Documentos de Académico
Documentos de Profesional
Documentos de Cultura
Título
Autor/es
Director/es
Departamento
Agricultura y Alimentación
Curso Académico
Estudio del aire como vía de diseminación de microorganismos enológicos,
tesis doctoral
de María del Patrocinio Garijo Jiménez, dirigida por María Pilar Santamaría Aquilué y Ana
Rosa Gutiérrez Viguera (publicada por la Universidad de La Rioja), se difunde bajo una
Licencia
Creative Commons Reconocimiento-NoComercial-SinObraDerivada 3.0 Unported.
Permisos que vayan más allá de lo cubierto por esta licencia pueden solicitarse a los
titulares del copyright.
© El autor
© Universidad de La Rioja, Servicio de Publicaciones, 2014
publicaciones.unirioja.es
E-mail: publicaciones@unirioja.es
ESTUDIO DEL AIRE COMO VÍA DE
DISEMINACIÓN DE
MICROORGANISMOS ENOLÓGICOS
Las abajo firmantes, Dra. Pilar Santamaría Aquilué, Investigadora del Instituto de
Ciencias de la Vid y del Vino (ICVV) y la Dra. Ana Rosa Gutiérrez Viguera Profesora
Titular del Departamento de Agricultura y alimentación de la Universidad de La Rioja,
HACEN CONSTAR
Que el presente trabajo titulado: “Estudio del aire como vía de diseminación de
microorganismos enológicos”, que presenta Dña. MARIA DEL PATROCINIO
GARIJO JIMÉNEZ para optar al grado de Doctor por la Universidad de La Rioja, ha
sido realizado bajo nuestra dirección en el Centro de Investigación y Desarrollo
Tecnológico de La Rioja, y que todos los resultados obtenidos son fruto de
experimentos llevados a cabo por la doctoranda.
Para que conste y tenga los efectos oportunos, firmamos el presente certificado
Para mis directoras me faltan elogios y palabras. Sin Ana Rosa este trabajo
no hubiera sido posible, es su empuje y optimismo lo que hace que todo resulte
más fácil. ¡Qué placer poder trabajar contigo! Espero que aún nos queden muchos
años.
A Irene y Jorge
ABREVIATURAS ......................................................................................... I
CAPÍTULO 1
INTRODUCCIÓN ......................................................................................... 3
1.1.-La elaboración del vino........................................................................ 3
1.2.-Microorganismos asociados a la uva y a la vinificación .................... 7
1.2.1.-Levaduras....................................................................................... 8
1.2.2.-Bacterias lácticas............................................................................ 16
1.2.3.-Mohos ............................................................................................ 21
1.3.-Origen y diseminación de los microorganismos enológicos .............. 23
1.3.1.-Microorganismos en las uvas y diseminación en viñedo ............... 24
1.3.2.-Microorganismos de vinificación y su diseminación
en la bodega ................................................................................... 28
CAPÍTULO 2
OBJETIVOS .................................................................................................. 35
CAPÍTULO 3
i
3.1.1.1.-Primer Ensayo ..................................................................... 43
3.1.1.2.-Segundo Ensayo .................................................................. 44
3.1.1.3.-Tercer Ensayo ..................................................................... 46
3.1.2.-Muestreos de instalaciones ............................................................ 47
3.1.3.-Muestreos de racimos .................................................................... 48
3.1.4.-Muestreos durante las Fermentaciones Alcohólica
y Maloláctica ................................................................................ 48
3.1.4.1.-Primer Ensayo ..................................................................... 48
3.1.4.2.-Segundo Ensayo .................................................................. 49
3.2.-Procesamiento de las muestras ........................................................... 50
3.2.1.-Muestras de aire ............................................................................. 50
3.2.2.-Muestras de instalaciones .............................................................. 51
3.2.3.-Muestras de racimos ...................................................................... 51
3.2.4.-Muestras de depósitos en fermentación ......................................... 52
3.3.-Aislamiento y conservación de colonias de los microorganismos ..... 53
3.3.1.-Levaduras ...................................................................................... 54
3.3.2.-Bacterias lácticas ........................................................................... 54
3.3.3.-Mohos ............................................................................................ 54
3.4.-Identificación de las colonias aisladas ................................................ 54
3.4.1.-Identificación de levaduras ............................................................ 54
3.4.1.1.-Identificación de las especies de levaduras
mediante PCR_RFLP ...................................................................... 55
3.4.1.2.-Identificación de especies mediante
secuenciación del ADN ................................................................... 61
3.4.1.3.-Caracterización clonal de Saccharomyces cerevisiae
mediante análisis de restricción del ADNmt .................................... 63
3.4.2.-Identificación de Bacterias Lácticas ............................................... 66
3.4.2.1.-Identificación fenotípica de bacterias lácticas ..................... 66
ii
3.4.2.2.-Identificación de las bacterias lácticas mediante PCR ......... 69
3.4.2.3.-Identificación de bacterias lácticas mediante
secuenciación del ADN ................................................................... 71
3.4.2.4.-Tipificación de los clones de Oenococcus oeni mediante
electroforesis de campos pulsados (PFGE) ....................................... 72
3.4.3.-Identificación de mohos ................................................................. 78
3.6.-Medios de cultivo y disoluciones ......................................................... 80
3.6.1.-Disoluciones base .......................................................................... 80
3.6.2.-Disoluciones empleadas en el análisis del ADNmt ........................ 81
3.6.3.-Disoluciones empleadas en el análisis de campos pulsados ........... 81
3.6.4.-Medios para el aislamiento, conservación y crecimiento de levaduras 82
3.6.5.-Medios para de recuento y aislamiento de bacterias lácticas .......... 84
3.6.6.-Medios para aislamiento y recuento de mohos ............................... 84
CAPÍTULO 4
RESULTADOS .............................................................................................. 87
iii
4.2.2.- Levaduras presentes en las instalaciones.......................................... 102
4.3.- Estudio del aire como vía de diseminación de las bacterias lácticas
responsables de la fermentación maloláctica. .............................................. 113
.........................................................................................................................
CAPÍTULO 5
CAPÍTULO 6
iv
Presentación
Esta memoria de Tesis Doctoral se presenta en forma de compendio de
publicaciones científicas siguiendo la normativa de la Universidad de La Rioja
aprobada por Consejo de Gobierno el 22 de julio de 2005.
El objetivo de esta tesis fue estudiar el efecto del aire como vía de
diseminación de microorganismos enológicos, primero en la bodega y
posteriormente en el viñedo, centrándose tanto en los agentes de las fermentaciones
alcohólica y maloláctica, levaduras y bacterias lácticas, como en los mohos. De
este modo, se presentan tres artículos científicos. En el primero se estudió la
presencia de mohos, levaduras y bacterias lácticas en el aire de una bodega durante
la vinificación, y se compararon los clones de Saccharomyces cerevisiae aislados
en el aire con los del mosto/vino de los depósitos en fermentación. Este artículo se
completó con los resultados obtenidos acerca del estudio de las levaduras aisladas
en diferentes zonas de las instalaciones de la misma bodega.
I
Abreviaturas
l Litro
LSU Large subunit
M Molar
m Metro
min Minuto
mg Miligramo
ml Mililitro
mm Milímetro
mM Milimolar
MRS Man, Rogosa and Sharpe
N Normal
NMP Numero más probable
OTA Ocratoxina A
pb Pares de bases
rpm Revoluciones por minuto
PCR Polymerase Chain Reaction
PCR-RFLP PCR-Restriction Fragment Length Polymorphism
p/v Peso/volumen
PFGE Pulsed Field Gel Electrophoresis
s Segundo
SDS Sodio dodecil sulfato
sp especie
spp especies
SSU Small subunit
Tª Temperatura
II
Abreviaturas
TCA Tricloroanisol
TCF Triclorofenol
TE Tris EDTA
TSB Tryptone Soy Broth
UFC Unidades formadoras de colonias
U.R: Universidad de La Rioja
UV Ultravioleta
YPD Yeast Peptone Dextrose
µg Microgramo
µl Microlitro
µm Micra
Microorganismos
A. pullulans Aureobasidium pullulans
A. niger Aspergillus niger
K. apiculata Kloeckera apiculata
L. Lactobacillus
Ln. Leuconostoc
N.S. No-Saccharomyces
O. Oenococcus
P. Pediococcus
P. verrucosum Penicillium verrucosum
P. viridicatum Penicillium viridicatum
S. Saccharomyces
S. b. Saccharomyces bayanus
III
Capítulo 1
Introducción
Introducción
Una de las definiciones más completas que se pueden encontrar del vino es
la que ofrece la ley 24/2003, de 10 de julio, de la Viña y el Vino, según la cual “el
vino es el alimento natural obtenido exclusivamente por fermentación alcohólica,
total o parcial, de uva fresca, estrujada o no, de mosto de uva”.
3
Introducción
4
Introducción
COOH
COOH
Enzima
HO – C – H
maloláctica
HO – C – H + CO2
NAD+ Mn++
H–C–H
CH3
COOH
5
Introducción
Al igual que las levaduras en la FA, las bacterias lácticas son capaces de
metabolizar un número importante de sustancias que contiene el vino produciendo
numerosos metabolitos secundarios:
- Los aminoácidos del vino son utilizados por las bacterias lácticas
para la síntesis de proteínas, pero este metabolismo nitrogenado
puede también producir aminas biógenas y carbamato de etilo, que
pueden resultar perjudiciales para la salud humana.
6
Introducción
7
Introducción
1.2.1.- Levaduras
8
LEVADURAS
ASCOMICETOS BASIDIOMICETOS
DEUTEROMICETOS HEMIASCOMICETOS
10
Introducción
11
Introducción
lleva la uva, el proceso fermentativo pudiera llevarse a cabo. Por tanto, se pone de
manifiesto que es interesante conocer los microorganismos presentes en otros
medios, como son las instalaciones y el ambiente de la bodega.
12
Introducción
13
Introducción
pueden favorecer o perjudicar la calidad final del producto (Mas et al., 2004). Por
ello, aunque durante mucho tiempo fueron consideradas sin interés, e incluso
indeseables, desde hace varios años son objeto de numerosos estudios. Estas
levaduras No-Saccharomyces producen y excretan diferentes enzimas (proteasas,
lipasas, estearasas, carbohidrolasas, etc.) que pueden interaccionar con los sustratos
presentes en el medio mejorando algunas etapas del proceso de elaboración del
vino como son la maceración, filtración y clarificación, el aumento de rendimiento
y la extracción de color o las características del vino, especialmente el aroma. En
este contexto, y teniendo en cuenta que las enzimas procedentes de la uva son
relativamente escasas y con una actividad muy limitada y que la levadura vínica
por excelencia, S. cerevisiae, no es en general una productora destacable de
enzimas extracelulares, es importante estudiar la posibilidad de sacar el mayor
rendimiento a las enzimas producidas por las levaduras que intervienen en la
elaboración, ya que permitiría por un lado reducir el aporte enzimático exógeno, y
por otro mejorar el proceso y los atributos sensoriales del vino. (Strauss et al.,
2001; Maturano et al., 2012). En este sentido, muchos autores opinan que las
levaduras No-Saccharomyces pueden dar lugar a vinos caracterizados por aromas
más complejos y de mayor calidad (Soden et al., 2000; Bely et al., 2008; Viana et
al., 2008; Ciani et al., 2010; Zott et al., 2011). Así, Moreira et al. (2008) plantearon
que el crecimiento de levaduras apiculadas durante los primeros días de
fermentación no influía negativamente sobre la producción de alcoholes superiores
y compuestos azufrados, y aumentaba la producción de ésteres. Debido a ésto,
durante los últimos años son muchos los estudios llevados a cabo con coinóculos
de levaduras No-Saccharomyces (Hanseniaspora uvarum, Torulaspora
delbrueckii, Kluyveromyces thermotolerans, Pichia kluyveri), junto con
Saccharomyces cerevisiae, bajo diferentes condiciones de vinificación (Anfang et
al., 2009; Andorrá et al., 2010; Izquierdo et al., 2011; Azzolini et al., 2012). Los
efectos positivos de estas fermentaciones multiestarter han favorecido la selección
14
Introducción
15
Introducción
16
Introducción
las cepas (Hidalgo, 2011). Las principales especies de bacterias lácticas que se
encuentran en los mostos y en los vinos aparecen reflejadas en la tabla 2.
17
Introducción
18
Introducción
19
Introducción
20
Introducción
1.2.3.- Mohos
21
Introducción
sector de la elaboración del vino, puesto que son los responsables de la presencia
de Ocratoxina A (OTA) (Bellí et al., 2004; Soriano del Castillo, 2007) y de la
contaminación de los corchos de las botellas (Suárez et al., 2004).
22
Introducción
23
Introducción
24
Introducción
obtuvieron recuentos más altos de levaduras totales en las bayas en años lluviosos,
resultado contrario al obtenido por Comitini y Ciani (2006). En concordancia con
estos últimos autores, Rementería et al. (2003) detectaron una población de
levaduras más elevada en años cálidos y secos. Sin embargo, los estudios
realizados por Jolly et al. (2003) en Sudáfrica durante tres vendimias y en cuatro
regiones diferentes no pudieron establecer una relación entre las condiciones
climáticas de estas zonas y las especies de No-Saccharomyces encontradas.
Asimismo, Valero et al. (2005) tampoco encontraron ninguna correlación entre las
cepas de S. cerevisiae y las condiciones climáticas de los viñedos del Noroeste de
Portugal donde se realizó el estudio.
25
Introducción
que no se encuentra distribuida ni en todas las cepas ni en todos los granos de uva
(Török et al., 1996; Van der Westhuizen et al., 2000; Mercado et al., 2007). Por el
contrario, Schuller et al. (2005) obtuvieron resultados que claramente indicaban
que S. cerevisiae estaba presente en las uvas de un viñedo de la región de Vinho
Verde en un número suficientemente elevado como para conducir una
fermentación espontánea. Valero et al. (2005 y 2007) demostraron que la
diseminación de cepas comerciales de S. cerevisiae en el viñedo se ve favorecida
por el agua de escorrentía y se da en distancias cortas, llevándose a cabo por
diversos vectores como insectos, viento y otros. También demostraron que algunas
cepas de esta especie podían permanecer en el ecosistema del viñedo de un año a
otro.
26
Introducción
la superficie de las bayas y desarrollarse cuando las condiciones les sean más
favorables, lo que ocurre generalmente entre el periodo de envero a vendimia.
27
Introducción
Fugelsang et al. (2007) indicaron que las bacterias lácticas también están
presentes en el viñedo, pero que debido a sus necesidades nutricionales, su
densidad de población y la diversidad de especies es limitada (las uvas sanas
contienen menos de 103 UFC/g). Bae et al. (2006) también encontraron muy bajas
poblaciones de estos microorganismos en el viñedo y sólo las detectaron en uvas
dañadas. El agente típico de la FML, Oenococcus oeni, se ha aislado raramente de
uvas, probablemente porque al tratarse de una bacteria anaerobia (o semianaerobia)
y nutritivamente escrupulosa, es incapaz de competir con levaduras y bacterias
acéticas en las condiciones aeróbicas de las bayas. No se han encontrado
referencias respecto a la presencia de bacterias lácticas en el aire del viñedo. Sin
embargo, Yanagida et al. (2008) las encontraron en muestras de suelo de viñedo, lo
que indica que pueden llegar al aire adheridas a partículas de polvo o insectos,
como ya se ha visto que ocurre con las levaduras (Parle y Di Mena, 1966).
28
Introducción
Desde hace años, los bodegueros han venido observando que las primeras
fermentaciones espontáneas, tanto alcohólicas como malolácticas, que tienen lugar
en la bodega cada campaña, suelen ser más largas que las que suceden a
continuación (Peynaud, 1989). La razón podría deberse a que a medida que
transcurren los días de vendimia, el material de bodega se enriquece en levaduras, y
por lo tanto también los mostos o vendimias procesadas, produciéndose un
aumento de microorganismos en los primeros depósitos, su posterior diseminación
por la bodega y la llegada en gran cantidad a otros depósitos, por lo que las
fermentaciones posteriores se inician más rápidamente y transcurren a mayor
velocidad. Granchi et al. (2007), han sugerido que las cepas de S. cerevisiae que
dominan la fermentación del primer depósito de cada vendimia invaden el
ambiente de la bodega y producen una inoculación natural en las fermentaciones
siguientes. Este fenómeno también se observa en bodegas de nueva instalación,
donde el inicio de la fermentación de los primeros mostos es difícil.
29
Introducción
30
Introducción
31
Introducción
microbiológica del aire, para asegurar que los productos alimenticios permanezcan
seguros y sanos en todas las etapas de su proceso, está bien establecida en fábricas
de alimentos. Concentraciones de microorganismos de 100 a 10.000 UFC/m 3 en el
aire son bastante normales (Curiel et al., 2000).
32
Capítulo 2
Objetivos
Objetivos
35
Capítulo 3
Material y Métodos
Material y Métodos
39
Material y Métodos
En todas las muestras se estudiaron y tipificaron las bacterias lácticas (BL) presentes
y se compararon los clones de O. oeni presentes en ambos medios.
40
Material y Métodos
Glucosa-Agar (CGA) para levaduras, placas con Agar-Czapek para mohos y placas
con MRS-Agar modificado para bacterias lácticas.
41
Material y Métodos
42
Material y Métodos
43
Material y Métodos
44
Material y Métodos
45
Material y Métodos
Las muestras se recogieron en dos puntos próximos a dos cepas del viñedo
(Apdo. 3.1.1), durante dos años consecutivos. Se realizaron cinco muestreos cada
año, coincidiendo con las cuatro semanas previas a la vendimia, y un último en el
momento de la misma. Se tomaron por duplicado muestras de aire junto a las cepas
marcadas con medios de cultivo selectivos, específicos para levaduras y bacterias
lácticas. Los trabajos se iniciaron a primera hora de la mañana, tomándose datos de
temperatura, radiación, viento y lluvia a lo largo de todo el proceso.
46
Material y Métodos
Tabla 5.- Muestreos realizados en el aire del viñedo y condiciones climatológicas. Campaña
2008.
Semanas antes Condiciones meteorológicas medias
Fecha
de vendimia Tª Radiación Viento Lluvia
4 11/09 27ºC Soleado Ligero** No
3 19/09 23ºC Nublado No No
2 25/09 17ºC Nublado Ligero No
1 03/10 12ºC Nublado Si Ligera
0* 10/10 15ºC Soleado No No
* Momento de la vendimia. ** Ligero: débil y esporádico.
Tabla 6.- Muestreos realizados en el aire del viñedo y condiciones climatológicas. Campaña
2009.
Semanas antes Condiciones meteorológicas medias
Fecha
de vendimia Tª Radiación Viento Lluvia
4 27/08 33ºC Soleado Ligero ** No
3 03/09 31ºC Soleado Ligero No
2 10/09 27ºC Soleado Ligero No
1 17/09 20ºC Soleado No No
0* 24/09 22ºC Soleado No No
*Momento de la vendimia. **Ligero: débil y esporádico.
47
Material y Métodos
48
Material y Métodos
49
Material y Métodos
Donde:
50
Material y Métodos
Los tubos con medio TSB que contenían los hisopos procedentes de la toma
de muestras de las instalaciones se incubaron durante 3 h a temperatura ambiente.
Posteriormente, se sembraron en superficie 100 µl de este medio en placas Petri con
CGA y se incubaron a 25ºC durante 48 h. Al cabo de este tiempo se realizó el
recuento de las colonias de levaduras presentes en cada uno de los 10 puntos elegidos
donde hubo crecimiento, expresándose el resultado como UFC/cm 2.
51
Material y Métodos
52
Material y Métodos
3.3.1.- Levaduras
Cada colonia fue reaislada por agotamiento de estría en placa Petri con medio
YPD (Yeast Peptone Dextrose) para asegurar la presencia de un solo microorganismo
(cultivo puro). Una colonia de cada placa se creció en YPD durante 24-48 h a 28ºC
para obtener cultivo suficiente para su posterior conservación.
53
Material y Métodos
3.3.3.- Mohos
54
Material y Métodos
La región que incluye el gen 5.8S y los dos ITS se conoce como región ITS y
se caracteriza por poseer una zona altamente conservada (5.8S) y otra zona variable
(los ITS) (Fig. 5).
55
Material y Métodos
Los cebadores empleados para la reacción de PCR en la región ITS son los
mismos para más de 500 especies de levaduras, por lo que las diferencias se
establecen por el diferente tamaño del amplificado (Pulvirenti et al., 2003).
NTS NTS
ETS ITS1 ITS2
ETS
56
Material y Métodos
MgCl2 50 mM (Bioline) 3 µl 3 mM
ADN 10 µl -
57
Material y Métodos
Fragmento amplificado
Cebadores (secuencia 5´ → 3´) Condiciones de amplificación
(pb)
SuRE/Cut buffer H, M ó L 1 µl
Producto de PCR 5 µl
58
Material y Métodos
59
Material y Métodos
1 2 3 4 5 6 7 8 9 10 11 12 14 15 18 19 20
1000 pb
100 pb
Figura 6.- Ejemplo de electroforesis en gel de agarosa de los amplificados de PCR de varias
especies. Carriles 1 y 20 marcador de 100 pb (Hyperlader IV).Carriles 2, 3, 4, 7 y 8 producto
de PCR de 585 pb. Carriles 5, 6, 9 y 10 producto de PCR de 800 pb. Carriles 11, 12, 14 y 15
producto de PCR de 400 pb. Carril 18 producto de PCR de 650 pb. Carril 19 control
negativo.
60
Material y Métodos
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
1000 pb
100 pb
Las colonias cuyos perfiles no fue posible identificar por el método anterior,
se identificaron mediante secuenciación. Para ello, se amplificó mediante PCR el
dominio D1/D2 con los cebadores y condiciones descritos por Kurtzman et al. (1998)
y que se detallan en la Tabla 10.
61
Material y Métodos
Tabla 10.- Cebadores y condiciones de la PCR universal de levaduras (Kurtzman et al., 1998).
Fragmento Condiciones de
Cebadores (secuencia 5´ → 3´)
amplificado (pb) amplificación
CGATTAGATACCCTGGTAGTCC
580 94ºC 1 min
NL4 52ºC 45 s 36 ciclos
72ºC 2 min
TCGTTGCGGGACTTAACCCAAC
D1/D2 D1/D2
62
Material y Métodos
Las cepas del género Saccharomyces, es decir las que produjeron un resultado
negativo en el test de Agar-Lisina, se identificaron a nivel de especie y clon mediante
técnicas de biología molecular. Se utilizó el análisis de restricción del ADN
mitocondrial (ADNmt) que permite la identificación de clones de Saccharomyces
cerevisiae, mediante determinación de su perfil genético.
A) Preparación de la muestra
63
Material y Métodos
64
Material y Métodos
El marcador de peso molecular utilizado en todos los geles fue el ADN del
fago λ, digerido λcon Hind λIII.
65
Material y Métodos
λ λ Clones S. cerevisiae λ
Tinción Gram.
66
Material y Métodos
67
Material y Métodos
Estudio morfológico
Oenococcus
Pediococcus
68
Material y Métodos
0 100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500 pb
V1 V2 V3 V4 V5 V6 V7 V8 V9
69
Material y Métodos
CGATTAGATACCCTGGTAGTCC 94ºC 30 s
320
60ºC 45 s 32 ciclos
rrs2
72ºC 2 min
TCGTTGCGGGACTTAACCCAAC
320 pb
320 pb
Figura 12.- Electroforesis en gel de agarosa de los amplificados de PCR universal de BL.
70
Material y Métodos
Tabla 12.- Cebadores de PCR empleados para la identificación de la especie Oenococcus oeni
y condiciones de amplificación (Zapparoli et al., 1998).
Fragmento
Cebadores (secuencia 5´ → 3´) amplificado Condiciones de amplificación
(pb)
94ºC 2 min 1 ciclo
Lo-1
TAATGTGGTTCTTGAGGAGAAAAT 94ºC 25 s
1023
64ºC 2 min 30 ciclos
Lo-2
72ºC 2 min
ATCATCGTCAAACAAGAGGCCTT
En todos los casos se incluyó una muestra control positivo y una muestra
control negativo (con cebadores y sin ADN) para asegurar el buen funcionamiento de
la técnica.
71
Material y Métodos
72
Material y Métodos
orientarse, de modo que en un campo eléctrico pulsado se retardan más las moléculas
grandes y avanzan más rápido las moléculas pequeñas. En el proceso de "reptación"
las moléculas grandes avanzan más despacio que las moléculas más pequeñas y se
separan en el campo eléctrico "pulsado", es decir, que es activo y desaparece
alternativamente en pulsos, y que además puede cambiar su orientación (N-S-E-O y
con distintos ángulos). En nuestro caso se utilizó el sistema CHEF (Clamped
Homogeneous Electric Field Electrophoresis) que consta de 24 electrodos en
disposición hexagonal. Entre ellos forman ángulos de 60º (resultante de 120º). Se
establece un gradiente de voltaje y las trayectorias de las moléculas de ADN son
rectas (Fig. 13).
73
Material y Métodos
Los pasos previos para la extracción del ADN genómico completo de estas
bacterias son:
A) Preparación de la muestra
74
Material y Métodos
Después de los lavados el inserto, cortado en una pieza del tamaño del pocillo
(1-2 mm), se colocó en un tubo eppendorf al que se adicionaron 100 µl del tampón
del enzima, manteniéndose durante 20 min a Tª ambiente.
75
Material y Métodos
El gel se tiñó en una solución de bromuro de etidio 0.5 µg/ml durante 15 min
y se visualizó, analizó y fotografió en el equipo Image Store 5000 (UVP) (BIO-RAD)
con el programa Quantity One. En ocasiones los resultados mejoraron si el gel se
mantiene en agua destilada con agitación suave durante 3 h aproximadamente (Fig.
14).
76
Material y Métodos
77
Material y Métodos
78
Material y Métodos
79
Material y Métodos
Tris HCl 1 M, pH 8
Tampón TBE 5x
80
Material y Métodos
81
Material y Métodos
82
Material y Métodos
83
Material y Métodos
84
Capítulo 4
Resultados
4.1
ESTUDIO DE LA PRESENCIA DE MOHOS, LEVADURAS
Y BACTERIAS EN EL AIRE DE UNA BODEGA
DURANTE LA VINIFICACIÓN.
Resumen
Desde hace años, los bodegueros han venido observando que las primeras
fermentaciones espontáneas que tienen lugar en la bodega cada campaña suelen ser
más largas que las que suceden a continuación. La razón podría deberse al
incremento de microorganismos que se produce en el primer depósito y su
posterior diseminación por la bodega. En este sentido, algunos autores han sugerido
que las cepas de Saccharomyces cerevisiae que dominan la fermentación del
primer depósito de cada vendimia invaden el ambiente de la bodega y producen
una inoculación natural en las fermentaciones siguientes. La diseminación de los
microorganismos en el interior de la bodega tiene lugar por la maquinaria e
instrumental de la misma, los operarios, los insectos y… probablemente el aire.
89
4.1 Resultados
90
4.1 Resultados
91
International Journal of Food Microbiology 125 (2008) 141–145
The occurrence of fungi, yeasts and bacteria in the air of a Spanish winery
during vintage
Patrocinio Garijo a, Pilar Santamaría a, Rosa López a, Susana Sanz b, Carmen Olarte b, Ana Rosa Gutiérrez b,⁎
a
Servicio de Investigación y Desarrollo Tecnológico de La Rioja (CIDA). Ctra. de Mendavia-Logroño, NA 134, km. 88, 26071 Logroño, La Rioja, Spain
b
Departamento de Agricultura y Alimentación (CCT), Universidad de La Rioja. C/Madre de Dios, 51 26006 Logroño, La Rioja, Spain
A R T I C L E I N F O A B S T R A C T
Article history: This research studies the presence of microorganisms of enological interest (yeasts, bacteria and molds) and
Received 23 October 2007 their evolution in the air of a wine cellar. The samples were taken throughout the winemaking campaign
Received in revised form 20 February 2008 (September–December) in a winery of the D.O.Ca. Rioja, Spain. They were collected using an airIDEAL
Accepted 24 March 2008
atmosphere sampler from Biomerieux. For the isolation, specific selective media were used for each group of
microorganisms. The results obtained indicate that the presence in the winery air of the various different
Keywords:
Yeasts
microorganisms studied is directly related to the winemaking processes that are taking place in the winery.
Lactic bacteria Thus, the number of molds present decreases once grapes have ceased to be brought into the winery. The
Molds maximum number of yeasts in the air is found when all the vats in the cellar are fermenting, while the lactic
Air bacteria are not detected until the first malolactic fermentation begins. The species of yeasts and molds
Winery identified are also related to the winemaking processes. The coincidence of strains of Saccharomyces
cerevisiae among those present in the vats during alcoholic fermentation and those isolated from the air,
confirms the role of the latter as a transmitter of microorganisms.
© 2008 Elsevier B.V. All rights reserved.
1. Introduction must and, if the environmental conditions allow, begin to multiply and
ferment.
Winemaking is a process in which a series of complex micro- Molds are ubiquitous, with various genera commonly found on
biological transformations take place, involving interactions between grapes (Aspergillus, Botrytis and Penicillium), and to a lesser extent
yeasts, bacteria and filamentous fungi. The conversion of must into Phythophthora, Moniliella, Alternaria and Cladosporium (Rosa et al.,
wine occurs through alcoholic fermentation (AF), a process performed 2002). Molds are also ubiquitous inside wineries and are present on
by yeasts. This initial transformation is followed by what is known as surfaces and in the air (Donnelly, 1977). The yeasts associated with
malolactic fermentation (MLF), caused by lactic bacteria. Both vinification can be grouped into two categories: Saccharomyces and
microbiological processes make an essential contribution to the final non-Saccharomyces. The first of these groups includes yeasts belong-
quality of the product. The origin of these microorganisms and the ing to the Saccharomyces genus and these are the main agents
way in which they get into the must is a question which has been responsible for fermentation (Beltrán et al., 2002). The yeasts get onto
debated for some time (see for example the studies carried out by the grapes through the effects of wind dispersal and via insects
Peynaud and Domercq on microorganisms in the winery environment (Carrascosa et al., 2005). The microbial load of the grapes entering the
by Peynaud and Domercq, 1956, 1961) but nowadays it is accepted that winery is almost exclusively composed of non-Saccharomyces yeasts,
the yeasts and bacteria which take part in the fermentation processes so the inoculation of musts with Saccharomyces mainly occurs through
have two possible sources: the grapes and the material in the winery the winery equipment (Pretorius, 2000). Lactic bacteria have been
environment (Fleet and Heard, 1993; Mortimer and Polsinelli, 1999). isolated from vine leaves, grapes, winery equipment, barrels, etc (Bae
The grapes which come into the winery have an important population et al., 2006). This means that they are present during all stages of
of microbes adhered to the bloom, made up of yeasts, bacteria and vinification and, like the yeasts, enter with the grapes and remain in
molds. But the winery equipment (stemmer, crusher, pipework, vats, the winery equipment after MLF (Fugelsang and Edwards, 2007).
etc.) also contribute microorganisms and thus, as the must comes into For many years, winemakers have found that the first spontaneous
contact with the different winery equipment, the yeasts, bacteria and fermentations (alcoholic and malolactic) carried out on each harvest
molds which have been in contact with these surfaces pass into the at the wineries take longer than subsequent ones (Peynaud, 1989). The
reason would be due to the increase in microorganisms which occurs
in the first vat, and in their dispersal around the cellar and arrival in
⁎ Corresponding author. Tel.: +34 941299727; fax: +34 941299721. large quantities in other vats in which the subsequent fermentations
E-mail address: ana-rosa.gutierrez@unirioja.es (A.R. Gutiérrez). take place, and which would start up more quickly. Recently, Granchi,
0168-1605/$ – see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2008.03.014
142 P. Garijo et al. / International Journal of Food Microbiology 125 (2008) 141–145
Augruso, Ganucci, and Vicenzini (2007), have suggested that Sac- the campaign were analyzed. The aim of the sampling was to compare
charomyces cerevisiae which dominate the fermentation of the first vat the microorganisms present at the same time in both media. The wine
of each harvest invade the winery environment and produce a natural was fermented in 25,000-l stainless steel vats at a controlled
inoculation in the subsequent fermentations. The dispersal of the temperature of 28 °C. The fermentation processes analyzed were:
microorganisms in the winery occurs through the machinery, tools, the first fermentation of the campaign, vatted on 2 October, another
insects and probably the air. midway through the period, vatted on 9 October and the final
The aim of the present work is to study the presence and evolution fermentation of the year, vatted on 16 October. The three spontaneous
of various types of winemaking microorganisms (yeasts, bacteria and fermentations were sampled at three different stages: 24 h after
molds) in the air of a winery during the period of vinification for the vatting, vigorous or tumultuous fermentation and end of fermenta-
2006 campaign. In the recent literature consulted, only Connell et al. tion. The collection of colonies was considered to be representative of
(2002), have used the analysis of air in a winery for a study of the the total yeast population (Santamaría et al., 2007), and it was in line
presence of microorganisms and they found Brettanomyces yeasts in with previous studies (Santamaría et al., 2005). All samples were
air samples taken from different parts of a commercial wine cellar. collected in sterile bottles and taken to the laboratory for processing.
Previously, Donnelly (1977) used this approach in a winery bottling
room. However, the analysis of the air is common in other food 2.2. Microbial analyses
industries (Salustiano et al., 2003), primarily in the aseptic packaging
of food, where the presence of microorganisms in the air is a source of The plates obtained from the air sampling were transferred to the
contamination and spoilage of foodstuffs. The need to control the laboratory and incubated in the appropriate conditions for the growth
microbiological quality of the air to ensure that food products remain of each microorganism (incubator at 25 °C for 48 h for yeasts, cool
safe and wholesome throughout their shelf life is well established in store at 20 °C for 7 days for molds, and anaerobiosis at 30 °C for
food factories, because air carries many microorganisms. Concentra- 10 days in the case of lactic bacteria). Some diphenyl crystals
tions of 100–10,000 microorganisms per cubic meter are quite normal (approximately 100 mg per plate)(Panreac Química SA, Barcelona,
(Curiel et al., 2000). Spain), were added to the yeast and bacteria plates in order to impede
the development of mold. After the incubation period, the number of
2. Materials and methods each type of microorganism was counted. From the two volumes of air
samples at any given moment, the one chosen for the count was that
2.1. Sample collection in which the plates contained less than 100 CFU (according to
manufacturer's instructions). The result of this count was expressed as
The research was carried out during the months of September– the average of the number obtained in the two repeat samples
December 2006 in a winery situated in the village of Tudelilla (La analyzed (CFU). Subsequently, this value was converted into the most
Rioja, Spain). Only red wines are made in this winery and all the probable number of microorganisms collected per plate (MPN). The
fermentation processes, both alcoholic and malolactic are always MPN value is calculated from the CFU count, using Feller's law:
spontaneous. Sampling of the winery air began on 27 September, MPN = N · (1/N + 1/N − 1 + 1/N − 2 + …….. + 1/N − CFU + 1). A reading and
5 days before the first grapes were brought into the cellar (which statistical correction table is used to convert the number of CFU to
happened on 2 October), and ended on 19 December, 1 month after MPN (included in the equipment's instruction manual). This statistical
the last malolactic fermentation was complete. In total, 13 air samples correction corresponds to the random passing of microorganisms
were taken in the winery (27 September; 2, 5, 9, 11, 16, 20, 24, 31 through the orifices of the grid. In order to determine the most
October; 8, 14, 28 November and 19 December). As can be seen, most probable number of microorganisms collected per cubic meter of air
of the samples were taken during the month of October coinciding (MPN/m3), the most probable number of microorganisms collected
with grape reception into the winery and alcoholic and malolactic per plate (MPN collected) was multiplied by 1000 and divided by the
fermentation. volume of air sampled in liters. In every plate with yeasts, ten colonies
Air samples were taken using the airIDEAL 3P air sampler from were randomly selected and stored in tubes with malt agar for later
BioMérieux, an impaction aerobiocollector used to detect the analysis.
presence of viable microorganisms in the environment to be tested Samples collected in sterile bottles during spontaneous alcoholic
by precise sampling of a given volume of air. Air is taken up with a fermentations for isolation of yeasts, were processed as follows: serial
turbine through a grid surface. The acceleration of airflow results in dilutions were carried out and the samples were seeded onto plates
the impaction of airborne microorganisms on the agar. Passage of the containing a chloramphenicol glucose agar medium. The plates were
air through the grid filters out particles, thereby facilitating the incubated at 25 °C for 48 h. Plates containing between 30 and 300
enumeration of CFU (colony forming units) after incubation of the yeast colonies were examined; ten colonies from each sample were
medium. randomly selected (10 from the start of fermentation, 10 from vigorous
An analysis was performed for the presence in the air of three types fermentation and 10 from the end of fermentation), making a total of
of winemaking microorganisms: yeasts, lactic bacteria and molds. All 30 colonies for each tank. The colonies chosen were stored in tubes
the samples were taken from the same point in the winery, located in with malt agar for later analysis.
the middle of the winemaking area. The sampler was placed on a All the colonies of yeasts isolated both in the air and in
platform 1 m above the ground. The study of each of the microorgan- fermentations were later seeded onto Petri plates containing Lysine
isms was made using petri dishes with specific selective media for Agar Medium (Scharlau Microbiology, Barcelona, Spain). The growth
each one: Cloramphenicol Glucose Agar for yeasts (Biokar Diagnostics, in these dishes allowed us to distinguish between Saccharomyces and
France), Agar Czapek (Scharlau Microbiology, Barcelona, Spain) for non-Saccharomyces yeasts, since only the latter are capable of growing
molds and modified MRS-Agar (Scharlau Microbiology, Barcelona, in such a medium.
Spain) for lactic bacteria. The volume of air analyzed varied between Individual isolates of the Saccharomyces genus, isolated both in the
20 and 100 l depending on the microorganism under study and of the air and in spontaneous fermentations, were identified by mithochon-
stage in the vinification process. In each sampling, two different drial DNA (mtDNA) restriction analysis. The Restriction Fragment
volumes of air were analyzed in duplicate for each microorganism. Length Polymorphism (RFLP) of mithochondrial DNA was used for
Simultaneously with the analysis of yeasts in the air, the distinguishing between strains of S. cerevisiae (Pulvirenti and Giudici,
indigenous yeasts which produced three of the eight spontaneous 2003). Yeast cells were grown overnight in a culture of 5 mL YEPD (1%
alcoholic fermentations carried out in the winery during the whole of yeast extract, 2% peptone, 2% glucose) (Cultimed, Panreac Química
P. Garijo et al. / International Journal of Food Microbiology 125 (2008) 141–145 143
S.A., Barcelona, Spain). DNA extraction and mtDNA restriction patterns (27 September) and on the first day of reception of grapes (2 October),
were determined by the methodology described by Querol et al. no yeasts were found in the air in the winemaking area. The maximum
(1992). The DNA of all the colonies was digested with the restriction number of yeasts was found when most of the vats in the winery were
endonuclease AluI, in accordance with the supplier's instructions fermenting (20 October), only to gradually decrease afterwards until
(Boehringer Mannheim, Mannheim, Germany). The restriction frag- they totally disappeared. For their part, the lactic bacteria were absent
ments were separated by electrophoresis (BioRad, Hercules, CA:DNA from the winery air until after the start of the first malolactic
Sub Cell, Segrate, Italy) in 1% agarose gels (Agarose MP, Roche fermentation (16 October), and rapidly disappeared from the air once
Diagnostics, GmbH, Mannheim, Germany) in a 0.5 × TBE buffer (45 mM this fermentation was complete in the last tank (14 November). These
Tris–borate, 1 mM EDTA, pH 8) (Sigma, St. Louis, USA.) and visualized data are in accord with Curiel et al. (2000), who indicated that the
on a UV transilluminator after ethidium bromide (5 μg/mL) staining concentration of microorganisms in food factories differs according to
for 10 min. Those strains which proved identical in this digestion were season and location. In agricultural areas during harvesting, the
compared again using the RsaI enzyme for the digestion. concentration of spores of bacteria and molds on the outside can be
On the mold plates, 10 colonies were randomly selected and grown extremely high, close to a billion per cubic meter. In enclosed spaces,
on plates with Agar Czapek until their later identification. Molds are the concentration usually varies less, between several hundred and a
filamentous fungi that are classified based on the morphology of thousand per cubic meter.
asexual or vegetative mycelial elements and their spore structures So as it seems clear that the source of the molds in the winery air
(Samson et al., 1995). Taxonomic identification of all isolates was during the harvesting period is basically the grapes, the presence of
achieved through macroscopic and microscopic observation in yeasts and lactic bacteria in the air during the same period seems to be
accordance with guidelines published for each genus. due to their projection from the tanks in which they are developing in
large numbers. Although both microorganisms (yeasts and lactic
3. Results and discussion bacteria) reach similar levels of population in the tanks during
fermentation (106–108 CFU/ml) (Carrascosa et al., 2005), the number
3.1. Evolution of microbial populations of yeasts detected in the air during the AF phase is much greater than
the number of bacteria found during MLF (Fig. 1). This fact could be
In general terms, the presence in the air of the three types of explained by the greater amount of CO2 given off in alcoholic
microorganisms associated with grapes and vinification, increases in fermentation, and by the processes carried out on the content of the
the winery atmosphere during harvest time (Fig. 1). The quantitatively vats during this (racking off, pumping over, pressing). These two
most abundant microorganisms in the winery air were molds, factors (CO2 released and processes in the vats) would suppose a
ubiquitous microorganisms which form part of any ecosystem. The greater degree of release of yeasts into the atmosphere than in the
yeasts and bacteria were found in a much smaller quantity, with their case of lactic bacteria.
presence limited to the period of time during which the fermentation The survival of the microorganisms and their subsequent growth is
processes induced by these microorganisms (alcoholic and malolactic closely related to environmental conditions such as temperature,
fermentation) were actually taking place. This data suggests that the humidity, presence of nutrients, etc. The air itself does not permit
yeasts and bacteria which were developing in the vats from the microbes to develop and only acts as a support medium or carrier until
components of the must or of the wine passed into the air, that is, that the microorganisms fall and are deposited on the surrounding
there was an exchange between the liquid medium in fermentation surfaces. The period of time during which the microorganisms remain
(must/wine) and the gaseous one (air). in the air is focused, then, in the period covering projection and
The results obtained indicated that the presence in the air of the transport, and afterwards they are rapidly deposited. These results
various microorganisms studied was directly related to the wine- coincide with the ones given in a generic form for food industries by
making processes that were taking place in the winery. As can be seen Curiel et al. (2000). They report that microorganisms can travel
in Fig. 1, the number of molds existing in the winery before the start of through the air in three ways: adhering to a dust particle, adhering to a
the campaign (sample of 27 September) increased to levels of above droplet or as a single particle. Most vegetative bacteria die rapidly (in
10,000 MPN/m3 throughout the period of reception of grapes (2 seconds) in dry air, but bacterial or fungal spores can survive. The
October to 16 October) drastically diminishing from then on, when the sedimentation rate of microorganisms, is also important as it
majority of the vats were already in fermentation. The presence of determines the rate of microbial recontamination of products or
yeasts in the air was only detected after alcoholic fermentation began equipment during the time of exposure.
in the first vat. Beforehand, in the samples taken in the empty winery
3.2. Molds
Yeast strain Air Tank Yeast strain Air Tank Yeast strain Air Tank
3.3. Yeasts
Ia 50 – Ib 30 – Ic 20 –
IIa 50 – IIb 10 – IIc 10 –
The yeasts isolated from the air belonged to both the Saccharo- IIIa – 10 IIIb 10 10 IIIc 20 10
myces genus and the non-Saccharomyces group (Fig. 3). The presence IVa – 10 IVb 10 – IVc 10 –
in the air of Saccharomyces yeasts was detected between 5 October Va – 10 Vb 10 10 Vc 10 10
VIa – 10 VIb 10 – VIc 10 –
VIIa – 10 VIIb 10 20 VIIc 10 20
VIIIa – 10 VIIIb 10 – VIIIc 10 –
IXa – 20 IXb – 30 IXc – 10
Xa – 20 Xb – 10 Xc – 10
XIb – 10 XIc – 10
XIIb – 10 XIIc – 10
XIIIc – 10
AF final
Yeast strain Air Tank Yeast strain Air Tank Yeast strain Air Tank
projected outside the vats to a lesser extent, and this would explain winery (Tudelilla, La Rioja, Spain) who allowed us the use of their
why they were not detected in the air during the period of greatest installations, equipment and wines for the study. We also thank Ian
fermentative activity in the winery (9 October to 20 October), despite Thomas for correcting the English of the manuscript.
being present at the beginning of fermentation in all the vats. The ratio
of Saccharomyces/non-Saccharomyces yeasts in each vat contributes to References
the chemical composition and the sensory characteristics of the wine
Abrunhosa, L., Pasterson, R.R.M., Kozakiewicz, Z., Lima, N., Venâncio, A., 2001.
obtained, clearly affecting its quality (Jolly et al., 2003).
Mycotoxin production from fungi isolated from grapes. Letters in Applied
Comparing the strains of S. cerevisiae isolated on the same date in Microbiology 32, 240–242.
the air and inside the fermentation vats (Table 1), various common Bae, S., Fleet, G.H., Heard, G.M., 2006. Lactic acid bacteria associated with wine grapes
from several Australian vineyards. Journal of Applied Microbiology 100 (4),
clones were found in both media, which confirmed that there is an
712–727.
exchange of microorganisms between the fermentation tanks and the Beltrán, G., Torija, M.J., Novo, M., Ferrer, N., Poblet, M., Guillamón, J.M., 2002. Analysis of
air. In tank 1 during the vigorous fermentation phase, no common yeast populations during alcoholic fermentation: a six year follow-up study.
clones were observed between the media. This could be due to the fact Systematic and Applied Microbiology 25, 287–293.
Carrascosa, A.V., Muñoz, R., González, R., 2005. Microbiología del Vino. AMV, Madrid,
that on the date of sampling (5 October), the presence of Saccharo- España.
myces yeasts in the air was still low (Fig. 3), as this was the first vat in Combina, M., Mercado, L., Borgo, P., Elia, A., Jofré, V., Ganga, A., Martínez, C., Catania, C.,
the winery to begin fermentation. Thus, only two different S. cerevisiae 2005. Yeasts associated to Malbec grape berries from Mendoza, Argentina. Journal
of Applied Microbiology 98 (5), 1055–1062.
clones were found in the air, and neither of these coincided with the 8 Connell, L., Stender, H., Edwards, C.G., 2002. Rapid detection of Brettanomyces from
different clones of this species detected in the fermentation vat. But winery air samples based on peptide nucleic acid analysis. American Journal of
after this time had passed, when the alcoholic fermentation had Enology and Viticulture 53, 322–324.
Curiel, G.J., Van Eijk, H.M.J., Lelieveld, H.L.M., 2000. Risk and control of airborne
become more widespread in the whole winery, and was coming to an contamination. In: Robinson, R.K., Butt, C.A., Patel, P.D. (Eds.), Encyclopedia of Food
end in the first vat, common clones were already detected between Microbiology. Academic Press, London, pp. 1816–1822.
the air and the vats. Thus, at the end of alcoholic fermentation in the Donnelly, D.M., 1977. Airborne microbial contamination in a winery bottling room.
American Journal of Enology and Viticulture 28, 176–181.
first vat (9 October), clone XVIa appeared in both media. Clones IIIb, Vb
Esteban, A., Abarca, M.L., Bragulat, M.R., Cabañes, F.J., 2004. Effects of temperature and
and VIIb appeared in both media during vigorous fermentation in tank incubation time on production of ochratoxin A by black aspergili. Research in
2, and XIVb did so towards the end of this phase. Finally, in tank 3, Microbiology 155, 861–866.
Fleet, G.H., Heard, G.M., 1993. Yeast: growth during fermentation. In: Fleet, G.H. (Ed.),
clones IIIc, Vc and VIIc in vigorous fermentation and IVc and XVIIc at
Wine Microbiology and Biotechnology. Harwood Academic Publishers, Switzer-
the end, were also present in both the air and the tanks. The land, pp. 27–54.
conclusion which can be drawn from these data is that there was an Fugelsang, K.C., Edwards, C.G., 2007. Wine Microbiology. Practical Applications and
exchange of microorganisms/strains between the liquid medium in Procedures. Springer Science+Business Media, LLC, New York.
Granchi, L., Augruso, S., Ganucci, D., Vicenzini, M., 2007. Biodiversité genomique de
fermentation and the gaseous one (the air), which could indicate that Saccharomyces cerevisiae pendant la fermentation spontanée du vin conditionnée
the air in itself could be an as yet unstudied means for the dispersal of par le progresión de la vendage dans la cave. Proceedings XXXth OIV World
microorganisms within the winery and for the inoculation of tanks, in Congress, Budapest.
Jolly, N.P., Augustyn, O.P.H., Pretorius, I.S., 2003. The occurrence of non-Saccharomyces
addition to the ones already known (insects, tools). Donnelly (1977), cerevisiae yeast species over three vintages in four vineyards and grape musts from
adapted a filtration air-sampling method to determine the extent and four production regions of the western cape, South Africa. South African Journal of
kinds of airborne microorganisms in a large bottling winery. Different Enology and Viticulture 24 (2), 35–42.
Leong, S.L., 2007. Wine and fungi—implications of vineyard infections. In: Dyjksterhuis,
sources contributed the majority of the airborne organisms which in J., Samson, R.A. (Eds.), Food Mycology. A Multifaceted Approach to Fungi and Food.
turn are the most likely to cause wine contamination at bottling. CRC Press, Boca Raton, Florida, USA.
Something similar could happen in the vinification area in the cellar. Mortimer, R., Polsinelli, M., 1999. On the origin of wine yeast. Research in Microbiology
150, 199–204.
However, in the recent bibliography consulted, no similar data
Peynaud, E., 1989. Enología Práctica. Conocimiento y elaboración del vino. Ed. Mundi
taken in wineries were found which would allow us to compare the Prensa, Madrid, pp. 122.
results of this study, so this could be the start of a new line of research Peynaud, E., Domercq, S., 1956. Sur les Brettanomyces isolés de raisins et de vins. Archiv
fur Mikrobiologie 24 (3), 266–280.
for the winemaking industry.
Peynaud, E., Domercq, S., 1961. Presence demontrée de bacteries lactiques sur les raisins
murs. Comptes rendus hebdomadaires des seances de l'academie des sciences 252
4. Conclusions (21), 3343.
Pretorius, I.S., 2000. Tailoring wine yeast for the new millennium: novel approaches to
the ancient art of winemaking. Yeast 16, 675–729.
The results of this study suggest that the microbial load of the air at Pulvirenti, A., Giudici, P., 2003. Identification of yeasts by molecular techniques. Bulletin
any given time seems to be indicative of the microorganisms which de l' O.I.V. 869–870, 635–649.
are acting in the winery. Hence, this technique to analyze the Querol, A., Barrio, E., Huerta, T., Ramón, D., 1992. Molecular monitoring of wine
fermentations conduced by yeasts strains. Applied and environmental Microbiol-
microbiological quality of the air, once perfected, could serve to ogy 58, 2948–2953.
control processes and even microbiological deviation during the Rosa, C.A., Palacios, V., Combina, M., Fraga, M.E., Rekson, A., Magnoli, C.E., Dalcero, A.M.,
production and storage of wines. The originality of this research lies in 2002. Potential Ochratoxin A producers from wine grapes in Argentina and Brazil.
Food Additives and Contaminants 19, 408–414.
the fact that it is the first time that this air analysis technology has Salustiano, V.C., Andrade, N.J., Cardoso, S.C., Cordeiro, R.M., Kitakawa, S.A., 2003.
been applied to monitoring microbial processes in the winemaking Microbiological air quality of processing areas in a dairy plant as evaluated by
sector. While it is true that the study has mainly focused on the sedimentation technique and a one-stage air sampler. Brazilian Journal of
Microbiology 34, 255–259.
dispersal of winemaking yeasts, in subsequent studies other micro-
Samson, R.A., Hoekstra, E.S., Frisvad, J.C., Filtenborg, O., 1995. Introduction to Food-
organisms of interest to winemakers will also be tackled in depth, borne Fungi. CBS, Baarn, Netherlands.
both those which have beneficial effects and those which can cause Santamaría, P., Garijo, P., López, R., Tenorio, C., Gutiérrez, A.R., 2005. Analysis of yeast
population during spontaneous alcoholic fermentation: effect of the age of the
defects. This study is therefore the start of an interesting line of
cellar and the practice of inoculation. International Journal of Food Microbiology
research in winery environmental microbiology. 103, 49–56.
Santamaría, P., Garijo, P., López, R., Gutiérrez, A.R., 2007. Análisis sobre el número
Acknowledgments óptimo de aislados para determinar la diversidad de levaduras en la
fermentación. Proceedings of Avances en Ciencias y Técnicas Enológicas.
Transferencia de Tecnología de la red GIENOL as sector vitivinícola. ISBN: 978-
This research received funding from the Government of La Rioja, 84-690-6060-5, pp. 19–21. Badajoz, Spain.
and was carried out with the collaboration of the Santos Montiel
4.2
ESTUDIO DE LAS LEVADURAS PRESENTES EN LAS
INSTALACIONES DE UNA BODEGA COMERCIAL.
COMPARACIÓN DE LOS CLONES DE Saccharomyces
cerevisiae AISLADOS DE INSTALACIONES, DEPÓSITOS
EN FERMENTACIÓN Y EN EL AIRE
4.2.1.- Resumen
Este estudio constituyó uno de los capítulos del trabajo presentado para la
obtención del Diploma de Estudios Avanzados (DEA), defendido en 2010 en la
U.R., bajo la dirección de la Dras. Ana Rosa Gutiérrez y Pilar Santamaría.
Por otra parte, hasta hace unos años se creía que las levaduras presentes en
los materiales de vinificación pertenecían principalmente a la especie S. cerevisiae,
es decir levaduras capaces de completar una fermentación. Sin embargo, en
trabajos más recientes se ha puesto de manifiesto que las No-Saccharomyces
pueden ser mayoritarias también en las instalaciones.
101
4.2 Resultados
102
4.2 Resultados
Sin embargo, los datos de este trabajo coincidieron con los aportados en
estudios previos por Ciani et al. (2004) y Santamaría et al. (2005, 2008), donde
103
4.2 Resultados
VII
VI
V
IV
No-Saccharomyces Saccharomyces
III
63% 37%
II
104
4.2 Resultados
V V II
III
VI
VI
II
IV
I
tolva
pared
suelo
bomba trasiego
salida depósito
pared interior depósito
prensa
estrujadora
despalilladora
105
4.2 Resultados
106
4.2 Resultados
107
4.2 Resultados
Instalaciones
III
Aire: zona de elaboración
II
V XIV XXI XXIV XXV XXVI
III
X XIX XXII XXIII VIII
IV VII XIII XXIII
XV XVIII
XII
I II
XI
XI XX
V VIII
XVII IX
VII
VI IX IX VIII
VI VI XVII
VI
VIII
tolva
pared
suelo
bomba trasiego
salida depósito
pared interior depósito
prensa
estrujadora
despalilladora
IV VIII IV
XVI
I VI I
8 nov.
5 oct.
9 oct.
11 oct.
16 oct.
20 oct.
24 oct.
31 oct.
Fechas de muestreos
Superficies muestreadas
Depósito A
II S.p. XVI
I XV
Depósito B
VIII
XIV
VII XII XIV
VII
XIII
VI XI XIII Depósito C
XII
XI
V XI I X IX
I XII
IV XVII X VII
II IX
VI VI XI
X V VIII *
V XIII
III IX
IX IV III X
III VIII
2-oct.
5-oct.
9-oct.
VIII VIII
III III IV
II
9-oct.
11-oct.
16-oct.
II
20-oct.
24-oct.
108
4.2 Resultados
109
4.2 Resultados
110
4.3
ESTUDIO DEL AIRE COMO VÍA DE DISEMINACIÓN
DE LAS BACTERIAS LÁCTICAS RESPONSABLES DE
LA FERMENTACIÓN MALOLÁCTICA.
Resumen
113
4.3 Resultados
114
4.3 Resultados
115
4.3 Resultados
116
International Journal of Food Microbiology 136 (2009) 142–146
Short communication
Presence of lactic bacteria in the air of a winery during the vinification period
P. Garijo a, R. López a, P. Santamaría a, E. Ocón b, C. Olarte b, S. Sanz b, A.R. Gutiérrez b,⁎
a
ICVV, Instituto de Ciencias de la Vid y el Vino (CSIC, Gobierno de La Rioja), C/Madre de Dios 51, 26006 Logroño, Spain
b
Universidad de La Rioja, C/Madre de Dios 51, 26006 Logroño, Spain
a r t i c l e i n f o a b s t r a c t
Article history: In this paper we have studied the presence and evolution in the winery air of the lactic bacteria responsible
Received 15 July 2009 for malolactic fermentation. Sampling took place during the winemaking process (between September 2007
Accepted 14 August 2009 and July 2008) in a winery from the Rioja appellation in Spain. The results obtained indicated that the
presence of these microorganisms in the atmosphere was detected when grapes were entering the winery,
Keywords:
while malolactic fermentation was taking place, and when liquid containing bacteria was manipulated. The
Winery
Air
species and clones of the lactic bacteria identified were also related to those present in the vinification tanks
Lactic acid bacteria at any given stage of the process.
Malolactic fermentation © 2009 Elsevier B.V. All rights reserved.
1. Introduction fermentations take place, and which would start up more quickly. This
dispersal could occur via the machinery, tools, insects and probably
The conversion of must into wine occurs through alcoholic fer- the air. The yeasts and bacteria could be projected out of the vats via
mentation (AF), a process performed by yeasts. This initial transfor- the CO2 gas which is given off during alcoholic and malolactic
mation is followed by what is known as malolactic fermentation fermentation, spreading through the winery by this means (Garijo
(MLF), caused by lactic bacteria. Both microbiological processes make et al., 2008). Recently, Granchi et al. (2007) have suggested that
an essential contribution to the final quality of the product (Swiegers Saccharomyces cerevisiae, which dominate the fermentation of the
et al., 2005). The origin of the yeasts and bacteria which take part in first vat of each harvest, invade the winery environment and produce
the fermentation processes has two possible sources: the grapes and a natural inoculation in the subsequent fermentations. Something
the material in the winery environment (Fleet and Heard, 1993; similar could happen with the lactic acid bacteria responsible for MLF.
Mortimer and Polsinelli, 1999). In published literature, no information has been found on the
Lactic bacteria are present during all stages of vinification and, like presence of lactic bacteria in the atmosphere of wineries, and very
the yeasts, enter with the grapes and remain in the winery equipment little on the presence of other oenological microorganisms in this
after MLF (Fugelsang and Edwards, 2007). Lactic acid bacteria have medium. Only Beech (1993), in cider, found a relationship between
been isolated from vine leaves, grapes, winery equipment, barrels, etc. exposure of the liquid to air and contamination with Brettanomyces
(Bae et al., 2006; Lonvaud-Funel, 1999). In the early stages of yeasts, and Connell et al. (2002) found Brettanomyces yeasts in air
winemaking (must and alcoholic fermentation) the lactic bacteria samples from different areas of a commercial wine cellar. Previously,
are found in small numbers and mainly belong to the Lactobacillus and Donnelly (1977) used this approach in a winery bottling room.
Pediococcus genera. However, as alcoholic fermentation progresses, Recently, Mandl et al. (2008) analyzed mold content in the air of
only those strains which are able to resist alcohol are able to survive, various Austrian wineries and Garijo et al. (2008) showed that the
belonging to the Oenococcus oeni species, and these are the main presence in the air of various microorganisms (yeasts, molds and
agents in MLF (Du Plessis et al., 2004; Reguant et al., 2005). bacteria) is linked to the oenological processes that are taking place in
For many years, winemakers have found that the first spontaneous the vats during the harvest period. In this work, it was stated that the
(alcoholic and malolactic) fermentations which occur during each presence of lactic bacteria was not detected in the air of the
harvest at the wineries take longer than subsequent ones (Peynaud, winemaking area until malolactic fermentation began in the vats. In
1989). The reason would be due to the increase in microorganisms other food industries a relationship has been found between the lactic
which occurs in the first vat, and in their dispersal around the cellar bacteria present in the processing plant air and those responsible for
and arrival in large quantities in other vats in which the subsequent the contamination of the finished product (Korkeala and Björkroth,
1997; Vihavainen et al., 2007).
The aims of this work were to study the presence and evolution of
⁎ Corresponding author. Tel.: +34 941299727; fax: +34 941299721. the lactic bacteria responsible for malolactic fermentation in the air of
E-mail address: ana-rosa.gutierrez@unirioja.es (A.R. Gutiérrez). a winery and compare these with those which are found in the nearby
0168-1605/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.ijfoodmicro.2009.08.018
P. Garijo et al. / International Journal of Food Microbiology 136 (2009) 142–146 143
vinification vats with the aim of evaluating the possible exchange of colonies were randomly selected and stored in frozen tubes with
these microorganisms between the two media. skimmed milk for later analysis.
Must and wine samples were serially diluted and 0.1 ml was
2. Materials and methods inoculated onto plates of modified MRS-Agar medium with pimaricin
that was incubated in anaerobiosis (GasPak. Oxoid Ltd., Basingstoke,
2.1. Sample collection England) at 30 °C for ten days and viable counts were obtained as the
number of CFU/ml. Plates containing bacteria colonies were examined
The research was carried out during the months of September and twenty colonies were randomly selected and stored in frozen
2007–July 2008 in a winery situated in the village of Alcanadre (La tubes with skimmed milk for later analysis.
Rioja, Spain). Sampling of the winery air began on September 18, All bacteria isolated both in the air (62 colonies) and in liquid (120
fifteen days before the first grapes were brought into the cellar, and colonies) were analyzed via PCR to detect those belonging to the
ended two weeks after the last malolactic fermentation was complete. group of lactic bacteria (Van de Klundert and Vliegenthart, 1993). The
In total, 20 air samples were taken in the winery (Table 1). sequences of the primers used were Rrs1 (GGATTAGATACCCTGG-
Air samples were taken using the air IDEAL 3P air sampler from TAGTCC) and Rrs2 (TCGTTGCGGGACTTAACCCAAC). These PCR pro-
BioMérieux, an impaction aerobiocollector used to detect the ducts were purified and sequenced by Macrogen Inc. facilities (Seoul,
presence of viable microorganisms in the environment to be tested South Korea) in order to determine the species of lactic bacteria each
by precise sampling of a given volume of air. The samples were taken isolate belonged to (retrieved from GenBank: www.ncbi.nlm.nih.gov/
from the point in the winery located in the middle of the winemaking blast/blast.cgi).
area or near to a vat in which MLF was in progress. The sampler was Subsequently, the O. oeni species was confirmed by the species-
placed on a platform 1 m above the ground. The study was made using specific PCR method described by Zapparoli et al. (1998) based on the
petri dishes with modified MRS-Agar (Scharlau Chemie S.A., Barce- amplification of a fragment of the gene of the specific malolactic
lona, Spain), a specific selective media for lactic bacteria, to which enzyme of that species. The sequences of the primers used in the
50 mg/l of pimaricin was added to inhibit the growth of yeasts. The identification were Lo-1 (TAATGTGGTTCTTGAGGAGAAAAT) and Lo-2
volume of air analyzed in duplicate was 1500 l. (ATCATCGTCAAACAAGAGGCCTT). The amplification reaction was
As well as the bacteria from the air, those present in the fer- conducted in an Applied Biosystems (GeneAmp PCR System 2700)
mentation vat nearest to the zone from which the air sample was taken thermocycler. For visualizing the amplified fragments the horizontal
were also analyzed. All the wines analyzed, with the exception of agarose gel electrophoresis technique was used, prepared with
samples 15 and 18, came from different vats. The samples of liquid agarose (Bio-Rad) at a concentration of 1% in a TBE 0.5× tampon,
were collected in sterile jars and taken to the laboratory for processing. staining of gel by immersion in ethidium bromide (2 μg/ml), and
visualization in an ultraviolet transilluminator with an image
2.2. Microbial analyses capturing system (GEL DOC, Bio-Rad, Madrid, Spain). The molecular
weight marker used was the Hyper Ladder IV (Bio-Rad).
The plates were incubated under anaerobiosis at 30 °C for 10 days. Finally, the classification of types of O. oeni clones was conducted
Some diphenyl crystals (approximately 100 mg per plate) (Panreac via Pulsed Field Gel Electrophoresis (PFGE) using the restriction
Química SA, Barcelona, Spain), were added to the plates in order to enzyme SfiI and the CHEF-DR II (Bio-Rad) system, according to the
impede the development of molds. Colonies were counted and cell method described by Birren and Lai (1993) with some modifications
populations (CFU) were calculated from duplicate analyses. Subse- for agarose blocks preparation (López et al., 2007). Electrophoresis
quently, this value was converted into the most probable number of was performed at 14 °C at a constant voltage of 4.5 V/cm with a switch
microorganisms collected per plate (MPN), using a statistical time ramped from 5 to 45 s over 24 h period. Gels were stained with
correction table included in the equipment's instruction manual. ethidium bromide (0.5 µg/ml) and photographed under UV light. The
Finally, the most probable number of microorganisms collected was FPQuest™ 4.5 software (Bio-Rad) was used for conversion, normal-
expressed as MPN/m3. From each plate, a maximum of twenty ization, and further processing of images. Comparison of the PFGE
Table 1
Conditions of vinification and evolution of MPN/m3 of lactic bacteria in the air of the vinification area and of the CUF/ml in the wine in a vinification tank during the period
September 2007–July 2008.
Sample Date Conditions of vinification in the winery MPN/m3 in air CUF/ml in must/wine
patterns obtained was performed with Pearson's product-moment Garijo et al. (2008) who found that the levels of microorganisms in the
correlation coefficient and the Unweighted Pair Group Method using air during AF were much higher than those of MLF, due to pumping
Arithmetical averages (UPGMA) (Fig. 1). over and the greater quantity of carbon dioxide freed in the first
transformation.
3. Results and discussion Specific PCR analysis for lactic bacteria from the bacteria isolated
from the air indicated that they all belonged to this group. The lactic
3.1. Lactic bacteria in the winery air bacteria isolated in the winery air in the first moments of the harvest
period (samples 1 and 3) were identified as belonging to the Leuco-
During the period studied, a low number of bacteria were detected nostoc mesenteroides and Pediococcus pentosaceus species. These
in the air (Table 1), probably due to the fact that malolactic species of bacteria are normally associated with grapes and the
fermentation had not occurred simultaneously in all the winery's vinification process but they are not normally the ones responsible for
vats. In most wineries, once alcoholic fermentation is complete, MLF triggering malolactic fermentation (Landete, 2005; Krieger, 2006;
usually starts up spontaneously. However, this spontaneous activity is Renouf et al., 2006). In addition, all the lactic bacteria isolated from
unpredictable, since there are many factors which affect the growth sample 9 onwards belonged to the O. oeni species. These results
and development of lactic bacteria in the wine (Carreté et al., 2002) would be because the bacteria were isolated in the air at times when
and, consequently, malolactic transformation. some tank in the winery was undergoing malolactic fermentation, a
As can be seen in Table 1, bacteria have only been isolated from transformation mainly conducted by bacteria of this species (Prama-
the air in two stages of the vinification process: when the grapes teftaki et al., 2006).
came into the winery and when malolactic activity was detected
in any isolated vat. In the first case, this presence could be linked to 3.2. Lactic bacteria isolated in musts and wines
the bacterial load which accompanies the grapes, and in the second,
to the development of lactic bacteria during malolactic fermenta- The lactic bacteria present in the vinification vats during the first
tion in one of the vats, which are given off outside the tanks due samples were also there in low quantities (Table 1). Such low
to the carbonic gas produced. However, the values in this latter populations in the wines could be due to the low ambient temperature
case are very low if we compare the ones obtained by Garijo et al. in the winery during the period studied, and would explain the slowness
(2008), which reached levels close to 500 MPN/m3 when all of of the malolactic fermentation in all the vats (Henick-Kling, 1993).
the tanks in the cellar were undergoing malolactic fermentation. In Of the colonies isolated in each of the previously mentioned
this study, the maximum value reached during MLF was 9 MPN/m3. moments, most of those from samples 1 and 3 did not belong to the O.
The numerical discrepancies found would be accounted for by oeni species (93% and 100% respectively), which would coincide with
the fact that in the previously mentioned study, all the tanks were the lactic population commonly detected in the must or at the start of
undergoing MLF simultaneously. In our case, the highest value for alcoholic fermentation. However, once malolactic fermentation began
bacteria in the air (328 MPN/m3) was detected when MLF had in the wine, all the isolates of lactic bacteria in the wine belonged to
finished in nearly all the vats, coinciding with emptying and cleaning that species. O. oeni has a high tolerance to the conditions of wine
one of them that had finished a few days earlier (sample no. 18). This (Lonvaud-Funel, 1995) and hence it is the majority microorganism
suggests that the fact that a large quantity of lactic bacteria passed during malolactic fermentation (Renouf et al., 2006). Various authors
into the air was due to the handling of the liquid charged with these have reported this situation in different winemaking regions
microorganisms. (Pramateftaki et al., 2006; Tenorio et al., 2007; Ruiz et al., 2008).
These data would seem to indicate that the potential dissemina-
tion and/or contamination of lactic bacteria in the winery through the 3.3. Strains of O. oeni in the air and in the wines
medium of the air, could occur when the product containing the
bacteria is moved (grapes or wine). The handling may be mechanical The data for lactic bacteria obtained from the air and from the
(movement of grapes or wine), or caused by the carbonic gas which is vinification vats would be totally linked: O. oeni, the agent of malolactic
given off during MLF. The handling of wine loaded with microorgan- fermentation, appear simultaneously in both media and in identical
isms as the source of these found in the air was already noted by proportions (100%), once malolactic fermentation began in the vats. On
Fig. 1. UPGMA dendrogram based on the SfiI PFGE patterns of the 8 Oenococcus oeni strains isolated from air in this study.
P. Garijo et al. / International Journal of Food Microbiology 136 (2009) 142–146 145
the other hand, when there is no malolactic fermentation in the wine, O. between them 90% and 55% respectively of the total population. Garijo
oeni is not detected in either the wine or the air. et al. (2008), studying S. cerevisiae clones in the air and in nearby vats
When analyzing the clones of O. oeni isolated from the air during also found a coincidence between them in both media which led them
the season (Table 2), it was observed that 2 of the 8 clones identified to conclude that in alcoholic fermentation there was an exchange of
in this medium (I and II), were present in 3 of the 4 samples in which yeasts between the liquid medium in fermentation and the gaseous
bacteria of this species were detected in the air. The diversity of clones one (the air), which could indicate that the air in itself could be an as
of the O. oeni species in the air was variable: initially one single clone yet unstudied means for the dispersal of microorganisms within the
was found (sample 9), then 2 (sample 11) and finally 7 and 3 different winery and for the inoculation of tanks. As can be seen in this study,
clones (samples 15 and 18 respectively). At the moment at which this hypothesis would also be valid for the lactic bacteria responsible
the greatest diversity was detected (sample 15), four tanks were for malolactic fermentation. The strains present in the liquid would
undergoing MLF that could have led to a greater number of bacteria pass into the air and in this way would spread around the cellar, so
coming from each of the 4 tanks being projected into the atmosphere, that they could fall into other wines and thereby contaminate them.
producing a more complex population. The diversity of clones of the Their subsequent development in these vats would depend on the
O. oeni species found in the air seems high at first sight (Table 2). greater or lesser adaptation to the conditions of the new wine. This
However, there are no data for lactic bacteria in the air of wineries continuous exchange between the two media would explain the
with which to compare these results. However, there are studies presence of common strains of O. oeni in both media and their
conducted in other food industries in which there are references to different proportion during the period under study.
the high diversity of species and clones of lactic bacteria present in the
air of the plants (Vihavainen et al., 2007). 4. Conclusions
When studying the clones of the O. oeni species isolated from the
wines during the harvest period, it was noticed that the two principal The results of this study confirm the role of the air in spreading
clones detected in the air also appeared in this medium in important vinification microorganisms through the wine cellar. In a previous work
proportions, particularly clone II, which was detected at three of the we studied the dispersal of winemaking yeast by this route and this
four points studied. As in the case of the air, the diversity of clones was study has concluded that this hypothesis is also valid as an explanation
also variable during the harvest period (2, 4, 3 and 4 different clones). of the spread of lactic bacteria in the cellar. The data obtained indicate
The clonal diversity of O. oeni in malolactic fermentation is variable in the simultaneous presence of the same species and strains of lactic
the different studies consulted. Thus, Reguant and Bordons (2003), bacteria in the winery air and in the vinification vats. This result would
Palacios et al. (2004) and Pramateftaki et al. (2006), all found little indicate the exchange of bacteria between the two media and would
diversity of strains, while Bartowsky et al. (2003) and Tenorio et al. suggest that the air is a factor in the spread of these microorganisms in
(2007) found a wide diversity between the strains responsible for the wine cellar, associated with malolactic fermentation and, principal-
spontaneous malolactic fermentation. ly, with the moments when the liquid is moved/racked. This hypothesis
When analyzing the presence of clones common to the air and the suggests the possibility that during such manipulation, other micro-
wine in each sample, we found that the percentage of clones in organisms can be spread through the air which has an effect on the
common was greater or lesser depending on the different conditions vinification process and the conservation of the wines. Nevertheless, the
prevailing at a given moment. However, coincidences were detected low number of bacteria isolated in the air at certain points during this
at each point of sampling except number 9, which may be due to MLF study, plus the fact that it is the first known study on this topic to date,
having just started in the cellar, since the vat analyzed at this point makes it necessary to deepen knowledge of the microbiology of winery
was the first to begin this transformation during the harvest time air and the role that this medium has in the dissemination, inoculation
studied. However, the majority clone detected in the wine at that and contamination of must and wine.
moment (II) is found in the air in subsequent samples. In contrast, in
sample number 11, the only two clones detected in the air (I and II) Acknowledgements
are the majority ones in the wine (30% and 50% respectively). In
sample 15 the two strains in the wine and in the air coincide (clones This study has been undertaken with a grant from the Government
IV and V), which between them represent 25% and 40% respectively of of La Rioja (R-10-07 and FOMENTA 2007/04 Projects), and was made
the total clones in each medium. In sample 18 clones II and IV were possible with the collaboration of the Bodega Cooperativa Vinícola
detected simultaneously in the air and in the wine, representing Riojana de Alcanadre (La Rioja, Spain).
References
Table 2
Clones of Oenococcus oeni (%) present simultaneously in the air and in the wines of a Bae, S., Fleet, G.H., Heard, G.M., 2006. Lactic acid bacteria associated with wine grapes
winery during a winemaking season. from several Australian vineyards. Journal of Applied Microbiology 100 (4),
712–727.
Clones Air Wine Bartowsky, E., McCarthy, J., Henschke, P., 2003. Differentiation of Australian wines
Sample Sample isolates of Oenococcus oeni using random amplified polymorphic DNA (RAPD).
Australian Journal of Grape and Wine Research 9, 122–126.
9 11 15 18 9 11 15 18 Beech, F.W., 1993. Yeasts in cider-making. In: Harrison, Rose (Eds.), The Yeasts, vol. 5.
Academic press, London, pp. 169–213.
I 100 75 25 – – 30 – –
Birren, B., Lai, E., 1993. Preparation of DNA for pulsed field analysis. In: Hartcourt Brace
II – 25 20 15 85 50 – 15 Jovanich (Ed.), Pulsed Gel Electrophoresis. A Practical Guide. Academic Press, San
III – – 15 – – – – – Diego, pp. 25–74.
IV – – 20 75 – – 10 40 Carreté, R., Vidal, M.T., Bordons, A., Constantí, M., 2002. Inhibitory effect of sulfur
V – – 5 – – – 30 – dioxide and other stress compounds in wine on the ATPase activity of Oenococcus
VI – – 5 – – – – – oeni. FEMS Microbiology Letters 211, 155–159.
VII – – 10 – – – – – Connell, L., Stender, H., Edwards, C.G., 2002. Rapid detection of Brettanomyces from
VIII – – – 10 – – – – winery air samples based on peptide nucleic acid analysis. American Journal of
IX – – – – 15 – – – Enology and Viticulture 53, 322–324.
X – – – – – 15 – – Donnelly, D.M., 1977. Airborne microbial contamination in a winery bottling room.
XI – – – – – 5 – – American Journal of Enology and Viticulture 28, 176–181.
XII – – – – – – 60 40 Du Plessis, H.W., Dicks, L.M.T., Pretorius, I.S., Lambrechts, M.G., Du Toit, M., 2004.
Identification of lactic acid bacteria isolated from South African brandy base wines.
XIII – – – – – – – 5
International Journal of Food Microbiology 91, 19–29.
146 P. Garijo et al. / International Journal of Food Microbiology 136 (2009) 142–146
Fleet, G.H., Heard, G.M., 1993. Yeast: growth during fermentation. In: Fleet, G.H. (Ed.), Pramateftaki, P., Metaza, M., Kallithraka, S., Lanaridis, P., 2006. Evolution of malolactic
Wine Microbiology and Biotechnology. Harwood Academic Publishers, Switzer- bacteria and biogenic amines during spontaneous fermentations in a Greek winery.
land, pp. 27–54. Letters in Applied Microbiology 43, 155–160.
Fugelsang, K.C., Edwards, C.G., 2007. Wine Microbiology. Practical Applications and Peynaud, E., 1989. Enología Práctica. Conocimiento y elaboración del vino. Ed. Mundi
Procedures. Springer Science + Business Media, LLC, New York. Prensa, Madrid, pp. 122.
Garijo, P., Santamaría, P., López, R., Sanz, S., Olarte, C., Gutiérrez, A.R., 2008. The Reguant, C., Bordons, A., 2003. Typification of Oenococcus oeni strains by multiplex
occurrence of fungi, yeasts and bacteria in the air of a Spanish winery during RAPD-PCR and study of population dynamics during malolactic fermentation.
vintage. International Journal of Food Microbiology 125, 141–145. Journal of Applied Microbiology 95, 344–353.
Granchi, L., Augruso, S., Ganucci, D., Vicenzini, M., 2007. Biodiversité genomique de Reguant, C., Carreté, R., Constantí, M., Bordons, A., 2005. Population dynamics of Oe-
Saccharomyces cerevisiae pendant la fermentation spontanée du vin conditionnée noccocus oeni strains in a new winery and the effect of SO2 and yeast strain. FEMS
par le progression de la vendage dans la cave. Proceedings XXXth OIV World Microbiology Letters 246 (1), 111–117.
Congress, Budapest. Renouf, V., Claisse, O., Miot-Sertier, C., Lonvaud-Funel, A., 2006. Lactic acid bacteria
Henick-Kling, T., 1993. Malolactic fermentation. In: Fleet, G.H. (Ed.), Wine Microbiology evolution during winemaking: use of rpoB gene as a target for PCR-DGGE analysis.
and Biotechnology. Harwood Academic Publishers, Philadelphia, CA, pp. 289–326. Food Microbiology 23, 136–145.
Korkeala, H.J., Björkroth, K.J., 1997. Microbiological spoilage and contamination of Ruiz, P., Izquierdo, P., Seseña, S., Fernández, M., Palop, M.L., 2008. Ecological study of
vacuum-packaged cooked sausages. A review. Journal of Food Protection 60, lactic microbiota isolated from malolactic fermentation of Cencibel (cv) wines from
724–731. cellars of Castilla-La Mancha. Actas 31 Congresso Mondiale della Vigna e del Vino.
Krieger, S., 2006. Historia de la bacteria maloláctica en el vino. En Informe Técnico III 15-20 giugno 2008. Verona (Italia).II.B.3: pp. 300.
Encuentro Enológico: “Fermentación Maloláctica”. (Ed.) Fundación para la Cultura Tenorio, C., López, I., López, R., Santamaría, P., Garijo, P., Gutiérrez, A.R., 2007. Estudio de
del Vino. Madrid, 15 de March de 2006. pp: 8–17. biodiversidad y selección de bacterias lácticas en vinos tintos de Rioja. IX Jornadas
Landete, J.M., 2005. Estudio y caracterización molecular de la producción de aminas de los Grupos de Investigación Enológica. Avances en Ciencias y Técnicas
biógenas por parte de las bacterias lácticas de origen enológico. Universidad de Enológicas. Transferencia de Tecnología de la Red GIENOL al Sector vitivinícola.
Valencia, Tesis Doctoral. (Ed.) M. Ramirez y col. Badajoz. pp. 28–30.
Lonvaud-Funel, A., 1995. Microbiology of the malolactic fermentation: molecular Swiegers, J.H., Bartowsky, E.J., Henschke, P.A., 2005. Yeast and bacterial modulation of
aspects. FEMS Microbiology Letters 126, 209–214. wine aroma and flavour. Australian Journal of Grape and Wine Research 11,
Lonvaud-Funel, A., 1999. Lactic acid bacteria in the quality improvement and 139–173.
depreciation of wine. Antonie van Leewenhoek 76, 317–331. Van de Klundert, J.A.M., Vliegenthart, J.S., 1993. PCR detection of genes coding for
López, I., Tenorio, C., Zarazaga, M., Dizy, M., Torres, C., Ruiz-Larrea, F., 2007. Evidence of aminoglycoside-modifying enzymes. Diagnostic Molecular Microbiology. Principles
mixed wild populations of Oenococcus oeni strains during wine spontaneous and Applications. American Society For Microbiology, Washington D.C, p. 548.
malolactic fermentations. European Food Research and Technology 226, 215–223. Vihavainen, E., Lundströn, H.S., Susiluoto, T., Koort, J., Paulin, L., Auvinen, P., Bjökroth, K.J.,
Mandl, K., Clemenz, A., Sterfliner, K., Kneifel, W., Schattauer, D., 2008. Characterisation 2007. Role of Broiler carcasses and processing plant air in contamination of modified-
of the aeromycological flora of selected wine cellars in Austria. 31 Congresso atmosphere-packaged broiler products with psychrotrophic lactic acid bacteria.
Mondiale della Vigna e del V, Verona, Italia. Applied and Environmental Microbiology 73, 1136–1145.
Mortimer, R., Polsinelli, M., 1999. On the origin of wine yeast. Research in Microbiology Zapparoli, G., Torriani, S., Pesente, P., Dellaglio, F., 1998. Design and evaluation of
150, 199–204. malolactic enzyme gene targeted primers for rapid identification and detection of
Palacios, A., Suárez, C., Krieger, S., Theodore, D., 2004. Fermentación maloláctica con bac- Oenococcus oeni in wine. Letters in Applied Microbiology 27, 243–246.
terias seleccionadas. Estudio de producción de histaminas, repercusión en la fracción
aromática y control de implantación. Tecnología del vino 23–27 September/October.
4.4
ESTUDIO DE LA PRESENCIA Y EVOLUCIÓN DE LOS
MICROORGANISMOS DE INTERÉS ENOLÓGICO EN
LAS UVAS Y EN EL AIRE DEL VIÑEDO
Resumen
125
4.4 Resultados
126
4.4 Resultados
127
4.4 Resultados
128
Eur Food Res Technol (2011) 233:359–365
DOI 10.1007/s00217-011-1528-3
ORIGINAL PAPER
Received: 5 April 2011 / Revised: 6 June 2011 / Accepted: 11 June 2011 / Published online: 28 June 2011
Ó Springer-Verlag 2011
123
360 Eur Food Res Technol (2011) 233:359–365
However, previously, Adams [9] had demonstrated the 100 L min-1). The acceleration of airflow results in the
presence of this species in vineyard air. Santamarı́a [10] impaction of airborne microorganisms on the agar. Passage
attributed the appearance of the same S. cerevisiae strain in of the air through the grid filters out particles, thereby
the grapes in four nearby wineries, to the strong winds facilitating the enumeration of CFU (colony-forming units)
experienced during the harvest period in the zone, and after incubation of the medium. The sampler was placed on
Valero et al. [11] also opted for this dispersal method to a platform 0.5 m above the ground in the middle of the
explain the appearance of these yeasts in vineyards far space between rows in the vineyard, near the corresponding
away from the wineries where they had been sown. vine stock. The study was made using petri dishes with
Consequently, the aim of this study was to compare the Chloramphenicol Glucose Agar and Modified MRS agar
yeasts and enological bacteria found simultaneously on the with pimaricin, the appropriate media for isolating yeasts
grapes and in the vineyard air during the weeks leading up and lactic acid bacteria, respectively. The volume of air
to the harvest, and to analyze the role of the air/wind in the analyzed in duplicate in both cases was 1,500 L.
dispersal of enological microorganisms in the vineyard. Samples in 2008 were taken on 11th, 19th, 25th Sep-
The role that this medium plays in the dissemination of tember and 3rd, 10th October. In the second year (2009),
yeasts and bacteria responsible for alcoholic and malolactic the weather conditions were very favorable for maturation
fermentation in the winery has been shown in previous of the grapes from the zone and the whole process was
studies [12, 13]. carried out about 15 days earlier. Consequently, the sam-
pling dates were 27th August, 3rd, 10th, 17th and 24th
September. The final sample analyzed each year corre-
Materials and methods sponded to the moment of harvesting.
The research was carried out during the grape ripening The yeast plates were incubated at 25 °C for 72 h, and the
period of the 2008 and 2009 vintages in a vineyard situated bacteria plates were incubated under anaerobiosis (GasPak.
in the village of Agoncillo (La Rioja, Spain). The samples Oxoid Ltd., Basingstoke, England) at 30 °C for 10 days.
were taken from two points (two stocks) in the middle of Some diphenyl crystals (approximately 100 mg per plate)
the vineyard. Samples were taken during the 4 weeks prior (Panreac Quı́mica SA, Barcelona, Spain) were added to the
to harvesting (five samples in all). Air and grape samples plates in order to impede the development of molds. Col-
were taken in duplicate from each of the two points. In onies were counted and cell populations (CFU) were cal-
addition, data concerning the environmental conditions at culated from duplicate analyses. Subsequently, in plates
each sampling (temperature, sun, wind, rain) were coming from air samples, this value was converted into the
recorded. most probable number of microorganisms collected per
From each of the vines, a cluster was cut using ethanol- plate (MPN), using a statistical correction table included in
sterilized shears and placed in a sterile plastic bag for the equipment instruction manual. Finally, the most prob-
transfer to the laboratory. At the laboratory, it was able number of microorganisms collected was expressed as
weighed, placed in a sterile flask containing 400 mL of an MPN/m3. From each plate, a maximum of twenty colonies
isotonic solution and shaken in an orbital shaker at were randomly selected and stored for later analysis: yeasts
150 rpm for 1 h in order to wash it and to release the in LM medium (10% D-glucose, 5% mycopeptone, 3%
microorganisms. From the saline solution, these were sown yeast extract, 3% malt extract, 20% bacteriological agar)
on petri dishes in duplicate quantities of 100 ll with a and bacteria in frozen tubes with skimmed milk.
suitable medium for isolating yeasts (Chloramphenicol
Glucose Agar: 5% yeast extract, 20% glucose, 0.5% Molecular characterization of the microorganisms
chloramphenicol, 17% agar) and lactic bacteria (Modified
selective MRS agar with pimaricin: 52% MRS broth, 6% The identification of yeasts analysis was carried out using
fructose, 5% D,L malic acid, 10% tomato juice, 0.5% PCR–RFLP of the ITS region of the ribosomal DNA. The
L-cystein CHL, 30% agar, 0.5% pimaricin). extraction of DNA was conducted from the fresh yeast
Air samples were collected between 10:00. and 13:00. culture using the method proposed by López [14]. PCR
using the airIDEAL 3P air sampler from BioMérieux, an amplification was applied to the 5.8S-ITS region of the
impaction aerobiocollector used to detect the presence of rDNA following the method proposed by Esteve Zarzoso
viable microorganisms in the environment to be tested by et al. [15]. The primers used to amplify the region were
precise sampling of a given volume of air. Air is taken up those described by White et al. [16]. The amplification
with a turbine through a grid surface (rate of flow reaction took place in the GeneAmpÒ PCRSystem 2700
123
Eur Food Res Technol (2011) 233:359–365 361
cfu x 103/1000g
ethidium bromide and photographed under ultraviolet light
150
in the Image Store 5000 (UVP) apparatus (BIO-RAD). For
the analysis of restriction of the product of PCR, 5-lL
100
aliquots were subjected to digestion by the HinfI, HaeIII
and CfoI enzymes. The RFLP products were analyzed by 50
electrophoresis in agar gel at 3% (p/v). The 100-bp PCR
Molecular Ruler molecular weight marker was used as a 0
standard for both the PCR products and the RFLP frag- 4 3 2 1 0
ments. The identification of the isolated yeasts was per- Weeks before harvest
MPN/m3
included in the previous references. The PCR products of 2,5
the D1/D2 domain of large subunit (26S) ribosomal DNA 2
[20] coming from these non-identified colonies were 1,5
purified and sequenced by Macrogen Inc. facilities (Seoul, 1
South Korea) in order to determine which species of yeast 0,5
each isolate belonged to (retrieved from GenBank: 0
www.ncbi.nlm.nih.gov/blast/blast.cgi). The yeasts identi- 4 3 2 1 0
fied by this method were Rhodosporidium babjevae, Spo- Weeks before harvest
rothrix spp, Acremonium strictum and Kabatiella
Fig. 1 Evolution of yeast number on grape clusters (a), and in
microsticta. vineyard air (b) during the weeks before harvest in two successive
All bacteria isolated were analyzed via PCR to detect vintages: 2008 (filled circle), 2009 (filled square)
those belonging to the group of lactic bacteria [21]. The
sequences of the primers used were Rrs1 (GGATTAGA-
TACCCTGGTAGTCC) and Rrs2 (TCGTTGCGGGACT- between 102 and 105 cfu/1,000 g, while in the air the levels
TAACCCAAC). These PCR products were purified and are 0–4 MPN/m3. These quantitative differences were
sequenced by Macrogen Inc. facilities (Seoul, South Korea) maintained during both years of the study. Fleet et al. [22]
in order to determine the species of lactic bacteria each indicated that only small populations of yeasts (\100 cfu/mL)
isolate belonged to (retrieved from GenBank: www.ncbi. are found in air. But in the present study, the level detected
nlm.nih.gov/blast/blast.cgi). is much lower than this value, even though the levels
detected on the grapes are normal [23].
The causes of these differences between the air and the
Results and discussion grapes may have been due to the different nature of the two
substrates and to the nonexistence of strong agitation of the
Evolution of microbial populations in grapes clusters [absence of human activity in the vineyard and the
and in air during ripening period atmospheric conditions in which there were no strong
winds or heavy rainfall during sampling (Table 1)]. Curiel
Of the two types of microorganisms of enological interest, et al. [24] indicated that the air only acts as a support
only the yeasts were present in both campaigns during medium or carrier until the microorganisms fall and are
almost the whole period studied, both on the grapes and in deposited on the surrounding surfaces. These authors also
the air. The presence of yeasts increases in the vineyard reported that microorganisms can travel through the air in
during the ripening period both on the grapes and in the three ways: adhering to a dust particle, adhering to a
atmosphere (Fig. 1). This increase in the number of yeasts droplet or as a single particle. Davenport [25] observed that
on grapes is due to the greater size and the elasticity of the most of the yeasts from the vineyard atmosphere were from
berries and so the microorganisms have more large surface airborne propagules, e.g., seed heads and flying insects,
available to adhere to and more access to nutrients. How- whereas the air itself contained very few yeasts. In the
ever, the quantities of yeasts found in the air are much previous studies conducted in two wineries, Garijo et al.
lower than those on the clusters: In the grapes it varies [12, 13] also detected a lower quantity of enological
123
362 Eur Food Res Technol (2011) 233:359–365
microorganisms in the air in comparison with the liquid in of lactic acid bacteria in grapes are in accordance with the
which they were fermenting and indicated that the presence level of these microorganisms detected in the air.
and detection of enological microorganisms in large
quantities in the winery air were conditioned by the han- Identification of the microorganisms present
dling of wine loaded with microorganisms. in the grapes and in the air
There is a big difference between the yeast population
found on the clusters in 2008 and 2009 (Fig. 1a). These The molecular analysis of the 4 colonies of bacteria iso-
differences may be due to the different climate conditions lated showed that these were all lactic bacteria. The sub-
prevailing in each year (Table 1), which play a crucial role sequent sequencing of them determined that the two
on microbial population [26]. Climatic variations and colonies isolated in the air and one of those isolated on the
viticultural practices are factors that are liable to influence clusters belonged to the species Pediococcus pentosaceus.
the berry microenvironment and consequently the micro- The other colony isolated on the grape clusters was
bial ecosystem on the surface. The temperature and cloud Oenococcus oeni. The former bacteria is normally associ-
conditions during the sampling were clearly different in the ated with grapes and the vinification process, but it is not
2 years. However, the yeasts detected in the air in the normally the one responsible for triggering malolactic
2 years are similar (0–4 MPN/m3) (Fig. 1b). fermentation [31]. However, O. oeni is the species pri-
The presence of lactic acid bacteria had no continuity. In marily responsible for conducting it [32].
2008 no bacteria were isolated from either the air or the The total number of yeasts isolated and identified in
grapes. In 2009 there was only bacterial growth on the 2008 was 176 (46 from the air and 130 from the clusters),
clusters in 2 out of five samplings, 2nd and 4th, with and 126 (14 from the air and 112 from the clusters) in
the equivalent of a concentration of 17 and 32 cfu/g, 2009. In this latter year, the number of yeast colonies
respectively. In the air, a bacteria was only isolated in the isolated in the air was lower than in 2008 (14 as against
4th sample and another in the 5th, representing a bacterial 46). Of the 14 colonies, 3 came from the third sampling, 4
load in both cases of 5 MPN/10 m3. Fugelsang et al. [27] from the fourth and 7 from the last. The weather conditions
indicated that lactic acid bacteria are present in vineyards; of this second year (Table 1) and the smaller yeast popu-
however, given their nutritional requirements, species lations on the clusters (Fig. 1a) could account for the lower
diversity and population density are limited (undamaged total number of colonies isolated from the air. In the first
fruits contain \103 cfu/g). In previous studies, Bae et al. two samples taken in 2009, no yeasts were detected in the
[28] also found very low populations of lactic acid bacteria air, which coincided with temperatures of over 30 °C in the
from the grapes and only a few samples of damaged grapes vineyard. Previously, Magyar et al. [33] demonstrated that
gave isolation of lactic acid bacteria when analyzed by meteorological circumstances affected to the biodiversity
direct plate culture. No references to lactic acid bacteria of air spora in an Italian vineyard.
present in the air of the vineyard have been found, although The population of yeasts present, both on the clusters
Yanagida et al. [29] isolated these microorganisms from and in the air, is dominated by the species Aureobasidium
samples of soil, so that they may become airborne attached pullulans throughout the period studied (Figs. 2, 3). It is
to dust particles or insects, as has already been shown to present in practically all the samples in high percentages.
occur in the case of yeasts [3]. Griffin et al. [30] demon- This makes it the main yeast in the vineyard despite
strated that dust particles can serve as a vessel for the playing absolutely no part in fermentation or vinification
dispersion of bacteria and fungi. However, and despite the processes. This yeast is considered as black yeast-like
low number of isolations, in the present work, populations fungus and is the most widespread sporophyte in the
123
Eur Food Res Technol (2011) 233:359–365 363
A A
100% 100%
90% 90%
80%
80%
70%
60% 70%
50% 60%
40% 50%
30%
40%
20%
30%
10%
0% 20%
4 3 2 1 0
10%
Weeks before harvest
0%
4 3 2 1 0
B Weeks before harvest
100%
90%
B
80% 100%
70% 90%
60% 80%
50% 70%
40%
60%
30%
50%
20%
40%
10%
30%
0%
4 3 2 1 0 20%
Weeks before harvest 10%
Aureobasidium pullulans Candida spp Hanseniaspora uvarum
0%
Pichia kluyveri Kabatiella microsticta Sporotrix spp. 4 3 2 1 0
Rodosporidium babjevae
Weeks before harvest
Aureobasidium pullulans Candida spp Hanseniaspora uvarum
Fig. 2 Percentage of yeast species isolated on grape clusters (a), and Saccharomyces cerevisiae Acremonium strictum
in vineyard air (b) during the weeks before 2008 harvest
Fig. 3 Percentage of yeast species isolated on grape clusters (a), and
in vineyard air (b) during the weeks before 2009 harvest
phyllosphere. Sabaté et al. [34] found this yeast in vineyard
soil and in vine plant substrates (bark, leaves and grapes).
Together with A. pullulans, other yeast species that species in grapes mainly at the first stage of grape devel-
appear continuously both in the air and on the grapes are opment. Prakitchaiwattana et al. [37] found it especially in
Candida spp., and to a lesser degree, Hanseniaspora uva- Chardonnay grapes. Kabatiella microsticta is a species
rum. These two yeasts among others are commonly found closely associated with A. pullulans (it used to be called
on the surface of grapes [35, 36]. Candida spp. was Aureobasidium microstictum) [38]. Sporothrix spp is a
detected on the clusters and in the air in both years, but in thermally dimorphic fungus that can be found worldwide.
2009 on the clusters it was found in only small quantities The species is present in soil and in plant material. Con-
and only on ripe grapes. H. uvarum was not detected in the sequently, its presence in the vineyard air is not surprising.
air in 2008 and appeared on the grapes in the last sample, Something similar could happen with the endophytic fun-
similarly when the grapes were already ripe. gus Acremonium. This end fungus was isolated from
Some yeasts were only detected in samples isolated grapevine material (leaves) in previous works [39]. In the
from clusters in 2009 (S. cerevisiae and Acremonium air in 2008, the Pichia yeast appears in the third sample;
strictum) and others only in the air in 2008 (Rhodospori- however, it is not detected in the clusters examined at that
dium babjevae, Sporothrix spp, Kabatiella microsticta and same point in time. It could have been carried in the air
Pichia kluyveri). These differences were perhaps also from another neighboring cluster. In the same way, on the
caused by the atmospheric conditions in each year which 2009 clusters, Candida spp appeared at the end although it
encouraged the evolution of certain particular species. The is not present in the air.
detection in only one of the media (air or grape clusters) Fleet et al. [22] indicated that small populations of
may have been due to the fact that they were there in such yeasts are found in air, with Sporobolomyces spp. being the
low quantities. R. babjevae appeared in the air at the end of most significant. Species of Kloeckera, Torulopsis and
ripening in 2008. However, Renouf et al. [36] detected this Cryptococcus have also been isolated from air samples
123
364 Eur Food Res Technol (2011) 233:359–365
collected around vineyards and other horticultural regions number of yeasts isolated in the air during this study make it
[9]. Davenport [25] observed that most yeasts from the necessary to deepen knowledge of the microbiology of
vineyard air belonged to Sporobolomyces and Cryptococ- vineyard air and the role that this medium has in the dis-
cus spp. The results found in the Annual Report 2009/2010 semination, inoculation and contamination of grapes.
from the Fraunhofer Institute for Molecular Biology and
Applied Ecology (http://www.ime.fraunhofer.de) show that Acknowledgments This study has been undertaken with a grant
from the Government of La Rioja (R-08-08, R-06-09 and FOMENTA
the yeasts found in the air from a Pinot Noir vineyard were 2007/04 Projects).
Zygosaccharomyces florentinus, Metschnikowia pulcherr-
ima and Pichia burtonii. In a Chardonnay vineyard, the
yeasts found were M. pulcherrima, P. burtonii and Can- References
dida ylanoide. In the corresponding grapes, the only spe-
cies found were M. pulcherrima and P. burtonii. These data 1. Carrascosa AV, Muñoz R, González R (2005) Microbiologı́a del
indicated a certain correspondence between the yeasts vino. Ed AMV. Madrid, España
found in the two media at the time of the harvest, similar 2. Mortimer R, Polsinelli M (1999) On the origin of wine yeast. Res
Microbiol 150:199–204
results to the ones found in the current study where there 3. Parle JN, Di Mena ME (1966) The source of yeast in New
was a large coincidence between the yeasts identified in the Zealand wines. New Zeal J Agr Res 9:98–107
air and grape clusters at the moment of the harvest, espe- 4. Martini A (1993) Origin and domestication of the wine yeast
cially in 2009. Saccharomyces cerevisiae. J Wine Res 4(3):165–176
5. Benda I (1982) ‘‘Wine and brandy’’. Prescott and Dunns indus-
Different authors have published contradictory infor- trial microbiology, 4th edn. AVI Publishing Company, Westport
mation about the presence of S. cerevisiae in the vineyard. Connecticut, pp 306–308
In this work, yeasts of this species were found in the 6. Jolly NP, Augustyn OPH, Pretorius IS (2003) The ocurrence of
samples on clusters taken three and 2 weeks before the non-Saccharomyces cerevisiae yeast species over three vintages
in four vineyards and grape musts from four production regions
harvest in 2009 in different proportions (3 and 33%, of the Western Cape, South Africa. South Afr J Enol Vitic
respectively). Different studies on grapes demonstrated that 24(2):35–42
it only occurs in percentages below 0.1% of naturally 7. Vaughan-Martini A, Martini A (1995) Facts, myths and legends
occurring yeast biota, and, moreover, that they are not on the prime industrial microorganisms. J Ind Microbiol
14:514–522
systematically widespread on either all plants or all grapes 8. Fleet GH, Heard GM (1993) Yeasts—growth during fermenta-
[40–42]. Shuller et al. [43] obtained results that clearly tion. Wine microbiology and biotechnology. Hardwood Aca-
indicated that S. cerevisiae occurs in vineyard ecosystems demic Publishers, Chur, p 29
belonging to the Vinho Verde Region in sufficiently high 9. Adams AM (1964) Airborne yeasts from horticultural sites. Can J
Microbiol 10:641–646
numbers to conduct a spontaneous fermentation. Valero 10. Santamarı́a MP (2009) Ecologı́a de la fermentation alcohólica
et al. [11] demonstrated that the dissemination of com- espontánea en la D.O.Ca. Rioja. Selección de levaduras para la
mercial yeast S. cerevisiae in the vineyard is mainly elaboración de vinos tintos. Tesis doctoral. Universidad de La
favored by water runoff and from macerated grape skin Rioja
11. Valero E, Schuller D, Cambon B, Casal M, Dequin S (2005)
dumping sites and then different vectors, insects, wind and Dissemination and survival of commercial wine yeast in the
others. But in the present study, this yeast was not detected vineyard: a large-scale, three-years study. FEMS Yeast Res
in the air at any time, which does not allow us to state that 5:959–969
it could be disseminated in this way. Perhaps, the dis- 12. Garijo P, Santamarı́a P, López R, Sanz S, Olarte C, Gutiérrez AR
(2008) The occurrence of fungi, yeasts and bacteria in the air of a
semination of this species in the vineyard occurs princi- Spanish winery during vintage. Int J Food Microbiol 125:141–145
pally postharvest as showed the previous articles cited. 13. Garijo P, Santamarı́a P, Ocón E, López R, Sanz S, Olarte C,
Gutiérrez AR (2009) Presence of lactic acid bacteria in the air of
a winery during the vinification period. Int J Food Microbiol
136:142–146
Conclusions 14. López I (2004) Detección y control por técnicas de la Biologı́a
Molecular de bacterias lácticas autóctonas responsables de la
The two main microorganisms responsible for vinification fermentation maloláctica en vinos de D.O.Ca.Rioja. Tesis Doc-
(S. cerevisiae and O. oeni) were detected at some isolated toral. Universidad de La Rioja
15. Esteve-Zarzoso B, Belloch C, Uruburu F, Querol A (1999)
moment during maturation, but neither of them was detec- Identification of yeasts by RFLP analysis of the 5.8S rRNA gene
ted in the air. The majority of the non-Saccharomyces and the two ribosomal internal transcribed spacers. Int J Syst Bact
yeasts detected in the vineyard air (A. pullulans and Can- 49:329–337
dida spp.) are the same as those found on the clusters during 16. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and
direct sequencing of fungi ribosomal RNA genes for phyloge-
the ripening period, which could suggest that an exchange netics. In: Innis MA, Gelfalnd DH, Sninsky JJ, White TT (eds)
of microorganisms takes place between the media. How- PCR protocols. A guide to methods and applications. Academic
ever, the absence or low number of bacteria and the limited Press, San Diego, pp 315–320
123
Eur Food Res Technol (2011) 233:359–365 365
17. Ocón E (2005) Estudio de las levaduras no-Saccharomyces que gene as a target for PCR-DGGE analysis. Food Microbiol
participan en la elaboración de vinos de la D.O.Ca. Rioja. Trabajo 23:136–145
de Investigación, Programa de Doctorado en Ciencias Agrarias y 32. Pramateftaki P, Metaza M, Kallithraka S, Lanaridis P (2006)
Alimentarias. Universidad de La Rioja Evolution of malolactic bacteria and biogenic amines during
18. Guillamón JM, Sabaté J, Barrio E, Cano J, Querol A (1998) spontaneous fermentations in a Greek winery. Lett Appl Micro-
Rapid identification of wine yeast species based on RFLP anal- biol 43:155–160
ysis of the ribosomal internal transcribed spacer (ITS) region. 33. Magyar D, Frenguelli G, Bricchi E, Tedeschini E, Csontos P, De-
Arch Microbiol 169:387–392 Wei L, János B (2009) The biodiversity of air spora in an italian
19. Granchi L, Bosco M, Messini A, Vincenzini M (1999) Rapid vineyard. Aerobiologia 25:99–109
detection and quantification of yeast species during spontaneous 34. Sabate J, Cano J, Esteve-Zarzoso B, Guillamon JM (2002) Iso-
wine fermentation by PCR-RFLP analysis of the rDNA ITS lation and identification of yeasts associated with vineyard and
region. J Appl Microbiol 87:949–956 winery by RFPL analysis of ribosomal genes and mitochondrial
20. Kurtzman CP, Robnett CJ (1998) Identification and phylogeny of DNA. Microbiol Res 157:267–274
ascomycetous yeasts form analysis of nuclear large subunit (26S) 35. Pretorius IS, van der Westhuizen TJ, Augustyn OPH (1999) Yeast
ribosomal DNA partial sequences. Antonie van Leeuwenhoek biodiversity in vineyards and wineries and its importance to the
73:331–371 South African wine industry. A review. S Af Enol Vitic 20(2):
21. Van de Klundert JAM, Vliegenthart JS (1993) PCR detection of 61–74
genes coding for aminoglycoside-modifying enzymes. In: Diag- 36. Renouf V, Claisse O, Lonvaud-Funel A (2005) Understanding the
nostic molecular microbiology. Principles and applications. microbial ecosystem on the grape berry surface through numer-
American Society For Microbiology, Washington, DC, p 548 ation and identification of yeast and bacteria. Aust J Grape Wine
22. Fleet GH, Prakitchaiwattana CJ, Beh A, Heard GM (2002) The Res 11:316–327
yeast ecology of wine grapes. In: Ciani M (ed) Biodiversity and 37. Prakitchaiwattana CJ, Fleet GH, Heard GM (2004) Application
biotechnology of wine yeasts. Res Signpost, Kerala, pp 1–17 and evaluation of denaturing gradient gel electrophoresis to
23. Renouf V, Miot-Sertier C, Strehaiano P, Lonvaud-Funel A (2006) analyse the yeast ecology of wine grapes. FEMS Yeast Res
The wine microbial consortium: a real terroir characteristic. J Int 4:865–877
de la Vigne et du Vin 40:101–116 38. Zalar P, Gostincar C, de Hoog GS, Ursic V, Sudhadham M,
24. Curiel GJ, Van Eijk HMJ, Lelieveld HLM (2000) Risk and Gunde-Cimerman N (2008) Redefinition of Aureobasidium
control of airborne contamination. In: Robinson RK, Batt CA, pullulans and its varieties. Stud Mycol 61:21–38
Patel PD (eds) Encyclopedia of food microbiology. Academic 39. Burruano S, Alfonzo A, Lo Piccolo S, Conigliaro G, Mondello V,
Press, London, pp 1816–1822 Torta L, Moretti M, Assante G (2008) Interaction between
25. Davenport RR (1974) Microecology of yeasts and yeast-like Acremonium byssoides and Plasmapora vitı´cola in Vitis vinifera.
organisms associated with an English vineyard. Vitis 13:123–130 Phytopathol Mediterr 47(2):122–131
26. Longo E, Cansado J, Agrelo D, Villa G (1991) Effect of climatic 40. Mercado L, Dalcero A, Masuelli R, Combina M (2007) Diversity
conditions on yeast diversity in grapes musts from northwest of Saccharomyces strains on grapes and winery surfaces: analysis
Spain. Am J Enol Vitic 42:141–144 of their contribution to fermentative flora of Malbec wine from
27. Fugelsang KC, Edwards ChG (2007) Wine microbiology. Prac- Mendoza (Argentina) during two consecutive years. Food
tical applications and procedures. Springer, NY, p 88 Microbiol 24:403–412
28. Bae S, Fleet GH, Heard GM (2006) Lactic acid bacteria associ- 41. Török T, Mortimer RK, Romano P, Suzzi G, Polsinelli M (1996)
ated with wine grapes from several Australian vineyards. J Appl Quest for wine yeasts—an old story revisited. J Ind Microbiol
Microbiol 100:712–727 17:303–313
29. Yanagida F, Srionnual S, Chen YS (2008) Isolation and charac- 42. Van der Westhuizen TJ, Augustyn OHP, Pretorius IS (2000)
teristics of lactic acid bacteria from koshu vineyards in Japan. Geographical distribution of indigenous Saccharomyces cerevi-
Lett Appl Microbiol 47:134–139 siae strains isolated from vineyards in the coastal regions of
30. Griffin DW, Kellogg ChA, Garrison VH, Lisle JT, Borden TC, western Cape in South Africa. South Afr J Enol Vitic 21:3–9
Shinn EA (2003) Atmospheric microbiology in the northern 43. Schuller D, Alves H, Dequin S, Casal M (2005) Ecological sur-
Caribbean during African dust events. Aerobiologia 19:143–157 vey of Saccharomyces cerevisiae strains from vineyards in the
31. Renouf V, Claisse O, Miot-Sertier C, Lonvaud-Funel A (2006) Vinho Verde Region os Portugal. FEMS Microbiol Ecol
Lactic acid bacteria evolution during winemaking: use of rpoB 51:167–177
123
Capítulo 5
Discusión
Discusión
139
Discusión
140
Discusión
141
Discusión
142
Discusión
143
Discusión
144
Discusión
145
Discusión
salida del depósito, prensa, bomba de trasiego, suelo y pared de la bodega), fue
mayor que la de Saccharomyces, lo que contrdijo lo apuntado por otros autores
(Rosini, 1984; Pretorius, 2000; Beltrán et al., 2002), que mostraron a la especie S.
cerevisiae como la principal colonizadora de las superficies de la bodega, aunque
estuvo de acuerdo con lo observado por otros investigadores (Ciani et al., 2004;
Santamaría et al., 2005, 2008; Ocón et al., 2010b). El análisis de las superficies se
llevó a cabo antes de que se iniciara la entrada de uva esa campaña, y en ese
momento las levaduras aisladas en el aire también fueron todas No-Saccharomyces.
Al comparar las cepas de S. cerevisiae identificadas en las instalaciones con las
aisladas en el aire de la zona de recepción y elaboración de la bodega y en los
depósitos en fermentación, se encontraron varios clones comunes, lo que vino a
confirmar el intercambio de microorganismos entre estos medios. De los 26 clones
de S. cerevisiae identificados en el aire de la zona de elaboración, dos se
encontraron también en el aire de la zona de recepción y cuatro en las instalaciones
de la bodega. Asimismo, diez de ellos también se detectaron en los aislados
obtenidos de los mostos en fermentación. A la vista de estos resultados, puede
concluirse que se produjo un intercambio de cepas de S. cerevisiae entre el medio
líquido (mosto/vino), el gaseoso (aire) y las superficies de la bodega.
146
Discusión
147
Discusión
Todas las bacterias aisladas en el aire antes del inicio de las fermentaciones
malolácticas pertenecieron al grupo de las BL (Pediococcus pentosaceus y
Leuconostoc mesenteroides), pero no a la especie Oenococcus oeni. Sin embargo, a
partir del inicio de la FML en los depósitos, todas las bacterias aisladas en el aire
pertenecieron a la especie O. oeni. Lo descrito en el aire fue reflejo de lo que estaba
ocurriendo simultáneamente en los depósitos. Así, todas las bacterias aisladas en
los depósitos con mosto-vino y en el aire durante la FA (antes de que se iniciara la
FML en ningún depósito) fueron BL, pero no pertenecieron a la especie O. oeni.
Sin embargo, una vez iniciada la FML, todos los aislados de BL de los vinos y del
aire pertenecieron a dicha especie. Por lo tanto, los datos de BL obtenidos en el aire
y en los depósitos de vinificación estarían totalmente relacionados, así las cepas de
O. oeni, verdaderos agentes de la fermentación maloláctica (Pramateftaki et al.,
2006; Renouf et al., 2006; Ruiz et al., 2008), aparecieron simultáneamente en
ambos medios y en proporciones idénticas (100%) cuando se desarrollaron las
fermentaciones malolácticas en los depósitos. Por el contrario, cuando no hubo
148
Discusión
En esta bodega, que nunca ha usado cepas comerciales de BL, parece que
hay varios clones autóctonos de O. oeni que aparecen de forma más o menos
continua en los vinos durante la FML y en el aire. La importancia de estas cepas en
cada momento y el número y proporción de otras cepas que les acompañan,
estarían determinados por las diferentes características de los vinos que se elaboran
en cada depósito, que hacen que se adapten mejor unas que otras (Landete, 2005;
149
Discusión
Krieger, 2006; Renouf et al., 2006a). Las cepas presentes en el líquido pasarían al
aire y de esta forma se podrían diseminar por la bodega pudiendo caer sobre otros
vinos y así inocularlos. Su desarrollo posterior en ellos estaría condicionado por su
mayor o menor adaptación a las condiciones del nuevo vino. Este intercambio
continuo entre ambos medios explicaría la presencia de cepas comunes de O. oeni
en ambos medios y su diferente proporción a lo largo del período estudiado.
Los resultados de este segundo trabajo parecen confirmar el papel del aire
como elemento diseminador de los microorganismos que participan en la
vinificación en las bodegas. En el trabajo anterior se constató la dispersión de
levaduras durante la FA por esta vía, y ahora se concluye que esta hipótesis
también es válida para explicar la dispersión en la bodega de las BL. Los datos
obtenidos indicaron la presencia simultánea de las mismas especies y cepas de BL
en el aire de la bodega y en los depósitos de vinificación. Este resultado indicaría
intercambio de bacterias entre ambos medios y sugeriría al aire como elemento
diseminador de estos microorganismos en la bodega, ligado a la FML y a los
momentos de manipulación/trasiego del líquido. Esta hipótesis sugiere la
posibilidad de que durante las manipulaciones también se puedan diseminar a
través del aire otros microorganismos “alterantes” relacionados con la vinificación
y conservación de los vinos. No obstante, el bajo número de bacterias aisladas en el
aire en algunos momentos de este trabajo, y el hecho de que sea el primer estudio
conocido sobre el tema hasta este momento, hace necesario ampliar conocimientos
sobre la microbiología del aire de las bodegas y el papel de este medio como vía de
propagación, inoculación o contaminación de mostos y vinos.
150
Discusión
151
Discusión
UFC/100 g). Estas diferencias cuantitativas, que se mantuvieron los dos años del
estudio, pudieron deberse a las condiciones climatológicas en las que se realizaron
los muestreos ya que no hubo vientos fuertes ni lluvias intensas durante los
muestreos que pudieran provocar movimientos vigorosos del material vegetal y el
paso de los microorganismos al aire. En los dos trabajos expuestos anteriormente
en esta memoria, también se detectó menor cantidad de microorganismos en el aire
respecto al líquido en el que estaban fermentando, y se indicó que la presencia y
detección de microorganismos en cantidades elevadas en el aire de la bodega
estuvo muy ligada a la manipulación del vino que los contenía. Los bajos niveles
de levaduras en el aire del viñedo pueden compararse con los detectados en el
trabajo anterior para las bacterias lácticas en el aire de la bodega (4 NMP/m 3) en
momentos de escasa actividad maloláctica. En dicho trabajo sólo se alcanzaron
poblaciones elevadas de bacterias en el aire al manipular el líquido al final de la
fermentación, lo que indica que hace falta no sólo mover con intensidad el material,
sino también que éste contenga una carga elevada de microorganismos para
evidenciarlos en gran cantidad en el aire. En el presente estudio, la menor
concentración de levaduras en los racimos respecto a depósitos en fermentación,
unido al hecho de que en las bodegas haya mayor acumulación de
microorganismos en el ambiente que en el campo, donde la renovación del aire es
constante, explicaría las menores cantidades medias de microorganismos
detectados en el aire del viñedo respecto al aire de las bodegas.
152
Discusión
Candida spp. y en menor medida Hanseniaspora uvarum. Estas dos levaduras son
habituales en la superficie de las uvas y en el inicio de la FA (Pretorius et al.,
1999). Hubo otras especies que se detectaron de forma esporádica sólo en una de
las campañas, sólo en los racimos ó sólo en el aire. Estas diferencias quizás
estuvieron provocadas por las condiciones ambientales de ambos años que
favorecieron el desarrollo de algunas especies en particular. La detección en uno
solo de los medios (aire o racimos) pudo deberse a la baja cantidad en que se
encontraban. En la única cita bibliográfica encontrada (Annual Report 2009/2010
www.ime.fraunhofer.de) que hace referencia a un trabajo similar a éste, se
obtuvieron datos que indicaron correspondencia entre las levaduras halladas en
ambos medios en el momento de la vendimia, resultados similares a los
encontrados en el presente trabajo donde la mayor coincidencia en las levaduras
identificadas entre racimos y aire fue en el momento de la vendimia, especialmente
en el segundo año de estudio.
153
Discusión
154
Capítulo 6
Conclusiones
Conclusiones
Conclusión general
La carga microbiológica del aire de la bodega es indicativa de los procesos
que tienen lugar en ella y existió un intercambio de microorganismos entre el
medio líquido (mosto/vino), el sólido (instalaciones) y el gaseoso (aire). Asimismo,
las manipulaciones del líquido fueron una fuente importante de proyección de
microorganismos al ambiente. Sin embargo, en el viñedo estas conclusiones no
fueron tan claras.
Conclusiones parciales
157
Conclusiones
158
Conclusiones
Consideración final
159
Bibliografía
Bibliografía
Andorrá, I., Berradre, M., Rozès, N., Mas, A., Guillamón, J.M.,
Esteve-Zarzoso, B. (2010). Effect of pure and mixed cultures of the main
wine yeast species on grape must fermentations. European. Food Research
and Technology, 231, 215-224.
Arena, M.P., Romano, A., Capozzi, V., Beneduce, L., Ghariani, M.,
Grieco, F., Lucas, P., Spano, G. (2011). Expression of Lactobacillus
brevis IOEB 9809 tyrosine decarboxylase and agmatine deiminase genes in
wine correlates with substrate availability. Letters in Applied
Microbiology, 53, 395-402.
Azzolini, M., Fedrizzi, B., Tosi, E., Finato, F., Vagnoli, P., Scrinzi, Ch.,
Zapparoli, G. (2012). Effects of Torulaspora delbrueckii and
Saccharomyces cerevisiae mixed cultures on fermentation and aroma of
Amarone wine. European Food Research and Technology, 235, 303-313.
163
Bibliografía
Bae, S., Fleet, G.H., Heard, G.M. (2006). Lactic acid bacteria associated
with wine grapes from several Australian vineyards. Journal of Applied
Microbiology, 100(4), 712–727.
Beech F.W., (1993). Yeast in cider-making. In: Harrison, Rose (Eds.). The
yeast, Vol. 5, 2 nd edition. Ed. Academic Press, London, pp. 169-213.
Beltrán, G., Torija, M.J., Novo, M., Ferrer, N., Poblet, M., Guillamón,
J.M., Rozès, N., Mas, A. (2002). Analysis of yeast populations during
alcoholic fermentation: a six year folow-up study. System Applied
Microbiology, 25, 287-293.
Benda, I. (1982). Wine and Brandy.In: Reed, G (Ed), Prescott and Dunn´s.
Industrial Microbiology, 4th edition. Ed. AVI Publishing Company,
Westport, Connecticut, pp 306-308.
164
Bibliografía
Bellí, N., Marín, S., Duaigues, A., Ramos, A. J., Sanchís, V: (2004).
Ochratoxin A in wines, musts and grape juices from Spain. Journal of the
Science of Food and Agriculture, 84, 591-594.
Birren, B., Lai, E. (1993). Preparation of DNA for pulsed field analysis.
In: Hartcourt Brace Jovanich (Ed.) Pulsed Gel Electrophoresis. A Practical
Guide. Ed. Academic Press, San Diego, pp 25-74.
Carlile, M.J., Watkinson, S.C., Gooday, G.W. (2001). The Fungi (2ª
Edition). Ed. Academic Press. Londres, Reino Unido.
Combina, M., Mercado, L., Borgo, P., Elia, A., Jofré, V., Ganga, A.,
Martínez, C., Catania, C. (2005). Yeasts associated to Malbec grape
berries from Mendoza, Argentina. Journal of Applied Microbiology, 98(5),
1055-1062.
165
Bibliografía
Comitini, F., Gobbi, M., Domizio, P., Romani, C., Lencioni, L.,
Mannazzu, I., Ciani, M. (2011). Selected non-Saccharomyces wine yeasts
in controlled multistarter fermentations with Saccharomyces cerevisiae.
Food Microbiology, 25, 778-785.
Connell, L., Stender, H., Edwards, C.G., (2002). Rapid detection and
identification of Brettanomyces from winery air samples based on peptide
nucleic acid analysis. American Journal of Enology and Viticulture, 53,
322–324.
Constantí, M., Poblet, M., Arola, L., Mas, A., Guillamón, J.M. (1997).
Analysis of yeasts populations during alcoholic fermentation in a newly
established winery. American Journal of Enology and Viticulture, 48, 339-
344.
Curiel, G.J., Van Eijk, H.M.J., Lelieveld, H.L.M., (2000). Risk and
control of airborne contamination. In: Robinson, R.K., Butt, C.A., Patel,
P.D. (Eds.), Encyclopedia of Food Microbiology. Ed. Academic Press,
London, pp. 1816–1822.
166
Bibliografía
Fleet, G.H. (2008). Wine yeasts for the future. FEMS Yeast Research, 8,
979–995.
167
Bibliografía
Fleet, G.H., Heard, G.M. (1993). Yeast: growth during fermentation. In:
Wine microbiology and biotechnology. Ed. Harwood Academic Publishers,
Switzerland, pp. 27-54.
Fleet, G.H., Prakitchaiwattana, C.J., Beh, A., Heard, G.M. (2002). The
yeasts ecology of wine grapes. In: Biodiversity and Biotechnology of wine
yeasts. Ed. Res Signpost, Kerala, pp 1-17.
González, L., López, R., Santamaría, P., Tenorio, C., López, I. (2012).
Dynamics of indigenous lactic acid bacteria populations in wine
fermentetions from La Rioja (Spain) during three vintages. Microbial
Ecology, 63(1), 12-19.
168
Bibliografía
Guillamón, J.M., Sabaté, J., Barrio, E., Cano, J., Querol, A. (1998).
Rapid identification of wine yeast species based on RFLP analysis of the
ribosomal internal trnscribed spacer (ITS) region. Archives of
Microbiology, 169, 387-392.
Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T., Willians S.T.
(1994). Bergey´s manual of determinative bacteriology. (Ed.) W.R. Hensyl,
9th edition, Ed. Willians and Wilkins, Baltimore, Md. USA.
Izquierdo, P.M., Ruiz, P., Seseña, S., Palop, M.Ll. (2009). Ecological
study of lactic acid microbiota isolated from Tempranillo wines of Castilla
La Mancha. Journal of Bioscience and Bioengineering, 108(3), 220-224.
169
Bibliografía
Kurtzman, C.P. y Fell, J.W. (1998). The yeasts, a taxonomic study 4th
edition. Ed. Elsevier Science, Amsterdam.
Logrieco, A.F., Ferracane, R., Cozzi, G., Haidukowsky, M., Susca, A.,
Mulè, G., Ritieni, A. (2011). Fumonisin B2 by Aspergillus niger in the
170
Bibliografía
Lopandic. K., Tiefenbrunner, W., Gangl, H., Mandl, K., Berger, S.,
Leitner, G., Abd-Ellah, G.A., Querol, A., Gardner, R.C., Sterflinger,
K., Prillinger, H. (2008). Molecular profiling of yeasts isolated during
spontaneous fermentations of Austrian wines. FEMS Yeast Research, 8,
1063–1075.
López, I., Tenorio, C., Zarazaga, M., Dizy, M., Torres, C., Ruiz-
Larrea, F. (2007). Evidence of mixed wild populations of Oenococcus
oeni strains during wine spontaneous malolactic fermentations. European
Food Research and Technology, 226, 215-223.
López, I., López, R., Santamaría, P., Garijo, P., Tenorio, C. (2007).
Aminas biógenas en vinos de la D.O.Ca. Rioja de la cosecha 2006. En:
Actas XIII Congreso Nacional de Enólogos. Logroño, La Rioja (España).
171
Bibliografía
López, I., Mangado, A., López, R., Santamaría, P., Garijo, P.,
Gutiérrez, A.R., Tenorio, C. (2008). Estudio de la biodiversidad de
bacterias lácticas presentes en un vino tinto. En: Actas 31. Congreso
Mundial de la OIV, Verona (Italia), p. 309.
Mas, A., Hierro, N., Guillamón, J.M., González, A., Poblet, M., Rozès,
N. (2004). Nuevas técnicas de identificación, detección y cuantificación de
levaduras de importancia en enología. Tecnología del vino, 15, 65-72.
Melki Ben Fredj, S., Chebil, S., Lebrihi, A., Lasram, S., Ghorbel, A.,
Mliki, A. (2007). Occurrence of pathogenic fungal species in Tunisian
vineyards. International Journal of Food Microbiology, 113, 245-250.
172
Bibliografía
Moreira, N., Mendes, F., Guedes de Pinho, P., Hogg, T., Vasconcelos, I.
(2008). Heavy sulphur compounds, higher alcohols and esters production
profile of Hanseniaspora uvarum and Hanseniaspora guilliermondii grown
as pure and mixed cultures in grape must. International Journal of Food
Microbiology, 124(3), 231–238.
Ocón, E., Gutiérrez, A.R., Garijo, P., Tenorio, C., López, I., López, R.,
Santamaría, P. (2010a). Quantitative and qualitative analysis of non-
Saccharomyces yeasts in spontaneous alcoholic fermentations. European
Food Research and Technology, 230, 885-891.
Ocón, E., Gutiérrez, A.R., Garijo, P., Santamaría, P., López, R.,
Olarte, C., Sanz, S. (2011). Factors of influence in the distribution of mold
in the air in a wine cellar. Journal of Food Science, 76(3), 169-174.
Ocón, E., Garijo, P., Sanz, S., Olarte, C., López, R., Santamaría, P.,
Gutiérrez, A.R. (2013a). Analysis of airborne yeast in one winery over a
period of one year. Food Control, 30, 585-589.
Ocón, E., Garijo, P., Sanz, S., Olarte, C., López, R., Santamaría, P.,
173
Bibliografía
Ocón, E., Gutiérrez, A.R., Garijo, P., Santamaría, P., López, R.,
Olarte, C., Sanz, S. (2013c). Influence of age and design in the
distribution of molds in the air in three wine cellars. Food Control (In
press).
Pan, W., Jussier, D., Terrade, N., Yada, R.Y., Mira de Orduña, R.
(2011). Kinetics of sugar, organic acids and acetaldehyde during
simultaneous yeast-bacterial fermentations of white wine at different pH
values. Food Research International, 44, 660-666.
Parle, J.N., Di Mena, M.E. (1966). The source of yeast in New Zealand
wines. New Zealand Journal of Agricultural Research, 9, 98-107.
Patiño, B., Vázquez, C., González- Salgado, A., Gil, J., González-Jaén,
M.T. (2007). PCR: Una herramienta estratégica para la prevención de
OTA en vinos. Simposio Internacional de Microbiología y Seguridad
Alimentaria del Vino, "Microsafetywine". Villafranca del Penedés
(Barcelona).
174
Bibliografía
Pretorius, I.S., (2000). Tailoring wine yeast for the new millennium: novel
approaches to the ancient art of winemaking. Yeast, 16, 675-729.
175
Bibliografía
Rantsiou, K., Dolci, P., Giacosa, S., Torchio, F., Tofalo, R., Torriani,
S., Suzzi, G., Rolle, L., Cocolin, L. (2012) Candida zemplinina can reduce
acetic acid produced by Saccharomyces cerevisiae in sweet wine
fermentations. Applied and Environmental Microbiology, 78 (6), 1987-
1994.
Raspor, P., Milek, D. M., Polanc, J., Možina, S.S., Čadež, N. (2006).
Yeast isolated from three varieties of grapes cultivated in different
locations of the Dolenjska vine-growing region, Slovenia. International
Journal of Food Microbiology, 109, 97-102.
176
Bibliografía
Rosa, C.A., Palacios, V., Combina, M., Fraga, M.E., Rekson, A.,
Magnoli, C.E., Dalcero, A.M. (2002). Potential Ochratoxin A producers
from wine grapes in Argentina and Brazil. Food Additives and
Contaminants, 19, 408–414.
Rosini, G., Federici, F., Martini, A. (1982). Yeast flora of grape berries
during ripening. Microbial Ecology, 8(1), 83-89.
Ruiz, P., Izquierdo, P., Seseña, S., Fernández, M., Palop, M.L. (2008).
Ecological study of lactic microbiota isolated from malolactic fermentation
of Cencibel (cv) wines from cellars of Castilla-La Mancha. Actas 31
Congreso Mundial de la OIV, Verona (Italia). II.B. 3 pp. 300.
Sabate, J., Cano, J., Querol, A., Esteve-Zarzoso, B., Guillamón, J.M.
(2002). Isolation and identification of yeast associated with vineyard and
winery by RFLP analysis and ribosomal genes and mitochondrial DNA.
Microbiological Research, 157, 267-264.
177
Bibliografía
Santamaría, P., Garijo, P., López, R., Tenorio, C., Gutiérrez, A.R.
(2005). Analysis of yeast population during spontaneous alcoholic
fermentation: effect of the age of the cellar and the practice of inoculation.
International Journal of Food Microbiology, 103, 49–56.
Santamaría, P., Garijo, P., López, R., Gutiérrez, A.R. (2007). Análisis
sobre el número óptimo de aislados para determinar la diversidad de
levaduras en la fermentación. Proceedings of Avances en Ciencias y
Técnicas Enológicas. Transferencia de Tecnología de la red GIENOL al
sector vitivinícola. ISBN: 978- 84-690-6060-5, pp. 19–21. Badajoz
(Spain).
Santamaría, P., López, R., López, E., Garijo, P., Gutiérrez, A.R.
(2008). Permanence of yeast inocula in the winery ecosystem and presence
in spontaneous fermentations. European Food Research and Technology,
227, 1563-1567.
178
Bibliografía
Schuller, D., Alves, H., Dequin, S., Casal, M. (2005). Ecological survey
of Saccharomyces cerevisiae strains from vineyards in the Vinho Verde
Region os Portugal. FEMS Microbiology Ecology, 51, 167-177.
Soden, A., Francis, I.L., Oakey, H., Henschke, P.A. (2000). Effects of
co-fermentation whith Candida stellata and Saccharomyces cerevisiae on
the aroma and composition of Chardonnay wine. Australian Journal of
Grape and Wine Research, 6, 21-30.
Stefanini, I., Dapporto, L., Legras, J.L., Calabretta, A., Di Paola, M.,
De Filippo, C., Viola, R., Capretti, P., Polsinelli, M., Turillazzi, S.,
Cavalieri, D. (2012). Role of social wasps in Saccharomyces cerevisiae
ecology and evolution. Proceedings of the National Academy of Sciences
of the United States of America, 109(33), 13398-13403.
179
Bibliografía
Tenorio, C., López, I., López, R., Santamaría, P., Garijo, P., Gutiérrez,
A.R. (2007). Estudio de biodiversidad y selección de bacterias lácticas en
vinos tintos de Rioja. IX Jornadas de los Grupos de Investigación
Enológica. Avances en Ciencias y Técnicas Enológicas. Transferencia de
Tecnología de la Red GIENOL al Sector vitivinícola. Ed. M. Ramírez y
col. Badajoz, pp. 28-30.
Torija, M.J., Rozès, N., Poblet, M., Guillamón, J.M., Mas, A. (2001).
Yeast population dynamics in spontaneous fermentations: comparison
between two different wine-producing areas over a period three years.
Antonie van Leeuwenhoek, 79, 345-35.
Valero, E., Schuller, D., Cambon, B., Casal, M., Dequin, S. (2005).
Dissemination and survival of commercial wine yeast in the vineyard: a
large-scale, three years study. FEMS Yeast Research, 5, 959-969.
Valero, E., Cambon, B., Schuller, D., Casal, M., Dequin, S. (2007).
Biodiversity of Saccharomyces yeast strains from grape berries of wine-
producing areas using starter commercial yeasts. FEMS Yeast Research, 7,
317-329.
180
Bibliografía
Viana, F., Gil, J.V., Genovés, S., Vallés, S., Manzanares, P. (2008).
Rational selection of non-Saccharomyces wine yeast for mixed starters
based on ester formation and enological traits. Food Microbiology, 25(6),
778-785.
Vihavainen, E., Lundström, H.S., Susiluoto, T., Koort, J., Paulin, L.,
Auvinen, P., Björkroth, K.J. (2007). Role of Broiler carcasses and
processing plant air in contamination of modified-atmosphere-packaged
broiler products with psychrotrophic lactic acid bacteria. Applied and.
Environmental Microbiology, 73, 1136–1145.
White, T.J., Bruns, T., Lee, S., Taylor, J. (1990). Amplification and
direct sequencing of fungi ribosomal RNA genes for phylogenetics. In:
Innis MA, Gelfalnd DH, Sninsky JJ, White TT Eds. PCR protocols. A
guide to methods and applications.Ed. Academic Press, San Diego, pp 315-
320.
Zalar, P., Gostinčar, C., de Hoog, G.S., Uršič, V., Sudhadam, M.,
Gunde-Cimerman, N. (2008). Redefinition of Aureobasidium pullulans
and its varieties. Studies in Mycology, 61, 21-38.
Zapparoli, G., Torriani, S., Pesente, P., Dellaglio, F. (1998). Design and
evaluation of malolactic enzyme gene targeted primers for rapid
identification and detection of Oenococcus oeni in wine. Letters in Applied
Microbiology, 27, 243-246.
181
Bibliografía
Zott, K., Thibon, C., Bely, M., Lonvaud-Funel, A., Dubourdieu, D.,
Masneuf-Pomarede, I. (2011). The grape must non-Saccharomyces
microbial community: Impact on volatile thiol release. International
Journal of Food Microbiology, 151, 210-215.
182