Aplicación de La PCR

APLICACIÓN DE LA PCR EN TIEMPO REAL PARA
LA DETECCIÓN DE PATÓGENOS EN LA
INDUSTRIA ALIMENTARIA
Alejandro Garrido Maestú

Vigo, 2013
Departamento de Bioquímica, Genética e Inmunología
APLICACIÓN DE LA PCR EN TIEMPO REAL PARA LA

DETECCIÓN PATÓGENOS EN LA INDUSTRIA
ALIMENTARIA
Memoria presentada por
Para optar al grado de
DOCTOR POR LA UNIVERSIDAD DE VIGO
Tesis Doctoral realizada bajo la dirección de la Dra. Ana García Cabado, Dra. María
José Chapela Garrido y el Dr. Juan Manuel Vieites Baptista de Sousa. Tutorizada por el
Dr. Armando Caballero Rúa
Directora Directora Director Tutor
Ana García Cabado María José Chapela Juan Manuel Vieites Armando Caballero
Garrido Baptista de Sousa Rúa
Dra. Ana García Cabado, coordinadora científica de ANFACO-CECOPESCA y
responsable de la división de Seguridad Alimentaria
INFORMA:
Que la Tesis Doctoral titulada: “Aplicación de la PCR en tiempo real para la

detección de patógenos en la industria alimentaria”, recogida en la presente
memoria, de la que es autor el Licenciado en Biología D. Alejandro Garrido Maestú, ha
C.I.F.: G – 36.625.309
sido realizada bajo su codirección en ANFACO-CECOPESCA, y cumple las condiciones

exigidas para que su autor pueda optar al grado de Doctor por la Universidad de Vigo,
por lo que da su aprobación para la correspondiente lectura y defensa.
Para que conste a los efectos oportunos, firma la presente en Vigo, 2013.
Fdo. Ana García Cabado
Fdo. Alejandro Garrido Maestú
Asociación Nacional de Fabricantes de Conservas de Pescados y Mariscos – Centro Técnico Nacional de Conservación de Productos de la Pesca
Carretera Colegio Universitario, 16 – 36310 Vigo (España) – Apdo.:258 • Telf. Oficinas: + 34 986 469 301 • Telf. Laboratorio: + 34 986 469 303
Fax: + 34 986 469 269 • E-mail: anfaco@anfaco.es / cecopesca@anfaco.es
Dra. María José Chapela Garrido, investigadora de ANFACO-CECOPESCA,
en la división de Seguridad Alimentaria
INFORMA:

C.I.F.: G – 36.625.309
Fdo. María José Chapela Garrido
Dr. Juan Manuel Vieites Baptista de Sousa, Secretario General de
ANFACO-CECOPESCA
INFORMA:

C.I.F.: G – 36.625.309
Fdo. Juan Manuel Vieites Baptista de Sousa
“Desgraciados los hombres que tienen todas las ideas claras”
Louis Pasteur
“Si he logrado ver más lejos, ha sido porque he subido a hombros de gigantes”
Isaac Newton
AGRADECIMIENTOS
AGRADECIMIENTOS
A mis directores de tesis, el Dr. Juan Manuel Vieites Baptista de Sousa, la Dra. Ana
García Cabado y la Dra. María José Chapela por darme la oportunidad de realizar esta
tesis en ANFACO-CECOPESCA.
Quiero agradecer a Ana por introducirme en el mundo de la investigación.
Muchas gracias María José por ayudarme a mantener siempre mis inquietudes
moleculares.
Jorge, por mantener tu visión crítica, que me ha servido siempre para mejorar.
Armando, gracias por tu ayuda y apoyo, sobre todo en el tramo final de este
camino.
Paula, Martiña y Mira por sus consejos, correcciones y colaboración en todo lo

que han podido y más.
A Belén, Elvira, Geles y Vicky, mis compañeras de batalla en el laboratorio que

tanto han cacharreado conmigo.
A mi familia, que siempre ha estado a mi lado, incluso cuando no tenían muy

claro a qué me dedicaba.
A Ra, por su apoyo estos años, por escucharme y por quedarse despierta hasta
las tres de la mañana mientras yo escribía.
ABREVIATURAS
ABREVIATURAS:
ADH: Arginina dehidrolasa.

ADN: ácido desoxirribonucleico.
ADNasa: enzima que degrada el ADN
AFLP: Polimorfismo en la longitud de los fragmentos amplificados, del inglés
“Amplified Fragment Lenth Polymorphism”.
ALOA: Agar Listeria según Ottaviani Agosti.
APA: Agua de Peptona Alcalina. Para el enriquecimiento de Vibrio spp. se utiliza
también el Agua de Peptona Alcalina Salina (APAS).
APPCC: Análisis de Peligros y Puntos Críticos de Control.
APT: Agua de Peptona Tamponada.
ARNr: ARN ribosómico.
ARNm: ARN mensajero.
ARN: ácido ribonucleico.
ARNasa: enzima que degrada el ARN.
BAM: manual de análisis bacteriológico, del inglés “Bacteriological Analytical
Manual”.
BHI: caldo cerebro corazón, del inglés “Brain Heart Infusion”.
bipA: gen con propiedades generales de modulación, que actúa como un factor
de traducción y que regula gran variedad de procesos metabólicos. Se ha usado para la
detección de Salmonella spp.
BM: baliza molecular.
CC: agar Celobiosa y Colistina
CDC: Centro para el control y prevención de enfermedades, del inglés “Centers
for Disease Control and Prevention”.
CIA: Control Interno de Amplificación.
CT-SMAC: agar MacConkey con sorbitol, cefixima y telurito.
ctxA: gen que codifica para la subunidad “A” de la toxina colérica. Principal
marcador de patogenicidad de V. cholerae.
dTTP: desoxitimidina trifosfato.
dNTP: desoxinucleótido trifosfato.
eaeA: gen que codifica para la producción de intimina. Habitualmente utilizado
para la detección de E. coli O157.
EIEC: E. coli enteroinvasivo.
ELISA: ensayo por inmuno-absorción ligado a enzimas, del inglés “Enzyme-Linked
Immunosorbent Assay”.
ELFA: ensayo de fluorescencia ligado a enzima, del inglés “Enzyme Linked
Fluorescent Assay”.
epsM: gen que codifica para una proteína de secreción extracelular. Utilizado
como marcador de patogenicidad de V. cholerae.
fimC: codifica una chaperona involucrada en la síntesis de fimbrias de tipo 1.
Utilizado en algunos métodos para la detección de Salmonella spp.
FISH: hibridación in-situ fluorescente, del inglés “Fluorescence In-Situ
Hybridization”.
fliC: gen que codifica para el antígeno flagelar “H”. Usado para la detección del
antígeno “H7” de E. coli O157.
FRET: química de detección de qPCR, del inglés “Fluorescence Resonance Energy
Transfer”.
hlyA: gen que codifica para hemolisinas. Muy utilizado en la detección de L.
monocytogenes a nivel de especie (listeriolisina O) o como factor de virulencia de V.
cholerae.
iagA: gen implicado en el proceso de invasión bacteriano. Utilizado en
determinados métodos para la detección de Salmonella spp.
IGS: separador intergénico, del inglés “Intergenic Spacer”.
invA: invasión A. Gen usado en la detección de Salmonella spp.
ipaH: antígeno H del plásmido de invasión. Diana usada para la detección de
Shigella spp.
LAMP: amplificación isotérmica mediada por lazo, del inglés “loop-mediated
isothermal amplification”.
LDC: Lisina descarboxilaxa
LEB: caldo de enriquecimiento de Listeria, del inglés “Listeria Enrichment Broth”.
Existe una versión tamponada cuyas siglas son “BLEB”.
L-EMB: agar eosina azul de metileno según Levine.
LNA: ácidos nucleicos bloqueados, del inglés “Locked Nucleic Acids”.
lolB: gen que codifica para una lipoproteína de membrana. También se conoce
como hemM. Se ha descrito recientemente como posible diana para la detección de V.
cholerae a nivel de especie.
LUX: cebador LUX, del inglés “Light Upon eXtension”.
mCPC: agar celobiosa, polimixina B y colistina modificado.
MGB: ligandos de surco menor, del inglés “Minor Groove Binder”.
NASBA: amplificación basada en la secuencia de ácidos nucleicos, del inglés
“Nucleic Acid Sequence-Based Amplification”.
NTP: nucleótido trifosfato.
ODC: Ornitina descarboxilasa.
ompW: gen que codifica para una proteína de membrana. Muy utilizado para la
detección de V. cholerae a nivel de especie.
ONPG: o-nitrofenil-β-D-galactopiranosido. Sustrato utilizado para detectar la
actividad β-galactosidasa.
ORF: marco abierto de lectura, del inglés “Open Reading Frame”.
PALCAM: Polymyxin Acriflavine Lithium chloride Ceftazidime Aesculin Mannitol.
PCR: reacción en cadena de la polimerasa, del inglés “Polymerase Chain
Reaction”.
PFGE: electroforesis en gel con campo pulsante, del inglés “Pulse-Field Gel
Electrophoresis”.
pilF: gen que codifica para la proteína pilF, necesaria para el ensamblaje de los pili
tipo IV. Recientemente se ha identificado un polimorfismo en este gen que permite
detectar cepas patógenas de V. vulnificus.
PNA: ácidos peptidonucleicos, del inglés “Peptide Nucleic Acids”.
prfA: gen central de regulación de la virulencia. Muy utilizado para la detección
de L. monocytogenes.
qPCR: PCR en tiempo real o cuantitativa, del inglés “quantitative PCR”.
RAPD: Amplificación aleatoria del ADN polimórfico, del inglés “Randomly
Amplified Polymorphic DNA”.
recA: gen que codifica para una recombinasa. Utilizado como marcador de
especie de varios vibrios en determinados trabajos.
rfb: gen que codifica para el antígeno “O”. Muy utilizado para la detección de E.
coli O157 (rfbE) y de los serotipos O1 y O139 de V. cholerae .
RFLP: polimorfismo de la longitud de los fragmentos de restricción, del inglés
“Restriction Fragment Length Polymorphism”.
rpoS: gen que codifica para el factor sigma de la RNA polimerasa. En algunos
trabajos se ha utilizado para la detección de V. vulnificus a nivel de especie.
rtxA: gen que codifica para repeticiones en la estructura de la toxina. Empleado
como factor de patogenicidad de V. cholerae.
RVS: caldo Rappaport Vassiliadis Soja.
RT -PCR: PCR de transcriptasa inversa, del inglés “retrotranscriptase PCR”.
stx : gen que codifica la toxina shiga. Existen dos variantes, stx1 y stx2. Diana muy
utilizada para la detección y/ o caracterización de E. coli O157.
TCBS: Tiosulfato Citrato sales Biliares Sacarosa.
tcpA: gen que codifica para pili. Se relaciona con la producción de toxinas, del
inglés “Toxin Correlated Pilus”. Se utiliza de modo habitual para diferenciar entre los
biotipos “Clásico” y “El Tor” de V. cholerae.
tcpI: gen que codifica para pili. Se relaciona con la producción de toxinas, del
inglés “Toxin Correlated Pilus”. Factor de virulencia de V. cholerae.
tdh: hemolisina directa termoestable. Gen que codifica uno de los principales
factores de patogenicidad de V. parahaemolyticus.
Tm: temperatura de fusión o disociación, del inglés “melting temperature”.
tlh: hemolisina termolábil. Gen ampliamente utilizado para la detección de V.
parahaemolyticus a nivel de especie.
toxR: gen que codifica un factor de transcripción que regula la expresión de
diferentes factores de patogenicidad en distintas especies bacterianas. Se utiliza con
frecuencia para la detección de V. cholerae y V. parahaemolyticus a nivel de especie.
trh: hemolisina relacionada con tdh. Gen que codifica uno de los principales
factores de patogenicidad de V. parahaemolyticus.
TSB: caldo triptona, soja.
TSYE: caldo triptona, soja y extracto de levadura.
TTB: caldo tetrationato.
ufc: unidad formadora de colonias.
UPB: caldo de preenriquecimiento universal, del inglés “Universal Preenrichment
Broth”.
uidA: gen que codifica para la enzima β-glucuronidasa. Usado en diferentes
procedimientos para la detección de E. coli O157.
UTP: uridín trifosfato.
virA: plásmido determinante de virulencia. La secuencia de este plásmido se ha
utilizado para la detección de Shigella spp. y E. coli enteroinvasivo.
virF: factor de virulencia e invasión. Gen utilizado para la detección de Shigella
spp.
viuB: proteína de uso de vulnibactina. Gen utilizado como marcador de virulencia
de V. vulnificus. Algunos trabajos recientes han indicado que no es apropiado para este
fin por encontrarse ampliamente distribuido dentro de la especie.
vvhA: gen que codifica para la citolisina-hemolisina de V. vulnificus. Uno de los
principales marcadores de especie.
XLD: Xilosa Lisina Desoxicolato
ZNA: ácidos nucleicos de cremallera, del inglés “ZIP Nucleic Ácids”.
ÍNDICE DE CONTENIDOS
ÍNDICE
Capítulo 1: Introducción ....................................................................................................1
1.1. Seguridad alimentaria en relación a los riesgos microbiológicos. Marco legal .........1
1.2. Métodos de análisis utilizados en microbiología de los alimentos ..........................4

1.2.1. Métodos clásicos o de cultivo .......................................................................5
1.2.2. Métodos moleculares ....................................................................................8
1.2.1.1. Métodos Inmunológicos ........................................................................9
1.2.1.2. Métodos basados en la amplificación de ácidos nucleicos .................15
1.3. Historia y fundamento PCR y PCR tiempo real. Diferencias más relevantes,
aplicación a la microbiología alimentaria .......................................................................19
1.3.1. Reacción en Cadena de la Polimerasa (PCR) convencional. Introducción
histórica .................................................................................................................19
1.3.1.1. Fundamento de la PCR convencional ..................................................20
1.3.1.2. Aplicaciones de la PCR convencional ...................................................21
1.3.2. PCR en tiempo real o cuantitativa (qPCR) ...................................................21
1.3.2.1. Químicas de detección ........................................................................22
1.3.2.2. Aplicaciones de la qPCR .......................................................................33
1.3.2.3. Diferencias PCR vs. qPCR. Ventajas y limitaciones ..............................33
1.4. Patógenos alimentarios ...........................................................................................35

1.4.1. Patógenos incluidos en el 2073 ...................................................................35
1.4.2. Patógenos relevantes no incluidos en el Reglamento 2073 ........................38
1.4.3. Patógenos emergentes ................................................................................41
Capítulo 2: Objetivos .......................................................................................................45

Capítulo 3: Publicaciones .................................................................................................46
3.1. Artículo 1 ..................................................................................................................46

3.2. Artículo 2 ..................................................................................................................58
3.3. Artículo 3 ..................................................................................................................69
3.4. Artículo 4 ..................................................................................................................96
3.5. Artículo 5 ................................................................................................................105
3.6. Artículo 6 ................................................................................................................111
3.7. Artículo 7 ................................................................................................................117
Capítulo 4: Discusión .....................................................................................................145
4.1. Selección de patógenos y optimización de medios de cultivo ...............................145

4.2. Evaluación de protocolos de extracción de ADN ....................................................147
4.3. Selección de genes diana, cebadores y sondas para detección mediante qPCR. ..148
4.4. Evaluación y unificación de los métodos de qPCR desarrollados ...........................150
4.5. Ventajas de los métodos de qPCR desarrollados ...................................................152
Capítulo 5: Conclusiones ...............................................................................................155
Capítulo 6: Bibliografía ..................................................................................................157

1. INTRODUCCIÓN
Capítulo 1: INTRODUCCIÓN
1.1. Seguridad alimentaria en relación a los riesgos microbiológicos. Marco

legal
Las zoonosis son enfermedades o infecciones que se producen en animales y que

son transmisibles al hombre en condiciones naturales, por ejemplo, mediante el
consumo de alimentos contaminados (6, 7). En marzo de 2012 la Autoridad Europea de
Seguridad Alimentaria (EFSA por sus siglas en inglés, European Food Safety Authority)
publicó el informe “Tendencias y Fuentes de Zoonosis, Agentes Zoonóticos y Brotes
asociados a alimentos” en Europa, con datos obtenidos en 2010 (10). En este informe
se notifican 15 tipos distintos de zoonosis, incluyendo datos de 27 Estados Miembros
de la Unión Europea y cuatro estados que no son miembros.
Las zoonosis más notificadas en Europa se deben a agentes bacterianos, siendo
las más relevantes las producidas por Campylobacter spp., Salmonella spp., Listeria
monocytogenes, Escherichia coli verotoxigénico (principalmente el serotipo O157) y
Yersinia enterocolitica. El resto de agentes zoonóticos recogidos en los informes
anuales de EFSA presentan incidencias menores e incluyen otros patógenos
bacterianos, víricos y parasitarios. De los mencionados anteriormente cabe resaltar
que la gran mayoría de brotes, se deben a Campylobacter spp. con más de 200.000
confirmados y a Salmonella spp. de la cual se confirmaron casi 100.000 casos (10).
La publicación en el año 2005 del Reglamento 2073 (11) por el cual se regulan los
parámetros microbiológicos aplicables a productos alimenticios, así como sus
posteriores modificaciones (12-14) han supuesto un gran impacto en las industrias
alimentarias y los sectores relacionados (15). Este Reglamento implicó la derogación de
las normativas nacionales en varios países de la Comunidad Europea, entre ellos
España, en favor del C.E. 2073/ 2005, con la consecuente adaptación a los nuevos
requisitos (16). La nueva normativa parece dejar mayor libertad a los productores ya
que elimina de indicadores de calidad microbiológicos (mesófilos, enterobacterias,
coliformes, estafilococos, entre otros) en gran cantidad de productos alimenticios y
1 Introducción
Aplicación de la PCR en tiempo real a la industria alimentaria 2013
centra el análisis de patógenos fundamentalmente en Salmonella spp. y Listeria

monocytogenes. Este último sólo en las diferentes modalidades de alimentos listos
para el consumo, como se recoge en la Tabla 1. Esta tabla se ha desarrollado en base a
lo especificado en el Reglamento C.E. 2073/ 2005 y sus modificaciones (11-14). Los
diferentes tipos de alimentos se han agrupado en seis categorías principales, aunque
no todos los parámetros especificados se exigen para todos los tipos de alimentos
dentro de una misma categoría.
Tabla 1. Parámetros Microbiológicos contemplados en el Reglamento C.E. 2073/ 2005
Alimento Microorganismo
Hortalizas frutas y derivados  E. coli

+
Salmonella spp.
Productos de la pesca  E. coli
 Estafilococos coagulasa positivos

+
Salmonella spp.
 Histamina
Ovoproductos  Enterobacterias

++
Leche y productos lácteos Enterobacterias
 E. coli
 Estafilococos coagulasa positivos
 Enterotoxinas estafilocócicas
 Cronobacter sakazakii*

+
Salmonella spp.
Carne y derivados  Enterobacterias
 E. coli
 Mesófilos

++++
Salmonella spp.
+++
Alimentos listos para el consumo  L. monocytogenes
*Preparados deshidratados para lactantes y alimentos dietéticos deshidratados destinados a usos médicos especiales para
+ ++
lactantes menores de 6 meses. Añadidos en el Reglamento 1441/ 2007. Incluido en el Reglamento C.E. 2073/ 2005 y
+++
modificado en el Reglamento 365/ 2010. Las tres categorías incluidas dentro del Reglamento C.E. 2073/ 2005 (alimentos
destinados a usos médicos o infantiles, alimentos que favorecen el crecimiento de L. monocytogenes y alimentos que no
++++
favorecen el crecimiento de L. monocytogenes). Restricción a S. Typhimurium y S. Enteritidis en cierto tipo de carnes,
modificación 1086/ 2011.
2 Introducción
Sin embargo, este reglamento implica que los fabricantes tienen una mayor
responsabilidad sobre los productos que comercializan y por tanto deben tener un
mayor autocontrol (11-15).
Es destacable que el número de parámetros microbiológicos requeridos varía
ampliamente en función del tipo de alimento. Los productos lácteos y cárnicos
presentan un mayor número de parámetros que los ovoproductos o las frutas y
hortalizas. Estas diferencias pueden deberse al hecho de que los últimos presenten un
menor riesgo para la salud por el tipo de producto, o que su consumo se encuentre
menos extendido que el de los producto lácteos y cárnicos.
Tabla 2. Brotes epidémicos recientes asociados a patógenos bacterianos
Microorganismo Año Localización Fuente Nº casos Nº fallecidos

S. Bredeney 2012 EE. UU. Pollo 76 1
S. Typhimurium y Newport 2012 EE. UU. Melón 261 3
S. Braenderup 2012 EE. UU. Mango 121 0
L. monocytogenes 2008 Canadá Carne 57 23
L. monocytogenes 2012 EE. UU. Ricotta 18 3
L. monocytogenes 2011 EE. UU. Melón 146 30
E. coli O26 2012 EE. UU. Brotes de trébol crudo 29 0
E. coli O145 2012 EE. UU. Desconocido 18 1
E. coli O157:H7 2011 EE. UU. Lechuga 60 0
L. monocytogenes 2000 Francia Lengua de cerdo 26 7
S. Stanley 2012 Europa Pavo 167 (254)* (0)
S. Thompson 2012 Holanda Pescado ahumado 190 0
E. coli O104:H4 2011 Alemania-Francia Brotes germinados (pepinos Alemania) 3842 53
*Entre paréntesis se indican datos provisionales de afectados. (10, 17, 18)
Sin embargo, a pesar de las medidas de prevención y control tomadas, tanto en

Europa como en otras regiones (Estados Unidos, Canadá, entre otros) se sigue
observando una alta incidencia de determinados agentes zoonóticos. En la Tabla 2 se
muestran algunos brotes epidémicos recientes asociados a los principales patógenos
alimentarios bacterianos.
3 Introducción
Como se puede observar en los datos expuestos en la Tabla 2, así como en los
informes anuales desarrollados por EFSA, en general estos brotes se pueden agrupar
en dos grandes problemáticas diferentes. Por un lado, aquellos que, a pesar de tener
una baja tasa de mortalidad, producen gran cantidad de brotes epidémicos durante el
año y que afectan a gran cantidad de individuos, como es el caso de Salmonella spp.
que en 2010 produjo más de 90.000 casos confirmados. Por otro lado, se encuentra la
situación opuesta, en la cual el número de brotes es menor, por lo general, su
incidencia también es más baja, pero que presentan una tasa de mortalidad muy
elevada, es el caso de L. monocytogenes que en 2010 no llegó a los 2000 casos
confirmados pero su tasa de mortalidad rondaba el 17 % (10).
Todos los datos mostrados anteriormente resaltan la importancia del control
microbiológico de los alimentos destinados al consumo humano como medida para
controlar y reducir la incidencia de las zoonosis producidas por patógenos bacterianos.
Desde el punto de vista de los productores y las empresas, se demandan cada vez
más métodos y técnicas que cumplan dos requisitos fundamentales. Por un lado, que
sean altamente fiables para permitir un control preciso sobre la calidad microbiológica
de los alimentos producidos y/ o procesados. Por otro lado, muy relacionado con la
fiabilidad, está la rapidez, ya que existen en el mercado gran variedad de productos
cuya vida útil es muy corta. Por tanto, retrasos en la obtención de los resultados
necesarios para la comercialización de estos alimentos, pueden repercutir en
importantes pérdidas económicas.
En esta tesis, atendiendo a las necesidades legales de las empresas, como
microorganismo de estudio se seleccionaron Salmonella spp. y L. monocytogenes.
Adicionalmente se incluyeron Shigella spp. y E. coli O157, que aunque no están
regulados explícitamente en el Reglamento 2073 sí son patógenos problemáticos y
reconocidos desde hace tiempo. Finalmente se incluyeron V. cholerae, V.
parahaemolyticus y V. vulnificus por su creciente incidencia e importancia en todo el
mundo.
1.2. Métodos de análisis utilizados en microbiología de los alimentos
4 Introducción
En el este apartado se describen los principales métodos de análisis utilizados en

microbiología alimentaria. Se ha establecido una clasificación basada en el tipo de
metodología utilizada. De este modo se diferencia entre métodos clásicos o de cultivo y
métodos moleculares.
1.2.1. Métodos Clásicos o de cultivo

Dentro de los denominados clásicos se incluyen los métodos microbiológicos
basados en el empleo de medios de cultivo líquidos y sólidos. Dentro de este tipo de
metodologías existen diferentes variantes como son los recuentos en placa, los
recuentos por número más probable (NMP) y/ o los métodos de investigación o
detección. En la presente tesis se utilizaron diversos métodos de investigación o
detección, que consisten en el uso de medios de cultivo líquidos para el
enriquecimiento de las muestras, y medios sólidos para el aislamiento de las bacterias
de interés. En microbiología clásica tras haber aislado el microorganismo de interés se
realiza su identificación mediante pruebas bioquímicas (19).
En general todos los métodos de detección de bacterias constan de los
siguientes pasos:
 Pre-enriquecimiento en medio líquido general que se emplea para
recuperar las bacterias dañadas o estresadas, y favorecer su multiplicación
 Enriquecimiento en medio líquido selectivo utilizado para que se
produzca el crecimiento de las bacterias de interés mediante el uso de agentes
selectivos que inhiben el crecimiento del resto de bacterias interferentes.
 Aislamiento en medios sólidos selectivos con inhibidores que tienen
como objetivo evitar el crecimiento de flora interferente para favorecer el
aislamiento de los potenciales microorganismos patógenos de interés. Suelen
permitir diferenciar las bacterias diana por su morfología o mediante
reacciones bioquímicas concretas.
 Aislamiento en medios generales para obtener cultivos puros y realizar
una identificación fiable de las colonias obtenidas en los medios selectivos.
 Identificación bioquímica/ molecular mediante diferentes pruebas
bioquímicas que dan un perfil concreto en función de la especie y diferentes
5 Introducción
pruebas serológicas, así como la detección de determinados genes de

virulencia.
El tipo de medios de cultivo empleados en cada paso, así como las temperaturas
utilizadas varían enormemente en función del microorganismo que se desea aislar. En
la Figura 1 se representa de forma esquemática el método ISO para la detección de
Salmonella spp. como ejemplo de un método microbiológico clásico (20).
Figura 1. Esquema del método ISO para la detección de Salmonella spp.
6 Introducción
Los diferentes métodos de microbiología clásica son económicos, proporcionan

resultados cuantitativos y/ o cualitativos, son muy sensibles, permitiendo la
recuperación y posterior identificación de números bajos del patógeno de interés
gracias a la realización de varios pasos de enriquecimiento. Actualmente el desarrollo
de kits comerciales que facilitan llevar a cabo la detección simultánea de varias pruebas
bioquímicas, en lugar de su realización individual, permite optimizar el tiempo
dedicado a este fin (19, 21, 22). En la actualidad los métodos de microbiología clásica
están contemplados como los métodos de referencia para el control de patógenos
alimentarios (19), tanto en Europa como en Estados Unidos (EE. UU.) y Canadá, entre
otros países (11-13, 23, 24).
Hay que destacar que el éxito de los métodos clásicos depende del número y
estado fisiológico de las bacterias en los alimentos, de la selectividad de los medios
(balance entre inhibición de los competidores y del organismo diana), de las
condiciones de incubación (tiempo, temperatura, oxígeno), y de la selectividad de los
medios de aislamiento (capacidad de discriminar entre el organismo diana y la
microflora interferente) (21).
A lo largo de estos últimos años, estas metodologías han ido mejorando con la
introducción de nuevos medios de cultivo, tanto líquidos (generales y selectivos) como
sólidos. El desarrollo de medios cromogénicos ha permitido mejorar los resultados
obtenidos utilizando la microbiología clásica, principalmente reduciendo costes
asociados a los procesos de confirmación. Estos medios de cultivo presentan una
elevada especificidad, lo que permite obtener buenas identificaciones con un número
menor de colonias aisladas. Los métodos de detección de Vibrio spp. (25-27),
representan un claro ejemplo del gran avance que supone la introducción de los
medios cromogénicos. El medio sólido oficial para el aislamiento es el TCBS (Tiosulfato
Citrato sales Biliares Sacarosa), pero en este medio V. parahaemolyticus, principal
agente causante de gastroenteritis asociada al consumo de marisco en EE. UU. (28),
presenta morfologías similares a otras especies del mismo género. También existe la
posibilidad de que se produzca sobrecrecimiento de determinadas especies invasivas
como V. alginolyticus, lo que puede llevar a un enmascaramiento de las bacterias de
interés (29). El uso del medio cromogénico Chromagar® Vibrio (Chromagar, Francia) o
Bio-Chrome Vibrio permite diferenciar ciertas especies de interés, como son V.
7 Introducción
parahaemolyticus, V. vulnificus y V. cholerae del resto de posibles interferentes

presentes en la muestra. A pesar de esto, en el caso de los vibrios, los medios
cromogénicos no se incluyen en las normas específicas de Vibrio spp. (26, 27), a
excepción del TCBS y dejan a la elección del laboratorio el uso de otro medio de cultivo
como complemento.
De igual modo ocurre en el caso de Salmonella spp. cuyo medio de elección es el
XLD (Xilosa Lisina Desoxicolato) pero este medio no detecta las cepas de salmonela que
no producen sufuro de hidrógeno, como ocurre con S. Paratiphi A, o las que son lactosa
positivas (20).
Un último caso a destacar, es el de Listeria monocytogenes, donde la relevancia
del medio cromogénico ALOA (Agar Listeria según Ottaviani Agosti) llevó a su inclusión
en la ISO correspondiente (30) relegando a un segundo lugar al medio de cultivo que
se había utilizado oficialmente durante casi 10 años (31), el agar PALCAM (Polymyxin
Acriflavine Lithium chloride Ceftazidime Aesculin Mannitol). Entre otros motivos, este
cambio viene motivado por el crecimiento de otras especies con morfología similar a L.
monocytogenes entre ellas L. innocua. Sin embargo, hay estudios que indican que el
uso de acriflavina, muy común como inhibidor en medios de enriquecimiento y sólidos,
tiende a afectar más a L. monocytogenes que a L. innocua llevando a una
subestimación de la contaminación asociada a L. monocytogenes (21).
Los ágares cromogénicos, se basan por tanto en la elección de sustancias
cromogénicas específicas que sólo producen cambio de color frente a determinadas
enzimas específicas de la especie deseada. Tomando como ejemplo el caso del ALOA, L.
monocytogenes y L. ivanovii tienen ambas el gen plcA, que codifica para una fosfatidil-
inositol fosfolipasa C específica, que no se encuentra en ninguna otra especie de
Listeria. (21).
1.2.2. Métodos Moleculares

Una gran desventaja que presentan los métodos de microbiología clásica, como
se ha descrito en el apartado anterior, es que requieren varios pasos en días sucesivos
para el aislamiento de las bacterias de interés. Esto hace que los procedimientos sean
largos y muy laboriosos. Además, los patógenos alimentarios generalmente se
8 Introducción
encuentran presentes en muy bajas concentraciones (menos de 100 ufc/ g), pueden
estar estresados ó en estado de viables no cultivables (VNC) y pueden no recuperarse
satisfactoriamente o pasar inadvertidas entre grandes cantidades de microorganismos
interferentes. Este hecho constituye uno de los grandes inconvenientes de estas
técnicas (32, 33) y puede suponer un peligro potencial para la salud pública.
Los métodos moleculares se basan en la detección de características genotípicas,
que son mucho más estables y objetivas que las fenotípicas tradicionalmente
empleadas en microbiología. Además, el genoma bacteriano presenta regiones de ADN
variables y comunes que permiten la detección de especies así como de factores de
virulencia y/ o toxinas (34). El gran aumento en la disponibilidad de información de
secuencias de ADN y de otras moléculas (ARN, ribosomas, etc.) ha permitido el
desarrollo de diferentes métodos y técnicas, que usando esta información, permiten
eliminar gran parte de los inconvenientes asociados a la microbiología clásica
(velocidad, especificidad, entre otros).
A continuación se detallan los principales métodos moleculares utilizados en
microbiología, tanto clínica como alimentaria.
1.2.2.1. Métodos inmunológicos

Los métodos inmunológicos son rápidos y relativamente económicos, permiten la
detección precisa de antígenos tras procesos sencillos de purificación y no están
sujetos a interferencias asociadas al tipo de alimento analizado (21). Se basan en el uso
de anticuerpos mono- o policlonales, o incluso recombinantes, que se unen a un
antígeno específico (19, 21, 22).
Los anticuerpos policlonales se han utilizado durante muchos años. Se obtienen
mediante la inmunización reiterada de animales de experimentación y posterior
obtención de su suero sanguíneo donde se encuentran una mezcla de anticuerpos de
diverso tipo. Hay que tener en cuenta que este modo de producción de anticuerpos,
aunque es sencillo, implica la obtención de muchos anticuerpos que no son útiles ya
que estaban presentes en el animal previo a la inmunización con el antígeno de interés.
Los anticuerpos policlonales se han utilizado en diferentes kits comerciales para la
detección de patógenos alimentarios (TECRA Listeria Visual Immunoassay (3M) y
Assurance Listeria polyclonal enzyme immunoassay).
9 Introducción
Sin embargo, los anticuerpos monoclonales suelen ser más útiles para la
detección específica de patógenos. Como se explicó anteriormente, se parte de la
inmunización de animales de experimentación, pero cuando la respuesta inmune es
máxima se obtienen los linfocitos B del bazo y se fusionan con un mieloma para formar
un hibridoma (célula teóricamente inmortal, tumoral, con capacidad de producción de
los linfocitos B). Como ventaja, proporcionan un tipo concreto de anticuerpo de modo
continuo. Se pueden obtener clones con diferentes especificidades y afinidades y los
anticuerpos que no sean específicos se pueden eliminar reduciendo las interferencias
causadas por aquellos anticuerpos no específicos. Este tipo de anticuerpos también se
ha utilizado en kits comerciales para la detección de patógenos alimentarios, como el
caso de los VIDAS Salmonella y VIDAS LMO para la detección de Salmonella y L.
monocytogenes respectivamente (BioMérieux) y el Lister test (Vicam). Los principales
problemas asociados a este tipo de anticuerpos son el coste, la necesidad de personal
altamente cualificado, el equipamiento especial para cultivos celulares y el bajo
rendimiento en la producción.
El desarrollo de los anticuerpos recombinantes solventa parte de estos
problemas, ya que permite la producción de cantidades razonables de anticuerpos en
un corto período de tiempo usando sistemas de expresión bacterianos. Asimismo se
eliminan la problemática ética asociada al uso de animales de experimentación (21).
Se pueden establecer dos grandes grupos de inmunoensayos:
 Inmunoensayos homogéneos: no es necesario separar los anticuerpos
unidos de los libres, ya que el complejo antígeno-anticuerpo, es directamente
visible o cuantificable. Los tiempos de incubación son muy cortos, es el caso de
las reacciones de aglutinación e inmunodifusión, entre otras.
 Inmunoensayos heterogéneos: al contrario que en el caso anterior, en
este grupo los anticuerpos ligados deben ser separados de los libres. Es el caso
del ELISA (Enzyme-Linked Immunosorbent Assay). En lo que respecta a la
detección de bacterias, presentan límites más elevados, por lo que no es
posible la detección directa, siendo necesario un paso de enriquecimiento.
La mayor ventaja de los métodos inmunológicos se debe a que son más rápidos y
presentan mayor especificidad que los métodos de microbiología clásica por la
10 Introducción
adsorción entre antígeno y anticuerpo. Se pueden usar para detectar antígenos

bacterianos o, si se trabaja con animales inmunizados, para detectar los anticuerpos
generados frente a estos antígenos. Estas ventajas están asociadas al desarrollo de
ensayos de mayor especificidad, automatización y técnicas que permiten la obtención
de anticuerpos con la especificidad deseada (19, 22). Los principales problemas que
presentan son baja sensibilidad, baja afinidad por el antígeno y posibles interferencias
con contaminantes (21).
A continuación se especificarán los principales métodos inmunológicos aplicados
a la detección de patógenos en la industria alimentaria.
1.2.2.1.1. Ensayo por inmuno-absorción ligado a enzimas (Enzyme-Linked

Inmunosorbent Assay, ELISA)
El ELISA constituye el método más común para la detección de patógenos
mediante inmunodetección. Estos métodos pueden ser directos, tipo sándwich y
competitivos. Existen kits comerciales para diferentes patógenos bacterianos, como
TECRA Visual Immunoassay (TECRA International), Listeria-Tek (Organon Teknika) y
Eiafoss (Foss Electric), entre otros (21).
1.2.2.1.2. Ensayo de fluorescencia ligado a enzimas (Enzyme Linked Fluorescent Assay,

ELFA)
Una manera de lograr ensayos ELISA más sensibles es mediante la unión de
marcadores fluorescentes a los anticuerpos. Esto permite reducir el tiempo necesario
para la detección, eliminando la reacción colorimétrica del paso final de un ELISA
convencional. Este tipo de ensayo es el utilizado en los kits comerciales del equipo
VIDAS para la detección de Salmonella spp., L. monocytogenes y enterotoxina
estafilocócica, entre otros (BioMérieux) (21, 35, 36).
Existen variaciones de los inmunoensayos fluorescentes para la detección de
patógenos, como el uso de microesferas con diferentes marcajes y cubiertos con
anticuerpos específicos para cada patógeno. Las esferas se separan por su espectro de
fluorescencia y la posterior detección del microorganismo se realiza con un anticuerpo
secundario marcado con un fluoróforo (21).
11 Introducción
1.2.2.1.3. Inmunoprecipitación y aglutinación

Son ensayos sencillos que se basan en el uso de esferas de látex cubiertas con
anticuerpos específicos de un antígeno concreto. Cada antígeno se puede unir a más
de un anticuerpo de diferentes esferas, produciendo su aglutinación. Proporciona
resultados cualitativos, aunque sus grandes ventajas incluyen la visualización de los
resultados interpretables a simple vista y que no es necesario el uso de reactivos de
elevado coste económico.
En el caso de los ensayos Visuales de Inmunoprecipitación (VIP, BioControl
Systems), la muestra fluye lateralmente por un soporte sólido, el patógeno interacciona
con un complejo anticuerpo-cromógeno y este sigue fluyendo hasta que es atrapado
por un anticuerpo inmovilizado en la membrana. De este modo si hay presencia del
patógeno de interés aparecerá una línea coloreada en la ventana del dispositivo (21).
1.2.2.1.4. Separación inmunomagnética

Los métodos de separación inmunomagnética requieren una mención aparte ya
que no se emplean para la detección por sí mismos, pero sí combinados con otras
metodologías. Básicamente estos métodos consisten en la utilización de esferas
magnéticas, cubiertas con anticuerpos específicos, que se añaden a la mezcla de
muestra y diluyente, para capturar el microorganismo de interés (19, 21, 22).
Los anticuerpos policlonales generalmente presentan reactividad cruzada, por lo
que es difícil hacer ensayos reproducibles. Por el contrario, los anticuerpos
monoclonales normalmente presentan mejores propiedades. En algunos casos se
puede utilizar una mezcla de ambos tipos de anticuerpos para capturar una amplia
variedad de serovares. Un ejemplo lo constituye un kit que existe contra Salmonella
(37).
Los métodos inmunológicos utilizados en esta tesis fueron los ELFA para la
detección de Salmonella spp. y L. monocytogenes, y la aglutinación con látex como
parte de la confirmación del procedimiento ISO para la detección de Salmonella spp.
1.2.2.2. Métodos basados en la amplificación de ácidos nucleicos

En los últimos años ha habido un aumento en la disponibilidad de secuencias
genéticas de diferentes microorganismos, incluyendo gran cantidad de patógenos
12 Introducción
alimentarios. Esto ha permitido establecer los cimientos para los sistemas de detección
basados en ácidos nucleicos (ADN y/ o ARN) (38).
Las técnicas de análisis rápidos para la aplicación en la industria deben ser
sencillos, económicos y deben demostrar una sensibilidad y especificidad
reproducibles. Hoy en día, la mayoría de los métodos moleculares que cumplen todos
estos requisitos, están basados en sistemas de detección de ADN (39).
A continuación se explican las principales técnicas basadas en la amplificación de
los ácidos nucleicos utilizadas para la detección de microorganismos (amplificación
basada en la secuencia de ácidos nucleicos (Nucleic Acid Sequence-Based
Amplification, NASBA), amplificación isotérmica mediada por lazo (Loop-mediated
isothermal amplification, LAMP), hibridación in-situ fluorescente (Fluorescent In-Situ
Hybridization, FISH) y microarrays), así como otras que son aplicadas para la tipificación
de estos (polimorfismo de la longitud de los fragmentos de restricción (Restriction
Fragment Lenght Polymorphism, RFLP), electroforesis en gel con campo pulsante
(Pulse-Field Gel Electrophoresis, PFGE), polimorfismo en la longitud de los fragmentos
amplificados (Amplified Fragment Length Polymorphism, AFLP) y amplificación
aleatoria del ADN polimórfico (Randomly Amplified Polymorphic DNA, RAPD)).
Posiblemente la técnica más conocida y utilizada para la detección de ácidos
nucleicos, sea la reacción en cadena de la polimerasa (PCR) (40) y su versión de última
generación, la PCR en tiempo real o cuantitativa (qPCR). Ambas técnicas se detallan en
la sección 3 de esta introducción.
1.2.2.2.1. Amplificación basada en la secuencia de ácidos nucleicos (Nucleic Acid

Sequence-Based Amplification, NASBA)
La técnica NASBA ha sido específicamente diseñada para amplificar ARN. Se basa
en el empleo de 3 enzimas: transcriptasa reversa, ARNsaH y ARN polimerasa T7, que
actúan de modo combinado para amplificar el ARN molde de cadena sencilla. Se usan
2 cebadores, uno complementario a la secuencia diana de ARN y otro a la de ADNc
(dado que se sintetizan, tanto ARN como ADN, la mezcla de reacción contiene dNTPs y
NTPs). Uno de los cebadores además contiene una secuencia de reconocimiento para
la ARN polimerasa T7. A continuación, tal y como se puede observar en la Figura 2, se
explica brevemente la secuencia de este proceso:
13 Introducción
Figura 2. Representación esquemática de la técnica NASBA. Detección final del

producto mediante el uso de balizas moleculares. Imagen extraída de (4).
 El primer cebador (P1) se une al ARN molde, permitiendo que la transcriptasa

reversa (RT) sintetice la hebra de ADN complementario (ADNc).
 Posteriormente la ARNsaH digiere el ARN (sólo el unido a ADN, no el
monocaterio) y el segundo cebador (P2) se une al ADNc permitiendo que la
transcriptasa reversa sintetice una copia de ADNc bicatenario de la secuencia
original.
 El ADN bicatenario actúa como un “minigen”, que es transcrito por la ARN
polimerasa T7 produciendo miles de transcritos que son ciclados en la reacción.
El proceso se lleva a cabo a una única temperatura, normalmente a 41 °C (41). A
esta temperatura, el ADN genómico del microorganismo diana permanece en forma de
doble hebra y por lo tanto no sirve de molde para la amplificación. Esto elimina la
necesidad de tratamiento con ADNsa, necesaria en transcripción inversa para la
detección de ARN, y también ofrece la posibilidad de la detección específica de células
viables, ya que el ARN es inestable y por tanto es menos probable encontrarlo en
14 Introducción
células muertas. El producto de reacción de la técnica NASBA es principalmente ARN

monocatenario, que puede ser detectado por electroforesis mediante la tinción con
bromuro de etidio. Sin embargo, con el fin de confirmar la especificidad del producto
generalmente se incluye un paso de confirmación usando una sonda de hibridación
(21, 42)
Esta técnica se ha utilizado para detectar varios patógenos bacterianos
(Salmonella enterica, L. monocytogenes, etc.), parásitos (Cryptosporidium parvum) e
incluso virus (Hepatitis A y rotavirus) (42-44). Asimismo, esta tecnología se ha
empleado para el desarrollo de kits comerciales como los NucliSENS® (BioMérieux).
1.2.2.2.2. Amplificación isotérmica mediada por lazo (Loop-mediated isothermal

amplification, LAMP)
La técnica LAMP se basa en el autociclado de las hebras con desplazamiento del
ADN sintetizado por el fragmento grande de la Bst ADN polimerasa. Fue diseñada por
Notomi et al. en el año 2000, como un método alternativo a la PCR y al NASBA para la
amplificación de material genético. Entre otras, presenta las ventajas de que toda la
reacción se realiza a una única temperatura, los productos de amplificación se pueden
observar directamente sin necesidad de ningún equipo y presenta una alta
especificidad ya que utiliza un total de seis cebadores para realizar la amplificación (45,
46). En la Figura 3 se puede ver un esquema de la técnica.
15 Introducción
Figura 3. Representación esquemática de la técnica LAMP. Imagen extraída de (3).
16 Introducción
Desde su aparición se han ido desarrollando métodos para la detección de

diferentes patógenos bacterianos como Salmonella spp., Shigella spp., V. vulnificus, V.
parahaemolyticus, V. cholerae o incluso hongos productores de toxinas (46-51).
1.2.2.2.3. Hibridación in situ fluorescente (Fluorescent In-Situ Hybridization, FISH)

Esta técnica se suele utilizar para realizar estudios sobre la presencia y
distribución de determinadas cepas en comunidades microbianas, sin tener que
recurrir al uso de cultivos. En primer lugar se fija la muestra, en el caso de bacterias
Gram positivas se permeabilizan las células usando proteinasa K para que puedan
entrar las sondas fluorescentes. A continuación se usan sondas fluorescentes
complementarias al ADN aunque no tienen porqué ir dirigidas única y exclusivamente a
una diana. Distintos estudios han utilizado ARNr o ARNm de las bacterias de interés
marcadas con un fluoróforo (52-54). Se realiza una incubación y finalmente las células
marcadas pueden ser visualizadas con un microscopio de fluorescencia (21).
Esta técnica, con diferentes variantes, se ha empleado para detectar y cuantificar
distintos microorganismos en el medio ambiente, alimentos e incluso poblaciones
dentro de los biofilms bacterianos (55-58).
La sustitución de las sondas de oligonucleótidos lineales por la tecnología de
balizas moleculares (Molecular Beacons, BM) ha supuesto un avance en esta
metodología. Este cambio ha proporcionado mayor capacidad de discriminación a la
técnica, además de reducir la necesidad de lavados y, por tanto, la aglomeración y
pérdida de células, lo que permite obtener recuentos más fiables (32). Adicionalmente,
estudios recientes han empleado sondas con ácidos nucleicos pépticos (Peptide
Nucleic Acids, PNA). Este tipo de sondas permite solucionar las limitaciones asociadas
al empleo de sondas de ADN en cuento a permeabilidad de la célula, afinidad de la
hibridación y acceso a los lugares específicos para dicha hibridación, además de unirse
más rápido y con mayor intensidad al ácido nucleico diana (57, 58). Otro de los
problemas que se ha descrito asociado al empleo de esta técnica radica en la baja
intensidad de la señal, hecho que puede ser debido a que las moléculas diana se
encuentren en baja concentración en la célula (ARNr 16S o 23S). La utilización de sodas
oligonucleotídicas de doble marcaje permite solucionar este inconveniente (59). Una
desventaja adicional de esta técnica consiste en que, aunque en teoría se puede
17 Introducción
detectar una única célula, en la práctica el límite de detección se encuentra en torno a

103 células por mL, haciéndola menos sensible que otras metodologías. Por otro lado,
aun no se dispone de suficiente automatización para poder analizar grandes cantidades
de muestras (32).
1.2.2.2.4. Microarrays de ADN

Uno de los últimos grandes avances en las técnicas de biología molecular son los
microarrays de ADN (60). Se diseñaron originariamente para el análisis de expresión
génica (61) y se componen de un número determinado de sondas de ADN fijadas a un
substrato sólido. Cada sonda se corresponde con un oligonucleótido específico de una
secuencia de ADN diana (también se puede utilizar ARN 16S y 23S (62)). Se realiza una
PCR tras la cual los fragmentos amplificados se unen exclusivamente a las sondas
complementarias. Uno de los oligonucleótidos usados en la PCR lleva un marcaje
fluorescente por lo que los sitios donde se ha unido el ADN presentan fluorescencia
(21).
Debido a su alto rendimiento, ya que permite analizar un elevado número de
muestras o dianas, se pueden utilizar para detectar e identificar diferentes genes
pertenecientes a una misma especie bacteriana, o a varios patógenos de modo
simultáneo en muestras de diferentes orígenes (alimentos, cultivos, animales, etc.)
(32). Con esta técnica se eliminan las limitaciones del poder de resolución de los geles
de agarosa que presenta la PCR o del número de fluoróforos diferentes que puede
detectar un equipo de qPCR (21, 38, 61-63). Estudios recientes han demostrado que los
errores de reproducibilidad y precisión de esta técnica se encuentran asociados al tipo
de muestra analizada y, principalmente, a errores humanos (60).
A continuación se describen varios métodos moleculares que, aunque no se
utilizan para análisis de rutina, presentan una gran importancia dentro de la
microbiología. Estas técnicas permiten verificar los resultados obtenidos o tipificar con
mayor detalle las cepas aisladas. Las huellas de ADN son los métodos más poderosos
de tipado y se han usado ampliamente para el genotipado de los patógenos
alimentarios aislados de productos alimenticios (60). Se trata de Polimorfismo de la
longitud de los fragmentos de restricción (RFLP), ribotipado, electroforesis en gel con
campo pulsante (PFGE), polimorfismo en la longitud de los fragmentos amplificados
18 Introducción
(AFLP) y amplificación aleatoria del ADN polimórfico (RAPD). Cada uno de estos
métodos permite una mayor caracterización del patógeno y puede determinar cuál de
los muchos subtipos dentro de cada serotipo es el causante de la enfermedad o es el
agente contaminante (21).
1.3. Historia y fundamento PCR y PCR tiempo real. Diferencias más relevantes,
aplicación a la microbiología alimentaria
1.3.1. Reacción en Cadena de la Polimerasa (PCR) convencional. Introducción

histórica
La PCR fue desarrollada en 1983 por el Dr. Kary Mullis, que se encontraba
investigando un método alternativo para la síntesis específica de secuencias de ADN.
Una primera aproximación a la cuantificación de ácidos nucleicos, previa a la PCR,
consistía en la adición de uridín trifosfato (UTP) o desoxitimidina trifosfato (dTTP) a
cultivos celulares pero, aunque era una técnica útil, no proporcionaba información
sobre transcritos o genes específicos. La introducción de las técnicas de Southern blot
y Northern blot supuso un gran avance ya que permitían identificar, mediante el uso
de sondas radioactivas, un gen concreto o un determinado transcrito. Estas técnicas
presentaban un problema, ninguna de las dos era cuantitativa. Con la introducción de
la reacción en cadena de la polimerasa (PCR) gran parte de los problemas asociados a
estas metodologías se resolvieron, permitiendo la amplificación y detección específica
de genes concretos, su cuantificación mediante comparación con estándares de ADN,
la cuantificación de transcritos mediante el uso de PCR de transcriptasa inversa (RT-
PCR), etc. (64).
1.3.1.1. Fundamento de la PCR convencional.

Consiste en el uso de dos oligonucleótidos (cebadores) que se unen, cada uno a
una hebra de ADN en sentido 5’ → 3’. Cada cebador hibridado proporciona un punto
de partida para la ADN polimerasa que lo amplifica añadiendo desoxinucleótidos. Este
proceso se repite durante varios ciclos de desnaturalización del ADN, hibridación y
extensión mediante el ajuste a la temperatura óptima para etapa (40, 65, 66)}. Tras la
19 Introducción
repetición de varios ciclos se consigue la amplificación específica, y aumento

exponencial, de la secuencia de ADN que se encuentra definida entre ambos
cebadores, como se observa en la Figura 4. La
forma más habitual de detectar el producto de
la reacción es realizando una electroforesis,
que separa los fragmentos por tamaño, y
tinción con bromuro de etidio que permite ver
el fragmento bajo luz ultravioleta; aunque
existen otras posibilidades como ELISA o
Southern blot (64, 65, 67). El fundamento de
la técnica era tan sencillo que el propio Dr.
Mullis se sorprendió de que nadie se hubiera
dado cuenta de sus posibilidades con
anterioridad (68). El impacto que supuso la
aparición de esta técnica, por sus múltiples
aplicaciones, fue tal que, en 1993 se le
concedió el Premio Nobel de química al Dr.
Mullis.
En la actualidad, sobre todo en lo que se
refiere a la detección de bacterias Figura 4. Representación esquemática
patógenas, la tendencia es hacia el de una PCR convencional. El ADN
original aparece en color azul, los
desarrollo de sistemas multiplex de PCR. fragmentos amplificados en verde y
Estos sistemas consisten en la amplificación los cebadores en rojo.
de modo simultáneo de varios genes diana. Este tipo de métodos presentan ventajas
añadidas sobre el método simplex, como son: reducción de espacio necesario para
manipular un elevado número de muestras, reactivos y trabajo; lo que en conjunto
conlleva una reducción de los costes. Además, esta aproximación es coherente con el
hecho de que existen diferentes tipos de alimentos que pueden estar contaminados
con más de un microorganismo patógeno (69-71).
20 Introducción
1.3.1.2. Aplicaciones de la PCR convencional

Dentro de las aplicaciones de la PCR se encuentran:
 Estudios de ecología, diversidad y evolución microbiana.
 Detección de agentes patógenos.
 Detección de animales y plantas transgénicos.
 Identificación de genes expresados.
 Técnica base de otras como RFLP, RAPD o AFLP.
 Diagnóstico precoz de enfermedades genéticas.
 Clonación de ADN amplificado.
 Caracterización genética de agentes infecciosos.
 Control de tratamientos antimicrobianos.
 Estudios epidemiológicos.
 Identificación de especies en alimentos procesados.
Además de las aplicaciones citadas, la PCR se puede utilizar conjuntamente con
otros métodos moleculares, como la restricción enzimática, la hibridación con sondas
específicas o la secuenciación de ácidos nucleicos. Por lo general, las técnicas de
tipificación basadas en la amplificación de ácidos nucleicos mediante PCR poseen un
elevado poder de discriminación, son menos laboriosas, más rápidas y más flexibles
que la PFGE (método de referencia) y permiten trabajar con un mayor número de
muestras (72-75).
1.3.2. PCR en tiempo real o cuantitativa (qPCR)

La qPCR se diferencia de la PCR convencional en que los procesos de
amplificación y detección se producen de manera simultánea, en el mismo vial cerrado,
sin necesidad de ninguna acción posterior (electroforesis, tinción con bromuro de
etidio, etc.) lo cual reduce las posibilidades de contaminación cruzada. La detección del
producto de amplificación se realiza mediante fluorescencia, y se puede medir la
cantidad de ADN sintetizado en cada momento, ya que la emisión de fluorescencia
producida en la reacción es proporcional a la cantidad de ADN formado. Este proceso
permite conocer y registrar en todo momento la cinética de la reacción de
amplificación en tiempo real (65, 73). Las diferencias entre ambas técnicas se
21 Introducción
comentan más en detalle en el punto 3.2.3.
1.3.2.1. Químicas de detección

En la actualidad existen una gran variedad de métodos de detección aplicados a
la qPCR. Aunque las diferencias entre ellas son considerables, todos utilizan la emisión
de fluorescencia para la detección de los fragmentos amplificados.
Independientemente del tipo de química de detección elegida, una “buena”
sonda debe tener poca fluorescencia de fondo (ruido), alta fluorescencia y alta
especificidad por la secuencia diana. Las longitudes de onda de excitación y emisión de
los fluoróforos son parámetros importantes a la hora de diseñar sistemas múltiples
(76). En este apartado se comentarán los principales agentes intercalantes y otras
químicas de detección utilizadas en la actualidad.
1.3.2.1.1. Agentes intercalantes (SYBR Green®, EvaGreen®, BEBO, etc)

Los agentes intercalantes son compuestos químicos que funcionan igual que el
bromuro de etidio, uniéndose a las dobles hebras de ADN que se forman en la reacción
y emitiendo fluorescencia mientras permanecen unidos, como se muestra en la Figura
5a. en la Figura 5b se muestran las curvas de amplificación generadas mediante el uso
de agentes intercalantes. La interpretación de los resultados, además de las curvas de
amplificación, suele ir unido al análisis de curvas de disociación o fusión. Este proceso
se va monitorizando la fluorescencia a medida que se va aumentando la temperatura,
lo que ocasiona que las dobles hebras se vayan separando y por tanto disminuyendo la
fluorescencia al liberarse el agente intercalante, como se aprecia en la Figura 5c.
Cuando se alcanza la temperatura de disociación o fusión (Tm), la fluorescencia cae
drásticamente. Generalmente las diferentes aplicaciones informáticas convierten estos
datos para obtener un resultado mucho más fácilmente interpretable en forma de
picos, como se observa en la Figura 5d. El valor de Tm depende tanto del tamaño del
fragmento amplificado como de su secuencia.
22 Introducción
Figura 5. a) esquema de funcionamiento de los agentes intercalantes. b) curvas de amplificación

obtenidas mediante qPCR. c) curvas de fusión. d) representación habitual de las curvas de fusión.
23 Introducción
Esta aproximación a la qPCR es más económica pero menos específica, ya que

el agente intercalante se une a todas las dobles hebras presentes,
independientemente de que se trate del producto específico, dímeros de cebadores o
una amplificación inespecífica (64, 77, 78).
La “inespecificidad” asociada al uso de agentes intercalantes se solventó con la
introducción de sondas fluorescentes dentro de la mezcla de reacción. Una sonda
marcada con un fluoróforo determinado, solo emite fluorescencia si hibrida entre dos
cebadores y el fragmento de ADN es amplificado. Generalmente el fluoróforo se sitúa
en el extremo 5’; en el extremo 3’ se coloca una molécula quelante, que absorbe la
fluorescencia emitida por el fluoróforo mientras ambos están próximos físicamente.
A continuación se detallarán las principales químicas de detección basadas en
sondas fluorescentes y otros sistemas que mejoran la especificidad de los agentes
intercalantes.
1.3.2.1.2. Sondas de hidrólisis (TaqMan®, Lionprobes®): este tipo de sondas son

degradadas durante la reacción (65, 77, 78).
 TaqMan®: se trata de oligonucleótidos lineales a los que se les asocia una
molécula fluorescente (fluoróforo) en el extremo 5’ y una quelante en el 3’ que
absorbe la fluorescencia mientras ambos se encuentran próximos. La emisión de
fluorescencia depende de la actividad exonucleasa de la ADN polimerasa.
Cuando se produce la amplificación, al llegar al extremo 5’ de la sonda, la
polimerasa “corta” el fluoróforo liberándolo. En este momento, al separarse
físicamente del quelante, la fluorescencia puede ser detectada. Al degradarse
completamente la sonda, no permite la realización de análisis de curvas de
disociación. En la Figura 6 se puede observar el funcionamiento de este tipo de
sondas.
24 Introducción
Figura 6. Representación esquemática del funcionamiento de las sondas de hidrólisis.
 Lionprobes®: la estructura de las sondas es muy similar a las anteriores, pero

presentan una o dos discordancias de secuencia en el extemo 3’.
Adicionalmente, al contrario de las sondas TaqMan®, que utilizan la actividad
exonucleasa 5’→3´de la ADN polimerasa (Taq) estas sondas se basan en la
actividad exonucleasa 3’→5’ de una polimerasa con actividad de corrección de
errores (Pfu). Otro aspecto característico es que la extensión sólo ocurre cuando
el oligonucleótido marcado presenta alguna diferencia en su secuencia en el
extremo 3´ respecto a la hebra molde. Es, en esta situación, cuando la Pfu
polimerasa “corta” el quelante permitiendo que se produzca la amplificación. En
este sentido, las Lionprobes® actúan simultáneamente como sonda y cebador
(www.biotools.net). Una ventaja añadida sobre la química tipo TaqMan® es que
con este tipo de sondas, a pesar de basarse en la hidrólisis, sí se puede realizar
análisis de curvas de disociación. La Figura 7 representa esquemáticamente el
funcionamiento de este tipo de química de detección.
25 Introducción
Figura 7. Representación esquemática de los sistemas basados en Lionprobes®

(www.biotools.net).
1.3.2.1.3. Sondas de hibridación (Fluorescence Resonance Energy Transfger (FRET) y

balizas moleculares): estas sondas no son degradadas durante el proceso de
amplificación (77, 78).
 FRET: este tipo de química de detección utiliza dos sondas con sus
correspondientes fluorórofos pero no presenta quelantes. Ambas sondas deben
hibridar próximas una de la otra ya que el proceso de detección consiste en
excitar el fluoróforo de la primera sonda a una determinada longitud de onda,
éste emite fluorescencia que es absorbida y quelada, por el fluoróforo de la
segunda sonda, que es a su vez excitado y vuelve a emitir a una segunda longitud
de onda mayor, que será detectada por el equipo. En la Figura 8 se puede
observar una representación esquemática del funcionamiento de estas sondas.
26 Introducción
Figura 8. Representación esquemática del funcionamiento de las sondas de hibridación

tipo FRET.
 Balizas moleculares (BM): la principal característica de estas sondas es que no

son lineales como todas las anteriores. En su secuencia se incluye una región
autocomplementaria que les confiere forma de horquilla. La secuencia específica
que se desea detectar queda “encerrada” en el bucle. El brazo de la horquilla
sitúa próximos los extremos 5’ y 3’ en los que se encuentran fluoróforo y
quelante. Si la secuencia diana no se encuentra en la muestra, la horquilla
permanece cerrada, pero si está presente, la baliza hibrida, separando ambos
extremos y emitiendo fluorescencia (79), como se aprecia en la Figura 9.
Figura 9. Representación esquemática del funcionamiento de las sondas de hibridación

tipo Baliza Molecular.
27 Introducción
Tanto las sondas de hibridación de tipo FRET como las BM, permiten la
realización de análisis de curvas de disociación ya que éstas no son degradadas
durante la amplificación.
1.3.2.1.4. Cebadores especiales: se trata de combinaciones de cebadores y sondas o

cebadores que ejercen ambas funciones
 Cebadores Scorpion™: este tipo de sondas combinan una baliza molecular con
un cebador en el extremo 3’. La unión entre la baliza y el cebador posee un
bloqueante de PCR para evitar la replicación de la secuencia de la baliza. El bucle
de la baliza es complementario a la secuencia amplificada a partir del cebador
situado en 3’. Tras la extensión del cebador, desnaturalización e hibridación, la
secuencia del bucle se une con la secuencia recién sintetizada, produciendo la
separación entre fluoróforo y quelante y así emitiendo fluorescencia. Este tipo de
sondas no pueden ser utilizadas para análisis de curvas de disociación. La Figura
10 ilustra un esquema de este tipo de cebadores.
Figura 10. Representación esquemática de los cebadores tipo Scorpion™.
28 Introducción
 Cebadores LUX™ (Light Upon eXtension): en este tipo de química de

detección, se prescinde de la sonda fluorescente. Se une el fluoróforo
directamente al cebador cerca del extremo 3’. El cebador debe ser diseñado para
que forme una horquilla, lo que produce el quelado de la fluorescencia. Cuando
el cebador es incorporado en una doble hebra de ADN, en el producto de PCR, se
despliega y por tanto emite fluorescencia. Las principales ventajas de este tipo de
químicas de detección son, entre otras, la simplificación de las cinéticas de PCR
(eliminación de la sonda) y la conformación en horquilla del cebador, que
previene la formación de dímeros de cebadores y permite la obtención de curvas
de fusión (80-82). Una representación de este tipo de cebadores se puede
observar en la Figura 11.
Figura 11. Representación esquemática de un cebador LUX™. Imagen extraída de (2).
 Cebadores Sunrise®: estos cebadores tienen una estructura similar a las

balizas moleculares y a los cebadores Scorpion™. En el extremo 5’ tiene una
molécula fluorescente, en 3’ el quelante y a mayores un cebador. La secuencia
del cebador Sunrise® está diseñada para ser duplicada por la hebra
complementaria que se sintetice en este sentido. El brazo de la horquilla está
desestabilizado y el fluoróforo está separado del quelante con lo que puede
emitir fluorescencia. El mayor inconveniente es que con este tipo de química de
detección se pueden obtener señales inespecíficas por formación de dímeros de
cebadores (1, 65). En la Figura 12 se presenta un esquema con el funcionamiento
29 Introducción
de estos cebadores.
Figura 12. Representación esquemática de los cebadores Sunrise®.

Imagen extraída de (1).
1.3.2.1.5. Modificaciones: a mayores de los diferentes tipos de sistemas fluorescentes

que se pueden encontrar, prácticamente todos ellos pueden ser modificados
añadiéndoles otras moléculas que mejoren sus propiedades.
 Ligandos de surco menor (MGB): la adición de esta molécula en el
extremo 3‘mejora la unión de la sonda a la secuencia diana. Esto se traduce
en un aumento de la temperatura de fusión, lo que facilita el uso de sondas
más cortas y con mayor eficiencia. Se utilizan frecuentemente, asociadas a
sondas de tipo TaqMan®. Una variante asociada a este tipo de modificaciones
son las MGB Eclipse®, en las cuales el ligando se sitúa en el extremo 5’ y la
sonda deja de ser lineal por lo que a pesar de ser corta, fluoróforo y quelante
30 Introducción
se aproximan por plegamiento y se separan una vez hibridada la sonda en la

secuencia diana. Otra salvedad añadida consiste en que la nueva posición del
MGB impide la actividad
exonucleasa de la polimerasa
de tal modo que se convierte
en sondas de hibridación y
no de hidrólisis, por lo que, a
mayores, a estos sistemas de
detección MGB, se les puede
acoplar un análisis de curvas
de disociación (83-85). En la
Figura 13 aparecen
representadas estas dos
variantes de las
modificaciones MGB.
 Ácidos nucleicos
bloqueados (LNA): se trata
de análogos que contienen
una unidad de furanosa
bicíclica bloqueada en una
conformación similar a la
Figura 13. En la parte superior izquierda se ve la
ribosa del ARN. Esta estructura de un MGB. En la zona superior
derecha se observa un esquema de
modificación de los funcionamiento de sonda con MGB. En la parte
inferior se puede ver una sonda MGB Eclipse®.
oligonucleótidos
Imagen extraída de (8, 9).
proporciona una mayor
fuerza de hibridación entre las dos hebras de ADN y por tanto mayor
temperatura de disociación (86). En la parte superior izquierda de la Figura 14
se puede apreciar la estructura de un LNA.
 Ácidos peptidonucleicos (PNA): son secuencias químicas sintéticas que
imitan el ADN a las que se les añaden las bases nitrogenadas, por lo que son
susceptibles de unirse a los ácidos nucleicos complementarios. El esqueleto
31 Introducción
sintético le confiere unas propiedades de hibridación únicas a estas sondas,

como son, mayor velocidad y más fuerza de unión a las secuencias
complementarias. Esto se debe a que no sufren repulsión electrostática ya
que el esqueleto no posee carga eléctrica, lo que además ocasiona que la
hibridación sea independiente de la concentración de sales. Dado que son
completamente sintéticas, estas moléculas no son reconocidas por enzimas,
por lo que no son degradadas ni se pueden usar sus monómeros para su
incorporación enzimática en fragmentos amplificados; por ello su aplicación
más frecuente es el diseño de sondas de hibridación (87, 88). La estructura de
este tipo de modificaciones aparece representada en la parte inferior
izquierda de la Figura 14.
 Ácidos nucleicos de cremallera (ZNA): se trata de oligonucleótidos
conjugados con unidades catiónicas repetitivas de espermina. Esta
modificación reduce la repulsión electrostática con las hebras del ácido
nucleico diana. El número de unidades catiónicas unidas a cualquier posición
del oligonucleótido regula la carga global de la molécula, elevando la Tm de la
doble hélice formada (89, 90). En la parte inferior derecha de la Figura 14 se
puede observar la estructura de este tipo de modificación.
Figura 14. Resumen de las principales modificaciones de nucleótidos utilizadas en qPCR

junto con la estructura normal del ADN y ARN. Imagen extraída de (5), www.biosyn.com.
32 Introducción
En la presente tesis se utilizaron dos químicas de detección con dos finalidades

diferentes. Por un lado, se usó SYBR Green® como agente intercalante para las
pruebas preliminares y de optimización de los cebadores en los diferentes estudios
de la fase experimental. Por otro lado, se usaron sondas de hidrólisis tipo TaqMan®
para el desarrollo de los métodos multiplex. Estas dos químicas de detección fueron
seleccionadas por constituir dos aproximaciones ampliamente utilizadas, además de
ser las más económicas y fácilmente implantables en los diferentes laboratorios de
control y en la industria.
1.3.2.2. Aplicaciones de la qPCR

Las aplicaciones de la qPCR dentro de la investigación científica, así como de la
industria, son múltiples. Se pueden resaltar las siguientes (65, 77, 91-95):
 Detección y cuantificación de patógenos.
 Detección de bacterias no patógenas y poblaciones beneficiosas
 Estudios de respuesta microbiana frente a cambio ambientales.
 Evaluación de riesgos sobre diferentes agentes bacterianos.
 Alternativa rápida a los métodos convencionales de serotipado.
 Detección y cuantificación de ácidos nucleicos de diverso origen:
alimentos, vectores virales y no virales usados en protocolos de terapia
génica, organismos modificados genéticamente.
 Estudios de microbiología humana y veterinaria.
 Estudios en los niveles de expresión de determinados genes
relacionados con diferentes enfermedades como el cáncer de pulmón,
diabetes Tipo 2 y enfermedades cardiovasculares.
 Identificación de especies en la industria alimentaria.
 Estudios forenses.
1.3.2.3. Diferencias PCR vs. qPCR. Ventajas y limitaciones

En la PCR convencional es necesaria la realización de un análisis post-
amplificación lo que conlleva una serie de inconvenientes: mayor tiempo de análisis
hasta la obtención del resultado, mayor probabilidad de contaminaciones cruzadas,
33 Introducción
utilizar reactivos tóxicos y/ o peligrosos como el bromuro de etidio. Mediante las

PCRs múltiples se diferencian las distintas dianas por el tamaño de los fragmentos
amplificados. Por otro lado, la qPCR presenta la ventaja de que permite realizar una
cuantificación más precisa de los ácidos nucleicos.. En lo que se refiere a la qPCR, los
sistemas múltiples diferencian cada fragmento mediante el marcaje con un fluoróforo
que emite fluorescencia a una longitud de onda diferenciable de los demás (65).
La qPCR es una técnica rápida, con una alta especificidad y sensibilidad. Sin
embargo, pero su aplicación, así como la de otros métodos moleculares, en el control
de la seguridad alimentaria parece estar limitado por:
 Presencia de compuestos en las diferentes matrices alimentarias que
pueden interferir con la técnica.
 Constante introducción de nuevas matrices, tanto alimentarias como
ambientales.
 Dificultad para detectar un bajo número de copias de ADN cuando el
tamaño de la muestra es pequeño.
 Discriminar entre bacterias vivas y muertas.
Con el paso del tiempo han ido apareciendo soluciones para, prácticamente
todos, los inconvenientes asociados con estas técnicas, como pueden ser:
 La introducción de un paso de enriquecimiento para aumentar los
microorganismos que se encuentren en bajas concentraciones (aumento de
las secuencias diana). Aunque los resultados pasan a ser cualitativos, si se
desea realizar una cuantificación, se puede acoplar un recuento por número
más probable (NMP) (39).
 Los casos de falsos negativos asociados a la presencia de agentes
inhibidores de la reacción puede ser eliminada mediante la adición de un
control interno de amplificación. Este tipo de controles, a mayores de los
controles positivos y negativos, está cobrando cada vez mayor importancia
para monitorizar el buen funcionamiento de la reacción (77, 78, 96-98).
 El uso de detergentes y/ o métodos de filtración, centrifugación
durante el procesado de las muestras, para eliminar las posibles sustancias
inhibidoras que puedan contener (39).
34 Introducción
En relación a la detección/ diferenciación entre bacterias vivas y muertas se han

introducido entre otros, los siguientes avances:
 Se ha descrito el uso de monoazida de etidio y propidio, para la
detección selectiva de bacterias vivas (99-102).
 Otra posibilidad es la detección de ARN, que es más inestable que el
ADN y por tanto se degrada antes una vez que las bacterias mueren (78).
 El enriquecimiento también permite reducir las posibilidades de falsos
positivos asociados a microorganismos muertos (78, 103).
A pesar de haberse solventado la gran mayoría de las problemáticas asociadas a
los métodos basados en ácidos nucleicos, sigue existiendo un problema importante
para su aceptación general. Se trata de la falta de estandarización y validación (39,
104-106).
Dada la gran importancia que han alcanzado los métodos de PCR, y con el
objetivo de solucionar la falta de estandarización y validación, en los últimos años se
han desarrollado una serie de normas internacionales para la validación de métodos
alternativos (107, 108). Del mismo modo también se han establecido normas
específicas para la aplicación de los métodos basados en PCR (98, 109-111) y qPCR
(112-116).
1.4. Patógenos alimentarios. Descripción y características, incidencia,

mortalidad, brotes epidemiológicos recientes (alimentos asociados).
En este punto se realizará una breve descripción de los microorganismos

patógenos analizados en la presente tesis. Igualmente se indicarán los métodos de
qPCR existentes para cada uno de ellos. Se han realizado tres grupos que engloban
todos los patógenos analizados, en función de su regulación en la C.E., de su
incidencia o según se trate o no de patógenos emergentes.
1.4.1. Patógenos incluidos en el Reglamento C.E. 2073/ 2005

En este apartado se incluyen dos de las bacterias patógenas contempladas
dentro de la normativa 2073 del año 2005, así como sus modificaciones posteriores
35 Introducción
(11-13): Salmonella spp. y Listeria monocytogenes.
1.4.1.1. Salmonella spp.

El género Salmonella pertenece a la familia Enterobacteriaceae, que fue
descrito por primera vez en 1880 por Karl Joseph Eberth. En la actualidad solamente
se reconocen dos especies, S. enterica y S. bongori. La especie S. enterica incluye seis
subespecies y 2579 serovares descritos según el esquema de White y Kauffmann, de
acuerdo con los antígenos O (somático), Vi (capsular) y H (flagelar); (117-119).
Las bacterias del género Salmonella son bacilos, Gram negativos, generalmente
móviles con flagelos peritricos y anaerobios facultativos. La mayoría de las cepas son
lactosa negativas y producen sulfuro de hidrógeno. Los organismos incluidos en este
género se caracterizan por ocasionar fiebre tifoidea, gastroenteritis y septicemia, y
aunque son patógenos humanos pueden infectar a otros animales (119).
Tabla 3. Métodos analíticos para detección de Salmonella spp.
Método Tipo Enriquecimiento Aislamiento/ Detección Referencia

ISO 6579:2003* C APT/ RVS-MKtt Agar XLD-agar adicional (20)
BAM Capítulo 5** C Variable según muestra Agar XLD-agar adicional (120)
VIDAS® Up Salmonella A APT+suplemento Agar ChromID Salmonella www.biomerieux.com
PCR A APT invA (121, 122)
qPCR A APT modificado-RVS/ TTB invA (123)
qPCR A APT Prot6e (124)
qPCR A APT bipA (125)
qPCR A APT-RVS fimC (126)
qPCR A APT iagA (127)
qPCR A Caldo Nº 17 modificado invA (128)
C: Cultivo. A: Alternativo. * Método de referencia según el Reglamento C.E. 2073/ 2005. ** Método aplicado en EE. UU.
Como ya se comentó anteriormente, junto con Campylobacter spp. es el

principal agente zoonótico en Europa con más de 90.000 casos confirmados en 2010.
En la Tabla 3 se indican algunos métodos analíticos que se utilizan para su detección,
incluidos los oficiales.
El gen más ampliamente utilizado, en PCR convencional y qPCR, para la
detección de Salmonella spp. es el invA. Se trata del primer gen del locus inv de
36 Introducción
Salmonella spp., que permite la entrada de la bacteria en las células epiteliales. Se

han descrito algunos serovares invA negativos, considerados no invasivos o que
utilizan otros mecanismos. A pesar de estas pequeñas discordancias este gen se ha
utilizado en la validación de un método de PCR para la detección de Salmonella spp. a
nivel europeo (121, 125, 129).
1.4.1.2. Listeria monocytogenes

Esta especie pertenece al género Listeria, englobado en la familia Listeriaceae.
L. monocytogenes fue aislada por primera vez en 1926 a partir de conejos enfermos.
Se consideró un patógeno de animales que podía ocasionar infecciones aisladas en el
ser humano, y no fue hasta 1981 cuando la transmisión de una cepa virulenta se
asoció con la ingestión de alimentos contaminados. Actualmente se conocen seis
especies de listerias, L. seeligeri, L. welshimeri, L. ivanovii, L. innocua, L. grayi y L.
monocytogenes, pero solo ésta última constituye un patógeno relevante para el ser
humano, aunque se han descrito casos aislados de infección por L. seeligeri, L.
welshimeri y L. ivanovii (119, 130). Recientemente se han descrito cuatro especies
nuevas pertenecientes a este género, L. fleischmannii, L. marthii, L. rocourtiae y L.
weihenstephanensis, aunque tampoco se consideran patógenas del ser humano (131-
134). En la actualidad se conocen trece serotipos de L. monocytogenes. En un estudio
en el cual se analizaron 300 aislados procedentes de 42 países en los 5 continentes se
observó que todos pertenecían a los serotipos 1/2a, 1/2b, 1/2c y 4b siendo el más
frecuente este último (135-137).
L. monocytogenes se encuentra ampliamente distribuida en el medio ambiente
y se ha detectado en gran variedad de alimentos (carnes, verduras, marisco, entre
otros). Se trata de un bacilo, Gram positivo, móvil mediante flagelos peritricos cuando
se cultiva entre 20 °C y 25 °C y anaerobio facultativo. Una de sus características más
importantes, radica en su capacidad para crecer a bajas temperaturas, de ahí su
peligrosidad para la industria. El aumento de productos que se conservan en
refrigeración ha supuesto un aumento en el riesgo de infecciones por esta bacteria
(138, 139).
Aunque su incidencia no es excesivamente alta, 1600 casos en Europa en 2010,
presenta una tasa de mortalidad que puede llegar hasta el 30 %. Los cuadros clínicos
37 Introducción
ocasionados por L. monocytogenes son variados, van desde una gastroenteritis con
dolor abdominal y diarrea, hasta una infección grave, la listeriosis, caracterizada por
meningoencefalitis, aborto en mujeres embarazadas y septicemia (10, 136, 140-144).
En la Tabla 4 se indican algunos métodos analíticos, incluidos los oficiales.
Tabla 4. Métodos analíticos para detección de L. monocytogenes

ISO 1129-1:1996* C Fraser semi-Fraser ALOA-PALCAM (30, 31)
BAM Capítulo 10** C BLEB Agar Oxford (145)
VIDAS® LMO2 A Fraser semi-Fraser Agar Ottaviani-Agosti www.biomerieux.com
PCR A Fraser semi prfA (146)
qPCR A - hlyA (142)
qPCR A UPB-LEB hlyA (147)
qPCR A BHI 16S-23S IGS (141)
qPCR A Fraser semi prfA (148)
qPCR A Caldo Nº 17 modificado hlyA (128)
C: Cultivo. A: Alternativo. * Método de referencia según el Reglamento C.E. 2073/ 2005. ** Método aplicado en EE. UU.
En cuanto a la detección de L. monocytogenes mediante PCR y qPCR, los genes

más utilizados son el hlyA, que codifica la listeriolisina O, y el prfA, que es un
regulador central de la virulencia de esta bacteria. Se ha validado a nivel europeo un
método para la detección de L. monocytogenes empleando el gen prfA (149-151).
1.4.2. Patógenos relevantes no incluidos en el Reglamento C.E. 2073/ 2005

En esta sección se comentarán las características de algunos patógenos
relevantes a nivel mundial, aunque no están específicamente contemplados en el
Reglamento 2073 (11).
1.4.2.1. Shigella spp.

El género Shigella pertenece a la familia Enterobacteriaceae, es un bacilo Gram
negativo, inmóvil, anaerobio facultativo y que no fermenta la lactosa. A pesar de
estos datos, hoy en día existe cierta problemática en cuanto a su clasificación. Las
especies de Shigella son relativamente inactivas bioquímicamente cuando se
38 Introducción
comparan con E. coli. Sin embargo, existen evidencias de que genéticamente las
especies de este género están tan relacionadas con E. coli que podrían ser
englobadas dentro del género Escherichia. La diferenciación entre Shigella y E. coli se
volvió más compleja con la aparición de los E. coli enteroinvasivos (EIEC), que
presentan las propiedades bioquímicas de E. coli, y la capacidad de producir
disentería como Shigella (130, 152, 153).
Esta bacteria fue descubierta como el agente causal de la disentería bacilar, o
shigelosis, por Kiyoshi Shiga en 1898. El género está compuesto por cuatro especies,
S. dysenteriae, S. flexneri, S. boydii y S. sonnei; y consta de 48 serotipos. Todas las
especies son patógenas para el ser humano, aunque su gravedad varía; siendo la más
grave S. dysenteriae y la que presenta el cuadro clínico más leve S. sonnei. Las otras
dos especies producen enfermedad de gravedad intermedia entre estas dos (119,
130). En 2010 se asoció a 23 brotes epidemiológicos en Europa, que produjeron 289
casos de shigelosis, de los cuales 32 necesitaron hospitalización (10).
Tabla 5. Métodos analíticos para detección de Shigella spp.
Método Tipo Enriquecimiento Aislamiento/ Referencia

Detección
ISO 21567:2004* C Caldo Shigella Agar XLD-agar adicional (154)
BAM Capítulo 6** C Caldo Shigella Agar MacConkey (155)
BAM Capítulos 6 y 24** A TSYE Hibridación de ADN (155)
LAMP A - ipaH (48)
PCR A APT virA (156)
PCR A - ipaH y virF (157)
PCR A BHI ipaH (158)
qPCR A - ipaH (159)
qPCR A APT ipaH (160)
qPCR A Caldo Nº 17 modificado ipaH (161)
C: Cultivo. A: Alternativo. * Método internacional. ** Método aplicado en EE. UU.
En el caso de Shigella spp. existe prácticamente unanimidad en el uso del gen

ipaH como diana para la detección de esta bacteria. Este gen también se ha
detectado en cepas EIEC, está relacionado con la virulencia y se encuentra en el
39 Introducción
plásmido de invasión y el cromosoma de estos microorganismos (162). La Tabla 5

recoge métodos, tanto clásicos como moleculares, para la detección de Shigella spp.
1.4.2.2. Escherichia coli O157

La especie Escherichia coli pertenece a la familia Enterobacteriaceae. Se trata
de un bacilo Gram negativo, móvil con flagelos peritricos, anaerobio facultativo,
capaza de crecer a 44,5 °C y bioquímicamente muy variable. Se han descrito más de
400 serotipos diferentes. Este género recibe su nombre en honor a Theodor
Escherich, quien describió la especie tipo del género en 1886 (119).
E. coli O157:H7 es el prototipo de un grupo de bacterias de esta especie
conocidas como enterohemorrágicos (EHEC). En la práctica éste término, EHEC, se
usa para describir a un subgrupo conocido como E. coli productores de toxina Shiga
(STEC) y/ o verotoxigénicos (VTEC). Este serotipo presenta ciertas diferencias
bioquímicas respecto al resto, como son la ausencia de actividad β-glucuronidasa o
su incapacidad de fermentar sorbitol en agar MacConkey (130, 163). Los principales
cuadros clínicos asociados con la infección por esta bacteria son la colitis
hemorrágica y el síndrome urémico hemolítico (164, 165). En 2010 se diagnosticaron
4000 casos de infección por E. coli verotoxigénico, siendo el serotipo “O157” el más
frecuente. El número de zoonosis asociado a esta bacteria sigue una tendencia
ascendente desde el año 2000 (10). En la Tabla 6 se muestra un resumen de
diferentes métodos utilizados para la detección y diagnóstico de esta bacteria.
40 Introducción
Tabla 6. Métodos analíticos para detección de E. coli O157

ISO 16654:2001* C TSB modificado y novobiocina Agar cefixima telurito sorbitol (166)
MacConkey (CT-SMAC)-agar adicional
BAM Capítulo 4** C BHI Agar MacConkey-Agar Eosina Azul de (167)
Metileno según Levine (L-EMB)
VIDAS UP® E. coli A APT ChromID™ O157:H7- www.biomerieux.com
O157 CT-SMAC
PCR A Caldo TA10 eae (168)
PCR A TSB eaeA (169)
PCR A TSB modificado y novobiocina rfbE (170-172)
PCR A - stx 2A (173)
qPCR A Caldo Nº 17 rfbE (174)
qPCR A - rfbE (175)
C: Cultivo. A: Alternativo. * Método internacional. ** Método aplicado en EE. UU.
En relación a E. coli O157:H7 no hay mucha uniformidad en cuanto a los genes

utilizados para su detección. A mayores de los citados en la tabla anterior, también se
han usado otros genes para detectar y/ o caracterizar E. coli O157: stx 1, fliC, uidA,
que codifican la toxina shiga, el antígeno flagelar “H” y la enzima β-glucuronidasa,
respectivamente (176-179).
1.4.3. Patógenos Emergentes

En este apartado se comentarán diferentes especies bacterianas que, con el
paso del tiempo, han ido aumentando su importancia debido a una mayor incidencia
y elevadas tasas de mortalidad. En concreto se ha centrado este apartado en especies
patógenas de la familia Vibrionaceae por la proximidad al sector que afecta, pesca y
acuicultura (180, 181). Aunque existen otros patógenos emergentes que no son el
objeto de esta Tesis Doctoral.
Las especies que se han recogido en esta memoria fueron: V. cholerae, V.
parahaemolyticus y V. vulnificus. La familia Vibrionaceae incluye los géneros Vibrio,
Aeromonas, Photobacterium y Plesiomonas. Dentro del género Vibrio se incluyen
treinta especies, todas bacterias ubicuas en el medio marino, bacilos curvos Gram
41 Introducción
negativos, móviles con un flagelo polar, oxidasa y catalasa positivos. En la Tabla 7 se

detallan algunas propiedades bioquímicas que permiten diferenciar estas 3 especies
entre sí, o del resto de especies del género (119, 130, 182, 183).
Tabla 7. Propiedades bioquímicas de V. cholerae, V. parahaemolyticus y V. vulnificus

Crecimiento Crecimiento Crecimiento
Especie ADH ODC LDC Sacarosa D-Celobiosa ONPG
a 42 °C con 0 % NaCl con 8 % NaCl
V. cholereae - + + + - + + - +
V. parahaemolyticus - + + - V + - + -
V. vulnificus - + + - + + - - +
“V”: variable. ONPG: o-nitrofenil-β-D-galactopiranosido. ADH: Arginina dehidrolasa. ODC: Ornitina descarboxilasa. LDC: Lisina
descarboxilaxa
La primera especie del género en ser descubierta, fue V. cholerae por Filippo
Pacini, en 1854. Hoy en día se conocen más de 200 serotipos de esta especie, siendo
el “O1” y el “O139” los causantes, tanto de epidemias, como pandemias. V.
parahaemolyticus fue identificado por Fujino como agente patógeno por primera vez
en 1950 asociado a una intoxicación alimentaria por el consumo de shirasu en Osaka.
En la actualidad se conocen 76 serotipos. En el año 1979 se describieron por primera
vez infecciones asociadas a V. vulnificus, aunque la bacteria fue aislada por primera
vez por el centro para control y prevención de enfermedades de EE. UU. (CDC) en
1969. Esta especie comprende tres biotipos (mediante una combinación de
caracteres fenotípicos, serológicos y de hospedador) siendo los biotipos 1 y 3 los
patógenos del hombre (biotipo 3 restringido a Israel) y el biotipo 2 principalmente
patógeno de anguilas (182, 184-189).
En la actualidad no se existen demasiados datos sobre incidencia de estas
bacterias en Europa. Esto es debido al bajo número de casos que se producen al año,
por lo que, en los informes EFSA se engloban dentro de “otros agente bacterianos”. A
pesar de ello, existen numerosos estudios sobre la presencia de vibrios patógenos en
Europa (28, 29, 190-192). Por el contrario, en EE. UU. sí existen estadísticas de
vibriosis, incluyendo datos desde 1988 recopilados por el CDC. Merece la pena
mencionar que de 2008 a 2009 hubo un aumento del 136 % en el número de
42 Introducción
vibriosis, aumentando de 608 a 837 casos.

En lo que concierne a los genes más ampliamente utilizados para la detección
de estas especies, se observa bastante uniformidad de criterio. La detección de V.
cholerae y V. parahaemolyticus se realiza mayoritariamente mediante el gen toxR
(también se utilizan el ompW y el tlh, respectivamente). En relación a V. vulnificus la
diana más frecuentemente usada es el gen vvhA. Del mismo modo también se
observa una elevada uniformidad de criterio en cuanto a la detección de
determinados factores de patogenicidad o virulencia asociado a estas bacterias. El
principal factor de virulencia asociado a V. cholerae es el gen ctxA (gen que codifica
para la subunidad A de la toxina colérica) aunque también se usan hly y tcpA.
Respecto a V. parahaemolyticus se reconocen dos genes asociados a la producción de
2 hemolisinas, los genes tdh y trh (hemolisina directa termoestable y hemolisina
relacionada con tdh respectivamente) aunque de modo más reciente también se ha
identificado el sistema de secreción de tipo 3 (T3SS) como un factor de patogenicidad
asociado a V. parahaemolyticus (193, 194). Finalmente, donde se observa mayor
discrepancia, o falta de uniformidad de criterio es en V. vulnificus. Recientemente se
ha descrito un polimorfismo en el gen pilF, que permite diferenciar cepas patógenas
de aquellas que no lo son (previamente se usó el vcgC/ vcgE o el rtxA entre otros). A
continuación, en la Tabla 8, se detallan diferentes métodos utilizados para la
detección de estas tres especies bacterianas.
43 Introducción
Tabla 8. Métodos analíticos para la detección de V. cholerae, V. parahaemolyticus y V. vulnificus

ISO 218721-2:2007* C APAS Agar TCBS-agar adicional (26, 27)
BAM Capítulo 9** C APA Agar TCBS-Agar CC/ mCPC (25)
BAM Capítulo 9** A - tlh, tdh (25, 195, 196)

BAM Capítulo 9** A - tlh, tdh y trh (25, 197)
BAM Capítulo 9** A - vvhA (25, 198)
NASBA A - hlyA, tcpA, ctxA, groEL, toxR (199)
LAMP A rpoS, vvhA (49)
LCR A - toxR, hlyA, ctxA, recA, tcpI, vvhA, viuB, (200)
tdh, trh, tl, ORF8
PCR A - lolB (201)

PCR A - ompW, hlyA, tcpI, ctxA, rfb, toxR (202)
PCR A - toxR, vvhA (181)

PCR A - toxR (180)
qPCR A APA tdh (203)
qPCR A APA tlh, tdh y trh (204)
qPCR A APA ctxA (205)
qPCR A APA vvhA (206)
qPCR A - pilF (207)

qPCR A APA tlh, tdh y trh (208)
qPCR A - rtxA, tcpA, epsM, ompW (209)
qPCR A APA ctxA (210)
qPCR A APAS tdh y trh (211)
C: Cultivo. A: Alternativo. * Método internacional. ** Método aplicado en EE. UU. APAS: agua de peptona alcalina salina. CC:
agar celobiosa y colistina. mCPC: agar celobiosa, polimixina B y colistina modificado. CIA: control interno de amplificación. LCR:
reacción en cadena de la ligasa
44 Introducción
2. OBJETIVOS
Capítulo 2: OBJETIVOS
El objetivo principal de la presente tesis es evaluar en detalle la aplicabilidad de

la técnica PCR en tiempo real (qPCR) como medida de control e identificación de
determinados patógenos humanos y poder ofrecer a la industria alimentaria
metodologías rápidas y económicas.
Para llevar a cabo el objetivo global se plantearon los siguientes objetivos específicos:
1. Seleccionar los genes diana, y diseñar en su caso, los cebadores y las sondas
más adecuados para llevar a cabo la detección específica de cada uno de los
microorganismos patógenos de interés.
2. Evaluar y optimizar los medios de cultivo líquidos para mejorar el
enriquecimiento simultáneo de los diferentes patógenos diana en alimentos y
muestras ambientales.
3. Evaluar y optimizar diferentes métodos de extracción de ADN que permitan
obtener ADN en cantidad y de calidad suficiente para su detección mediante
qPCR.
4. Evaluar los métodos desarrollados para su aplicación en la industria
alimentaria.
5. Comparar y pre-validar los métodos de qPCR desarrollados con otros métodos
microbiológicos previamente validados por organismos oficiales.
6. Proponer diferentes protocolos unificados para los distintos grupos de
bacterias patógenas estudiadas que permitan una óptima detección tanto en
muestras alimentarias como ambientales.
45 Objetivos
3. PUBLICACIONES
Capítulo 3: PUBLICACIONES
3.1 Artículo 1
Título: A new multiplex real-time PCR developed method for Salmonella spp. and
Listeria monocytogenes detection in food and environmental samples
Autores: Garrido, A., Chapela, M.-J., Román, B., Fajardo, P., Lago, J., Vieites, J. M.,
Cabado, A. G.
Revista: Food Control, 30 (1), 76-85. (2013)
Área temática: Ciencia y Tecnología de Alimentos
Índice de impacto: 2,656 (año 2011)
Resumen:
El objetivo de este trabajo fue desarrollar un método completo de PCR en

tiempo real (qPCR) que permitiera la detección simultánea de Salmonella spp. y L.
monocytogenes. Adicionalmente el método debía ser rápido, fiable y aplicable a
alimentos y muestras ambientales.
Para cumplir el objetivo, por un lado, se optimizó un medio de cultivo líquido

común para ambas bacterias, caldo Nº 17 (comercialmente TA10). Por otro, se
compararon dos protocolos de extracción de ADN para valorar la mejor alternativa en
cuanto a cantidad y calidad del ADN obtenido.
Se valoró la eficiencia de la qPCR, obteniéndose resultados superiores al 90 %,

con un rango dinámico de cinco órdenes de magnitud. Se obtuvo un límite de
detección para el método muy bajo (5 ufc/ 25 g). En los diferentes parámetros
evaluados para valorar la capacidad diagnóstica del método, se obtuvieron valores
46 Publicaciones
superiores al 90 %. La valoración final del correcto funcionamiento del método se

realizó aplicándolo a 95 muestras naturales de diferentes orígenes. Se demostró que,
tanto el método de qPCR como el medio de cultivo y el protocolo de extracción
descritos eran apropiados para la detección simultanea y rápida de Salmonella spp. y L.
monocytogenes en muestras ambientales y alimentarias.
47 Publicaciones
Food Control 30 (2013) 76e85
Contents lists available at SciVerse ScienceDirect
Food Control
journal homepage: www.elsevier.com/locate/foodcont
A new multiplex real-time PCR developed method for Salmonella spp. and Listeria
monocytogenes detection in food and environmental samples
Alejandro Garrido, María-José Chapela, Belén Román, Paula Fajardo, Jorge Lago, Juan M. Vieites,
Ana G. Cabado*
Microbiology and Toxins Area, ANFACO-CECOPESCA, Campus Univ. 16, 36310 Vigo PO, Spain
a r t i c l e i n f o a b s t r a c t
Article history: Despite efforts done by industries some well known foodborne pathogens, like Salmonella spp. and
Received 10 January 2012 Listeria monocytogenes, continue to be a challenge to public health institutions and a threat for
Received in revised form consumers. The aim of this study was to develop a complete, rapid and reliable multiplex real-time PCR
7 June 2012
(qPCR) method for the simultaneous detection of these two bacteria in food and environmental samples,
Accepted 20 June 2012
including a novel single enrichment broth (TA10) for both bacteria. TA10 broth was modified (pH and
buffer concentration) to enhance simultaneous growth of both pathogens in the presence of high
Keywords:
numbers of competitors bacteria. Also two different DNA-extraction protocols were compared. qPCR
TA10
Salmonella spp.
efficiency above 90% was obtained, covering 5 orders of magnitude. Complete method achieved low limit
Listeria monocytogenes of detection (5 cfu/25 g), and all quality parameters of the method returned values over 90%. Complete
Multiplex real-time PCR qPCR method was applied to 95 natural samples covering a wide variety of food types proving that the
Food safety qPCR method described, including the use of one single enrichment broth, modified TA10, was suitable
for the simultaneous and reliable screening of Salmonella spp. and L. monocytogenes in food and envi-
ronmental samples.
Ó 2012 Elsevier Ltd. All rights reserved.
1. Introduction present in very low numbers against a background of indigenous

microflora, rendering the recovery of target organisms difficult
Foodborne diseases are a widespread and growing public health (Kawasaki, Fratamico, Kamisaki-Horikoshi, et al., 2010).
concern affecting both developed and developing countries, In the early 1990s the polymerase chain reaction (PCR) was used
microbiologically contaminated food and water, being the major for simple identification of pure bacterial cultures or colonies on
causes of diarrheal diseases. Although their global incidence is agar plates. Since then, the development of sample preparations
difficult to estimate, authors generally agree that the percentage of suitable for PCR detection of bacteria in food or pre-enrichment
the population suffering from foodborne diseases each year could media has expanded enormously (Rijpens & Herman, 2002) and
be up to 30% in industrialized countries and figures could be even several PCR validation studies have reported that the PCR method is
worse in developing countries (Germini, Masola, Carnevali, & one of the most promising among the rapid microbiological
Marchelli, 2009). In order to minimize the risk of infection for methods for the detection and identification of bacteria in a wide
consumers, microbiological control of the food chain is being variety of samples (Myint, Johnson, Tablante, & Heckert, 2006) as
increasingly applied. Thus, the availability of reliable, rapid, and previously demonstrated (Chapela et al., 2010; Garrido et al., 2012).
internationally accepted test systems for determination of the PCR-based techniques such as nested-PCR, reverse transcription-
presence or absence of foodborne pathogens has become increas- PCR, PCR-based fingerprinting, quantitative PCR, and alternative
ingly important for the agricultural and food industry, as well as for amplification techniques such as nucleic acid sequence-based
legislative regulation of food safety (Malorny, Hoorfar, Bunge, & amplification (NASBA), among others, were introduced over the
Helmuth, 2003) as stated in regulation 2073/05 and the amend- years (Rijpens & Herman, 2002). Within them, real-time PCR
ment 1441/07 ((EC), 2005, 2007). Bacterial pathogens are often possess sensitivity equal to culture methods but it is rapid and
allow testing to be completed in 48 h (Navas et al., 2006). However
reliability of PCR-based detection methods partly depends on the
* Corresponding author. Tel.: þ34 986 469 303x344; fax: þ34 986 469 269. target bacterial cell number, i.e., the copy numbers of target
E-mail address: agcabado@anfaco.es (A.G. Cabado). molecules present in food samples. Detection methods for
0956-7135/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.foodcont.2012.06.029
A. Garrido et al. / Food Control 30 (2013) 76e85 77
Salmonella spp. and Listeria monocytogenes pathogens in food are To achieve the required limit of detection of Salmonella spp.
based on enrichment using selective media to increase the (absence in 25 g of sample), and the no tolerance of
concentration of viable bacteria which can be followed by PCR for L. monocytogenes in ready-to-eat food in most countries, assays
identification. There are two major obstacles for simple and rapid have been coupled to pre-enrichment and DNA purification steps
detection of Salmonella spp. and L. monocytogenes pathogens in (Badosa et al., 2009). Nevertheless, not much attention was paid to
food: (a) the lack of one single medium for the simultaneous the development of novel broths for simultaneous recovery of both
enrichment of Salmonella spp. and L. monocytogenes; and (b) the bacteria as can be assessed by the scarce studies published during
presence of inhibitors of the PCR in foods such as beef or chicken, last years, underlining among others the following (Kawasaki et al.,
synthetic media and DNA preparation solutions (Bhaduri & Cottrell, 2005; Kim & Bhunia, 2008; Kobayashi et al., 2009). Universal pre-
2001; Lantz, Hahnhagerdal, & Radstrom, 1994; Lantz et al., 1998). enrichment broth (UP) was developed for the simultaneous
Though the sensitivities of many of the modern detection detection of Salmonella and Listeria in foods, although in that time
methods have improved significantly, an enrichment step is still many foods used to be analyzed for these two pathogens, but not
needed to overcome the problems of low pathogen numbers and to simultaneously. This medium allowed sublethally injured bacteria
limit the risk of detecting dead cells (Badosa, Chico, Pla, Pares, & to resuscitate and proliferate to high levels so that selective
Montesinos, 2009; Kim & Bhunia, 2008; Lantz et al., 1994; secondary enrichment media can be used (Hammack, Amaguana,
Mahmuda, Kawasaki, & Kawamoto, 2007) as their sensitivity is Johnson, & Andrews, 2003). Later studies proved that No. 17 broth
limited (Kimura et al., 1999). Concerning PCR, the reaction can showed a higher recovery than UP broth for injured Salmonella due
dramatically decrease if the sample contains PCR inhibitors (Lantz to the higher amount of nutritious compounds (Kamisaki-
et al., 1994). The enrichment step is required not only to increase Horikoshi et al., 2011).
the target-pathogen concentration in a sample but also to resus- The aim of the present work was the development of a complete
citate physiologically stressed or injured cells. Selective enrichment protocol for the detection of Salmonella spp. and L. monocytogenes,
is also necessary to suppress the natural background microorgan- including one single enrichment broth, a DNA-extraction method
isms as well as to improve detection efficiency and to avoid false- and a multiplex Real-Time PCR (qPCR) detection system able of
negative results. However, the drawbacks of some of the selective achieving a low limit of detection, even in the presence of high
enrichment broths are that selective agents can be inhibitory or can numbers of competitors. The medium selected was evaluated for its
delay growth of healthy microorganisms or the recovery of stressed ability to achieve high bacterial density of S. enterica and
target pathogens, thus affecting pathogens detection that have the L. monocytogenes when cultured either individually or simulta-
potential to recover and grow when the food is consumed neously with other common competitors. DNA-extraction method
(Kawasaki et al., 2009; Kim & Bhunia, 2008). In addition, DNA- chosen was compared with a common boiling protocol and,
extraction solutions condition the effectiveness of the PCR by furthermore, correct PCR reaction was controlled with an internal
reducing assay sensitivity due to loss of target DNA. The array of amplification control. Finally, this modified complete protocol was
methods developed for preparing PCR samples determines the applied to natural samples to evaluate presence of Salmonella spp.
need for techniques that are tailored to each type of food (Bhaduri & and L. monocytogenes.
Cottrell, 2001).
Several studies have reported the use of multiplex PCR systems 2. Materials and methods
to detect two or more pathogens in one assay (Mahmuda et al.,
2007). The multipathogen detection approach is attractive and 2.1. Bacterial strains and culture media
economically favorable since it can reduce the total space
requirement for handling a large number of samples, as well as the Spanish Culture Collection (CECT) strains used as reference
bench space, supplies, reagents, and labor needed, thus reducing strains for evaluation of modified TA10 broth were: S. enterica CECT
the overall cost of testing per pathogen (Elizaquivel & Aznar, 2008; 4594 (serovar Typhimurium, serotype 4, 5, 12: i: 1, 2) and
Ruiz-Rueda, Soler, & Calvo, 2010; Singh, Batish, & Grover, 2011). L. monocytogenes CECT 935. Bacteria were stored frozen at 20 C
Furthermore, multiplex detection is a rational approach since many until use. Additionally two strains of Salmonella spp. and one of
foods, such as milk, diary products, meat, poultry, fruits and L. monocytogenes were isolated from meat samples in a local food
vegetables, are common carriers of more than one pathogen like, control laboratory, and were used for spiking experiments. All other
Salmonella enterica, Escherichia coli O157:H7, and L. monocytogenes organisms used in this study are summarized in Table 1.
(Kim & Bhunia, 2008). Fresh cultures of all strains used in the present work were ob-
As can be observed from the high number of singleplex PCR tained by inoculating 10 mL tubes of Tryptic Soy Broth (TSB, Bio-
methods published for the detection of Salmonella spp. and Mérieux S.A., France). All strains were incubated at 37 C overnight,
L. monocytogenes (Calvo, Martinez-Planells, Pardos-Bosch, & Garcia- except for Bacillus subtilis which was incubated at 31 C.
Gil, 2008; Cheng et al., 2008; Hyeon et al., 2010; Kawasaki, Kimura, In order to know the reference values of each of both pathogenic
& Fujii, 2001; Lofstrom, Hansen, & Hoorfar, 2010; Malorny, Huehn, bacteria under study they were grown as described above, ten-fold
Dieckmann, Kramer, & Helmuth, 2009; Myint et al., 2006; Navas serially diluted in Buffered Peptone Water (BPW, Biokar diagnostics
et al., 2006; Poltronieri, de Blasi, & D’Urso, 2009; Rantsiou, Ales- S.A., France) and plated on Tryptic Soy Agar (TSA, Biokar diagnostics
sandria, Urso, Dolci, & Cocolin, 2008; Rodriguez-Lazaro, Jofre, S.A., France) for S. enterica and on Tryptic Soy Yeast Extract Agar
Aymerich, Hugas, & Pla, 2004; Rossmanith, Krassnig, Wagner, & (TSYEA, Biolife Italiana S.r.l., Italy) for L. monocytogenes. Plates were
Hein, 2006; Vanegas, Vasquez, Martinez, & Rueda, 2009) and also incubated 18 h at 37 C. Reference values of competitors were
multiplex PCR methods (Badosa et al., 2009; Elizaquivel, Gabaldon, plated on TSA, except for Vibrio cholera and Vibrio parahaemolyticus
& Aznar, 2010; Germini et al., 2009; Jofre et al., 2005; Kawasaki, which were plated on Nutrient Agar (NA, Biokar diagnostics S.A.,
Fratamico, Horikoshi, et al., 2010; Kim & Bhunia, 2008; Mahmuda France) supplemented with 10 g/L of sodium chloride.
et al., 2007; Omiccioli, Amagliani, Brandi, & Magnani, 2009; Ruiz- TA10 broth, commercial name of No. 17 broth (Kamisaki-
Rueda et al., 2010; Singh et al., 2011; Suo, He, Tu, & Shi, 2010; Horikoshi et al., 2011; Kawasaki et al., 2005), was chosen for
Zhang et al., 2009) among others, it is clear that these pathogens qPCR sample enrichment. The medium was modified as suggested
continue to be a health hazard and a serious problem for the food by Omiccioli et al. (2009), who stated that dextrose was not
industry which needs fast and reliable methods. necessary for successful recovery of Salmonella spp. and
78 A. Garrido et al. / Food Control 30 (2013) 76e85
Table 1 absorbance to evaluate capacity of selected bacterial species to

Strains used for productivity evaluation and sample inoculation. grow in the differently buffered versions of the broth (1). Second,
Bacteria Strain RT-PCR Co-culture individual growth of each bacterium without competitors, was
invA/hlyA reference evaluated by pure culture in three differently buffered broths and
value (cfu/mL) compared to a reference medium BPW (2). Third, simultaneous
Salmonella entericaa CECT 4594 þ/ 10e102 growth of Salmonella and L. monocytogenes, in all three differently
Salmonella sppb S1 þ/ e
buffered broths was evaluated with different competitors and, in
Salmonella sppb S2 þ/ e
Listeria monocytogenesa CECT 935 /þ 10e102 parallel, by adding selective agents to inhibit competitors, at
L. monocytogenesb Lm1 /þ e different times (3). Three different buffering salt concentrations
Escherichia colia CECT 434 / 102e103 were tested, A) the buffer specified in the ISO method (ISO, 1996)
Bacillus subtilisa CECT 435 / 20 for Half-Fraser broth (ISO Buffer: Na2HPO4 12.0 g/L; KH2PO4 1.35 g/
Staphylococcus aureusa CECT 240 / 3 107
Enterococcus faecalisa CECT 481 / 4 103
L), B) 150 mM (Na2HPO4 29.0 g/L; KH2PO4 5.0 g/L) and C) 100 mM
Vibrio parahaemolyticusa CECT 511 / 2 107 (Na2HPO4 19.3 g/L; KH2PO4 3.4 g/L), see Table 2. All three buffers
Vibrio choleraea CECT 514 (O1) / 108 tested rendered a final pH value of 7.2 0.2.
a
Strains used for evaluation of productivity. Inoculation of the different broths in the three steps of the
b
Natural strains isolated from meat in a local food laboratory. invA: Salmonella evaluation was done following the procedure described below. To
invasion gene, hlyA: hemolysin gene. CECT: Spanish type culture collection. obtain the desired bacterial concentration, from an overnight
culture in TSB of S. enterica and L. monocytogenes, turbidity was
L. monocytogenes. An additional modification performed in this adjusted to 2 McFarland with TSB in a Densimat (BioMérieux S.A.,
study, was to change the amount of buffering salts used to increase France) turbidimeter and ten-fold serially diluted in BPW.
the final pH of the broth to 7.2 0.2 (final medium composition: Initial turbidity of 2 McFarland corresponds to a theoretical
tryptose 10.0 g/L, beef extract 5.0 g/L, yeast extract 5.0 g/L, sodium concentration of 6 108 cfu/mL. Dilutions were done to reach
chloride 5.0 g/L, disodium phosphate 19.3 g/L, monopotassium theoretical inocula of 6 cfu (viable counts in the laboratory showed
phosphate 3.4 g/L). growth between 10 and 100 cfu/mL) for the inoculation of mTA10
Evaluation of simultaneous growth of Salmonella spp., and broth. Dilutions were plated on TSA and TSYEA for S. enterica and
L. monocytogenes, was determined by plating ten-fold serial dilutions L. monocytogenes respectively to get a viable bacteria reference
in Xylose Lysine Deoxycholate (XLD) agar and COMPASS Listeria agar value. Plates were incubated at 37 C overnight.
(Biokar diagnostics S.A., France) for viable counts of S. enterica and
L. monocytogenes respectively. Plates were incubated at 37 C for 24 h. 2.2.1. Growth kinetics
The growth kinetics study was done with two purposes, one, to
2.2. Evaluation of modified TA10 broth (mTA10) verify the suitability of the buffers selected for the growth of the
bacteria of interest, and second, to check if any of them was clearly
In order to evaluate the selected and modified broth, three steps better than the others in final absorbance, generation time or
were done, see Fig. 1. First, bacterial growth was monitored by duration of the lag phase. Buffering salts concentrations selected
Fig. 1. Schematic representation of the steps followed for the buffer evaluation of mTA10 broth. 1) Growth kinetics measured in microtiter plates in a SPECTRAmax instrument. A
and B are growth curves generated for S. enterica and L. monocytogenes respectively. 2) Viable counts after growth of S. enterica and L. monocytogenes in the different media tested
and comparison against reference broth. 3) Simultaneous growth of S. enterica and L. monocytogenes with other competitors under three conditions, NS: no supplement, 1 h:
supplementation after 1 h of incubation, 5 h: supplementation after 5 h of incubation.
Table 2 was transferred to a new tube and centrifuged at 13,000 rpm for
Individual bacterial growth evaluation. 5 min, supernatant was discarded and the resulting pellet was
BPW ISO buffer 150 mM 100 mM resuspended in 1 mL PBS with Tween 20 (Rossmanith et al., 2006),
broth broth broth and centrifuged again under the same conditions, supernatant was
S. enterica 9.19 0.09ab 8.96 0.08a 9.13 0.11ab 9.32 0.21b discarded and bacterial cell pellet was processed according to the
L. monocytogenes 8.88 0.04a 9.02 0.14a 8.84 0.32a 9.21 0.02a respective method.
aeb
Different lower cases in the same row indicate statistically significant differences
(p < 0.05). Results expressed in Log cfu/mL. Data analyzed with one-way ANOVA 2.3.1. Boiling DNA-extraction method
Tukey-b.
Bacterial cell pellet was resuspended in 200 mL of PBS with
Tween 20 and boiled for 15 min. After boiling, suspension was
centrifuged at 13,000 rpm for 5 min at 4 C.
were tested for the growth of S. enteric and L. monocytogenes, by
spiking 200 mL of mTA10 medium prepared with the different
2.3.2. Lysis-GuSCN DNA-extraction method (Kawasaki et al., 2005)
buffers, with 2 mL rendering a viable count of 10e100 cfu, as rec-
Bacterial cells were resuspended in 200 mL of the enzyme
ommended in ISO 11133-2:2003 for productivity inocula (ISO,
solution containing 1 mg/mL achromopeptidase and 1 mg/mL
2003, p. 27), of the corresponding bacterium in a Falcon 96 well
lysozyme in TE 1 buffer. After incubation at 37 C with constant
plate and measured using SpectraMax M5 microplate reader (Bio-
agitation at 1000 rpm for 1 h, in a Thermomixer 5436 dry bath
Nova Científica S.L., Spain). Growth curves were constructed by
(Eppendorf AG, Germany) the solution was mixed with 300 mL of
measuring bacterial growth of S. enterica and L. monocytogenes at
4 M GuSCN containing 2% (wt/vol) Tween 20. A portion (400 mL) of
600 nm every 15 min for 24 h at 35 C.
the supernatant was transferred to a new tube containing 400 mL of
100% isopropanol. After mixing, the mixture was centrifuged for
2.2.2. Pure culture of S. enterica and L. monocytogenes in mTA10
10 min at 13,000 rpm, and the resulting DNA pellet was rinsed with
broth
75% isopropanol. The pellet was then dissolved in 160 mL of sterile
The growth of S. enterica and L. monocytogenes on mTA10 was
milli-Q water by heating with constant agitation at 14,000 rpm, at
evaluated by inoculating three series of tubes containing 10 mL of
70 C for 3 min. Prior to use, the template DNA solution was
mTA10 and BPW, with 10e100 cfu of the corresponding microor-
centrifuged for 5 min at 13,000 rpm to further remove water-
ganism. All tubes were incubated at 35 C for 24 h.
insoluble impurities.
After incubation ten-fold serial dilutions were done in BPW and
After extraction with both methods, DNA was quantified and
plated on TSA and TSYEA for S. enterica and L. monocytogenes
purity assessed, using a NanoDrop 1000 spectrophotometer
respectively. Plates were incubated at 37 C for 24 h.
(Thermo Fischer Scientific, Inc., USA) software ND-1000 v3.7.1.
2.2.3. Simultaneous growth of S. enterica and L. monocytogenes in
2.4. Genes, primers and probes used for qPCR method
mTA10 broth
For the evaluation of simultaneous bacterial growth 100 mL of
Primers and probe described by Cheng et al. (2008) targeting
medium were inoculated with 10e100 cfu of each target bacterium.
invA gene (Cheng et al., 2008) for the detection of Salmonella spp.
Competitors were also added, see Table 1. Inoculated medium was
tagged with FAM fluorescence dye, and those described by
incubated at 35 C 24 h.
Omiccioli et al. (2009) targeting hlyA for detection of
As previous authors have reported the advantages of using
L. monocytogenes tagged with Cy3 fluorescence dye were used. The
selective media for the simultaneous enrichment of Salmonella spp.
Internal Amplification Control (IAC) developed by Calvo et al.
and L. monocytogenes (Kim & Bhunia, 2008), in parallel the same
(2008) tagged with Texas Red fluorescence dye was also used.
broths were supplemented with selective agents (2 mg of Nalidixic
These Primers and probes were provided by IDT (Integrated DNA
acid, 2.5 mg of Acriflavine hydrochloride, and 100 mg of ferric
Technologies, Inc., USA).
ammonium citrate) added to the broth after 1 and 5 h of incubation
Specificity of primers and probes for selected genes was
(Wu, 2008), time left for recovery of stressed cells; then all media
extensively tested in original works, where Salmonella spp. primers
were incubated to fulfill the 24 h.
and probe were tested against 328 various Salmonella serovars and
After incubation ten-fold serial dilutions were done in BPW and
56 non-Salmonella strains (Cheng et al., 2008). Regarding
plated in XLD and COMPASS Listeria agar (Biokar diagnostics S.A.,
L. monocytogenes a total of 90 target and non-target bacterial strains
France) for both sets of experiments, none-supplement and selec-
were used to test the specificity (Omiccioli et al., 2009).
tive broth, with two “recovery times”. These plates were incubated
24 h at 37 C. After incubation, viable counts of presumptive
2.5. Multiplex qPCR detection method for Salmonella spp. and
colonies of S. enterica and L. monocytogenes were obtained. In
L. monocytogenes
addition to plate counts, qPCR was done after enrichment in every
variant of the broth (different buffers, with or without selective
The qPCR reaction was carried out in a final volume of 50 mL with
agents).
the following components: 30 mL of SsoFastÔ Probes Supermix
(Bio-Rad Laboratories, Inc., USA), 1000 nM primers and 250 nM
2.3. DNA-extraction methods comparison probe were used for Salmonella spp., 900 nM primers and 200 nM
probe were used for L. monocytogenes; and for Internal Amplifica-
Two different DNA-extraction methods were tested for their tion Control (IAC) 200 nM primers, 45 nM probe and 9 102 copies
application in the qPCR method described: conventional boiling of IAC DNA were added per reaction.
method, and the lysis-Guanidine isothiocyanate method (lysis- 5 mL of template DNA was added per reaction tube. Stratagene
GuSCN) (Kawasaki et al., 2005) with slight modifications. Mx3005p thermocycler (Agilent Technologies, Inc., USA) was used
For the comparison of both methods, 1 mL of pure cultures of with the following thermal profile: 2 min at 95 C for the activation
S. enterica and L. monocytogenes, grown overnight in 10 mL of TSB, of the polymerase (Hot Start), followed by 40 cycles, each cycle
were taken. Aliquots were centrifuged at 2000 rpm for 2 min in consisted on a denaturation step of 10 s at 95 C, and annealing-
a Biofuge fresco (Heraeus Instruments, England), the supernatant extension step at 63 C for 30 s.
Table 3 The qPCR method consisted of the enrichment of 25 g of sample

DNA-extraction protocols. in 225 mL mTA10 broth at 35 C for 24 2 h. After primary
Method DNA concentration Abs 260/280 Abs 260/230 enrichment, 1 mL was transferred to a tube containing 10 mL of
(ng/mL) new mTA10 broth and further incubated for a minimum of 8 h at
Boiling Salmonella 159.40 56.56 2.17 0.03 1.26 0.13a 35 C. After incubation, 1 mL was taken for DNA extraction as
Lysis-GuSCN 195.89 32.73 2.17 0.01 0.39 0.08a described in Section 2.3.2 and 5 mL were used as template.
Salmonella
Real-Time PCR results were gathered from both, pre-enrichment
Boiling L. 46.28 7.21b 2.71 0.02b 1.50 0.10b
monocytogenes broth and re-seeded tube, and statistically compared to evaluate
Lysis-GuSCN L. 141.03 42.05b 2.17 0.04b 0.27 0.08b the effect of the secondary enrichment.
monocytogenes
Data analyzed with ManneWhitney U-test.

a
Statistical differences for Salmonella. 2.8. Estimation of relative sensitivity, relative specificity, relative
b
Statistical differences for L. monocytogenes. accuracy, positive and negative predictive value and index kappa of
concordance of the qPCR method
2.6. qPCR efficiency
With the data from the LOD and additional spiked and blind
For calculation of the efficiency, overnight pure cultures of samples (with known result as were previously analyzed), see
S. enterica and L. monocytogenes in 10 mL of TSB, incubated at 37 C Table 5, relative sensitivity (SE), relative specificity (SP), relative
were used. DNA of each bacterium was extracted as described in accuracy (AC), positive and negative predictive values (PPV and
Section 2.3.2, and measured with the NanoDrop 1000 spectro- NPV) of the method were calculated. Evaluation of these parame-
photometer. For singleplex qPCR efficiency calculation, DNA from ters was done by comparing the qPCR method with the expected
S. enterica and L. monocytogenes were ten-fold serially diluted in results of the spiked samples or the blind, previously analyzed
sterile milli-Q water. In the same way for multiplex qPCR efficiency samples.
calculation, DNA from both bacteria were mixed in equal volumes, Each sample with positive (PA) and negative (NA) Accordance
again ten-fold serially diluted and analyzed. For both sets of were defined as samples presenting the same result, positive or
experiments 5 mL of each dilution was used as template for qPCR. negative, for the qPCR method and the expected result for spiked
qPCR efficiency was determined in duplicate for individual samples. Negative deviations (ND) are the number of samples ex-
singleplex detection of each pathogen. When calculating the effi- pected positive with a negative result, and positive deviations (PD),
ciency for simultaneous multiplex qPCR, three replicates were are the number of samples expected negative with a positive result.
done. SE was defined as the percentage of positive samples giving
The Mx3005pro software automatically calculates the standard a correct positive signal (SE ¼ PA/(PA þ ND) 100).
curve for each run based on the Cycle threshold (Ct) for each SP was defined as the percentage of negative samples giving
standard. The formula from which the amplification efficiency was a correct negative signal (SP ¼ NA/(PD þ NA) 100).
calculated is e ¼ 101/s 1 (Kawasaki, Fratamico, Horikoshi, et al., AC is defined as the degree of correspondence between the
2010), where s is the slope of the standard curve. response obtained by the expected result and the method on
identical samples (AC ¼ [(PA þ NA)/N] 100; where N ¼ number of
2.7. Evaluation of the limit of detection (LOD) in food samples by analyzed samples).
qPCR PPV and NPV are measures of the performance of the method by
giving the probability of a sample being really positive or negative
Evaluation of the LOD was done as previously described by when the method shows a positive or negative result PPV ¼ [(PA/
Garrido et al. (2012). Briefly, ten samples were inoculated with low PA) þ PD] 100; NPV ¼ [(NA/NA þ ND) 100].
concentration of both pathogens and 90% of positive results must Finally the index kappa of concordance shows the degree of
be achieved. concordance between the method and the expected result
Samples used for LOD are specified in Table 5 along with other k ¼ 2 (PA NA ND PD)/[(PA þ PD) (PD þ NA) þ
spiked and blind analyzed samples. The procedure was done twice (PA þ ND) (ND þ NA)] (Anderson et al., 2011; Tomas, Rodrigo,
and spiking procedure was done following the same procedure Hernandez, & Ferrus, 2009).
described below.
Both target bacteria were grown overnight at 37 C in 10 mL TSB.
Turbidity to 0.5e2 McFarland was adjusted with sterile TSB. Ten- 2.9. Natural samples
fold serial dilutions were done to get a final concentration
ranging 1.5 to 6 cfu/mL for the inoculation of samples and TSA A survey was carried out with samples from local suppliers.
plates, for S. enterica, and TSYEA, for L. monocytogenes, to get Samples were transported to the laboratory, either frozen or
a reference value of viable bacteria after 18 2 h incubation at refrigerated, and were kept under the same conditions until
37 C. analysis.
Table 4
RT-PCR efficiency for S. enterica and L. monocytogenes pure DNA and DNA mixture.
RT-PCR DNA mixturea RT-PCR pure DNAb
S. enterica L. monocytogenes S. enterica L. monocytogenes

Amplification efficiency (%) 96.2 0.7 99.5 8.0 95.8 4.2 109.4 2.9
r2 0.999 0.000 0.998 0.002 0.997 0.000 0.999 0.000
Standard curve slope 3.415 0.018 3.344 0.187 3.430 0.110 3.117 0.058
a
All values are averages of three replicates.
b
All values are averages of two replicates.
Table 5 (Na2HPO4 19.3 g/L; KH2PO4 3.4 g/L), each bacterium was grown in
Spiked and blind samples for evaluation of the method. 200 mL of medium inoculated with 10e100 cfu of the corresponding
Food type N RT-PCR Salmonella spp. L. monocytogenes bacterium and monitored by measuring absorbance at 600 nm
samples result
PA PD NA ND PA PD NA ND
every 15 min for 24 h at 35 C.
invA/hlyA S. enterica and L. monocytogenes grew correctly in all buffers
Bivalves 12 10/10 10 0 1 1 10 0 2 0 tested for mTA10 broth at 35 C, as it can be seen in Fig. 1 “A” and
Cephalopods 5 1/0 1 0 4 0 0 0 5 0
“B” but none of them showed differences respect to the others,
Meat 21 7/3 7 0 13 1b 6 0 14 1b
Vegetables 5 2/1 2 0 3 0 1 0 4 0 regarding maximum absorbance, maximum rate of growth or lag
Ready-to-eat 8 1/1 1 0 7 0 1 0 7 0 phase.
a
Boiled mussels 11 9/9 9 0 1 1 9 0 1 1
a
Samples used for LOD calculation. PA: positive agreement, PD: positive devia- 3.1.2. Pure culture of S. enterica and L. monocytogenes in mTA10
tion, NA: negative agreement, ND: negative deviation. broth
b
Inoculation level below the LOD. invA: Salmonella invasion gene, hlyA: hemo- Growth of S. enterica and L. monocytogenes in mTA10 broth was
lysin gene.
evaluated by inoculating 10 mL of medium with the different
buffering salts, with approximately 10 cfu of each bacterium. Ten
A total of 95 samples were analyzed which included fish, milliliters BPW tubes were inoculated in parallel, as a reference
vegetables, bivalves, cephalopods, crustaceans, ready-to-eat foods, medium. After incubation at 35 C for 24 h, ten-fold serial dilutions
byproducts, and environmental samples, see Table 6 for details. were done in BPW and plated in TSA and TSYEA for S. enterica and
L. monocytogenes respectively. Plates were incubated at 37 C for
2.10. Statistical analysis 24 h.
Statistical analysis did not show significant differences
Two different statistical analyses were applied. Comparison of (p < 0.05) in the viable counts of S. enterica in mTA10 with 100 mM
target bacteria growth in pure culture and in co-culture with or 150 mM buffers, and the reference broth (BPW). However, plate
competitors plus supplement was performed with one-way ANOVA counts increased significantly from 100 mM respect to the ISO
Tukey-b. For comparison of the Ct values obtained in co-cultures of buffer, see Table 2. Regarding L. monocytogenes although no
S. enterica and L. monocytogenes, Ct values from whole food matrix statistical significant differences were observed, there was a growth
versus the re-seeded tube qPCR, and DNA-extraction parameters increase in 100 mM broth similar to S. enterica proliferation.
(DNA concentration, and purity ratios 260/280 and 260/230),
ManneWhitney U-test was used. 3.1.3. Simultaneous growth of S. enterica and L. monocytogenes in
These analysis were performed using SPSS 15.0 software (SPSS mTA10 broth
Inc., Chicago, IL, USA). Evaluation of the co-culture was done by inoculating 100 mL of
the corresponding medium with a theoretical inoculum of 10 cfu of
each microorganism, in presence of competitors. After incubation
3. Results
ten-fold serial dilutions were done and plated in XLD and COMPASS
Listeria agar.
3.1. Evaluation of mTA10 broth
With the ISO buffer, for S. enterica highest colony counts were
obtained supplementing the medium with selective agents after
The evaluation of mTA10 broth was done in three consecutive
1 h, being the second highest result the medium without any
steps: 1) checking growth kinetics, 2) comparing growth against
supplement; regarding L. monocytogenes these results inversed,
a reference medium (BPW), and 3) checking co-culture growth of
highest values for the medium without supplement and second,
the target bacteria with competitors and with/without selective
supplemented after 1 h. For both bacteria, supplementation after
agents, as illustrates Fig. 1.
5 h showed the lowest results.
When the 150 mM buffer was used for S. enterica, lowest
3.1.1. Growth kinetics
productivity was obtained supplementing the broth with antibi-
To evaluate the suitability of the medium with the different
otics after 1 h. Higher viable counts were obtained when supple-
buffers tested, A) ISO Buffer (Na2HPO4 12.0 g/L; KH2PO4 1.35 g/L), B)
mented after 5 h or without supplementation. Regarding
150 mM (Na2HPO4 29.0 g/L; KH2PO4 5.0 g/L) and C) 100 mM
L. monocytogenes no statistical differences were observed.
Finally when the 100 mM buffer was tested, no statistical
Table 6 differences were observed in the data obtained for S. enterica
Natural samples analyzed. however, for L. monocytogenes significantly higher results were
Food type N RT-PCR results Food samples obtained with the medium without supplement.
samples Salmonella spp./ To summarize, even in presence of high number of competitors,
L. best results were obtained for S. enterica and L. monocytogenes
monocytogenes
without selective agents. Among these three buffers, statistical
Bivalves 14 0/2 Boiled musselsa,c analysis did not show any differences in the growth of
Fish 53 0/5 Pangassius,c patagonian
toothfish,c kingklipc and
L. monocytogenes, but it did for S. enterica in which significantly
tunaa,c higher data were collected for the ISO and the 100 mM buffer.
Cephalopods 9 0/0 Results obtained indicated that 150 mM buffer was the worst of
Crustaceans 1 0/0 the three buffers analyzed, so it was discarded. The Ct values ob-
Vegetables 1 0/1 Pre-fried onionc
tained for the ISO buffer and the 100 mM were compared with the
Ready-to-eat 9 0/1 Hake roe
Environmental 7 0/0 ManneWhitney U-test. Statistical differences (p < 0.05) were
Food byproducts 1 1/0 Fishmealb observed for L. monocytogenes but not for S. enterica, see lower part
a
Corresponding pathogen found in two samples.
of Fig. 2. The 100 mM buffer was selected considering that highly
b
Detected Salmonella spp. buffered broths are recommended in the literature when no
c
Detected L. monocytogenes. selective agents are added (Kawasaki et al., 2005; Omiccioli et al.,
Fig. 2. Simultaneous growth of S. enterica and L. monocytogenes in mTA10 broth with ISO buffer, 150 mM and 100 mM buffers. Upper part corresponds to viable counts obtained
without supplement (NS) and supplementation after 1 or 5 h post-incubation (1 h and 5 h respectively). aecDifferent lower cases in the same buffer group indicate statistically
significant differences (p < 0.05). Lower part corresponds to Ct (cycle threshold) values obtained for those viable counts shown in upper part. *Indicates statistically significant
differences (p < 0.05).
2009) and that in this study statistically lower Ct values were ob- (b ¼ 3.415 0.018) and 99.5% (b ¼ 3.344 0.187) respectively,
tained for L. monocytogenes using this type of broths, the 100 mM with an r2 of 0.999 and 0.998. When qPCR efficiency was deter-
buffer was selected to be added to the enrichment broth. mined using only pure DNA from each bacterium, values obtained
were 95.8% (b ¼ 3.430 0.110) and 109.4% (b ¼ 3.117 0.058)
3.2. DNA-extraction methods comparison respectively, with r2 of 0.997 and 0.999 respectively, see Table 4.
A simple boiling protocol and lysis-GuSCN method (Kawasaki 3.4. Evaluation of the limit of detection (LOD) for the multiplex
et al., 2005) were compared. qPCR method in inoculated food samples
Data obtained for S. enterica only showed significant differences
(p < 0.05) for 260/230 ratio, being higher for the boiling method. The evaluation of the LOD was done by spiking 10 samples
Regarding L. monocytogenes the boiling method also gave statisti- following the procedure described below. These experiments were
cally higher values for 260/230 ratio, but showed lower concen- done twice.
tration of DNA obtained and a lower 260/280 ratio, see Table 3. Samples were processed as described in Section 2.7. For the LOD
Finally the lysis-GuSCN method was selected. to be established, 90% of positive results must be achieved.
The first group of samples spiked for the LOD gave 9 out of 10
3.3. Singleplex and multiplex qPCR efficiency positive samples with an LOD of 4 cfu in 25 g, for Salmonella and 10
out of 10 for L. monocytogenes with 8 cfu in 25 g. As the objective of
Evaluation of singleplex efficiency was done by using pure DNA the study was to achieve a low LOD, it was re-evaluated with new
of S. enterica or L. monocytogenes. For multiplex qPCR efficiency, inoculations of low pathogens concentrations. Finally 9 out of the
DNA of each bacterium was mixed (ratio 1:1). Either for singleplex 10 samples were obtained simultaneously positive for S. enterica
or multiplex qPCR efficiency DNA was ten-fold serially diluted and and L. monocytogenes with an LOD of 5 cfu in 25 g of sample, for
5 mL of each dilution were used as template. Standard curve was each bacterium.
calculated by plotting the amount of DNA in ng, versus the Ct value Statistical analysis of the Ct data obtained indicated that after
obtained. 8 h of secondary enrichment in this broth, values obtained are
Efficiency for simultaneous detection of S. enterica and significantly lower than those reported from the whole food matrix
L. monocytogenes yielded an average efficiency of 96.2% sample.
3.5. Estimation of relative sensitivity, relative specificity, relative On the other hand, different authors have shown that a two-step,
accuracy, positive and negative predictive value and index kappa of primary and secondary, enrichment is necessary to obtain
concordance of the qPCR method a higher number of positive results by PCR with L. monocytogenes
(Navas et al., 2006).
With all spiked and blind (natural samples previously analyzed) In addition to the presence of inhibitors in food and growth
samples analyzed in the present study LOD, relative sensitivity (SE), media, DNA extraction traditionally includes extraction of the sample
relative specificity (SP), relative accuracy (AC), positive and negative in phenolechloroform followed by precipitation of the DNA using
predictive values (PPV and NPV) and the index kappa of concordance cold ethanol. A disadvantage of this method is that a major fraction of
(k) were calculated following the formula shown in Section 2.8. the DNA is usually lost during the procedure and it is difficult to
All parameter analyzed for the evaluation of the quality of the process several samples simultaneously in a short time. Aqueous
method, SE, SP, AC, PPV and NPV showed values higher than 90%, two-phase systems have previously been used as a rapid and simple
see Table 7. Finally the k values calculated were 0.92 and 0.93. Data sample preparation method to separate PCR inhibitors in soft cheese
are summarized in Tables 5 and 7. from L. monocytogenes as well as to separate PCR inhibitors in faeces
from Helicobacter pylori. A disadvantage of this method is that the
3.6. Natural samples PCR sensitivity may be negatively affected if the target bacteria
partition to the interface of the aqueous two-phase system or to the
A total of 95 natural non spiked samples which covered a wide phase containing the PCR inhibitors. Buoyant density centrifugation
range of food and environmental samples were analyzed following has been used to remove PCR inhibitors when detecting pathogenic
the method developed. bacteria in blue cheese and in beef. A reduction in sensitivity of the
Salmonella spp. was detected in one sample (fishmeal) and 9 PCR may be attributed to attachment of the bacteria to the food
resulted positive for L. monocytogenes, including seafood and sample, especially minced meat. These attachments may result in
vegetables, see Table 6. a loss of detectable bacteria since only non-attached bacteria are
separated by buoyant density centrifugation (Lantz et al., 1998).
4. Discussion When a negative result is detected it is important to know whether
PCR failure occurred of if it was a real negative PCR result. A negative
Traditional microbiological methods for the detection of path- PCR result does not necessarily indicate that no template DNA was
ogenic bacteria involve several steps of enrichment, plate isolation present in the sample. Inhibitory substances present in the sample
and biochemical identification, taking up to 7e10 days in the case of may influence the outcome of the PCR by lowering or completely
Salmonella spp. and L. monocytogenes (Jofre et al., 2005). However preventing the amplification (Rip & Gouws, 2009).
PCR-based techniques have the potential to allow for rapid and Previous studies have classically used two broths for the
sensitive detection of foodborne pathogens. Since PCR can target enrichment of Salmonella spp. and L. monocytogenes (Buffered
unique genetic sequences such as virulence genes of microorgan- Peptone Water and Half-Fraser broth, respectively (Badosa et al.,
isms, it also has the advantage of potentially being an extremely 2009; Chua & Bhagwat, 2009; Jofre et al., 2005; Ruiz-Rueda et al.,
specific assay (Fratamico & Strobaugh, 1998). But, even these rapid 2010)) or have tried the application or development of single broth
detection methods still require an enrichment procedure (Hyeon for both bacteria, either general (Tryptic Soy Broth (Germini et al.,
et al., 2010; Kobayashi et al., 2009). 2009), Nutrient Broth (Zhang et al., 2009), Universal Pre-
Bacterial pathogens may coexist, at different concentrations, in enrichment Broth (Bhagwat, 2003), SEB (Kobayashi et al., 2009),
the same food sample, but they usually occur at low levels. Their No. 17 (Kawasaki et al., 2005)) or selective (SEL (Kim & Bhunia,
detection is usually preceded by an enrichment step to increase cell 2008)). One of the main factors affecting bacterial recovery from
numbers to the detection level. For the simultaneous detection of food is the drop in pH associated with bacterial growth. This is the
more than one pathogen, differences in growth requirements and reason why many authors have suggested the use of highly buffered
growth rates must be considered (Alarcon, Garcia-Canas, Cifuentes, broths and poor in carbohydrates (Kawasaki et al., 2005; Omiccioli
Gonzalez, & Aznar, 2004). A second major issue added to the et al., 2009). A factor not considered in most previous studies is that
selection of the appropriate enrichment medium is the presence of most media intended for the recovery of L. monocytogenes and
certain substances that inhibit the PCR reaction. These compounds Salmonella spp. present slightly basic pH values (BPW, TSB, Fraser
can contaminate the DNA templates extracted from food samples or Broth, Buffered Listeria Enrichment Broth, among others). The
environmental samples such as air, soil, and water, and may in turn modified medium described in the present work was designed
generate false-negative results (Hyeon et al., 2010). following this concept, with a final pH value 7.2 0.2. In addition,
Many authors have demonstrated the advantages of using a simple DNA-extraction method without phenol and chloroform
multiplex PCR methods (Elizaquivel & Aznar, 2008; Ruiz-Rueda ensures not only the high sensitivity of the multiplex PCR assay but
et al., 2010; Singh et al., 2011). In the multiplex PCR assay for the also safety in handling for practical use (Kawasaki, Fratamico,
detection of different bacterial strains, the ability to detect small Kamisaki-Horikoshi, et al., 2010).
numbers of cells in foods was considered strongly dependent of the Results obtained from the kinetics with the different buffering
DNA-extraction procedure used (Kawasaki et al., 2005). Detection strengths show that all broths studied in this work would be suit-
of L. monocytogenes with PCR is less sensitive than the corre- able for the enrichment of Salmonella, but the medium with
sponding methods for Gram-negative pathogens, which can be 100 mM achieved the highest growth for L. monocytogenes.
related to low levels of Listeria in the primary enrichment cultures. These results were verified by enriching pure cultures of each
microorganism and comparing them with the growth obtained in
Table 7 BPW. According to plate counts, growth of Salmonella in broth with
Method evaluation.
100 mM buffer was significantly higher than in other buffers and
SE SP AC PPV NPV k BPW; regarding L. monocytogenes there was no statistical difference
S. enterica 91 100 95 1 91 0.92 in plate counts.
L. monocytogenes 93 100 97 1 94 0.93 Finally, all three buffers were compared for the simultaneous
SE: relative sensitivity, SP: relative specificity, AC: relative accuracy, PPV: positive growth of both target bacteria, but with the addition of other
predictive value, NPV: negative predictive value, k: index kappa of concordance. competitors and selective agents. Data from all analysis showed, in
general, a better performance of the different broths without the Limit of detection was established in 5 cfu/25 g for each path-
selective supplement, thus these were compared to check which one ogen, with a 90% of positive results in spiked samples. Several
is the best and it was found that there were no significant differences spiked samples proved that detection could be as low as 3 cfu/25 g,
for the growth of L. monocytogenes. In the case of Salmonella plate but this inoculum concentration was not further evaluated as ND
counts were higher for the ISO and the 100 mM buffer. were observed for both pathogens, see Table 5. Inclusion of the
Previous authors (Kim & Bhunia, 2008; Mahmuda et al., 2007) secondary enrichment step did not enhance the number of positive
have reported problems on the recovery of L. monocytogenes when samples for LOD but did significantly decreased the Ct values ob-
high numbers of competitors were present in the samples. In the tained, when compared to that of whole matrix. This effect may be
present study, with the results gathered from the different steps in due to extending sample incubation in new medium and
the evaluation of the most suitable buffer for the broth, the 100 mM decreasing the amount of food particles. Reduction of food particles
was chosen as its buffering capacity is higher than the ISO buffer. has been previously recommended for enhanced DNA extraction
Also high viable counts were obtained for both pathogens, thus (Kawasaki et al., 2009; Malorny et al., 2009). The method described
supporting simultaneous growth of Salmonella spp. and in the present work proved to overcome troubles related to LOD
L. monocytogenes even in the presence of a high concentration of expressed by previous authors (Mahmuda et al., 2007).
competitors with different requirements. These results were When the method was applied to natural non spiked samples
confirmed by plate counts and qPCR, see Fig. 2. detection of both pathogens was possible in different types of
Evaluation of DNA-extraction protocols did not show statistical samples (fish, bivalves, vegetables and fishmeal), thus proving its
differences when applied for S. enterica but, when data for applicability to samples from different origins.
L. monocytogenes were analyzed, significant differences were ob-
tained for all three parameters evaluated. Results are consistent
5. Conclusions
with data reported by Kawasaki et al. (2005) who showed that even
there were no differences in the sensitivity achieved by boiling of
In the present study the modification of TA10 broth was
Lysis-GuSCN method when applied either on Salmonella Enteritidis
completely evaluated for the simultaneous growth of S. enterica and
or E. coli O157:H7 (both Gram-negative bacteria) but when used
L. monocytogenes in the presence of high numbers of different
with L. monocytogenes (Gram-positive) only the sensitivity of the
competitors. Previous authors reported difficulties recovering,
Lysis-GuSCN method was comparable to that obtained for Gram-
specially L. monocytogenes, when it was overnumbered by
negative bacteria.
competitors (Kim & Bhunia, 2008; Mahmuda et al., 2007).
In the present paper the purity of the DNA obtained was also
The evaluation of the lysis-GuSCN DNA-extraction method
evaluated. Concerning Salmonella no differences were observed for
showed that for Gram-positive bacteria a statistically higher
260/280 ratio, but the boiling method showed statistically higher
amount of DNA could be obtained. The drawback noted was the
values of 260/230 ratio, closer to the optimum of pure DNA
lack of DNA purity, specially observed by the low 260/230 ratio.
(z2.0e2.2). In the case of L. monocytogenes the boiling method had
The qPCR method showed high efficiency that coupled with the
statistically higher values of 260/280 thus, further from ideal pure
enrichment medium and the DNA-extraction protocol selected, was
DNA (z1.8); also significant differences were observed for 260/230
able to detect 3 cfu of Salmonella and L. monocytogenes in 25 g of
were the boiling method exhibited better results, closer to ideally
samples, even though the LOD was established at 5 cfu in 25 g for
pure DNA. The slightly high values obtained with the lysis-GuSCN
both bacterial pathogens.
method for 260/280 ratio may be due to traces of GuSCN in the
Inclusion of an IAC to discard possible PCR reaction inhibition
final extract as this compound absorbs at 260 nm. The low values
and avoid false-negative results, makes the method described in
measured for 260/230 may be related to the presence of organic
the present study suitable for application in routine food and
compounds or chaotropic salts (GuSCN) in the purified DNA. If this
environmental samples control.
method was intended for other purposes where additional DNA
To summarize, the use of mTA10 broth with 100 mM buffer with
purity was required, the extract obtained may be coupled with any
the secondary enrichment step, coupled with the lysis-GuSCN
commercial purification kit.
DNA-extraction method can be used with the qPCR detection
Even though the DNA purity parameters measured were out of
system described in the present study for the simultaneous
the ideally pure DNA values, the overall method performed perfectly
screening of Salmonella spp. and L. monocytogenes from food and
well as it could be extrapolated from the Ct values observed for the
environmental samples.
IAC from all samples, were no remarkable alterations were detected,
which may have indicated presence of inhibitory substances not
eliminated during the DNA-extraction protocol. Furthermore, all Acknowledgments
quality parameters calculated for the method (SE, SP, AC, PPV and
NPV) were above 90%, even more, the k value for both, Salmonella This work is financially supported by the Secretary General for
and L. monocytogenes, were above 0.9, keeping in mind that values of the Sea of the Spanish Ministry of Agricultural, Land and Marine
0.81e1 indicate a “very good concordance” (DG, 1991) between the Resources (MARM), by order ARM/1193/2009. Authors also thank
method and the expected result. Victoria Docampo and Angeles Marcote for technical assistance,
The PCR characteristics can be defined from a standard curve and Lema & Bandin Laboratories for the strains isolated from meat.
based on ten-fold serial dilutions of the DNA or cDNA (reference
material), within the dynamic range of the method. The slope of the References
linear regression line, ideally 3.3219, results in a real-time PCR
efficiency of 1 indicating that the number of target molecules Alarcon, B., Garcia-Canas, V., Cifuentes, A., Gonzalez, R., & Aznar, R. (2004). Simul-
taneous and sensitive detection of three foodborne pathogens by multiplex
exactly doubles in one PCR cycle. Slopes between 3.1 and 3.6,
PCR, capillary gel electrophoresis, and laser-induced fluorescence. Journal of
with efficiency percentage between 90 and 110 are generally Agricultural and Food Chemistry, 52(23), 7180e7186.
acceptable (Raymaekers, Smets, Maes, & Cartuyvels, 2009). All Anderson, A., Pietsch, K., Zucker, R., Mayr, A., Muller-Hohe, E., Messelhausser, U.,
values calculated for efficiency either singleplex or multiplex et al. (2011). Validation of a Duplex real-time PCR for the detection of Salmo-
nella spp. in different food products. Food Analytical Methods, 4(3), 259e267.
resulted in values above 90% and below 110% and the slope values Badosa, E., Chico, N., Pla, M., Pares, D., & Montesinos, E. (2009). Evaluation of ISO
between 3.1 and 3.4, see Table 3. enrichment real-time PCR methods with internal amplification control for
detection of Listeria monocytogenes and Salmonella enterica in fresh fruit and Kim, H. C., & Bhunia, A. K. (2008). SEL, a selective enrichment broth for simulta-
vegetables. Letters in Applied Microbiology, 49(1), 105e111. neous growth of Salmonella enterica, Escherichia coli O157:H7, and Listeria
Bhaduri, S., & Cottrell, B. (2001). Sample preparation methods for PCR detection of monocytogenes. Applied and Environmental Microbiology, 74(15), 4853e4866.
Escherichia coli O157:H7, Salmonella typhimurium, and Listeria monocytogenes Kimura, B., Kawasaki, S., Fujii, T., Kusunoki, J., Itoh, T., & Flood, S. J. A. (1999).
on beef chuck shoulder using a single enrichment medium. Molecular and Evaluation of TaqMan PCR assay for detecting Salmonella in raw meat and
Cellular Probes, 15(5), 267e274. shrimp. Journal of Food Protection, 62(4), 329e335.
Bhagwat, A. A. (2003). Simultaneous detection of Escherichia coli O157:H7, Listeria Kobayashi, H., Kubota, J., Fujihara, K., Honjoh, K., Ito, M., Fujiki, N., et al. (2009).
monocytogenes and Salmonella strains by real-time PCR. International Journal of Simultaneous enrichment of Salmonella spp, Escherichia coli O157:H7, Vibrio
Food Microbiology, 84(2), 217e224. parahaemolyticus, Staphylococcus aureus, Bacillus cereus, and Listeria mono-
Calvo, L., Martinez-Planells, A., Pardos-Bosch, J., & Garcia-Gil, L. J. (2008). A new cytogenes by single broth and screening of the pathogens by multiplex real-time
real-time PCR assay for the specific detection of Salmonella spp. Targeting the PCR. Food Science and Technology Research, 15(4), 427e438.
bipA gene. Food Analytical Methods, 1(4), 236e242. Lantz, P. G., Hahnhagerdal, B., & Radstrom, P. (1994). Sample preparation methods in
Chapela, M. J., Fajardo, P., Garrido, A., Cabado, A. G., Ferreira, M., Lago, J., et al. (2010). PCR-based detection of food pathogens. Trends in Food Science & Technology,
Comparison between a TaqMan polymerase chain reaction assay and a culture 5(12), 384e389.
method for ctx-positive Vibrio cholerae detection. Journal of Agricultural and Lantz, P. G., Knutsson, R., Blixt, Y., Abu Al-Soud, W., Borch, E., & Radstrom, P. (1998).
Food Chemistry, 58(7), 4051e4055. Detection of pathogenic Yersinia enterocolitica in enrichment media and pork by
Cheng, C. M., Lin, W., Van, K. T., Phan, L., Tran, N. N., & Farmer, D. (2008). Rapid a multiplex PCR: a study of sample preparation and PCR-inhibitory compo-
detection of Salmonella in foods using real-time PCR. Journal of Food Protection, nents. International Journal of Food Microbiology, 45(2), 93e105.
71(12), 2436e2441. Lofstrom, C., Hansen, F., & Hoorfar, J. (2010). Validation of a 20-h real-time PCR
Chua, T., & Bhagwat, A. A. (2009). A rapid and simple DNA extraction procedure to method for screening of Salmonella in poultry faecal samples. Veterinary
detect Salmonella spp. and Listeria monocytogenes from fresh produce using Microbiology, 144(3e4), 511e514.
real-time PCR. Food Analytical Methods, 2(2), 96e101. Mahmuda, Y., Kawasaki, S., & Kawamoto, S. (2007). Evaluation of multiplex PCR
DG, A. (1991). Practical statistics for medical research. New York. system for simultaneous detection of Escherichia coli O157:H7, Listeria mono-
(EC), C. R. (2005). Microbiological criteria for foodstuffs. Official Journal of the cytogenes and Salmonella enteritidis in shrimp samples. Bangladesh Journal of
European Union, 2073/2005. Microbiology, 24(1), 42e46.
(EC), C. R. (2007). Amending Regulation (EC) No 2073/2005 on microbiological Malorny, B., Hoorfar, J., Bunge, C., & Helmuth, R. (2003). Multicenter validation of
criteria for foodstuffs. Official Journal of the European Union, 1441/2007. the analytical accuracy of Salmonella PCR: towards an international standard.
Elizaquivel, P., & Aznar, R. (2008). A multiplex RTi-PCR reaction for simultaneous Applied and Environmental Microbiology, 69(1), 290e296.
detection of Escherichia coli O157:H7, Salmonella spp. and Staphylococcus Malorny, B., Huehn, S., Dieckmann, R., Kramer, N., & Helmuth, R. (2009). Polymerase
aureus on fresh, minimally processed vegetables. Food Microbiology, 25(5), chain reaction for the rapid detection and serovar identification of Salmonella in
705e713. food and feeding stuff. Food Analytical Methods, 2(2), 81e95.
Elizaquivel, P., Gabaldon, J. A., & Aznar, R. (2010). Quantification of Salmonella spp, Myint, M. S., Johnson, Y. J., Tablante, N. L., & Heckert, R. A. (2006). The effect of pre-
Listeria monocytogenes and Escherichia coli O157 H7 in non-spiked food prod- enrichment protocol on the sensitivity and specificity of PCR for detection of
ucts and evaluation of real-time PCR as a diagnostic tool in routine food anal- naturally contaminated Salmonella in raw poultry compared to conventional
ysis. Food Control, 22(2), 158e164. culture. Food Microbiology, 23(6), 599e604.
Fratamico, P. M., & Strobaugh, T. P. (1998). Simultaneous detection of Salmonella spp Navas, J., Ortiz, S., Lopez, P., Jantzen, M. M., Lopez, V., & Martinez-Suarez, J. V. (2006).
and Escherichia coli O157:H7 by multiplex PCR. Journal of Industrial Microbiology Evaluation of effects of primary and secondary enrichment for the detection of
& Biotechnology, 21(3), 92e98. Listeria monocytogenes by real-time PCR in retail ground chicken meat. Food-
Garrido, A., Chapela, M. J., Ferreira, M., Atanassova, M., Fajardo, P., Lago, J., et al. borne Pathogens and Disease, 3(4), 347e354.
(2012). Development of a multiplex real-time PCR method for pathogenic Vibrio Omiccioli, E., Amagliani, G., Brandi, G., & Magnani, M. (2009). A new platform for
parahaemolyticus detection (tdhþ and trhþ). Food Control, 24(1e2), 128e135. real-time PCR detection of Salmonella spp., Listeria monocytogenes and Escher-
Germini, A., Masola, A., Carnevali, P., & Marchelli, R. (2009). Simultaneous detection ichia coli O157 in milk. Food Microbiology, 26(6), 615e622.
of Escherichia coli O175:H7, Salmonella spp., and Listeria monocytogenes by Poltronieri, P., de Blasi, M. D., & D’Urso, O. F. (2009). Detection of Listeria mono-
multiplex PCR. Food Control, 20(8), 733e738. cytogenes through real-time PCR and biosensor methods. Plant Soil and Envi-
Hammack, T. S., Amaguana, R. M., Johnson, M. L., & Andrews, W. H. (2003). Effec- ronment, 55(9), 363e369.
tiveness of universal pre-enrichment broth for recovery of Salmonella from Rantsiou, K., Alessandria, V., Urso, R., Dolci, P., & Cocolin, L. (2008). Detection,
selected dairy foods. Journal of AOAC International, 86(4), 714e718. quantification and vitality of Listeria monocytogenes in food as determined by
Hyeon, J. Y., Hwang, I. G., Kwak, H. S., Park, C., Choi, I. S., & Seo, K. H. (2010). Eval- quantitative PCR. International Journal of Food Microbiology, 127(3), 321, (Vol.
uation of PCR inhibitory effect of enrichment broths and comparison of DNA 121, pg 99, 2008).
extraction methods for detection of Salmonella Enteritidis using real-time PCR Raymaekers, M., Smets, R., Maes, B., & Cartuyvels, R. (2009). Checklist for optimi-
assay. Journal of Veterinary Science, 11(2), 143e149. zation and validation of real-time PCR assays. Journal of Clinical Laboratory
ISO. (1996). Microbiology of food and animal feeding stuffs e Horizontal method for Analysis, 23(3), 145e151.
the detection and enumeration of Listeria monocytogenes e Part 1: Detection Rijpens, N., & Herman, L. (2002). Molecular methods for identification and detection
method, Vol. 11290-1. of bacterial food pathogens. Journal of AOAC International, 85(2), 984e995.
ISO. (2003). Microbiology of food and animal feeding stuffs e Guidelines on prepa- Rip, D., & Gouws, P. A. (2009). Development of an internal amplification control
ration and production of culture media e Part 2: Practical guidelines on perfor- using multiplex PCR for the detection of Listeria monocytogenes in food prod-
mance testing of culture media, Vol. 11133-2. ucts. Food Analytical Methods, 2(3), 190e196.
Jofre, A., Martin, B., Garriga, M., Hugas, M., Pla, M., Rodriguez-Lazaro, D., et al. Rodriguez-Lazaro, D., Jofre, A., Aymerich, T., Hugas, M., & Pla, M. (2004). Rapid
(2005). Simultaneous detection of Listeria monocytogenes and Salmonella by quantitative detection of Listeria monocytogenes in meat products by real-time
multiplex PCR in cooked ham. Food Microbiology, 22(1), 109e115. PCR. Applied and Environmental Microbiology, 70(10), 6299e6301.
Kamisaki-Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., Kawasaki, S., Rossmanith, P., Krassnig, M., Wagner, M., & Hein, I. (2006). Detection of Listeria
Kawamoto, S., et al. (2011). Evaluation of TA10 broth for recovery of heat- and monocytogenes in food using a combined enrichment/real-time PCR method
freeze-injured Salmonella from beef. Journal of AOAC International, 94(3), targeting the prfA gene. Research in Microbiology, 157(8), 763e771.
857e862. Ruiz-Rueda, O., Soler, M., & Calvo, L. (2010). Multiplex real-time PCR for the
Kawasaki, S., Fratamico, P. M., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., simultaneous detection of Salmonella spp. and Listeria monocytogenes in food
et al. (2009). Evaluation of a multiplex PCR system for simultaneous detection samples. Food Analytical Methods, .
of Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:H7 in foods Singh, J., Batish, V. K., & Grover, S. (2011). Simultaneous detection of Listeria mon-
and in food subjected to freezing. Foodborne Pathogens and Disease, 6(1), 81e89. ocytogenes and Salmonella spp. in dairy products using real time PCR-melt curve
Kawasaki, S., Fratamico, P. M., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., analysis. Journal of Food Science and Technology, .
et al. (2010). Multiplex real-time polymerase chain reaction assay for simulta- Suo, B., He, Y. P., Tu, S. I., & Shi, X. M. (2010). A multiplex real-time polymerase chain
neous detection and quantification of Salmonella species, Listeria mono- reaction for simultaneous detection of Salmonella spp., Escherichia coli O157,
cytogenes, and Escherichia coli O157:H7 in ground pork samples. Foodborne and Listeria monocytogenes in meat products. Foodborne Pathogens and Disease,
Pathogens and Disease, 7(5), 549e554. 7(6), 619e628.
Kawasaki, S., Fratamico, P. M., Kamisaki-Horikoshi, N., Okada, Y., Takeshita, K., Tomas, D., Rodrigo, A., Hernandez, M., & Ferrus, M. A. (2009). Validation of real-time
Sameshima, T., et al. (2010). Development of the multiplex PCR detection kit for PCR and enzyme-linked fluorescent assay-based methods for detection of
Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:H7. JARQ e Salmonella spp. in chicken feces samples. Food Analytical Methods, 2(3), 180e189.
Japan Agricultural Research Quarterly, 45(1), 77e81. Vanegas, M. C., Vasquez, E., Martinez, A. J., & Rueda, A. M. (2009). Detection of
Kawasaki, S., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., & Kawamoto, S. Listeria monocytogenes in raw whole milk for human consumption in Colombia
(2005). Multiplex PCR for simultaneous detection of Salmonella spp., Listeria by real-time PCR. Food Control, 20(4), 430e432.
monocytogenes, and Escherichia coli O157:H7 in meat samples. Journal of Food Wu, V. C. H. (2008). A review of microbial injury and recovery methods in food. Food
Protection, 68(3), 551e556. Microbiology, 25(8), 1001, (Vol. 25, pg 735, 2008).
Kawasaki, S., Kimura, B., & Fujii, T. (2001). Comparison of TaqMan (TM) Salmonella Zhang, D., Zhang, H., Yang, L., Guo, J., Li, X., & Feng, Y. (2009). Simultaneous
amplification/detection kit with standard culture procedure for detection of detection of Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica
Salmonella in meat samples. Journal of the Food Hygienic Society of Japan, 42(1), and Escherichia coli O157:H7 in food samples using multiplex PCR method.
33e39. Journal of Food Safety, 29(3), 348e363.
3.2 Artículo 2
Título: Development of a multiplex real-time PCR method for simultaneous detection

of Salmonella enterica, Shigella flexneri and Listeria monocytogenes in
processed food samples
Autores: Garrido, A., Chapela, M. J., Roman, B., Ferreira, M., Lago, J., Vieites, J. M.,
Cabado, A. G.
Revista: European Food Research and Technology, 234 (4), 571-580. (2012)
Resumen:
Este trabajo está enfocado al desarrollo de un método de PCR en tiempo real

múltiple mediante el uso de sondas tipo TaqMan®, para la detección simultánea de
Salmonella spp., Shigella spp. y L. monocytogenes en alimentos listos para el consumo
y productos de la pesca y la acuicultura.
Para realizar la detección de estos microorganismos se seleccionaron los genes

invA, ipaH y hlyA. Adicionalmente, se utilizó el caldo Nº 17 (comercialmente TA10), que
fue modificado (sin glucosa y con tween 80) para el enriquecimiento simultáneo de los
tres microorganismos.
La especificidad del método se comprobó frente a 24 cepas bacterianas no diana.

Se evaluó la eficiencia de la qPCR obteniéndose valores entre 102 % y 109 %.
Adicionalmente se evaluó el límite de detección en los dos grupos de alimentos de
interés, estableciéndose entre 3 y 22 ufc/ 25 g. La verificación final de la utilidad del
método se realizó mediante el análisis de un total de 78 muestras incluyendo
inoculadas y naturales.
58 Publicaciones
Eur Food Res Technol (2012) 234:571–580
DOI 10.1007/s00217-012-1665-3
ORIGINAL PAPER
Development of a multiplex real-time PCR method

for simultaneous detection of Salmonella enterica, Shigella Xexneri
and Listeria monocytogenes in processed food samples
Alejandro Garrido · María-José Chapela · Belén Román ·
Martiña Ferreira · Jorge Lago · Juan M. Vieites · Ana G. Cabado
Received: 22 July 2011 / Revised: 23 December 2011 / Accepted: 9 January 2012 / Published online: 22 January 2012
© Springer-Verlag 2012
Abstract The present work is focused on the develop- would be reXected in a faster response in those risk situa-
ment of a TaqMan multiplex real-time PCR method for the tions when they are detected.
detection of Salmonella, Shigella and L. monocytogenes in
seafood, meat and ready-to-eat products. The aim of this Keywords Salmonella spp. · Shigella spp. · Listeria
study is to detect the three pathogens in one single test monocytogenes · Multiplex real-time PCR · Food safety ·
including an enrichment medium for the simultaneous Ready-to-eat products
growth of the bacteria of interest and an Internal AmpliWca-
tion Control (IAC) to monitor PCR inhibitors. For this pur-
pose, three genes were selected, invA for Salmonella, ipaH Introduction
for Shigella and hlyA for L. monocytogenes. Also, no. 17
broth without dextrose and further modiWed by adding The incidence of food-borne infections has markedly
Tween 80 was used for the enrichment step. SpeciWcity of increased over the last 20 years, with nearly a quarter of the
the method was checked against a panel of 24 non-target population at higher risk of illness today [1]. Three major
bacterial strains. RT-PCR eYciency obtained for the simul- food-borne pathogens aVecting people worldwide are
taneous ampliWcation of all three pathogens was 102.5% for Salmonella spp., Shigella spp., and Listeria monocytoge-
Salmonella, 108.9% for Shigella and 106.4% for L. mono- nes. In 2009, a total of 5,550 food-borne outbreaks were
cytogenes. The limit of detection (LOD) was evaluated in reported in the European Union, causing 48,964 human
seafood, meat and ready-to-eat products, being established cases, 4,356 hospitalizations and 46 deaths. Most of the
within 3 and 22 cfu in 25 g of sample for the three bacteria reported outbreaks were caused by Salmonella, viruses and
analyzed. Seventy-eight samples were analyzed with bacterial toxins [2].
multiplex RT-PCR including spiked and natural samples Bacteria of Salmonella genus are rod-shaped, Gram-neg-
collected from diVerent laboratories. Even though several ative and non-spore forming. Salmonella genus is the lead-
RT-PCR methods have been developed for the detection of ing cause of food-borne outbreaks and remains a major
Salmonella, Shigella and L. monocytogenes, as far as we public health concern around the world [3]. This genus is
know this is the Wrst method developed for the simulta- included in the Enterobacteriaceae family [4]. Currently,
neous detection of these three pathogens, coupling RT-PCR two species are recognized, Salmonella enterica, sub-
with an enrichment in the same broth and being tested in a divided into six subspecies, and Salmonella bongori [5].
wide range of diVerent processed food samples with a low Salmonella strains can cause serious infection mainly
LOD. The application of this method can signiWcantly through food poisoning, and salmonellosis, a zoonotic dis-
reduce costs and time of analysis in laboratories, what ease of considerable importance [6]. In total, 108,614 con-
Wrmed human cases were reported in 2009 in the European
A. Garrido · M.-J. Chapela · B. Román · M. Ferreira · J. Lago · Union, with a case fatality rate of 0.08% [2].
J. M. Vieites · A. G. Cabado (&)
Microbiology and Toxins Area, ANFACO-CECOPESCA,
Shigella spp. are Gram-negative, facultatively anaerobic,
Campus Univ. 16, 36310 Vigo, PO, Spain non-sporulating, non-motile rods belonging to the Entero-
e-mail: agcabado@anfaco.es bacteriaceae family. They do not decarboxylate lysine or
123
572 Eur Food Res Technol (2012) 234:571–580
ferment lactose. They utilize glucose and other carbohy- isms and it has become an essential analytical tool for
drates, producing acid but not gas. However, because of their researchers working with food-borne pathogens. Compared
aYnity with E. coli, frequent exceptions may be encountered, with culture-based methods, PCR is faster, more sensitive
e.g., some biotypes produce gas from glucose and mannitol and more speciWc and enables the detection of death or via-
[7]. There were 164.7 million cases of shigellosis estimated ble but non-cultivable cells, see Postollec et al. [21] for
worldwide, resulting in 1.1 million deaths [8]. In 2008, 7,258 review of quantitative PCR applications in food microbiol-
conWrmed shigellosis cases were reported in 29 European ogy. This methodology is increasingly applied in surveil-
Union and European Economic Area/European Free Trade lance and monitoring programs to detect pathogens,
Association countries. Virulent Shigella species can cause especially for ensuring the safety and quality of food and to
severe illnesses with a low infection dose (10 cfu), including identify weak points during production [22]. In the early
bacillary dysentery and hemolytic uremic syndrome [9]. 1990s, the “second” generation of PCR technologies was
Listeria monocytogenes is a Gram-positive rod-shaped introduced by the use of Xuorescent ds-DNA dyes or DNA
bacterium of approx. 1–2 m in length [10, 11], and it is rec- probes, where PCR and detection occur in a one-step,
ognized worldwide as one of the most important food-borne closed-tube procedure reducing the risk of contamination
pathogens of great concern for the food industries. This bac- leading to false-positive results [5]. Several methods have
terium has the peculiarity that it can survive or even grow at been developed for single real-time PCR detection of Shi-
low temperatures [12, 13]. Ingestion of foods contaminated gella spp. [8], Salmonella spp. [23] and L. monocytogenes
with L. monocytogenes can result in listeriosis, a severe [24], or multipathogen detection [1, 9, 25]. Multipathogen
infectious disease characterized by meningoencephalitis, detection on a single-assay platform not only reduces the
abortion, septicemia and a high fatality rate (30%) [13–16]. cost for testing but also provides data on the presence of
The number of listeriosis cases in humans in Europe pathogens in a single experiment [26].
increased in 2009 by 19.1% compared to 2008, with 1,645 Even though several methods for the simultaneous detec-
conWrmed cases. A high case fatality ratio of 16.6% was tion of Salmonella spp. and Shigella spp. [27, 28] or Salmo-
reported in the EU. Listeria monocytogenes was seldom nella spp. and L. monocytogenes [25, 29, 30] have been
detected above the legal safety limit from ready-to-eat developed, to our knowledge, there are no previous studies
foods, and Wndings over this limit were most often reported for the simultaneous detection of these three bacterial patho-
from Wshery products, cheeses and meat products at levels of gens. One of the main problems for multipathogen detection
0.3–1.1% in the European Union [2]. In Canada, a large out- is the selection of an appropriate enrichment medium able of
break in 2008 associated with deli meats, caused 65 con- supporting the growth of the interested bacteria in a single-
Wrmed cases with 20 deaths. The intense media scrutiny on assay format; therefore, a suitable enrichment medium is
the listeriosis outbreak posed some challenging questions on urgently needed [26]. The medium described by Kawasaki
how the food industry is organized and monitored [17]. et al. [31] and modiWed by Omiccioli et al. [1] was further
Based on the reported fatality rates and the total numbers of modiWed to enhance the simultaneous growth of Salmonella
reported conWrmed cases, it is estimated that in 2009 there spp., Shigella spp., and L. monocytogenes. A modiWcation of
were approximately 270 human deaths due to listeriosis [2]. the enrichment process was also carried out, including a
These Wgures highlight the importance of developing double-enrichment procedure to enhance the recovery of the
rapid, economic and easy methodologies that can be target bacteria. The objective of the present work was to
applied in food control to avoid the introduction of poten- develop a multiplex real-time PCR method for the simulta-
tially dangerous products in the community. There is a need neous detection of Salmonella spp., Shigella spp., and Liste-
of methods able of detecting multiple pathogens simulta- ria monocytogenes. Detection was done by simultaneous
neously through a rapid and simple test that can substan- RT-PCR, detecting all three pathogens in one single test. An
tially cut down time, labor, and overall cost of detection Internal AmpliWcation Control (IAC) was included to moni-
process [6]. This issue is currently of particular importance, tor the possible presence of PCR inhibitors that may lead to
when most European countries have derogated their own false-negative results in all reactions.
microbiological regulations in favor of the European one,
2073/2005 [18] with its amendments [19, 20]. A closer look
to these regulations shows that the most important regu- Materials and methods
lated pathogen is Salmonella spp., leaving the analysis of
L. monocytogenes only for ready-to-eat foods and not even Bacterial strains and culture media
considering others, like Shigella spp.
In this sense, the polymerase chain reaction (PCR) is one Strains used in the development of this work are summarized
of the most important rapid methods for the sensitive and on Table 1. They were purchased lyophilized and were
speciWc detection of pathogenic and spoilage microorgan- revived and stored, following the instructions of the supplier.
123
Eur Food Res Technol (2012) 234:571–580 573
Table 1 Strains used for the evaluation of the speciWcity of primers and probes selected of multiplex RT-PCR result
Bacteria Strain RT-PCR Bacteria Strain RT-PCR
invA/ipaH/hlyA invA/ipaH/hlyA
Salmonella enterica CECT 4594 +/¡/¡ V. parahaemolyticus CECT 511 ¡/¡/¡

Shigella sonnei CECT 413 ¡/+/¡ V. parahaemolyticus CECT 5271 ¡/¡/¡
Shigella Xexneri CECT 4804 ¡/+/¡ V. parahaemolyticus CCUG 43362 ¡/¡/¡
L. monocytogenes CECT 935 ¡/¡/+ V. parahaemolyticus CCUG 43363 ¡/¡/¡
L. innocua CECT 910 ¡/¡/¡ V. parahaemolyticus CCUG 43364 ¡/¡/¡
L. seeligeri CECT 917 ¡/¡/¡ V. parahaemolyticus CCUG 43365 ¡/¡/¡
L. ivanovii CECT 913 ¡/¡/¡ V. parahaemolyticus CAIM 58 ¡/¡/¡
Escherichia coli CECT 516 ¡/¡/¡ V. alginolyticus CECT 586 ¡/¡/¡
Escherichia coli CECT 434 ¡/¡/¡ V. alginolyticus CAIM 342 ¡/¡/¡
Staphylococcus aureus CECT 435 ¡/¡/¡ V. mimicus CECT 4218 ¡/¡/¡
Staphylococcus aureus CECT 240 ¡/¡/¡ V. mimicus BCCM/LMG 7896 ¡/¡/¡
Enterococcus faecalis CECT 481 ¡/¡/¡ V. vulniWcus CAIM 611 ¡/¡/¡
C. freundii CECT 401 ¡/¡/¡ P. aeruginosa CECT 108 ¡/¡/¡
V. cholerae CECT 514 (O1) ¡/¡/¡ A. hydrophila CECT 839 ¡/¡/¡
CECT, Spanish Type Culture Collection; CCUG, Culture Collection University of Göteborg; CAIM, Collection of Aquatic Important Microorgan-
isms; BCCM/LMG, Belgian Co-OrWnated Collections Of Micro-Organsims
All Vibrio spp. and Aeromonas spp. strains were cultured in aliquot was centrifuged at 9,000£g for 7 min. The resulting
Alkaline Peptone Water (APW, Biolife Italiana S.r.l., Italy) pellet was resuspended in 300 L of Tris–EDTA 1 X (TE)
before using, and all other strains in BuVered Peptone Water buVer, and cell suspensions were lysed by boiling for
(BPW, Biokar diagnostics S.A., France) or Tryptic Soy 10 min. The lysate was centrifuged at 10,000£g for 5 min
Broth (TSB, BioMérieux S.A., France) for 18 h at 37 °C. at 4 °C. The supernatant was transferred to a new tube and
In order to obtain the reference values of each of the stored at ¡20 °C until use.
pathogenic bacteria under study, they were grown in BPW
for 18 h at 37 °C; then, tenfold serial dilutions were done in DNA extraction from food samples
BPW and plated on Tryptic Soy Agar (TSA, Biokar diag-
nostics S.A., France) for Salmonella enterica, Shigella son- To carry out DNA extraction from food samples, the
nei and Shigella Xexneri., and on Tryptic Soy Yeast Extract method described by Malorny et al. was used [5] with slight
Agar (TSYEA, Biolife Italiana S.r.l., Italy) for L. monocyt- modiWcations, see Table 2. BrieXy, it consisted of several
ogenes. Plates were incubated 18 h at 37 °C. centrifugation steps, chelex puriWcation and cell lysis by a
For simultaneous detection of Salmonella spp., Shigella detergent-boiling combination.
spp., and Listeria monocytogenes by RT-PCR on food sam-
ples, no. 17 broth [31, 32] was chosen. The medium was Genes, primers and probes used for RT-PCR method
prepared without dextrose as described by Omiccioli et al.
[1] and further modiWed by adding 5 g of Tween 80 and Primers and probes used in this study, for the simultaneous
increasing the pH to 7.2 (no. 17 m broth). detection of Salmonella spp., Shigella spp. and L. monocyt-
ogenes, are listed on Table 3, and target invA [3], ipaH [9]
DNA extraction and hlyA [1] genes, respectively. The detection of Salmo-
nella spp. was done by using primers and probe previously
Before DNA extraction, aliquots must not contain food described by Cheng et al. [3], for Shigella spp. those
debris. For this purpose, aliquots were centrifuged 2 min at described by Wang et al. [9], and for L. monocytogenes the
2,000 rpm to pellet large food particles; then, supernatant ones applied by Omiccioli et al. [1].
was transferred to a new tube and the corresponding DNA SpeciWcity of primers and probes chosen was exten-
extraction method was applied. sively tested on the original works from where they were
selected. A short trial for the veriWcation of speciWcity
DNA extraction from pure bacterial cultures under the conditions described below was done with the
bacterial strains listed on Table 1, which included a total of
For DNA extraction from bacterial cultures, the method 28 bacterial strains (24 non-target and 4 target strains)
described by Blanco-Abad et al. [33] was used. A 1 mL susceptible of being present in the types of samples where
123
Table 2 Thermal cell lysis protocol using SDS/Chelex-100

Step Procedure
1 Centrifuge at 10,000£g/5 min

2 Discard supernatant and resuspend cell pellet in 500 L lysis buVer (0.5% SDS in TE 1 X), vigorously vortex the suspension for a couple
of seconds. Centrifuge in the same conditions as step 1
3 Discard supernatant and resuspend cell pellet in 300 L 10% (w/v) Chelex-100, vigorously vortex the mixture for a couple of seconds.
Incubate the suspension at 60 °C for 15–20 min. Resin in suspension by constant agitation at 1,400 rpm
4 Place the tube immediately at 95–100 °C and incubate for 8 min
5 Chill the tube for 2 min on ice
6 Centrifuge the tube for 5 min at 14,000£g and 4 °C
7 Take 2–5 L of the DNA containing supernatant for RT-PCR
Table 3 Primers and probes for multiplex RT-PCR detection of Salmonella spp., Shigella spp. and L. monocytogenes
Microorganism Gene Primer/probe Sequence (5⬘–3⬘) ModiWcations Reference
Salmonella invA3F AACGTGTTTCCGTGCGTAAT –

invA invA3R TCCATCAAATTAGCGGAGGC – [3]
invA Probe1 TGGAAGCGCTCGCATTGTGG 5⬘-/56-FAM//3BHQ_1/-3⬘
Shigella Shig1 CTTGACCGCCTTTCCGATA –
ipaH Shig2 AGCGAAAGACTGCTGTCGAAG – [9]
Shig probe AACAGGTCGCTGCATGGCTGGAA 5⬘-/5Cy5//3BHQ_2/-3⬘
L. monocytogenes 634F ACTTCGGCGCAATCAGTGA –
hlyA 770R TTGCAACTGCTCTTTAGTAACAGCTT – [1]
713T TGAACCTACAAGACCTTCCA 5⬘-/5Cy3//3BHQ_2/-3⬘
GATTTTTCGGC
IAC – IAC forward TCCAGGGCGAAAGTAAACGT –
IAC – IAC reverse GGCGAGCCGTACGAACAC – [4]
IAC – IAC probe CCCAGTTGGCTGATCACTTTCG 5⬘-/5TexRd-XN//3BHQ_2/-3⬘
Salmonella spp., Shigella spp. and L. monocytogenes can for the activation of the polymerase (Hot Start), followed
be found like seafood, meat, water. by 40 cycles. Each cycle consisted on a denaturation step of
Primers and probes were provided by IDT (Integrated 10 s at 95 °C, and annealing/extension at 63 °C for 30 s.
DNA Technologies, Inc., USA).
RT-PCR eYciency
Multiplex RT-PCR detection method for Salmonella spp.,
Shigella spp. and L. monocytogenes For the calculation of the eYciency, overnight pure cul-
tures of S. enterica, Sh. Xexneri and L. monocytogenes
The RT-PCR was carried out in a Wnal volume of 50 L incubated at 37 °C were used to obtain DNA of each
with the following components: 31,25 L of SsoFast™ bacterium as described in Materials and methods for pure
Probes Supermix (Bio-Rad Laboratories, Inc., USA), cultures. DNA was measured with NanoDrop 1000 spec-
0.225 M primers and 0.021 M probe were used for Sal- trophotometer (Thermo Fischer ScientiWc, Inc., USA)
monella spp.; 0.125 M primers and 0.045 M probe were with software ND-1000 v3.7.1. All three DNAs were
used for Shigella spp.; 1.650 M primers and 0.140 M mixed in equal volumes, tenfold serially diluted and used
probe were used for L. monocytogenes; and for Internal as template for PCR to determine the standard curve. The
AmpliWcation Control (IAC) 0.040 M primers, 0.018 M Mx3005pro software automatically calculates the stan-
probe and 9 £ 102 copies of IAC DNA were added per dard curve for each run based on the Ct for each standard.
reaction. 5 L of DNA were used as template. Stratagene The formula from which the ampliWcation eYciency was
Mx3005p thermocycler (Agilent Technologies, Inc., USA) calculated is e = 10¡1/s¡1, where s is the slope of the
was used with the following thermal proWle: 3 min at 95 °C standard curve, see Table 4.
123
Table 4 Standard curves obtained with multiplex RT-PCR for containing 10 mL of new no. 17 m broth and further incu-
S. enterica, Sh. Xexneri and L. monocytogenes bated 7 § 1 h at 35 °C. After incubation, 1 mL was taken
Bacterium Standard curve AmpliWcation r2 for DNA extraction as described in Materials and methods
equation eYciency (%) for food samples. Samples were inoculated with 1 mL of all
three bacterial strains, after preparing the inoculums as
S. enterica Ct = ¡3.264(logX) + 22.38 102.5 0.999
described below.
Sh. Xexneri Ct = ¡3.125(logX) + 19.41 108.9 1.000
Bacterial species used for the LOD calculation were Sal-
L. monocytogenes Ct =¡3.177(logX) + 27.10 106.4 1.000
monella enterica CECT 4594, Shigella Xexneri CECT 4804
The standard curve was constructed by plotting the Ct versus the con- and L. monocytogenes CECT 935. All three were grown
centration of DNA (ng/L) overnight at 37 °C either in 10 mL BPW or in TSB. These
The ampliWcation eYciency was calculated from the following for- fresh cultures were used to prepare starting vials with a the-
mula: e = 10¡1/s¡1, where s is the slope of the standard curve
oretical concentration between 1.5 and 3 £ 108 cfu/mL, by
r2, correlation coeYcient; Ct, cycle threshold
adjusting the turbidity to 0.5–1 McFarland on a Densimat
(BioMérieux S.A., France) turbidimeter using the same
Evaluation of the limit of detection (LOD) in processed medium where the corresponding bacteria were grown.
food samples by RT-PCR Tenfold serial dilutions were done to get a Wnal concentra-
tion ranging 1.5–3 cfu/mL for the inoculation of samples
To determine the LOD, three groups of food samples with and plates of TSA for S. enterica, Sh. Xexneri and TSYEA
ten samples each were inoculated below 10 cfu/mL. These for L. monocytogenes, to get a reference value of viable
groups were boiled frozen mussels, tuna lasagna and turkey bacteria. Plates of both media were incubated at 37 °C for
breast. For each sample preparation 25 g were weighted 18 § 2 h.
and 225 mL of no. 17 m broth were added, the mixture was For the LOD to be established, 90% of positive results
homogenized 30 s in a laboratory blender at normal speed must be achieved for each group of ten samples. The same
and incubated at 35 °C for 20 § 1 h. After primary enrich- criterion was followed for each of the three groups of food
ment, 1 mL of the mixture was transferred to a tube analyzed.
Table 5 List of spiked samples analyzed for the determination of LOD and evaluation of the SE, SP and AC
Sample No Strains used for inoculation RT-PCR results Observations
genes invA/ipaH/hlyA
Boiled frozen musselsa 10 S. enterica, Sh. Xexneri, L. monocytogenes +/+/+ –

Boiled frozen musselsa 1 – ¡/¡/¡
Tuna lasagnaa 10 S. enterica, Sh. Xexneri, L. monocytogenes +/+/+ –
Tuna lasagnaa 1 – ¡/¡/¡
Turkey breasta 10 S. enterica, Sh. Xexneri, L. monocytogenes +/+/+ –
Turkey breasta 1 – ¡/¡/¡ –
Turkey breast 1 S. enterica, L. monocytogenes ¡/¡/+ NDb Salmonella
Smoked salmon 7 L. monocytogenes ¡/¡/+ –
Smoked salmon 6 S. enterica, L. monocytogenes +/¡/+ –
Smoked salmon 7 Sh. Xexneri, L. monocytogenes ¡/+/+ NDb Shigella*
Smoked salmon 4 Sh. sonnei, L. monocytogenes ¡/+/+ –
Boiled frozen mussels 1 – ¡/¡/¡ –
Fish Wngers 1 S. enterica, Sh. Xexneri ¡/+/¡ NDb Salmonella
Fish Wngers 1 S. enterica, Sh. sonnei ¡/+/¡ NDb Salmonella
Fish Wngers 1 – ¡/¡/¡ –
Strawberry milkshake 1 Salmonella spp. +/¡/¡ –
Total 63
a
LOD samples
b
Negative deviation
* One negative deviation detected, see Table 6
123
Estimation of relative sensitivity, relative speciWcity Table 6 Relative sensibility (SE), relative speciWcity (SP) and rela-
and relative accuracy of the RT-PCR method tive accuracy (AC) results
S. enterica Shigella spp. L. monocytogenes Method
With the data collected from all the spiked samples, 63
detailed in Table 5, relative sensitivity (SE), relative speci- PAa 37 42 55 –
Wcity (SP) and relative accuracy (AC) of the method were NAb 23 20 8 –
calculated by comparing the RT-PCR method with a refer- PDc 0 0 0 –
ence one. NDd 3 1 0 –
Each sample Positive (PA) and Negative (NA) Accor- No of samples 63 63 63 –
dance were deWned as samples presenting the same result, SE % 93 98 100 97
positive or negative, for the RT-PCR method and the refer- SP % 100 100 100 100
ence method or the expected result for spiked samples. AC % 95 98 100 98
Negative Deviations (ND) is the number of samples a
Positive agreement
expected positive giving a negative result, and Positive b
Negative agreement
Deviations (PD) is the number of samples expected nega- c
Positive deviation
tive with a positive result. d
Negative deviation
SP was deWned as the percentage of negative samples
giving a correct negative signal (SP = NA/
(PD + NA) £ 100). SE was deWned as the percentage of Table 7 Natural non-inoculated samples collected
positive samples giving a correct positive signal (SE = PA/ Sample L. monocytogenes L. monocytogenes Multiplex
(PA + ND) £ 100). AC is deWned as the degree of corre- Plate counta Vidas LMO2b RT-PCRc
spondence between the response obtained by the reference
Pizza <10 NA +*
method and the alternative method on identical samples
Pizza <10 NA +*
(AC = [(PA + NA)/N] £ 100; where N = Number of ana-
Pizza <10 NA ¡
lyzed samples).
Pizza >15 £ 102 NA +
All these parameters were calculated both, for the detec-
Pizza >15 £ 102 NA +
tion of each individual microorganism, and for the com-
Pizza 14 £ 102 NA +
bined results of all them, see Table 6.
Pangasius Wsh <40 NA +
Pangasius Wsh <40 NA +
Commercial samples: Spiked and non-inoculated
Pangasius Wsh <40 NA ¡*
All samples came mainly from Spain and were obtained Smoked salmon <10 NA +
from local suppliers and also from national control labora- Boiled mussels NA Presence +
tories. Samples were sent to our laboratory either refriger- Boiled mussels NA Presence ¡*
ated (4 °C) or frozen (¡20 °C) and kept in the same Boiled mussels NA Presence ¡*
conditions until analysis. Boiled mussels NA Presence +
In addition to the samples used for the LOD, 33 more Half shell mussel NA Presence +
samples of diVerent types were spiked with one, two or all Total samples: 15
three pathogens. The two species of Shigella detailed in NA not analyzed
Table 1, Shigella Xexneri and Shigella sonnei, were used a
Results in cfu/g
for the inoculation of non-contaminated food samples, see b
Results in presence–absence/25 g
Table 5. These samples and those used for the determina- c
Only results for L. monocytogenes
tion of the LOD were used for the calculation of the relative * Method discrepancies
sensitivity, speciWcity and accuracy.
A total of 15 diVerent types of naturally contaminated
samples were collected from diVerent laboratories and ana- samples included pizza, pangasius Wsh, boiled mussels,
lyzed. Samples collected were only positive for L. monocyt- tuna and smoked salmon. These samples were all positive
ogenes as no positive samples for either Salmonella spp. or for L. monocytogenes. They were previously analyzed
Shigella spp. were found. either with Vidas LMO2 (BioMérieux S.A., France) or with
Reference methods were either Vidas LMO2 (Bio- plate count technique, following the ISO method [34], see
Mérieux S.A., France) or ISO for plate counts [34]. These Table 7.
123
Results Estimation of relative sensitivity, relative speciWcity

and relative accuracy of the RT-PCR method
SpeciWcity of primers and probes used in the multiplex with artiWcially contaminated samples
RT-PCR method for the detection of Salmonella spp.,
Shigella spp. and L. monocytogenes 63 spiked samples, including those analyzed for the deter-
mination of LOD, were analyzed along with Wve blank
SpeciWc simultaneous multiplex detection of each patho- samples. Two diVerent species of Shigella were used for the
gen was achieved with its corresponding probe with the inoculation of samples; the RT-PCR method correctly
conditions described in Materials and methods. No inter- detected both species. Three negative deviations were
ferences were detected between them or with the selected found for the detection of Salmonella spp. one in turkey
IAC. and two in Wsh Wngers, while one was obtained for Shigella
SpeciWcity was checked against a panel of 24 non-target spp. detection in smoked salmon. With the results obtained,
bacterial strains. After DNA extraction as described in SE, SP and AC were calculated as described in Sect. 2.7 of
Materials and methods, 5 L of DNA was used as template Materials and methods.
for RT-PCR. Fluorescence was only detected for the IAC The lowest SE obtained was 93% for the detection of
but not for any of the other three probes. Salmonella spp., due to the presence of three ND. Since no
PD were detected, the SP was 100%, and the AC of the
Multiplex RT-PCR eYciency method for the detection of this bacterium was of 95%.
Only one ND was detected for Shigella spp. what low-
To construct the standard curve for multipathogen detec- ered the SE down to 98%. However, as for Salmonella spp.,
tion, overnight pure cultures of S. enterica, Sh. Xexneri,, no PD were observed, achieving a SP of 100% and the AC
and L. monocytogenes incubated at 37 °C were used. was 98%.
1 mL aliquots of each strain were used to obtain pure In the case of L. monocytogenes, neither ND nor PD
DNA. The extracts obtained were mixed and tenfold seri- were detected thus all three, SE, SP and AC, were 100%.
ally diluted and used as the template for RT-PCR. Cycle When analyzing the data all together, the overall SE of
threshold (Ct) values obtained in RT-PCR were plotted the method, for the simultaneous detection of these bacte-
versus DNA concentration in ng/L, and with the slope rial pathogens, was calculated as 97%. The SP for the
of the regression line, the RT-PCR eYciency was calcu- method was 100%; the AC for the method was 98%.
lated.
Good RT-PCR eYciency was obtained for the simulta- Analysis of natural non-inoculated samples
neous ampliWcation of all three pathogens, 102.5% for Sal-
monella enterica, 108.9% for Shigella Xexneri and 106.4% Fifteen samples were collected from diVerent laboratories.
for L. monocytogenes; with high correlation coeYcient These samples were analyzed for the presence of L. mono-
(from 0.999 to 1.000). cytogenes, either with Vidas LMO2 (BioMérieux S.A.,
France) or with plate count technique following the ISO
Determination of the limit of detection (LOD) method [34]. Concordance was found in the rest of the sam-
ples within the RT-PCR method and the other method used.
For the estimation of the LOD of the RT-PCR method, Two out of the three pizza samples with plate counts
three groups of foods were used. Ten samples of each below 10 cfu/g resulted positive by RT-PCR. One panga-
group were simultaneously spiked with Salmonella enter- sius Wsh with plate count higher than 10 cfu/g but lower
ica, Shigella Xexneri and L. monocytogenes. For each group than 40 cfu/g resulted negative by RT-PCR. Two out of
of ten samples, one blank was analyzed to ensure the four boiled mussels positive with Vidas LMO2 were nega-
absence of the pathogens of interest. tive with RT-PCR.
The reference value for the tuna lasagna was of 9 cfu of
Salmonella, 11 cfu of Shigella and 8 cfu of L. monocytoge-
nes in 25 g of sample. In boiled mussels, the LOD was Discussion
15 cfu, 14 cfu and 22 cfu for Salmonella, Shigella and
L. monocytogenes, respectively; and for the turkey breast, Standard methods for Salmonella spp. and L. monocytoge-
the LOD was established in 11 cfu, 14 cfu and 3 cfu for nes detection involve growth in pre-enrichment and selec-
Salmonella, Shigella and L. monocytogenes. tive media, followed by conWrmatory biochemical and
All ten replicates of each type of food gave positive serological tests (International Standard Organization, ISO)
results for the three bacteria, while no ampliWcation was that can take from 5 to 10 days and considerable handling
detected for any of the control samples. [29, 30]. Conventional detection methods for Shigella, as
123
outlined in the U.S. Food and Drug Administration Bacteri- Salmonella spp. [3]. Even though previous studies have
ological Analytical Manual, and ISO [35] methods involve reported the existence of a strain of Salmonella negative for
culturing the organism in selective media and identifying invA, serotype Saintpaul, [42, 43], absence of the invA gene
isolates according to their morphological, biochemical and in Salmonella seems to be rare [42].
immunological characteristics [9, 36]. All these traditional One popular PCR assay, based on the ampliWcation of
culture methods take too long to get a deWnitive positive the invasion plasmid antigen H (ipaH) gene sequence, is
result due to all the steps needed for conWrmation of pre- used for the diagnosis of bacillary dysentery. Primers and
sumptive positives, what is not acceptable for certain prod- probe previously described by Wang et al. [9] were
ucts with short shelf-lifes. selected. IpaH is carried by all four Shigella species as well
Though the sensitivities of many of the modern detection as by enteroinvasive Escherichia coli (EIEC) [8, 41].
methods, such as antibody-, nucleic acid- and biosensor- Concerning L. monocytogenes, several genes have been
based methods, have improved signiWcantly, an enrichment proposed in the literature for its detection. 16S-23S inter-
step is still needed. This step is required not only to genic region [14], pfrA which is a central virulence gene
increase the target pathogen concentration in a sample but regulator [29, 36, 40]; but the most commonly used is the
also to resuscitate physiologically stressed or injured cells hlyA gene [1, 25, 30] which encodes for Listerolysin O, a
[26]. virulence factor for L. monocytogenes [30]. For the devel-
Current research trends emphasize the development of opment of this work, primers and probe described by
multipathogen platforms in a single-assay format [26], Omiccioli et al. [1] targeting hlyA gene were selected.
which will help to reduce costs and time needed to carry out The ampliWcation eYciency of the multiplex RT-PCR
those analyses. Among molecular-based methods, PCR has method for Salmonella spp., Shigella spp. and L. monocyt-
been established as a valuable alternative to the traditional ogenes ranged from 103 to 109% with a correlation coeY-
detection methods and oVers the possibility of detecting cient (r2) above 0.999, see Table 4. Even though no
speciWc genes involved in pathogen virulence. In recent quantitative analysis was done, these eYciencies and their
years, PCR procedures have demonstrated to be suitable for correlation coeYcient indicate a correct optimization of the
the pathogen detection in food products, because they are method.
rapid and simple to use [37]. Multiplex PCR allows the Three diVerent processed food types were analyzed for
simultaneous ampliWcation of more than one target the calculation of the LOD, including seafood (boiled mus-
sequence in a single PCR, saving considerable time and sels), ready-to-eat food (tuna lasagna) and meat (frozen tur-
eVort and decreasing the number of reactions to be per- key breast). Similar LODs were obtained for the three
formed in order to assess the possible presence of food- bacteria in the diVerent types of foods. For Salmonella spp.,
borne pathogens in a food sample [29]. LODs were 15 cfu, 9 cfu and 11 cfu/25 g, respectively; for
Advances in molecular biology have led to the use of Shigella spp., 11 cfu, 14 cfu and 14 cfu/25 g, respectively;
real-time PCR as an eYcient and reproducible method for and for L. monocytogenes, the values obtained were 22, 8
detecting pathogens [38]; moreover, real-time PCR allows and 3 cfu/25 g. These LODs were achieved with 100% pos-
accurate, automated and quantitative detection of diVerent itive results for the 30 samples used (of the three diVerent
microorganisms without the need to open the tubes for elec- types of foods), see Table 5.
trophoresis after ampliWcation, thus reducing the risk of With the types of food tested and the enrichment
cross-contamination [37]. medium developed, no inhibition of RT-PCR was detected
Even though several RT-PCR methods have been devel- when DNA extraction was carried out with the DNA
oped for the detection of Salmonella spp., Shigella spp. and extraction method described in Materials and methods for
L. monocytogenes [8, 28, 29, 39–41], as far as we know this food samples. Template DNA was used without further
is the Wrst method developed for the simultaneous detection dilutions for all matrixes; thus, the DNA extraction method
of these three pathogens, coupling RT-PCR with an enrich- selected resulted adequate for being coupled with the
ment in the same broth. The evaluation of the method RT-PCR method proposed.
developed was not restricted to one type of food but In addition to the spiked samples used for the establish-
extended to processed foods of diVerent types including ment of the LOD for the method developed, the relative
seafood, ready-to-eat food and meat. sensitivity (SE), relative speciWcity (SP) and relative accu-
For Salmonella detection, primers and probe previously racy (AC) were calculated by analyzing up to 63 samples.
used by Cheng et al. (2008) were used. The target was the These spiked samples included combinations of the three
Salmonella invasion gene, invA, that has been shown to be bacterial pathogens under study and blank samples. It was
involved in the internalization of Salmonella Typhimurium found that for all three bacteria, when data were analyzed
in mammalian epithelial cells. This gene is unique to Sal- either separately or combined, the SE was above 93% and
monella, and the DNA sequence is highly conserved among the SP was 100%. The AC in all cases was above 95% (see
123
Table 6). These data show that the method developed in the of the Spanish Ministry of Agricultural, Land and Marine Resources
present study constitutes a feasible alternative for the (MARM), by order RM/1193/2009 from the Public Interest Collective
Actions, co-Wnanced by European Fisheries Fund (EFF).
simultaneous detection of the bacterial pathogens under
study.
Some discrepancies were found in naturally contami-
References
nated samples containing L. monocytogenes, when ana-
lyzed with the RT-PCR method developed in the present 1. Omiccioli E, Amagliani G, Brandi G, Magnani M (2009) A new
work and compared to other microbiological methods, platform for real-time PCR detection of Salmonella spp., Listeria
Vidas LMO2 (BioMérieux S.A., France) or plate count monocytogenes and Escherichia coli O157 in milk. Food Micro-
technique following the ISO method [34]. In this sense, biol 26(6):615–622
2. EFSA (2011) The European Union summary report, Trends and
good results were obtained for all six samples of ready- sources of zoonoses and zoonotic agents and food-borne outbreaks
to-eat foods (pizza samples), where two out of three sam- in 2009. European food safety authority
ples with plate counts under 10 cfu/g resulted positive for 3. Cheng CM, Lin W, Van KT, Phan L, Tran NN, Farmer D (2008)
RT-PCR. Total concordance was found in all other samples Rapid detection of Salmonella in foods using real-time PCR.
J Food Protect 71(12):2436–2441
of this type. Out of the remaining nine samples, three 4. Calvo L, Martinez-Planells A, Pardos-Bosch J, Garcia-Gil LJ
resulted negative for RT-PCR. It is worth to mention that (2008) A new real-time PCR assay for the speciWc detection of
two of the three discrepancies were positive results with Salmonella spp. targeting the bipA gene. Food Anal Methods
Vidas LMO2, a method that has a lower LOD than the one 1(4):236–242
5. Malorny B, Huehn S, Dieckmann R, Kramer N, Helmuth R (2009)
described in the present study (3 cfu/25 g). The third Polymerase chain reaction for the rapid detection and serovar iden-
discrepant result was obtained in a pangasius Wsh sample, tiWcation of Salmonella in food and feeding stuV. Food Anal Meth-
usually this type of Wsh has relatively high counts of ods 2(2):81–95
enterobacteria (close to 102 cfu/g). This high amount of 6. Yuan YF, Xu WT, Zhai ZF, Shi H, Luo YB, Chen ZJ, Huang KL
(2009) Universal primer-multiplex PCR approach for simulta-
interfering bacteria may have overgrown, thus leading to a neous detection of Escherichia coli, Listeria monocytogenes, and
false-negative result of L. monocytogenes. Salmonella spp. Food samples. J Food Sci 74(8):M446–M452
In natural samples, best results were achieved with 7. Shigella Chapter 6 (2001) FDA bacteriological analytical manual
ready-to-eat samples, where the detection of L. monocytog- 8. Thiem VD, Sethabutr O, von Seidlein L, Van Tung T, Canh DG,
Chien BT, Tho LH, Lee H, Houng HS, Hale TL, Clemens JD,
enes is crucial. For this purpose, addition of selective Mason C, Trach DD (2004) Detection of Shigella by a PCR assay
agents to the medium, which may reduce the overgrowth of targeting the ipaH gene suggests increased prevalence of shigello-
interfering bacteria, could enhance the sensitivity for sis in Nha Trang Vietnam. J Clin Microbiol 42(5):2031–2035
L. monocytogenes. 9. Wang LX, Li Y, Mustapha A (2007) Rapid and simultaneous
quantitation of Escherichia coli O157: H7, Salmonella, and Shi-
gella in ground beef by multiplex real-time PCR and immunomag-
netic separation. J Food Protect 70(6):1366–1372
Conclusions 10. Reichert-Schwillinsky F, Pin C, Dzieciol M, Wagner M, Hein I
(2009) Stress- and growth rate-related diVerences between plate
count and real-time PCR data during growth of Listeria monocyt-
In summary, the development of a method for the simulta- ogenes. Appl Environ Microbiol 75(7):2132–2138
neous detection of Salmonella spp., Shigella spp. and 11. Rossmanith P, Wagner M (2010) The challenge to quantify Liste-
L. monocytogenes can signiWcantly reduce costs and time ria monocytogenes- a model leading to new aspects in molecular
of analysis in laboratories, what would be reXected in a biological food pathogen detection. J Appl Microbiol 110(3):605–
617
faster response in those risk situations when they are 12. Vanegas MC, Vasquez E, Martinez AJ, Rueda AM (2009) Detection
detected. In this context, the Wrst step is the development of of Listeria monocytogenes in raw whole milk for human consump-
an enrichment medium able of supporting the simultaneous tion in Colombia by real-time PCR. Food Control 20(4):430–432
growth of the bacteria of interest, and once fulWlled the Wrst 13. Rodriguez-Lazaro D, Hernandez M, Scortti M, Esteve T, Vaz-
quez-Boland JA, Pla M (2004) Quantitative detection of Listeria
requirement, a technique able of eYcient and reliable detec- monocytogenes and Listeria innocua by real-time PCR: assess-
tion is also needed. The method developed proved suitable ment of hly, iap, and lin02483 targets and ampliFluor technology.
for the simultaneous detection of Salmonella spp., Shigella Appl Environ Microbiol 70(3):1366–1377
spp. and L. monocytogenes in one single enrichment 14. Rantsiou K, Alessandria V, Urso R, Dolci P, Cocolin L (2008)
Detection, quantiWcation and vitality of Listeria monocytogenes in
medium, being tested in a wide range of diVerent processed food as determined by quantitative PCR. Int J Food Microbiol
food samples with a low LOD. 127(3):321 (vol 121, pg 99)
15. Ruiz-Rueda O, Soler M, Calvo L (2010) Multiplex real-time PCR
Acknowledgments Authors thank Victoria Docampo and Ángeles for the simultaneous detection of Salmonella spp. and Listeria mon-
Marcote for technical assistance. Authors also want to thank Dr. Paula ocytogenes in food samples. Food Anal Methods 4(2):131–138
Fajardo and Dr. Miroslava Atanassova for valuable suggestions. This 16. Norton DM (2002) Polymerase chain reaction-based methods for
work is Wnancially supported by Xunta de Galicia (Spain) through detection of Listeria monocytogenes: toward real-time screening
research grant 09TAL002CT and by the Secretary General for the Sea for food and environmental samples. J AOAC Int 85(2):505–515
123
17. Warriner K, Namvar A (2009) What is the hysteria with Listeria? 31. Kawasaki S, Horikoshi N, Okada Y, Takeshita K, Sameshima T,
Trends Food Sci Technol 20(6–7):245–254 Kawamoto S (2005) Multiplex PCR for simultaneous detection of
18. (EC) CR (2005) Microbiological criteria for foodstuVs. vol 2073/ Salmonella spp., Listeria monocytogenes, and Escherichia coli
2005. OYcial J Eur Union O157: H7 in meat samples. J Food Protect 68(3):551–556
19. (EC) CR (2007) amending Regulation (EC) No 2073/2005 on 32. Kawasaki S, Fratamico PM, Horikoshi N, Okada Y, Takeshita K,
microbiological criteria for foodstuVs. vol 1441/2007. OYcial J Sameshima T, Kawamoto S (2010) Multiplex real-time polymer-
Eur Union ase chain reaction assay for simultaneous detection and quantiWca-
20. (EC) CR (2010) amending Regulation (EC) No 2073/2005 on tion of Salmonella Species, Listeria monocytogenes, and
microbiological criteria for foodstuVs as regards Enterobacteria- Escherichia coli O157: H7 in ground pork samples. Foodborne
ceae in pasteurised milk and other pasteurised liquid dairy prod- Pathog Dis 7(5):549–554
ucts and Listeria monocytogenes in food grade salt., vol 365/2010. 33. Blanco-Abad V, Ansede-Bermejo J, Rodriguez-Castro A, Marti-
OYcial J Eur Union nez-Urtaza J (2009) Evaluation of diVerent procedures for the opti-
21. Postollec F, Falentin H, Pavan S, Combrisson J, Sohier D (2011) mized detection of Vibrio parahaemolyticus in mussels and
Recent advances in quantitative PCR (qPCR) applications in food environmental samples. Int J Food Microbiol 129(3):229–236
microbiology. Food Microbiol 28(5):848–861 34. ISO (1998) Microbiology of food and animal feeding stuVs—
22. Cocolin L, Rajkovic A, Rantsiou K, Uyttendaele M (2011) The Horizontal method for the detection and enumeration of Listeria
challenge of merging food safety diagnostic needs with quantita- monocytogenes—Part 2: enumeration method. ISO 11290–
tive PCR platforms. Trends Food Sci Technol 22:S30–S38 02:1998
23. Tomas D, Rodrigo A, Hernandez M, Ferrus MA (2009) Validation 35. ISO (2004) Microbiology of food and animal feeding stuVs—
of Real-Time PCR and Enzyme-Linked Fluorescent Assay-Based Horizontal method for the detection of Shigella spp. 21567
Methods for Detection of Salmonella spp. Chicken feces samples. 36. D’Urso OF, Poltronieri P, Marsigliante S, Storelli C, Hernandez
Food Anal Methods 2(3):180–189 M, Rodriguez-Lazaro D (2009) A Wltration-based real-time PCR
24. Poltronieri P, de Blasi MD, D’Urso OF (2009) Detection of Liste- method for the quantitative detection of viable Salmonella enteri-
ria monocytogenes through real-time PCR and biosensor methods. ca and Listeria monocytogenes in food samples. Food Microbiol
Plant Soil Environ 55(9):363–369 26(3):311–316
25. Suo B, He YP, Tu SI, Shi XM (2010) A multiplex real-time poly- 37. Elizaquivel P, Gabaldon JA, Aznar R (2010) QuantiWcation of Sal-
merase chain reaction for simultaneous detection of Salmonella monella spp., Listeria monocytogenes and Escherichia coli O157
spp., Escherichia coli O157, and Listeria monocytogenes in meat H7 in non-spiked food products and evaluation of real-time PCR
products. Foodborne Pathog Dis 7(6):619–628 as a diagnostic tool in routine food analysis. Food Control
26. Kim HC, Bhunia AK (2008) SEL, a selective enrichment broth for 22(2):158–164
simultaneous growth of Salmonella enterica, Escherichia coli 38. Chua T, Bhagwat AA (2009) A rapid and simple DNA extraction
O157: H7, and Listeria monocytogenes. Appl Environ Microbiol procedure to detect Salmonella spp. and Listeria monocytogenes
74(15):4853–4866 from fresh produce using real-time PCR. Food Anal Methods
27. Li Y, Zhuang S, Mustapha A (2005) Application of a multiplex 2(2):96–101
PCR for the simultaneous detection of Escherichia coli O157: H7, 39. Bhagwat AA (2003) Simultaneous detection of Escherichia coli
Salmonella and Shigella in raw and ready-to-eat meat products. O157: H7, Listeria monocytogenes and Salmonella strains by real-
Meat Sci 71(2):402–406 time PCR. Int J Food Microbiol 84(2):217–224
28. Gomez-Duarte OG, Bai J, Newell E (2009) Detection of Esche- 40. Germini A, Masola A, Carnevali P, Marchelli R (2009) Simulta-
richia coli, Salmonella spp., Shigella spp., Yersinia enterocolitica, neous detection of Escherichia coli O175:H7, Salmonella spp.,
Vibrio cholerae, and Campylobacter spp. enteropathogens by and Listeria monocytogenes by multiplex PCR. Food Control
3-reaction multiplex polymerase chain reaction. Diagn Microbiol 20(8):733–738
Infect Dis 63(1):1–9 41. Hsu BM, Wu SF, Huang SW, Tseng YJ, Ji DD, Chen JS, Shih FC
29. Jofre A, Martin B, Garriga M, Hugas M, Pla M, Rodriguez-Lazaro (2010) DiVerentiation and identiWcation of Shigella spp. and
D, Aymerich T (2005) Simultaneous detection of Listeria mono- enteroinvasive Escherichia coli in environmental waters by a
cytogenes and Salmonella by multiplex PCR in cooked ham. Food molecular method and biochemical test. Water Res 44(3):949–955
Microbiol 22(1):109–115 42. Malorny B, Hoorfar J, Bunge C, Helmuth R (2003) Multicenter
30. Badosa E, Chico N, Pla M, Pares D, Montesinos E (2009) Evalua- validation of the analytical accuracy of Salmonella PCR: towards
tion of ISO enrichment real-time PCR methods with internal an international standard. Appl Environ Microbiol 69(1):290–296
ampliWcation control for detection of Listeria monocytogenes and 43. Malorny B, Paccassoni E, Fach P, Bunge C, Martin A, Helmuth R
Salmonella enterica in fresh fruit and vegetables. Lett Appl Micro- (2004) Diagnostic real-time PCR for detection of Salmonella in
biol 49(1):105–111 food. Appl Environ Microbiol 70(12):7046–7052
123
3.3 Artículo 3
Título: In-house validation of multiplex Real-Time PCR method for simultaneous

detection of Salmonella spp., Escherichia coli O157 and Listeria monocytogenes
Autores: Alejandro Garrido, María-José Chapela, Belén Román, Paula Fajardo, Juan M.
Vieites, Ana G. Cabado
Revista: International Journal of Food Microbiology (aceptado)
Resumen:
El objetivo del presente estudio fue desarrollar y validar un método de qPCR

múltiple, a partir de sondas y cebadores previamente validados en formatos simples,
para la detección simultánea de Salmonella spp., E. coli O157 y L. monocytogenes.
Hoy en día existe un gran número de métodos de qPCR para la detección de

Salmonella spp., E. coli O157 y L. monocytogenes, que utilizan distintos tipos de
química de detección y diferentes genes, tanto en formatos simples como múltiples,
aunque la mayoría no se han validado.
Se optimizó el enriquecimiento de las muestras y se valoró la eficiencia de la

qPCR tanto con amplificación simple como múltiple obteniendo valores entre el 91 % y
el 108 %. Se obtuvo un límite de detección muy bajo (5 ufc/ 25 g) para la detección
simultánea de los tres patógenos.
Finalmente el método se aplicó a 152 muestras ambientales y alimentarias,

incluyendo muestras inoculadas artificialmente. Los parámetros analizados para
valorar la capacidad diagnóstica del método obtuvieron valores por encima del 91 %,
cumpliendo todos los requisitos de un método alternativo
69 Publicaciones
Title
In-house validation of a multiplex Real-Time PCR method for simultaneous detection of

Salmonella spp., Escherichia coli O157 and Listeria monocytogenes
Alejandro Garrido, María-José Chapela, Belén Román, Paula Fajardo, Juan M. Vieites,
Ana G. Cabado*
*Corresponding author Ana G. Cabado
Microbiology and Toxins Area, ANFACO-CECOPESCA, Campus Univ. 16, 36310 Vigo PO,
Spain
Tel: 00 34 986 469 303
Fax: 00 34 986 469 269
E-mail: agcabado@anfaco.es
Abstract
A wide variety of qPCR methods currently exist for Salmonella spp., Escherichia coli
O157 and Listeria monocytogenes detection. These methods target several genes and
use different detection chemistries, either in simplex or in multiplex formats. However,
the majority of these methods have not been carefully validated, and the number of
validated methods that use multiplex qPCR is even lower. The aim of the present study
was to develop and validate a multiplex qPCR method from previously validated
simplex qPCR primers and probes. A modified broth medium was selected and primary
and secondary enrichment times were further optimized. Efficiency of the newly
combined qPCR system was comprised between 91 % and 108 %, for simplex and
multiplex analysis. A total of 152 food and environmental, natural and spiked samples,
70 Publicaciones
were analyzed for the evaluation of the method obtainig values above 91 % were
reached for all the quality parameters analyzed. A very low limit of detection (5 cfu/
25g after enrichment) for simultaneous identification of these 3 pathogens was
obtained.
Keywords: Salmonella spp., E. coli O157, L. monocytogenes, multiplex qPCR, validation,

invA, rfbE, prfA
1 Introduction
Microbiological analysis of foodstuffs is an integrated part of microbial safety

management in the food chain (Kagkli et al., 2011). As an example, in the year 2010,
99,020 human salmonellosis cases were reported in Europe. The same year the
number of human listeriosis were 1,601. Regarding verotoxigenic E. coli (VTEC), a total
of 4,000 infections were reported, being serogroup O157 the most frequently
identified (EFSA, 2012). In June 2012 the Centers for Disease Control and Prevention
(CDC) posted a multistate outbreak in the USA due to Salmonella serovar Montevideo
which caused 66 illnesses and 1 death. In 2011 another multistate outbreak affected 8
people who were infected with E. coli O157. Moreover, in 2011 a larger multistate
outbreak due to L. monocytogenes caused 146 infections and 29 deaths (CDC, 2011;
CDC, 2012a; CDC, 2012b).
A trend toward molecular methods, mainly PCR-based methods, for rapid

detection of food-borne pathogens in food and feed microbiology, has been observed
in recent years (Kagkli et al., 2011). These methods, based on the detection of nucleic
acids, are faster, more specific and sensitive than traditional culture methods. These
procedures enable the detection of sub-dominant populations, even in the absence of
a selective enrichment medium and in the presence of other populations (Anderson et
al., 2011; Postollec et al., 2011).
71 Publicaciones
One major difficulty for the application of PCR for foodborne pathogen detection
is the presence of compounds that inhibit the PCR reaction. These compounds can
contaminate DNA templates extracted from food or environmental samples generating
false-negative results (Hyeon et al., 2010). Some inhibitors that may affect different
steps of the qPCR method include: phenolic compounds, fats and glycogen. For this
reason, the implementation of an adequate internal amplification control (IAC) in
diagnostic PCR and qPCR has been strongly recommended by different authors
(Anderson et al., 2011; Hoorfar et al., 2003; Hoorfar et al., 2004). The European
Standarization Committee (CEN), in collaboration with International Standard
Organization (ISO), has proposed a general guideline for PCR testing, and the inclusion
of an IAC is always required in the reaction mixture. In fact, a complete set of rules
concerning these types of methods have been developed (Hoorfar et al., 2003; Hoorfar
et al., 2004; ISO, 2005a; ISO, 2005b; ISO, 2006a; ISO, 2006b; ISO, 2011a; ISO, 2011b).
In the past decade, improved PCR assays including, multiplex PCR and qPCR have
been developed for the detection of food-poisoning bacteria, being specificity and
rapidity of the assay greatly improved at present (Kagkli et al., 2011; Kobayashi et al.,
2009).
Although qPCR has many of these advantages with respect to culture methods,
the development of robust and highly reproducible assays require optimization,
standardization and a thorough evaluation performing proficiency tests. These
verifications and assessments are difficult to achieve but they are needed for the
adoption of these protocols in order to be used by the industry (Abdulmawjood et al.,
2004a; Wright et al., 2007). To be completely suitable for implementation as an
analytical tool, the diagnostic accuracy of the PCR-based method must be thoroughly
evaluated and demonstrated. Selectivity and the limit of detection are the most critical
parameters which define the accuracy of a PCR-based assay (Abdulmawjood et al.,
2004b).
Many previous PCR and qPCR methods for detection of Salmonella spp., E. coli
O157 and L. monocytogenes have been developed and applied (Bhagwat, 2004; Calvo
et al., 2008; Fratamico, DebRoy, 2010; Gordillo et al., 2011; Liming, Bhagwat, 2004;
72 Publicaciones
Myint et al., 2006; Oravcova et al., 2007; Paddock et al., 2011; Rantsiou et al., 2008;
Sharma, Dean-Nystrom, 2003) either in simplex or multiplex formats (Elizaquivel,
Aznar, 2008; Germini et al., 2009; Jofre et al., 2005; Kawasaki et al., 2005; Ruiz-Rueda
et al., 2010; Singh, 2011). Recent studies have applied qPCR for multiplex simultaneous
detection of these 3 pathogens (Kim, Bhunia, 2008; Omiccioli et al., 2009; Suo et al.,
2010; Zhang et al., 2009) but an extensive validation has not been performed. In the
development of the present study the “modular approach” for microbial PCR methods
validation was applied (Kagkli et al., 2011).
In this study a multiplex qPCR method for the simultaneous detection of

Salmonella spp., E. coli O157 and L. monocytogenes which fulfills all requirements for
international validation and application in food testing laboratories was developed and
validated. To achieve this goal previously inter-laboratory validated primers and
probes were selected and optimized in a multiplex format with an appropriate Internal
Amplification Control (IAC). Adequate enrichment broth and DNA extraction method
were chosen, and the overall method was pre-validated. Moreover, relative specificity,
sensitivity, dynamic range, qPCR efficiency and limit of detection, as well as relative
accuracy, positive and negative predictive values and the kappa index of concordance
of this procedure were in-house evaluated.
2 Materials and methods
2.1 Bacterial strains and culture media
For the evaluation of modified TA10 broth, S. enterica CECT 4594 (serovar
Typhimurium, serotype 4, 5, 12: i: 1, 2), E. coli O157 CECT 4267 and L. monocytogenes
CECT 935 purchased by the Spanish Type Culture Collection (CECT) were used as
reference strains. The microorganisms were stored frozen at -20 °C. Fresh cultures used
in the present study were obtained by inoculating 10 mL tubes of Tryptic Soy Broth
(TSB, BioMérieux S.A., France) and incubated at 37 °C overnight.
Several Vibrio spp. strains were selected to test the method specificity (Table 1).
These bacteria were grown in 10 mL of Alkaline Peptone Water double strength (SAPW,
73 Publicaciones
Biolife Italiana S.r.l., Italy) and incubated at 37 °C overnight.
Viable reference values of each pathogenic bacterium under study were

calculated. Microorganisms were grown as described above, ten-fold serially diluted in
Buffered Peptone Water (BPW, Biokar diagnostics S.A., France) and plated on Tryptic
Soy Agar (TSA, Biokar diagnostics S.A., France) for S. enterica and E. coli O157 and on
Tryptic Soy Yeast Extract Agar (TSYEA, Biolife Italiana S.r.l., Italy) for L. monocytogenes.
Plates were incubated 18 hours at 37 °C.
Sample enrichment for qPCR analysis was done in TA10 broth, the commercial
name of No.17 broth (Kamisaki-Horikoshi et al., 2011; Kawasaki et al., 2005). This broth
was modified as previously described, being the final composition as follows: tryptose
10.0 g/L, beef extract 5.0 g/ L, yeast extract 5.0 g/ L, sodium chloride 5.0 g/ L, disodium
phosphate 19.3 g/ L, monopotassium phosphate 3.4 g/ L (Garrido et al., 2013;
Omiccioli et al., 2009).
2.2 Enrichment optimization
The enrichment optimization was carried out in 2 consecutive steps. First,

selected broth was evaluated measuring growth kinetics by absorbance to ensure the
suitability of the broth for the growth of the 3 target bacteria. The second step
consisted in the optimization of secondary enrichment time for reduction of the
previously reported 8 hours (Garrido et al., 2013) using thermally stressed and non-
stressed bacteria.
2.2.1 Growth kinetics
The growth kinetics study was performed not only to verify the suitability of
modified TA10 (mTA10) for the growth of the bacteria of interest, both “healthy” and
stressed, but also to evaluate a reduction in the minimum primary enrichment time
determined in a previous study (Garrido et al., 2013). Then, the secondary enrichment
would be further optimized (see Materials and Methods 2.2.2). Two hundred µL of
mTA10 medium were inoculated with 2 µL of the corresponding bacterium, rendering a
final viable count of 10-100 cfu, following ISO 11133-2:2003 recommendations
regarding productivity inocula (ISO, 2003). Growth curves were constructed by
74 Publicaciones
measuring bacterial growth of S. enterica, E. coli O157 and L. monocytogenes at 600

nm, every 15 minutes for 24 hours at 35 °C, in a Falcon 96 well plate. Measurements
were done in a SpectraMax M5 microplate reader (BioNova Científica S.L., Spain).
Concerning stress experiments, overnight enrichment cultures of each target

bacterium were transferred to a new tube, turbidity adjusted to 2 McFarland with
sterile TSB and incubated in a water bath at 60 °C for 1 hour. After heating, tubes were
placed in a beaker with water and ice for 2 minutes. This thermal treatment showed a
constant reduction of 4 log units in the viable bacterial counts (experimentally
determined).
The growth data were fitted to the following logistic model (Guerra et al., 2010):
K
y  y0  umax ·( b t )
1 e
Where “y” and “y0” correspond to the cell load (O.D. at 600 nm) at time t and
zero, respectively; “K” is the global increase of cell load attained in the stationary
phase; “µmax” is the maximum rate of growth (∆O.D. 600 nm h-1) and “b” is the lag
time (h). Kinetic experiments were repeated 4 times for either “healthy” or stressed
bacteria.
2.2.2 Secondary enrichment optimization
For the optimization of the secondary enrichment time “healthy” and thermally
stressed bacteria were prepared as in Materials and Methods 2.1 and 2.2.1.
Twenty-five grams of boiled frozen mussels were spiked with 10-100 cfu of either
stressed or non-stressed bacteria and then 225 mL of mTA10 were added. This mixture
was homogenized for 1 minute in a stomacher at normal speed and incubated 22 ± 2
hours at 35 °C. After incubation, 1 mL of the enrichment broth was transferred to a
tube containing 10 mL of fresh mTA10 medium which was re-incubated at 35 °C.
Aliquots from time 0 to 8 were taken every hour and analyzed by multiplex qPCR.
2.3 DNA extraction methods
75 Publicaciones
2.3.1 DNA extraction from Vibrio spp. pure cultures
DNA extraction of all Vibrio spp. strains selected for this study was done as
previously reported (Blanco-Abad et al., 2009; Garrido et al., 2012a). Briefly, overnight
cultures of each strain were sedimented by centrifugation, pellets were washed and re-
suspended in Tris-EDTA (TE) 1 X and boiled for 10 minutes. Finally, they were
centrifuged again and supernatant, containing DNA, was stored at -20 °C until use.
2.3.2 DNA extraction from target bacteria and from food samples
Guanidium thiocyanate DNA extraction method (lysis-GuSCN) (Kawasaki et al.,

2005) was applied with slight modifications previously described (Garrido et al., 2013).
This method was also used for the obtention of DNA from pure cultures of S. enterica,
E. coli O157 and L. monocytogenes in the enrichment time optimization experiments
and for the evaluation of the qPCR efficiency.
2.4 Target genes, primers and probes for qPCR
Detection of each pathogenic bacterium was achieved by targeting specific

genes. For Salmonella spp. the invA gene was selected and primers and probe
previously validated by Cheng et al. were selected (Cheng et al., 2008; Cheng et al.,
2009). Detection of E. coli O157 was carried out targeting the rfbE gene with the
primers and probe developed by Perelle et al. (Perelle et al., 2004). Finally, detection
of L. monocytogenes was achieved targeting prfA gene by using primers and probe
previously developed and validated (D'Agostino et al., 2004; Rossmanith et al., 2006;
Simon et al., 1996). Internal control based on chimerical DNA was selected to monitor
qPCR reaction (Calvo et al., 2008). Genes, primers and probes used in this study are
gathered in Table 2.
2.5 Multiplex qPCR detection method for Salmonella spp., E. coli O157 and L.
monocytogenes
76 Publicaciones
The qPCR reaction was carried out in a final volume of 50 µL with the following
components: 30 µL Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Inc.,
USA), 300 nM primers and 50 nM probe for Salmonella spp., 75 nM primers and 45 nM
probe for E. coli O157; 500 nM primers and 250 nM probe for L. monocytogenes.
Regarding the IAC, 75 nM primers, 45 nM probe and 8 x 10 2 copies of IAC DNA were
added per reaction.
Two µL of template DNA were added per reaction tube. Stratagene Mx3005p
thermocycler (Agilent Technologies, Inc., USA) was programmed with the following
thermal profile: 3 minutes at 95 °C for the activation of the polymerase (Hot Start),
followed by 40 cycles, each one consisting on a denaturation step of 15 seconds at 94
°C and annealing-extension step at 64 °C for 60 seconds.
2.6 qPCR method evaluation
2.6.1 qPCR efficiency
QPCR efficiency was calculated using overnight pure cultures of S. enterica, E. coli
O157 and L. monocytogenes incubated at 37 °C in 10 mL of TSB. DNA of each
bacterium was extracted with the lysis-GuSCN method and measured with a NanoDrop
1000 spectrophotometer. For simplex qPCR efficiency calculation, DNA from each
bacterium was ten-fold serially diluted in sterile milli-Q water. When evaluating
multiplex qPCR efficiency, DNA from all 3 bacteria were mixed in equal concentrations,
ten-fold serially diluted and analyzed by adding 2 µL of each dilution as template. All
experiments, either for simplex or multiplex qPCR were performed in triplicate.
The Mx3005pro software automatically calculates the standard curve for each
run based on the Cycle threshold (Ct) of each standard. The formula from which the
amplification efficiency was calculated was e=10-1/s-1 (Kawasaki et al., 2010), where “s”
is the slope of the standard curve.
2.6.2 Evaluation of the Limit of Detection (LOD) in food samples by qPCR
Evaluation of the LOD was performed as previously described (Garrido et al.,
77 Publicaciones
2012a; Garrido et al., 2012b). Briefly, 10 samples were inoculated with low
concentration of S. enterica, E. coli O157 and L. monocytogenes. As an acceptance
criterion 90 % of positive results must be achieved.
All 3 target bacteria were grown individually by an overnight incubation at 37 °C

in 10 mL TSB. Turbidity of all pathogens was adjusted to 0.5 – 2 McFarland with sterile
TSB. Ten-fold serial dilutions were done in BPW to reach a final concentration ranging
from 1.5 to 6 cfu/ mL. These dilutions were plated on TSA, for S. enterica and E. coli
O157 and in TSYEA for L. monocytogenes, to get a reference value of viable bacteria
after incubation at 37 °C for 18 ± 2 hours. The qPCR method consisted of the
enrichment of 25 g of sample in 225 mL mTA10 broth at 35 °C for 22 ± 2 hours. After
primary enrichment, 1 mL was transferred to a tube containing 10 mL of new mTA10
broth and further incubated for a minimum of 5 hours at 35 °C. After incubation, 1 mL
was taken for DNA extraction, and 2 µL as template for qPCR.
2.6.3 Estimation of Relative Sensitivity, Relative Specificity, Relative Accuracy, Positive

and Negative Predictive Value and Index Kappa of concordance of the qPCR method
With the data obtained from the LOD, additional spiked and blind samples
(previously analyzed by traditional plating or alternative methods as VIDAS BioMérieux
S.A., France), relative sensitivity (SE), relative specificity (SP), relative accuracy (AC),
positive and negative predictive values (PPV and NPV) and kappa index of concordance
(ĸ) of the method were calculated by comparing results obtained by qPCR with
expected results. All mentioned parameters were calculated as previously described
(Anderson et al., 2011; Tomas et al., 2009). All samples were kept in the same
conditions as received until analysis (room temperature, refrigerated or frozen).
2.7 Statistical analysis
Data obtained for stressed and non-stressed bacterial kinetics regarding “K”,
“µmax” and “b”, were compared applying Mann-Whitney U-test. Analysis were
performed with SPSS 15.0 software (SPSS Inc., Chicago, IL, USA).
78 Publicaciones
3 Results
3.1 Specificity
The qPCR analysis did not show positive signal with any of the 3 targets (invA,
rfbE and prfA) for any of the Vibrio spp. strains selected, as expected. Correct
amplification of the optimized IAC selected was observed with all strains. Results are
shown in Table 1.
3.2 Enrichment optimization
3.2.1 Growth kinetics
Evaluation of the optimization of the enrichment broth was accomplished using

stressed and non-stressed bacteria to ensure suitability of the broth for the recovery of
the microorganisms of interest. Growth curves demonstrated that the enrichment
broth is suitable for all 3 bacteria selected in the present study.
Statistical analysis with Mann-Whitney U-test showed no statistical differences (p

>0.05) between thermally stressed and non-stressed bacteria for all variables analyzed
(“K”, “µmax” and “b”). Data are summarized in Table 3.
3.2.2 Secondary enrichment
Evaluation of results was carried out taking into account, the Ct values obtained
for each sample, and also the final fluorescence signal. Results obtained for non-
stressed S. enterica and E. coli O157 showed consistent positive values at all times
analyzed, including the direct food matrix, obtaining Ct values lower than 25 and final
fluorescence higher than 8000 and 2000 respectively. Only a slight delay was observed
at time 0, where a Ct value of 24 was recorded. In contrast, all other samples showed
values lower than 22. In the case of L. monocytogenes, even though direct detection
was observed from food matrix, more consistent results were observed after 5 hours
79 Publicaciones
of secondary enrichment, since all samples showed Ct values lower than 35 with a final
fluorescence signal higher than 1000.
When aliquots taken from stressed samples were analyzed, for S. enterica and E.
coli O157 a general delay in the Ct value was observed although the same results were
obtained with non-stressed bacteria. Regarding L. monocytogenes, a generalized delay
in Ct values was obtained, thus not making possible a reliable detection before 5 hours
of secondary enrichment.
3.3.1 qPCR efficiency
Three replicates were done for the efficiency evaluation of each simplex and
multiplex qPCR method. All 3 microorganisms returned correct amplification
efficiencies, between 91.8 % and 107.1%, with high correlation coefficients, above
0.997, for simplex and multiplex qPCR. These efficiency results were successfully
obtained covering 5 orders of magnitude. Results for each individual bacterium as well
as the multiplex format, are detailed in Table 4.
3.3.2 Evaluation of the Limit of Detection (LOD)
Viable bacteria reference values were calculated as described in Materials and

Methods paragraph 2.1. Reference values obtained indicated a level of viable S.
enterica, E. coli O157 and L. monocytogenes of 5 cfu/ mL for each pathogen. All 10
spiked samples returned clear positive results after 5 hours of secondary enrichment,
with Ct values lower than 25 for S. enterica and E. coli O157, with final fluorescence
higher than 2000. Ct values were lower than 35 with final fluorescence higher than
1000 for L. monocytogenes. IAC showed consistent positive Ct values between 30 and
35. Thus the LOD for the method was established at 5 cfu/ 25 g for all 3
microorganisms.
80 Publicaciones
3.3.3 Estimation of Relative Sensitivity, Relative Specificity, Relative Accuracy, Positive

and Negative Predictive Value and Index Kappa of concordance of the qPCR method
Few discrepant results concerning Salmonella spp. and L. monocytogenes were

obtained. Out of the 152 samples analyzed only 5 Negative Deviations (ND) were
obtained for Salmonella spp.; and 3 Positive Deviations (PD) and 6 ND were observed
for L. monocytogenes. No discrepant results were detected for E. coli O157. Results
obtained for all food samples analyzed are listed in Table 5.
Method quality parameters were calculated from all spiked and blind samples
previously mentioned, obtaining values above 90 % for the 3 pathogens. Results are
listed in Table 6.
4. Discussion
qPCR development has revolutionized molecular biology and an extensive

number of applications have been carried out, both for research and clinical diagnosis
(Raymaekers et al., 2009). qPCR offers additional speed, sensitivity and specificity over
traditional PCR methods (Chapela et al., 2010; Elizaquivel et al., 2010). Its application in
multiplex format increases the number of pathogens that can be analyzed in the same
reaction, and reduces costs (Elizaquivel, Aznar, 2008; Ruiz-Rueda et al., 2010).
However, there is some uncertainty about the reliable performance of qPCR due to the
lack of harmonized or validated protocols (Bustin et al., 2009; Rossmanith, Wagner,
2011). It has been shown that a cautious selection of the enrichment medium,
combined with a proper DNA extraction method improves the detection of food-borne
pathogens by qPCR (Martin et al., 2012; Taskila et al., 2012). The majority of these
qPCR applications are noncommercial and in-house developed open assays, being
standardization and quality assurance required for molecular diagnostics (Raymaekers
et al., 2009).
Even though in recent years many PCR and qPCR methods have been developed,
only a few have undergone a complete validation for its application in food
laboratories (Abdulmawjood et al., 2003; Lofstrom et al., 2010; Tomas et al., 2009).
81 Publicaciones
This number is even lower and not always easily available when a multiplex format is
desired (Kawasaki et al., 2010). This lack of validated PCR and qPCR methods could be
due to the fact that this type of methods are not recognized as official, neither in
Europe nor in many other parts of the world, where traditional culture methods are
still the gold standard in food microbiology. Furthermore, microbiological legislation
from many countries do not even consider the possibility of applying PCR-based
methods, or any other alternative, as official, for pathogens screening as it can be
outlined from current European legislation and its amendments ((EC), 2005; (EC),
2007; (EC), 2010; (EU), 2011).
Genes selected for each pathogen in the present study were previously proposed
as optimal by previous authors for individual detection. The invasion gene, invA,
involved in the internalization of the bacterium in mammalian epithelial cells was
selected for Salmonella spp. For E. coli O157 the rfbE gene, which is the fifth gene of
the rfb gene cluster, coding for the O-antigen and known to be specific for E. coli O157,
was used. Regarding L. monocytogenes, the prfA gene, which is the central virulence
gene regulator was targeted (Abdulmawjood et al., 2003; Cheng et al., 2008;
D'Agostino et al., 2004). In the present report inter-laboratory validated primers and
probes were selected for multiplex qPCR detection of Salmonella spp., (Cheng et al.,
2008; Cheng et al., 2009) and L. monocytogenes, (D'Agostino et al., 2004; Rossmanith
et al., 2006; Simon et al., 1996).
However, E. coli O157 primers and probe selected (Perelle et al., 2004) have not
gone through a complete inter-laboratory validation procedure, although a modular
approach validation was previously described (Kagkli et al., 2011). Furthermore, the
gene selected, rfbE, was also proposed as optimal for this bacterium detection, and
selected in previous studies for PCR detection method validation (Abdulmawjood et
al., 2003; Abdulmawjood et al., 2004a; Abdulmawjood et al., 2004b). Even though their
specificity and extensive application, no previous study has tested their specificity
against Vibrio spp., a genus that is known to posses the rfbE gene (Abdulmawjood et
al., 2003). In the present study the specificity of primers and probe targeting rfbE gene,
described by Perelle et al. 2004 was demonstrated against a panel of 18 Vibrio spp.
from 5 different species (Table 1). It was concluded from this and previous studies
82 Publicaciones
(Kagkli et al., 2011) that primers and probe developed by Perelle et al. in 2004 are
suitable for a deeper validation study. Concerning the IAC, the system was extensively
applied in several qPCR detection methods (Calvo et al., 2008; Garrido et al., 2012a;
Garrido et al., 2012b). Overall the complete system with selected primers and probes
was considered reliable for specific detection of Salmonella spp., E. coli O157 and L.
monocytogenes with correct control of qPCR reaction by an exogenous IAC.
The enrichment broth selected (TA10) was previously developed and thoroughly
evaluated (Kawasaki et al., 2005), proving suitable for the recovery of these 3 bacteria
from previously frozen foods (Kawasaki et al., 2009). From independent studies this
broth gave better results than BLEB (Buffered Listeria Enrichment Broth), SEL (Kim,
Bhunia, 2008), TSB and UPB (Universal Pre-enrichment Broth) for the enrichment of L.
monocytogenes in foods (Gehring et al., 2012; Kawasaki et al., 2005). Original
formulation was modified according to later studies where it was re-formulated and
evaluated again in vitro and with different foods (Garrido et al., 2013; Horikoshi et al.,
2008; Omiccioli et al., 2009).
The enrichment time was optimized by monitoring individual growth of each

bacterium, both in optimal and heat-stressed conditions. No statistical differences (p
>0.05) were observed for any of the parameters analyzed, see Table 3 (the global
increase, the maximum rate of growth and the lag time). These results indicate that
selected broth allows the recovery of thermally injured bacteria. Considering the 3
parameters analyzed in this section, the lag time was the most important. Reduction,
or not increasing, in lag time improves the use of starter cultures and the recovering of
bacteria from food and environmental samples (Robinson et al., 1998). In the present
study this effect is enhanced by the addition of the 5 hour-secondary enrichment.
Regarding this secondary enrichment, after analyzing the direct food matrix in
mTA10 and 1 aliquot every hour, up to 8 hours, it was observed that this step is not
necessary to detect Salmonella spp. and/ or E. coli O157. Although this step is highly
recommended for detection of low numbers of L. monocytogenes. These results
proved that the secondary enrichment time may be reduced from 8 hours, previously
reported (Garrido et al., 2013), to only 5 hours. Furthermore, if L. monocytogenes
83 Publicaciones
detection was not requested in the analysis, direct detection of Salmonella spp. and E.
coli O157 may be achieved from the primary enrichment, even though it was observed
that after 5 hours of enrichment, Ct and final fluorescence results are clearer.
The DNA extraction method selected has been extensively applied, and its
advantages over other protocols has also been reported previously (Garrido et al.,
2013; Germini et al., 2009; Horikoshi et al., 2008; Kawasaki et al., 2009; Kawasaki et al.,
2010; Kawasaki et al., 2005; Mahmuda Y., 2007).
The analysis of the method developed indicated that the combination of the
primers and probes selected with the IAC, maintained expected efficiency between 90
% and 110 % (Raymaekers et al., 2009) covering 5 orders of magnitude and a high
correlation coefficient above 0.997 (Table 4). All parameters analyzed to test the
method (SE, SP, AC, PPV, NPV and ĸ) yielded values higher than 90 % demonstrating the
high quality of the method developed. Out of the 152 samples analyzed only few
discrepancies were detected, 5 ND for Salmonella spp., which were associated either
with previously analyzed samples which were submitted to several freezing and
thawing steps (previous authors have reported a reduction in bacterial viability after
freezing and thawing (Archer, 2004; Keener et al., 2004)) or DNA extracts which were
stored for long periods of time (more than 5 months). The same situation happened
with the 6 ND found for L. monocytogenes. Regarding the 3 PD detected for L.
monocytogenes, may be due to a lack of homogeneity in the samples since there are
no previous reports indicating any cross reactivity. Even though the highest numbers of
deviations were found for L. monocytogenes, the results obtained for SE, SP and AC are
in agreement with those previously reported for selected primers and probe, as no
significant differences were observed (original studies indicated values of 94.2 %, 100
% and 97.5 % respectively) (Rossmanith et al., 2006; Rossmanith et al., 2010).
“ĸ” values indicated the fidelity of the method since values between 81 % and
100 % correspond to a “very good concordance” (Anderson et al., 2011; Cheng et al.,
2009; DG, 1991).
5. Conclusions
84 Publicaciones
The complete multiplex qPCR method developed and in-house validated in this
study showed high sensitivity, specificity, accuracy and achieved a low limit of
detection (5 cfu/ 25g for each pathogen). This design constitutes a robust, fast and
reliable method that can be applied for screening of Salmonella spp., E. coli O157 and
L. monocytogenes even for thermally stressed bacteria, in a wide variety of foods and
feeding stuffs. It is also suitable for extensive application by the food industry,
reducing time and money, compared to other methods.
Acknowledgements
This work is financially supported by the Secretary General for the Sea of the
Spanish Ministry of Agricultural, Land and Marine Resources (MARM), by order
ARM/1193/2009.
Authors also thank Victoria Docampo and Angeles Marcote for technical
assistance.
85 Publicaciones
Tables
Table 1. Bacterial strains selected for specificity

Microorganism Strain invA rfbE prfA IAC
V. cholerae CECT 514 (O1) – – – +
V. cholerae CCUG 47460 (O139) – – – +
V. parahaemolyticus CCUG 43362 – – – +
V. parahaemolyticus CECT 5271 – – – +
V. parahaemolyticus CECT511 – – – +
V. parahaemolyticus CAIM 58 – – – +
V. alginolyticus * – – – +
V. alginolyticus CECT 586 – – – +
V. alginolyticus CAIM 342 – – – +
V. mimicus BCCM/ LMG 7896 – – – +
V. mimicus CECT 4218 – – – +
V. vulnificus CECT 4608 – – – +
V. vulnificus CAIM 611 – – – +
CECT: Spanish Type Culture Collection, CCUG: Culture Collection University of Göteborg, CAIM: Collection of
Aquatic Important Microorganisms, BCCM/ LMG: Belgian Co-Orfinated Collections of Micro-Organisms.
*Strain isolated in our laboratory.
IAC: Internal Amplification Control. “+/-“: indicates positive/ negative qPCR signal.
86 Publicaciones
Table 2. Primers and probes for multiplex qPCR detection of Salmonella spp., E. coli O157 and L. monocytogenes.
Microorganism Gene Primer/ probe Sequence (5’ to 3’) Modifications Reference
invA3F AACGTGTTTCCGTGCGT -
AAT
Salmonella invA invA3R TCCATCAAATTAGCGGA - (Cheng et al.,

GGC 2008)
invA Probe1 TGGAAGCGCTCGCATT 5’-/56-FAM/ /3BHQ_1 /-3’

GTGG
rfbE F TTTCACACTTATTGGAT -
GGTCTCAA
E. coli O157 rfbE rfbE R CGATGAGTTTATCTGCA - (Perelle et al.,

AGGTGAT 2004a)
rfbE probe AGGACCGCAGAGGAAA 5’-/5TYE665/ /3IAbRQSp /-3’

GAGAGGAATTAAGG
LIP1 GATACAGAAACATCGG -
TTGGC
L. monocytogenes prfA LIP2 GTGTAATCTTGATGCCA - (Rossmanith

TCAGG et al., 2006)
LIP3 CAGGATTAAAAGTTGA 5’-/5HEX / /3IABkFQ /-3’

CCGCA
IAC - IAC forward TCCAGGGCGAAAGTAA -

ACGT
IAC - IAC reverse GGCGAGCCGTACGAAC - (Calvo et al.,

AC 2008)
IAC - IAC probe CCCAGTTGGCTGATCAC 5’-/5TexRd-XN/ /3BHQ_2/-3’

TTTCG
TYE665: is a trademark of IDT, it can be used as a substitute of Cy5. IABkFQ and IAbRQSp: are trademarks of IDT and stands for Iowa
Black Flurophore Quencher, they differ in their absorbance spectre.
87 Publicaciones
Table 3. Growth kinetic results for thermally stressed and non-stressed bacteria
Microorganism Thermal treatment K µmax b
NS 0.437 ± 0.016 0.607 ± 0.055 14.7 ± 0.4

S. enterica
S 0.463 ± 0.040 0.530 ± 0.037 15.7 ± 1.6
NS 0.312 ± 0.050 1.014 ± 0.243 12.6 ± 0.4

E. coli O157
S 0.376 ± 0.038 0.723 ± 0.211 12.5 ± 0.8
NS 0.155 ± 0.011 0.926 ± 0.155 18.0 ± 0.9

L. monocytogenes
S 0.156 ± 0.020 0.782 ± 0.210 17.3 ± 2.4
“K”: global increase of cell load attained in the stationary phase. “µmax”: maximum rate of
growth. “b”: lag time measured in hours. NS: Non-Stressed, S: thermally Stressed
Table 4. qPCR Simplex and Multiplex Efficiency

Simplex Multiplex
2 2
Efficiency Slope R Efficiency Slope R
S. enterica 107.1 ± 2.5 -3.163 ± 0.052 0.998 ± 0.001 91.8 ± 1.6 -3.536 ± 0.044 0.999 ± 0.001
E. coli O157 104.7 ± 4.2 -3.212 ± 0.095 0.998 ± 0.001 96.4 ± 3.5 -3.413 ± 0.090 0.999 ± 0.001
L. monocytogenes 98.5 ± 8.6 -3.370 ± 0.206 0.997 ± 0.004 93.9 ± 2.7 -3.478 ± 0.073 0.999 ± 0.001
All values are averages of three independent replicates
88 Publicaciones
Table 5. Results obtained for blind and spiked samples in the evaluation of the method
Food Type Bld/ Spk N Salmonella spp. E. coli O157 L. monocytogenes
PA PD NA ND PA PD NA ND PA PD NA ND
Bivalves 6/ 20 26 15 0 6 5 0 0 26 0 17 0 6 3
Cephalopods 4/ 0 4 0 0 4 0 0 0 4 0 0 0 4 0
Fish 19/ 2 21 0 0 21 0 0 0 21 0 4 2 13 2
Crustaceans 4/ 0 4 0 0 4 0 0 0 4 0 0 0 4 0
Meat 12/ 5 17 2 0 15 0 2 0 15 0 5 0 12 0
Water 6/ 0 6 0 0 6 0 0 0 6 0 1 0 5 0
b
Byproducts 11/ 0 11 1 0 10 0 0 0 11 0 0 0 11 0
Vegetables 4/ 1 5 1 0 4 0 0 0 5 0 1 0 4 0
Ready-to-eat 13/ 30 43 21 0 22 0 17 0 26 0 31 0 11 1
Proficiency test 4/ 0 4 2 0 2 0 0 0 4 0 2 1 1 0
a
Boiled mussels 1/ 10 11 10 0 1 0 10 0 1 0 10 0 1 0
a b
Samples used for LOD calculation. Byproducts analyzed consisted on fishmeal. N: represents the total number of samples
including blind and spiked. Bld: Blind samples, Spk: Spiked samples. PA: Positive Agreement, PD: Positive Deviation, NA: Negative
Agreement, ND: Negative Deviation.
Table 6. Summary of samples analyzed and results of quality parameters of the method
a a a a b b b b b b
PA NA PD ND SE SP AC PPV NPV ĸ
Salmonella spp. 52 95 0 5 91 100 97 100 95 93
E. coli O157 29 123 0 0 100 100 100 100 100 100
L. monocytogenes 71 72 3 6 92 97 96 96 92 94
a b
Values are the sum of those obtained for each type of food. Values are expressed as percentage. PA:
Positive Agreement, NA: Negative Agreement, PD: Positive Deviation, ND: Negative Deviation, SE: Relative
Sensitivity, SP: Relative Specificity, AC: Relative Accuracy, PPV: Positive Predictive Value, NPV: Negative
Predictive Value, ĸ: Kappa Index of Concordance
89 Publicaciones
Bibliography
(EC), C.R. 2005. Microbiological criteria for foodstuffs, vol. 2073/2005. Official Journal of the
European Union.
(EC), C.R. 2007. amending Regulation (EC) No 2073/2005 on microbiological criteria for
foodstuffs, vol. 1441/2007. Official Journal of the European Union.
(EC), C.R. 2010. amending Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs
as regards Enterobacteriaceae in pasteurised milk and other pasteurised liquid dairy products and
Listeria monocytogenes in food grade salt., vol. 365/2010. Official Journal of the European Union.
(EU), C.R. 2011. amending Annex II to Regulation (EC) No 2160/2003 of the European Parliament
and of the Council and Annex I to Commission Regulation (EC) No 2073/2005 as regards salmonella in
fresh poultry meat, vol. 1086/2011. Official Journal of the European Union.
Abdulmawjood, A., Bulte, M., Cook, N., Roth, S., Schonenbrucher, H., Hoorfar, J. 2003. Toward an
international standard for PCR-based detection of Escherichia coli O157 - Part 1. Assay development and
multi-center validation. Journal of Microbiological Methods 55, 775-786.
Abdulmawjood, A., Bulte, M., Roth, S., Schonenbrucher, H., Cook, N., D'Agostino, M., Malorny, B.,
Jordan, M., Pelkonen, S., Hoorfar, J. 2004a. Toward an international standard for PCR-based detection of
foodborne Escherichia coli O157: Validation of the PCR-based method in a multicenter interlaboratory
trial. Journal of Aoac International 87, 856-860.
Abdulmawjood, A., Bulte, M., Roth, S., Schonenbrucher, H., Cook, N., Heuvelink, A.E., Hoorfar, J.
2004b. Development, validation, and standardization of polymerase chain reaction-based detection of E.
coli O157. Journal of Aoac International 87, 596-603.
Anderson, A., Pietsch, K., Zucker, R., Mayr, A., Muller-Hohe, E., Messelhausser, U., Sing, A., Busch,
U., Huber, I. 2011. Validation of a Duplex Real-Time PCR for the Detection of Salmonella spp. in Different
Food Products. Food Analytical Methods 4, 259-267.
Archer, D.L. 2004. Freezing: an underutilized food safety technology? International Journal of
Food Microbiology 90, 127-138.
Bhagwat, A.A. 2004. Rapid detection of Salmonella from vegetable rinse-water using real-time
PCR. Food Microbiology 21, 73-78.
Blanco-Abad, V., Ansede-Bermejo, J., Rodriguez-Castro, A., Martinez-Urtaza, J. 2009. Evaluation

of different procedures for the optimized detection of Vibrio parahaemolyticus in mussels and
environmental samples. International Journal of Food Microbiology 129, 229-236.
Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T.,
Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T. 2009. The MIQE Guidelines: Minimum
Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry 55, 611-622.
Calvo, L., Martinez-Planells, A., Pardos-Bosch, J., Garcia-Gil, L.J. 2008. A New Real-Time PCR Assay
for the Specific Detection of Salmonella spp. targeting the bipA Gene. Food Analytical Methods 1, 236-
242.
90 Publicaciones
CDC. 2011. Investigation Update: Multistate Outbreak of E. coli O157:H7 Infections Associated
with In-shell Hazelnuts [Online]. Available at http://www.cdc.gov/ecoli/2011/hazelnuts0157/.
CDC. 2012a. Cholera and Other Vibrio Illness Surveillance System [Online]. Available at
http://www.cdc.gov/nationalsurveillance/cholera_vibrio_surveillance.html.
CDC. 2012b. Multistate Outbreak of Human Salmonella Montevideo Infections Linked to Live
Poultry [Online]. Available at http://www.cdc.gov/salmonella/montevideo-06-12/index.html.
Chapela, M.J., Fajardo, P., Garrido, A., Cabado, A.G., Ferreira, M., Lago, J., Vieites, J.M. 2010.
Comparison between a TaqMan Polymerase Chain Reaction Assay and a Culture Method for ctx-Positive
Vibrio cholerae Detection. Journal of Agricultural and Food Chemistry 58, 4051-4055.
Cheng, C.M., Lin, W., Van, K.T., Phan, L., Tran, N.N., Farmer, D. 2008. Rapid Detection of
Salmonella in Foods Using Real-Time PCR. Journal of Food Protection 71, 2436-2441.
Cheng, C.M., Van, K.T., Lin, W., Ruby, R.M. 2009. Interlaboratory Validation of a Real-Time PCR
24-Hour Rapid Method for Detection of Salmonella in Foods. Journal of Food Protection 72, 945-951.
D'Agostino, M., Wagner, M., Vazquez-Boland, J.A., Kuchta, T., Karpiskova, R., Hoorfar, J., Novella,
S., Scortti, M., Ellison, J., Murray, A., Fernandes, I., Kuhn, M., Pazlarova, J., Heuvelink, A., Cook, N. 2004.
A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food model -
Towards an international standard. Journal of Food Protection 67, 1646-1655.
DG, A. 1991. Practical statistics for medical research, New York.
EFSA. 2012. THE EUROPEAN UNION SUMMARY REPORT. Trends and Sources of Zoonoses and
Zoonotic Agents and Food-borne Outbreaks in 2010. European Food Safety Authority. 442.
Elizaquivel, P., Aznar, R. 2008. A multiplex RTi-PCR reaction for simultaneous detection of
Escherichia coli O157 : H7, Salmonella spp. and Staphylococcus aureus on fresh, minimally processed
vegetables. Food Microbiology 25, 705-713.
Elizaquivel, P., Gabaldon, J.A., Aznar, R. 2010. Quantification of Salmonella spp, Listeria
monocytogenes and Escherichia coli O157 H7 in non-spiked food products and evaluation of real-time
PCR as a diagnostic tool in routine food analysis. Food Control 22, 158-164.
Fratamico, P.M., DebRoy, C. 2010. Detection of Escherichia coli O157:H7 in Food Using Real-Time
Multiplex PCR Assays Targeting the stx(1), stx(2), wzy(O157), and the fliC(h7) or eae Genes. Food
Analytical Methods 3, 330-337.
Garrido, A., Chapela, M.-J., Román, B., Fajardo, P., Lago, J., Vieites, J.M., Cabado, A.G. 2013. A
new multiplex real-time PCR developed method for Salmonella spp. and Listeria monocytogenes
detection in food and environmental samples. Food Control 30, 76-85.
Garrido, A., Chapela, M.J., Ferreira, M., Atanassova, M., Fajardo, P., Lago, J., Vieites, J.M., Cabado,
A.G. 2012a. Development of a multiplex real-time PCR method for pathogenic Vibrio parahaemolyticus
detection (tdh+ and trh+). Food Control 24, 128-135.
Garrido, A., Chapela, M.J., Roman, B., Ferreira, M., Lago, J., Vieites, J.M., Cabado, A.G. 2012b.
Development of a multiplex real-time PCR method for simultaneous detection of Salmonella enterica,
Shigella flexneri and Listeria monocytogenes in processed food samples. European Food Research and
Technology 234, 571-580.
91 Publicaciones
Gehring, A.G., Albin, D.M., Bhunia, A.K., Kim, H., Reed, S.A., Tu, S.-I. 2012. Mixed culture
enrichment of Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica, and Yersinia
enterocolitica. Food Control 26, 269-273.
Germini, A., Masola, A., Carnevali, P., Marchelli, R. 2009. Simultaneous detection of Escherichia
coli O175:H7, Salmonella spp., and Listeria monocytogenes by multiplex PCR. Food Control 20, 733-738.
Gordillo, R., Cordoba, J.J., Andrade, M.J., Isabel Luque, M., Rodriguez, M. 2011. Development of
PCR assays for detection of Escherichia coli O157:H7 in meat products. Meat Science 88, 767-773.
Guerra, P., Nelson, Fajardo, P., Fucinos, C., Rodriguez Amado, I., Alonso, E., Torrado, A., Pastrana,
L. 2010. Modelling the Biphasic Growth and Product Formation by Enterococcus faecium CECT 410 in
Realkalized Fed-Batch Fermentations in Whey. Journal of Biomedicine and Biotechnology.
Hoorfar, J., Cook, N., Malorny, B., Wagner, M., De Medici, D., Abdulmaajood, A., Fach, P. 2003.
Making internal amplification control mandatory for diagnostic PCR. Journal of Clinical Microbiology 41,
5835-5835.
Hoorfar, J., Malorny, B., Abdulmawjood, A., Cook, N., Wagner, M., Fach, P. 2004. Practical
considerations in design of internal amplification controls for diagnostic PCR assays. Journal of Clinical
Microbiology 42, 1863-1868.
Horikoshi, N., Kawasaki, S., Okada, Y., Takeshita, K., Sameshima, T., Kawamoto, S., Isshiki, K. 2008.
Method of Multiplex Microorganism detection. 15.
Hyeon, J.Y., Hwang, I.G., Kwak, H.S., Park, C., Choi, I.S., Seo, K.H. 2010. Evaluation of PCR
inhibitory effect of enrichment broths and comparison of DNA extraction methods for detection of
Salmonella Enteritidis using real-time PCR assay. Journal of Veterinary Science 11, 143-149.
ISO. 2003. Microbiology of food and animal feeding stuffs -- Guidelines on preparation and
production of culture media -- Part 2: Practical guidelines on performance testing of culture media vol.
11133-2. 27.
ISO. 2005a. Microbiology of food and animal feeding stuffs -- Polymerase chain reaction (PCR) for
the detection of food-borne pathogens-- Performance testing for thermal cyclers vol. 20836. 21.
ISO. 2005b. Microbiology of food and animal feeding stuffs -- Polymerase chain reaction (PCR) for
the detection of food-borne pathogens. General requirements and definitions vol. 22174. 19.
ISO. 2006a. Microbiology of food and animal feeding stuffs -- Polymerase chain reaction (PCR) for
the detection of food-borne pathogens -- Requirements for amplification and detection for qualitative
methods, vol. 20838. 15.
ISO. 2006b. Microbiology of food and animal feeding stuffs -- Polymerase chain reaction (PCR) for
the detection of food-borne pathogens -- Requirements for sample preparation for qualitative
detection, vol. 20837. 15.
ISO. 2011a. Microbiología de los alimentos para consumo humano y animal -- Reacción en cadena
de la polimerasa (PCR) para la detección y cuantificación de patógenos en los alimentos. Características
de funcionamiento, vol. 22118. 16.
92 Publicaciones
ISO. 2011b. Microbiología de los alimentos para consumo humano y animal -- Reacción en
cadena de la polimerasa (PCR) para la detección y cuantificación de patógenos en los alimentos.
Requisitos generales y definiciones, vol. 22119. 18.
Jofre, A., Martin, B., Garriga, M., Hugas, M., Pla, M., Rodriguez-Lazaro, D., Aymerich, T. 2005.
Simultaneous detection of Listeria monocytogenes and Salmonella by multiplex PCR in cooked ham.
Kagkli, D.M., Weber, T.P., Van den Bulcke, M., Folloni, S., Tozzoli, R., Morabito, S., Ermolli, M.,
Gribaldo, L., Van den Eede, G. 2011. Application of the Modular Approach to an In-House Validation
Study of Real-Time PCR Methods for the Detection and Serogroup Determination of Verocytotoxigenic
Escherichia coli. Applied and Environmental Microbiology 77, 6954-6963.
Kamisaki-Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., Kawasaki, S., Kawamoto, S.,
Fratamico, P.M. 2011. Evaluation of TA10 Broth for Recovery of Heat- and Freeze-Injured Salmonella
from Beef. Journal of Aoac International 94, 857-862.
Kawasaki, S., Fratamico, P.M., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., Kawamoto,
S. 2009. Evaluation of a Multiplex PCR System for Simultaneous Detection of Salmonella spp., Listeria
monocytogenes, and Escherichia coli O157:H7 in Foods and in Food Subjected to Freezing. Foodborne
Pathogens and Disease 6, 81-89.
Kawasaki, S., Fratamico, P.M., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., Kawamoto,
S. 2010. Multiplex Real-Time Polymerase Chain Reaction Assay for Simultaneous Detection and
Quantification of Salmonella Species, Listeria monocytogenes, and Escherichia coli O157:H7 in Ground
Pork Samples. Foodborne Pathogens and Disease 7, 549-554.
Kawasaki, S., Horikoshi, N., Okada, Y., Takeshita, K., Sameshima, T., Kawamoto, S. 2005. Multiplex
PCR for simultaneous detection of Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:
H7 in meat samples. Journal of Food Protection 68, 551-556.
Keener, K.M., Bashor, M.P., Curtis, P.A., Sheldon, B.W., Kathariou, S. 2004. Comprehensive review
of Campylobacter and poultry processing. Comprehensive Reviews in Food Science and Food Safety 3,
105-116.
Kim, H.C., Bhunia, A.K. 2008. SEL, a selective enrichment broth for simultaneous growth of
Salmonella enterica, Escherichia coli O157: H7, and Listeria monocytogenes. Applied and Environmental
Kobayashi, H., Kubota, J., Fujihara, K., Honjoh, K., Ito, M., Fujiki, N., Nakabe, M., Oda, S.,
Satoyama, T., Takasu, K., Nakanishi, H., Miyamoto, T. 2009. Simultaneous Enrichment of Salmonella spp,
Escherichia coli O157:H7, Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus, and Listeria
monocytogenes by Single Broth and Screening of the Pathogens by Multiplex Real-time PCR. Food
Science and Technology Research 15, 427-438.
Liming, S.H., Bhagwat, A.A. 2004. Application of a molecular beacon - real-time PCR technology to
detect Salmonella species contaminating fruits and vegetables. International Journal of Food
Lofstrom, C., Hansen, F., Hoorfar, J. 2010. Validation of a 20-h real-time PCR method for
screening of Salmonella in poultry faecal samples. Veterinary Microbiology 144, 511-514.
93 Publicaciones
Mahmuda Y., K.S., Kawamoto S. 2007. Evaluation of Multiplex PCR System for Simultaneous
Detection of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella enteritidis in Shrimp
Samples. Bangladesh J Microbiol 24, 42-46.
Martin, B., Garriga, M., Aymerich, T. 2012. Pre-PCR treatments as a key factor on the probability
of detection of Listeria monocytogenes and Salmonella in ready-to-eat meat products by real-time PCR.
Food Control 27, 163-169.
Myint, M.S., Johnson, Y.J., Tablante, N.L., Heckert, R.A. 2006. The effect of pre-enrichment
protocol on the sensitivity and specificity of PCR for detection of naturally contaminated Salmonella in
raw poultry compared to conventional culture. Food Microbiology 23, 599-604.
Omiccioli, E., Amagliani, G., Brandi, G., Magnani, M. 2009. A new platform for Real-Time PCR
detection of Salmonella spp., Listeria monocytogenes and Escherichia coli O157 in milk. Food
Oravcova, K., Trncikova, T., Kaclikova, E. 2007. Comparison of three real-time PCR-based methods
for the detection of Listeria monocytogenes in food. Journal of Food and Nutrition Research 46, 63-67.
Paddock, Z., Shi, X., Bai, J., Nagaraja, T.G. 2011. Applicability of a multiplex PCR to detect O26,
O45, O103, O111, O121, O145, and O157 serogroups of Escherichia coli in cattle feces. Veterinary
Perelle, S., Dilasser, F., Grout, J.L., Fach, P. 2004. Detection by 5 '-nuclease PCR of Shiga-toxin
producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157 : H7, associated with the
world's most frequent clinical cases. Molecular and Cellular Probes 18, 185-192.
Postollec, F., Falentin, H., Pavan, S., Combrisson, J., Sohier, D. 2011. Recent advances in
quantitative PCR (qPCR) applications in food microbiology. Food Microbiology 28, 848-861.
Rantsiou, K., Alessandria, V., Urso, R., Dolci, P., Cocolin, L. 2008. Detection, quantification and
vitality of Listeria monocytogenes in food as determined by quantitative PCR (vol 121, pg 99, 2008).
International Journal of Food Microbiology 127, 321-321.
Raymaekers, M., Smets, R., Maes, B., Cartuyvels, R. 2009. Checklist for Optimization and
Validation of Real-Time PCR Assays. Journal of Clinical Laboratory Analysis 23, 145-151.
Robinson, T.P., Ocio, M.J., Kaloti, A., Mackey, B.M. 1998. The effect of the growth environment
on the lag phase of Listeria monocytogenes. International Journal of Food Microbiology 44, 83-92.
Rossmanith, P., Krassnig, M., Wagner, M., Hein, I. 2006. Detection of Listeria monocytogenes in
food using a combined enrichment/real-time PCR method targeting the prfA gene. Research in
Rossmanith, P., Mester, P., Wagner, M., Schoder, D. 2010. Demonstration of the effective
performance of a combined enrichment/real-time PCR method targeting the prfA gene of Listeria
monocytogenes by testing fresh naturally contaminated acid curd cheese. Letters in Applied
Rossmanith, P., Wagner, M. 2011. Aspects of systems theory in the analysis and validation of
innovative molecular-biological based food pathogen detection methods. Trends in Food Science &
94 Publicaciones
Ruiz-Rueda, O., Soler, M., Calvo, L. 2010. Multiplex Real-time PCR for the Simultaneous Detection
of Salmonella spp. and Listeria monocytogenes in Food Samples. Food Analytical Methods.
Sharma, V.K., Dean-Nystrom, E.A. 2003. Detection of enterohemorrhagic Escherichia coli O157 :
H7 by using a multiplex real-time PCR assay for genes encoding intimin and Shiga toxins. Veterinary
Simon, M.C., Grey, D.I., Cook, N. 1996. DNA extraction and PCR methods for the detection of
Listeria monocytogenes in cold-smoked salmon. Applied and Environmental Microbiology 62, 822-824.
Singh, J., Batish, V. K., Grover, S. 2011. Simultaneous detection of Listeria monocytogenes and
Salmonella spp. in dairy products using real time PCR-melt curve analysis. Journal of Food Science and
Technology.
Suo, B., He, Y.P., Tu, S.I., Shi, X.M. 2010. A Multiplex Real-Time Polymerase Chain Reaction for
Simultaneous Detection of Salmonella spp., Escherichia coli O157, and Listeria monocytogenes in Meat
Products. Foodborne Pathogens and Disease 7, 619-628.
Taskila, S., Tuomola, M., Ojamo, H. 2012. Enrichment cultivation in detection of food-borne
Salmonella. Food Control 26, 369-377.
Tomas, D., Rodrigo, A., Hernandez, M., Ferrus, M.A. 2009. Validation of Real-Time PCR and
Enzyme-Linked Fluorescent Assay-Based Methods for Detection of Salmonella spp. in Chicken Feces
Samples. Food Analytical Methods 2, 180-189.
Wright, A.C., Garrido, V., Debuex, G., Farrell-Evans, M., Mudbidri, A.A., Otwell, W.S. 2007.
Evaluation of postharvest-processed oysters by using PCR-based most-probable-number enumeration of
Vibrio vulnificus bacteria. Applied and Environmental Microbiology 73, 7477-7481.
Zhang, D., Zhang, H., Yang, L., Guo, J., Li, X., Feng, Y. 2009. Simultaneous Detection of Listeria
monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli O157:H7 in Food
Samples Using Multiplex PCR Method. Journal of Food Safety 29, 348-363.
95 Publicaciones
3.4 Artículo 4
Título: Development of a multiplex real-time PCR method for pathogenic Vibrio

parahaemolyticus detection (tdh+ and trh+).
Autores: Garrido, A., Chapela, M. J., Ferreira, M., Atanassova, M., Fajardo, P., Lago, J.,
Vieites, J. M., Cabado, A. G.
Revista: Food Control, 24 (1-2), 128-135. (2012)
Resumen:
En este trabajo se desarrolló un método de qPCR para la detección de V.

parahaemolyticus, patógeno distribuido en el ambiente y considerado un riesgo para la
salud pública, en agua y alimentos.
El método desarrollado en este estudio se probó con diferentes cepas que

presentaban los principales genes de virulencia de esta especie (tdh y/ o trh). Los
resultados obtenidos fueron comparados con el método ISO de referencia, 21872-
1:2007.
Se obtuvo un valor para el límite de detección de 6 ufc/25 g para tdh, 11 ufc/ 25

g para trh1 y 8 ufc/25 g para trh2. Estos valores fueron idénticos mediante ambos
métodos, sin embargo el método clásico (ISO 21872-1:2007) sólo permite la detección
de V. parahemolyticus a nivel de especie para lo cual son necesarios tres días de
análisis y posterior caracterización molecular mediante técnicas complementarias para
identificar serotipos patógenos. Con el método de qPCR múltiple desarrollado el
tiempo total de análisis puede ser reducido a 24 horas
96 Publicaciones
Food Control 24 (2012) 128e135
Contents lists available at SciVerse ScienceDirect
Food Control
journal homepage: www.elsevier.com/locate/foodcont
Development of a multiplex real-time PCR method for pathogenic Vibrio

parahaemolyticus detection (tdhþ and trhþ)
Alejandro Garrido, María-José Chapela, Martiña Ferreira, Miroslava Atanassova, Paula Fajardo, Jorge Lago,
Juan M. Vieites, Ana G. Cabado*
Microbiology and Toxins Area, ANFACO-CECOPESCA, Campus Univ. 16, 36310 Vigo PO, Spain
a r t i c l e i n f o a b s t r a c t
Article history: A multiplex real-time PCR (RT-PCR) method was developed in this work for pathogenic Vibrio para-
Received 4 March 2011 haemolyticus detection in water and food samples. This bacterium is found in the environment and it is
Received in revised form considered a major foodborne pathogen that poses a considerable public health risk; in fact, last year the
12 August 2011
World Health Organization (WHO) organized an expert meeting to review and recommend microbio-
Accepted 6 September 2011
logical methods in order to monitor the levels of pathogenic Vibrio spp. in seafood and water. Our
method was tested with different pathogenic strains of V. parahaemolyticus containing tdh and/or trh
Keywords:
pathogenicity genes and results were compared with the cultured-based method ISO 21872-1:2007. The
Vibrio parahaemolyticus
tdh
limit of detection (LOD) for pathogenic V. parahaemolyticus was established at 6 cfu/25 g for tdh, 11 cfu/
trh 25 g for trh1 and 8 cfu/25 g for trh2 with both methods studied. However, with ISO 21872-1:2007 only
Pathogenicity the detection of total V. parahaemolyticus is possible and this takes at least 3 days followed by
Real-time PCR complementary techniques to identify pathogenic serotypes. With multiplex real-time PCR developed in
ISO 21872 this work identification of pathogenic V. parahaemolyticus takes only 24 .
Ó 2011 Elsevier Ltd. All rights reserved.
1. Introduction When the FAO/WHO risk assessment procedure was under

development, data on the attack rates of pandemic strains of
Pathogenic species from the genus Vibrio pose a considerable V. parahaemolyticus were not available, but epidemiological studies
public health threat as the causative agents of both sporadic and in some regions suggested that virulence among tdhþ and/or trhþ
epidemic human infections. Vibrio cholerae, Vibrio parahaemolyticus strains varied in public health outcomes and depended on the
and Vibrio vulnificus are considered the most significant pathogens strain and on the ability to grow in various bivalve mollusk species.
within this taxon. In September 2010 an expert meeting was organized in order to
V. parahaemolyticus is a gram-negative, halophilic bacterium consider: 1) all the methods used for estimating numbers of total
described for the first time in the 1950s. It is widely distributed and pathogenic V. parahaemolyticus and V. vulnificus in various
in coastal and marine waters throughout the world (Blanco-Abad, studies, 2) any national/regional attempts to validate the methods
Ansede-Bermejo, Rodriguez-Castro, & Martinez-Urtaza, 2009; by inter-laboratory calibration or ring test and 3) assess the
Tyagi, Saravanan, Karunasagar, & Karunasagar, 2009), and is methods used by various agencies in order to recommend widely
frequently isolated from seafood including fish, crustaceans and applicable methods that accurately measure the hazard of concern
molluscs. Recently, pathogenic strains of this bacterium have been (WHO&FAO, 2010b). The expert meeting have considered that, as
reported from outbreaks in Europe, Russia and Africa (Su & Liu, 2007). the development of molecular methods for V. parahaemolyticus is
Even though V. parahaemolyticus is found in the environment and in evolving rapidly, the final decision on the method selected will
food samples, the presence of pathogenic strains is very low, depend to a great extent on the specific purpose of the monitoring
comprising 0.3e3% of the total population (Nordstrom, Vickery, activity, the cost, the speed with which results are required and the
Blackstone, Murray, & DePaola, 2007). However, its importance has technical capacity of the laboratory (WHO&FAO, 2010a).
grown in the past years. Historically the pathogenicity of these bacteria has been asso-
ciated with the Kanagawa phenomenon (KP) which is observed as
beta-hemolysis on Wagatsuma agar. Virtually all clinical isolates are
* Corresponding author. Tel.: þ34 986 469 303; fax: þ34 986 469 269 344. KP-positive, whereas only 1e2% of the environmental strains are
E-mail address: agcabado@anfaco.es (A.G. Cabado). KP-positive. It is now known that this hemolytic reaction is caused
0956-7135/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved.
doi:10.1016/j.foodcont.2011.09.015
by the thermostable direct hemolysin (TDH) protein (Drake, both traditional and real-time PCR (RT-PCR), to test food and
DePaola, & Jaykus, 2007). Regardless of the importance of the environmental enrichment samples for specific virulence genes
Kanagawa factor and the TDH protein, KP-negative strains have (Blackstone et al., 2003). Many RT-PCR methods, which use fluo-
occasionally been associated with outbreaks of gastroenteritis. rescent probes to monitor the PCR and avoid post-amplification
Previous studies have reported on some KP-negative strains of analysis such as gel electrophoresis, have been reported for rapid
V. parahaemolyticus associated with illness in humans that detection of pathogens (Blackstone et al., 2007; Cheng et al., 2008;
produced a TDHrelated hemolysin (designated TRH) which was Omiccioli, Amagliani, Brandi, & Magnani, 2009; Wang, Li, &
similar but not identical to the TDH protein. The gene corre- Mustapha, 2007). Development of specific primers and probes is
sponding to TRH has about 69% similarity in its nucleotide sequence essential to the success of this method (Takahashi, Iwade, Konuma,
to the one coding for TDH (Drake et al., 2007; Gil et al., 2007; & Hara-Kudo, 2005). Since fluorogenic probes target gene-specific
Parveen et al., 2008; Raghunath, Karunasagar, & Karunasagar, sequences internal to the primer sites, RT-PCR imparts an added
2009; Ward & Bej, 2006). degree of specificity compared to conventional PCR-based methods
Regarding TDH and TRH variability, recent studies have reported (Blackstone et al., 2003).
five variants of the tdh gene, named tdh1, tdh2, tdh3, tdh4 and tdh5 The aim of the present work was to develop a rapid detection
and all of them have more than 97% identity in their sequence (Lo method based on multiplex RT-PCR able to detect pathogenic
et al., 2008). Different variants of the trh gene exist, strain-to-strain V. parahaemolyticus (tdhþ and trhþ) in food and seawater samples.
nucleotide sequence variation being known. Its variants can be Due to the differences existing between trh1 and trh2 sequences,
separated in two groups, actually representing two trh genes: trh1 strains with both forms of the gene were tested for the detection of
and trh2, which share 84% sequence identity (Nakaguchi et al., trh. Two different probes were used for tdh, trh1 and trh2 detection
2004). in one single RT-PCR reaction. To our knowledge, this is one of the
Many virulence factors are thought to play a role in the patho- few works detecting pathogenic V. parahaemolyticus strains con-
genicity of V. parahaemolyticus, including those associated with taining different forms of the trh gene in one single reaction,
beta-hemolysis, adherence factors, various enzymes, the products previous studies focused on identification to the species level only
of the tdh, trh, and ure (urease) genes (Drake et al., 2007). Also (Bauer & Rorvik, 2007; Croci et al., 2007; Kim et al., 1999). In
recent studies have associated the pathogenicity of this bacterium addition, results obtained by this method were compared with
with Type III Secretion Systems (Hiyoshi, Kodama, Iida, & Honda, results from the application of the procedure described in the ISO/
2010; Pineyro et al., 2010). Even though there are several possible TS 21872-1:2007 as one of the latest developed and internationally
targets, the only genes accepted as pathogenicity markers by ISO accepted. So far, a few authors have used this traditional microbi-
(ISO, 2007) and FDA (Kaysner & DePaola, 2004) are thermostable ological method before (Rosec, Simon, Causse, & Boudjemaa, 2009).
direct hemolysin (tdh) and TDHrelated hemolysin (trh) genes. Two different culture methods were evaluated following the
Traditionally, microbiological identification methods for Vibrio specifications of the ISO methods (ISO, 2007) (ISO, 2003a). Addi-
spp. consisted in an enrichment step followed by isolation on tionally, four DNA extraction methods were compared. Further-
selective agar medium. Typical colonies were confirmed by more, spiked and natural non inoculated samples were analyzed for
biochemical and serological testing for species and serotypes pathogenic V. parahaemolyticus detection with the ISO method (ISO,
identification (Blanco-Abad et al., 2009; Hara-Kudo et al., 2001; 2007) and the multiplex RT-PCR method and results were
Roque et al., 2009) as it is specified in the FDA (Kaysner & DePaola compared.
2004) and ISO methods (ISO, 2007). In these conditions, dis-
tinguishing pathogenic from non-pathogenic V. parahaemolyticus 2. Materials and methods
represents a problem and undifferentiated total counts are nor-
mally used for food control, but these are not good indicator for 2.1. Bacterial strains and culture media
food risk asseassment (AESAN, 2010).
Another approach, alternative to classical microbiological Vibrio spp. and other bacterial strains were obtained lyophilized
detection of Vibrio spp. is the application of PCR-based methods, and from culture plates (see Table 1). These strains were selected
Table 1
Strains used to test: productivity and selectivity of media and specificity of primers and probes (RT-PCR result).
Bacteria Strain RT-PCR result Bacteria Strain RT-PCR result

V. parahaemolyticusa,c,l CECT 511 (TDH/TRH) P. putidab,c,l CECT 324 e
V. parahaemolyticusa,c,l CECT 5271 (TDHþ/TRH) þ P. aeruginosab,c,l CECT 108
V. parahaemolyticusc,l CCUG 43362 (TDHþ/TRH) þ P. fluorescensb,c,l CECT 378
V. parahaemolyticusc,l CCUG 43363 (TDHþ/TRH) þ E. colib,c,l CECT 516
V. parahaemolyticusa,c,l CCUG 43364 (TDH/TRH1þ) þ E. colib,c,l CECT 434
V. parahaemolyticusa,c,l CCUG 43365 (TDH/TRH2þ) þ C. freundiib,c,l CECT 401
V. parahaemolyticusa,c,p CAIM 58 (TDH/TRH) S. aureusb,c,l CECT 240
V. choleraec,l CECT 514 (O1) S. aureusb,c,l CECT 435
V. choleraec,l CCUG 47460 (O139) S. entericab,c,l CECT 4594
V. alginolyticusc,p CECT 586 S. sonneib,c,l CECT 413
V. alginolyticusc,p CAIM 342 S. flexnerib,c,l CECT 4804
V. alginolyticusc,p,* (internal reference) L. monocytogenesb,c,l CECT 935
V. mimicusc,l CECT 4218 L. innocuab,c,l CECT 910
V. mimicusc,p BCCM/LMG 7896 L. seeligerib,c,l CECT 917
V. vulnificusc,p CAIM 611 L. ivanoviib,c,l CECT 913
A. hydrophilab,c,l CECT 839 E. faecalisb,c,l CECT 481 e
a. productivity, b. selectivity, c. specificity of primers and probes, l. lyophilized, p. plate culture.

CECT: Spanish Type Culture Collection, CCUG: Culture Collection University of Göteborg, CAIM: Collection of Aquatic Important Microorganisms, BCCM/LMG: Belgian Co-
Orfinated Collections Of Micro-Organsims. *Strain identified in our laboratory.
for being susceptible of being present either in the samples or in the species level can be reached. In order to determine if a certain
environment where V. parahaemolyticus could normally be found. isolate is pathogenic or not, the method indicates that the detection
All lyophilized strains were revived and stored, following the of the pathogenicity genes, tdh and trh must be done; for this
instructions of CECT (Spanish Type Culture Collection, Valencia purpose the method described by Blanco-Abad et al. (2009) has
Spain). Besides Vibrio alginolyticus 110819 all strains from culture been applied, see Table 2.
plates were kindly provided by Dr. Teresa Pérez Nieto from
University of Vigo. All Vibrio spp. and Aeromonas spp. strains were 2.4. Detection of pathogenic V. parahaemolyticus using RT-PCR
cultured in Alkaline Peptone Water (APW, Biolife Italiana S.r.l.,
Italy), and all other strains in Buffered Peptone Water (BPW, Biokar For tdh detection primers and probe described by (Blackstone
diagnostics S.A., France) for 18 h at 37 C, before use. et al., 2003) were chosen. trh forward primer previously pub-
For the inoculation of samples and preliminary trials with lished by (Nordstrom et al., 2007) was used, while reverse primer
V. parahaemolyticus, turbidity was adjusted to 0.5 McFarland, that and probe were designed (Table 2). For primer and probe design,
corresponds to 107 cfu/mL (determined experimentally) and ten several trh sequences from the GenBank (FJ409545, FJ409544,
fold-serial dilutions were done to reach the concentration of FJ409543, FJ409542, FJ409541, FJ409540, FJ409539, FJ409538,
microorganisms needed for inoculation. At the same time these AB112354, ABAA2353, AY586620, AY742219, AY586613, AY034609,
dilutions were inoculated on Saline Nutrient Agar (SNA, Biokar M88112, DQ359749, DQ35748, DQ345441, DQ345442) were used.
diagnostics S.A., France) to obtain the reference value. These sequences were aligned with ClustalX 2.0.11 (Support, 2009),
see Fig. 2. Design was carried out with the free online application
2.2. Culture media comparison Primer3 (Untergasser, Rao, Bisseling, Geurts, & Leunissen, 2007.
Using BLAST (Basic Local Alignment Search Tool, http://blast.ncbi.
ISO/TS 21872-1:2007 establishes a selective isolation step on nlm.nih.gov/Blast.cgi) we checked out that both, primer and
Thiosulphate Citrate Bile salt Sucrose (TCBS), and recommends the probe designed, were specific for V. parahaemolyticus. We also
use of a second solid selective media leaving it to the choice of each tested specificity of primers and probes against all bacterial strains
laboratory. Following this recommendation two chromogenic from Table 1. Primers and probes were provided by IDT (Integrated
media were evaluated, CHROMagarÔVibrio (CHROMagar Microbi- DNA Technologies, Inc., USA). An Internal Amplification Control
ology, Paris, France) (Blanco-Abad et al., 2009; Hara-Kudo et al., (IAC) was added in order to avoid false negative results due to
2001; Rosec et al., 2009), and the newly developed, Agar ChromIDÔ matrix inhibition effects on the reaction (Calvo, Martinez-Planells,
VIBRIO (BioMérieux S.A., France). Pardos-Bosch, & Garcia-Gil, 2008).
Comparison among media was carried out following the speci- The RT-PCR reaction was carried out in a final volume of 20 mL
fications of ISO/TS 21872-1:2007 (ISO, 2007) as further detailed in with the following components: KapaÔ PROBEFAST qPCR Master
ISO/TS 11133-2:2003 (ISO, 2003a), which sets quantitative, semi- Mix (2X) Universal (Kapa Biosystems, Inc., USA), 25 nM primers
quantitative and qualitative criteria for the evaluation of media and 20 nM probe were used for tdh; 300 nM forward primer,
productivity and selectivity. 350 nM reverse primer and 150 nM probe were used for trh; and
Productivity was evaluated using quantitative criteria for solid for Internal Amplification Control (IAC) 25 nM primers, 20 nM
media. 10 to 100 cfu of five different V. parahaemolyticus strains probe and 103 copies of IAC DNA were added per reaction. Sample
(Table 1), were streaked on media under control and on a non DNA used as template for the RT-PCR was 4 mL of DNA diluted 1/
selective reference medium (SNA) to obtain a reference value. 10 in sterile milli-Q water. Stratagene Mx3005 thermocycler
Plates were incubated at 37 C/24 h and then the proportion of (Agilent Technologies, inc., USA) was used with the following
productivity (Pr) was calculated using the formula Pr ¼ Ns/N0, method: 3 min at 95 C for the activation of the polymerase (Hot
where Ns is the number of colonies in the test medium and N0 is the Start), followed by 35 cycles, each cycle has a denaturation step of
number of colonies in the reference medium. Productivity was 30 s at 95 C, annealing at 54 C for 30 s, and extension at 72 C
evaluated using five strains of V. parahaemolyticus in order to check for 30 s.
for strain variations in productivity.
For the evaluation of the selectivity, a semi-quantitative method 2.4.1. Comparison of DNA extraction methods
based on ecometry was chosen. With an inoculum concentration of Four DNA extraction methods were compared. Two of them (M
non-target microorganisms between 104 and 106 cfu/mL, and using 1 and M 2) were described by (Blanco-Abad et al., 2009). The third
a 1 mL loop, plates of media under control and the reference one method tested (M 3) was described by (Tyagi et al., 2009). The last
were streaked. The streaking method was a standardized one with extraction method compared (M 4) was a commercially available
a defined inoculating line pattern. Plates were incubated for 24 h at extraction kit (NucleoSpinÒ Tissue, MachereyeNagel GmbH & Co
37 C. After incubation of colonies, aspect, size and growth were KG). M 1 and M 2 consisted in several centrifugation steps to clean
evaluated and the growth index (GI) was calculated. The principle of the sample and concentrate the bacteria, re-suspension in
the calculation is that each line with complete growth will get TriseEDTA (TE) buffer 1 X, and boiled to release the DNA; the main
a score of 1. If the bacterium only grows in half of the line it was difference between M 1 and M 2 was that in M 1 the cell
scored with 0.5; and a line with weak or without growth (less than suspension was incubated with chelex 5% for 20 min. M 3 was very
half of the line) gets a 0. The maximum score is 16. The different similar to M1 and M2 but sterile milli-Q water was used to re-
scores are added up to get the GI score. This index must be lower suspend bacteria instead of TE buffer 1 X. M 4 was carried out
than 6 for non-target strains. following manufacturer’s specifications for gram-negative
Target bacteria for the media evaluated were Vibrio spp., the rest bacteria.
were non-target bacteria, specified in Table 1. To evaluate the four extraction methods, a sample was inocu-
lated with 1 mL of a culture of Vibrio parahemolyticus CCUG 43364
2.3. Detection of pathogenic V. parahaemolyticus by the ISO/TS grown in APW at 37 C for 18 h 12 aliquots were taken to carry out
21872-1:2007 method each DNA extraction method in triplicate. DNA concentration was
measured on a NanoDrop 1000 spectrophotometer (Thermo
The ISO procedure used for the detection of V. parahaemolyticus scientific) with software ND-1000 v3.7.1. Ct values obtained after
is shown in Fig. 1. Following this identification method only to the DNA amplification with RT-PCR, amount of DNA extracted, in ng/mL,
Fig. 1. Schematic representation of ISO/TS 21872-1:2007 compared with RT-PCR methods. For RT-PCR method, after initial incubation, the whole matrix is incubated at 41.5 C.
Pathogenicity genes can be directly detected after DNA extraction.
the 260/280 ratio were statistically compared, also time needed to 2.5. Sampling and preparation of the samples
complete each method was considered (Table 3). When DNA
extraction was done from colonies, these were re-suspended on The RT-PCR method developed in this work was applied to
sterile milli-Q water, boiled for 10 min and centrifuged at 10000 g, different types of samples including environmental and natural
5 min at 4 C. food samples (Table 4). All samples used were kept either at
Table 2
Primers, probes and IAC for of pathogenic V. parahaemolyticus detection using both, traditional and RT-PCR.
Primer/probe Sequence (50 to 30 ) Modifications Method Reference

tdh forward CCACTACCACTCTCATATGC PCR (Blanco-Abad et al., 2009)
tdh reverse GGTACTAAATGGCTGACATC PCR (Blanco-Abad et al., 2009)
trh forward GGCTCAAAATGGTTAAGCG PCR (Blanco-Abad et al., 2009)
trh reverse CATTTCCGCTCTCATATGC PCR (Blanco-Abad et al., 2009)
IAC forward TCCAGGGCGAAAGTAAACGT RT-PCR (Calvo et al., 2008)
IAC reverse GGCGAGCCGTACGAACAC RT-PCR (Calvo et al., 2008)
IAC probe CCCAGTTGGCTGATCACTTTCG 50 -/5TexRd-XN//3BHQ_2/-30 RT-PCR (Calvo et al., 2008)
IAC DNA TCCAGGGCGAAAGTAAACGTNNNCCCAGTTGGCT RT-PCR (Calvo et al., 2008)
GATCACTTTCGNNGTGTTCGTACGGCTCGCC
tdh forward AAACATCTGCTTTTGAGCTTCCA RT-PCR (Blackstone et al., 2003)
tdh reverse CTCGAACAACAAACAATATCT CATCAG RT-PCR (Blackstone et al., 2003)
0 0
tdh probe TGTCCCTTTTCCTGCCCCCGG 5 -/56-FAM//36-TAMSp/-3 RT-PCR (Blackstone et al., 2003)
trh forward TTGCTTTCAGTTTGCTATTGGCT RT-PCR (Nordstrom et al., 2007)
trh reverse ACGATTGCGTTAACTGGTGAT RT-PCR This work
trh probe CATTCGCGATTGACCTACCATCCA 50 -/5Cy3//3BHQ_2/-30 RT-PCR This work
Fig. 2. trh sequences alignment. Primers designed by Nordstrom et al. are shown. The probe and the reverse primer designed in this work are also shown.
refrigeration (4 C), for fresh products and water, or frozen pathogenic V. parahaemolyticus in the original sample. Our crite-
(20 C). rium for the acceptance of the LOD was 90% of detection.
A total of 54 samples were tested and inoculations were done Turbidity of the bacterial culture grown at 37 C overnight on
with different concentrations and proportions of pathogenic strains APW was adjusted to 0.5 McFarland and ten-fold serially diluted.
of V. parahaemolyticus. All ten samples were contaminated with 1 mL of 7 dilution of each
All matrices were prepared following the procedure described trhþ, V. parahaemolyticus CCUG 43364 and CCUG 43365, and
in ISO/TS 21872-1:2007 (ISO, 2007), 25 g per sample were weighted V. parahaemolyticus CECT 5271 as tdhþ. Serial dilutions used to
and diluted with 225 mL of ASPW (Alkaline Saline Peptone Water, inoculate the samples, were also seeded in plates with SNA in order
Biolife Italiana S.r.l., Italy). For water analysis, a method based on to get a reference value of viable bacteria.
ISO 6340 (ISO, 1995) was applied, 500 mL or the whole volume of Samples were homogenized in a stomacher for 30 s, and incu-
the sample, if less than 500 mL were available, were filtered bated following the procedure described in the ISO (ISO, 2007).
through a 0.45 mm membrane (Millipore, Ma USA); this filter was Traditional PCR was done in all samples, with a positive biochem-
placed in a stomacher bag with 50 mL of ASPW, homogenized for ical identification, for the detection of pathogenicity genes (Blanco-
30 s and then the bag with the sample was incubated at 37 C for Abad et al., 2009).
18 h as a bacterial enrichment step. To compare the LOD, the 10 spiked and one control sample were
analyzed with both methods, ISO and RT-PCR, simultaneously. 1 mL
2.6. Limit of detection (LOD) aliquots were taken of each sample for RT-PCR, and after DNA
extraction were stored at 20 C until analysis.
The Limit of Detection (LOD) can be defined as the smallest
amount which can be detected (not null), but not quantified as an
exact value, which has to be well over 50%, for example 95% (ISO, Table 4
2003b). To evaluate the LOD of both methods, ISO and RT-PCR, Matrices analyzed, combination of genes used for the inoculation, and results ob-
tained with RT-PCR.
boiled frozen mussels were used. 11 samples were weighted, 10
to determine the LOD and 1 blank in order to control the absence of Type of sample N Strain used Result
Octopus 1 tdh, trh2þ tdh/trhþ
Manta ray 1 tdhþ, trh2þ tdhþ/trhþ
Table 3 Pangasius 1 tdh, trh1þ tdh/trhþ
DNA extraction methods comparison. Sea water 1 tdh, trh1þ tdh/trhþ
Sea water 1 tdh, trh2þ tdh/trhþ
Extraction method Thresh cycle Concentration Purity Time Sea water 1 tdhþ, trh1-, trh2- tdhþ/TRH
260/280 abs (min.) Sea water 1 tdhþ, trh1þ, trh2þ tdhþ/trhþ
M1 (Blanco-Abad 29.17 0.84a 173.99 26.73a 1.51 0.12a 45 Boiled frozen mussels 21 tdhþ, trh2þ tdhþ/trhþ
et al., 2009) Boiled frozena mussels 10 tdhþ,trh1þ, trh2þ tdhþ/trhþ
a a a
M2 (Blanco-Abad 27.50 0.69 149.02 6.72 1.50 0.01 25 Boiled frozen mussels 10 tdhþ,trh1þ, trh2þ 7 tdhþb 10 trhþ
et al., 2009) Sea water 1 Natural non inoculated tdh/trh
M3 (Tyagi et al., 32.47 0.61b 74.06 0.08b 1.48 0.35a 45 Boiled frozen mussels 5 Natural non inoculated tdh/trh
2009)
N: number of samples.
M4 Kit 27.77 0.76a 79.69 15.31b 2.45 0.05b 90
The strains bearing the pathogenicity genes are listed on Table 1.
a-b a
Different lower case letters in the same column indicate a statistically significant group of samples used for LOD.
b
difference (p < 0.05). inoculated with tdh under the limit of detection established for the method.
2.7. Estimation of sensitivity, specificity and efficiency of the RT-PCR obtained from M 4 was significantly lower than that from M 1 or M
method 2 and as it was also the longest one it was the next one discarded.
Finally no statistical differences were found between Ct values,
V. parahaemolyticus is a marine bacterium, then it may DNA purity and concentration for methods M 1 and M 2, so method
contaminate different types of feeding stuffs and other types of M 2 was selected as the easiest and shortest one.
samples from this origin. To test the applicability of the method,
several samples were inoculated with pathogenic strains of 3.3. Limit of detection (LOD)
V. parahaemolyticus. These samples included: octopus, manta ray,
pangasius, sea water and boiled frozen mussels as illustrates All 10 samples inoculated to test the LOD were positive for tdh
Table 4. Each sample was processed as described in Sections 2 and and trh, thus fulfilling the 90% criterium of acceptance. LOD for the
2.5, and analyzed following the RT-PCR method developed. individual genes was established at 6 cfu/25 g for tdh, 11 cfu/25 g for
With the data collected from all the spiked samples (Table 4) trh1 and 8 cfu/25 g for trh2.
sensitivity, specificity and efficiency of the method was calculated
applying the following formulas: 3.4. Application of the RT-PCR method developed for the detection
Sensitivity ¼ TP/(TP þ FN); Specificity ¼ TN/(FP þ TN); of pathogenic V. parahaemolyticus
Efficiency ¼ (TP þ TN)/(TP þ TN þ FP þ FN) 100 where, TP: True
Positive, FP: False Positive, TN: True Negative, FN: False Negative. Each sample was processed as described in Sections 2 and 2.5,
and analyzed following the RT-PCR method developed.
2.8. Statistical analysis IAC gave positive results for all the samples analyzed showing
no matrix inhibition. Pathogenic V. parahaemolyticus was properly
Student t-test (a ¼ 5%) was selected for the analysis of the detected in most samples. We only detected 3 false negative results
productivity data collected for both chromogenic media. In order to for tdh. According to the reference values obtained for that group of
compare all the data gathered for the different DNA extraction spiked samples, 2 ufc/25 g, these false negative samples proved out
methods, one-way ANOVA, Tukey b (p < 0.05) test was used. These to be inoculated under the limit of detection established for our
analysis were performed using SPSS 15.0 software (SPSS Inc., Chi- method, even for the individual LOD of tdh.
cago, IL, USA).
3.5. Estimation of sensitivity, specificity and efficiency of RT-PCR
method
3. Results
Data obtained from the 48 spiked samples and 6 natural non

3.1. ISO/TS 21872-1:2007 method: media comparison
inoculated samples, sea water and boiled frozen mussels (Table 4)
were used to estimate the sensitivity, specificity and efficiency of
Two solid selective media: CHROMagarÔ Vibrio and ChromIDÔ
the method. The values obtained were: 94%, 100% and 94%
Vibrio agar were compared regarding their productivity and
respectively.
selectivity as described in the Materials and Methods section. Other
factors like price and durability were also considered. Productivity
4. Discussion
results are shown in Table 5. The productivity of ChromIDÔ Vibrio
agar was significantly higher (p < 0.05) as demonstrated for three
V. parahaemolyticus is considered a foodborne pathogen of
of the strains analyzed.
increasing interest worldwide. In some regions is regarded as the
Both chromogenic media proved to inhibit the growth of the
most common food poisoning agent associated with the
non-target bacterial strains tested since all scored a GI lower than 6.
consumption of fish mainly in Asia, where it represents half of the
ISO/TS 21872-1:2007 states that TCBS must be used for the
outbreaks of this type. Even in Spain, in Galicia and other coastal
isolation of V. parahaemolyticus, and recommends the use of
areas, several major outbreaks of this disease including serious
a second solid selective medium. Even though CHROMagarÔ Vibrio
cases with hospitalizations have been experienced. In addition
had lower productivity for some of the strains tested, it was
most outbreaks produced in Europe are due to consumption of
preferred rather than the ChromIDÔ Vibrio agar, because of its
imported seafood so it is advantageous and necessary to maintain
higher durability and lower price.
control of fish and fish products from third countries (AESAN,
2010).
3.2. Comparison of different DNA extraction methods Many microbiological methods have been developed so far for
detection of V. parahaemolyticus in food and environmental
Ct values obtained for M 3 were significantly higher than those samples, including traditional culture methods (ISO, 2007; Kaysner
of the other methods, so it was discarded. Then, the amount of DNA & DePaola, 2004), and DNA-based methods (Bauer & Rorvik, 2007;
Blanco-Abad et al., 2009; Croci et al., 2007; Kaysner & DePaola,
Table 5 2004; Raghunath et al., 2009).
Media productivity (Pr) compared by bacterial strain. Since culture methods are still the most widely used and stan-
dardized procedures, we applied the one described in the ISO/TS
Bacteria Strain Medium
21872-1:2007 (ISO, 2007) for the comparison with the RT-PCR
CHROMagar ChromIDÔ method for pathogenic V. parahaemolyticus detection in food and
Vibrio Vibrio
water samples. TCBS is the solid selective medium on which
V. parahaemolyticus CECT 511 (TDH/TRH) 0.81 0.87a 1.31 0.86a
bacteria must be isolated following the ISO/TS 21872-1:2007
V. parahaemolyticus CECT 5271 (TDHþ/TRH) 0.06 0.06a 0.12 0.17a
V. parahaemolyticus CCUG 43364 (TDH/TRH1þ) 0.24 0.35a 1.46 0.85b procedure, but this procedure also recommends the use of another
V. parahaemolyticus CCUG 43365 (TDH/TRH2þ) 0.15 0.12a 0.95 0.28b solid selective medium, complementary to TCBS in order to
V. parahaemolyticus CAIM 58 (TDH/TRH) 0.19 0.15a 0.69 0.09b enhance the probability of detecting this microorganism.
a-b
Different lower case letters in the same row indicate a statistically significant Following ISO/TS 11133-2:2003 specifications, both chromo-
difference (p < 0.05). genic media tested inhibited the growth of all the interfering
bacteria included in our study. However there were significant of a chimerical DNA with its own primers and probe to be co-
differences in the productivity of the evaluated media using the amplified with our target genes. This IAC had not been previously
specifications of ISO/TS 11133-2:2003. It was found that ChromIDÔ applied to a multiplex RT-PCR method. It did not show any problem
Vibrio had a greater productivity than CHROMagarÔ Vibrio for of cross reactivity neither with the targets searched nor with the
some of the strains tested. Even though previous works have used bacterial strains tested from Table 1. Then, its applicability to our
CHROMagarÔ Vibrio (Blanco-Abad et al., 2009; Hara-Kudo et al., samples and targets has been completely demonstrated.
2001; Roque et al., 2009) this is the first time that this medium has The RT-PCR method developed not only reaches the same limit
been quantitatively compared with other chromogenic medium. of detection as the traditional microbiology method used for
Culture microbiological methods show serious limitations, as comparison, but also attains the same sensitivity (94%) and speci-
time, manipulation, presence of viable but non cultivable forms ficity, (100%); providing the method with an overall efficiency of
(VBNC) and an added problem is that microorganisms can only be 94%. The RT-PCR method has the added advantage of time reduc-
identified to the species level. In addition, in some cases, including tion. This is a crucial factor since some of the products susceptible
V. parahaemolyticus, not all strains are equally virulent. Thus, of being contaminated with this bacterium are consumed fresh and
a necessity exists of identifying the serotype or detecting certain can not be kept in storage for longer periods of time. In this work,
virulence genes of these bacteria, in order to avoid rejection of safe all natural samples analyzed did not contain pathogenic
products unnecessarily. This last step for the detection of a certain V. parahaemolyticus, a result being in agreement with previously
pathogen is usually done on individual isolates, increasing the reported results that showed very low incidence of this pathogenic
chances of false negative results as it is not feasible to identify every bacteria (Nordstrom et al., 2007). Further studies are being con-
single isolate from a sample. In this study a traditional PCR method, ducted in order to extend the range of environmental samples
previously applied by Blanco-Abad, was chosen for tdh and/or trh tested.
detection since it has demonstrated useful in combination with Even though the present method was designed for the detection
traditional culture methods (Blanco-Abad et al., 2009). of total pathogenic V. parahaemolyticus, the addition of a treatment
To overcome the disadvantages mentioned, molecular methods with propidium/ethidium monoazide (Girones et al., 2010; Graiver,
have been developed for pathogenic V. parahaemolyticus detection, Saunders, Topliff, Kelling, & Bartelt-Hunt, 2010; Nocker, Cheung, &
such as traditional PCR and Real-Time PCR (Blackstone et al., 2007; Camper, 2006) previous to DNA extraction may be useful for the
Blackstone et al., 2003; Chapela et al., 2010; Nordstrom et al., 2007). specific detection of viable cells only.
DNA-based methods previously published for V. parahaemolyticus In conclusion, the RT-PCR detection method developed in this
have proven useful for the individual or simultaneous detection of study is a valid and easily transferable alternative to traditional
V. parahaemolyticus pathogenicity genes tdh and trh using microbiology, that goes further since detection of pathogenic
conventional (Blanco-Abad et al., 2009; Croci et al., 2007; V. parahaemolyticus can be done in only 24 h.
Gonzalez-Escalona, Blackstone, & DePaola, 2006; Rosec et al.,
2009) or RT-PCR (Blackstone et al., 2003; Blanco-Abad et al., 2009; Acknowledgments
Nordstrom et al., 2007; Ward & Bej, 2006) but to our knowledge
this is the first time that a method used for the detection of trh This work is financially supported by Xunta de Galicia (Spain)
proved capable of detecting both forms of the gene with one single through research grants 08TAL003CT and 09TAL002CT and by the
probe. Previous reports did not use certified strains, leaving an Secretary General for the Sea of the Spanish Ministry of Agricul-
open door to the possibility of overestimating the real potential of tural, Land and Marine Resources (MARM), by order RM/1193/2009
those methods to detect pathogenic V. parahaemolyticus. from the Public Interest Collective Actions, co-financed by Euro-
In the RT-PCR method developed, an enrichment step was pean Fisheries Fund (EFF). Authors also thank Belén Román,
included in order to enhance the detection limit. It was verified that Victoria Docampo and Ángeles Marcote for technical assistance and
all pathogenic strains grew correctly in the liquid medium selected Dr. Teresa Pérez Nieto (University of Vigo, Spain) for kindly
for this purpose (ASPW) either individually or in a mixed culture. providing some of the bacterial strains used in this study.
This fact allowed us to develop a multiplex RT-PCR method able to
detect simultaneously tdh and trh. References
Regarding RT-PCR, results from this work show that selected
primers and probes are specific for pathogenic V. parahaemolyticus, AESAN. (2010). In. Report from the scientific commitee of the Spanish Agency of Food
and RT-PCR method developed is useful for the detection of Safety and Nutrition about the microbiological criteria for the pathogenic species of
Vibrio genus, as additional means of control in the border inspection points, to
different forms of the trh gene with one single probe. To our imported fish products, Vol. 12. Scientific’s Commitee Magazine.
knowledge this is one of the few works that has used well char- Bauer, A., & Rorvik, L. M. (2007). A novel multiplex PCR for the identification of
acterized reference strains containing different forms of the trh Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Letters in Applied
Microbiology, 45, 371e375.
gene (Bauer & Rorvik, 2007; Croci et al., 2007; Kim et al., 1999), and Blackstone, G. M., Nordstrom, J. L., Vickery, M. C. L., Bowen, M. D., Meyer, R. F., &
the first study to use these strains to detect both forms of the trh DePaola, A. (2003). Detection of pathogenic Vibrio parahaemolyticus in oyster
gene with one single probe. enrichments by real time PCR. Journal of Microbiological Methods, 53(2),
149e155.
One challenge derived by the use of PCR-based methods is the Blackstone, G. M., Nordstrom, J. L., Bowen, M. D., Meyer, R. F., Imbro, P., & DePaola, A.
presence of PCR inhibitors in food (Blackstone et al., 2003) and (2007). Use of a real time PCR assay for detection of the ctxA gene of Vibrio
environmental samples. While positive and negative controls are cholerae in an environmental survey of Mobile Bay. Journal of Microbiological
Methods, 68(2), 254e259.
normally run with every PCR master mix to ensure the integrity of Blanco-Abad, V., Ansede-Bermejo, J., Rodriguez-Castro, A., & Martinez-Urtaza, J.
the reagents, PCR inhibitors in the sample matrix can prevent the (2009). Evaluation of different procedures for the optimized detection of Vibrio
amplification of the target template, resulting in false-negative parahaemolyticus in mussels and environmental samples. International Journal
of Food Microbiology, 129(3), 229e236.
reporting. Therefore, it is necessary to include an IAC in each
Calvo, L., Martinez-Planells, A., Pardos-Bosch, J., & Garcia-Gil, L. J. (2008). A new
individual reaction mixture. Previous works have utilized various real-time PCR assay for the specific detection of Salmonella spp. targeting the
methods of developing and using IAC, including, but not limited bipA gene. Food Analytical Methods, 1(4), 236e242.
to, housekeeping genes and synthetic plasmid constructs Chapela, M. J., Fajardo, P., Garrido, A., Cabado, A. G., Ferreira, M., Lago, J., et al. (2010).
Comparison between a TaqMan polymerase chain reaction assay and a culture
(Nordstrom et al., 2007). We chose a previously described IAC method for ctx-positive Vibrio cholerae detection. Journal of Agricultural and
(Calvo et al., 2008) to be added to our RT-PCR method. It consists Food Chemistry, 58(7), 4051e4055.
Cheng, C. M., Lin, W., Van, K. T., Phan, L., Tran, N. N., & Farmer, D. (2008). Rapid selective removal of DNA from dead cells. Journal of Microbiological Methods,
detection of Salmonella in foods using real-time PCR. Journal of Food Protection, 67(2), 310e320.
71(12), 2436e2441. Nordstrom, J. L., Vickery, M. C. L., Blackstone, G. M., Murray, S. L., & DePaola, A.
Croci, L., Suffredini, E., Cozzi, L., Paniconi, M., Ciccaglioni, G., & Colombo, M. M. (2007). Development of a multiplex real-time PCR assay with an internal
(2007). Evaluation of different polymerase chain reaction methods for the amplification control for the detection of total and pathogenic Vibrio para-
identification of Vibrio Parahaemolyticus strains isolated by cultural methods. haemolyticus bacteria in oysters. Applied and Environmental Microbiology, 73,
Journal of AOAC International, 90(6), 1588e1597. 5840e5847.
Drake, S. L., DePaola, A., & Jaykus, L. A. (2007). An overview of Vibrio vulnificus and Omiccioli, E., Amagliani, G., Brandi, G., & Magnani, M. (2009). A new platform for
Vibrio parahaemolyticus. Comprehensive Reviews in Food Science and Food Safety, Real-Time PCR detection of Salmonella spp., Listeria monocytogenes and
6(4), 120e144. Escherichia coli O157 in milk. Food Microbiology, 26(6), 615e622.
Gil, A. I., Miranda, H., Lanata, C. F., Prada, A., Hall, E. R., Barreno, C. M., et al. (2007). Parveen, S., Hettiarachchi, K. A., Bowers, J. C., Jones, J. L., Tamplin, M. L., McKay, R.,
O3: K6 serotype of Vibrio parahaemolyticus identical to the global pandemic et al. (2008). Seasonal distribution of total and pathogenic Vibrio para-
clone associated with diarrhea in Peru. International Journal of Infectious haemolyticus in Chesapeake Bay oysters and waters. International Journal of Food
Diseases, 11(4), 324e328. Microbiology, 128(2), 354e361.
Girones, R., Ferrus, M. A., Alonso, J. L., Rodriguez-Manzano, J., Calgua, B., Pineyro, P., Zhou, X. H., Orfe, L. H., Friel, P. J., Lahmers, K., & Call, D. R. (2010).
Correa, A. D., et al. (2010). Molecular detection of pathogens in water - the pros Development of two animal models to study the function of Vibrio para-
and cons of molecular techniques. Water Research, 44(15), 4325e4339. haemolyticus type III secretion systems. Infection and Immunity, 78(11),
Gonzalez-Escalona, N., Blackstone, G. M., & DePaola, A. (2006). Characterization of 4551e4559.
a Vibrio alginolyticus strain, isolated from Alaskan oysters, carrying a hemolysin Raghunath, P., Karunasagar, I., & Karunasagar, I. (2009). Improved isolation and
gene similar to the thermostable direct hemolysin-related hemolysin gene (trh) detection of pathogenic Vibrio parahaemolyticus from seafood using a new
of Vibrio parahaemolyticus. Applied and Environmental Microbiology, 72(12), enrichment broth. International Journal of Food Microbiology, 129(2),
7925e7929. 200e203.
Graiver, D. A., Saunders, S. E., Topliff, C. L., Kelling, C. L., & Bartelt-Hunt, S. L. (2010). Roque, A., Lopez-Joven, C., Lacuesta, B., Elandaloussi, L., Wagley, S., Furones, M. D.,
Ethidium monoazide does not inhibit RT-PCR amplification of nonviable avian et al. (2009). Detection and identification of TDH and TRHpositive Vibrio
influenza RNA. Journal of Virological Methods, 164(1e2), 51e54. parahaemolyticus strains from four species of cultured bivalve molluscs on the
Hara-Kudo, Y., Nishina, T., Nakagawa, H., Konuma, H., Hasegawa, J., & Kumagai, S. Spanish Mediterranean Coast. Applied and Environmental Microbiology, 75(23),
(2001). Improved method for detection of Vibrio parahaemolyticus in seafood. 7574e7577.
Applied and Environmental Microbiology, 67(12), 5819e5823. Rosec, J. P., Simon, M., Causse, V., & Boudjemaa, M. (2009). Detection of total and
Hiyoshi, H., Kodama, T., Iida, T., & Honda, T. (2010). Contribution of Vibrio para- pathogenic Vibrio parahaemolyticus in shellfish: comparison of PCR protocols
haemolyticus virulence factors to cytotoxicity, enterotoxicity, and lethality in using pR72H or toxR targets with a culture method. International Journal of Food
Mice. Infection and Immunity, 78(4), 1772e1780. Microbiology, 129(2), 136e145.
ISO. (1995). In. Water quality - Detection of Salmonella species, vol. 6340 (pp. 11). Su, Y. C., & Liu, C. C. (2007). Vibrio parahaemolyticus: a concern of seafood safety.
ISO. (2003a). In Microbiology of food and animal feeding stuffs e Guidelines on Food Microbiology, 24(6), 549e558.
preparation and production of culture media e Part 2. Practical guidelines on Support, C.I.B. (2009). Multiple sequence alignments. In (2.0.11 ed.). UDC Dublin.
performance testing of culture media, vol. 11133-2 (pp. 27). Takahashi, H., Iwade, Y., Konuma, H., & Hara-Kudo, Y. (2005). Development of
ISO. (2003b). In. Microbiology of food and animal feeding stuffs - Protocol for the a quantitative real-time PCR method for estimation of the total number of
validation of altenative methods, Vol. 16140:2003. Vibrio parahaemolyticus in contaminated shellfish and seawater. Journal of Food
ISO. (2007). In Microbiology of food and animal feeding stuffs-horizontal method for Protection, 68(5), 1083e1088.
the detection of potentially enteropathogenic Vibrio spp.- Part 1 (1st ed.). Detection Tyagi, A., Saravanan, V., Karunasagar, I., & Karunasagar, I. (2009). Detection of Vibrio
of Vibrio parahaemolyticus and Vibrio cholerae, Vol. 21872-1 (pp. 19). parahaemolyticus in tropical shellfish by SYBR green real-time PCR and evalu-
Kaysner, C. A., & DePaola, A. J. (2004). Vibrio cholerae, V. parahaemolyticus, ation of three enrichment media. International Journal of Food Microbiology,
V. vulnificus, ond other Vibrio spp.. Revision A, 1998. (Chapter 9) (8th ed.). 129(2), 124e130.
Bacteriological Analytical Manual. Untergasser, A., Xiangyu Rao, H. N., Bisseling, T., Geurts, R., & Leunissen, JA. M.
Kim, Y. B., Okuda, J., Matsumoto, C., Takahashi, N., Hashimoto, S., & Nishibuchi, M. (2007). Primer3Plus, an enhanced web interface to Primer3 nucleic acids research.
(1999). Identification of Vibrio parahaemolyticus strains at the species level by Wang, L. X., Li, Y., & Mustapha, A. (2007). Rapid and simultaneous quantitation of
PCR targeted to the toxR gene. Journal of Clinical Microbiology, 37(4), 1173e1177. Escherichia coli O157: H7, Salmonella, and Shigella in ground beef by multiplex
Lo, C. L. H., Leung, P. H. M., Yip, S. P., To, T. S. S., Ng, T. K., & Kam, K. M. (2008). Rapid real-time PCR and immunomagnetic separation. Journal of Food Protection,
detection of pathogenic Vibrio parahaemolyticus by a sensitive and specific 70(6), 1366e1372.
duplex PCR-hybridization probes assay using LightCycler. Journal of Applied Ward, L. N., & Bej, A. K. (2006). Detection of Vibrio parahaemolyticus in shellfish by
Microbiology, 105(2), 575e584. use of multiplexed real-time PCR with TaqMan fluorescent probes. Applied and
Nakaguchi, Y., Ishizuka, T., Ohnaka, S., Hayashi, T., Yasukawa, K., Ishiguro, T., et al. Environmental Microbiology, 72(3), 2031e2042.
(2004). Rapid and specific detection of tdh, trh1, and trh2 mRNA of Vibrio WHO&FAO. (2010a). Joint FAO/ WHO food standards programme Codex commitee on
parahaemolyticus by transcription-reverse transcription concerted reaction food hygiene.
with an automated system. Journal of Clinical Microbiology, 42(9), 4284e4292. WHO & FAO. (2010b). Joint FAO/WHO expert meeting on risk assessment tools for
Nocker, A., Cheung, C. Y., & Camper, A. K. (2006). Comparison of propidium mon- Vibrio parahaemolyticus and Vibrio Vulnificus associated with seafoods call for
oazide with ethidium monoazide for differentiation of live vs. dead bacteria by data and experts.
3.5 Artículo 5
Título: Comparison between a TaqMan Polymerase Chain Reaction Assay and a Culture
Method for ctx-Positive Vibrio cholerae Detection
Autores: Chapela, M. J., Fajardo, P., Garrido, A., Cabado, A. G., Ferreira, M., Lago, J.,
Vieites, J. M.
Revista: Journal of Agricultural and Food Chemistry, 58 (7), 4051-4055. (2010)
Índice de impacto: 2,816
Resumen:
El principal objetivo de este estudio fue evaluar un método de qPCR para la

detección de V. cholerae toxigénico en Pangasius hypophthalmus, un pez de agua
dulce cultivado en el sureste asiático.
Para ello se utilizó un método de microbiología clásica desarrollado por la FDA,

que fue comparado con un método de qPCR para la detección del gen ctx de V.
cholereae, en muestras inoculadas de panga. Tras el paso de enriquecimiento en agua
de peptona alcalina, a 37 °C, fue posible detectar dos ufc del microorganismo en 25 g
con ambos métodos. Aunque ambos fueron muy sensibles, la duración del método
microbiológico fue mucho más extensa, necesitando varios días para la confirmación
de los cultivos, mientras que el método de qPCR se completó en unas pocas horas.
Además, con los métodos tradicionales son necesarias técnicas adicionales, como el
serotipado, para poder tipificar V. cholerae toxigénico, mientras que con el método de
qPCR todos los serotipos toxigénicos pueden ser detectados en un único paso tras el
enriquecimiento.
105 Publicaciones
J. Agric. Food Chem. 2010, 58, 4051–4055 4051
DOI:10.1021/jf903658k
Comparison between a TaqMan Polymerase Chain Reaction

Assay and a Culture Method for ctx-Positive Vibrio cholerae
Detection
MARIA-JOSE CHAPELA,* PAULA FAJARDO, ALEJANDRO GARRIDO, ANA G. CABADO,
MARTINA FERREIRA, JORGE LAGO, AND JUAN M. VIEITES
ANFACO-CECOPESCA, Colegio Universitario 16, 36310 Vigo, Pontevedra, Spain
The main objective of the present work was to evaluate a real-time polymerase chain reaction (PCR)
method to detect toxigenic Vibrio cholerae in Pangasius hypophthalmus, a freshwater fish cultured
mainly in South East Asia. A FDA traditional culture method and a real-time PCR method of the ctx
gene were used for detection of V. cholerae in spiked samples of pangasius fish. After an overnight
enrichment of samples at 37 °C in alkaline peptone water, 2 cfu/25 g of fish was detected with both
methods. Although both methods were very sensitive, obtaining results with culture methods may
take several days, while real-time PCR takes only a few hours. Furthermore, with traditional
methods, complementary techniques such as serotyping, although not available for all serogroups,
are needed to identify toxigenic V. cholerae. However, with real-time PCR, toxigenic serogroups are
detected in only one step after overnight enrichment.
KEYWORDS: ctx gene; culture fish; real-time PCR; Vibrio cholerae
INTRODUCTION mortality in many developing countries. Strains associated with

Monitoring, characterization, and enumeration of foodborne cholera disease are those containing the ctxAB genes that encode
pathogens is a key aspect in food microbiology and food safety, for cholera toxin (CT). These include V. cholerae O1, the most
and rapid methods for pathogen testing have been gaining interest common of them, V. cholerae O139, and V. cholerae O141 (14,
for the food industry. These methods include antibody-based 15). Recently, V. cholerae serogroup O75 has also been identified
assays, genetic amplification methods, and sensor develop- as the causative agent of severe diarrhea in some patients in the
ment (1-7). Southeastern part of the United States (16).
The genus Vibrio belongs to the family Vibrionaceae, which Although European legislation concerning microbial criteria
also includes the genera Aeromonas, Plesiomonas, and Photobac- for foodstuffs (17, 18) does not specifically consider the study of
terium. There are 30 species in the genus Vibrio; 13 of these are V. cholerae, we should take into consideration the possible
pathogenic to humans, including Vibrio cholerae, Vibrio mimicus, presence of these pathogens in cultured fish products or in
Vibrio fluvialis, Vibrio parahaemolyticus, Vibrio alginolyticus, seafood. In this sense, it is important for health authorities to
Vibrio cincinnatiensis, Vibrio hollisae, Vibrio vulnificus, Vibrio have a fast method to analyze fish products that come from areas
furnissii, Vibrio damsela, Vibrio metshnikovii, and Vibrio carchar- where V. cholerae could be present or in cases of a food alert.
iae. All of the pathogenic vibrios have been reported to cause The FDA Bacteriological Analytical Manual (BAM) culture
foodborne diseases, although V. cholerae, V. parahaemolyticus, method uses an enrichment step in alkaline peptone water (APW)
and V. vulnificus are considered the most significant pathogens. followed by isolation on the selective and differential medium,
These agents are of great concern to the food industry, public thiosulfate citrate bile salts sucrose (TCBS) agar. Sucrose-positive
health institutions, and consumers (8). colonies are selected for biochemical tests (19). However, a
Nowadays, there are many culture-based and molecular meth- further study based on antisera agglutination, expensive and
ods for the characterization of different species of Vibrio (9-12). not available for all serogroups, is needed to identify toxigenic
Methods for the differentiation of pathogenic serogroups of V. cholerae.
V. cholerae are scarce; the most common are those based on Another approach is to use molecular biology methods; in fact,
antisera agglutination. Within molecular methods, polymerase there are several works concerning the application of PCR on the
chain reaction (PCR) has become the most extensively used APW enrichment for detecting V. cholerae, but most are based on
molecular technique (13). traditional PCR. However, methods based on real-time PCR,
V. cholerae is naturally present in tropical and temperate which is simpler and faster than conventional PCR assays, are
climates and still remains the leading cause of morbidity and scarce. Table 1 shows published genes employed in real-time PCR
for identification of V. cholerae. Only ctx operon can discriminate
*To whom correspondence should be addressed. Tel: 00 34 986 469 toxigenic from nontoxigenic V. cholerae (20, 21). This gene is
303 (344). Fax: 00 34 986 469 269. E-mail: mjchapela@anfaco.es. responsible for the production of the cholera toxin that induces
© 2010 American Chemical Society Published on Web 03/15/2010 pubs.acs.org/JAFC

4052 J. Agric. Food Chem., Vol. 58, No. 7, 2010 Chapela et al.
Table 1. Previously Published Genes Used To Identify V. cholerae with Real-
Time PCR Method
gene description size (bp) dye ref
hlyA hemolysin protein 70 TaqMan 42

ctx cholera toxin 308 SYBR green 20
rtx repeat in toxin 265
rtx repeat in toxin 120 SYBR green 43
epsM extracellular secretion protein 145
tcpA toxin coregulated pilus 147
mshA mannose sensitive hemaglutinin 113
rtx repeat in toxin 120 Molecular Beacon 44
epsM extracellular secretion protein 145
tcpA toxin coregulated pilus 147
ompW outer membrane protein 89
ctx cholera toxin 84 TaqMan 21
cholera disease. In the present work, ctx operon was selected for
real-time PCR because it is specific for toxigenic V. cholerae.
The objective of the present work was to evaluate a real-time
PCR technique to detect and quantify V. cholerae in pangasius
fish (Pangasius hypophthalmus) spiked with toxigenic V. cholerae
and to compare this technique with traditional culture methods.
A real-time PCR method based on the method of Blackstone (21)
was used in cultured fish products for the first time. Also, a
commercial DNA extraction kit and three different pre-PCR
conditions were evaluated as follows: (a) enrichment of samples in
APW for 7 h before PCR, (b) enrichment of samples in APW for
19 h before PCR, and (c) no enrichment before PCR. Spiked Figure 1. Diagram showing comparison of FDA-BAM culture method and
samples a and b were also analyzed following the FDA culture real-time PCR.
method. A comparison was established between the FDA BAM
culture method (19) and real-time PCR for toxigenic V. cholerae denaturation at 95 °C for 30 s, annealing and extension at 63 °C for 30 s,
detection in fish products. Furthermore, a study of the presence and 72 °C for 1 min.
of toxigenic V. cholerae was carried out by applying the real-time The template for the generation of standard curves from pure cultures
PCR technology. was prepared by growing V. cholerae O1 and O139 as described above.
DNA was extracted from 1 mL of pure cultures, and 10-fold serial dilutions
MATERIALS AND METHODS in water of DNA were used as a template for real-time PCR in triplicate and
repeated three different times for each serotype. The standard curve was
Vibrio Species Bacterial Strains. V. cholerae O1 (CECT 514) and
generated by plotting the log value of the calculated cfu per reac-
V. parahaemolyticus (CECT 511) were obtained from the Spanish Type
tion versus the cycle threshold (Ct). The efficiency of the real-time PCR
Culture Collection (CECT); V. cholerae O139 CCUG 47460 was obtained
assay was calculated using the following formula: E = (10[-1/slope] - 1) 100.
from CCUG (Culture Collection, University of G€oteborg). All were
Comparison of Real-Time PCR and Plating on TCBS. The
obtained in lyophilized format. They were grown in APW (10 g/L tryptic
application of each one of these methods was carried out as it is detailed in
digest of casein and 10 g/L NaCl, pH 8.5), and stock cultures were stored
Figure 1. Fish samples used for this study (P. hypophthalmus) were previously
at -80 °C.
analyzed for V. cholerae by plating on TCBS, giving negative results.
For viable counts, inocula were prepared diluting the overnight culture
First, nine samples of 25 g of pangasius were inoculated with 2.25 mL of
in APW, and serial dilutions were streaked onto TSA plates (15 g/L bovine
10-fold serial dilutions of a 20 h culture of V. cholerae O139 (7.5 107 cfu/
casein peptone, 5 g/L soya peptone, 15 g/L agar, and 5 g/L NaCl, pH 7.2).
mL), and then, 225 mL of APW was added to inoculated fish and
The plates were incubated at 37 ( 1 °C for 24 h, and colonies were counted.
homogenized for 30 s in a stomacher. One milliliter of the homogenized
V. cholerae Detection by Plating on Selective Agar. The method
of each dilution was taken, and DNA was extracted using the NucleoSpin
used was based on FDA BAM (19). Two hundred twenty-five milliliters of
kit and analyzed for V. cholerae detection by means of real-time PCR as
APW was added to 25 g of pangasius, previously spiked with toxigenic V.
described above (t = 0). Homogenized samples described above were
cholerae, and homogenized for 30 s. Incubation was carried out at 37 (
incubated at 37 ( 1 °C and analyzed after 7 ( 1 (t = 7) and 19 ( 1 h (t =
1 °C, and inocula were streaked onto TCBS agar-selective media (pH 8.6)
19) by real-time PCR and by traditional plating on TCBS, and results were
at 7 ( 1 and 19 ( 1 h of incubation. Plates were incubated at 37 ( 1 °C for
compared.
24 and 48 h. Typical V. cholerae colonies in TCBS were yellow and round
Screening for ctx-Positive V. cholerae in Fish Samples. Twenty-
(2-3 mm of diameter), since most strains ferment sucrose. Biochemical
nine pangasius fillets from different batches and culture areas were
confirmation was carried out using API20E from Biomérieux.
analyzed by means of the FDA BAM method and also by using a real-
Toxigenic V. cholerae Detection by Real-Time PCR. DNA
time PCR method. Fish samples were kept frozen until analyzed.
extraction was done using NucleoSpin Tissue kit (Macherey-Nagel) (22)
following the manufacturer’s instructions for Gram-negative bacteria. The
real-time PCR cycling protocol for detection of ctx gene was done in a final RESULTS
volume of 25 μL that contained 1x qPCR MasterMix No ROX Sensitivity Studies of Real-Time PCR Method for Detection of
(Eurogentec), 250 nM sense and antisense primers (Integrated DNA
ctx-Positive V. cholerae. Conditions described in the Materials
Technologies), 100 nM nuclease probe 50 -labeled with FAM and Black
Hole Quencher-1 on the 30 end (Integrated DNA Technologies), and 5 μL and Methods were employed for the detection of V. cholerae O1
of template. The fluorogenic probe and primer set were previously and O139. Both serogroups gave positive results, confirming the
described by Blackstone et al. (21). Real-time PCR was run using sensitivity of the real-time PCR method. Nontoxigenic V. choler-
Mx3005P QPCR System (Stratagene) with an initial denaturation/poly- ae and V. parahaemolyticus were also tested, but no amplification
merase activation step of 95 °C for 10 min, followed by 45 cycles of signal was obtained.
Article J. Agric. Food Chem., Vol. 58, No. 7, 2010 4053
Figure 3. Standard curves showing correlation between log value of cfu of

Figure 2. Standard curves showing correlation between log value of cfu of 10-fold serial dilutions in 25 g of pangasius of O139 V. cholerae and Ct
10-fold serial dilutions in water of V. cholerae DNA and Ct values obtained. values obtained. Three different incubation times at 37 °C were analyzed.
Values are the means ( SEMs of three experiments by triplicate.
After 19 ( 1 h of enrichment, another aliquot was streaked on
Table 2. Detection of O139 V. cholerae in Spiked Fish Samples Enriched 7 TCBS, and also, 1 mL was taken to be analyzed with real-time
and 19 h at 37 °C by Real-Time PCR and Culture in Selective Mediuma PCR. After 24 h of incubation at 37 ( 1 °C, growth was observed
7 h of enrichment 19 h of enrichment in all of the studied dilutions. Real-time PCR gave positive results
cfu/25 g real-time TCBS TCBS real-time TCBS TCBS for all of the dilutions analyzed. The negative control (non spiked
sample of fish PCR (24 h) (48 h) PCR (24 h) (48 h) pangasius fillets) was analyzed at 7 and 19 h, and no growth of
specific colonies was observed with both methods. The limit of
P0 1.7 108 þ þ þ þ þ þ detection of both the culture method and the real-time PCR
P1 1.7 107 þ þ þ þ þ þ method was 2 cfu/25 g of fish after enrichment in APW at 37 ( 1
P2 1.7 106 þ þ þ þ þ þ °C for 19 ( 1 h. The same results were obtained for pangasius
P3 1.7 105 þ - þ þ þ þ
fillets spiked with serial dilutions of V. cholerae O1.
P4 1.7 104 þ - þ þ þ þ
P5 1.7 103 - - þ þ þ þ
Figure 3 shows real-time PCR results obtained for pangasius
P6 1.7 102 - - þ þ þ þ fish fillets spiked with serially diluted cells of V. cholerae O139.
P7 1.7 101 - - - þ þ þ Without enrichment (t = 0), the limit of detection was established
P8 1.7 100 - - - þ þ þ in 104 cfu/25 g of fish. Similar results were obtained after 7 h of
negative - - - - - - enrichment. However, with 19 h of enrichment, 2 cfu/25 g of fish
control was detected. Three different tests with 10 replicates for each one
a
TCBS plates were read at 24 and 48 h.
were done to find the detection level of the method after 19 h of
enrichment. Results were similar in all cases, obtaining a detection
Studies of Real-Time PCR Method with Pure Cultures of V. level of 2 ufc/25 g of fish.
cholerae O1 and O139. To determine the efficiency of the real-time Commercial Fish Samples. Twenty-nine samples of frozen
PCR for ctx-positive V. cholerae detection in food samples, pangasius were analyzed following the FDA culture method
standard curves were created (see Figure 2). DNA from pure and the real-time PCR method used in this work. Fifteen were
cultures of V. cholerae O1 and O139 was extracted with NucleoS- negative for V. cholerae with both methods, and 14 samples
pin kit as described in the Materials and Methods. Once ex- were positive with traditional culture methods, but no toxigenic
tracted, DNA was diluted in water and subjected to real-time V. cholerae was found using a real-time PCR method.
PCR to construct standard curves. The linearity range was from
107 to 100 cfu covering 8 orders of magnitude for both serotypes. DISCUSSION
The efficiency of the reaction was 92 ( 3% for the O139 serotype Molecular Methodology for Detection of Toxigenic V. cholerae.
and 99 ( 3% for O1. The correlation coefficient was 0.99 in both Nucleic acid-based methods have been developed for V. cholerae
cases. This experiment was repeated three times for each serotype. identification and offer a useful alternative to culture methods
Correlation between the Real-Time PCR Analysis and Plate (23, 24). There are some previous works about V. cholerae
Spread on TCBS. Twenty-five grams of pangasius fillets were detection by traditional PCR; some of them involved a single
spiked with serial dilutions of V. cholerae O139 following the gene target (25, 26), while others employed two (23, 27-30),
protocol described in Materials and Methods and analyzed using four (31), or even seven genes (32). Different types of genes were
two different procedures: the culture method based on BAM and employed, for instance, sequences encoding outer membrane
the real-time PCR method used in this study. Results obtained proteins, virulence and regulatory genes, or genes involved in
with both methods were compared (see Table 2). O-antigen biosynthesis. However, all of these studies rely on
After 7 ( 1 h of enrichment, an aliquot of each sample was conventional PCR, which requires product characterization by gel
streaked on TCBS, and also, 1 mL was taken to be analyzed with electrophoresis, which is time-consuming and laborious.
real-time PCR. After 24 h of incubation at 37 ( 1 °C, growth of However, real-time PCR enables the detection of reaction
the yellow colonies in dilutions 0 (P0), -1 (P1) and -2 (P2) was products through fluorescence, which provides a quicker and
observed. When incubation time at 37 ( 1 °C increased to more sensitive method for the detection of a diverse range of
48 h, growth of the yellow colonies was observed in all of the bacteria and has revolutionized pathogen detection in microbiol-
dilutions except for -7 (P7) and -8 (P8). Real-time PCR after ogy. This technique allows visualization of the amount of PCR
7 ( 1 h of enrichment gave positive results in all of the dilutions product formed during the amplification process, introducing
except for -5 (P5), -6 (P6), -7 (P7) and -8 (P8). fluorescent dyes or probes in the reaction.
4054 J. Agric. Food Chem., Vol. 58, No. 7, 2010 Chapela et al.
As it is shown in Table 1, only Fukushima and Blackstone real- negative samples or up to 5 days for positive samples, and this
time PCR methods (20, 21) detect toxigenic V. cholerae amplify- may result in considerable loss of perishable foods. Also, it does
ing the ctx operon (serogroup identification). Other genes are not give any information about toxigenic serogroups, and addi-
used only for species identification. tional techniques are needed to identify pathogenic strains. From
Detection chemistries used were different in both studies; our point of view, the characterization of these serogroups is very
Fukushima used SYBR Green I dye, and Blackstone used a important since it would not be necessary to reject and destroy
TaqMan fluorogenic probe. SYBR Green I dye binds to any millions of tons of fish suitable for human consumption. More-
double-stranded DNA, including nonspecific sequences, and it over, as we detected in this study, there is a very low probability of
may generate false-positive signals. On the contrary, for TaqMan finding toxigenic V. cholerae in cultured fish; then, serotyping
probes, specific hybridization between probe and target is re- better than species identification is completely necessary.
quired to generate a fluorescent signal, significantly reducing It must be added that for routine laboratory analysis, the
background and false positives. development of a standardized PCR protocol is necessary, and
Taking these facts into consideration, Blackstone’s method rapid methods like this real-time PCR method are adequate for
was selected for toxigenic V. cholerae identification in the present monitoring these microorganisms in food. Also, inhibitors of
study. This method was employed previously in shellfish, sedi- samples should be considered when analyzing different matrixes,
ments, ballast water, milk, potato salad, and bottled water, but it but the use of traditional methods remains an important compo-
had never been employed before in cultured fish or fish pro- nent of sample analysis for testing laboratories.
ducts (21, 33). Although ctx is an excellent indicator of the While agencies such as AOAC International accept negative
virulence potential of the bacteria, we must take into account rapid screening results as definitive, positive samples must be
the evidence of horizontal gene transfer between V. cholerae and confirmed by culture techniques, which remain an important
some other Vibrio spp. such as V. mimicus (21). That is the reason component of sample analysis in testing laboratories. Never-
why ctx has also been found in this species. The fact that the theless, our results on the detection of toxigenic V. cholerae by
method proposed could detect any serogroup of Vibrio spp. that real-time PCR suggest that this technique could constitute a fast
produces the CT (cholera toxin) could alert scientists and health and reliable method for the confirmation of positive samples in
authorities to the possibility of a new epidemic strain. routine monitoring of microorganisms in food and efforts must
The most challenging aspect of real-time PCR-based detection be dedicated to develop standardized protocols optimized for
is that the detection limit could be affected by inhibitory com- different types of matrixes.
pounds of different matrixes, and then, inhibitors present in
samples should be considered. Inhibitors may interfere in differ- ACKNOWLEDGMENT
ent ways, degrading DNA template or affecting DNA polymer-

We thank Victoria Docampo, Angeles Marcote, and Raquel
ase. Also, an adequate selection of the DNA extraction method
and of the enrichment media is necessary (34, 35). In this study, Balseras for technical assistance.
the NucleoSpin Tissue kit was selected to extract DNA from fish
samples to avoid real-time PCR inhibition. This differs from LITERATURE CITED
previous results with other matrixes (21, 33) and demonstrates (1) Nugen, S. R.; Baeumner, A. J. Trends and opportunities in food
that the adaptation of the PCR system to a food matrix, although pathogen detection. Anal. Bioanal. Chem. 2008, 391 (2), 451–454.
it is a time-consuming process, is essential for the success of a (2) Rengpipat, S.; Pusiririt, S.; Rukpratanporn, S. Differentiating
PCR-based detection system. Diluted DNA from food samples or between isolates of Vibrio vulnificus with monoclonal antibodies.
bacterial colonies previously isolated on selective agar media are J. Microbiol. Methods 2008, 75 (3), 398–404.
(3) Lee, J. L.; Levin, R. E. New approach for discrimination of Vibrio
also used to avoid real-time PCR inhibition (36).
vulnificus by real-time PCR before and after gamma-irradiation.
BAM Culture Method versus Real-Time PCR Detection. Cul- J. Microbiol. Methods 2008, 73 (1), 1–6.
tured fish harvested in waters contaminated with pathogenic (4) Kimura, B.; Sekine, Y.; Takahashi, H.; Tanaka, Y.; Obata, H.; Kai,
V. cholerae can act as reservoirs and may spread the disease (37). A.; Morozurm, S.; Full, T. Multiple-locus variable-number of
However, as it was found in this work, fish often contain tandem-repeats analysis distinguishes Vibrio parahaemolyticus pan-
V. cholerae that lack the ctx gene or other vibrios that produce demic O3: X6 strains. J. Microbiol. Methods 2008, 72 (3), 313–320.
similar colony morphologies on TCBS, making isolation of the (5) Demkin, V. V.; Zimin, A. L. A new amplification target for PCR-
toxigenic strains difficult. Additional biochemical tests and mole- RFLP detection and identification of Chlamydiaceae species. Arch.
cular methods must be performed to confirm the presence of ctx- Microbiol. 2005, 183 (3), 169–175.
positive serogroups. Also, sometimes, cells can enter in a viable (6) Magliulo, M.; Simoni, P.; Guardigli, M.; Michelini, E.; Luciani, M.;
Lelli, R.; Roda, A. A rapid multiplexed chemiluminescent immu-
but noncultivable (VBNC) state (38); in these cases, cells will not
noassay for the detection of Escherichia coli O157:H7, Yersinia
be detected with culture methods (39, 40). It has been suggested enterocolitica, Salmonella typhimurium, and Listeria monocytogenes
that the VBNC state accounts for the seasonal nature of cholera pathogen bacteria. J. Agric. Food Chem. 2007, 55 (13), 4933–4939.
outbreaks because of survival for long periods, for example, in (7) Alarcon, B.; Garcia-Canas, V.; Cifuentes, A.; Gonzalez, R.; Aznar,
river sediments (41). Thus, assays allowing rapid differentiation R. Simultaneous and sensitive detection of three foodborne patho-
of viable and nonviable cells may be of great importance in the gens by multiplex PCR, capillary gel electrophoresis, and laser-
future, particularly if routine end product testing is priori- induced fluorescence. J. Agric. Food Chem. 2004, 52 (23), 7180–7186.
tized (35). Time needed to give positive results could be consid- (8) Drake, S. L.; DePaola, A.; Jaykus, L. A. An overview of Vibrio
ered a disadvantage of culture methods, and it is not feasible to vulnificus and Vibrio parahaemolyticus. Compr. Rev. Food Sci. Food
hold a food product for distribution for that length of time. Saf. 2007, 6 (4), 120–144.
(9) Espi~neira, M.; Atanassova, M.; Vieites, J. M.; Santaclara, F. J.
It must be noticed that in our study both real-time PCR and
Validation of a method for the detection of five species, serogroups,
culture methods had the same limit of detection of 2 cfu/25 g of biotypes and virulence factors of Vibrio by multiplex-PCR in fish
fish after the enrichment in APW at 37 ( 1 °C for 19 ( 1 h. and seafood. Food Microbiol. 2010, 27, 122–131.
However, the real-time PCR method used in this work for the (10) Das, B.; Bhadra, R. K. Molecular characterization of V. cholerae
detection of toxigenic V. cholerae in culture fish takes approxi- Delta relA Delta spoT double mutants. Arch. Microbiol. 2008, 189
mately 4 h, while the culture method takes at least 3 days for (3), 227–238.
Article J. Agric. Food Chem., Vol. 58, No. 7, 2010 4055
(11) Reshef, L.; Ron, E.; Rosenberg, E. Genome analysis of the coral in water samples in Thailand. J. Gen. Appl. Microbiol. 2007, 53, 229–
bleaching pathogen Vibrio shiloi. Arch. Microbiol. 2008, 190 (2), 237.
185–194. (29) Rivera, I. N. G.; Chun, J.; Huq, A.; Sack, R. B.; Colwell, R. R.
(12) Thompson, F. L.; Iida, T.; Swings, J. Biodiversity of vibrios. Genotypes associated with virulence in environmental isolates of
Microbiol. Mol. Biol. Rev. 2004, 68 (3), 403–431. V. cholerae. Appl. Environ. Microbiol. 2001, 67 (6), 2421–2429.
(13) Rodriguez-Lazaro, D.; Lombard, B.; Smith, H.; Rzezutka, A.; (30) Rivera, I. N. G.; Lipp, E. K.; Gil, A.; Choopun, N.; Huq, A.;
D’Agostino, M.; Helmuth, R.; Schroeter, A.; Malorny, B.; Miko, Colwell, R. R. Method of DNA extraction and application of
A.; Guerra, B.; Davison, J.; Kobilinsky, A.; Hernandez, M.; multiplex polymerase chain reaction to detect toxigenic V. cholerae
Bertheau, Y.; Cook, N. Trends in analytical methodology in food O1 and O139 from aquatic ecosystems. Environ. Microbiol. 2003, 5
safety and quality: monitoring microorganisms and genetically (7), 599–606.
modified organisms. Trends Food Sci. Technol. 2007, 18 (6), 306–319. (31) Khuntia, H. K.; Pal, B. B.; Chhotray, G. P. Quadruplex PCR for
(14) Dalsgaard, A.; Echeverria, P.; Larsen, J. L.; Siebeling, R.; Serichantalergs, simultaneous detection of serotype, biotype, toxigenic potential, and
O.; Huss, H. H. Application of ribotyping for differentiating Vibrio central regulating factor of V. cholerae. J. Clin. Microbiol. 2008, 46
cholerae non-01 isolated from shrimp farms in Thailand. Appl. Environ. (7), 2399–2401.
Microbiol. 1995, 61 (1), 245–251. (32) Mantri, C. K.; Mohapatra, S. S.; Ramamurthy, T.; Ghosh, R.;
(15) Crump, J. A.; Bopp, C. A.; Greene, K. D.; Kubota, K. A.; Colwell, R. R.; Singh, D. V. Septaplex PCR assay for rapid
Middendorf, R. L.; Wells, J. G.; Mintz, E. D. Toxigenic V. cholerae identification of V. cholerae including detection of virulence and
serogroup O141-associated cholera-like diarrhea and bloodstream int SXT genes. FEMS Microbiol. Lett. 2006, 265, 208–214.
infection in the United States. J. Infect. Dis. 2003, 187 (5), 866–868. (33) Fedio, W.; Blackstone, G. M.; Kikuta-Oshima, L.; Wendakoon, C.;
(16) Tobin-D’Angelo, M.; Smith, A. R.; Bulens, S. N.; Thomas, S.; McGrath, T. H.; DePaola, A. Rapid detection of the V. cholerae ctx
Hodel, M.; Izumiya, H.; Arakawa, E.; Morita, M.; Watanabe, H.; gene in food enrichments using real-time polymerase chain reaction.
Marin, C.; Parsons, M. B.; Greene, K.; Cooper, K.; Haydel, D.; J. AOAC Int. 2007, 90, 1278–1283.
Bopp, C.; Yu, P.; Mintz, E. Severe diarrhea caused by cholera toxin- (34) Rossen, L.; Norskov, P.; Holmstrom, K.; Rasmussen, O. F. Inhibi-
producing V. cholerae serogroup O75 infections acquired in the tion of PCR by components of food samples, microbial diagnostic
southeastern United States. Clin. Infect. Dis. 2008, 47 (8), 1035–1040. assays and DNA-extraction solutions. Int. J. Food Microbiol. 1992,
(17) EC. Commission Regulation (EC) No. 2073/2005 of 15 November 17 (1), 37–45.
2005 on microbiological criteria for foodstuffs. Off. J. Eur. Union (35) Norton, D. M. Polymerase chain reaction-based methods for detec-
2005, L338, 1–26. tion of Listeria monocytogenes: Toward real-time screening for food
(18) EC. Commission Regulation (EC) No 1441/2007 of 5 December and environmental samples. J. AOAC Int. 2002, 85 (2), 505–515.
2007 amending Regulation (EC) No. 2073/2005 on microbiological (36) Scheu, P. M.; Berghof, K.; Stahl, U. Detection of pathogenic and
criteria for foodsstuffs. Off. J. Eur. Union 2007, L322, 12–29. spoilage micro-organisms in food with the polymerase chain reac-
(19) FDA. Bacteriological Analytical Manual Online; 2004;http://www. tion. Food Microbiol. 1998, 15 (1), 13–31.
cfsan.fda.gov/∼ebam/bam-9.html. (37) Saravanan, V.; Kumar, H. S.; Karunasagar, I.; Karunasagar, I.
(20) Fukushima, H.; Tsunomori, Y.; Seki, R. Duplex real-time SYBR Putative virulence genes of V. cholerae from seafoods and the coastal
green PCR assays for detection of 17 species of food- or waterborne environment of Southwest India. Int. J. Food Microbiol. 2007, 119
pathogens in stools. J. Clin. Microbiol. 2003, 41 (11), 5134–5146. (3), 329–333.
(21) Blackstone, G. M.; Nordstrom, J. L.; Bowen, M. D.; Meyer, R. F.; (38) Du, M.; Chen, J. X.; Zhang, X. H.; Li, A. J.; Li, Y. Characterization
Imbro, P.; DePaola, A. Use of a real time PCR assay for detection of and resuscitation of viable but nonculturable Vibrio alginolyticus
the ctxA gene of V. cholerae in an environmental survey of Mobile VIB283. Arch. Microbiol. 2007, 188 (3), 283–288.
Bay. J. Microbiol. Methods 2007, 68 (2), 254–259. (39) Asakura, H.; Ishiwa, A.; Arakawa, E.; Makino, S. I.; Okada, Y.;
(22) Queipo-Ortuno, M. I.; Tena, F.; Colmenero, J. D.; Morata, P. Yamamoto, S.; Igimi, S. Gene expression profile of V. cholerae in the
Comparison of seven commercial DNA extraction kits for the cold stress-induced viable but non-culturable state. Environ. Micro-
recovery of Brucella DNA from spiked human serum samples using biol. 2007, 9 (4), 869–879.
real-time PCR. Eur. J. Clin. Microbiol. Infect. Dis. 2008, 27 (2), 109–114. (40) Gonzalez-Escalona, N.; Fey, A.; Hofle, M. G.; Espejo, R. T.;
(23) Lipp, E. K.; Rivera, I. N. G.; Gil, A. I.; Espeland, E. M.; Choopun, Guzman, C. A. Quantitative reverse transcription polymerase chain
N.; Louis, V. R.; Russek-Cohen, E.; Huq, A.; Colwell, R. R. Direct reaction analysis of V. cholerae cells entering the viable but non-
detection of V. cholerae and ctxA in Peruvian coastal water and culturable state and starvation in response to cold shock. Environ.
plankton by PCR. Appl. Environ. Microbiol. 2003, 69 (6), 3676–3680. Microbiol. 2006, 8 (4), 658–666.
(24) Chen, C. H.; Shimada, T.; Elhadi, N.; Radu, S.; Nishibuchi, M. (41) Skovgaard, N. New trends in emerging pathogens. Int. J. Food
Phenotypic and genotypic characteristics and epidemiological signi- Microbiol. 2007, 120 (3), 217–224.
ficance of ctx(þ) strains of V. cholerae isolated from seafood in (42) Lyon, W. J. TaqMan PCR for detection of V. cholerae O1, O139,
Malaysia. Appl. Environ. Microbiol. 2004, 70 (4), 1964–1972. non-O1, and non-O139 in pure cultures, raw oysters, and synthetic
(25) Chow, K. H.; Ng, T. K.; Yuen, K. Y.; Yam, W. C. Detection of RTX seawater. Appl. Environ. Microbiol. 2001, 67 (10), 4685–4693.
toxin gene in V. cholerae by PCR. J. Clin. Microbiol. 2001, 39 (7), (43) Gubala, A. J. Multiplex real-time PCR detection of V. cholerae. J.
2594–2597. Microbiol. Methods 2006, 65 (2), 278–293.
(26) Bauer, A.; Rorvik, L. M. A novel multiplex PCR for the identifica- (44) Gubala, A. J.; Proll, D. F. Molecular-beacon multiplex real-time
tion of Vibrio parahaemolyticus, V. cholerae and Vibrio vulnificus. PCR assay for detection of V. cholerae. Appl. Environ. Microbiol.
Lett. Appl. Microbiol. 2007, 45, 371–375. 2006, 72 (9), 6424–6428.
(27) Baron, S.; Chevalier, S.; Lesne, J. V. cholerae in the environment: A
simple method for reliable identification of the species. J. Health
Population Nutr. 2007, 25 (3), 312–318. Received for review October 19, 2009. Revised manuscript received
(28) Chomvarin, C.; Namwat, W.; Wongwajana, S.; Alam, M.; Thaew- February 24, 2010. Accepted March 02, 2010. This work is financially
Nonngiew, K.; Sinchaturus, A.; Engchanil, C. Application of supported by Xunta de Galicia (Spain) through research grants
duplex-PCR in rapid and reliable detection of toxigenic V. cholerae 08TAL003CT and 09TAL002CT.
3.6 Artículo 6
Título: Application of a novel pathogenicity marker in a multiplex Real-Time PCR method to

assess total and pathogenic Vibrio vulnificus in food and environmental samples
Autores: Alejandro Garrido, María-José Chapela, Belén Román, Juan M. Vieites, Ana G.
Cabado
Revista: Food Control (sometido)
Resumen:
El objetivo de este estudio fue desarrollar un método rápido y fiable para la

detección mediante qPCR múltiple de V. vulnificus, tanto a nivel de especie como de las
cepas patógenas.
Las especies patógenas del género Vibrio, incluyendo V. vulnificus, constituyen una
amenaza para los consumidores. V. vulnificus puede estar presente en moluscos bivalvos
como ostras, almejas y mejillones, así como en el agua, sedimentos y plancton, descritos
también como reservorios de esta especie. En la actualidad representa el principal agente
causal de muerte por consumo de marisco en Estados Unidos.
En este estudio se evaluaron dos medios de cultivo líquido específicos para esta
bacteria (PNC/ PNCC), de acuerdo con criterios internacionales (ISO 11133-1/ 2). Asimismo
se evaluaron tres posibles métodos de extracción de ADN en base a la cantidad, pureza y
resultados obtenidos mediante qPCR.
Finalmente la qPCR diseñada obtuvo valores de eficiencia superiores al 90 %. Se

obtuvo un límite de detección de 3 ufc/ 25 g, y todos los parámetros de la capacidad
diagnóstica del método, por encima del 90 %. El método de qPCR fue aplicado a 28
muestras que incluían varios tipos de alimentos así como muestras de agua.
111 Publicaciones
Title
Application of a novel pathogenicity marker in a multiplex Real-Time PCR method to asses

total and pathogenic Vibrio vulnificus in food and environmental samples
Alejandro Garrido, María-José Chapela, Belén Román, Juan M. Vieites, Ana G. Cabado*
Spain
Tel: 00 34 986 469 303 (344)
Fax: 00 34 986 469 269
Abstract
Pathogenic species of Vibrio genus, including Vibrio vulnificus, constitute a great challenge
for food control agencies and a threat for consumers. V. vulnificus can appear in bivalve
mollusks such as oysters, clams, and mussels. In addition, water, sediment, and plankton,
have been described as reservoirs for this pathogen. It constitutes the leading cause of
death by consuming seafood in the United States.
The aim of this study was to develop a complete, rapid and reliable multiplex real-time PCR
(qPCR) method. The method was designed for simultaneous detection of total and
pathogenic V. vulnificus in food and environmental samples. A scarcely used enrichment
broth, Peptone, Sodium Chloride, Cellobiose (PNC) and a more selective version with
Colistin (PNCC) were evaluated according to international methods (ISO), for its ability to
112 Publicaciones
recover low numbers of pathogenic V. vulnificus in the presence of high numbers of

interfering microorganisms, and the possibility to combine it with the qPCR method.
Also 3 different DNA extraction protocols were compared, but 1 proved to be better than
the others regarding DNA concentration and purity, and also Ct values and final
fluorescence obtained by qPCR.
A qPCR efficiency above 90 % was obtained, covering 5 orders of magnitude. Complete

method achieved low limit of detection (3 cfu/ 25g), and all quality parameters of the
method (relative sensitivity, specificity, and accuracy) returned values over 90 %.
In this study the complete qPCR method developed was applied to 28 natural samples
including a wide variety of seafood types and environmental samples (water), but no
positive samples were detected for either target.
Keywords: V. vulnificus, vcgC, pilF, PNC, PNCC, qPCR
1 Introduction
The Gram-negative halophilic bacterium Vibrio vulnificus is a natural inhabitant of

marine and estuarine environments worldwide (Craig Baker-Austin, Stockley, Rangdale, &
Martinez-Urtaza, 2010), and its presence is especially high in filtering feeding bivalve
mollusks such as oysters (Han, Pu, Hou, & Ge, 2009; Panicker, Call, Krug, & Bej, 2004).
Clams, mussels, as well as water, sediment, and plankton, have been described as
reservoirs for this pathogen (Harwood, Gandhi, & Wright, 2004). Historically V. vulnificus
strains have been classified by biotyping, a technique based on a combination of different
phenotypic, serologic, and host range characteristics. Biotype 1 can be found in warm
marine waters and was initially thought to be the only biotype associated with human
infection, biotype 2 was first thought to be pathogenic only to eels, but this was later
113 Publicaciones
disputed based on human clinical evidence; in 1996, V. vulnificus biotype 3 was first
described in Israeli patients (Drake, DePaola, & Jaykus, 2007; Harwood et al., 2004).
V. vulnificus is an opportunistic human pathogen highly lethal and is responsible for

the overwhelming majority of reported seafood-related deaths in the United States.
Outbreaks of V. vulnificus have been also reported in Europe and Asia (Canigral, Moreno,
Alonso, Gonzalez, & Ferrus, 2010; DePaola et al., 2003; Gulig, Bourdage, & Starks, 2005;
Harwood et al., 2004; Jones & Oliver, 2009). Case-fatality rate for primary septicemia has
been reported at greater than 50 %, and death can occur within a day or two of the onset
of symptoms (Harwood et al., 2004). In addition to septicemia, it can produce serious
wound infection that can typically result from exposure of open wounds to water harboring
the bacterium; like systemic disease, wound infections progress rapidly to cellulitis,
ecchymoses, and bullae, which can progress to necrotizing fasciitis at the site of infection;
however the mortality rate for wound infections is lower than that for systemic disease.
Finally gastroenteritis caused by V. vulnificus may go unreported since the disease is not
usually life-threatening and symptoms are typically not severe enough to warrant medical
attention (Drake et al., 2007).
This organism possesses a wide array of virulence factors, including acid

neutralization, capsular polysaccharide expression, iron acquisition, cytotoxicity, motility,
and expression of proteins involved in attachment and adhesion. Overall, V. vulnificus is a
complex microorganism with physiological characteristics that contribute to its survival in
the marine environment and in the human host (Jones & Oliver, 2009).
It has been shown that faecal indicator bacteria levels in water or seafood do not
correlate with the presence of pathogenic Vibrio spp. Therefore, efficient and sensible
techniques are necessary to increase the rate of detection of this human pathogen
(Canigral et al., 2010). In 2010 the Scientific Committee of the Spanish Agency for Food
Safety and Nutrition (AESAN) published a report on the applicable microbiological criteria
for pathogenic species of the genus Vibrio in imported fishery products in Spain, as
additional control measures at border inspection posts; the extension to V. vulnificus in the
surveillance of fish and shellfish from areas at risk is also recommended . In addition, it is
recommended to keep certain caution with respect to the same areas (at risk) for any other
114 Publicaciones
species of Vibrio, particularly V. parahaemolyticus and V. cholerae (for this last species
apply zero-tolerance criterion without distinguishing between serotypes) (AESAN, 2010).
Virulence factors are generally present in most strains and do not provide predictive
value. Thus, appropriate markers to screen the virulence potential of V. vulnificus in
environmental reservoirs are needed (Chatzidaki-Livanis, Hubbard, Gordon, Harwood, &
Wright, 2006). Recently, DNA sequence polymorphisms at individual loci discriminated
isolates with clinical or oysters origin in several independent studies. Polymorphic variants
generally included two genotypes, such as types A and B of the 16S rRNA gene, whose
distribution significantly correlated with either environmental or clinical origin,
respectively. Another important virulence factor is the capsular polysaccharide (CPS) which
presents 2 different alleles, 1 and 2, correlated with the clinical or environmental
character(Chatzidaki-Livanis et al., 2006; Gulig et al., 2005). Similar genetic distributions
were reported for types E (Environmental) and C (Clinical) of the vcg gene (virulence
correlated gene, without known fuction) (Rosche, Yano, & Oliver, 2005).
Since 1963, when Thiosulphate Citrate Bile Salt agar (TCBS) was formulated for the
isolation of pathogenic vibrios, several selective media have been developed for the
complementation and/ or improvement of TCBS in the isolation of vibrios, as SPS agar, VV
agar, CPC agar, VVE agar, VVA agar, CC agar, etc; but little effort has been focused on the
development of enrichment broths for V. vulnificus. One study (Hsu, Wei, & Tamplin, 1998)
optimized alkaline peptone broth for rapid growth of V. vulnificus and suppression of
nontarget bacteria. The authors recommended PNCC broth, containing peptone, sodium
chloride, cellobiose, and colistin, as an enrichment broth for environmental V. vulnificus;
however, the use of this medium has not been widely reported in the literature (Harwood
et al., 2004).
The aim of the present study was to develop a novel multiplex qPCR detection
method for total and pathogenic V. vulnificus, able to reliably identify not only biotype 1
strains, but also pathogenic strains of biotypes 2 and 3. Two individual objectives were
assessed: first, evaluation of the suitability of the scarcely used PNC/ PNCC broth for
sample enrichment to achieve a low limit of detection in the presence of interfering
bacteria, and to compare it to the ISO reference broth; second, combination of a species
115 Publicaciones
specific gene for the detection of total V. vulnificus (vvhA, (Campbell & Wright, 2003)), a
well know pathogenic related marker, the virulence correlated gene (vcgC, (Rosche et al.,
2005)), and a novel pathogenicity marker (pilF, (Roig, Sanjuan, Llorens, & Amaro, 2010)). A
previously applied Internal Amplification Control (IAC) (Calvo, Martinez-Planells, Pardos-
Bosch, & Garcia-Gil, 2008) was also added to the qPCR method to ensure absence of false
negative results due to PCR reaction inhibition.
2 Materials and methods
Spanish Type Culture Collection (CECT) strains used as reference strains for evaluation
of PNC and PNCC (PNC plus colistin, 1U/ mL) broth were: V. vulnificus CECT 529, V. vulnificus
CECT 4608 and V. vulnificus CECT 4869. These reference strains were cultured in Nutrient
Broth (NB, Biokar diagnostics S.A., France) supplemented with 1-2 % of sodium chloride
(SNB), and incubated at 37 ºC overnight.
Other bacterial strains used as interfering microorganisms and for the evaluation of
the qPCR specificity, were cultured in Tryptic Soy Broth (TSB, BioMérieux S.A., France)
overnight at 37 ºC, see Table 1.
Productivity of PNC/ PNCC was compared against Saline Alkaline Peptone Water
(SAPW, Biolife Italiana S.r.l., Italy) the International Standards Organization (ISO)
recommended broth.
2.2 Enrichment broth comparison
Evaluation of different enrichment broths was performed based on recommendations

of ISO 11133-2 (ISO, 2003a) in 2 steps. Firstly, bacterial growth was evaluated in pure
culture. Secondly, mixed cultures of V. vulnificus along with interfering bacteria were done.
For the evaluation of PNC, PNCC and SAPW, V. vulnificus CECT 4608, a pathogenic strain,
was selected as the reference strain.
Inoculum level of target microorganism, V. vulnificus, was established at 10-100 cfu.
116 Publicaciones
To obtain the required inoculum concentration from the SNB overnight culture, ten-fold
serial dilutions were done in Alkaline Peptone Water (APW, Biolife Italiana S.r.l., Italy) and
plated on Saline Nutrient Agar (SNA, Biokar diagnostics S.A., France) which contains 10 g /L
of sodium chloride. Plates were incubated overnight at 37 ºC to calculate reference values.
Productivity evaluation of each different step was done in triplicate.
2.2.1 Pure cultures
In the first step, tubes containing 10 mL of SAPW, PNC and PNCC were inoculated with
target bacterium. Tubes were incubated at 35 ºC for 22 ± 2 hours (optimal temperature)
according to a previous study (Hsu et al., 1998). After enrichment ten-fold serial dilutions
were done in APW and plated in SNA. Plates were incubated at 37 ºC overnight.
2.2.2 Mixed cultures
The second step of the evaluation of the productivity consisted on the inoculation of
100 mL of the different broths under study with the same concentration of target
microorganism as previously mentioned and also non-target bacteria, see Table 1, in a
higher concentration. Bottles with mixed cultures were incubated under the same
conditions as in Materials and methods 2.2.1. After enrichment ten-fold serial dilutions
were done in APW and plated on CHROMagar™Vibrio (CHROMagar Microbiology, Paris,
France). Plates were incubated at 37 ºC overnight.
2.3 Genes, primers and probes used for qPCR method
On the one hand, detection of total V. vulnificus was done targeting the species
specific gene vvhA as previously described vvha-F: TGTTTATGGTGAGAACGGTGACA, vvha-R:
(5Cy5)
TTCTTTATCTAGGCCCCAAACTTG, vvha-Probe: -CCGTTAACCGAACCACCCGCAA-(3BHQ_2)
(Campbell & Wright, 2003). On the other hand, the assessment of the pathogenic character
of V. vulnificus was done targeting 2 genes, the newly described pilF polimorfism PilF-F:
(56-FAM)
GATTGACTACGAYCCACACCG, PilF-R: GRCGCGCTTGGGTGTAG, PilF Probe: -
TGCTCAACCTCGCTAAGTTGGAAATCGATAC-(3BHQ_1) as previously described (C. Baker-Austin
et al., 2011).
117 Publicaciones
Regarding vcgC new primers and probe were designed for our multiplex qPCR
detection system within the original 505 bp fragment. For this purpose several sequences
of the gene were obtained from the GenBank (AY626575.1, AY626576.1 AY626577.1,
AY626578.1, and EU851904.1), aligned with CLC Sequence Viewer 6 (A/S). Primers and
probe design was carried out with the free online application Primer3 (Andreas
Untergasser, 2007). Specificity of primers and probe designed was verified with BLAST
(Basic Local Alignment Search Tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi), and against
bacterial strains specified in Table 1. Primers and probe designed were: PvcgC-F:
AGTTCAAACATGGTCTCAAAAAGGAG, PvcgC-R: CGATAACTCATTGTTTTCGTTACTG, vcgC-
Probe: (5HEX)-CACTAATGTGTCATCTGAACAGGCTATTG-(3IABkFQ).
Internal control based on chimerical DNA, published by Calvo et al. (2008) was
selected to monitor qPCR reaction. Primers and probe were: IAC F:
TCCAGGGCGAAAGTAAACGT, IAC R: GGCGAGCCGTACGAACAC, IAC Probe: (5TexRd-XN)-
CCCAGTTGGCTGATCACTTTCG-(3BHQ_2), IAC DNA:
TCCAGGGCGAAAGTAAACGTNNNCCCAGTTGGCTGATCACTTTCGNNGTGTTCGTACGGCTCGCC
DNA extraction from pure cultures was done as previously described by Blanco-Abad
et al. (Blanco-Abad, Ansede-Bermejo, Rodriguez-Castro, & Martinez-Urtaza, 2009).
Regarding extraction from food samples, 3 methods were compared, boiling (method 1), a
previously published method using Chelex 100 method was also tested (Malorny et al.,
2004), (method 2) and a modification of the Chelex 100 method (method 3, modification
consisted on an additional washing step of bacterial pellet with PBS). An initial
centrifugation step of 2000 rpm for 2 minutes was done to eliminate big food particles, and
supernatant was transferred to a new clean tube in methods 1 and 3. DNA obtained from
all 3 methods was stored at -20 ºC until use. All the protocols are summarized in Figure 2.
DNA was quantified and purity assessed, using a NanoDrop 1000 spectrophotometer
(Thermo Fischer Scientific, Inc., USA) software ND-1000 v3.7.1. Methods were compared
according to the amount of DNA obtained (ng/ µL), 260/ 280, 260/ 230 ratios, Cycle
Threshold (Ct) obtained by qPCR and dR last value (R is the raw fluorescence, and the dR
118 Publicaciones
value is dR baseline-corrected raw fluorescence which is calculated as final fluorescence

minus the initial fluorescence) for vvhA.
For the comparison of both methods, pure bacterial cultures of V. vulnificus CECT
4608 were used and also 1 oyster sample was inoculated with the same strain, and after
enrichment in PNC all 3 methods were applied. To compare pure cultures all parameters
previously mentioned were compared; for the inoculated sample only the last 2 were taken
into account. Three replicates were done for each experiment.
2.5 Multiplex qPCR detection method for V. vulnificus
components: 12.5 µL of Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies, Inc.,
USA), 700 nM primers and 250 nM probe were used for vvhA, 75 nM primers and 200 nM
probe were used for pilF; 300 nM primers and 200 nM probe were used for vcgC and for
Internal Amplification Control (IAC) 150 nM primers, 45 nM probe and 8x102 copies of IAC
DNA were added per reaction. Two microlitres of template DNA was added per reaction
tube.
Stratagene Mx3005p thermocycler (Agilent Technologies, Inc., USA) was used with
the following thermal profile: 3 minutes at 95 ºC for the activation of the polymerase (Hot
Start), followed by 40 cycles, each cycle consisted on a denaturation step of 15 seconds at
95 ºC, and annealing-extension step at 60 ºC for 60 seconds.
2.6 qPCR efficiency
Calculation of qPCR efficiency was done culturing overnight V. vulnificus CECT 4608 in
10 mL of SNB at 37 ºC. This strain was selected since it presents all 3 target genes. DNA
extraction was accomplished as described in Materials and methods 2.3.2, and measured
with a NanoDrop 1000 spectrophotometer.
Initial DNA template was ten-fold serially diluted in sterile milli-Q water, and 2 µL of
each dilution was used as template for qPCR. Efficiency was determined in triplicate for
119 Publicaciones
total, and for each pathogenicity gene of V. vulnificus.
The Mx3005pro software automatically calculates the standard curve for each run
based on the Cycle threshold (Ct) for each standard versus DNA concentration in ng. The
formula from which the amplification efficiency was calculated is e=10-1/s-1, where “s” is
the slope of the standard curve (Blackstone et al., 2007; Nordstrom, Vickery, Blackstone,
Murray, & DePaola, 2007).
2.7 Sampling and sample preparation
All food samples were received at the laboratory from external suppliers, either
frozen or refrigerated, and were kept in the same conditions until analysis. Regarding
water samples, were collected in sterile 500 mL plastic bottles, and stored at 4 ºC until
analysis.
Food samples were prepared by weighting 25 g of sample plus 225 mL of PNC.

Complete matrix was homogenized for 30 s in a laboratory stomacher at normal speed.
Water samples were processed as previously described (Garrido, Chapela, Ferreira et al.,
2012), briefly 500 mL or the whole sample volume, if less than 500 mL were available, were
filtered through a 0.45 µm membrane (Millipore, Ma USA); this filter was placed in a
stomacher bag with 50 mL of PNC, homogenized for 30 seconds. All samples were
incubated at 35 ºC for 22 ± 2 hours.
2.8 Limit of detection (LOD)
Raw oysters were inoculated for the evaluation of the LOD, which included a total of
22 samples. Two sets of 10 spiked samples with 1 black, all weighting 25 g, were used to
determine the LOD. Raw oysters of each set of 11 samples, belonged to distinct batches
and were received different days.
V. vulnificus CECT 4608 was used for the evaluation of the LOD. Bacterium was grown
in 10 mL of SNB at 37 ºC overnight and ten-fold serially diluted in APW. All 20 samples were
inoculated with 1 mL with anexpected concentration below 10 cfu/ mL. Serial dilutions
120 Publicaciones
used to inoculate the samples, were also seeded on SNA plates in order to get a reference
value of viable bacteria.
Evaluation of the method was done by calculating several parameters: relative

sensitivity (SE), relative specificity (SP), and relative accuracy (AC), as previously described
(Tomas, Rodrigo, Hernandez, & Ferrus, 2009).
Evaluation of these parameters was done by comparing the results obtained by qPCR
against the expected values of the spiked or blind, previously analyzed, samples.
Each sample with Positive (PA) and Negative (NA) Accordance were defined as
samples presenting the same result, positive or negative, for the qPCR method and the
expected results for spiked samples. Negative Deviations (ND) include the number of
samples expected positive with a negative result, and Positive Deviations (PD), represent
the number of samples expected negative with a positive result.
One-way ANOVA, Tukey b (p < 0.05) was used to evaluate SAPW, PNC and PNCC
broth productivity data, as well as DNA extraction methods. These analyses were
performed with SPSS 15.0 software (SPSS Inc., Chicago, IL, USA).
3 Results
3.1 Specificity of qPCR method
DNA obtained from bacteria in Table 1 was used as template for qPCR following
specifications mentioned in Materials and Methods 2.5.
Amplification for vvhA gene was obtained for all 4 strains of V. vulnificus tested in the
present study. Regarding vcgC gene positive results were only observed for strain CECT
121 Publicaciones
4608 (alignment along with primers and probe design can be seen in Figure 1). Finally pilF
was detected in strains CECT 4608 and CAIM 611.
According to BLAST tool, primers and probe designed for vcgC were specific of V.
vulnificus. When specificity was verified for all 3 genes against strains listed in Table 1, no
amplification was observed for any of the 30 non V. vulnificus strains tested, which covered
14 strains of the genus Vibrio, including the main pathogenic species (V. cholerae, V.
parahaemolyticus, V. alginolyticus, and V. mimicus) and 16 strains of other different
species which may be found in the same aquatic environment as V. vulnificus.
3.2 Enrichment broth comparison
The evaluation of the different enrichment broths was performed based on the
specifications of ISO 11133 (ISO, 2003b), in 2 consecutive steps. The first step consisted of
the evaluation of each broth for the enrichment of pure cultures; and the second step
consisted of the evaluation of each broth to recover V. vulnificus in the presence of
interfering bacteria.
3.2.1 Pure cultures
Tubes containing 10 mL of all 3 media under comparison (SAPW, PNC and PNCC)
were inoculated with a low concentration of target bacterium. Tubes were incubated, and
after enrichment ten-fold serial dilutions were plated. Finally plates were incubated at 37
ºC overnight.
Viable bacterial counts, expressed as log cfu/ mL, show significantly higher values for
PNC and PNCC (8.72 ± 0.09, and 8.80 ± 0.07 respectively) than for SAPW (8.05 ± 0.42),
however without differences among them, according to the statistical test applied.
3.2.2 Mixed cultures
Evaluation of the capacity of the media to recover V. vulnificus in the presence of

competing bacteria, was done inoculating 100 mL of broth with target microorganism (10-
100 cfu) and also with non-target bacteria, see Table 1, in a higher concentration (more
than 103 cfu). Bottles with mixed cultures were incubated under the same conditions
122 Publicaciones
described in Materials and methods 2.2.1. After enrichment ten-fold serial dilutions were
done, plated and incubated as previously described in Materials and methods.
Viable counts, expressed as log cfu/ mL, were statistically compared, and once more
higher values were obtained for PNC and PNCC (7.11 ± 0.32 and 7.40 ± 0.04) than for SAPW
(6.21 ± 1.15).
Three different DNA extraction methods were statistically compared, a simple boiling
protocol (method 1) and 2 based on Chelex 100 treatment (method 2) which differed, from
one another basically, in an additional PBS washing step (modified Chelex 100 protocol,
method 3).
Significantly higher DNA concentration was obtained for method 1, followed by

method 3, and the lowest concentration was obtained for method 2. Regarding purity,
260/ 280 ratio for methods 1 and 3 obtained the highest values without differences among
them, and again the lowest was obtained for method 2. Concerning 260/ 230 ratio, the
highest value was achieved with method 1, followed by methods 2 and 3. No statistical
differences were observed for either Ct or dR last values obtained with all 3 methods
applied to pure cultures.
Method 3 showed statistically lower Ct values than the other 2 protocols, which did
not show differences among them. Regarding dR last values, method 1 showed significantly
lower data, and statistically higher values were obtained for methods 2 and 3. All data are
summarized in Table 2.
3.4 qPCR efficiency
The software automatically calculates the standard curve for each run based on the
Ct for each standard (ten-fold serial dilutions from initial DNA extract). The formula from
which the amplification efficiency was calculated is e=10-1/s-1. In order to asses the
123 Publicaciones
efficiency of the method developed in the present study it was calculated in 3 different
experiments.
Average efficiency over 95 % was obtained for every gene (vvhA 97.8 %, pilF 98.9 %,
vcgC 96.1), covering 5 orders of magnitude. Amplification of all targets gave a correlation
coefficient higher than 0.99.
3.5 Limit of detection (LOD)
Evaluation of the LOD was done twice by spiking raw oysters from 2 different batches
and received at the laboratory different days.
Blank samples of each trial resulted negative for total and pathogenic V. vulnificus.
Out of the 20 inoculated samples 18 resulted positive (90 %) for the 3 pathogens with an
initial inoculation level of 3 cfu/ mL; thus the LOD of the method was established in 3 cfu in
25 g of sample.
A total of 28 natural, non inoculated samples were analyzed with the method
described. These samples covered oysters (main source of infection with this bacterium),
other bivalves, crustaceans, fish and water. None of the samples analyzed resulted positive
for the genes studied. Results obtained for both, inoculated and natural samples, are listed
in Table 3.
Evaluation of the method was done as previously described by Tomas et al. (2009)
(Tomas et al., 2009), thus relative sensitivity (SE), specificity (SP) and accuracy (AC)
parameters were calculated.
All 3 parameters showed values over 90 %, even though slight differences were
observed among the genes analized, due to 2 ND for all 3 targets and 3 for pilF and vcgC.
Values obtained for pilF and vcgC were 93 % for SE and AC, and 100 % for SP; regarding
vvhA values were higher achieving 95 % for SE, 100 % for SP and 96 % for AC.
124 Publicaciones
4. Discussion
V. vulnificus is an opportunistic human pathogen that may cause gastroenteritis,

severe necrotizing soft-tissue infections and primary septicemia, with a high lethality rate.
Illness is associated to ingestion of seafood or to the exposure of contaminated water
(Canigral et al., 2010). Currently shellfish industry faces many concerns and the most
critical is the presence of V. vulnificus in oysters. In humans, most cases occur in individuals
who are inmunocrompromised, have diabetes, or who have underlying diseases/
syndromes which result in elevated serum iron levels, primarily liver cirrhosis secondary to
alcohol abuse/ alcoholism (Rosche et al., 2005).
The Centers for Diseases Control and Prevention (CDC) along with the FDA and the
Gulf Coast states initiated a Cholera and Other Vibrio Illness Surveillance System (COVIS) in
1988, and by 1997 nearly all states of USA were voluntarily reporting to this database. It
was observed that in a 5 year period (2005-2009) the number of vibriosis due to V.
vulnificus was relatively stable, around 100 cases per year with an average mortality rate of
32 % (http://www.cdc.gov/nationalsurveillance/cholera_vibrio_surveillance.html). Even
though the number of cases is relatively low, the mortality rate is extremely high. So far, in
Europe there has been no such initiative. The European Union Regulation (EC) No. 2073/
2005 ((EC), 2005) sets out the microbiological criteria for foodstuff. This regulation makes
no provision for Vibrio controls in seafood traded within the European Community. Thus
currently, in the EU there is no legal basis for Vibrio testing. This is in part due to the
recommendations of the EU expert scientific committee on veterinary measures related to
public health (SCVMPH) who advised that existing internationally recognized methods were
not sufficiently fit for purpose and that available data did not support specific standards for
V.vulnificus in raw and undercooked seafood (Craig Baker-Austin, Stockley et al., 2010).
In the present study detection of V. vulnificus was done targeting vvhA gene, known
to encode for an extracellular cytolysin/ hemolysin, which was originally thought to be
involved in pathogenesis. Later on this role was dismissed and proved to be species specific
and was selected for total V. vulnificus detection (Campbell & Wright, 2003; Jones & Oliver,
2009). Even though previous studies suggested a lack of specificity of primers and probe
designed by Campbell et al. (2003) (Panicker & Bej, 2005), later studies by original authors
125 Publicaciones
confirmed originally described specificity by obtaining those strains from which the lack of
specificity was reported, and re-analyzing them (Wright et al., 2007).
Concerning pathogenicity, viuB was previously proposed as a classical pathogenicity

marker according to previous studies (Han et al., 2009; M. Azab El-Lathy, 2009; Panicker et
al., 2004), but later studies suggested that the presence of this gene may not be related
with pathogenic strains. Furthermore it was suggested that it was present in most strains
of V. vulnificus but showed allelic variation (Bogard & Oliver, 2007, , 2008; R.A. Swain,
2010), this was in agreement with the results obtained in our laboratory. Thus viuB was
discarded and 2 other different targets were selected for the evaluation of the pathogenic
character of the bacteria. First vcgC gene, from which previous studies have demonstrated
that in V. vulnificus biotype 1 is strongly correlated with potential virulence in humans, and
may also be used for typing biotypes 2 and 3 even though it has limited usefulness with
these biotypes (Craig Baker-Austin, Gore et al., 2010; C. Baker-Austin et al., 2011; Rosche et
al., 2005; Warner & Oliver, 2007, , 2008). The second pathogenicity target chosen was the
variability in pilF gene, which codes for a protein required for pilus-type IV assembly, whose
mutation in some bacterial pathogens implies attenuated virulence (C. Baker-Austin et al.,
2011; Roig et al., 2010). The later target has been scarcely applied for typing strains, and to
our knowledge this is the first report to test it against food and/ or water samples.
Recent studies have demonstrated the utility of combining several molecular

virulence testing approaches simultaneously (C. Baker-Austin et al., 2011). In this regard
the present study combined previously described primers and probes for specific detection
of a species specific target, vvhA, and well know pathogenicity indicator, vcgC (primers and
probe designed in the present study), with a recently described one, pilF. Previous studies
have applied either 1 or 2 of these targets (C. Baker-Austin et al., 2011; Campbell & Wright,
2003) but this is the first study to combine these 3 genes with a previously developed and
extensively applied IAC (Calvo et al., 2008; Garrido, Chapela, Ferreira et al., 2012; Garrido,
Chapela, Roman et al., 2012), being this last a highly recommended criterion for diagnostic
methods.
BLAST and qPCR verifications were carried out against target and non-target strains
to evaluate the specificity of primers and probes, especially those designed in the present
126 Publicaciones
study (vcgC). Results confirmed the correct designed and selection made in all cases
studied and the evaluation of multiplex qPCR efficiency reported values between 96 % and
99 %, being these between previously described acceptable limits (Raymaekers, Smets,
Maes, & Cartuyvels, 2009).
qPCR results obtained for the DNA extraction methods compared are in agreement
with previous studies, which reported that the addition of oyster tissue produced a
significant loss of sensitivity of qPCR methods (Wright et al., 2007). A modification of a
previous DNA extraction (Malorny et al., 2004) was evaluated and coupled to our method.
It was proved to be statistically better than the original one, regarding to DNA
concentration and purity obtained in pure cultures; and also in Ct and dR values in spiked
samples.
The complete method was able to specifically detect both, total and pathogenic V.
vulnificus, achieving a very low LOD (3 cfu/ 25 g), comparable to other studies performed
with other pathogenic Vibrio spp. by qPCR and traditional culture methods (Chapela et al.,
2010; Garrido, Chapela, Ferreira et al., 2012). Other authors have previously used 3
different concentrations for the evaluation of the LOD (high, medium and low). The present
study was focused only in the detection of the lowest bacterial concentration. Other spiked
samples were inoculated above the LOD, achieving correct detection. Also high SE, SP, and
AC values were obtained (all over 90 %). Furthermore, this is the first report to completely
evaluate PNC/ PNCC broth according to ISO requirements (ISO, 2003b) (PNCC was prepared
with 1 U/ mL of colistin as it has been reported that higher concentrations may inhibit low
concentrations of V. vulnificus (Hsu et al., 1998)), and extensively apply it to natural and
spiked sample screening. Results obtained proved that this broth was suitable for the
enrichment and detection of V. vulnificus even in the presence of high numbers of
interfering bacteria. In a total of 45 blind samples, including LOD, only 3 ND were detected,
but this results may be explained due to the very low inocula concentration used (lower
than 5 cfu/ mL, thus higher deviations in bacterial counts may be expected, and probably
these samples were below the LOD).
No natural food or water samples were found positive for, either total or pathogenic
V. vulnificus. This is in agreement with previous studies, which reported that in contrast to
127 Publicaciones
Asian countries and the USA, non-cholera Vibrio infections are less often reported in
Europe (Craig Baker-Austin, Stockley et al., 2010; Kuhnt-Lenz, Krengel, Fetscher, Heer-
Sonderhoff, & Solbach, 2004). V. vulnificus occurs naturally, and is not pollution associated,
in temperate and coastal waters worldwide, but it is most frequently isolated when water
temperatures are above 20 ºC and salinities are between 5 and 25 ‰. Because of such
environmental restrictions, there have been few cases reported in the Mediterranean,
presumably because the high salinity (38 ‰) of the water body (Oliver, 2005). Regarding
Spain, according to data gathered up to 2010, the risk of vibriosis is very low (AESAN,
2010), even though the presence of this bacterium has been reported in different sources
in Spain and other European countries (Canigral et al., 2010; Oliver, 2005; Schaerer, Savioz,
Cernela, Saegesser, & Stephan, 2011).
5. Conclusions
The present study demonstrated, after extensive evaluation according to

internationally acceptance criteria, that PNC/ PNCC may be used for selective enrichment
of food samples intended for detection of V. vulnificus. Furthermore, it may be applied
combined with a qPCR detection method for fast and reliable detection of both, total and
pathogenic V. vulnificus in food and environmental samples.
Complete monitoring of total and pathogenic V. vulnificus can be achieved in less

than 2 hours after enrichment, with a very low LOD (including DNA extraction and qPCR
run) thus making this method suitable for sensitive analysis of food products with very
short shelf-life or any other products when fast results are needed. It may be also used for
environmental monitoring of this pathogenic bacterium in water samples, and for research
purposes.
128 Publicaciones
Acknowledgements
This work is financially supported by the Secretary General for the Sea of the Spanish
Ministry of Agricultural, Land and Marine Resources (MARM), by order ARM/1193/2009.
Authors also thank Victoria Docampo and Angeles Marcote for technical assistance.
129 Publicaciones
Tables
Table 1. Strains used to test: productivity and selectivity of media and specificity of primers and probes (qPCR result)
qPCR result vvhA, qPCR result vvhA,

Strain Bacteria Strain
Bacteria pilF, vcgC* pilF, vcgC*
V. vulnificus a, b CECT 4608 +/ +/ + E. faecalis b CECT 481 –
V. vulnificusb CECT 529 +/ –/ – A. hydrophila b CECT 839 –
V. vulnificus b CECT 4869 +/ –/ – P. putida b CECT 324 –
V. vulnificus b CAIM 611 +/ +/– P. aeruginosa b CECT 108 –
V. parahaemolyticus b CECT 511 – P. fluorescens b CECT 378 –
V. parahaemolyticus b CECT 5271 – E. coli b CECT 516 –
V. parahaemolyticus b CCUG 43362 – E. coli b CECT 434 –
V. parahaemolyticus b CCUG 43363 – C. freundii b CECT 401 –
V. parahaemolyticus b CCUG 43364 – S. aureus b CECT 240 –
V. parahaemolyticus b CCUG 43365 – S. aureus b CECT 435 –
V. parahaemolyticus b CAIM 58 – S. enterica b CECT 4594 –
V. cholerae b CECT 514 (O1) – S. sonnei b CECT 413 –
V. cholerae b CCUG 47460 (O139) – S. flexneri b CECT 4804 –
V. alginolyticus b CECT 586 – L. monocytogenes b CECT 935 –
V. alginolyticus b CAIM 342 – L. innocua b CECT 910 –
V. alginolyticus ** b (internal reference) – L. seeligeri b CECT 917 –
V. mimicus b CECT 4218 – L. ivanovii b CECT 913 –
V. mimicus b BCCM/ LMG 7896 –
a. productivity, b. specificity of primers and probes. *Unless otherwise stated negative sign indicates no amplification of all three qPCR
targets. ** Strain identified in the laboratory of ANFACO-CECOPESCA. CECT: Spanish Type Culture Collection, CCUG: Culture Collection
University of Göteborg, CAIM: Collection of Aquatic Important Microorganisms, BCCM/ LMG: Belgian Co-Orfinated Collections Of
Micro-Organsims
130 Publicaciones
Table 2. Ct and dR values in pure cultures and inoculated oyster samples
Pure culture Pure culture

Pure culture Ct 260/ 280 260/ 230 Oyster Ct Oyster dR last
dR last DNA
7592.72 ±
Method 1 20.31 ± 0.48a 44.11 ± 1.28a 1.89 ± 0.03a 1.26 ± 0.03a 21.73 ± 0.27b 2903.68 ± 322b
911.27 a
7339.06 ± 6050.89 ±
Method 2 22.86 ± 2.40 a 14.74 ± 3.31c 1.43 ± 0.14b 0.52 ± 0.08c 23.31 ± 1.26b
3775.29 a 1451.04a
9580.98 ± 7099.15 ±
Method 3 19.42 ± 0.31 a 28.11 ± 1.09b 1.93 ± 0. 12a 0.93b 19.62 ± 0.06a
769.58 a 29.45a
Within same column, different letters indicate statiscally significant differences among data (p< 0.05). Method 1: boiling, Method
2: Chelex 100, Method 3: modified Chelex 100. DNA concentration expressed in ng/ µL. dR last indicates final fluorescence
obtained
131 Publicaciones
Table 3. Spiked and natural samples analyzed
Number Strain used for inoculation qPCR result Observations

I/ N* of
Samples CECT 529 CECT 4869 CECT 4608 vvha pilF vcgC
Oysters+ I 20 – – + + + + Two ND for all 3 genes
Oysters I 3 – – – – – –
2 + – – + – –
2 – – + + + +
2 – + – + – –
1 + + – + – –
1 + – + – + – One ND for pilF and vcgC
2 + + + + + +
Bivalves I 1 – – + + + +
1 – + – + – –
Water I 2 – – – – – –
2 + – – + – –
3 – – + + + +
2 – + – + – –
Crustaceans I 1 – – + + + +
Oysters N 6 – – –
Bivalves N 10 – – –
Fish N 6 – – –
Water N 4 – – –
Crustaceans N 2 – – –
+
Spiked samples used for evaluation of the LOD. *I: Inoculated; N: Natural non spiked samples. ND: Negative Deviation
111 Publicaciones
Figures
Figure 1. vcgC gene sequence alignment with primers and probe designed in the present study
Method 1: boiling* Method 2: Chelex 100 Method 3: modified Chelex 100*
200 µL enrichment +
13000 rpm/ 5 min 13000 rpm/ 5 min
800 µL steril MQ water
13000 rpm/ 5 min
Pellet
SN
Pellet
Pellet
SN
SN
+ 1mL PBS + 1mL PBS

13000 rpm/ 5 min 13000 rpm/ 5 min
Pellet
300 µL Chelex 100 6 %

SN
Pellet
SN
56 ºC
1000rpm/ 20 min 200 µL PBS +
800 µL steril MQ water
100 ºC/ 8 min
+ 200 µL PBS 13000 rpm/ 5 min
Ice 2 min
100 ºC/ 10 min 13000 rpm/ 5 min
Ice 2 min
Pellet
300 µL Chelex 100 6 %

SN
13000 rpm/ 5 min

56 ºC/ 1000rpm- 15 min
100 ºC/ 8 min
Ice 2 min
13000 rpm/ 5 min
DNA
DNA
DNA
*Previous step for methods 1 and 3: Centrifuge 1 ml of enrichment broth (2000 rpm/2 min) and take the supernatant (SN) obtained.
Figure 2. Schematic representation of DNA extraction methods compared.
112 Publicaciones
Bibliography
(EC), C. R. (2005). Microbiological criteria for foodstuffs. In (Vol. 2073/2005): Official Journal of
the European Union.
A/S, C. b. CLC Sequence Viewer. In (6.5.4 ed.).
AESAN. (2010). Report from the Scientific Commitee of the Spanish Agency of Food Safety and
Nutrition about the microbiological criteria for the pathogenic species of Vibrio genus, as additional
means of control in the border inspection points, to imported fish products. In Scientific's Commitee
Magazine (Vol. Number 12).
Andreas Untergasser, H. N., Xiangyu Rao, Ton Bisseling, Ren Geurts, and Jack A.M. Leunissen.
(2007). Primer3Plus, an enhanced web interface to Primer3 Nucleic Acids Research.
Baker-Austin, C., Gore, A., Oliver, J. D., Rangdale, R., McArthur, J. V., & Lees, D. N. (2010). Rapid in
situ detection of virulent Vibrio vulnificus strains in raw oyster matrices using real-time PCR.
Environmental Microbiology Reports, 2 (1), 76-80.
Baker-Austin, C., Lemm, E., Hartnell, R., Lowther, J., Onley, R., Amaro, C., Oliver, J. D., & Lees, D.
(2011). pilF polymorphism-based real-time PCR to distinguish Vibrio vulnificus strains of human health
relevance. Food Microbiology.
Baker-Austin, C., Stockley, L., Rangdale, R., & Martinez-Urtaza, J. (2010). Environmental
occurrence and clinical impact of Vibrio vulnificus and Vibrio parahaemolyticus: a European perspective.
Environmental Microbiology Reports, 2 (1), 7-18.
Blackstone, G. M., Nordstrom, J. L., Bowen, M. D., Meyer, R. F., Imbro, P., & DePaola, A. (2007).
Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey
of Mobile Bay. Journal of Microbiological Methods, 68 (2), 254-259.
Blanco-Abad, V., Ansede-Bermejo, J., Rodriguez-Castro, A., & Martinez-Urtaza, J. (2009).

Evaluation of different procedures for the optimized detection of Vibrio parahaemolyticus in mussels
and environmental samples. International Journal of Food Microbiology, 129 (3), 229-236.
Bogard, R. W., & Oliver, J. D. (2007). Role of iron in human serum resistance of the clinical and
environmental Vibrio vulnificus genotypes. Applied and Environmental Microbiology, 73 (23), 7501-
7505.
Bogard, R. W., & Oliver, J. D. (2008). Role of iron in human serum resistance of the clinical and
environmental Vibrio vulnificus genotypes (vol 53, pg 671, 2007). Applied and Environmental
Microbiology, 74 (10), 3322-3322.
Calvo, L., Martinez-Planells, A., Pardos-Bosch, J., & Garcia-Gil, L. J. (2008). A New Real-Time PCR
Assay for the Specific Detection of Salmonella spp. targeting the bipA Gene. Food Analytical Methods, 1
(4), 236-242.
Campbell, M. S., & Wright, A. C. (2003). Real-time PCR analysis of Vibrio vulnificus from oysters.
Applied and Environmental Microbiology, 69 (12), 7137-7144.
113 Publicaciones
Canigral, I., Moreno, Y., Alonso, J. L., Gonzalez, A., & Ferrus, M. A. (2010). Detection of Vibrio
vulnificus in seafood, seawater and wastewater samples from a Mediterranean coastal area.
Microbiological Research, 165 (8), 657-664.
Chapela, M. J., Fajardo, P., Garrido, A., Cabado, A. G., Ferreira, M., Lago, J., & Vieites, J. M. (2010).
Vibrio cholerae Detection. Journal of Agricultural and Food Chemistry, 58 (7), 4051-4055.
Chatzidaki-Livanis, M., Hubbard, M. A., Gordon, K., Harwood, V. J., & Wright, A. C. (2006). Genetic
distinctions among clinical and environmental strains of Vibrio vulnificus. Applied and Environmental
Microbiology, 72 (9), 6136-6141.
DePaola, A., Nordstrom, J. L., Dalsgaard, A., Forslund, A., Oliver, J., Bates, T., Bourdage, K. L., &
Gulig, P. A. (2003). Analysis of Vibrio vulnificus from market oysters and septicemia cases for virulence
markers. Applied and Environmental Microbiology, 69 (7), 4006-4011.
Drake, S. L., DePaola, A., & Jaykus, L. A. (2007). An overview of Vibrio vulnificus and Vibrio
parahaemolyticus. Comprehensive Reviews in Food Science and Food Safety, 6 (4), 120-144.
Garrido, A., Chapela, M. J., Ferreira, M., Atanassova, M., Fajardo, P., Lago, J., Vieites, J. M., &
Cabado, A. G. (2012). Development of a multiplex real-time PCR method for pathogenic Vibrio
parahaemolyticus detection (tdh+ and trh+). Food Control, 24 (1-2), 128-135.
Garrido, A., Chapela, M. J., Roman, B., Ferreira, M., Lago, J., Vieites, J. M., & Cabado, A. G. (2012).
Technology, 234 (4), 571-580.
Gulig, P. A., Bourdage, K. L., & Starks, A. M. (2005). Molecular pathogenesis of Vibrio vulnificus.
Journal of Microbiology, 43, 118-131.
Han, F. F., Pu, S. H., Hou, A. X., & Ge, B. L. (2009). Characterization of Clinical and Environmental
Types of Vibrio vulnificus Isolates from Louisiana Oysters. Foodborne Pathogens and Disease, 6 (10),
1251-1258.
Harwood, V. J., Gandhi, J. P., & Wright, A. C. (2004). Methods for isolation and confirmation of
Vibrio vulnificus from oysters and environmental sources: a review. Journal of Microbiological Methods,
59 (3), 301-316.
Hsu, W. Y., Wei, C. I., & Tamplin, M. L. (1998). Enhanced broth media for selective growth of
Vibrio vulnificus. Applied and Environmental Microbiology, 64 (7), 2701-2704.
ISO. (2003a). Microbiology of food and animal feeding stuffs -- Guidelines on preparation and
production of culture media -- Part 2: Practical guidelines on performance testing of culture media In
(Vol. 11133-2, pp. 27).
ISO. (2003b). Microbiology of food and animal feeding stuffs -- Guidelines on preparation and
production of culture media -- Part 2: Practical guidelines on performance testing of culture media.
Amendment 1. In (1st ed., Vol. 11133-2, pp. 27).
Jones, M. K., & Oliver, J. D. (2009). Vibrio vulnificus: Disease and Pathogenesis. Infection and
Immunity, 77 (5), 1723-1733.
114 Publicaciones
Kuhnt-Lenz, K., Krengel, S., Fetscher, S., Heer-Sonderhoff, A., & Solbach, W. (2004). Sepsis with
bullous necrotizing skin lesions due to Vibrio vulnificus acquired through recreational activities in the
Baltic Sea. European Journal of Clinical Microbiology & Infectious Diseases, 23 (1), 49-52.
M. Azab El-Lathy, G. E. E.-T., Waled Morsy El-Sonosy, F. A. Samhan, Tarek A. A. Moussa. (2009).
Determination of pathogenic bacteria in wastewater using conventional and PCR techniques.
Environmental Biotechnology, 5 (2), 73-80.
Malorny, B., Cook, N., D'Agostino, M., De Medici, D., Croci, L., Abdulmawjood, A., Fach, P.,
Karpiskova, R., Aymerich, T., Kwaitek, K., Kuchta, T., & Hoorfar, J. (2004). Multicenter validation of PCR-
based method for detection of Salmonella in chicken and pig samples. Journal of Aoac International, 87
(4), 861-866.
Nordstrom, J. L., Vickery, M. C. L., Blackstone, G. M., Murray, S. L., & DePaola, A. (2007).
Development of a multiplex real-time PCR assay with an internal amplification control for the detection
of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and Environmental
Microbiology, 73, 5840-5847.
Oliver, J. D. (2005). Wound infections caused by Vibrio vulnificus and other marine bacteria.
Epidemiology and Infection, 133 (3), 383-391.
Panicker, G., & Bej, A. K. (2005). Real-time PCR detection of Vibrio vulnificus in oysters:
Comparison of oligonucleotide primers and probes targeting vvhA. Applied and Environmental
Microbiology, 71 (10), 5702-5709.
Panicker, G., Call, D. R., Krug, M. J., & Bej, A. K. (2004). Detection of pathogenic Vibrio spp. in
shellfish by using multiplex PCR and DNA microarrays. Applied and Environmental Microbiology, 70 (12),
7436-7444.
R.A. Swain, M. K. J., P. Thiaville, J. Joseph, P.A. Gulig, A.C. Wright. (2010). The iron limitation
response of Vibrio vulnificus: genetic variation, GacA regulation, and virulence. In Vibrios In The
Environment. Biloxi, Mississippi.
Raymaekers, M., Smets, R., Maes, B., & Cartuyvels, R. (2009). Checklist for Optimization and
Validation of Real-Time PCR Assays. Journal of Clinical Laboratory Analysis, 23 (3), 145-151.
Roig, F. J., Sanjuan, E., Llorens, A., & Amaro, C. (2010). pilF Polymorphism-Based PCR To
Distinguish Vibrio vulnificus Strains Potentially Dangerous to Public Health. Applied and Environmental
Microbiology, 76 (5), 1328-1333.
Rosche, T. M., Yano, Y., & Oliver, J. D. (2005). A rapid and simple PCR analysis indicates there are
two subgroups of Vibrio vulnificus which correlate with clinical or environmental isolation. Microbiology
and Immunology, 49 (4), 381-389.
Schaerer, K., Savioz, S., Cernela, N., Saegesser, G., & Stephan, R. (2011). Occurrence of Vibrio spp.
in Fish and Shellfish Collected from the Swiss Market. Journal of Food Protection, 74 (8), 1345-1347.
Strom, M. S., & Paranjpye, R. N. (2000). Epidemiology and pathogenesis of Vibrio vulnificus.
Microbes and Infection, 2 (2), 177-188.
Tomas, D., Rodrigo, A., Hernandez, M., & Ferrus, M. A. (2009). Validation of Real-Time PCR and
Samples. Food Analytical Methods, 2 (3), 180-189.
115 Publicaciones
Warner, E., & Oliver, J. D. (2007). Refined medium for direct isolation of Vibrio vulnificus from
oyster tissue and seawater. Applied and Environmental Microbiology, 73 (9), 3098-3100.
Warner, E., & Oliver, J. D. (2008). Population structures of two genotypes of Vibrio vulnificus in
oysters (Crassostrea virginica) and seawater. Applied and Environmental Microbiology, 74 (1), 80-85.
Wright, A. C., Garrido, V., Debuex, G., Farrell-Evans, M., Mudbidri, A. A., & Otwell, W. S. (2007).
Vibrio vulnificus bacteria. Applied and Environmental Microbiology, 73 (22), 7477-7481.
116 Publicaciones
3.7 Artículo 7
Título: In-house validation of novel multiplex Real-Time PCR gene combination for the
simultaneous detection of the main human pathogenic vibrios (V. cholerae, V.
parahaemolyticus, and V. vulnificus)
Autores: Alejandro Garrido, María-José Chapela, Elvira Peñaranda, Juan M. Vieites,

Ana G. Cabado
Revista: International Journal of Food Microbiology (sometido)
Resumen:
El objetivo de este estudio fue el desarrollo de un método de qPCR múltiple para

detectar las tres principales especies de vibrios patógenos que afectan al ser humano,
V. cholerae, V. parahaemolyticus y V. vulnificus.
El reciente aumento en la incidencia de episodios de vibriosis ha incrementado la

preocupación sobre la inocuidad de los alimentos de riesgo. Esto ha llevado por un
lado, a que en determinados países, como EE. UU. y Canadá, se implanten normas más
estrictas sobre el control de estos microorganismos (ausencia de V. cholerae
independientemente del serotipo, que anteriormente se restringía a los serotipos O1 y
O139). Por otro lado, en otros países como España, se han incluido recomendaciones
específicas, para el control de estos patógenos.
En este estudio se valoró la posibilidad de utilizar una única temperatura de

incubación para las tres especies bacterianas, y la realización del análisis directamente
del enriquecimiento. La introducción de las dos consideraciones anteriormente citadas
en el método de análisis permite simplificar el ensayo y dotaría de mayor versatilidad a
los laboratorios de control. Asimismo se evaluaron dos métodos de extracción de ADN
117 Publicaciones
basados en el empleo de Chelex-100 y lisis térmica, teniendo en cuenta cantidad y

pureza del ADN extraído así como los resultados obtenidos mediante qPCR.
Finalmente la qPCR diseñada obtuvo valores de eficiencia comprendidos entre el

95,7 % y el 103,1 % en los formatos simple y múltiple. Se obtuvo un límite de detección
de inferior a 10 ufc por 25 g de muestra. Asimismo, todos los parámetros de la
capacidad diagnóstica del método, obtuvieron valores por encima del 94 %. El método
de qPCR fue aplicado a 141 muestras que incluían pescado, bivalvos, algas, crustáceos,
agua y dos ensayos interlaboratorio.. El método de qPCR fue aplicado a 141 muestras
que incluían pescado, bivalvos, algas, crustáceos, agua y dos ensayos interlaboratorio.
Title
In-house validation of novel multiplex Real-Time PCR gene combination for the
simultaneous detection of the main human pathogenic vibrios (V. cholerae, V.
parahaemolyticus, and V. vulnificus)
Alejandro Garrido, María-José Chapela, Elvira Peñaranda, Juan M. Vieites, Ana G.

Cabado*
Spain
Tel: 00 34 986 469 303
Fax: 00 34 986 469 269
118 Publicaciones
Abstract
In recent years the incidence of vibriosis has greatly increased, raising the concern
about food safety associated with food products at risk. Recent studies demonstrated
various advantages of molecular methods for the screening of foodborne pathogens in
food, among them, qPCR is the most popular technique. The new method developed in
the present study allows fast and reliable detection of the main human pathogenic
vibrio species (V. cholerae, V. parahaemolyticus, and V. vulnificus). Specificity of the
combination of primers and probes was tested against several bacterial strains and
species (44 different strains) as well as among them by evaluating qPCR efficiency
(values were over 94 %). The evaluation of the quality of the method was based on six
parameters: the relative sensitivity, specificity, accuracy, positive and negative
predictive values as well as index kappa of concordance. For each one of them the
values obtained were higher than 94 %. Additionally a very low limit of detection was
determined for the developed method (less than 10 cfu/ 25 g). All the parameters
analyzed for the method were obtained from the analysis of a wide variety of food and
water samples as well as proficiency tests, and compared against the culture reference
method.
Keywords: ompW, tlh, vvhA, qPCR, Vibrio spp., qPCR
119 Publicaciones
1. Introduction
The genus Vibrio is a group of gram-negative bacteria comprising more than 70

species. These microorganisms are ubiquitous in aquatic environments and inhabit
marine animals. Even though 13 different species have been associated with human
pathogenesis; the majority of human Vibrio infections are associated with three
species: V. cholerae, V. parahaemolyticus, and V. vulnificus (Drake et al., 2007; Izumiya
et al., 2011; Neogi et al., 2010; Thompson et al., 2004). The number of diagnosed cases
of vibriosis in the USA during the period comprised from 2005 to 2009 shows a
significant increase. Thus, in 2005, 231 cases were diagnosed, raising up to 837 in 2009
(CDC, 2012).
V. cholerae is the causative agent of Asiatic or epidemic cholera. Two serogroups

(O1 and O139) are responsible for cholera epidemics but these are rarely isolated in
the environment, while some strains of other serogroups (non-O1/ non-O139) are also
associated with sporadic gastroenteritis, and they are common inhabitants of the
aquatic ecosystems (Blackwell, Oliver, 2008; Jones, Oliver, 2009; Neogi et al., 2010).
The first report of V. parahaemolyticus infection was documented in 1950, and since
then it has become the leading cause of seafood-derived food poisoning worldwide.
Infection causes acute gastroenteritis, but it may also cause wound infection and
septicemia (Broberg et al., 2011; Hiyoshi et al., 2010; Su, Liu, 2007). Finally, V.
vulnificus has been identified as the most deadly food-borne pathogen in the US,
accounting for 95 % of all seafood related deaths. Its fatality rate can be as high as 50
%, among immunocompromised patients or individuals with underlying chronic
disease, particularly liver disease. It may also cause gastroenteritis, necrotizing fasciitis,
and wound infections (Gulig et al., 2010; Roig et al., 2010).
European regulation does not consider analysis of pathogenic vibrios in food, not
even in its latest amendments ((EC), 2005; (EC), 2007; (EC), 2010). In contrast, the
Canadian and American regulations specifically mention the main pathogenic Vibrio
spp. (Canadian Food Inspection Agency, ; FDA, 2011). In 2010, the Scientific Committee
of the Spanish Agency for Food Safety and Nutrition (AESAN) published several
recommendations regarding pathogenic vibrios. These recommendations included the
120 Publicaciones
application of the zero-tolerance without distinguishing serotypes for V. cholerae and

the inclusion of a maximum limit of 102 cfu/ g for V. parahaemolyticus. Finally, it also
recommended to extend the surveillance over V. vulnificus in fish, and shellfish from
areas at risk (AESAN, 2010).
At present several methods exist for the screening of pathogenic vibrios in food,
like those developed by the Internal Standarization Organization (ISO) or by the Food
and Drugs Administration (FDA) (Charles A. Kaysner and Angelo DePaola, 2004; ISO,
2007a; ISO, 2007b). Although these methods are reliable, all of them are culture based,
thus presenting several limitations as: lack of recovery of viable but not culturable
bacteria (VBNC), duration of the assay (up to 4 days to obtain a biochemical
identification), overgrowth of other bacteria that may hide desired colonies or make
the isolation step difficult, among others. (Chomvarin et al., 2007; Fedio et al., 2007;
Lyon, 2001; Saravanan et al., 2007). All these problems may be overcome by the
application of molecular methods from which PCR is the most commonly applied
(Bauer, Rorvik, 2007; Blanco-Abad et al., 2009; Malayil et al., ; Neogi et al., 2010;
Sharma, Chaturvedi, 2006; Sheikh et al., 2012). Furthermore, real-time PCR (qPCR) has
been successfully used to detect and quantify foodborne pathogens, including
pathogenic vibrios, taking advantage of different detection chemistries like SYBR
Green, TaqMan probes or Molecular Beacons (Gubala, 2006; Gubala, Proll, 2006;
Kamio et al., 2008; Takahashi et al., 2005; Tyagi et al., 2009). Multiplex qPCR methods
for simultaneous detection of the specific species detection of V. cholerae, V.
parahaemolyticus¸ and V. vulnificus are scarce. Furthermore, the sequence of primers
and probes are not always freely available as in some are included in commercial
detection kits ((Tebbs et al.), BAX® System Real-Time PCR assay for Vibrio (DuPont
Qualicon, Wilmington DE)).
The aim of the present study was to develop and evaluate a straightforward
multiplex qPCR method for simultaneous detection of the three most important
human pathogenic vibrios. The complete method included direct sample enrichment in
Alkaline Saline Peptone Water (ASPW), and a simple DNA extraction steps previous to
multiplex qPCR for the simultaneous detection V. cholerae, V. parahaemolyticus¸ and
V. vulnificus.
121 Publicaciones
2. Materials and Methods

Spanish Type Culture Collection (CECT) strains used as reference strains for the
evaluation of the method were: V. cholerae CECT 514, V. parahemolyticus CECT 511,
and V. vulnificus CECT 529. Bacteria were stored frozen at -20 °C until use. All other
organisms were also purchased from the CECT and are summarized in Table 1.
Fresh cultures of all strains used in the present study were obtained by
inoculating 10 mL tubes of Tryptic Soy Broth (TSB, BioMérieux S.A., France), and were
incubated at 37 °C overnight, except for Bacillus subtilis which was incubated at 31 °C.
Reference values of each target bacterium under study was determined by

growing the microorganisms in an appropriate general broth (V. cholerae in TSB, V.
parahaemolyticus, and V. vulnificus in TSB supplemented with 2 % NaCl) incubated
overnight at 37 °C. After enrichment, ten-fold serial dilutions were done in Alkaline
Peptone Water (APW, Biolife Italiana S.r.l., Italy), and plated on Saline Nutrient Agar
(SNA, Biokar diagnostics S.A., France) supplemented with 10 g/ L of sodium chloride.
Plates were incubated overnight at 37 °C overnight.
Sample enrichment was performed using Saline Alkaline Peptone Water (ASPW,
Biolife Italiana S.r.l., Italy). The composition of this broth was double strength of APW
(10 g/ L Peptone plus 10 g/ L sodium chloride).
2.2 Culture method for detection of pathogenic Vibrio spp.

Detection of V. cholerae, V. parahemolyticus, and V. vulnificus by traditional
microbiology was carried out following the methods described in ISO/TS 21872-1:2007
(method for detection of V. cholerae and V. parahaemolyticus) and ISO/TS 21872-
2:2007 (method for detection of other potentially pathogenic vibrios other than V.
cholerae and V. parahaemolyticus) (ISO, 2007a; ISO, 2007b). Briefly, the achievement
of both methods consist in two enrichment steps in ASPW, and plating after each
enrichment on selective solid media. Thiosulphate Citrate Bile salt Sucrose (TCBS) is
used in both methods for isolation of these bacteria. A second isolation medium is
122 Publicaciones
recommended as well, either to be chosen by the laboratory (ISO, 2007a) or to be

selected among a list of media (ISO, 2007b).
In the present study TCBS (OXOID, Hampshire, England) and CHROMagar™ Vibrio
(CHROMagar Microbiology, Paris, France), were used as second medium for the
isolation of V. cholerae and V. parahaemolyticus; and Colistin Polymixin β-Cellobiose
agar (CPC, Sigma-Aldrich, St. Louis, USA) was selected as the second isolation medium
for V. vulnificus. The initial study also included HiCrome™ Vibrio (HC, Sigma-Aldrich, St.
Louis, USA) as a possible secondary selective medium. A schematic presentation of the
method is shown in Figure 1.
2.3 DNA extraction

Three different DNA extraction protocols were evaluated. A boiling procedure
was used for cultures and 2 similar methods were compared for food samples (boiling
DNA extraction was preceded by a Chelex-100 (Bio-Rad Laboratories, Inc., USA)
purification step). DNA obtained from pure cultures was quantified using a NanoDrop
1000 spectrophotometer (Thermo Fischer Scientific, Inc., USA) software ND-1000
v3.7.1. Food samples protocols were compared according to the amount of DNA
obtained (ng/ µL), 260/ 280, 260/ 230 ratios. Both methods were applied to 1 mL
aliquots of the corresponding samples.
2.3.1 DNA extraction from pure cultures

DNA extraction from pure cultures was done as previously described by Blanco-
Abad et al. (Blanco-Abad et al., 2009). The method consists of several centrifugation
steps to eliminate food particles and concentrate bacteria, washing with TE 1 X to
eliminate possible interfering substances and a boiling step to lyse the cells.
2.3.2 DNA extraction from food samples

An initial centrifugation step of 2000 rpm for 2 minutes was performed to
eliminate big food particles. Then supernatant centrifuged again at 13000 rpm for 5
minutes to precipitate the cells and bacterial pellet was resuspended in 1 mL of sterile
PBS (Rossmanith et al., 2006) and centrifuged again in the same conditions. Additional
123 Publicaciones
washing step with milli-Q water was done for the first protocol and samples were
centrifuged again. Bacterial cell pellets were resuspended in 300 µL of 6 % or 10 %
Chelex-100 and incubated at 56 °C for 15 minutes. After incubation cells were lysed by
placing the tubes in a boiling water bath for 8 and 10 minutes for the 6 % and 10 %
chelex respectively, then chilled on ice for 2 minutes and finally centrifuged again at
13000 rpm for 5 minutes. Supernatant containing DNA was stored at -20 °C until use.
In order to evaluate the quality of the assays, two samples from a proficiency test were
analyzed by duplicate following both methods described.
2.4 Genes, primers and probes used for qPCR method

Species-specific genes were selected for each bacterium including ompW for V.
cholerae, tlh for V. parahaemolyticus, and vvhA for V. vulnificus.
On the one hand, detection of V. vulnificus was done targeting vvhA gene as
previously described by Campbell et al. (Campbell, Wright, 2003) vvha-F:
TGTTTATGGTGAGAACGGTGACA, vvha-R: TTCTTTATCTAGGCCCCAAACTTG, vvha-Probe:
(5Cy5)
-CCGTTAACCGAACCACCCGCAA-(3BHQ_2). On the other hand, detection of V.
parahaemolyticus was performed targeting the tlh gene, as described Nordstrom et al.
2007 (Nordstrom et al., 2007) tlh-F: ACTCAACACAAGAAGAGATCGACAA tlh-R:
GATGAGCGGTTGATGTCCAA and tlh-probe: (5FAM)-CGCTCGCGTTCACGAAACCGT-(3BHQ_1)
Regarding V. cholerae, to our knowledge, no extensively used qPCR primers and

probes have been published for ompW, thus primers and probe were designed in this
study. For this purpose several sequences were obtained from GenBank (FJ462445,
FJ462447, FJ462449, FJ462451, FJ462453, FJ462454, FJ462455, AF001009, and
X51948) and aligned with CLC Sequence Viewer version 6 (A/S). Primers and probe
design was carried out with the free online application Primer3 (Andreas Untergasser,
2007). The following primers and probe were selected for specific detection of V.
cholerae: ompW-F: TCAATGATAGCTGGTTCCTCAAC, ompW-R:
(5HEX)
CGATGATAAATACCCAAGGATTGA, ompW-Probe: -
TGGTATGCCAATATTGAAACAACG-(3IABkFQ). Specificity of primers and probe designed
was checked using BLAST (Basic Local Alignment Search Tool,
124 Publicaciones
http://blast.ncbi.nlm.nih.gov/Blast.cgi), and against bacterial strains specified in Table

1.
An internal control based on a chimerical DNA, published by Calvo et al. 2008

(Calvo et al., 2008) and extensively used previously in our laboratory (Garrido et al.,
2013; Garrido et al., 2012a; Garrido et al., 2012b), was selected to monitor qPCR
reaction. Primers and probe sequences were: IAC F: TCCAGGGCGAAAGTAAACGT, IAC
R: GGCGAGCCGTACGAACAC, IAC Probe: (5TexRd-XN)-CCCAGTTGGCTGATCACTTTCG-(3BHQ_2).
2.5 Multiplex qPCR detection method for pathogenic Vibrio spp.

components: 12.5 µL of Brilliant III Ultra-Fast QPCR Master Mix (Agilent Technologies,
Inc., USA), 100 nM primers and 100 nM probe were used for vvha, 75 nM primers and
were used for tlh and ompW, with 100 nM and 150 nM probe respectively. Regarding
Internal Amplification Control (IAC) 150 nM primers, 45 nM probe and 8x102 copies of
the chimerical DNA were added per reaction. Two microlitres of template DNA were
added per reaction tube.
Stratagene Mx3005p thermocycler (Agilent Technologies, Inc., USA) was used

with the following thermal profile: 3 minutes at 95 °C for the activation of the
polymerase (Hot Start), followed by 40 cycles, each cycle consisted on a denaturation
step of 15 seconds at 95 °C, and an annealing-extension step at 61 °C for 30 seconds.
2.6 Sampling and sample preparation

All food samples were received at the laboratory from external suppliers, either
frozen or refrigerated, and were kept under the same conditions until analysis. Water
samples were collected in sterile 500 mL plastic bottles, and stored at 4 °C previous to
analysis.
Twenty-five grams of sample was weighted for food products and 225 mL of
ASPW were added. Samples were homogenized for 30 s in a laboratory stomacher at
normal speed. Water samples were processed as previously described (Garrido et al.,
125 Publicaciones
2012a), briefly, a minimum of 500 mL, were filtered through a 0.45 µm membrane
(Millipore, Ma USA), then the filter was placed in a stomacher bag with 50 mL of
ASPW, and homogenized for 30 seconds. All samples were incubated at 35 °C for 18 ±
2 hours.

A complete evaluation of the newly developed qPCR method was performed
taking into account 3 different aspects:
 Efficiency of the reaction to ensure correct amplification of the four targets

(including IAC).
 Limit of detection to guarantee reliable recovery and detection of low numbers
of each bacterium.
 Method recovery from spiked samples with different origins was evaluated
taking into account expected results.
2.7.1 qPCR efficiency determination
For the evaluation of the qPCR efficiency V. cholerae, V. parahaemolyticus, and V.

vulnificus reference strains were grown and DNA was extracted as described in
Materials and Methods 2.1 and 2.3.1 respectively, and measured with the NanoDrop
1000 spectrophotometer.
Initial DNA template was ten-fold serially diluted in sterile Tris-EDTA 1X (TE), and
2 µL of each dilution was used as template for qPCR. Efficiency was determined in
triplicate for simplex, and multiplex qPCR efficiency evaluation.
The Mx3005pro software automatically calculates the standard curve for each
run based on the Cycle threshold (Ct) versus amount of DNA in ng. Amplification
efficiency was calculated according to the following formula e=10-1/s-1, where “s” is the
slope of the standard curve (Blackstone et al., 2007; Nordstrom et al., 2007).
126 Publicaciones
2.7.2 Evaluation of the Limit of detection (LOD)
The evaluation of the LOD of the method was performed by inoculation of boiled
frozen mussels or shrimps with low concentrations of the three target bacteria. A total
of 11 samples (25 g each) were analyzed, 10 spiked samples and a negative control.
Reference values of viable bacteria were obtained following the procedure

specified in Materials and Methods 2.1, however, starting turbidity of each culture was
adjusted to 1.5-1.7 McFarland using, either TSB or TSB plus 2 % sodium chloride. This
adjustment establishes a theoretical starting concentration of 5 x 108 cfu/ mL.
2.7.2 Quality evaluation of the method
In order to evaluate the quality of the method several parameters were

calculated in spiked samples. These included: relative sensitivity (SE), relative
specificity (SP), relative accuracy (AC), positive and negative predictive values (PPV and
NPV), and the index kappa of concordance (ĸ).
Each sample was classified as a Positive (PA) or Negative (NA) Accordance,

whenever presenting the same result, positive or negative, for the qPCR method and
the expected result for spiked samples. Negative Deviations (ND) include those
samples expected to be positive but with a negative result, and Positive Deviations
(PD), correspond to the number of samples expected to be negative where a positive
result was obtained.
SE was defined as the percentage of positive samples giving a correct positive

signal (SE= PA/ (PA + ND) x 100).
SP was defined as the percentage of negative samples giving a correct negative

signal (SP= NA/ (PD + NA) x 100).
AC is defined as the degree of correspondence between the response obtained

by the expected result and the method on identical samples (AC= [(PA + NA)/ N] × 100;
where N = Number of analyzed samples).
Postive and Negative Predictive Values (PPV and NPV) are measures of the
performance of the method by giving the probability of a sample being really positive
127 Publicaciones
or negative when the method shows a positive or negative result PPV= [(PA/ PA) + PD]
× 100; NPV= [(NA/ NA + ND) × 100].
Finally the index kappa of concordance shows the degree of concordance

between the method and the expected result ĸ= 2 x (PA x NA – ND x PD)/ [(PA + PD) x
(PD + NA) + (PA + ND) x (ND + NA)] (Anderson et al., 2011; Tomas et al., 2009).
All data obtained according to the different DNA extraction protocols were
compared using Mann-Whitney U test SPSS 15.0 software (SPSS Inc., Chicago, IL, USA).
3 Results
3.1 Specificity of the qPCR method
All 44, 16 target and 28 non-target strains detailed in Table 1 were correctly
identified with the multiplex qPCR method developed. No interference was observed
between all primers and probes selected for vvhA, tlh, and ompW genes. Correct
amplification of the IAC was also obtained. Additionally in Figure 2 homogeneity in the
sequences of the ompW can be observed.
The statistical comparison of the 260/ 280 ratio, among the DNA extraction
methods using 6 % and 10 % Chelex-100 did not show significant differences (p >0.05).
On the contrary, after the additional washing step and 6 % chelex purification,
significantly higher values were obtained for 260/ 230 ratio. It was observed that this
slight difference did not affect the qPCR performance, thus the fastest method (10 %
chelex) was selected for further analysis. A summary of the results obtained are shown
in Table 2.
128 Publicaciones
3.3 qPCR efficiency determination
Evaluation of the qPCR efficiency was performed in triplicate. It was evaluated

individually for each bacterium and also mixing DNA in equal proportions.
Individual efficiencies returned values between 100.7 % and 102 % depending on

the microorganism. Regarding the multiplex efficiency, values obtained were
comprised 96.7 % and 103.1 %. These values were obtained in the range of five orders
of magnitude. Exact values are detailed in Table 3.
3.4 Evaluation of the LOD
Boiled frozen mussels or shrimps were selected as the reference matrix for
evaluation of the LOD of the method. In a first attempt, the reference value obtained
for viable bacteria gave values of 3 cfu/ 25 g for V. vulnificus, 7 cfu/ 25 g for V.
parahaemolyticus, and 4 cfu/ 25 g fro V. cholerae.
3.5 Method recovery calculation
A total of 83 spiked samples were analyzed in order to evaluate the quality of the
method, and the following parameters were included: relative sensitivity (SE), relative
specificity (SP), relative accuracy (AC), positive and negative predictive values (PPV and
NPV), and the index kappa of concordance (ĸ). Very few discrepancies were observed
among all samples analyzed. One PD was observed for V. parahaemolyticus, and 3 ND
for V. cholerae, these results are summarized in Table 4. These data were used to
calculate the SE, SP, AC, PPV, NPV, and ĸ index of the method. All these parameters
showed values higher than 91 %. As listed in Table 5.
Additionally, 58 natural non-spiked samples from different origins were analyzed

in parallel with both methods, ISO and qPCR for pathogenic Vibrio spp. system. V.
vulnificus was not detected in any of the samples analyzed by any method. Regarding
V. parahaemolyticus only 1 positive sample was detected with the ISO method,
meanwhile 4 were detected with the qPCR. More surprising results were obtained for
129 Publicaciones
V. cholerae finding 7 positive samples with the ISO procedure and 13 by using qPCR.
These results are summarized in Table 6.
4. Discussion
The incidence of vibriosis has increased for the last few years, consequently it
has also increased the interest for detecting these pathogenic bacteria. In this context
“The Cholera and Other Vibrio Illness Surveillance System” (COVIS), which was initiated
by CDC, FDA, and the Gulf Coast states (Alabama, Florida, Louisiana, Mississippi, and
Texas) in 1988, has received data of vibriosis cases from 41 states in 2009. In
September 2010 an expert meeting was organized by the WHO/ FAO in order to
evaluate several factors related to incidence, pathogenicity, methods available, etc. for
V. parahaemoltyticus and V. vulnificus (WHO&FAO, 2010). All these actions highlight
the potential threat posed by these bacteria to human health. Specific actions have
been carried out in order to preserve food safety, such as the inclusion of zero-
tolerance regarding V. cholerae independently of its serotype (although previously only
O1 and O139 were considered toxigenic). Moreover, certain recommendations were
published as controlling initial numbers of V. parahaemolyticus or extending
surveillance to V. vulnificus in samples from countries at risk.
Detection of pathogenic vibrios is generally performed by culture-dependent

methods, reported previously by ISO or BAM. These methods are generally time-
consuming, labor-intensive and they can not detect microorganisms in the viable but
non culturable state (VBNC) or with atypical biochemical profiles (Cariani et al., 2012;
Wei et al., 2008). From an industrial point of view these disadvanges are critical due to
the need of fast and reliable methods as certain food products present very short shelf
lifes. Molecular methods represent a possible solution that fulfills all these desired
requirements. Nowadays several possibilities for the detection of pathogenic vibrios
through molecular approaches have been described, as NASBA, LAMP or ligation
reaction, among others (Cariani et al., 2012; Drake et al., 2007; Fykse et al., 2012;
Surasilp et al., 2011; Yamazaki et al., 2008). there is no doubt that among them the
most popular approach is based on PCR or, more recently, qPCR (Blackstone et al.,
130 Publicaciones
2007; Fedio et al., 2007; Gubala, Proll, 2006; Izumiya et al., 2011; Takahashi et al.,
2005).
In the present study three well known species-specific genes were selected for
the simultaneous detection of the main pathogenic vibrios: V. cholerae (ompW) (Nandi
et al., 2000), V. parahaemolyticus (tlh) (Nordstrom et al., 2007), and V. vulnificus (vvhA)
(Campbell, Wright, 2003). Surprisingly, a few previous studies have approached
simultaneous detection of these 3 bacteria (Bauer, Rorvik, 2007; Izumiya et al., 2011;
Kim et al., 2012; Neogi et al., 2010; Tebbs et al., 2011), but most of them are
conventional PCR-based. Moreover, either they do not provide the sequences applied,
or they do not use probes that represent a given degree of specificity. Furthermore to
our knowledge none of them have used the gene combination selected in the present
study where all primers and probes have been extensively used for the detection of its
individual targets.
However, there are newly designed primers and probe targeted an outer
membrane protein OmpW gene (ompW) for V. cholerae detection. High sequence
homology in this gene was reported between strains (only 0.2 to 2 % variation).
Furthermore, previous studies have demonstrated better detection results with ompW
than with other targets, like toxR (Nandi et al., 2000). Additionally, this target has been
widely used for purpose (Alam et al., 2006; Chatterjee et al., 2009; Goel et al., 2007;
Jain et al., 2011; Phetsouvanh et al., 2008; Sharma, Chaturvedi, 2006; Sheikh et al.,
2012; Shuan Ju Teh et al., 2009; Tamrakar et al., 2009). Recently the outer membrane
lipoprotein gene (lolB, previously hemH) has been proposed as a better target for V.
cholerae species detection (Lalitha et al., 2008), but this target has not been
extensively tested and only few studies report its application (Chua et al., 2011; Zhang
et al., 2012). Design of primers and probe for ompW used in the present study was
based on eight sequences obtained from Genbank. Specificity was verified through
BLAST and also against five V. cholerae strains (O1, O139 from type culture collections
and three natural strains isolated from food samples). When combined with primers
and probes for V. parahaemolyticus, V. vulnificus and IAC, no cross-reactivity was
observed with each target or bacterial strain tested (16 target Vibrio spp., 5 non-taget
Vibrio spp., and 23 non-vibrio strains).
131 Publicaciones
For the isolation of the pathogenic vibrios of interest, several selective agars
were considered (TCBS, Chromagar Vibrio, CPC and HiCrome Vibrio™). HiCrome
Vibrio™ was discarded since it was observed that it could not differentiate between V.
parahaemolyticus and V. alginolyticus as both grow bluish-green. Among the other
media, most confirmed isolates, independently on the species, were obtained from
CHROMagar™ Vibrio (data not shown). This observation was in good agreement with
previous studies (Blanco-Abad et al., 2009).
Some reports have demonstrated that food extracts in DNA isolates may affect
qPCR detection (Wright et al., 2007). This fact highlights the need of applying a DNA
extraction/ purification procedure before the analysis. Data obtained in the present
study showed that this fast (about 40 minutes including bacteria concentration,
purification, and lysis), simple, and economic DNA extraction protocol produces
enough DNA and of good quality for qPCR.
Before application of the qPCR method, the evaluation of the qPCR efficiency to
ensure correct amplification of all targets, including the IAC, was performed. Data
obtained fitted into expected values (Raymaekers et al., 2009), reporting an average
efficiency between 95.7 % and 103.1 %. No variation between amplification of one,
two or 3 targets, along with the IAC, was observed
Finally, evaluation of the complete qPCR method was carried out depending on
the results obtained from spiked samples. Regarding the LOD, one hundred percent
detection was obtained by the present new qPCR method with a very low LOD (4 cfu/
25 g for V. cholerae, 7 cfu/ 25 g for V. parahemolyticus, and 3 cfu/ 25 g for V.
vulnificus). These results are comparable to other previously developed methods for
the detection of single or multiple vibrios (Chapela et al., 2010; Fedio et al., 2007;
Garrido et al., 2012a; Kim et al., 2012). Differences in the LOD for V. cholerae were not
associated with the type of food matrix chosen. Few deviations were observed out of
the 83 samples analyzed. These samples covered five different food categories
including proficiency tests. On the one hand, one PD in V. parahemolyticus detection
was obtained with frozen boiled mussel expected to be negative, this may have been
due to lack of homogeneity within the batch. On the other hand two ND for V.
132 Publicaciones
cholerae in a water sample and one of the proficiency tests were detected. In the
water sample, it was observed that the strain used to inoculate did not grow correctly
even in a general medium (SNA), thus its inability to grow may have interfered with its
detection. Regarding the proficiency test, the only explanation was the time taken
from sample processing/ storage, and analysis (was not performed immediately after
extraction and was stored for over two months) thus, once the result with the inocula
concentration and all interfering species was received, four samples were spiked with
four different V. cholerae strains, in the same concentrations and all them were
correctly identified by qPCR. Even considering this slight deviations high quality of the
method was observed, as all values for SE, SP, AC, PPV, NPV returned values over 94 %.
With minimal differences all values obtained are comparable to previous PCR and
qPCR studies (Chua et al., 2011; Garrido et al., 2013; Garrido et al., 2012b), and the
index kappa of concordance (between 95 % and 100 %) indicated a “very good”
concordance between the results obtained with the qPCR method and the expected
results (Danilla et al., 2005).
Finally the newly developed method was applied to 58 natural non-spiked

samples of 5 different types. No differences were obtained between both methods for
the detection of V. vulnficus, as no positive samples were detected with either
method. On the contrary higher detection frequencies were obtained by qPCR than
with the traditional culture method for V. cholerae (7 positives with ISO against 13 by
qPCR) and V. parahaemolyticus (1 positive with ISO against 4 by qPCR). Previous
studies had already highlighted higher detection frequencies by PCR versus culture
methods (Blanco-Abad et al., 2009; Fedio et al., 2007; Rosec et al., 2012; Rosec et al.,
2009).
5. Conclusions
The newly developed qPCR method proved fast, economic and reliable for the
simultaneous detection of the main pathogenic vibrio species (V. cholerae, V.
parahaemolyticus, and V. vunificus). This facts were observed after extensive testing in
vitro and against spiked and natural food and environmental samples.
133 Publicaciones
Acknowledgements
This work is financially supported by the Secretary General for the Sea of the
Spanish Ministry of Agricultural, Land and Marine Resources (MARM), by order
ARM/1193/2009.
Authors also thank Victoria Docampo and Angeles Marcote for technical
assistance.
134 Publicaciones
Tables
Table 1. Strains used for the evaluation of the specificity of primers and probes, and for the inoculation of
food samples
qPCR
Bacteria Strain
ompW tlh vvhA
CECT 511, CECT 5271, CCUG 43362, CCUG 43363, CCUG
V. parahaemolyticus - + -
43364, CCUG 43365, CAIM 58
CECT 514 (O1), CCUG 47460 (O139), 1789* (algae), 8053c
V. cholerae + - -
(pangasius)*, 8053o (pangasius)*
V. vulnificus CAIM 611, CECT 529, CECT 4869, CECT 4608 - - +
V. alginolyticus CECT 586, CAIM 342, (unknown)* - - -
V. mimicus CECT 4218, BCCM/ LMG 7896 - - -
A. hydrophila CECT 839 - - -
P. putida CECT 324 - - -

P. aeruginosa CECT 108 - - -
P. fluorescens CECT 378 - - -
E. coli CECT 516, CECT 434 - - -
C. freundii CECT 401 - - -
S. aureus CECT 240, CECT 435 - - -
S. enterica CECT 4594 - - -
311* (fishmeal), 312* (fishmeal), 313* (fishmeal), 314*
Salmonella spp. - - -
(fishmeal), 315* (fishmeal)
L. monocytogenes CECT 935, 810* (mussel) - - -
L. innocua CECT 910 - - -
L. seeligeri CECT 917 - - -
L. ivanovii CECT 913 - - -
S. sonnei CECT 413 - - -
S. flexneri CECT 4804 - - -
E. faecalis CECT 481 - - -
a
specificity of primers and probes. * Strain identified in our laboratory. If known source and/ or serotype was indicated in
parenthesis. CECT: Spanish Type Culture Collection, CCUG: Culture Collection University of Göteborg, CAIM: Collection of
Aquatic Important Microorganisms, BCCM/ LMG: Belgian Co-Orfinated Collections Of Micro-Organsims
135 Publicaciones
Table 2. DNA extraction data summary

Method DNA concentration 260/ 280 260/ 230
10 % Chelex 187.68 ± 44.84 1.82 ± 0.02 0.82 ± 0.01
6 % Chelex 135.83 ± 24.46 1.81 ± 0.03 0.88 ± 0.02*
*Indicates statistical significant differences. All values are averages of
four replicates from two proficiency test.
Table 3. qPCR efficiency data

Simplex Multiplex
Efficiency b r2 Efficiency b r2
V. cholerae 101.2 ± 5.9 -3.298 ± 0.135 0.997 ± 0.001 96.5 ± 4.2 -3.412 ± 0.108 0.992 ± 0.007
V. parahaemolyticus 102.0 ± 2.3 -3.277 ± 0.054 0.999 ± 0.000 95.7 ± 6.5 -3.437 ± 0.165 0.998 ± 0.002
V. vulnificus 100.7 ± 1.9 -3.306 ± 0.045 1.000 ± 0.001 103.1 ± 5.3 -3.254 ± 0.118 0.900 ± 0.001
All values are averages of three replicates. “b” represents the slope and r2 the correlation coefficient
Table 4. Results of spiked samples

PA NA PD ND
Food Type N
Vc Vp Vv Vc Vp Vv Vc Vp Vv Vc Vp Vv
Bivalves 29 22 22 22 7 6 7 - 1 - - - -
Crustaceans 35 24 5 5 11 30 30 - - - - - -
Water 12 3 6 6 8 6 6 - - - 1 - -
Fish 5 1 - - 4 5 5 - - - - - -
Proficiency tests* 2 - 1 - 1 1 2 - - - 1 - -
*Two different proficiency test consistent of four samples. PA: Positive Agreement,
NA: Negative Agreement, PD: Positive Deviation, ND: Negative Deviation. Vc: V.
choleare, Vp: V. parahaemolyticus, Vv: V. vulnificus
136 Publicaciones
Table 5. Summary of spiked samples and Method Evaluation

Summary of Results Method Evaluation
Bacteria
PA NA PD ND SE SP AC PPV NPV ĸ
V. cholerae 50 31 0 2 96 100 98 100 94 95
V. parahaemolyticus 34 48 1 0 100 98 100 97 100 99
V. vulnificus 32 51 0 0 100 100 100 100 100 100
SE: Relative Sensitivity, SP: Relative Specificity, AC: Relative Accuracy, PPV: Positive
Predictive Value, NPV: Negative Predictive Value, ĸ: kappa index of concordance
Table 6. Natural non-spiked samples

ISO qPCR
Food Type N Vc Vp Vv Vc Vp Vv
+ - + - + - + - + - + -
Fish 32 0 32 0 32 0 32 5 25 1 31 0 32
Bivalves 7 0 7 1 6 0 7 0 7 3 4 0 7
Crustaceans 4 0 4 0 4 0 4 0 4 0 4 0 4
Algae 6 4 2 0 6 0 6 5 1 0 6 0 6
Water 9 3 6 0 9 0 9 3 6 0 9 0 9
+/- sign indicate positive/ negative results with specified method
137 Publicaciones
Figures
Figure 1. Schematic representation of ISO/ TS 21872-1/ 2: 2007 and newly developed qPCR
method.
Figure 2. ompW sequence alignment. Primers and probe designed for V. cholerae detection are
highlighted.
138 Publicaciones
Bibliography
(EC), C.R. 2005. Microbiological criteria for foodstuffs, vol. 2073/2005. Official Journal of the
European Union.
(EC), C.R. 2007. amending Regulation (EC) No 2073/2005 on microbiological criteria for
foodstuffs, vol. 1441/2007. Official Journal of the European Union.
(EC), C.R. 2010. amending Regulation (EC) No 2073/2005 on microbiological criteria for foodstuffs
as regards Enterobacteriaceae in pasteurised milk and other pasteurised liquid dairy products and
Listeria monocytogenes in food grade salt., vol. 365/2010. Official Journal of the European Union.
A/S, C.b. CLC Sequence Viewer, 6.5.4 ed.
AESAN. 2010. Report of the Scientific Commitee of the Spanish Agency for Food Safety and
Nutrition (AESAN) on the applicable microbiological criteria for pathogenic species of the genus Vibrio in
imported fishery products, as additional control measures at border inspection posts, Scientific's
Commitee Magazine, vol. Number 12.
Alam, M., Sadique, A., Nur, A.H., Bhuiyan, N.A., Nair, G.B., Siddique, A.K., Sack, D.A., Ahsan, S.,
Huq, A., Sack, R.B., Colwell, R.R. 2006. Effect of transport at ambient temperature on detection and
isolation of Vibrio cholerae from environmental samples. Applied and Environmental Microbiology 72,
2185-2190.
Anderson, A., Pietsch, K., Zucker, R., Mayr, A., Muller-Hohe, E., Messelhausser, U., Sing, A., Busch,
U., Huber, I. 2011. Validation of a Duplex Real-Time PCR for the Detection of Salmonella spp. in Different
Food Products. Food Analytical Methods 4, 259-267.
Andreas Untergasser, H.N., Xiangyu Rao, Ton Bisseling, Ren Geurts, and Jack A.M. Leunissen.
2007. Primer3Plus, an enhanced web interface to Primer3 Nucleic Acids Research.
Bauer, A., Rorvik, L.M. 2007. A novel multiplex PCR for the identification of Vibrio
parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Letters in Applied Microbiology 45, 371-375.
Blackstone, G.M., Nordstrom, J.L., Bowen, M.D., Meyer, R.F., Imbro, P., DePaola, A. 2007. Use of
a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey of
Mobile Bay. Journal of Microbiological Methods 68, 254-259.
Blackwell, K.D., Oliver, J.D. 2008. The ecology of Vibrio vulnificus, Vibrio cholerae, and Vibrio
parahaemolyticus in North Carolina estuaries. Journal of Microbiology 46, 146-153.
Blanco-Abad, V., Ansede-Bermejo, J., Rodriguez-Castro, A., Martinez-Urtaza, J. 2009. Evaluation

of different procedures for the optimized detection of Vibrio parahaemolyticus in mussels and
environmental samples. International Journal of Food Microbiology 129, 229-236.
Broberg, C.A., Calder, T.J., Orth, K. 2011. Vibrio parahaemolyticus cell biology and pathogenicity
determinants. Microbes and Infection 13, 992-1001.
Calvo, L., Martinez-Planells, A., Pardos-Bosch, J., Garcia-Gil, L.J. 2008. A New Real-Time PCR Assay
for the Specific Detection of Salmonella spp. targeting the bipA Gene. Food Analytical Methods 1, 236-
242.
139 Publicaciones
Campbell, M.S., Wright, A.C. 2003. Real-time PCR analysis of Vibrio vulnificus from oysters.
Applied and Environmental Microbiology 69, 7137-7144.
Canadian Food Inspection Agency. Fish Products Standards and Methods Manual.
Cariani, A., Piano, A., Consolandi, C., Severgnini, M., Castiglioni, B., Caredda, G., Candela, M.,
Serratore, P., De Bellis, G., Tinti, F. 2012. Detection and characterization of pathogenic vibrios in shellfish
by a Ligation Detection Reaction-Universal Array approach. International Journal of Food Microbiology
153, 474-482.
CDC. 2012. Investigation Update: Multistate Outbreak of E. coli O157:H7 Infections Associated
with In-shell Hazelnuts [Online]. Available at http://www.cdc.gov/features/dsfoodborneillness/.
Chapela, M.J., Fajardo, P., Garrido, A., Cabado, A.G., Ferreira, M., Lago, J., Vieites, J.M. 2010.
Vibrio cholerae Detection. Journal of Agricultural and Food Chemistry 58, 4051-4055.
Charles A. Kaysner and Angelo DePaola, J. 2004. Chapter 9. Vibrio. Bacteriological Analytical
Manual.
Chatterjee, S., Ghosh, K., Raychoudhuri, A., Chowdhury, G., Bhattacharya, M.K., Mukhopadhyay,
A.K., Ramamurthy, T., Bhattacharya, S.K., Klose, K.E., Nandy, R.K. 2009. Incidence, Virulence Factors, and
Clonality among Clinical Strains of Non-O1, Non-O139 Vibrio cholerae Isolates from Hospitalized
Diarrheal Patients in Kolkata, India. Journal of Clinical Microbiology 47, 1087-1095.
Chomvarin, C., Namwat, W., Wongwajana, S., Alam, M., Thaew-Nonngiew, K., Sinchaturus, A.,
Engchanil, C. 2007. Application of duplex-PCR in rapid and reliable detection of toxigenic Vibrio cholerae
in water samples in Thailand. Journal of General and Applied Microbiology 53, 229-237.
Chua, A.L., Elina, H.T., Lim, B.H., Yean, C.Y., Ravichandran, M., Lalitha, P. 2011. Development of a
dry reagent-based triplex PCR for the detection of toxigenic and non-toxigenic Vibrio cholerae. Journal of
Medical Microbiology 60, 481-485.
Danilla, S., Andrades, P., Gomez, M.E., Chamorro, M., Leniz, P., Pineros, J.L., Llanos, S., Roco, H.,
Correa, G., Pasten, J.A., Eulufi, A., Roa, R., Calderon, W. 2005. Concordance between qualitative and
quantitative cultures in burned patients - Analysis of 2886 cultures. Burns 31, 967-971.
Drake, S.L., DePaola, A., Jaykus, L.A. 2007. An overview of Vibrio vulnificus and Vibrio
parahaemolyticus. Comprehensive Reviews in Food Science and Food Safety 6, 120-144.
FDA. 2011. Fish and Fishery Products
Hazards and Controls Guidance. In: DEPARTMENT OF HEALTH AND HUMAN SERVICES, PUBLIC
HEALTH SERVICE, FOOD AND DRUG ADMINISTRATION, CENTER FOR FOOD SAFETY AND APPLIED
NUTRITION, SAFETY, O.O.F., (Eds.), 4th ed.
Fedio, W., Blackstone, G.M., Kikuta-Oshima, L., Wendakoon, C., McGrath, T.H., DePaola, A. 2007.
Rapid detection of the Vibrio cholerae ctx gene in food enrichments using real-time polymerase chain
reaction. Journal of Aoac International 90, 1278-1283.
Fykse, E.M., Nilsen, T., Nielsen, A.D., Tryland, I., Delacroix, S., Blatny, J.M. 2012. Real-time PCR
and NASBA for rapid and sensitive detection of Vibrio cholerae in ballast water. Marine Pollution Bulletin
64, 200-206.
140 Publicaciones
Garrido, A., Chapela, M.-J., Román, B., Fajardo, P., Lago, J., Vieites, J.M., Cabado, A.G. 2013. A
new multiplex real-time PCR developed method for Salmonella spp. and Listeria monocytogenes
detection in food and environmental samples. Food Control 30, 76-85.
Garrido, A., Chapela, M.J., Ferreira, M., Atanassova, M., Fajardo, P., Lago, J., Vieites, J.M., Cabado,
A.G. 2012a. Development of a multiplex real-time PCR method for pathogenic Vibrio parahaemolyticus
detection (tdh+ and trh+). Food Control 24, 128-135.
Garrido, A., Chapela, M.J., Roman, B., Ferreira, M., Lago, J., Vieites, J.M., Cabado, A.G. 2012b.
Goel, A.K., Ponmariappan, S., Kamboj, D.V., Singh, L. 2007. Single multiplex polymerase chain
reaction for environmental surveillance of toxigenic-pathogenic O1 and non-O1 Vibrio cholerae. Folia
Microbiologica 52, 81-85.
Gubala, A.J. 2006. Multiplex real-time PCR detection of Vibrio cholerae. Journal of Microbiological
Methods 65, 278-293.
Gubala, A.J., Proll, D.F. 2006. Molecular-beacon multiplex real-time PCR assay for detection of
Vibrio cholerae. Applied and Environmental Microbiology 72, 6424-6428.
Gulig, P.A., de Crecy-Lagard, V., Wright, A.C., Walts, B., Telonis-Scott, M., McIntyre, L.M. 2010.
SOLiD sequencing of four Vibrio vulnificus genomes enables comparative genomic analysis and
identification of candidate clade-specific virulence genes. Bmc Genomics 11.
Hiyoshi, H., Kodama, T., Iida, T., Honda, T. 2010. Contribution of Vibrio parahaemolyticus
Virulence Factors to Cytotoxicity, Enterotoxicity, and Lethality in Mice. Infection and Immunity 78, 1772-
1780.
ISO. 2007a. Microbiology of food and animal feeding stuffs -- Horizontal method for the detection
of potentially enteropathogenic Vibrio spp.- Part 1: Detection of Vibrio parahaemolyticus and Vibrio
cholerae, vol. 21872-1, First ed. 19.
ISO. 2007b. Microbiology of food and animal feeding stuffs -- Horizontal method for the
detection of potentially enteropathogenic Vibrio spp.- Part 2: Detection of species other than Vibrio
parahaemolyticus and Vibrio cholerae, vol. 21872-2, 1 st ed. 25.
Izumiya, H., Matsumoto, K., Yahiro, S., Lee, J., Morita, M., Yamamoto, S., Arakawa, E., Ohnishi, M.
2011. Multiplex PCR assay for identification of three major pathogenic Vibrio spp., Vibrio cholerae, Vibrio
parahaemolyticus, and Vibrio vulnificus. Molecular and Cellular Probes 25, 174-176.
Jain, M., Goel, A.K., Bhattacharya, P., Ghatole, M., Kamboj, D.V. 2011. Multidrug resistant Vibrio
cholerae O1 El Tor carrying classical ctxB allele involved in a cholera outbreak in South Western India.
Acta Tropica 117, 152-156.
Jones, M.K., Oliver, J.D. 2009. Vibrio vulnificus: Disease and Pathogenesis. Infection and Immunity
77, 1723-1733.
Kamio, A., Hara-Kudo, Y., Miyasaka, J., Yahiro, S., Konuma, H. 2008. Efficiency of real-time
polymerase chain reaction assay to detect Vibrio vulnificus in seawater. International Journal of Hygiene
and Environmental Health 211, 518-523.
141 Publicaciones
Kim, H.-J., Lee, H.-J., Lee, K.-H., Cho, J.-C. 2012. Simultaneous detection of Pathogenic Vibrio
species using multiplex real-time PCR. Food Control 23, 491-498.
Lalitha, P., Suraiya, M.N.S., Lim, K.L., Lee, S.Y., Haslindawaty, A.R.N., Chan, Y.Y., Ismail, A.,
Zainuddin, Z.F., Ravichandran, M. 2008. Analysis of lolB gene sequence and its use in the development of
a PCR assay for the detection of Vibrio cholerae. Journal of Microbiological Methods 75, 142-144.
Lyon, W.J. 2001. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139
in pure cultures, raw oysters, and synthetic seawater. Applied and Environmental Microbiology 67,
4685-4693.
Malayil, L., Turner, J.W., Mote, B.L., Howe, K., Lipp, E.K. Evaluation of enrichment media for
improved PCR-based detection of V. cholerae and V. vulnificus from estuarine water and plankton.
Journal of Applied Microbiology 110, 1470-1475.
Nandi, B., Nandy, R.K., Mukhopadhyay, S., Nair, G.B., Shimada, T., Ghose, A.C. 2000. Rapid
method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer
membrane protein OmpW. Journal of Clinical Microbiology 38, 4145-4151.
Neogi, S.B., Chowdhury, N., Asakura, M., Hinenoya, A., Haldar, S., Saidi, S.M., Kogure, K., Lara,
R.J., Yamasaki, S. 2010. A highly sensitive and specific multiplex PCR assay for simultaneous detection of
Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus. Letters in Applied Microbiology 51, 293-
300.
Nordstrom, J.L., Vickery, M.C.L., Blackstone, G.M., Murray, S.L., DePaola, A. 2007. Development
of a multiplex real-time PCR assay with an internal amplification control for the detection of total and
pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and Environmental Microbiology 73,
5840-5847.
Phetsouvanh, R., Nakatsu, M., Arakawa, E., Davong, V., Vongsouvath, M., Lattana, O., Moore,
C.E., Nakamura, S., Newton, P.N. 2008. Fatal bacteremia due to immotile Vibrio cholerae serogroup O21
in Vientiane, Laos - a case report. Annals of clinical microbiology and antimicrobials 7, 10-10.
Raymaekers, M., Smets, R., Maes, B., Cartuyvels, R. 2009. Checklist for Optimization and
Validation of Real-Time PCR Assays. Journal of Clinical Laboratory Analysis 23, 145-151.
Roig, F.J., Sanjuan, E., Llorens, A., Amaro, C. 2010. pilF Polymorphism-Based PCR To Distinguish
Vibrio vulnificus Strains Potentially Dangerous to Public Health. Applied and Environmental Microbiology
76, 1328-1333.
Rosec, J.-P., Causse, V., Cruz, B., Rauzier, J., Carnat, L. 2012. The international standard ISO/TS
21872-1 to study the occurence of total and pathogenic Vibrio parahaemolyticus and Vibrio cholerae in
seafood: ITS improvement by use of a chromogenic medium and PCR. International Journal of Food
Rosec, J.P., Simon, M., Causse, V., Boudjemaa, M. 2009. Detection of total and pathogenic Vibrio
parahaemolyticus in shellfish: Comparison of PCR protocols using pR72H or toxR targets with a culture
method. International Journal of Food Microbiology 129, 136-145.
Rossmanith, P., Krassnig, M., Wagner, M., Hein, I. 2006. Detection of Listeria monocytogenes in
food using a combined enrichment/real-time PCR method targeting the prfA gene. Research in
142 Publicaciones
Saravanan, V., Kumar, H.S., Karunasagar, I., Karunasagar, I. 2007. Putative virulence genes of
Vibrio cholerae from seafoods and the coastal environment of Southwest India. International Journal of
Sharma, A., Chaturvedi, A.N. 2006. Prevalence of virulence genes (ctxA, stn, OmpW and tcpA)
among non-O1 Vibrio cholerae isolated from fresh water environment. International Journal of Hygiene
and Environmental Health 209, 521-526.
Sheikh, A.F., Goodarzi, H., Aslani, S. 2012. Identification of Vibrio cholerae pathogenicity island
(ctxA, OmpW and tcpA) in non-O139 and non-O1 V. cholerae strains isolated from Karun River in Ahvaz,
Iran. African Journal of Microbiology Research 6, 1185-1189.
Shuan Ju Teh, C., Lin Thong, K., Tein Ngoi, S., Ahmad, N., Balakrish Nair, G., Ramamurthy, T. 2009.
Molecular characterization of serogrouping and virulence genes of Malaysian Vibrio cholerae isolated
from different sources. The Journal of general and applied microbiology 55, 419-425.
Su, Y.C., Liu, C.C. 2007. Vibrio parahaemolyticus: A concern of seafood safety. Food Microbiology
24, 549-558.
Surasilp, T., Longyant, S., Rukpratanporn, S., Sridulyakul, P., Sithigorngul, P., Chaivisuthangkura, P.
2011. Rapid and sensitive detection of Vibrio vulnificus by loop-mediated isothermal amplification
combined with lateral flow dipstick targeted to rpoS gene. Molecular and Cellular Probes 25, 158-163.
Takahashi, H., Iwade, Y., Konuma, H., Hara-Kudo, Y. 2005. Development of a quantitative real-
time PCR method for estimation of the total number of Vibrio parahaemolyticus in contaminated
shellfish and seawater. Journal of Food Protection 68, 1083-1088.
Tamrakar, A.K., Jain, M., Goel, A.K., Kamboj, D.V., Singh, L. 2009. Characterization of Vibrio
cholerae from deep ground water in a cholera endemic area in Central India. Indian Journal of
Tebbs, R.S., Brzoska, P.M., Furtado, M.R., Petrauskene, O.V. 2011. Design and Validation of a
Novel Multiplex Real-Time PCR Assay for Vibrio Pathogen Detection. Journal of Food Protection 74, 939-
948.
Thompson, F.L., Iida, T., Swings, J. 2004. Biodiversity of vibrios. Microbiology and Molecular
Biology Reviews 68, 403-+.
Tomas, D., Rodrigo, A., Hernandez, M., Ferrus, M.A. 2009. Validation of Real-Time PCR and
Samples. Food Analytical Methods 2, 180-189.
Tyagi, A., Saravanan, V., Karunasagar, I., Karunasagar, I. 2009. Detection of Vibrio
parahaemolyticus in tropical shellfish by SYBR green real-time PCR and evaluation of three enrichment
media. International Journal of Food Microbiology 129, 124-130.
Wei, S.-W., Chern, L.-L., Wu, Y.-C., Wang, Y.-L., Lin, C.-M., Chiou, C.-S. 2008. Foodborne disease
outbreaks caused by sucrose-nonfermenting and beta-galactosidase-deficient variants of Vibrio
cholerae. International Journal of Food Microbiology 122, 148-155.
WHO&FAO. 2010. Joint FAO/WHO expert meeting on risk assessment tools for Vibrio
parahaemolyticus and Vibrio Vulnificus associated with seafoods call for data and experts.
143 Publicaciones
Wright, A.C., Garrido, V., Debuex, G., Farrell-Evans, M., Mudbidri, A.A., Otwell, W.S. 2007.
Vibrio vulnificus bacteria. Applied and Environmental Microbiology 73, 7477-7481.
Yamazaki, W., Seto, K., Taguchi, M., Ishibashi, M., Inoue, K. 2008. Sensitive and rapid detection of
cholera toxin-producing Vibrio cholerae using a loop-mediated isothermal amplification. Bmc
Microbiology 8.
Zhang, X.-J., Yao, D.-R., Yan, B.-L., Bi, K.-R., Liang, L.-G., Qin, G.-M. 2012. Identification of Vibrio
cholerae as a causative bacterium for an ulcer disease of cultured loach Misgurnus anguillicaudatus in
China. African Journal of Microbiology Research 6, 2060-2070.
144 Publicaciones
4. DISCUSIÓN GENERAL
GENERAL
Capítulo 4: DISCUSIÓN GENERAL
4.1. Selección de patógenos y optimización de medios de cultivo
En la Unión Europea, cada año se diagnostican más de 300.000 casos de

infecciones alimentarias de diversa gravedad (10). Estos datos resaltan la importancia
del control microbiológico de los productos destinados al consumo humano. En la
actualidad, y desde la introducción del Reglamento C.E. 2073 en el año 2005 (11), los
explotadores de las empresas alimentarias deben decidir por sí mismos, como parte
de sus procedimientos basados en los principios de APPCC y otros procedimientos de
control de la higiene, la frecuencia de la toma de muestras y de la realización de
pruebas. El plan de muestreo del entorno donde se llevan a cabo los procesos de
producción y transformación en la industria es un instrumento útil para identificar y
prevenir la presencia de microorganismos patógenos en los productos alimenticios
(15).
En la presente Tesis Doctoral se abordó la detección, mediante qPCR, de
diferentes microorganismos patógenos que pueden estar presentes en alimentos. La
elección de las bacterias de estudio, se estableció en base a requisitos legales,
incidencia, interés epidemiológico y riesgos potenciales. De acuerdo con lo
especificado anteriormente se seleccionaron los microorganismos Salmonella spp. y L.
monocytogenes, ya que explícitamente se mencionan en el Reglamento C.E. 2073/
2005 y E. coli O157 y Shigella spp., por presentar elevada incidencia tanto en Europa
como en otras zonas del mundo. Finalmente dentro del género Vibrio, se llevó acabo el
estudio de las tres principales especies patógenas V. cholerae, V. parahaemolyticus y V.
vulnificus como posibles amenazas emergentes en productos alimenticios.
Históricamente se ha abordado la detección de los microorganismos patógenos
en alimentos mediante técnicas de microbiología clásica. Estos métodos, aunque
fiables, son de larga duración, en algunos casos tediosos y muchas veces están sujetos
a interpretaciones subjetivas. Los métodos moleculares como la PCR y más
concretamente la qPCR o PCR en tiempo real, permiten optimizar los procesos de
145 Discusión General

Aplicación de la PCR en Tiempo Real en la Industria Alimentaria 2013
detección de patógenos en alimentos dada su elevada especificidad, sensibilidad y

reducido tiempo de análisis (148, 150, 168).
A pesar de presentar diversas ventajas respecto a los métodos de microbiología
clásica, llevar a cabo un proceso de detección fiable mediante qPCR, que permita
cumplir los límites establecidos por la legislación, sigue necesitando una etapa de
enriquecimiento de la muestra en un diluyente apropiado (151). Por ello, la elección y/
o optimización del medio de cultivo líquido a utilizar es un paso crítico en todos los
métodos de detección (212-214). Cuando el objetivo es detectar un único
microorganismo patógeno, generalmente la elección del medio de cultivo no es
complicada, ya que se han desarrollado gran cantidad de caldos que permiten una
recuperación y multiplicación óptima de la mayoría de patógenos alimentarios (143,
149, 205, 211, 215-218).
Sin embargo, cuando se desea realizar una detección múltiple, es necesario
valorar dos alternativas. Por un lado, cultivar cada bacteria diana por separado, en un
medio de cultivo adecuado, realizar la extracción por separado o conjuntamente de
una alícuota de cada uno de los caldos de enriquecimiento y finalmente realizar la
qPCR conjunta (146, 151, 219). Esta opción es válida, pero muy laboriosa.
Alternativamente, se puede realizar un enriquecimiento simultáneo de todos los
patógenos que se desee detectar, realizar una extracción común y posteriormente
llevar a cabo la detección. Esta opción es la ideal ya que permite reducir los costes
asociados a los medios de cultivo, a los reactivos de extracción y de PCR, y los tiempos
destinados a cada una de las etapas del método (69, 70, 220, 221). Sin embargo, esta
última alternativa, aunque es la más deseable, es compleja de llevar a cabo, sobre todo
si los microorganismos que se desea detectar son muy diferentes. En esta situación hay
que tener en cuenta, entre otros factores, los requerimientos nutricionales de cada una
de las bacterias de interés, las diferencias en las cinéticas y temperaturas de
crecimiento y la adición de agentes selectivos que puedan afectar más a una bacteria
que a otra.
En la presente tesis se abordó, principalmente, el desarrollo de métodos
múltiples para la detección de patógenos como una herramienta rápida y económica
para ofrecer a la industria alimentaria. En determinados trabajos simplemente se
detectaron varios genes diana, con el fin de caracterizar mejor el agente patógeno de
interés (210, 211). En otros se analizaron diferentes microorganismos de modo

simultáneo (128, 161).
En este sentido, se evaluaron diferentes medios de cultivo para el
enriquecimiento de los patógenos alimentarios de interés. Todos ellos cumplieron las
requisitos indicados en la norma internacional para la evaluación de medios de cultivo
(222-224). En los medios de enriquecimiento se realizaron modificaciones respecto a la
composición original lo que proporcionó mejores resultados que los obtenidos con los
medios originales, como ocurrió con el caldo Nº 17. Esto fue especialmente importante
en lo que concierne al crecimiento de L. monocytogenes, para la que se obtuvieron
resultados claramente superiores respecto a otros medios generales utilizados como el
agua de peptona tamponada o el caldo de preenriquecimiento universal (128, 161,
174, 220, 225).
4.2. Evaluación de protocolos de extracción de ADN
Durante el desarrollo de esta tesis se valoraron diferentes protocolos de

extracción de ADN, como fueron:
 Lisis por calor directamente del caldo de enriquecimiento.
 Tratamientos con diferentes tampones y compuestos químicos (Chelex-100)
previamente al hervido.
 Tratamientos enzimáticos.
 Kits comerciales de extracción.
Cada una de estas opciones demostró ser válida para la obtención de ADN en
cantidad y calidad suficiente para realizar la detección mediante qPCR, aunque algunos
proporcionaron mejores resultados que otros. Los protocolos de hervido directo para
la liberación del ADN, aunque son muy rápidos, sencillos y económicos, presentan la
desventaja de que se pueden arrastrar diferentes sustancias que pueden afectar o
inhibir la qPCR (226). La eliminación de restos de alimentos y simple lavado de los
pellets bacterianos mejora enormemente los resultados obtenidos en cuanto a valores
de ciclo umbral (Ct) y fluorescencia final obtenida (122). La inclusión de un tratamiento
enzimático, generalmente con lisozima sola, o combinada con otras enzimas como la

acromopeptidasa o la lisostafina, también mejora la extracción de ADN, especialmente

de bacterias más resistentes a la simple lisis por calor, como son en general las Gram
positivas (220). Generalmente, los kits comerciales de extracción de ADN proporcionan
buenos resultados, aunque suelen requerir tiempos más largos de extracción (una hora
y media respecto a quince o veinte minutos, que puede llevar una extracción por
hervido) y el precio puede suponer un problema añadido.
4.3. Selección de genes diana, cebadores y sondas para detección mediante qPCR.
En todos los métodos de detección basados en qPCR la elección correcta del gen
o los genes a detectar, junto con los cebadores y sondas empleados, es un paso crítico
para que la técnica sea altamente específica de la bacteria que deseamos detectar. Se
han descrito gran cantidad de posibles para cada microorganismo dianas, y según los
casos puede existir mayor o menor grado de consenso en cuanto al uso de una u otra.
Asimismo para un mismo gen de detección se describen gran cantidad de posibilidades
en cuanto a los cebadores y sondas a utilizar. Por ejemplo, en cuanto a la detección de
Samonella spp. y Shigella spp. una diana ampliamente utilizada serían los genes invA e
ipaH respectivamente, pero existen diferentes trabajos que utilizan distintas regiones
del mismo gen para llevar a cabo la detección (121, 123, 157, 161, 162, 215). En el caso
de L. monocytogenes y E. coli O157 se puede observar algo más de diversidad en
cuanto a los genes a emplear, como pueden ser el hly o el prfA para L. monocytogenes
y eaeA o rfbE para E. coli O157, con sus correspondientes variantes de cebadores y
sondas (128, 142, 149, 169, 171, 174, 175, 220, 227). También se observan casos en los
cuales la uniformidad o no de las dianas de detección varía en función del objetivo de
la detección, como sucede para V. vulnificus. En este caso, la identificación como
especie está ampliamente extendida a la detección del gen vvhA pero no existe
uniformidad de criterio en cuanto a la asignación del carácter patogénico o no, para el
cual se ha utilizado el gen vcg o el polisacárido capsular, entre otros (212, 228, 229). No
ocurre lo mismo con V. cholerae para el cual existe unanimidad en el uso del gen ctx
para la asignación del carácter patógeno aunque se puedan emplear otros genes
adicionales (200, 205, 209, 210, 218), y la detección a nivel de especie se centra en la
detección del gen toxR, junto con ompW y lolB, que se ha descrito recientemente (201,
230, 231). De igual modo también existe una relativa uniformidad en cuanto a la
detección de V. parahaemolyticus, tanto a nivel de especie, empleando los genes toxR
y tlh, como para los principales factores de virulencia, mediante los genes tdh y trh
(204, 211, 232, 233). Recientemente se han descrito los sistemas de secreción de tipo
tres como factores de virulencia (193, 194).
En la presente tesis, se han seleccionado los siguientes genes:
 Salmonella spp. gen invA (123).
 Shigella spp. gen ipaH (160).
 E. coli O157 gen rfbE (175).
 L. monocytogenes genes hly y prfA (148, 174).
 V. cholerae gen ctx (205).
 V. parahaemolyticus genes tdh y trh (203, 204, 211).
 V. vulnificus genes vvhA, vcgC y pilF (206, 207).
Dado que uno de los objetivos era la transferencia de esta tecnología a

laboratorios y empresas alimentarias, se seleccionaron cebadores y sondas
ampliamente testados y/ o validados en diferentes laboratorios, los cuales hubieran
demostrado elevada especificidad para los genes diana correspondientes. Este fue el
caso de la elección de los cebadores y sondas para Salmonella spp. (123, 234) y los
correspondientes al gen prfA de L. monocytogenes (148, 149, 235). En determinados
casos se realizaron nuevos diseños para mejorar los previamente existentes, como en
el caso del gen trh cuyo nuevo diseño garantiza la detección para ambas formas del gen
(trh1 y trh2), como se demostró usando cepas de colección que contenían las
diferentes formas (211). De un modo similar el nuevo diseño de cebadores y sondas
para vcgC demostró ser óptimo, clasificando correctamente todas las cepas de V.
vulnificus estudiadas y no mostró ningún tipo de reactividad cruzada con otras cepas
de la misma u otra especie.
En todos los métodos desarrollados se incluyó un control interno de
amplificación a mayores de los controles positivos y negativos correspondientes. La
importancia del control interno de amplificación radica en que permite descartar falsos
negativos asociados a inhibición de la qPCR, fallos en el termociclador, poca actividad
de la ADN polimerasa y/ o mala preparación de la mezcla de reacción. Este tipo de

controles se exigen cada vez más, como parte de los métodos de detección mediante
PCR y qPCR, y los solicita explícitamente la norma ISO correspondiente a la detección
de patógenos alimentarios por PCR (96, 109, 142, 236, 237).
4.4. Evaluación y unificación de los métodos de qPCR desarrollados
Todos los métodos desarrollados demostraron ser aptos para su aplicación e

implantación en la industria alimentaria ya que son altamente específicos, sensibles,
rápidos y permiten ahorrar costes asociados a tiempo y reactivos. Estos métodos
fueron aplicados a diferentes tipos de muestras alimentarias y ambientales e incluso
subproductos complejos. Se demostró una óptima recuperación de los patógenos de
estudio, tanto en bajas concentraciones como en diferentes condiciones de estrés,
empleando los medios de enriquecimiento seleccionados. Del mismo modo los
protocolos de extracción aplicados en los diferentes estudios proporcionaron ADN en
cantidad y calidad suficiente para su aplicación en qPCR. Estos resultados coinciden con
otros previamente publicados, tanto para la detección individual o múltiple de estos
microorganismos mediante PCR o qPCR. Los métodos desarrollados fueron
comparados con los métodos de microbiología clásica, o en determinados casos, frente
a métodos alternativos si estaban disponibles. La principal metodología alternativa
aplicada fue el sistema VIDAS para la detección de Salmonella spp., L. monocytogenes
y E. coli O157. Independientemente de la metodología empleada en la comparación,
siempre se obtuvo muy buena concordancia entre los métodos desarrollados durante
esta tesis y los de referencia (121, 128, 161, 169, 210, 211, 220, 235, 238)
Como punto final de esta tesis se desarrollaron los siguientes métodos para la
detección de los distintos patógenos alimentarios de interés:
1. Detección múltiple de Salmonella spp., E. coli O 157 (o Shigella spp.) y L.
monocytogenes:
 Enriquecimiento de 25 g de muestra en 225 mL de caldo TA10 modificado.
 Incubación durante 22± 2 h a 35 °C.
 Resiembra de 1 mL en 10 mL de medio fresco y reincubación a 35 °C
durante un mínimo de 5 h.

 Tomar 1 mL y realizar el protocolo de extracción enzimática, combinado con

tiocianato de guanidina según se describió previamente (128).
 Analizar el extracto de ADN mediante qPCR múltiple.
Este protocolo ha demostrado resultados óptimos para cualquiera de las

bacterias analizadas. Adicionalmente se ha observado gran versatilidad ya que permite
la optimización de tiempos y reactivos. Cuando no se realiza el análisis de L.
monocytogenes se apreció una detección correcta de Salmonella spp., Shigella spp. y/
o E. coli O157, a partir de los caldos enriquecimiento primario, sin necesidad de realizar
el secundario, lo que permite reducir entre cinco o seis horas el tiempo de análisis. Por
otro lado, también se puede modificar el protocolo de extracción, sustituyendo el
método de tiocianato por uno combinado de Chelex-100 y lisis térmica, ya que todas
las bacterias diana, salvo L. monocytogenes, crecen rápido pudiendo obtener un mayor
número de microorganismos. Además al tratarse de bacterias Gram negativas, son más
fácilmente lisables por calor que L. monocytogenes (220).
2. Detección múltiple de V. cholerae, V. parahaemolyticus y V. vulnificus:
 Enriquecimiento de 25 g de muestra en 225 mL de agua de peptona alcalina
o agua de peptona alcalina salina.
 Incubación durante 22 ± 2 h a 35 °C.
 Tomar 1 mL y realizar el protocolo de extracción combinado de Chelex-100 y
lisis térmica.
 Analizar el extracto de ADN mediante qPCR múltiple (210, 211).
Este procedimiento demostró ser adecuado para la recuperación de las

diferentes especies de vibrios que se analizaron V. cholerae, V. parahaemolyticus y V.
vulnificus, que constituyen las principales especies de vibrios patógenos, obteniendo
resultados fiables, en muy poco tiempo y a un bajo coste.
Este mismo protocolo es aplicable en la detección de factores de virulencia de las
tres especies de vibrios, ctx en V. cholerae, tdh y trh en V. parahaemolyticus y vcgC y
pilF en V. vulnificus. En el caso de V. vulnificus se puede aplicar específicamente el
tercer protocolo optimizado, que se describe a continuación.
3. Detección específica de V. vulnificus:

 Enriquecimiento de 25 g de muestra en 225 mL de caldo peptona, cloruro

sódico y celobiosa (PNC).
 Incubación durante 22 ± 2 h a 35 °C.
 Tomar 1 mL y realizar el protocolo de extracción combinado de Chelex-100 y
lisis térmica.
 Analizar el extracto de ADN mediante qPCR múltiple.
El cambio en el medio de cultivo permite obtener un enriquecimiento apropiado

de V. vulnificus sobre otras posibles especies bacterianas interferentes (adicionalmente
se puede incluir colistina como agente selectivo). El rápido crecimiento de esta especie,
combinado con la optimización del caldo de enriquecimiento y el protocolo de
extracción, permite obtener resultados en plazos de tiempo muy reducidos. Teniendo
en cuenta que una de las principales fuentes de infección es el consumo de ostras
crudas, producto altamente perecedero, la rapidez y fiabilidad en los análisis de V.
vulnificus, son factores críticos.
4.5. Ventajas de los métodos de qPCR desarrollados
En la presente Tesis Doctoral se desarrollaron y evaluaron métodos para la

detección de los siguientes patógenos alimentarios:
 Detección de V. cholerae toxigénico.
 Detección de V. parahaemolyticus patogénico.
 Detección de V. vulnificus, cepas ambientales y patógenas.
 Detección múltiple de las especies V. cholerae, V. parahaemolyticus y V.
vulnificus
 Detección múltiple de Salmonella spp. y L. monocytogenes.
 Detección múltiple de Salmonella spp., Shigella spp. y L. monocytogenes.
 Detección múltiple de Salmonella spp., E. coli O157 y L. monocytogenes.
En todos los métodos desarrollados se intentó optimizar al máximo el tiempo y

los gastos en medios de cultivo y reactivos. Se optimizaron métodos de qPCR múltiple
evitando el uso de kits comerciales, tanto para la detección, como para la extracción de

ADN así como el uso de medios de cultivo comunes para los diferentes patógenos
diana en cada método. En este sentido se tuvo en cuenta la posibilidad de aplicar los
métodos a diferentes tipos de alimentos o tipos de muestras. Por un lado, en estudios
previos, aunque se obtenían buenos resultados no se aprovechaban al máximo las
ventajas de la qPCR ya que muchos estudios centran sus métodos en un único
microorganismo (239, 240) o tipo de alimento (174, 241, 242). Por otro lado, se puede
apreciar que hay gran cantidad de estudios que aplican medios de cultivo específicos
para cada microorganismo y después realizan la detección simultánea (70, 146, 213),
utilizando kits comerciales de extracción de ADN (236, 243, 244). Hoy en día el empleo
de un control interno de amplificación en los métodos de qPCR es prácticamente un
requisito imprescindible. Existen estudios recientes que no lo contemplan por lo que
carecen de un parámetro imprescindible para su aplicabilidad en la industria (213, 241,
243).
Los métodos desarrollados fueron sometidos a un extenso proceso de validación
interna. Dentro de los parámetros analizados se incluyeron: especificidad de los
cebadores y sondas, productividad de los medios de cultivo, concentración y pureza de
ADN con los diferentes métodos de extracción, límite de detección, sensibilidad,
especificidad y eficiencias relativas de los métodos, así como los valores predictivos
positivo y negativo, junto con el índice kappa de concordancia respecto a los resultados
esperados. Todos estos parámetros garantizan la calidad de los métodos desarrollados,
y la mayoría se consideran factores críticos para la estandarización de métodos de
diagnóstico (105).
Todos los métodos desarrollados en la presente tesis se implantaron en los
laboratorios de ANFACO-CECOPESCA como parte de los análisis de rutina. Los
patógenos más solicitados son Salmonella spp., L. monocytogenes y Shigella spp.,
demostrando la correcta elección de los microorganismos de estudio respecto a las
necesidades de la industria alimentaria. Recientemente, gracias a esta metodología se
pudo detectar un aumento en la incidencia de L. monocytogenes en una planta de
procesado de mejillón. Asimismo, se pudo definir concretamente el punto de
contaminación del alimento, y monitorizar las tareas de limpieza hasta la total
eliminación de la bacteria en el producto final (manuscrito en preparación).

5. CONCLUSIONES
Capítulo 5: CONCLUSIONES
 Los genes, cebadores y sondas seleccionados son adecuados para realizar la

detección de cada microorganismo de interés, obteniéndose una especificidad del
100 % en todos los casos:
o Salmonella spp. (invA).
o L. monocytogenes (hlyA y prfA).
o E. coli O157 (rfbE).
o Shigella spp. (ipaH).
o V. cholerae (ctxA).
o V. parahaemolyticus (tdh).
o V. vulnificus (vvhA y pilF).
 Se obtuvo una especificidad del 100 % para los cebadores y sondas diseñados
durante el desarrollo de la presente tesis:
o V. parahaemolyticus (trh).
o V. vulnificus (vcgC).
 Los medios de cultivo líquido y su optimización proporcionaron resultados
satisfactorios para la recuperación y crecimiento de las bacterias de interés.
o Caldo Nº 17 modificado para Salmonella spp., L. monocytogenes, E. coli
O157 y Shigella spp.
o Agua de peptona alcalina salina para V. cholerae, V. parahaemolyticus y
V. vulnificus.
o Caldo PNC para la detección específica de V. vulnificus.
 Los diferentes métodos de extracción de ADN, empleados proporcionaron ADN
en cantidad y de calidad suficiente para su aplicación en qPCR.
o Bacterias Gram negativas realizando una purificación con Chelex-100
entre el 6 y el 10 % y extracción mediante hervido.
o Bacterias Gram positivas lisis enzimática con lisozima y
acromopeptidasa y posterior tratamiento con una agente caotrópico
(tiocianato de guanidina).
155 Conclusiones
Aplicaciones de la PCR en Tiempo Real en la Industria Alimentaria 2013
 Los métodos desarrollados tienen una alta especificidad y sensibilidad, con límites
de detección de menos de 10 ufc/ 25 g, lo que permite cumplir con las exigencias
legales para la mayor parte de los patógenos analizados, ausencia en 25 g de
muestra.
 La pre-validación y comparación con otros métodos más ampliamente
implantados, microbiología clásica e inmunológicos, demostró la fiabilidad de los
métodos de qPCR desarrollados, obteniéndose valores elevados de sensibilidad,
especificidad y eficiencia diagnóstica.
156 Conclusiones
6. BIBLIOGRAFÍA
Capítulo 6: Bibliografía
1. Mackay, I. M.; Arden, K. E.; Nitsche, A., Real-time PCR in virology. Nucleic Acids
Research 2002, 30, (6), 1292-1305.
2. Barletta, J., Applications of real-time immuno-polymerase chain reaction (rt-IPCR) for
the rapid diagnoses of viral antigens and pathologic proteins. Molecular aspects of medicine 2006, 27,
(2-3), 224-53.
3. Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T., Loop-mediated isothermal amplification
(LAMP) of gene sequences and simple visual detection of products. Nature Protocols 2008, 3, (5), 877-
882.
4. Deiman, B.; van Aarle, P.; Sillekens, P., Characteristics and applications of nucleic acid
sequence-based amplification (NASBA). Molecular Biotechnology 2002, 20, (2), 163-179.
5. Kubota, K.; Ohashi, A.; Imachi, H.; Harada, H., Improved in situ hybridization
efficiency with locked-nucleic-acid-incorporated DNA probes. Applied and Environmental Microbiology
2006, 72, (8), 5311-5317.
6. Stevenson, J.; Hymas, W.; Hillyard, D., Effect of sequence polymorphisms on
performance of two real-time PCR assays for detection of herpes simplex virus. Journal of Clinical
Microbiology 2005, 43, (5), 2391-2398.
7. Kutyavin, I. V.; Afonina, I. A.; Mills, A.; Gorn, V. V.; Lukhtanov, E. A.; Belousov, E. S.;
Singer, M. J.; Walburger, D. K.; Lokhov, S. G.; Gall, A. A.; Dempcy, R.; Reed, M. W.; Meyer, R. B.;
Hedgpeth, J., 3 '-minor groove binder-DNA probes increase sequence specificity at PCR extension
temperatures. Nucleic Acids Research 2000, 28, (2), 655-661.
8. Madigan, M. T.; Martinko, J. M.; Parker, J., BROCK, BIOLOGÍA de los
MICROORGANISMOS. 2002.
9. Prescott, L. M.; Herley, J. P.; Klein, D. A., MICROBIOLOGÍA. 5th ed.; McGraw-Hill
Higher Education: 2001.
10. EFSA The European Union summary report. Trends and Sources of Zoonoses and
Zoonotic Agents and Food-borne Outbreaks in 2010; European Food Safety Authority: May 11th, 2012,
2012; p 442.
11. (EC), C. R., Microbiological criteria for foodstuffs. In Official Journal of the European
Union: 2005; Vol. 2073/2005.
12. (EC), C. R., amending Regulation (EC) No 2073/2005 on microbiological criteria for
foodstuffs. In Official Journal of the European Union: 2007; Vol. 1441/2007.
13. (EC), C. R., amending Regulation (EC) No 2073/2005 on microbiological criteria for
foodstuffs as regards Enterobacteriaceae in pasteurised milk and other pasteurised liquid dairy
products and Listeria monocytogenes in food grade salt. In Official Journal of the European Union:
2010; Vol. 365/2010.
14. (EU), C. R., amending Annex II to Regulation (EC) No 2160/2003 of the European
Parliament and of the Council and Annex I to Commission Regulation (EC) No 2073/2005 as regards
salmonella in fresh poultry meat. In Official Journal of the European Union: 2011; Vol. 1086/2011.
15. Cabado, A. G.; Atanassova, M.; Chapela, M. J.; Garrido, A.; Vieites, J. M., Evaluación
de riesgos microbiológicos en alimentos listos para el consumo. LAP LAMBERT Academic Publishing
GmbH & Co. KG: 2012; p 73.
16. Ministerio, d. l. P., Derogación de las disposiciones relativas a los criterios
microbiológicos de los productos alimenticios. In BOE: 2010; Vol. R.D. 135/2010.
17. CDC Cholera and Other Vibrio Illness Surveillance System.
http://www.cdc.gov/nationalsurveillance/cholera_vibrio_surveillance.html
18. eCDC Multi-country outbreak of Salmonella Stanley infections Update.
http://ecdc.europa.eu/en/publications/surveillance_reports/Communicable-Disease-Threats-
Report/Pages/Communicable-Disease-Threats-Report.aspx
19. Mandal, P. K.; Biswas, A. K.; Choi, K.; Pal, U. K., Methods for rapid detection of
foodborne pathogens: An overview. American Journal of Food Technology 2011, 6, (2), 87-102.
20. ISO, Microbiology of food and animal feeding stuffs -- Horizontal method for the
detection of Salmonella spp. . In 2003; Vol. 6579:2002.
157 Bibliografía
21. Churchill, R. L. T.; Lee, H.; Hall, J. C., Detection of Listeria monocytogenes and the
toxin listeriolysin O in food. Journal of Microbiological Methods 2006, 64, (2), 141-170.
22. Maciorowski, K. G.; Herrera, P.; Jones, F. T.; Pillai, S. D.; Ricke, S. C., Cultural and
Immunological Detection Methods for Salmonella spp. in Animal Feeds - A Review. Veterinary Research
Communications 2006, 30, (2), 127-137.
23. FDA Bacteriological Analytical Manual.
http://www.fda.gov/Food/ScienceResearch/LaboratoryMethods/BacteriologicalAnalyticalManualBAM
/default.htm
24. HC The Compendium of Analytical Methods.
25. Kaysner, C. A.; DePaola, A. J., Vibrio. In FDA, Bacteriological Analytical Manual Online:
2004; Vol. Chapter 9, p 20.
detection of potentially enteropathogenic Vibrio spp.- Part 1: Detection of Vibrio parahaemolyticus
and Vibrio cholerae. In First ed.; 2007; Vol. 21872-1, p 19.
detection of potentially enteropathogenic Vibrio spp.- Part 2: Detection of species other than Vibrio
parahaemolyticus and Vibrio cholerae. In 1 st ed.; 2007; Vol. 21872-2, p 25.
28. Rodriguez-Castro, A.; Ansede-Bermejo, J.; Blanco-Abad, V.; Varela-Pet, J.; Garcia-
Martin, O.; Martinez-Urtaza, J., Prevalence and genetic diversity of pathogenic populations of Vibrio
parahaemolyticus in coastal waters of Galicia, Spain. Environmental Microbiology Reports 2010, 2, (1),
58-66.
29. Blanco-Abad, V.; Ansede-Bermejo, J.; Rodriguez-Castro, A.; Martinez-Urtaza, J.,
Evaluation of different procedures for the optimized detection of Vibrio parahaemolyticus in mussels
and environmental samples. International Journal of Food Microbiology 2009, 129, (3), 229-236.
detection and enumeration of Listeria monocytogenes -- Part 1: Detection method In 1996; Vol. 11290-
1:1996
detection and enumeration of Listeria monocytogenes -- Part 1: Detection method -- Modification 1:
Modification of the isolation media and the haemolysis test, and inclusion of precision data. In 2005;
Vol. 11290-1:1996
32. Justé, A.; Thomma, B. P. H. J.; Lievens, B., Recent advances in molecular techniques to
study microbial communities in food-associated matrices and processes. Food Microbiology 2008, 25,
(6), 745-761.
33. Naravaneni, R.; Jamil, K., Rapid detection of food-borne pathogens by using
molecular techniques. Journal of Medical Microbiology 2005, 54, (1), 51-54.
34. Sibley, C. D.; Peirano, G.; Church, D. L., Molecular methods for pathogen and
microbial community detection and characterization: Current and potential application in diagnostic
microbiology. Infection Genetics and Evolution 2012, 12, (3), 505-521.
35. Cheung, P.-Y.; Kam, K. M., Salmonella in food surveillance: PCR, immunoassays, and
other rapid detection and quantification methods. Food Research International 2012, 45, (2), 802-808.
36. Vernozy-Rozand, C.; Mazuy-Cruchaudet, C.; Bavai, C.; Richard, Y., Comparison of three
immunological methods for detecting staphylococcal enterotoxins from food. Letters in Applied
Microbiology 2004, 39, (6), 490-494.
37. Safarik, I.; Safarikova, M.; Forsythe, S. J., The Application of Magnetic Separations in
Applied Microbiology. Journal of Applied Bacteriology 1995, 78, (6), 575-585.
38. Abee, T.; van Schaik, W.; Siezen, R. J., Impact of genomics on microbial food safety.
Trends in Biotechnology 2004, 22, (12), 653-660.
39. Havelaar, A. H.; Brul, S.; de Jong, A.; de Jonge, R.; Zwietering, M. H.; ter Kuile, B. H.,
Future challenges to microbial food safety. International Journal of Food Microbiology 2010, 139, S79-
S94.
40. Mullis, K.; Faloona, F.; Scharf, S.; Saiki, R.; Horn, G.; Erlich, H., Specific Enzymatic
Amplification of DNA Invitro - the Polymerase Chain-Reaction. Cold Spring Harbor Symposia on
Quantitative Biology 1986, 51, 263-273.
41. Compton, J., Nucleic-Acid Sequence-Based Amplification. Nature 1991, 350, (6313),
91-92.
42. Cook, N., The use of NASBA for the detection of microbial pathogens in food and
158 Bibliografía
environmental samples. Journal of Microbiological Methods 2003, 53, (2), 165-174.

43. Molden, T.; Kraus, I.; Skomedal, H.; Nordstrom, T.; Karlsen, F., PreTect HPV-Proofer:
Real-time detection and typing of E6/E7 mRNA from carcinogenic human papillomaviruses. Journal of
Virological Methods 2007, 142, (1-2), 204-212.
44. Fykse, E. M.; Nilsen, T.; Nielsen, A. D.; Tryland, I.; Delacroix, S.; Blatny, J. M., Real-time
PCR and NASBA for rapid and sensitive detection of Vibrio cholerae in ballast water. Marine Pollution
Bulletin 2012, 64, (2), 200-206.
45. Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.;
Hase, T., Loop-mediated isothermal amplification of DNA. Nucleic Acids Research 2000, 28, (12), e63.
46. Yamazaki, W.; Seto, K.; Taguchi, M.; Ishibashi, M.; Inoue, K., Sensitive and rapid
detection of cholera toxin-producing Vibrio cholerae using a loop-mediated isothermal amplification.
Bmc Microbiology 2008, 8.
47. Luo, J.; Vogel, R. F.; Niessen, L., Development and application of a loop-mediated
isothermal amplification assay for rapid identification of aflatoxigenic molds and their detection in
food samples. International journal of food microbiology 2012, 159, (3), 214-24.
48. Shao, Y.; Zhu, S.; Jin, C.; Chen, F., Development of multiplex loop-mediated isothermal
amplification-RFLP (mLAMP-RFLP) to detect Salmonella spp. and Shigella spp. in milk. International
Journal of Food Microbiology 2011, 148, (2), 75-79.
49. Surasilp, T.; Longyant, S.; Rukpratanporn, S.; Sridulyakul, P.; Sithigorngul, P.;
Chaivisuthangkura, P., Rapid and sensitive detection of Vibrio vulnificus by loop-mediated isothermal
amplification combined with lateral flow dipstick targeted to rpoS gene. Molecular and Cellular Probes
2011, 25, (4), 158-163.
50. Han, F.; Wang, F.; Ge, B., Detecting Potentially Virulent Vibrio vulnificus Strains in Raw
Oysters by Quantitative Loop-Mediated Isothermal Amplification. Applied and Environmental
Microbiology 2011, 77, (8), 2589-2595.
51. Nemoto, J.; Sugawara, C.; Akahane, K.; Hashimoto, K.; Kojima, T.; Ikedo, M.; Konuma,
H.; Hara-Kudo, Y., Rapid and Specific Detection of the Thermostable Direct Hemolysin Gene in Vibrio
parahaemolyticus by Loop-Mediated Isothermal Amplification. Journal of Food Protection 2009, 72,
(4), 748-754.
52. Oliveira, M.; Vieira-Pinto, M.; da Costa, P. M.; Vilela, C. L.; Martins, C.; Bernardo, F.,
Occurrence of Salmonella spp. in samples from pigs slaughtered for consumption: A comparison
between ISO 6579:2002 and 23S rRNA Fluorescent In Situ Hybridization method. Food Research
International 2010, 45, (2), 984-988.
53. Wagner, M.; Schmid, M.; Juretschko, S.; Trebesius, K.-H.; Bubert, A.; Goebel, W.;
Schleifer, K.-H., In situ detection of a virulence factor mRNA and 16S rRNA in Listeria monocytogenes.
FEMS Microbiology Letters 1998, 160, (1), 159-168.
54. Jasson, V.; Jacxsens, L.; Luning, P.; Rajkovic, A.; Uyttendaele, M., Alternative microbial
methods: An overview and selection criteria. Food Microbiology 2010, 27, (6), 710-730.
55. Almeida, C.; Azevedo, N. F.; Santos, S.; Keevil, C. W.; Vieira, M. J., Discriminating
Multi-Species Populations in Biofilms with Peptide Nucleic Acid Fluorescence In Situ Hybridization (PNA
FISH). Plos One 2011, 6, (3).
56. Schauer, S.; Sommer, R.; Farnleitner, A. H.; Kirschner, A. K. T., Rapid and Sensitive
Quantification of Vibrio cholerae and Vibrio mimicus Cells in Water Samples by Use of Catalyzed
Reporter Deposition Fluorescence In Situ Hybridization Combined with Solid-Phase Cytometry. Applied
and Environmental Microbiology 2012, 78, (20), 7369-7375.
57. Wang, K. Y.; Zeng, Y. L.; Yang, X. Y.; Li, W. B.; Lan, X. P., Utility of aptamer-fluorescence
in situ hybridization for rapid detection of Pseudomonas aeruginosa. European Journal of Clinical
Microbiology & Infectious Diseases 2011, 30, (2), 273-278.
58. Zhang, X.; Wu, S.; Li, K.; Shuai, J.; Dong, Q.; Fang, W., Peptide nucleic acid
fluorescence in situ hybridization for identification of Listeria genus, Listeria monocytogenes and
Listeria ivanovii. International Journal of Food Microbiology 2012, 157, (2), 309-313.
59. Stoecker, K.; Dorninger, C.; Daims, H.; Wagner, M., Double Labeling of Oligonucleotide
Probes for Fluorescence In Situ Hybridization (DOPE-FISH) Improves Signal Intensity and Increases
rRNA Accessibility. Applied and Environmental Microbiology 2010, 76, (3), 922-926.
60. Shi, X.-M.; Long, F.; Suo, B., Molecular methods for the detection and characterization
of foodborne pathogens. Pure and Applied Chemistry 2010, 82, (1), 69-79.
61. Severgnini, M.; Cremonesi, P.; Consolandi, C.; De Bellis, G.; Castiglioni, B., Advances in
159 Bibliografía
DNA Microarray Technology for the Detection of Foodborne Pathogens. Food and Bioprocess
Technology 2011, 4, (6), 936-953.
62. Zhou, G.; Wen, S.; Liu, Y.; Li, R.; Zhong, X.; Feng, L.; Wang, L.; Cao, B., Development of
a DNA microarray for detection and identification of Legionella pneumophila and ten other pathogens
in drinking water. International Journal of Food Microbiology 2011, 145, (1), 293-300.
63. Panicker, G.; Call, D. R.; Krug, M. J.; Bej, A. K., Detection of pathogenic Vibrio spp. in
shellfish by using multiplex PCR and DNA microarrays. Applied and Environmental Microbiology 2004,
70, (12), 7436-7444.
64. Dorak, M. T., Real-time PCR. Taylor & Francis Group: Newcastle, 2006.
65. Mackay, I. M., Real-Time PCR in Microbiology. From Diagnostics to Characterization.
Caister Academic Press: 2007.
66. Saiki, R. K.; Scharf, S.; Faloona, F.; Mullis, K. B.; Horn, G. T.; Erlich, H. A.; Arnheim, N.,
Enzymatic Amplification of Beta-Globin Genomic Sequences and Restriction Site Analysis for Diagnosis
of Sickle-Cell Anemia. Science 1985, 230, (4732), 1350-1354.
67. Perelle, S.; Dilasser, F.; Malorny, B.; Grout, J.; Hoorfar, J.; Fach, P., Comparison of PCR-
ELISA and LightCycler real-time PCR assays for detecting Salmonella spp. in milk and meat samples.
Molecular and Cellular Probes 2004, 18, (6), 409-420.
68. Mullis, K. B., The Unusual Origin of the Polymerase Chain-Reaction. Scientific
American 1990, 262, (4), 56-&.
69. Kim, H. C.; Bhunia, A. K., SEL, a selective enrichment broth for simultaneous growth
of Salmonella enterica, Escherichia coli O157: H7, and Listeria monocytogenes. Applied and
Environmental Microbiology 2008, 74, (15), 4853-4866.
70. Ruiz-Rueda, O.; Soler, M.; Calvo, L., Multiplex Real-time PCR for the Simultaneous
Detection of Salmonella spp. and Listeria monocytogenes in Food Samples. Food Analytical Methods
2010.
71. Mendez-Alvarez, S.; Perez-Roth, E., Multiplex PCR in clinical microbiology.
Enfermedades Infecciosas Y Microbiologia Clinica 2004, 22, (3), 183-192.
72. Tena M.; G., D., Prácticas Generales de Bioquímica y Biología Molecular. 2008.
73. Costa, J., Real-time PCR. Enfermedades Infecciosas Y Microbiologia Clinica 2004, 22,
(5), 299-305.
74. Ishii, S.; Sadowsky, M. J., Applications of the rep-PCR DNA fingerprinting technique to
study microbial diversity, ecology and evolution. Environmental Microbiology 2009, 11, (4), 733-740.
75. Fernandez-Cuenca, F., PCR techniques for molecular epidemiology of infectious
diseases. Enfermedades Infecciosas Y Microbiologia Clinica 2004, 22, (6), 355-360.
76. Kubista, M.; Andrade, J. M.; Bengtsson, M.; Forootan, A.; Jonak, J.; Lind, K.; Sindelka,
R.; Sjoback, R.; Sjogreen, B.; Strombom, L.; Stahlberg, A.; Zoric, N., The real-time polymerase chain
reaction. Molecular aspects of medicine 2006, 27, (2-3), 95-125.
77. Postollec, F.; Falentin, H.; Pavan, S.; Combrisson, J.; Sohier, D., Recent advances in
quantitative PCR (qPCR) applications in food microbiology. Food Microbiology 2011, 28, (5), 848-861.
78. Cocolin, L., Rajkovic, A., Rantsiou, K., Uyttendaele, M. , The challenge of merging food
safety diagnostic needs with quantitative PCR platforms. Trends in Food Science & Technology 2011,
22, S30-S38.
79. Goel, G.; Kumar, A.; Puniya, A. K.; Chen, W.; Singh, K., Molecular beacon: a multitask
probe. Journal of Applied Microbiology 2005, 99, (3), 435-442.
80. Nordgren, J.; Bucardo, F.; Svensson, L.; Lindgren, P.-E., Novel Light-Upon-Extension
Real-Time PCR Assay for Simultaneous Detection, Quantification, and Genogrouping of Group A
Rotavirus. Journal of Clinical Microbiology 2008, 48, (5), 1859-1865.
81. Lowe, B.; Avila, H. A.; Bloom, F. R.; Gleeson, M.; Kusser, W., Quantitation of gene
expression in neural precursors by reverse-transcription polymerase chain reaction using self-
quenched, fluorogenic primers. Analytical Biochemistry 2003, 315, (1), 95-105.
82. Nazarenko, I.; Lowe, B.; Darfler, M.; Ikonomi, P.; Schuster, D.; Rashtchian, A., Multiplex
quantitative PCR using self-quenched primers labeled with a single fluorophore. Nucleic Acids Research
2002, 30, (9).
83. Lukhtanov, E. A.; Lokhov, S. G.; Gorn, V. V.; Podyminogin, M. A.; Mahoney, W., Novel
DNA probes with low background and high hybridization-triggered fluorescence. Nucleic Acids
Research 2007, 35, (5).
84. Afonina, I. A.; Reed, M. W.; Lusby, E.; Shishkina, I. G.; Belousov, Y. S., Minor groove
160 Bibliografía
binder-conjugated DNA probes for quantitative DNA detection by hybridization-triggered fluorescence.

Biotechniques 2002, 32, (4), 940-+.
85. Monis, P. T.; Giglio, S., Nucleic acid amplification-based techniques for pathogen
detection and identification. Infection Genetics and Evolution 2006, 6, (1), 2-12.
86. Reynisson, E.; Josefsen, M. H.; Krause, A.; Hoorfar, J., Evaluation of probe chemistries
and platforms to improve the detection limit of real-time PCR. Journal of Microbiological Methods
2006, 66, (2), 206-216.
87. Brandt, O.; Hoheisel, J. D., Peptide nucleic acids on microarrays and other biosensors.
Trends in Biotechnology 2004, 22, (12), 617-622.
88. Stender, H.; Fiandaca, M.; Hyldig-Nielsen, J. J.; Coull, J., PNA for rapid microbiology.
Journal of Microbiological Methods 2002, 48, (1), 1-17.
89. Paris, C.; Moreau, V.; Deglane, G.; Voirin, E.; Erbacher, P.; Lenne-Samuel, N., Zip
nucleic acids are potent hydrolysis probes for quantitative PCR. Nucleic Acids Research 2010, 38, (7).
90. Moreau, V.; Voirin, E.; Paris, C.; Kotera, M.; Nothisen, M.; Remy, J.-S.; Behr, J.-P.;
Erbacher, P.; Lenne-Samuel, N., Zip Nucleic Acids: new high affinity oligonucleotides as potent primers
for PCR and reverse transcription. Nucleic Acids Research 2009, 37, (19).
91. Rodriguez-Lazaro, D.; Hernandez, M., Molecular methodology in Food Microbiology
diagnostics: trends and current challenges. 2006, 643.
92. Vitullo, M.; Grant, K. A.; Sammarco, M. L.; Tamburro, M.; Ripabelli, G.; Amar, C. F. L.,
Real-time PCRs assay for serogrouping Listeria monocytogenes and differentiation from other Listeria
spp. Molecular and Cellular Probes 2013, 27, (1), 68-70.
93. Krojgaard, L.; Krogfelt, K.; Albrechtsen, H.-J.; Uldum, S., Detection of Legionella by
quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment. BMC Microbiology
2011, 11, (1), 254.
94. Rantsiou, K.; Mataragas, M.; Jespersen, L.; Cocolin, L., Understanding the behavior of
foodborne pathogens in the food chain: New information for risk assessment analysis. Trends in Food
Science & Technology 2011, 22, Supplement 1, (0), S21-S29.
95. Devonshire, A. S.; Sanders, R.; Wilkes, T. M.; Taylor, M. S.; Foy, C. A.; Huggett, J. F.,
Application of next generation qPCR and sequencing platforms to mRNA biomarker analysis. Methods
2012, 59, (1), 89-100.
96. Hoorfar, J.; Cook, N.; Malorny, B.; Wagner, M.; De Medici, D.; Abdulmaajood, A.; Fach,
P., Making internal amplification control mandatory for diagnostic PCR. Journal of Clinical Microbiology
2003, 41, (12), 5835-5835.
97. Hoorfar, J.; Malorny, B.; Abdulmawjood, A.; Cook, N.; Wagner, M.; Fach, P., Practical
considerations in design of internal amplification controls for diagnostic PCR assays. Journal of Clinical
Microbiology 2004, 42, (5), 1863-1868.
98. ISO, Microbiology of food and animal feeding stuffs -- Polymerase chain reaction
(PCR) for the detection of food-borne pathogens -- Requirements for amplification and detection for
qualitative methods. In 2006; Vol. 20838, p 15.
99. Nocker, A.; Cheung, C. Y.; Camper, A. K., Comparison of propidium monoazide with
ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead
cells. Journal of Microbiological Methods 2006, 67, (2), 310-320.
100. Wagner, A. O.; Malin, C.; Knapp, B. A.; Illmer, P., Removal of free extracellular DNA
from environmental samples by ethidium monoazide and propidium monoazide. Applied and
101. Pan, Y.; Breidt, F., Jr., Enumeration of viable Listeria monocytogenes cells by real-time
PCR with propidium monoazide and ethidium monoazide in the presence of dead cells. Applied and
102. Elizaquivel, P.; Sanchez, G.; Aznar, R., Quantitative detection of viable foodborne E.
coli O157:H7, Listeria monocytogenes and Salmonella in fresh-cut vegetables combining propidium
monoazide and real-time PCR. Food Control 2012, 25, (2), 704-708.
103. Scheu, P. M.; Berghof, K.; Stahl, U., Detection of pathogenic and spoilage micro-
organisms in food with the polymerase chain reaction. Food Microbiology 1998, 15, (1), 13-31.
104. Glynn, B.; Lahiff, S.; Wernecke, M.; Barry, T.; Smith, T. J.; Maher, M., Current and
emerging molecular diagnostic technologies applicable to bacterial food safety. International Journal of
Dairy Technology 2006, 59, (2), 126-139.
105. Malorny, B.; Tassios, P. T.; Radstrom, P.; Cook, N.; Wagner, M.; Hoorfar, J.,
161 Bibliografía
Standardization of diagnostic PCR for the detection of foodborne pathogens. International Journal of
Food Microbiology 2003, 83, (1), 39-48.
106. Hoorfar, J., The need for standardization of real-time PCR methods. Journal of Aoac
International 2005, 88, (2), 45A-45A.
107. ISO, Microbiology of food and animal feeding stuffs -- Protocol for the validation of
alternative methods. In 2003; Vol. 16140.
108. ISO, Microbiology of food and animal feeding stuffs -- Protocol for the validation of
altenative methods. Amendment 1. In 2011; Vol. 16140.
(PCR) for the detection of food-borne pathogens. General requirements and definitions In 2005; Vol.
22174, p 19.
(PCR) for the detection of food-borne pathogens-- Performance testing for thermal cyclers In 2005;
Vol. 20836, p 21.
(PCR) for the detection of food-borne pathogens -- Requirements for sample preparation for
qualitative detection. In 2006; Vol. 20837, p 15.
112. ISO, Microbiología de los alimentos para consumo humano y animal -- Reacción en
Características de funcionamiento. In 2011; Vol. 22118, p 16.
113. ISO, Microbiología de los alimentos para consumo humano y animal -- Reacción en
Requisitos generales y definiciones. In 2011; Vol. 22119, p 18.
114. Bustin, S. A.; Benes, V.; Garson, J. A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller,
R.; Nolan, T.; Pfaffl, M. W.; Shipley, G. L.; Vandesompele, J.; Wittwer, C. T., The MIQE Guidelines:
Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry
2009, 55, (4), 611-622.
115. Raymaekers, M.; Smets, R.; Maes, B.; Cartuyvels, R., Checklist for Optimization and
Validation of Real-Time PCR Assays. Journal of Clinical Laboratory Analysis 2009, 23, (3), 145-151.
116. Bustin, S. A.; Beaulieu, J.-F.; Huggett, J.; Jaggi, R.; Kibenge, F. S. B.; Olsvik, P. A.;
Penning, L. C.; Toegel, S., MIQE precis: Practical implementation of minimum standard guidelines for
fluorescence-based quantitative real-time PCR experiments. Bmc Molecular Biology 2010, 11.
117. Malorny, B.; Huehn, S.; Dieckmann, R.; Kramer, N.; Helmuth, R., Polymerase Chain
Reaction for the Rapid Detection and Serovar Identification of Salmonella in Food and Feeding Stuff.
Food Analytical Methods 2009, 2, (2), 81-95.
118. Grimont, P. A. D.; Weill, F. X. Antigenic formulae of the Salmonella serovars; Institute
Pasteur: 2007; p 166.
119. Garrity, G. M.; Bell, A. J.; Lilburn, T. G., Taxonomic Outline of the Prokaryotes. Bergey's
Manual of Systematic Bacteriology. 2nd ed.; SPRINGER: 2004.
120. Andrews, W. H.; Jacobson, A.; Hammack, T., Salmonella. In FDA, Bacteriological
Analytical Manual Online: 2011; Vol. Chapter 5.
121. Malorny, B.; Hoorfar, J.; Bunge, C.; Helmuth, R., Multicenter validation of the
analytical accuracy of Salmonella PCR: towards an international standard. Applied and Environmental
Microbiology 2003, 69, (1), 290-296.
122. Malorny, B.; Cook, N.; D'Agostino, M.; De Medici, D.; Croci, L.; Abdulmawjood, A.;
Fach, P.; Karpiskova, R.; Aymerich, T.; Kwaitek, K.; Kuchta, T.; Hoorfar, J., Multicenter validation of PCR-
based method for detection of Salmonella in chicken and pig samples. Journal of Aoac International
2004, 87, (4), 861-866.
123. Cheng, C. M.; Lin, W.; Van, K. T.; Phan, L.; Tran, N. N.; Farmer, D., Rapid Detection of
Salmonella in Foods Using Real-Time PCR. Journal of Food Protection 2008, 71, (12), 2436-2441.
124. Malorny, B.; Bunge, C.; Helmuth, R., A real-time PCR for the detection of Salmonella
Enteritidis in poultry meat and consumption eggs. Journal of Microbiological Methods 2007, 70, (2),
245-251.
125. Calvo, L.; Martinez-Planells, A.; Pardos-Bosch, J.; Garcia-Gil, L. J., A New Real-Time
PCR Assay for the Specific Detection of Salmonella spp. targeting the bipA Gene. Food Analytical
Methods 2008, 1, (4), 236-242.
126. Krascsenicsova, K.; Piknova, L.; Kaclikova, E.; Kuchta, T., Detection of Salmonella
162 Bibliografía
enterica in food using two-step enrichment and real-time polymerase chain reaction. Letters in Applied
Microbiology 2008, 46, (4), 483-487.
127. Chua, T.; Bhagwat, A. A., A Rapid and Simple DNA Extraction Procedure to Detect
Salmonella spp. and Listeria monocytogenes from Fresh Produce Using Real-time PCR. Food Analytical
Methods 2009, 2, (2), 96-101.
128. Garrido, A.; Chapela, M.-J.; Román, B.; Fajardo, P.; Lago, J.; Vieites, J. M.; Cabado, A.
G., A new multiplex real-time PCR developed method for Salmonella spp. and Listeria monocytogenes
detection in food and environmental samples. Food Control 2013, 30, (1), 76-85.
129. Malorny, B.; Paccassoni, E.; Fach, P.; Bunge, C.; Martin, A.; Helmuth, R., Diagnostic
real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology 2004, 70,
(12), 7046-7052.
130. Adams, M. R.; Moss, M. O., Food Microbiology. 3rd ed.; RSC Publishing: 2008; p 477.
131. Bertsch, D.; Rau, J. r.; Eugster, M. R.; Haug, M. C.; Lawson, P. A.; Lacroix, C.; Meile, L.,
Listeria fleischmannii sp. nov., isolated from cheese. International Journal of Systematic and
Evolutionary Microbiology 2012.
132. Graves, L. M.; Helsel, L. O.; Steigerwalt, A. G.; Morey, R. E.; Daneshvar, M. I.; Roof, S.
E.; Orsi, R. H.; Fortes, E. D.; Milillo, S. R.; den Bakker, H. C.; Wiedmann, M.; Swaminathan, B.; Sauders,
B. D., Listeria marthii sp. nov., isolated from the natural environment, Finger Lakes National Forest.
International Journal of Systematic and Evolutionary Microbiology 2010, 60, (6), 1280-1288.
133. Lang Halter, E.; Neuhaus, K.; Scherer, S., Listeria weihenstephanensis sp. nov., isolated
from the water plant Lemna trisulca of a German fresh water pond. International Journal of Systematic
and Evolutionary Microbiology 2012.
134. Leclercq, A.; Clermont, D.; Bizet, C.; Grimont, P. A. D.; Le FlÃ¨che-MatÃ©os, A.;
Roche, S. M.; Buchrieser, C.; Cadet-Daniel, V. r.; Le Monnier, A.; Lecuit, M.; Allerberger, F., Listeria
rocourtiae sp. nov. International Journal of Systematic and Evolutionary Microbiology 2010, 60, (9),
2210-2214.
135. Rossmanith, P.; Wagner, M., The challenge to quantify Listeria monocytogenes- a
model leading to new aspects in molecular biological food pathogen detection. Journal of Applied
Microbiology 2010, 110, (3), 605-617.
136. Warriner, K.; Namvar, A., What is the hysteria with Listeria? Trends in Food Science &
Technology 2009, 20, (6-7), 245-254.
137. Chenal-Francisque, V.; Lopez, J.; Cantinelli, T.; Caro, V.; Tran, C.; Leclercq, A.; Lecuit,
M.; Brisse, S., Worldwide Distribution of Major Clones of Listeria monocytogenes. Emerging Infectious
Diseases 2011, 17, (6), 1110-1112.
138. Vasseur, C.; Baverel, L.; Hebraud, M.; Labadie, J., Effect of osmotic, alkaline, acid or
thermal stresses on the growth and inhibition of Listeria monocytogenes. Journal of Applied
Microbiology 1999, 86, (3), 469-476.
139. Farber, J. M.; Peterkin, P. I., Listeria monocytogenes, a Food-Borne Pathogen.
Microbiological Reviews 1991, 55, (3), 476-511.
140. Longhi, C.; Maffeo, A.; Penta, M.; Petrone, G.; Seganti, L.; Conte, M. P., Detection of
Listeria monocytogenes in Italian-style soft cheeses. Journal of Applied Microbiology 2003, 94, (5), 879-
885.
141. Rantsiou, K.; Alessandria, V.; Urso, R.; Dolci, P.; Cocolin, L., Detection, quantification
and vitality of Listeria monocytogenes in food as determined by quantitative PCR (vol 121, pg 99,
2008). International Journal of Food Microbiology 2008, 127, (3), 321-321.
142. Traunsek, U.; Toplak, N.; Jersek, B.; Lapanje, A.; Majstorovic, T.; Kovac, M., Novel cost-
efficient real-time PCR assays for detection and quantitation of Listeria monocytogenes. Journal of
Microbiological Methods 2011, 85, (1), 40-46.
143. Al-Zeyara, S. A.; Jarvis, B.; Mackey, B. M., The inhibitory effect of natural microflora of
food on growth of Listeria monocytogenes in enrichment broths. International Journal of Food
Microbiology 2011, 145, (1), 98-105.
144. Vollenhofer-Schrumpf, S.; Buresch, R.; Unger, G.; Stahl, N.; Franzl, G.; Schinkinger, M.,
Detection of Salmonella spp., Escherichia coli O157, Listeria monocytogenes and Campylobacter spp. in
chicken samples by multiplex polymerase chain reaction and hybridization using the genegen major
food pathogens detection kit. Journal of Rapid Methods and Automation in Microbiology 2005, 13, (3),
148-176.
145. Hitchins, A. D.; Karen Jinneman, K., Listeria monocytogenes. In FDA. Bacteriological
163 Bibliografía
Analytical Manual Online: 2011; Vol. Chapter 10.

146. Jofre, A.; Martin, B.; Garriga, M.; Hugas, M.; Pla, M.; Rodriguez-Lazaro, D.; Aymerich,
T., Simultaneous detection of Listeria monocytogenes and Salmonella by multiplex PCR in cooked ham.
Food Microbiology 2005, 22, (1), 109-115.
147. Singh, J., Batish, V. K., Grover, S., Simultaneous detection of Listeria monocytogenes
and Salmonella spp. in dairy products using real time PCR-melt curve analysis. Journal of Food Science
and Technology 2011.
148. Rossmanith, P.; Krassnig, M.; Wagner, M.; Hein, I., Detection of Listeria
monocytogenes in food using a combined enrichment/real-time PCR method targeting the prfA gene.
Research in Microbiology 2006, 157, (8), 763-771.
149. D'Agostino, M.; Wagner, M.; Vazquez-Boland, J. A.; Kuchta, T.; Karpiskova, R.; Hoorfar,
J.; Novella, S.; Scortti, M.; Ellison, J.; Murray, A.; Fernandes, I.; Kuhn, M.; Pazlarova, J.; Heuvelink, A.;
Cook, N., A validated PCR-based method to detect Listeria monocytogenes using raw milk as a food
model - Towards an international standard. Journal of Food Protection 2004, 67, (8), 1646-1655.
150. Zhang, D.; Zhang, H.; Yang, L.; Guo, J.; Li, X.; Feng, Y., Simultaneous Detection of
Listeria monocytogenes, Staphylococcus aureus, Salmonella enterica and Escherichia coli O157:H7 in
Food Samples Using Multiplex PCR Method. Journal of Food Safety 2009, 29, (3), 348-363.
151. Badosa, E.; Chico, N.; Pla, M.; Pares, D.; Montesinos, E., Evaluation of ISO enrichment
real-time PCR methods with internal amplification control for detection of Listeria monocytogenes and
Salmonella enterica in fresh fruit and vegetables. Letters in Applied Microbiology 2009, 49, (1), 105-
111.
152. Zuo, G.; Xu, Z.; Hao, B., Shigella Strains Are Not Clones of Escherichia coli but Sister
Species in the Genus Escherichia. Genomics, Proteomics & Bioinformatics 2012, (0).
153. van den Beld, M. J. C.; Reubsaet, F. A. G., Differentiation between Shigella,
enteroinvasive Escherichia coli (EIEC) and noninvasive Escherichia coli. European Journal of Clinical
Microbiology & Infectious Diseases 2012, 31, (6), 899-904.
detection of Shigella spp. . In 2004; Vol. 21567: 2004.
155. Wallace, H. A.; Jacobson, A., Shigella Chapter 6. In FDA Bacteriological Analytical
Manual: 2001.
156. Vantarakis, A.; Komninou, G.; Venieri, D.; Papapetropoulou, M., Development of a
multiplex PCR detection of Salmonella spp. and Shigella spp. in mussels. Letters in Applied
Microbiology 2000, 31, (2), 105-109.
157. Gomez-Duarte, O. G.; Bai, J.; Newell, E., Detection of Escherichia coli, Salmonella
spp., Shigella spp., Yersinia enterocolitica, Vibrio cholerae, and Campylobacter spp. enteropathogens
by 3-reaction multiplex polymerase chain reaction. Diagnostic Microbiology and Infectious Disease
2009, 63, (1), 1-9.
158. Li, Y.; Zhuang, S.; Mustapha, A., Application of a multiplex PCR for the simultaneous
detection of Escherichia coli O157 : H7, Salmonella and Shigella in raw and ready-to-eat meat
products. Meat Science 2005, 71, (2), 402-406.
159. Thiem, V. D.; Sethabutr, O.; von Seidlein, L.; Van Tung, T.; Canh, D. G.; Chien, B. T.;
Tho, L. H.; Lee, H.; Houng, H. S.; Hale, T. L.; Clemens, J. D.; Mason, C.; Trach, D. D., Detection of Shigella
by a PCR assay targeting the ipaH gene suggests increased prevalence of shigellosis in Nha Trang,
Vietnam. Journal of Clinical Microbiology 2004, 42, (5), 2031-2035.
160. Wang, L. X.; Li, Y.; Mustapha, A., Rapid and simultaneous quantitation of Escherichia
coli O157 : H7, Salmonella, and Shigella in ground beef by multiplex real-time PCR and
immunomagnetic separation. Journal of Food Protection 2007, 70, (6), 1366-1372.
161. Garrido, A.; Chapela, M. J.; Roman, B.; Ferreira, M.; Lago, J.; Vieites, J. M.; Cabado, A.
G., Development of a multiplex real-time PCR method for simultaneous detection of Salmonella
enterica, Shigella flexneri and Listeria monocytogenes in processed food samples. European Food
Research and Technology 2012, 234, (4), 571-580.
162. Hsu, B. M.; Wu, S. F.; Huang, S. W.; Tseng, Y. J.; Ji, D. D.; Chen, J. S.; Shih, F. C.,
Differentiation and identification of Shigella spp. and enteroinvasive Escherichia coli in environmental
waters by a molecular method and biochemical test. Water Research 2010, 44, (3), 949-955.
163. Franz, E.; Klerks, M. A.; De Vos, O. J.; Termorshuizen, A. J.; van Bruggen, A. H. C.,
Prevalence of Shiga toxin-producing Escherichia coli stx(1), stx(2), eaeA, and rfbE genes and survival of
E. coli O157 : H7 in manure from organic and low-input conventional dairy farms. Applied and
164 Bibliografía

164. Wang, G. H.; Clark, C. G.; Rodgers, F. G., Detection in Escherichia coli of the genes
encoding the major virulence factors, the genes defining the O157 : H7 serotype, and components of
the type 2 Shiga toxin family by multiplex PCR. Journal of Clinical Microbiology 2002, 40, (10), 3613-
3619.
165. Fortin, N. Y.; Mulchandani, A.; Chen, W., Use of real-time polymerase chain reaction
and molecular beacons for the detection of Escherichia coli O157 : H7. Analytical Biochemistry 2001,
289, (2), 281-288.
detection of Escherichia coli O157. In 2001; Vol. 16654: 2001.
167. Feng, P.; Weagant, S. D.; Jinneman, K., Diarrheagenic Escherichia coli. In FDA,
Bacteriological Analytical Manual Online: 2011; Vol. Chapter 5.
168. Kawasaki, S.; Fratamico, P. M.; Kamisaki-Horikoshi, N.; Okada, Y.; Takeshita, K.;
Sameshima, T.; Kawamoto, S., Development of the Multiplex PCR Detection Kit for Salmonella spp.,
Listeria monocytogenes, and Escherichia coli O157:H7. Jarq-Japan Agricultural Research Quarterly
2011, 45, (1), 77-81.
169. Germini, A.; Masola, A.; Carnevali, P.; Marchelli, R., Simultaneous detection of
Escherichia coli O175:H7, Salmonella spp., and Listeria monocytogenes by multiplex PCR. Food Control
2009, 20, (8), 733-738.
170. Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; Heuvelink, A.
E.; Hoorfar, J., Development, validation, and standardization of polymerase chain reaction-based
detection of E. coli O157. Journal of Aoac International 2004, 87, (3), 596-603.
171. Abdulmawjood, A.; Bulte, M.; Cook, N.; Roth, S.; Schonenbrucher, H.; Hoorfar, J.,
Toward an international standard for PCR-based detection of Escherichia coli O157 - Part 1. Assay
development and multi-center validation. Journal of Microbiological Methods 2003, 55, (3), 775-786.
172. Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; D'Agostino, M.;
Malorny, B.; Jordan, M.; Pelkonen, S.; Hoorfar, J., Toward an international standard for PCR-based
detection of foodborne Escherichia coli O157: Validation of the PCR-based method in a multicenter
interlaboratory trial. Journal of Aoac International 2004, 87, (4), 856-860.
173. Park, Y. S.; Lee, S. R.; Kim, Y. G., Detection of Escherichia coli O157 : H7, Salmonella
spp., Staphylococcus aureus and Listeria monocytogenes in kimchi by multiplex polymerase chain
reaction (mPCR). Journal of Microbiology 2006, 44, (1), 92-97.
174. Omiccioli, E.; Amagliani, G.; Brandi, G.; Magnani, M., A new platform for Real-Time
PCR detection of Salmonella spp., Listeria monocytogenes and Escherichia coli O157 in milk. Food
Microbiology 2009, 26, (6), 615-622.
175. Perelle, S.; Dilasser, F.; Grout, J. L.; Fach, P., Detection by 5 '-nuclease PCR of Shiga-
toxin producing Escherichia coli O26, O55, O91, O103, O111, O113, O145 and O157 : H7, associated
with the world's most frequent clinical cases. Molecular and Cellular Probes 2004, 18, (3), 185-192.
176. Bai, J.; Shi, X.; Nagaraja, T. G., A multiplex PCR procedure for the detection of six
major virulence genes in Escherichia coli O157:H7. Journal of Microbiological Methods 2010, 82, (1),
85-89.
177. Al-Ajmi, D.; Padmanabha, J.; Denman, S. E.; Gilbert, R. A.; Al Jassim, R. A. M.;
McSweeney, C. S., Evaluation of a PCR detection method for Escherichia coli O157 : H7/H- bovine
faecal samples. Letters in Applied Microbiology 2006, 42, (4), 386-391.
178. Hu, Y.; Zhang, Q.; Meitzler, J. C., Rapid and sensitive detection of Escherichia coli
O157 : H7 in bovine faeces by a multiplex PCR. Journal of Applied Microbiology 1999, 87, (6), 867-876.
179. Esteban, J. I.; Oporto, B.; Aduriz, G.; Juste, R. n. A.; Hurtado, A., A survey of food-
borne pathogens in free-range poultry farms. International Journal of Food Microbiology 2008, 123,
(1â€“2), 177-182.
180. Bauer, A.; Rorvik, L. M., A novel multiplex PCR for the identification of Vibrio
parahaemolyticus, Vibrio cholerae and Vibrio vulnificus. Letters in Applied Microbiology 2007, 45, 371-
375.
181. Neogi, S. B.; Chowdhury, N.; Asakura, M.; Hinenoya, A.; Haldar, S.; Saidi, S. M.;
Kogure, K.; Lara, R. J.; Yamasaki, S., A highly sensitive and specific multiplex PCR assay for simultaneous
detection of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus. Letters in Applied
Microbiology 2010, 51, (3), 293-300.
182. Thompson, F. L.; Iida, T.; Swings, J., Biodiversity of vibrios. Microbiology and
165 Bibliografía
Molecular Biology Reviews 2004, 68, (3), 403-+.

183. Austin, B., Vibrios as causal agents of zoonoses. Veterinary Microbiology 2010, 140,
(3-4), 310-317.
184. Tobin-D'Angelo, M.; Smith, A. R.; Bulens, S. N.; Thomas, S.; Hodel, M.; Izumiya, H.;
Arakawa, E.; Morita, M.; Watanabe, H.; Marin, C.; Parsons, M. B.; Greene, K.; Cooper, K.; Haydel, D.;
Bopp, C.; Yu, P.; Mintz, E., Severe diarrhea caused by cholera toxin-producing Vibrio cholerae serogroup
O75 infections acquired in the southeastern United States. Clinical Infectious Diseases 2008, 47, (8),
1035-1040.
185. Huang, J.; Zhu, Y.; Wen, H.; Zhang, J.; Huang, S.; Niu, J.; Li, Q., Quadruplex Real-Time
PCR Assay for Detection and Identification of Vibrio cholerae O1 and O139 Strains and Determination
of Their Toxigenic Potential. Applied and Environmental Microbiology 2009, 75, (22), 6981-6985.
186. Raghunath, P.; Pradeep, B.; Karunasagar, I.; Karunasagar, I., Rapid detection and
enumeration of trh-carrying Vibrio parahaemolyticus with the alkaline phosphatase-labelled
oligonucleotide probe. Environmental Microbiology 2007, 9, (1), 266-270.
187. Oliver, J. D., Wound infections caused by Vibrio vulnificus and other marine bacteria.
Epidemiology and Infection 2005, 133, (3), 383-391.
188. Koenig, K. L.; Mueller, J.; Rose, T., Vibrio vulnificus - Hazard on the Half Shell. Western
Journal of Medicine 1991, 155, (4), 400-403.
189. Fujino, T., Bacterial food poisoning. Saishin Igaku 1951, 6, 263-271.
190. Canigral, I.; Moreno, Y.; Alonso, J. L.; Gonzalez, A.; Ferrus, M. A., Detection of Vibrio
vulnificus in seafood, seawater and wastewater samples from a Mediterranean coastal area.
Microbiological Research 2010, 165, (8), 657-664.
191. Schaerer, K.; Savioz, S.; Cernela, N.; Saegesser, G.; Stephan, R., Occurrence of Vibrio
spp. in Fish and Shellfish Collected from the Swiss Market. Journal of Food Protection 2011, 74, (8),
1345-1347.
192. Baker-Austin, C.; Stockley, L.; Rangdale, R.; Martinez-Urtaza, J., Environmental
occurrence and clinical impact of Vibrio vulnificus and Vibrio parahaemolyticus: a European
perspective. Environmental Microbiology Reports 2010, 2, (1), 7-18.
193. Hiyoshi, H.; Kodama, T.; Iida, T.; Honda, T., Contribution of Vibrio parahaemolyticus
Virulence Factors to Cytotoxicity, Enterotoxicity, and Lethality in Mice. Infection and Immunity 2010,
78, (4), 1772-1780.
194. Pineyro, P.; Zhou, X. H.; Orfe, L. H.; Friel, P. J.; Lahmers, K.; Call, D. R., Development of
Two Animal Models To Study the Function of Vibrio parahaemolyticus Type III Secretion Systems.
Infection and Immunity 2010, 78, (11), 4551-4559.
195. McCarthy, S. A.; DePaola, A.; Kaysner, C. A.; Hill, W. E.; Cook, D. W., Evaluation of
nonisotopic DNA hybridization methods for detection of the tdh gene of Vibrio parahaemolyticus.
Journal of Food Protection 2000, 63, (12), 1660-1664.
196. McCarthy, S. A.; DePaola, A.; Cook, D. W.; Kaysner, C. A.; Hill, W. E., Evaluation of
alkaline phosphatase- and digoxigenin-labelled probes for detection of the thermolabile hemolysin
(tlh) gene of Vibrio parahaemolyticus. Letters in Applied Microbiology 1999, 28, (1), 66-70.
197. Bej, A. K.; Patterson, D. P.; Brasher, C. W.; Vickery, M. C. L.; Jones, D. D.; Kaysner, C. A.,
Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR
amplification of tl, tdh and trh. Journal of Microbiological Methods 1999, 36, (3), 215-225.
198. Hill, W. E.; Keasler, S. P.; Trucksess, M. W.; Feng, P.; Kaysner, C. A.; Lampel, K. A.,
Polymerase Chain-Reaction Identification of Vibrio vulnificus in Artificially Contaminated Oysters.
Applied and Environmental Microbiology 1991, 57, (3), 707-711.
199. Fykse, E. M.; Skogan, G.; Davies, W.; Olsen, J. S.; Blatny, J. M., Detection of Vibrio
cholerae by real-time nucleic acid sequence-based amplification. Applied and Environmental
Microbiology 2007, 73, (5), 1457-1466.
200. Cariani, A.; Piano, A.; Consolandi, C.; Severgnini, M.; Castiglioni, B.; Caredda, G.;
Candela, M.; Serratore, P.; De Bellis, G.; Tinti, F., Detection and characterization of pathogenic vibrios in
shellfish by a Ligation Detection Reaction-Universal Array approach. International Journal of Food
Microbiology 2012, 153, (3), 474-482.
201. Lalitha, P.; Suraiya, M. N. S.; Lim, K. L.; Lee, S. Y.; Haslindawaty, A. R. N.; Chan, Y. Y.;
Ismail, A.; Zainuddin, Z. F.; Ravichandran, M., Analysis of lolB gene sequence and its use in the
development of a PCR assay for the detection of Vibrio cholerae. Journal of Microbiological Methods
2008, 75, (1), 142-144.
166 Bibliografía
202. Shuan Ju Teh, C.; Lin Thong, K.; Tein Ngoi, S.; Ahmad, N.; Balakrish Nair, G.;
Ramamurthy, T., Molecular characterization of serogrouping and virulence genes of Malaysian Vibrio
cholerae isolated from different sources. The Journal of general and applied microbiology 2009, 55, (6),
419-25.
203. Blackstone, G. M.; Nordstrom, J. L.; Vickery, M. C. L.; Bowen, M. D.; Meyer, R. F.;
DePaola, A., Detection of pathogenic Vibrio parahaemolyticus in oyster enrichments by real time PCR.
Journal of Microbiological Methods 2003, 53, (2), 149-155.
204. Nordstrom, J. L.; Vickery, M. C. L.; Blackstone, G. M.; Murray, S. L.; DePaola, A.,
Development of a multiplex real-time PCR assay with an internal amplification control for the
detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and
Environmental Microbiology 2007, 73, 5840-5847.
205. Blackstone, G. M.; Nordstrom, J. L.; Bowen, M. D.; Meyer, R. F.; Imbro, P.; DePaola, A.,
Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental
survey of Mobile Bay. Journal of Microbiological Methods 2007, 68, (2), 254-259.
206. Campbell, M. S.; Wright, A. C., Real-time PCR analysis of Vibrio vulnificus from
oysters. Applied and Environmental Microbiology 2003, 69, (12), 7137-7144.
207. Baker-Austin, C.; Lemm, E.; Hartnell, R.; Lowther, J.; Onley, R.; Amaro, C.; Oliver, J. D.;
Lees, D., pilF polymorphism-based real-time PCR to distinguish Vibrio vulnificus strains of human
health relevance. Food Microbiology 2011.
208. Davis, C. R.; Heller, L. C.; Peak, K. K.; Wingfield, D. L.; Goldstein-Hart, C. L.; Bodager, D.
W.; Cannons, A. C.; Amuso, P. T.; Cattani, J., Real-time PCR detection of the thermostable direct
hemolysin and thermolabile hemolysin genes in a Vibrio parahaemolyticus cultured from mussels and
mussel homogenate associated with a foodborne outbreak. Journal of Food Protection 2004, 67, (5),
1005-1008.
209. Gubala, A. J.; Proll, D. F., Molecular-beacon multiplex real-time PCR assay for
detection of Vibrio cholerae. Applied and Environmental Microbiology 2006, 72, (9), 6424-6428.
210. Chapela, M. J.; Fajardo, P.; Garrido, A.; Cabado, A. G.; Ferreira, M.; Lago, J.; Vieites, J.
M., Comparison between a TaqMan Polymerase Chain Reaction Assay and a Culture Method for ctx-
Positive Vibrio cholerae Detection. Journal of Agricultural and Food Chemistry 2010, 58, (7), 4051-
4055.
211. Garrido, A.; Chapela, M. J.; Ferreira, M.; Atanassova, M.; Fajardo, P.; Lago, J.; Vieites,
J. M.; Cabado, A. G., Development of a multiplex real-time PCR method for pathogenic Vibrio
parahaemolyticus detection (tdh+ and trh+). Food Control 2012, 24, (1-2), 128-135.
212. Harwood, V. J.; Gandhi, J. P.; Wright, A. C., Methods for isolation and confirmation of
Vibrio vulnificus from oysters and environmental sources: a review. Journal of Microbiological Methods
2004, 59, (3), 301-316.
213. Elizaquivel, P.; Gabaldon, J. A.; Aznar, R., Quantification of Salmonella spp., Listeria
monocytogenes and Escherichia coli O157 H7 in non-spiked food products and evaluation of real-time
PCR as a diagnostic tool in routine food analysis. Food Control 2011, 22, (2), 158-164.
214. Bonetta, S.; Borelli, E.; Bonetta, S.; Conio, O.; Palumbo, F.; Carraro, E., Development of
a PCR protocol for the detection of Escherichia coli O157:H7 and Salmonella spp. in surface water.
Environmental Monitoring and Assessment 2011, 177, (1-4), 493-503.
215. Tomas, D.; Rodrigo, A.; Hernandez, M.; Ferrus, M. A., Validation of Real-Time PCR and
Samples. Food Analytical Methods 2009, 2, (3), 180-189.
216. Gordillo, R.; Cordoba, J. J.; Andrade, M. J.; Isabel Luque, M.; Rodriguez, M.,
Development of PCR assays for detection of Escherichia coli O157:H7 in meat products. Meat Science
2011, 88, (4), 767-773.
217. Chapman, P. A.; Ashton, R., An evaluation of rapid methods for detecting Escherichia
coli O157 on beef carcasses. International Journal of Food Microbiology 2003, 87, (3), 279-285.
218. Fedio, W.; Blackstone, G. M.; Kikuta-Oshima, L.; Wendakoon, C.; McGrath, T. H.;
DePaola, A., Rapid detection of the Vibrio cholerae ctx gene in food enrichments using real-time
polymerase chain reaction. Journal of Aoac International 2007, 90, (5), 1278-1283.
219. Samadpour, M.; Barbour, M. W.; Nguyen, T.; Cao, T. M.; Buck, F.; Depavia, G. A.;
Mazengia, E.; Yang, P.; Alfi, D.; Lopes, M.; Stopforth, J. D., Incidence of enterohemorrhagic Escherichia
coli, Escherichia coli O157, Salmonella, and Listeria monocytogenes in retail fresh ground beef, sprouts,
and mushrooms. Journal of Food Protection 2006, 69, (2), 441-443.
167 Bibliografía
220. Kawasaki, S.; Horikoshi, N.; Okada, Y.; Takeshita, K.; Sameshima, T.; Kawamoto, S.,
Multiplex PCR for simultaneous detection of Salmonella spp., Listeria monocytogenes, and Escherichia
coli O157: H7 in meat samples. Journal of Food Protection 2005, 68, (3), 551-556.
221. Pui, C. F.; Wong, W. C.; Chai, L. C.; Nillian, E.; Ghazali, F. M.; Cheah, Y. K.; Nakaguchi, Y.;
Nishibuchi, M.; Radu, S., Simultaneous detection of Salmonella spp., Salmonella Typhi and Salmonella
Typhimurium in sliced fruits using multiplex PCR. Food Control 2011, 22, (2), 337-342.
222. ISO, Microbiology of food and animal feeding stuffs -- Guidelines on preparation and
production of culture media -- Part 1: General guidelines on quality assurance for the preparation of
culture media in the laboratory In 2009; Vol. 11133-1:2009, p 23.
production of culture media -- Part 2: Practical guidelines on performance testing of culture media In
2003; Vol. 11133-2, p 27.
production of culture media -- Part 2: Practical guidelines on performance testing of culture media.
Amendment 1. In 1st ed.; 2011; Vol. 11133-2/ Amd 1:2011, p 27.
225. Mafu, A. A.; Pitre, M.; Sirois, S., Real-Time PCR as a Tool for Detection of Pathogenic
Bacteria on Contaminated Food Contact Surfaces by Using a Single Enrichment Medium. Journal of
Food Protection 2009, 72, (6), 1310-1314.
226. Wright, A. C.; Garrido, V.; Debuex, G.; Farrell-Evans, M.; Mudbidri, A. A.; Otwell, W. S.,
Evaluation of postharvest-processed oysters by using PCR-based most-probable-number enumeration
of Vibrio vulnificus bacteria. Applied and Environmental Microbiology 2007, 73, (22), 7477-7481.
227. Prendergast, D. M.; Lendrum, L.; Pearce, R.; Ball, C.; McLernon, J.; O'Grady, D.; Scott,
L.; Fanning, S.; Egan, J.; Gutierrez, M., Verocytotoxigenic Escherichia coli O157 in beef and sheep
abattoirs in Ireland and characterisation of isolates by Pulsed-Field Gel Electrophoresis and Multi-Locus
Variable Number of Tandem Repeat Analysis. International Journal of Food Microbiology 2011, 144,
(3), 519-527.
228. Drake, S. L.; DePaola, A.; Jaykus, L. A., An overview of Vibrio vulnificus and Vibrio
parahaemolyticus. Comprehensive Reviews in Food Science and Food Safety 2007, 6, (4), 120-144.
229. Rosche, T. M.; Yano, Y.; Oliver, J. D., A rapid and simple PCR analysis indicates there
are two subgroups of Vibrio vulnificus which correlate with clinical or environmental isolation.
Microbiology and Immunology 2005, 49, (4), 381-389.
230. Nandi, B.; Nandy, R. K.; Mukhopadhyay, S.; Nair, G. B.; Shimada, T.; Ghose, A. C., Rapid
method for species-specific identification of Vibrio cholerae using primers targeted to the gene of
outer membrane protein OmpW. Journal of Clinical Microbiology 2000, 38, (11), 4145-4151.
231. Rivera, I. N. G.; Chun, J.; Huq, A.; Sack, R. B.; Colwell, R. R., Genotypes associated with
virulence in environmental isolates of Vibrio cholerae. Applied and Environmental Microbiology 2001,
67, (6), 2421-2429.
232. Su, Y. C.; Liu, C. C., Vibrio parahaemolyticus: A concern of seafood safety. Food
Microbiology 2007, 24, (6), 549-558.
233. Rizvi, A. V.; Bej, A. K., Multiplexed real-time PCR amplification of tlh, tdh and trh
genes in Vibrio parahaemolyticus and its rapid detection in shellfish and Gulf of Mexico water. Antonie
Van Leeuwenhoek International Journal of General and Molecular Microbiology 2010, 98, (3), 279-290.
234. Cheng, C. M.; Van, K. T.; Lin, W.; Ruby, R. M., Interlaboratory Validation of a Real-Time
PCR 24-Hour Rapid Method for Detection of Salmonella in Foods. Journal of Food Protection 2009, 72,
(5), 945-951.
235. Rossmanith, P.; Mester, P.; Wagner, M.; Schoder, D., Demonstration of the effective
performance of a combined enrichment/real-time PCR method targeting the prfA gene of Listeria
monocytogenes by testing fresh naturally contaminated acid curd cheese. Letters in Applied
Microbiology 2010, 51, (4), 480-484.
236. Suo, B.; He, Y. P.; Tu, S. I.; Shi, X. M., A Multiplex Real-Time Polymerase Chain Reaction
for Simultaneous Detection of Salmonella spp., Escherichia coli O157, and Listeria monocytogenes in
Meat Products. Foodborne Pathogens and Disease 2010, 7, (6), 619-628.
237. Hoorfar, J.; Cook, N.; Malorny, B.; Wagner, M.; De Medici, D.; Abdulmawjood, A.;
Fach, P., Diagnostic PCR: Making internal amplification control mandatory. Journal of Applied
Microbiology 2004, 96, (2), 221-222.
238. Kawasaki, S.; Fratamico, P. M.; Horikoshi, N.; Okada, Y.; Takeshita, K.; Sameshima, T.;
Kawamoto, S., Multiplex Real-Time Polymerase Chain Reaction Assay for Simultaneous Detection and
168 Bibliografía
Quantification of Salmonella Species, Listeria monocytogenes, and Escherichia coli O157:H7 in Ground
Pork Samples. Foodborne Pathogens and Disease 2010, 7, (5), 549-554.
239. Anderson, A.; Pietsch, K.; Zucker, R.; Mayr, A.; Muller-Hohe, E.; Messelhausser, U.;
Sing, A.; Busch, U.; Huber, I., Validation of a Duplex Real-Time PCR for the Detection of Salmonella spp.
in Different Food Products. Food Analytical Methods 2011, 4, (3), 259-267.
240. Bhagwat, A. A., Rapid detection of Salmonella from vegetable rinse-water using real-
time PCR. Food Microbiology 2004, 21, (1), 73-78.
241. Vanegas, M. C.; Vasquez, E.; Martinez, A. J.; Rueda, A. M., Detection of Listeria
monocytogenes in raw whole milk for human consumption in Colombia by real-time PCR. Food Control
2009, 20, (4), 430-432.
242. McGuinness, S.; McCabe, E.; O'Regan, E.; Dolan, A.; Duffy, G.; Burgess, C.; Fanning, S.;
Barry, T.; O'Grady, J., Development and validation of a rapid real-time PCR based method for the
specific detection of Salmonella on fresh meat. Meat Science 2009, 83, (3), 555-562.
243. Kobayashi, H.; Kubota, J.; Fujihara, K.; Honjoh, K.; Ito, M.; Fujiki, N.; Nakabe, M.; Oda,
S.; Satoyama, T.; Takasu, K.; Nakanishi, H.; Miyamoto, T., Simultaneous Enrichment of Salmonella spp.,
Escherichia coli O157:H7, Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus, and Listeria
monocytogenes by Single Broth and Screening of the Pathogens by Multiplex Real-time PCR. Food
Science and Technology Research 2009, 15, (4), 427-438.
244. Martin, B.; Garriga, M.; Aymerich, T., Pre-PCR treatments as a key factor on the
probability of detection of Listeria monocytogenes and Salmonella in ready-to-eat meat products by
real-time PCR. Food Control 2012, 27, (1), 163-169.
169 Bibliografía

Aplicación de La PCR

Cargado por

Información del documento

Derechos de autor

Formatos disponibles

Compartir este documento

Compartir o incrustar documentos

Opciones para compartir

¿Le pareció útil este documento?

¿Este contenido es inapropiado?

Copyright:

Formatos disponibles

Aplicación de La PCR

Cargado por

Copyright:

Formatos disponibles

APLICACIÓN DE LA PCR EN TIEMPO REAL PARA

Alejandro Garrido Maestú

APLICACIÓN DE LA PCR EN TIEMPO REAL PARA LA

Memoria presentada por

Alejandro Garrido Maestú

Para optar al grado de

DOCTOR POR LA UNIVERSIDAD DE VIGO

Directora Directora Director Tutor

Que la Tesis Doctoral titulada: “Aplicación de la PCR en tiempo real para la

sido realizada bajo su codirección en ANFACO-CECOPESCA, y cumple las condiciones

Fdo. Ana García Cabado

Fdo. Alejandro Garrido Maestú

Que la Tesis Doctoral titulada: “Aplicación de la PCR en tiempo real para la

por lo que da su aprobación para la correspondiente lectura y defensa.

Fdo. María José Chapela Garrido

Fdo. Alejandro Garrido Maestú

Que la Tesis Doctoral titulada: “Aplicación de la PCR en tiempo real para la

Fdo. Juan Manuel Vieites Baptista de Sousa

Fdo. Alejandro Garrido Maestú

Quiero agradecer a Ana por introducirme en el mundo de la investigación.

Paula, Martiña y Mira por sus consejos, correcciones y colaboración en todo lo

A Belén, Elvira, Geles y Vicky, mis compañeras de batalla en el laboratorio que

A mi familia, que siempre ha estado a mi lado, incluso cuando no tenían muy

ADH: Arginina dehidrolasa.

Capítulo 1: Introducción ....................................................................................................1

1.2. Métodos de análisis utilizados en microbiología de los alimentos ..........................4

1.4. Patógenos alimentarios ...........................................................................................35

Capítulo 2: Objetivos .......................................................................................................45

3.1. Artículo 1 ..................................................................................................................46

Capítulo 4: Discusión .....................................................................................................145

4.1. Selección de patógenos y optimización de medios de cultivo ...............................145

Capítulo 5: Conclusiones ...............................................................................................155

Capítulo 6: Bibliografía ..................................................................................................157

1.1. Seguridad alimentaria en relación a los riesgos microbiológicos. Marco

Las zoonosis son enfermedades o infecciones que se producen en animales y que

centra el análisis de patógenos fundamentalmente en Salmonella spp. y Listeria

Tabla 1. Parámetros Microbiológicos contemplados en el Reglamento C.E. 2073/ 2005

Tabla 2. Brotes epidémicos recientes asociados a patógenos bacterianos

Microorganismo Año Localización Fuente Nº casos Nº fallecidos

Sin embargo, a pesar de las medidas de prevención y control tomadas, tanto en

1.2. Métodos de análisis utilizados en microbiología de los alimentos

En el este apartado se describen los principales métodos de análisis utilizados en

1.2.1. Métodos Clásicos o de cultivo

pruebas serológicas, así como la detección de determinados genes de

Figura 1. Esquema del método ISO para la detección de Salmonella spp.

Los diferentes métodos de microbiología clásica son económicos, proporcionan

parahaemolyticus, V. vulnificus y V. cholerae del resto de posibles interferentes

1.2.2. Métodos Moleculares

1.2.2.1. Métodos inmunológicos

adsorción entre antígeno y anticuerpo. Se pueden usar para detectar antígenos

1.2.2.1.1. Ensayo por inmuno-absorción ligado a enzimas (Enzyme-Linked

1.2.2.1.2. Ensayo de fluorescencia ligado a enzimas (Enzyme Linked Fluorescent Assay,

1.2.2.1.3. Inmunoprecipitación y aglutinación

1.2.2.1.4. Separación inmunomagnética

1.2.2.2. Métodos basados en la amplificación de ácidos nucleicos

1.2.2.2.1. Amplificación basada en la secuencia de ácidos nucleicos (Nucleic Acid

Figura 2. Representación esquemática de la técnica NASBA. Detección final del

 El primer cebador (P1) se une al ARN molde, permitiendo que la transcriptasa

células muertas. El producto de reacción de la técnica NASBA es principalmente ARN

1.2.2.2.2. Amplificación isotérmica mediada por lazo (Loop-mediated isothermal

Figura 3. Representación esquemática de la técnica LAMP. Imagen extraída de (3).

Desde su aparición se han ido desarrollando métodos para la detección de

1.2.2.2.3. Hibridación in situ fluorescente (Fluorescent In-Situ Hybridization, FISH)

detectar una única célula, en la práctica el límite de detección se encuentra en torno a