate con antibiticos?

A SIDA.
B Malaria.
C Sfilis.
2.

Na especie humana hai numerosos caracteres herdables, algns nos autosomas e outros nos
cromosomas sexuais. Cal das seguintes alteracins depende dun xene recesivo ligado ao sexo?
En la especie humana hay numerosos caracteres heredables, algunos en los autosomas y otros en los cromosomas sexuales. Cul de las siguientes alteraciones depende de un gen recesivo ligado al sexo?

A Hemofilia.
B Albinismo.
C Calvicie.
3.

Nas especies eucariotas pluricelulares distnguense dous tipos de clulas: diploides 2n e haploides n. Como son as clulas resultantes da divisin dunha clula somtica 2n = 40 cromosomas?
En las especies eucariotas pluricelulares se distinguen dos tipos de clulas: diploides 2n y haploides n. Cmo son las clulas resultantes de la divisin de una clula somtica 2n= 40 cromosomas?

A 2n= 20
B n=20
C 2n=40
4.

Cal o nmero de cromosomas 21 que presentan os individuos co xenotipo mis frecuente da


sndrome de Down?
Cul es el nmero de cromosomas 21 que presentan los individuos con el genotipo ms frecuente del sndrome de Down?

A 2 cromosomas.
B 3 cromosomas.
C 1 cromosoma.

Pxina 3 de 7

Parte especfica
BIOLOXA

[CS.PE.C03]

5.

Os lpidos son un grupo de biomolculas insolubles en auga que desempean funcins moi diversas nas clulas. Cal das seguintes biomolculas NON pertence a este grupo?
Los lpidos son un grupo de biomolculas insolubles en agua que desempean funciones muy diversas en las
clulas. Cul de las siguientes molculas NO pertenece a este grupo?

A Triglicridos.
B Vitamina C.
C Colesterol.
6.

O sistema linftico axuda o sistema sanguneo a eliminar o exceso de lquidos extracelulares e a


combater infeccins. Cal dos seguintes rganos NON pertence ao sistema linftico?
El sistema linftico ayuda al sistema sanguneo a eliminar el exceso de lquidos extracelulares y a combatir
infecciones. Cul de los siguientes rganos NO pertenece al sistema linftico?

A Amgdalas.
B Apndice vermiforme.
C Vescula biliar.
7.

A nicotina no organismo estreita os vasos sanguneos e favorece a aparicin de certas doenzas.


Cal das seguintes doenzas est relacionada directamente co consumo desta substancia?
La nicotina en el organismo estrecha los vasos sanguneos y favorece la aparicin de ciertas enfermedades.
Cul de las siguientes enfermedades est relacionada directamente con el consumo de esta sustancia?

A Tuberculose.
Tuberculosis.

B Hepatite.
Hepatitis.

C Hipertensin.
Hipertensin.

8.

A descuberta da penicilina por Alexander Fleming permitiu notables avances na investigacin dos
antibiticos. Que tipo de organismo produtor desta substancia?
El descubrimiento de la penicilina por Alexander Fleming permiti notables avances en la investigacin de
los antibiticos. Qu tipo de organismo es productor de esta sustancia?

A Fungo.
Hongo.

B Protozoo.
Protozoo.

C Alga.
Alga.
Pxina 4 de 7

Parte especfica
BIOLOXA

[CS.PE.C03]

9.

Os cidos nucleicos son polmeros de nucletidos formados por adenina, timina, guanina, citosina
e uracilo. Se a cadea de ADN que se transcribe ten a secuencia TAAGCGA, cal das seguintes a
secuencia do ARN que se forma?
Los cidos nucleicos son polmeros nucletidos formados por adenina, timina, guanina, citosina y uracilo.
Si la cadena de ADN que se transcribe tiene la secuencia TAAGCGA, cul de las siguientes es la secuencia
del ARN que se forma?

A ATTCGCT.
B AUUGCGU.
C AUUCGCU.
10.

O pncreas unha glndula que realiza unha funcin endcrina producindo hormonas. Cal das
seguintes hormonas producidas aumenta a glicosa no sangue?
El pncreas es una glndula que realiza una funcin endocrina produciendo hormonas. Cul de las siguientes hormonas producidas aumenta la glucosa en la sangre?

A Adrenalina.
B Glucagn.
C Insulina.
11.

Os maiores xitos da enxeera xentica dronse na acuicultura. Os peixes son bo material para
este tipo de manipulacins. Que nome reciben os organismos manipulados xeneticamente?
Los mayores xitos de la ingeniera gentica se han dado en acuicultura. Los peces son buen material para
este tipo de manipulaciones. Qu nombre reciben los organismos manipulados genticamente?

A Conxugados.
Conjugados.

B Transxnicos.
Transgnicos.

C Hbridos.
12.

Antxeno unha substancia estraa que introducida nun organismo desencadea a resposta inmunitaria. Como se chaman as molculas liberadas no organismo ante a presenza de antxenos?
Antgeno es una sustancia extraa que se introduce en un organismo que desencadena una respuesta inmunitaria. Cmo se llaman las molculas liberadas en el organismo ante la presencia de antgenos?

A Anticorpo.
Anticuerpo.

B Vacina.
Vacuna.

C Soro.
Suero.
Pxina 5 de 7

Parte especfica
BIOLOXA

[CS.PE.C03]

13.

As clulas procariotas, igual que as eucariotas, presentan membrana plasmtica, citoplasma e


material xentico. Cal dos seguintes NON un compoente celular das clulas procariotas?
Las clulas procariotas al igual que las eucariotas, presentan membrana plasmtica, citoplasma y material
gentico. Cul de los siguientes NO es un componente celular de las clulas procariotas?

A Parede celular.
Pared celular.

B Ribosomas.
C Membrana nuclear.
14.

Unha clula cunha concentracin salina no seu medio interno de 5mM atpase nun medio cunha
concentracin salina de 7mM. Cal destes procesos se producir ao cabo de cinco minutos?
Una clula con una concentracin salina en su medio interno de 5 mM se encuentra en un medio con una
concentracin salina de 7 mM. Cul de estos procesos se producirn al pasar cinco minutos?

A Turxescencia.
Turgencia.

B Plasmlise.
Plasmlisis

C Foresia.
15.

Cal dos seguintes orgnulos NON presenta estrutura membranosa?


Cul de los siguientes orgnulos NO presenta estructura membranosa?

A Cloroplasto.
B Aparato de Golgi.
Aparello de Golgi.

C Centrosoma.
16.

Ao fillo nico (varn) dunha parella sen alteracin diagnosticuselle unha alteracin chamada daltonismo, que se debe a un alelo recesivo d localizado no cromosoma X. Cal dos seguintes xenotipos corresponde a seu pai?
Al hijo nico varn de una pareja sin alteracin se le ha diagnosticado una alteracin llamada daltonismo,
que se debe a un alelo recesivo d localizado en el cromosoma X. Cul de los siguientes genotipos corresponde a su padre?

A XD Y.
B Xd Y.
C XD Yd.

Pxina 6 de 7

Parte especfica
BIOLOXA

[CS.PE.C03]

17.

O anabolismo a va construtiva do metabolismo, dicir, a ruta de sntese de molculas complexas a partir de molculas sinxelas. Cal destes procesos pertence a un metabolismo auttrofo.
El anabolismo es la va constructiva del metabolismo, es decir, la ruta de sntesis de molculas complejas a
partir de molculas sencillas. Cul de estos procesos pertenece a un metabolismo auttrofo?

A Respiracin celular.
B Fermentacin.
C Fontosntese.
Fotosntesis.

18.

Ao dicirmos que algns polisacridos son molculas que almacenan enerxa queremos indicar
que o seu destino ser a sa degradacin para liberar a enerxa que conteen. Cal das seguintes
molculas ten esa funcin?
Cuando decimos que algunos polisacridos son molculas que almacenan energa queremos indicar que su
destino ser su degradacin para liberar la energa que contienen. Cul de las siguientes molculas tiene
esa funcin?

A Ribosa.
B Amidn.
Almidn.

C Quitina.
19.

Unha molcula que ten un extremo hidrfobo e outro hidrfilo denomnase:


Una molcula que tiene un extremo hidrfobo y otro hidrfilo se denomina:

A Anfiblica.
B Apolar.
C Anfiptica.
20.

Cal dos seguintes procesos ocorre no citoplasma da clula eucariota?


Cul de los siguientes procesos ocurre en el citoplasma de la clula eucariota?

A Replicacin do ADN.
Replicacin del ADN.

B Traducin
Traduccin

C Transcricin
Transcripcin.

Pxina 7 de 7

Probas de acceso a ciclos


formativos de grao superior

Proba de

Bioloxa

Cdigo

CSPEC03

Parte especfica
BIOLOXA

[CS.PE.C03]

1.

Formato da proba
Formato

A proba constar de 20 cuestins tipo test.


As cuestins tipo test teen tres posibles respostas das que soamente unha correcta.
Puntuacin

Puntuacin: 0,50 puntos por cuestin tipo test correctamente contestada.


Cada cuestin tipo test incorrecta restar 0,125 puntos.
As respostas en branco non descontarn puntuacin.
Duracin

Este exercicio ter unha duracin mxima de 60 minutos.

Pxina 2 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

2.

Exercicio
1.

O experimento de Meselson e Stahl consista en cultivar bacterias Escherichia coli nun medio
con N15 e N14. Os resultados foron definitivos para dilucidar a hiptese correcta sobre a replicacin do ADN. Cal das seguintes replicacins do ADN segua a bacteria Escherichia coli?
El experimento de Meselson y Stahl consista en cultivar bacterias Escherichia coli en un medio con N15
y N14. Los resultados fueron definitivos para dilucidar la hiptesis correcta sobre la replicacin del
ADN. Cul de las siguientes replicaciones del ADN segua la bacteria Escherichia coli?

A Semiconservativa.
B Conservativa.
C Dispersiva.
2.

Os virus son estruturas infecciosas organizadas, formadas por cido nucleico e protenas. Cal
dos seguintes elementos constite a sa cuberta protenica?
Los virus son estructuras infecciosas organizadas, formadas por cido nucleico y proteinas. Cul de
los siguientes elementos constituye su cubierta protenica?.

A Cpside.
Cpside.

B Parede celular.
Pared celular.

C Membrana celular.
Membrana celular.

3.

Margulis propuxo que unha clula procariota anaerobia de gran tamao fagocitou outras clulas procariotas que sobreviviron con ela e acabaron por constitur os orgnulos dunha clula
eucariota aerobia. Que nome recibe a teora proposta por Margulis?
Margulis propuso que una clula procariota anaerobia de gran tamao fagocit otras clulas procariotas que sobrevivieron con ella y acabaron por constitur los orgnulos de una celula eucariota aerobia.
Qu nombre recibe la teora propuesta por Margulis?

A Xeracin espontnea.
Generacin espontnea.

B Orixe da vida.
Origen de la vida.

C Endosimbiose.
Endosimbiosis.

Pxina 3 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

4.

A rbore da evolucin humana hoxe moi diferente do que se pensaba hai cincuenta anos.
probable que todas as especies do xnero Homo descendan dun tronco ancestral. En cal dos
seguintes continentes se atoparon os restos do primeiro Homo?
El rbol de la evolucin humana es hoy muy diferente de lo que se pensaba hace cincuenta aos. Es
probable que todas las especies del genero Homo desciendan de un tronco ancestral. En cul de los siguientes continentes se descubrieron los restos del primer Homo?.

A Europa.
B frica.
C Australia.
5.

Algns antibiticos bloquean as reaccins metablicas das bacterias, de xeito que estas deixan de medrar e de multiplicarse. Cal das seguintes substancias NON un antibitico?
Algunos antibiticos bloquean las reacciones metablicas de las bacterias, de forma que estas dejan de
crecer y de multiplicarse. Cul de las siguientes sustancias NO es un antibitico?

A Penicilina.
B Tetraciclina.
C Ptialina.
6.

A auga a substancia qumica mis abundante na materia viva, xa que constite a maior parte
do seu peso. Esta molcula a temperatura ambiente lquida anda que debera ser gas. Cal
dos seguintes enlaces responsable do estado lquido da auga?
El agua es la sustancia qumica ms abundante en la materia viva, ya que constituye la mayor parte de
su peso. Esta molcula a temperatura ambiente es lquida aunque debera ser gaseosa. Cul de los siguientes enlaces es responsable del estado lquido del agua?.

A Covalentes entre tomos.


B Inicos entre molculas.
C Pontes de hidrxeno entre molculas.
Puentes de hidrgeno entre molculas.

7.

Se a envoltura nuclear rompe, a cromatina condnsase, os cromosomas fanse visibles e nas


clulas animais divdese o centriolo desprazndose a cada polo celular. Cal das seguintes fases da mitose presenta estas caractersticas?
Si la envoltura nuclear se rompe, la cromatina se condensa, los cromosomas se hacen visibles y en las
clulas animales se divide el centriolo desplazndose a cada polo celular. Cul de las siguientes fases
de la mitosis presenta estas caractersticas?

A Anafase.
B Profase.
C Metafase.

Pxina 4 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

8.

Os beneficios de tomarmos vitaminas para evitarmos serias deficiencias estn ben estudados.
As, os principais sntomas do escorbuto por deficiencia dunha vitamina son o sangrado das
enxivas, a lenta cicatrizacin das feridas, fracturas e fatiga en xeral. Cal das seguintes vitaminas preveen esta doenza?
Los beneficios de tomar vitaminas para evitar serias deficiencias estn bien estudiados. As, los principales sntomas del escorbuto por deficiencia de una vitamina son el sangrado de las encas, la lenta cicatrizacin de las heridas, fracturas y fatiga en general. Cul de las siguientes vitaminas previenen esta enfermedad?

A Vitamina A.
B Vitamina C.
C Vitamina B.
9.

A neurona a unidade funcional e estrutural do sistema nervioso; esta clula presenta un corpo celular ou soma, un axn e dendritas, pero carece dun orgnulo que lle impide realizar
unha das funcins vitais. Cal dos seguintes orgnulos o responsable desa funcin?
La neurona es la unidad funcional y estructural del sistema nervioso; esta clula presenta cuerpo celular o soma, axon y dendritas, pero carece de un orgnulo que le impide realizar una de las funciones vitales. Cul de los siguientes orgnulos es el responsable de esa funcin?

A Ncleo.
B Mitocondria.
C Centriolo.
10.

Dous exemplos clsicos de herdanza ligada ao sexo son o daltonismo (incapacidade para distinguir a cor vermella e a verde) e a hemofilia A (alteracin da coagulacin do sangue). En cal
dos cromosomas se atopan os xenes responsables desta anomala?
Dos ejemplos clsicos de herencia ligada al sexo son el daltonismo (incapacidad para distinguir el color
rojo y el verde) y la hemofilia A (alteracin de la coagulacin de la sangre). En cul de los cromosomas se ecuentran los genes responsables de esta anomala?

A Cromosoma X.
B Cromosoma Y.
C Ambos.

Pxina 5 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

11.

A actividade catablica das clulas humanas xera produtos de refugo nitroxenados que deben
ser expulsados ao exterior a travs dalgunha estrutura. Cal das seguintes estruturas NON
utilizada para expulsar os refugos nitroxenados?
La actividad catablica de las clulas humanas genera productos de deshecho nitrogenados que deben
ser expulsados al exterior a travs de alguna estructura. Cul de las siguientes estructuras NO es utilizada para expulsar los deshechos nitrogenados?

A Aparello dixestivo.
Aparato digestivo.

B Pel.
Piel.

C Aparello excretor.
Aparato excretor.

12.

As mutacins son alteracins ao chou do material xentico e a primeira causa de variabilidade


das especies. Que nome reciben as mutacins que afectan a uns poucos nucletidos?
Las mutaciones son alteraciones al azar del material gentico y la primera causa de variabilidad de las
especies. Qu nombre reciben las mutaciones que afectan a unos pocos nucletidos?

A Cromosmicas.
Cromosmicas.

B Allicas.
Allicas.

C Xnicas.
Gnicas.

13.

A membrana plasmtica unha lmina delgada formada por unha dobre capa lpidica cun elevado nmero de protenas asociadas que lle permiten realizar determinadas funcins. Cal das
seguintes funcins NON propia da membrana plasmtica?
La membrana plasmtica es una lmina delgada formada por una doble capa lpidica con un elevado
nmero de protenas asociadas que le permiten realizar determinadas funciones. Cul de las siguientes
funciones No es propia de la membrana plasmtica.

A Estrutural.
Estructural.

B Reserva.
Reserva.

C Fagocitose.
Fagocitosis.

Pxina 6 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

14.

O catabolismo semellante nos organismos auttrofos e hetertrofos, e consiste en reaccins


qumicas que na sa maior parte son de oxidacin e reducin. Cal das seguintes molculas se
obteen a partir do proceso respiratorio aerobio?
El catabolismo es semejante en los organismos auttrofos y hetertrofos, y consiste en reacciones qumicas que en su mayor parte son de oxidacin y reduccin. Cul de las siguientes molculas se obtienen a partir del proceso respiratorio aerobio?

A CO2 e H2O
CO2 y H2O

B Materia orgnica e O2
Materia orgnica y O2

C ATP, CO2 e H2O


ATP, CO2 y H2O

15.

A obtencin de anticorpos polo neonato, a partir do leite materno, un exemplo de inmunidade


natural. Cal dos seguintes tipos de inmunidade presentan os neonatos?
La obtencin de anticuerpos por el recin nacido, a partir de la leche materna, es un ejemplo de inmunidad natural. Cul de los siguientes tipos de inmunidad presentan los recin nacidos?

A Antixnica.
Antignica.

B Pasiva.
Pasiva.

C Activa.
Activa

16.

O sarcoma de Rous e a SIDA son doenzas producidas por un virus. Cando o cido nucleico do
virus consegue penetrar na clula hospedadora inciase un proceso de retrotranscricin. Cal
o tipo de cido nucleico que produce estas patoloxas?
El sarcoma de Rous y el SIDA son enfermedades producidas por un virus. Cuando el cido nucleico del
virus consigue penetrar en la clula hospedadora se inicia un proceso de retrotranscripcin. Cul es el
tipo de cido nucleico que produce estas patologas?

A ADN.
B ARN monocatenario.
C ARN bicatenario.

Pxina 7 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

17.

Cando o sangue ve dificultada a circulacin polos vasos sanguneos prodcese un aumento da


presin. Cal das seguintes causas NON aumenta a presin arterial?
Cuando la sangre ve dificultada la circulacin por los vasos sanguneos se produce un aumento de la
presin. Cul de las siguientes causas NO aumenta la presin arterial?

A Exceso de colesterol.
B Exceso de sal.
C Levantarse bruscamente.
18.

Na actualidade os alimentos tranxnicos que se venden deben facer constar na etiqueta a sa


procedencia. Cal das seguintes afirmacins unha condicin que deben cumprir os organismos transxnicos?
En la actualidad los alimentos transgnicos que se venden deben hacer constar en la etiqueta su procedencia. Cul de las siguientes afirmaciones es una condicin que deben cumplir los organismos transgnicos?

A Obtido por clonacin.


Obtenido por clonacin.

B Obtido por clulas troncais.


Obtenido por clulas madre.

C Presenta xenes doutro ser vivo.


Presenta genes de otro ser vivo.

19.

A interpretacin da clave xentica, dicir, a relacin que hai entre a secuencia de nucletidos
e aminocidos, conseguiuse a partir dos descubimentos de varios cientficos. Cal destes cientficos NON traballou no cdigo xentico?
La interpretacin de la clave gentica, es decir, la relacin que hay entre la secuencia de nucletidos y
aminocidos, se consigue a partir de los descubrimientos de varios cientficos. Cul de estos cientficos
NO trabaj en el cdigo gentico?

A Krebs.
B Niremberg.
C Severo Ochoa.
20.

O xene a unidade hereditaria dos seres vivos; molecularmente unha secuencia de desoxirribonucletidos que contn informacin para a sntese dunha protena. Como se denominan
as variantes que pode presentar un xene?
El gen es la unidad hereditaria de los seres vivos, molecularmente es una secuencia de desoxirribonucletidos que contiene informacin para la sntesis de una protena. Cmo se denominan las variantes
que puede presentar un gen?

A Ismeros.
B Tripletes.
C Alelos.
Pxina 8 de 9

Probas de acceso a ciclos


formativos de grao superior

Proba de

Bioloxa

Cdigo

CSPEC03

Parte especfica
BIOLOXA

[CS.PE.C03]

1.

Formato da proba
Formato

A proba constar de 20 cuestins tipo test.


As cuestins tipo test teen tres posibles respostas, das que soamente unha correcta.
Puntuacin

0,50 puntos por cuestin tipo test correctamente contestada.


Cada cuestin tipo test incorrecta restar 0,125 puntos.
As respostas en branco non descontarn puntuacin.
Duracin

Este exercicio ter unha duracin mxima de 60 minutos.

Pxina 2 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

2.

Exercicio
1.

Os plsmidos, utilizados como vectores na clonacin de xenes, son molculas habitualmente


circulares de ADN presentes nun determinado organismo. Cal dos seguintes organismos leva
este tipo de molculas?
Los plsmidos, utilizados como vectores en la clonacin de genes, son molculas habitualmente circulares de ADN presentes en un determinado organismo. Cul de los siguientes organismos lleva este tipo
de molculas?

A Bacterias.
Bacterias.

B Fungos.
Hongos.

C Virus.
Virus.

2.

Mendel realizou a sa primeira experiencia cruzando razas puras para un mesmo carcter.
Con que nome se coece a primeira lei de Mendel?
Mendel realiz su primera experiencia cruzando razas puras para un mismo carcter. Con qu nombre
se conoce la primera lei de Mendel?

A Lei de segregacin independente.


Ley de segregacin independiente.

B Lei de uniformidade.
Ley de uniformidad.

C Lei de segregacin.
Ley de segregacin.

3.

O coecemento das clulas nai abriu as portas a novos tipos de terapias. Que nome reciben
as clulas nai capaces de orixinar un individuo completo?
El conocimiento de clulas madre abri las puertas a nuevos tipos de terapias. Qu nombre reciben las
clulas madre capaces de originar un individuo completo?

A Pluripotentes
B Totipotentes
C Multipotentes

Pxina 3 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

4.

As relacins interespecficas permiten que das especies se asocien. Con que nome se coece a relacin que se establece entre as bacterias da flora intestinal e o ser humano?
Las relaciones interespecficas permiten que dos especies se asocien. Con qu nombre se conoce la relacin que se establece entre las bacterias de la flora intestinal y el ser humano?

A Inquilinismo.
B Parasitismo.
C Simbiose.
Simbiosis.

5.

Os pigmentos fotosintticos son as molculas encargadas de absorber a enerxa luminosa no


proceso fotosinttico. Cal dos seguintes pigmentos dos vexetais terrestres e algas presenta a
cor laranxa?
Los pigmentos fotosintticos son las molculas encargadas de absorber la energa luminosa en el proceso fotosinttico. Cul de los siguientes pigmentos de los vegetales terrestres y algas presenta el color
naranja?

A Carotenoide.
B Ficobilina.
C Clorofila.
6.

A existencia dos rganos homlogos e dos anlogos unha proba da evolucin. Que nome
reciben os rganos que teen igual funcin pero distinta estrutura interna?
La existencia de los rganos homlogos y de los anlogos es una prueba de la evolucin. Qu nombre
reciben los rganos que tienen igual funcin pero distinta estructura interna?

A Homlogos.
B Bifuncionais.
Bifuncionales.

C Anlogos.
7.

A herdanza do sexo est determinada polos cromosomas sexuais X e Y. Con que outro nome
se coecen estes cromosomas?
La herencia del sexo est determinada por los cromosomas sexuales X e Y. Con qu otro nombre se conocen estos cromosomas?

A Autosomas.
B Heterocromosomas.
C Telocntricos.

Pxina 4 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

8.

A meiose un proceso no que unha clula 2n sofre divisins consecutivas para dar lugar a catro clulas fillas n. Na anafase I da meiose hai unha separacin realizada polos microtbulos.
Sabe que separan os microtbulos nesta fase?
La meiosis es un proceso en el que una clula 2n sufre divisiones consecutivas para dar lugar a cuatro
clulas hijas n. En la anafase I de la meiosis hay una separacin realizada por los microtbulos. Sabe
qu separan los microtbulos en esta fase?

A Cromosomas homlogos.
Cromosomas homlogos.

B Cromtidas irms.
Cromtidas hermanas.

C Cromosomas fillos.
Cromosomas hijos.

9.

Cal das seguintes molculas un compoente da membrana plasmtica animal?


Cul de las siguientes molculas es un componente de la membrana plasmtica animal?

A Sales de sodio.
B Aminocido serina.
C Colesterol.
10.

A capacidade de almacenamento enerxtico do ATP radica na sa natureza qumica. Cal das


seguintes molculas forma parte do ATP?
La capacidad de almacenamiento energtico del ATP radica en su naturaleza qumica. Cu de las siguientes molculas forma parte del ATP?

A Nuclesidos.
B Hormonas.
C Vitaminas.
11.

Singer e Nicholson propuxeron un modelo acerca da estrutura da membrana plasmtica no


que indican a disposicin das protenas, os lpidos e os hidratos de carbono. Que nome recibe
ese modelo?
Singer y Nicholson propusieron un modelo acerca de la estructura de la membrana plasmtica en el que
indican la disposicin de las protenas, los lpidos y los hidratos de carbono. Qu nombre recibe ese
modelo?

A Glucoclix.
B Van der Waals.
C Mosaico fludo.
Mosaico fluido.

Pxina 5 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

12.

Cal dos seguintes procesos representa unha modificacin do dogma central da bioloxa molecular?
Cul de los siguientes procesos representa una modificacin del dogma central de la biologa molecular?

A Transcricin.
Transcripcin.

B Transcricin inversa.
Transcripcin inversa.

C Traducin.
Traduccin.

13.

Se se dividira unha clula da pel dun home, cantos cromosomas tera cada clula filla?
Si se dividiera una clula de la piel de un hombre, cuntos cromosomas tendra cada clula hija?

A 46 cromosomas.
B 23 cromosomas.
C 44 cromosomas.
14.

O estudo das mutacins acumuladas no xenoma mitocondrial permite establecer a liaxe evolutiva da especie humana desde a sa sada de frica. Sabe que lle achegan as mutacins
evolucin das especies?
El estudio de las mutaciones acumuladas en el genoma mitocondrial permite establecer el linaje evolutivo de la especie humana desde su salida de frica. Sabe qu aportan las mutaciones a la evolucin de
las especies?

A Motilidade.
Motilidad.

B Translocacin.
Translocacin.

C Variabilidade.
Variabilidad.

15.

Nas doenzas autoinmunes, o sistema inmunitario non recoece os compoentes do propio organismo, polo que se desencadea unha resposta inmune contra eles. Cl das seguintes non
unha doenza autoinmune ?
En las enfermedades autoinmunes, el sistema inmunitario no reconoce los componentes del propio organismo, por lo que se desencadena una respuesta inmune contra ellos. Cul de las siguientes no es una
enfermedad autoinmune?

A Lupus erimatoso.
B Alzheimer.
C Psoriase.
Psoriasis.
Pxina 6 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

16.

A gliclise unha ruta catablica do metabolismo que se produce nas clulas. Sinale o lugar
onde se produce este proceso.
La glucolisis es una ruta catablica del metabolismo que se produce en las clulas. Seale el lugar en
donde se produce este proceso.

A Citosol.
B Mitocondrias.
C Ribosomas.
17.

A fabricacin de bebidas alcohlicas lvase a cabo grazas fermentacin alcohlica. Cal dos
seguintes organismos NON se encarga do devandito proceso?
La fabricacin de bebidas alcohlicas se lleva a cabo gracias a la fermentacin alcohlica. Cul de los
siguientes organismos NO se encarga de dicho proceso?

A Protozoo.
Protozoo.

B Fungo.
Hongo.

C Bacteria.
Bacteria.

18.

As funcins das protenas son especficas e permtenlles s clulas manteren a sa integridade, controlar e regular funcins, arranxar danos, etc. Cal das seguintes funcins a que desempean as histonas?
Las funciones de las protenas son especficas y permiten a las clulas mantener su integridad, controlar
y regular funciones, reparar daos, etc. Cul de las siguientes funciones es la que desempean las histonas?

A Defensiva.
Defensiva.

B Enerxtica.
Energtica.

C Estrutural.
Estructural.

Pxina 7 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

19.

Os prins son molculas infecciosas carentes de material xentico, causantes de varias doenzas neurodexenerativas nos animais e no ser humano. Que tipo de molculas son os prins?
Los priones son molculas infecciosas carentes de material gentico, causantes de varias enfermedades
neurodegenerativas en los animales y en el ser humano. Qu tipo de molculas son los priones?

A Glcidos.
Glcidos.

B Lpidos.
Lpidos.

C Prtidos.
Prtidos.

20.

O glicxeno un polisacrido propio dos animais. Cal dos seguintes rganos do corpo humano non acumula este polisacrido?
El glucgeno es un polisacrido propio de los animales. Cul de los siguientes rganos del cuerpo
humano no acumula este polisacrido?

A Fgado.
Hgado.

B Msculo.
Msculo.

C Ril.
Rin.

Pxina 8 de 9

Parte especfica
BIOLOXA

[CS.PE.C03]

1.

Formato da proba
Formato

A proba constar de 20 cuestins tipo test.


As cuestins tipo test teen tres posibles respostas, das que soamente unha correcta.
Puntuacin

Puntuacin: 0,50 puntos por cuestin tipo test correctamente contestada.


Cada cuestin tipo test incorrecta restar 0,125 puntos.
As respostas en branco non descontarn puntuacin.
Duracin

Este exercicio ter unha duracin mxima de 60 minutos.

Pxina 2 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

2.

Exercicio
1.

En cada ovario distnguese a codia, na parte externa, e a medula no interior. A codia presenta
unha serie de cavidades que conteen as clulas sexuais femininas en desenvolvemento. Cal dos
seguintes o nome que reciben estas cavidades?

En cada ovario se distinguen la corteza, en la parte externa, y la mdula en el interior. La


corteza presenta una serie de cavidades que contienen las clulas sexuales femeninas en
desarrollo. Cul de los siguientes es el nombre que reciben estas cavidades?

A Vescula xerminativa.
Vescula germinativa.

B Folculo de Graaf.
Folculo de Graaf.

C Illotes de Langerhans.
Islotes de Langerghans.

2.

Un sistema de conservacin de alimentos a salgadura. Desde a antigidade, aos alimentos engadaselles sal para os preservar do ataque de microorganismos que os puidesen alterar. Cal dos
seguintes procesos o causante da morte destes microorganismos rodeados de sal?

Un sistema de conservacin de alimentos es la salazn. Desde la antigedad, a los alimentos se les aada sal para preservarlos del ataque de microorganismos que pudiesen
alterarlos. Cal de los siguientes procesos es el causante de la muerte de estos microorganismos rodeados de sal?

A Plasmlise.
Plasmlisis.

B Turxescencia.
Turgencia.

C Liofilizacin.
Liofilizacin.

3.

Un exemplo tpico de doenza venrea a sfilis. A infeccin pdese transmitir a travs da mucosa
vaxinal e da uretra no contacto sexual, e a travs da placenta tamn pode pasar ao feto. Cal dos
seguintes organismos producen esta enfermidade?

Un ejemplo tpico de enfermedad venrea es la sfilis. La infeccin puede transmitirse a


travs de la mucosa vaginal y de la uretra en el contacto sexual, y a travs de la placenta
tambin puede pasar al feto. Cul de los siguientes organismos producen esta enfermedad?

A Virus
Pxina 3 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

B Bacterias
C Fungos
Hongos

Pxina 4 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

4.

Algns glcidos presentan poder redutor, xa que teen o grupo OH hemiacetlico libre, que lles
confire esa propiedade. Indique cal dos seguintes glcidos non presenta poder redutor.

Algunos glcidos presentan poder reductor, ya que tienen el grupo OH hemiacetlico libre, que les confiere esa propiedad. Indique cul de los siguientes glcidos no presenta
poder reductor.

A Glicosa.
Glucosa.

B Maltosa.
Maltosa.

C Sacarosa.
Sacarosa.

5.

Cal das seguintes vitaminas ten un papel importante no proceso visual dos bastns da retina cando hai pouca luz e, ademais, acta protexendo os tecidos epiteliais?

Cul de las siguientes vitaminas tiene un papel importante en el proceso visual de los
bastones de la retina cuando hay poca luz y, adems, acta protegiendo los tejidos epiteliales.

A Vitamina D.
B Vitamina E.
C Vitamina A.
6.

Un home con certa doenza ten oito fillos (catro fillos e catro fillas) cunha muller sa. Todas as nenas teen a doenza do pai, pero ningn neno presenta esa doenza. Cal dos seguintes tipos de
herdanza suxire estes datos.

Un hombre con cierta enfermedad tiene ocho hijos (cuatro hijos y cuatro hijas) con una
mujer sana. Todas las nias tienen la enfermedad del padre, pero ningn nio presenta
dicha enfermedad. Cul de los siguientes tipos de herencia sugiere estos datos?

A Autosmica dominante.
B Ligada a cromosoma Y.
C Dominante ligada a cromosoma X.
7.

No interior dos cloroplastos hai unha cavidade na que se atopa o ADN circular e os ribosomas.
Cal dos seguintes nomes corresponde ao dese espazo central dos cloroplastos?

En el interior de los cloroplastos hay una cavidad en la que se encuentra el ADN circular
y los ribosomas. Cul de los siguientes nombres corresponde al de ese espacio central de
los cloroplastos?

A Matriz.
B Estroma.
Pxina 5 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

C Soma.

Pxina 6 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

8.

Entndese por inmunidade o estado de resistencia que presenta un organismo fronte infeccin.
Con que outro nome se coece a inmunidade innata?

Se entiende por inmunidad el estado de resistencia que presenta un organismo frente a la


infeccin. Con qu otro nombre se conoce a la inmunidad innata?

A Conxnita.
Congnita.

B Orgnica.
Orgnica.

C Humoral.
Humoral.

9.

Cocese como ciclo celular o tempo que transcorre desde que unha clula se forma por divisin
dunha preexistente ata que se divide. Cal das seguintes fases non pertence ao ciclo celular?

Se conoce como ciclo celular el tiempo que transcurre desde que una clula se forma por
divisin de una preexistente hasta que se divide. Cul de las siguientes fases no pertenece al ciclo celular?

A Interfase.
Interfase.

B Mitose.
Mitosis.

C Maduracin.
Maduracin.

10.

Os retrovirus son virus que presentan o encima chamado transcriptasa inversa, o que constite a
principal caracterstica do seu ciclo vital. Cal dos seguintes cidos nucleicos forma o seu xenoma?

Los retrovirus son virus que presentan el enzima llamado transcriptasa inversa, lo que
constituye la principal caracterstica de su ciclo vital. Cul de los siguientes cidos nucleicos forma su genoma?

A ADN.
B ARN monocatenario
C ARN bicatenario.
11.

Os oligoelementos son elementos secundarios que estn en proporcin inferior 0,1 % pero son
imprescindibles para o funcionamento da materia viva. Cal dos seguintes un oligoelemento?

Los oligoelementos son elementos secundarios que se encuentran en proporcin inferior


al 0,1 % pero son imprescindibles para el funcionamiento de la materia viva. Cul de los
siguientes es un oligoelemento?
Pxina 7 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

A Fe
B C
C N

Pxina 8 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

12.

Normalmente, o sistema inmune quen de recoecer as propias clulas; en determinadas ocasins pode formar anticorpos contra os seus propios tecidos, o que favorece a destrucin das clulas non recoecidas como propias e produce doenzas autoinmunes. Cal das seguintes enfermidades NON est causada habitualmente por un proceso autoinmune?

Normalmente, el sistema inmune es capaz de reconocer a las propias clulas; en determinadas ocasiones puede formar anticuerpos contra sus propios tejidos, lo que favorece la
destruccin de las clulas no reconocidas como propias y produce enfermedades autoinmunes. Cul de las siguientes enfermedades NO est causada habitualmente por un proceso autoinmune?

A Artrite reumatoide.
Artritis reumatoide.

B Psoriase.
Psoriasis.

C Pancreatite aguda.
Pancreatitis aguda.

13.

As clulas somticas da maiora das plantas de trigo teen 42 cromosomas. Basendose nestes
feitos e nos seus coecementos sobre ciclos biolxicos, cantos cromosomas ten cada unha das
clulas do grao de pole do trigo?

Las clulas somticas de la mayora de las plantas de trigo tienen 42 cromosomas.


Basndose en estos hechos y en sus conocimientos sobre ciclos biolgicos, Cuntos cromosomas tiene cada una de las clulas del grano de polen del trigo?

A 21 cromosomas.
B 42 cromosomas.
C 84 cromosomas.
14.

Os rganos linfoides son centros onde se localizan e producen os linfocitos. Cal dos seguintes rganos produce linfocitos?

Los rganos linfoides son centros donde se localizan y producen los linfocitos. Cul de
los siguientes rganos produce linfocitos?

A Bazo.
Bazo.

B Fgado.
Hgado.

C Pncreas.
Pncreas.

Pxina 9 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

15.

O NADH e o NADPH son coencimas que interveen en reaccins de transferencia de electrns.


Fisioloxicamente diferncianse polo tipo de rutas metablicas sobre as que actan. En cal das
seguintes rutas acta o NADPH?

O NADH y el NADPH son coenzimas que intervienen en reacciones de transferencia de


electrones. Fisiolgicamente se diferencian por el tipo de rutas metablicas sobre las que
actan. En cul de las siguientes rutas acta el NADPH?

A Catablicas.
B Anablicas.
C Dixestivas.
Digestivas.

16.

A inxestin dun exceso de graxas animais pode aumentar os niveis de triglicridos e colesterol no
sangue, co conseguinte risco para a sade. Cal dos seguintes tipos de cidos graxos escollera
para incorporar a unha dieta sa?

La ingestin de un exceso de grasas animales puede aumentar los niveles de triglicridos


y colesterol en la sangre, con el consiguiente riesgo para la salud. Cul de los siguientes
tipos de cidos grasos escogera para incorporar a una dieta sana?

A Saturados.
B Insaturados.
C Inorgnicos.
17.

A fermentacin actica unha fermentacin oxidativa que require osxeno. Sinale cal das seguintes molculas se oxida a cido actico.

La fermentacin actica es una fermentacin oxidativa que requiere oxgeno. Seale cul
de las siguientes molculas se oxida a cido actico.

A Etanol.
B cido pirvico.
C cido lctico.
18.

O ADN eucaritico presenta xenes descontinuos que codifican protenas. Que nome reciben estes
xenes?

El ADN eucaritico presenta genes discontinuos que codifican protenas. Qu nombre


reciben estos genes?

A Exns.
Exones.

B Intrns.
Intrones.

C Alelos.
Alelos.
Pxina 10 de 12

Parte especfica
BIOLOXA

[CS.PE.C03]

19.

A hibridacin consiste na mestura de das molculas distintas de ADN. O grao de hibridacin do


ADN utilizado na obtencin de millns de copias dunha secuencia de ADN determinada. Que
nome recibe a tcnica que permite obter mltiples copias de fragmentos de ADN?

La hibridacin consiste en la mezcla de dos molculas diferentes de ADN. El grado de


hibridacin del ADN es utilizado en la obtencin de millones de copias de una secuencia
de ADN determinada. Qu nombre recibe la tcnica que permite obtener mltiples copias de fragmentos de ADN?

A PCR.
B ATG.
C ATP.
20.

Os glbulos vermellos son clulas sanguneas que teen forma de disco bicncavo, carentes de
ncleo e de mitocondrias nos mamferos excepto nos camlidos. Os glbulos vermellos teen vida limitada e deben ser substitudos periodicamente. Que nome recibe a formacin continuada
destas clulas ?

Los glbulos rojos son clulas sanguneas que tienen forma de disco bicncavo, que carecen de ncleo y de mitocondrias en los mamferos excepto en los camlidos. Los glbulos
rojos tienen vida limitada y deben ser reemplazados peridicamente. Qu nombre recibe
la formacin continuada de estas clulas?

A Eritropoiese.
Eritropoyesis.

B Homeostase.
Homeostasis.

C Leucopoiese.
Leucopoyesis.

Pxina 11 de 12

! "

#
(

$ $ %

&

'

*
-

+
,

' !

$ %

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 5 de junio (Resolucin n 1353, de 9 de abril de 2008, BOR del 24 y Correccin de
errores BOR de 17 de mayo)
OPCIN C (a elegir una):

Biologa
Qumica
DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _________________________________________________________
Nombre: __________________________________________________________
D.N.I.: _______________________
Instituto de Educacin Secundaria:______________________________________
INSTRUCCIONES GENERALES
La duracin del ejercicio es de dos horas: de las 16,30 a las 18,30 horas.
Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados antes de responder.
Realice primero aquellos ejercicios que tenga seguridad en su resolucin. Deje para el final aquellos que
tenga dudas.
Cuide la presentacin y escriba la solucin de forma ordenada.
Puede utilizar calculadora no programable.
Entregue esta hoja cuando finalice el ejercicio.
Al finalizar el ejercicio enumerar las hojas y firmar en la ltima.
FAMILIAS PROFESIONALES A LAS QUE DA ACCESO
Qumica
Actividades Fsicas y Deportivas
Actividades Martimo-Pesqueras (Ciclo Formativo de Grado Superior Produccin Acucola)
Actividades Agrarias
Industrias Alimentarias
Sanidad
Imagen Personal
Textil, Confeccin y Piel (Ciclo Formativo de Grado Superior Curtidos y Procesos de Ennoblecimiento
Textil)

CRITERIOS DE VALORACIN:
Todas las preguntas valen un punto.

1. Explica la caracterstica de la molcula de agua que la hace ser un buen disolvente de muchas
sustancias y seala las funciones que desempea en los seres vivos por el hecho de serlo.

2. Los radicales de dos aminocidos son: - CH3 y - CH2OH respectivamente. Escribe su estructura,
seala los grupos funcionales caractersticos y nelos para formar un dipptido explicando cmo se forma
el enlace entre ellos.

3. En la siguiente figura esquemtica del corazn:


a) Pon nombre a las partes sealadas.
b) Indica mediante flechas por donde entra y sale la sangre y el camino que sigue en su interior.
c) Define latido cardaco y describe lo que sucede en cada latido.

4. Pon el nombre de los orgnulos sealados en el dibujo. Seala qu tipo de clula es e indica la funcin
de los orgnulos que tienen nmero.
3
2

5. El daltonismo es una anomala visual que produce confusin de algunos colores. Genticamente es un
carcter ligado al sexo pues est determinado por un alelo recesivo de un gen situado en el cromosoma X.
En una familia el padre y el hijo varn son daltnicos, la madre y la hija tienen visin normal.
Quin transmiti la anomala visual al hijo, el padre o la madre? b) Puede la hija tener descendencia
daltnica? Razona las respuestas.
6. Entre los microorganismos encontramos virus y bacterias:
a. Cul es la diferencia entre ellos?
b. Define:
1. Ciclo ltico
2. Antgeno
3. Vacuna
7. Indica las diferencias existentes entre el ADN y el ARN tanto en estructura como en funcin.

8. Enumera las 5 clases de inmunoglobulinas humanas y describe brevemente sus funciones


principales.

9. Compara la espermatognesis con la ovognesis y seala las semejanzas y diferencias.


10. Explica cmo actan los enzimas.

! "

#
(

$ $ %

&

'

*
-

+
,

' !

$ %

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 4 de junio (Resolucin n 1261, de 13 de mazo de 2009, BOR de 8 de abril)
OPCIN C (a elegir una):

Biologa
Qumica
DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _________________________________________________________
Nombre: __________________________________________________________
D.N.I.: _______________________
Instituto de Educacin Secundaria:______________________________________
INSTRUCCIONES GENERALES
La duracin del ejercicio es de dos horas: de las 18,30 a las 20,30 horas.
Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados antes de responder.
Realice primero aquellos ejercicios que tenga seguridad en su resolucin. Deje para el final aquellos que
tenga dudas.
Cuide la presentacin y escriba la solucin de forma ordenada.
Puede utilizar calculadora no programable.
Entregue esta hoja cuando finalice el ejercicio.
Al finalizar el ejercicio enumerar las hojas y firmar en la ltima.
FAMILIAS PROFESIONALES A LAS QUE DA ACCESO
Qumica
Actividades Fsicas y Deportivas
Actividades Martimo-Pesqueras (Ciclo Formativo de Grado Superior Produccin Acucola)
Actividades Agrarias
Industrias Alimentarias
Sanidad
Imagen Personal
Textil, Confeccin y Piel (Ciclo Formativo de Grado Superior Curtidos y Procesos de Ennoblecimiento
Textil)

CRITERIOS DE VALORACIN:
Todas las preguntas valen un punto.

1) Compara la estructura y la funcin de estos dos orgnulos: mitocondria y cloroplasto.


- Identifica estos orgnulos en estas dos imgenes celulares.

2) Describe el proceso de traduccin del ARN a protena, as como la estructura y funcin de los
cidos nucleicos que intervienen.
3) Explica brevemente el mecanismo de accin de la inmunidad especfica sealando el papel de los
tipos celulares que intervienen.
4) Describe el transporte de molculas a travs de la membrana celular.
5) Resuelve el siguiente problema de gentica:
Un varn de ojos azules se casa con una mujer de ojos pardos. La madre de la mujer era de ojos
azules, el padre de ojos pardos y tena un hermano de ojos azules. Razonar como ser el genotipo de
todos los individuos citados y que tipos de hijos tendr ese matrimonio, sabiendo que el color pardo de
ojos domina sobre el azul.
6) Describe el ciclo de replicacin de un retrovirus.
7) Describe la doble circulacin del aparato circulatorio humano y su funcin principal.
8) Clasifica las bacterias en funcin de su morfologa y modo de agrupacin.
9) Define el concepto de osmosis.

-. Es necesario mantener una concentracin salina dentro de la clula


igual que la del medio
exterior?. Razona la respuesta.
-. En qu tipo de medio salino se encuentran las clulas de las imgenes a), b) y c)?.
a)

b)

c)

10) Ordena y nombra estas imgenes celulares en fase de mitosis. Describe brevemente cada fase.
a)

b)

d)

e)

c)

! "

#
(

$ $ %

&

'

*
-

+
,

' !

$ %

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 3 de junio (Resolucin n 1142, de 10 de marzo de 2010, BOR de 22 marzo)
OPCIN C (a elegir una):

Biologa
Qumica
DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _________________________________________________________
Nombre: __________________________________________________________
D.N.I.: _______________________
Instituto de Educacin Secundaria:______________________________________
INSTRUCCIONES GENERALES
La duracin del ejercicio es de dos horas: de las 18,30 a las 20,30 horas.
Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados antes de responder.
Realice primero aquellos ejercicios que tenga seguridad en su resolucin. Deje para el final aquellos que
tenga dudas.
Cuide la presentacin y escriba la solucin de forma ordenada.
Puede utilizar calculadora no programable.
Entregue esta hoja cuando finalice el ejercicio.
Al finalizar el ejercicio enumerar las hojas y firmar en la ltima.
FAMILIAS PROFESIONALES A LAS QUE DA ACCESO
Qumica
Industrias Extractivas
Actividades Fsicas y Deportivas
Martimo-Pesquera (Ciclo Formativo de Grado Superior Produccin Acucola)
Agraria
Industrias Alimentarias
Sanidad
Imagen Personal
Textil, Confeccin y Piel (Ciclo Formativo de Grado Superior Curtidos y Procesos de Ennoblecimiento
Textil)
CRITERIOS DE VALORACIN:
Todas las preguntas valen un punto.

1- La frmula cclica de la glucosa es la siguiente:


a) Construye la molcula correspondiente uniendo dos glucosas
b) Explica como se produce el enlace y que molcula se forma

a)

2- Define los siguientes fenmenos que se pueden producir en un medio acuoso:


-

Adsorcin
Difusin
dilisis
smosis

3- Responde a las siguientes preguntas referidas a la clula del dibujo


a) Clasifica la siguiente clula en eucariota o procariota y en animal o vegetal y razona t respuesta
b) Indica los nombres de las partes sealadas
c) Nombra la funcin que tienen los componentes 3 y 5
1

7
6

3
4

4- Qu representa el siguiente esquema? Explica lo que sepas.

5- Compara la mitosis con la meiosis estableciendo las diferencias que existen entre ambos procesos de
divisin celular
6- Explica los siguientes conceptos del ADN:
a) Funcin del ADN
b) Componentes de una cadena de ADN
c) La estructura de doble hlice
d) Cmo se codifica la informacin gentica
7- Qu diferencia existe entre reacciones anablicas y catablicas, define algunos procesos de ambos tipos.
8- Sabemos que la hemofilia es una enfermedad ligada al sexo, entonces:
a) Explica por qu la hemofilia se expresa en los hombres y slo puede haber mujeres portadoras
b) Cules sern las proporciones genotpicas y fenotpicas que podramos esperar de la
descendencia de una mujer normal, cuyo padre era hemoflico y cuyo marido es normal?
9- Explica el ciclo de reproduccin del VIH, relacionndolo con las fases del ciclo lisognico y ltico de un
virus:
10- Qu diferencia existe entre estas dos inmunopatologas, pon un ejemplo de cada una de ellas:
Autoinmunidad
Inmunodeficiencia

Marqus de Murrieta,76 ala oeste


26071 Logroo
Telfono: 941.291 660
Fax: 941 291 679

www.larioja.org

Gobierno
de La Rioja

Educacin, Cultura y
Turismo

Educacin

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 5 de junio (Resolucin n 487, de 5 de marzo de 2012, BOR de 16 marzo)
OPCIN C :

Biologa
DATOS DEL ASPIRANTE

CALIFICACIN

Apellidos: _________________________________________________________
Nombre: __________________________________________________________
D.N.I.: _______________________
Instituto de Educacin Secundaria:______________________________________
INSTRUCCIONES GENERALES
La duracin del ejercicio es de dos horas: de las 18,30 a las 20,30 horas.

Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.


Lea detenidamente los enunciados antes de responder.
Realice primero aquellos ejercicios que tenga seguridad en su resolucin. Deje para el final aquellos que
tenga dudas.
Cuide la presentacin y escriba la solucin de forma ordenada.
Puede utilizar calculadora no programable.
Entregue esta hoja cuando finalice el ejercicio.
Al finalizar el ejercicio enumerar las hojas y firmar en la ltima.

FAMILIAS PROFESIONALES A LAS QUE DA ACCESO


Qumica
Industrias Extractivas
Actividades Fsicas y Deportivas
Martimo-Pesquera (Ciclo Formativo de Grado Superior Produccin Acucola)
Agraria
Industrias Alimentaras
Sanidad
Imagen Personal
Textil, Confeccin y Piel (Ciclo Formativo de Grado Superior Curtidos y Procesos de Ennoblecimiento
Textil)
Seguridad y Medio Ambiente

CRITERIOS DE CALIFICACIN:
La prueba consta de dos partes:
Parte 1:
Consta de 30 preguntas tipo-test que suponen 3 puntos del total.
Cada pregunta acertada del test se punta con 0,1 puntos.
Cada respuesta sin contestar se punta con 0 puntos.
Cada respuesta negativa se penaliza con -0,05 puntos, es decir, cada dos respuestas negativas
se punta con -0,1 puntos.

www.larioja.org

Gobierno
de La Rioja
Parte 2:
Consta de 7 cuestiones valoradas con 1 punto cada una.
La puntuacin total de esta parte es de 7 puntos.
Parte 1:
1- Subraya la respuesta correcta de estas 30 preguntas de test:
1- El agua al ionizarse produce:
a) Iones H3O+ y OH-.
b) Iones H3O- y OH+.
c) Iones H3O+ y OH+.
d) Iones H3O- y OH-.
2- Una de estas propiedades del agua no es correcta:
a) Elevado calor de vaporizacin.
b) Elevado punto de fusin.
c) Bajo calor especfico.
d) Elevado punto de ebullicin.
3- Una de estas sustancias es un monosacrido:
a) La glucosa.
b) La celulosa.
c) El almidn.
d) La sacarosa.
4- El hemiacetal intramolecular en las aldopentosas se forma:
a) Entre el carbono 1 y el 5.
b) Entre el carbono 1 y el 4.
c) Entre el carbono 2 y el 5.
d) Entre el carbono 2 y el 4.
5- La esterificacin del glicerol con cidos grasos produce:
a)
Lpidos complejos.
b)
Glicerolpidos.
c)
Acilglicridos.
d)
Aminocidos.
6- Las ceras son lpidos
a)
Saponificables.
b)
No saponificables.
c)
Ninguna de las tres respuestas.
d)
Fosfolpidos.
7-Los terpenos son lpidos:
a) Formados por isoprenos.
b) Formados por esteranos.
c) Formados por dos glicerinas y un cido graso.
a) Formados por cidos grasos.

www.larioja.org

Gobierno
de La Rioja
8- Un enzima cuando cataliza:
a) Rebaja la energa de activacin y aumenta la velocidad de la reaccin.
b) Aumenta la energa de activacin y aumenta la velocidad de la reaccin.
c) Rebaja la energa de activacin y rebaja la velocidad de la reaccin.
d) Aumenta la energa de activacin y rebaja la velocidad de la reaccin.
9- El ADN se diferencia del ARN.
a) En que en el ADN no hay timina.
b) En que en el ADN no hay uracilo.
c) En que en el ADN no hay citosina.
d) Ninguna de las anteriores respuestas es correcta.
10- Un codn esta formado por:
a) Por un triplete de bases.
b) Por un nucletido.
c) Por un nuclesido.
d) Por aminocidos.
11-Los organismos hetertrofos animales obtienen:
a) La energa de la luz y los materiales de las sustancias orgnicas.
b) La energa de la luz y los materiales de las sustancias inorgnicas.
c) La energa y los materiales de las sustancias orgnicas.
d) La energa y los materiales de las sustancias inorgnicas.
12-Slo una de las ecuaciones globales de la respiracin celular es la correcta:
a) 6CO2 + 6H2O = C6H12O6 + 6O2
b) C6H12O6 + 6H2O = 6CO2 + 6O2
c) C6H12O6 + 6O2 = 6CO2 + 6H2O
d) 6CO2 + 6O2 = C6H12O6 + 6H2O
13-El objetivo de la fotosntesis es:
a) La respiracin de la planta.
b) La obtencin de oxgeno.
c) La obtencin de agua.
d) La fabricacin de compuestos orgnicos a partir de compuestos inorgnicos.
14- En la fotosntesis, para obtener 1 mol de glucosa:
a) Se necesitan 6 molculas de C02 y 28 ATP.
b) Se necesitan 6 molculas de C02 y 8 ATP.
c) Se necesitan 6 molculas de C02 y 18 ATP.
d) Se necesitan 8 molculas de C02 y 18 ATP.
15-Indica qu orgnulo est relacionado con la sntesis de protenas:
a) Ribosomas.
b) Lisosomas.
c) Retculo endoplasmtico liso.
d) Aparato de Golgi.

www.larioja.org

Gobierno
de La Rioja
16-.En la escena de un crimen se encuentra entre
las uas de la vctima unos pocos pelos. A los dos
das se detiene a un sospechoso de haber
cometido dicho crimen. Se realiza por orden del
juez, la prueba del ADN que se muestra? Es el
sospechoso autor del crimen de que le acusan?
a) No
b) Si

17-Si el transporte de sustancias entre la clula y el exterior se realiza a favor del gradiente
de concentracin por simple difusin de las sustancias diremos que se trata de:
a) Un transporte pasivo.
b) Un transporte pasivo facilitado.
c) Un transporte activo.
d) No se puede realizar un transporte a favor del gradiente de concentracin.
18-.Slo una de estas sustancias se obtiene en la glucolisis como producto final:
a) Glucosa.
b) Oxgeno.
c) Dixido de carbono.
d) Pirvico.
19- El intercambio de informacin gentica entre dos bacterias, mediadas por un virus del
grupo de los fagos se denomina:
a) Transformacin.
b) Conjugacin.
c) Transduccin.
d) Recombinacin.
20- Si ests trabajando en un laboratorio clnico, realizas la prueba de Gram y observas
clulas esfricas color azul. Se trata de:
a) Cocos Gram+
b) Cocos Gram
c) Bacilos Gram+
d) Vibrios Gram-

www.larioja.org

Gobierno
de La Rioja
21- Se cruzan plantas homocigticas de flores naranjas con plantas de flores blancas ambas
homocigticas. Sucede que todos los descendientes presentan flores naranjas. Por eso, se
puede decir que:
a) En el carcter "color de la flor" el naranja es dominante y el blanco, recesivo.
b) El blanco es dominante y el naranja, recesivo.
c) Los dos son dominantes.
d) Esto no es posible.
22- Cul de los siguientes grupos de microrganismos pertenecen al grupo de
arqueobacterias?
a) Enterobacterias.
b) Virus del SIDA.
c) Levaduras.
d) Bacterias metanognicas.
23- De las siguientes clulas sanguneas, indica cules son de la lnea mieloide.
a) Eosinfilos.
b) Celulas NK
c) Linfocitos T citotxicos.
d) Linfocitos T supresores.
24-La biotecnologa:
a) Es la utilizacin de microrganismos en procesos de inters industrial.
b) Es la utilizacin de microrganismos para la recuperacin de ambientes contaminados.
c) Es la utilizacin de microrganismos para la produccin de antibiticos.
d) Es la capacidad de los microrganismos de producir inmunidad.
25- El objetivo de la fase lumnica de la fotosntesis es obtener:
a) NADPH y ATP.
b) Oxgeno.
c) H2O.
d) CO2.
26- En la duplicacin del ADN intervienen enzimas como:
a) Helicasas, topoisomerasas, ADNpolimerasas.
b) Oxido-reductasas.
c) Transferrasas.
d) Deshidrogenasas.
27- Indica cul de estas enfermedades est producida por protozoo:
a) Insuficiencia coronaria.
b) SIDA.
c) Salmonelosis.
d) Malaria.
28- El comportamiento anftero de los aminocidos se refiere a que:
a)
El pH que exista en una disolucin acuosa determina su ionizacin.
b)
El pH que exista en una disolucin acuosa determina su actividad ptica.
c)
El pH impide que se solubilicen en una disolucin acuosa.
d)
La temperatura determina su ionizacin.

www.larioja.org

Gobierno
de La Rioja
29- La hebra retardada, en la duplicacin de ADN, utiliza:
a) Fragmentos de Crik.
b) Fragmentos de Okazaki.
c) Fragmentos de Watson.
d) Fragmentos de Frankil.
30- El enlace peptdico es un tipo de enlace:
a) Inico.
b) Metlico.
c) Covalente.
d) Puentes de hidrgeno.

Parte 2:
1- Defina mutacin gnica. Tipos de mutaciones gnicas. (Puntuacin: 1 punto).

www.larioja.org

Gobierno
de La Rioja
2- Si un hombre de grupo sanguneo AB se casa con una mujer de grupo A, cuyo padre
era de grupo 0. ? Qu grupos sanguneos se puede esperar entre sus hijos y con
qu frecuencia? (Puntuacin: 1 punto).

3- Caractersticas de los nucletidos. (Puntuacin: 1 punto).

4- Defina qu son organismos aerobios y anaerobios. En qu orgnulo celular se


desarrolla el metabolismo aerobio? Dibuje dicho orgnulo y seale sus estructuras
principales. (Puntuacin: 1 punto).

www.larioja.org

Gobierno
de La Rioja

5- Diferencias de transcripcin entre procariotas y eucariotas. (Puntuacin: 1 punto).

6- Funciones de los lpidos. (Puntuacin: 1 punto).

www.larioja.org

Gobierno
de La Rioja

7- Qu es un anticuerpo? Dibuje y explique la estructura de un anticuerpo. (Puntuacin:


1 punto).

Marqus de Murrieta,76 ala oeste


26071 Logroo
Telfono: 941.291 660
Fax: 941 291 679

www.larioja.org

Gobierno
de La Rioja

Educacin, Cultura y
Turismo

Educacin

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Convocatoria de 5 de junio (Resolucin n 324, de 13 de febrero de 2013, BOR de 22 de febrero)

OPCIN C :
DATOS DEL ASPIRANTE

Biologa
CALIFICACIN

Apellidos: _________________________________________________________
Nombre: __________________________________________________________
D.N.I.: _______________________
Instituto de Educacin Secundaria:______________________________________
INSTRUCCIONES GENERALES
Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los enunciados antes de responder.
Realice primero aquellos ejercicios que tenga seguridad en su resolucin. Deje para el final aquellos que
tenga dudas.
Cuide la presentacin y escriba la solucin de forma ordenada.
Puede utilizar calculadora no programable.
Entregue esta hoja cuando finalice el ejercicio.
Al finalizar el ejercicio enumerar las hojas y firmar en la ltima.
Realizacin:
La duracin del ejercicio es de dos horas: 18,30 a las 20,30 horas.
FAMILIAS PROFESIONALES A LAS QUE DA ACCESO
Qumica
Industrias Extractivas
Actividades Fsicas y Deportivas
Martimo-Pesquera (Ciclo Formativo de Grado Superior: Produccin Acucola)
Agraria
Industrias Alimentaras
Sanidad
Imagen Personal
Textil, Confeccin y Piel (Ciclo Formativo de Grado Superior: Curtidos y Procesos de Ennoblecimiento
Textil)
Seguridad y Medio Ambiente
Criterios de calificacin:
La prueba consta de 10 preguntas cada una valorada con 1 punto.
Las dos primeras constan a su vez de 10 cuestiones tipo test. En cada una solo se puede marcar una
opcin. Cada respuesta correcta del test se punta con 0.1 puntos. Cada dos respuestas incorrectas se
penalizan con -0.1. Las respuestas en blanco o con ms de una opcin marcada se puntuarn con 0 puntos.
Las 8 preguntas restantes son de respuesta abierta, y se valoran con 1 punto cada una. En las que tienen
varios apartados, cada uno de ellos se puntuar de manera proporcional.

www.larioja.org

Gobierno
de La Rioja
Pregunta 1:
1. Una de estas sustancias es un polisacrido con funcin estructural en los vegetales:
a. glucgeno
b. quitina
c. celulosa
d. almidn
2. Los enlaces que unen unas molculas de agua con otras se llaman:
a. covalentes
b. dipolares
c. hidroflicos
d. puentes de hidrgeno
3. La saponificacin es la capacidad de formar:
a. ster
b. alcohol
c. jabn
d. ceras
4. Una de estas caractersticas no es propia de las enzimas:
a. presentan un peso molecular muy elevado
b. son muy especficas
c. aumentan la energa de activacin
d. no se consumen en la reaccin
5. La miosina es una protena con funcin:
a. Contrctil
b. Funcional
c. Estructural
d. Hormonal
6. El ADN se diferencia del ARN en que:
a. la relacin C/G=1
b. la cantidad de U es igual a la cantidad de T
c. su peso molecular es menor
d. la cantidad de G es igual a la cantidad de A
7. Indica qu orgnulo est relacionado con la sntesis de ATP:
a. aparato de Golgi
b. ribosomas
c. mitocondria
d. retculo endoplasmtico liso
8. El objetivo de la fotosntesis es:
a. la produccin de oxgeno
b. el intercambio de gases con la atmsfera
c. la elaboracin de compuestos orgnicos
d. la absorcin de dixido de carbono

www.larioja.org

Gobierno
de La Rioja
9. Los conductos que atraviesan la pared celular de las clulas vegetales se denominan:
a. Diplosomas
b. Peroxisomas
c. Plasmodesmos
d. La pared celular no tiene conductos porque es impermeable
10. La estructura primaria de las protenas viene dada por:
a. la secuencia de los aminocidos
b. el orden de las bases nitrogenadas
c. las hlices alfa o beta
d. la posicin de los puentes disulfuro
Pregunta 2:
1. El cdigo gentico:
a. es tpico de cada especie
b. est formado por los anticodones del transferente
c. est formado por tripletes de aminocidos
d. es universal
2. Las hormonas proteicas:
a. no penetran en el medio interno del rgano diana
b. tienen un peso molecular bajo
c. son exclusivas de animales
d. se difunden en el citoplasma de las clulas diana
3. Cul de los siguientes grupos de microorganismos tiene ncleo y plastos?
a. enterobacterias
b. cianobacterias
c. levaduras
d. diatomeas
4. La biorremediacin es la utilizacin de microorganismos:
a. en procesos industriales
b. para tratar algunas enfermedades
c. para producir vacunas
d. para recuperar ambientes contaminados
5. Una pareja de grupo sanguneo 0 y AB:
a. pueden tener un 50% de sus hijos del grupo A y otro 50% del grupo B
b. pueden tener un 50% de sus hijos del grupo 0 y otro 50% del grupo AB
c. todos sus hijos sern AB porque A y B dominan sobre 0
d. tendrn hijos del grupo A, grupo B y grupo 0

www.larioja.org

Gobierno
de La Rioja
6. El enlace que une los aminocidos para formar una protena se llama:
a. ster
b. proteico
c. peptdico
d. amino-carboxlico
7. Una de las siguientes funciones no corresponde a los lpidos:
a. estructural
b. transportadora
c. energtica
d. hidratante
8. Las molculas de ADN extracromosmico circular bacteriano son los:
a. plsmidos
b. viriones
c. histonas
d. anillos de conjugacin
9. Entre los siguientes orgnulos celulares hay uno que no tiene doble membrana:
a. ncleo
b. retculo endoplasmtico
c. cloroplasto
d. mitocondria
10. Uno de los siguientes productos no se obtiene durante un proceso de fermentacin:
a. Etanol
b. cido esterico
c. cido actico
d. glucosa
Pregunta 3:
Cite los tipos de lpidos segn su estructura molecular y explique brevemente las diferencias entre
ellos.
Pregunta 4:
Defina los siguientes conceptos:
a) cromatina
b) cromtida
c) centrmero
d) cromosoma
Pregunta 5:
Qu funcin desempean en la fotosntesis?
a) la ATP sintetasa
b) las cadenas de transporte electrnico
c) un fotosistema
d) la enzima rubisco

www.larioja.org

Gobierno
de La Rioja
Pregunta 6:
Explique en qu consisten los mecanismos de transcripcin y traduccin celular.
Pregunta 7:
Defina y diferencie los siguientes conceptos:
a) anabolismo y catabolismo
b) anabolismo auttrofo y anabolismo hetertrofo
Pregunta 8:
Compare los procesos de mitosis y meiosis en relacin con:
a) los tipos de clulas implicadas
b) anafase y anafase I
c) resultado de ambos procesos
Pregunta 9:
Dado el siguiente cruzamiento AaBb x aabb
a) Qu genotipos y en qu proporciones se esperara encontrar en la F1?
b) Explique en qu consiste el cruzamiento prueba y qu utilidad tiene
Pregunta 10:
Los cambios inducidos por mutaciones pueden ser de diferentes tipos.
a) qu diferencia hay entre las mutaciones cromosmicas y las mutaciones genmicas?
b) qu mutacin aparece asociada al sndrome de Down?
c) hubiera sido mejor que el ADN fuera totalmente inmutable? por qu?
d) existe alguna diferencia entre las consecuencias de las mutaciones que se producen
en clulas somticas y en clulas germinales?

Subdireccin General
de Formacin Profesional
CONSEJERA DE EDUCACIN

Comunidad de Madrid

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Orden 102/2007 de 15 de enero de 2007, de la Consejera de Educacin (B.O.C.M. 08.02.2007)

INSTITUTO DE EDUCACIN SECUNDARIA

Fecha

DATOS DEL ASPIRANTE

CALIFICACIN

APELLIDOS:
NOMBRE:

D.N.I.:

PARTE ESPECFICA
Opcin 18: Sanidad

Materia: Biologa
INSTRUCCIONES

La duracin mxima del ejercicio ser de dos horas.

Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.

Entregue esta hoja al finalizar el ejercicio.

Lea detenidamente los textos, cuestiones o enunciados. Realice primero aquellas


cuestiones que tenga seguridad en su resolucin.

Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada.

Una vez acabado el ejercicio, revselo meticulosamente antes de entregarle.


CRITERIOS DE CALIFICACIN

La valoracin total es de 10 puntos.

Se indica a continuacin la puntuacin de cada una de las cuestiones que componen


el ejercicio:

1 cuestin: 2 puntos.
2 cuestin: 1,5 puntos.
3 cuestin: 3 puntos.
4 cuestin: 3,5 puntos.

Subdireccin General
de Formacin Profesional
CONSEJERA DE EDUCACIN

Comunidad de Madrid
Instituto de Educacin Secundaria

Fecha

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:

D.N.I.:

CUESTIONES
1. Con relacin a las enzimas, conteste a las siguientes cuestiones:
Naturaleza bioqumica
Funcin principal
Cite tres clases o grupos de enzimas
Ponga cinco ejemplos de enzimas
Concepto y ejemplo de coenzima

2. Complete las siguientes cuestiones indicando, en su caso, el nombre de los


orgnulos celulares:
La estructura que controla selectivamente el intercambio de sustancias con el
medio es..
Ense producen las oxidaciones respiratorias que
dan lugar a la sntesis de ATP
..contienen enzimas que intervienen en la
digestin intracelular de macromolculas
En..se desarrolla la replicacin del ADN
Los centriolos intervienen fundamentalmente en

3. Conteste a las siguientes cuestiones que hacen referencia a los microorganismos :


Conceptos de virulencia, infeccin y enfermedad infecciosa
Concepto y clasificacin de toxinas bacterianas
Factores de los que depende la virulencia
Definicin de reacciones de hipersensibilidad

4. Con relacin al sistema nervioso :


Indique el nombre de las estructuras que se sealan en el dibujo

Subdireccin General
de Formacin Profesional
CONSEJERA DE EDUCACIN

Comunidad de Madrid
Instituto de Educacin Secundaria

Fecha

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:

D.N.I.:

Dibuje de forma sencilla una sinapsis, defnala, indique su funcin y las


estructuras que la componen
Explique la principal diferencia entre :
- Sistema nervioso autnomo y somtico
- Sistema nervioso central y perifrico

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Orden 4879/2008 de 21 de octubre de 2008, de la Consejera de Educacin (B.O.C.M. 10.11.2008)

CONVOCATORIA DE JUNIO DE 2009

Fecha:
2 de Junio de 2009
de 16,00H a 17,30H

INSTITUTO DE EDUCACIN SECUNDARIA


________________________________________________________

DATOS DEL ASPIRANTE

CALIFICACIN
De 0 a 10
(Sin Decimales)

APELLIDOS: .
NOMBRE: . N documento de identificacin

PARTE ESPECFICA OPCIN CIENCIAS: BIOLOGA


INSTRUCCIONES

Entregue esta hoja al finalizar esta parte de la prueba de acceso.

Mantenga su documento de identificacin en lugar visible durante la realizacin del


ejercicio (D. N. I. ; Pasaporte;
)

La duracin mxima del ejercicio ser de UNA HORA Y MEDIA (1 hora y 30


minutos).

Lea detenidamente los textos, cuestiones o enunciados. Realice primero aquellas


cuestiones que tenga seguridad en su resolucin.

Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada y con


grafa clara.

Una vez acabado el ejercicio, revselo meticulosamente antes de entregarlo.


CRITERIOS DE CALIFICACIN

La valoracin es entre 0 y 10 sin decimales.

Se indica a continuacin la puntuacin de cada una de las cuestiones que constituyen


esta parte de la prueba:

Cuestin 1: Total 2,5 puntos: Cada apartado 1,25 puntos


Cuestin 2: Total 1,5 puntos: Cada respuesta 0,30 puntos
Cuestin 3: Total 2 puntos (Apartado a) 1 punto; los otros dos b) y c) 0,5
cada uno)
Cuestin 4: Total 2 puntos
Cuestin 5: Total 2 puntos (0,4 puntos cada concepto)

1
DEFINITIVO: 08/12/2009
Opcin CIENCIAS: Ejercicio de BIOLOGA / 2 de Junio de 16,00 a 17,30

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid
PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE
GRADO SUPERIOR

CONVOCATORIA DE JUNIO DE 2009

Fecha:
2 de Junio de 2009
de 16,00H a 17,30H

INSTITUTO DE EDUCACIN SECUNDARIA


______________________________________________________

DATOS DEL ASPIRANTE


APELLIDOS: ..
NOMBRE: N de documento de identificacin: .

CUESTIONES de la Parte Especfica de la OPCIN DE CIENCIAS: BIOLOGA

1.- En relacin con la divisin celular:


a) Conteste a las siguientes cuestiones:
Concepto de mitosis
Objetivo de la mitosis
b) Ayudndose del siguiente esquema identifique y explique cada una de las fases de la
divisin celular

Nucleolo
INTERFASE

Cromatina
Membrana
nulear

2
DEFINITIVO: 08/12/2009
Opcin CIENCIAS: Ejercicio de BIOLOGA / 2 de Junio de 16,00 a 17,30

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid
PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE
GRADO SUPERIOR

CONVOCATORIA DE JUNIO DE 2009

Fecha:
2 de Junio de 2009
de 16,00H a 17,30H

INSTITUTO DE EDUCACIN SECUNDARIA


______________________________________________________

DATOS DEL ASPIRANTE


APELLIDOS: ..
NOMBRE: N de documento de identificacin: .

CUESTIONES de la Parte Especfica de la OPCIN DE CIENCIAS: BIOLOGA

2.- En relacin

con el aparato circulatorio:


Seale en el dibujo que se indica a continuacin, las siguientes estructuras:
Cayado de la aorta
Cava superior
Vlvula pulmonar
Aurcula derecha
Ventrculo izquierdo

3
DEFINITIVO: 08/12/2009
Opcin CIENCIAS: Ejercicio de BIOLOGA / 2 de Junio de 16,00 a 17,30

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid
PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE
GRADO SUPERIOR

CONVOCATORIA DE JUNIO DE 2009

Fecha:
2 de Junio de 2009
de 16,00H a 17,30H

INSTITUTO DE EDUCACIN SECUNDARIA


______________________________________________________

DATOS DEL ASPIRANTE


APELLIDOS: ..
NOMBRE: N de documento de identificacin: .

CUESTIONES de la Parte Especfica de la OPCIN DE CIENCIAS: BIOLOGA

3).- En relacin con los componentes de la sangre, responda a las siguientes cuestiones:
a) Concepto de plasma, composicin y funcin
b) Diferencia entre plasma y suero:
c) Glbulos blancos: clasificacin y funciones

4).- Los grupos sanguneos en la especie humana estn determinados por tres genes alelos:
IA determina el grupo A
IB determina el grupo B
i determina el grupo O
Los genes IA y IB son codominantes y ambos son dominantes respecto al gen i que es
recesivo.
Razone cmo podrn ser los hijos de un hombre del grupo A, cuya madre era del grupo O, y
de una mujer del grupo B, cuyo padre era del grupo O y realice un esquema de cruzamiento.

5).- Explique los siguientes conceptos:

Alergia
Autoinmunidad
Inmunodeficiencia adquirida
Vacuna
Antgeno

4
DEFINITIVO: 08/12/2009
Opcin CIENCIAS: Ejercicio de BIOLOGA / 2 de Junio de 16,00 a 17,30

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid
PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE
GRADO SUPERIOR

CONVOCATORIA DE JUNIO DE 2009

Fecha:
2 de Junio de 2009
de 16,00H a 17,30H

INSTITUTO DE EDUCACIN SECUNDARIA


______________________________________________________

DATOS DEL ASPIRANTE


APELLIDOS: ..
NOMBRE: N de documento de identificacin: .

CUESTIONES de la Parte Especfica de la OPCIN DE CIENCIAS: BIOLOGA

5
DEFINITIVO: 08/12/2009
Opcin CIENCIAS: Ejercicio de BIOLOGA / 2 de Junio de 16,00 a 17,30

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

Segn RESOLUCIN de 14 de Enero de 2010 - (BOCM 1 de Febrero de 2010)

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de BIOLOGA
Da 1 de JUNIO de 2010 - Horario: de 16:00 a 17:30 (1 hora y 30 minutos)

DATOS DEL CANDIDATO

CALIFICACIN

APELLIDOS: .

Calificacin NUMRICA
Sin decimales

NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

o
o
o
o
o
o
o

..

INSTRUCCIONES GENERALES
Mantenga su documento de identificacin en lugar visible durante la realizacin del Ejercicio
(DNI, Pasaporte,.)
Lea detenidamente los textos, cuestiones o enunciados antes de responder.
Realice en primer lugar las cuestiones que le resulten ms sencillas.
Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada y con grafa
clara.
Una vez acabado el ejercicio, revselo meticulosamente antes de entregarlo.
No est permitido la utilizacin ni la mera exhibicin de diccionario, calculadora, telfono mvil
o cualquier otro dispositivo de telecomunicacin.
Entregue esta hoja al finalizar el Ejercicio.

CRITERIOS DE CALIFICACIN

La valoracin de este Ejercicio es entre 0 y 10 sin decimales.


Se valorar la comprensin de las cuestiones planteadas, y la buena presentacin.
Se indica a continuacin la puntuacin de cada una de las cuestiones que constituyen el
Ejercicio de BIOLOGA
Cuestin 1.- 2,7 Puntos.
Cuestin 2.- 2,5 Punto.
Cuestin 3.- 1 Puntos.
Cuestin 4.- 1,8 Puntos
Cuestin 5.- 2 Puntos

1
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de BIOLOGA
Da 1 de JUNIO de 2010 - Horario: de 16:00 a 17:30 (1hora y 30minutos)
DATOS DEL CANDIDATO
APELLIDOS: .
NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

CUESTIONES

1.- Complete la siguiente tabla indicando la Funcin y Naturaleza de los siguientes Compuestos
Compuesto

Funcin

Naturaleza

Colesterol

Estructural

Lpido

Colgeno

..

..

Vitamina D

..

..

Actina

..

..

Triglicridos

..

..

Hemoglobina

..

..

ADN

..

..

Celulosa

..

..

Queratina

..

..

Glucosa

..

..

2.- Indique el nombre de las estructuras sealadas en el dibujo y explique el proceso de la audicin

2
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de BIOLOGA
Da 1 de JUNIO de 2010 - Horario: de 16:00 a 17:30 (1 hora y 30 minutos)
DATOS DEL CANDIDATO
APELLIDOS: .
NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

Indique el nombre de las Estructuras.


1

..

..

..

..

..

..

..

..

..

10

..

Proceso de la Audicin:

3
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

CONSEJERA DE EDUCACIN

Comunidad de Madrid

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de BIOLOGA
Da 1 de JUNIO de 2010 - Horario: de 16:00 a 17:30 (1 hora y 30 minutos)
DATOS DEL CANDIDATO
APELLIDOS: .
NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

3.- Con relacin a la estructura y funcin de las clulas, complete las siguientes cuestiones:
a) - La membrana plasmtica est constituida fundamentalmente por una doble capa compuesta por

b) - En la clula procariota el material gentico se localiza en...


c) - En la clula eucariota el material gentico se localiza en.
d) - La envoltura gruesa y rgida que rodea a la clula vegetal recibe el nombre de.
e) - La fagocitosis permite a la clula..

4.- Indique que son y dnde se sitan las diferentes estructuras anatmicas que se relacionan:

Estructuras
Parietal

Qu son?

Dnde estn
situados?

Hueso

Crneo

Diafragma

Calcneo

Metatarsiano

Pectoral

Cccix

Martillo

Membrana sinovial

Periostio

Carpo

4
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de BIOLOGA
Da 1 de JUNIO de 2010 - Horario: de 16:00 a 17:30 (1 hora y 30 minutos)
DATOS DEL CANDIDATO
APELLIDOS: .
NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

5.- Cite dos ejemplos de cada uno de los siguientes grupos:


- Enfermedades de transmisin sexual.
- Enfermedades transmitidas por agua y alimentos.
- Enfermedades transmitidas por aire.
- Enfermedades en las que en su ciclo infeccioso intervenga algn insecto.

5
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

Segn RESOLUCIN de 14 de Enero de 2010 - (BOCM 1 de Febrero de 2010)

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de QUMICA
Da 1 de JUNIO de 2010 - Horario: de 18:00 a 19:30 (1 hora y 30 minutos)

DATOS DEL CANDIDATO

CALIFICACIN

APELLIDOS: .

Calificacin NUMRICA
Sin decimales

NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

o
o
o
o
o
o
o

..

INSTRUCCIONES GENERALES
Mantenga su documento de identificacin en lugar visible durante la realizacin del Ejercicio
(DNI, Pasaporte,.)
Lea detenidamente los textos, cuestiones o enunciados antes de responder.
Realice en primer lugar las cuestiones que le resulten ms sencillas.
Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada y con grafa
clara.
Una vez acabado el ejercicio, revselo meticulosamente antes de entregarlo.
No est permitido la utilizacin ni la mera exhibicin de diccionario, calculadora, telfono mvil
o cualquier otro dispositivo de telecomunicacin.
Entregue esta hoja al finalizar el Ejercicio.

CRITERIOS DE CALIFICACIN

La valoracin de este Ejercicio es entre 0 y 10 sin decimales.


Se valorar la comprensin de las cuestiones planteadas y la buena presentacin.
Se indica a continuacin la puntuacin de cada una de las cuestiones que constituyen el
Ejercicio de QUMICA.
Cuestin 1.- 2,5 Puntos.
Cuestin 2.- 2,5 Puntos.
Cuestin 3.- 2,5 Puntos.
Cuestin 4.- 2,5 Puntos.

1
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

CONSEJERA DE EDUCACIN

Comunidad de Madrid

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de QUMICA
Da 1 de JUNIO de 2010 - Horario: de 18:00 a 19:30 (1 hora y 30 minutos)
DATOS DEL CANDIDATO
APELLIDOS: .
NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:


CUESTIONES

1.- Dadas las siguientes sustancias:


Sustancia

O2

Z (O) = 8
Z (K) = 19

KCl

Z (Cl) = 17
Na

Z(Na) = 11

HCl

Z(H) = 1

Se pide:
a).- Nombrarlas.
b).- Justificar el tipo de enlace que presentan a partir de las estructuras electrnicas de
los elementos.

2.- El nitrgeno reacciona con el hidrgeno para dar amoniaco.


a).- Escriba y ajuste la reaccin.
b).- Si se ponen 10 litros de hidrgeno y 10 litros de nitrgeno. Cuntos litros de
amonaco se formarn?
c).- Calcule las cantidades de las sustancias que quedarn al final de la reaccin?
Datos: N=14u # O=16u

3.- Formule y nombre los siguientes compuestos y cite una utilidad de cada uno de ellos
a).- Un alcohol.
b).- Una cetona.
c).- Un cido orgnico.
d).- Un hidrocarburo no saturado.

4.- Se quiere preparar 500 ml de disolucin de cido ntrico 0.5M.


a).- Cuntos moles de cido puro se necesitan?
-3
b).- Si el cido del que se dispone es del 70% y densidad 1.44g cm . Qu volumen de
este cido tendramos que poner para preparar dicha disolucin?

Datos: N=14u # O=16u # H=1u

2
2010

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

Pruebas de Acceso a Ciclos Formativos


GRADO SUPERIOR

PARTE ESPECFICA: OPCIN DE CIENCIAS


Ejercicio de la Materia de QUMICA
Da 1 de JUNIO de 2010 - Horario: de 18:00 a 19:30 (1 hora y 30 minutos)
DATOS DEL CANDIDATO
APELLIDOS: .
NOMBRE: .. N de Documento de Identificacin: ..

Instituto de Educacin Secundaria:

3
2010

Prue~ad~Acceso,aCicIOsF()l'rfiatiy()~~~~RADO~LJPERIOR
GONSE,IERtA DE EDUCACION

Comunidad de Madrid

SElg1JnF{~BPLU~J()Nde 23 de, N()Viemprj~rg~1Q(BqCM;,1!S/1P201 0)


T/ '.". ';',:r~~noGe~~r,"'I""0~H~,i()":')~911. '..., ;.' '.";'. ".. .

;"'Part~Especific"':Ejer~ipiQ"qeBIQLOGiA,

.,.

'PATOS DEL CANDIDAT


APELLIOOS:
NOMBRE:

.
N Oocumento Identificaci6n:

..

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA

LA DURACION ES: 1 Hera V 30 Minutes

o Mantenga su documento de identificaci6n en lugar visible durante la realizaci6n del Ejercicio


(ONI, Pasaporte, .... )
oLea detenidamente los textos, cuestiones 0 enunciados antes de responder.
o Realice en primer lugar las cuestiones que Ie resulten mas sencillas.
o Cuide la presentaci6n y escriba la respuesta 0 el proceso de forma ordenada y con gratia
clara.
o Una vez acabado el ejercicio, revfselo meticulosamente antes de entregarlo.
o No esta perrnitido la utilizaci6n ni la mera exhibici6n de diccionario, calculadora, telefono m6vil
o cualquier otro dispositivo de telecomunicaci6n.
o Entregue esta hoja al finalizar el Ejercicio.

E:gl()SD~CAI;J~ICACI~N'

La valoraci6n de este Ejercicio es entre 0 y 10 sin decimales.


Se valorara la comprensi6n de las cuestiones planteadas, asf como la buena presentaci6n.
Se indica a continuaci6n la puntuaci6n de cada una de las cuestiones que constituyen el
Ejercicio de 8iologla.
Cuesti6n 1a ._ 2,5 puntos, (a y b 1 punto cada apartado; el c se califlcara con 0,5 puntos)
Cuesti6n 2a ._ 2,5 puntos. (los apartados aye con 0,5 puntos cada uno; los b y d con 0,75
cada uno)
Cuesti6n 3a ._ 2,5 puntos. (los apartados a y d con 0,5 puntos cad a uno; los bye con 0,75
cada uno)
Cuesti6n 4a ._ 2,5 puntos. (los apartados a y b con 0,5 puntos cad a uno; los c y d con 0,75
cada uno)

Calificaci6n NLiMERICA

Sin decimales

1 de Junia 2011
De 16;00 a 17,30 Haras

Acc~soaCiclosFormativ~~d~~RADO~UPERIOR '

Djreccion (3eneral de Educacion Secundaria


y Ensenanzas Profesionales

~ESOLUCIQt4c:l~i23cJe N9vie~pr~d~2010(BOCM ,15/t2/2Q1 0)


,,'> Turl1qGe~~rtll,..... ~y.~.i~~Qt1 '
.. , "

CONSEJERiA DE EDUCACION

Comunidad de Madrid

Pal1eEspec::ific~:Ejerci<;i~deBIOLOGIA

I\JOMBRE:

N Documento Identificaci6n:

..

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA

CUESTIONES

Con relaci6n a los actos reflejos (movimientos reflejos):


a).- Explique en que consisten:

,_

b).- Indique las fases que lIevan a la aparici6n de movimientos reflejos.

c).- Pong a dos ejemplos de este tipo de movimientos.

23 , _

Con relaci6n al metabolismo:


a).- Defina el concepto:

b).- Indique las dos vertientes que tiene el metabolismo:

c).- Explique que ocurre con los hidratos de carbono que se ingieren cuando en ese momenta no se
precisan:

............................................................................................................l

d).- Indique a que tipo de reacciones metab6licas pertenecen las siguientes:


- Hidr61isis de AlP:
- Gluc6geno

Glucosa

.
~

CO 2 + H20 + Energia:

- Uni6n de glucosas para formar gluc6geno:


1 de Junia 2011
De 16;00 a 17,30 Haras

.
.

. Prueba de Acceso a Ciclos Forrpativos de G~DO SUPERIOR


CONSEJERiA DE EDUCACION

Segun RESOLUCI6Nqe 23 de Noviembrede2010 (SOCM 15/12/2010)

TurnoGf.meral 7..Juhi~ ",2011

Comunidad de Madrid

P~rte Especificil:Ej~r~iciq.(t~.BIOLOGiA

. DATOS DEL CANDIDATO .....


APELLIDOS:
NOMBRE:

.
N Documento Identificaci6n:

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA

3a._ AI cruzar dos individuos heterocig6ticos Aa x Aa, seiiale cual

es la probabilidad de que tengan:

a).- Un hijo aa:

b).- Dos hijos, el primero AA y el segundo aa:

c).- Dos hijos, uno AA y otro aa , sin que importe el orden en que nazcan:

d).- Un hijo, de fenotipo A:

..

4 a._ Con

relaci6n a los virus:

a).- Enumere desde el interior al exterior los componentes de su estructura:

b).- Indique cinco enfermedades producidas par virus:

c).- Cite cinco enfermedades vlricas para las que existe vacuna:

d).- Razone de que forma se administran los virus en las vacunas:

1 de Junia 2011
De 16;00 a 17,30 Horas

DireCCfon General de Educacion Secundana

y Enscnanzas Prolcsionales

. Prueb,i de Acceso a Ciclos Formativos de GRADO SUPERIOR


. Seg(m RESOLLJCION de 23 de Noviembrede201D (BOCM 15/12/2010) .

CONSE.JERiA DE EDUCACION

Comunidad de Madrid

. . . . ..
. Turno General :....Ju
. Parte Especifica: Ejercici

,011
e QUiMICA .

ELCANDID
APELLIOOS:
NOMBRE:

.
N Oocumento Identificaci6n:

..

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA

LA DURACION ES: 1 Hora V 30 Minutos

o Mantenga su documento de identificaci6n en lugar visible durante la realizaci6n del Ejercicio


(ONI, Pasaporte, ....)
oLea detenidamente los textos, cuestiones 0 enunciados antes de responder.
o Realice en primer lugar las cuestiones que Ie resulten mas sencillas.
o Cuide la presentaci6n y escriba la respuesta 0 el proceso de forma ordenada y con gratia
clara.
o Una vez acabado el ejercicio, reviselo meticulosamente antes de entregarlo.
o No esta permitido la utilizaci6n ni la mera exhibici6n de diccionario, calculadora, telefono m6vil
o cualquier otro dispositivo de telecomunicaci6n.
o Entregue esta hoja al finalizar el Ejercicio.

La valoraci6n de este Ejercicio es entre 0 y 10 sin decimales.


Se valorara la comprensi6n de las cuestiones planteadas, asl como la buena presentaci6n.
Se indica a continuaci6n la puntuaci6n de cada una de las cuestiones que constituyen el
Ejercicio de Quimica.
Cuesti6n 18 . _ 2,5 Puntos. (Los apartados a y b se valoraran con 0,75 puntos cada uno y
los c y d con 0,5 cada uno)
Cuesti6n 28 . _ 2,5 Puntos. (1,25 puntos cada apartado)
Cuesti6n 38 . _ 2,5 Puntos. (1,25 puntos cada apartado)

Cuesti6n 48 . _ 2,5 Puntos. (1,25 puntos cada apartado)

Calificacion NUMERICA

Sin decimales

1 de Junio 2011
De 18;00 a 19,30 Horas

I
CONSEJERIA DE EDlJCACION

Comunidad de Madrid

Prueba de AccesoaCiclosF6111l~tiv~stJEtGAAbOSOPERIOR
Segun REsoLuclqN.qe~3qe~$Yi~l11prrqr;.2P19 (~~GM 15/12/2010)
....,.urno.General-.,J~m9:.~Q11.
. .. ~arte~specifica:Ejercici9deQt:JiMICA
.

APELLIDOS:
NOMBRE:

.
N Documento Identificaci6n:

..

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA


CUESTIONES
1a._ Responder a las siguientes cuestiones sobre el magnesio, siendo su nO at6mico 12 y su nO rnasico 24:
a).- l,Cuantos protones, neutrones y electrones tiene?

..

b).- l,Cual es su configuraci6n electr6nica?

..

c).- l,Cuantos electrones tiene en el ultimo nivel?

d).- l,Cuantos electrones Ie sobran para tener configuraci6n electr6nica de gas noble?

..

2a . _ Responder a las siguientes preguntas sobre la tabla peri6dica:


a).- l,C6mo se lIaman las filas horizontales de la tabla peri6dica?

1 de Junia 2011

De 18;00 a 19,30 Haras

..

Dnecc.on General de Educacion Secundar:a


y E.nse(tc:H'!zas F)rofeslanc;les
CONSEJER1A DE EDUCACION

. Prueba de Acceso

a Ci.clos FormativosdeGRADO SUPERIOR

S~gun RESOLUCION de 23 de Noviembrede 2010 (SOeM 15/12i2010)

Comunidad de Madrid

.
. Turno General .... Junio - 2011 .
.... Parte Especrfica: Ejercici~ de QUiMICA

APELLIDOS:
NOMBRE:

.
N Documento Identificaci6n:

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA

b).- Escribe el nombre y el simbolo de los elementos del grupo de los alcalinos y del grupo de los
haI6genos

..

38 . _ Se disuelven

10 gramos de hidr6xido de sodio en agua, obteniendose 250 ern" de disoluci6n.


a).-Calcular la Molaridad de la disoluci6n.

b).- Calcular su pH.

Datos: Masas at6micas: Na: 23u. # 0: 16u. # H: 1u.

48 Dada la siguiente ecuaci6n quimica: 2 AI + 6HCI


adecuados los siguientes parrafos:

a).- Si reaccionan 3 moles de AI, 10 hacen con

~ 2 AICI3 + 3 H2 completar con los nurneros '

moles de HCI y se obtienen

moles de AICI3 y

......... moles de H2

Calculos:

1 de Junia 2011

De 18;00 a 19,30 Haras

prYe~a~e Ac~es~ aCiClo$f&Fn1Clti"p~"~eG"RAPO


SUPERIOR
CONSEJERiA DE EDUCACION

Comunidad de Madrid

.Segun RESOLUCION d~23deNoviell1~red"}01 0 (BOOM t511~/201 0)

Tum:8(7e2'''~!T"J~!;1.()
Parte"Esp.,cifica:Eje~9ii9

011
UllVllCA

APELLIDOS:
NOMBRE:

.
N Documento Identificaci6n:

Instituto de Educaci6n Secundaria: PARQUE DE L1SBOA

b).- Si se obtienen 0,5 moles de H2 , tienen que haber reaccionado


HCI y tienen que haberse obtenido tamblen
Calculos:

1 de Junia 2011
De 18;00 a 19,30 Horas

moles de AI y

moles de

moles de AICI3 .
.

~~p~eb~, de<A.~~O Si C~~'0S'Form<s~i~s de-GRADO SUPERIOR


"

<

,"

,:.',

~ ~~

,~,', '<~'
..

'"

"

Mayo-2012 ,"
,Parte Esp~Cfflca~ Ejercicio de BIOlOGiA ,
"

- .

'"

Tu~no ~eneral
, " ' "

"

DATOS DEL CANDIDATO


l~pELLlDOS

,............................... ' .... ' ...................................... ,........._..._.._

NOMBRE: .......... .... ...................... W Documento Identificacin: ....................... .

~<------'--------

Instituto de Educacin Secundaria:

<-----~---------~.... <-----~

LA DURACiN ES: 1 Hora y 30 Minutos


INSTRUCCIONES GENERALES

Mantenga su documento de identificacin en lugar visible durante la realizacin del Ejercicio


(Df\II, Pasaporte, .... )
detenidamente los textos, cuestiones o enunciados antes de responder.
Realice en primer lugar las cuestiones que le resulten ms sencillas.
Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada y con grafa
clara,
Una vez acabado el ejercicio, revselo meticulosamente antes de entregarlo.
No est permitido la utilizacin ni la mera exhibicin de diccionario, calculadora, telfono mvil
o cualquier otro dispositivo de telecomunicacin.
Entregue esta hoja al finalizar el Ejercicio.

CRITERIOS DE CALIFICACiN

La valoracin de este Ejercicio es entre O y 10 sin decimales.


Se valorar la comprensin de las cuestiones planteadas, as como la buena presentacin.
Se indica a continuacin la puntuacin de cada una de las cuestiones que constituyen el
Ejercicio de Biologa.
Cuestin 1a._ 2,5 puntos.(0,25 cada cuestin)
Cuestin 2a ._ 2,5 puntos. (0,5 cada cuestin)
Cuestin 3 a ._ 2,5puntos. (0,5 cuestiones a y c; 0,75 cuestiones b y d).
Cuestin 4 a ._ 2,5 puntos. (0,5 cuestiones a y d; 0,75 cuestiones b y c)

CALIFICACiN
Calificacin
NUMRICA
Sin decimales

',

DATOS DEL CANDIDATO


APELLIDOS: .....
~--_._--_.

.................................................................................

_----_
~.---_

.......

.......

..

_~._

..

NOMBRE: ............ .... ..................... N Documento Identificacin: .......................


Instituto de Educacin Secundaria:

CUESTIONES

1.- Complete las siguientes frases:


a. La anatoma estudia ..
b. La citologa trata el estudio de ...
c. La membrana plasmtica est compuesta por molculas de ...
d. La fagocitosis es el proceso de ...
e. La envoltura gruesa y rgida que rodea a las clulas vegetales se denomina ...
f. Los ribosomas estn constituidos fundamentalmente por ...
g. El retculo endoplasmtico rugoso presenta en su cara citoplasmtica o externa ...
h. Los lisosomas contienen ...
1.
Los orgnulos de las clulas eucariotas en dnde tiene lugar la cadena respiratoria son ...
J.
parte de la clula que contiene el material gentico y dirige la actividad celular es ...

2.-. Con relacin al aparato locomotor:


a. Indique las funciones de los huesos
b. l\Jombre dos huesos de cada uno de los siguientes tipos: largos, cortos, planos e irregulares
c. Cite dos articulaciones que realicen movimientos de flexin-extensin
d. Cite dos articulaciones que realicen movimientos de abduccin-aduccin
e. Indique en qu consiste el movimiento de pronacin-supinacin

siguientes cuestiones:
3.- Con relacin al aparato digestivo responda a
a. Conceptos de digestin y absorcin
b. Nombre de dos rganos accesorios del tubo digestivo
c. Indique en qu consisten los movimientos peristlticos
d. Cite las estructuras que proporcionan al intestino delgado una gran superficie de absorcin

4.- a.-Defina los siguientes conceptos:


Alelo dominante
Genotipo
b.-Una de las contribuciones de Mendel en el campo de la gentica es el desarrollo de lneas puras.
Indique en qu consisten
c.-Indique en qu consiste la herencia ligada al sexo.
d.-Cite alguna patologa o anomala relacionada con la herencia ligada al sexo

EMPLEO

Mad d

DATOS DEL CANDIDATO

APELLIDOS:
NOrvlBRE:

O"

"

.... , ......

.,

.................................... ..............................

oo.

Identificacin:
N Documento
.__.'_.......

O"

......

..

Instituto de Educacin Secundaria:


SOLUCIONES

1. Complete
siguientes frases:
a. La anatoma estudia la estructura de los seres vivos
b. La citologa trata estudio de la estructura y funcin de la clula
c.
membrana plasmtica est compuesta por molculas de lpidos y protenas
d. La fagocitosis es el proceso de introduccin en la clula de grandes partculas
e. La envoltura gruesa y rgida que rodea a las clulas vegetales se denomina pared celular
f. Los ribosomas estn constituidos fundamentalmente por cido ribonucleico
g. El retculo endoplasmtico rugoso presenta en su cara citoplasmtica o externa ribosomas
h. Los lisosomas contienen enzimas
l.
Los orgnulos de las clulas eucariotas en dnde tiene lugar la cadena respiratoria se
denominan mitocondrias
j. La parte de la clula que contiene el material gentico y dirige la actividad celular es el ncleo
2. Con relacin al aparato locomotor:
a. Indique las funciones de los huesos: permitir el movimiento, sostener el cuerpo, proteger
rganos internos, contener la mdula sea, almacenar sales minerales.
b. Nombre dos huesos de cada uno de los siguientes tipos: largos, cortos, planos e irregulares:
largos: hmero, tibia, fmur, cbito... , cortos: huesos del carpo, del tarso, rtula ... ,
planos: frontal, parietal, escpula ... , irregulares: vrtebras, sacro, esfenoides ...
c. Cite dos articulaciones que realicen movimientos de flexin-extensin: codo, rodilla, dedos .. .
d. Cite dos articulaciones que realicen movimientos de abduccin-aduccin: cadera, hombro.. .
e. Indique en qu consiste el movimiento de pronacin-supinacin: en posicin anatmica, la
pronacin es la rotacin para que la palma de la mano mire hacia atrs y supinacin la
rotacin para que mire hacia delante
3. Con relacin al aparato digestivo responda a las siguientes cuestiones:
a. Conceptos de digestin y absorcin: Digestin: proceso mediante el cual los alimentos se
descomponen en sus elementos constituyentes, ms simples, para poder ser absorbidos.
Absorcin: paso de las molculas sencillas desde el intestino a los capilares sanguneos
y linfticos.
b. Nombre de dos rganos accesorios del tubo digestivo: hgado, vescula biliar, pncreas,
glndulas salivales.
c. Indique en qu consisten los movimientos peristlticos: contraccin rtmica de la musculatura
lisa del tubo digestivo con la finalidad de desplazar el contenido del mismo
d. Cite las estructuras que proporcionan al intestino delgado una gran superficie de absorcin:
pliegues de la mucosa, vellosidades y microvellosidades
4.
a. Defina los siguientes conceptos:
Alelo dominante: aqul que se expresa sin tener en cuenta el segundo alelo
Genotipo: totalidad de los alelos de un organismo
b. Una de las contribuciones de Mendel en el campo de la gentica es el desarrollo de lneas puras.
Indique en qu consisten: son poblaciones que dan slo descendientes iguales para una
determinada caracterstica
c. Indique en qu consiste la herencia ligada al sexo. que los genes responsables de los
caracteres transmitidos mediante esta herencia se localizan en los cromosomas sexuales.
d. Cite alguna patologa o anomala relacionada con la herencia ligada al sexo: P.ej. daltonismo,
hemofilia ...

Prueba de Acceso a Ciclos formativos de


GRADO SUPERIOR- JUNIO 2013

Direccin General de Educacin Secundaria,


Formacin Profesional y Enseanzas de Rgimen Especial

11
Comunidad de Madrid
CONSEJERIA DE EDUCACiN,

JUVENTUD Y DEPORTE

Turno General- Parte Especfica

Ejercicio de BIOLOGA
l'

l'

APELLIDOS: ,.", ...... .. ... ... ...... .... .. , ... ............... ..... ... ,.. ,........ .... .. .... ... ..... .. ....... .
NOMBRE: ., .. , .... .... , ...... ...... ...... ..... . N Documento Identificacin: ... .... ....... ..........
Instituto de Educacin Secundaria :

LA DURACiN ES: 1 Hora y 30 Minutos

,l~st~p~~e,!?~ES GNl$RALtS ;,~~.:!!<~.tL.'..~:~",~::~J',~,~~",:,~.;''~.;.::.: .: .,

' .~

..

. . ', : .. r. :. ,.:."

'.

.~ .. \

_ _ .... ~ " .....,. _

;.'11...,.

"

.',, )~ :

o Mantenga su documento de identificacin en lugar visible durante la realizacin del Ejercicio


(DNI, Pasaporte, .. .. )
o Lea detenidamente los textos, cuestiones o enunciados antes de responder.
o Realice en primer lugar las cuestiones que le resulten ms sencillas.
o Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada y con grafa
clara.
o Una vez acabado el ejercicio, revselo meticulosamente antes de entregarlo.
o No est permitido la utilizacin ni la mera exhibicin de diccionario, calculadora, telfono mvil
o cualquier otro dispositivo de telecomunicacin.
o Entregue esta hoja al finalizar el Ejercicio.

La valoracin de este Ejercicio es entre O y 10 puntos sin decimales.


Se valorar la comprensin de las cuestiones planteadas, as como la buena presentacin.
Se indica a continuacin la puntuacin de cada una de las cuestiones que constituyen el
Ejercicio de Biologa .

. Cuestin 1a ._ 2,5 puntos. (0,5 puntos por cada apartado).

Cuestin 2 a ._ 2,5 puntos. (0,5 puntos por cada apartado).


, Cuestin 3a ._ 2,5puntos. (0,5 puntos por cada apartado).
Cuestin 4 a ,- 2,5 puntos. (0,5 puntos por cada apartado).

CALIFICACiN
Calificacin

NUMRICA

Sin decimales

Prueba de Acceso a Ciclos Formativos de


GRADO SUPERIOR - JUNIO 2013 .

Direccin General de Educacin Secundaria.


Formacin Profesional y Enseanzas de Rgimen Especial

11
Comunidad de Madrid
CONSEJERIA DE EDUCACiN,
JUVENTUD Y DEPORTE

Turno General - Parte Especfica

Ejercicio de BIOLOGA
.,

."

..

APELLIDOS:
NOMBRE: ...................................... N Documento Identificacin:
Instituto de Educacin Secundaria:

CUESTIONES

1a Conteste a las siguientes preguntas sobre la respiracin celular


A) Defnala.
B) Explique su significado biolgico .
C) Explique la diferencia entre la respiracin celular aerbica y la
anaerbica.
O) Escriba la reaccin quimica global de la respiracin de la glucosa.
E) Indique en que orgnulo celular se realiza la respiracin en clulas
eucariotas.
2 a ._ ADN Y ARN son las siglas de dos importantes macromolculas orgnicas.
Conteste a las siguientes cuestiones sobre las mismas:
A) Escriba el significado de las citadas siglas. Explique qu es un
nucletido y de qu est compuesto.
B) Indique qu molculas constituyen un nucletido del ADN y del ARN .
C) Describa la estructura espacial del ADN .
O) Explique la funcin del ADN en los seres vivos.
E) Cite dos tipos de ARN y explique la funcin de cada uno.
3._
Conteste a las siguientes cuestiones sobre el aparato reproductor
femenino.

r-2 '!

--s:~~I~

.t

Direccin General de Educacin Secundaria.


Formacin Profesional y Enseanzas de Rgimen Especial

11
Comunidad de Madrid
CONSEJERIA DE EDUCACiN.
JUVENTUD Y DEPORTE

Prueba de Acceso a Ciclos Formativos de


GRADO SUPERIOR JUNIO 2013
Turno General- Parte Especfica

Ejercicio de BIOLOGA

APELLIDOS:
NOMBRE: .......... .. ..... .. ................... N Documento Identificacin:
Instituto de Educacin Secundaria:

A) Indique el nombre de los rganos o estructuras del esquema marcadas


con un nmero.
B) Explique la funcin de los numerados con 1 y 3.
C) Escriba en qu consiste la funcin endocrina del rgano nO. 4.
D) Explique qu son caracteres sexuales primarios y qu caracteres
sexuales secundarios.
E) Indique en qu rgano se produce la fecundacin del vulo y cmo se
denomina la capa interna del rgano 1, que es eliminada en la
menstruacin.

4_ Conteste las siguientes preguntas sobre la inmunidad:


A)
B)
C)
D)

Defina inmunidad

Explique qu es un antgeno y un anticuerpo .

Describa las principales clulas que intervienen en la respuesta inmune.

Describa u proceso de inmunidad natural pasiva y un proceso de

inmunidad activa.
E) Explique de qu depende la aceptacin o rechazo de un rgano en un
trasplante.

Regin de Murcia
Consejera de Educacin,
Ciencia e Investigacin

Secretara Autonmica de Educacin


y Formacin Profesional

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


CONVOCATORIA 2008

Resolucin de 30 de enero de 2008, ( BORM de 22 de febrero de 2008)

CALIFICACIN PARTE ESPECFICA

DATOS DEL ASPIRANTE


Apellidos: ...................
Nombre: ....................

OPCIN C1-Biologa

Calificacin numrica:
Exento

D.N.I./N.I.E./Pasaporte: .....Fecha de nacimiento:.......................

IES Ramn y Cajal









INSTRUCCIONES GENERALES
Mantenga su DNI., o documento alternativo en caso de aspirantes sin nacionalidad espaola,
en lugar visible durante la realizacin del ejercicio.
Lea detenidamente los textos, cuestiones o enunciados antes de responder.
Realice primero los ejercicios que le resulten ms sencillos y deje para el final aquellos en los
que tenga dudas.
Puede utilizar calculadora cientfica en los ejercicios que la requieran, pero no puede usar
equipos programables.
Cuide la presentacin, escribiendo el proceso y la solucin de forma ordenada.
Una vez acabada la prueba, revsela meticulosamente antes de entregarla.
No est permitida la utilizacin ni la mera exhibicin del telfono mvil. Tampoco est permitida
la utilizacin de ningn otro dispositivo de telecomunicacin.
REALIZACIN Y DESARROLLO DE LA PRUEBA

PARTE ESPECFICA:
De 16,30 h. a 1830 h. (Opcin C1) - Biologa

CRITERIOS PARA OBTENER LA CALIFICACIN FINAL




El criterio de puntuacin general a utilizar para la calificacin de cada ejercicio es el


comprendido entre cero y diez puntos, teniendo en cuenta los criterios especficos de
evaluacin y calificacin expresados en los enunciados.

La Calificacin Global de la Prueba se obtendr por media aritmtica de las dos partes (Comn
y Especfica), siempre y cuando se haya alcanzado al menos la puntuacin de cuatro en cada
una de ellas, o de Exento y Apto, en una y otra parte, en su caso, o Exento en ambas. Cuando
el aspirante deba realizar una sola de las partes, por exencin de la otra, la Calificacin Global
ser la obtenida en la misma. Se considerar Apto al aspirante cuando la Calificacin Global
obtenida sea de cinco o ms puntos.

______________________________________________________
Prueba de acceso a ciclos formativos de grado superior. Convocatoria 2008.
Parte Especfica .

44

Regin de Murcia
Consejera de Educacin,
Ciencia e Investigacin

Secretara Autonmica de Educacin


y Formacin Profesional

DATOS DEL ASPIRANTE

CALIFICACIN DEL
EJERCICIO DE BIOLOGA
OPCIN C1

Apellidos: ..................
Nombre: ............................

Calificacin numrica

D.N.I./N.I.E./Pasaporte n: .............

PARTE ESPECFICA: BIOLOGA Duracin 2 horas

1. Atendiendo a la siguiente microfotografa, responda:

a)
b)
c)
d)
e)

Qu ser vivo representa


Tipo de organizacin celular
Cmo se denominan atendiendo a su forma
Cmo se reproducen. Explquelo
Qu diferencia un nucleoide, de un plsmido y de un episoma

2. Atendiendo al catabolismo de la glucosa, responda:


a)
b)
c)
d)

Cite las fases de todo el proceso


En qu lugar de la clula ocurre cada fase
Escriba la frmula general del proceso.
Qu mecanismos de sntesis utiliza la clula para obtener energa, y en que fase ocurre
cada uno.
e) Qu ocurre si al final de la primera fase est presente o no el oxgeno

______________________________________________________
Prueba de acceso a ciclos formativos de grado superior. Convocatoria 2008.
Parte Especfica .

45

Regin de Murcia
Consejera de Educacin,
Ciencia e Investigacin

Secretara Autonmica de Educacin


y Formacin Profesional

3. Un gen recesivo, situado en uno de los brazos del cromosoma X, es el causante de una
anomala estructural. Un matrimonio sin anomalas ninguno de ellos, pero siendo ella
portadora:
a) Cmo es el genotipo de la pareja.
b) Cmo son los vulos y los espermatozoides de los componentes de la pareja.
c) Cmo ser la descendencia de esta pareja. Indique proporciones de sexo,
fenotpicas y genotpicas.

4. El siguiente grfico representa la variacin de la cantidad de A.D.N. a lo largo del tiempo:

4n

2n

tiempo

a) Seale sobre el grfico las fases que observe.


b) Explique, brevemente, cada una de las fases
c) Representa una mitosis o una meiosis. Por qu?
5. Diferencias entre sueros y vacunas

CRITERIO DE EVALUACIN.
Dominio de las capacidades especficas que son objeto de esta prueba.

CRITERIOS DE CALIFICACIN.
1.- Las calificaciones de la prueba atendern al criterio de evaluacin anterior.
2.-Se valorar sobre un total de 10 puntos con la siguiente distribucin:
Cada cuestin vale dos puntos. En aquellas que tienen apartados se repartir por igual entre
ellos.
______________________________________________________
Prueba de acceso a ciclos formativos de grado superior. Convocatoria 2008.
Parte Especfica .

46

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional
y Educacin de Personas Adultas

DATOS DEL ASPIRANTE

CALIFICACIN
NUMRICA

Apellidos: ...
Nombre: ............

PARTE ESPECFICA: BIOLOGA


Duracin 2horas
1.- La siguiente va metablica, cuya reaccin global se indica a continuacin, es esencial para el
metabolismo de las clulas:
Glucosa + 2NAD+ + 2ADP + Pi 2 Piruvato + 2 NADH+H+ + 2ATP + H2O
a).- Indique el nombre de la va y en qu compartimento celular se produce.
b).- Por qu se dice que esta va metablica es prcticamente universal?.
c).- Indique si es un proceso catablico o anablico y por qu.
d).- Mediante que proceso se ha obtenido el ATP de la reaccin anterior.
2.- Existen distintos tipos de mecanismos de defensa:
a) Defina defensa especfica.
b) Defina inmunidad humoral y cite sus clulas responsables.
c) Defina inmunidad celular y cite sus clulas responsables .
3.-Atendiendo a la reproduccin celular, responda:
a).- Diferencia entre la anafase I de una meiosis y la anafase de un mitosis.
b).- Qu tipo de clulas realizan la mitosis? Y la meiosis?
c).- Cuntas clulas se originan tras la primera divisin meitica? Y tras la segunda?
Cmo sern las clulas?
d).- Por qu se dice que la segunda divisin meitica equivale a una mitosis normal?
4:- Un matrimonio tiene 6 hijos con los siguientes grupos sanguneos:
N de hijos
Grupos sanguneos
2
AB
2
O
1
A
1
B
a).- Cul es el genotipo de los padres? El genotipo de la abuela paterna era AB
b).- Proporcin genotpica de los hijos
c).- Si uno de los hijos de grupo sanguneo O, se casa con una mujer del mismo grupo
sanguneo Cmo sern sus hijos?
d).- De qu tipo de herencia se trata?

Prueba de acceso a ciclos formativos de grado superior - Convocatoria 2009-

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional
y Educacin de Personas Adultas

5.- Atendiendo al siguiente dibujo responda:

a).- Qu organismo representa?


b).- Qu estructuras observas en la microfotografa?
c).- Cul es la composicin de estos organismos?
d).- Cmo se clasifican en funcin del ser vivo al que afectan?
e).- Qu tipo de ciclos vitales tienen? Explquelos brevemente.

CRITERIOS DE EVALUACIN
1. Uso correcto del lengueje biolgico.
2. Claridad y concrecin en las respuestas
3. La ortografa y la presentacin del ejercicio

CRITERIOS DE CALIFICACIN
La prueba se calificar con un total de 10 puntos distribuidos de la forma siguiente:
1.- 2 puntos: (0`5 puntos por cada apartado)
2.- 2 puntos: (apartado a: 0,5 puntos; apartados b y c 0,75 puntos )
3.- 2 puntos: (0`5 puntos por cada apartado)
4.- 2 puntos: (0`5 puntos por cada apartado)
5.- 2 puntos: (0`4 puntos por cada apartado)

Prueba de acceso a ciclos formativos de grado superior - Convocatoria 2009-

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional
y Educacin de Personas Adultas

DATOS DEL ASPIRANTE


Apellidos:

CALIFICACIN
NUMRICA
PARTE ESPECFICA

Nombre: ...
PARTE ESPECFICA: BIOLOGA.
Duracin 2 horas
Lea atentamente las preguntas antes de contestar
1. Atendiendo a la siguiente microfotografa. Indique:(2 puntos).

a) De qu orgnulo se trata?.
b) A qu tipo de organizacin celular pertenece?.
c) Es propio de las clulas vegetales, animales
o ambas?.
d) Indique las estructuras que observa.
e) Qu funciones realiza?.

2. Responda las siguientes cuestiones: (2 puntos).


a) En qu lugar de la clula eucariota tiene lugar la respiracin celular?.
b) Cita al menos dos diferencias entre mitosis y meiosis.
c) Cul es la principal funcin del sistema endocrino?.
d) Cita los rganos del aparato respiratorio.

3. A comienzos de marzo de 2009, se detect un brote de gripe en La Gloria (Mxico) que


afect al 60% de la poblacin. El 30 de abril la OMS (Organizacin Mundial de la salud) la
denomin gripe A. Atendiendo a esta enfermedad responda: (1,5 puntos).
a) Qu organismo causa la gripe y a qu nivel de organizacin pertenece?. Explique esto ltimo.
b) Cules son sus componentes principales?.
c) Existiendo tantos antibiticos en el mercado, Por que los pases tuvieron que abastecerse de
tamifl, que no es un antibitico?.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL -CONVOCATORIA 2010-

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional
y Educacin de Personas Adultas

4. El color de las flores de Mirabilis jalapa que se muestra en la fotografa siguiente, est
controlado por los siguientes genes: El gen A determina el color blanco. El gen R el color rojo.
Cuando aparecen ambos genes juntos, las flores son rosas. (2 puntos).
a) De qu tipo de herencia se trata?.
b) Si cruzamos dos plantas una roja y otra blanca:
*.- Indique los gametos de cada planta.
*.- Cmo sern los descendientes?.
c) Si cruzamos dos plantas rosas
*.- Indique los gametos.
*.- Cmo sern los descendientes?.

5. Explique los siguientes conceptos: (2,5 puntos).


a) Escorbuto.
b) Interfern
c) Vacuna
d) smosis
e) ATP
CRITERIOS DE EVALUACIN
- Dominio de las capacidades especficas que son objeto de esta prueba.
- Se tendr en cuenta la claridad en la exposicin y el vocabulario especfico empleado.
CRITERIOS DE CALIFICACIN
La calificacin de cada cuestin planteada viene expresada en el enunciado de la misma. Si la
cuestin dispone de varios apartados se repartir equitativamente la puntuacin mxima asignada a
la misma.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR DE FORMACIN PROFESIONAL -CONVOCATORIA 2010-

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional y Educacin de
Personas Adultas

PRUEBA DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR FP
PARTE ESPECFICA: BIOLOGA OPCIN C
CONVOCATORIA 2011

DATOS DEL ASPIRANTE:


Apellidos:

CALIFICACIN
EJERCICIO

Nombre: ...

PARTE ESPECFICA OPCIN C


BIOLOGA (Duracin 1h 15)
1.- El esquema siguiente representa la membrana plasmtica de una clula:

a) Seala los nmeros que corresponden a fosfolpidos, colesterol, glucolpidos, protenas perifricas,
protenas de transmembrana, glucoprotenas, bicapa lipdica y glucoclix. (0,8 puntos)
b) Cules de las molculas sealadas son anfipticas? (0,8 puntos)
c) Qu significa que la membrana plasmtica es asimtrica? (1 punto)

2. Se realiza un primer cruzamiento de dos plantas de flores color naranja y se obtiene una descendencia
formada: (3 puntos)
- 60 de flores naranja.
- 30 plantas de flores rojas.
- 30 de flores amarillas.
Qu descendencia se obtendr al cruzar las plantas de flores naranjas obtenidas, con las rojas tambin
obtenidas?. Y con las amarillas tambin obtenidas?. Razona los tres cruzamientos. Gametos R (Rojo) y
gametos A (amarillo) son codominantes.

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional y Educacin de
Personas Adultas

PRUEBA DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR FP
PARTE ESPECFICA: BIOLOGA OPCIN C
CONVOCATORIA 2011

3. De los siguientes enunciados, seale con una cruz cules son Verdaderos (V) o Falsos (F): (2 puntos)
V
a) La pleura visceral es el fluido que recorre los pulmones.
b) Todas las fases de la respiracin celular ocurren en la mitocondria.
c) La molcula de agua est formada por dos tomos de oxgeno y uno de hidrgeno
d) Se produce ms energa en la respiracin celular que en la fermentacin
e) A partir de los centrolos se forma el huso acromtico.
f) A partir del aparato de Golgi se forma la envuelta nuclear.
g) Los cromosomas contienen exclusivamente ARN.
h) El nuclolo contiene ARN.
i) A travs de las vacuolas se realizan los intercambios de sustancias entre la clula y el exterior.
j) Una estructura compuesta por dos o ms tejidos se denomina rgano.

4.- Definicin y diferencias entre: (2,4 puntos)


a) Antgeno y anticuerpo.
b) Respuesta inmune inespecfica y especfica.
c) Catabolismo y anabolismo.

Criterios de evaluacin
- Dominio de las capacidades especficas que son objeto de esta prueba.
- Se tendr en cuenta la claridad en la exposicin y el vocabulario especfico empleado.
Criterios de calificacin
- La calificacin de cada cuestin planteada viene expresada en el enunciado de la misma.
- Cuando se disponga de varios apartados se repartir equitativamente la puntuacin mxima asignada a la misma.

PRUEBA DE ACCESO A CICLOS FORMATIVOS

Regin de Murcia
Consejera de Educacin, Formacin y Empleo

DE GRADO SUPERIOR FP

Direccin General de Formacin Profesional y Educacin de


Personas Adultas

PARTE ESPECFICA: BIOLOGA OPCIN C


CONVOCATORIA AO 2012

CALIFICACIN
EJERCICIO

DATOS DEL ASPIRANTE:


Apellidos:
Nombre: ...

PARTE ESPECFICA OPCIN C


BIOLOGA (Duracin 1h 15)

RESUELVE 5 DE LOS 6 EJERCICIOS PROPUESTOS


Ejercicio 1. Componentes qumicos de la materia viva
Concepto y composicin de los glcidos. Clasificacin. Ejemplos de cada uno y su funcin biolgica
principal.

(2 puntos)

Ejercicio 2. La clula: Unidad de estructura y funcin


Responda a las siguientes cuestiones
a) Qu es la mitosis? Qu importancia tiene este proceso?

(0,6 puntos)

b) Las siguientes fases de la mitosis estn desordenadas; seala en qu orden se produce y qu


nombre recibe cada una de las fases del dibujo.

(0,6 puntos)

c) Describa lo que ocurre en el dibujo 2 y dibujo 3.

(0,8 puntos)

Dibujo 1

Fase N______
Nombre: ________

Dibujo 2

Fase N__________
Nombre:.___________

Dibujo 3

Fase N __________
Nombre:___________

Ejercicio 3. Anatoma y fisiologa humanas. Aparatos digestivo y respiratorio. Contesta a las


siguientes cuestiones:
a) Cmo se llama la salida del estmago?

(0,5 puntos)

b) Cmo se llama la papilla semilquida, espesa y cida, en que los alimentos se transforman en el
estmago por la digestin?

(0,5 puntos)

c) Cmo se llama la membrana doble que rodea cada pulmn?

(0,5 puntos)

d) "Es un tubo corto, en cuyo interior estn las cuerdas vocales". A qu conducto hace referencia
esta definicin?

(0,5 puntos)

Regin de Murcia
Consejera de Educacin, Formacin y Empleo

PRUEBA DE ACCESO A CICLOS FORMATIVOS

Direccin General de Formacin Profesional y Educacin de


Personas Adultas

DE GRADO SUPERIOR FP
PARTE ESPECFICA: BIOLOGA OPCIN C
CONVOCATORIA AO 2012

Ejercicio 4. Gentica
En los conejos, el pelo corto se debe a un gen dominante C y el pelo largo su alelo recesivo c. Al
cruzar una hembra de pelo corto con un macho de pelo largo se produce una camada de 8
conejitos, de los cuales 1 es de pelo largo y 7 de pelo corto.
a) Cules son los genotipos de sus padres?

(0,5 puntos)

b) Cul es la proporcin genotpica y fenotpica de la F1 ?

(1 punto)

c) Cuntos de los 8 conejitos podran tener el pelo largo? Razonar la respuesta.

(0,5 puntos)

Ejercicio 5. Microbiologa
Existen protenas que causan enfermedades contagiosas y graves. Una de ellas es la enfermedad de
Creutzfeldt-Jakob, responde a las siguientes cuestiones relacionadas con la misma:
a) Cundo y dnde comenz?

(0,5 puntos)

b) Cul es su causa?

(0,5 puntos)

c) Cmo se pueden contagiar las personas?

(0,5 puntos)

d) Cmo puede prevenirse? Se dispone de tratamiento?

(0,5 puntos)

Ejercicio 6. Inmunologa
Describa en qu consiste la respuesta inflamatoria.

(2 puntos)

Criterios de evaluacin
Dominio de las capacidades especficas que son objeto de esta prueba. Se tendr en cuenta la claridad
en la exposicin y el vocabulario especfico empleado.
Criterios de calificacin
La calificacin de cada cuestin planteada viene expresada en el enunciado de la misma.

PRUEBA DE ACCESO A CICLOS FORMATIVOS

Regin de Murcia
Consejera de Educacin, Formacin y Empleo

DE GRADO SUPERIOR FP
PARTE ESPECFICA: BIOLOGA OPCIN C

Direccin General de Formacin Profesional y Educacin de


Personas Adultas

CONVOCATORIA AO 2013

DATOS DEL ASPIRANTE:


Apellidos:

CALIFICACIN
EJERCICIO

Nombre: ...

PARTE ESPECFICA OPCIN C


BIOLOGA (Duracin 1h 15)

RESUELVE 5 DE LOS 6 EJERCICIOS PROPUESTOS


EJERCICIO 1. Componentes qumicos de la materia viva
A continuacin se representan cuatro biomolculas que componen los seres vivos.

2
4

Observe cada compuesto y conteste a las siguientes cuestiones:


a) Identifique el grupo de biomolculas a las que pertenecen los compuestos representados (nivel
mximo de concrecin).
(0,5 puntos)
b) Indique cules de ellos son compuestos monmeros y que biopolmero puede formar.

(0,5 puntos)

c) Explique la funcin del compuesto 2.

(1 punto)
Pgina 1/3

Regin de Murcia
Consejera de Educacin, Formacin y Empleo
Direccin General de Formacin Profesional y Educacin de
Personas Adultas

PRUEBA DE ACCESO A CICLOS FORMATIVOS


DE GRADO SUPERIOR FP
PARTE ESPECFICA: BIOLOGA OPCIN C
CONVOCATORIA AO 2013

RESUELVE 5 DE LOS 6 EJERCICIOS PROPUESTOS


EJERCICIO 2. La clula: Unidad de estructura y funcin. Respecto a la etapa de divisin en el
ciclo celular, responda a:
a) Qu tejidos animales elegira para observar clulas en mitosis y en meiosis?

(0,25 puntos)

b) Si contemplamos la profase de la divisin celular: Qu diferencias existen entre mitosis y meiosis?


(1 punto)
c) Cmo se observan los cromosomas y cuntas cromtidas poseen en la metafase mittica y en las
metafases meiticas?

(0,5 puntos)

d) Al final de la mitosis y de la meiosis cuntas clulas resultan en cada caso y qu nmero de


cromosomas posee cada una?

(0,25 puntos)

EJERCICIO 3. Anatoma y fisiologa humanas. Aparato respiratorio:


a) Escriba los nombres 1),2),3),4) del dibujo que se adjunta:
(1 punto)

1.
2.

3.

4.

b) Dnde se produce el intercambio de gases? Explica el proceso por el que se produce.


(0,5 puntos)
c) Qu es la ventilacin pulmonar? Por qu se produce?
(0,5 puntos)

Pgina 2/3

PRUEBA DE ACCESO A CICLOS FORMATIVOS

Regin de Murcia
Consejera de Educacin, Formacin y Empleo

DE GRADO SUPERIOR FP

Direccin General de Formacin Profesional y Educacin de


Personas Adultas

PARTE ESPECFICA: BIOLOGA OPCIN C


CONVOCATORIA AO 2013

RESUELVE 5 DE LOS 6 EJERCICIOS PROPUESTOS


EJERCICIO 4. Gentica: Interprete los siguientes problemas sobre transmisin de caracteres:
P1. En una raza de conejos, el color negro (N) domina sobre el color pardo (n). Seale los genotipos y
fenotipos de la F1 y de la F2 del cruzamiento entre un conejo negro y una coneja parda.
(1 punto)
P2. Un cruce entre un cobaya de pelo rizado con otro de pelo liso ha dado ocho cras todas de pelo
rizado. En otro cruzamiento entre dos cobayas de pelo rizado han salido seis cras de pelo rizado y dos
de pelo liso. Cul es el genotipo de los padres en los dos cruzamientos? Razone la respuesta.
(1 punto)

EJERCICIO 5. Microbiologa
a) Qu tipo de virus es el VIH (virus de la inmunodeficiencia humana)?
(1 punto)
b) Qu infecta especficamente y cmo acta?
(1 punto)
EJERCICIO 6. Inmunologa
Los siguientes trminos estn todos relacionados con el sistema inmunitario. Explique cada uno de
ellos:
a) Linfocito B
b) Linfocito T
c) Macrfago
d) Antgenos
(0,5 puntos cada definicin, hasta un mximo 2 puntos)

Criterios de evaluacin
Dominio de las capacidades especficas que son objeto de esta prueba. Se tendr en cuenta la claridad
en la exposicin y el vocabulario especfico empleado.
Criterios de calificacin
La calificacin de cada cuestin planteada viene expresada en el enunciado de la misma.

Pgina 3/3

BIOLOGA
8. La hormona responsable de elevar el nivel de glucosa en sangre es:
a) Insulina.
b) Glucgeno.
c) Glucagn.
d) Prolactina.
9. Podemos afirmar que:
a) Las clulas eucariotas son ms grandes que las procariotas.
b) Las clulas procariotas no tienen ncleo.
c) Las bacterias se incluyen en el Reino Monera.
d) Todas las afirmaciones anteriores son ciertas.
10. Las venas pulmonares:
a) Llevan a la aurcula derecha la sangre oxigenada procedente de los pulmones.
b) Llevan al ventrculo derecho la sangre oxigenada procedente de los pulmones.
c) Llevan a la aurcula izquierda la sangre oxigenada procedente de los pulmones.
d) Llevan al ventrculo izquierdo la sangre oxigenada procedente de los pulmones.
11. Por smosis:
a) Tiende a pasar disolvente del medio hipotnico al hipertnico.
b) Tiende a pasar disolvente del medio hipertnico al hipotnico.
c) Tiende a pasar soluto de donde hay ms soluto a donde hay menos.
d) Tiende a pasar soluto de donde hay menos soluto a donde hay ms.
12. Los orgnulos celulares que se encargan de la sntesis de protenas son:
a) Mitocondrias.
b) Lisosomas.
c) Ribosomas.
d) Vacuolas.
13. Los organismos hetertrofos:
a) Son los productores primarios de un ecosistema.
b) Obtienen la energa qumica a partir de reacciones de compuestos inorgnicos sencillos.
c) Obtienen la energa qumica de los alimentos que consiguen del medio.
d) Captan la energa procedente del sol y la transforman en energa qumica.
14. En la especie humana el color pardo de los ojos domina sobre el color azul. Un varn de
ojos pardos, cuya madre tena ojos azules, se casa con una mujer de ojos azules. Cul
ser la probabilidad de que su primer hijo tenga ojos azules?:
a) 10%
b) 25%
c) 50%
d) 75%

Parte Especfica-CIENCIAS DE LA SALUD_ Grado Superior

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA
Convocatoria 2010 RESOLUCIN 383/2009, de 1 de diciembre

BIOLOGA
CALIFICACIN
APELLIDOS:
NOMBRE:
DNI/NIE:

RESPONDA EN EL ENUNCIADO
Criterios: cada pregunta respondida correctamente 2 puntos
1. Dibuje una clula eucariota animal, representando en ella aquellos orgnulos y/o estructuras
que considere importantes para la vida de la clula, indicando en cada caso (y en no ms de
10 palabras por caso) la funcin de cada uno de ellos.

2. El daltonismo es un carcter ligado al cromosoma X. Represente los siguientes cruzamientos


indicando, para cada individuo, genotipo y fenotipo.
a. Descendencia que pueden tener una mujer portadora de daltonismo y un hombre no
daltnico.

CIENCIAS DE LA SALUD



La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA
Convocatoria 2010 RESOLUCIN 383/2009, de 1 de diciembre

b.

Descendencia que pueden tener una mujer homocigtica de visin normal y un hombre
daltnico.

3. Imagine que un glbulo rojo se situara en la aurcula derecha y que hiciera el recorrido
necesario para regresar al mismo sitio:
a. Haga un dibujo del corazn, con sus cavidades, y de los principales vasos sanguneos que
utilizara en su recorrido. Seale con flechas el camino que sigue.

b.

Indique el tipo de hemoglobina (oxigenada o pobre en oxgeno) que contendra en cada


vaso.

CIENCIAS DE LA SALUD



La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA
Convocatoria 2010 RESOLUCIN 383/2009, de 1 de diciembre

4. Imagine que come un filete con patatas fritas (protena, almidn, grasa). Explique los
procesos digestivos que tendran lugar sobre cada tipo de alimento, indicando, en cada caso:
- Enzimas que intervienen:

Productos obtenidos:

rgano donde ocurre:

5. Explique, de manera esquemtica, las dos fases de la fotosntesis, indicando especialmente


los productos que se obtienen en la fase luminosa, localizacin celular detallada y cmo se
utilizan en la fase oscura.

CIENCIAS DE LA SALUD



La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA CIENCIAS DE LA SALUD


CONVOCATORIA 2011
RESOLUCIN 481/2010 de 13 de diciembre

BIOLOGA
CALIFICACIN
APELLIDOS:
NOMBRE:
DNI/NIE:
RESPONDA EN EL ENUNCIADO
1. Explique la estructura y la funcin de dos orgnulos celulares eucariticos que contengan
ribosomas de tipo procaritico y ADN, indicando en qu tipo de clula (animal o vegetal) se
encuentra cada uno. (2 puntos)

CIENCIAS DE LA SALUD



1 de 9

La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA CIENCIAS DE LA SALUD


CONVOCATORIA 2011
RESOLUCIN 481/2010 de 13 de diciembre

2. Explique, de manera esquemtica, las dos fases de la fotosntesis, indicando especialmente


los productos que se obtienen en la fase luminosa, modo de obtencin, localizacin celular
detallada y cmo se utilizan en la fase oscura. Es un proceso anablico o catablico?
Explquelo. (2 puntos)

3. El siguiente esquema representa algunos aspectos de los intercambios entre el organismo y


el medio externo. (2 puntos)
a.
Indique qu intercambios se producen en las zonas marcadas con A, B y C.
b. Para qu sirven los nutrientes y el oxgeno consumido por las clulas (D)? Qu
desechos se producen? Cul es su origen?

CIENCIAS DE LA SALUD



2 de 9

La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA CIENCIAS DE LA SALUD


CONVOCATORIA 2011
RESOLUCIN 481/2010 de 13 de diciembre

4. Complete las siguientes frases con la palabra adecuada. (2 puntos)


El

Sistema

Nervioso

est

constituido

por

los

formados

fundamentalmente por los . neuronales, y por los .., constituidos


fundamentalmente por los . de las neuronas.
En nuestro Sistema Nervioso se pueden diferenciar tres partes:
a. Sistema Nervioso .. (SNC): formado por el .. y la espinal,
cuya funcin es llevar el control de todo el organismo, la .. de estmulos y
elaboracin de respuestas, la voluntariedad, las funciones superiores, etc.
b. Sistema Nervioso . (SNP): formado por y .
se encarga de transportar impulsos por todo el organismo.
c. Sistema

Nervioso

(SNA):

tambin

formado

por

nervios

..controla el funcionamiento de nuestros

CIENCIAS DE LA SALUD



3 de 9

La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR

PARTE ESPECFICA CIENCIAS DE LA SALUD


CONVOCATORIA 2011
RESOLUCIN 481/2010 de 13 de diciembre

5. Tras el estudio de la transmisin de determinado carcter en una familia se ha obtenido el


rbol genealgico que aparece en la figura adjunta, en el que los individuos que presentan
dicho carcter aparecen en negro. Indique qu tipo de transmisin sigue el carcter en
estudio, as como los genotipos de los individuos sealados. Razone la respuesta. (2 puntos)
A

CIENCIAS DE LA SALUD



4 de 9

La calificacin final de la parte especfica ser la media aritmtica, con dos decimales, de la calificacin obtenida en las materias
seleccionadas.
Es necesario obtener un mnimo de 4 en la parte especfica, para poder realizar la media aritmtica con la calificacin obtenida en la Parte
Comn.

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2012
RESOLUCIN 13/2012 de 13 de febrero
BIOLOGA

CALIFICACIN
APELLIDOS
NOMBRE
DNI

1. Conteste estas dos cuestiones:


a) Enuncie la Teora celular.

b) Nombre los orgnulos citoplasmticos de una clula eucariota, diga si estn


presentes en la clula animal y en la clula vegetal, e indique su funcin.
Orgnulo celular
Membrana plasmtica

Clula
Animal
Si

Clula
vegetal
Si

Funcin

1/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2012
RESOLUCIN 13/2012 de 13 de febrero
BIOLOGA

2. El siguiente esquema representa a un cloroplasto. Responda a las siguientes


cuestiones:

a) En qu tipo celular podemos encontrar este orgnulo y qu importante proceso


realiza en dichas clulas?

b) Nombra cada una de las estructuras sealadas con nmeros.


c) En cul de las anteriores estructuras se realiza la fase luminosa y en cul la fase
oscura?

d) Explique, de manera esquemtica, las dos fases de la fotosntesis, indicando


especialmente los productos que se obtienen en la fase luminosa y cmo se
utilizan en la fase oscura.

2/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2012
RESOLUCIN 13/2012 de 13 de febrero
BIOLOGA

3. A continuacin le representamos un esquema de nuestro aparato digestivo. Conteste


las siguientes preguntas.

a) Nombre las estructuras sealadas con nmeros.


b) Desde que nos tomamos un alimento por la boca, desarrolle con detalle cmo
atraviesa y cmo funciona nuestro aparato digestivo.

3/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2012
RESOLUCIN 13/2012 de 13 de febrero
BIOLOGA

c) Indique cules son las glndulas digestivas, qu sustancias segregan cada una y
sobre qu nutrientes actan.

4. El ADN es una biomolcula cuya estructura fue descrita por J. Watson y F. Crick en
1952. Es un polmero constituido por la repeticin de cuatro monmeros
denominados nucletidos. Responda a las siguientes cuestiones:
a) Indique los componentes de los nucletidos.

b) Nombre los cuatro nucletidos componentes del ADN.

c) Explique en qu consiste la complementariedad entre las bases.

4/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2012
RESOLUCIN 13/2012 de 13 de febrero
BIOLOGA

d) Explique las funciones del ADN.

e) Dnde se encuentra localizado el ADN en las clulas eucariotas? y en las


procariotas?

5. Sabemos que el grupo sanguneo depende del que tengan nuestros padres, es decir,
se transmite genticamente. Tambin sabemos que genotipo es la informacin que
tenemos en los dos cromosomas y fenotipo es lo que se expresa. Observe la
siguiente tabla de genotipos y fenotipos del grupo sanguneo y responda a las
cuestiones planteadas.

Fenotipo
AB
0
A
B

Genotipo
AB
00
A0 y AA
B0 y BB

Cromosomas que transmite a la descendencia


AB
0
A0
B0

a) Julia tiene como grupo sanguneo A y su marido Salvador el grupo sanguneo B.


Pueden tener un hijo/a con grupo sanguneo 0?. Razone su respuesta.
b) Qe genotipo deben tener Julia y Salvador para que su hijo/a tenga fenotipo
AB?. Razone su respuesta.
c) Si una mujer es A0 y un hombre es BB. De las dos combinaciones posibles en
cuntas de ellas el hijo/a de ambos tendr fenotipo AB?. Razone su respuesta.

5/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2013
RESOLUCIN 22/2013 de 22 de enero
BIOLOGA

CALIFICACIN
APELLIDOS
NOMBRE
DNI/TIE

1. Acerca de la excrecin en la especie humana, responde a las siguientes cuestiones:


(2 puntos)
a) A qu aparato corresponde el siguiente dibujo? Explica la funcin bsica de este
aparato. (0,4 puntos)
b) Indica todos los rganos marcados con un nmero. (0,4 puntos)
c) Indica la funcin de cada uno de ellos. (0,4 puntos)
d) Qu camino seguira la orina desde su formacin hasta su salida al exterior?
(0,4 puntos)
e) Qu son las nefronas? Cul es su funcin? (0,4 puntos)

1/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2013
RESOLUCIN 22/2013 de 22 de enero
BIOLOGA

2. El Sistema Inmunitario est constituido por un conjunto de rganos, tejidos, clulas y


molculas que, de forma coordinada, defienden al organismo de todo aquello que pueda
ser potencialmente nocivo. Define los siguientes conceptos: (2 puntos)
a) Antgeno. (0,4 puntos)
b) Anticuerpo. (0,4 puntos)
c) Autoinmunidad. (0,4 puntos)
d) Hipersensibilidad. (0,4 puntos)
e) Inmunodeficiencia. (0,4 puntos)

2/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2013
RESOLUCIN 22/2013 de 22 de enero
BIOLOGA

3. La molcula que contiene la informacin de las caractersticas biolgicas de los seres


vivos es el ADN. A continuacin, se representa un fragmento de cadena de ADN
simple. Realiza los ejercicios que se proponen sobre ella: (2 puntos)
A-T-A-C-G-C-G-T-C-G-C-T-G-C-C-G-G-T-A-A-C-C-A-T-T-C-A-A-C-G-T-T-G
a) Escribe la secuencia de su cadena complementaria (ADN) (0,5 puntos)

b) Escribe la cadena resultante del proceso de transcripcin del fragmento del


enunciado. (0,5 puntos)

c) Usando la tabla que se aporta a continuacin, escribe la secuencia resultante de la


traduccin del fragmento del apartado b) (0,5 puntos)

Las abreviaturas usadas en el cuadro significan lo siguiente: Phe=Fenilalanina,


Leu=Leucina, Ile=Isoleucina, Met=Metionina, Val=Valina, Ser=Serina, Pro=Prolina,
Thr=Treonina,

Ala=Alanina,

Tyr=Tirosina,

His=Histidina,

Gln=Glutamina,

3/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2013
RESOLUCIN 22/2013 de 22 de enero
BIOLOGA

Asn=Asparagina,

Lys=Lisina,

Asp=cido

Asprtico,

Glu=cido

Glutmico,

Cys=Cisterna, Trp=Triptfano, Arg=Arginina, y Gly=Glicina


SECUENCIA:

d) De qu tipo de molcula se trata? (0,5 puntos)

4. Con respecto a la imagen siguiente, responde a las siguientes cuestiones: (2 puntos)

a) Identifica el orgnulo celular representado. (0,5 puntos)


b) Seala sus componentes fundamentales. (0,5 puntos)
c) Explica la funcin principal que realiza en la clula. (0,5 puntos)
d) Explica los conceptos de endocitosis y exocitosis. (0,5 puntos)

4/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


PARTE ESPECFICA CIENCIAS DE LA SALUD
CONVOCATORIA 2013
RESOLUCIN 22/2013 de 22 de enero
BIOLOGA

5. El siguiente esquema representa a un cloroplasto. Responde a las siguientes


cuestiones: (2 puntos)

a) En qu tipo celular podemos encontrar este orgnulo y qu importante


proceso realiza en dichas clulas? (0,6 puntos)
b) Nombra cada una de las estructuras sealadas con nmero. (0,8 puntos)
1

8
c) En cul de las anteriores estructuras se realiza la fase luminosa y en cul la
fase oscura? (0,6 puntos)

FASE LUMINOSA
FASE OSCURA

5/5

PRUEBA DE ACCESO A CICLOS FORMATIVOS


HEZIKETA ZIKLOETARA SARTZEKO FROGA
JUNIO 2008 / 2008KO EKAINA

GOI MAILAKO ZIKLOAK / CICLOS DE GRADO SUPERIOR


ARLO ESPEZIFIKOA / PARTE ESPECFICA

BIOLOGA
BIOLOGIA

Abizenak
Apellidos

________________________________________________________

Izena
Nombre

__________________________________________

Lurraldea
Territorio

N.A.N.
__________________ D.N.I. __________________

Ikastetxea
Centro

________________________________________________________

Adina
Edad _____

GOI MAILAKO PRESTAKUNTZA ZIKLOAK

BIOLOGIA

1. (2p) Ondorengo biomolekula bakoitzarentzat:


Esan zein molekula-mota den
Esan zein funtzio biologikoa duen
Molekula-mota

Funtzioa

Hemoglobina
Antigorputza
Olioa
Intsulina
ATP-a
Zelulosa
Kolesterola
Entzima
Histonak
Esteroideak

2. (2p) HIESa birus batek eragindako gaixotasuna da.


Zerez daude osatuta birusak? (0,5p)
Zein antolakuntza-mailatan kokatzen dira birusak? Beste organismorik gabe, gai
al dira bizirik irauteko? (0,5p)
Zer da erretrobirus bat? zein dira bere berezitasunak? (0,5p)
Zer da seropositiboa izatea? (0,5p)

3. (2p) Egin meiosiaren eta mitosiaren laburpen bat eta adierazi haien arteko antzekotasunak eta aldeak. (1,5p)
Ondoren, eman erantzuna hurrengo galdera hauei:
Zer dira gizakiaren zelula sexualak, haploideak ala diploideak? (0,25p)
Zenbat kromosoma ditu zelula sexual bakoitzak? (0,25p)
4. (2p) Nutrizio-prozesuak gizakian. Eman ezazu erantzuna ondoko galdera hauei:
Ohikoa da odol oxigenatuari arteria-odola deitzea eta odol oxigenatu gabeari,
CO2 daramanari, bena-odola. Egokiak al dira izendapen horiek? Zergatik?
(0,5p)
Nola eta non eratzen da gernua? (0,5p)
Non eta nola gertatzen da gas-trukea? (0,5p)
Zertan datza eta non gertatzen da nutrienteen xurgapena? (0,5p)

5. (2p) Irudian zelula-eredu ideal bat azaltzen da


Identifikatu zenbakiez seinalaturiko atalak (1p)
Arrazoitu zelula eukariota ala prokariota den (0,5p)
Arrazoitu landare ala animalia-zelula den (0,5p)

10
0
1
2

3
9

4
5
6
7

CICLOS FORMATIVOS DE GRADO SUPERIOR

BIOLOGA
1. (2p) Para cada una de las siguientes biomolculas debes decir:
Qu tipo de molcula es
Funcin biolgica que desempea

Tipo de molcula

Funcin

Hemoglobina
Anticuerpo
Aceite
Insulina
ATP
Celulosa
Colesterol
Enzima
Histonas
Esteroides

2. (2p) El SIDA es una enfermedad producida por un virus:

Cul es la composicin de los virus? (0,5p)


En qu nivel de organizacin se sitan? Son capaces de subsistir sin otros
organismos? (0,5p)
Qu son los retrovirus? cules son sus particularidades? (0,5p)
Qu significa ser seropositivo? (0,5p)

3. (2p) Explica de forma resumida la mitosis y la meiosis indicando las diferencias y


semejanzas entre ambos procesos (1,5p)
Responde a las siguientes cuestiones:
Las clulas sexuales humanas, son haploides o diploides? (0,25p)
Cuntos cromosomas tiene cada clula sexual? (0,25p)
4. (2p) Procesos de nutricin en el ser humano. Responde a las siguientes cuestiones:
Es habitual denominar a la sangre oxigenada sangre arterial y a la sangre
desoxigenada, que transporta CO2, sangre venosa. Son correctas estas
denominaciones? por qu? (0,5p)
Dnde y cmo se forma la orina? (0,5p)
Dnde y cmo se realiza el intercambio de gases? (0,5p)
En qu consiste y dnde se realiza la absorcin de los nutrientes? (0,5p)
5. (2p) En la figura se representa un modelo de clula ideal:
Identifica los componentes sealados con nmeros (1p)
Razona si se trata de una clula eucariota o procariota (0,5p)
Razona si se trata de una clula animal o vegetal (0,5p)

10
0
1
2

3
9

4
5
6
7

PRUEBA DE ACCESO A CICLOS FORMATIVOS


HEZIKETA ZIKLOETARA SARTZEKO FROGA
JUNIO 2009 / 2009KO EKAINA

GOI MAILAKO ZIKLOAK / CICLOS DE GRADO SUPERIOR


ARLO ESPEZIFIKOA / PARTE ESPECFICA

BIOLOGA
BIOLOGIA

Abizenak
Apellidos

________________________________________________________

Izena
Nombre

Ordena Zkia.
__________________________________________N orden _______

Lurraldea
Territorio

N.A.N.
__________________ D.N.I. __________________

Ikastetxea
Centro

Adina
Edad _____

_________________________________________________________

GOI MAILAKO PRESTAKUNTZA ZIKLOAK

BIOLOGIA
1. (2p) Irudian zeluletan gertatzen den prozesu bat azaltzen da.

(0,25p) Zein prozesu da?

(1,25p) Izendatu zenbakiez seinalaturiko egiturak


eta prozesuak

1
3

1.

2.
3.

4.
5.
6.

7.
8.
9.
10.
11.

12.

10

13.

(0,5p) Azaldu irudikaturiko prozesua.

13
11
12

2. (0,5p) Giza zelula mitosiaren bidez zatitzen baldin bada...


a) Zenbat kromosoma edukiko ditu zatiketaren hasieran?
b) Zenbat kromatida izango ditu kromosoma bakoitzak?
c) Zenbat zelula-kume sortuko dira?
d) Zenbat kromosoma izango ditu zelula-kume bakoitzak?
e) Beraz nolakoak dira zelula-kumeak, haploideak ala diploideak
3. (0,5p) Giza zelula meiosiaren bidez zatitzen baldin bada...
a) Zenbat kromosoma edukiko ditu zatiketaren hasieran?
b) Zenbat zelula-kume sortuko dira?
c) Zenbat kromosoma izango ditu zelula-kume bakoitzak?
d) Beraz nolakoak dira zelula-kumeak, haploideak ala diploideak
e) Nola deitzen dira zelula-kumeak?

4. (2p) Nutrizioan ondoko prozesuak desberdindu ohi dira:.


a) (0,5p) Defini itzazu
Ingestioa:
Digestioa:
Garraioa:
Metabolismoa:
Iraizketa:
b) (0,5p) Aipatu funtzio horretan parte hartzen duten aparatuak/sistemak

c) (1p) Azaldu non eta nola gertatzen den:


Gas-trukea
Nutrienteen xurgapena

5. (1p) Ondorengo erreakzio kimikoek bizitzarako ezinbestekoak diren bi prozesu adierazten dute.

A:

......................... + H2O + ....................... energia

B:

Glukosa + ........................

glukosa + ...................
........................ + H2O + energia

Osatu erreakzioak

Esan zein prozesuri dagokion erreakzio bakoitza: A : ................................................


B : .................................................

6. (2p) Definitu eta desberdindu hurrengo kontzeptu hauek:

Genotipoa / Fenotipoa

Gene / Aleloa

Antigenoa / Antigorputza

Birusa / Bakterioa

Eukariota / Prokariota

Entzima / Hormona

Defentsa espezifikoak / Defentsa inespezifikoak

7. (1p) Aipatu zein diren hurrrengo gaixotasunen eragileak eta transmisio bideak:
ERAGILEA

TRANSMISIO-BIDEA

Tetanoa

.............................

.............................

Hiesa

.............................

.............................

Paludismoa

.............................

.............................

Gripea

.............................

.............................

Behi eroen gaitza

.............................

.............................

8. (1p) Identifikatu irudian azaltzen den egitura, beren osagaiak izendatuz.

Ondoren aipatu egitura honek betetzen dituen 3 funtzio

3
2

CICLOS FORMATIVOS DE GRADO SUPERIOR

BIOLOGA
1. (2p) La imagen representa un proceso que tiene lugar en las clulas

(0,25p) De qu proceso se trata?

(1,25p) Identifica las estructuras y procesos


sealados por nmeros

1
3

1.

2.
3.

4.
5.
6.

7.
8.
9.
10.
11.

12.

10

13.

(0,5p) Explica el proceso representado en la


imagen

13
11
12

2. (0,5p) Si una clula humana se divide por mitosis....


a) Cuntos cromosomas tendr al comienzo de la divisin?
b) Cuntas cromtidas tendr cada cromosoma?
c) Cuntas clulas hijas se formarn?
d) Cuntos cromosomas tendr cada clula hija?
e) Por tanto, cmo sern las clulas hijas, haploides o diploides?
3. (0,5p) Si una clula humana se divide por meiosis....
a) Cuntos cromosomas tendr al comienzo de la divisin?
b) Cuntas clulas hijas se formarn?
c) Cuntos cromosomas tendr cada clula hija?
d) Por tanto, cmo sern las clulas hijas, haploides o diploides?
e) Cmo se denominan las clulas hijas?

4. (2p) En la nutricin se suele diferenciar los siguientes procesos:


a) (0,5p) Defnelos
Ingestin:
Digestin:
Transporte:
Metabolismo:
Excrecin:
b) (0,5p) Cita los aparatos /sistemas que toman parte en dichos procesos :
c) (1p) Explica dnde y cmo se realiza:
El intercambio de gases
La absorcin de nutrientes

5. (1p) Las siguientes reacciones qumicas expresan dos procesos fundamentales para lavida:

A:

......................... + H2O + energa .......................

B:

Glucosa + ........................

glucosa + ...................
........................ + H2O + energa

Completa las reacciones

Indica a qu proceso corresponde cada una de las reacciones: A : ....................................................


B : .................................................

6. (2p) Define y diferencia los siguientes conceptos:

Genotipo / Fenotipo

Gen / Alelo

Antgeno / Anticuerpo

Virus / Bacteria

Eucariota / Procariota

Enzima / Hormona

Defensas especificas / Defensas inespecficas

7. (1p) Indica qu agente infeccioso es el causante e cada una de las siguientes enfermedades, as como la
forma de contagio

AGENTE

FORMA DE CONTAGIO

Ttanos

.............................

.............................

Sida

.............................

.............................

Paludismo

.............................

.............................

Gripe

.............................

.............................

Mal de las vacas locas

.............................

.............................

8. (1p) Identifica la estructura que aparece en la figura e indica el nombre de sus componentes

Cita tres funciones que realiza dicha estructura

3
2

PRUEBA DE ACCESO A CICLOS FORMATIVOS


HEZIKETA ZIKLOETARA SARTZEKO FROGA
JUNIO 2010 / 2010EKO EKAINA

GOI MAILAKO ZIKLOAK / CICLOS DE GRADO SUPERIOR


ARLO ESPEZIFIKOA / PARTE ESPECFICA

BIOLOGA
BIOLOGIA

Abizenak
Apellidos

________________________________________________________

Izena
Nombre

Ordena Zkia.
__________________________________________N orden _______

Lurraldea
Territorio

N.A.N.
__________________ D.N.I. __________________

Ikastetxea
Centro

Adina
Edad _____

_________________________________________________________

GOI MAILAKO PRESTAKUNTZA ZIKLOAK

BIOLOGIA
1. (2p) GLUZIDOAK:

(0,25p) Gauza bera dira triosa eta trisakaridoa? Arrazoitu zure erantzuna.
(0,75p) Zein dira monosakarido nagusiak? Aipatu bakoitzak betetzen duen funtzioa.
(0,25p) Azaldu nola lotzen diren monosakaridoak.
(0,75p) Aipatu zein diren polisakarido nagusiak, bakoitzak duen kokapena eta betetzen duen
funtzioa azalduz.

2. (2p) INMUNOLOGIA

(0,5p) Azaldu zer den autoinmunitatea

(0,5p) Azaldu alergiaren prozesua

(1p) Bereizi:
 Txertoa eta gazura
 Antigeno eta antigorputza

3. (2p) MIKROBIOLOGIA.

(0,5p) Zein dira mikroorganismo prokariotoak eta eukariotoak?

(0,5p) Aipatu birus eta bakterioen arteko desberdintasunak.

(0,5p) Deskriba ezazu bakteriofago (birus) baten ziko litikoa.

(0,5p) Aipatu birusek eragindako 2 gaixotasun eta bakterioek eragindako beste bi.

4. (2p) GIZA ANATOMIA eta FISIOLOGIA.

(1p) Zer dira birika-albeoloak? Zergatik dira hain meheak beren paretak? Zer gertatzen da
pareta horietan zehar?

(1p) Egin bihotzaren marrazki eskematikoa eta seinalatu aurikulak, bentrikuluak, balbulak eta
sartzen eta ateratzen diren arterial eta benak. Adierazi odola zer noranzkotan mugitzen den.

5. (2p) Adierazi zer baieztapen diren okerrak eta zein zuzenak; arrazoitu erantzuna okerren kasuan.

Zelula izaki bizidunen egitura-unitatea da. Izaki zelulanitzak bakarrik, zelulez osatuta daude.
Zelula oro aurreko beste batetik dator. Zelula oro beste zelula batzuen fusiotik dator.
Zelula izaki bizidunen funtzio-unitatea da. Bizitza-zikloa osatzeko beharrezko prozesu
metaboliko guztiak egiten ditu.

Animalia-zelulek arnasketa zelularra egiteko organulu espezifikoak dituzte.


Landare-zelulek ez dute arnasketa zelularra egiteko organulu espezifikorik.
Landare-zelulek ez dute inguruarekiko elkarrekintza erregulatzen duen mintz
plasmatikorik.
Zatiketa zelularraren fasean ADNaren bikoizketa gertatzen da eta kromosomak ikusgai
egiten dira.
Mutazioak beti heredatzen dira.
Mutazioak eragileak dira espezien eboluziorako.
Mutazioak beti dira kaltegarriak organismorako.
Geneak ARNz osatuta daude.
Testikuluetan sortzen diren espermatozoide guztiek izango dituzte 22 autosoma eta X
kromosoma bat.

CICLOS FORMATIVOS DE GRADO SUPERIOR

BIOLOGA
1. (2p) GLCIDOS:

(0,25p) Es lo mismo una triosa que un trisacrido? Razona la respuesta

(0,75p) Cules son los principales monosacridos? Indica qu funcin desempea cada uno.

(0,25p) Explica cmo se unen los monosacridos

(0,75p) Cita cules son los principales polisacridos, indicando la localizacin y funcin de
cada uno.

2. (2p) INMUNOLOGA

(0,5p) Explica en qu consiste la autoinmunidad.

(0,5p) Explica el proceso de alergia

(1p) Diferencia:
 Vacuna y suero
 Antgeno y anticuerpo

3. (2p) MICROBIOLOGA.

(0,5p) Cules son los microorganismos procariotas y eucariotas?

(0,5p) Cita las diferencias entre virus y bacterias.

(0,5p) Describe el ciclo ltico de un bacterifago (virus).

(0,5p) Cita 2 enfermedades causadas por virus y otras dos causadas por bacterias

4. (2p) ANATOMA Y FISIOLOGA. HUMANAS

(1p) Qu son los alvolos pulmonares? Por qu sus paredes son tan finas? Qu ocurre a
travs de esas paredes

(1p) Haz un dibujo esquemtico del corazn y seala las aurculas, ventrculos, vlvulas y las
venas y arterias que entran y salen. Indica en qu direccin se mueve la sangre.

5. (2p) Indica qu afirmaciones son correctas y cules errneas; razona la respuesta si es errnea.

La clula es la unidad estructural de los seres vivos. Solamente los seres pluricelulares estn
formados por clulas.

Toda clula procede de una anterior.Toda clula procede de la fusin de otras clulas
La clula es la unidad funcional de los seres vivos. Realiza todos los procesos metablicos
necesarios para completar el ciclo de la vida.

Las clulas animales poseen orgnulos especficos para realizar la respiracin celular.
Las clulas vegetales no poseen orgnulos especficos para realizar la respiracin celular.
Las clulas vegetales no poseen membrana plasmtica que regule las interacciones con
el medio externo.
En la fase de divisin celular se produce la duplicacin del ADN y los cromosomas se
hacen visibles.
Las mutaciones siempre se heredan
Las mutaciones son responsables de la evolucin de las especies.
Las mutaciones son siempre perjudiciales para el organismo.
Los genes estn formados por ARN
Todos los espermatozoides que se formen en los testculos tendrn 22 autosomas y un
cromosoma X.

Ordena zkia
N orden

PRUEBA DE ACCESO A CICLOS FORMATIVOS


HEZIKETA ZIKLOETARA SARTZEKO PROBA
JUNIO 2011 / 2011KO EKAINA

GOI MAILAKO ZIKLOAK / CICLOS DE GRADO SUPERIOR


ARLO ESPEZIFIKOA / PARTE ESPECFICA

BIOLOGA
BIOLOGIA

Abizenak
Apellidos

________________________________________________________

Izena
Nombre

________________________________________________________

N.A.N.
D.N.I._________________________

1. (1p) CIDOS NUCLEICOS:


a) (0,25p) Concepto.
b) (0,25p) Composicin de los nucletidos.
c) ) (0,25p) Estructura secundaria del ADN.
d) (0,25p) Diferencias entre el ADN y el ARN.

2. (1p) CLULAS:
a) (0,25p) Diferencias entre clulas procariotas y eucariotas.
b) (0,25p) Diferencias entre clulas animales y vegetales.
c) (0,5p) Cules son los principales componentes de la membrana plasmtica? Realiza un dibujo mostrando
la estructura de la membrana plasmtica.

3. (1p) ENZIMAS:
a) (0,25p) Concepto.
b) (0,25p) Explica cmo influyen la temperatura y el pH en la actividad enzimtica.
c) (0,25p) ATP: composicin y funcin.
d) (0,25p) Define y diferencia los conceptos de anabolismo y catabolismo.

4. (1p) MITOSIS Y MEIOSIS:


a) (0,5p) Realiza un esquema de las distintas fases de la meiosis.
b) (0,25p) Explica la diferencia entre mitosis y meiosis.
c) (0,25p) Explica la diferencia entre genotipo y fenotipo.

5. (1p) VIRUS:
a) (0,25p) Estructura y composicin.
b) (0,5p) El ciclo ltico.
c) (0,25p) Cita alguna enfermedad producida por virus.

6. (0,25p) Asocia una biomolcula a cada una de las siguientes frases:


1. Componente de caparazones y paredes celulares (hongos)

A. cido nucleico

2. Cataliza las reacciones bioqumicas

B. Lpido

3. Est formada por la unin de aminocidos

C. Enzima

4. Almacena la informacin de un ser vivo

D. Quitina

5. Constituyente principal de las membranas biolgicas

E. Protena

7. (0,25p) El producto final de la glucolisis es:


a) Glucosa
b) Glucgeno
c) Acetil coA
d) cido pirvico

8. (0,25p) Relaciona las siguientes protenas con una funcin especfica de cada una:
1. Hemoglobina

A. Estructural

2. Insulina

B. Cataltica

3. Amilasa

C. Hormonal

4. Anticuerpo

D. Defensiva

5. Colgeno

E. Transporte

9. (0,25p) La capacidad que tiene el sudor para enfriar el cuerpo se debe a:


a) El elevado calor de vaporizacin del agua.
b) La elevada fuerza de cohesin entre las molculas de agua.
c) El carcter dipolar de la molcula de agua.
d) La baja densidad del agua.

10. (0,25p) La respiracin celular:


a) Consiste en el intercambio gaseoso entre la clula y el medio externo, mediante la difusin.
b) Es el conjunto de reacciones que tiene lugar en el interior de la clula.
c) Consiste en la oxidacin de los nutrientes hasta CO 2 y H 2 O para obtener energa.
d) Es un proceso anablico.

11. (0,25p) La siguiente lista enumera algunas de las posibles caractersticas de la transcripcin en procariotas. Indica
cul es correcta:
a) Todos los tipos de ARN son sintetizados por un nico tipo de ARN-polimerasa.
b) Tres tipos de ARN polimerasa son responsables de la sntesis de los distintos tipos de ARN.
c) El ARN mensajero es procesado antes de ser traducido.
d) El proceso ocurre en los ribosomas.
e) El proceso ocurre en el ncleo.

12. (0,25p) Llamamos hetertrofas a las clulas que son:


a) Eucariotas fotosintetizadoras.
b) Eucariotas y procariotas fotosintetizadoras.
c) Eucariotas y procariotas no fotosintetizadoras.
d) Procariotas fotosintetizadoras.

13. (0,25p) Relaciona las siguientes columnas:


1. Retculo endoplasmtico liso

A) Sntesis de lpidos

2. Lisosomas

B) Modificacin de protenas y lpidos

3. Mitocondrias

C) Sntesis de protenas

4. Ribosomas

D) Respiracin celular

5. Aparato de Golgi

E) Digestin celular

14. (0,25p) Indica cuntos cromosomas existen en la metafase y anafase mittica de una clula, siendo n = 8
a) 16 en metafase y 8 en anafase.
b) En metafase 16 con dos cromtidas y en anafase 32 de una cromtida.
c) En las dos fases hay 16 cromosomas de una cromtida.
d) En las dos fases hay 8 cromosomas de dos cromtidas.
e) 8 en metafase y 8 en anafase.

15. (0,25p) Las base pirirmidnicas que se encuentran en el ADN son:


a) Uracilo y timina.
b) Citosina, uracilo y guanina.
c) Citosina y timina.
d) Citosina, adenina y guanina.
16. (0,5p) Eva ha tenido un accidente y necesita una transfusin de sangre. Su grupo es B y Rh+. Sus amigos le han
llevado al hospital y estn dispuestos a donar sangre. De ellos sabemos:
a) Jon es del grupo 0 y sabe que sus dos progenitores don Rh- .
b) Maite es del grupo AB y sus dos progenitores don Rh+ .
c) Miren no sabe su grupo, pero est segura que su padre es del grupo 0 y su madre del B.
Cul o cules de los amigos de Eva podran donarle sangre?: Razona tu respuesta

17. (0,25p) El encfalo se divide en:


a) Cerebro, cerebelo y mdula espinal.
b) Mdula espinal, meninges y bulbo raqudeo.
c) Mdula espinal, cerebro y meninges.
d) Cerebro, cerebelo y bulbo raqudeo.
e) Cerebro, cerebelo y meninges.

18. (0,25p) Las hormonas que se encargan de regular los niveles de glucosa en sangre son:
a) El glucagn y la tiroxina.
b) La insulina y el glucagn.
c) La tiroxina y la insulina.
d) La progesterona y la adrenalina.
e) La adrenalina y la tiroxina.

19. (0,25p) El corazn humano:


a) Es un rgano musculoso situado en el trax constituido esencialmente por fibras musculares lisas.
b) Contienen cuatro cavidades comunicadas todas ellas entre s.
c) Presenta vlvulas aurculo-ventriculares y arteriales que aseguran el flujo unidireccional de sangre desde
las venas a las arterias a travs del corazn.
d) La contraccin auricular se produce al mismo tiempo que la ventricular.

20. (0,25p) El dixido de carbono se elimina del cuerpo utilizando una serie de rganos y vasos en el siguiente orden:
a) Vena pulmonar, alvolos, bronquios, bronquiolos.
b) Arteria pulmonar, alvolos, bronquiolos, bronquios.
c) Arteria pulmonar, bronquiolos, alvolos, bronquios.
d) Vena pulmonar, alvolos, bronquiolos, bronquios

21. (0,25p) Los riones cumplen una serie de funciones fundamentales para el organismo. Seala el enunciado
correcto:
a) La formacin de orina depende de procesos de filtracin glomerular seguidos de reabsorcin y
secrecin tubular.
b) Nunca se incluyen procesos de transporte activo.
c) La concentracin de la orina eliminada es siempre constante.
d) La orina slo contiene productos finales del metabolismo nitrogenado en solucin acuosa.
e) El volumen de orina eliminada es siempre constante.

22. (0,25p) Qu tipo de inmunidad resulta de la administracin de una vacuna que contenga un patgeno muerto?:
a) Inmunidad activa y artificial.
b) Inmunidad activa y natural.
c) Inmunidad pasiva y artificial.
d) Inmunidad pasiva y natural.

23. (0,25p) Los linfocitos T:


a) Se originan en el timo.
b) Producen anticuerpos.
c) Producen antgenos.
d) Se originan en la mdula sea.

24. (0,25p) La respuesta en la que participan los anticuerpos se denomina:


a) Respuesta inmune inespecfica celular.
b) Respuesta inmune especfica humoral.
c) Respuesta inmune especfica celular.
d) Respuesta inmune inespecfica humoral.

1. (1p) AZIDO NUKLEIKOAK:


a) (0,25p) Kontzeptua.
b) (0,25p) Nukleotidoen konposizioa.
c) ) (0,25p) ADNaren egitura sekundarioa.
d) (0,25p) ARN eta ADN aren arteko aldeak.

2. (1p) ZELULAK:
a) (0,25p) Zelula prokariotikoaren eta eukarioikoaren arteko aldeak.
b) (0,25p) Animalia- eta landare-zelulen arteko aldeak.
c) (0,5p) Zein dira mintz plasmatikoaren osagai nagusiak? Egin mintz plasmatikoaren egitura adierazten duen
marrazkia,

3. (1p) ENTZIMAK:
a) (0,25p) Kontzeptua
b) (0,25p) Adierazi nolako eragina duten tenperaturak eta pH-ak ekintza entzimatikoan.
c) (0,25p) ATP-a: konposizioa eta funtzioa.
d) (0,25p) Definitu eta alderatu katabolismoaren eta anabolismoaren kontzeptuak.

4. (1p) MITOSIA ETA MEIOSIA:


a) (0,5p) Egin mitosiaren fase bakoitzeko eskemak.
b) (0,25p) Azaldu mitosiaren eta meiosiaren artreko aldeak.
c) (0,25p) Azaldu genotipoaren eta fenotipoaren arteko aldeak.

5. (1p) BIRUSAK
a) (0,25p) Egitura eta konposizioa.
b) (0,5p) Ziklo litikoa
c) (0,25p) Aipatu birusek eragindako zenbait gaixotasun.

6 . (0,25p) Erlazionatu esaldiak eta biomolekulak:


1. Oskolen eta pareta zelularraren osagaia (onddoak).

A. Azido nukleikoa

2. Erreakzio biokimikoen katalizatzailea.

B. Lipidoa

3. Aminoazidoez osatuta dago

C. Entzima

4. Izaki bizidunen informazioa biltzen du

D. Kitina

5. Mintz biologikoen osagai nagusia.

E. Proteina

7. (0,25p) Zein da glukolisiaren azken produktua?:


a) Glukosa.
b) Glukogenoa.
c) Azetil-koA.
d) Azido pirubikoa.
8. (0,25p) Erlaziona itzazu ondorengo proteinak bakoitzak betetzen duen funtzio espezifiko batekin:
1. Hemoglobina

A. Egiturazkoa

2. Intsulina

B. Katalitikoa

3. Amilasa

C. Hormonala

4. Antigorputza

D. Defentsa

5. Kolagenoa

E. Garraioa

9. (0,25p) Izerdiak gorputza hozteko ahamen handia du:


a) Uraren lurruntze-bero handiagatik.
b) Ur molekulen atxikidura-indar handiagatik.
c) Ur molekularen izaera dipolarrarengatik.
d) Uraren dentsitate baxuagatik.

10. (0,25p) Arnasketa zelularra:


a) Zelula eta kanpo ingurunearen artean, difusio bidez, egiten den gas-trukea da.
b) Zelularen barruan gertatzen den erreakzio-multzoa da.
c) Nutrienteak CO 2 eta H 2 O bihurtu arte oxidatzea da, energia lortzeko.
d) Prozesu anabolikoa da.
.
11. (0,25p) Prokariotoen transkripzioak izan ditzakeen ezaugarrietako batzuk zerrendatu dira jarraian. Zein da zuzena?
a) ARN polimerasa mota bakar batek sintetizatzen ditu ARN mota guztiak.
b) Hiru ARNpolimerasa motek sintetizatzen dituzte ARN ezberdinak.
c) ARN mezulariak heltze prozesua behar du itzulpena baino lehen.
d) Prozesua erribosometan gertatzen da.
e) Prozesua nukleoan gertatzen da.

12. (0,25p) Hurrengo zelula hauei heterotrofo deitzen diegu:


a) Eukarioto fotosintetikoak.
b) Eukarioto eta prokarioto fotosintetikoak.
c) Eukarioto eta prokarioto ez-fotosintetikoak.
d) Prokarioto fotosintetikoak.

13. (0,25p) Erlaziona itzazu hurrengo zutabeak:


1. Erretikuku endoplasmatiko leuna

A) Lipidoen sintesia

2. Lisosomak

B) Proteinen eta lipidoen eraldaketa

3. Mitokondriak

C) Proteinen sintesia

4. Erribosomak

D) Arnasketa zelularra

5. Golgi-aparatua

E) Digestio zelularra

14. (0,25p) Adierazi zelula batek zenbat kromosoma dituen metafase eta anafase mitotikoan, n = 8 dela jakinda.
a) 16 metafasean eta 8 anafasean.
b) Bi kromatidako 16 metafasean eta kromatida bakarreko 32 anafasean.
c) Kromatida bakarreko 16 bi faseetan .
d) Bi kromatidako 8 kromosoma bi faseetan.
e) 8 metafasean eta 8 anafasean..

15. (0,25p) ADNan azaltzen diren base pirimidinikoak hauek dira:


a) Uraziloa eta timina
b) Zitosina, uraziloa eta guanina.
c) Zitosina eta timina.
d) Zitosina, adenina eta guanina.
16. (0,5p) Evak istripua izan du eta odol-transfusioa behar du. Bere odol-taldea B da eta Rh+. Lagunek ospitalera
eraman dute eta odola emateko prest daude. Hau dakigu haiei buruz:
a) Jon 0 taldekoa da eta bere gurasoek Rh- direla badaki
b) Maite AB taldekoa da eta bere gurasoak Rh+ .
c) Mirenek ez daki zein den bere odol-taldea, baina ziur dago aita 0 taldekoa dela eta ama B taldekoa.
Zeinek eman diezaioke odola Evari?: Arrazoitu zure erantzuna

17. (0,25p) Entzefaloa honela dago banatuta:


a) Garuna, zerebeloa eta bizkarrezur-muina.
b) Bizkarrezur-muina, meningeak eta bizkarrezur-erraboila.
c) Bizkarrezur-muina, garuna eta meningeak.
d) Garuna, zerebeloa eta bizkarrezur-erraboila.
e) Garuna, zerebeloa eta meningeak.

18. (0,2p) Hauek dira odoleko glukosa maila erregulatzeaz arduratzen diren hormonak:
a) Glukagoia eta tiroxina.
b) Intsulina eta glukagoia.
c) Tiroxina eta intsulina.
d) Progesterona eta adrenalina.
e) Adrenalina eta tiroxina.

19. (0,25p) Gizakiaren bihotza:


a) Toraxean dagoen organo muskulutsua da, batez ere muskulu-zuntz leunak osasutakoa.
b) Beren artean komunikatuta dauden lau barrunbe ditu.
c) Odola benetatik arterietara norabide bakarrean, bihotzaren bidez, igarotzea bermatzen duten balbula
aurikular-bentrikularrak eta arterialak ditu.
d) Aurikuluen uzkurdura bentrikuluenarekin batera gertatzen da.

20. (0,25p) Karbono dioxidoa kanporatzen da organo eta baso batzuk ordena honetan erabiliz.
a) Birika-bena, albeoloak, bronkioak, bronkioloak.
b) Birika-arteria, albeoloak, bronkioloak, bronkioak.
c) Birika-arteria, bronkioloak, albeoloak, bronkioak.
d) Birika-bena, albeoloak, bronkioloak, bronkioak.
21. (0,25p) Giltzurrunek organismorako beharrezkoak diren hainbat funtzio betetzen dituzte: Seinala ezazu esaldi
egokia.
a) Gernua iragazketa glomerularreko prozesuen bidez eta, ondoren, birxurgapenaren eta jariaketa tubularraren bidez sortzen da.
b) Inoiz ez da garraio aktiboko prozesurik izaten.
c) Kanporatutako gernuaren kontzentrazioa konstantea da beti.
d) Gernuak metabolismo nitrogenatuaren azken produktuak besterik ez du, ur-disoluzioan.
e) Kanporatutako gernuaren bolumena konstantea da beti.

22. (0,25p) Patogeno hila duen txertoa hartu ondoren, zein immunitate-mota izango dugu?
a) Immunitate aktiboa eta artifiziala.
b) Immunitate aktiboa eta naturala.
c) Immunitate pasiboa eta artifiziala.
d) Immunitate pasiboa eta naturala.
23. (0,25p) T linfozitoei dagokionez:.
a) Timoan sortzen dira
b) Antigorputzak sortzen dituzte.
c) Antigenoak sortzen dituzte.
d) Hezur-muinean sortzen dira.

24. (0,25p) Antigorputzek ematen duten erantzuna deitzen da:


a) Erantzun immune inespezifiko zelularra.
b) Erantzun immune espezifiko humorala.
c) Erantzun immune espezifiko zelularra.
d) Erantzun immune inespezifiko humorala.

Ordena zkia
N orden

PRUEBA DE ACCESO A CICLOS FORMATIVOS


HEZIKETA ZIKLOETARA SARTZEKO PROBA
JUNIO 2012 / 2012KO EKAINA

GOI MAILAKO ZIKLOAK / CICLOS DE GRADO SUPERIOR


ARLO ESPEZIFIKOA / PARTE ESPECFICA

BIOLOGA
BIOLOGIA

Abizenak
Apellidos

________________________________________________________

Izena
Nombre

________________________________________________________

N.A.N.
D.N.I._________________________

pgina 1 orria

1. (2p) Responde a las siguientes cuestiones:


a.

(0,2p) Qu ventajas puede suponer para un ser vivo disponer de sistemas tampn en su medio interno?

b. (0,2p) Qu le ocurrira a un glbulo rojo si lo ponemos en una solucin hipotnica?

c.

(0,1p) Qu tipo de enlace se establece entre los monosacridos?

d. (0,1p) Qu enlaces mantienen la estructura primaria de una protena?

e.

(0,1p)Qu funcin tiene el almidn en los seres vivos?

f.

(0,1p) Cul es el componente principal de la pared de las clulas vegetales?

g.

(0,2p) Por qu los fosfolpidos son molculas anfipticas?

h.

(0,2p) Por qu el colesterol es necesario para las clulas?

i.

(0,1p) Qu grupos funcionales tienen todos los aminocidos?

j.

(0,2p) Qu significa que los aminocidos son sustancias anfteras?

k.

(0,1p) Por qu a los enzimas se les llama biocatalizadores?

l.

(0,2p) Qu diferencia hay entre un nucletido y un nuclesido?

m. (0,2p) Qu funcin realiza el ATP?

pgina 2 orria

2. (0,2p) La desnaturalizacin de una enzima supone (seala la respuesta correcta) :


a) La disminucin de su energa de activacin.
b) La ruptura de los enlaces peptdicos.
c) La modificacin de su estructura tridimensional.
d) La modificacin de su sustrato.

3. (0,25p) La presencia de carbonos asimtricos en los monosacridos es responsable:


a) De la aparicin de estereoismeros

b) De su color blanco

c) De la actividad ptica de la molcula

d) De su sabor dulce

e) De su solubilidad en agua

4. (0,25p) La siguiente lista enumera algunas de las posibles caractersticas del ADN en eucariotas.
(Seala las letras que corresponden a las caractersticas reales de la replicacin en
eucariota)s.
a) Modelo semiconservativo

d) Mltiples orgenes de replicacin

b) Modelo conservativo

e) Ocurre durante la mitosis

c) Origen nico de replicacin

f) Ocurre durante la interfase

5. (0,5p) Responde a las siguientes preguntas:


a) Qu etapas se distinguen en el ciclo celular?:
b) En qu fase de la mitosis los cromosomas se sitan alineados en el plano ecuatorial de la clula?:
.....
c) Cundo una clula sufre meiosis, cuntas clulas se originan?: .
d) Qu clulas humanas son haploides?:
e) Cul es el nmero diploide de la especie humana?:

6. (0,2p) Si en una mutacin del ADN se encuentra una base prica donde haba una pirimdinica,
ahora hay: (seala la respuesta correcta)
a) Adenina donde haba timina

d) Adenina donde haba uracilo

b) Citosina donde haba guanina

e) Citosina donde haba uracilo

c) Citosina donde haba timina

7. (0,2p) Hay 40 cromosomas en las clulas somticas del ratn de campo. Cuntos autosomas se
encuentran en un gameto de ese ratn? (seala la respuesta correcta)
a) 20

d) 38

b) 1

e) Los gametos no tienen autosomas

c) 19

pgina 3 orria

8. (0,2p) Una molcula de glucosa cuyo destino es una clula renal, podra seguir, entre otros, el
siguiente recorrido: (seala la respuesta correcta)
a) Arteria renal, glomrulo, tbulo colector, cpsula de Bowman, clula
b) Vena renal, capilares venosos, capilares arteriales, clula.
c) Arteriola renal, cpsula de Bowman, tbulo contorneado, capilares, clulas.
d) Vnula renal, glomrulo, tbulo colector, tbulo contorneado, clula
e) Arteriola renal, capilares venosos, capilares, clulas.

9. (0,2p) Cul de los siguientes vasos contiene sangre no oxigenada? (seala la respuesta correcta)
a) Arteria pulmonar

c) Arteria aorta

b) Vena pulmonar

d) Arteria cartida

10. (0,25p) Completa la siguiente tabla:


GRUPO SANGUNEO

AGLUTINGENOS

AGLUTININAS

A
B
AB
0

11. (0,25p) Relaciona las dos columnas:


a)
b)
c)
d)
e)

Esfago
Estmago
Ploro
Pncreas
Intestino grueso

1.
2.
3.
4.
5.

Salida del estmago


Transporte del bolo alimenticio
Produce una secrecin rica en enzimas
Segrega un jugo cido
Absorbe agua y sales

12. (0,5p) Responde a las siguientes cuestiones:


a.

Dnde se produce la bilis?: .

b. Dnde se almacena la bilis?:


c.

Dnde se sintetiza la insulina?:..

d. Dnde se sintetiza la adrenalina? :..


e.

Cmo se denominan los rganos secretores de hormonas?:.

13. (1,5p) Virus y bacterias


a) (0,5p) En qu se diferencian? Son todos patgenos?
b) (0,5p) Describe la estructura de las bacterias.
b) (0,5p) Describe los ciclos vitales de los virus.

pgina 4 orria

14. (1p) La inmunidad puede ser natural/ artificial y activa/pasiva.


a) (0,25p) Explica las caractersticas de cada tipo de inmunidad
b) (0,25p) Describe la estructura de un anticuerpo.
c) (0,25p) Explica cmo se desarrolla un proceso alrgico.
d) (0,25p) Diferencia enfermedad autoinmune e inmunodeficiencia; cita ejemplos.

15. (1,5p) Metabolismo.


a) (0,25p) Diferencia anabolismoa y catabolismo.
b) (0,25p) Qu es el ATP? Cul es su funcin?
c) (0,25p) Qu es la fotosntesis? Por que se dice que es un proceso anablico?
d) (0,25p) Por qu la fotosntesis es el proceso bioqumico ms importante para la biosfera?
c) (0,5p) Explica los tipos de respiracin celular.

16. (1p) Clula.


a) (0,25p) Realiza un dibujo mostrando la estructura de la membrana celular.
b) (0,25p) Qu dos grandes tipos de transporte a travs de la membrana conoces?
c) (0,25p) Cita cinco orgnulos membranosos de las clulas eucariticas.
d) (0,25p) Indica la localizacin de los ribosomas en las clulas procariticas y eucariticas.

pgina 5 orria

1.. (2p) Eman erantzuna hurrengo galdera hauei:


a.

(0,2p) Zer hobari dauka izaki bizidun batentzat barneko inguruan tanpoi-sistemak edukitzeak?

b. (0,2p) Zer gertatuko litzaioke globulu gorri bati disoluzio hipotonikoan jarriz gero?

c.

(0,1p) Zer lotura-mota ezartzen da monosakaridoen artean?

d. (0,1p) Zer loturek mantentzen dute proteina baten egitura primarioa?

e.

(0,1p) Zer funtzio du almidoiak izaki bizidunetan?

f.

(0,1p) Zein da landare-zelulen paretaren osagai nagusia?

g.

(0,2p) Fosfolipidoak zergatik dira molekula anfipatikoak?

h.

(0,2p) Zergatik da beharrezkoa kolesterola zeluletarako?

i.

(0,1p) Zein dira aminoazido guztien talde funtzionalak?

j.

(0,2p) Zer esan nahi du aminoazidoek sustantzi anfoteroak direla?

k.

(0,1p)Zer dela eta esaten zaie biokatalizatzaile entzimei?

l.

(0,2p) Zer alde dago nukleosidoaren eta nukleotidoaren artean?

m. (0,2p) Zein funtzio du ATPak?

pgina 6 orria

2. (0,2p) Entzima bat desnaturalizatzen bada: (adierazi erantzun zuzena)


a) Bere aktibazio-energia gutxitzen da.
b) Lotura peptidikoak hausten dira
c) Bere egitura tridimentsionala aldatzen da.
d) Bere sustratua aldatzen da.

3. (0,25p) Monosakaridoetan karbono asimetrikoak egotearen ondorioz


a) Estereoisomeroak agertzen dira

b) Kolore zuria dute

c) Jarduera optikoa dute

d) Zapore gozoa dute

e) Uretan disolbagarriak dira

4. (0,25p) Eukariotoetako DNAren erreplikazioak izan ditzakeen ezaugarrietako batzuk azaltzen dira
jarraian. Idatz itzazu eukariotoetako erreplikazioaren benetako ezaugarriei dagozkien
letrak.
a) Eredu erdikontserbatzailea

d) Erreplikazioaren hainbat jatorri

b) Eredu kontserbatzailea

e) Mitosian gertatzen da.

c) Erreplikazioaren jatorri bakarra

f) Interfasean gertatzen da.

5. (0,5p) Eman erantzuna hurrengo galdera hauei:


a) Zein aldi bereizten dira ziklo zelularrean?:
b) Mitosiaren zein fasetan lerrokatzen dira kromosomak zelularen ekuatore-planoan?:...
c) Zelula batek meiosia jasaten duenean, zenbat zelula sortzen dira?: .
d) Zein giza_zelula dira haploideak?:
e) Zein da gizakiaren zenbaki diploidea? :

6. (0,2p) ADNaren mutazio batean base pirimdinikoa zegoen tokian base puriko bat badago, orain
hau izango dugu: (adierazi erantzun zuzena)
a) Adenina timina zegoen tokian

d) Adenina uracilo zegoen tokian

b) Zitosina guanina zegoen tokian

e) Zitosina uracilo zegoen tokian

c) Zitosina timina zegoen tokian

7. (0,2p) Basasaguaren zelula somatikoetan, 40 kromosoma daude. Zenbat autosoma daude basasagu

horren gameto batean ?


a) 20

d) 38

b) 1

e) Gametoek ez dute autosomarik.

c) 19

pgina 7 orria

8. (0,2p) Giltzurrun-zelula batera iritsi behar duen glukosa-molekula batek, besteak beste, ibilbide
hau egin dezake: : (adierazi erantzun zuzena)
a) Giltzurrun-arteria, glomerulua, hodi biltzailea,, Bowman-kapsula, zelula.
b) Giltzurrun-bena, kapilar benosoak, kapilar arterialak, zelula.
c) Giltzurrun-arteriola, Bowman-kapsula, hodi bihurgunetsua, kapilarrak, zelula.
d) Giltzurrun-benula, glomerulua, hodi biltzailea, hodi bihurgunetsua, zelula
e) Giltzurrun-arteriola, kapilar benosoak, kapilarrak, zelula.

9. (0,2p) Hurrengo basoen artean, zeinek du odol ez oxigenatua? (aukeratu erantzun zuzena)
a) Birika arteria

c) Arteria aorta

b) Birika bena

d) Arteria karotida

10. (0,25p) Osatu hurrengo taula:


ODOL-TALDEA

AGLUTINOGENOAK

AGLUTININAK

A
B
AB
0
11. (0,25p) Erlazionatu hurrengo zutabeak:
a)
b)
c)
d)
e)

Esofagoa
Urdaila
Piloroa
Pankreasa
Heste lodia

1.
2.
3.
4.
5.

Urdailaren irteera
Elikadura boloa garraiatzen du.
Jariatzen duen urina entzima ugari ditu.
Urin azido jariatzen du.
Ura eta gatzak xurgatzen ditu

12. (0,5p) Eman erantzuna hurrengo galdera hauei:


a.

Non sintetizatzen da behazuna?: .

b. Non biltzen da behazuna?:


c.

Non sintetizatzen da intsulina?. ..

d. Non sintetizatzen da adrenalina?:..


e.

Nola deitzen dira hormonak jariatzen dituzten organoak?:.

13. (1,5p) Birusak eta bakteriok:


a) (0,5p) Zertan bereizten dira? Denak patogenoak al dira?
b) (0,5p) Deskribatu bakterioen egitura
b) (0,5p) Deskribatu birusen bizi-zikloak.

pgina 8 orria

14. (1p) Immunitatea izan daiteke naturala/ artifiziala eta aktiboa/pasiboa.


a) (0,25p) Azaldu immunitate bakoitzaren ezaugarriak
b) (0,25p) Deskribatu antigorputzen egitura.
c) (0,25p) Azaldu nola garatzen den prozesu alergikoa.
d) (0,25p) Bereizi gaixotasun autoimmunea eta immunoeskasia; jarri adibideak

15. (1,5p) Metabolismoa.


a) (0,25p) Bereizi anabolismoa eta katabolismoa
b) (0,25p) Zer da ATPa? Zein da bere funtzioa?
c) (0,25p) Zer da fotosintesia? Zergatik esaten da prozesu anabolikoa dela?
d) (0,25p) Zer dela-eta da fotosintesia biosferarako prozesu biokimikorik garrantzitsuena?
c) (0,5p) Azaldu arnasketa zelular motak

16. (1p) Zelula.


a) (0,25p) Egin mintz zelularraren egitura adierazten duen marrazkia.
b) (0,25p) Zein bi garraio mota nagusi ezagutzen duzu mintzetan zehar?
c) (0,25p) Aipatu zelula eukariotikoetako bost mintz-organulu.
d) (0,25p) Adierazi zein lekutan kokatzen diren erribosomak zelula prokariotoetan eta zelula
eukariotikoetan.

pgina 9 orria

pgina 10 orria

PRUEBA DE ACCESO
A CICLOS FORMATIVOS DE GRADO SUPERIOR
JUNIO 2010
PARTE ESPECFICA OPCIN C CIENCIAS.
Materia: BIOLOGA Y CIENCIAS DE LA TIERRA
Duracin: 1h15

RESPONDE A 5 DE LAS 6 PREGUNTAS PROPUESTAS

Pregunta 1.
Clasifica las siguientes sustancias en las casillas vacas de la siguiente tabla:
Testosterona, Lactosa, Amilasa, Actina, cido oleico, Fructosa,
esterico, Celulosa

ARN,

Almidn,

cido

cido graso insaturado


cido graso saturado
cido nucleico
Disacrido
Enzima
Hormona
Monosacrido
Polisacrido
Protena

Pregunta 2.
Funciones de los lpidos.

Pregunta 3.
a)
Pon nombre (no en esta hoja sino en folio
aparte) a las referencias numricas de la
siguiente figura
b)
Es una clula procariota o eucariota?,
Por qu?
c)
Se trata de una clula animal o vegetal?,
Por qu?
d)

Explica las funciones de 6, 8 y 11.

Pregunta 4.
Define: desoxiribosa, ATP, esternocleidomastoideo, bomba de sodio / potasio y ventrculo.
CRITERIOS DE EVALUACIN Y CALIFICACIN
- Todas las cuestiones puntan igual.
- La calificacin de esta Parte o Apartado se adaptar a lo establecido en la RESOLUCIN de 15 de marzo de 2010, de la Direccin general de
Evaluacin, Innovacin y Calidad Educativa y de la Formacin Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de
Formacin Profesional. (DOCV 13.04.2010)

Pregunta 5.
El siguiente esquema se refiere al ciclo biogeoqumico del carbono. Explcalo.

Pregunta 6.
De todas las maneras en que nuestra especie podra extinguirse rpidamente, los cientficos,
convertidos en nuevos profetas del fin del mundo, llaman la atencin hacia varios factores, entre ellos estn
la degradacin ambiental que el propio ser humano provoca con la continua acumulacin en el aire de
sustancias qumicas txicas. A corto plazo, el recalentamiento del planeta no hace peligrar la supervivencia
de la especie humana, pero a largo plazo podemos acabar como Venus, donde un efecto invernadero
descontrolado ha generado una atmsfera cida y elevado la temperatura de la corteza hasta los 500 C.
Otro de los factores con que la propia especie se amenaza a s misma es para muchos cientficos el mayor
peligro, y se trata de la curiosidad humana y la manipulacin poco escrupulosa de la tecnologa.
SEMANAL n853, febrero de 2004.
a) Analiza el texto anterior y comenta brevemente la problemtica que se plantea.
b) Qu efecto trmico tiene el aumento del CO2 en la atmsfera? Qu hbitos estaras
dispuesto a cambiar para contribuir a la reduccin de las emisiones de gases de efecto
invernadero?
c) En relacin con un posible calentamiento atmosfrico del planeta, aumentara el vapor de
agua en la atmsfera? Subira el nivel de los ocanos? Razona la respuesta.
d) Qu es el efecto invernadero? Comenta dos gases principales del efecto invernadero y sus
fuentes de emisin.
e) Cmo ha conseguido el ser humano influir en la subida de las temperaturas? Qu
consecuencias puede acarrear el aumento de la temperatura en el planeta? Razona las
respuestas.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las cuestiones puntan igual.
- La calificacin de esta Parte o Apartado se adaptar a lo establecido en la RESOLUCIN de 15 de marzo de 2010, de la Direccin general de
Evaluacin, Innovacin y Calidad Educativa y de la Formacin Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de
Formacin Profesional. (DOCV 13.04.2010)

PRUEBA DE ACCESO
A CICLOS FORMATIVOS DE GRADO SUPERIOR
JUNIO 2011
PARTE ESPECFICA OPCIN C CIENCIAS.
Materia: BIOLOGA Y CIENCIAS DE LA TIERRA
Duracin: 1h15

RESPONDE A 5 DE LAS 6 PREGUNTAS PROPUESTAS

Pregunta 1 Importancia biolgica de la molcula del agua.

Pregunta 2 El ser humano se encuentra en contacto con multitud de microorganismos. Algunos son inocuos o
incluso beneficiosos para nuestra salud, pero otros son perjudiciales. Contesta las siguientes preguntas:
a)

Qu es un patgeno?

b)

Qu microorganismos pueden producir enfermedades en el ser humano?

c)

Cita un ejemplo de enfermedad producida por cada uno de los tipos de microorganismos que has
indicado en el apartado anterior.

d)

Son contagiosas todas las enfermedades infecciosas? Y al contrario, son infecciosas todas las
enfermedades contagiosas? Razona tu respuesta.

e)

Qu es un antibitico? Es til para tratar cualquier enfermedad infecciosa?

Pregunta 3 El siguiente dibujo representa el aparato digestivo del ser humano.


a)

Identifica las partes sealadas.

b)

Qu secrecin producen 2, 5, 6 y 7 respectivamente?

c)

Indica en qu parte tienen lugar cada uno de los


siguientes procesos:
1. Masticacin.
2. Digestin qumica.
3. Absorcin de los nutrientes.
4. Formacin de las heces.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las cuestiones puntan igual.
- La calificacin de esta parte se adaptar a lo establecido en la RESOLUCIN de 17 de marzo de 2011, de la Direccin General de Evaluacin,
Innovacin y Calidad Educativa y de la Formacin Profesional, por la que se convocan pruebas de acceso a los Ciclos Formativos de la Formacin
Profesional. (DOCV 01.04.2011)

Pregunta 4 Relaciona cada uno de los siguientes orgnulos celulares con su funcin:
1

Retculo endoplasmtico liso

Motilidad celular

Lisosomas

Fotosntesis

Mitocondrias

Digestin intracelular

Ribosomas

Almacenamiento de sustancias

Complejo de Golgi

Sntesis de lpidos

Cloroplastos

Respiracin celular

Vacuolas

Sntesis de protenas

Cilios

Procesos de secrecin

Centrosoma

Replicacin del ADN

10

Ncleo

Centro organizador de microtbulos

10

Pregunta 5 La calvicie es un carcter hereditario influido por el sexo, dominante en los hombres y recesivo en
las mujeres. (C: calvicie; N: no calvicie). Indica el genotipo de un hombre calvo cuyo padre no era calvo, el de su
esposa que no es calva, pero cuya madre s lo era, y el de sus futuros hijos. Realiza un esquema de
cruzamiento y explica los resultados.

Pregunta 6 Lee el siguiente texto y contesta las cuestiones planteadas:


En general, la presin sobre la fauna y la flora ir en direccin sur a norte y desde el suroeste espaol hacia al
noreste, explica Felicsimo. Ante el clima ms duro, las especies migran al norte o suben en altura. Pero la fragmentacin
de los hbitats provocada por el hombre y la rapidez de los cambios que estamos experimentando har difcil que las
especies se adapten como han hecho en el pasado a los cambios del clima, afirma el profesor.
Esteban Manrique seala la importancia de lo que esta investigacin nos indica: Cuando hablamos de
biodiversidad, nos referimos a la naturaleza, la que nos da todos los bienes y servicios que necesitamos para vivir. Lo que
ocurre a la fauna y la flora tambin nos afecta a nosotros directamente. No hay que olvidar que los alimentos vienen del
campo, no del supermercado.
EL MUNDO, mircoles 9 de marzo de 2011.

a)

Analiza el texto y comenta brevemente la problemtica que se plantea.

b)

Qu se entiende por biodiversidad?

c)

Seala las razones que justifiquen la necesidad de conservar la biodiversidad en los ecosistemas.
Cmo influye la desaparicin de especies en el resto del ecosistema?

d)

Indica las principales causas antropognicas en la extincin de especies.

e)

A la vista del texto anterior, crees que los ecosistemas cambiaran si no actuara el hombre sobre
ellos? Justifica tu respuesta.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las cuestiones puntan igual.
- La calificacin de esta parte se adaptar a lo establecido en la RESOLUCIN de 17 de marzo de 2011, de la Direccin General de Evaluacin,
Innovacin y Calidad Educativa y de la Formacin Profesional, por la que se convocan pruebas de acceso a los Ciclos Formativos de la Formacin
Profesional. (DOCV 01.04.2011)

PRUEBA DE ACCESO
A CICLOS FORMATIVOS DE GRADO SUPERIOR
JUNIO 2012
PARTE ESPECFICA OPCIN C CIENCIAS.
Materia: BIOLOGA Y CIENCIAS DE LA TIERRA
Duracin: 1h15
RESPONDE A 5 DE LAS 6 PREGUNTAS PROPUESTAS
Pregunta 1 Relaciona cada una de las siguientes caractersticas con el componente de la materia viva que
corresponda.
1

Es el ms indispensable de todos los nutrientes.

Glcidos

Son los principales combustibles que utilizan las clulas para obtener
energa.

Protenas

Son elementos inorgnicos imprescindibles para que el organismo


funcione de manera correcta, aunque en cantidades muy pequeas.

cidos nucleicos

Estn formadas por molculas ms sencillas llamadas aminocidos.

Sales minerales

Contienen la informacin gentica de los seres vivos.

Enzimas

Son biomolculas de naturaleza heterognea, que nuestro organismo


necesita en pequeas cantidades, siendo su presencia imprescindible
para el desarrollo normal del organismo.

Lpidos

Son molculas de naturaleza proteica que catalizan reacciones


bioqumicas, siendo conocidas como biocatalizadores o catalizadores
biolgicos.

Vitaminas

Constituyen las principales reservas energticas del organismo.

Agua

Pregunta 2 En relacin a la fotosntesis:


a)
b)
c)
d)

Define fotosntesis. Qu seres vivos la realizan?


Qu orgnulos participan en este proceso?
Cules son sus fases? Indica qu proceso bsico se realiza en cada una de ellas.
Escribe la reaccin global de la fotosntesis.

Pregunta 3 En relacin al cdigo gentico:


a)
b)
c)

Qu es el cdigo gentico y para qu sirve?


Qu es un codn?
Explica cuatro caractersticas del cdigo gentico.

Pregunta 4 Se cruzan dos cobayas homocigticos, uno de ellos de pelaje liso de color negro y otro de pelaje
rizado y blanco. El rizado domina sobre el liso, mientras que el blanco es recesivo.
a)
b)
c)

Utilizando smbolos genticos para los caracteres definidos, indica los genotipos de ambos parentales.
Indica los genotipos y los fenotipos que tienen los individuos de la F1.
Calcula las proporciones genotpicas y fenotpicas de la F2.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las cuestiones puntan igual.
- La calificacin de esta parte se adaptar a lo establecido en la RESOLUCIN de 3 de abril de 2012 de la Direccin General de Formacin y
Cualificacin Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formacin Profesional. (DOCV 27.04.2012)

Pregunta 5
Lee el siguiente texto y contesta las cuestiones planteadas:
Nuevos esfuerzos internacionales para lograr una vacuna contra la tuberculosis
Para erradicar la tuberculosis se necesitan mejores herramientas diagnsticas, tratamientos ms eficaces y una
vacuna capaz de prevenir el contagio. Con este ltimo objetivo se han unido los principales actores implicados en
la lucha contra esta enfermedad para apoyar un plan de accin dirigido a acabar con esta infeccin respiratoria.
()
Esta enfermedad infecta cada ao a nueve millones de personas y se cobra al menos otro milln y medio de
vidas. Pero ms all de las prdidas humanas, la tuberculosis supone tambin una importante carga
econmica en numerosos pases en desarrollo, debido a que se ceba sobre todo con adultos jvenes.
La nica vacuna disponible en la actualidad (la llamada BCG, diseada en 1925) muestra unos buenos niveles
de proteccin en los nios, pero no resulta tan eficaz cuando los pacientes llegan a la adolescencia y la
enfermedad est en su fase respiratoria, en la que resulta altamente contagiosa.
Por eso, los nuevos esfuerzos van dirigidos a disear una nueva terapia, ms eficaz que sta, bien por s sola o
en combinacin con ella. ()
EL MUNDO.es, martes 20 de marzo de 2012

a)
b)
c)

Analiza el texto y comenta brevemente la problemtica que se plantea.


Qu son las vacunas y para qu se utilizan?
En qu casos deben utilizarse las vacunas?

Pregunta 6
Relaciona cada uno de los siguientes conceptos con su definicin:
PRODUCTORES - COMUNIDAD CADENA TRFICA - BIOTOPO -DESCOMPONEDORES - POBLACIN ECOSISTEMA CONSUMIDORES
1

Medio fsico que ocupa una biocenosis.

Nivel trfico de un ecosistema formado por organismos detritvoros


que transforman la materia orgnica procedente de los restos de los
seres vivos del ecosistema y la transforman en materia inorgnica.

Representacin lineal de las relaciones alimentarias entre los


diferentes seres vivos de un ecosistema.

Conjunto de individuos de la misma especie que viven en un rea


determinada.

Conjunto de poblaciones que comparten un mismo territorio.

Nivel trfico de un ecosistema formado por seres vivos capaces de


fabricar su propio alimento.

Conjunto formado por una comunidad y su biotopo, y las relaciones


que se establecen entre ellos.

Nivel trfico de un ecosistema constituido por aquellos organismos


que se alimentan de otros seres vivos.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las cuestiones puntan igual.
- La calificacin de esta parte se adaptar a lo establecido en la RESOLUCIN de 3 de abril de 2012 de la Direccin General de Formacin y
Cualificacin Profesional, por la que se convocan pruebas de acceso a los ciclos formativos de Formacin Profesional. (DOCV 27.04.2012)

PRUEBA DE ACCESO
A CICLOS FORMATIVOS DE GRADO SUPERIOR
JUNIO 2013
PARTE ESPECFICA OPCIN C CIENCIAS.
Materia: BIOLOGA Y CIENCIAS DE LA TIERRA
Duracin: 1h15
RESPONDE A 5 DE LAS 6 PREGUNTAS PROPUESTAS

Pregunta 1
La clula es la unidad anatmica y funcional de los seres vivos. Observa la imagen y contesta las
siguientes cuestiones:

a)

Identifica y nombra las estructuras numeradas en ambos dibujos.


1.

5.

2.

6.

3.

7.

4.
b)

A qu tipo de clula corresponde el dibujo A? Y el B?

c)

Indica qu orgnulos son exclusivos de cada tipo celular.

d)

Se trata de clulas procariotas o eucariotas? Justifica tu respuesta.

e)

Indica las funciones de las estructuras celulares 3, 4 y 6.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las preguntas puntan igual.
- La calificacin de esta Parte o Apartado se adaptar a lo establecido en la RESOLUCIN de 26 de marzo de 2013, de la
Direccin General de Formacin Profesional y Enseanzas de Rgimen Especial, por la que se convocan pruebas de acceso a
los ciclos formativos de Formacin Profesional (DOCV 05-04-2013).

Pregunta 2
Relaciona cada una de las siguientes caractersticas con el tipo de microorganismo que corresponda:
1

Organismos acelulares. Parsitos obligados.

Bacterias

Organismos eucariotas unicelulares hetertrofos.

Protozoos

Organismos eucariotas unicelulares o pluricelulares hetertrofos


que se alimentan por absorcin de nutrientes.

Algas

Organismos procariticos unicelulares.

Hongos

Organismos eucariticos fotosintticos.

Virus

Pregunta 3
Describe detalladamente el recorrido de una molcula de oxgeno desde que se encuentra en el aire
hasta que aparece en un capilar sanguneo de los pulmones.
Pregunta 4
Ciertos caracteres, como la enfermedad de la hemofilia, estn determinados por un gen recesivo
ligado al cromosoma X. Una mujer no hemoflica, cuyo padre era hemoflico, se casa con un hombre
normal.
a)

Haz un esquema del cruzamiento.

b)

Qu probabilidad se espera en su descendencia de que sus hijos varones sean hemoflicos?


Y en las hijas?

Pregunta 5
Respecto a la respuesta inmunitaria:
a)

Define el concepto de antgeno.

b)

Define el concepto de anticuerpo.

c)

Menciona el tipo de clulas sanguneas que se encarga de la produccin de anticuerpos y el


tipo celular del que se diferencian.

d)

Nombra el tipo de enfermedades originadas al producirse anticuerpos contra estructuras del


propio organismo. Pon un ejemplo de este tipo de enfermedades.

Pregunta 6
El suelo. Composicin. Factores que intervienen en su formacin. Perfil del suelo.

CRITERIOS DE EVALUACIN Y CALIFICACIN


- Todas las preguntas puntan igual.
- La calificacin de esta Parte o Apartado se adaptar a lo establecido en la RESOLUCIN de 26 de marzo de 2013, de la
Direccin General de Formacin Profesional y Enseanzas de Rgimen Especial, por la que se convocan pruebas de acceso a
los ciclos formativos de Formacin Profesional (DOCV 05-04-2013).

Subdireccin General
de Formacin Profesional
CONSEJERA DE EDUCACIN

Comunidad de Madrid

PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE GRADO SUPERIOR


Resolucin de 12 de diciembre de 2005, de la Viceconsejera de Educacin (B.O.C.M. 07.01.06)

CALIFICACIN

DATOS DEL ASPIRANTE


APELLIDOS:
NOMBRE:

D.N.I.:

Instituto de Educacin Secundaria:

PARTE ESPECFICA
Opcin: 18. Sanidad

Materia: Biologa
INSTRUCCIONES

La duracin mxima del ejercicio ser de dos horas.

Mantenga su D.N.I. en lugar visible durante la realizacin del ejercicio.

Entregue esta hoja al finalizar esta parte de la prueba de acceso.


Lea detenidamente los textos, cuestiones o enunciados. Realice primero aquellos
ejercicios que tenga seguridad en su resolucin.

Cuide la presentacin y escriba la respuesta o el proceso de forma ordenada.


Una vez acabada la prueba, revsela meticulosamente antes de entregarla.
CRITERIOS DE CALIFICACIN

La valoracin total es de 10 puntos.

Se indica a continuacin la puntuacin mxima a otorgar en cada cuestin del ejercicio:


Cuestin n 1: 3

puntos.

Cuestin n 2: 2,5 puntos.


Cuestin n 3: 2 puntos.
Cuestin n 4: 2,5 puntos.

Subdireccin General
de Formacin Profesional
CONSEJERA DE EDUCACIN

Comunidad de Madrid
DATOS DEL ASPIRANTE
APELLIDOS:
NOMBRE:

D.N.I.:

Instituto de Educacin Secundaria:


CUESTIONES

1. Con relacin a las protenas:


a) Cite los monmeros que las forman y cinco ejemplos de los mismos.
b) Describa someramente las conformaciones ms importantes de la estructura
secundaria.
c) Explique el concepto de desnaturalizacin proteica y sus consecuencias. Nombre
alguna situacin que induzca a desnaturalizacin.
d) Cite cuatro funciones de las protenas.

2. En referencia al aparato cardiocirculatorio:


a) Describa las diferencias funcionales y estructurales entre arterias, venas y capilares.
b) Complete las siguientes cuestiones:
La aurcula izquierda comunica con el ventrculo izquierdo a travs
de ..
A la aurcula derecha llega sangre a travs de
La sangre sale del ventrculo izquierdo a travs de
La funcin principal de las vlvulas auriculoventriculares es

3. Indique la funcin de los siguientes componentes celulares:


Ribosomas
Lisosomas
Mitocondrias
Aparato de Golgi
Cilios y flagelos

Subdireccin General
de Formacin Profesional
CONSEJERA DE EDUCACIN

Comunidad de Madrid
DATOS DEL ASPIRANTE
APELLIDOS:
NOMBRE:

D.N.I.:

Instituto de Educacin Secundaria:

4. A partir de la secuencia de nucletidos que se indica:


TACATGGTTGTACCCGCC
a) Escriba la secuencia del ARN-m complementaria
b) Determine el oligopptido que podra sintetizarse

Segunda letra
UUU
U

UUC
UUA
UUG

C
Phe
Leu

Primera letra

CUU
C

CUC
CUA

Leu

CUG
AUU
A

AUC
AUA
AUG

Ile

UAU

UCC

UAC

UCA

Ser

Cys

U
C

Stop

UCG

UAG

Stop

UGG

Trp

CCU

CAU

CCC
CCA

Pro

CAC
CAA

CCG

CAG

ACU

AAU

ACC

AAC

Thr

AAA

GUU

GCU

GAU

GUC

GCC

GAC

GUA

UGC
UGA

AAG

GUG

Tyr
Stop

ACG

Val

G
UGU

UAA

ACA
Met

UCU

GCA
GCG

Ala

GAA
GAG

His
Gln
Asn
Lys
Asp
Glu

CGU
CGC
CGA

U
Arg

CGG
AGU
AGC
AGA
AGG

GGA
GGG

A
G

Ser
Arg

GGY
GGC

U
C
A
G
U

Gly

C
A
G

Tercera letra

Problemas de gentica

Biologa 4 de ESO

PROBLEMAS DE GENTICA: PRIMERA Y SEGUNDA LEYES DE MENDEL


1. En cierta especie de plantas el color azul de la flor, (A), domina sobre el color blanco (a)
Cmo podrn ser los descendientes del cruce de plantas de flores azules con plantas de
flores blancas, ambas homocigticas? Haz un esquema de cruzamiento bien hecho.
2. Ciertos tipos de miopa en la especie humana dependen de un gen dominante (A); el gen
para la vista normal es recesivo (a). Cmo podrn ser los hijos de un varn normal y de una
mujer miope, heterocigtica? Haz un esquema de cruzamiento bien hecho.
3. En la especie humana el pelo en pico depende de un gen dominante (P); el gen que
determina el pelo recto es recesivo (p). Cmo podrn ser los hijos de un varn de pelo en
pico, homocigtico, y de una mujer de pelo recto, homocigtica? Haz un esquema de
cruzamiento bien hecho.
4. En el hombre el color pardo de los ojos A domina sobre el color azul a. Una pareja en la
que el hombre tiene los ojos pardos y la mujer ojos azules tienen dos hijos, uno de ellos de
ojos pardos y otro de ojos azules. Averiguar:
i. El genotipo del padre
ii. La probabilidad de que el tercer hijo sea de ojos azules.
5. La acondroplasia es una anomala determinada por un gen autosmico que da lugar a un
tipo de enanismo en la especie humana. Dos enanos acondroplsicos tienen dos hijos, uno
acondroplsico y otro normal.
i. La acondroplasia, es un carcter dominante o recesivo? Por qu?
ii. Cul es el genotipo de cada uno de los progenitores? Por qu?
iii. Cul es la probabilidad de que el prximo descendiente de la pareja sea
normal? Y de qu sea acondroplsico? Hacer un esquema del cruzamiento.
6. El gen R que rige el pelo rizado domina sobre el gen recesivo (r) del pelo liso. Una mujer
con el pelo rizado se casa con un varn con el pelo liso y tienen una hija con el pelo rizado.
El padre de la mujer tena el pelo liso, el de la madre no lo recuerdan, pero s saben que la
abuela materna lo tena liso y el abuelo materno lo tena rizado, aunque el de la madre de
ste era liso. Cul es el genotipo de todos ellos?
7. Cruzando dos moscas grises entre s se obtiene una descendencia de 153 moscas grises y
49 moscas negras. Qu genotipo tendrn los progenitores? y las moscas grises de la
descendencia?
8. El color negro de la piel de los hmsteres depende de un gen dominante B y el color blanco
de un gen recesivo b. Si una hembra tiene descendientes de piel blanca Cul debe ser su
genotipo?Qu genotipo y fenotipo podra haber tenido el macho?
9. Una vaca de pelo retinto (rojizo), cuyos padres son de pelo negro, se cruza con un toro de
pelo negro, cuyos padres tienen pelo negro, uno de ellos, y pelo retinto el otro.
a. Cul es el genotipo de los animales que se cruzan?
b. Y el fenotipo de la descendencia?

3 ley de Mendel

Pgina 1

Problemas de gentica

Biologa 4 de ESO

10. Una pareja de ratones de pelo negro tiene un descendiente de pelo blanco. Este se cruza
con una hembra de pelo negro, cuyos progenitores eran uno de pelo negro y otro de pelo
blanco, pero nunca tuvieron descendencia de pelo blanco. Indica el genotipo de todos ellos
y el de sus descendientes (el alelo blanco es recesivo).
11. Cruzando dos moscas de tipo comn (grises) entre s, se obtiene una descendencia
compuesta por 152 moscas grises y 48 negras. Cul ser la constitucin gnica de los
genitores?
12. El albinismo es un defecto de pigmentacin controlado por un gen recesivo. Cul es la
probabilidad de que dos padres albinos tengan un descendiente normalmente pigmentado?
Razona la respuesta.
13. El color de tipo comn del cuerpo de Drosophila est determinado por el gen dominante
n+; su alelo recesivo n produce cuerpo de color negro. Cuando una mosca de tipo comn
de lnea pura se cruza con otra de cuerpo negro. Qu fraccin de la F2 de tipo comn se
espera que sea heterocigtica?
14. En la especie humana el color de los ojos viene determinado por un par de alelos. Un
hombre de ojos azules se casa con una mujer de ojos pardos. La madre de la mujer era de
ojos azules y el padre, que tena un hermano de ojos azules, era de ojos pardos. Del
matrimonio naci un hijo con ojos pardos.
a) Indica los genotipos de toda la familia.
b) Qu otros genotipos son posibles en la descendencia?
Razona la respuesta
15. El pelo rizado de los perros es dominante sobre el pelo liso. Una pareja de pelo rizado tuvo
un cachorro de pelo rizado y otro de pelo liso.
a) Con qu clase de hembra debera cruzarse el cachorro de pelo rizado para conocer su
genotipo?
b) Qu proporciones fenotpicas y genotpicas se obtienen de la descendencia del
cruzamiento anterior?
Razona las respuestas
16. En el dondiego de noche, el color rojo de las flores lo determina el alelo c+, dominante
incompleto sobre el color blanco producido por el alelo c, siendo rosas las flores de las
plantas heterocigticas. Si una planta con flores rojas se cruza con otra de flores blancas,
cul ser el fenotipo de las flores de la F1 y de la F2 resultante de cruzar entre s dos
plantas cualesquiera de F1, y cul ser el fenotipo de la descendencia obtenida de un
cruzamiento de las F1 con su genitor rojo, y con su genitor blanco?
17. La variedad de gallinas llamadas andaluzas o "azules" se producen cuando se cruzan un
animal negro con uno blanco, e interviene en dicha herencia un solo par de alelos.
a) Qu descendencia se esperara del cruce de dos individuos azules?
b) y de dos negros?. Razona las respuestas.
18. La ausencia de patas en las reses se debe a un gen letal recesivo. Del apareamiento entre
un toro heterocigtico normal y una vaca normal no portadora, qu proporcin genotpica
se espera en la F2 adulta obtenida del apareamiento al azar entre los individuos de la F1?
3 ley de Mendel

Pgina 2

Problemas de gentica

Biologa 4 de ESO

19. La calvicie es provocada por un gen que se comporta como dominante en los varones y
recesivo en las mujeres. Un varn no calvo se cas con una mujer calva raznese como
ser la descendencia del matrimonio.
20. Una mujer enana, cuya madre era normal, se casa con un hombre normal. En el supuesto
de que este matrimonio tuviera cinco hijos y sabiendo que el enanismo es dominante,
indica y razona cules de las siguientes afirmaciones son correctas:
a) Si ninguno de los hermanos mayores es enano, es casi seguro que el ltimo que nazca
lo ser.
b) Toda la descendencia ser enana.
c) Toda le descendencia ser normal.
d) Cada nio que nazca tiene un 50% de probabilidad de ser enano.
21. El tipo mocho (sin cuerna) de las ovejas es producido por un gen P que es dominante en
las hembras, pero recesivo en los machos. Un macho homocigtico con cuernos se cruza
por una hembra tambin homocigtica, pero mocha. Realiza la segregacin respecto al
sexo y al carcter mocho en F1 y F2.
22. En el tomate, la flor amarilla es dominante sobre la flor blanca. Al cruzar dos plantas
heterocigotas se obtienen 300 descendientes. Responder de forma razonada:
a) Cuntos de ellos sern de fenotipo dominante?
b) Cmo se puede averiguar si uno de esos descendientes de fenotipo dominante es
homocigoto o heterocigoto?
23. En Drosophila el color normal del cuerpo es acaramelado pero existen colores alternativos,
uno de ellos es el amarillo. Cuando se cruzan machos de una lnea homocigtica amarilla
por hembras de color normal la F1 es de color normal, pero cuando se cruzan hembras
amarillas por machos normales en la F1 todos los machos son amarillos y todas las
hembras normales. Cuando se cruzan machos y hembras de la F1 del cruzamiento
mencionado en primer lugar, la F2 est constituida por hembras de color normal mientras
que los machos son amarillos o de color normal en cantidades aproximadamente iguales.
En el segundo caso, en la F2 aproximadamente la mitad de los machos y de las hembras
son de color amarillo y la otra mitad de color normal. Explicar estos resultados.
24. La raza Plymouth-Rock de gallinas tiene un plumaje con coloracin a franjas o " barrado"
mientras que la raza menorquina es negra uniforme. Cuando se cruza un gallo PlymouthRock con una gallina menorquina la F1 es toda de tipo "barrado" ; la F2 presenta un 75%
de los individuos de tipo " barrado"y un 25% negros, siendo todos los gallos del primer tipo
y una mitad de las gallinas de tipo "barrado" y lo otra mitad negras. Cuando se cruza un
gallo menorqun con una gallina Plymouth-Rock en la F1 los machos son de tipo PlymouthRock mientras que las hembras son negras, y en la F2 la mitad de los gallos y gallinas son
"barrados" y la otra mitad negros. Explicar estos resultados.
25. En ciertas razas ovinas la presencia o no de cuernos est determinada genticamente.
Para conocer el modo de herencia de ese rasgo se cruz una hembra homocigtica sin
cuernos con un macho homocigtico con cuernos. En la descendencia obtenida todos los
machos presentaban cuernos mientras que las hembras carecan de ellos. El cruzamiento

3 ley de Mendel

Pgina 3

Problemas de gentica

Biologa 4 de ESO

recproco (hembra con cuernos y macho sin ellos) produjo una descendencia igual a la
anterior.
26. Al cruzar entre s los individuos de estas F1 se obtuvo una segregacin 3: 1 de machos con
cuernos frente a sin cuernos, mientras que en las hembras fue al revs, es decir, un 25%
con cuernos y el resto sin cuernos. Cmo podra explicar estos resultados?
27. Un hombre albino y sano se casa con una mujer morena cuyo padre era hemoflico y cuya
madre era albina. Qu clases de hijos pueden tener y en que proporcin?
28. Un hombre calvo cuyo padre no lo era, se caso con una mujer normal cuya madre era
calva. Dense los genotipos de marido y mujer y los tipos de hijos que puedan tener.
29. En el ratn silvestre, el color normal es oscuro. Al cruzar un ratn amarillo con uno oscuro,
de raza pura, se obtuvo una descendencia formada por ratones amarillos y oscuros en
proporcin 1:1.Al cruzar ratones amarillos entre s, el resultado era, ratones amarillos y
oscuros en proporcin 2:1. Explica este tipo de herencia?
30. El albinismo es un carcter recesivo con respecto a la pigmentacin normal. Cul sera la
descendencia de un hombre albino en los siguientes casos?:
a)
Si se casa con una mujer sin antecedentes familiares de albinismo.
b)
Si se casa con una mujer normal cuya madre era albina.
c)
Si se casa con una prima hermana de pigmentacin normal pero cuyos
abuelos comunes eran albinos.
31. La galactosemia es un carcter recesivo autonmico. Un matrimonio normal tiene un hijo
afectado.
a) encontrar la probabilidad de que los dos hijos siguientes sean galactosmico.
b) que de los cuatro hijos al menos uno sea tambin galactosmico.
c) que el hijo siguiente sea heterocigoto para el alelo recesivo.
d) que si el hijo galactosmico hubiese tenido un hermano gemelo este tambien
hubiese sido galactosmico.
e) que el padre del hijo galactosmico sea heterocigoto.
32. En la especie humana el poder plegar la lengua depende de un gen dominante (L); el gen
que determina no poder hacerlo (lengua recta) es recesivo (l). Sabiendo que Juan puede
plegar la lengua, Ana no puede hacerlo y el padre de Juan tampoco Qu probabilidades
tienen Juan y Ana de tener un hijo que pueda plegar la lengua? Haz un esquema de
cruzamiento bien hecho.
33. La acondroplasia es una anomala determinada por un gen autosmico que da lugar a un
tipo de enanismo en la especie humana. Dos enanos acondroplsicos tienen dos hijos, uno
acondroplsico y otro normal.
a) La acondroplasia, es un carcter dominante o recesivo? Por qu?
b) Cul es el genotipo de cada uno de los progenitores? Por qu?
c) Cul es la probabilidad de que el prximo descendiente de la pareja sea normal?
Y de qu sea acondroplsico ?. Hacer un esquema del cruzamiento.
34. La fenilcetonuria (FCU) es un desorden metablico que se hereda con carcter autosmico
recesivo. Dos progenitores sanos tienen un hijo con FCU.
3 ley de Mendel

Pgina 4

Problemas de gentica

Biologa 4 de ESO

a) Indica los fenotipos y genotipos de todos los apareamientos que tericamente


pueden dar un descendiente afectado de FCU.
b) ? A cul de estos tipos de apareamiento pertenece el caso descrito ?.
c) ? Cul es la probabilidad de que el siguiente hijo padezca tambin la enfermedad ?.
d) ? Cul ser la probabilidad de qu un hijo normal (sano) de estos padres sea
portador heterocigtico para FCU?
35. La ausencia de patas en las reses se debe a un gen letal recesivo. Del apareamiento entre
un toro y una vaca, ambos hbridos qu proporciones genotpicas se esperan en la F2
adulta? Los becerros amputados mueren al nacer.
36. Cmo pueden diferenciarse dos individuos, uno homocigtico de otro heterocigtico, que
presentan el mismo fenotipo. Razonar la respuesta
37. El albinismo es un carcter recesivo con respecto a la pigmentacin normal. ? Cul sera la
descendencia de un hombre albino en los siguientes casos?:
a) Si se casa con una mujer sin antecedentes familiares de albinismo.
b) Si se casa con una mujer normal cuya madre era albina.
c) Si se casa con una prima hermana de pigmentacin normal pero cuyos abuelos
comunes eran albinos.
38. Mendel descubri que el color amarillo de la semilla de los guisantes es dominante sobre el
color verde. En los siguientes experimentos, plantas con fenotipos conocidos, pero con
genotipos desconocidos, dieron lugar a la siguiente descendencia:
a)
b)
c)
d)
e)

Amarilla
Amarilla
Verde
Amarilla
Amarilla

x
x
x
x
x

Verde
Amarilla
Verde
Verde
Amarilla

=
=
=
=
=

82 Amarillas + 78 Verdes.
118 Amarillas + 39 Verdes.
50 Verdes
74 Amarillas
90 Amarillas

Segn la proporcin de descendientes, indquense los genotipos ms


probables de cada progenitor.
39. En el ganado vacuno la falta de cuernos es dominante sobre la presencia de cuernos. Un
toro sin cuernos se cruz con tres vacas. Con la vaca A, que tena cuernos, tuvo un ternero
sin cuernos; con la vaca B, tambin con cuernos, tuvo un ternero con cuernos; con la vaca
C, que no tena cuernos, tuvo un ternero con cuernos. Cules son los genotipos de los
cuatro progenitores? Qu otra descendencia, y en qu proporciones, cabra esperar de
estos cruzamientos?
40. A partir de un cruzamiento entre dos Drosophilas de alas normales se obtuvo 27 individuos
de alas dumpy y 79 normales. a) Cul es la naturaleza del gen de alas dumpy?; b)
Cules eran los genotipos de los padres?; c) En un cruce entre una mosca dumpy de la
F1 y uno de sus padres Cuntas moscas de alas normales se esperara obtener de una
descendencia de 120?
41. En la raza de ganado lechero Holstein-Friesian, un alelo recesivo r produce pelo rojo y
blanco; el alelo dominante R produce pelo blanco y negro. Si un toro portador es cruzado
3 ley de Mendel

Pgina 5

Problemas de gentica

Biologa 4 de ESO

con vacas portadoras, 1-determine la probabilidad de que a) el primer descendiente que


nazca sea rojo y blanco; b) los primeros cuatro descendientes sean blanco y negro. 2Cul es la proporcin fenotpica esperada entre la progenie resultante de retrocruzar
vacas F1 blanco y negro con el toro portador? 3- Si el toro portador se cruza con vacas
blanco y negro homocigticas, qu proporcin fenotpica puede esperarse entre la
progenie resultante de cruzar las vacas de la F1 con el macho portador?
42. Se cruzan entre s cobayas negros heterocigticos Bb. a) Cul es la probabilidad de que
los tres primeros descendientes sean alternativamente negro-blanco-negro o blanco-negroblanco? b) Cul es la probabilidad de producir entre tres descendientes, dos negros y uno
blanco?
43. La corea de Huntington es una enfermedad rara, mortal, que aparece normalmente a
mediana edad. Se debe a un alelo dominante. Un hombre fenotpicamente normal, de poco
ms de 20 aos, advierte que su padre ha desarrollado la corea de Huntington. a) Cul es
la probabilidad de que ms tarde l mismo desarrolle la enfermedad? b) Cul es la
probabilidad de que la desarrolle su hijo al cabo del tiempo?
44. Considere una serie de familias con dos hijos en las que los dos padres han sido
identificados como portadores de un alelo autosmico recesivo, dado que al menos uno de
los hijos muestra el fenotipo correspondiente. Al sumar todos los hijos de tales familias
Qu proporcin de ellos mostrarn dicho fenotipo?
45. Una pareja decide tener 4 hijos. Calcula la probabilidad de que:
a) Se cumpla el deseo del padre de tener cuatro varones
b) Se cumpla el deseo de la madre de tener dos de cada sexo
c) Se cumpla el deseo de la abuela de tener tres chicos y una chica
d) Si tuvieran un 5 hijo Cul sera la probabilidad de que ste fuera varn?
46. Plantear una hiptesis gentica que explique estos resultados e indicar el genotipo de cada
uno de los parentales implicados en los cruces y de las aves de la descendencia.
47. Dos personas fenotpicamente normales tienen un hijo/a albino/a. Cul es probabilidad de
que si tienen dos hijos/as ms, el segundo sea normal y el tercero albino/a? Si otra pareja,
genotpicamente igual, tuviera cuatro hijos/as, cul sera la probabilidad de que tuviera
dos albinos/as?

3 ley de Mendel

Pgina 6

Problemas de gentica

Biologa 4 de ESO

PROBLEMAS DE GENTICA: TERCERA LEY DE MENDEL


1. En los guisantes, el gen para el color de la piel tiene dos alelos: amarillo (A) y verde (a). El
gen que determina la textura de la piel tiene otros dos: piel lisa (B) y rugosa (b). Se cruzan
plantas de guisantes amarillos-lisos (AABB) con plantas de guisantes verdes-rugosos
(aabb). De estos cruces se obtienen 1000 guisantes. Qu resultados son previsibles? Haz
un esquema del cruzamiento.
2. En los guisantes, el gen para el color de la piel tiene dos alelos: amarillo (A) y verde (a). El
gen que determina la textura de la piel tiene otros dos: piel lisa (B) y rugosa (b). Se cruzan
plantas de guisantes amarillos-lisos (AaBb) con plantas de guisantes verdes-lisos (aaBb).
De estos cruces se obtienen 884 Kg de guisantes. Qu resultados son previsibles? Haz
un esquema del cruzamiento.
3. En los guisantes, el gen para el color de la piel tiene dos alelos: amarillo (A) y verde (a). El
gen que determina la textura de la piel tiene otros dos: piel lisa (B) y rugosa (b). Se cruzan
plantas de guisantes amarillos-lisos (AaBb) con plantas de guisantes amarillos-lisos
(AaBb). De estos cruces se obtienen plantas que dan 220 Kg de guisantes Cuntos
kilogramos de cada clase se obtendrn? Haz un esquema de cruzamiento bien hecho.

4. El pelo oscuro y el color marrn de los ojos se consideran dominantes sobre el pelo claro y
ojos azules. Un varn de estas caractersticas tiene dos hijos con una mujer de pelo claro y
ojos azules; uno de los hijos tiene pelo claro y ojos marrones, y el otro ojos azules y pelo
oscuro.
Cul es la probabilidad de que un tercer hijo tenga el pelo claro y los ojos
marrones? Razonar la respuesta.
5. En las plantas de guisante, el alelo "L", que indica semillas lisas, es dominante sobre el
alelo "l", que indica semillas rugosas, y el alelo "A" que indica color amarillo, es dominante
sobre el alelo "a", que indica color verde. Si se cruza una variedad pura lisa de color
amarillo con una variedad pura rugosa de color verde,
a) cul es el genotipo y el fenotipo de la primera generacin filial (F1) ?.
b) Indicar los fenotipos de la segunda generacin (F2) y la proporcin de cada uno de
ellos que resulta de la autofecundacin de las plantas de la F1.
6. En el guisante, los caracteres tallo largo y flor roja dominan sobre tallo enano y flor blanca.
Cul ser la proporcin de plantas doble homocigticas que cabe esperar en la F2
obtenida a partir de un cruzamiento entre dos lneas puras, una de tallo largo y flor blanca
con otra de tallo enano y flor roja? Indicar el genotipo de todas las plantas homocigticas
que pueden aparecer en la F2. Razonar la respuesta.
7. El color rojo de la pulpa del tomate depende de la presecia del factor R, dominante sobre
su alelo r para el amarillo. El enanismo se debe a un gen recesivo d. Se dispone de una
variedad homocigtica de pulpa amarilla y tamao normal y otra enana de pulpa roja.
a) Podra obtenerse a partir de las variedades disponibles, una variedad
homocigtica de pulpa roja y tamao normal ?
b) Y una variedad de pulpa amarilla y de porte enano ? Raznese la respuesta.
3 ley de Mendel

Pgina 7

Problemas de gentica

Biologa 4 de ESO

8. La miopa es debida a un gen dominante, al igual que el fenotipo Rh+. Una mujer de visin
normal Rh+, hija de un hombre Rh-, tiene descendencia con un varn miope heterocigoto y
Rh-. Establzcanse los previsibles genotipos y fenotipos de los hijos de la pareja.
9. La enfermedad de Tay-Sachs es una enfermedad hereditaria recesiva que causa la muerte
en los primeros aos de vida cuando se encuentra en condicin homocigtica. Se piensa
que los dedos anormalmente cortos, braquifalangia,se deben al genotipo heterocigtico
para un gen letal, siendo normal el individuo BB. ? Cules son los fenotipos esperados
entre nios adolescentes hijos de padres braquifalngicos y heterocigticos para la
enfermedad de Tay-Sachs?
10. Dos condiciones anormales en el hombre, que son las cataratas y la fragilidad de huesos
son debidas a alelos dominantes. Un hombre con cataratas y huesos normales cuyo padre
tena ojos normales, se cas con una mujer sin cataratas pero con huesos frgiles, cuyo
padre tena huesos normales. Calcula la probabilidad de :
a) Tener un hijo completamente normal
b) Que tenga cataratas y huesos normales
c) Que tenga ojos normales y huesos frgiles
d) Que padezca ambas enfermedades.
11. En el guisante, los caracteres tallo largo y flor roja dominan sobre tallo enano y flor blanca.
Cul ser la proporcin de plantas doble homocigticas que cabe esperar en la F2
obtenida a partir de un cruzamiento entre dos lneas puras, una de tallo largo y flor blanca
con otra de tallo enano y flor roja?. Indicar el genotipo de todas las plantas homocigticas
que pueden aparecer en la F2. Razonar la respuesta.
12. Se cruza un ratn de pelo largo y de color gris con otro tambin de pelo largo pero de color
blanco, existe alguna posibilidad de que nazcan ratones con el pelo corto y de color gris?
Y con el pelo corto y de color blanco? Si es as, cundo? (Pelo largo, L, domina sobre
pelo corto, l; y pelo gris, B, sobre pelo blanco b).
13. El fruto de las sandas puede ser liso o a rayas y alargado o achatado. Una planta de una
variedad homocigtica de fruto liso y alargado se cruzo con otra, tambin homocigtica, de
fruto a rayas y achatado. Las plantas de la F1 tenan el fruto liso y achatado. En la F2 se
obtuvieron nueve plantas de fruto liso y achatado, tres de fruto rayado y achatado, tres de
fruto liso y alargado, y una de fruto rayado y alargado. Indica:
a) Los pares de alelos que intervienen en esta herencia .
b) Cules son los alelos dominantes y por qu?
c) Los genotipos de la F1 y de la F2.
14. Un hombre de cabello rizado y con dificultad para ver a distancia (miopa) se casa con una
mujer tambin de pelo rizado y de visin normal. Tuvieron dos hijos: uno de pelo rizado y
miope y otro de pelo liso y visin normal. Sabiendo que los rasgos pelo rizado y miopa son
dominantes, responder
a) Cul sera el genotipo de los progenitores?.
b) Cul sera el genotipo de los hijos?. Indicar todas las posibilidades.
c) Si esta pareja tuviera un tercer hijo, podra ste ser de pelo rizado y visin normal?.
Razona la respuesta.

3 ley de Mendel

Pgina 8

Problemas de gentica

Biologa 4 de ESO

15. En cierta especie animal, el pelo gris es dominante sobre el pelo blanco y el pelo rizado
sobre el liso. Se cruza un individuo de pelo blanco y liso con otro de pelo gris y rizado, que
tiene un padre de pelo blanco y una madre de pelo liso.
a) Pueden tener hijos de pelo gris y liso? En caso afirmativo, en qu porcentaje?
b) Pueden tener hijos de pelo blanco y rizado? En caso afirmativo, en qu
porcentaje?
16. En las ratas, C es un gen necesario para la formacin del color. Su alelo recesivo c
produce albinismo. R origina el color negro, mientras que su alelo recesivo r da color
crema. Si se cruza una rata homocigtica de color negro con otra albina de genotipo ccrr,
cul ser la coloracin de la F1 y de la F2?
17. Se cruzaron plantas puras de guisante con longitud de tallo alto y cuya flor era de color
blanco, por plantas de longitud de tallo enano u flor de color rojo. Sabiendo que el carcter
tallo alto es dominante sobre tallo enano y que la flor de color blanco es recesiva respecto
a la de color rojo. Cul ser la proporcin de dobles heterocigotos esperados en la F2?
18. La forma de los rbanos puede ser alargada o redonda, en los individuos homocigticos, y
oval en los heterocigticos. Los colores pueden ser blanco o rojo para los individuos
homocigticos, y prpura para los heterocigticos. Contestar, razonando las respuestas:
a) Qu tipo de descendencia cabe esperar del cruzamiento entre una planta de rbanos
alargados y blancos con otra de rbanos redondos y rojos?
b) Y entre una planta oval y prpura con otra redonda y roja?
19. Las plumas de color marrn para una raza de gallinas estn determinadas por el alelo b+,
dominante sobre su recesivo b, que determina color rojo. En otro cromosoma se encuentra
el locus del gen s+ dominante que determina cresta lisa, la cresta arrugada se debe al
recesivo s. Un macho de cresta lisa y color rojo se cruza con una hembra de cresta lisa y
color marrn, producindose una descendencia formada por: 2 individuos de cresta lisa y
color marrn, 3 de cresta lisa y color rojo, 1 de cresta arrugada y color marrn y 1 de cresta
arrugada y color rojo. Determinar el genotipo de los genitores.
20. En Drosophila, el color del cuerpo gris est determinado por el alelo dominante a+, el color
negro por el recesivo a. Las alas de tipo normal por el dominante vg+ y las alas vestigiales
por el recesivo vg. Al cruzar moscas dihbridas de tipo comn, se produce una
descendencia de 384 individuos. Cuantos se esperan de cada clase fenotpica?
25. El color rojo del fruto del tomate es dominante sobre el color amarillo, y la forma
biloculada domina sobre multiloculada. Se desea obtener una lnea de plantas de frutos
rojos y multiloculados, a partir del cruzamiento entre razas puras rojas y biloculadas con
razas amarillas y multiloculadas. Qu proporcin de la F2 tendr el fenotipo deseado y
qu proporcin de sta ser homocigtica para los dos caracteres?
21. La aniridia (ceguera) en la especie humana se debe a un factor dominante A. La jaqueca
es debida a otro gen tambin dominante J. Un hombre que padeca aniridia y cuya madre
no era ciega, se cas con una mujer que sufra jaqueca, pero cuyo padre no la sufra.
Qu proporcin de sus hijos sufrir ambos males?
22. Suponiendo que en la especie humana la jaqueca y la aniridia (un tipo de ceguera
hereditaria) son debidas a dos genes dominantes, un hombre que padeca jaqueca y cuyo
3 ley de Mendel

Pgina 9

Problemas de gentica

Biologa 4 de ESO

padre no la tena, se cas con una mujer que tena aniridia pero cuya madre no la padeca.
a)
Indica los genotipos y fenotipos de todos los descendientes posibles.
b)
Calcular la proporcin de hijos que padecern simultneamente las dos
enfermedades.
23. En el hombre el cabello pelirrojo es recesivo frente al normal y los lbulos de las orejas
libres, dominante frente a las pegadas. Se casa un hombre homocigtico puro para el color
de pelo normal y lbulos de las orejas pegadas, con una mujer de pelo pelirrojo y
homocigtico para lbulos de las orejas libres. Indica fenotipos y genotipos de la
descendencia.
24. El cabello oscuro (R) en el hombre es dominante del cabello rojo (r). El color pardo de los
ojos (A) domina sobre el azul (a). Un hombre de ojos pardos y cabello oscuro se cas con
una mujer de cabello oscuro y ojos azules. Tuvieron dos hijos, uno de ojos pardos y pelo
rojo y otro de ojos azules y pelo oscuro. Indica de forma razonada los genotipos de los
padres y de los hijos.
25. El color rojo de la pulpa del tomate depende de la presencia del factor (R), dominante
sobre su alelo (r) para el amarillo. El enanismo se debe a un gen recesivo (d) se dispone
de una variedad de pulpa amarilla y tamao normal y otra enana de pulpa roja. Podra
obtenerse a partir de las variedades disponibles una variedad homocigtica de pulpa roja y
tamao normal? Y una variedad de pulpa amarilla y de porte enano?. Raznense las
respuestas.
26. En una especie animal el pelo oscuro y el color marrn de los ojos son caracteres
dominantes sobre el pelo dorado y los ojos azules. Un macho de pelo oscuro y ojos de
color marrn se cruz con una hembra de pelo dorado y ojos de color azul. La
descendencia fue de dos cras, una con pelo dorado y ojos marrones y otra de pelo oscuro
y ojos azules
a) Cules son los genotipos de los padres?
b) Cules son los genotipos de las cras? Razona las respuestas
27. Los ratones gordos se pueden producir por dos genes independientes. El genotipo "oo"
genera un ratn gordo y estril, llamado obeso; su alelo dominante "O" da lugar a
crecimiento normal. El genotipo recesivo "aa" tambin produce un ratn gordo y estril
llamado adiposo, mientras que su alelo dominante ocasiona crecimiento normal. ? Qu
proporciones fenotpicas de ratones gordos frente a normales podemos esperar en F1,
siendo los padres de genotipo OoAa.
28. La miopa es debida a un gen dominante, al igual que el fenotipo Rh+. Una mujer de visin normal y
Rh+, hija de un hombre Rh-, tiene descendencia con un varn miope heterocigoto y Rh-.
Establzcanse los previsibles genotipos y fenotipos de los hijos de la pareja.

29. El color rojo de la pulpa del tomate depende de la presencia de un factor R dominante
sobre su alelo r, que da color amarillo. El enanismo se debe a un gen recesivo d. Se
dispone de una variedad de pulpa amarilla y tamao normal y de otra enana y de pulpa
roja, ambas variedades puras. a) Se podra obtener una variedad de pulpa roja y de
tamao normal?; b) y una de pulpa amarilla y enana?; c) cul se obtendra antes?
3 ley de Mendel

Pgina 10

Problemas de gentica

Biologa 4 de ESO

30. Si dos pares de alelos se transmiten independientemente, siendo A dominante sobre a y B


sobre b, cul es la probabilidad de obtener: a) un gameto Ab a partir de un individuo
AaBb, b) un zigoto AABB a partir de un cruzamiento AaBB x AaBb, c) un gameto Ab a
partir de un individuo AABb, d) un zigoto AABB a partir de un cruzamiento aabb x AABB, e)
un fenotipo AB a partir de un cruzamiento AaBb x AaBb, f) un fenotipo AB a partir de un
cruzamiento AaBb x AABB, y g) un fenotipo aB a partir de un cruzamiento AaBb x AaBB?
31. El pelaje negro en los cocker spaniels est gobernado por un alelo B dominante y el color
rojo por su alelo recesivo b. El patrn uniforme del color est gobernado por el alelo
dominante de un locus S que se transmite independientemente y el patrn moteado por su
alelo recesivo s. Un macho de pelo color negro y uniforme se aparea con una hembra con
piel moteada y de color rojo y producen una camada de seis cachorros: dos negro
uniforme, dos rojo uniforme, uno negro moteado y uno rojo moteado. Determine los
genotipos de los progenitores.
32. El carcter normal de pata hendida en los cerdos es producida por el genotipo
homocigtico recesivo mm. Un genotipo dominante M- produce una condicin de pata de
mula. El color blanco del pelo est determinado por un alelo dominante de otro locus B y el
negro por su alelo recesivo b. Un cerdo blanco con pata de mula se cruza con una hembra
del mismo fenotipo. Entre la descendencia se encontraron seis cerdos blancos con pezua
normal; siete negros con pata de mula; quince blancos con pata de mula y tres negros con
pezua normal. Si se realiza el cruzamiento retrogrado de toda la F1 de color negro con
pata de mula Qu frecuencia fenotpica podra esperarse entre la descendencia?
33. Dos anormalidades, como son las cataratas y la fragilidad excesiva de los huesos, parecen
depender de genes dominantes separados, localizados en diferentes cromosomas. Un
hombre con cataratas y huesos normales, cuyo padre tena ojos normales, se cas con
una mujer sin cataratas pero con huesos frgiles, cuyo padre tena los huesos normales.
Cul es la probabilidad de que su primer hijo/a:
a) est libre de ambas anormalidades?
b) tenga cataratas y huesos normales?
c) no tenga cataratas y sus huesos sean frgiles?
d) tenga cataratas y huesos frgiles?

3 ley de Mendel

Pgina 11

Problemas de gentica

Biologa 4 de ESO

PROBLEMAS DE GENTICA: CODOMINANCIA Y HERENCIA INTERMEDIA


1. En cierta especie de plantas los colores de las flores pueden ser rojos, blancos o rosas. Se
sabe que este carcter est determinado por dos genes alelos, rojo (CR) y blanco (CB),
codominantes. Cmo podrn ser los descendientes del cruce entre plantas de flores rosas?
Haz un esquema del cruzamiento.
2. En cierta especie de plantas los colores de las flores pueden ser rojos, blancos o rosas. Se
sabe que este carcter est determinado por dos genes alelos, rojo (CR) y blanco (CB)
codominantes. Cmo podrn ser los descendientes del cruce entre plantas de flores rosas
con plantas de flores rojas? Haz un esquema del cruzamiento.
3. En cierta especie de plantas los colores de las flores pueden ser rojos, blancos o rosas. Se
sabe que este carcter est determinado por dos genes alelos, rojo (CR) y blanco (CB)
codominantes. Cmo podrn ser los descendientes del cruce entre plantas de flores rosas
con plantas de flores blancas? Haz un esquema del cruzamiento.
4. Los grupos sanguneos en la especie humana estn determinados por tres genes alelos: I A,
que determina el grupo A, IB, que determina el grupo B e i, que determina el grupo O. Los
genes IA e IB son codominantes y ambos son dominantes respecto al gen i que es
recesivo. Cmo podrn ser los hijos de un hombre de grupo O y de una mujer de grupo
AB? Haz un esquema del cruzamiento.
5. Al realizar un cruzamiento entre una mariposa de alas grises con otra de alas negras se
obtuvo una descendencia formada por 93 mariposas de alas negras y 93 mariposas de
alas grises. La mariposa de alas grises se cruz con otra que presenta alas blancas,
obtenindose una descendencia formada por 35 mariposas blancas y 35 mariposas grises.
Averiguar los genotipos, tanto de las mariposas que se cruzan como de los descendientes.
Razonar la respuesta.
6. Las cobayas de pelaje color amarillo son homocigotos (CACA}, el color crema se debe a un
genotipo heterocigtico (CACB), y el blanco es debido al genotipo homocigtico (CBCB)
Qu proporciones genotpicas y fenotpicas se obtienen de un cruzamiento entre dos
cobayas de color crema?
7. Un perro de pelo negro, cuyo padre era de pelo blanco, se cruza con una perra de pelo
gris, cuya madre era negra. Sabiendo que el color negro del pelaje domina sobre el blanco
en los machos, y que en las hembras negro y blanco presentan herencia intermedia,
explicar cmo sern los genotipos de los perros que se cruzan y tipos de hijos que pueden
tener respecto del carcter considerado.
8. Dos plantas de dondiego (Mirabilis jalapa) son homocigticas para el color de las flores.
Una de ellas produce flores de color blanco marfil y la otra, flores rojas. Seale los
genotipos y fenotipos de los dondiegos originados del cruce de ambas plantas, sabiendo
que B es el gen responsable del color marfil, R es el gen que condiciona el color rojo y
que los genes R y B son equipotentes (herencia intermedia).
9. Un dondiego de flores rojas y hojas grandes se cruza con otro de flores blancas y hojas
pequeas. Calcula los fenotipos de la F2 y sus porcentajes, teniendo en cuenta que estos
dos caracteres se rigen por el mecanismo de la equipotencia o herencia intermedia.
3 ley de Mendel

Pgina 12

Problemas de gentica

Biologa 4 de ESO

10. Los genes alelos P y p rigen el desarrollo de las plumas de las gallinas. El genotipo PP
determina gallinas con las plumas muy rizadas, el pp normalmente rizadas y el Pp
medianamente rizadas. Cuando se cruzan una gallina con plumas normales y un gallo de
plumas muy rizadas, qu fraccin de la F2 se espera que tenga las plumas
medianamente rizadas?
11. Un hombre de grupo sanguneo 0 se casa con una mujer de tipo 0. Cul es la
probabilidad de que sus hijos sean de tipo A, B, 0 y AB?
12. En un conflicto conyugal, el hombre demanda el divorcio, alegando los hechos siguientes:
Los dos primeros hijos, a quienes reconoce, presentan los grupos sanguneos AB y O.
Pero el tercero que no reconoce, tiene el grupo B. Queremos saber si esta informacin
basta para decidir en su favor. Raznalo.
13. Si el padre de un nio de grupo sanguneo 0 es del grupo A1 y la madre del grupo B, qu
fenotipos sanguneos pueden presentar los hijos que puedan tener?
14. El sistema de grupos sanguneos A B 0, est determinado por tres alelos A, B, 0. Indicar
las proporciones fenotpicas que se espera en la descendencia de los cruzamientos
siguientes:
a.
b.
c.
d.
e.

AA x AB
AA x B0
AA x A0
A0 x A0
A0 x AB

15. En una clnica se mezclan por error 4 recin nacidos. Los grupos sanguneos de estos
nios son: 0, A, B, AB. Los grupos sanguneos de las cuatro parejas de padres son :
a)
b)
c)
d)

AB x 0
Ax0
A x AB
0x0

Indicar qu nio corresponde a cada pareja


16. Mara y Julia tuvieron ambas su beb en el mismo hospital y en el mismo momento Mara
se llev a casa una nia, a la que llam Irene. Julia se llev un nio, al que bautiz con el
nombre de Gonzalo Sin embargo, esta ltima seora estaba segura de que haba dado a
luz a una nia, por lo que demand al hospital Las pruebas sanguneas revelaron que el
mando de Julia era del grupo 0. Julia era del tipo AB y Mara y su esposo tenan el grupo
B. Irene es del grupo A y Gonzalo es del grupo O. Hubo realmente un cambio de bebs?
17. Un marido acusa a su esposa de infidelidad y pide la custodia de sus dos primeros hijos,
mientras que rechaza al tercero afirmando que no es suyo. El primer hijo es del grupo
sanguneo O, el segundo, del grupo B, y el tercero, del grupo AB El marido es del grupo
sanguneo O, y la mujer, del grupo B Crees que la acusacin del hombre esta fundada?
Razona la respuesta.

3 ley de Mendel

Pgina 13

Problemas de gentica

Biologa 4 de ESO

18. En un hospital se produjo un apagn de luz durante media hora debido a una fuerte
tormenta en el momento en que estaban dando a luz dos seoras (Prez y Fernndez),
ambas del grupo sanguneo AB. Las dos tuvieron un nio, siendo uno del grupo sanguneo
AB y el otro del grupo A. Debido al apagn se produjeron unos instantes de confusin en la
maternidad de manera que no se saba cul de los nios perteneca a cul de las madres.
El problema, afortunadamente, se solucion al conocer que el grupo sanguneo del seor
Prez era O y el del seor Fernndez A. Cmo se solucion el problema?
19. Si un hombre de grupo sanguneo AB se casa con una mujer de grupo A, cuyo padre era
de grupo 0. Qu grupos sanguneos se puede esperar entre sus hijos y con qu
frecuencia?
20. Un hombre de grupo sanguneo A y una mujer de grupo sanguneo B tienen cuatro hijos,
de los cuales, uno pertenece al grupo AB, otro al 0, otro al B, y otro al A. Sealar
razonadamente el genotipo de los padres.
21. Una raza de gallinas, denominada andaluza, presenta plumajes de tres colores negro,
blanco y azul. El azul resulta de la combinacin hbrida de los genes negro y blanco.
Averiguar los fenotipos y los genotipos de la descendencia de estos tres cruzamientos:
a. Plumaje azul x plumaje negro.
b. Plumaje azul x plumaje azul
c. Plumaje azul x plumaje blanco
22. En las plantas del genero Antirhinum, las flores rojas y las blancas presentan herencia
intermedia. Lo mismo ocurre con las hojas estrechas y las hojas anchas Suponiendo que
las parejas allicas correspondientes segregan de forma independiente, indica las
proporciones genotpicas y fenotpicas esperadas en:
a. La autofecundacin de una planta de flores rosas y hojas de anchura intermedia.
b. El cruzamiento entre una planta igual a la anterior y otra de flores blancas y hojas
estrechas.
23. Se cruzan dos plantas de flores color naranja y se obtiene una descendencia formada por
30 plantas de flores rojas, 60 de flores naranja y 30 de flores amarillas. Qu
descendencia se obtendr al cruzar las plantas de flores naranjas obtenidas, con las rojas
y con las amarillas tambin obtenidas? Razonar los tres cruzamientos.
24. Los grupos sanguneos en la especie humana estn determinados por tres genes alelos: I A,
que determina el grupo A, IB, que determina el grupo B e i, que determina el grupo O. Los
genes IA e IB son codominantes y ambos son dominantes respecto al gen i que es
recesivo. Cmo podrn ser los hijos de un hombre de grupo AB y de una mujer de grupo
AB? Haz un esquema del cruzamiento.
25. Los grupos sanguneos en la especie humana estn determinados por tres genes alelos: I A,
que determina el grupo A, IB, que determina el grupo B e i, que determina el grupo O. Los
genes IA e IB son codominantes y ambos son dominantes respecto al gen i que es
recesivo. Cmo podrn ser los hijos de un hombre de grupo A, cuya madre era del grupo
O, y de una mujer de grupo B, cuyo padre era del grupo O? Haz un esquema del
cruzamiento.

3 ley de Mendel

Pgina 14

Problemas de gentica

Biologa 4 de ESO

26. En las gallinas de raza andaluza, la combinacin heterozigtica de los alelos que determina
el plumaje negro y el plumaje blanco da lugar a plumaje azul. Qu descendencia tendr
una gallina de plumaje azul, y en qu proporciones, si se cruza con aves de los siguientes
colores de plumaje: a) Negro, b) Azul, y c) Blanco.
27. Antirrhinum puede tener flores rosas, blancas o rojas. En la tabla se detallan los resultados
de una serie de cruces entre diversas plantas y los resultados obtenidos:
Cruces

Descendencia

Roja x Rosa
Blanca x Rosa
Roja x Blanca
Rosa x Rosa

126 Rojas y 131 Rosas


88 Blancas y 92 Rosas
115 Rosas
43 Blancas, 39 Rojas y 83 Rosas

Qu mecanismo gentico puede deducirse de estos resultados?


28. En cierta poblacin el 30% de los individuos del grupo sanguneo A son heterocigotos para
dicho alelo. Una mujer del grupo A se casa con un hombre del grupo AB. Cul es la
probabilidad de que el primer hijo sea a) del grupo B, b) del grupo A, y c) del grupo AB?
29. Se present ante los tribunales de justicia el siguiente caso: una familia x reclama que
cierto beb Y, que les dieron en la maternidad, no les pertenece y que, en cambio, el beb
Z, que tiene la familia W, es el suyo. La familia W niega este hecho, y el tribunal ordena el
examen de los grupos sanguneos de los bebes y de los padres, con los siguientes
resultados:

Familia X/Y
Familia W/Z

Madre

Padre

Beb

AB
A

O
O

A
O

Qu familia tiene razn?


30. En las gallinas de raza andaluza, la combinacin heterozigtica de los alelos que determina
el plumaje negro y el plumaje blanco da lugar a plumaje azul. Qu descendencia tendr
una gallina de plumaje azul, y en qu proporciones, si se cruza con aves de los siguientes
colores de plumaje: a) Negro, b) Azul, y c) Blanco.

3 ley de Mendel

Pgina 15

Problemas de gentica

Biologa 4 de ESO

PROBLEMAS DE GENTICA: HERENCIA LIGADA AL SEXO


1. La hemofilia es un carcter ligado al sexo. Si una mujer normal, cuyo padre era
hemoflico se casa con un varn normal. Qu proporcin de la descendencia tendr el
gen para la hemofilia?
2. En las plantas, la determinacin del sexo es similar a la del hombre. Se sabe que un
gen ligado "v" es letal en las hembras homocigticas. Cuando se encuentra en los
machos da lugar a manchas de color amarillo-verde. El alelo dominante "V" produce
color verde oscuro normal. Del cruce entre hembras heterocigticas y machos amarilloverde, predecir las proporciones fenotpicas esperadas en la descendencia.
3. Consideremos simultneamente dos caracteres influidos por el sexo; la calvicie y el
dedo ndice corto. Ambos caracteres se manifiestan como dominantes en el hombre y
recesivo en la mujer. Un hombre heterocigtico para la calvicie y con el dedo ndice
normal se casa con una mujer calva y heterocigtica para el carcter de longitud de
dedo. Qu descendencia se espera?
4. Se cruz una hembra heterocigtica para los genes recesivos "a" y "b", con un macho
de fenotipo Ab. En la descendencia, el 50% de las hembras eran de fenotipo AB y el
otro 50% presentaban fenotipo Ab. En los machos, aparecera el 25% de cada uno de
los fenotipos AB, Ab, aB, ab. Explicar el tipo de herencia.
5. Es posible que dos genes vayan sobre el mismo cromosoma X, uno sea ligado al sexo
y el otro no?
6. Se sabe que la hemofilia est provocada por un gen recesivo ligado al sexo. Una mujer
que tiene un hermano hemoflico, y cuyo marido es normal, acude a una consulta de
gentica.
a. Qu porcentaje de sus hijos varones heredar la enfermedad?
b. Si el marido de la mujer es hemoflico, cambiarn los porcentajes para sus hijos?
7. El daltonismo depende de un gen recesivo ligado al sexo. Juan es daltnico y sus
padres tenan visin normal. Se casa con Mara, que tiene visin normal. Su hijo, Jaime,
es daltnico.
a. Explicar cmo son los genotipos de Juan, Mara, Jaime, el padre de Juan y la madre
de Juan.
b. Qu otra descendencia podran tener Juan y Mara?
8. Representar esquemticamente los diferentes gametos que producen una mujer que
sea portadora de una enfermedad ligada al cromosoma X (se supone que es una
enfermedad recesiva) y un varn sano, y contestar a las siguientes cuestiones:
a. Las hijas de estas dos personas sufrirn la enfermedad?
b. Si se diera el caso de que alguna de las hijas se casara con un varn que padeciera
la enfermedad de la madre, podran tener algn hijo, nio o nia, con esta
enfermedad?

3 ley de Mendel

Pgina 16

Problemas de gentica

Biologa 4 de ESO

9. La hemofilia es una enfermedad hereditaria controlada por un gen (h) recesivo ligado al
cromosoma X, mientras que el albinismo esta determinado por un gen (a) recesivo
ligado a un autosoma. Un hombre normal, respecto a la hemofilia pero albino, se casa
con una mujer morena, de madre albina y de padre hemoflico. Cules sern los
genotipos y los fenotipos de los cnyuges? Y los de los hijos? Con qu frecuencia se
presentan?
10. E l daltonismo depende de un gen recesivo ligado al sexo. Un hombre y una mujer de
visin normal tienen tres hijos: un varn daltnico que tiene una hija de visin normal;
una hija de visin normal que tiene dos hijos, uno daltnico y otro de visin normal, y
una tercera hija de visin normal que tiene todos los hijos de visin normal. Realizar
todos los cruzamientos. Cules son los genotipos de abuelos, hijos y nietos? Razonar
las respuestas.
11. Representar esquemticamente los diferentes gametos que producen una mujer que
sea portadora de una enfermedad ligada al cromosoma X (se supone que es una
enfermedad recesiva) y un varn sano, y contestar a las siguientes cuestiones:
a. Las hijas de estas dos personas sufrirn la enfermedad?
b. Si se diera el caso de que alguna de las hijas se casara con un varn que padeciera
la enfermedad de la madre, podran tener algn hijo, nio o nia, con esta
enfermedad?
12. El daltonismo est regido por un gen (d) recesivo frente a su alelo (D) que provoca
visin normal, y se encuentra ligado al cromosoma X. El color de los ojos est
controlado por una pareja allica en la que el color azul se debe a un gen {a) recesivo
frente al que produce color pardo (A). Una mujer de ojos pardos, cuyo padre era
daltnico y cuya madre tena los ojos azules se casa con un hombre de ojos azules y
visin normal. Determinar los genotipos del hombre y la mujer, los tipos de gametos y
los fenotipos de sus hijos, indicando la probabilidad en cada sexo.
13. En D. melanogaster las alas vestigiales v son recesivas respecto al carcter normal,
alas largas V y el gen para este carcter no se halla en el cromosoma sexual. En el
mismo insecto el color blanco de los ojos es producido por un gen recesivo situado en
el cromosoma X, respecto del color rojo dominante. Si una hembra homocigtica de
ojos blancos y alas largas se cruza con un macho de ojos rojos y alas largas,
descendiente de otro con alas cortas, cmo ser la descendencia?
14. En un mamfero el nmero de cromosomas es 2n = 48: Cuntos autosomas tendr un
espermatozoide? y cuntos cromosomas sexuales? Cuntos autosomas tendr una
clula somtica? y cuntos cromosomas sexuales? Razonar las respuestas.
15. El color rojo de los ojos de Drosophila es dominante. Se realiz un cruzamiento en el
que ambos parentales tenan los ojos rojos y se observ que la descendencia era
fenotpicamente uniforme, con ojos rojos. De esta descendencia se tomaron una serie
de moscas, cada una de las cuales se cruz con una mosca de ojos prpura. La mitad
de los cruzamientos produjo slo moscas de ojos rojos y la otra mitad produjo el 50%
de moscas con ojos rojos y el otro 50% de moscas con ojos prpura.
a. Indicar los genotipos de la descendencia del primer cruzamiento.
b. Indicar los genotipos de la descendencia del segundo cruzamiento.
3 ley de Mendel

Pgina 17

Problemas de gentica

Biologa 4 de ESO

16. En la hemofilia:
a. Cules sern las proporciones genotpicas que podramos esperar de la
descendencia de una mujer fenotpicamente normal, cuyo padre era hemoflico y
cuyo marido es normal?
b. Qu circunstancias tienen que darse para que un padre y su hijo varn sean
hemoflicos?
17. El color rojo de los ojos de Drosophila es dominante. Se realiz un cruzamiento en el
que ambos parentales tenan los ojos rojos y se observ que la descendencia era
fenotpicamente uniforme, con ojos rojos. De esta descendencia se tomaron una serie
de moscas, cada una de las cuales se cruz con una mosca de ojos prpura. La mitad
de los cruzamientos produjo solo moscas de ojos rojos y la otra mitad produjo el 50%
de moscas con ojos rojos y el otro 50% de moscas con ojos prpura.
a) Indicar los genotipos de la descendencia del primer cruzamiento.
b) Indicar los genotipos de la descendencia del segundo cruzamiento
18. En Drosophila el carcter ojo sepia es recesivo respecto al carcter ojo rojo, el ala curva es
recesivo respecto al ala recta. Si una mosca (lnea pura) de ojos sepia y alas rectas es
apareada con otra mosca (lnea pura) de ojos sepia y alas curvas. Qu fenotipos
aparecern en la generacin F1? Si se permite que dos moscas F1 se apareen, qu
fenotipos resultaran en la generacin F2 y en que proporcin?
19. Un matrimonio, ambos con visin normal, tiene un hijo varn daltnico. Cul es la
probabilidad de que tengan una hija daltnica?. Si el hijo daltnico se casa con una
mujer normal no portadora, podran tener algn hijo, varn o hembra, daltnico?.
Razonar las respuestas en cada caso.
20. La abuela materna de un varn tiene visin normal; su abuelo materno era daltnico, su
madre es daltnica y su padre es de visin normal.
a) Raznese cul es el genotipo de la abuela materna.
b) Qu tipo de visin tendr este varn?
c) Si se casara con una mujer genotpicamente igual a sus hermanas, qu tipo de
visin debera esperarse en la descendencia y en que proporciones?
21. Se cruz una hembra de Drosophila heterocigtica para los genes a (alas cortadas) y b
(ojos sepia), ambos recesivos, por un macho de alas normales y ojos sepia. En la
descendencia el 50% de las hembras eran normales y el otro 50% tenan ojos sepia. En
los machos haba el 25% de cada uno de los tipos: normal, ojos sepia y alas normales,
ojos normales y alas cortadas, y ojos sepia y alas cortadas. Explquese el tipo de
herencia.
22. En los gatos, el color del pelo est regulado por un locus situado en el segmento
diferencial del cromosoma X. El alelo A produce color negro, el a color amarillo y el
heterocigoto Aa es de color "tortuga". Una gata amarilla tiene en un parto 4 gatitos, 3
"tortuga" y 1 amarillo. Se pide el genotipo del padre y el sexo y genotipo de los 4
gatitos.

3 ley de Mendel

Pgina 18

Problemas de gentica

Biologa 4 de ESO

23. En Drosophila, las alas vestigiales dependen del gen autosmico vg recesivo de su
alelo para alas normales. Los ojos blancos se deben al alelo w recesivo de W que
determina color rojo, estn situados en el segmento diferencial del cromosoma X. Se
cruza un macho de ojos blancos y alas vestigiales por una hembra homocigtica de tipo
normal. Una hembra de la F1 se retrocruza con el padre. Obtener los resultados de este
otro cruzamiento.
24. Sabiendo que la hemofilia se debe a un alelo recesivo localizado en el cromosoma X,
estudiar la descendencia del cruzamiento entre un varn no hemoflico y una hembra
normal cuya madre fue hemoflica.
25. Un hombre no hemoflico que presenta albinismo, se casa con una mujer morena cuyo
padre era hemoflico y cuya madre presentaba albinismo. Teniendo en cuenta que el
albinismo se debe a un carcter autosmico recesivo:
a) Qu tipos de hijos pueden tener?
b) En qu proporciones?
26. El daltonismo depende de un gen recesivo ligado al sexo. Juan es daltnico y sus padres
tenan visin normal. Se casa con Mara, que tiene visin normal. Su hijo, Jaime, es
daltnico.
a) Explicar cmo son los genotipos de Juan, Mara y Jaime, el padre y la madre de Juan.
b) Qu otra descendencia podran tener Juan y Mara? Razona las respuestas.
27. El daltonismo depende de un gen recesivo ligado al sexo. Un hombre y una mujer de
visin normal tienen tres hijos: un varn daltnico que tiene una hija de visin normal;
una hija de visin normal que tiene dos hijos, uno daltnico y otro de visin normal; y
una tercera hija de visin normal que tiene todos los hijos de visin normal.
a) Realizar todos los cruzamientos.
b) Cules son los genotipos de abuelos, hijos y nietos? Razona la respuesta.
28. Se sabe que la hemofilia est provocada por un gen recesivo ligado al sexo. Una mujer
que tiene un hermano hemoflico, y cuyo marido es normal, acude a una consulta
gentica.
Qu porcentaje de sus hijos varones heredar la enfermedad?
Si el marido de la mujer es hemoflico, cambiarn los porcentajes para sus hijos?
Razona la respuesta.
29. En la especie humana el albinismo es un carcter autosmico recesivo y el daltonismo
es un carcter recesivo ligado al sexo. Si una mujer albina y daltnica se casa con un
hombre que no padece dichas enfermedades, pero cuya madre es albina:
a) Qu porcentaje de sus hijos padecer ambas enfermedades y a qu sexo
pertenecen?
b) Qu porcentaje de sus hijos ser normal y a qu sexo pertenecen?

3 ley de Mendel

Pgina 19

Problemas de gentica

Biologa 4 de ESO

30. Los gatos machos domsticos pueden ser negros o amarillos. Las hembras pueden ser
negras, barcinas (con manchas amarillas y negras) o amarillas. Si estos colores son
determinados por un gen ligado al sexo.
a) Cmo pueden explicarse estos resultados?
b) Determinar los fenotipos esperados en la descendencia al cruzar una hembra
amarilla con un macho negro.
c) Un cierto tipo de apareamiento produce la siguiente camada de gatitos:
Machos amarillos 1/4

Machos negros 1/4

Hembras barcinas 1/4

Hembras negras 1/4

Qu colores tienen los progenitores?.


d) Otro tipo de apareamiento produce la siguiente camada de gatos:
machos amarillos 1/4

machos negros 1/4

hembras amarillas 1/4

hembras barcinas 1/4

Qu colores tienen los progenitores?


Cmo podramos explicar la aparicin, de un macho barcino?
31. 7. Al analizar las clulas somticas de un saltamontes, se observa que ellas poseen 23
cromosomas.
a. Determine el sexo de este individuo.
b. Determine la frmula del cariotipo de los gametos que forma este individuo,
estableciendo su frecuencia.
c. Determine el nmero de cromosomas que tendran las clulas somticas de la
hembra.
d. Determine la frmula cariotpica de los gametos que forma la hembra.
32. En las gallinas, el tipo de plumaje es controlado por un par de genes ligados al sexo, el
alelo dominante determina al fenotipo llamado chano y su alelo recesivo determina el
fenotipo de plumas lisas. Si se cruza una hembra de plumas lisas con un macho chano,
cuya madre era de plumas lisas. Determine las proporciones fenotipicas y genotipicas
de la descendencia, por sexos.

EJERCICIOS CON RBOLES GENEALGICOS.


1. Un gen recesivo ligado al sexo (e) causa esterilidad en los machos. A la vista del pedigree,
responder a las siguientes preguntas:

3 ley de Mendel

Pgina 20

Problemas de gentica

Biologa 4 de ESO

a. Cul es la probabilidad de que II1 X II2 tengan otro hijo macho normal?
b) Cul es la probabilidad de que II5 X II6 tengan una hija portadora?
2. Un gen recesivo ligado al sexo, determina la hemofilia. De la informacin obtenida en el
siguiente pedigree, contestar las siguientes preguntas:

Si II 2 se casa con un hombre normal, Cul es la probabilidad de que su primer


hijo sea nio hemofilico?
Suponga que su primer hijo es hemoflico, Cul es la probabilidad de que su
segundo hijo sea un nio hemofilico?
Si la madre de I1 era portadora, Cul era el fenotipo del padre de I1?

3. En los canarios, la variedad verde con ojos negros depende de un gen dominante ligado al
sexo y la variedad canela con ojos rojos se debe a su alelo recesivo. De la informacin dada por
el siguiente pedigree:

3 ley de Mendel

Pgina 21

Problemas de gentica

Biologa 4 de ESO

Responda:
Cul es la probabilidad que la pareja II-12 y III-13, tengan un macho canela de ojos rojos?
Cul es la probabilidad que la pareja II-4 y II-5 tengan otra hembra verde de ojos negros?
Cul es la probabilidad que la pareja II-8 y II-9 tengan 2 hembras verdes de ojos negros, 1
hembra canela de ojos rojos y 2 machos de verdes de ojos negros?
4. El rbol genealgico adjunto representa la herencia de una forma de atrofia muscular congnita
(crculos o cuadrados oscurecidos). Esta enfermedad se hereda en forma:
autosmica recesiva
autosmica dominante
ligada a X recesiva
ligada a X dominante
ligada a Y

5. En el rbol genealgico adjunto, cierta ceguera para los colores est simbolizada por
crculos o cuadrados oscurecidos. Este tipo de herencia es:

3 ley de Mendel

Pgina 22

Problemas de gentica

Biologa 4 de ESO

6. El ratn de casa, posee 40 cromosomas. Cuntos autosomas se encuentran en las


clulas somticas de la hembra?:
19
20
38
39
40
7. El daltonismo en la especie humana est dado por un carcter recesivo ligado al sexo.
Cul de los siguientes cruzamientos NO producir varones daltnicos?:
mujer daltnca y hombre normal
mujer daltnica y hombre daltnico
mujer normal homocigota y hombre daltnico
mujer heterocigota portadora y hombre normal
mujer heterocigota portadora y hombre daltnico
8.
17. Cmo se denomina a la patologa en la que hay un juego de cromosomas en
exceso?:
Trisoma
triploida
aneuploida
nulisoma
monosoma
9.
18. El sexo en los saltamontes es de tipo "XO". Al analizar las clulas somticas de uno
de ellos, se encuentra que tiene 17 cromosomas. Cul es la frecuencia en que los
diferentes gametos pueden ser formados en este individuo?:

10. El siguiente diagrama muestra un pedigree de miopa:

3 ley de Mendel

Pgina 23

Problemas de gentica

3 ley de Mendel

Biologa 4 de ESO

Pgina 24

Problemas de gentica

3 ley de Mendel

Biologa 4 de ESO

Pgina 25

TEMA 6.- LOS GRUPOS SANGUNEOS.


PROBLEMAS DE GENTICA.

LOS GRUPOS SANGUNEOS


Los grupos sanguneos fueron descubiertos en 1900 por el doctor austriaco Karl Landsteiner. Las
transfusiones sanguneas se llevaban a cabo muchos aos antes de este descubrimiento, aunque
siempre eran un peligro. Unas veces el paciente reciba sangre de un donador sin complicaciones;
pero en otras los glbulos rojos de la sangre del donador se aglutinaban despus de mezclarse con
la sangre del receptor. Cuando suceda esto los glbulos rojos obstruan los capilares y llegaban a
causar la muerte del paciente.
Los glbulos rojos humanos pueden tener en su superficie dos tipos diferentes de sustancias
llamadas antgenos A y B. Los cuatro grupos sanguneos se nombran de acuerdo con el antgeno
que llevan los glbulos rojos. Si estos llevan el antgeno A, se dice que la sangre es del grupo A. Si
llevan el antgeno B, la sangre es del grupo B. Si llevan los dos antgenos, la sangre es del grupo AB,
y si no llevan ninguno de ellos es del grupo O.
Por otra parte, el plasma de la sangre del grupo A lleva anticuerpos que aglutinan los glbulos
rojos con antgeno B (anticuerpos anti-B). El plasma de la sangre del grupo B lleva anticuerpos
que aglutinan los glbulos rojos con antgeno A (anti-A). El plasma de la sangre del grupo AB no
lleva ni anticuerpos anti-A ni anti-B. El plasma de la sangre del grupo O, lleva anticuerpos anti-A
y anti-B.
Grupo sanguneo

Antgenos en glbulos rojos

Anticuerpos en el plasma

anti-B

anti-A

AB

A+B

-------

-------

anti-A y anti-B

Para que una transfusin sea posible hay que tener en cuenta que el
plasma del receptor no contenga anticuerpos que aglutinen a los
glbulos rojos del donante.
Esto se puede resumir de la siguiente manera:

DETERMINACION DE GRUPOS SANGUINEOS


Para obtener las muestras de sangre utilizar lancetas esterilizadas de un solo uso y
desinfectar la herida con alcohol. NO INTERCAMBIAR LAS LANCETAS
Colocar en un portaobjetos dos gotas de sangre y aadir sobre la primera una gota de suero
con anticuerpos anti-A y sobre la segunda una gota de suero con anticuerpos anti-B.
Observar si se presenta aglutinacin despus de unos minutos.

HERENCIA DE LOS GRUPOS SANGUNEOS


GEN.- Fragmento de ADN que determina un carcter. Ej. Gen del
daltonismo. Para cada carcter un individuo posee dos genes,
uno heredado del padre y otro de la madre.
ALELOS.- Son las formas que puede presentar un gen. Ej. En los
guisantes, el gen color de las semillas puede presentar dos
alelos, amarillo y verde.
ALELO DOMINANTE.- Es el que se manifiesta siempre que est
presente.
ALELO RECESIVO.- Slo se manifiesta si no est presente el dominante.
ALELOS CODOMINANTES.- Se manifiestan simultneamente.
GENOTIPO.- Es la dotacin gentica de un individuo para un determinado carcter. Se representa
por letras, los alelos dominantes con letras maysculas, los recesivos con letras minsculas. Ej. AA,
Aa, aa.
HOMOCIGTICO.- Un individuo es homocigtico para un carcter cuando los dos genes que posee
para ese carcter son diferentes. Ej. Aa.
HETEROCIGTICO.- Un individuo es heterocigtico para un carcter cuando los dos genes que
posee para ese carcter son iguales. Ej. AA o aa.
FENOTIPO.- Es la manifestacin externa del genotipo. Ej. Verde, daltnico
Los grupos sanguneos en la especie humana estn determinados por un gen que presenta tres
alelos: IA, que determina el grupo A, IB, que determina el grupo B e i, que determina el grupo O.
Los genes IA e IB son codominantes y ambos son dominantes respecto al gen i que es recesivo.

Ejercicio 1.- Completa el siguiente cuadro:


Fenotipo del padre

Fenotipo de la madre

AB

AB

AB

Fenotipos posibles de los hijos

Ejercicio 2.- Es posible que un hombre del tipo sanguneo B y una mujer del tipo AB tengan un
hijo del tipo O?
Ejercicio 3.- Una pareja tiene 3 hijos de los grupos A, O y AB Qu genotipos presentan los
padres?
Ejercicio 4.- Una mujer del grupo sanguneo A tiene un hijo del grupo O. Puede ser el padre un
hombre del grupo A cuyos padres son ambos del grupo AB?
Ejercicio 5.- Cmo podrn ser los hijos de un hombre de grupo A, cuya madre era del grupo O,
y de una mujer de grupo B, cuyo padre era del grupo O?
Ejercicio 6.- Una pareja slo puede tener descendientes del grupo sanguneo B heterocigticos
o del grupo 0. Indique el genotipo y el fenotipo de la pareja. Explique cul es la probabilidad en
esa pareja de tener descendientes del grupo sanguneo 0 y cul la de tener descendientes del
grupo B. Razone las respuestas.
Ejercicio 7.- Un hombre del grupo sanguneo B es sometido a juicio de paternidad por una mujer
del grupo sanguneo A y que tiene un hijo de grupo sanguneo O.
a) Es este hombre el padre del nio?
b) Si lo fuera, Cules seran los genotipos de los progenitores?
c) Qu genotipo tendra que tener para no ser el padre del nio?

FACTOR Rh
Es otro antgeno que puede estar presente en la membrana plasmtica de los glbulos rojos.
Fue descubierto en 1940 a partir de los eritrocitos del mono Macacus rhesus. El 85% de las
personas poseen el factor Rh, por lo que se clasifican en este caso como Rh positivas (Rh+). El
15% restante corresponde a las personas Rh negativas (Rh-) por carecer de dicho factor.
Al nacimiento, ni las personas Rh+ ni las Rh- tienen anticuerpos anti-Rh en el plasma sanguneo.
Estos anticuerpos slo se producen cuando un individuo Rh- recibe sangre Rh+ o en el caso de
una mujer Rh- embarazada de un feto Rh+.
4

En el caso de los embarazos los problemas se pueden presentar cuando la madre es Rh y el


feto Rh +. En el primer embarazo no suele haber problemas, pero la madre se sensibiliza y
produce anticuerpos anti-Rh, que actuarn en el segundo embarazo si el nuevo feto es Rh+.

Segn lo anterior un individuo Rh+ slo puede donar sangre a otro Rh+, mientras que un
individuo Rh- puede donar a otro Rh+ o Rh-.
Teniendo en cuenta la compatibilidad de los grupos ABO y del factor Rh se puede establecer el
siguiente cuadro de posibles donaciones:

El grupo O factor Rh- es considerado donante universal, ya que su sangre puede ser
transfundida a todos los grupos existentes, pero solo puede recibir de su mismo grupo O factor
Rh-. En el extremo opuesto se ubica el grupo AB+, considerado receptor universal, ya que
recibe sangre de todos los grupos y no puede donar sangre a ningn otro grupo que no sea el
AB+.
Ejercicio 8.- Son posibles las siguientes donaciones? Justifica la respuesta
DONANTE
A+
O+
ABBO-

RECEPTOR
AB +
B+
O+
AAB+

HERENCIA DEL FACTOR Rh


El factor Rh se determina genticamente mediante los alelos D (Rh +) que es dominante y el d
(Rh -) que es recesivo. De manera que los genotipos y fenotipos posibles para este carcter son.
Genotipo
DD
Dd
dd

Fenotipo
Rh +
Rh +
Rh -

*************************************************************
Distribucin de los grupos sanguneos

Ejercicio 9.- Cmo puede ser la descendencia de una pareja formada por un hombre 0 Rh+ y
una mujer AB Rh-?
Ejercicio 10.- Cmo puede ser la descendencia de una pareja formada por un hombre B Rh- y
una mujer AB Rh-?
Ejercicio 11.- Una mujer del grupo A, Rh- ha tenido 4 hijos de los siguientes grupos:
0, Rh
0, Rh +
A, Rh +
AB, Rh +
a) Se puede saber con estos datos el genotipo del padre?
b) Cules son los genotipos de la madre y de los 4 hijos?
http://www.biologia.arizona.edu/human/sets/blood_types/intro.html Calculadora de grupos
sanguneos.
http://www.medindia.net/animation/blood-groups.asp Animacin, en ingls.
http://highered.mcgrawhill.com/sites/0072495855/student_view0/chapter21/animation__cytotoxic__type_ii_hypersen
sitivity_.html

LA HERENCIA LIGADA AL SEXO


Los cromosomas sexuales son portadores de muchos genes a parte de los implicados en los
caracteres sexuales. En la mayor parte de los mamferos el cromosoma X es ms grande que el
cromosoma Y, y por tanto portador de ms genes.
Segmentos diferenciales. Hay una zona del cromosoma X cuyos genes son homlogos de los del
cromosoma Y, de manera que los individuos poseen un par de alelos de esos genes, como pasa con
el resto. Pero existe una zona del cromosoma X cuyos genes no tienen su correspondiente en el
cromosoma Y; es el llamado segmento diferencial del cromosoma X, que contiene los genes
ligados al X.
Los caracteres determinados por los genes que se encuentran en los segmentos diferenciales se
denominan caracteres ligados al sexo. Entre los caracteres ligados al cromosoma X se encuentran
el del daltonismo y el de la hemofilia.
DALTONISMO: consiste en la dificultad para distinguir los colores. Las mujeres presentan sta
anomala slo en el caso de que sus dos cromosomas X lleven el alelo que produce esta
enfermedad, ya que se trata de un carcter recesivo. En el caso de que presenten un alelo normal
y otro del daltonismo tienen una visin normal de los colores y reciben el nombre de portadoras,
ya que pueden transmitir la enfermedad a su descendencia. En el caso de los varones basta con
que su nico cromosoma X lleve el alelo del daltonismo. La notacin habitualmente utilizada para
el daltonismo es la siguiente:
GENOTIPO FENOTIPO
GENOTIPO
FENOTIPO
XD XD
Mujer normal
XDY
Hombre normal
D d
X X
Mujer normal portadora
XdY
Hombre daltnico
Xd Xd
Mujer daltnica
HEMOFILIA: es una enfermedad que se caracteriza
por la dificultad en la coagulacin de la sangre. Se hereda de la misma forma que el daltonismo.
La notacin habitualmente utilizada para la hemofilia es la siguiente:
GENOTIPO
FENOTIPO
H H
X X
Mujer normal
H h
X X
Mujer normal portadora
h h
X X
Mujer hemoflica
Ejercicio 12.- Qu tipo de descendencia cabe esperar de los siguientes cruzamientos?
a) hombre de visin normal x mujer daltnica
b) hombre daltnico x mujer de visin normal (no portadora)
GENOTIPO
XH Y
XhY

FENOTIPO
Hombre normal
Hombre hemoflico

Ejercicio 13.- Una mujer de visin normal para los colores, cuyo padre era daltnico, se casa con un
hombre de visin normal. Qu tipo de visin cabe esperar en la descendencia de esta pareja?

Ejercicio 14.- Qu tipo de descendencia cabe esperar de los siguientes cruzamientos?


a) hombre hemoflico x mujer normal (no portadora)
b) hombre normal x mujer portadora de la hemofilia
c) hombre hemoflico x mujer portadora de la hemofilia.
Ejercicio 15.- Teniendo en cuenta el mecanismo hereditario del daltonismo, determina el genotipo
de todas las personas representadas en la siguiente genealoga.

Ejercicio 16.- A partir del siguiente rbol genealgico, contesta las siguientes preguntas:
a. Si II2 se casa con un hombre normal y su primer hijo es hemoflico, Cul es la
probabilidad de tener un segundo hijo hemoflico?
b. Si II1 se casa con una mujer normal, no portadora de la hemofilia, Cul es la probabilidad
de que su primer hijo varn sea hemoflico?

Ejercicio 17.- En la familia de la figura se indican los grupos sanguneos de cada individuo (los
hombres se representan con un cuadrado y las mujeres con un crculo). Uno de los miembros de
la genealoga tiene un grupo sanguneo no explicable en base al tipo de herencia del carcter.
Indique cual es esa persona. Indique cul de estas dos explicaciones es la ms probable: (1) La
persona en cuestin es hijo/a extramatrimonial de la persona que figura como su madre en la
genealoga, (2) hubo una confusin (cambio de nio/a) en la clnica en que naci esa persona.

Ejercicio 18.- Una pareja formada por un hombre (A) daltnico y una mujer (B) portadora del
daltonismo tienen 3 hijos: un nio normal, un nio daltnico y una nia daltnica.
La mujer (B) tiene dos hermanos varones (uno de ellos daltnico y el otro no) y una hermana que
tiene una visin normal para los colores.
La hermana de la mujer B tiene tres hijos: dos nios daltnicos y una nia de visin normal. El
padre de estos nios no es daltnico.
Ni el padre ni la madre de la mujer B son daltnicos.
a) Construir el rbol genealgico.
b) Determinar el genotipo de cada uno de los individuos que aparecen en el rbol
genealgico.
Ejercicio 19.- La abuela materna de un varn (A) tiene una visin normal para los colores y su
abuelo materno era daltnico. La madre de A es daltnica y su padre no lo es. El hombre A tiene
una hermana.
La mujer y la hermana de A tienen el mismo genotipo.
a) Construir el rbol genealgico indicando los genotipos.
b) Cmo se espera que sea la descendencia de A y su mujer?
Ejercicio 20.- El albinismo lo produce un alelo recesivo frente al color de piel normal (no es un
carcter ligado al sexo). Un hombre albino y no hemoflico se casa con una mujer morena cuyo
padre era hemoflico y cuya madre era albina. Cmo se espera que sea la descendencia de esta
pareja?

PROBLEMAS DE GENTICA

1. Si una planta homocigtica de tallo alto (AA) se cruza con una homocigtica de tallo enano (aa),
sabiendo que el tallo alto es dominante sobre el tallo enano, Cmo sern los genotipos y fenotipos
de la F1 y de la F2?
P

AA

gametos

aa
a

F1

Aa

En la primera generacin el 100% de los individuos son heterocigotos Aa de tallo alto


F1
gametos

Aa
A

Aa

gametos

AA

Aa

Tallo alto

Tallo alto

F2

Aa

aa

Tallo alto

Tallo enano

GENOTIPOS

PROPORCIN

FENOTIPOS

PROPORCIN

AA
Aa
aa

1/4
1/2
1/4

Tallo alto
Tallo enano

3/4
1/4

2. Al cruzar dos moscas negras se obtiene una descendencia formada por 216 moscas negras y 72
blancas. Representando por NN el color negro y por nn el color blanco, raznese el cruzamiento y
cul ser el genotipo de las moscas que se cruzan y de la descendencia obtenida.
Slo si las dos moscas negras son hbridas (Nn) pueden tener descendientes de color blanco
P
gametos

F1

Nn
N

Nn

gametos

NN

Nn

Negras

Negras

Nn

nn

Negras

Blancas

GENOTIPOS

PROPORCIN

FENOTIPOS

PROPORCIN

NN
Nn
nn

1/4
1/2
1/4

Moscas negras
Moscas blancas

3/4
1/4

3/4 de 288 = 216


1/4 de 288 = 72

3. El pelo rizado en los perros domina sobre el pelo liso. Una pareja de pelo rizado tuvo un cachorro de
pelo tambin rizado y del que se quiere saber si es heterocigtico. Con qu tipo de hembras tendr que cruzarse? Raznese dicho cruzamiento.
Habr que realizar un cruce prueba, es decir, cruzarlo con una hembra de pelo liso (genotipo conocido por manifestar el carcter recesivo). Si aparece algn descendiente de pelo liso el individuo es
heterocigoto, pero si no aparece ninguno lo ms probable es que sea homocigoto.

28 PROBLEMAS DE GENTICA RESUELTOS 1

4. Una mariposa de alas grises se cruza con una de alas negras y se obtiene un descendencia formada
por 116 mariposas de alas negras y 115 mariposas de alas grises. Si la mariposa de alas grises se
cruza con una de alas blancas se obtienen 93 mariposas de alas blancas y 94 mariposas de alas
grises. Razona ambos cruzamientos indicando cmo son los genotipos de las mariposas que se
cruzan y de la descendencia.
Los caracteres blanco (B) y negro (N) son codominantes. Las mariposas grises son heterocigotos
(BN), mientras que las blancas (BB) y las negras (NN) son homocigotos. Los cruces seran:
BN

Gris
gametos

NN

BN

Negra
N

Gris

gametos

BN

NN

Grises
1/2

Negras
1/2

gametos

BB

Blanca
N

gametos

BB

BN

Blancas
1/2

Grises
1/2

5. Un ratn A de pelo blanco se cruza con uno de pelo negro y toda la descendencia obtenida es de
pelo blanco. Otro ratn B tambin de pelo blanco se cruza tambin con uno de pelo negro y se obtiene una descendencia formada por 5 ratones de pelo blanco y 5 de pelo negro. Cul de los ratones A o B ser homocigtico y cul heterocigtico? Razona la respuesta.
El carcter blanco es dominante y el ratn B es heterocigoto. (B blanco; b negro)
BB
gametos

Ratn blanco A
B
gametos

bb

Bb

Ratn negro
b

Ratn blanco B
B
b

gametos

gametos

Bb

Blancos
100%

bb
Ratn negro
b

Bb

bb

Blancos
50%

Negros
50%

6. Se cruzan dos plantas de flores color naranja y se obtiene una descendencia formada por 30 plantas
de flores rojas, 60 de flores naranja y 30 de flores amarillas. Qu descendencia se obtendr al
cruzar las plantas de flores naranjas obtenidas, con las rojas y con las amarillas tambin obtenidas?
Razona los tres cruzamientos.
Los caracteres rojo (R) y amarillo (A) son codominantes. Todos los individuos naranjas son por lo
tanto heterocigotos que manifiestan el carcter intermedio.
El cruce entre plantas de flores naranjas sera:
RA
gametos

Flores naranjas
R
A

RR

Flores naranjas
R
A

gametos

RR

RA

Rojas

Naranjas

RA

AA

Naranjas

Amarillas

Se obtiene de plantas
con flores rojas, con
flores naranjas y con
flores amarillas.

Y los cruces entre las plantas de la descendencia:


RA
gametos

Flores naranjas
R
A
gametos
R

RR

RA

Flores rojas
R

Flores naranjas
R
A

RR

RA

Rojas
1/2

Naranjas
1/2

gametos

gametos
A

AA
Flores rojas
A

RA

AA

Naranjas
1/2

Amarillas
1/2

28 PROBLEMAS DE GENTICA RESUELTOS 2

7. Una planta de jardn presenta dos variedades: una de flores rojas y hojas alargadas y otra de flores
blancas y hojas pequeas. El carcter color de las flores sigue una herencia intermedia, y el carcter tamao de la hoja presenta dominancia del carcter alargado. Si se cruzan ambas variedades,
Qu proporciones genotpicas y fenotpicas aparecern en la F2? Qu proporcin de las flores rojas y hojas alargadas de la F2 sern homocigticas?
R flor roja; B flor blanca. A hojas alargadas; a hojas pequeas
RRAA

Rojas Alargadas
RA

gametos

RBAa

F1

100% de flores rosas y hojas alargadas

RBAa

F1

Rosas Alargadas
RA
Ra
BA
Ba

gametos

BBaa
Blancas Pequeas
Ba

F2

RBAa
Rosas Alargadas
RA
Ra
BA
Ba

RA

Ra

RA

RRAA

RRAa

RBAA

RBAa

Roj.Alar

Roj.Alar

Ros.Alar

Ros.Alar

Ra

RRAa

RRaa

RBAa

RBaa

Roj.Alar

Roj.Peq.

Ros.Alar

Ros.Peq.

BA
Ba

BA

Ba

RBAA

RBAa

BBAA

BBAa

Ros.Alar

Ros.Alar

Blan.Alar

Blan.Alar

RBAa

RBaa

BBAa

BBaa

Ros.Alar

Ros.Peq.

Blan.Alar

Blan.Peq.

GENOTIPOS

PROPORCIN

FENOTIPOS

PROPORCIN

RRAA
RRAa
RBAA
RBAa
RRaa
RBaa
BBAA
BBAa
BBaa

1/16
1/8
1/8
1/4
1/16
1/8
1/16
1/8
1/16

Rosas Alargadas
Rosas Pequeas
Rojas Alargadas
Rojas Pequeas
Blancas Alargadas
Blancas Pequeas

3/8
1/8
3/16
1/16
3/16
1/16

De las plantas con flores rojas y hojas


alargadas 1/3 son homocigticas

8.Qu proporcin genotpica cabe esperar en un matrimonio entre un hombre daltnico y una mujer
portadora? Qu proporcin de daltnicos cabe esperar en la familia si tiene ocho hijos?
El daltonismo se debe a un gen recesivo ligado al sexo. Si representamos como Xd el cromosoma
X portador del gen del daltonismo y como X el que posee el dominante que determina la visin normal, el cruce sera como sigue:
XdY
Hombre daltnico
gametos

Xd

XdX

Mujer portadora
Xd

gametos

Xd
d

XX

X
Y

XdY

Mujeres
daltnicas

XdX

XY

Mujeres
normales
(portadoras)

Hombres
normales

Hombres
daltnicos

Cada uno de los cuatro genotipos aparecer e la


misma proporcin (1/4).
La mitad de los descendientes (tanto varones
como mujeres) sern daltnicos.

28 PROBLEMAS DE GENTICA RESUELTOS 3

9. Indica el genotipo de un hombre calvo cuyo padre no era calvo, el de su esposa que no es calva,
pero cuya madre s lo era, y el de sus futuros hijos.
La calvicie es un carcter hereditario influido por el sexo, dominante en los hombres y recesivo en
las mujeres. (C calvicie; N no calvicie)
Los dos individuos que se cruzan son heterocigotos: el hombre habr heredado de su padre (NN)
el gen N y la mujer habr heredado de su madre (CC) el gen C.
CN
gametos

Flores naranjas
C
N

CN

Flores naranjas
C
N

gametos

CC

CN

CN

NN

Los varones de genotipos CC y CN sern


calvos, pero slo las mujeres CC sern calvas. Por lo tanto de los hijos varones sern
calvos y slo de las hijas sern calvas.

10. En el cruce de Drosophila melanogaster de alas curvadas y quetas en forma de maza dihbridas
consigo mismas se obtuvieron 590 con alas curvadas y quetas en maza, 180 con alas curvadas y
quetas normales, 160 con alas normales y quetas en maza y 60 normales para ambos caracteres.
Se puede aceptar la hiptesis de que estos caracteres se heredan independientemente?
S, porque las proporciones se aproximan a la segregacin 9:3:3:1 de la tercera ley de Mendel. Sobre un total de 990 individuos (590+180+160+60) las proporciones deberan ser:
9/16 de 990 556
3/16 de 990 186
3/16 de 990 186
1/16 de 990 62
11. En el visn el color de pelo es negro, platino (azul grisceo) o zafiro (azul muy claro). En los cruzamiento que se detallan se obtuvieron los siguientes resultados en F1:
negro x zafiro : Todos negros.
negro x zafiro :1/2 negros + 1/2 zafiros
negro x zafiro : 1/2 negros + 1/2 platino
zafiro x zafiro : Todos zafiro
platino x zafiro : 1/2 platino + 1/2 zafiro
Qu hiptesis explicara mejor estos resultados?
Estos resultados se pueden explicar considerando que el color del pelaje se debe a tres posibles
alelos de un gen: N, que determina el color negro; P, responsable del color platino; y Z, que determina el color zafiro. El alelo N es dominante sobre los otros dos y P domina sobre Z (N>P>Z).
Los zorros negros pueden tener los genotipos NN, NP o NZ; los de color platino PP o PZ; y los zafiro sern siempre ZZ. De esta manera los cruces que se indican seran:
Negro (NN)

Zafiro (ZZ)

Todos negros (NZ)

Negro (NZ)

Zafiro (ZZ)

1/2 negros (NZ) + 1/2 zafiros (ZZ)

Negro (NP)

Zafiro (ZZ)

1/2 negros (NZ) + 1/2 platino (PZ)

Zafiro (ZZ)

Zafiro (ZZ)

Todos zafiro (ZZ)

Platino (PZ)

Zafiro (ZZ)

1/2 platino (PZ) + 1/2 zafiro (ZZ)

28 PROBLEMAS DE GENTICA RESUELTOS 4

12. Un criador de zorros de pelaje plateado encontr en su granja un zorro de pelaje platino. Al cruzar
este zorro platino con sus zorros plateados la descendencia fue siempre 1/2 platino + 1/2 plateado.
Al cruzar zorros platino entre s, obtuvo zorros platino y plateado en las proporciones 2/3 y 1/3 respectivamente. Indica cuntos alelos del gen que controla el color del pelo hay en la granja del criador de zorros, sus relaciones y los genotipos de los individuos.
Como del cruce entre zorros platino se obtienen tanto zorros platino como plateados podemos deducir
que el carcter plateado es recesivo (est presente en los zorros platino, pero no se manifiesta).
El hecho de que del cruce entre zorros plateados produzca una descendencia equilibrada de zorros platino y plateados nos sugiere que los zorros platino son siempre heterocigotos. Este carcter hbrido de
los zorros platino explicara tambin por qu al cruzarlos entre s se obtiene la proporcin 2:3 en vez de
3:1, proporcin caracterstica que se obtiene del cruce entre individuos heterocigotos para un carcter,
ya que no se contabilizan los individuos homocigotos en la descendencia (probablemente el gen responsable del carcter platino es letal en homocigosis).
De esta manera los cruces sealados en el enunciado podran ser:

(pt+ pelaje platino; pt pelaje plateado)


pt+pt
gametos

pt+

Platino
pt

gametos
pt

ptpt

pt+pt

Plateado
pt

Platino

pt+

gametos

pt+

pt

pt pt

ptpt

Platino
1/2

Plateados
1/2

pt+pt

x
pt+

pt

pt

pt

pt+

pt

pt+pt+

pt+pt

Platino

Platino
1/3

gametos
pt+

Platino

pt+pt

ptpt

Platino
1/3

Plateados
1/3

13. Se cruzan tomates rojos hbridos y de tamao normal homocigticos con la variedad amarilla enana. Qu proporcin de los tomates rojos que salen en la F2 sern enanos? (Los alelos dominantes
son color rojo y tamao normal).
R color rojo; r color amarillo (R > r). N variedad normal; n variedad enana (N > n)
RrNN

P
gametos

F1

rrnn

Rojos Normales
RN
rN

Amarillos Enanos
rn

gametos

RN

rN

rn

RrNn

rrNn

Rojos Normales

Amarillos Normales

Para obtener la F2 tendremos que realizar todos los cruzamientos posibles entre los individuos de la F1.

F1
F1

RrNn

rrNn

gametos

RN

Rn

rN

rn

rN

rn

rN

rn

RN

RRNN

RRNn

RrNN

RrNn

RrNN

RrNn

RrNN

RrNn

Roj.Nor.

Roj.Nor.

Roj.Nor.

Roj.Nor.

Roj.Nor.

Roj.Nor.

Roj.Nor.

Roj.Nor.

Rn

RRNn

RRnn

RrNn

Rrnn

RrNn

Rrnn

RrNn

Rrnn

Roj.Nor.

Roj.Ena.

Roj.Nor.

Roj.Ena.

Roj.Nor.

Roj.Ena.

Roj.Nor.

Roj.Ena.

RrNn
rN
rn

F2
rN
rn

rrNn
rN
rn

RrNN

RrNn

rrNN

rrNn

rrNN

rrNn

rrNN

rrNn

Roj.Nor.

Roj.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor

Ama.Nor.

Ama.Nor

Ama.Nor.

Rrnn

rrNn

RrNn
Roj.Nor.

Roj.Ena. Ama.Nor.

rrnn

rrNn

rrnn

rrNn

rrnn

Ama.Ena.

Ama.Nor

Ama.Ena.

Ama.Nor

Ama.Ena.

RrNN

RrNn

rrNN

rrNn

rrNN

rrNn

rrNN

rrNn

Roj.Nor.

Roj.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Rrnn

rrNn

rrNn

rrnn

rrNn

RrNn
Roj.Nor.

Roj.Ena. Ama.Nor.

rrnn
Ama.Ena.

Ama.Nor. Ama.Ena. Ama.Nor.

rrnn
Ama.Ena.

RrNN

RrNn

rrNN

rrNn

rrNN

rrNn

rrNN

rrNn

Roj.Nor.

Roj.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Ama.Nor.

Rrnn

rrNn

rrNn

rrnn

rrNn

RrNn
Roj.Nor.

Roj.Ena. Ama.Nor.

rrnn
Ama.Ena.

Ama.Nor. Ama.Ena. Ama.Nor.

rrnn
Ama.Ena.

De cada 28 tomates rojos de la descendencia 7 sern enanos, es decir una proporcin de 1/4
(7/28)
28 PROBLEMAS DE GENTICA RESUELTOS 5

14. Supongamos que en las gallinas la produccin de carne entre los 500 y los 1.100 gramos se debe a
dos pares de factores A1A1A2A2 que contribuyen cada uno de ellos con 150 gramos. Cruzando un
gallo de 1.100 gramos con una gallina de 650 gramos, cules sern los genotipos y fenotipos de
la descendencia?
A1A1A2A2
gametos

A1a1a2a2

Gallo 1.100
A1A2

Gallina 650
A1a2
a1a2

gametos

A1A2

A1a2

A1A1A2a2

a1a2

A1a1A2a2

950 g
800 g

GENOTIPOS

PROPORCIN

FENOTIPOS

PROPORCIN

A1A1A2a2
A1a1A2a2

1/2
1/2

950 g
800 g

1/2
1/2

15. Al cruzar una gallina normal con un gallo paticorto salieron todos los gallitos normales y todas las
gallinitas paticortas. Posteriormente se realiza la F2 y se obtiene que la mitad de los gallos y la mitad de las gallinas salen paticortas. Tratar de explicar estos resultados.
Estos resultados se pueden explicar considerando que el carcter paticorto" se debe a un gen recesivo ligado al sexo (situado en el cromosoma X). Representado como XP el cromosoma X portador del carcter paticorto" y como X el que lleva el gen dominante normal, el cruzamiento sera:
P
gametos

X PY

XX

Macho paticorto
XP
Y

Hembra normal
X

XP

gametos

X X
X

gametos

F1

XY

F1

gametos

XP
P

XY

Gallinas
normales
(portadoras)

Gallo normal
X
Y

F2

Gallos
normales

XPX
Gallina portadora
XP
X
Y

XP

X XP

X PY

Gallinas
paticortas

Gallos
paticortos

XPX

XY

Gallinas
normales

Gallos
normales

16. En D. melanogaster las alas vestigiales vg son recesivas respecto al carcter normal, alas largas
vg+ y el gen para este carcter no se halla en el cromosoma sexual. En el mismo insecto el color
blanco de los ojos es producido por un gen recesivo situado en el cromosoma X, respecto del color
rojo dominante. Si una hembra homocigtica de ojos blancos y alas largas se cruza con un macho
de ojos rojos y alas largas, descendiente de otro con alas cortas, cmo ser la descendencia?
Representamos como Xb el cromosoma X que lleva el gen responsable del color blanco de los ojos y X
al que posee el dominante que determina el color rojo.
El genotipo del macho ser XYvg+vg, heterocigoto para el tipo de alas, puesto que habr heredado el
gen vg del progenitor de alas vestigiales (que necesariamente ser homocigoto, ya que manifiesta el carcter recesivo). El cruzamiento sera como sigue:

XYvg+vg
gametos

Xvg+

Macho Rojos Largas


Xvg
Yvg+
Xvg+

X vg

XbXbvg+vg+
Hembra Blancos Largas
Xbvg+

Yvg
Xvg

Yvg+

Yvg

XbXvg+vg+ XbXvg+vg XbYvg+vg+ XbYvg+vg


Hembras
Roj. Norm.

Hembras
Roj. Norm.

Machos
Blan. Norm.

Machos
Blan. Norm.

La descendencia estar formada por hembras de ojos rojos y


alas normales y machos de ojos
blancos y alas normales.

28 PROBLEMAS DE GENTICA RESUELTOS 6

17. La siguiente genealoga corresponde a cobayas. El negro corresponde a pelo rizado y el blanco a
pelo liso. El cuadrado significa macho y el crculo significa hembra.

Determina qu carcter es dominante y cul recesivo. Determina si es un carcter ligado al sexo.


Rizado x Rizado
Rizado Rizado Liso
Si, como se puede ver en el cruce, de cobayas con el pelo rizado se obtienen individuos con el pelo
liso, se puede deducir que el carcter pelo rizado es dominante sobre pelo liso (est presente en
los individuos de pelo rizado, pero no se manifiesta).
Aunque no aparecen machos con el pelo liso, no hay ningn indicio que nos permita suponer que
se trate de un gen ligado al sexo, ya que ni un alelo dominante ni uno recesivo en el cromosoma X
o en el cromosoma Y puede explicar los resultados que se pueden observar en la genealoga.
18. Un cobaya de pelo blanco, cuyos padres son de pelo negro, se cruza con otro de pelo negro, cuyos
padres son de pelo negro uno de ellos y blanco el otro. Cmo sern los genotipos de los cobayas
que se cruzan y de su descendencia?
Si los progenitores del cobaya blanco son de pelo negro, podemos deducir que el carcter pelo
negro es dominante sobre pelo blanco (el alelo que determina el pelaje de color blanco est presente en los progenitores, pero no se manifiesta.
Como los progenitores del cobaya negro son uno blanco y otro negro, deducimos que su genotipo
es heterocigoto puesto que habr recibido el alelo blanco de su progenitor blanco, que es homocigoto.
N pelo negro; n pelo blanco (N > n)
Nn
gametos

Cobaya negro
N
n

GENOTIPOS

PROPORCIN

Nn

nn

Negros
1/2

Blancos
1/2

Nn
nn

1/2
1/2

gametos
n

nn
Cobaya blanco
n

19. Un perro de pelo negro, cuyo padre era de pelo blanco, se cruza con una perra de pelo gris, cuya
madre era negra. Sabiendo que el pelaje negro domina sobre el blanco en los machos, y que en las
hembras negro y blanco presentan herencia intermedia, explica cmo sern los genotipos de los
perros que se cruzan y qu tipos de hijos pueden tener respecto del carcter considerado.
N pelo negro; B pelo blanco (N > B en machos; N = B en hembras)
El perro de pelo negro es heterocigtico (NB) puesto que su padre es blanco (BB). La hembra de
pelo gris es tambin heterocigtica (NB), puesto que manifiesta el carcter intermedio.
NB
gametos

Perro negro
N
B
gametos

NB
Perra gris
N
B

NN

NB

Mach.negr.
Hemb.negr.

Mach.negr.
Hemb.grises

NB

BB

Mach.negr.
Hemb.grises

Mach.blancos
Hemb. blanc.

de los machos de la descendencia sern


negros y blancos. de las hembras de la
descendencia sern negras, blancas y
grises.

28 PROBLEMAS DE GENTICA RESUELTOS 7

20. Un varn de ojos azules se casa con una mujer de ojos pardos. La madre de la mujer era de ojos
azules, el padre de ojos pardos y tena un hermano de ojos azules. Del matrimonio naci un hijo
con ojos pardos. Razonar cmo ser el genotipo de todos ellos, sabiendo que el color pardo domina sobre el color azul.
A ojos pardos; a Ojos azules (A > a)

Madre
Azules
aa

Hombre
Azules
aa

Mujer
Pardos
Aa

Padre
Pardos
AA/Aa

Hermano
Azules
aa

Los individuos que manifiestan el carcter recesivo (ojos azules) son necesariamente homocigotos aa.
Los individuos de ojos pardos que tienen un
progenitor de ojos azules tienen que ser heterocigotos Aa.
No tenemos datos para determinar con seguridad el genotipo del padre de la mujer.

Hijo
Pardos
Aa

21. En la especie vacuna, la falta de cuernos F, es dominante sobre la presencia f. Un toro sin cuernos
se cruza con tres vacas:
Con la vaca A que tiene cuernos se obtiene un ternero sin cuernos.
Con la vaca B tambin con cuernos se produce un ternero con cuernos.
Con la vaca C que no tiene cuernos se produce un ternero con cuernos.
Cules son los genotipos del toro y de las tres vacas y qu descendencia cabra esperar de estos
cruzamientos?
El toro es heterocigoto Ff puesto que si no no podra tener descendientes con el carcter recesivo
sin cuernos como ocurre al aparearse con las vacas B y C.
La vaca A es homocigota ff puesto que manifiesta el carcter recesivo sin cuernos.
La vaca B es tambin homocigota ff por la misma razn.
La vaca C es heterocigoto por la misma razn que el toro.
Ff

Toro sin cu.

ff

Ff

Vaca A con cu.

Toro sin cu.


gametos

Ff

ff

Sin cu..

Con cu.

gametos

Ff

ff

Sin cu.

Con cu.

ff

Ff

Vaca B con cu.

Toro sin cu.


gametos

FF

Ff

Sin cu.

Sin cu.

Ff
Vaca C sin cu.
f

Ff

Ff

Sin cu.

Con cu.

22. La aniridia (dificultades en la visin) en el hombre se debe a un factor dominante (A). La jaqueca es
debida a otro gen tambin dominante (J). Un hombre que padeca de aniridia y cuya madre no , se
cas con una mujer que sufra jaqueca, pero cuyo padre no la sufra. Qu proporcin de sus hijos
sufrirn ambos males?
El hombre es heterocigoto para la aniridia Aa puesto que su madre no la padeca y es homocigoto
recesivo para la jaqueca jj puesto que no la padece.
La mujer es heterocigota para la jaqueca Jj puesto que su padre no la padeca y es homocigota recesivo para la aniridia aa puesto que no la padece.
Aajj
gametos

Hombre con aniridia


Aj
aj

Aj
aJ
aj

aaJj
Mujer con jaqueca
aJ
aj
aj

AaJj

aaJj

Aniridia Jaqueca

Jaqueca

Aajj

aajj

Aniridia

Sanos

de los descendientes padecern ambos males.

28 PROBLEMAS DE GENTICA RESUELTOS 8

23. En la mosca del vinagre, la longitud de las alas puede ser normal o vestigial, siendo el carcter vestigial recesivo respecto del normal. Al cruzar dos razas puras con las alternativas para este carcter, qu proporciones genotpicas y fenotpicas apareceran en F1, F2 y F3 (resultado del cruce de
todos los individuos de F2)? vg+ alas normales; vg alas vestigiales (vg+ > vg)
vg+vg+

vg+

gametos

vgvg
GENOTIPOS

vg
+

F1

vg vg
vg+vg

F1
+

gametos

vg vg

PROPORCIN
100%

FENOTIPOS
Alas norm.

PROPORCIN
100%

GENOTIPOS

PROPORCIN

FENOTIPOS

PROPORCIN

1/4

Alas norm.

3/4

1/2

Alas vest.

1/4

vg+vg

x
+

vg

vg

vg

vg

vg+vg+
vg+

gametos

vg vg

vg+

F2

vg
+

vg vg

Alas norm.

vg

vg+vg

Alas norm.

vg vg

vgvg

Alas norm.

Alas vest.

vgvg

1/4

Para obtener la F3 hay que hacer todos los cruces posibles entre los individuos de la F2. Como los
resultados de todos los cruzamientos posibles son equiprobables, indico en cada cruce todos los
gametos posibles, aunque sean iguales.
vg+vg+

F2
F2
vg vg

vg
+

vg
+

vg+vg

vg

vg+

vgvg

vg

vg

vg

vg vg vg vg vg vg vg vg vg vg vg vg vg vg vg+vg

vg

vg+

vg+vg+ vg+vg+ vg+vg+ vg+vg vg+vg+ vg+vg vg+vg vg+vg

vg+vg
+

vg

vg+vg
vg
vg

vgvg
vg

Normal Normal Normal Normal Normal Normal Normal Normal


Normal Normal Normal Normal Normal Normal Normal Normal
+

vg

Genotipos
vg vg+

vg+vg

vgvg

Normal Normal Normal Normal Normal Normal Normal Normal

vg+vg+ vg+vg+ vg+vg+ vg+vg vg+vg+ vg+vg vg+vg vg+vg

F3

vg+vg
+

vg

gametos

vg+
+

(16/64)
(32/64)
(16/64)

vg vg vg vg vg vg vgvg vg vg vgvg vgvg vgvg


Normal Normal Normal Vest. Normal Vest.

Vest.

Fenotipos
Alas
(48/64)
normales
Alas
(16/64)
vestigiales

Vest.

vg+vg+ vg+vg+ vg+vg+ vg+vg vg+vg+ vg+vg vg+vg vg+vg


Normal Normal Normal Normal Normal Normal Normal Normal

vg+vg vg+vg vg+vg vgvg vg+vg vgvg vgvg vgvg


Normal Normal Normal Vest. Normal Vest.

Vest.

Vest.

vg+vg vg+vg vg+vg vgvg vg+vg vgvg vgvg vgvg


Normal Normal Normal Vest. Normal Vest.

Vest.

Vest.

vg+vg vg+vg vg+vg vgvg vg+vg vgvg vgvg vgvg


Normal Normal Normal Normal Normal Vest.

Vest.

Vest.

24. Un nio compr en una pajarera un pareja de canarios moudos. Durante varias temporadas cri
con ellos y obtuvo 25 canarios moudos y 12 normales. Y al cruzar estos hijos moudos con los otros
hijos no moudos, obtena una descendencia aproximada de mitad moudos y mitad normales. Explicar al nio los genotipos de todos sus pjaros.
Los resultados de los crucfs sugieren que el carcter moudo es dominante y que todos los canarios moudos son heterocigotos, por lo que el gen responsable del carcter debe ser letal en homocigosis. Representando el gen responsable
del carcter moudo como M y como m el carcter no moudo, los cruzamientos indicados en el enunciado seran:

Mm
gametos

Canario moudo
M
m

Mm

Mm

Canario moudo
M
m

Canario moudo
M
m

gametos

MM

Moudos
1/3

Mm

mm

Moudos
1/3

No moudos
1/3

Mm

gametos

mm
Canario no moudo
M
m

gametos

Mm

mm

Moudo
1/2

No moudos
1/2

28 PROBLEMAS DE GENTICA RESUELTOS 9

25. El color rojo de la pulpa del tomate depende de la presencia de un factor R dominante sobre su
alelo r para el amarillo. El tamao normal de la planta se debe a un gen N dominante sobre el tamao enano n.
Se cruza una planta de pulpa roja y tamao normal, con otra amarilla y normal y se obtienen: 30
plantas rojas normales, 31 amarillas normales, 9 rojas enanas y 10 amarillas enanas. Cules son
los genotipos de las plantas que se cruzan. Comprobar el resultado realizando el cruzamiento.
La planta de pulpa roja y tamao normal (rasgos dominantes), tiene que ser heterocigoto para ambos caracteres (RrNn) puesto que aparecen descendientes amarillos (rr) y enanos (nn).
La planta con tomates amarillos de tamao normal tambin debe tiene que ser heterocigoto (Nn)
para este ltimo carcter por la misma razn. El color amarillo, por ser el carcter recesivo, corresponder a un genotipo homocigoto rr.
El cruce realizado ser, por lo tanto:
F1
gametos

RrNn

RN

F2

Rojos Normales
RN
Rn
rN
rn

rN
rn

Rn

rrNn
Amarillos Normales
rN
rn
rN

rn

RrNN

RrNn

rrNN

rrNn

Roj.Nor.

Roj.Nor.

Ama.Nor.

Ama.Nor.

RrNn

Rrnn

rrNn

rrnn

Roj.Nor.

Roj.Ena.

Ama.Nor.

Ama.Ena.

GENOTIPOS

PROPORCIN

FENOTIPOS

PROPORCIN

RrNN
RrNn
rrNN
rrNn
Rrnn
rrnn

1/8
1/4
1/8
1/4
1/8
1/8

Rojos normales
Rojos enanos
Amarillos normales
Amarillos enanos

3/8
1/8
3/8
1/8

3/8 de 80 = 30
1/8 de 80 = 10
3/8 de 80 = 30
1/8 de 80 = 10

26. Supongamos que en los melones la diferencia del peso del fruto entre un tipo de 1.500 gramos y
otro de 2.500 gramos se debe a dos pares de factores A1A1A2A2 que contribuyen cada uno de ellos
con 250 gramos de peso al fruto. Indicar en el siguiente cruzamiento cul ser la amplitud de variacin en el peso del fruto de la descendencia: A1a1A2a2 x A1a1A2A2 .
A1a1A2a2
gametos

Meln 2.000
A1a2
a1A2

A1A2

A1a1A2A2

Meln 2.250
A1A2
a1A2

a1a2

gametos

A1A2

A1a2

a1A2

a1a2

A1A2

A1A1A2A2

A1A1A2a2

A1a1A2A2

A1a1A2a2

2.500 g

2.250 g

2.250 g

2.000 g

a1A2

A1a1A2A2

A1a1A2a2

a1a1A2A2

a1a1A2a2

2.250 g

2.000 g

2.000 g

1.750 g

El peso en la descendencia
oscilar entre los 1.750g y los
2.500 g.

27. Una mujer lleva en uno de sus cromosomas X un gen letal recesivo l y en el otro el dominante normal L. Cul es la proporcin de sexos en la descendencia de esta mujer con un hombre normal?
XLXl
Mujer portadora
gametos

XL

Xl

XLY
Hombre normal
Y
XL

gametos

XL

Xl

XL

XLXL

XLXl

XLY

X lY

La proporcin de sexos en la descendencia


ser de 2:1 a favor de las mujeres, ya que la
mitad de los embriones masculinos sufrirn
los efectos del gen letal.
28 PROBLEMAS DE GENTICA RESUELTOS 10

28. En la mosca del vinagre el color blanco de los ojos es producido por un gen recesivo situado en el
cromosoma X, respecto del color rojo dominante. Las alas vestigiales vg, son recesivas respecto de
las alas largas vg+, y este carcter no se halla ligado al sexo.
Realizamos el cruzamiento de un macho de alas vestigiales y ojos rojos con una hembra de alas
largas heterocigtica y ojos rojos portadora del gen blanco. Supongamos adems que en el mismo
cromosoma X en que va el gen ojos blancos, va tambin ligado un gen letal l, recesivo.
Sobre un total de 150 descendientes de la pareja que se cruza, razona qu proporcin de hembras
y de machos habr con alas normales y con alas vestigiales. Y respecto al color?
Es posible que dos genes vayan sobre el mismo cromosoma X, uno sea ligado al sexo y el otro
no?
El genotipo del macho de ojos rojos y alas vestigiales es: XRYvgvg. El de la hembra de alas largas
heterocigtica y ojos rojos portadora del gen blanco y del gen letal es:
XRYvgvg
Macho Rojos Vestigiales

gametos

XRvg

XRXblvg+vg

Hembra Rojos Largas

XRvg+

Yvg

XRvg

Xblvg+

Xblvg

Xblvg+

XRvg

Yvg

X XRvg+vg

XRYvg+vg

Hembras
Roj. Norm.

Machos
Roj. Norm.

XRXRvgvg

XRYvgvg

Hembras
Roj. Vest.

Machos
Roj. Vest.

XRvg+

XRvg

XRXblvg+vg XblYvg+vg
Hembras
Roj. Norm.

XRXblvgvg

Xblvg

FENOTIPOS
Hembras Ojos roj. Alas Norm.

PROPORCIN

Hembras Ojos roj. Alas Vest.


Machos Ojos roj. Alas Norm.
Machos Ojos roj. Alas Vest.

XblYvgvg

1/3
1/3
1/6
1/6

Hembras
Roj. Vest.

Las proporciones de machos y hembras con alas normales o vestigiales son:


FENOTIPOS
Hembras Alas normales
Hembras Alas vestigiales
Machos Alas normales
Machos Alas vestigiales

PROPORCIN

1/3 de 150 50
1/3 de 150 50
1/6 de 150 25
1/6 de 150 25

Las proporciones de machos y hembras con ojos rojos o blancos son:


FENOTIPOS
Hembras Ojos rojos
Machos Ojos rojos

PROPORCIN

2/3 de 150 100


1/3 de 150 50

S es posible que dos genes vayan sobre el mismo cromosoma X y uno sea ligado al sexo y el otro
no, puesto que existe una zona homloga entre los cromosomas X e Y y los genes que se encuentran en esa zona se heredan como los rasgos autonmicos.

28 PROBLEMAS DE GENTICA RESUELTOS 11

PROBLEMAS DE GENTICA 2011 (RESUELTOS)


Ejercicio 1.
En cierta especie de plantas el color azul de la
flor, (A), domina sobre el color blanco (a).
Cmo podrn ser los descendientes del cruce
de plantas de flores azules con plantas de flores blancas, ambas homocigticas? Haz un
esquema de cruzamiento bien hecho.

Ejercicio 2.
En cierta especie de plantas los colores de las
flores pueden ser rojos, blancos o rosas. Se
sabe que este carcter est determinado por
dos genes alelos, rojo (CR) y blanco (CB), codominantes.
Cmo podrn ser los descendientes del cruce
entre plantas de flores rosas? Haz un esquema de cruzamiento bien hecho.

Ejercicio 3.
En cierta especie de plantas los colores de las
flores pueden ser rojos, blancos o rosas. Se
sabe que este carcter est determinado por
dos genes alelos, rojo (CR) y blanco (CB), codominantes.
Cmo podrn ser los descendientes del cruce
entre plantas de flores rosas con plantas de
flores rojas? Haz un esquema de cruzamiento
bien hecho.

Ejercicio 4.
Ciertos tipos de miopa en la especie humana
dependen de un gen dominante (A); el gen
para la vista normal es recesivo (a). Cmo
podrn ser los hijos de un varn normal y de
una mujer miope, heterocigtica? Haz un esquema de cruzamiento bien hecho.

Ejercicio 5.
En la especie humana el pelo en pico depende
de un gen dominante (P); el gen que determina el pelo recto es recesivo (p). Cmo
podrn ser los hijos de un varn de pelo en
pico, homocigtico, y de una mujer de pelo
recto, homocigtica? Haz un esquema de cruzamiento bien hecho.

Ejercicio 6.
En cierta especie de plantas los colores de las
flores pueden ser rojos, blancos o rosas. Este
carcter est determinado por dos genes alelos, rojo (CR) y blanco (CB) codominantes.
Cmo podrn ser los descendientes del cruce
entre plantas de flores rosas con plantas de
flores blancas? Haz un esquema de cruzamiento bien hecho.

Ejercicio 7.
En la especie humana el poder plegar la lengua depende de un gen dominante (L); el gen
que determina no poder hacerlo (lengua recta) es recesivo (l). Sabiendo que Juan puede
plegar la lengua, Ana no puede hacerlo y el
padre de Juan tampoco Qu probabilidades
tienen Juan y Ana de tener un hijo que pueda
plegar la lengua? Haz un esquema de cruzamiento bien hecho.

Ejercicio 8.
Los grupos sanguneos en la especie humana
estn determinados por tres genes alelos: IA,
que determina el grupo A, IB, que determina
el grupo B e i, que determina el grupo 0. Los
genes IA e IB son codominantes y ambos son
dominantes respecto al gen i que es recesivo.
Cmo podrn ser los hijos de un hombre de
grupo 0 y de una mujer de grupo AB? Haz un
esquema de cruzamiento bien hecho.

Ejercicio 9.
Los grupos sanguneos en la especie humana
estn determinados por tres genes alelos: IA,
que determina el grupo A, IB, que determina
el grupo B e i, que determina el grupo 0. Los
genes IA e IB son codominantes y ambos son
dominantes respecto al gen i que es recesivo.
Cmo podrn ser los hijos de un hombre de
grupo AB y de una mujer de grupo AB? Haz un
esquema de cruzamiento bien hecho.

Ejercicio 10.
Los grupos sanguneos en la especie humana
estn determinados por tres genes alelos: IA,
que determina el grupo A, IB, que determina
el grupo B e i, que determina el grupo 0. Los
genes IA e IB son codominantes y ambos son
dominantes respecto al gen i que es recesivo.
Cmo podrn ser los hijos de un hombre de
grupo A, cuya madre era del grupo 0, y de una
mujer de grupo B, cuyo padre era del grupo
0? Haz un esquema de cruzamiento bien
hecho.

Ejercicio 11.
Ciertos caracteres, como la enfermedad de la
hemofilia, estn determinados por un gen recesivo ligado al cromosoma X. Cmo podrn
ser los descendientes de un hombre normal
(XHY) y una mujer portadora (XHXh)? Haz un
esquema de cruzamiento bien hecho.

Ejercicio 12.
Ciertos caracteres, como el daltonismo, estn
determinados por un gen recesivo (d) ligado
al cromosoma X. Cmo podrn ser los descendientes de un hombre daltnico y una mujer normal no portadora? Haz un esquema de
cruzamiento bien hecho.

Ejercicio 13.
Ciertos caracteres, como el daltonismo, estn
determinados por un gen recesivo (d) ligado
al cromosoma X Cmo podrn ser los descendientes de un hombre daltnico y una mujer no daltnica, hija de un hombre daltnico?
Haz un esquema de cruzamiento bien hecho.

Ejercicio 14.
En los guisantes, el gen para el color de la piel
tiene dos alelos: amarillo (A) y verde (a). El
gen que determina la textura de la piel tiene
otros dos: piel lisa (B) y rugosa (b). Se cruzan
plantas de guisantes amarillos-lisos (AA, BB)
con plantas de guisantes verdes-rugosos (aa,
bb). De estos cruces se obtienen 1000 guisantes. Qu resultados son previsibles? Haz un
esquema de cruzamiento bien hecho.

Ejercicio 15.
En los guisantes, el gen para el color de la piel
tiene dos alelos: amarillo (A) y verde (a). El
gen que determina la textura de la piel tiene
otros dos: piel lisa (B) y rugosa (b). Se cruzan
plantas de guisantes amarillos-lisos (Aa, Bb)
con plantas de guisantes verdes-lisos aa, Bb).
De estos cruces se obtienen 884 Kg de guisantes. Qu resultados son previsibles? Haz un
esquema de cruzamiento bien hecho.

Ejercicio 16.
En los guisantes, el gen para el color de la piel
tiene dos alelos: amarillo (A) y verde (a). El
gen que determina la textura de la piel tiene
otros dos: piel lisa (B) y rugosa (b). Se cruzan
plantas de guisantes amarillos-lisos (Aa, Bb)
con plantas de guisantes amarillos-lisos (Aa,
Bb). De estos cruces se obtienen plantas que
dan 220 Kg de guisantes Cuntos kilogramos
de cada clase se obtendrn? Haz un esquema
de cruzamiento bien hecho.

Imgenes y ejercicios obtenidos de:


Web de Jos Luis Snchez Guilln
Profesor de Biologa y Geologa
I.E.S. PANDO - OVIEDO (ESPAA)
http://web.educastur.princast.es/proyectos/biogeo_ov/4a_ESO/06_genetica/problemas.htm

Cajn de Ciencias

Ejercicios resueltos de gentica


1) Un varn de cabello rizado se cas con una mujer de pelo tambin rizado. Esta pareja tuvo dos
hijos, uno con pelo rizado y otro con pelo liso. Si el caracter de pelo liso es recesivo frente al rizado,
indica cules son los genotipos de los padres y los hijos.
2) En la mosca del vinagre, Drosophila melanogaster, el color gris del cuerpo domina sobre el
negro. Al cruzar dos moscas grises, se han obtenido 152 moscas grises y 48 negras. Indica
razonadamente cul es el genotipo de los progenitores.
3) Un cerdo de orejas peludas se cruz con dos cerdas; la primera tena las orejas sin pelo y la
segunda con pelo. Del primer cruzamiento se obtuvieron un 50% de la descendencia de orejas
peludas y otro 50% de orejas sin pelo. Qu descendencia esperaras del cruzamiento con la cerda
de orejas peludas?
4) Al cruzarse dos razas puras para el color de sus flores, unas rojas y otras blancas, result una F1
de flores rosas. Al autopolinizarse esta F1 se origin una F2 con un 25% de flores rojas, 50% de
flores rosas y 25% de flores blancas. Qu explicacin propones para los resultados del
experimento?
5) Tres parejas reclaman en un juzgado la paternidad de una nia que tiene un grupo sanguneo AB.
Los primeros tienen los grupos sanguneos A y 0; los segundos son AB y 0, y los terceros, A y AB
Qu pareja tiene razn?
6) Cuatro amigos que viajan juntos tienen un accidente de automvil y mientras tres de ellos salen
ilesos, el cuarto tiene una fuerte hemorragia que necesita con urgencia una transfusin. El mdico
plantea una donacin entre ellos y los datos que aportan son los siguientes:
- El herido es del grupo sanguneo A y Rh+
- El primero de los amigos es 0, y sabe que sus padres son ambos Rh- El segundo de los amigos no conoce su grupo, pero sabe que sus padres son uno del grupo 0 y otro
del grupo A.
- El tercer amigo tambin desconoce su grupo sanguneo pero sus padres son los dos del grupo B
Rh+
Si fueras el mdico y dispusieras de esta informacin qu donante escogeras, si es que alguno de
ellos es el apropiado? (No lo elijas al azar, piensa que est en juego la vida de una persona!).

www.cajondeciencias.com

Cajn de Ciencias

Soluciones
1) Un varn de cabello rizado se cas con una mujer de pelo tambin rizado. Esta pareja tuvo dos
hijos, uno con pelo rizado y otro con pelo liso. Si el caracter de pelo liso es recesivo frente al
rizado, indica cules son los genotipos de los padres y los hijos.
Como sabemos que pelo rizado domina sobre pelo liso, llamaremos R al alelo pelo rizado y r al
alelo pelo liso.
R>r
Los padres, ambos con pelo rizado, tienen dos genotipos posibles, RR y Rr. El hijo de pelo rizado no
nos aporta informacin, porque, como los padres, puede ser homocigoto o heterocigoto. Pero el hijo
con pelo liso s nos aclara algo: como es de fenotipo recesivo, su genotipo obligatoriamente tiene
que ser rr. Y como ambos alelos han debido salir de algn lado (suponemos que los miembros de la
pareja se han sido fieles!) esto obliga a que los padres sean ambos heterocigotos.
Padres
Hijo pelo liso
Hijo pelo rizado

Rr
rr
RR o Rr (es imposible determinarlo con la informacin del enunciado).

2) En la mosca del vinagre, Drosophila melanogaster, el color gris del cuerpo domina sobre el
negro. Al cruzar dos moscas grises, se han obtenido 152 moscas grises y 48 negras. Indica
razonadamente cul es el genotipo de los progenitores.
Para empezar, podemos descartar que las moscas progenitoras fueran homocigotas, porque entonces
su descendencia habra sido uniforme (si los padres son AA o aa, todos los hijos habran salido AA o
aa, respectivamente). Por lo tanto, debe existir al menos un heterocigoto. Esto nos deja con tres
posibilidades, y sus respectivas descendencias:
AA x Aa
aa x Aa
Aa x Aa

1/2 AA, 1/2 Aa


Todas fenotipo dominante
1/2 Aa, 1/2 aa
La mitad fenotipo dominante, la mitad recesivo
1/4 AA, 1/2Aa, 1/4 aa 3/4 fenotipo dominante, 1/4 fenotipo recesivo

La primera opcin, por dar una descendencia uniforme, queda descartada. De las otras dos, la segunda no
parece encajar, porque las proporciones deberan ser mitad y mitad, y tenemos 152 grises y 48 negras.
Podra ser la tercera? Segn los resultados tericos, debera haber el triple de fenotipos dominantes frente a
los recesivos. Si dividimos 152 entre 48 obtenemos 3,17. Esto se ajusta lo suficientemente bien, por lo que
podemos afirmar que los padres eran ambos heterocigotos Aa.

Importante: cuando trabajamos con problemas de gentica que tengan resultados numricos como
es este caso, no tenemos que exigir que las proporciones se cumplan con exactitud. De hecho, en la
naturaleza no ocurre as: las leyes de la gentica que establecen las proporciones son estadsticas, y
la determinacin de los caracteres de un individuo concreto sucede al azar. Con que las cifras que
obtengamos sean razonablemente aproximadas, es suficiente. Otro cantar sera que en la divisin
www.cajondeciencias.com

Cajn de Ciencias
anterior nos hubiese salido 5,6 Eso est demasiado alojado de 3!1
3) Un cerdo de orejas peludas se cruz con dos cerdas; la primera tena las orejas sin pelo y la
segunda con pelo. Del primer cruzamiento se obtuvieron un 50% de la descendencia de orejas
peludas y otro 50% de orejas sin pelo. Qu descendencia esperaras del cruzamiento con la cerda
de orejas peludas?
Aqu no nos dicen si el caracter orejas peludas es dominante o recesivo frente al de orejas sin pelo.
Hagamos un esquema de los datos que nos dan, a ver si podemos sacar algo en claro:
Oreja peluda x Oreja sin pelo
Oreja peluda x oreja peluda

1/2 peluda 1/2 sin pelo.


?

Echa un vistazo a los cruzamientos que aparecen en las leyes de Mendel. Cules de ellos nos dan
una descendencia de 50% de un fenotipo y 50% de otro?
AA x AA
aa x aa
Aa x AA
Aa x aa
Aa x Aa

Todos fenotipo dominante


Todos fenotipo recesivo
Todos fenotipo dominante
1/2 fenotipo dominante, 1/2 fenotipo recesivo
3/4 fenotipo dominante, 1/4 fenotipo recesivo

Sabemos entonces que el primer cruce del enunciado es de un heterocigoto con un homocigoto
recesivo. Lo que no sabemos es a qu miembro de la parejita corresponde cada uno. Por lo tanto,
como respuesta, planteamos las dos posibilidades:
* Si el macho es Aa, entonces oreja peluda domina sobre oreja sin pelo, y la segunda hembra
puede ser AA o Aa (ambos tienen fenotipo orejas peludas). Sea cual sea el genotipo de la segunda
hembra, toda la descendencia ser o AA o Aa, es decir, con fenotipo dominante (orejas peludas).
* Si el macho es aa, entonces oreja peluda es recesivo, y la segunda hembra es tambin aa.
Conclusin: toda la descendencia ser aa, oreja peluda (fenotipo recesivo).
Fjate que, an sin saber qu caracter es dominante y cul recesivo, incluso sin saber los genotipos
exactos de cada individuo, podemos deducir que la descendencia del segundo cruzamiento ser a la
fuerza orejas peludas!

Y cunto es demasiado alejado? preguntarn los ms quisquillosos. Bueno, no es algo que se deje al criterio de
cada uno. Existen mtodos matemticos para determinar cmo de distinto puede ser un resultado antes de que deje
de ser fiable, pero pertenecen a una teora matemtica normalmente reservada para el nivel universitario. En los
ejercicios que tengas que hacer de este estilo se ver claramente si un resultado aproximado es vlido o no. Si an
as tienes curiosidad por ahondar en esa rama de las matemticas, puedes empezar buscando informacin sobre uno
de los mtodos ms asequibles, llamado el Chi cuadrado.

www.cajondeciencias.com

Cajn de Ciencias
4) Al cruzarse dos razas puras para el color de sus flores, unas rojas y otras blancas, result una
F1 de flores rosas. Al autopolinizarse esta F1 se origin una F2 con un 25% de flores rojas, 50%
de flores rosas y 25% de flores blancas. Qu explicacin propones para los resultados del
experimento?
Este es facilito si ests atento a un detalle. En cuanto nos dicen que de padres rojo y blanco nos sale
descendencia rosa est claro que tenemos un caso de herencia intermedia (no confundir con
codominancia2!). En estos casos no puede hablarse de dominancia y recesividad. Llamamos B al
alelo flor blanca y R al alelo flor roja. Las flores rosas salen de un genotipo BR. Sabiendo esto,
los cruces que nos plantea el enunciado sern:
RR x BB
RB x RB

RB
1/4 RR

1/2 RB

1/4 BB

Lo cual se ajusta perfectamente a las proporciones del enunciado.


5) Tres parejas reclaman en un juzgado la paternidad de una nia que tiene un grupo sanguneo
AB. Los primeros tienen los grupos sanguneos A y 0; los segundos son AB y 0, y los terceros, A y
AB Qu pareja tiene razn?
Recuerda en primer lugar que el sistema sanguneo humano AB0 se rige por tres alelos con la
siguiente relacin:
A= B>0
Es decir, A es codominante con B (si coinciden, ambos se manifiestan) y tanto A como B dominan
sobre 0. La forma correcta y ms profesional de simbolizar estos alelos es IA, IB, I.
Despus de esta introduccin, vamos con el problema. La nia objeto de la disputa es AB, por lo
que su genotipo no deja lugar a dudas. El nico posible es IAIB.
De esos dos alelos, uno ha debido venir del padre y otro de la madre. Vamos a ver en cul de las tres
parejas ha podido darse esto. Es muy fcil, si caes en la cuenta de que, en cuanto haya uno de los
padres con grupo 0 (que a la fuerza, por ser recesivo, debe ser II) es imposible que haya cedido a su
hija un alelo IA o IB. Con esto, descartamos las dos primeras parejas. Podra ser la tercera? El padre
que es A tiene indudablemente un alelo IA (el otro no lo sabemos, podra ser IA o I, pero eso es
indiferente), mientras que est claro que el segundo progenitor AB, al ser I AIB, s puede dar a su hija
un alelo IB problema resuelto!

Herencia intermedia es cuando el heterocigoto tiene una mezcla de ambos fenotipos (blanco + rojo = rosa).
Codominancia es cuando el heterocigoto muestra ambos fenotipos a la vez (blanco + rojo = flor con manchas
blancas y rojas)

www.cajondeciencias.com

Cajn de Ciencias
6) Cuatro amigos que viajan juntos tienen un accidente de automvil y mientras tres de ellos salen
ilesos, el cuarto tiene una fuerte hemorragia que necesita con urgencia una transfusin. El mdico
plantea una donacin entre ellos y los datos que aportan son los siguientes:
- El herido es del grupo sanguneo A y Rh+
- El primero de los amigos es 0, y sabe que sus padres son ambos Rh- El segundo de los amigos no conoce su grupo, pero sabe que sus padres son uno del grupo 0 y
otro del grupo A.
- El tercer amigo tambin desconoce su grupo sanguneo pero sus padres son los dos del grupo B
Rh+
Si fueras el mdico y dispusieras de esta informacin qu donante escogeras, si es que alguno de
ellos es el apropiado? (No lo elijas al azar, piensa que est en juego la vida de una persona!).
En cuanto al sistema AB0, ya hemos explicado en el ejercicio anterior. El sistema Rh funciona con
dos alelos, Rh+ domina sobre Rh-.
Para saber qu grupo puede donar a qu grupo, pondremos aqu una tabla resumen. Si no entiendes
el porqu la tabla es como es, repsalo en los apuntes o en nuestra web:
Sistema AB0
Donante

Receptor

AB

AB

Sistema Rh

Receptor

Donante
Rh+

Rh-

Rh+

Rh-

Para que una transfusin sea viable, ambos sistemas deben ser compatibles.
Visto esto, vamos a organizar los datos, escribiendo los fenotipos de los implicados siempre que nos
sea posible.
El herido

Fenotipo A, Rh+

www.cajondeciencias.com

Cajn de Ciencias
Amigo 1
Sistema AB0: 0
Sistema Rh: si los dos padres son Rh- (el alelo recesivo), l a la fuerza debe ser RhAmigo 2
Sistema AB0: desconocido, pero como uno de sus padres es A (I AIA o IAI) y otro 0 (I I ), solo puede
ser A o 0.
Sistema Rh: sin datos. No sabemos nada.
Amigo 3
Sistema AB0: desconocido, pero si los padres son del grupo B (IBIB o IBI), l puede ser del grupo B
o del 0.
Sistema Rh: como los dos padres son Rh+ (Rh+Rh+ o Rh+Rh-), l puede ser Rh+ o RhVamos a analizar los datos, que se nos desangra el paciente. Fjate que el grupo perfecto como
donante es el 0 Rh-, porque puede donar a todos. Con esto en mente, el amigo 1 es sin duda la mejor
opcin. Valdra alguno de los otros? Tanto el 2 como el 3 tienen una posibilidad de ser 0 Rh-, pero
no es seguro. El 2 podra ser A+, A-, 0+ o 0-, por lo que tambin podra donar, sea cual sea su
grupo, al herido. Sin embargo, el 3 podra ser 0+, 0 - (ambos sin problemas para donar al herido), Bo B+. En cualquiera de estos dos ltimos casos, una transfusin sera fatal.
Conclusin: los amigos 1 y 2 son donantes viables. Sin embargo, cualquier mdico ira directamente
al amigo 1, del que tiene seguridad respecto al grupo sanguneo que adems resulta ser donante
universal.

www.cajondeciencias.com

PROBLEMAS DE GENTICA MENDELIANA Y DE HERENCIA LIGADA AL SEXO


Herencia de un carcter
1.

Una planta homocigtica de tallo alto se cruza con una planta homocigtica de tallo enano. Sabiendo que el tallo
alto es dominante, indicar genotipo y fenotipo de la F1 y de la F2.

2.

El color azul de los ojos en el hombre se debe a un gen recesivo respecto a su alelo para el color pardo. Los padres
de un nio de ojos azules tienen ambos los ojos pardos. Cmo son los genotipos?

3.

Existen variedades de lino con flores blancas y variedades con flores violetas. La F1 de un cruzamiento entre plantas
de las dos variedades fue de color violeta claro, y la F2 dio una violeta, dos violeta claro y una blanca. Explquese el
tipo de herencia y realcese el cruzamiento.

4.

Al cruzar dos moscas negras se obtiene una descendencia formada por 216 moscas negras y 72 blancas. Raznese
el cruzamiento y cul ser el genotipo de las moscas que se cruzan y la descendencia obtenida.

5.

Cruzando dos plantas de flores rosas entre s se obtiene una descendencia compuesta por 49 plantas con flores
rojas, 98 con flores rosas y 49 con flores blancas. Explicar por qu y realizar un esquema de cruzamiento.

6.

Se cruzaron plantas de pimiento picante con plantas de pimiento dulce. La F1 fue de frutos picantes y en la F2 se
obtuvieron 42 plantas de pimiento picante y 14 plantas de pimiento dulce. Cuntas de las plantas picantes se
esperan que sean homocigticas y cuntas heterocigticas? Cmo averiguar cules de las 42 plantas picantes son
heterocigticas?

7.

La forma de los rbanos puede ser alargada, redondeada y ovalada. Cruzando plantas alargadas con redondeadas
se obtienen plantas ovaladas. Cruzando dos plantas ovales entre s se obtienen 133 redondeadas, 128 alargadas y
244 ovales. Explicar cmo son los genotipos de las plantas alargadas, redondeadas y ovales, y representar el
cruzamiento de las dos ovales y de su descendencia.

8.

La acondroplasia es una anomala determinada por un gen autonmico que da lugar a un tipo de enanismo en la
especie humana. Dos enanos acondroplsicos tienen dos hijos, uno acondroplsico y otro normal:
a) La acondroplasia, es un carcter dominante o recesivo?
b) Cul es el genotipo en cada uno de los progenitores? Por qu?
c) Cul es la probabilidad de que el prximo descendiente de la pareja sea normal? Y de que sea
acondroplsico? Haz un esquema del cruzamiento

9.

Se cruza una mariposa negra con una mariposa gris y se obtienen 67 mariposas negras y 64 mariposas grises. Ahora
se cruza una mariposa gris con una blanca y se obtienen 36 mariposas blancas y 40 grises. Razonar los dos
cruzamientos indicando cules sern los genotipos de las mariposas que se cruzan y de la descendencia, as como si
se trata de un caso de herencia intermedia o dominante.

10. Se cruzan dos plantas de flores color naranja y se obtiene una descendencia formada por 32 plantas de flores rojas,
57 de flores naranja y 31 de flores amarillas. Qu descendencia se obtendr al cruzar las plantas de flores naranja
obtenidas, con las rojas y con las amarillas tambin obtenidas? Razonar los tres cruzamientos.
11. Un cobayo de pelo blanco, cuyos padres son de pelo negro se cruza con otro de pelo negro cuyos padres son de
pelo negro uno de ellos y blanco el otro. Cmo sern los genotipos de los cobayas que se cruzan y de su
descendencia?
12. Se cruzan dos ratones blancos y se obtiene una descendencia formada por 9 ratones blancos y 3 ratones negros.
Cruzamos ahora uno de los blancos obtenidos con otro de los negros y nacen 4 ratones negros y 4 blancos.
Genotipo y fenotipo de los cruzamientos.

13. Sabiendo que en las gallinas el plumaje blanco domina sobre el negro, cmo se podr averiguar si una gallina
blanca es homocigtica o heterocigtica para el carcter blanco?

Joaqun Rodrguez Piaya

PROBLEMAS DE GENTICA MENDELIANA Y DE HERENCIA LIGADA AL SEXO


14. Como Mendel descubri, las semillas de color amarillo en los guisantes son dominantes sobre las de color verde. En
los experimentos siguientes, padres con fenotipos conocidos pero genotipos desconocidos produjeron la siguiente
descendencia:
Parentales
A. amarillo x verde
B. amarillo x amarillo
C. verde x verde
D. amarillo x amarillo
E. amarillo x amarillo

Amarillo
82
118
0
74
90

Verde
78
39
50
0
0

a) Dar los genotipos ms probables de cada parental


b) En los cruces B, D y E, indquese qu proporcin de la descendencia amarilla producida en cada uno de
ellos se esperara que produjera descendientes verdes por autopolinizacin
15. El pelo rizado de los perros domina sobre el pelo liso. Una pareja de pelo rizado tuvo un cachorro de pelo tambin
rizado y del que se quiere saber si es heterocigtico. Con qu tipo de hembras tendr que cruzarse? Raznese
dicho cruzamiento.
16. Un cruce entre dos plantas de calabaza, ambas con frutos blancos, ha dado la siguiente generacin: 26 plantas con
calabazas blancas y 14 con calabazas amarillas. Se pregunta:
a) Tericamente, cuntas calabazas de cada tipo deberan de haber salido?
b) Genotipo y fenotipo de los cruces.
17. El color gris del cuerpo de Drosophyla domina sobre el negro. Una mosca de cuerpo gris se cruza con otra de cuerpo
tambin gris, la cual a su vez tena a uno de sus padres con el cuerpo negro. Del cruzamiento se obtiene una
descendencia de moscas todas grises. Razonar cmo sern los genotipos de las moscas que se cruzan y de su
descendencia.
18. Un cruce entre un conejillo de indias de pelo erizado y uno de pelo liso ha dado 7 cras de pelo erizado y una de
pelo liso. En otro caso, el cruce de un conejillo de indias de pelo erizado y otro de pelo liso no ha dado ms que
descendientes de pelo erizado. Se pregunta:
a) Cul es el carcter dominante y cul el recesivo?
b) Cul es el genotipo de los padres en ambos casos?

Herencia de dos caracteres


19. En el cobayo el pelo rizado domina sobre el liso y el pelo negro sobre el blanco. Si cruzamos un cobayo rizado y
negro con otro blanco y liso, indicar cules sern los genotipos y fenotipos de la F1 y de la F2 y qu proporcin de
individuos rizados y negros cabe esperar que sean homocigticos para ambos caracteres. Los cobayos que se
cruzan son puros para ambos caracteres.

21. Un agricultor tiene en cultivo dos razas puras de tomates, una de las plantas de tamao normal y pulpa de color
rojo y otra de las plantas enana y pulpa de color amarillo. Se sabe tambin que el tamao normal de la planta es
dominante sobre el enano y que el color rojo es dominante sobre el amarillo. Quiere obtener una variedad o raza
pura de tomates enanos con pulpa de color rojo. Se pregunta:
a) Ser posible lograrlo?
b) Qu cruces tendr que realizar?
c) En qu generacin podr obtenerlo?
d) En qu proporcin obtendr, en la generacin que lo logre, las plantas enanas de color rojo?

Joaqun Rodrguez Piaya

20. Sabiendo que al cruzar un cobayo de pelo blanco y liso con otro de pelo blanco y liso se obtienen cobayos de pelo
negro y rizado, realiza los siguientes cruzamientos:
a) Negro y rizado con blanco y liso heterocigticos.
b) Blanco heterocigtico y rizado con negro y liso heterocigtico.

PROBLEMAS DE GENTICA MENDELIANA Y DE HERENCIA LIGADA AL SEXO


22. En el cobayo el pelo rizado domina sobre el liso. El color del cuerpo puede ser negro, blanco y gris, siendo los
colores blanco y negro los homocigticos. Indica el genotipo y el fenotipo de la F1 de los siguientes cruces:
a) Cobayo negro y rizado heterocigtico con cobayo gris y liso.
b) Cobayo gris y rizado heterocigtico con cobayo gris y liso.
23. El cabello oscuro en el hombre domina sobre el cabello rubio, al igual que los ojos pardos sobre los ojos azules. Un
hombre de ojos pardos y cabello oscuro y una mujer de cabello oscuro y ojos azules tuvieron dos hijos, uno de ojos
pardos y pelo rubio y otro de ojos azules y pelo oscuro.
a) Indicar genotipo y fenotipo de padres e hijos.
b) Qu probabilidad existe de que tengan un hijo de cabello rubio y ojos azules?
24. Existe un tipo de anemia que la presentan los individuos heterocigticos: los individuos homocigticos dominantes
son normales, mientras que los homocigticos recesivos mueren antes de nacer. La sordera est provocada por una
homocigosis recesiva, siendo los individuos dominantes los normales. Qu proporciones fenotpicas y genotpicas
obtendremos en la F1 de los siguientes cruces?
a) Heterocigtico para la sordera y anmico con heterocigtico para la sordera y no anmico.
b) Sordo y anmico con heterocigtico para la sordera y anmico.
25. En el tomate, el color prpura del tallo est determinado por un alelo autosmico dominante sobre el alelo verde.
Otro gen autosmico independiente controla la forma de la hoja: el borde recortado est determinado por un alelo
dominante sobre el alelo que determina el borde entero.
En la siguiente tabla se indican los resultados en tres cruces entre plantas de fenotipos diferentes. En cada
caso, indica cules son los genotipos de los progenitores y por qu.
Fenotipo de los progenitores
Prpura recortada x Verde recortada
Prpura recortada x Prpura recortada
Prpura recortada x Verde recortada

Prpura
recortada
321
144
722

Prpura
entera
101
48
231

Verde
recortada
310
50
0

Verde
entera
107
18
0

26. Sabemos que el enanismo se debe a un gen dominante y que los grupos sanguneos vienen determinados por los
A
B
alelos I , I e i. Un hombre enano del grupo sanguneo A, cuyo padre del grupo O no era enano, tienen
descendencia con una mujer enana del grupo AB y cuya madre era normal. Qu proporciones fenotpicas y
genotpicas se pueden esperar en la descendencia?
27. Una mujer A positiva, heterocigtica para los dos caracteres, se casa con un hombre del grupo AB negativo.
Genotipo y fenotipo de la descendencia.
28. Una mujer A+ y un hombre AB- tienen dos hijos, uno B- y otro A+. Realizar el cruce indicando fenotipos y
genotipos.
+

29. Una mujer del grupo sanguneo A y Rh y un hombre del grupo sanguneo B y Rh tienen dos hijos, uno de ellos A
+
Rh y otro B Rh . Genotipo y fenotipo del cruce.
30. Una mujer B+, heterocigtica para los dos caracteres, se casa con un hombre del grupo O+. Genotipo y fenotipo de
la descendencia.
31. Seala todos los posibles padres que puede tener un individuo del grupo AB negativo.

33. Una planta de jardn presenta dos variedades: una de flores rojas y hojas alargadas y otra de flores blancas y hojas
pequeas. El carcter color de las flores sigue una herencia intermedia, y el carcter tamao de la hoja presenta
dominancia del carcter alargado. Si se cruzan ambas variedades, Qu proporciones genotpicas y fenotpicas
aparecern en la F2? Qu proporcin de las flores rojas y hojas alargadas de la F2 sern homocigticas?
Joaqun Rodrguez Piaya

32. Seala todos los posibles padres que puede tener un individuo del grupo A negativo.

PROBLEMAS DE GENTICA MENDELIANA Y DE HERENCIA LIGADA AL SEXO


34. En el cruce de Drosophila melanogaster de alas curvadas y quetas en forma de maza dihbridas consigo mismas se
obtuvieron 590 con alas curvadas y quetas en maza, 180 con alas curvadas y quetas normales, 160 con alas
normales y quetas en maza y 60 normales para ambos caracteres. Se puede aceptar la hiptesis de que estos
caracteres se heredan independientemente?
35. Supongamos que en las gallinas la produccin de carne entre los 500 y los 1.100 gramos se debe a dos pares de
factores A1A1A2A2 que contribuyen cada uno de ellos con 150 gramos. Cruzando un gallo de 1.100 gramos con una
gallina de 650 gramos, cules sern los genotipos y fenotipos de la descendencia?
36. Supongamos que en los melones la diferencia del peso del fruto entre un tipo de 1.500 gramos y otro de 2.500
gramos se debe a dos pares de factores A1A1A2A2 que contribuyen cada uno de ellos con 250 gramos de peso al
fruto. Indicar en el siguiente cruzamiento cul ser la amplitud de variacin en el peso del fruto de la descendencia:
A1a1A2a2 x A1a1A2A2.
37. Un perro de pelo negro, cuyo padre era de pelo blanco, se cruza con una perra de pelo gris, cuya madre era negra.
Sabiendo que el pelaje negro domina sobre el blanco en los machos, y que en las hembras negro y blanco
presentan herencia intermedia, explica cmo sern los genotipos de los perros que se cruzan y qu tipos de hijos
pueden tener respecto del carcter considerado.

Herencia ligada al sexo


38. Como sabemos, los cromosomas sexuales en la especie humana son XX para la mujer y XY para
el hombre. Una mujer lleva en uno de sus cromosomas X un gen letal (que produce la muerte)
recesivo y en el otro el dominante normal. Cul es la proporcin de sexos en la descendencia
de esta mujer si contrae matrimonio con un hombre normal?
39. Supongamos que el color rubio del pelo domina sobre el color negro y que los genes que rigen estos caracteres
estn en los cromosomas X.
a) Qu descendencia se obtendr de un matrimonio cuyo padre es de pelo rubio y cuya madre es de pelo
negro? Indicar no slo cuntos hijos lo tendrn de cada color, sino tambin su sexo.
b) Qu descendencia se obtendr de un matrimonio cuyo padre es de pelo negro y la madre de pelo rubio
heterocigtica?
40. El color amarillo de los gatos est ligado al sexo. En un cruzamiento entre un gato amarillo y una gata negra se
obtienen dos hembras de color intermedio y tres machos de color negro. Genotipo y fenotipo de la descendencia.
41. El daltonismo (ceguera para los colores) es una enfermedad ligada al sexo que depende de un gen recesivo situado
en el cromosoma X. Una mujer normal, cuyo padre era daltnico, se casa con un hombre normal, cuyo padre era
tambin daltnico. Genotipo y fenotipo de la descendencia.
42. La hemofilia es una enfermedad determinada por un gen recesivo ligado al cromosoma X.
a) Una mujer normal, cuyo padre era hemoflico, se cruza con un hombre normal, cuyo padre tambin era
hemoflico. Genotipo y fenotipo de la descendencia.
b) Una mujer normal, cuyo padre era hemoflico, se cruza con un hombre hemoflico, cuyos padres eran
normales. Genotipo y fenotipo de la descendencia.
c) Cul es la probabilidad de que la hermana de un hemoflico (ambos de padres fenotpicamente normales)
sea portadora de la hemofilia?
d) Si una mujer normal cuyo padre era hemoflico tiene descendencia con un hombre hemoflico:
Qu proporcin de la descendencia tendr el gen para la hemofilia?
Qu proporcin de la descendencia ser hemoflica?
Entre los individuos varones, qu proporcin ser hemoflica?

43. Una mujer y un hombre fenotpicamente normales tienen dos hijos, uno daltnico y otro hemoflico. Averiguar el
genotipo de los padres y de los hijos.

Joaqun Rodrguez Piaya

PROBLEMAS DE GENTICA MENDELIANA Y DE HERENCIA LIGADA AL SEXO


44. Qu proporcin genotpica cabe esperar en un matrimonio entre un hombre daltnico y una mujer portadora?
Qu proporcin de daltnicos cabe esperar en la familia
fa
si tiene ocho hijos?
45. Indica el genotipo de un hombre calvo cuyo padre no era calvo, el de su esposa que no es calva, pero cuya madre s
lo era, y el de sus futuros hijos (la calvicie es un carcter hereditario influido por el sexo, dominante en los hombres
y recesivo en las mujeres)
46. Al cruzar una gallina normal con un gallo paticorto salieron todos los
los gallitos normales y todas las gallinitas
paticortas. Posteriormente se realiza la F2 y se obtiene que la mitad de los gallos y la mitad de las gallinas salen
paticortas. Tratar de explicar estos resultados.
47. En D. melanogaster las alas vestigiales vg son recesivas respecto al carcter normal, alas largas vg+ y el gen para
este carcter no se halla en el cromosoma sexual. En el mismo insecto el color blanco
blanco de los ojos es producido por
un gen recesivo situado en el cromosoma X, respecto del color rojo dominante. Si una hembra homocigtica de
ojos blancos y alas largas se cruza con un macho de ojos rojos y alas largas, descendiente de otro con alas cortas,
cortas
cmo ser la descendencia?

48. En la mosca del vinagre el color blanco de los ojos es producido por un gen recesivo situado en el cromosoma X,
respecto del color rojo dominante. Las alas vestigiales vg, son recesivas respecto de las alas
largas vg+, y estee carcter no se halla ligado al sexo. Realizamos el cruzamiento de un macho
de alas vestigiales y ojos rojos con una hembra de alas largas heterocigtica y ojos rojos
portadora del gen blanco. Supongamos adems que en el mismo cromosoma X en que va el
gen ojos blancos, va tambin ligado un gen letal l, recesivo. Sobre un total de 150
descendientes de la pareja que se cruza, razona qu proporcin de hembras y de machos
habr con alas normales y con alas vestigiales. Y respecto al color? Es posible que dos genes vayan sobre el
mismo cromosoma X, uno sea ligado al sexo y el otro no?

Joaqun Rodrguez Piaya

Biologa Ciencias Ambientales (Problemas de gentica)

PROBLEMAS DE GENTICA
1.- Cobayas negras heterocigotas (Bb) se aparearon con cobayas blancas recesivas homocigotas (bb).
Indicar las proporciones genotpicas y fenotpicas esperadas del retrocruzamiento de un descendiente
de la F1 de color negro con:
- El parental negro
Bb x Bb

BB

Bb

25%

Bb

bb

50%

25%

75% cobayas negros


25% cobayas blancos

- El parental blanco
Bb x bb

Bb

bb

50%

50%

50% cobayas negros


50% cobayas blancos

2.- Dos plantas de dondiego (Mirabilis jalapa) son homocigotas para el color de las flores. Una de ellas
produce flores de color blanco marfil y la otra, flores rojas. Seale los genotipos y fenotipos de la
descendencia al cruzar ambas plantas que B es el gen responsable del color marfil, R es el gen que
condiciona el color rojo y que los genes R y B son equipotentes (herencia intermedia).
Ambas son homocigotas y la herencia es intermedia (o codominante). En este caso, por lo tanto, toda la descendencia
es heterocigota y el fenotipo ser intermedio entre ambas (rosa, probablemente). El cruzamiento es:

BB x RR

BR

BR

BR

BR

100% rosas

3.- En el tomate el color prpura del tallo est determinado por un alelo autosmico dominante A. El
alelo recesivo a determina tallo de color verde. Otro gen autosmico independiente controla la forma
de la hoja: el alelo dominante C determina hoja con borde recortado mientras que el alelo recesivo c
determina hoja con borde entero.
En la siguiente tabla se indican los resultados en tres cruces entre plantas de fenotipos
diferentes. Indicar en cada caso cules son los genotipos de los progenitores y explique porqu.
FENOTIPOS DE LOS PROGENITORES

PRPURA/RECORTADA PRPURA/ENTERA VERDE/RECORTADA VERDE/ENTERA

A.- prpura, recortada x verde, recortada

321

101

310

107

B.- prpura, recortada x prpura recortada

144

48

50

18

C.- prpura, recortada x verde, recortada

722

231

Jose Luis Martinez, Iciar Salces Beti, Rosario Planell, Gloria Morcillo

Biologa Ciencias Ambientales (Problemas de gentica)


En el cruce A tenemos un parental de color prpura y hoja recortada y otro de color verde y hoja recortada. En
cuanto al color, sabemos que el verde es recesivo. Si el parental prpura fuera homocigoto dominante toda la descendencia
sera prpura. Al existir descendientes de color verde sabemos que tiene uno de los alelos recesivos. En cuanto a la hoja,
ambos tienen el fenotipo dominante pero en la descendencia podemos observar que hay individuos con la hoja entera, que es
recesiva. Esto indica que ambos individuos tienen un alelo revesivo y por tanto son heterocigotos para este carcter. El
cruzamiento sera: AaCc x aaCc.
En el cruce B tenemos un parental de color prpura y hoja recortada y otro de color prpura y hoja recortada. Como
aparecen individuos que manifiestan los fenotipos recesivos esto indica que han recibido los alelos recesivos de los parentales.
Por tanto, tenemos un cruce entre dos dobles heterocigotos: AaCc x AaCc.
En el cruce C tenemos un parental de color prpura y hoja recortada y otro de color verde y hoja recortada. Podemos
ver que en la descendencia no aparece ninguno de color verde, por lo que el parental de color prpura tiene los dos alelos
dominantes para este carcter. En el caso de la hoja, podemos ver que hay individuos que presentan la hoja entera. Esto
quiere decir que reciben de sus progenitores alelos recesivos y, por tanto, ambos son heterocigotos para este carcter. El
cruzamiento sera: AACc x aaCc.

4.- Los ratones gordos se pueden producir por dos genes independientes. El genotipo oo genera un
ratn gordo y estril, llamado obeso; su alelo dominante O da lugar a crecimiento normal. El genotipo
recesivo aa tambin produce un ratn gordo y estril llamado adiposo, mientras que su alelo dominante
A ocasiona crecimiento normal. Qu proporciones fenotpicas de ratones gordos frente a normales
podemos esperar en F1, siendo los padres de genotipo OoAa?
El cruzamiento es OoAa x OoAa. Entonces:
Gametos

OA

Oa

oA

oa

OA

OOAA (normal, normal) OOAa (normal, normal) OoAA (normal, normal) OoAa (normal, normal)

Oa

OOAa (normal, normal) OOaa (normal, adiposo) OoAa (normal, normal) Ooaa (normal, adiposo)

oA

OoAA (normal, normal) OoAa (normal, normal) ooAA (obeso, normal)

ooAa (obeso, normal)

oa

OoAa (normal, normal) Ooaa (normal, adiposo) ooAa (obeso, normal)

ooaa (obeso, adiposo)

Teniendo en cuenta que nos pide las proporciones fenotpicas de ratones gordos respecto a los normales, en este caso
hay que tener en cuenta que basta la presencia de uno de los caracteres como recesivo para que el ratn sea gordo. Por
tanto, tenemos 9/16 normales y 7/16 gordos (en unos casos debido al gen A y en otros debidos al gen O).

5.- En la raza de ganado lechero Holstein-Friesian, un alelo recesivo r produce pelo rojo y blanco; el
alelo dominante R produce pelo blanco y negro. Si un toro portador es cruzado con vacas portadoras,
determinar:
- la probabilidad de que el primer descendiente que nazca sea rojo y blanco
Al decirse que el toro y las vacas son portadoras se indica que son animales heterocigotos y su fenotipo es pelo blanco
y negro. El cruzamiento es:
Gametos

RR

Rr

Rr

rr

La probabilidad de que el primer descendiente sea de color rojo y blanco es de 1/4.

- la probabilidad de que los primeros cuatro descendientes sean blancos y negros


Para que un individuo tenga fenotipo blanco y negro tiene que tener un alelo dominante, en este caso esta condicin se
cumple en los homocigotos dominantes y en los heterocigotos. Por tanto, la probabilidad de que un individuo sea de color
blanco y negro es de 3/4. Como se pide la probabilidad para los cuatro primeros descendientes y el fenotipo de cada
individuo no depende del fenotipo de los otros descendientes, el resultado es: 3/4x3/4x3/4x3/4 = 81/256.

- la proporcin fenotpica esperada entre la progenie resultante de retrocruzar vacas F1 blanco y


negro con el toro portador

Jose Luis Martinez, Iciar Salces Beti, Rosario Planell, Gloria Morcillo

Biologa Ciencias Ambientales (Problemas de gentica)


Si la vaca es homocigota, RR, entonces el 100% de la descendencia ser blanca y negra.
heterocigota, Rr, entonces se espera una descendencia de 3/4 blanca y negra y 1/4 rojo y negro.

Si la vaca es

- la proporcin fenotpica que puede esperarse entre la progenie resultante de retrocruzar las
vacas de la F1 por el macho portador si el toro portador se cruza con vacas blanco y negro
homozigticas
El cruzamiento en este caso es entre el macho Rr y las vacas RR. Por tanto la descendencia es 100% blanco y negro
pero la mitad tiene genotipo RR mientras que la otra mitad tienen genotipo Rr. Al cruzar las vacas de la F1 con el toro el
resultado es de un 100% blanco y negro si la vaca es RR mientras que 3/4 blanco y negro y 1/4 rojo y negro si la vaca
es Rr.

6.- Dar los genotipos ms probables de los padres en los siguientes cruzamientos de cobayas, que se
diferencian por el color del pelaje:
negro

sepia

crema

albino

1 negro x negro

22

2 negro x albino

10

3 crema x crema

34

11

4 sepia x crema

24

11

12

5 negro x albino

13

12

6 negro x crema

19

20

7 negro x sepia

18

20

8 sepia x sepia

26

9 crema x albino

15

17

Como se puede ver, hay cuatro fenotipos posibles que posiblemente se deben a cuatro alelos diferentes. De esta
manera, de acuerdo con los resultados de los cruzamientos que se nos dan podemos decir que el negro (C) domina sobre todos,
el sepia (cs) sobre el crema y el albino y el crema (cc) sobre el albino (c) (negro > sepia > crema > albino). De acuerdo con esto,
los genotipos son:
1.- Cc x Cc
2.- Ccs x cc
3.- ccc x ccc
4.- csc x ccc
5.- Ccc x cc
6.- Ccs x cccc o ccc
7.- Ccs x cscs, cscc o csc
8.- cscc x cscc

7.- Una pareja en la que la visin de ambos es normal tiene cuatro hijos.
descendientes se aprecian las siguientes caractersticas:

En ellos y en sus

Una hija con visin normal, que tiene un hijo normal y un hijo y una hija daltnica.

Una hija con visin normal, que tiene tres hijas y dos hijos normales.

Un hijo daltnico, con dos hijas normales.

Un hijo normal, con dos hijos y dos hijas normales.

Jose Luis Martinez, Iciar Salces Beti, Rosario Planell, Gloria Morcillo

Biologa Ciencias Ambientales (Problemas de gentica)

Construir la genealoga de esta familia indicando en cada caso el genotipo ms probable y el tipo
de herencia.
La genealoga se representa a continuacin. Los crculos representan a las mujeres y los cuadrados a los hombres.
Aquellos que estn en rojo claro indican que el individuo es portador de un alelo de daltonismo mientras que los que estn en
rojo indican que padecen la enfermedad. La herencia es ligada al sexo, al cromosoma X.

8.- En el siguiente rbol genealgico, los cuadros negros representan a personas afectadas de
hemofilia, enfermedad determinada por un alelo recesivo ligado al sexo.

I
II
III

- Si la mujer II2 tuviese dos hijos varones, cul sera la probabilidad de que ninguno fuera
hemoflico?.
La mujer II2 tiene un hermano hemoflico, por lo que su madre es portadora del alelo recesivo. De su padre recibe un
alelo dominante. Tambin ha tenido ya un hijo hemoflico, lo que indica que es portadora del alelo revesivo. La probabilidad de
la mujer de tener un hijo hemoflico o un hijo normal es de 1/2, ya que produce la mitad de los gametos con el alelo dominante
y la otra mitad con el alelo recesivo.
La pregunta nos pde la probabilidad de tener dos hijos normales. La probabilidad de tener un hijo es 1/2 (ya que
puede ser nio o nia). Como se ha comentado, la probabilidad de que siendo nio ste sea normal es de 1/2. Por tanto, la
probabilidad de tener un hijo normal es de 1/2x1/2=1/4. Para el caso de un segundo hijo normal la probabilidad es la misma,
1/4. Por tanto, la probabilidad final de tener dos hijos normales para la mujer II2 es: 1/4x1/4=1/16.

- Cul es la probabilidad de qu el primer hijo varn de la pareja II4 y II5 sea hemoflico?.
La probabilidad de que la mujer en este caso tenga el alelo recesivo es de 1/4, ya que tiene que tener el cromosoma X
del padre para ser mujer (probabilidad de 1/2) y el cromosoma X que lleva el alelo recesivo cedido por la madre (probabilidad
de 1/2). Por tanto, la probabilidad de ser portadora es: 1/2x1/2=1/4.
Por otro lado, para que el primer hijo sea hemoflico hay que tener en cuenta que el descendiente reciba el cromosoma
Y del padre (probabilidad de 1/2) y que reciba el cromosoma X con el alelo recesivo de su madre (probabilidad de 1/2). La
probabilidad de que este descendiente sea un nio hemoflico es: 1/2x1/2=1/4. Esta sera la probabilidad si conocieramos el
genotipo de la madre.
Es preciso tener en cuenta que desconocemos el genotipo de la madre por lo que hay que concluir que la probabilidad
de la pareja II4 y II5 de tener un hijo hemoflico es: 1/4x1/4=1/16.

9.- El sistema de grupos sanguneos AB0, est determinado por tres alelos A, B, 0.
proporciones fenotpicas que se espera en la descendencia de los cruzamientos siguientes:

Indicar las

- AA x AB
La mitad de los descendientes sern AB y la otra mitad sern A.

- AA x B0
Jose Luis Martinez, Iciar Salces Beti, Rosario Planell, Gloria Morcillo

Biologa Ciencias Ambientales (Problemas de gentica)


La mitad de los descendientes sern AB y la otra mitad sern A.

- AA x A0
Todos los descendientes sern A.

- A0 x A0
Tres cuartos de los descendientes sern A y un cuarto ser O.

- A0 x AB
La mitad de los descendientes sern A, un cuarto ser AB y otro cuarto ser B.

10.- Dos condiciones anormales en el hombre, las cataratas y la fragilidad de huesos, son debidas a
alelos dominantes. Un hombre con cataratas y huesos normales cuyo padre tena ojos normales, se cas
con una mujer sin cataratas pero con huesos frgiles, cuyo padre tena huesos normales. Indicar la
probabilidad de tener:

Un descendiente normal
El genotipo del hombre es Cchh. Al tener su padre los ojos normales, lo que quiere decir que es homocigoto para este
carcter, el hombre tiene que tener un alelo recesivo para este carcter. El genotipo de la mujer es ccHh. Al igual que el
hombre, su padre era homocigoto revesivo para el carcter de huesos y por tanto debe tener un alelo recesivo. Los gametos
que produce cada uno de ellos son:
Hombre: Ch y ch.
Mujer: cH y ch,
El resultado del cruzamiento entre ambos sera:
Gametos

cH

ch

Ch

CcHh

Cchh

ch

ccHh

cchh

La pregunta nos pide que tengan un descendiente normal, lo que quiere decir que sea doble homocigoto recesivo
(cchh). En este caso la probabilidad es de 1/4.

Un descendiente con cataratas y huesos normales


En este caso se nos pide la probabilidad de un descendiente con cataratas y huesos normales, por tanto el genotipo
es Cc o CC para las cataratas y hh para huesos normales. Como se puede ver en el apartado anterior, solo uno de los
descendientes (Cchh) cumple las condiciones por lo que la frecuencia es 1/4.

Un descendiente con ojos normales y huesos frgiles


Un descendiente con ojos normales y huesos frgiles tiene como genotipos posibles ccHh o ccHH. Slo el primero
de los genotipos se puede obtener con este cruce. La probabilidad es de 1/4.

Un descendiente que padezca ambas enfermedades


Por ltimo, se nos pide un individuo con ambas enfermedades. Esto quiere decir que el individuo puede tener como
genotipos posibles CCHH, CCHh, CcHH o CcHh. Slo uno de estos genotipos puede obtenerse en el cruce con estos
parentales, como se observa en el apartado primero. La probabilidad de obtenerlo es de 1/4.

Jose Luis Martinez, Iciar Salces Beti, Rosario Planell, Gloria Morcillo

VIDEOS CFGS.

BLOQUE I. LA MATERIA VIVA


El cuerpo humano en nmeros. Bioelementos.
https://drive.google.com/file/d/0BygIX9eT-QHkYVFOVzJsSG56U0E/edit?usp=sharing

La chispa e la vida. La Clula. (ADN)


https://drive.google.com/file/d/0B4ph3k6dqxpvM0tWam50UmdMS0k/edit?usp=sharing

BLOQUE II. LA ESTRUCTURA Y EL FUNCIONAMIENTO DE LA CLULA


La qumica de la Vida. La Clula. (Teora celular)
https://drive.google.com/file/d/0B4ph3k6dqxpvbzdUTDExQUkyWXc/edit?usp=sharing

El origen de las clulas.


https://drive.google.com/file/d/0B4DZjBjy3-oQQjhMMUVaaUpQQzA/edit?usp=sharing

BLOQUE III. ANATOMA Y FISIOLOGA HUMANA. NUTRICIN.


Aparato Digestivo
https://drive.google.com/file/d/0B7a7NQFqbBUTci1kckZRdUhudFk/edit?usp=sharing

Sistema Respiratorio.
https://drive.google.com/file/d/0B0qM5ZddRxoma2xrcEVFT1dHZkk/edit?usp=sharing

Pulmones
https://drive.google.com/file/d/0BzXNQD4LeomrbmtucWZyd3REMk0/edit?usp=sharing

Circulatorio
https://drive.google.com/file/d/0B0qM5ZddRxomWXB1c0U3eFZLU2c/edit?usp=sharing

Corazon
https://drive.google.com/file/d/0B4DZjBjy3-oQVUhIZ2RfaFNIRVU/edit?usp=sharing

Los Riones
https://drive.google.com/file/d/0BygIX9eT-QHkMFMycTBVTGw0UDQ/edit?usp=sharing

El hgado

https://drive.google.com/file/d/0BygIX9eT-QHkNURfb0c0TFc0ZUE/edit?usp=sharing

BLOQUE III: ANATOMA Y FISIOLOGA HUMANA. RELACIN ( S. NERVIOSO).


Sistema nervioso
https://drive.google.com/file/d/0B0qM5ZddRxomRzhoQzdiSnlmSzg/edit?usp=sharing

Cerebro. No mueras joven.


https://drive.google.com/file/d/0B0GD2BscjMHIY1Z1WEN6Mld6dEk/edit?usp=sharing

BLOQUE III: ANATOMA Y FISIOLOGA HUMANA. RELACIN ( Apto.


LOCOMOTOR).
Sistema Oseo.
https://drive.google.com/file/d/0B0qM5ZddRxomZzRMLW92UU5PbFk/edit?usp=sharing

BLOQUE III: ANATOMA Y FISIOLOGA HUMANA. REPRODUCCIN.


El nacimiento
https://drive.google.com/file/d/0BygIX9eT-QHkMEpJUHM2NHVIS00/edit?usp=sharing

BLOQUE IV. GENTICA


La historia de Mendel
https://drive.google.com/file/d/0BygIX9eT-QHkQnl1enRreFVla2M/edit?usp=sharing

BLOQUE V. MICROBIOLOGA
Enfermedades virales.
https://drive.google.com/file/d/0BygIX9eT-QHkU1JNU0drbmZkTE0/edit?usp=sharing

Un mundo de bacterias
https://drive.google.com/file/d/0B7a7NQFqbBUTQ1FxME9Mb1RzSUU/edit?usp=sharing

Todo sobre los virus


https://drive.google.com/file/d/0B0qM5ZddRxomdzVvUVQ2ekd1ZUk/edit?usp=sharing

Los 10 microbios ms letales.


https://drive.google.com/file/d/0BwKnwoV3dZZwaW16WGNobzhFQXc/edit?usp=sharing

BLOQUE VI. INMUNOLOGA


Inmunologia
https://drive.google.com/file/d/0B0qM5ZddRxomUTltb3B6VkQzMnc/edit?usp=sharing

Nuevas actualizaciones.
https://docs.google.com/document/d/11YYrlHWsiYLOe5pPWhdj7JSsBR3HBuYfGojWbTuzOpE/edit

Proyecto Biosfera

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/2bachillerato/La_celula/contenidos.htm (2 de 2)17/09/2011 10:27:11

Untitled Document

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/2bachillerato/biomol/actividades/cierre.htm30/09/2011 13:11:29

Los homnidos III

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/4ESO/evolucion/actividad17.htm (1 de 2)30/09/2011 13:17:19

Los homnidos III

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/4ESO/evolucion/actividad17.htm (2 de 2)30/09/2011 13:17:19

El ojo

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/3ESO/Relacor/activ_coord19.htm (1 de 2)30/09/2011 13:18:21

El ojo

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/3ESO/Relacor/activ_coord19.htm (2 de 2)30/09/2011 13:18:21

El origen de la Tierra

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/4ESO/tierra_cambia/actividad1.htm (1 de 2)30/09/2011 13:18:31

El origen de la Tierra

http://recursostic.educacion.es/ciencias/biosfera/web/alumno/4ESO/tierra_cambia/actividad1.htm (2 de 2)30/09/2011 13:18:31

Ref: 09/741824.9/10

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

PRUEBAS DE ACCESO A
CICLOS FORMATIVOS

Mediante la Resolucin de 23 de noviembre de 2010, de la Direccin General de Educacin


Secundaria y Enseanzas Profesionales de la Consejera de Educacin (BOCM 15.12.10), se han
convocado para el ao 2011 las Pruebas de Acceso a ciclos formativos correspondientes a la
Formacin Profesional de grado medio y de grado superior, y se ha autorizado a la Subdireccin
General de Ordenacin Acadmica de Educacin Secundaria, Formacin Profesional y
Enseanzas de Rgimen Especial a dictar las normas que garanticen y faciliten el desarrollo de lo
dispuesto en dicha Resolucin.
De conformidad con todo ello, se emiten las siguientes

INSTRUCCIONES
I. PLAZOS DE INSCRIPCIN Y FECHAS DE REALIZACIN DE LAS PRUEBAS.
PRUEBAS DE ACCESO A CICLOS FORMATIVOS DE FORMACIN PROFESIONAL
Grado

Perodo de inscripcin

Fecha de celebracin

MEDIO

15 a 24 de febrero de 2011 (ambos inclusive)

21 y 22 de junio

Turno
GENERAL

15 a 24 de febrero de 2011 (ambos inclusive)

31 de mayo y 1 de junio

Turno
ESPECIAL

27 de junio a 1 de julio de 2011


(ambos inclusive)

1 de septiembre

SUPERIOR

II. REQUISITOS QUE HAN DE REUNIR LOS CANDIDATOS.


1. Para la Prueba de acceso a los Ciclos de GRADO MEDIO
Tener como mnimo 17 aos o cumplirlos durante el ao 2011.

2. Para la Prueba de acceso a los Ciclos de GRADO SUPERIOR


Reunir alguna de las condiciones siguientes:
Tener al menos 19 aos de edad, o cumplirlos durante el ao 2011.
Tener 18 aos, o cumplirlos durante el ao 2011 y estar en posesin del ttulo de Tcnico, siempre que el
candidato se presente a una de las opciones en la que est incluida la familia profesional a la que
pertenece el ciclo de grado medio superado, de acuerdo con la distribucin incluida en la siguiente tabla:

PRUEBAS DE ACCESO A CICLOS FORMATIVOS: 2011

Pacc2011-Instrucciones (Vdefinitiva).doc

La autenticidad de este documento se puede comprobar en www.madrid.org


mediante el siguiente cdigo seguro de verificacin: 1202732516195054270170

Ao 2011

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

FAMILIA PROFESIONAL A LA QUE PERTENECE EL CICLO FORMATIVO


SUPERADO POR EL CANDIDATO

Ley Orgnica 1/1990, de 3 de


octubre, de Ordenacin General
del Sistema Educativo (LOGSE)

Administracin.
Comercio y marketing.
Hostelera y turismo.
Servicios socioculturales y a la
comunidad.

Actividades agrarias.
Actividades fsicas y deportivas.
Imagen personal.
Industrias alimentarias.
Qumica.
Sanidad.

Actividades martimo-pesqueras.
Artes grficas.
Comunicacin, imagen y sonido.
Edificacin y obra civil.
Electricidad y electrnica.
Fabricacin mecnica.
Informtica.
Madera y mueble.
Mantenimiento de vehculos
autopropulsados
Mantenimiento y servicios a la
produccin.
Textil, confeccin y piel.
Vidrio y cermica.

Ley Orgnica 2/2006, de 3 de


mayo, de Educacin (LOE)

OPCIN DE LA PRUEBA A LA
QUE SE PUEDE PRESENTAR EL
CANDIDATO CON 18 AOS DE
EDAD

Administracin y gestin.
Comercio y marketing.
Hostelera y turismo.
Servicios socioculturales y a la
comunidad.

HUMANIDADES Y CIENCIAS
SOCIALES

Actividades fsicas y deportivas.


Agraria.
Imagen personal.
Industrias alimentarias.
Qumica.
Sanidad.
Seguridad y medio ambiente.

CIENCIAS

Artes grficas.
Artes y artesanas.
Edificacin y obra civil.
Electricidad y electrnica.
Energa y agua.
Fabricacin mecnica.
Imagen y sonido.
Industrias extractivas.
Informtica y comunicaciones.
Instalacin y mantenimiento.
Madera, mueble y corcho.
Martimo-pesquera.
Textil, confeccin y piel.
Transporte y mantenimiento de
vehculos.
Vidrio y cermica.

TECNOLOGA

III. DOCUMENTACIN QUE DEBEN PRESENTAR LOS CANDIDATOS.


Solicitud de inscripcin (ANEXO III para grado medio y ANEXO IV para grado superior de la Resolucin de 23
de noviembre de 2010).
Original y copia para su cotejo del documento de identidad nacional o extranjero, o del pasaporte que acredite
el cumplimiento del requisito de edad.
Quienes se inscriban en la prueba de acceso de grado superior debern adjuntar el ejemplar para la
administracin del modelo 030 acreditativo del abono de los precios pblicos establecidos para la inscripcin,
Quienes se inscriban en la prueba de grado superior por estar en posesin del ttulo de Tcnico presentarn,
adems, fotocopia debidamente compulsada del ttulo, o de la certificacin acadmica oficial.
Quienes soliciten la exencin de alguna parte de la prueba presentarn, junto con la solicitud de inscripcin, la
documentacin sobre la que basan su peticin. Las exenciones resueltas por el director del Instituto pueden
ser objeto de reclamacin en el plazo de los dos das siguientes al de la publicacin de la resolucin.
Quienes se hayan presentado en la Comunidad de Madrid a las pruebas de acceso en las convocatorias del
ao 2009 y posteriores y deseen que se les tengan en cuenta las calificaciones positivas o las exenciones
obtenidas en alguna de las partes de la prueba, debern presentar la certificacin original de la prueba y una
copia para su cotejo, que se adjuntar a la solicitud.
Quienes soliciten la exencin de la parte especfica de la prueba de acceso a ciclos formativos de grado
superior por experiencia laboral, procedern conforme a lo dispuesto en el artculo 15, apartado 2, de la
Resolucin de 23 de noviembre de 2010. La resolucin adoptada por la Comisin de Exenciones se podr
consultar por los solicitantes a partir del da 12 de abril en los tablones de anuncios de los centros
examinadores; y de forma individual a ttulo informativo- en la direccin web www.madrid.org/fp>admisin
y pruebas>pruebas de acceso introduciendo el DNI.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS: 2011

Pacc2011-Instrucciones (Vdefinitiva).doc

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

IV. COMISIONES DE EVALUACIN.


1. Composicin de las comisiones:
q Pruebas de acceso a ciclos de GRADO MEDIO
Presidente:
Vocal:
Vocal:
Vocal:

Director de IES
Profesor de Lengua Castellana y Literatura o de Geografa e Historia
Profesor de Matemticas
(1)
Profesor de Fsica y Qumica, Biologa y Geologa o de Tecnologa

(1).Se incluyen en esta especialidad los Profesores Tcnicos de Formacin Profesional que ocupan plaza de dicha especialidad por cumplir en
su da con la disposicin transitoria segunda del Real Decreto 1635/95 de 6 de octubre (BOE 10.10.95).

q Pruebas de Acceso a ciclos de GRADO SUPERIOR


Presidente:
Vocal:
Vocal:
Vocal:
Vocal:
Vocal:

Director de IES
Profesor de Lengua Castellana y Literatura
Profesor de Matemticas
Profesor de Ingls
Profesor para la Materia 1 de la opcin correspondiente de la Prueba
Profesor para la Materia 2 de la opcin correspondiente de la Prueba.

NOTA: Las especialidades del profesorado con competencia docente para la Materia 1 y la Materia 2 se especifican en la siguiente tabla:

CUERPOS DE CATEDRTICOS Y PROFESORES DE ENSEANZA SECUNDARIA

HUMANIDADES Y
CIENCIAS
SOCIALES

Opciones

Materias

Materia 1: Economa de la
empresa

Materia 2: Geografa

PARTE
ESPECFICA

CIENCIAS

Materias

Materia 1: Biologa

Materia 2: Qumica

TECNOLOGA

Materias

Materia 1: Fsica

Materia 2: Dibujo Tcnico

Especialidad docente

Cdigo

Denominacin de la especialidad

061

Economa

101

Administracin de Empresas

105

Formacin y Orientacin Laboral (1)

110

Organizacin y Gestin Comercial

005

Geografa e Historia
Especialidad docente

Cdigo

Denominacin de la especialidad

008

Biologa y Geologa

103

Asesora y Procesos de Imagen Personal (2)

117

Procesos de Diagnsticos Clnicos y


Productos Ortoprotsicos

118

Procesos Sanitarios

007

Fsica y Qumica

102

Anlisis y Qumica Industrial


Especialidad docente

Cdigo

Denominacin de la especialidad

007

Fsica y Qumica

009

Dibujo

104

Construcciones Civiles y Edificacin

123

Procesos y Productos en Madera y Mueble

(1)

Siempre que se trate de licenciados o graduados en alguna especialidad de la rama de conocimientos de Ciencias Sociales y Jur dicas con formacin en
Economa.

(2)

Siempre que se trate de licenciados o graduados en ciencias con formacin en Biologa.

PRUEBAS DE ACCESO A CICLOS FORMATIVOS: 2011

Pacc2011-Instrucciones (Vdefinitiva).doc

Direccin General de Educacin Secundaria


y Enseanzas Profesionales
CONSEJERA DE EDUCACIN

Comunidad de Madrid

2. Nmero de Comisiones de Evaluacin.


Los Directores de las reas Territoriales determinarn en cada uno de sus mbitos la Unidad
Administrativa a la que los Institutos enviarn, dentro de los 5 das siguientes a la finalizacin
del plazo de inscripcin, el Anexo 1, el Anexo 2.a y el Anexo 2.b de estas Instrucciones con el
nmero de inscritos en la Prueba de grado medio y en las diferentes opciones de la Prueba de
grado superior. Estos anexos sern tambin remitidos a la Direccin General de Educacin
Secundaria y Enseanzas Profesionales (rea de Ordenacin de la Formacin Profesional
Fax 91.720.13.96).
En funcin de dicho nmero, las reas Territoriales realizarn los ajustes previstos en el
artculo 9.2 de la Resolucin de 23 de noviembre de 2010, y fijarn las comisiones de
evaluacin que se precisen, confirmando stas a los centros examinadores y comunicando su
nmero y cdigo, segn el caso, en los Anexos 5, 6.a y 6.b de estas Instrucciones, a la
Direccin General de Educacin Secundaria y Enseanzas Profesionales (rea de Ordenacin
de la Formacin Profesional Fax: 91-720.13.96).
3. Nombramiento de las Comisiones de Evaluacin.
En las fechas establecidas en el artculo 9.4 de la Resolucin de 23 de noviembre de 2010, los
Directores de las reas Territoriales, a propuesta de los respectivos Servicios de la Inspeccin
Educativa, efectuarn el nombramiento de los miembros de las