Está en la página 1de 8

Instituto Inmaculada Concepcin Valdivia

Departamento de Ciencias y Educacin Tecnolgica


Biologa

GUIA DE APRENDIZAJE DE BIOLOGIA IV AO E.M.

Objetivos
Capacidad: Razonamiento Lgico, Analizar
Destrezas.: Expresar, Identificar, Interpretar, Describir, Determinar
VALOR: Verdad Actitud: Honestidad
Contenido: Transcripcin del ADN
El flujo de la informacin gentica en las clulas normalmente es:
ADN ARN Protena
La sntesis de ARN usando un ADN patrn es llamada transcripcin, mientras que la
sntesis de protena a partir de un ARN patrn es llamado traduccin.

Clases de ARN.
Existen tres clases de ARN:
-

ARN mensajero (mARN)


ARN de transferencia(tARN)
ARN ribosomal (rARN)

En general, todos estos ARN son de hebra simple, pero el ARN de transferencia y
ARN ribosomal, contienen extensas regiones de doble hlice (la cadena de
nucletidos se dobla formando una horquilla o loop).
Los ARN ms pequeos son los tARNs, que contienen alrededor de 75 nucletidos,
mientras que el ms grande esta entre los mARN, que pueden tener ms de 5.000
nucletidos.
Ribosmico (rRNA): los diversos rRNA, junto con sus protenas asociadas, constituyen
los ribosomas que intervienen en la sntesis proteica. Representa el 70% del RNA
celular; mientras que sus precursores (45S), presentes en el ncleo representan el 5%
del RNA celular.
- Mensajero (mRNA): las diferentes secuencias de los nucletidos que constituyen los
mltiples mRNA de la clula determinan las cadenas polipeptdicas que se sintetizarn
en los ribosomas. La proporcin de mRNA vara mucho dependiendo del tipo decelula y
momento funcional. Por trmino medio representa el 3% del RNA celular y sus
precursores (hnRNA) el 7%. Cuando lleva la informacin para una sola protena, se
denomina monocistrn, y policistrn, si lleva informacin para ms.
- De transferencia (tRNA): los diversos tRNA transportan los diferentes aminocidos
hacia los ribosomas en la sntesis proteica. Constituyen el 15% del RNA celular.

Enzima de la sntesis
Todos los ARN celulares son sintetizados por la ARN polimerasa de acuerdo a las
instrucciones dadas por un ADN-patrn (o molde), empleando ribonuclesido-5trifosfatos como sustrato. La direccin de la sntesis de ARN es 53, similar a la
sntesis de ADN.
Cuando una parte de la informacin contenida en la molcula de ADN debe ser
utilizada en el citoplasma de la clula para la construccin de las protenas, ella es
transcrita bajo la forma de una pequea cadena de cido ribonuclico: el ARN
mensajero (ARNm) utilizando las mismas correspondencias de base que el ADN visto
anteriormente, pero con la diferencia ya sealada de que la timina es reemplazada por
el uracilo. Uno a uno se van aadiendo los ribonucletidostrifosfato en la direccin 5a
3, usando de molde slo una de las ramas de la cadena de ADN y a la ARN polimerasa
como catalizador.
La operacin de trascripcin no puede tener lugar salvo que dos secuencias
particulares estn presentes en el ADN: la promotora al comienzo de la secuencia, que
es distinta en las eucariotas y en los procariotas, y la de corte propiamente dicha
-conocida como cola de poli A (compuesto de hasta 200 nucletidos de adenina)-, que
en las procariotas slo existe al final de la secuencia.
Transcripcin en Eucariontes
La maquinaria transcripcional de eucariontes es ms complejo que en procariontes.
Una importante consideracin es que en eucariontes superiores solamente una pequea
proporcin del genoma es expresada a ARN (cerca de 10% como mximo). Una
considerable proporcin del genoma de eucariontes existe permanentemente como
cromatina (ADN cromosomal) altamente condensada y es transcripcionalmente inerte.
Adicionalmente, hay protenas accesorias especficas llamadas FACTORES DE
TRANSCRIPCIN y son requeridos para una transcripcin eficiente de todos los
genes de eucariontes.
La secuencia de una transcripcin la podemos resumir en:
La RNA polimerasa se une al DNA en una secuencia especfica secuencia promotora o
promotor. Los promotores tienen secuencias de nucletidos definidas, como la cajas
"TATA" y "TTGACA". Los promotores se localizan en los extremos 5'-terminales de
los genes.
Se Abre la doble hlice en una pequea regin, por accin de la enzima Helicasa,
quedando expuestos los nucletidos de una secuencia corta de DNA. La ARN
polimerasa se une a las secuencias de dichos promotores iniciando el proceso de la
transcripcin.
La enzima aade nucletidos , desenrrollando la doble hlice y exponiendo as nuevas
regiones con las que se aparearn los ribonucletidos complementarios .

Despus de que en el ncleo se ha completado la transcripcin, los transcripto de RNA


(primarios) se modifican antes de abandonar el ncleo para unir el RNAm al ribosoma
y evitar su degradacin.

Algunas diferencias importantes que se pueden mencionar entre el proceso de


transcripcin del mRNA para procariotas y eucariotas son:
En procariotas las molculas de mRNA se producen directamente por transcripcin del
DNA, en eucariotas superiores, la mayor parte de los transcriptos sufren un
procesamiento posterior a la transcripcin (llamada splicing del DNA) antes de dejar
el ncleo o ingresar al citoplasma.
En procariotas, hay un nico tipo de RNA polimerasa que, en realidad, es un gran
complejo multienzimtico asociado con varias protenas que participan en diferentes
momentos de la transcripcin.
La RNA polimerasa a diferencia de la DNA polimerasa , no requiere cebador para
comenzar la sntesis de RNA , ya que es capaz de iniciar una nueva cadena uniendo dos
ribonucletidos.
Se sabe que solo una de las cadenas es transcripta por cada gen. Qu es lo que
indica a la RNA polimerasa cual secuencia copiar?. Se ha demostrado que la
responsable de esta decisin es la secuencia promotora cuya orientacin particular
apunta a la RNA polimerasa en la direccin en la que debe efectuar la sntesis.
El mRNA transcripto a partir del DNA es, entonces, la copia activa de la informacin
gentica. Incorporando las instrucciones codificadas en el DNA, el mRNA dicta la
secuencia de aminocidos en las protenas.

Trabajo con Alegra y honestidad

A continuacin con ayuda del texto gua y apuntes complementarios desarrolla


las siguientes estrategias
1. Expresar

en forma breve y precisa, el proceso

que representa la imagen

adjunta, utilizando vocabulario adecuado al subsector de biologa, trabajando


con honestidad.

2. Identificar la hebra complementaria del siguiente fragmento de DNA y el RNAm


que se obtiene a partir de ella completando dichas secuencias.

ACTCGCGTAAATCAGCCGCGG
TA

ADN COMPLEMENTARIO:
ARN MENSAJERO
:
3.- Identificar los conceptos que completan las siguientes textos referidos a la
transcripcin.

5'-3' - Elongacin polimerasa

Iniciacin -

Terminacin -

polimerasa - promotor

Maduracin

exones -

RNA-ligasa

intrones -

poli-A -

RNApoli-A

- ribonucleoprotena pequea nuclear

La transcripcin se lleva en las siguientes etapas:


1.- : La se une a una zona del DNA previa al DNA
que se quiere transcribir llamada ; a continuacin se corta la hebra de
DNA y se separan las dos cadenas, inicindose el proceso de copia del DNA a
transcribir; esta copia no requiere ningn cebador; los ribonucletidos se aaden en
sentido.. .
2.- : La RNA-polimerasa contina aadiendo ribonucletidos
complementarios al DNA hasta que se llega a una determinada secuencia que indica a
la polimerasa el final de la zona a transcribir.

3.-. : La transcripcin finaliza, y al RNA recin formado se le


aade una cola de unos 200 nucletidos de adenina, la cola de. ,
aadida por la enzima , que sirve para que el RNA no sea
destruido por las nucleasas celulares.
4.- de los productos de la trancripcin: Se da en el ncleo de
eucariotas y la realiza la enzima.

(RNPpn) eliminando

los del RNA, quedando los. libres para ser unidos


por una .

3.- Identificar cuales de los siguientes elementos participan en la transcripcin del


DNA y sealar su funcin. Trabaje con Honestidad.

Transcripcin DNA
Nucletidos trifosfato
Una molcula de DNA
DNA-polimerasa
RNA-ligasa
Helicasas

Poli-A polimerasa
Desoxirribonucletidos
Ribonucletidos
RNA-transferentes
RNA-ribosmicos
Ribonucleoprotena pequea
nuclear
RNA-polimerasa
4.- Interpretar la imagen adjunta sealando:
A. Lo que representa
B. Cul es el significado de la
informacin que proporciona.

5.

Interpretar

transcripcin

las

imgenes

respondiendo

de
las

siguientes preguntas en el espacio en blanco.

A.

A.

Qu sentido tiene la hebra de templado?

B. Cul es la funcin de la RNA polimerasa?

C. Cul es el sentido del transcripto?


D. Cul es la funcin del sitio activo?
E .De qu manera se relaciona la ADN polimerasa con la ARN polimerasa?

B: ACul es la secuencia de inicio y cul de


trmino?

C. Qu funcin realiza la enzima girasa?

d..Qu

estructuras

participan

en

este

proceso de transcripcin?

6.- Describir como es la


estructura de un gen en
eucariotas, a partir de la
siguiente
utilizando

imagen
los

conceptos

que corresponden.

7.- Determinar si en la imgen referida a la estructura de un gen existe algn


error, fundamentando la respuesta

8.-A

Determinar

qu

tipo

de

proceso

se

muestran en las

imgenes y el tipo de clula en la cual se realiza

fundamentando

la

respuesta.
B. Determinar lo que representan cada uno de los nmeros y letras

Se obtiene una muestra de DNA, se transcribe a mRNA y se purifica. Se


separan entonces las dos hebras del DNA y se analiza la composicin de bases
de cada hebra del DNA y del mRNA. Se obtienen los datos recogidos en la

mRNA

hebra DNA n. 1

19.1

26.0

31.0

23.9

hebra DNA n. 2

24.2

30.8

25.7

19.3

19.0

25.9

30.8

24.3

tabla de la derecha. Qu hebra del DNA es la hebra transcrita, que sirve como
molde para la sntesis del mRNA?

10. Interpretar tabla de datos experimentales para resolver el siguiente problema

11.- Determinar la respuesta al siguiente problema referido a la transcripcin del


DNA
La regin codificadora de un gen en eucariotas est formada por cuatro exones de 99,
75, 66 y 90 nucletidos y tres intrones, intercalados entre los exones, de 45, 63 y 42
nucletidos, respectivamente. Indicar: a) cuntos nucletidos tendr el ARN m
precursor; b) cuntos nucletidos tendr la regin que se traducir del ARN m maduro y
c) cuntos aminocidos tendr el pptido codificado.