Bases Genéticas de La Hipercolesterolemia Familiar en España: El Caso Particular de La Isla de Gran Canaria

UNIVERSIDAD DE LAS PALMAS DE GRAN CANARIA
Escuela de Doctorado
Departamento de Ciencias Clínicas
TESIS DOCTORAL
BASES GENÉTICAS DE LA HIPERCOLESTEROLEMIA

FAMILIAR EN ESPAÑA:
EL CASO PARTICULAR DE LA ISLA DE GRAN
CANARIA
Rosa María Sánchez Hernández

Las Palmas de Gran Canaria
2019
UNIVERSIDAD DE LAS PALMAS
DE GRAN CANARIA
Anexo I
D JUAN FRANCISCO LORO FERRER,

COORDINADOR DEL PROGRAMA DE DOCTORADO
INVESTIGACIÓN APLICADA A LAS CIENCIAS SANITARIAS, DE
LA ESCUELA DE DOCTORADO DE LA UNIVERSIDAD DE LAS
PALMAS DE GRAN CANARIA,
INFORMA,
Que la Comisión Académica del programa de doctorado Autoriza la

lectura de la tesis doctoral titulada “Bases genéticas de la
hipercolesterolemia familiar en España: el caso particular de la
isla de Gran Canaria” presentada por la doctoranda Dª Rosa María
Sánchez Hernández y dirigida por los Doctores Ana María Wägner
Fahlin y Mauro Boronat Cortés.
Y para que así conste, y a efectos de lo previsto en el Artº 11 del

Reglamento de Estudios de Doctorado (BOULPGC 7/10/2016) de la
Universidad de Las Palmas de Gran Canaria, firmo la presente en
Las Palmas de Gran Canaria, a 19 de junio de 2019.
LORO
FERRER JUAN
FRANCISCO -
Anexo II
UNIVERSIDAD DE LAS PALMAS DE GRAN CANARIA
ESCUELA DE DOCTORADO DE LA ULPGC
Departamento de Ciencias Clínicas
PROGRAMA DE DOCTORADO
INVESTIGACIÓN APLICADA A LAS CIENCIAS SANITARIAS
Título
Bases gené cas de la hipercolesterolemia familiar en España: el caso
par cular de la isla de Gran Canaria
Memoria que para optar al grado de Doctor por la Universidad de Las Palmas de Gran Canaria
presenta la licenciada
Rosa María Sánchez Hernández
Dirigida por los Dres. Ana Mª Wägner y Mauro Boronat Cortés
Los Directores La Doctorando
ROSA MARIA
Firmado por ANNA MARIA SANCHEZ
CLAUDIA
MAURO WÄGNER HERNANDEZ
Las Palmas de Gran Canaria, a 27 de Mayo de 2019
D. ANA MARÍA WÄGNER FAHLIN, PROFESORA TITULAR DE LA UNIVERSIDAD DE LAS PALMAS
DE GRAN CANARIA, DEPARTAMENTO DE CIENCIAS MÉDICAS Y QUIRÚGICAS, SERVICIO DE
ENDOCRINOLOGÍA Y NUTRICIÓN DEL HOSPITAL UNIVERSITARIO INSULAR DE GRAN CANARIA.
INFORMA:
Que el trabajo de investigación “Bases genéticas de la

titulado
hipercolesterolemia familiar en España: el caso particular de la isla de Gran Canaria”
ha sido realizado por Dña. Rosa María Sánchez Hernández, en el Departamento de Ciencias
Clínicas de la Universidad de Las Palmas de Gran Canaria, bajo su dirección y asesoramiento
técnico y científico, y que una vez revisada la presente Memoria, la encuentra apta para su
defensa ante tribunal.
Y para que así conste y surta los efectos oportunos, extiende el presente certificado en Las
Palmas de Gran Canaria a 27 de Mayo de 2019
ANNA MARIA
CLAUDIA
WÄGNER
La Directora
D. MAURO BORONAT CORTÉS, PROFESOR ASOCIADO DE LA UNIVERSIDAD DE LAS PALMAS
DE GRAN CANARIA, DEPARTAMENTO DE CIENCIAS MÉDICAS Y QUIRÚGICAS, SERVICIO DE
ENDOCRINOLOGÍA Y NUTRICIÓN DEL HOSPITAL UNIVERSITARIO INSULAR DE GRAN CANARIA.
INFORMA:
Que el trabajo de invesgación tulado “Bases gené$cas de la

hipercolesterolemia familiar en España: el caso par$cular de la isla de Gran Canaria” ,
ha sido realizado por Dña. Rosa María Sánchez Hernández , en el Departamento de Ciencias
Clínicas de la Universidad de Las Palmas de Gran Canaria, bajo su dirección y asesoramiento
técnico y cien+,co, y que una vez revisada la presente Memoria, la encuentra apta para su
defensa ante tribunal.
Y para que así conste y surta los efectos oportunos, exende el presente cer,cado en Las
Palmas de Gran Canaria a 27 de Mayo de 2019
El Director
Firmado por
MAURO
A mi familia
A Yeray
ÍNDICE
ABREVIATURAS ................................................................................................................... 17
ÍNDICE DE TABLAS Y FIGURAS ....................................................................................... 19
INTRODUCCIÓN ................................................................................................................... 21
1. Metabolismo de las lipoproteínas .................................................................... 21
2. Hipercolesterolemia familiar ............................................................................. 31
2.1. Definición y antecedentes históricos ........................................................................ 31
2.2. Etiología y patogénesis.................................................................................................... 33
2.3 Manifestaciones clínicas .................................................................................................. 48
2.4 Criterios diagnósticos ....................................................................................................... 58
2.5 Principios del tratamiento .............................................................................................. 65
2.6. Epidemiología de la HF. Poblaciones con aislamiento genético .................... 72
2.7. Programas de detección de la HF basados en el diagnóstico genético ....... 74
REFERENCIAS ....................................................................................................................... 79
OBJETIVOS ............................................................................................................................ 89
ARTÍCULOS PUBLICADOS................................................................................................. 91
JUSTIFICACIÓN DE LA UNIDAD TEMÁTICA DE LA TESIS........................................ 93
ARTÍCULOS ........................................................................................................................... 95
CONCLUSIONES FINALES ................................................................................................159
ANEXOS ................................................................................................................................161
15
16
ABREVIATURAS
ABCG5: transportador de casete de HCHOLA4: cuarto locus autosómico

unión al ATP G5 dominante o Hypercholesterolemia
ABCG8 transportador de casete de Autosomal Dominant 4
unión al ATP G8 HDL: lipoproteínas de alta densidad o
ACAT: Acil colesterol acil transferasa High Density Lipoprotein.
ACGS: Asociación de Ciencia de la HF: hipercolesterolemia familiar
Genética Clínica o Association for HFHe: hipercolesterolemia familiar
Clinical Genetic Science heterocigota
Apo: Apolipoproteína HFHo: hipercolesterolemia familiar
APOB: gen de la ApoB100 homocigota
APOE: gen de la ApoE HMG-CoA: hidroximetilglutaril
BDF: apoB defectuosa familiar coenzima A
CETP: proteína transferidora de ésteres IAM: infarto agudo de miocardio
de colesterol IAS: Sociedad Internacional de
c-HDL: colesterol unido a HDL Arterioesclerosis
c-LDL: colesterol unido a LDL ICAM-1: molécula de adhesión
ECV: enfermedad cardiovascular endotelial tipo 1
EGF: factor de crecimiento epidérmico IDL: lipoproteínas de densidad
EAS: Sociedad Europea de intermedia o Intermediate Density
Arterioesclerosis Lipoprotein.
EMA: Agencia Europea de iPCSK9: inhibidores de PCSK9
Medicamentos LCAT: lecitincolesterol aciltransferasa
FDA: Administración Federal de LDL: lipoproteínas de baja densidad o
Alimentos y Fármacos o Food and Low Density Lipoprotein
Drug Administration LDLR : receptor de LDL
GOF: ganancia de función LDLR: el gen del LDLR
HAR: hipercolesterolemia autosómica LDLRAP1: proteína adaptadora tipo 1
recesiva del LDLR
HCHOLA3: tercer locus autosómico LDLRAP1: gen del adaptador tipo 1 del
dominante o Hypercholesterolemia LDLR
Autosomal Dominant 3 LH: lipasa hepática
17
LPL: lipoproteín lipasa VLDL: lipoproteínas de muy baja
Lp(a): lipoproteína (a) densidad o Very Low Density
LPR: receptor hepático de apoE. lipoprotein
LOVD : Leiden Open Variation
Database
LXR: receptores X hepáticos
MCP-1: proteína quimiotáctica para
monocitos-1
MLPA: multiplex ligation-depent probe
amplification
MTP: proteína de transferencia
microsomal
NICE: National Institutes for Health
and Clinical Excellence
NPC1L1: proteína 1 similar a la
proteína C1 de Niemann-Pick,
Niemann-Pick C1-Like
PCSK9: la proteína subsilitina kexina
tipo 9
QM: quilomicrones
RCLH: Redes Clínicas de Lípidos
Holandesas
SEA: Sociedad Española de
Arterioesclerosis
SERB: elementos de respuesta a los
esteroles
SIFT: Sorting Intolerant From Tolerant
SR-AI: receptores del tipo scavenger
receptor A-I
STAP1: adaptador transductor de señal
tipo 1
VCAM-1: molécula de adhesión
vascular-1
18
ÍNDICE DE TABLAS Y FIGURAS
ÍNDICE DE TABLAS
Tabla 1. Tipos, localización y función de las apoproteínas. ……………………… 23
Tabla 2. Puntos de corte de c-LDL para la detección de HF con mayor sensibilidad y
especificidad en España. ………………………………………………………….. 46
Tabla 3. Criterios Simon Brome para el diagnóstico clínico de HF. …………….. 58
Tabla 4. Puntos de corte de colesterol total para el diagnóstico clínico de HF de la
escala MedPed. …………………………………………………………………… 59
Tabla 5. Criterios de las Redes Clínicas de Lípidos Holandesas para el diagnóstico
clínico de HF .….…………………………………………………………………. 59
ÍNDICE DE FIGURAS
Figura 1. Estructura de una lipoproteína …………………………………………21
Figura 2. Tipos de lipoproteínas ………………………………………………… 22
Figura 3. Papel de las lipoproteínas en el transporte de lípidos ………………… 26
Figura 4. Transporte reverso de colesterol ……………………………………….28
Figura 5. Estructura de la lipoproteína (a) ………………………………………. 29
Figura 6. Proteínas implicadas en la patogénesis de la HF……………………… 32
Figura 7. Estructura del LDLR ..………………………………………………… 36
Figura 8. Clases de mutaciones del LDLR ……………………………………… 39
Figura 9. Formas genéticas de la hipercolesterolemia familiar …………………. 45
Figura 10. Signos de HF: arco corneal y xantomas tendinosos …………………. 47
Figura 11. Xantelasmas en párpados ……………………………………………. 48
Figura 12. Xantomas cutáneos en un paciente con HFHo ………………………. 53
Figura 13. Posibles fenotipos de HF …………………………………………….. 55
Figura 14. Niveles de c-LDL según genotipo …………………………………... 56
Figura 15. Anticuerpos monoclonales inhibiendo la acción de PCSK9 …………65
Figura 16. Regresión completa de xantomas cutáneos tras 10 años de aféresis de LDL
…………………………………………………………………………………….68
Figura 17. Algoritmo de tratamiento de la HFHo ……………………………….69
19
20
INTRODUCCIÓN
1. Metabolismo de las lipoproteínas
Las funciones del colesterol en el organismo son múltiples, siendo las más importantes:
precursor de hormonas esteroideas suprarrenales y gonadales, vitamina D, ácidos
biliares, oxiesteroles y lipoproteínas; componente de membranas; participación en
distintos procesos celulares. El colesterol es una molécula de
ciclopentanoperhidrofrenantreno (esterano) con una cabeza polar (grupo hidroxilo) y
cola apolar que, por su carácter hidrofóbico, tiene que ser transportado en sangre por las
lipoproteínas. Puede estar en forma libre, como lo encontramos en la mayoría de tejidos
formando parte de las membranas celulares, o esterificado a uno o varios ácidos grasos.
La forma esterificada es más frecuente en el plasma y es insoluble en agua, pero no en
el núcleo de las lipoproteínas (1).
El colesterol plasmático procede de la absorción intestinal en un 15-20% (dieta, bilis y
descamación intestinal), mientras que el resto procede de biosíntesis endógena, a través
de su precursor (acetil coenzima A), mediante la acción de la enzima intracelular
hidroximetilglutaril coenzima A (HMG-CoA) reductasa. Esto ocurre principalmente en
el hígado, aunque la mayoría de los tejidos pueden sintetizar colesterol. Los niveles
elevados de colesterol a nivel intracelular inhiben la HMG-CoA reductasa y la
transcripción del receptor de LDL (LDLR) a nivel nuclear y, por el contrario, la
depleción intracelular de colesterol activa la síntesis a través de esta enzima y aumenta
la transcripción de LDLR (2, 3).
La absorción de colesterol a nivel intestinal se lleva a cabo por varios transportadores, el
principal de los cuales es la proteína 1 similar a la proteína C1 de Niemann-Pick
(NPC1L1), que es la diana del ezetimibe. También tienen un papel importante los
transportadores de casete de unión al ATP G5 y G8 (ABCG5 y ABCG8), que

21
transportan el colesterol y los esteroles vegetales hacia la luz intestinal. En el interior de
la célula el colesterol libre es esterificado en el retículo endoplasmático.
El colesterol puede eliminarse a nivel hepático como colesterol libre, en la bilis, o
metabolizarse a ácidos biliares mediante la 7α-hidroxilasa. La mayoría de los ácidos
biliares segregados y la mitad aproximadamente del colesterol que llega al intestino, se
reabsorben y van nuevamente al hígado. Esta recirculación de ácidos biliares y
colesterol se denomina circulación enterohepática. La cantidad que no se reabsorbe se
elimina mediante las heces. A su vez, la síntesis hepática de colesterol y ácidos biliares
está regulada por los ácidos biliares y el colesterol que se reabsorben (4).
Por otra parte, los triglicéridos constituyen la fuente principal de lípidos de la dieta,
pudiendo proceder de grasas animales o de aceites vegetales. Están formados por tres
ácidos grasos que se unen a una molécula de glicerol. Estos ácidos grasos pueden ser
iguales o diferentes (triglicéridos simples o complejos). Los triglicéridos de la dieta son
en su mayoría complejos y contienen ácidos grasos de cadena larga (oleico y palmítico
principalmente). Su función principal es el almacenamiento de energía. Además de la
dieta, proceden de la síntesis endógena en el hígado y, al igual que el colesterol, son
transportados en plasma por lipopoteínas. Los triglicéridos procedentes de la dieta se
vehiculizan a través de los quilomicrones (QM), mientras que los de síntesis hepática
son transportados por las lipoproteínas de muy baja densidad (VLDL). A su paso por
los tejidos se produce su hidrólisis por la enzima lipoprotein-lipasa (LPL) en el
endotelio, de manera que los ácidos grasos liberados pasan a las células periféricas
donde se produce β-oxidación o almacenamiento en forma de gotas de lípidos en el
tejido adiposo (5).
El transporte por el plasma de los lípidos insolubles se lleva a cabo por las
lipoproteínas, que son estructuras esféricas compuestas por una cubierta polar que
22
contiene apolipoproteínas, fosfolípidos y colesterol libre, y un núcleo hidrofóbico de
colesterol esterificado y triglicéridos (figura 1). El contenido en lípidos y proteínas
determina la densidad de las lipoproteínas. Se han identificado cinco tipos de
lipoproteínas plasmáticas. De mayor a menor tamaño y de menor a mayor densidad
(figura 2): QM, VLDL, lipoproteínas de densidad intermedia o IDL (Intermediate
Density Lipoprotein), lipoproteínas de baja densidad o LDL (Low Density Lipoprotein)
y lipoproteínas de alta densidad o HDL (High Density Lipoprotein). Las más grandes y
con mayor contenido en lípidos son los QM, seguidas de las VLDL, que son las de
menor densidad. Ambas transportan principalmente triglicéridos, en el caso de los QM
de origen intestinal, y en el de las VLDL de origen hepático. El colesterol plasmático es
transportado principalmente por las LDL (un 70%) y en menor medida por las HDL,
que tienen menos cantidad de lípidos, por lo que tienen una mayor densidad (1).
Figura 1. Estructura de una lipoproteína. Extraído de Douglas et al,

2017 (6).
23
Figura 2. Tipos de lipoproteínas.
Las apoproteínas o apoliproteínas constituyen el componente proteico de las
lipoproteínas, son capaces de solubilizar los lípidos en la sangre, puede interactuar con
receptores celulares como ligandos y con enzimas como cofactores. Estas proteínas se
sintetizan tanto en el hígado como en el intestino y pueden ser estructurales, es decir
fijas en la misma lipoproteína, o funcionales, cuando pueden intercambiarse entre
lipoproteínas. Existen distintos tipos de apoproteínas y suelen variar entre las
lipoproteínas. Normalmente las lipoproteínas contienen más de una apoproteína,
excepto en el caso de las LDL, que contienen únicamente apolipoproteína B (apoB). La
apolipoproteína A (apoA) está presente en el HDL principalmente, aunque también
forma parte de los QM, mientras que las apolipoproteínas C y E (apoC y apoE) están en
todas las lipoproteínas a excepción de las LDL. La apoB100 también está presente en
todas las lipoproteínas excepto en el HDL y los QM. En los QM se encuentra una forma
truncada, la apoB48. Hay distintos subtipos de cada apoproteína, dependiendo de su
función. Los distintos tipos de apolipoproteínas, su localización y función se detallan en
la tabla 1 (4, 5, 7).
24
Tabla 1. Tipos, localización y función de las apoproteínas.
Apoproteína Lipoproteína Síntesis Función

Activador LCAT
A-I HDL, QM, VLDL Hígado, intestino
Estructural en HDL
Activador LH
A-II HDL, QM, VLDL Hígado, intestino
Estructural en HDL
Activador LCAT
A-IV HDL, QM, VLDL Hígado, intestino
Interactúa con CII en LPL
Ensamblaje de QM y VLDL
A-V HDL, QM, VLDL Hígado
Activador de LPL
Estructural
B-48 QM, remanentes de QM Intestino
Secreción de QM
Estructural
B-100 VLDL, IDL, LDL Hígado
Ligando del LDLR
Activa LCAT
C-I QM, VLDL, IDL, LDL Hígado, intestino
Inhibe LPL
C-II QM, VLDL, IDL, LDL Hígado, intestino Activa LPL
C-III QM, VLDL, IDL, LDL Hígado, intestino Inhibe LPL
Hígado, intestino,
QM remanentes, VLDL, Ligando del LDLR, Ligando
E cerebro, bazo, riñón,
IDL, LDL, HDL del LPR
adrenales, otros
Apo(a) Lp(a) Hígado Desconocida
Apo: apopoproteína, QM: quilomicrón, HDL: lipoproteína de alta densidad; VLDL: lipoproteína
de muy baja densidad; IDL: lipoproteínas de densidad intermedia; LDL: lipoproteínas de baja
densidad; LCAT: lecitincolesterol aciltransferasa; LH: lipasa hepática; LPL: lipoproteín lipasa,
LDLR: receptor de LDL; LPR: receptor de apoE.
Metabolismo de los quilomicrones
Los QM son las lipoproteínas de mayor tamaño y menor densidad. Se encargan del
transporte de los lípidos procedentes de la dieta. Contienen distintas apolipoproteínas, la
apoA-I, apoAIV, apoCII, apoC-III, apoE y apoB-48. La apoB48 está presente
únicamente en los QM y es una forma truncada de la apoB100, ya que solamente se
expresa el 48% de la longitud de la proteína. Esta apoB48 forma parte de la estructura
del QM y es un marcador específico del mismo. Estas lipoproteínas se sintetizan en el

25
intestino y son las encargadas del transporte de los lípidos de la dieta a los distintos
tejidos. Contienen un 85% de triglicéridos y un 2% de proteínas. Los QM se secretan
inicialmente a la linfa y posteriormente a la sangre. A su paso por los capilares se
hidrolizan mediante la acción de la LPL, liberando triglicéridos que serán usados por el
tejido muscular como fuente de energía, o por el tejido adiposo para almacenamiento.
La LPL es activada por la apoCII, que actúa como cofactor. Tras su paso por los
capilares, los QM pierden su contenido en triglicéridos y se reduce su tamaño,
convirtiéndose en QM residuales y siendo captados por los receptores hepáticos de
apoE (LPR) (8).
Metabolismo de las VLDL
Las VLDL son partículas poco densas (d< 1,006 g/mL) y de gran tamaño, ricas en
triglicéridos, como los QM, conteniendo un 55% de triglicéridos y un 10-15% de
colesterol. Tienen apoB100 y pequeñas cantidades de apoC y apoE. Las VLDL son las
encargadas del transporte endógeno de los lípidos hepáticos a los distintos tejidos. Los
estímulos principales para su síntesis son, durante el ayuno, la llegada de ácidos grasos
libres a nivel hepático, y durante el periodo postprandial, la llegada de QM residuales.
Las VLDL interaccionan con las HDL, que les ceden apoC y apoE, intercambiándose
además colesterol libre y esterificado. Este intercambio está mediado por la proteína
transferidora de ésteres de colesterol (CETP). A su paso por los capilares, sufren el
mismo proceso que los QM por la acción de la LPL, perdiendo triglicéridos y
disminuyendo su tamaño, para quedar con un contenido similar de triglicéridos y
colesterol, convirtiéndose en IDL. Las VLDL también son hidrolizadas a nivel hepático
por la lipasa hepática (LH) (9).
26
Metabolismo de las IDL
Las IDL (d <1,019 g/mL > 1,006 g/mL) proceden, según se ha explicado, del
metabolismo de las VLDL y tienen una composición de apolipoproteínas similar a éstas.
Contienen apoB100 y apoE, pero no apoC. Estas lipoproteínas son menos numerosas,
sobre todo durante el ayuno, y tienen una vida media más corta. Como se ha comentado
anteriormente, la proporción de triglicéridos y de colesterol que las conforman es
similar. Aproximadamente la mitad de las IDL son captadas por el hígado por el LDLR
y el LRP, y la otra mitad se convierte en LDL por la acción de la LH. La mayoría de las
IDL proceden del catabolismo de las VLDL, pero en algunas situaciones patológicas o
en el postprandio, pueden generarse partículas de IDL que proceden de los QM, que
corresponderían a QM residuales (9, 10).
Metabolismo de las LDL
La mayor parte del colesterol plasmático está vehiculizado por las LDL. Las LDL son
lipoproteínas de baja densidad (d <1,063 g/mL > 1,019 g/mL). La partícula de LDL
contiene principalmente ésteres de colesterol unidos a una molécula de apoB, que es su
principal apolipoproteína. Esta lipoproteína es la encargada del suministro de colesterol
a los distintos tejidos y al hígado. Las LDL son reconocidas a través de la apoB por el
LDLR expresado en la superficie de las células. El LDLR está expresado un 70% en los
hepatocitos y un 30% en el resto de tejidos. La unión de la partícula de LDL al receptor
hace que el complejo se internalice dentro del endosoma y en su interior esta partícula
se destruye. El colesterol no esterificado se libera y es utilizado por la célula o es
almacenado nuevamente como colesterol esterificado por la acción de la acil colesterol
acil transferasa (ACAT). El receptor puede volver a la membrana en un mecanismo de
reciclado o dirigirse al lisosoma y destruirse, no pudiendo ser reciclado nuevamente
27
hacia la superficie. Cualquier defecto en este ciclo podría ser causa de
hipercolesterolemia familiar (HF) (11).
El metabolismo de las lipoproteínas encargadas del transporte endógeno y exógeno se
ilustra en la figura 3.
Figura 3. Papel de las lipoproteínas en el transporte de lípidos. LDLR: Receptor de

lipoproteína de baja densidad; LDL: lipoproteína de baja densidad, LPL: lipoproteín
lipasa, HL: lipasa hepática, FFA: ácidos grasos libres; IDL: lipoproteína de densidad
intermedia; VLDL: lipoproteína de muy baja densidad. Extraído de Douglas et al,
2017 (6).
28
Metabolismo de las HDL
Las HDL son lipoproteínas de alta densidad (d <1,21 g/mlL > 1,063 g/mL), contienen
sobre todo ésteres de colesterol y su apoproteína principal es la apoA-1, aunque
contienen además apoAII, apoC y apoE. Las HDL tienen la capacidad de intercambiar
sus componentes y también llevan a cabo el intercambio de lípidos entre las
lipoproteínas y los tejidos. Existen distintos subtipos de HDL; HDL nacientes, HDL1,
HDL2 y HDL3. Se sintetizan tanto en el hígado como en el intestino, y algunos
subtipos proceden de la hidrólisis de los QM y las VLDL. La función principal de las
HDL es el transporte reverso de colesterol, pero también tienen acciones
antitrombóticas y antiinflamatorias. El transporte de los lípidos desde los tejidos puede
llevarse a cabo por la presencia de apoA-I, que favorece el eflujo o salida de colesterol
de las células. Este colesterol pasa a las HDL y se esterifica en su interior gracias a la
enzima lecitincolesterolaciltransferasa (LCAT). De esta forma las HDL aumentan su
tamaño y adquieren una forma más redondeada. Las HDL además ceden parte del
colesterol esterificado a las LDL a través de la proteína transferidora de ésteres de
colesterol (CETP). Finalmente, el colesterol transportado por las HDL retorna al hígado,
bien mediante estas mismas, que interaccionan con el receptor receptor scavenger B-I
(SR-BI), o a través de las LDL que se unen al LDLR (12). En la figura 4 se ilustra el
metabolismo de las HDL.
29
Figura 4. Transporte reverso de colesterol. Extraído
de Lieberman M et al., 2013 (13).
Lipoproteína (a)
Otra lipoproteína de interés clínico es la lipoproteína (a) (Lp(a)), que se asemeja a la
LDL, contiene ésteres de colesterol y fosfolípidos y una glicoproteína específica que es
la apolipoproteína (a) (apo(a)). Esta apo(a) está unida a la apoB100 por un puente
disulfuro (figura 5) (14).
Una de las características más llamativas de la apo(a) es su sorprendente homología
estructural con el plasminógeno, de un 80% aproximadamente. La concentración
plasmática de Lp(a) varía entre 0,1 y 300 mg/dl, y esta variabilidad se debe
principalmente a variaciones en una secuencia denominada kringle IV-2 en el gen de la
apo(a). Esta zona del gen puede tener varias copias repetidas, entre 3 y 60, de manera
que, a mayor número de repeticiones, los niveles plasmáticos son más bajos, y viceversa
(15).
Por su analogía con el plasminógeno y su similitud con la partícula de LDL, esta
lipoproteína está implicada en la patogénesis de la aterosclerosis, aunque su función
30
biológica se desconoce. Los niveles elevados de Lp(a) se han asociado de manera
independiente con la aparición de enfermedad cardiovascular (ECV) en múltiples
estudios epidemiológicos (16).
Figura 5. Estructura de la lipoproteína (a). Adaptado de

Foundation, 2013 (17).
2. Hipercolesterolemia familiar
2.1. Definición y antecedentes históricos
La HF es una enfermedad monogénica autosómica codominante del metabolismo
lipídico, que se caracteriza por concentraciones plasmáticas muy elevadas de colesterol
LDL (c-LDL), enfermedad coronaria prematura y depósitos extravasculares de
colesterol en forma de arco corneal y xantomas tendinosos (18) (19). Está presente por
igual en ambos sexos y puede manifestarse desde el nacimiento, con una penetrancia
mayor al 90%. Existen dos formas clínicas, heterocigota (HFHe), si solamente está
afecto un alelo, y homocigota (HFHo), más grave y menos frecuente, en la que ambos
alelos están afectos. También existe una forma de hipercolesterolemia autosómica
recesiva (HAR). La prevalencia es mayor a la descrita inicialmente, que se cifraba en de

31
1 de 500 personas para la HFHe y 1 de 1.000.000 en la HFHo ((18). Se calcula en la
actualidad que es de 1 de 200-250 para la HFHe (20-22) y 1 de 300.000-450.000 para la
HFHo (23, 24), siendo así la enfermedad monogénica más frecuente. La HAR es menos
frecuente, con una prevalencia estimada de 1 de 5.000.000, excepto en la isla de
Cerdeña, donde existe efecto fundador y 1 de 40 personas es portadora y 1 de 40.000
está afecta (25). En España datos recientes cifran una prevalencia de HAR 1: 6.500.000
(26).
Se estima que unos 34 millones de personas en el mundo están afectos por esta
enfermedad (20). Existen regiones del mundo en las que la prevalencia es incluso
mayor, con cifras de hasta un afecto por cada 70 personas. Esto se produce en
poblaciones con cierto aislamiento genético, como son los canadienses franceses (27),
los finlandeses (28), los libaneses (29), los judíos Askenazi (30) o los afrikáners de
Sudáfrica (31).
A pesar de su elevada prevalencia, se considera que la HF está infradiagnosticada, con
20% de diagnóstico en la mayoría de países (32). Esto tiene implicaciones clínicas muy
importantes, ya que, sin tratamiento, la mortalidad por ECV es muy elevada, 50% antes
de los 50 años en varones y el 15% antes de los 60 en mujeres (18).
La primera referencia de la enfermedad es del año 1938, cuando Carl Müller la describe
como un error innato del metabolismo asociado a niveles muy elevados de colesterol en
plasma, enfermedad coronaria prematura y presencia de xantomas tendinosos. Este
autor hace referencia a un patrón de herencia autosómico dominante (33).
Posteriormente, en 1960, Khachadurian confirma este tipo de herencia en una amplia
familia libanesa, distinguiendo dos formas clínicas: heterocigota menos severa y
homocigota, más grave (34). En esa misma década, Fredrickson y Levy relacionan la
enfermedad con el metabolismo de las LDL (35).
32
En 1974 los autores Goldstein y Brown reciben el premio nobel por su descubrimiento
del receptor de LDL y su asociación con la enfermedad. Ellos describen por primera vez
la asociación de distintas mutaciones en esta proteína y la enfermedad en 110 sujetos
con formas homocigotas (2).
2.2. Etiología y patogénesis
La HF se produce por mutaciones en los genes relacionados con el metabolismo de las
partículas LDL. La mayoría (aproximadamente el 80%) de sus formas están causadas
por mutaciones en el gen del LDLR, pero también pueden estar implicados otros genes,
como el gen de la ApoB100 (APOB), que supone un 5%, o el gen de la proteína
subsilitina kexina tipo 9 (PCSK9), responsable del 1%. También hay una forma
autosómica recesiva por mutaciones en el gen del adaptador tipo 1 del LDLR
(LDLRAP1), mucho menos frecuente (figura 6). Otros genes también involucrados, pero
con menor frecuencia, son el de la ApoE (APOE), el STAP1 y el HCHOLA4 (36). En
un 20-40% de los casos no se detecta ninguna mutación en los genes mencionados, y
tampoco en estudios más extensos de secuenciación de exoma, por lo que se cree que
podría tratarse de formas poligénicas severas (37).
33
Figura 6. Proteínas implicadas en la patogénesis de la HF. Adaptado de Hovingh et al.
2013 (38).
Hipercolesterolemia familiar por mutaciones en el gen del LDLR
En la actualidad hay más de 1.700 mutaciones descritas que afectan a la funcionalidad
del LDLR (Leiden Open Variation Database (LOVD) (39). La HF por mutaciones con
pérdida de función en el LDLR es la forma mejor caracterizada y estudiada, además de
la hipercolesterolemia monogénica más frecuente en la población.
Las mutaciones en el LDLR pueden encontrarse en un alelo, tratándose de la forma
heterocigota simple; la misma mutación en ambos alelos, que sería la forma
homocigota, o dos mutaciones diferentes en ambos alelos del LDLR, tratándose de
heterocigotos compuestos.
El LDLR se encuentra en la superficie celular. Se trata de una proteína transmembrana
localizada principalmente en los hepatocitos, pero se expresa en la mayoría del
organismo. Esta glucoproteína, en su forma madura, consta de 839 aminoácidos, tras la
pérdida del péptido señal de 21 aminoácidos y se sintetiza como un precursor de 120
kDa (40). La proteína madura contiene seis dominios: el péptido señal, el dominio de
34
unión al ligando, el dominio homólogo al factor de crecimiento epidérmico (EGF) 1,
dominio con sitios de O-glicosilación, dominio transmembrana y dominio
citoplasmático (40). En el aparato de Golgi sufre N y O-glicosilaciones, por lo que su
peso molecular asciende a 160 kDa (41). Posteriormente, en el retículo endoplasmático,
se completa su maduración, eliminándose el péptido señal y quedándose la proteína
madura con cinco dominios. El LDLR maduro se dirige a la superficie de la célula y se
sitúa en las invaginaciones recubiertas con clatrina. A este nivel se produce la unión del
dominio extracelular del receptor con las lipoproteínas que contienen apoB, como son
las LDL, y apoE, como los QM remanentes y las VLDL. Este complejo receptor-
lipoproteína se internaliza mediante endocitosis (42), proceso en el cual la proteína
LDLRAP1 tiene un papel importante. Este complejo LDL-receptor se dirige al
endosoma y, de ahí, al lisosoma, donde se libera la partícula de LDL. El contenido
lipídico y proteico de esta partícula se hidroliza, liberándose aminoácidos y colesterol
libre. Este colesterol no esterificado puede ser tóxico para la célula, por lo que es
utilizado o esterificado mediante la ACAT. El receptor que también ha quedado libre en
esta acción vuelve a la superficie. Este proceso de denomina reciclaje del receptor y
puede producirse hasta 100 veces antes de su degradación final (2, 43). Sin embargo, en
presencia de PCSK9, este reciclaje no se produce, ya que esta proteína se une al
dominio homólogo del EGF del receptor y este complejo PCSK9-LDLR es degradado
(44).
De este modo, la homeostasis del colesterol intracelular está regulada de forma muy
precisa por la célula. El papel del LDLR es muy importante, además, en la síntesis
endógena de colesterol intracelular. Cuando hay una depleción de colesterol dentro de la
célula, aumenta el número de receptores por aumento de su transcripción a nivel
35
nuclear. Además, también aumenta la síntesis de novo de colesterol, llevada a cabo por
la enzima HMG CoA reductasa, que cataliza el paso de HMG CoA a mevalonato.
En el caso contrario, cuando existe un aumento de los niveles de colesterol en el interior
celular, se inhibe la transcripción de receptores y la síntesis de novo (45). Esta
regulación transcripcional la llevan a cabo las proteínas de unión a los elementos de
respuesta a los esteroles (SREBP), que aumentan la transcripción del LDLR, y los
receptores X hepáticos (LXR), que contribuyen a degradar el LDLR mediante la
expresión de la E3-ubiquitina-ligasa IDOL (46). Estos sistemas de regulación impiden
que se produzca un exceso de colesterol intracelular. Esto es así en la mayoría de las
células, a excepción de los macrófagos, que pueden captar partículas de LDL, como es
el caso de las LDL oxidadas, a través de unos receptores del tipo scavenger receptor A-I
(SR-AI). Estos macrófagos se convierten en células espumosas, que son iniciadoras del
proceso de la arterioesclerosis.
El gen LDLR se localiza en el brazo corto del cromosoma 19 (19p13.2), contiene 18
exones y 17 intrones, tiene una longitud de 45 kb y codifica, como se mencionó
previamente, una proteína madura de 860 aminoácidos con seis dominios (40). En la
figura 7 podemos ver la estructura del LDLR y los exones que codifican cada región.
Adicionalmente, el gen LDLR posee un empalme alternativo y produce 6 isoformas de
la proteína (47).
El exón 1 contiene una secuencia de 21 aminoácidos o péptido señal, que se escinde del
receptor en el retículo endoplasmático en el proceso de translocación.
Aproximadamente un 4,5% de las mutaciones en el LDLR se han localizado en este
exón (39, 48).
Los exones 2 al 6 codifican el dominio de unión al ligando, formando una secuencia de
siete repeticiones en tándem homológas, ricas en cisteína, de 40 aminoácidos, que son
36
necesarias para la interacción con los ligandos extracelulares del LDLR, en este caso las
lipoproteínas. Cada una de las siete repeticiones contiene un grupo de aminoácidos con
carga negativa (Asp-X-Ser-Asp-Glu) y seis residuos de cisteína que forman tres enlaces
disulfuro (49). La unión de las lipoproteínas al LDLR parece estar mediada por una
interacción de los residuos ácidos del dominio de unión del receptor de LDL y los
básicos de apoB100 y apoE (50). En este dominio de unión al receptor está localizadas
aproximadamente un 40% de las mutaciones asociadas con HF (39). En esta región del
gen es el exón 4 el que presenta más mutaciones, ya que es un exón de gran tamaño.
Los exones 7 al 14 codifican el dominio homólogo del EGF, que comparte en un 33% la
secuencia con el EGF humano. Este dominio contiene 411 aminoácidos y, a su vez,
posee tres repeticiones de 40-50 aminoácidos ricas en cisteína. Las dos primeras
repeticiones, que se denominan A y B, están codificadas por los exones 7 y 8, y están
separadas de la repetición C, que está codificada por el exón número 14. Este dominio
interviene en la disociación de las partículas de LDL del receptor y de las fosas de
clatrina durante el reciclado del receptor. El 55% de las mutaciones descritas en el
LDLR se asocian con la región homóloga al EGF.
El exón 15 codifica una región rica en oligosacáridos. Se trata de un dominio de 58
aminoácidos, rico en treonina y serina, cuya función se desconoce, pero podría ser la de
estabilización del receptor. No hay muchas variantes que afecten a este exón, se han
descrito unas 41.
El exón 16 y parte del 17 codifican la región transmembrana, un dominio de 22
aminoácidos hidrófobos, cuya función es el anclaje del LDLR a la membrana celular.
Por último, el resto del exón 17, junto con el 18, codifican la región citosólica de la
proteína. Este dominio citoplasmático posee 50 aminoácidos y dos señales de
secuencias para orientar al receptor hacia la superficie y para la localización en las
37
invaginaciones revestidas de clatrina. Es la región más conservada en las distintas
especies y sólo el 6% del total de las variantes alélicas se han descrito en el dominio
citoplasmático (51).
Figura 7. Estructura del LDLR. Adaptado de Gabcova-Balaziova, 2015 (52).
38
Como se ha expuesto, las mutaciones causales de HF afectan a la totalidad del gen,
alcanzando en la actualidad más de 1.700 variantes descritas (39). La mayoría son
mutaciones con cambio de sentido o de cambio de aminoácido (missense), y pequeños o
grandes reordenamientos (según tengan menos o más de 100 pb) (53).
Según a qué región afecten y al tipo de mutación, pueden alterar la transcripción del
gen, la postranscripción, la traducción y la postraducción. Y según el comportamiento
de la proteína mutada, las mutaciones en la HF se han agrupado clásicamente en cinco
tipos (figura 8) (54):
Clase 1 o alelos nulos. Son aquellas que afectan a la síntesis del receptor, impidiendo
que se produzca proteína funcional. Son mutaciones graves que se producen por pérdida
del promotor, grandes reordenamientos, mutaciones que afectan al empalme y bloquean
la síntesis de ARN mensajero, cambios en la pauta del marco de lectura, mutaciones que
generan codones de parada o sin sentido. Es la forma más grave.
Clase 2 o alelos defectuosos para el transporte. Son las más frecuentes. En este caso la
mutación genera una proteína que no adopta una estructura tridimensional correcta tras
la síntesis. Esto hace que se quede bloqueada total (2A) o parcialmente (2B) en el
transporte entre el retículo endoplásmico y el aparato de Golgi. Este tipo de mutaciones
se produce por cambios de aminoácido o pequeñas deleciones en el LDLR.
Clase 3 o alelos defectuosos para la unión. En este caso la proteína se sintetiza y se
transporta a la superficie, pero hay un defecto en la unión de la apoB. La capacidad de
unión del LDLR al LDL puede variar entre un 2 y un 30% de lo normal.
Clase 4 o alelos defectuosos para la internalización. El LDLR no se interioriza en las
fosas revestidas de clatrina y por tanto no se puede internalizar.
Clase 5 o alelos defectuosos para el reciclaje. Este tipo de mutación produce proteína
que une e internaliza las partículas de LDL, pero el complejo LDL-LDLR queda
39
atrapado en el endosoma, no se recicla a la superficie y se dirige directamente a los
lisosomas para su degradación.
Figura 8. Clases de mutaciones del LDLR. Extraído de www.uniovi.es (55).
Las mutaciones más frecuentes son aquellas que corresponden a alelos defectuosos, y
las más graves las que corresponden a alelos nulos, ya que al no producirse proteína
funcional, los niveles de c-LDL serán mayores y se asocian con más riesgo de ECV
prematura. A su vez, el defecto genético puede tener una modulación ambiental y dar
40
lugar a diferentes fenotipos, pero en general las mutaciones más graves se traducen en
fenotipos más agresivos (56).
También hay autores que recomiendan una clasificación más simple, en dos grupos,
mutaciones de clase 1 o nulas y mutaciones no de clase 1 o defectuosas (57).
Hipercolesterolemia familiar por mutaciones en el gen del la apoB
La apoB-100 es una apolipoproteína que actúa de ligando del LDL para su unión con el
LDLR. Por tanto mutaciones en el gen que codifica esta proteína también son causa de
HF.
El gen de la apoB se localiza en el brazo corto del cromosoma 2. Las mutaciones en este
gen representan aproximadamente un 5% de los casos de HF (36). El gen tiene una
longitud de 43 kb y está compuesto por 29 exones. La proteína que se genera tras su
traducción tiene 4563 aminoácidos (58).
Este gen fue el segundo identificado como causa de HF y se describió en individuos
con fenotipo clínico muy parecido al de los portadores de mutaciones en LDLR, con un
catabolismo disminuido de las LDL, pero en este caso con actividad normal del LDLR.
A esta segunda forma de HF se le denominó apoB defectuosa familiar (BDF).
Representa una forma minoritaria de HF, pero existen algunas poblaciones con
aislamiento genético en las que la prevalencia es mayor, como algunas poblaciones
europeas o los amish en EEUU (59).
Las mutaciones en APOB que producen HF generalmente son mutaciones missense que
generan una apoB que actúa como un ligando defectuoso. Esta apoB del alelo mutado
no es capaz de unirse al LDLR y el c-LDL se acumula extracelularmente. La primera
mutación descrita (60) que producía un fenotipo de HF fue la p.Arg3527Gln, localizada
en el exón 26, y se trata de un cambio de aminoácido. Esta mutación es responsable de
41
entre 6-10% de todos los casos de HF en población del norte de Europa (61).
En 1995 se describieron dos mutaciones (p.Gln3527Trp y p.Arg3558Cys), que reducen
un 30 y 70% respectivamente la afinidad de la apoB al LDLR (62). Se han identificado
hasta ahora aproximadamente más de 10 variantes alélicas en APOB que alteran la
unión de la apoB al LDLR (63). Este número está aumentando en la actualidad, ya que
se está secuenciando todo el gen, mientras que previamente se secuenciaba solo el
dominio de unión al ligando. Por ejemplo, recientemente se han descrito varias
mutaciones en otras regiones del gen, como p.Arg50Trp, p.Arg1164Thr y
p.Gln4494del, que son causantes de HF (11).
En comparación con los que tienen mutaciones en el gen del LDLR, el fenotipo de estos
pacientes es más benigno. Sus concentraciones de c-LDL son aproximadamente un 25%
menores, así como su riesgo de ECV (8.5 en HF vs 2.7 en apoB defectuosa, comparado
con familiares no afectos) y tienen una mejor respuesta a las estatinas. Dado que el
defecto está en la apoB y no en LDLR, estos pacientes son capaces de eliminar los
remanentes de VLDL a través de la unión del LDLR con la apoE, lo cual podría
explicar el fenotipo más benigno que el de los pacientes con mutación en el LDLR (64,
65).
Hipercolesterolemia familiar por mutaciones en el gen de PCSK9
Como se mencionó previamente, la proteína PCSK9 interviene en el proceso de
reciclaje del receptor. Se secreta al plasma desde el aparato de Golgi y se une al LDLR
extracelularmente mediante el dominio homólogo al EGF tipo 1. Tras la unión, este
complejo LDLR-PCSK9 es internalizado por endocitosis mediada por clatrina, y
posteriormente se dirige a los lisosomas donde se degrada, evitando su reciclaje a la
superficie (figura 6) (66, 67).
42
El gen que codifica a esta proteína se localiza en el cromosoma 1, consta de 12 exones y
tiene una longitud de 39 kb que se transcriben a un ADN complementario de 3617 pb
(68). Fue descrito por primera vez en 1999 por Varret et al., que identificaron mediante
análisis de ligamiento un tercer locus autosómico dominante (HCHOLA3), en el
cromosoma 1q34.1-p32, y demostraron que se trataba del gen PCSK9 (69).
La PCSK9 es una glucoproteína de 692 aminoácidos con una secuencia señal de 22-30
aminoácidos, un prodominio, dominio catalítico y dominio C-terminal (70, 71), que
comparte homología estructural con la familia de proteinasas K subtilisina-like serina
proteasas. La PCSK9 es una proteína secretada principalmente por el hígado, como un
zimógeno inactivo, que en el retículo endoplasmático sufre la escisión de un péptido
señal, en tanto que el prodominio se queda unido de forma no covalente al dominio
catalítico para evitar su activación, que se produce en el lisosoma para degradar el
LDLR (72).
En 2003, Abifadel et al. describieron por primera vez las mutaciones con ganancia de
función (GOF) en el gen PCSK9 como causantes de hipercolesterolemia familiar. Este
tipo de HF se ha denominó HF3 y supone entre un 1-3% de las causas (73). El aumento
de función de PCSK9 se traduce en mayor degradación del LDLR, menor número de
receptores en superficie y, por tanto, menor recaptación del c-LDL.
Normalmente estas mutaciones GOF suelen aparecer en heterocigosis simple, aunque
también hay casos de heterocigocis compuesta, heterocigosis doble en combinación con
mutaciones en el LDLR y recientemente se ha descrito un homocigoto (74). Las
mutaciones en el gen PCSK9, al igual que las que afectan al LDLR, se han dividido en
varias clases y tenemos: alelos nulos, variantes que alteran la escisión autocatalítica
(alterando el paso a través del retículo endoplasmático o desde el retículo
endoplásmático a la superficie de la célula), mutaciones que afectan la estabilidad de la
43
proteína y, por último, alelos que producen GOF por sobreexpresión de genes (75, 76).
Por el contrario, las mutaciones en PCSK9 que producen pérdida de función están
asociadas con valores bajos de c-LDL y menor riesgo de ECV, como la mutación
p.Arg46Leu, que condiciona una reducción del riesgo de ECV del 28% (77). En la
actualidad hay más de 30 mutaciones descritas, de las cuales la más frecuente es la
p.Asp374Tyr. Esta variante supone el 2% de las causas de HF en el Reino Unido.
Genera un fenotipo muy agresivo, con niveles muy elevados de c-LDL y mayor riesgo
de ECV (78). Por lo general las variantes GOF en PCSK9 presentan fenotipos algo más
benignos que las mutaciones con pérdida de función en el LDLR y mejor respuesta al
tratamiento hipolipemiante.
Hipercolesterolemia familiar por mutaciones en el gen LDLRAP1
Para la actividad del LDLR es necesaria la proteína 1 adaptadora del receptor de LDLR
(LDLRAP1). Esta proteína lleva a cabo la internalización del complejo LDLR-LDL
mediante las vesículas de clatrina, un proceso mediado por un motivo rico en tirosina
(NPXY) en la cola citoplasmática del receptor (79). El gen LDLRAP1 se localiza en el
cromosoma 1p, consta de 9 exones y 8 intrones y posee una longitud de 25 kb. De su
traducción se obtiene una proteína de 308 aminoácidos. En ausencia de esta proteína,
este proceso de internalización es defectuoso y esto se traduce en aumento de c-LDL a
nivel extracelular. Existen mutaciones en esta proteína que generan formas de HF, pero
a diferencia de las formas anteriores, estas mutaciones se transmiten con herencia
autosómica recesiva, dando lugar a una forma de HF denominada hipercolesterolemia
autosómica recesiva (HAR), que solo se manifestará en formas homocigóticas. Estos
pacientes presentan un fenotipo parecido a la HFHo, con niveles muy elevados de c-
LDL, aunque menos riesgo de ECV prematura (80) y mejor respuesta al tratamiento
44
(26). Las mutaciones en el gen LDLRAP1 suelen generar alelos nulos, correspondientes
a codones de parada prematuros, donde no se produce ARNm o se generan proteínas
truncadas y pueden presentarse tanto en homocigosis como en heterocigosis compuesta.
El estado de portador no genera fenotipo de HF, pero sí se ha observado en algunos
casos niveles mayores de c-LDL que en no afectos (81). La ARH es una entidad
extremadamente infrecuente, aceptándose que la prevalencia sea de menos de 1 caso por
5.000.000 (82). La enfermedad es más prevalente en Cerdeña, una región de Italia con
efecto fundador y asilamiento genético, en la que el ratio de portadores de la mutación
es de 1 de 143 y el de homocigotos 1 de 40.000 (83). El fenotipo de los pacientes con
ARH es similar al de los HFHo, con niveles basales de c-LDL similares y desde las
primeras décadas de la vida, pero con mejor pronóstico cardiovascular y con mayores
niveles de c-HDL (23). No obstante, la presentación puede ser variable y la clínica
puede aparecer más tarde, con un fenotipo más parecido a los pacientes heterocigotos
para mutaciones en el LDLR. La estenosis aórtica no es tan común como en la HFHo y
la progresión de la misma es menos frecuente (81, 84). Para el diagnóstico definitivo se
requieren dos mutaciones patogénicas en cada alelo del gen LDLRAP1, bien sea en
homocigosis o en heterocigosis compuesta. En general la respuesta al tratamiento
hipolipemiante es mayor que en los pacientes heterocigotos para el LDLR (85).
Otros Loci asociados con hipercolesterolemia familiar
STAP1
El gen del adaptador transductor de señal tipo 1 o STAP1 se ha relacionado con formas
de HF en algunos pacientes, pero esta observación ha sido en un número muy pequeño
de pacientes y no se ha confirmado en estudios posteriores (86).
APOE
45
La apoE está relacionada con la etiopatogenia de la disbetalipoproteinemia. Sin
embargo, se ha descrito un fenotipo propio de HF en portadores de la mutación
p.Leu167del. Esta mutación específica de APOE también está asociada a otras
entidades, como la hiperlipemia familiar combinada o la histiocitosis sea-blue, y parece
que se desarrolle una enfermedad u otra depende de modificadores genéticos (87, 88).
HCHOLA4
El gen HCHOLA4 (Hypercholesterolemia Autosomal Dominant 4) en el cromosoma
16q22, codifica a una proteína que puede estar implicada en el tráfico y la degradación
de los receptores de LDL y algunas mutaciones en este gen se han asociado a pacientes
con HF sin mutaciones en los otros genes (89).
Hipercolesterolemia familiar homocigótica: bases genéticas
La HFHo es una forma más grave de la enfermedad causada por mutaciones en dos
alelos de genes relacionados con el metabolismo del colesterol LDL que se han
nombrado previamente.
Según el defecto genético, se distinguen cuatro formas de la HFHo desde el punto de
vista genético (figura 9):
- Homocigotos verdaderos: portadores de dos mutaciones idénticas en ambas
copias del mismo gen que afecta la función del LDLR.
- Heterocigotos compuestos: portadores de dos mutaciones diferentes en ambas
copias del mismo gen que afecta la función del LDLR. Estas dos mutaciones
diferentes pueden estar en el mismo alelo (heterocigotos compuestos en cis) o
en alelos diferentes (heterocigotos compuestos en trans).
- Heterocigotos dobles: portadores de dos mutaciones diferentes en dos genes
diferentes.
46
- Hipercolesterolemia autosómica recesiva (ARH): portadores de dos
mutaciones en el gen LDLRAP1.
Figura 9. Formas genéticas de la hipercolesterolemia familiar.
Como en la forma heterocigótica el gen más frecuentemente implicado es el gen del
LDLR, siendo la forma homocigótica verdadera más frecuente en países con menos
heterogeneidad genética y los heterocigotos compuestos más prevalentes en zonas con
mayor variabilidad genética como España (23). Hay descritos pocos homocigotos
verdaderos para APOB y recientemente se describió un homocigoto para PCSK9 (74).
La última forma, la hipercolesterolemia autósomica recesiva es bastante menos
47
frecuente y se han descrito tanto homocigotos verdaderos como heterocigotos
compuestos, siempre portadores de mutaciones correspondientes a alelos nulos (26).
En el caso de las mutaciones del LDLR, según el grado de actividad del LDLR residual
que tenga el paciente se consideran receptor negativo aquellos con una actividad menor
al 2% y receptor defectuoso cuando la actividad se encuentra entre el 2 y el 25% (18,
23, 90).
2.3 Manifestaciones clínicas
Como se ha comentado, existen dos formas clínicas de la enfermedad, la HF
heterocigota y la HF homocigota.
Las manifestaciones clínicas de la forma heterocigótica son:
• Elevación de c-LDL: las cifras de c-LDL están por encima del percentil 95 con
cifras que duplican las de la población general (normalmente entre 190-400
mg/dl). Esta manifestación está presente desde el nacimiento. En la siguiente
tabla se muestran los puntos de corte de c-LDL con mayor sensibilidad y
especificidad en España.
Tabla 2. Puntos de corte de c-LDL para la detección de HF con mayor

sensibilidad y especificidad en España (91).
Edad c-LDL (mg/dl)
<30 230
30-39 238
40-49 260
> 49 255
48
• Depósitos lipídicos extravasculares:
o Arco corneal: se trata de un depósito de colesterol que aparece en la parte
superior y se extiende por toda la circunferencia de la córnea (figura 10). Es
sugestivo de HF cuando aparece antes de los 45 años. En algunos casos la
existencia de arco corneal puede estar asociado a un aumento de la presión
intraocular y menor espesor central de la córnea, pero no está clara su asociación
con el glaucoma (92).
o Xantomas tendinosos: son depósitos de colesterol en los tendones,
principalmente aquíleos, codos, rotulianos y de las manos (figura 10). No suelen
aparecer antes de los 20 años. La presencia de xantomas se asocia con niveles
mayores de c-LDL, mutaciones más graves y tres veces más riesgo de ECV.
Normalmente son asintomáticos, pero pueden predisponer al desarrollo de
tendinitis (93).
o Xantelasmas: placas aplanadas de color amarillo-anaranjado en los párpados
(figura 11), que pueden estar presentes en pacientes con HF y en otro tipo de
dislipemias, incluso en sujetos sin alteración del metabolismo de los lípidos (38).
Figura 10: signos de HF: arco corneal y xantomas tendinosos.

Extraído de Hovingh et al. 2013 (38).
49
Figura 11: xantelasmas en párpados. Extraído de
Merchán et al. 2016 (94).
• Enfermedad cardiovascular:
Los niveles elevados de c-LDL predisponen a los individuos con HF a mayor riesgo de
eventos cardiovasculares.
El c-LDL es uno de los principales precursores del desarrollo de arteriosclerosis, ya que
niveles elevados en plasma favorecen que esta lipoproteína atraviese la capa íntima de
la arteria, quedando retenida por glucosaminoglucanos y proteoglicanos. A su vez, las
células endoteliales, células musculares lisas y macrófagos del subendotelio liberan
radicales libres que contribuyen a la oxidación de las LDL (95, 96).
Estas LDL oxidadas son más aterogénicas y contribuyen al desarrollo de la placa de
ateroma produciendo distintas moléculas de adhesión (proteína quimiotáctica para
monocitos-1 (MCP-1), molécula de adhesión vascular-1 (VCAM-1) y molécula de
adhesión endotelial (ICAM-1), E y P selectinas). A través de estas moléculas, los
monocitos y linfocitos T se adhieren al endotelio. Se produce la diferenciación de
monocitos a macrófagos, disminuyendo su motilidad y estas LDL oxidadas son
captadas por los receptores scavenger que están presentes en macrófagos y células
musculares lisas. De esta forma estas células acumulan colesterol convirtiéndose en
células espumosas, que son el constituyente principal de la placa de ateroma (95, 96).
Las manifestaciones clínicas más graves de la HFHe suceden por la arterioesclerosis
coronaria, que sin tratamiento puede aparecer entre los 40 y 50 años en varones y 10
50
años más tarde en mujeres. Los pacientes con HF sin tratamiento tienen un riesgo de
entre 5-13 veces mayor de padecer ECV que la población general, con una mortalidad
temprana por cardiopatía isquémica en jóvenes hasta 100 veces más alta (97). (32). Este
riesgo elevado de cardiopatía isquémica reduce la expectativa de vida en 20 años en
hombres y 12 años en mujeres sin tratamiento adecuado (98). De hecho, antes de la
introducción de las estatinas, un 50% de los varones y un 30% de las mujeres
presentaban un infarto agudo de miocardio (IAM) antes de los 60 años. La prevalencia
de la HFHe en pacientes con enfermedad coronaria se estimó en el estudio
EUROASPIRE IV y fue de un 8% (99).
Sin embargo, tras la introducción del tratamiento con estatinas en 1980, la ECV en estos
pacientes ha disminuido, mejorando la historia natural de la enfermedad (100). En el
estudio SAFEHEART un 21,9% de los participantes presentaba ECV, mientras que la
prevalencia en ese mismo grupo de edad en la población general era de 2,6%.
Recientemente, en un estudio del Registro Español de Dislipemias, la prevalencia de
ECV fue del 15,1%, con una edad media del primer evento de 49,3 años. También se ha
objetivado que la aparición de enfermedad coronaria depende del momento del inicio
del tratamiento con estatinas: cuanto más precoz, menos riesgo de ECV. Los eventos en
pacientes en tratamiento prolongado con estatinas son poco frecuentes y aparecen más
en sujetos con varios factores de riesgo, como hipertensión arterial, diabetes,
tabaquismo, obesidad, sexo masculino, tratamiento con estatinas menor a 5 años, cLDL
sin tratamiento mayor a 250 mg/dl o presencia de mutación causal en alguno de los
genes candidatos (101). Otras cohortes de pacientes con HF de Canadá, Holanda y
Reino Unido han experimentado reducciones de más del 50% de la enfermedad
coronaria (102, 103).
51
Además, el tipo de mutación causal tiene relación con la aparición de ECV. Las
mutaciones correspondientes a alelos nulos se asocian a mayor riesgo y precocidad de
ECV. Un estudio español mostró un riesgo 1,7 veces más alto de padecer enfermedades
cardiovasculares en aquellos portadores de mutaciones correspondientes a alelos nulos
vs alelos defectuosos, incluso independientemente de c-LDL, sexo, edad y otros
factores de riesgo. Estas mutaciones se asociaron también a mayor arterioesclerosis
carotídea (91).
Otro factor que modifica el riesgo de padecer ECV es la presencia de niveles elevados
de Lp(a). Se recomienda su determinación de forma rutinaria en la valoración inicial en
pacientes con HFHe, ya que niveles superiores a 30 mg/dl se asocian con mayor riesgo
de enfermedad coronaria.
Recientemente, la Sociedad Internacional de Arterioesclerosis (IAS) ha propuesto unos
criterios para clasificar la HF severa (104):
- cLDL sin tratamiento > 400 mg/dl.
- cLDL sin tratamiento > 310 mg/dl y un factor de alto riesgo.
- cLDL sin tratamiento > 190 mg/dl y dos factores de alto riesgo.
Las condiciones de alto riesgo son las siguientes:
• > 40 años sin tratamiento hipolipemiante.
• Tabaquismo.
• Sexo masculino.
• Lp(a) > 50 mg/dl
• cHDL < 40 mg/dl
• Hipertensión arterial.
• Diabetes mellitus.
• Historia familiar de ECV precoz en familiares de primer grado.
52
• Enfermedad renal crónica.
• IMC > 30 kg/m2.
Por todo esto, las distintas guías de práctica clínica disponibles han clasificado la HF
como una condición asociada a riesgo cardiovascular alto o muy alto, que necesita un
diagnóstico y tratamiento temprano, sin que sea necesario el cálculo del riesgo
cardiovascular mediante tablas (32).
Manifestaciones clínicas de la forma homocigótica
La HFHo es la forma más severa de la enfermedad. Los niveles de c-LDL están más
elevados que en la forma heterocigota. Suelen ser valores de entre 4 y 6 veces más altos
que los de la población general y están presentes desde el nacimiento, incluso en la
etapa fetal. Normalmente el c-LDL está por encima de 500 mg/dl, pero depende del
defecto genético subyacente. En niños, valores de c-LDL mayores a 300 mg/dl son
sospechosos de HFHo (105). A mayor gravedad de la alteración genética, mayores
niveles de c-LDL, aunque existe una variabilidad fenotípica importante. Los
homocigotos verdaderos tienen los fenotipos más graves, sobre todo los portadores de
alelos nulos, mientras que los heterocigotos dobles exhiben fenotipos más benignos (ver
apartado correlación genotipo-fenotipo).
En pacientes con tratamiento hipolipemiante debe sospecharse HFHo con valores más
bajos de c-LDL, sobre todo cuando existe el antecedente de hipercolesterolemia en
ambos progenitores. Niveles de LDL mayores a 200 mg/dl con tratamiento
hipolipemiante máximo deberían alertar la sospecha clínica (106).
Otras alteraciones metabólicas presentes en los sujetos con HFHo son el aumento de las
partículas IDL, que puede explicar el aumento discreto de triglicéridos que presentan
algunos pacientes; el aumento de la apoB, como consecuencia de los niveles elevados
53
de LDL (también elevada en la forma HFHe) y por aumento de la secreción hepática de
esta apoliproteína; el aumento de la Lp(a), por un mecanismo desconocido, y niveles
bajos de colesterol HDL, que se atribuyen a un recambio mayor de la ApoAI y
alteración del flujo de salida del c-HDL. Suelen presentar también aumento de la
velocidad de sedimentación globular y del fibrinógeno (107).
En cuanto a las manifestaciones extravasculares, en la HFHo es característica la
presencia de xantomas desde los primeros meses o años de vida. La aparición de
xantomas antes de los 10 años es un criterio diagnóstico de esta forma de HF, pues están
presentes en el 100% de estos sujetos. Suelen ser de color amarillo-anaranjado y
localizados a nivel cutáneo y tendinoso. Normalmente aparecen antes y son más
extensos en aquellos sujetos con formas más graves y niveles más elevados de c-LDL.
Suelen presentarse en codos, manos, en regiones interdigitales, rodillas, nalgas, talones,
etc (figura 13). Sin embargo, existe mucha variabilidad en la presentación, incluso en
sujetos con cifras similares de c-LDL y mutaciones graves, por lo que se piensa que
pueda existir alguna alteración genética que condicione la aparición de esta
manifestación y su extensión. Los xantomas pueden producir cuadros de tendinitis y
dolor articular, siendo necesario en algunas ocasiones su extirpación. De forma
excepcional pueden aparecer xantomas ectópicos gigantes, que son más típicos de la
xantomatosis cerebrotendinosa, puediendo localizarse en cerebro, lengua, mediastino,
etc.
54
Figura 12: Xantomas cutáneos en un paciente con HFHo.
Los xantelasmas, sin embargo, no son típicos de esta enfermedad y aparecen en un 20-
30% de los casos. El arco corneal se encuentra en la mitad de los casos de HFHo y
también es diagnóstico si aparece antes de los 10 años (106).
Dentro de las manifestaciones vasculares de la HFHo, la ECV arterioesclerótica
prematura es la manifestación más grave. Los niveles tan elevados de c-LDL desde el
nacimiento predisponen a una aterosclerosis muy precoz, que aparece normalmente
antes de los 20 años, con riesgo de ECV antes de los 30 años. Sin tratamiento estos
pacientes solían presentar muerte de causa cardiovascular antes de los 20 años. El índice
colesterol-año (108), medida que determina la gravedad y duración de la
hipercolesterolemia, es muy alto en estos sujetos y está directamente asociado a la
aparición de complicaciones cardiovasculares. Como se ha comentado, el tipo de
mutación determina el fenotipo y el pronóstico, y aquellos sujetos con mutaciones
correspondientes a alelos nulos presentan más episodios de ECV, incluso en la primera
década de la vida, si no han recibido tratamiento. Las mutaciones de alelos defectuosos
en el LDLR o en otros genes como APOB, PCSK9 o LDLRAP1, tienen riesgo elevado
de ECV, pero más tardía, entre la 3 y 4 década de la vida (23).
55
Otra manifestación muy característica de la HFHo es la presencia de estenosis aórtica,
que aparece entre los 10 y 20 años. La estenosis aórtica puede aparecer a nivel valvular
por depósito de colesterol, con calcificación y fibrosis posterior, o a nivel supravalvular.
Esta valvulopatía puede progresar a pesar de reducirse los niveles de colesterol, por la
fibrosis y el estrés hemodinámico de la válvula. Otros síntomas asociados son la
presencia de disnea, síncopes, desarrollo de insuficiencia cardiaca izquierda e incluso
muerte súbita. Por esto se recomienda la realización de un ecocardiograma anual a estos
pacientes y un angioTAC cada 5 años, para evaluar la presencia de estenosis aórtica y
arteriesclerosis subclínica, sobre todo a nivel coronario (107).
La HAR cursa con un fenotipo muy similar al la HFHo dependiente del LDLR, con
niveles muy elevados de c-LDL, pero menos riesgo de ECV (9 veces menor) y mejor
respuesta a estatinas y ezetimibe.
Correlación fenotipo-genotipo
La existencia de más de 1700 variantes alélicas que afectan de forma diferente a la
función de aclaramiento de partículas de LDL que lleva a cabo el LDLR se traduce en
una variabilidad fenotípica importante. El defecto genético subyacente puede predecir el
fenotipo de HF. Existen, por tanto, según la actividad del LDLR, mutaciones tipo
receptor negativo o alelo nulo, receptor o alelo defectuoso, o de actividad indeterminada
(18).
Se ha estudiado ampliamente cómo el tipo de mutación afecta al riesgo de ECV,
comparando portadores de mutaciones en el LDLR correspondientes a alelos nulos vs
alelos defectuosos, y se ha visto que el riesgo de padecer enfermedad coronaria es
mayor en los primeros, con un odds ratio entre 2,5-3. También es mayor de la presencia
de xantomas (109-111). Esto se explica en parte porque los sujetos con mutaciones
56
LDLR negativas tienen niveles mayores de c-LDL. Sin embargo, en un estudio de un
grupo Español se vio que la prevalencia de arterioesclerosis carotidea era mayor en
portadores de mutaciones nulas con igualdad de sexo, concentraciones de c-LDL y edad
(91).
Aunque normalmente existe una amplia correlación genotipo-fenotipo, hay sujetos con
niveles no tan elevados o incluso normales de c-LDL pese a la presencia de mutación.
De igual forma, existen sujetos con clínica de HF con diagnóstico genético negativo
(figura 14).
Figura 13. Posibles fenotipos de HF. Adaptado de Nordestgaard et al., 2013 (20).
Esto también se refleja en la HFHo. En un trabajo reciente de nuestro grupo se puso de
manifiesto que los homocigotos verdaderos con mutaciones receptor negativo presentan
niveles muy elevados de c-LDL, un mayor porcentaje de ECV y una edad más precoz
de instauración.
Por tanto, a mayor gravedad de la alteración genética, mayores niveles de c-LDL y,
aunque existe una variabilidad fenotípica importante, generalmente de mayor a menor
gravedad tenemos (figura 15):
- Homocigotos verdaderos del LDLR con mutaciones nulas.
57
- Homocigotos verdaderos del LDLR con mutaciones nulas-defectuosas o
defectuosas.
- Mutación en LDLRAP1 o HAR.
- Heterocigotos compuestos con mutaciones nulas.
- Heterocigotos compuestos con mutaciones defectuosas.
- Homocigotos para mutaciones de APOB.
- Homocigotos con mutaciones con ganancia de función en PCSK9.
- Heterocigotos dobles.
Figura 14: Niveles de c-LDL según genotipo. Adaptado de Santos et al., 2016 (104).
2.4 Criterios diagnósticos
En la HF es fundamental el diagnóstico precoz para el inicio temprano del tratamiento
hipolipemiante, ya que, con el tratamiento adecuado, estas personas pasan a tener el
mismo riesgo cardiovascular que la población general (112).
Como se ha visto, los niveles de c-LDL de los pacientes con HF suelen duplicar las
cifras de la población general, pero esto no suele ser suficiente para el diagnóstico. El
diagnóstico suele basarse, además de en los niveles elevados de c-LDL, en antecedentes
familiares de hipercolesterolemia, presencia de xantomas e historia personal o familiar
58
de enfermedad coronaria prematura, y la probabilidad diagnóstica aumenta cuando hay
niños con c-LDL elevado (20, 113).
El Panel de expertos en HF de la Sociedad Europea de Arterioesclerosis (EAS) (114) y
la Sociedad Española de Arterioesclerosis (SEA) sugieren realizar el cribado de HF en
aquellos sujetos que tengan uno o más de los siguientes criterios:
- Con familiares afectos de HF.
- Adultos con colesterol total >310 mg/dl o niños con c-LDL > 230 mg/dl.
- Historia personal o familiar de enfermedad cardiovascular prematura.
- Xantomas tendinosos.
- Antecedentes familiares de muerte súbita prematura de origen coronario.
Los criterios diagnósticos en esta enfermedad se basan, además de datos clínicos y
analíticos, en la presencia de una mutación patogénica en los genes LDLR, APOB,
PCSK9, APOE, STAP1 o LDLRAP1. De hecho, el diagnóstico de confirmación se
realiza en presencia de una mutación funcional, pero no siempre está disponible el
estudio genético, por lo que se han establecido unas escalas para el diagnóstico clínico
de HF.
Existen tres herramientas diagnósticas según la región para el diagnóstico clínico de
HF:
1) Los criterios de Simon Broome en Reino Unido, que son los recomendados por
la guía NICE (97).
2) Los criterios de las Redes Clínicas de Lípidos Holandesas (RCLH), usados en
Holanda y en muchos países Europeos (115).
3) Los criterios MedPed en Estados Unidos (116).
59
Los criterios de Simon Brome se muestran en la tabla 3. Indican un diagnóstico
definitivo de HF en sujetos con una concentración elevada de colesterol total y
presencia de xantomas o cuando se ha identificado la mutación en alguno de los genes
candidatos, mientras que un diagnóstico probable se establece en presencia de niveles
elevados de colesterol con antecedentes familiares de hipercolesterolemia o enfermedad
coronaria precoz.
Tabla 3. Criterios Simon Brome para el diagnóstico clínico de HF (97).

Criterios Descripción
Colesterol total superior a 7.5 mmol/l (290 mg/dl) o superior a 6.7 (260
mg/dl) mmol/l en niños de edad superior a 16 años. O cLDL superior a
A
4.9 mmol/l (190 mg/dl) en adultos o de 4.0 mmol/l (155 mg/dl) en
niños mayores de 16 años.
B Xantomas tendinosos en el paciente o en familiares de primer grado.
C Diagnóstico genético de mutación en los genes: LDLR, APOB, PCSK9
Historia familiar de infarto de miocardio antes de los 50 años en un
D familiar de segundo grado o antes de los 60 años en uno de primer
grado.
Historia familiar de concentraciones de colesterol superiores a 7.5
E
mmol/l (290 mg/dl) en familiares de primer o segundo grado.
Definitivo Criterio a y criterios b o c
Diagnóstico
Probable Criterio a y criterio d o criterio a y e
El programa MedPed tiene unos puntos de corte de colesterol total diferentes en función
de si se trata de familiares afectos de sujetos con HF o población general. Los puntos de
corte se muestran la tabla 4.
60
Tabla 4. Puntos de corte de colesterol total para el diagnóstico clínico de HF de la
escala MedPed (116).
Límites de colesterol total (mmol/l y mg/dl)
Familiares de Familiares de Familiares de
Población
Edad 1º grado con 2º grado con 3º grado con
general
HF HF HF
<20 5.7 (220) 5.9 (230) 6.2 (240) 7.0 (270)
20-29 6.2 (240) 6.5 (250) 6.7 (260) 7.5 (290)
30-39 7.0 (270) 7.2 (280) 7.5 (290) 8.8 (340)
≥ 40 7.5 (290) 7.8 (300) 8.0 (310) 9.3 (360)
Diagnóstico Si los niveles de colesterol total exceden estos límites
Los más usados en Europa y recomendados por la SEA son los criterios de las RCLH,
en los que cada uno de los siguientes ítems tiene una puntuación determinada: presencia
de familiares con hipercolesterolemia, presencia de niños con hipercolesterolemia,
historia de ECV, existencia de xantomas tendinosos o arco corneal antes de los 45 años,
los niveles de c-LDL y la presencia de mutación patogénica en alguno de los genes
candidatos (LDLR, APOB, PCSK9 y LDLRAP1). La suma de estas puntuaciones resulta
en un diagnóstico “definitivo”, si es mayor de 8, “probable”, entre 6 y 8, y “posible”,
entre 3 y 5 (tabla 5). Se puede apreciar que la presencia de niveles elevados de c-LDL y
xantomas tiene una alta predictibilidad para el diagnóstico de HF (91).
Tabla 5. Criterios de las Redes Clínicas de Lípidos Holandesas para el diagnóstico clínico de HF (115).
Historia familiar
a) Familiar de primer grado con ECV precoz (<55 años varón; < 60 años 1
mujer)
b) Familiar de primer grado con cLDL> percentil 95 1
c) Familiar de primer grado con xantomas tendinosos o arco corneal 2
d) Niños < 18 años con cLDL>percentil 95 2
Historia personal
a) El paciente tiene historia de enfermedad coronaria precoz (<55 años varón; 2
< 60 años mujer)
b) El paciente tiene historia de enfermedad cerebrovascular o arterial 1
periférica precoz (<55 años varón; < 60 años mujer)
61
Examen físico
a) Xantomas tendinosos 6
b) Arco corneal en pacientes < 45 años 4
Datos bioquímicos (cLDL en mmol/l [mg/dl])

> 8,5 [330] 8
6,5-8,4 [250-329] 5
5,0-6,4 [194-249] 3
4,0-4,9 [155-189] 1
Análisis genético ADN

a) Mutación funcional en los genes LDLR, APOB o PCSK9 8
Diagnóstico en niños:
En niños las escalas clínicas previamente comentadas no son de utilidad por los niveles
más bajos de c-LDL en esta población. El cribado se recomienda entre los 2 y los 10
años y es sugestivo de HF cuando:
- c-LDL > 135 mg/dl con un progenitor afecto de HF confirmado genéticamente.
- c-LDL>160 mg/dl con historia familiar de ECV precoz.
- c-LDL>190 mg/dl.
En estos casos se recomienda confirmación genética si está disponible (114).
Criterios diagnósticos de la forma HFHo:
Clínicamente la HFHo se ha diagnosticado por los hallazgos clínico-bioquímicos.
1. Niveles elevados de cLDL: cLDL sin tratamiento ≥ 500 mg/dL o una
concentración de cLDL con tratamiento ≥ 300 mg/dL. Niveles más bajos en
niños o en pacientes tratados no excluyen el diagnóstico de HFHo.
2. Presencia de xantomas cutáneos y/o tendinosos antes de los 10 años de edad.
62
3. Presencia de niveles elevados de cLDL sin tratamiento en ambos progenitores,
compatible con HFHe.
O confirmación genética de dos alelos portadores de mutaciones funcionales en algunos
de los siguientes genes: LDLR, APOB, PCSK9 o LDLRAP1 (90, 106).
Diagnóstico genético
El estudio genético permite confirmar el diagnóstico de HF con la presencia de una
mutación funcional en alguno de los genes implicados. Aunque no siempre está
disponible, es una estrategia diagnóstica que permite, además, el cribado de familiares y
ha demostrado ser costo efectivo (20).
Se recomienda realizar estudio genético a aquellos casos índices con puntuaciones
RHCL>6, ya que existe un porcentaje de pacientes con estudio genético negativo, entre
10-40%, si se hace en sujetos con menor puntuación bajaría la especificidad diagnóstica
y podrían encontrarse un mayor número de estudios negativos. En esta enfermedad
existe gran variabilidad fenotípica y podemos encontrar sujetos con diagnóstico
genético positivo con fenotipo compatible con HF, sujetos con estudio genético
negativo pero con criterios clínicos de HF y sujetos con diagnóstico genético positivo
con puntuaciones bajas en el RCLH (20).
Actualmente el estudio molecular se realiza mediante técnicas de secuenciación masiva
(NGS, next generation sequencing), con una secuenciación completa de todos los genes:
LDLR, APOB, PCSK9, LDLRAP1, APOE y STAP1. Inicialmente se secuenciaban
completamente LDLR, PCSK9, LDLRAP1 y del gen de la APOB únicamente el dominio
de unión al receptor, pero en la actualidad en muchos sitios se está secuenciando en su
totalidad (117).
63
Una vez detectada la mutación hay que determinar si es una variante patogénica o
causal de enfermedad o por el contrario un polimorfismo. Existen bases de datos con la
información de todas las variantes descritas (39) y en el caso de que no esté descrita,
existen programas que predicen la patogenicidad de la variante in silico (PolyPhen2,
SIFT (Sorting Intolerant From Tolerant) y Mutation Taster (116, 118-120) si no está
disponible el estudio funcional in vitro, que no se hace de rutina en la actualidad. La
Asociación de Ciencia de la Genética Clínica [Association for Clinical Genetic Science
(ACGS) (53)] ha propuesto una clasificación según la predicción in silico de las
variantes nuevas, sobre todo las de cambio de aminoácido o missense:
1) No patogénica
2) Probablemente no patogénica
3) De significado incierto
4) Posiblemente patogénica
5) Patogénica
En el caso de que no sea una mutación puntual, sino un gran reordenamiento por una
deleción o inserción de una parte del gen, puede no detectarse con la metodología
anterior y ser necesarias otras técnicas como la MLPA (multiplex ligation-depent probe
amplification) (121).
La mayoría de las mutaciones causantes de HF se localizan en el LDLR, 80-90%, en

segundo lugar en APOB, 5%, y en PCSK9 <1%, las mutaciones en LDLRAP1, APOE y
STAP1 son minoritarias y en un 10-40% de los casos el estudio genético es negativo. Se
han realizado estudios de exoma completo en busca de otros genes y no se han
identificado otros genes candidatos, por lo que podría tratarse de formas poligénicas
graves (37).
64
2.5 Principios del tratamiento
El tratamiento hipolipemiante es el pilar fundamental en el manejo de los pacientes con
HF, ya que la reducción de las concentraciones de c-LDL a niveles normales reduce el
riesgo de padecer ECV a valores similares a los de la población general.
Las medidas higiénico-dietéticas y un estilo de vida saludable son parte muy importante
del tratamiento. Las modificaciones en la dieta pueden ayudar a reducir el c-LDL hasta
un 15%. La dieta mediterránea ha demostrado reducir el riesgo de ECV y puede ser
beneficiosa en esta población (122). También se recomienda la suplementación dietética
con esteroles y estanoles vegetales, que pueden conseguir reducciones de c-LDL de un
10%. Es importante también la práctica ejercicio físico regular, mantener un índice de
masa corporal normal y no fumar, lo que, junto con el tratamiento farmacológico, puede
mejorar mucho el pronóstico de la enfermedad (114).
Existe un acuerdo de la mayoría de las sociedades científicas sobre que el objetivo en
estos pacientes sea reducir el c-LDL con tratamiento hipolipemiante intensivo. Las
guías de la Sociedades Europea de Cardiología y Arterioesclerosis, así como la IAS y el
panel Europeo de expertos de HF, recomiendan conseguir un c-LDL menor de 100
mg/dl en pacientes adultos sin ECV y menor de 70 mg/dl en aquellos con ECV (104,
114, 123). Si no se pudieran alcanzar estos niveles, debería intentarse la máxima
reducción de c-LDL posible (>50%). En niños se recomienda empezar el tratamiento
con estatinas entre los 8 y los 10 años, sin diferencias entre sexos. Entre los 10 y los 14
años el objetivo de c-LDL recomendando es inferior a 135 mg/dl o una reducción del
50%. Algunos casos de bajo riesgo en los que los niveles de c-LDL no son tan elevados
y no hay historia familiar de ECV, se puede individualizar el objetivo.
65
Tratamiento farmacológico
Estatinas:
Los fármacos más usados en el manejo de la HF son las estatinas, inhibidores de la
hidroximetil-glutaril (HMG) coenzima A reductasa, que han demostrado reducción de la
morbi-mortalidad cardiovascular en la población general, tanto en prevención primaria
como secundaria. Este beneficio también se ha observado en población con HF y en
estudios de intervención como el 4S o el WOSCOPS, en los que se incluyeron sujetos
con c-LDL>190 mg/dl, podrían tener HF (124-128). En esta población se recomienda el
uso de estatinas de alta potencia, como atorvastatina o rosuvastatina, a la dosis máxima
tolerada para conseguir la reducción de c-LDL necesaria. Dosis máximas de estas
estatinas reducen el c-LDL en sujetos con HF entre un 50-58%, lo que no suele ser
suficiente para alcanzar el objetivo de c-LDL, por lo que es necesario con frecuencia
asociar otros fármacos.
Ezetimiba:
El ezetimiba es un inhibidor selectivo del transportador de colesterol intestinal
Niemann-Pick C1-Like 1 (NPC1L1). Su metabolización hepática es diferente a la del
citocromo P450, por lo que tiene menos interacciones farmacológicas, entre otros con la
mayoría de las estatinas, y es un fármaco en general bien tolerado. Ha demostrado ser
efectivo en pacientes con HF con reducciones adicionales del c-LDL del 20%
aproximadamente (129). Además, ha demostrado seguridad en población pediátrica
(130).
Resinas:
Las resinas secuestradoras de ácidos biliares disminuyen la recaptación de colesterol en
la circulación enterohepática, por lo que no tienen efectos a nivel sistémico. Las
reducciones de c-LDL se sitúan entre 15 y 20 mg/dl y pueden incrementar ligeramente
66
los triglicéridos, por lo que no se recomiendan cuando están elevados. Sus efectos
secundarios gastrointestinales limitan parcialmente su uso. La resina con mayor
evidencia en población con HF es el colesevelam, que es el mejor tolerado (131).
Inhibidores de PCSK9:
Recientemente se han comercializado los anticuerpos monoclonales humanos
(inhibidores) contra PCSK9 (iPCSK9), evolocumab y alirocumab, que actúan
bloqueando esta proteína. Al inhibir la PCSK9 aumenta el número de receptores
disponibles en la superficie celular, ya que no se produce su destrucción en el lisosoma
y esto se traduce en una reducción del c-LDL plasmático (figura 16). Estas reducciones
son del 50-70% adicionales al tratamiento con estatinas y ezetimiba. Los iPCSK9
también reducen las concentraciones de Lp(a) entre un 25 a 30%. Se administran por vía
subcutánea cada 2 o 4 semanas y su acción es inmediata. Ambos fármacos están
aprobados por la Administración Federal de Alimentos y Fármacos [(Food and Drug
Administration (FDA)] y la Agencia Europea de Medicamentos (EMA) y han sido
comercializados en España desde el año 2016.
Figura 15. Anticuerpos monoclonales inhibiendo la acción de PCSK9.

Extraído de López-Sendon J et al., 2017 (132)
67
Se ha estudiado la eficacia de los iPCSK9 en monoterapia o asociados a estatinas y
ezetimiba en distintos grupos de pacientes: HFHe, HFHo (el evolocumab), intolerantes
a estatinas y pacientes de alto riesgo de ECV(133, 134). Son fármacos muy bien
tolerados y con pocos efectos secundarios; se ha constatado un ligero incremento de
reacciones en el sitio de inyección y los problemas neurocognitivos por niveles
extremadamente bajos de c-LDL se han descartado en estudios dirigidos (135).
Estos fármacos han demostrado además reducción de eventos cardiovasculares en dos
estudios recientes (136, 137) y están indicados cuando a pesar de tratamiento máximo
no se consiguen los niveles de c-LDL deseados o en pacientes intolerantes a las
estatinas (136, 137).
Las indicaciones para tratamiento con iPCSK9 propuesta por la Sociedad Española de
Arterioesclerosis (SEA) (138) son:
- Pacientes con ECV establecida inestable (un evento en los últimos 5 años)
con c-LDL> 100 mg/dl con tratamiento hipolipemiante máximo
(atorvastatina 40-80 mg/rosuvastatina 20 mg + ezetimiba 10 mg).
- Pacientes con ECV estable y c-LDL>130 mg/dl con tratamiento
hipolipemiante máximo (atorvastatina 40-80 mg/rosuvastatina 20 mg +
ezetimibe 10 mg).
- Pacientes con hipercolesterolemia familiar con factores de riesgo
(antecedentes familiares de ECV precoz, edad >40 años, Lp(a) > 50 mg/dl)
que tengan c-LDL > 130 mg/dl con tratamiento hipolipemiante máximo
(atorvastatina 40-80 mg/rosuvastatina 20 mg + ezetimiba 10 mg).
68
- Pacientes con hipercolesterolemia familiar con c-LDL >180 mg/dl con
tratamiento hipolipemiante máximo (atorvastatina 40-80 mg/rosuvastatina 20
mg + ezetimiba 10 mg).
- Pacientes con los criterios previos con intolerancia probada a estatinas y
tratados con ezetimiba 10 mg.
Tratamiento de la HFHo
En la forma homocigota el tratamiento hipolipemiante tiene que ser más precoz e
intensivo, ya que el riesgo de arterioesclerosis es mucho mayor.
Estatinas y ezetimibe:
En general, dosis altas de atorvastatina y rosuvastatina logran reducciones del c-LDL
del 10-30% y el ezetimibe un 10-15% adicional, pudiendo también usarse resinas (130)
. La respuesta a las estatinas en pacientes con HAR es mayor, con reducciones mayores
al 50% en algunos casos (81).
Aféresis de LDL:
En estos pacientes, si el c-LDL no se controla con el tratamiento, lo que suele ocurrir en
la mayoría de los casos, se recomienda la aféresis de LDL. Este procedimiento consiste
en la eliminación extracorpórea de c-LDL en una sesión de duración variable, y ha
demostrado ser coste-efectivo. La aféresis reduce el c-LDL entre un 55-70% por sesión.
Debe iniciarse a los 5 años y no más tarde de los 8 (105). En el procedimiento puede
producirse hipotensión, dolor abdominal, náuseas o ferropenia, pero son efectos
secundarios poco frecuentes. Con la aféresis continuada se puede lograr la regresión de
lesiones cutáneas y la regresión o estabilización de lesiones vasculares, mejorando el
pronóstico de estos pacientes (figura 16).
69
A B C
D E F
Figura 16. Paciente con xantomas cutáneos en diferentes localizaciones corporales (A,
B, C) y regresión completa de estas lesiones, en el mismo paciente, tras 10 años de
aféresis de LDL (D, E, F).
Inhibidores de PCSK9:
En pacientes con HFHo con mutaciones correspondientes a alelos defectuosos en el
LDLR, los iPCSK9, en concreto el evolocumab, ha mostrado reducciones del c-LDL del
30% (139).
Lomitapida y mipomersen:
Existen en la actualidad dos tratamientos específicos para la HFHo, la lomitapida y el
mipomersen, este último no está aprobado en Europa. La lomitapida es un inhibidor oral
de la proteína de transferencia microsomal (MTP), que es la enzima que transfiere
triglicéridos a los QM en el intestino y a las VLDL en el hígado, con reducciones del c-
LDL de hasta un 50%. Su mecanismo de acción es independiente de la vía del LDLR,
por lo que es eficaz en estos pacientes. Sus efectos secundarios principales son la
esteatosis hepática y las alteraciones gastrointestinales y debe administrarse con una
dieta con menos del 20% del aporte calórico en forma de grasas, siendo necesaria la
70
suplementación con ácidos grasos esenciales y vitamina E. Es necesario realizar pruebas
de imagen hepáticas periódicas para evaluar la esteatosis (140).
El mipomersen es un oligonucleótido antisentido que bloquea el ARNm de APOB, por
lo que no se produce la proteína y se reduce el ensamblaje de las VLDL. Se administra
por vía subcutánea y reduce el c-LDL de un 25%. Sus principales efectos secundarios
son reacciones cutáneas en la zona de inyección y esteatosis hepática (141).
Trasplante hepático:
El trasplante hepático es una opción terapéutica prácticamente en desuso, que debe
considerarse únicamente cuando fallan las demás opciones.
Figura 17. Algoritmo de tratamiento de la HFHo, extraído de Ascaso et al., 2015 (107).
71
2.6. Epidemiología de la HF. Poblaciones con aislamiento genético
El espectro de mutaciones en el LDLR varía en función de los países. En algunos de
ellos, un número no muy grande de mutaciones dan lugar a la mayoría de casos de HF,
tal y como sucede en Grecia, Brasil y Méjico (11). En los dos últimos se han
identificado pocas mutaciones en el LDLR, descritas previamente en poblaciones
Europeas (142). No hay muchos datos del diagnóstico genético de HF en otros países de
Latinoamérica.
Por el contrario, hay otros países de Europa, como Holanda, en el que hay un espectro
muy amplio de mutaciones. Situación similar ocurre en Reino Unido o Italia, donde
también se han reportado más de 200 mutaciones diferentes (143, 144), o España. En
nuestro país hay identificadas más de 400 mutaciones en el LDLR, la mayoría descritas
previamente en otros países de Europa (145-147). Un estudio reciente del registro
SAFEHEART español describe 194 variantes (189 en LDLR y 5 en APOB) en 775
familias, de las cuales 24 son nuevas. De estas, 10 variantes representan el 40% de la
muestra, la más prevalente es la p.(Gln488*) en el LDLR, que supone el 7% del total
(148). Un estudio, realizado en la isla de Mallorca, puso de manifiesto una amplia
heterogeneidad, con la existencia de 24 mutaciones, sólo 4 nuevas y ninguna recurrente.
Una excepción es la mutación R3500Q en el gen de la APOB, que es poco frecuente en
España, pero sí lo es en la población de Galicia (149).
Existen ciertas zonas del mundo en las que una o varias mutaciones en el LDLR son
responsables de la mayoría de las formas de HF. Esto puede deberse a un efecto
fundador y a cierto aislamiento genético, de manera que la prevalencia de esta
enfermedad es mucho mayor en esas regiones.
Es el caso del Líbano, donde la frecuencia de homocigotos es 10 veces mayor que en
otras poblaciones, con una mayor prevalencia también de sujetos con HFHe, debido
72
fundamentalmente a la consanguinidad. En 1987 Lehrman y colaboradores identificaron
la mutación p.(Cys681X) en el gen de LDLR en 4 pacientes con HFHo, 3 libaneses y un
sirio. Los autores asignaron el término “alelo Libanés” a esta mutación, que genera un
codón de parada y una proteína truncada. Es responsable del 81.5% de las formas de HF
en el Líbano, lo que supone la frecuencia más alta descrita de la misma mutación en una
población. Los estudios de haplotipo revelan que es una mutación muy antigua, que está
presente tanto en probandos de religión cristiana como musulmanes (29, 150).
Los canadienses franceses también tienen una prevalencia de HFHe mayor a la
población general. En la provincia de Quebec hay 1 afecto por cada 154 personas y 3
mutaciones en el LDLR son responsables del 80% de los casos, también un mayor
número de sujetos con HFHo (151). Estas mutaciones son W66G, E207K y C646Y. Se
estima que, entre los años 1632 y 1680, unas 2500 personas se asentaron y
permanecieron relativamente aisladas en el Rio Sant Lawrence, con muchos
matrimonios y una tasa alta de natalidad, lo que podría explicar el origen del efecto
fundador que se observa en esta población (27).
Los Judíos Ashkenazi son otra población con efecto fundador conocido para esta y otras
enfermedades. La mutación de origen Lituano (G197del) es causante del 80% de las
HF. Esta deleción impide el transporte correcto del receptor de LDL desde el aparato de
Golgi y se describió en la década de los 90 en Judíos Ashkenazi de distintas partes del
mundo: un sujeto con HFHo en Estados Unidos, ocho judíos sudafricanos, 6 familias
no relacionadas de Reino Unido, un alemán y siete sujetos de San Petersburgo. En
estudios de haplotipo parece que la mutación podría provenir de un antecesor común
nacido entre los años 1330 y 1360 después de Cristo (30).
En el caso de los finlandeses, 5 mutaciones (FH-Helsinki (c.2311+246_*808del, p.NA),
FH-Turku p.(Gly844Asp), FH-North Karelia p.(Pro309Lysfs*59), FH-Pori
73
(p.(Leu401His) y FH-Pogosta (p.(Arg595Gln)) suponen algo más del 75% de las HF
(152). Finlandia ha estado habitada desde hace miles de años. Hay datos de población
desde la edad de piedra y bronce. Posteriormente, en los primeros siglos después de
Cristo, hubo corrientes migratorias a la zona del mar Báltico. Esta población ha estado
relativamente aislada y ha mantenido costumbres diferentes a las de otras poblaciones
Europeas, y esto ha motivado la presencia de mutaciones de HF típicas de esa región
(28).
Por último, los Afrikaners en Sudráfrica también tienen una prevalencia elevada de HF
y de enfermedad coronaria, con tres mutaciones fundadoras (D206E, V408M y D154N),
que son responsables del 90% de los sujetos con HF en este grupo étnico (31).
2.7. Programas de detección de la HF basados en el diagnóstico genético
La HF está infradiagnosticada a nivel mundial, y sabemos que un diagnóstico y
tratamiento tempranos reducen el riesgo de padecer ECV y aumenta la esperanza de
vida de los pacientes afectos. Muchos de ellos son tratados en Atención Primaria y sólo
los fenotipos más graves se derivan a las Unidades de Lípidos o a Atención
Especializada. A menudo, incluso tras el diagnóstico de ECV, este se atribuye a otros
factores de riesgo más comunes y no se considera la posibilidad de una
hipercolesterolemia de causa genética (153). Para poder aumentar el diagnóstico de esta
patología es necesaria la implementación de estrategias de cribado. En nuestro medio
usando los criterios RCLH (tabla 4).
La HF es una enfermedad que cumple los criterios de la Organización Mundial de la
Salud para su cribado sistemático:
1) Es una enfermedad grave.
2) Se puede detectar antes de la aparición de los síntomas.
74
3) Tiene un diagnóstico de confirmación y tratamiento eficaz.
Una vez establecido el diagnóstico en un caso índice, distintos estudios han mostrado
que la medida más coste-efectiva para la identificación de casos nuevos es el cribado en
cascada de sus familiares. Este cribado debe hacerse en base a los niveles de colesterol,
pero el uso de los tests genéticos permite un diagnóstico más certero, ya que se ha visto
que hasta un 24% de familiares con estudio genético positivo tienen niveles de c-LDL
que no están por encima del p90 de la población general (154).
A pesar de esto no se han implementado programas para la detección genética de HF en
muchos países. El país con el programa mejor establecido es Holanda, donde el cribado
empezó en 1994 y hasta la actualidad ha diagnosticado al 70% de la población con HF
del país. En los primeros 5 años se estudiaron 5442 familiares de 237 casos índices y se
detectaron 2039 sujetos con HFHe con mutaciones en el LDLR. Al diagnóstico
únicamente el 39% tenían tratamiento hipolipemiante y al año el porcentaje de pacientes
con tratamiento ascendió al 93%. También se observó que el 18% de los sujetos con
diagnóstico genético positivo no tenían niveles de c-LDL mayores al percentil 90, por lo
que no hubiesen sido diagnosticados mediante criterios clínicos (155).
En Italia se ha llevado a cabo el estudio LIPIGEN, con la identificación de más de 200
variantes en 1076 sujetos, que ha dado pie al inicio de un cribado en cascada familiar
(144).
Otros países donde hay estrategias para la búsqueda de HF son Canada y Reino Unido,
donde la National Institutes for Health and Clinical Excellence (NICE) recomienda
cribado mediante cascada familiar con niveles de c-LDL y diagnóstico genético (156).
En España se estima que hay unas 20,000 personas diagnosticadas, que podrían
representar tan solo el 20% de la población con HF. De éstos, aproximadamente el 40%
estaría diagnosticado genéticamente (153). Las estrategias de cribado sistemático de HF
75
se han implementado en algunas comunidades, incluyendo el diagnóstico genético, pero
de forma muy desigual, y hay muchas comunidades que no tienen esta posibilidad.
Castilla y León tiene una estrategia mediante estudio genético en la que participan tanto
médicos de atención primaria como de atención especializada. Cuando hay sospecha de
un caso índice según los criterios de la RCHL, se solicita el estudio genético mediante
una muestra de saliva. Si se confirma el diagnóstico, se procede al cribado genético de
los familiares o detección en cascada. De esta forma se han diagnosticado unas 1000
personas con HF en esta comunidad.
Por su parte, la Fundación de Hipercolesterolemia Familiar lleva a cabo un programa de
detección y registro de HF a nivel nacional en colaboración con algunos centros de
distintas comunidades, ofreciendo el diagnóstico genético del caso índice y de sus
familiares. En este registro aproximadamente unas 3000 personas tienen diagnóstico
genético positivo.
Recientemente, se ha estimado que una estrategia de detección de HF en España que
identificara unos 9000 casos al año supondría evitar 705 eventos coronarios, 96 muertes
y la pérdida de productividad de unos 200.000 días laborales en los siguientes 10 años
(153).
Por último, en 2014 se celebró una reunión sobre diagnóstico y tratamiento de HF en el
Parlamento Europeo, en la que se expuso la importancia de la detección precoz y el
tratamiento temprano de la HF. En esta reunión se dieron una serie de mensajes:
- Necesidad de estimular estrategias que mejoren el diagnóstico precoz y
tratamiento de esta enfermedad para la prevención de ECV.
- Los programas de cribado mediante cascada familiar han demostrado ser costo-
efectivos, previniendo enfermedad coronaria y suponiendo ahorros para los
sistema sanitarios.
76
- Que exista vinculación entre las iniciativas europeas y el desarrollo de
actividades en los distintos países, estimulando que se desarrollen políticas de
salud para mejorar la calidad de vida de pacientes con HF.
- Fomentar la existencia de registros asociados a programas de cribado, para
mejorar el conocimiento, la prevención y la investigación sobre la enfermedad
(153).
77
78
REFERENCIAS
1. Herrera E LM. Metabolismo de las lipoproteínas. In: E H, editor. Bioquímica I.
2ª ed. Madrid: Iberamericana-McGraw-Hill; 1991. p. 667-702.
2. Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol
homeostasis. Science. 1986;232(4746):34-47.
3. Repa JJ, Mangelsdorf DJ. The role of orphan nuclear receptors in the regulation
of cholesterol homeostasis. Annu Rev Cell Dev Biol. 2000;16:459-81.
4. Camejo G H-CE. Consideraciones fisicoquímicas sobre las lipoproteínas y su
metabolismo. In: Carmena R OJ, editor. Hiperlipemias Clínica y tratamiento.
Barcelona: Editorial Doyma; 1999. p. 1-32.
5. Hegele RA. Plasma lipoproteins: genetic influences and clinical implications.
Nat Rev Genet. 2009;10(2):109-21.
6. Douglas L. Digestión, transporte y metabolismo de los lípidos. Valencia: Atrium
Innovations España S.L.; 2017 [Available from:
http://www.douglaslabs.es/blog/digestion-transporte-y-metabolismo-de-los-lipidos/.
7. Dominiczak MH, Caslake MJ. Apolipoproteins: metabolic role and clinical
biochemistry applications. Ann Clin Biochem. 2011;48(Pt 6):498-515.
8. Errico TL, Chen X, Martin Campos JM, Julve J, Escola-Gil JC, Blanco-Vaca F.
[Basic mechanisms: structure, function and metabolism of plasma lipoproteins]. Clin
Investig Arterioscler. 2013;25(2):98-103.
9. Shelness GS, Sellers JA. Very-low-density lipoprotein assembly and secretion.
Curr Opin Lipidol. 2001;12(2):151-7.
10. Pownall HJ GA. Metabolismo de las lipoproteínas plasmáticas humanas. In: CM
B, editor. Lipidología clínica Complemento al tratado de cardiología de Braunwald's
Heart Disease. Barcelona2011. p. 1-10.
11. Sharifi M, Futema M, Nair D, Humphries SE. Genetic Architecture of Familial
Hypercholesterolaemia. Curr Cardiol Rep. 2017;19(5):44.
12. Errico TC, X; Martin Campos, JM; Julve, J; Escolà-Gil, JC; Blanco-Vaca, F. .
Mecanismos básicos: estructura, función y metabolismo de las lipoproteínas. Clínica e
Investigación en Arteriosclerosis. 2013;25(2):98-103.
13. Lieberman M MA, Peet A. Marks' basic medical biochemistry : a clinical
approach: Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2013.
14. Koschinsky ML, Marcovina SM. Lipoprotein(a): structural implications for
pathophysiology. Int J Clin Lab Res. 1997;27(1):14-23.
15. Kamstrup PR, Tybjaerg-Hansen A, Steffensen R, Nordestgaard BG. Genetically
elevated lipoprotein(a) and increased risk of myocardial infarction. JAMA.
2009;301(22):2331-9.
16. Danesh J, Collins R, Peto R. Lipoprotein(a) and coronary heart disease. Meta-
analysis of prospective studies. Circulation. 2000;102(10):1082-5.
17. Foundation TLa. Understand Inherited Lipoprotein(a) San Carlos,
California2013 [Available from:
https://www.lipoproteinafoundation.org/page/UnderstandLpa.
18. Goldstein JL HH, Brown MS. Familial hypercholesterolemia. In: Scriver CR BA,
Sly WS, Valle D, editor. The Metabolic and Molecular Bases of Inherited Disease. New
York: McGraw-Hill; 2001. p. 2863-913.
19. Slack J. Risks of ischaemic heart-disease in familial hyperlipoproteinaemic
states. Lancet. 1969;2(7635):1380-2.
79
20. Nordestgaard BG, Chapman MJ, Humphries SE, Ginsberg HN, Masana L,
Descamps OS, et al. Familial hypercholesterolaemia is underdiagnosed and undertreated
in the general population: guidance for clinicians to prevent coronary heart disease:
consensus statement of the European Atherosclerosis Society. Eur Heart J.
2013;34(45):3478-90a.
21. de Ferranti SD, Rodday AM, Mendelson MM, Wong JB, Leslie LK, Sheldrick
RC. Prevalence of Familial Hypercholesterolemia in the 1999 to 2012 United States
National Health and Nutrition Examination Surveys (NHANES). Circulation.
2016;133(11):1067-72.
22. Akioyamen LE, Genest J, Shan SD, Reel RL, Albaum JM, Chu A, et al.
Estimating the prevalence of heterozygous familial hypercholesterolaemia: a systematic
review and meta-analysis. BMJ Open. 2017;7(9):e016461.
23. Sanchez-Hernandez RM, Civeira F, Stef M, Perez-Calahorra S, Almagro F,
Plana N, et al. Homozygous Familial Hypercholesterolemia in Spain: Prevalence and
Phenotype-Genotype Relationship. Circ Cardiovasc Genet. 2016;9(6):504-10.
24. Sjouke B, Hovingh GK, Kastelein JJ, Stefanutti C. Homozygous autosomal
dominant hypercholesterolaemia: prevalence, diagnosis, and current and future
treatment perspectives. Curr Opin Lipidol. 2015;26(3):200-9.
25. Arca M, Zuliani G, Wilund K, Campagna F, Fellin R, Bertolini S, et al.
Autosomal recessive hypercholesterolaemia in Sardinia, Italy, and mutations in ARH: a
clinical and molecular genetic analysis. Lancet. 2002;359(9309):841-7.
26. Sanchez-Hernandez RM, Prieto-Matos P, Civeira F, Lafuente EE, Vargas MF,
Real JT, et al. Autosomal recessive hypercholesterolemia in Spain. Atherosclerosis.
2018;269:1-5.
27. Couture P, Morissette J, Gaudet D, Vohl MC, Gagne C, Bergeron J, et al. Fine
mapping of low-density lipoprotein receptor gene by genetic linkage on chromosome
19p13.1-p13.3 and study of the founder effect of four French Canadian low-density
lipoprotein receptor gene mutations. Atherosclerosis. 1999;143(1):145-51.
28. Lahtinen AM, Havulinna AS, Jula A, Salomaa V, Kontula K. Prevalence and
clinical correlates of familial hypercholesterolemia founder mutations in the general
population. Atherosclerosis. 2015;238(1):64-9.
29. Abifadel M, Rabes JP, Jambart S, Halaby G, Gannage-Yared MH, Sarkis A, et
al. The molecular basis of familial hypercholesterolemia in Lebanon: spectrum of
LDLR mutations and role of PCSK9 as a modifier gene. Hum Mutat. 2009;30(7):E682-
91.
30. Meiner V, Landsberger D, Berkman N, Reshef A, Segal P, Seftel HC, et al. A
common Lithuanian mutation causing familial hypercholesterolemia in Ashkenazi Jews.
Am J Hum Genet. 1991;49(2):443-9.
31. Kotze MJ, Langenhoven E, Warnich L, du Plessis L, Retief AE. The molecular
basis and diagnosis of familial hypercholesterolaemia in South African Afrikaners. Ann
Hum Genet. 1991;55(2):115-21.
32. Goldberg AC, Hopkins PN, Toth PP, Ballantyne CM, Rader DJ, Robinson JG, et
al. Familial hypercholesterolemia: screening, diagnosis and management of pediatric
and adult patients: clinical guidance from the National Lipid Association Expert Panel
on Familial Hypercholesterolemia. J Clin Lipidol. 2011;5(3):133-40.
33. Müller C. Xanthomata, Hypercholesterolemia, Angina Pectoris. Acta Medica
Scandinavica. 1938;95(S89):75-84.
34. Khachadurian AK. The Inheritance of Essential Familial Hypercholesterolemia.
Am J Med. 1964;37:402-7.
80
35. Fredrickson DS, Levy RI, Lees RS. Fat transport in lipoproteins--an integrated
approach to mechanisms and disorders. N Engl J Med. 1967;276(5):273-81 concl.
36. Bruikman CS, Hovingh GK, Kastelein JJ. Molecular basis of familial
hypercholesterolemia. Curr Opin Cardiol. 2017.
37. De Castro-Oros I, Pocovi M, Civeira F. The genetic basis of familial
hypercholesterolemia: inheritance, linkage, and mutations. Appl Clin Genet. 2010;3:53-
64.
38. Hovingh GK, Davidson MH, Kastelein JJ, O'Connor AM. Diagnosis and
treatment of familial hypercholesterolaemia. Eur Heart J. 2013;34(13):962-71.
39. Fokkema IF, Taschner PE, Schaafsma GC, Celli J, Laros JF, den Dunnen JT.
LOVD v.2.0: the next generation in gene variant databases. Hum Mutat.
2011;32(5):557-63.
40. Sudhof TC, Goldstein JL, Brown MS, Russell DW. The LDL receptor gene: a
mosaic of exons shared with different proteins. Science. 1985;228(4701):815-22.
41. Cummings RD, Kornfeld S, Schneider WJ, Hobgood KK, Tolleshaug H, Brown
MS, et al. Biosynthesis of N- and O-linked oligosaccharides of the low density
lipoprotein receptor. J Biol Chem. 1983;258(24):15261-73.
42. Anderson RG, Goldstein JL, Brown MS. Localization of low density lipoprotein
receptors on plasma membrane of normal human fibroblasts and their absence in cells
from a familial hypercholesterolemia homozygote. Proc Natl Acad Sci U S A.
1976;73(7):2434-8.
43. Sommerville R, Brown AF, Upjohn M. A standardised equine-based welfare
assessment tool used for six years in low and middle income countries. PLoS One.
2018;13(2):e0192354.
44. Wang Y, Huang Y, Hobbs HH, Cohen JC. Molecular characterization of
proprotein convertase subtilisin/kexin type 9-mediated degradation of the LDLR. J
Lipid Res. 2012;53(9):1932-43.
45. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature.
1990;343(6257):425-30.
46. Zelcer N, Hong C, Boyadjian R, Tontonoz P. LXR regulates cholesterol uptake
through Idol-dependent ubiquitination of the LDL receptor. Science.
2009;325(5936):100-4.
47. UniProt Consortium T. UniProt: the universal protein knowledgebase. Nucleic
Acids Res. 2018;46(5):2699.
48. Beroud C, Collod-Beroud G, Boileau C, Soussi T, Junien C. UMD (Universal
mutation database): a generic software to build and analyze locus-specific databases.
Hum Mutat. 2000;15(1):86-94.
49. Russell DW, Brown MS, Goldstein JL. Different combinations of cysteine-rich
repeats mediate binding of low density lipoprotein receptor to two different proteins. J
Biol Chem. 1989;264(36):21682-8.
50. Fisher C, Abdul-Aziz D, Blacklow SC. A two-module region of the low-density
lipoprotein receptor sufficient for formation of complexes with apolipoprotein E ligands.
Biochemistry. 2004;43(4):1037-44.
51. Yokode M, Pathak RK, Hammer RE, Brown MS, Goldstein JL, Anderson RG.
Cytoplasmic sequence required for basolateral targeting of LDL receptor in livers of
transgenic mice. J Cell Biol. 1992;117(1):39-46.
52. Gabcova-Balaziova D, Stanikova D, Vohnout B, Huckova M, Stanik J, Klimes I,
et al. Molecular-genetic aspects of familial hypercholesterolemia. Endocr Regul.
2015;49(3):164-81.
81
53. Leigh S, Futema M, Whittall R, Taylor-Beadling A, Williams M, den Dunnen
JT, et al. The UCL low-density lipoprotein receptor gene variant database:
pathogenicity update. J Med Genet. 2017;54(4):217-23.
54. Hobbs HH, Brown MS, Goldstein JL. Molecular genetics of the LDL receptor
gene in familial hypercholesterolemia. Hum Mutat. 1992;1(6):445-66.
55. Oviedo Ud. Hipercolesterolemia familiar [Available from:
http://www10.uniovi.es/anatopatodon/modulo8/tema02_defectos/09familiar.htm.
56. Gudnason V, Day IN, Humphries SE. Effect on plasma lipid levels of different
classes of mutations in the low-density lipoprotein receptor gene in patients with
familial hypercholesterolemia. Arterioscler Thromb. 1994;14(11):1717-22.
57. Goldberg AC, Hopkins PN, Toth PP, Ballantyne CM, Rader DJ, Robinson JG, et
al. Familial hypercholesterolemia: screening, diagnosis and management of pediatric
and adult patients: clinical guidance from the National Lipid Association Expert Panel
on Familial Hypercholesterolemia. J Clin Lipidol. 2011;5(3 Suppl):S1-8.
58. Chen SH, Yang CY, Chen PF, Setzer D, Tanimura M, Li WH, et al. The
complete cDNA and amino acid sequence of human apolipoprotein B-100. J Biol Chem.
1986;261(28):12918-21.
59. Myant NB. Familial defective apolipoprotein B-100: a review, including some
comparisons with familial hypercholesterolaemia. Atherosclerosis. 1993;104(1-2):1-18.
60. Soria LF, Ludwig EH, Clarke HR, Vega GL, Grundy SM, McCarthy BJ.
Association between a specific apolipoprotein B mutation and familial defective
apolipoprotein B-100. Proc Natl Acad Sci U S A. 1989;86(2):587-91.
61. Myant NB, Forbes SA, Day IN, Gallagher J. Estimation of the age of the
ancestral arginine3500-->glutamine mutation in human apoB-100. Genomics.
1997;45(1):78-87.
62. Pullinger CR, Hennessy LK, Chatterton JE, Liu W, Love JA, Mendel CM, et al.
Familial ligand-defective apolipoprotein B. Identification of a new mutation that
decreases LDL receptor binding affinity. J Clin Invest. 1995;95(3):1225-34.
63. Alves AC, Etxebarria A, Soutar AK, Martin C, Bourbon M. Novel functional
APOB mutations outside LDL-binding region causing familial hypercholesterolaemia.
Hum Mol Genet. 2014;23(7):1817-28.
64. Fouchier SW, Defesche JC, Kastelein JJ, Sijbrands EJ. Familial defective
apolipoprotein B versus familial hypercholesterolemia: an assessment of risk. Semin
Vasc Med. 2004;4(3):259-64.
65. Schaefer JR, Scharnagl H, Baumstark MW, Schweer H, Zech LA, Seyberth H, et
al. Homozygous familial defective apolipoprotein B-100. Enhanced removal of
apolipoprotein E-containing VLDLs and decreased production of LDLs. Arterioscler
Thromb Vasc Biol. 1997;17(2):348-53.
66. Zhang DW, Lagace TA, Garuti R, Zhao Z, McDonald M, Horton JD, et al.
Binding of proprotein convertase subtilisin/kexin type 9 to epidermal growth factor-like
repeat A of low density lipoprotein receptor decreases receptor recycling and increases
degradation. J Biol Chem. 2007;282(25):18602-12.
67. Shan L, Pang L, Zhang R, Murgolo NJ, Lan H, Hedrick JA. PCSK9 binds to
multiple receptors and can be functionally inhibited by an EGF-A peptide. Biochem
Biophys Res Commun. 2008;375(1):69-73.
68. Humphries SE, Neely RD, Whittall RA, Troutt JS, Konrad RJ, Scartezini M, et
al. Healthy individuals carrying the PCSK9 p.R46L variant and familial
hypercholesterolemia patients carrying PCSK9 p.D374Y exhibit lower plasma
concentrations of PCSK9. Clin Chem. 2009;55(12):2153-61.
82
69. Varret M, Rabes JP, Saint-Jore B, Cenarro A, Marinoni JC, Civeira F, et al. A
third major locus for autosomal dominant hypercholesterolemia maps to 1p34.1-p32.
Am J Hum Genet. 1999;64(5):1378-87.
70. Cariou B, Le May C, Costet P. Clinical aspects of PCSK9. Atherosclerosis.
2011;216(2):258-65.
71. Pandit S, Wisniewski D, Santoro JC, Ha S, Ramakrishnan V, Cubbon RM, et al.
Functional analysis of sites within PCSK9 responsible for hypercholesterolemia. J Lipid
Res. 2008;49(6):1333-43.
72. Lagace TA, Curtis DE, Garuti R, McNutt MC, Park SW, Prather HB, et al.
Secreted PCSK9 decreases the number of LDL receptors in hepatocytes and in livers of
parabiotic mice. J Clin Invest. 2006;116(11):2995-3005.
73. Abifadel M, Varret M, Rabes JP, Allard D, Ouguerram K, Devillers M, et al.
Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat Genet.
2003;34(2):154-6.
74. Alves AC, Etxebarria A, Medeiros AM, Benito-Vicente A, Thedrez A, Passard
M, et al. Characterization of the first PCSK9 gain of function homozygote. J Am Coll
Cardiol. 2015;66(19):2152-4.
75. Cameron J, Holla OL, Ranheim T, Kulseth MA, Berge KE, Leren TP. Effect of
mutations in the PCSK9 gene on the cell surface LDL receptors. Hum Mol Genet.
2006;15(9):1551-8.
76. Cunningham D, Danley DE, Geoghegan KF, Griffor MC, Hawkins JL, Subashi
TA, et al. Structural and biophysical studies of PCSK9 and its mutants linked to familial
hypercholesterolemia. Nat Struct Mol Biol. 2007;14(5):413-9.
77. Cohen J, Pertsemlidis A, Kotowski IK, Graham R, Garcia CK, Hobbs HH. Low
LDL cholesterol in individuals of African descent resulting from frequent nonsense
mutations in PCSK9. Nat Genet. 2005;37(2):161-5.
78. Naoumova RP, Tosi I, Patel D, Neuwirth C, Horswell SD, Marais AD, et al.
Severe hypercholesterolemia in four British families with the D374Y mutation in the
PCSK9 gene: long-term follow-up and treatment response. Arterioscler Thromb Vasc
Biol. 2005;25(12):2654-60.
79. Michaely P, Li WP, Anderson RG, Cohen JC, Hobbs HH. The modular adaptor
protein ARH is required for low density lipoprotein (LDL) binding and internalization
but not for LDL receptor clustering in coated pits. J Biol Chem. 2004;279(32):34023-31.
80. Garcia CK, Wilund K, Arca M, Zuliani G, Fellin R, Maioli M, et al. Autosomal
recessive hypercholesterolemia caused by mutations in a putative LDL receptor adaptor
protein. Science. 2001;292(5520):1394-8.
81. Pisciotta L, Priore Oliva C, Pes GM, Di Scala L, Bellocchio A, Fresa R, et al.
Autosomal recessive hypercholesterolemia (ARH) and homozygous familial
hypercholesterolemia (FH): a phenotypic comparison. Atherosclerosis.
2006;188(2):398-405.
82. Rader DJ, Cohen J, Hobbs HH. Monogenic hypercholesterolemia: new insights
in pathogenesis and treatment. J Clin Invest. 2003;111(12):1795-803.
83. Filigheddu F, Quagliarini F, Campagna F, Secci T, Degortes S, Zaninello R, et
al. Prevalence and clinical features of heterozygous carriers of autosomal recessive
hypercholesterolemia in Sardinia. Atherosclerosis. 2009;207(1):162-7.
84. Soutar AK, Naoumova RP. Mechanisms of disease: genetic causes of familial
hypercholesterolemia. Nat Clin Pract Cardiovasc Med. 2007;4(4):214-25.
85. Brautbar A, Leary E, Rasmussen K, Wilson DP, Steiner RD, Virani S. Genetics
of familial hypercholesterolemia. Curr Atheroscler Rep. 2015;17(4):491.
83
86. Fouchier SW, Dallinga-Thie GM, Meijers JC, Zelcer N, Kastelein JJ, Defesche
JC, et al. Mutations in STAP1 are associated with autosomal dominant
hypercholesterolemia. Circ Res. 2014;115(6):552-5.
87. Awan Z, Choi HY, Stitziel N, Ruel I, Bamimore MA, Husa R, et al. APOE
p.Leu167del mutation in familial hypercholesterolemia. Atherosclerosis.
2013;231(2):218-22.
88. Marduel M, Ouguerram K, Serre V, Bonnefont-Rousselot D, Marques-Pinheiro
A, Erik Berge K, et al. Description of a large family with autosomal dominant
hypercholesterolemia associated with the APOE p.Leu167del mutation. Hum Mutat.
2013;34(1):83-7.
89. Marques-Pinheiro A, Marduel M, Rabes JP, Devillers M, Villeger L, Allard D,
et al. A fourth locus for autosomal dominant hypercholesterolemia maps at 16q22.1.
Eur J Hum Genet. 2010;18(11):1236-42.
90. Raal FJ, Sjouke B, Hovingh GK, Isaac BF. Phenotype diversity among patients
with homozygous familial hypercholesterolemia: A cohort study. Atherosclerosis.
2016;248:238-44.
91. Civeira F, Ros E, Jarauta E, Plana N, Zambon D, Puzo J, et al. Comparison of
genetic versus clinical diagnosis in familial hypercholesterolemia. Am J Cardiol.
2008;102(9):1187-93, 93 e1.
92. Wu R, Wong TY, Saw SM, Cajucom-Uy H, Rosman M, Aung T. Effect of
corneal arcus on central corneal thickness, intraocular pressure, and primary open-angle
glaucoma: the Singapore Malay Eye Study. Arch Ophthalmol. 2010;128(11):1455-61.
93. Oosterveer DM, Versmissen J, Yazdanpanah M, Hamza TH, Sijbrands EJ.
Differences in characteristics and risk of cardiovascular disease in familial
hypercholesterolemia patients with and without tendon xanthomas: a systematic review
and meta-analysis. Atherosclerosis. 2009;207(2):311-7.
94. A. Merchán ÁJR, Rafael Campo, Carlos E. Prada, Juan M. Toro, Robinson
Sánchez, Juan E. Gómez, Nicolás I. Jaramillo, Dora I. Molina, Hernando Vargas-
Uricoechea, Sherien Sixto, Javier M. Castro, Adalberto E. Quintero, Mauricio Coll,
Stase Slotkus, Andrés Ramírez, Harry Pachajoa, Fernando A. Ávila, Rodrigo Alonso.
Hipercolesterolemia familiar: artículo de revisión. Rev Colomb Cardiol. 2016;23(S4):4-
26.
95. Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl
J Med. 2005;352(16):1685-95.
96. Martinez-Gonzalez J, Llorente-Cortes V, Badimon L. [Cellular and molecular
biology of atherosclerotic lesions]. Rev Esp Cardiol. 2001;54(2):218-31.
97. Risk of fatal coronary heart disease in familial hypercholesterolaemia. Scientific
Steering Committee on behalf of the Simon Broome Register Group. BMJ.
1991;303(6807):893-6.
98. Perak AM, Ning H, de Ferranti SD, Gooding HC, Wilkins JT, Lloyd-Jones DM.
Long-Term Risk of Atherosclerotic Cardiovascular Disease in US Adults With the
Familial Hypercholesterolemia Phenotype. Circulation. 2016;134(1):9-19.
99. De Backer G, Besseling J, Chapman J, Hovingh GK, Kastelein JJ, Kotseva K, et
al. Prevalence and management of familial hypercholesterolaemia in coronary patients:
An analysis of EUROASPIRE IV, a study of the European Society of Cardiology.
Atherosclerosis. 2015;241(1):169-75.
100. Civeira F, International Panel on Management of Familial H. Guidelines for the
diagnosis and management of heterozygous familial hypercholesterolemia.
84
101. Perez-Calahorra S, Laclaustra M, Marco-Benedi V, Lamiquiz-Moneo I, Pedro-
Botet J, Plana N, et al. Effect of lipid-lowering treatment in cardiovascular disease
prevalence in familial hypercholesterolemia. Atherosclerosis. 2019;284:245-52.
102. Brunham LR, Cermakova L, Lee T, Priecelova I, Alloul K, de Chantal M, et al.
Contemporary Trends in the Management and Outcomes of Patients With Familial
Hypercholesterolemia in Canada: A Prospective Observational Study. Can J Cardiol.
2017;33(3):385-92.
103. Mundal L, Veierod MB, Halvorsen T, Holven KB, Ose L, Iversen PO, et al.
Cardiovascular disease in patients with genotyped familial hypercholesterolemia in
Norway during 1994-2009, a registry study. Eur J Prev Cardiol. 2016;23(18):1962-9.
104. Santos RD, Gidding SS, Hegele RA, Cuchel MA, Barter PJ, Watts GF, et al.
Defining severe familial hypercholesterolaemia and the implications for clinical
management: a consensus statement from the International Atherosclerosis Society
Severe Familial Hypercholesterolemia Panel. Lancet Diabetes Endocrinol.
2016;4(10):850-61.
105. Raal FJ, Santos RD. Homozygous familial hypercholesterolemia: current
perspectives on diagnosis and treatment. Atherosclerosis. 2012;223(2):262-8.
106. Cuchel M, Bruckert E, Ginsberg HN, Raal FJ, Santos RD, Hegele RA, et al.
Homozygous familial hypercholesterolaemia: new insights and guidance for clinicians
to improve detection and clinical management. A position paper from the Consensus
Panel on Familial Hypercholesterolaemia of the European Atherosclerosis Society. Eur
Heart J. 2014;35(32):2146-57.
107. Ascaso JF, Mata P, Arbona C, Civeira F, Valdivielso P, Masana L.
[Homozygous familial hypercholesterolaemia: Spanish adaptation of the position paper
from the Consensus Panel on Familial Hypercholesterolaemia of the European
Atherosclerosis Society. Consensus document of the Spanish Society of Arteriosclerosis
(SEA) and Familial Hypercholesterolaemia Foundation (FHF)]. Clin Investig
Arterioscler. 2015;27(2):80-96.
108. Schmidt HH, Hill S, Makariou EV, Feuerstein IM, Dugi KA, Hoeg JM. Relation
of cholesterol-year score to severity of calcific atherosclerosis and tissue deposition in
homozygous familial hypercholesterolemia. Am J Cardiol. 1996;77(8):575-80.
109. Koeijvoets KC, Wiegman A, Rodenburg J, Defesche JC, Kastelein JJ, Sijbrands
EJ. Effect of low-density lipoprotein receptor mutation on lipoproteins and
cardiovascular disease risk: a parent-offspring study. Atherosclerosis. 2005;180(1):93-9.
110. Tejedor D, Castillo S, Mozas P, Jimenez E, Lopez M, Tejedor MT, et al.
Reliable low-density DNA array based on allele-specific probes for detection of 118
mutations causing familial hypercholesterolemia. Clin Chem. 2005;51(7):1137-44.
111. Alonso R, Mata N, Castillo S, Fuentes F, Saenz P, Muniz O, et al.
Cardiovascular disease in familial hypercholesterolaemia: influence of low-density
lipoprotein receptor mutation type and classic risk factors. Atherosclerosis.
2008;200(2):315-21.
112. Masana L, Civeira F, Pedro-Botet J, de Castro I, Pocovi M, Plana N, et al.
[Expert consensus on the detection and clinical management of familial
hypercholesterolemia]. Clin Investig Arterioscler. 2013;25(4):182-93.
113. Haase A, Goldberg AC. Identification of people with heterozygous familial
hypercholesterolemia. Curr Opin Lipidol. 2012;23(4):282-9.
114. Catapano AL, Graham I, De Backer G, Wiklund O, Chapman MJ, Drexel H, et
al. 2016 ESC/EAS Guidelines for the Management of Dyslipidaemias. Eur Heart J.
2016;37(39):2999-3058.
85
115. Defesche J. Familial hypercholesterolemia. Lipids and Vacular Disease. 6.
London: Martin Dunitz; 2000.
116. Williams RR, Hunt SC, Schumacher MC, Hegele RA, Leppert MF, Ludwig EH,
et al. Diagnosing heterozygous familial hypercholesterolemia using new practical
criteria validated by molecular genetics. Am J Cardiol. 1993;72(2):171-6.
117. Maglio C, Mancina RM, Motta BM, Stef M, Pirazzi C, Palacios L, et al. Genetic
diagnosis of familial hypercholesterolaemia by targeted next-generation sequencing. J
Intern Med. 2014;276(4):396-403.
118. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, et
al. A method and server for predicting damaging missense mutations. Nat Methods.
2010;7(4):248-9.
119. Schwarz JM, Rodelsperger C, Schuelke M, Seelow D. MutationTaster evaluates
disease-causing potential of sequence alterations. Nat Methods. 2010;7(8):575-6.
120. Ng PC, Henikoff S. Predicting the effects of amino acid substitutions on protein
function. Annu Rev Genomics Hum Genet. 2006;7:61-80.
121. Wang J, Dron JS, Ban MR, Robinson JF, McIntyre AD, Alazzam M, et al.
Polygenic Versus Monogenic Causes of Hypercholesterolemia Ascertained Clinically.
Arterioscler Thromb Vasc Biol. 2016;36(12):2439-45.
122. Estruch R, Ros E, Salas-Salvado J, Covas MI, Corella D, Aros F, et al. Primary
prevention of cardiovascular disease with a Mediterranean diet. N Engl J Med.
2013;368(14):1279-90.
123. Farnier M, Civeira F, Descamps O, group FHew. How to implement clinical
guidelines to optimise familial hypercholesterolaemia diagnosis and treatment.
Atheroscler Suppl. 2017;26:25-35.
124. Besseling J, Hovingh GK, Huijgen R, Kastelein JJP, Hutten BA. Statins in
Familial Hypercholesterolemia: Consequences for Coronary Artery Disease and All-
Cause Mortality. J Am Coll Cardiol. 2016;68(3):252-60.
125. Neil A, Cooper J, Betteridge J, Capps N, McDowell I, Durrington P, et al.
Reductions in all-cause, cancer, and coronary mortality in statin-treated patients with
heterozygous familial hypercholesterolaemia: a prospective registry study. Eur Heart J.
2008;29(21):2625-33.
126. Versmissen J, Oosterveer DM, Yazdanpanah M, Defesche JC, Basart DC, Liem
AH, et al. Efficacy of statins in familial hypercholesterolaemia: a long term cohort study.
BMJ. 2008;337:a2423.
127. Randomised trial of cholesterol lowering in 4444 patients with coronary heart
disease: the Scandinavian Simvastatin Survival Study (4S). Lancet.
1994;344(8934):1383-9.
128. Shepherd J, Cobbe SM, Ford I, Isles CG, Lorimer AR, MacFarlane PW, et al.
Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia.
1995. Atheroscler Suppl. 2004;5(3):91-7.
129. Pisciotta L, Fasano T, Bellocchio A, Bocchi L, Sallo R, Fresa R, et al. Effect of
ezetimibe coadministered with statins in genotype-confirmed heterozygous FH patients.
Atherosclerosis. 2007;194(2):e116-22.
130. Gagne C, Gaudet D, Bruckert E, Ezetimibe Study G. Efficacy and safety of
ezetimibe coadministered with atorvastatin or simvastatin in patients with homozygous
familial hypercholesterolemia. Circulation. 2002;105(21):2469-75.
131. Ito MK, McGowan MP, Moriarty PM, National Lipid Association Expert Panel
on Familial H. Management of familial hypercholesterolemias in adult patients:
recommendations from the National Lipid Association Expert Panel on Familial
Hypercholesterolemia. J Clin Lipidol. 2011;5(3 Suppl):S38-45.
86
132. López-Sendon J CA, Dalmau R. Una historia resumida. La inhibición de la
PCSK9 y su desarrollo clínico. Revista Española de Cardiología. 2017;17(A):10-5.
133. Joseph L, Robinson JG. Proprotein Convertase Subtilisin/Kexin Type 9
(PCSK9) Inhibition and the Future of Lipid Lowering Therapy. Prog Cardiovasc Dis.
2015;58(1):19-31.
134. Catapano AL, Papadopoulos N. The safety of therapeutic monoclonal
antibodies: implications for cardiovascular disease and targeting the PCSK9 pathway.
135. Giugliano RP, Mach F, Zavitz K, Kurtz C, Im K, Kanevsky E, et al. Cognitive
Function in a Randomized Trial of Evolocumab. N Engl J Med. 2017;377(7):633-43.
136. Schwartz GG, Steg PG, Szarek M, Bhatt DL, Bittner VA, Diaz R, et al.
Alirocumab and Cardiovascular Outcomes after Acute Coronary Syndrome. N Engl J
Med. 2018;379(22):2097-107.
137. Sabatine MS, Giugliano RP, Keech AC, Honarpour N, Wiviott SD, Murphy SA,
et al. Evolocumab and Clinical Outcomes in Patients with Cardiovascular Disease. N
Engl J Med. 2017;376(18):1713-22.
138. Masana L, Ascaso JF, Civeira F, Pedro-Botet J, Valdivielso P, Guijarro C, et al.
[Consensus document of the Spanish Society of Arteriosclerosis on indications of
inhibitors of PCSK9]. Clin Investig Arterioscler. 2016;28(3):164-5.
139. Stein EA, Honarpour N, Wasserman SM, Xu F, Scott R, Raal FJ. Effect of the
proprotein convertase subtilisin/kexin 9 monoclonal antibody, AMG 145, in
homozygous familial hypercholesterolemia. Circulation. 2013;128(19):2113-20.
140. Cuchel M, Meagher EA, du Toit Theron H, Blom DJ, Marais AD, Hegele RA, et
al. Efficacy and safety of a microsomal triglyceride transfer protein inhibitor in patients
with homozygous familial hypercholesterolaemia: a single-arm, open-label, phase 3
study. Lancet. 2013;381(9860):40-6.
141. Raal FJ, Santos RD, Blom DJ, Marais AD, Charng MJ, Cromwell WC, et al.
Mipomersen, an apolipoprotein B synthesis inhibitor, for lowering of LDL cholesterol
concentrations in patients with homozygous familial hypercholesterolaemia: a
randomised, double-blind, placebo-controlled trial. Lancet. 2010;375(9719):998-1006.
142. Mehta R, Zubiran R, Martagon AJ, Vazquez-Cardenas A, Segura-Kato Y, Tusie-
Luna MT, et al. The panorama of familial hypercholesterolemia in Latin America: a
systematic review. J Lipid Res. 2016;57(12):2115-29.
143. Futema M, Whittall RA, Kiley A, Steel LK, Cooper JA, Badmus E, et al.
Analysis of the frequency and spectrum of mutations recognised to cause familial
hypercholesterolaemia in routine clinical practice in a UK specialist hospital lipid clinic.
144. Pirillo A, Garlaschelli K, Arca M, Averna M, Bertolini S, Calandra S, et al.
Spectrum of mutations in Italian patients with familial hypercholesterolemia: New
results from the LIPIGEN study. Atheroscler Suppl. 2017;29:17-24.
145. Palacios L, Grandoso L, Cuevas N, Olano-Martin E, Martinez A, Tejedor D, et
al. Molecular characterization of familial hypercholesterolemia in Spain.
146. Mozas P, Castillo S, Tejedor D, Reyes G, Alonso R, Franco M, et al. Molecular
characterization of familial hypercholesterolemia in Spain: identification of 39 novel
and 77 recurrent mutations in LDLR. Hum Mutat. 2004;24(2):187.
147. Martorell Mateu EM PCM. Clínica y genética de la hipercolesterolemia familiar
en Mallorca. Medicina Balear. 2009;24(2):19-31.
87
148. Bourbon M, Alves AC, Alonso R, Mata N, Aguiar P, Padro T, et al. Mutational
analysis and genotype-phenotype relation in familial hypercholesterolemia: The
SAFEHEART registry. Atherosclerosis. 2017;262:8-13.
149. Castillo S, Tejedor D, Mozas P, Reyes G, Civeira F, Alonso R, et al. The
apolipoprotein B R3500Q gene mutation in Spanish subjects with a clinical diagnosis of
familial hypercholesterolemia. Atherosclerosis. 2002;165(1):127-35.
150. Lehrman MA, Schneider WJ, Brown MS, Davis CG, Elhammer A, Russell DW,
et al. The Lebanese allele at the low density lipoprotein receptor locus. Nonsense
mutation produces truncated receptor that is retained in endoplasmic reticulum. J Biol
Chem. 1987;262(1):401-10.
151. Moorjani S, Roy M, Gagne C, Davignon J, Brun D, Toussaint M, et al.
Homozygous familial hypercholesterolemia among French Canadians in Quebec
Province. Arteriosclerosis. 1989;9(2):211-6.
152. Koivisto UM, Viikari JS, Kontula K. Molecular characterization of minor gene
rearrangements in Finnish patients with heterozygous familial hypercholesterolemia:
identification of two common missense mutations (Gly823-->Asp and Leu380-->His)
and eight rare mutations of the LDL receptor gene. Am J Hum Genet. 1995;57(4):789-
97.
153. Alonso R PL, Muñiz O, Díaz JL, Andrés R, Mata P. Recomendaciones prácticas
en la detección y tratamiento de la hipercolesterolemia familiar en España. Ergon ed.
Madrid: Fundación Hipercolesterolemia Familiar; 2015.
154. Damgaard D, Larsen ML, Nissen PH, Jensen JM, Jensen HK, Soerensen VR, et
al. The relationship of molecular genetic to clinical diagnosis of familial
hypercholesterolemia in a Danish population. Atherosclerosis. 2005;180(1):155-60.
155. Umans-Eckenhausen MA, Defesche JC, Sijbrands EJ, Scheerder RL, Kastelein
JJ. Review of first 5 years of screening for familial hypercholesterolaemia in the
Netherlands. Lancet. 2001;357(9251):165-8.
156. NICE NIfHaCE. Identification and management of familial
hypercholesterolaemia. Clinical Guideline CG71. London: NICE; 2017.
157. (INE) INdE. Series detalladas desde 1996 2017 [Available from:
http://www.ine.es/jaxi/menu.do?type=pcaxis&path=/t15/p417/&file=inebase.
158. Jesús Millán Núñez-Cortés EA, Luis Alvarez-Sala Walthera, Juan Ascaso
Gimilio, Carlos Lahoz Rallo, Teresa Mantilla Morató, José M. Mostaza Prieto, Juan
Pedro-Botet Montoya, Xavier Pintó Sala. Documento Abordaje de la dislipidemia.
Sociedad Española de Arteriosclerosis (parte III). Clínica e Investigación en
Arteriosclerosis. 2012;24(2):57-114.
88
OBJETIVOS
1. Caracterización de la HFHo en España, estimación de su prevalencia y estudio
de la correlación genotipo-fenotipo.
2. Caracterización en España de una forma de HFHo poco frecuente: la
hipercolesterolemia autosómica recesiva, estudio de su prevalencia, correlación
genotipo-fenotipo y respuesta al tratamiento.
3. Estudio de las características clínicas y genéticas de la población con HFHe en
Gran Canaria.
4. Estudio de la segregación familiar de las mutaciones asociadas a HF en Gran
Canaria.
5. Estudio de la segregación familiar y de la funcionalidad in vitro para evaluar la
patogenicidad una mutación nueva en el gen de PCSK9: la p.(Arg499His).
89
90
PRESENTACIÓN DE ARTÍCULOS
1. ‘Homozygous Familial Hypercholesterolemia in Spain Prevalence and
Phenotype–Genotype Relationship’
Autores: Rosa M. Sánchez-Hernández, Fernando Civeira, Marianne Stef, Sofía
Perez-Calahorra, Fátima Almagro, Nuria Plana, Francisco J. Novoa, Pedro Sáenz-
Aranzubía, Daniel Mosquera, Cristina Soler, Francisco J. Fuentes, Yeray Brito-
Casillas, Jose T. Real, Francisco Blanco-Vaca, Juan F. Ascaso, Miguel Pocovi.
Revista: Circ Cardiovasc Genet. 2016;9:504-510.
DOI: 10.1161/CIRCGENETICS.116.001545
Factor de impacto (Journal Impact Factor, JIF; Journal Citacion Reports,
JCR): 4.743
Orden de la revista en su área (2016): 29/126, Q1, Cardiac and Cardiovascular
Systems; 26/167, Q1, Genetics and Heredity.
2. ‘Autosomal recessive hypercholesterolemia in Spain’
Autores: Rosa María Sánchez-Hernández, Pablo Prieto-Matos, Fernando Civeira,
Eduardo Esteve Lafuente, Manuel Frías Vargas, Jose T. Real, Fernando Goñi
Goicoechea, Francisco J. Fuentes, Miguel Pocovi, Mauro Boronat, Ana María
Wägner, Luis Masana.
Revista: Atherosclerosis 2018; 269:1-5.
DOI: 10.1016/j.atherosclerosis.2017.12.006
Factor de impacto (JIF JCR): 4.467
Orden de la revista en su área (2017): 9/65, Q1, Peripheral Vascular Disease;
34/128, Q2, Cardiac and Cardiovascular Systems.
91
3. ‘The island of Gran Canaria, a genetic isolate for familial
hypercholesterolemia’
Autores: Rosa M. Sánchez-Hernández, Antonio Tugores, Francisco J. Nóvoa,
Yeray Brito-Casillas, Ana B. Expósito-Montesdeoca, Paloma Garay, Ana M. Bea,
Marta Riaño, Miguel Pocovi, Fernando Civeira, Ana M. Wägner, Mauro Boronat.
Revista: Journal of Clinical Lipidology, Available online 8 May 2019. Manuscrito
aceptado.
DOI: 10.1016/j.jacl.2019.04.099
Orden de la revista en su área (2017): 61/261, Q1, Pharmacology and Pharmacy.
4. A novel gain-of-function PCSK9 mutation in the C-terminal domain
Autores: Rosa Mª Sánchez-Hernández, Maria Donata Di Taranto, Asier Benito-
Vicente, Kepa B. Uribe, Itziar Lamiquiz-Moneo, Asier Larrea-Sebal, F. Javier
Nóvoa, Mauro Boronat, Ana M Wägner, Fernando Civeira, César Martín, Giuliana
Fortunato.
Revista (artículo enviado): Atherosclerosis (en segunda revisión).
Orden de la revista en su área (2017): 9/65, Q1, Peripheral Vascular Disease;
34/128, Q2, Cardiac and Cardiovascular Systems.
92
JUSTIFICACIÓN DE LA UNIDAD TEMÁTICA DE
LA TESIS
La hipercolesterolemia es uno de los factores que más contribuye a la enfermedad
cardiovascular, que es la primera causa de muerte en España (157) y en el resto de
países occidentales. Dentro de las causas de hipercolesterolemia de origen primario, la
hipercolesterolemia familiar es de las más frecuentes, con una prevalencia elevada en la
población general (20).
Existen formas más graves de hipercolesterolemia familiar, poco estudiadas, cuya
frecuencia podría ser mayor de lo descrito hasta ahora (24).
Además, en las Islas Canarias contamos con la tasa más alta de hipercolesterolemia de
España (158), no descartándose que esto pueda deberse a una mayor frecuencia de
dislipemias genéticas, incluyendo la hipercolesterolemia familiar. Sin embargo, no
existen estudios epidemiológicos de esta enfermedad en las Islas.
En la presente tesis se estudia la prevalencia, a nivel nacional, de las formas más graves
de hipercolesterolemia familiar, que serían las formas homocigotas, incluyendo la
hipercolesterolemia autosómica recesiva. Y, en el ámbito de Gran Canaria, el estudio se
centra en la forma más frecuente, la hipercolesterolemia familiar heterocigota, para
profundizar en el conocimiento de las características clínicas y genéticas de las familias
afectas por esta enfermedad en nuestro territorio.
93
94
ARTÍCULOS
95
96
Original Article
Homozygous Familial Hypercholesterolemia in Spain

Prevalence and Phenotype–Genotype Relationship
Rosa M. Sánchez-Hernández, MD; Fernando Civeira, MD, PhD; Marianne Stef, PhD;
Sofía Perez-Calahorra, RD, MSc; Fátima Almagro, MD, PhD; Nuria Plana, MD, PhD;
Francisco J. Novoa, MD, PhD; Pedro Sáenz-Aranzubía, MD, PhD;
Daniel Mosquera, MD, PhD; Cristina Soler, MD, PhD; Francisco J. Fuentes, MD, PhD;
Yeray Brito-Casillas, DVM, PhD; Jose T. Real, MD, PhD; Francisco Blanco-Vaca, MD, PhD;
Juan F. Ascaso, MD, PhD; Miguel Pocovi, PhD
Background—Homozygous familial hypercholesterolemia (HoFH) is a rare disease characterized by elevated plasma levels of
low-density lipoprotein cholesterol (LDL-C) and extremely high risk of premature atherosclerotic cardiovascular disease.
HoFH is caused by mutations in several genes, including LDL receptor (LDLR), apolipoprotein B (APOB), proprotein
Downloaded from http://circgenetics.ahajournals.org/ by guest on December 21, 2016
convertase subtilisin/kexin type 9 (PCSK9), and LDL protein receptor adaptor 1 (LDLRAP1). No epidemiological
studies have assessed HoFH prevalence or the clinical and molecular characteristics of this condition. Here, we aimed to
characterize HoFH in Spain.
Methods and Results—Data were collected from the Spanish Dyslipidemia Registry of the Spanish Atherosclerosis Society
and from all molecular diagnoses performed for familial hypercholesterolemia in Spain between 1996 and 2015 (n=16 751).
Clinical data included baseline lipid levels and atherosclerotic cardiovascular disease events. A total of 97 subjects were
identified as having HoFH—of whom, 47 were true homozygous (1 for APOB, 5 for LDLRAP1, and 41 for LDLR), 45
compound heterozygous for LDLR, 3 double heterozygous for LDLR and PSCK9, and 2 double heterozygous for LDLR
and APOB. No PSCK9 homozygous cases were identified. Two variants in LDLR were identified in 4.8% of the molecular
studies. Over 50% of patients did not meet the classical HoFH diagnosis criteria. The estimated HoFH prevalence was
1:450 000. Compared with compound heterozygous cases, true homozygous cases showed more aggressive phenotypes
with higher LDL-C and more atherosclerotic cardiovascular disease events.
Conclusions—HoFH frequency in Spain was higher than expected. Clinical criteria would underestimate the actual prevalence
of individuals with genetic HoFH, highlighting the importance of genetic analysis to improve familial hypercholesterolemia
diagnosis accuracy. (Circ Cardiovasc Genet. 2016;9:504-510. DOI: 10.1161/CIRCGENETICS.116.001545.)
Key Words: alleles ◼ hypercholesterolemia ◼ lipids ◼ mutation ◼ registries
F amilial hypercholesterolemia (FH) is a monogenic autoso-

mal codominant disease characterized by low cell uptake
of low-density lipoprotein cholesterol (LDL-C), resulting
Clinical Perspective on p 510
higher rates in genetically isolated populations, such as
in high plasma LDL-C levels.1 Homozygous FH (HoFH) French Canadians, Afrikaners from South Africa, or Christian
is caused by mutations in both copies of any of the 3 main Lebanese people.10–13 However, recent publications showed
genes involved in FH development: LDL receptor (LDLR; that the true prevalence may be higher, with estimated HoFH
95% of cases; OMIM #606945);1 apolipoprotein B (APOB; prevalences of 1:160 000 in Denmark,14 1:300 000 in the
2% to 5% of cases; OMIM #107730);2 and proprotein con- Netherlands,15 and 1:800 000 in Germany.16 Additionally,
vertase subtilisin/kexin type 9 (PCSK9; <1% of cases; OMIM a recent document from the Spanish Atherosclerosis
#607786).3,4 Additionally, recessive autosomal FH has been Society refers to 44 genetically confirmed cases in Spain.17
described, involving mutations on both LDLRAP1 alleles Recent genetic studies of FH highlight the great variabil-
(<1% of cases; OMIM #695747).5 The recessive form of FH ity of the clinical phenotypes in HoFH and heterozygous FH
is clinically indistinguishable from HoFH,6–8 although less (HeFH), the poor genotype–phenotype correlation, and the
aggressive phenotypes have also been described,9 for this large clinical overlap between HoFH and HeFH.15,18–20 These
reason, this form of FH has also been included in our stud- findings can be explained based on the variations in the num-
ies. The classical HoFH prevalence is 1:1 000 000,1 with ber of genes involved, the specific pathogenic mutations, and
Received May 10, 2016; accepted September 28, 2016.

The Data Supplement is available at http://circgenetics.ahajournals.org/lookup/suppl/doi:10.1161/CIRCGENETICS.116.001545/-/DC1.
Correspondence to Rosa M. Sánchez-Hernández, MD, Endocrinology Department, Complejo Hospitalario Universitario Insular Materno Infantil de
Gran Canaria, Las Palmas de Gran Canaria, Avenida Marítima, S/N 35016 Las Palmas, Spain. E-mail rosamariasanher@gmail.com
© 2016 American Heart Association, Inc.
Circ Cardiovasc Genet is available at http://circgenetics.ahajournals.org DOI: 10.1161/CIRCGENETICS.116.001545
504
Sánchez-Hernández et al Homozygous Familial Hypercholesterolemia in Spain 505
the resulting decrease of function.18,21 Moreover, genetic diag- determined whether both mutations were present in >2 nonrelated
nosis of HeFH or HoFH can be challenging because of the fre- patients. Null allele mutations were categorized as nonsense, frame-
shift, splicing, or large rearrangements.
quent coexistence of 2 functional mutations within a patient
Pathogenicity of LDLR variants had been previously assessed by
and the potential difficulty of identifying whether they are in LDL uptake by cultured fibroblast for all the mutations identified in true
the same allele (compound heterozygous in cis) or in 2 differ- homozygous. In compound heterozygotes when the assessment of LDL
ent alleles (compound heterozygous in trans). uptake by fibroblast was not available, in silico predictions were used to
Molecular diagnosis of HoFH is currently based on cases evaluate the pathogenicity of these genetic variant: PolyPhen-2, SIFT,
and Mutation Taster.27–29 NetGene2 and NNSplice were used to predict
showing the most aggressive phenotype. This leads to a selec-
the effect of variants in potential splicing sites.30,31
tion bias in which the HoFH definition typically includes severe
clinical criteria.22 Consequently, many genetically diagnosed
patients do not meet the classical clinical criteria for HoFH,15,20 Clinical Diagnostic Features and Diagnostic Criteria
Genetic studies were performed using the clinical criteria recommended
and the actual prevalence of this disease remains unknown. in the guidelines of the European Atherosclerosis Society, which are
In Spain, the genetic basis of FH has been investigated for based on the Dutch Lipid Clinic Network criteria for HeFH diagnosis
the past 20 years, and our country pioneered the inclusion of among adults.32 Clinical diagnosis of HoFH was based on an LDL-C
biochips and next-generation sequencing in FH diagnostic pro- level of >500 mg/dL without treatment or of >300 mg/dL while on high-
cedures.23,24 These genetic-based studies have been conducted intensive lipid-lowering therapy and the presence of tendon xanthomas
before 10 years of age.22 All clinical information was obtained from
almost exclusively in 4 research centers, with >16 000 genetic the National Registry of Dyslipidemias of the Spanish Atherosclerosis
studies performed in patients with clinical suspicion of FH. Society, which includes data from most lipid clinics of Spain, or was
Our present study aimed to determine the actual preva- obtained directly from the patients’ physicians. Clinical data for 3 cases
lence of HoFH in Spain, to describe the clinical impact of the were obtained from published data.33,34 For the genetic study, the follow-
different genotypes and to facilitate the diagnosis of patients ing clinical features were recorded: current age; age at diagnosis; off-
treatment levels of total cholesterol, LDL-C, high-density lipoprotein
carrying double mutations. We analyzed all cases with a clini- cholesterol (HDL-C), and triglycerides; presence and type of atheroscle-
cal diagnosis of HoFH or HeFH within all FH genetic studies rotic cardiovascular disease (ASCVD); and age at first ASCVD event.
performed in Spain over the past 20 years.
Statistical Analysis
Methods Prevalence was calculated as the number of HoFH cases divided by the
We reanalyzed all diagnostic genetic studies for FH in Spain from mean total number of population for the whole period. Mean popula-
1996 to June 2015. All included studies were performed at 4 Spanish tion was estimated using demographic data provided by the Spanish
centers: Zaragoza University, Progenika Biopharma SA (A Grifols National Institute for Statistics (Instituto Nacional Estadística).35
Company, Derio, Vizcaya), Hospital Clínico of Valencia, and Statistical analyses were performed using SPSS 20.0 software (IBM,
Hospital Santa Creu i Sant Pau of Barcelona. These 4 centers are the SPSS, Inc, Chicago, IL,). Between-group comparisons were performed
reference genetic laboratories for the lipid units in Spain. The Spanish using the Student t or Mann–Whitney U tests. Data are expressed as
public healthcare system includes the whole Spanish population and mean±SD for numeric variables that followed a normal distribution or
comprises lipid units around the country where all severe FH cases as median and range for other numeric variables. Differences were con-
are referred to perform genetic diagnosis. All patients who underwent sidered significant when the 2-tailed P value was <0.05.
molecular diagnosis were informed and
signed an informed consent. In each center, the study was ap-
proved by all the ethics committees. Results
A total of 16 751 genetic studies for FH diagnosis were per-
Molecular Diagnosis formed in Spain from 1996 to 2015. Of these studies, 11 094
The methods of molecular diagnosis changed over time. Until 2004, (66.2%) detected at least 1 pathogenic mutation, 531 (4.79%
molecular diagnosis involved complete sequencing of LDLR exons of the positive studies) showed multiple pathogenic muta-
and intron–exon boundaries and of the apolipoprotein (apo) B–binding tions, and 97 (0.87%) carried 2 mutations corresponding to
domain of APOB to the LDL receptor.23 From 2004 to 2012, microar- the HoFH criteria (Figure). All centers had similar detection
ray analysis was performed to examine the most frequent LDLR and
APOB mutations in Spanish populations. When no mutation was iden-
rates of multiple pathogenic mutations: Zaragoza University,
tified, complete sequencing was conducted of the LDLR promoter, ex- 6.7%; Progenika, 4.6%; Hospital Clínico of Valencia, 3.1%;
ons, and intron–exon boundaries, as well as the APOB LDLR-binding and Hospital Santa Creu i Sant Pau of Barcelona, 6%. Cases
domain.4,25 From 2012 to 2015, molecular diagnosis was performed of HoFH showed the following distribution: 47 true homo-
using next-generation sequencing of the LDLR promoter, exons, and zygous (41 for LDLR, 5 for LDLRAP1, and 1 for APOB); 45
intron–exon boundaries; the APOB LDLR-binding domain; the PCSK9
promoter, exons, and intron–exon boundaries; and the LDLRAP1 pro- compound heterozygous for LDLR; and 5 double heterozy-
moter, exons, and intron–exon boundaries.24 From all analyzed studies, gous (3 for PCSK9 and LDLR and 2 for APOB and LDLR).
we selected the patients carrying at least 2 mutations within the 3 genes No cases were identified as homozygous for pathogenic muta-
responsible for FH or in LDLRAP1, as previously described. tions in the PCSK9 gene (Table I in the Data Supplement).
Patients were diagnosed with HoFH if they were homozygous for
For the whole study period, the mean Spanish population
the same pathogenic mutation in LDLR, APOB, PCSK9, or LDLRAP1;
double heterozygous for pathogenic mutations in 2 different genes was 43 673 187 people, and 97 genetic HoFH were identified.
(LDLR, APOB, or PCSK9); or compound heterozygous with 2 differ- Hence, for the same period, the estimated prevalence of genet-
ent pathogenic mutations in the same gene (LDLR, APOB, PCSK9, ically diagnosed HoFH in Spain was found to be 1:450 000.
or LDLRAP1).21 To differentiate compound heterozygous patients In compound heterozygous cases, to elucidate whether the
carrying 2 mutations in trans from compound heterozygous patients
in cis, mutation analysis was performed in first-degree relatives to LDLR variants were in cis or trans positions, we reviewed famil-
verify familial segregation, haplotypes were examined using common ial genetic studies that were also included in the database. On the
LDLR variants (previously described by Tejedor et al),26 and studies basis of allelic segregation, 33 HoFH cases were unequivocally
506 Circ Cardiovasc Genet December 2016
in trans. However, no familial details were available for 12 sub- criterion of a baseline LDL-C level >500 mg/dL. This criterion
jects. We, therefore, examined their LDLR variants throughout was not met by 32.4% of true homozygotes, 64% of compound
the entire database and found that all 12 were distributed in het- heterozygotes, and 100% of double heterozygotes. Regarding
erozygosis. Thus, these 12 patients were considered compound sex distribution, men were over-represented among most of the
heterozygous in trans. This diagnosis was supported by the studied groups, except for double heterozygotes (Table 1).
HoFH-like phenotype observed in these cases and their haplo-
types with LDLR single-nucleotide variants. Four pairs of LDLR Discussion
variants were classified as compound heterozygous in cis (Table The present study results revealed an HoFH prevalence of
II in the Data Supplement) because they were frequently associ- 1:450 000. This is higher than that previously reported and
ated with each other throughout the database and because famil- almost twice the prevalence expected according to the classical
ial genetic studies confirmed their presence in the same allele. clinical criterion of an off-treatment LDL-C level >500 mg/dL.1
Tables 1 and 2 present the clinical characteristics of HoFH. This greater frequency is in agreement with the recently defined
Baseline LDL-C levels were correlated with genotype severity, HeFH prevalence of ≈1:250 within unselected representative
being higher in receptor-negative HoFH compared with recep- populations from Denmark36 and United States.37 Spain is home
tor-defective HoFH and, also, in true homozygotes compared to a genetically heterogeneous population that lacks any relevant
with compound or double heterozygotes (Table 1). Genotype genetically isolated groups, which explains the absence of recur-
was also strongly associated with ASCVD events (Table 1), with rent mutations responsible for FH or other monogenic diseases.38
more ASCVD events in true homozygous carrying null alleles Over 400 different FH-causing mutations have been described in
than in those carrying defective alleles (50% versus 43.8%). the Spanish population, almost all of which have been described
Moreover, ASCVD events started earlier in patients carrying in other populations and none accounting for >6.5% of cases.4
null allele–related mutations (23±19 years versus 39±11 years; In fact, our presently obtained prevalence value is similar
P=0.046). Among these reported ASCVD events, 87% were pre- to the rates obtained using genetic criteria.21 This reinforces
mature (before 55 years in men and 60 years in women) and 5 the idea that the classical clinical criteria identify only the
patients experienced ASCVD before 30 years of age. Compared most severe cases.20 Further supporting this notion, almost
with true LDLR null allele homozygotes, carriers of LDLRAP1 half of our patients who were genetically diagnosed with
mutations showed higher LDL-C levels at diagnosis (806 ver- HoFH did not meet the classical clinical criteria for HoFH
sus 788 mg/dL) but fewer ASCVD events (20% versus 50%). diagnosis.22 In our study, to estimate the molecular prevalence
Among all patients, 46.7% did not meet the classical HoFH of this disease, we included patients with autosomal recessive
Figure. Genetic familial hypercholes-

terolemia diagnosis performed in Spain
between 1996 and 2015.
Table 1. Clinical Characteristics of True Homozygotes, Compound Heterozygotes, and Double Heterozygotes for LDLR, APOB,
PCSK9, and LDLRAP1
True Homozygotes True Homozygotes True Homozygous Compound Heterozygotes
(LDLR) (LDLRAP1) (APOB) (LDLR) Double Heterozygotes P
N 41 5 1 45 LDLR & APOB (3) LDLR & PCSK9 (2)
Age, y 36.8 (18.4) 32.4 (18.7) 74 37.9 (18.56) 52.5 (28.2) NS
Age of diagnosis, y 6.5 (0.6–57) 1.2 (0.2–12) 50 21.8 (16.2) 43 (10–63) 0.034
Male sex, % 73.3 80 100 51.7 25 0.065
TC, mg/dL 692 (262) 886 (298) 391 465 (279–950) 370 (25.54) 0.005
LDL-C, mg/dL 625 (271.5) 806.3 (287) 329 397 (197–890) 304 (37) 0.008
HDL-C, mg/dL 43 (14) 39 (9) 33 48.7 (15) 48 (7) NS
Triglycerides, mg/dL 100 (42) 115 (84–522) 144 105 (26–514) 65 (17) NS
ASCVD, % 46.4 20 100 25 25 NS
Age of ASCVD 31.7 (17) 55 56 34.3 (17.4) 43 NS
ASCVD type, % 100 CHD 100 CHD 100 CHD 71.4% CHD 28.6% stroke 100% CHD NS
All true homozygous for LDLRAP1 were null alleles; the true homozygote for APOB presented defective alleles. ASCVD indicates atherosclerotic cardiovascular disease;
CHD, coronary heart disease; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; N, number of patients; and TC, total cholesterol.
hypercholesterolemia and double heterozygotes—subjects that in the cohort described by Raal et al20 (31.7 years). Overall,
who have been excluded from previous studies.15,20 our results are compatible with previous reports in patients with
HoFH is a heterogeneous disease that does not always exhibit HoFH. Additionally, our present findings suggest that the clini-
the classical phenotype.19,39 This heterogeneity seems to depend cal prognosis of these patients has gradually improved in recent
in part on the causative genetic defect.40 The highest LDL-C years because of the availability of more efficient lipid-lowering
levels are found in true homozygous patients carrying null treatments and the introduction of LDL apheresis.41,42
alleles, whereas the lowest blood LDL-C levels are measured The clinical phenotype of some cases of HoFH overlaps with
in compound heterozygous patients carrying defective alleles the clinical phenotype of some severe cases of HeFH. Thus, we
and in double heterozygous patients.8,18,21,39 This continuum is must reconsider the criteria used for the differential diagnosis
also observed with regard to ASCVD occurrence, which is more of HoFH. Along these lines, the American Heart Association
frequent among patients with severe mutations and less com- recently suggested that HoFH be suspected in cases with an
mon with decreasing mutation malignancy. The presently noted untreated LDL-C level >400 mg/dL.43 In this sense, 21.23% of
percentage of ASCVD patients (≈50%) among true homozy- the patients from the Spanish Atherosclerosis Society Registry
gous subjects was similar to that described by Pisciotta et al,8 but presented untreated LDL-C levels between 300 and 500 mg/
higher than that previously reported by Raal et al20 (38.3%). On dL, and only 5 were genetically defined HoFH (1.4%). In
the contrary, the presently determined mean age at first ASCVD Spain, ≈100 000 patients could have FH according to the 1:500
among true homozygous patients (27.9 years) was similar to reported prevalence.4 On the basis of this estimation, ≈20 000
Table 2. Clinical Characteristics Depending on the Type of Mutation in LDLR

True Homozygotes Compound Homozygotes
Null Alleles Defective Alleles Null/Null Alleles* Null/Defective Alleles Defective/Defective Alleles P
N 15 26 2 24 19
Current age, y 24.2 (18) 43.8 (15) 51 35.7 (21) 40.1 (16) NS
Diagnosis age, y 5 (2.5–35) 8 (0.6–57) 40 10.5 (7–29) 21 (7–49) NS
Male sex, % 64.3 81.3 0 64.7 36.4 NS
TC, mg/dL 845 (208) 559 (233) 525 527 (154) 423 (279–950) 0.006
LDL-D, mg/dL 788 (208) 488 (248.5) 428.2 452 (288–760) 340 (197–890) <0.001
HDL-C, mg/dL 35.6 (10) 48 (15) 84 47 (14) 48 (13.6) 0.011
Triglycerides, mg/dL 121 (50) 85 (28) 64 109 (58–514) 104.4 (43.2) NS
ASCVD, % 50 43.8 0 25 27.3 NS
Age ASCVD 23 (19) 39 (11) … 32 (23.9) 37 (5.19) NS
ASCVD indicates atherosclerotic cardiovascular disease; CHD, coronary heart disease; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein
cholesterol; N, number of patients; TC, total cholesterol; and y, years.
*
Clinical data available only for 1 of 2 heterozygotes carriers of 2 null alleles in LDLR.
FH patients could have untreated LDL-C levels between 300 Our results also have therapeutic implications. LDL apher-
and 500 mg/dL, but only a minority (0.25%) will have geneti- esis is currently the most used treatment for metabolic control
cally defined HoFH. Hence, a high percentage of HoFH patients of the most severe cases of HoFH. However, new therapeutic
have LDL-C between 400 and 500 mg/dL, but a low percentage options are available, including the microsomal triglyceride
of those with genetically confirmed FH in that range are homo- transfer protein inhibitor, lomitapide;45 PCSK9 inhibitors;46
zygotes, and the vast majority are heterozygotes. and mipomersen, an antisense oligonucleotide that targets
In the present study, as well as in a previous Dutch study,15 APOB mRNA.47 Of these agents, lomitapide and mipomersen
patients with a genetic diagnosis of HoFH showed an LDL-C have been specifically approved to treat only HoFH. Our pres-
level of >290 mg/dL (7.5 mmol/L). The complexity of the diag- ent findings support the application of these drugs based on
nosis of HoFH should be considered, and it seems necessary LDL-C levels. Many of our patients had been diagnosed with
a better definition of this disease that should include genetic HeFH before genetic analysis and showed acceptable meta-
information, phenotypic characterization, and cardiovascular bolic control after treatment with statins and ezetimibe (article
risk. It must be taken into account that a confirmed genetic in preparation). This may indicate that the newer drugs should
diagnosis of HoFH does not completely reflect cardiovascular be used not only in cases with a specific clinical diagnosis but
risk, and risk stratification to identify severe FH is needed con- also in response to the LDL-C level achieved after treatment
sidering LDL-C levels and others risk factors such us hyper- with traditional lipid-lowering drugs. Such a change would
tension, smoking habits, diabetes mellitus, and high levels of prevent situations in which severe HeFH patients with poor
lipoprotein(a). We think that this complexity should be consid- control of LDL-C might be a priori deprived of newer drugs.
ered in the diagnosis of this disease. Further refinement of these
diagnostic criteria will require additional comparisons among Study Limitations
molecularly diagnosed cases from different research studies. The present study includes all diagnostic centers that performed
Improved diagnostic criteria could be used in familial screen- molecular diagnosis of FH in Spain up to 2015; however, there
ings to make new diagnoses among patients’ relatives, as well is insufficient evidence to guarantee that genetic analysis was
as for testing of new, specifically designed drugs. Our present performed in all cases with clinical suspicion of HoFH. Conse-
conclusions are similar to those of Raal et al,20 highlighting that quently, the present prevalence was calculated based on the cases
HoFH is a heterogeneous disease resulting in a wide range of that were seen in specialized units that performed molecular anal-
elevated LDL-C levels, such that diagnosis should not be lim- yses. Considering the structure of our public healthcare system,
ited to selected patients with a more severe phenotype. in which the most severe cases are referred to these units, it can
Another major finding of our study is the frequent pres- be presumed that our study included all severe FH cases. How-
ence of 2 functional mutations within the same patient. In all ever, some HoFH cases with less aggressive phenotypes, showing
of the included diagnostic centers, it was consistently observed LDL-C levels similar to HeFH phenotypes, could not have been
that ≈5% of cases presented ≥2 pathogenic variants. To our subjected to molecular analysis. About prevalence estimation, the
knowledge, no previous evidence demonstrates the prevalence follow-up information in this cohort was not available in all HoFH
of multiple mutations among patients with clinical suspicion cases, and the clinical status was referred at the time of genetic
of FH. Additionally, it is difficult to elucidate whether muta- analysis. However, most of the diagnoses have been performed
tions affect the same allele (cis position) or different alleles in recent years, and the mortality rate in this cohort is <5%; there-
(trans position), complicating the classification of patients as fore, we think that the prevalence estimation is accurate.
HeFH or HoFH, respectively. To this end, family segregation Although all genetic analyses included complete LDLR
is the best practical identification method—as the analysis of sequencing and APOB-3500 detection, few studies included
first-degree relatives (particularly parents) confirms whether analysis of the PCSK9 gene. Therefore, the frequency of muta-
mutations are in different alleles because each parent carries 1 tions at this locus could be underdiagnosed. Nevertheless, the
of the 2 mutations. However, other procedures are necessary frequency of PCSK9 mutations causing FH in Spain is low.4
when DNA from first-degree relatives is unavailable. Finally, it was difficult to identify compound heterozygous
Newly developed techniques enable the sequencing of long patients in trans when we had insufficient information avail-
stretches of DNA (>10 kb) from a single molecule or single allele, able on their relatives. The results of thousands of previous
which allow determination of the cis or trans status of 2 variants genetic studies indicate that some mutations are frequently
on the same gene. Although more severe phenotypes would be present in cis. However, this status was only discerned in a few
expected in compound heterozygous patients in trans, our pres- cases by constructing haplotypes with LDLR single-nucleo-
ent results demonstrate that this criterion is not sufficiently sensi- tide variants. Thus, it is impossible to definitively determine
tive because of the frequently overlapping phenotypes between that the 2 mutations were in different alleles.
homozygous and heterozygous patients. Moreover, variants can
be associated in linkage disequilibrium within the same allele, and Conclusions
they must be separately identified in different populations. For The presently determined actual frequency of patients hav-
instance, in Spain, several variants have been described in cis in the ing HoFH is higher than previously reported prevalence rates
LDLR, including c.(829G>A; c.12G>A) p.(Trp4*;Glu277Lys); that have largely included only the most aggressive cases. A
c.(1061-8T>C;274C>G)26; c.(313+1G>C; c.274C>G) p.(NA; high percentage of patients genetically diagnosed with HoFH
Gln92Glu); and c.(2397_2405delCGTCTTCCT;1690A>C) p. do not meet the clinical diagnostic criteria. This highlights the
(Lys799_Phe801del;Asn564His),44 but may have different segre- relevance of molecular diagnosis and the need for improved pro-
gation patterns in other populations. cedures for HoFH diagnosis. The aggressiveness of the HoFH
phenotype ranges from severe in homozygous patients to milder hypercholesterolemia in Spain. Atherosclerosis. 2012;221:137–142. doi:
10.1016/j.atherosclerosis.2011.12.021.
in double or compound heterozygous patients. High suspicion is
5. Varret M, Abifadel M, Rabès JP, Boileau C. Genetic heterogeneity of au-
required to diagnose this disease in patients who show LDL-C tosomal dominant hypercholesterolemia. Clin Genet. 2008;73:1–13. doi:
levels lower than those previously considered as diagnostic. 10.1111/j.1399-0004.2007.00915.x.
6. Marais AD. Familial hypercholesterolaemia. Clin Biochem Rev.
2004;25:49–68.
Acknowledgments 7. Soutar AK, Naoumova RP. Mechanisms of disease: genetic causes
We thank Amelia Oleaga, Leire Pérez, Rosaura Figueras, Miguel Ángel of familial hypercholesterolemia. Nat Clin Pract Cardiovasc Med.
Lasunción, Margarita Martínez de Atienza, Nuria Espinosa, José Antonio 2007;4:214–225. doi: 10.1038/ncpcardio0836.
Gimeno, Luis Irigoyen, Maria Gema Grau, Ángel Brea, Antonio Pérez, 8. Pisciotta L, Priore Oliva C, Pes GM, Di Scala L, Bellocchio A, Fresa R,
and Pablo Prieto for providing clinical data. We also thank Ana Wägner et al. Autosomal recessive hypercholesterolemia (ARH) and homozygous
and Mauro Boronat for their critical reading of the article. familial hypercholesterolemia (FH): a phenotypic comparison. Athero-
sclerosis. 2006;188:398–405. doi: 10.1016/j.atherosclerosis.2005.11.016.
9. Tada H, Kawashiri MA, Nohara A, Inazu A, Kobayashi J, Mabuchi H, et
Sources of Funding al. Autosomal recessive hypercholesterolemia: a mild phenotype of familial
This study was supported by grants from the Spanish Ministry of Economy hypercholesterolemia: insight from the kinetic study using stable isotope and
and Competitiveness PI12/01087, PI12/01703, IPT-2011-0817-010000, animal studies. J Atheroscler Thromb. 2015;22:1–9. doi: 10.5551/jat.27227.
ISCIII -PI14/01648, Marató TV3 foundation grant 201524-31 and Red 10. Moorjani S, Roy M, Gagné C, Davignon J, Brun D, Toussaint M, et al.
de Investigación Cardiovascular (RIC) RD12/0042/0055. Homozygous familial hypercholesterolemia among French Canadians in
Québec Province. Arteriosclerosis. 1989;9:211–216.
11. Kotze MJ, Davis HJ, Bissbort S, Langenhoven E, Brusnicky J, Oosthuizen

Disclosures CJ. Intrafamilial variability in the clinical expression of familial hypercho-
M. Stef is employee of Progenika Biopharma SA, A Grifols company, lesterolemia: importance of risk factor determination for genetic counsel-
ling. Clin Genet. 1993;43:295–299.
company dedicated to genetic diagnosis. The other authors report no
12. Austin MA, Hutter CM, Zimmern RL, Humphries SE. Genetic causes
conflicts.
of monogenic heterozygous familial hypercholesterolemia: a HuGE
prevalence review. Am J Epidemiol. 2004;160:407–420. doi: 10.1093/aje/
Appendix kwh236.
13. Fahed AC, Safa RM, Haddad FF, Bitar FF, Andary RR, Arabi MT, et al.
Sección de Endocrinología y Nutrición, Complejo Hospitalario
Homozygous familial hypercholesterolemia in Lebanon: a genotype/phe-
Universitario Insular Materno Infantil de Gran Canaria (R.M.S.-H., F.J.N., notype correlation. Mol Genet Metab. 2011;102:181–188. doi: 10.1016/j.
Y.B.-C.); Instituto Universitario de Investigación Biomédica y Sanitaria ymgme.2010.11.006.
(IUIBS) de la Universidad de Las Palmas de Gran Canaria, Las Palmas de 14. Nordestgaard BG, Chapman MJ, Humphries SE, Ginsberg HN, Masana L,
Gran Canaria (R.M.S.-H., F.J.N., Y.B.-C.); Unidad de Lípidos, Hospital Descamps OS, et al; European Atherosclerosis Society Consensus Panel.
Universitario Miguel Servet, Red de Investigación Cardiovascular (RIC), Familial hypercholesterolaemia is underdiagnosed and undertreated in the
Instituto de Investigación Sanitaria (IIS) de Aragón. Universidad de general population: guidance for clinicians to prevent coronary heart dis-
Zaragoza, Zaragoza (F.C., S.P.-C.); Progenika Biopharma SA (a Grifols ease: consensus statement of the European Atherosclerosis Society. Eur
company), Derio, Vizcaya (M.S.); Unidad de Lípidos, Hospital Donostia Heart J. 2013;34:3478–3490a. doi: 10.1093/eurheartj/eht273.
de San Sebastián, Guipúzcoa (F.A.); Unidad de Medicina Vascular y 15. Sjouke B, Kusters DM, Kindt I, Besseling J, Defesche JC, Sijbrands EJ,
Metabólica, Unidad de Investigación en Lípidos y Arteriosclerosis, et al. Homozygous autosomal dominant hypercholesterolaemia in the
Hospital Universitario Sant Joan, Universitat Rovira i Virgili, Institut Netherlands: prevalence, genotype-phenotype relationship, and clini-
d'Investigació Sanitària Pere Virgili (IISPV), Reus, Tarragona (N.P.); cal outcome. Eur Heart J. 2015;36:560–565. doi: 10.1093/eurheartj/
Unidad de Lípidos, Hospital de Mérida, Mérida (P.S.-A.); Unidad de ehu058.
Lípidos, Hospital de San Pedro y San Millán, Logroño (D.M.); Unidad 16. Walzer S, Travers K, Rieder S, Erazo-Fischer E, Matusiewicz D. Homo-
de Lípidos y Arteriosclerosis, Hospital de Santa Caterina de Salt, zygous familial hypercholesterolemia (HoFH) in Germany: an epidemio-
Girona (C.S.); Instituto Maimónedes de Investigación Biomédica de logical survey. Clinicoecon Outcomes Res. 2013;5:189–192. doi: 10.2147/
CEOR.S43087.
Córdoba (IMIBIC), Hospital Universitario Reina Sofía, Universidad de
17. Ascaso JF, Mata P, Arbona C, Civeira F, Valdivielso P, Masana L. [Homo-
Córdoba (F.J.F.); Córdoba y Centro de Investigación Biomédica en Red
zygous familial hypercholesterolaemia: Spanish adaptation of the position
de Fisiopatolgía de la Obesidad y Nutrición (CIBEROBN), Instituto de paper from the Consensus Panel on Familial Hypercholesterolaemia of
Salud Carlos III (ISCIII), Madrid (F.J.F.); Servicio de Endocrinología the European Atherosclerosis Society. Consensus document of the Span-
y Nutrición, Hospital Clínico Universitario de Valencia. Universitat de ish Society of Arteriosclerosis (SEA) and Familial Hypercholesterolae-
Valencia. CIBERDEM, Valencia (J.T.R., J.F.A.); Institut d'Investigació mia Foundation (FHF)]. Clin Investig Arterioscler. 2015;27:80–96. doi:
Biomèdica Sant Pau (IIB); Departamento de Bioquímica y Biología 10.1016/j.arteri.2015.01.002.
Molecular, Universitat Autònoma de Barcelona; Centro de Investigación 18. Cuchel M, Bruckert E, Ginsberg HN, Raal FJ, Santos RD, Hegele RA, et
Biomédica en Red de Diabetes y Enfermedades Metabólicas Asociadas al; European Atherosclerosis Society Consensus Panel on Familial Hy-
(CIBERDEM), Barcelona (F.B.-V.); Departamento de Bioquímica y percholesterolaemia. Homozygous familial hypercholesterolaemia: new
Biología Molecular y Celular, Facultad de Ciencias, Universidad de insights and guidance for clinicians to improve detection and clinical
Zaragoza & IIS Aragón, Zaragoza (M.P.). management. A position paper from the Consensus Panel on Familial Hy-
percholesterolaemia of the European Atherosclerosis Society. Eur Heart J.
2014;35:2146–2157. doi: 10.1093/eurheartj/ehu274.
References 19. Wiegman A, Gidding SS, Watts GF, Chapman MJ, Ginsberg HN, Cuchel
1. Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. In: M, et al; European Atherosclerosis Society Consensus Panel. Familial hy-
Beaudet A, Scriver CR, Sly WS, Valle D, eds. The Metabolic and Molecu- percholesterolaemia in children and adolescents: gaining decades of life
lar Bases of Inherited Disease. New York: McGraw-Hill; 2001:2863–2913. by optimizing detection and treatment. Eur Heart J. 2015;36:2425–2437.
2. Soria LF, Ludwig EH, Clarke HR, Vega GL, Grundy SM, McCar- doi: 10.1093/eurheartj/ehv157.
thy BJ. Association between a specific apolipoprotein B mutation and 20. Raal FJ, Sjouke B, Hovingh GK, Isaac BF. Phenotype diversity
familial defective apolipoprotein B-100. Proc Natl Acad Sci USA. among patients with homozygous familial hypercholesterolemia: a
1989;86:587–591. cohort study. Atherosclerosis. 2016;248:238–244. doi: 10.1016/j.
3. Abifadel M, Varret M, Rabès JP, Allard D, Ouguerram K, Devillers M, et atherosclerosis.2016.03.009.
al. Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. 21. Sjouke B, Hovingh GK, Kastelein JJ, Stefanutti C. Homozygous autoso-
Nat Genet. 2003;34:154–156. doi: 10.1038/ng1161. mal dominant hypercholesterolaemia: prevalence, diagnosis, and current
4. Palacios L, Grandoso L, Cuevas N, Olano-Martín E, Marti- and future treatment perspectives. Curr Opin Lipidol. 2015;26:200–209.
nez A, Tejedor D, et al. Molecular characterization of familial doi: 10.1097/MOL.0000000000000179.
22. Raal FJ, Santos RD. Homozygous familial hypercholesterolemia: current Surveys (NHANES). Circulation. 2016;133:1067–1072. doi: 10.1161/
perspectives on diagnosis and treatment. Atherosclerosis. 2012;223:262– CIRCULATIONAHA.115.018791.
268. doi: 10.1016/j.atherosclerosis.2012.02.019. 38. Alonso MJ, Heine-Suñer D, Calvo M, Rosell J, Giménez J, Ramos MD,
23. Tejedor D, Castillo S, Mozas P, Jiménez E, López M, Tejedor MT, et al. Spectrum of mutations in the CFTR gene in cystic fibrosis pa-
et al; Spanish FH Group. Reliable low-density DNA array based on tients of Spanish ancestry. Ann Hum Genet. 2007;71(pt 2):194–201. doi:
allele-specific probes for detection of 118 mutations causing familial 10.1111/j.1469-1809.2006.00310.x.
hypercholesterolemia. Clin Chem. 2005;51:1137–1144. doi: 10.1373/ 39. Mabuchi H, Nohara A, Noguchi T, Kobayashi J, Kawashiri MA, Tada
clinchem.2004.045203. H, et al; Hokuriku FH Study Group. Molecular genetic epidemiol-
24. Maglio C, Mancina RM, Motta BM, Stef M, Pirazzi C, Palacios L, et ogy of homozygous familial hypercholesterolemia in the Hokuriku
al. Genetic diagnosis of familial hypercholesterolaemia by targeted next- district of Japan. Atherosclerosis. 2011;214:404–407. doi: 10.1016/j.
generation sequencing. J Intern Med. 2014;276:396–403. doi: 10.1111/ atherosclerosis.2010.11.005.
joim.12263. 40. Sniderman AD, Tsimikas S, Fazio S. The severe hypercholesterolemia
25. Blesa S, Garcia-Garcia AB, Martinez-Hervas S, Mansego ML, Gonzalez- phenotype: clinical diagnosis, management, and emerging therapies. J Am
Albert V, Ascaso JF, et al. Analysis of sequence variations in the LDL recep- Coll Cardiol. 2014;63:1935–1947. doi: 10.1016/j.jacc.2014.01.060.
tor gene in Spain: general gene screening or search for specific alterations? 41. Thompson GR, Seed M, Naoumova RP, Neuwirth C, Walji S, Aitman TJ,
Clin Chem. 2006;52:1021–1025. doi: 10.1373/clinchem.2006.067645. et al. Improved cardiovascular outcomes following temporal advances in
26. Tejedor MT, Cenarro A, Tejedor D, Stef M, Mateo-Gallego R, de Cas- lipid-lowering therapy in a genetically-characterised cohort of familial hy-
tro I, et al. Haplotype analyses, mechanism and evolution of common percholesterolaemia homozygotes. Atherosclerosis. 2015;243:328–333.
double mutants in the human LDL receptor gene. Mol Genet Genomics. doi: 10.1016/j.atherosclerosis.2015.09.029.
2010;283:565–574. doi: 10.1007/s00438-010-0541-8. 42. Raal FJ, Pilcher GJ, Panz VR, van Deventer HE, Brice BC, Blom
27. Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork DJ, et al. Reduction in mortality in subjects with homozygous fa-
P, et al. A method and server for predicting damaging missense mutations. milial hypercholesterolemia associated with advances in lipid-
Nat Methods. 2010;7:248–249. doi: 10.1038/nmeth0410-248. lowering therapy. Circulation. 2011;124:2202–2207. doi: 10.1161/
28. Schwarz JM, Rödelsperger C, Schuelke M, Seelow D. MutationTaster CIRCULATIONAHA.111.042523.
evaluates disease-causing potential of sequence alterations. Nat Methods. 43. Gidding SS, Champagne MA, de Ferranti SD, Defesche J, Ito MK,
2010;7:575–576. doi: 10.1038/nmeth0810-575. Knowles JW, et al; American Heart Association Atherosclerosis, Hyperten-
29. Ng PC, Henikoff S. Predicting the effects of amino acid substitutions on sion, and Obesity in Young Committee of Council on Cardiovascular Dis-
protein function. Annu Rev Genomics Hum Genet. 2006;7:61–80. doi: ease in Young, Council on Cardiovascular and Stroke Nursing, Council on
10.1146/annurev.genom.7.080505.115630. Functional Genomics and Translational Biology, and Council on Lifestyle
30. Brunak S, Engelbrecht J, Knudsen S. Prediction of human mRNA donor and Cardiometabolic Health. The agenda for familial hypercholesterol-
and acceptor sites from the DNA sequence. J Mol Biol. 1991;220:49–65. emia: a scientific statement from the American Heart Association. Circula-
31. Reese MG, Eeckman FH, Kulp D, Haussler D. Improved splice site tion. 2015;132:2167–2192. doi: 10.1161/CIR.0000000000000297.
detection in Genie. J Comput Biol. 1997;4:311–323. doi: 10.1089/ 44. Tejedor MT, Cenarro A, Tejedor D, Stef M, Palacios L, de Castro I, et
cmb.1997.4.311. al. New contributions to the study of common double mutants in the hu-
32. Betteridge DJ. Familial hypercholesterolemia. In: Betteridge DJ, ed. Lip- man LDL receptor gene. Naturwissenschaften. 2011;98:943–949. doi:
ids and Vascular Disease. London: Martin Dunitz; 2000:65–76. 10.1007/s00114-011-0845-5.
33. Alonso R, Mata P, Alonso Y Gregorio M, de Andrés R. [Homozygous fa- 45. Cuchel M, Meagher EA, du Toit Theron H, Blom DJ, Marais AD, Hegele
milial hypercholesterolemia. First case in Spain treated with lomitapide, RA, et al; Phase 3 HoFH Lomitapide Study Investigators. Efficacy and safe-
an inhibitor of the synthesis of lipoproteins with apolipoprotein B]. Med ty of a microsomal triglyceride transfer protein inhibitor in patients with ho-
Clin (Barc). 2015;145:229–230. doi: 10.1016/j.medcli.2014.11.002. mozygous familial hypercholesterolaemia: a single-arm, open-label, phase
34. Martínez-Botas J, Suárez Y, Reshef A, Carrero P, Ortega H, Gómez-Coro- 3 study. Lancet. 2013;381:40–46. doi: 10.1016/S0140-6736(12)61731-0.
nado D, et al. Impact of different low-density lipoprotein (LDL) receptor 46. Raal FJ, Honarpour N, Blom DJ, Hovingh GK, Xu F, Scott R, et al; TES-
mutations on the ability of LDL to support lymphocyte proliferation. Me- LA Investigators. Inhibition of PCSK9 with evolocumab in homozygous
tabolism. 1999;48:834–839. familial hypercholesterolaemia (TESLA Part B): a randomised, double-
35. INE. Series Detalladas Desde 1996. 2016. Available at www.ine.es. blind, placebo-controlled trial. Lancet. 2015;385:341–350. doi: 10.1016/
36. Benn M, Watts GF, Tybjaerg-Hansen A, Nordestgaard BG. Familial hy- S0140-6736(14)61374-X.
percholesterolemia in the danish general population: prevalence, coronary 47. Raal FJ, Santos RD, Blom DJ, Marais AD, Charng MJ, Cromwell
artery disease, and cholesterol-lowering medication. J Clin Endocrinol WC, et al. Mipomersen, an apolipoprotein B synthesis inhibitor, for
Metab. 2012;97:3956–3964. doi: 10.1210/jc.2012-1563. lowering of LDL cholesterol concentrations in patients with homo-
37. de Ferranti SD, Rodday AM, Mendelson MM, Wong JB, Leslie LK, zygous familial hypercholesterolaemia: a randomised, double-blind,
Sheldrick RC. Prevalence of familial hypercholesterolemia in the 1999 placebo-controlled trial. Lancet. 2010;375:998–1006. doi: 10.1016/
to 2012 United States National Health and Nutrition Examination S0140-6736(10)60284-X.
CLINICAL PERSPECTIVE
The present study includes all diagnostic tests for familial hypercholesterolemia performed in Spain up to 2015. The study
shows that genetically defined homozygous familial hypercholesterolemia (HoFH) prevalence is higher than the previously
reported that was based mostly on low-density lipoprotein cholesterol (LDL-C) levels and that the classical clinical criteria
identify only the most severe HoFH cases. Almost half of the patients who were genetically diagnosed with HoFH did not
meet the classical clinical criteria for HoFH diagnosis. The study demonstrates that the lipid phenotype of HoFH is heteroge-
neous, and the causative genetic defect is the major driver of this heterogeneity. The highest LDL-C levels are found in true
homozygous patients carrying null alleles, whereas the lowest blood LDL-C levels are present in compound heterozygous
patients carrying defective alleles. The clinical phenotype of some cases of HoFH overlaps with the clinical phenotype of
some severe cases of heterozygous familial hypercholesterolemia. Thus, the study suggests that the criteria used for the
differential diagnosis of HoFH must be reconsidered. Our results also have therapeutic implications. LDL apheresis is the
most used treatment in HoFH. However, new therapeutic options are available, and some of these agents have been specifi-
cally approved to treat only HoFH. Our findings support the application of these drugs based on LDL-C levels rather than a
specific diagnosis.
Homozygous Familial Hypercholesterolemia in Spain: Prevalence and Phenotype−
Genotype Relationship
Rosa M. Sánchez-Hernández, Fernando Civeira, Marianne Stef, Sofía Perez-Calahorra, Fátima
Almagro, Nuria Plana, Francisco J. Novoa, Pedro Sáenz-Aranzubía, Daniel Mosquera, Cristina
Soler, Francisco J. Fuentes, Yeray Brito-Casillas, Jose T. Real, Francisco Blanco-Vaca, Juan F.
Ascaso and Miguel Pocovi
Circ Cardiovasc Genet. 2016;9:504-510; originally published online October 26, 2016;
doi: 10.1161/CIRCGENETICS.116.001545
Circulation: Cardiovascular Genetics is published by the American Heart Association, 7272 Greenville Avenue,
Dallas, TX 75231
Copyright © 2016 American Heart Association, Inc. All rights reserved.
Print ISSN: 1942-325X. Online ISSN: 1942-3268
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circgenetics.ahajournals.org/content/9/6/504
Data Supplement (unedited) at:

http://circgenetics.ahajournals.org/content/suppl/2016/10/26/CIRCGENETICS.116.001545.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation: Cardiovascular Genetics can be obtained via RightsLink, a service of the Copyright Clearance
Center, not the Editorial Office. Once the online version of the published article for which permission is being
requested is located, click Request Permissions in the middle column of the Web page under Services. Further
information about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:

http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation: Cardiovascular Genetics is online at:
http://circgenetics.ahajournals.org//subscriptions/
Supplemental Material
Supplementary tables
Table 1. Mutations causing HoFH
Nucleotide substitution (c-DNA) Allele name (Protein) N
True Homozygous: LDLR
c.[1162_1173del12];[1162_1173del12] p.[His388_Ala391del];[His388_Ala391del] 1
c.[1199_1207delACCTCTTCT];
p.[Tyr400_Phe402del];[Tyr400_Phe402del] 1
[1199_1207delACCTCTTCT]
c.[1965C>G];[1965C>G] p.[Phe655Leu];[Phe655Leu] 1
c.[1048C>T];[1048C>T] p.[Arg350*];[Arg350*] 1
c.[1045delC];[1045delC] p.[Gln349Serfs*21];[Gln349Serfs*21] 2
c.[1301C>G];[1301C>G] p.[Thr434Arg];[Thr434Arg] 2
c.[97C>T];[97C>T] p.[Gln33*];[Gln33*] 1
c.[2397_2405delCGTCTTCCT;1690A>C];[23 p.[Val800_Leu802del;Asn564His];[Val800
1
97_2405delCGTCTTCCT;1690A>C] _Leu802del;Asn564His]
c.[800A>C];[800A>C] p.[Glu267Ala];[Glu267Ala] 1
c.[682G>T];[682G>T] p.[Glu228*];[Glu228*] 1
c.[953G>T];[953G>T] p.[Cys318Phe];[Cys318Phe] 1
c.[1916T>A];[1916T>A] p.[Val639Asp];[Val639Asp] 1
c.[1775G>A];[1775G>A] p.[Gly592Glu];[Gly592Glu] 1
c.[2397_2405delCGTCTTCCT;1690A>C];[23 p.[Val800_Leu802del;Asn564His];[Val800
1
97_2405delCGTCTTCCT;1690A>C] _Leu802del;Asn564His]
c.[1897C>T];[1897C>T] p.[Arg633Cys];[Arg633Cys] 2
c.[621C>T];[621C>T] p.[Gly207Gly];[Gly207Gly] 1
c.[1706-?_1845+?del];[1706-?_1845+?del] NA 1
c.[898A>G];[898A>G] p.[Arg300Gly];[Arg300Gly] 1
c.[1965C>G];[1965C>G] p.[Phe655Leu];[Phe655Leu] 1
c.[1783C>T];[1783C>T] p.[Arg595Trp];[Arg595Trp] 3
c.[1027G>A];[1027G>A] p.[Gly343Ser];[Gly343Ser] 1
c.[502G>A];[502G>A] p.[Asp168Asn];[Asp168Asn] 1
c.[97C>T];[97C>T] p.[Gln33*];[Gln33*] 1
c.[1342C>T];[1342C>T] p.[Gln448*];[Gln448*] 2
p.[Leu64_Pro105delinsSer];[Leu64_Pro105
c.[313+2dupT];[313+2dupT] 2
delinsSer]
c.[313+5G>A];[313+5G>A] NA 1
p.[Leu64_Pro105delinsSer];[Leu64_Pro105
c.[313+2dupT];[313+2dupT] 1
delinsSer]
c.[2475C>G];[2475C>G] p.[Asn825Lys];p.[Asn825Lys] 1
p.[Pro685ArgFs*24)];[ p.[Pro685ArgFs*24
[c.2054delC]; [c.2054delC] 1
]
[c.916_919dupTCAG] [c.916_919dupTCAG] [pAsp307Valfs*3];[pAsp307Valfs*3] 2
True Homozygotes: LDLRAP1
c.[431dupA];[431dupA] p.[His144Glnfs*27];[His144Glnfs*27] 1
c.[207delC];[207delC] p.[Ala70ProfsX19 ];[Ala70ProfsX19]

1
c.[603dupC];[c.603dupC] p.[Ser202LeuFs*19];[Ser202LeuFs*19]
c. [345-?_459+?del]; [345-?_459+?del] NA 2
True Homozygous: APOB
c.[10580G>A];[10580G>A] p.[Arg3527Gln];[Arg3527Gln] 1
Compound Heterozygotes: LDLR
c.[346T>C];[2100C>G] p.[Cys116Arg];[Asp700Glu] 1
c.[1246C>T];[737G>A] p.[Arg416Trp];[Gly246Glu] 1
c.[97C>T(;)584G>A] p.[Gln33*(;)Ser195Asn] 1
c.[313+1G>C;274C>G];[2099A>G] p.[NA;Gln92Glu];[Asp700Gly] 1
p.[Trp4*;
c.[12G>A;829G>A];
Glu277Lys];[Val800_Leu802del;Asn564Hi 1
[2397_2405delCGTCTTCCT;1690A>C]
s]
c.[313+1G>C;274C>G];[240C>A] p.[NA;Gln92Glu];[Asn80Lys] 2
c.[346T>C];[12G>A ; 829G>A] p.[Cys116Arg];[Trp4*; Glu277Lys] 1
c.[12G>A;829G>A ];[1358+1G>A] p.[Trp4*, Glu277Lys];[NA] 1
c.[2397_2405delCGTCTTCCT;1690A>C];[39 p.[Val800_Leu802del;Asn564His];[Arg132
1
4C>T] Trp]
c.[313+1G>C;274C>G];[1027G>A] p.[NA;Gln92Glu];[Gly343Ser] 1
c.[514G>A];[1103G>A] p.[Asp172Asn];[Cys368Tyr] 1
c.[2397_2405delCGTCTTCCT;1690A>C];[26 p.[Val800_Leu802del;Asn564His];[Cys89T
2
7C>G] rp]
c.[313+1G>C;274C>G];[58G>A] p.[NA;Gln92Glu];[Gly20Arg] 1
c.[2086T>C];[1-?_67+?del] p.[Cys696Arg];[NA] 1
c.[2001T>A];[48C>A] p.[Cys667*];[Leu16Leu] 1
c.[1897C>T];[953G>T] p.[Arg633Cys];[Cys318Phe] 1
c.[2375T>C];[1133A>C] p.[Ile792Thr];[Gln378Pro] 1
c.[530C>T];[1-?_67+?del] p.[Ser177Leu];[NA] 1
c.[2390-?_2547+?del];[1775G>A] p.[NA];[Gly592Glu] 1
c.[451_453delGCC(;)1618G>A] p.[Ala151del(;)Ala540Thr] 1
c.[9delC];[1567G>A] p.[Trp4Glyfs*202];[Val523Met] 1
c.[2475C>A];[1195G>A] p.[Asn825Lys];[Ala399Thr] 1
c.[1816G>A(;)556G>C] p.[Ala606Thr(;)Gly186Arg] 1
c.[313+1G>C];[2140+1G>A] p.[NA];[NA] 1
c.[1816G>T(;)631C>G] p.[Ala606Ser(;)His211Asp] 3
c.[1816G>T(;)621C>T] p.[Ala606Ser(;)Gly207Gly] 1
c.[1072T>C(;)2441G>A] p.[Cys358Arg(;)Arg814Gln] 1
c.[460C>T];[1247G>A] p.[Gln154*];[Arg416Gln] 1
c.[1133A>C];[1-?_67+?del] p.[Gln378Pro];[NA] 1
c.[672_686del15(;)2390-?_2547+?del] p.[Asp224_Glu228del(;)NA] 1
c.[97C>T(;)1093A>G] p.[Gln33*(;)Ser365Gly] 1
c.[916_919dupTCAG];[185C>T] p.[Asp307Valfs*3];[Thr62Met] 1
c.[1618G>A];[451_453delGCC] p.[Ala540Thr];[Ala151del] 1
c.[(-268)G>T(;)2093G>A] p.[NA(;)Cys698Tyr] 1
c.[1246C>T];[1510A>G] p.[Arg416Trp];[Lys504Glu] 1
c.[1816G>T];[631C>G] p.[Ala606Ser];[His211Asp] 1
c.[2390-?_2583+?del];[1898G>A] p.[NA];[Arg633His] 1
c.[1898G>A];[2390-?_2583+?del] p.[Arg633His];[NA] 1
c.[58G>A];[1697T>C] p.[Gly20Arg];[Ile566Thr] 1
c.[11G>A(;)1694G>A] p.[Trp4*(;)Gly565Asp] 1
c.(-140)C>T];[858C>A] p.[NA];[Ser286Arg] 1
[c.902A>G ];[c.1646G>T] p.[Asp301Gly];[Gly549Val] 1
Double Heterozygotes: LDLR and PCSK9
LDLR: c.(-228)G>C LDLR: p.NA

1
PCSK9:c.60_65dupGCTGCT PCSK9: p.Leu22_Leu23dup
LDLR: c.760C>T LDLR: p.Gln254*

1
PCSK9:c.60_65dupGCTGCT PCSK9: p.Leu22_Leu23dup
LDLR: c.[314-?_940+?del] LDLR: NA

1
PCSK9:c.[60_65dupGCTGCT] PCSK9: p.Leu22_Leu23dup
Double Heterozygotes: LDLR and APOB
LDLR: c.520G>A LDLR: p.Glu174Lys

1
APOB: c.10580G>A APOB: p.Arg3527Gln
LDLR: c.1-?_67+?del LDLR: p.NA

1
APOB: c.10588G>A APOB: p.Val3530Met
Table 2. Frequent LDLR variants associated in cis position
c.[313+1G>C; 274C>G] p.(Gln92Glu)
c.[829G>A; c.12G>A] p.[Glu277Lys; Trp4*]
c.[1061-8T>C; 274C>G]
c.[2397_2405delCGTCTTCCT; 1690A>C]p.[Lys799_Phe801del;Asn564His]
Atherosclerosis 269 (2018) 1e5
Contents lists available at ScienceDirect
Atherosclerosis
journal homepage: www.elsevier.com/locate/atherosclerosis
Autosomal recessive hypercholesterolemia in Spain

Rosa María Sa
!nchez-Herna !ndez a, *, Pablo Prieto-Matos b, Fernando Civeira c,
Eduardo Esteve Lafuente , Manuel Frías Vargas e, Jose
d ! T. Real f,
Fernando Gon~ i Goicoechea , Francisco J. Fuentes , Miguel Pocovi i, Mauro Boronat a,
g h
Ana María Wa€gner a, Luis Masana j

a
Seccio!n de Endocrinología y Nutricio!n, Complejo Hospitalario Universitario Insular Materno Infantil de Gran Canaria, Instituto Universitario de
Investigaciones Biom! edicas y Sanitarias (IUIBS) de la Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, Spain
b
Unidad de Endocrinología Pedia !trica, Hospital Universitario de Salamanca, Instituto de Investigacio !n Biom! edica de Salamanca, Spain
c
Unidad Clínica y de Investigacio
!n en Lípidos y Arterioesclerosis, Hospital Universitario Miguel Servet, IIS Arago
!n, Centro de Investigacio
!n Biomedica en Red
de Enfermedades Cardiovasculares (CIBERCV), Universidad de Zaragoza, Zaragoza, Spain
d
Servicio Endocrinología y Nutricio!n, Hospital Universitari de Girona Dr. Josep Trueta, Spain
e
Centro de Salud San Andr! es, Madrid, Spain
f
Servicio de Endocrinología y Nutricio!n, Hospital Clínico Valencia, Departamento de Medicina, Universidad de Valencia, INCLIVA, Centro de Investigacio !n
Biomedica en Red de Diabetes y Enfermedades Metabolicas Asociadas (CIBERDEM), Spain
g
Servicio Endocrinología y Nutricio!n, Hospital Universitario de Basurto, Bilbao, Spain
h
Hospital Universitario Reina Sofía, Universidad de Co !rdoba, Centro de Investigacio !n Biom!edica en Red de Fisiopatolgía de la Obesidad y Nutricio !n
(CIBEROBN), Instituto de Salud Carlos III (ISCIII), Madrid, Instituto Maimo !nedes de Investigacio
!n Biom! edica de Co
!rdoba (IMIBIC), Spain
i
Departamento de Bioquímica y Biología Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza, IIS Arago !n, CIBERCV, Zaragoza, Spain
j
Unidad de Medicina Vascular y Metabolica, Unidad de Investigacio !n en Lipidos y Arterioesclerosis, Hospital Universitario "Sant Joan", Universitat Rovira i
Virgili, IISPV, CIBERDEM, Reus, Madrid, Spain
a r t i c l e i n f o a b s t r a c t
Article history: Background and aims: Autosomal recessive hypercholesterolemia (ARH) is a very rare disease, caused by
Received 17 October 2017 mutations in LDL protein receptor adaptor 1 (LDLRAP1). It is characterized by high levels of low-density
Received in revised form lipoprotein cholesterol (LDL-C) and increased risk of premature cardiovascular disease. We aimed to
21 November 2017
characterize ARH in Spain.
Accepted 5 December 2017
Available online 6 December 2017
Methods: Data were collected from the Dyslipidemia Registry of the Spanish Atherosclerosis Society. A
literature search was performed up to June 2017, and all diagnostic genetic studies for familial hyper-
cholesterolemia of Spain were reviewed.
Keywords:
Familial hypercholesterolemia
Results: Seven patients with ARH were identified, 6 true homozygous and one compound heterozygous
Autosomal recessive hypercholesterolemia with a novel mutation: c.[863C>T];p.[Ser288Leu]. High genetic heterogeneity was found in this cohort.
LDLRAP1 True homozygous subjects for LDLRAP1 have more severe phenotypes than the compound heterozygous
patient, but similar to patients with homozygous familial hypercholesterolemia (HoFH). Cardiovascular
disease was present in 14% of the ARH patients. LDL-C under treatment was above 185 mg/dl and the
response to PCSK9 inhibitors was heterogeneous. Finally, the estimated prevalence in Spain is very low,
with just 1 case per 6.5 million people.
Conclusions: ARH is a very rare disease in Spain, showing high genetic heterogeneity, similarly high LDL-
C concentrations, but lower incidence of ASCVD than HoFH.
© 2017 Elsevier B.V. All rights reserved.
1. Introduction
Autosomal recessive hypercholesterolemia (ARH) (ARH; OMIM

#603813) is a rare monogenic disease, characterized by very high
* Corresponding author. Present/permanent address. Hospital Universitario levels of low-density lipoprotein cholesterol (LDL-C), usually above
Insular de Gran Canaria, Avenida Marítima Sin Número, CP: 35016, Las Palmas de
400 mg/dl, and increased risk of premature atherosclerotic car-
Gran Canaria, Las Palmas, Spain.
E-mail address: rosamariasanher@gmail.com (R.M. Sa
!nchez-Herna!ndez). diovascular disease (ASCVD) [1]. ARH is caused by loss-of-function
https://doi.org/10.1016/j.atherosclerosis.2017.12.006
0021-9150/© 2017 Elsevier B.V. All rights reserved.
2 R.M. Sa
!nchez-Herna
!ndez et al. / Atherosclerosis 269 (2018) 1e5
mutations in LDLRAP1, a gene encoding an adaptor protein involved documented pathogenic mutations in LDLRAP1, including true ho-
in the uptake of the LDL receptor (LDLr) and clearance of LDL par- mozygous and compound heterozygous mutations. Double het-
ticles. LDLRAP1 protein is an LDLr chaperone that binds to the LDLr, erozygous subjects, with mutations in other FH candidate genes
to allow the LDL/LDLr complex to be internalized in the clathrin (LDLR, APOB, PCSK9), were excluded. Next generation sequencing of
coated pit [2]. The gene causing ARH is located on chromosome 1. It the promoter, exon, and intron-exon boundaries of the LDLRAP1
was identified in 2001 [3], although the disease had been clinically gene was performed [7]. The heterozygous status, defined as the
described by Khachadurian and Uthman in 1973, in four siblings presence of one pathogenic variant of LDLRAP1, was evaluated in all
from a Lebanese family, with a phenotype that reminded of ho- the molecular studies where the LDLRAP1 gene was sequenced.
mozygous familial hypercholesterolemia (HoFH), but whose par- Predict-SNP [8], Polyphen-2 [9] and SIFT [10] bioinformatic tools
ents were normolipemic [4]. Given its recessive inheritance were used to predict functionality of previously unknown
pattern, two mutated alleles have to be present for the disease to mutations.
develop. Although homozygous mutations in LDLRAP1 are the most
frequent cause of ARH, compound heterozygous mutations have 2.3. Clinical and biochemical measurements
also been described. Mutations causing ARH are null alleles with
nonsense mutations resulting in a truncated or non-functional The clinical data recorded were family history of hypercholes-
protein [3]. Heterozygous carriers of LDLRAP1 mutations have terolemia and premature ASCVD, personal history of hypercholes-
normal LDL-C concentrations, because one functional copy of the terolemia and ASCVD, presence of aortic stenosis, current lipid-
gene is enough to maintain LDLr uptake. lowering treatment, and a physical examination at diagnosis,
LDL particle clearance rate is similar in ARH and HoFH patients including the presence of arcus cornealis and xanthomata. All data
who lack the LDLr, but much lower than in normolipemic patients. were collected directly by the patient's attending physician or from
Since most ARH forms are clinically indistinguishable from HoFH, the Dyslipidemia Registry of the Spanish Arteriosclerosis Society.
the former is considered a clinical subtype of HoFH [1]. Its mani- Results of blood tests were also recorded, including a fasting
festations include extremely high LDL-C levels, very extensive lipid profile (total cholesterol, HDL-cholesterol, LDL-C and tri-
xanthomas, aortic stenosis and premature ASCVD, although less glycerides) without and with current lipid lowering treatment.
aggressive phenotypes have also been described [5]. Furthermore, Samples were processed at the standardized laboratories in the
in spite of similarly low LDL particle uptake, and for reasons that are participating centers.
still to be elucidated, ARH patients have lower rates of ASCVD and All patients who underwent molecular diagnosis were informed
better response to lipid lowering treatment than HoFH [6]. and signed a written, informed consent form. In each center, the
The real prevalence of ARH remains undetermined and could be, study was approved by the local ethics committee.
as described for HoFH, higher than previously reported. Our present
study aimed to establish an estimation of ARH prevalence, pheno- 2.4. Statistical analysis
type variability, genotype-phenotype correlation and response to
lipid-lowering treatment in all ARH cases diagnosed in Spain. Prevalence was calculated as the number of ARH cases divided
by the mean total number of population for the whole period. Mean
2. Materials and methods population was estimated using demographic data provided by the
Spanish National Institute for Statistics (Instituto Nacional
2.1. Patients Estadística).
Data are expressed as mean ± SD for numeric variables that
The identification of all potential ARH patients was performed followed a normal distribution or as median and range for other
by several approaches: numeric variables. Between-group comparisons were performed
using Student's t or ManneWhitney's U tests. Differences were
1. A search on the Dyslipidemia Registry of the Spanish Athero- considered significant when the 2-tailed p value was <0.05.
sclerosis Society, an active on-line registry, in which 50 certified
lipid units throughout all Spanish regions enter cases with 3. Results
different types of primary hyperlipidemia. These lipid units are
the facilities in the Spanish Public National Health System where Seven ARH patients were identified, 6 true homozygous and one
severe primary hyperlipidemias are usually referred for diag- compound heterozygous. Their clinical and genetic features are
nosis and treatment. displayed in Table 1. Four were female and their mean age at
2. Extensive literature search up to June 2017 of all PubMed diagnosis was 19.2 years. Xanthomata were present in 2 patients.
recorded publications from Spain in which any of the following Mean LDL-C at diagnosis was 689.2 ± 319.5 mg/dl. Regarding mu-
words were included: Homozygous Familial Hypercholester- tations in LDLRAP1, except for siblings, all were different among
olemia/ARH/Autosomal recessive hypercholesterolemia/ patients, and were previously described [11,12]. The mutation
LDLRAP1. c.[863C>T];p.[Ser288Leu] was a novel mutation, not previously
3. Review of all diagnostic genetic studies for FH performed in described, possibly pathogenic according to in silico predictions
Spain from 1996 to June 2017. All genetic tests were performed (PredictSNP 87%, PolyPhen 0.806, SIFT 0) identified in the com-
at one of the following six Spanish centers: Zaragoza University, pound heterozygous patient in heterozygosis with c.[653C>T];
Progenika-Biopharma SA (Derio, Vizcaya), Hospital Clínico in p.[Thr218Ile], which is present in the Human Gene Mutation Data-
Valencia, Hospital Santa Creu i Sant Pau in Barcelona, Hospital La base (www.ucl.ac.uk). Furthermore, most homozygous patients
Paz in Madrid and Laboratorio de Ana !lisis Clínico-Gene!ticos, had null allele mutations. Interestingly, the compound heterozy-
Gendiag.exe, Barcelona. gous subject presented a milder phenotype, with much lower
baseline LDL-C concentrations and later diagnosis than most true
homozygous. Regarding cardiovascular disease, only one patient
2.2. Molecular diagnosis had suffered from ASCVD (at 55), although the age at the time of
this report was 38.3 years and 5 subjects were below 50 years of
Diagnosis of ARH was defined by the presence of two age. No patient developed aortic stenosis and only two subjects
Table 1
Baseline clinical and genetic data.
Subject Gender Genotype Genotype Age at diagnosis Xanthomata Total cholesterol HDL-cholesterol LDL-cholesterol Triglycerides
number nucleotide substitution (c.DNA) allele name (Protein) (years) (mg/dl) (mg/dl) (mg/dl) (mg/dl)
1 Female [c.603dupC];[c.603dupC] p.[Ser202LeuFs*19];p.[Ser202LeuFs*19] 32 Yes 1056 50 901.6 522

2 Female c.[431dupA]; [431dupA] p.[His144Glnfs*27];[His144Glnfs*27] 12 Yes 570 46 502.6 107
3 Female c.[207delC];[207delC] p.Ala70ProfsX19;p.Ala70ProfsX19 2 No 565 37 511.2 84
4 Female c. [345-?_459þ?del];[345-?_459þ?del] NA 2 months No 1200 40 1135 123
5 Male c. [345-?_459þ?del];[345-?_459þ?del] NA 4 months No 1040 31 986 115
6 Male c.[1A>G];c.[1A>G] p.[Met1Val];p.[Met1Val] 48 No 621 60 535 130
7 Male c.[653C>T]a;c.[863C>T]b p.[Thr218Ile];p.[Ser288Leu] 40 No 325 50 253 109
a
Present in database www.ucl.ac.uk.
b
Not described, possibly pathogenic in silico prediction.
R.M. Sa
!nchez-Herna
Table 2
Current clinical data, treatment, post-treatment values of LDL-C and % of LDL-C reduction compared to baseline concentrations.
Subject Age BMI (kg/m2) ASCVD Aortic Lipid lowering treatment Total cholesterol HDL-cholesterol LDL-cholesterol Triglycerides % LDL-C reduction
number (years) stenosis (mg/dl) (mg/dl) (mg/dl) (mg/dl)
1 45 24.97 No No Atorvastatin 80 mg 221 63 150 51 83.4%

2 60 28 Yes, 55 y No Atorvastatin 80 mg þ ezetimibe 10 mg þ resins (4 g/d) þ evolocumab 420/15 days 274 56 210 81 58.2%
3 11 18.3 No No Atorvastatina 40 mg þ ezetimibe 10 mg 389 35 334 100 41.5%
4 27 22.3 No No Rosuvastatin 20 mg þ Ezetimibe 10 mg 239 47 176 80 84.5%
5 33 27.03 No No Rosuvastatin 40 mg þ Ezetimibe 10 mg þ Evolocumab 140 mg/15 days 267 37 215 76 78.2%
6 50 29 No No Atorvastatin 80 þ ezetimibe 10 mg þ evolocumab 420 mg/15 days 176 44 60 107 88.8%
7 42 23.27 No No Atorvastatin 20 mg þ ezetimibe 10 mg 223 53 149 107 41.1%
BMI, body mass index; ASCVD, atherosclerotic cardiovascular disease; y, years.

3
4 R.M. Sa
!nchez-Herna
have atherosclerotic plaques in the carotid arteries. Current clinical the Spanish patients, among whom only two siblings had the same
data, lipid profile and lipid lowering treatment are shown in mutations in homozygosis, while the rest of cases carried different
Table 2. pathogenic mutations. The compound heterozygous patient has a
Concerning treatment, most patients were on combined therapy new, previously undescribed variant: c.[863C>T], which was prob-
with a statin and ezetimibe, whereas one patient was on atorvas- ably pathogenic according to in silico predictions, although no
tatin monotherapy. Three patients were receiving triple, combined functional study was performed.
treatment with PCSK9 inhibitors (evolocumab), obtaining hetero- Regarding ASCVD, only one (14.3%) female ARH patient suffered
geneous responses. Specifically, case number 2 showed no response from premature ASCVD at the age of 55 and no patient had
to evolocumab. This patient had previously been offered LDL developed aortic stenosis during follow-up. This represents a low
apheresis, which she declined. Case number 5 showed only a small frequency of ASCVD in comparison to previous reports. In a study
reduction (19%) in LDL-C concentrations, which remained very high performed in Sardinian patients with ARH, 11 out of 28 had evi-
(215 mg/dl), in spite of the PCSK9 inhibitor administration. Finally, dence of coronary atherosclerosis and 3 had suffered a myocardial
in case number 6, who received higher doses of evolocumab, a infarction [19] and another Italian study found a prevalence of 40%
more significant reduction of LDL-C (59%) was achieved (see of premature ASCVD in ARH [6]. Regarding HoFH subjects, in a
Table 2). Regarding drug therapy, the starting age was 23.3 ± 15.8 Spanish cohort, the ASCVD prevalence was higher in carriers of null
years and the mean duration of the treatment was 13 ± 9 years. allele mutations of LDLR (50%) and defective allele mutations
After treatment, the achieved mean LDL-C level was (43.8%) [20]. It must be considered that our ARH group is composed
185 ± 79.3 mg/dl for the true homozygous patients and 149 mg/dl of quite young patients, with clinical diagnosis at an early age, and
for the compound heterozygous subject. potent lipid-lowering treatment for many years, all of which could
Regarding the prevalence of ARH in Spain, this was estimated as explain the low prevalence of ASCVD, but also emphasizes the good
approximately 1 case per 6.5 million people (7 cases out of over prognosis of these patients with appropriate lipid-lowering treat-
46.5 million people in Spain at 1st January of 2017) [13]. ment begun early in life.
In 3623 subjects who undergone LDLRAP1 sequencing with the Although affected patients have approximately 9-fold lower risk
clinical diagnosis of familial hypercholesterolemia, 19 LDLRAP1 of ASCVD than HoFH and aortic stenosis appears later [6], ARH has a
carriers with damaging or probably damaging mutations by bio- lipid phenotype similar to HoFH [21]. In this regard, patients in our
informatic analysis were detected. These data provide a frequency cohort showed very high LDL-C at diagnosis, approaching con-
of LDLRAP carriers of 0.52%. centrations seen in patients with HoFH with a defective allele [1].
However, in the Spanish HoFH cohort LDL-C at diagnosis was lower
4. Discussion in defective allele carriers than in ARH patients (488 mg/dl vs
689.2 mg/dl) [20]. The more favorable clinical prognosis of ARH
ARH is a very rare disease affecting less than 1:1000,000 of the patients is probably explained by their response to classical lipid-
population [6], with the exception of Sardinia, a region in Italy with lowering treatment, compared to that of patients with HoFH. The
a founder effect [14,15], that has a prevalence of 1:40,000 including LDLRAP1 protein is necessary for the LDLr uptake by hepatic cells
both true homozygotes and compound heterozygotes. The present and lymphocytes, but the lack of LDLRAP1 does not affect the
report shows that the estimated prevalence of ARH in Spain is internalization of LDLr in fibroblasts [2]. These facts could also
extremely low, with only 7 cases out of over 46.5 million people, contribute to the milder ASCVD phenotype in ARH compared with
representing a prevalence of approximately 1 case per 6.5 million HoFH.
people. Considering the extreme phenotype of ARH patients and The LDL-C reduction with statins in ARH is variable. Some series
the extensive case search in our study, it seems improbable that have reported decreases of up to 60% [5,19,22], ranging between 60
many subjects with ARH have remained undetected. Hence, our and 80% when high potency statins are combined with ezetimibe
study provides an approximation to the prevalence of this disease [14,22,23]. In the present report, the LDL-C decrease with lipid-
in a population with wide genetic heterogeneity. This prevalence is lowing therapy ranged from 41 to 84%, confirming a much larger
in agreement with recently published data from the Sicilian pop- lipid response than HoFH and very similar to that observed in
ulation, with a c.432insA (p.H144QfsX26) mutation carrier status of general population. Nevertheless, our patients' mean LDL-C after
1:2500 [16]. Furthermore, except for two siblings, the ARH cases in treatment was 185 mg/dl, an unacceptably high level that implies
Spain are unrelated and come from geographically spread Spanish the need of new treatments to achieve the recommended LDL-C
regions. goals. A heterogeneous reduction of LDL-C levels response to
Most patients were true homozygotes carrying null allele mu- PCSK9 inhibitor was observed in this case report. In agreement with
tations. Indeed, the vast majority of ARH subjects reported so far are previous reports, showing a moderate (15e32%) reduction of LDL-C
true homozygotes with a premature termination codon or trun- in ARH [24,25], one patient here treated with this drug, experi-
cated protein [3], leading to complete loss of function of the enced a mild decrease in LDL-C ("19%). Besides, another patient did
LDLRAP1 [17]. This suggests that complete abolition of LDLRAP1 is not show any response at all. However, one homozygous patient
needed to express the disease, in agreement with in vitro studies experimented a better response ("59%). PCSK9 reduces LDLr
demonstrating that partial LDLRAP1 activity restores LDL/LDLr expression in the cell surface, and activates monoclonal antibodies
internalization in hepatic cells [18], and explains the discrepancy against PCSK9 enhance LDL-LDLr uptake by increasing the LDLr
between the prevalence of LDLRAP1 mutation carriers and ARH activity in the presence of normal LDLRAP1 protein, hence with a
subjects. Probably, severe, biallelic mutations in LDLRAP1 are predictably mild response in ARH subjects who lack functional
required for the full phenotype of ARH to be expressed. The high LDLRAP1 [25]. Lomitapide, an inhibitor of the microsomal triglyc-
prevalence of mutations carriers in our study, approximately 1:200 eride transfer protein, could be an alternative treatment for ARH,
subjects with primary hypercholesterolemia, would suggest that because it acts independently of the LDLr. An Italian study reported
non-severe mutations in LDRAP1 may play a role in the pathogen- 5 ARH patients treated with lomitapide achieving an important
esis of some forms of polygenic hypercholesterolemia. reduction (68.2 ± 24.8%) in LDL-C [26].
Except in Sardinia, where 3 alleles are responsible for most of Nevertheless, the small number of patients limits the conclu-
the cases [15], ARH is due to multiple, different mutations along the sions that can be drawn from the results on genotype-phenotype
LDLRAP1 gene [3]. Great genetic heterogeneity was also observed in correlation and response to therapy.
R.M. Sa
!nchez-Herna
!ndez et al. / Atherosclerosis 269 (2018) 1e5 5
4.1. Conclusions Biol. 12 (5) (2016), e1004962, https://doi.org/10.1371/journal.pcbi.1004962.

[9] I.A. Adzhubei, S. Schmidt, L. Peshkin, V.E. Ramensky, A. Gerasimova, et al.,
A method and server for predicting damaging missense mutations, Nat.
ARH is a rare disease with a very low prevalence in Spain, with Methods 7 (4) (2010) 248e249, https://doi.org/10.1038/nmeth0410-248.
only seven cases diagnosed so far. It is a disease with great genetic [10] P.C. Ng, S.S.I.F.T. Henikoff, Predicting amino acid changes that affect protein
heterogeneity, similarly high LDL-C concentrations but lower inci- function, Nucleic Acids Res. 31 (13) (2003) 3812e3814.
[11] M. Harada-Shiba, A. Takagi, Y. Miyamoto, M. Tsushima, Y. Ikeda, et al., Clinical
dence of ASCVD than HoFH. In spite of the strong LDL-C lowering features and genetic analysis of autosomal recessive hypercholesterolemia,
effect of statins and ezetimibe, LDL-C is not adequately controlled in J. Clin. Endocrinol. Metab. 88 (6) (2003) 2541e2547, https://doi.org/10.1210/
this population. jc.2002-021487.
[12] F. Quagliarini, J.C. Vallve, F. Campagna, A. Alvaro, F.J. Fuentes-Jimenez, et al.,
Autosomal recessive hypercholesterolemia in Spanish kindred due to a large
Conflict of interest deletion in the ARH gene, Mol. Genet. Metab. 92 (3) (2007) 243e248, https://
doi.org/10.1016/j.ymgme.2007.06.012.
[13] (INE) INdE. Series detalladas desde 1996 2017 [Available from: http://www.i
The authors declared they do not have anything to disclose ne.es/jaxi/menu.do?type¼pcaxis&path¼/t15/p417/&file¼inebase.
regarding conflict of interest with respect to this manuscript. [14] S. Muntoni, L. Pisciotta, S. Muntoni, S. Bertolini, Pharmacological treatment of
a sardinian patient affected by autosomal recessive hypercholesterolemia
(ARH), J. Clin. Lipidol. 9 (1) (2015) 103e106, https://doi.org/10.1016/
Author contributions j.jacl.2014.08.009.
[15] F. Filigheddu, F. Quagliarini, F. Campagna, T. Secci, S. Degortes, et al., Preva-
RMS drafted the manuscript, LM, PPM, EE, JTR, FF, FG and MF lence and clinical features of heterozygous carriers of autosomal recessive
hypercholesterolemia in Sardinia, Atherosclerosis 207 (1) (2009) 162e167,
contributed with patient data, MP performed genetic analysis. RMS,
https://doi.org/10.1016/j.atherosclerosis.2009.04.027.
FC, MB and AMW contributed to the interpretation of the data and [16] R. Spina, D. Noto, C.M. Barbagallo, R. Monastero, V. Ingrassia, et al., Genetic
writing the manuscript. All of the authors have read and accept the epidemiology of autosomal recessive hypercholesterolemia in Sicily: identi-
final version of the paper. fication by next-generation sequencing of a new kindred, J. Clin. Lipidol.
(2017), https://doi.org/10.1016/j.jacl.2017.10.014.
[17] E.R. Eden, D.D. Patel, X.M. Sun, J.J. Burden, M. Themis, et al., Restoration of LDL
Acknowledgements receptor function in cells from patients with autosomal recessive hypercho-
lesterolemia by retroviral expression of ARH1, J. Clin. Invest. 110 (11) (2002)
1695e1702, https://doi.org/10.1172/JCI16445.
We thank Progenika-Biopharma SA (Derio, Vizcaya) and Labo- [18] R. Fellin, G. Zuliani, M. Arca, P. Pintus, A. Pacifico, et al., Clinical and
ratorio de An!
alisis Clínico-Gene
!ticos, Gendiag.exe(Barcelona), for biochemical characterisation of patients with autosomal recessive hyper-
providing genetical data. cholesterolemia (ARH), Nutr. Metab. Cardiovasc Dis. 13 (5) (2003) 278e286.
[19] M. Arca, G. Zuliani, K. Wilund, F. Campagna, R. Fellin, et al., Autosomal
recessive hypercholesterolaemia in Sardinia, Italy, and mutations in ARH: a
References clinical and molecular genetic analysis, Lancet 359 (9309) (2002) 841e847,
https://doi.org/10.1016/S0140-6736(02)07955-2.
[1] A.K. Soutar, R.P. Naoumova, L.M. Traub, Genetics, clinical phenotype, and [20] R.M. Sanchez-Hernandez, F. Civeira, M. Stef, S. Perez-Calahorra, F. Almagro, et
molecular cell biology of autosomal recessive hypercholesterolemia, Arte- al., Homozygous familial hypercholesterolemia in Spain: prevalence and
rioscler. Thromb. Vasc. Biol. 23 (11) (2003) 1963e1970, https://doi.org/ phenotype-genotype relationship, Circ. Cardiovasc Genet. 9 (6) (2016)
10.1161/01.ATV.0000094410.66558.9A. 504e510, https://doi.org/10.1161/CIRCGENETICS.116.001545.
[2] J.R. Priest, J.W. Knowles, Standards of evidence and mechanistic inference in [21] G. Zuliani, M. Arca, A. Signore, G. Bader, S. Fazio, et al., Characterization of a
autosomal recessive hypercholesterolemia, Arterioscler. Thromb. Vasc. Biol. new form of inherited hypercholesterolemia: familial recessive hypercholes-
36 (8) (2016) 1465e1466, https://doi.org/10.1161/ATVBAHA.116.307714. terolemia, Arterioscler. Thromb. Vasc. Biol. 19 (3) (1999) 802e809.
[3] C.K. Garcia, K. Wilund, M. Arca, G. Zuliani, R. Fellin, et al., Autosomal recessive [22] S. Lind, A.G. Olsson, M. Eriksson, M. Rudling, G. Eggertsen, et al., Autosomal
hypercholesterolemia caused by mutations in a putative LDL receptor adaptor recessive hypercholesterolaemia: normalization of plasma LDL cholesterol by
protein, Science 292 (5520) (2001) 1394e1398, https://doi.org/10.1126/ ezetimibe in combination with statin treatment, J. Intern Med. 256 (5) (2004)
science.1060458. 406e412, https://doi.org/10.1111/j.1365-2796.2004.01401.x.
[4] A.K. Khachadurian, S.M. Uthman, Experiences with the homozygous cases of [23] J. Rodenburg, A. Wiegman, M.N. Vissers, J.J. Kastelein, A.F. Stalenhoef, A boy
familial hypercholesterolemia. A report of 52 patients, Nutr. Metab. 15 (1) with autosomal recessive hypercholesterolaemia, Neth J. Med. 62 (3) (2004)
(1973) 132e140. 89e93.
[5] H. Tada, M.A. Kawashiri, A. Nohara, A. Inazu, J. Kobayashi, et al., Autosomal [24] F.J. Raal, G.K. Hovingh, D. Blom, R.D. Santos, M. Harada-Shiba, et al., Long-term
recessive hypercholesterolemia: a mild phenotype of familial hypercholes- treatment with evolocumab added to conventional drug therapy, with or
terolemia: insight from the kinetic study using stable isotope and animal without apheresis, in patients with homozygous familial hyper-
studies, J. Atheroscler. Thromb. 22 (1) (2015) 1e9, https://doi.org/10.5551/ cholesterolaemia: an interim subset analysis of the open-label TAUSSIG study,
jat.27227. Lancet Diabetes Endocrinol. 5 (4) (2017) 280e290, https://doi.org/10.1016/
[6] L. Pisciotta, C. Priore Oliva, G.M. Pes, L. Di Scala, A. Bellocchio, et al., Autosomal S2213-8587(17)30044-X.
recessive hypercholesterolemia (ARH) and homozygous familial hypercho- [25] E.F. Fahy, E. McCarthy, E. Steinhagen-Thiessen, C.J. Vaughan, A case of auto-
lesterolemia (FH): a phenotypic comparison, Atherosclerosis 188 (2) (2006) somal recessive hypercholesterolemia responsive to proprotein convertase
398e405, https://doi.org/10.1016/j.atherosclerosis.2005.11.016. subtilisin/kexin 9 inhibition, J. Clin. Lipidol. 11 (1) (2017) 287e288, https://
[7] C. Maglio, R.M. Mancina, B.M. Motta, M. Stef, C. Pirazzi, et al., Genetic diagnosis doi.org/10.1016/j.jacl.2016.10.002.
of familial hypercholesterolaemia by targeted next-generation sequencing, [26] L. D'Erasmo, A.B. Cefalu, D. Noto, A. Giammanco, M. Averna, et al., Efficacy of
J. Intern Med. 276 (4) (2014) 396e403, https://doi.org/10.1111/joim.12263. lomitapide in the treatment of familial homozygous hypercholesterolemia:
[8] J. Bendl, M. Musil, J. Stourac, J. Zendulka, J. Damborsky, et al., PredictSNP2: a results of a real-world clinical experience in Italy, Adv. Ther. 34 (5) (2017)
unified platform for accurately evaluating SNP effects by exploiting the 1200e1210, https://doi.org/10.1007/s12325-017-0531-x.
different characteristics of variants in distinct genomic regions, PLoS Comput.
Journal of Clinical Lipidology (2019) -, -–-
Original Research
The island of Gran Canaria: A genetic isolate for

familial hypercholesterolemia
Rosa M. S!anchez-Hern!andez, MD, PhD(c), Antonio Tugores, PhD,
!voa, MD, PhD, Yeray Brito-Casillas, DMV,
Francisco J. No
Ana B. Expo!sito-Montesdeoca, MLT, Paloma Garay, MLT, Ana M. Bea, MLT,
~o, DPharm, Miguel Pocovi, PhD, Fernando Civeira, MD, PhD,
Marta Rian
Ana M. W€agner, MD, PhD*, Mauro Boronat, MD, PhD**
Secci!
on de Endocrinolog!ıa y Nutrici!
on, Complejo Hospitalario Universitario Insular Materno–Infantil de Gran Canaria,
Las Palmas de Gran Canaria, Spain (Drs S! anchez-Hern!andez, N!ovoa, Chapman, W€agner, and Boronat); Instituto
Universitario de Investigaciones Biom!edicas y Sanitarias (IUIBS), Universidad de Las Palmas de Gran Canaria, Las
Palmas de Gran Canaria, Spain (Drs S! anchez-Hern!andez, Tugores, N!ovoa, Brito-Casillas, Exp!osito-Montesdeoca, Garay,
W€agner, and Boronat); Unidad de Investigaci!on, Complejo Hospitalario Universitario Insular Materno–Infantil de Gran
Canaria, Las Palmas de Gran Canaria, Spain (Drs Tugores, and Garay); Hospital Universitario Miguel Servet, IIS
Arag!on, CIBERCV, Universidad de Zaragoza, Zaragoza, Spain (Drs Bea, and Civeira); Servicio de Bioqu!ımica, Complejo
Hospitalario Universitario Insular Materno–Infantil de Gran Canaria, Las Palmas de Gran Canaria, Spain (Dr Ria~ no);
and Departamento de Bioqu!ımica y Biolog!ıa Molecular y Celular, Facultad de Ciencias, Universidad de Zaragoza & IIS
Arag!on, Zaragoza, Spain (Dr Pocovi)
KEYWORDS: BACKGROUND: Genetic diagnosis of familial hypercholesterolemia (FH) has not been universally
Founder effect; performed in the Canary Islands (Spain).
Genetic isolation; OBJECTIVES: This study aimed to genetically characterize a cohort of patients with FH in the island
Familial of Gran Canaria.
hypercholesterolemia; METHODS: Study subjects were 70 unrelated index cases attending a tertiary hospital in Gran Cana-
Canary Islands ria, with a clinical diagnosis of FH, according to the criteria of the Dutch Lipid Clinic Network. Given
that 7 of the first 10 cases with positive genetic study were carriers of a single mutation in the LDLR
Conflict of interest: Fernando Civeira reports honoraria for consultancies and lectures from Amgen, Sanofi, Pfizer, and MSD. The other authors declare
that they have no conflicts of interest.
Contributor statement: RMS-H recruited the patients, collected data, and wrote the manuscript draft. AT designed the genetic investigations and contrib-
uted to the conception and execution of the project. YB-C, AE-M, PG, and MR performed the laboratory work. FJN recruited patients and collected clinical
data. AMB, MP, and FC contributed to the conception of the work and its intellectual content. AMW and MB conceived and planned the study, interpreted the
results, and reviewed the definitive manuscript. All the authors have read and accept the final version of the manuscript.
Funding sources: This work was supported by grants from the Spanish Atherosclerosis Society, Spain (Cl!ınico-Epidemiol!ogica 2015) and Colegio Oficial
de M!edicos de Las Palmas (Gonz!alez-Jaraba 2015). This work was also supported by a Sanofi-Aventis institutional grant to support genetic analysis in our
hospital and CIBERCV.
* Corresponding author. Secci!on de Endocrinolog!ıa y Nutrici!on, Complejo Hospitalario Universitario Insular Materno-Infantil de Gran Canaria, Avda.
Mar!ıtima del Sur, s/n 35016, Las Palmas de Gran Canaria, Spain.
** Corresponding author. Secci!on de Endocrinolog!ıa y Nutrici!on, Complejo Hospitalario Universitario Insular Materno-Infantil de Gran Canaria, Avda.
Mar!ıtima del Sur, s/n 35016, Las Palmas de Gran Canaria, Spain.
E-mail addresses: ana.wagner@ulpgc.es; mborcor@yahoo.es
Submitted December 6, 2018. Accepted for publication April 30, 2019.
1933-2874/! 2019 National Lipid Association. All rights reserved.

https://doi.org/10.1016/j.jacl.2019.04.099
2 Journal of Clinical Lipidology, Vol -, No -, - 2019
gene [p.(Tyr400_Phe402del)], a specific polymerase chain reaction-based assay was developed for the
detection of this variant as a first screening step on the remaining subjects. In those without this mu-
tation, molecular diagnosis was completed using a next-generation sequencing panel including LDLR,
APOB, PCSK9, LDLRAP1, APOE, STAP1, and LIPA genes and incorporating copy number variation
detection in LDLR.
RESULTS: On the whole, 44 subjects (62%) had a positive genetic study, of whom 30 (68%) were
heterozygous carriers of the p.(Tyr400_Phe402del) variant. Eleven subjects carried other mutations in
LDLR, including the novel mutation NM_000527.4: c.877dupG; NP_000518.1: p.(Asp293Glyfs*8).
An unclassified PCSK9 gene variant was found in one subject [(NM_174936.3:c.1496G.A;
NP_777596.2: p.(Arg499His)]. Other single patients had mutations in APOB (heterozygous) and in
LIPA (homozygous). All identified variants co-segregated with the disease phenotype.
CONCLUSIONS: These findings suggest a founder effect for the p.(Tyr400_Phe402del) LDLR mu-
tation in Gran Canaria. A cost-effective local screening strategy for genetic diagnosis of FH could
be implemented in this region.
! 2019 National Lipid Association. All rights reserved.
Introduction 100 miles off the West African coast. With over 845,000 in-
habitants, Gran Canaria is the most populous island in the ar-
Familial hypercholesterolemia (FH, OMIM 144400) is chipelago. Although the Canary Islands have the highest
the most common monogenic disorder. It is transmitted in an prevalence of hypercholesterolemia in Spain,14 they have
autosomal dominant pattern with a penetrance above 90%. not been subject of any specific epidemiological study on FH.
Phenotypically, it is characterized by very high serum low- In this study, we assessed the genetic determinants
density lipoprotein cholesterol (LDL-C), premature athero- underlying FH in a population of Gran Canaria and found
sclerotic cardiovascular disease (ASCVD), and cholesterol a highly prevalent mutation in the LDLR gene.
deposits in the skin, tendons, and cornea, in the form of
xanthelasmas, xanthomas, and corneal arcus, respectively.1
FH is produced by mutations in different genes that Methods
regulate cholesterol metabolism.2 The LDL receptor gene
(LDLR), with more than 1700 known pathogenic mutations, Subjects
accounts for 80% of the cases of FH. The remaining are
caused by mutations in APOB (the gene encoding apolipo- The study population included all index cases of families
protein B100) and PCSK9 (subtilisin-convertase propro- attending the Lipids Unit of the Complejo Hospitalario
tein/kexin type 9) and, exceptionally, mutations in APOE Universitario Insular Materno-Infantil (CHUIMI) with a
(apolipoprotein E), STAP1 (signal transducing adaptor fam- clinical diagnosis of definite FH, according to the criteria of
ily member 1), and LDLRAP1 (low-density lipoprotein re- the Dutch Lipid Clinic Network (scores $ 8 points),15 un-
ceptor adaptor protein 1) genes, the latter producing a treated LDL-C concentrations .220 mg/dL, and with both
recessive form of the disease. The 20 to 40% of cases, parents born in Gran Canaria. Patients with the following
where no responsible mutation is detected, are believed to causes of secondary hypercholesterolemia were excluded: hy-
be severe forms of polygenic hypercholesterolemia.3 pothyroidism (serum thyroid stimulating hormone $6 mU/l),
Approximately 34 million people in the world suffer cholestasis (direct bilirubin $1.0 mg/dL), nephrotic syndrome
from FH, although it is likely to be underdiagnosed and (proteinuria $3.5 g/d), advanced chronic kidney disease (esti-
undertreated.4 The heterozygous form of FH (HeFH) is the mated glomerular filtration rate ,30 mL/min/1.73 m2), or cur-
most common, with a prevalence of 1:200 to 250 people,5 rent use of drugs with significant effects on lipid metabolism
whereas the more severe, homozygous form (HoFH), oc- (glucocorticoids, retinoids, cyclosporine, antiretrovirals).
curs with a frequency of 1:300,000 to 450,000.6 In some Previously, since September 2015, a screening campaign
genetically isolated populations, owing to the transmission was carried out in the primary care centers covering the
of one or more mutations with a founder effect, the preva- influence area of the CHUIMI, to identify patients with
lence is higher. So far, this phenomenon has been reported undiagnosed FH. Subjects with LDL-C .220 mg/dL and
in Lebanese,7 French Canadians,8 Afrikaners,9 Finns,10 and one or more of the following criteria were to be referred to
Ashkenazi Jews.11 the Lipids Unit: (1) personal or family history of premature
In Spain, there is wide genetic heterogeneity in FH, and coronary heart disease (CHD) (,55 years in men and
most of the reported LDLR gene mutations have also been ,60 years in women) and (2) first-degree relatives older
observed in other countries. There are no known areas with than 18 years with total cholesterol .310 mg/dL and/or
genetic isolation, and the highest regional prevalence of a sin- LDL-C .190 mg/dL or younger than 18 years with total
gle LDLR mutation does not exceed 7%.12,13 The Canary cholesterol .230 mg/dL and/or LDL-C .160 mg/dL.
Islands (Spain) are located in the Atlantic Ocean, about Patients were also referred if they had an LDL-C
S!anchez-Hern!andez et al Gran Canaria: A genetic isolate for FH 3
.100 mg/dL despite high-dose treatment with potent LDLR, APOB, PCSK9, LDLRAP1, APOE, STAP1, and
statins (atorvastatin 40-80 mg or rosuvastatin 20–40 mg). LIPA genes. Multiplex ligation primer amplification was
The study followed the ethical standards of the 1975 also performed to detect large-scale copy number variations
Declaration of Helsinki and was approved by the local in LDLR.19 Sequencing included LIPA (encoding lysosomal
ethics committee. All patients were informed of the study acid lipase) because some LIPA mutations, known to be
procedure and signed an informed consent form. linked to Wolman disease and cholesterol ester storage dis-
ease, have also been found in subjects with a clinical
Study protocol phenotype overlapping HeFH.20
The potential pathogenicity of all genetic variants was
Clinical and demographic information was recorded for evaluated with in silico prediction tools (PolyPhen2, SIFT,
each participant, including age, sex, birth municipalities of and Mutation Taster)21-23 and classified, according to the
the patients and their parents, previous diagnosis of hyper- Association for Clinical Genetic Science, into five cate-
tension and diabetes, smoking, age at diagnosis of FH, gories: (1) clearly not pathogenic; (2) unlikely to be patho-
history of ASCVD as well as age at diagnosis and clinical genic; (3) unknown significance; (4) likely to be
form of presentation, and family history of hypercholester- pathogenic; and (5) clearly pathogenic.24 Potentially patho-
olemia and ASCVD in first-degree relatives. Serum con- genic variants found in probands were ascertained in family
centrations of total cholesterol, high-density lipoprotein studies to verify co-segregation with hypercholesterolemia.
cholesterol (HDL-C), LDL-C, and triglycerides, measured
without any lipid-lowering medication, were also collected. Statistical analyses
Physical examination included measurement of weight,
height, waist circumference and blood pressure, and Results were summarized as means 6 SD or medians
assessment of the presence of corneal arcus, xanthelasmas, (interquartile range) for continuous variables and frequencies
and tendon xanthomas. (%) for categorical variables. Percentages were compared
using the chi-square test (c2), means with Student’s t-test, and
Genetic analysis medians by Wilcoxon’s test for independent data. Statistical
significance was established at a two-tailed P value , .05.
Genomic DNA was isolated from blood samples collected Data were analyzed using the statistical package SPSS,
in EDTA-containing tubes, using a salt precipitation proto- version 20.0 (IBM Corporation, Armonk, NY).
col.16 The first 10 probands were genotyped using next-
generation sequencing (NGS) of the LDLR, PCSK9, and
LDLRAP1 promoter, exons, and intron-exon boundaries Results
and the LDLR-binding domain of APOB17 in Progenika Bio-
pharma SA (Derio, Vizcaya, Spain). Given its prevalence in In total, 70 unrelated probands (50 women and 20 men;
these subjects, the p.(Tyr400_Phe402del) mutation was set mean age 52.2 6 14.4 years) met the inclusion criteria
for detection as a first screening test on all remaining (Table 1). An initial approach involved the selection of 10
subjects, before any further investigation. As the wild-type unrelated index cases, chosen from different geographic or-
allele for this variant is 9 bp larger than the mutant allele, igins within the island of Gran Canaria, who underwent
the assay was based on this difference. The Primer BLAST NGS screening as described in the Methods section. Seven
application18 was used to design specific oligonucleotide of them were carriers of same p.(Tyr400_Phe402del) in
primers: LDLR_e9_1F (50 -AGGCACTCTTGGTTCCATC frame deletion (SNP Id: rs879254826), already described
G-30 ), labeled with 6-carboxyfluorescein (FAM) and in a previous Spanish study involving patients from Gran
LDLR_e9_1R (GAGGAGAGAAGGGCATCAGC). Ampli- Canaria.25 This predominant mutation was then screened
fication was performed with 35 cycles (95! C, 1 min; 55! C, in the rest of the index cases, revealing that a total of 30
1 min; 72! C, 1 min) on 50 ng genomic DNA, with Taq po- (43%) were heterozygous carriers of this deletion. Among
lymerase, following the manufacturer’s instructions (Prom- the subjects who did not have p.(Tyr400_Phe402del) muta-
ega Biotech, Madison, WI, EEUU). Polymerase chain tion, 11 carried one of six other variants in LDLR (see
reaction products were denatured by adding one volume of Table 2). One of them [c.877dupG; p.(Asp293Glyfs*8)],
deionized formamide, heated at 95! C for five minutes and not described before, was detected in a 45-year-old man
run through 4% acrylamide:bis acrylamide (19:1), 50% with CHD since the age of 33 years and with untreated total
urea denaturing gels in 1xTBE (1xTBE 5 89 mM Tris and LDL-C concentrations of 346 and 258 mg/dL, respec-
borate, 2 mM EDTA, pH 8.2). After electrophoresis, 6- tively. The frameshift caused by this mutation generates a
FAM fluorescence was detected by using a FUJI FLA truncated polypeptide lacking the C-terminal end of
9000 Starion scanner (Fujifilm Corporation, Tokyo, Japan), LDLR in the ligand-binding domain and, therefore, may
following the manufacturer’s instructions. be considered as a null allele, classified as category 5
In subjects without p.(Tyr400_Phe402del) mutation, (clearly pathogenic). The other five variants, all of them
molecular diagnosis was completed at the Gendiag Labo- classified as categories 4 (likely to be pathogenic) or 5
ratory (Barcelona, Spain) using an NGS panel including were c.-135C.G, in the promoter region,25,26 also
affect splicing and result in complete deletion of exon 8.

Table 1 Clinical and biochemical characteristics of family
probands This was a 47-year-old woman with total cholesterol of
590 mg/dL, HDL-C of 31 mg/dL, LDL-C of 519 mg/dL,
Sex (% women) 71.4 and triglycerides of 200 mg/dL, subclinical atherosclerosis
Age (y) 52.2 6 14.4 detected by carotid ultrasound, and minimally increased
Smokers (%) liver enzymes, but no established ASCVD or hepatospleno-
Current 22.8
megaly. Three siblings were genotyped for the mutation,
Former 11.4
Nonsmokers 64.3 two of whom were carriers, but none was homozygous.
Age of FH diagnosis (y) 30.8 6 16.6 Finally, in two probands, one variant of uncertain
Family history of ASCVD (%) 61.4 clinical significance was identified in heterozygosis in
Age of familial ASCVD (y) 52.4 6 11.4 LDLRAP1. The variant (NM_015627.2:c.604_605TC.CA;
Personal history of ASCVD (%) 17.1 NP_056442.2:p.Ser202His), coincident with ClinVar: 4776,
Age of personal ASCVD (y) 47.8 6 11.5 but leading to a different missense substitution, was found
Type of ASCVD (%) in isolation in a 52-year-old woman with total cholesterol
Coronary heart disease 91.7 of 352 mg/dL and LDL-C of 243 mg/dL and a paternal his-
Stroke 8.3 tory of CHD at age 54. In the second case, the same muta-
Hypertension (%) 45.7 tion was associated with p.(Cys364Tyr) mutation in LDLR.
Diabetes (%) 24.3
To summarize, of 70 unrelated probands, 44 had a
Body mass index (kg/m2) 28.0 6 5.4
Systolic blood pressure (mmHg) 130 (90 to 190) positive genetic study (62%). Among these, 30 subjects
Diastolic blood pressure (mmHg) 80 (53 to 110) were heterozygous carriers of the p.(Tyr400_Phe402del)
Waist circumference (cm) 92.3 6 16.1 variant of LDLR, representing 43% of the selected probands
Tendon xanthomas (%) 34.3 and 68% of those with a positive genetic diagnosis. Eleven
Total cholesterol (mg/dL) 363 (291 to 634) subjects carried other mutations in LDLR, one in PCSK9,
HDL cholesterol (mg/dL) 57 6 15 one in APOB, and one was homozygous for a LIPA muta-
LDL cholesterol (mg/dL) 268 (221 to 575) tion. In addition, two of them had an LDLRAP variant in
Triglycerides (mg/dL) 142 (50 to 380) heterozygosis (one associated to an LDLR mutation).
Lipoprotein(a) (mg/dL) 48 (2 to 322) Family studies were performed on all subjects with LDLR
ASCVD, atherosclerotic cardiovascular disease; FH, familial hyper- mutations, except one with p.(Thr62Met) mutation, as well as
cholesterolemia; HDL, high-density lipoprotein; LDL, low-density on the subject carrying the p.(Arg499His) variant in PCSK9
lipoprotein.
(data not shown). A total of 83 relatives of the probands with
LDLR mutations were studied, and co-segregation of the mu-
tations with hypercholesterolemia was confirmed. A son of
identified in three probands; c.760C.T [p.(Gln254*)]27 in two heterozygous probands for p.(Tyr400_Phe402del) had
one subject; c.1091G.A [p.(Cys364Tyr)],19 identified in HoFH and has been reported before.31
three subjects; c.1609G.T [p.(Gly537*)]25 in two; and Table 3 shows the clinical and biochemical characteris-
c.185C.T [p.(Thr62Met)]28 in another one (Table 2). tics of all carriers of the p.(Tyr400_Phe402del) mutation,
Two of the patients with LDLR mutations, one heterozy- compared with those of individuals carrying other LDLR
gous for p.(Gln254*) and one for p.(Cys364Tyr), were mutations. There were no differences in concentrations of
found to be double heterozygotes as they also carried the total or LDL-C or in frequencies of xanthomas or ASCVD.
c.60_65dupGCTGCTGCT [p.(Leu22_Leu23dup)] variant However, carriers of the p.(Tyr400_Phe402del) mutation
in the PCSK9 gene (ClinVar: 265916).29 The first case had a higher frequency of diabetes (17.8% vs 0%,
was a 61-year-old woman with myocardial infarction at P 5 .021), in spite of similar age and other risk factors
age 43, total cholesterol of 395 mg/dL, and LDL-C of for diabetes, such as body mass index or waist circumfer-
337 mg/dL; the second was a 59-year-old male without ence. Nevertheless, they did have higher triglyceride and
ASCVD, with total cholesterol of 397 mg/dL and LDL-C lower HDL-C concentrations.
of 334.4 mg/dL. Both subjects had tendon xanthomas. In Figure 1 shows the pedigree of a large family affected by
addition to the described LDLR mutations, variants were the p.(Tyr400_Phe402del) mutation. LDL-C was very high
also found in other genes. These included one unclassified in all carriers, with expression of the disease from very early
variant in PCSK9 [NM_174936.3:c.1496G.A; ages, as demonstrated by the case of a girl with serum LDL-C
NP_777596.2: p.(Arg499His)] and another one in APOB values of 207 mg/dL at the age of one. Furthermore, several
[NM_000384.2:c.8882A.G; NP_000375.2: p.Asn2961Ser; of the family members had premature CHD (Table 4).
ClinVar: 477822], both of uncertain clinical significance.
All variants in LDLR and p.Asn2961Ser in APOB were pre-
dicted in silico to be deleterious. Discussion
One subject was homozygous for the rs116928232
variant in LIPA (NM_000235.3:c.894G.A; The most striking result in this study is the high
NP_000226.2:p.Gln298His, ClinVar: 203361),30 likely to prevalence of a single mutation in LDLR
Table 2 LDLR mutations found in patients from Gran Canaria
S!anchez-Hern!andez et al
Proband’s lipid levels (mg/dL) Mutation type

Number of families Region Functional consequence
Variant Number of affected subjects Domain ClinVar classification ClinVar ID
c.-135C.G Total-C 320.7 and LDL-C 266.9 Promoter Promoter variant 250956
Chr19:11089414 rs879254375 3 No or low transcript levels
6 Pathogenic/likely pathogenic
c.185C.T Total-C 330 and LDL-C 230.4 LDLR A1 Missense substitution 161273
p.(Thr62Met) 1 L1 domain pfam00057 Functional change
Chr19:11100340 rs376207800 1 Pathogenic
c.760C.T Total-C 389 and LDL-C 293.2 LDLR A6 Nonsense substitution 251436
p.Gln254Ter 1 L6 domain pfam00057 Truncated polypeptide lacking Ct end from
Chr19: 11106630 rs759109699 5 LDLR A6 domain
Pathogenic
c.877dupG Total-C 346 and LDL-C 258.4 LDLR A7 Frameshift Novel
p.Asp293Glyfs*8 1 L7 domain pfam00057 Truncated polypeptide lacking Ct end from
Gran Canaria: A genetic isolate for FH
Chr19:11107451 2 LDLR A7 domain

c.1091G.A Total-C 391 and LDL-C 304.7 EGF_CA Missense substitution 369852
p.Cys364Tyr 3 Calcium-binding EGF-like domain Disulfide bridge between Cys364 and Cys377
Chr19: 11111544 rs879254788 7 smart00179 is disrupted: Calcium binding compromised
Likely pathogenic
c.1199_1207delACCTCTTCT Total-C 377 LDLR B1 In frame deletion 251727
p.Tyr400_Phe402del LDL-C 292.2 W1/YWTD domain smart00135 First residues of first LDLRB/YWTD motif are
Chr19:11113290-11113298 rs879254826 30 deleted
97 Uncertain significance
c.1609G.T Total-C 367.5 and LDL-C 285.4 LDL B4 Nonsense substitution; Truncated polypeptide 251933
p.Gly537Ter 2 W14/YWTD domain smart00135 lacking Ct end from LDLR B4 domain
Chr19: 11116116 rs879254958 6 Pathogenic
HDL, high-density lipoprotein; LDL, low-density lipoprotein; Total-C, total cholesterol; LDL-C, LDL-cholesterol.
Reference mRNA is NM_000527.4; reference genome is Assembly GRCh38; and reference peptide is NP_000518.1. ClinVar classification is available at https://www.ncbi.nlm.nih.gov/clinvar/.
5
Table 3 Clinical and biochemical characteristics of LDLR mutation carriers: index cases and their affected relatives
Characteristics p.(Tyr400_Phe402del) Other LDLR mutations P
Number of cases 97 27
Sex (% women) 56 69.2 .223
Age (y) 44.3 6 17.9 46.1 6 17.3 .662
Hypertension (%) 36.7 23.1 .196
Diabetes (%) 17.8 0 .021
ASCVD 23.1 11.5 .99
Age of ASCVD (y) 45.8 6 10.4 45.3 6 13.7 .945
BMI (kg/m2) 27.3 6 5.1 27.2 6 7.1 .906
Waist (cm) 88 (57–121) 82 (62–130) .559
Tendon xanthomas (%) 31.6 34.6 .334
Total cholesterol (mg/dL) 351 (213–634) 345 (239–465) .489
HDL-cholesterol (mg/dL) 52 6 15 60 6 15 .015
LDL-cholesterol (mg/dL) 274 (143–575) 262 (165–385) .446
Triglycerides (mg/dL) 119 (40–343) 86 (47–380) .009
Lipoprotein(a) (mg/dL) 40 (2–300) 30 (2–322) .287
ASCVD, atherosclerotic cardiovascular disease; BMI, body mass index; HDL, high-density lipoprotein; LDL, low-density lipoprotein.
[p.(Tyr400_Phe402del)], which is responsible for 43% of arrived to the islands mostly during the 15th and 16th cen-
clinical FH and 68% of those with a positive genetic diag- turies.34 Therefore, it is reasonable to believe that some
nosis. In most regions worldwide, FH displays broad ge- inheritable disorders have spread within the islands through
netic heterogeneity,32 and Spain is no exception: no the transmission of certain mutations with a founder effect.
predominant LDLR mutation had been reported before This has been shown to be the case for specific mutations
and most of those described were present in several re- causing rare, recessive disorders, such as Wilson’s disease35
gions.12,13,25 Indeed, in a study of 2246 unrelated patients and type 2 tyrosinemia.36
with FH, the most prevalent variants in Spain added up to Indeed, the prevalence of p.(Tyr400_Phe402del) muta-
30.6% and the most common mutation tion is very high in this population, but not as high as that
(c.31311G.C1c.274C.G; NA1p.Gln71Glu) repre- described for other founding mutations in other genetically
sented only 6.5%.13 isolated regions, where the founding group could have been
To put our findings in perspective, in a previous study smaller, or endogamy more pronounced. This is the case for
performed in Mallorca, the largest Balearic Island, whose Lebanon, where p.(Cys681X) mutation represents 81.5% of
population size is similar to that in Gran Canaria, the the cases of FH7 or for Ashkenazi Jews, where the Lithua-
authors found 24 different, nonrecurring FH mutations.33 In nian mutation (G197del) is the cause of 80% of FH.11 Other
contrast to the Balearic Islands, the Canaries have remained genetically isolated regions include the French Canadian
poorly communicated until the middle of the last century. community, who have an FH prevalence of 1:154 and three
Although several investigations have pointed out that the founding mutations accounting for 80% of the cases,8
Canarian people hold genetic traits from the aboriginal is- Finland, where five mutations account for a bit more than
landers, their genetic origin is mainly Caucasian, contrib- 75% of FH,10 and Afrikaners, in whom 90% of cases are
uted by descendants of the Spanish conquerors who caused by one of the three mutations.9 In genetically
Figure 1 Family pedigree with p.(Tyr400_Phe402del) mutation in LDLR gene. Blackened symbols indicate carriers of the p.(Tyr400_-
Phe402del) and affected members (.95th percentile adjusted for sex and age). White symbols indicate nonaffected members. The crossed
line indicates deceased patients. Lipid values and presence of atherosclerotic cardiovascular disease are shown in Table 4.
Table 4 Lipid values and atherosclerotic cardiovascular disease in a family pedigree with p.(Tyr400_Phe402del) mutation in the LDLR
gene
Subject Age (y) Total-C (mg/dL) HDL-C (mg/dL) LDL-C (mg/dL) Triglycerides (mg/dL) ASCVD
1003 70 369 45 286 192 CHD (46 y)
1004 68 312 22 331 262 CHD (68 y)
1005 SD (28 y)
1011 65 215 54 134 136
1012 52 202 58 125 93
1006 64 371 55 283 165
1007 61 364 42 282 200 CHD (33 y)
1008 59 362 54 282 131
1009 SD (30 y)
1010 SD (32 y)
1031 46 405 22 331 262 CHD (41 y)
1032 40 299 45 239.2 74
1033 50 214 66 133 75
1034 48 166 46 102 91
1051 37 228 87 130 55
1061 31 298 33 243.4 108
1062 39 188 70 103 74
1081 39 146 39 98 46
1082 37 207 46 138 114
1091 26 299 42 231 133
1311 24 349 20 289 200
1321 19 298 55 222 105
1322 15 305 54 233.4 88
1611 1 275 46.2 206.8 110
ASCVD, atherosclerotic cardiovascular disease; CHD, coronary heart disease (age at diagnosis); HDL-C, high-density lipoprotein cholesterol; LDL-C,
low-density lipoprotein cholesterol; SD, sudden death (age at diagnosis); Total-C, total cholesterol.
isolated regions, the prevalence of FH and the percentage of leads to a typical FH phenotype, characterized by severe
cases with homozygous forms of the disease are especially hypercholesterolemia and increased cardiovascular risk.
high. Nevertheless, in our population, the prevalence of In fact, the patient who is homozygous for this mutation
HoFH is similar to that usually reported for FH.6 had LDL-C concentrations above 900 mg/dL and very
The frequency of the p.(Tyr400_Phe402del) mutation is poor response to lipid-lowering treatments,31 very similar
not reported in dbSNP, Ensembl, ExAc, gnomAD, or to what would be expected of a null allele. Therefore, we
Exome Variant Server databases. The finding of such a propose that this variant, currently still classified as of un-
large cohort of probands carrying this variant, which co- known significance (ClinVar: 251727), is pathogenic.
segregated with the FH phenotype, provides an excellent An unexpected finding in this study was the high
framework to approach the issue of the functional signif- prevalence of diabetes (17.8%) in the carriers of
icance of this variant. This in-frame deletion removes a p.(Tyr400_Phe402del) mutation, above what has been
tyrosine residue from a highly conserved motif in the first previously described in the background population of the
YWTD domain (smart00135) of the LDLR polypeptide, island.40 None of the carriers of any other LDLR mutations
which, in turn, is part of a group of six repeats forming the had diabetes, which, acknowledging small sample size, is in
beta propeller, a functional domain also present in other agreement with recent studies suggesting that FH could
receptors, kinases, and extracellular matrix components.37 protect against the disease.41,42 Therefore, the association
Functional analyses have revealed that this domain is of p.(Tyr400_Phe402del) mutation with diabetes is espe-
required for the acid-dependent ligand dissociation at the cially surprising and prompts us to perform confirmatory
endosome and the recycling of the receptor back to the studies and accurately assess if there is co-segregation of
cell surface.38 Interestingly, this deletion is also close to diabetes with the mutation.
the region interacting with PCSK9,39 where structural A second mutation worth noticing is the pCys364Tyr
changes could be expected to occur after the three missense substitution, which is the second most prevalent
amino-acid deletion. In any case, the expected functional LDLR mutation, affecting seven members of three appar-
consequence would be reduced availability of the recycled ently unrelated families. This mutation affects a highly
receptor at the cell surface, compromising the rate of LDL conserved cysteine residue in all EGF-CA domains
uptake. Indeed, our findings demonstrate that this mutation (smart00179), which is essential for the formation of three
critical disulphide bonds within this domain. In fact, analo- the study includes a broad number of families and is the
gous variations in other EGF-CA domains are also the first epidemiological study on FH performed in the Canary
cause of dominant mutations,43 reinforcing the view that Islands.
this variant is pathogenic.
It is interesting to note that two subjects presenting
particularly severe phenotypes were double combined
Conclusions
heterozygotes for LDLR mutations [one heterozygous for The p.(Tyr400_Phe402del) mutation in the LDLR gene
p.(Gln254*) and one for p.(Cys364Tyr)] in conjunction represents 68% of the genetic diagnoses of FH in the stud-
with the c.60_65dupGCTGCTGCT [p.(Leu22_Leu23dup)] ied population and is responsible for almost half of the clin-
variant in the PCSK9 gene (ClinVar: 265916: 42). Although ical cases of the disease. The island of Gran Canaria seems
this PCSK9 mutation is classified as of uncertain clinical to be a genetically isolated region for FH and is the perfect
significance, a recent report showed that it leads to a setting for a population-based diagnostic strategy for FH.
reduced LDLR expression at the plasma membrane and
to a 20% reduction in LDL uptake.44
Regarding other genes, among the subjects with clinical References
FH, a case of lysosomal acid lipase deficiency, an 1. Goldstein JL, Schrott HG, Hazzard WR, Bierman EL, Motulsky AG.
autosomal recessive disease, leading to cholesterol ester Hyperlipidemia in coronary heart disease. II. Genetic analysis of lipid
levels in 176 families and delineation of a new inherited disorder,
deposits in adults, was found. The mutation identified in combined hyperlipidemia. J Clin Invest. 1973;52:1544–1568.
this patient [p.(Ser202His)] is the most frequent one in 2. Bruikman CS, Hovingh GK, Kastelein JJP. Molecular basis of familial
LIPA45 and has been detected in other subjects with an FH hypercholesterolemia. Curr Opin Cardiol. 2017;32:262–267.
phenotype in the absence of mutations in other causative 3. Castro-Oros I, Pocovi M, Civeira F. The genetic basis of familial hy-
genes,46 which highlights the relevance of assessing LIPA percholesterolemia: inheritance, linkage, and mutations. Appl Clin
Genet. 2010;3:53–64.
in this context.20 4. Nordestgaard BG, Chapman MJ, Humphries SE, et al. Familial hyper-
In addition, an LDLRAP1 variant of uncertain clinical cholesterolaemia is underdiagnosed and undertreated in the general
significance was identified in heterozygosis. Homozygous population: guidance for clinicians to prevent coronary heart disease:
forms of LDLRAP1 mutations are the cause of a recessive consensus statement of the European atherosclerosis Society. Eur
form of FH. According to a recent Spanish study, 0.5% Heart J. 2013;34:3478–3490.
5. Akioyamen LE, Genest J, Shan SD, et al. Estimating the prevalence of
of subjects with a clinical diagnosis of FH who are geno- heterozygous familial hypercholesterolaemia: a systematic review and
typed for LDLRAP1 are heterozygous carriers of patho- meta-analysis. BMJ Open. 2017;7:e016461.
genic or probably pathogenic variants.47 These mutations 6. S!anchez-Hern!andez RM, Civeira F, Stef M, et al. Homozygous famil-
could play a role in polygenic forms of hypercholesterole- ial hypercholesterolemia in Spain: prevalence and phenotype-
mia. It seems rather improbable that these variants are the genotype relationship. Circ Cardiovasc Genet. 2016;9:504–510.
7. Abifadel M, Rab#es JP, Jambart S, et al. The molecular basis of familial
only cause of the FH phenotype in the carrier identified hypercholesterolemia in Lebanon: spectrum of LDLR mutations and
in our cohort. role of PCSK9 as a modifier gene. Hum Mutat. 2009;30:E682–E691.
This study highlights that it is possible to implement a 8. Couture P, Morissette J, Gaudet D, et al. Fine mapping of low-density lipo-
cost-effective strategy in the genetic diagnosis of FH in protein receptor gene by genetic linkage on chromosome 19p13.1-p13.3 and
Gran Canaria, prioritizing the identification of the most study of the founder effect of four French Canadian low-density lipoprotein
receptor gene mutations. Atherosclerosis. 1999;143:145–151.
prevalent mutation in all cases with a clinical suspicion of 9. Kotze MJ, Langenhoven E, Warnich L, du Plessis L, Retief AE. The
the disease. Furthermore, affected subjects could receive molecular basis and diagnosis of familial hypercholesterolaemia in
adequate genetic counseling, to avoid new cases of HoFH. South African Afrikaners. Ann Hum Genet. 1991;55:115–121.
We acknowledge that this study has some limitations, 10. Lahtinen AM, Havulinna AS, Jula A, Salomaa V, Kontula K. Preva-
the main one being the small size of the studied population, lence and clinical correlates of familial hypercholesterolemia founder
mutations in the general population. Atherosclerosis. 2015;238:64–69.
and the fact that it represents the reference area of the 11. Meiner V, Landsberger D, Berkman N, et al. A common Lithuanian
CHUIMI (Southern and Eastern parts of the island) but mutation causing familial hypercholesterolemia in Ashkenazi Jews.
might not be representative of the rest of Gran Canaria. Am J Hum Genet. 1991;49:443–449.
Furthermore, we restricted genetic studies to subjects with 12. Palacios L, Grandoso L, Cuevas N, et al. Molecular characterization of fa-
LDL-C . 220 mg/dL and Dutch Lipid Clinic Network milial hypercholesterolemia in Spain. Atherosclerosis. 2012;221:137–142.
13. Bourbon M, Alves AC, Alonso R, et al. Mutational analysis and
score $ 8, so FH cases with lower scores could have been genotype-phenotype relation in familial hypercholesterolemia: The
excluded. This LDL-C cutoff point has shown a high SAFEHEART registry. Atherosclerosis. 2017;262:8–13.
specificity for positive genetic testing in Spanish popula- 14. Mill!an N!un~ez-Cort!es J, Alegr!ıa E, Alvarez-Sala Walther L, et al. Doc-
tion.48 However, it would be important to determine the umento abordaje de la dislipemia. Sociedad Espa~nola de Arterioscle-
prevalence of p.(Tyr400_Phe402del) mutation in the entire rosis (parte III). Clin Investig Arterioscler. 2012;24:102–107.
15. Defesche JC, Lansberg PJ, Umans-Eckenhausen MA, Kastelein JJ.
population with probable FH. Finally, we did not perform Advanced method for the identification of patients with inherited hy-
the NGS and multiplex ligation primer amplification anal- percholesterolemia. Semin Vasc Med. 2004;4:59–65.
ysis in carriers of p.(Tyr400_Phe402del) mutation, so we 16. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for
cannot rule out additional variants in other candidate genes, extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;
especially among people with severe phenotypes. However, 16:1215.
17. Maglio C, Mancina RM, Motta BM, et al. Genetic diagnosis of famil- polymorphisms and the peopling of Canary Islands. Ann Hum Genet.
ial hypercholesterolaemia by targeted next generation sequencing. J 2004;68(Pt 6):600–605.
Intern Med. 2014;276:396–403. 35. Garc!ıa-Villarreal L, Daniels S, Shaw SH, et al. High prevalence of the
18. Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T. very rare Wilson disease gene mutation Leu708Pro in the island of
Primer-BLAST: A tool to design target-specific primers for polymer- Gran Canaria (Canary Islands, Spain): a genetic and clinical study.
ase chain reaction. BMC Bioinformatics. 2012;13:134. Hepatology. 2000;32:1329–1336.
19. Wang J, Dron JS, Ban MR, et al. Polygenic versus monogenic causes 36. Pe~na-Quintana L, Scherer G, Curbelo-Est!evez ML, et al. Tyrosinemia
of hypercholesterolemia ascertained clinically. Arterioscler Thromb type II: Mutation update, 11 novel mutations and description of 5 in-
Vasc Biol. 2016;36:2439–2445. dependent subjects with a novel founder mutation. Clin Genet. 2017;
20. Sjouke B, Defesche JC, de Randamie JSE, Wiegman A, Fouchier SW, 92:306–317.
Hovingh GK. Sequencing for LIPA mutations in patients with a clin- 37. Springer TA. An extracellular beta-propeller module predicted in lipo-
ical diagnosis of familial hypercholesterolemia. Atherosclerosis. 2016; protein and scavenger receptors, tyrosine kinases, epidermal growth
251:263–265. factor precursor, and extracellular matrix components. J Mol Biol.
21. Adzhubei IA, Schmidt S, Peshkin L, et al. A method and server for 1998;283:837–862.
predicting damaging missense mutations. Nat Methods. 2010;7: 38. Davis CG, Goldstein JL, S€udhof TC, Anderson RG, Russell DW,
248–249. Brown MS. Acid-dependent ligand dissociation and recycling of
22. Schwarz JM, R€ odelsperger C, Schuelke M, Seelow D. MutationTaster LDL receptor mediated by growth factor homology region. Nature.
evaluates disease-causing potential of sequence alterations. Nat 1987;326:760–765.
Methods. 2010;7:575–576. 39. Rudenko G, Henry L, Henderson K, et al. Structure of the LDL recep-
23. Ng PC, Henikoff S. Predicting the effects of amino acid substitutions tor extracellular domain at endosomal pH. Science. 2002;298:
on protein function. Annu Rev Genomics Hum Genet. 2006;7:61–80. 2353–2358.
24. Leigh S, Futema M, Whittall R, et al. The UCL low-density lipopro- 40. Boronat M, Varillas VF, Saavedra P, et al. Diabetes mellitus and
tein receptor gene variant database: pathogenicity update. J Med impaired glucose regulation in the Canary Islands (Spain): prevalence
Genet. 2017;54:217–223. and associated factors in the adult population of Telde, Gran Canaria.
25. Mozas P, Castillo S, Tejedor D, et al. Molecular characterization of fa- Diabet Med. 2006;23:148–155.
milial hypercholesterolemia in Spain: identification of 39 novel and 77 41. Besseling J, Kastelein JJP, Defesche JC, Hutten BA, Hovingh GK. As-
recurrent mutations in LDLR. Hum Mutat. 2004;24:187. sociation between familial hypercholesterolemia and prevalence of
26. Hobbs HH, Brown MS, Goldstein JL. Molecular genetics of the LDL type 2 diabetes mellitus. JAMA. 2015;313:1029–1036.
receptor gene in familial hypercholesterolemia. Hum Mutat. 1992;1: 42. Climent E, P!erez-Calahorra S, Marco-Benedi V, et al. Effect of LDL
445–466. cholesterol, statins and presence of mutations on the prevalence of
27. Bertolini S, Pisciotta L, Rabacchi C, et al. Spectrum of mutations and type 2 diabetes in heterozygous familial hypercholesterolemia. Sci
phenotypic expression in patients with autosomal dominant hypercho- Rep. 2017;7:5596.
lesterolemia identified in Italy. Atherosclerosis. 2013;227:342–348. 43. Dietz HC, Saraiva JM, Pyeritz RE, Cutting GR, Francomano CA.
28. Fouchier SW, Kastelein JJ, Defesche JC. Update of the molecular ba- Clustering of fibrillin (FBN1) missense mutations in Marfan syndrome
sis of familial hypercholesterolemia in The Netherlands. Hum Mutat. patients at cysteine residues in EGF-like domains. Hum Mutat. 1992;1:
2005;26:550–556. 366–374.
29. Abifadel M, Bernier L, Dubuc G, et al. A PCSK9 variant and familial 44. Galicia Garc!ıa U, Benito Vicente A, Etxebarria A, et al. The leucine
combined hyperlipidaemia. J Med Genet. 2008;45:780–786. stretch length of PCSK9 signal peptide and its role in development
30. Klima H, Ullrich K, Aslanidis C, Fehringer P, Lackner KJ, Schmitz G. of autosomal dominant hypercholesterolaemia: unravelling the activ-
A splice junction mutation causes deletion of a 72-base exon from the ities of p.leu23del and p.leu22_leu23dup variants. Atherosclerosis.
mRNA for lysosomal acid lipase in a patient with cholesteryl ester 2017;263:e37.
storage disease. J Clin Invest. 1993;92:2713–2718. 45. Scott SA, Liu B, Nazarenko I, et al. Frequency of the cholesterol ester
31. Fern!andez-Fuertes LF, Tapia Mart!ın M, Nieves Pl!a I, N!ovoa Mogoll!on FJ, storage disease common LIPA E8SJM mutation (c.894G.A) in various
D!ıaz Cremades J. Low-density lipoprotein apheresis using double filtra- racial and ethnic groups. Hepatology. 2013;58:958–965.
tion plasmapheresis: 27-month use in a child with homozygous familial 46. Chora JR, Alves AC, Medeiros AM. Lysosomal acid lipase deficiency:
hypercholesterolemia. Ther Apher Dial. 2010;14:484–485. A hidden disease among cohorts of familial hypercholesterolemia? J
32. Sharifi M, Futema M, Nair D, Humphries SE. Genetic architecture of Clin Lipidol. 2017;11:477–484.
familial hypercholesterolaemia. Curr Cardiol Rep. 2017;19:44. 47. S!anchez-Hern!andez RM, Prieto-Matos P, Civeira F, et al. Autosomal
33. Martorell-Mateu EM, Puigserver-Colom M. Cl!ınica y gen!etica de la recessive hypercholesterolemia in Spain. Atherosclerosis. 2018;269:
hipercolesterolemia familiar en Mallorca. Medicina Balear. 2009;24: 1–5.
19–31. 48. Civeira F, Ros E, Jarauta E, et al. Comparison of genetic versus clin-
34. Maca-Meyer N, Villar J, P!erez-M!endez L, Cabrera de Le! on A, ical diagnosis in familial hypercholesterolemia. Am J Cardiol. 2008;
Flores C. A tale of aborigines, conquerors and slaves: alu insertion 102:1187–1193.
Title: A novel gain-of-function PCSK9 mutation in the C-terminal domain
Rosa Mª Sánchez-Hernández1*, Maria Donata Di Taranto2*, Asier Benito-Vicente3*, Kepa B.
Uribe3, Itziar Lamiquiz-Moneo4, Asier Larrea-Sebal3, F. Javier Nóvoa1, Mauro Boronat1, Ana M
Wägner1, Fernando Civeira4, César Martín3#, Giuliana Fortunato2#
1 Sección de Endocrinología y Nutrición, Complejo Hospitalario Universitario Insular Materno
Infantil de Gran Canaria, Instituto Universitario de Investigaciones Biomédicas y Sanitarias
(IUIBS) de la Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, Spain.
2 Dipartimento di Medicina Molecolare e Biotecnologie Mediche, Università degli Studi di
Napoli Federico II, Napoli and CEINGE S.C.a r.l. Biotecnologie Avanzate, Napoli, Italy.
3 Instituto Biofisika (UPV/EHU, CSIC) and Departamento de Bioquímica, Universidad del País
Vasco, Apdo. 644, 48080 Bilbao, Spain.
4 Hospital Universitario Miguel Servet. IIS Aragon. CIBERCV. Universidad de Zaragoza,
Zaragoza, Spain.
* Rosa Mª Sánchez-Hernández, Maria Donata Di Taranto and Asier Benito-Vicente contributed
equally to this work.

#
Corresponding authors:
Giuliana Fortunato and César Martín.
Email: fortunat@unina.it and cesar.martin@ehu.eus
Present address:
Instituto Biofisika (UPV/EHU, CSIC) and Departamento de Bioquímica, Universidad del País
Vasco, Apdo. 644, 48080 Bilbao, Spain Phone number: 94 601 8053
Running title: A novel gain-of-function PCSK9 mutation
Abbreviations:
Gain of function: GOF
LDL receptor: LDLR
1
Proprotein convertase subtilisin/kexin type 9: PCSK9
Multiplex Ligation-dependent Probe Amplification: MLPA
Loss of function: LOF
C-terminal domain: CTD
Human Genome Variation Society: HGVS
Leiden Open Variation Database: LOVD
Exome Aggregation Consortium: ExAC
Genome Aggregation Database: gnomAD
Exome Variant Server: EVS
Fluorescein isothiocyanate: FITC
Fluorescence-activated cell sorter: FACS
Glyceraldehyde 3-phosphate dehydrogenase: GAPDH
2
Abstract:
Familial hypercholesterolemia (FH) is a monogenic disease characterized by high levels of low-
density lipoprotein cholesterol and premature atherosclerotic cardiovascular disease. FH is
caused by loss of function mutations in genes encoding the LDL receptor (LDLR),
Apolipoprotein B (APOB) or gain of function (GOF) mutations in the Proprotein convertase
subtilisin/kexin type 9 (PCSK9) gene. In this study, we identified a novel GOF variant in
PCSK9, p.(Arg499His), located in the c-terminal domain, in two unrelated FH patients from
Spain and Italy. We studied familial segregation and performed in vitro functional
characterization of the variant. We determined PCSK9 expression, secretion and activity of the
variant in transfected HEK293 cells, extracellular activity of the recombinant p.(Arg499His)
PCSK9 variant in HEK 293 and HEPG2 cells, and PCSK9 affinity to the LDL receptor at
neutral and acidic pH. We studied the mechanism of action of the p.(Arg499His) PCSK9 variant
by co-transfection with a soluble construct of the LDL receptor. Our results show high LDL-C
concentrations and FH phenotype in p.(Arg499His) carriers and in vitro assays revealed reduced
LDL receptor expression at membrane surface with p.(Arg499His). In conclusion, we
demonstrated that p.(Arg499His) is a GOF mutation that causes FH through an intracellular
effect reducing LDLr availability.
Keywords: Dyslipemia, genetics, lipids, cholesterol, gene expression, familial
hypercholesterolemia, mutations, functional assay
3
Introduction:
Low-density lipoprotein cholesterol (LDL-C) is removed from circulation through the LDL
receptor (LDLr). When an LDL particle binds its receptor, the LDL-LDLr complex is
internalized and LDLr is mostly recycled to the surface or, less frequently, degraded in the
lysosomes (1). LDLr degradation is promoted by the proprotein convertase subtilisin-kexin type
9 (PCSK9) (2).
PCSK9 belongs to a family of 9 subtilisin-like serine proteases and one of its functions is to
increase LDLr degradation, in addition to the proteolytic maturation of different proteins like
hormones and cytokines (2). PCSK9 is a 692-amino acid glycoprotein, synthesized as a 72 kDa
soluble zymogen (proPCSK9), which contains a signal peptide, an N-terminal peptide and a
prodomain region, followed by a catalytic domain with the catalytic triad of serine proteases,
aspartate (D), histidine (H) and serine (S), and a cysteine/histidine-rich-C-terminal domain
(CTD). The proPCSK9 undergoes an autocatalytic process at the N-terminal domain, the
cleavage releases a 14 kDa peptide, but the prodomain remains attached to the mature protein,
inactivating the catalytic domain (3).
Genetic variation in PCSK9 has an enormous impact on LDL-C concentration in humans and
both gain of function (GOF) and loss of function (LOF) PCSK9 mutations have been described
(4) (5). While PCSK9 LOF mutations cause hypocholesterolemia, GOF mutations are a rare
cause of familial hypercholesterolemia (FH) (4), a monogenic disease characterized by very
high levels of LDL-C and premature atherosclerotic cardiovascular disease (ASCVD) (1). LOF
mutations in the LDLR gene encoding the LDLr, or in APOB, are the most frequent causes of
FH, with more than 1700 pathogenic variants reported (6). GOF mutations in the PCSK9 gene
are a minor cause of FH, representing less than 1% of cases, with approximately 30 variants
described so far (7). PCSK9 GOF mutations are causative of FH, because the enhancement in
PCSK9 function leads to increased LDLr degradation and reduced recycling to the cell surface.
As a consequence, there is a reduction in LDL uptake and an increase in plasmatic circulating
LDL-C concentrations (8).
4
PCSK9 GOF mutations are usually missense defects, located in any exon, except exon 3 (7).
Although variants that affect the catalytic domain and prodomain have been studied, the effects
of variants affecting the CTD are less known (9). Furthermore, conflicting data has been
published on how most GOF mutations can influence the biology of the LDLr, and the
information about effects of variants in the CTD would be very useful to fully elucidate the
pathophysiology of LDLr-PCSK9 interactions.
For new variants detected by genetic screening, it is important to assess their role in the disease.
For this purpose, bioinformatic tools are a good approximation (10-12), but the functional
characterization by in vitro studies has proved to be the best method to provide evidence of the
pathogenic role of the identified variants (13-15).
After identifying the novel p.(Arg499His) PCSK9 variant in two unrelated FH patients from
Spain and Italy, we characterize the GOF activity resulting in high LDL-C in mutation carriers,
through familial studies and in vitro assays.
Material and Methods
Patients
Case 1. Fifty-one year old female native of Gran Canaria Island (Spain) with known
hypercholesterolemia since the age of 36. Her untreated lipid levels were: total cholesterol 375
mg/dL (9.7 mmol/l), LDL-C 270 mg/dL (6.98 mmol/l), HDL-C 62 mg/dL (1.6 mmol/l),
triglycerides 217 mg/dL (2.45 mmol/l). She had 11 siblings, one deceased in an accident and 8
with hypercholesterolemia (Figure 1). Two brothers had suffered a myocardial infarction, at the
age of 54 and 64, respectively. Her father had died of myocardial infarction at the age of 60. On
physical examination, she had a body mass index (BMI) of 27.1 kg/m2, corneal arcus, achilles
tendon xanthomas and she scored 14 points according to the Dutch Lipid Clinic Network
diagnosis criteria for FH (16). Hence, a clinical diagnosis of definite heterozygous FH was
made.
Case 2. Nine year old female native from Naples with hypercholesterolemia with untreated total
cholesterol 240 mg/dL (6.2 mmol/l), LDL-C 167 mg/dL (4.32 mmol/l), HDL-C 60 mg/dL (1.6
5
mmol/l), triglyceride 64 mg/dL (0.72 mmol/l), family history of hypercholesterolemia and
premature cardiovascular disease, vertical transmission in the family of high LDL-C and a
clinical diagnosis of probable heterozygous FH.
Family study. A total of 20 family members of case 1 were studied, including their medical
personal history, current treatments, cardiovascular risk factors, physical exam for the presence
of xanthomata and corneal arcus, and fasting blood sampling for lipid profile and DNA
extraction. No family history was available for Case 2.
Case 1 and Case 2’s legal representatives and all family members signed written, informed
consent for FH genetic analysis according to a protocol previously approved by the
corresponding Ethical boards of our institutions. This work has been carried out in accordance
with the Declaration of Helsinki for experiments involving humans.
Genetic analysis
Genomic DNA was extracted from whole blood samples by using standard methods. Genetic
screening for the presence of FH causative mutations in LDLR, and APOB was carried out by
Lipochip® platform (Progenika Biopharma SA A Grifols Company, Derio, Vizcaya, Spain) for
case 1 and by PCR amplification of the promoter, exons and exon-intron junctions, followed by
direct sequencing, as previously described, for case 2 (17, 18). Since no mutations were
detected, Multiplex Ligation-dependent Probe Amplification (MLPA) was performed as
previously reported (18) to search for large rearrangements in the LDLR gene. Molecular
analysis of PCSK9 included the amplification and direct sequencing of the promoter, exons and
exon-intron junctions in both cases (17).
The coding region containing the mutation p.(Arg499His) in the PCSK9 gene (NM_174936)
was amplified by PCR and sequenced for all family members of case 1.
DNA sequences were analyzed using VariantReporterTM software (Applied Biosystems) or
CodonCode Aligner (CodonCode corporation). The Human Genome Variation Society (HGVS)
recommendations (http://varnomen.hgvs.org/) were used for variant nomenclature. The Human
Gene Mutation Database (HGMD) and Leiden Open Variation Database (LOVD) 3.0 were
6
consulted as mutation databases. To evaluate the Minor Allele Frequency (MAF), the following
variant databases were consulted: dbSNP 149 (NCBI), Exome Aggregation Consortium (ExAC),
genome Aggregation Database (gnomAD), Exome Variant Server (EVS) and 1000 genomes
(1kG).
Functional study
Site-directed mutagenesis and cloning
Plasmids carrying PCSK9 variants were constructed by Innoprot (Derio, Spain). Briefly,
variants were introduced into the human PCSK9 cDNA (NM_174936.3), in the mammalian
expression vector WT-PCSK9 plasmid (pCMV-PCSK9-FLAG) kindly provided by Prof.
Horton (19), by oligonucleotide site-directed mutagenesis, using the QuickChange Lightning
mutagenesis kit (Agilent) according to the manufacturer's instructions. A 6x His tag was
introduced to allow purification with no effects on PCSK9 activity. Restriction enzyme
digestion of the appropriate fragments and the integrity of the remaining PCSK9 cDNA
sequences of all constructs were verified by direct sequence analysis.
PCSK9 expression in transfected HEK293 cells
A total of 5×105 HEK293 cells were transfected with 1 µg of a plasmid encoding WT-PCSK9
and p.(Asp374Tyr) or p.(Arg499His) PCSK9-variants with Lipofectamine® LTX and PlusTM
Reagent (Invitrogen). Twenty-four hours post-transfection, cells were washed and then
incubated with fresh DMEM medium for an additional 24 h. Next, cells were lysed to analyse
intracellular PCSK9 by Western blot as described below.
PCSK9 quantification
Aliquots from the culture mediums were collected at different times (4-24 h) and PCSK9 levels
were determined by ELISA following manufacturer instructions (Quantikine® ELISA; R&D
Systems, Min, USA).
PCSK9 purification from stably transfected HEK293 cells
HEK293 cells grown to subconfluence were transfected with the different PCSK9 plasmids and
selected with geneticin G418 sulphate (Gibco) according to the manufacturer's instructions to
7
obtain the stably transfected cells. For PCSK9 purification, stably transfected HEK293 cells
were grown at 80% confluence in DMEM medium. Then, the culture medium was replaced by
Opti-MEM (Invitrogen) without geneticin and cells were maintained under these conditions for
48 h. Finally, the medium was harvested and PCSK9 was purified using one-step nickel affinity
chromatography. Purified PCSK9 variants were stored at -80ºC in 50 mM Tris-HCl buffer
supplemented with 150 mM NaCl and 10% glycerol, pH 8.0.
Lipoprotein labelling with fluorescein isothiocyanate
LDL were purified from blood plasma by centrifugation, at 12,000 × g at 4 °C. LDL (1.019–
1.050 g/mL) was isolated through sequential ultracentrifugation by adjusting plasma density to
1.21 g/mL by the addition of KBr.
LDL particles were labelled with fluorescein isothiocyanate (FITC) as previously described (20).
Briefly, 10 µL of FITC (2 mg/mL) were added to 1 mL LDL (1 mg/mL apoB) in 0.1 M
NaHCO3, pH 9.0, and mixed for 2 h by slow rocking at room temperature. The unreacted dye
was removed by gel filtration on a sephadex G-25 column equilibrated with PBS EDTA-free
buffer. All fractions were assayed for protein content using bovine serum albumin as standard
(Pierce BCA protein assay, Pierce).
Quantification of LDL uptake by flow cytometry
LDLr expression and LDL uptake were assessed in HEK293 cells 48 h after transfection with
the plasmids containing WT or p.(Arg499His) PCSK9-variant. To determine LDLr cell surface
expression by fluorescence-activated cell sorter (FACS), cells were incubated with a mouse
anti-LDLr primary antibody (1:100; 2.5 mg/L; Progen Biotechnik GmbH) for 1 h, at room
temperature, then washed twice with PBS-1%BSA and incubated with Alexa Fluor 488-
conjugated goat anti-mouse IgG secondary antibody (1:100; Molecular Probes). For LDL
uptake analysis, HEK293 cells were incubated for 4 h, at 37ºC with 20 µg/mL FITC-LDL and
lipoprotein uptake was determined as previously described (20). In addition, LDL uptake was
determined by incubating purified WT or p.(Arg499His) PCSK9 variant on HepG2 and
HEK293 cells. Briefly, 2 µg/mL of each purified PCSK9 variant were added to the cell culture
medium and 2 h post-addition, 20 µg/mL FITC-LDL were added to the medium; thereafter the
8
LDL uptake was determined 4 h by FACS. In both experimental approaches, after incubation
with FITC-LDL, cells were washed twice in PBS-1%BSA, fixed on 4% formaldehyde for 10
min and washed again twice with PBS-1%BSA. The amount of internalized LDL was
determined as described before by adding Trypan blue solution (Sigma-Aldrich, Steinheim,
Germany) to a final concentration of 0.2%. Fluorescence intensities were measured in a
FACSCalibur™ (BD Bioscience, NJ, USA) flow cytometer as previously described (20). For
each sample, fluorescence of 10,000 events was acquired for data analysis. All measurements
have been performed at least in triplicate. In all assays, cells transfected with the known
p.(Asp374Tyr) GOF PCSK9 variant or treated with the recombinant purified p.(Asp374Tyr)
PCSK9 were used as internal positive controls of the assay.
LDLr-ectodomain production and purification
The LDLr construct encoding the N-terminal extracellular ectodomain (ED-LDLr,
corresponding to 1-789 amino acids) plus c-myc and His tags was purified by affinity
chromatography from cells transfected with the pcDNA3.1-EC-LDLR-His plasmid, kindly
provided by Prof. Leren (21). Briefly, HEK293 cells at 70-80% confluency were transfected
with the plasmid by calcium phosphate method for 24-48 h and selected in successive passages
by geneticin (G-418 sulphate, Gibco, Invitrogen). For ED-LDLr expression and purification, the
culture medium of positively transfected cells was changed to Opti-MEM (Invitrogen) without
geneticin and maintained under these conditions for three additional days. Then the medium
was harvested, supplemented with protease inhibitors (complete EDTA-free, Roche) and the
ED-LDLr was affinity purified using one-step nickel affinity chromatography. For protein long-
term maintenance, the buffer was changed to storage buffer (50 mM Tris-HCl, 50 mM NaCl,
10% glycerol, and 0.01% Brij-35, pH 7.5) (22) and frozen to -80ºC.
Solid-phase immunoassay for PCSK9-LDLr ectodomain binding
LDLr ectodomain fragments diluted in working buffer (10 mM Tris-HCl, pH 7.4, 50 mM NaCl,
2 mM CaCl2) were coated at a fixed concentration onto 96-well microtiter plates by incubation
overnight (ON) at 4ºC. Plates were then blocked and incubated with a serial dilution of each of
the different PCSK9 variants diluted in working buffer (for test at pH 7.4) or in buffer 10 mM
9
Tris-Maleate, 50 mM NaCl, 2 mM CaCl2, pH 5.2, during 2 hours at room temperature (RT), and
then washed thoroughly with working buffer supplemented with 0.1% (w/v) Tween 20 (Sigma-
Aldrich, MO, USA). For ligand detection, the antibodies (rat monoclonal anti-DYKDDDDK tag,
clone L5, ThermoFisher, USA; and peroxidase-conjugated goat anti-rat, Cell Signalling, USA)
were diluted in working buffer supplemented with 5% (w/v) BSA, applied directly to the plate
and incubated for 1 hour at RT, with an extensive washing between both incubations. After a
final wash, antibody binding was determined using 50 µL per well of 2,2´-Azino-bis (3-
ethylbenzothiazoline-6-sulfonic acid) substrate solution (Sigma-Aldrich, MO, USA) and
measuring colour change at 405 nm. The time course for colour development was essentially
linear and measurements were taken 30-60 min after the addition of substrate. For data
processing, all absorbance values were corrected for unspecific binding, relativized to maximum
absorbance and EC50 values were extracted from curves after fitting the data to 5-parameter
logistic (5-PL) equation (SigmaPlot 13.0, Systat Software Inc., CA, USA).
Analysis of p.(Arg499His) PCSK9 variant on the secretion of the ED-LDLr
pcDNA3.1-EC-LDLR-His plasmid was used to analyze the effect of p.(Arg499His) on
intracellular LDLr trafficking, HEK293 cells stably transfected with the WT
or p.(Arg499His) PCSK9 variant were transiently co-transfected with pcDNA3.1-EC-LDLR-
His using the calcium phosphate method. Forty-eight hours after transfection, HEK293 cells
were washed with PBS and the medium was replaced with OptiMEM (Gibco) supplemented
with penicillin (50 units/ml) and streptomycin (50 µg/ml) for additional 24 h incubation. The
medium was collected and cell debris was removed by centrifugation.
Western blot analysis of intracellular and secreted PCSK9 and ED-LDLr secretion in the
presence of PCSK9
PCSK9 expression and secretion analysis in HEK293 cells transfected with the different PCSK9
variants was performed in cell lysates and culture media by Western blot. For that purpose,
proteins from the cell lysate or from the supernatants were resolved by 8.5% Tris-Glycine SDS-
PAGE. The gels were blotted onto Nitrocellulose membranes (Protran BA 83, Whatman™, GE
10
Healthcare, Germany), blocked for 1 h in TBS-T (50 mM Tris-HCl, pH 7.5, 150 mM NaCl,
0.1% Tween 20) containing 5% non-fat milk and immunoblotted with a rabbit polyclonal anti-
human PCSK9 antibody (1:1000) (Cayman Chemical Company, USA, Cat.No: 10240) for 16 h
at 4°C. Then, they were counterstained with a horseradish peroxidase-conjugated anti-rabbit
antibody (Cell Signalling, Cat.No: 7074s).
For ED-LDLr detection membranes were immunostained with a mouse monoclonal anti-c-Myc
antibody (9E10) (Invitrogen, MA1-980). A rabbit polyclonal IgG anti-GAPDH antibody
(1:1000) (Santa Cruz Biotechnology, Cat No: 7074s) was used to check protein loading and to
normalize the extent of protein expression.
The signal was developed using SuperSignal West Dura Extended Substrate (Pierce
Biotechnology, Rockford, IL, USA). ChemiDoc XRS (Bio-Rad, Hercules, CA, USA) was used
to detect the signals. The concentrations of the antibodies were optimized to achieve low
background and a linear dose-dependent increase in signal intensity. Quantification in all cases
was performed relative to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using
Quantity One Basic 4.4.0 software (Bio-Rad).
Statistical analysis
Data are presented as mean ± SD or means (interquartile range) for continuous variables.
Experimental data presented in graphs are reported as percentage relative to the control. Flow
cytometry and solid-phase immunoassays were performed independently 3 times and all
measurements were performed in triplicate. Western blots from 3 independent experiments were
quantified by densitometry to determine statistical significance. For comparisons between
groups the T-test was used. Statistical significance was established at a p value <0.05.
Results
The initial genetic screening of the probands found no pathogenic mutations in LDLR or APOB.
PCSK9 sequencing identified the c.1496G>A, p.(Arg499His) variant in both cases 1 and 2, and
in 12 of the 20 family members of case 1.

11
To our knowledge, this variant has never been reported before as a cause of FH and was absent
in the HGMD and LOVD mutation databases. It has been found at very low frequencies in
GnomAD (MAF of 0.002%) and ExAC (MAF of 0.0047%), and was absent in EVS and 1000
genomes.
Familial segregation
Family lipid values, presence of ACSVD or xanthomas and PCSK9 genotype are presented
within the family tree (figure 1). There was high segregation of the hypercholesterolemia
phenotype in p.(Arg499His) sibling carriers. The association of high LDL-C with the mutation
was less clear in the second generation of young adults and children. Nevertheless, mean LDL-
C in carrier family members was 199 (±66.4) mg/dL (5.2±1.7 mmol/l) versus 108 (±28.1)
mg/dL (2.79±0.73 mmol/l), (p=0.003) in non-carriers.
Functional analyses
Intracellular expression and extracellular secretion in the culture medium of the
p.(Arg499His) PCSK9 variant
HEK293 cells were transfected with DNA constructs encoding for WT, p.(Asp374Tyr), and
p.(Arg499His) PCSK9 variants and the effects of those mutations on intracellular PCSK9 and
secretion to the culture medium were analysed by Western blot and ELISA, respectively, as
described in the Methods section. As shown in Figure 2A (upper panel), the p.(Arg499His)
PCSK9 variant is expressed intracellularly as detected 24 h after transfection. Equal loading of
protein was confirmed in each blot by membrane stripping and further incubation with
antibodies to visualise cytosolic GAPDH protein (Figure 2A, lower panel). Interestingly, the
amount of p.(Arg499His) PCSK9 variant secreted in the culture medium was lower compared to
both WT and p.(Asp374Tyr) variant as determined by ELISA (0-24 h) (Figure 2B).
Transfection of HEK293 cells with p.(Arg499His) PCSK9 variant diminishes LDLr
expression at the cellular surface and LDL uptake activity
In the first experimental approach to determine the activity of the p.(Arg499His) PCSK9
12
variant, HEK293 cells were transiently transfected with WT, or with p.(Arg499His), or GOF
p.(Asp374Tyr) PCSK9 variants. The LDLr expression at cellular surface and the efficiency of
fluorescent LDL uptake by the cells were measured as described in the Methods section. As
shown in figure 3A, LDLr expression was lower in the cells transfected with p.(Arg499His)
PCSK9 variants than in those transfected with WT PCSK9. In addition, and as shown in Figure
3B, LDL uptake was significantly reduced (≈25%) with the expression of p.(Arg499His),
compared to WT PCSK9. The p.(Asp374Tyr) variant (used as a GOF control) showed an
expected reduction in LDL uptake (≈50%) (Fig. 3B).
Recombinant purified p.(Arg499His) PCSK9 variant does not modify LDLr activity when
added exogenously to HEK293 and HepG2 cells
Extracellular activity of p.(Arg499His) PCSK9 variant was studied by determining FITC-LDL
uptake in HEK293 and HepG2 cells treated with 2 µg/mL of purified PCSK9 variants. As
shown in Figure 4A, in HEK293 cells, activity of the p.(Arg499His) PCSK9 variant was similar
to WT PCSK9. The p.(Asp374Tyr) GOF variant caused the expected reduction of LDL uptake
already described. Similar results were obtained in HepG2 cells when treated exogenously with
purified PCSK9 variants (Figure 4B).
Purified p.(Arg499His) PCSK9 variant shows an affinity for LDLr similar to the WT
PCSK9
Next, we tested binding affinities of p.(Arg499His) PCSK9 variants for the LDLr using a solid
phase binding immunoassay and compared them to those of WT PCSK9 and p.(Asp374Tyr)
variants. The results at pH 7.4, shown in Table 1, indicate an EC50 for WT LDLr of 112.2 nM,
very similar to previously reported values (23). The affinity value of the p.(Arg499His) variant
to LDLr was similar to those found for WT PCSK9, whereas the EC50 value of p.(Asp374Tyr)
GOF variant was lower, indicating the higher affinity to the LDLr compared to WT PCSK9
(19.3 nM vs. 112.2 nM, respectively) (Table 1). As show in Table 1, also affinities of WT and
p.(Asp499His) at pH 5.2 were similar (23.2 nM vs 33.2 nM) while, as expected, affinity of
p.(Asp374Tyr) GOF PCSK9 variant for LDLr was increased (7.4 nM). These results indicate
that the GOF effect of p.(Asp499His) variant is not due to increased affinity for LDLr.
13
The p.(Arg499His) PCSK9 variant drives LDLr to intracellular degradation
To study whether PCSK9 affects intracellular LDLr levels and the transport of ED-LDLr
towards the cell membrane, stably transfected HEK293 cells with WT or p.(Arg499His) PCSK9
were co-transfected with a plasmid containing cDNA of the ED-LDLR. The amounts of ED-
LDLr in the medium were analyzed by Western blot and quantified by densitometry (Figure 5A
and B). The results show that the medium of cells co-transfected with ED-LDLR and the
p.(Arg499His) PCSK9 variants contained 2-fold less ED-LDLr than those transfected with WT
PCSK9 (Figure 5A and B) indicating that LDLr is being degraded intracellularly.
Discussion
We report the clinical phenotype and the pathogenic mechanism of a novel GOF mutation in the
PCSK9 gene in two unrelated probands from Spain and Italy. This new mutation changes an
arginine into histidine in the CTD in the PCSK9 protein, c.1496G>A; p.(Arg499His). The GOF
mutations altering the CTD of PCSK9 are very rare and the mechanisms inducing
hypercholesterolemia are poorly understood (7). Our work identifies the CTD of PCSK9 as a
key determinant of the intracellular metabolism of the LDLr.
The phenotype of p.(Arg499His) GOF carriers is indistinguishable from FH caused by LDLR
mutations with almost complete penetrance (24). Most p.(Arg499His) GOF carriers have LDL-
C concentrations in the range of FH secondary to LDLR mutations; and some p.(Arg499His)
GOF carriers present with ASCVD, corneal arcus and tendon xanthomas in a frequency similar
to the LDLR-caused FH (25). The p.(Arg499His) mutation shows co-segregation with the
hypercholesterolemic phenotype in the pedigree of case 1and the mutation was not found
among normocholesterolemic subjects. Carriers of the p.(Arg499His) mutation showed LDL-C
concentrations 2-fold higher than non-carriers (199±66.4 mg/dL versus 108±28.1mg/dL,
(p=0.003)). The phenotype linked to PCSK9 GOF mutations showed a large variability in
severity depending on the mutation (26-29). In particular, the p.(Asp374Tyr) mutation, is
associated with a very severe phenotype with very high LDL-C levels, premature coronary heart
disease (CHD) and poor response to treatment (28).
14
Case 2 of our study showed that the mutation is expressed since childhood with high LDL-C
concentrations. Some of the young affected patients in case 1’s family also showed elevated
LDL-C, although the expression in the p.(Arg499His) carriers was variable, especially in the
young members. This variability has also been described for other causes of FH (30).
Conversely, all the adult carriers showed elevated levels of LDL-C. Few reports about children
with PCSK9 GOF mutations have been published so far: they show a variable phenotype,
usually less aggressive than LDLR LOF mutations (31, 32); an example is the PCSK9 GOF
homozygous patient recently described with a mild phenotype (33).
Our study shows that p.(Arg499His) PCSK9 variant is efficiently produced but is secreted less
efficiently than WT PCSK9. An extracellular mechanism of action can be excluded since
similar affinities were obtained by solid-phase immunoassay and similar LDLr activities were
obtained in experiments on cells incubated with purified WT and p.(Arg499His) PCSK9 variant.
However, a GOF effect of p.(Arg499His) PCSK9 variant is appreciable in the experiments
based on PCSK9 variant transfection. In fact, cells transfected with p.(Arg499His) PCSK9
variant showed a LDLr expression and activity significantly lower than those transfected with
WT PCSK9. Taken together, these results suggest that an intracellular mechanism of action
reducing LDLr availability is responsible of the GOF effect of the p.(Arg499His) PCSK9
variant, although this mechanism is not completely clarified.
PCSK9 GOF mutations have different mechanisms of action depending on the protein domain
involved. The majority of them appear in the prodomain or in the catalytic domain, whereas the
CTD GOF variants are less frequent (7, 8). The variants located in the prodomain have a broad
mechanism of action; most frequently they increase LDLr degradation by both intracellular and
extracellular effects (7, 34, 35). Hence, some of them increase intracellular activity and LDLr
degradation independently of autocatalytic activity (34), others show reduced autocatalytic
cleavage but increased intracellular LDLr degradation (23, 35, 36) and finally, in some
prodomain variants, the extracellular affinity of PCSK9 for LDLr is increased (34, 35). The
catalytic domain is involved in the autocatalytic cleavage and the extracellular binding of
15
PCSK9 to the LDLr and, consequently, the mutations located in this domain lead to partial or
complete resistance to furin cleavage, increasing PCSK9 activity (28).
Finally, the CTD of PCSK9 has 3 repeat modules called M1, M2, M3 (37), which are necessary
to induce PCSK9-mediated degradation of the PCSK9-LDLr complex. The best-characterized
function of the PCSK9 CTD is to increase the affinity between PCSK9 and LDLr at the low pH
of the endosomes, although this domain does not directly interact with the EGF-A domain of the
LDLr (9). Some variants in CTD increasing external degradation of LDLr are p.(Asn425Ser)
and p.(Arg496Trp) (35). Other variants in the CTD could lead to misfolding of PCSK9 and
generate more stable extracellular unions (37). Other intracellular mechanisms of the interaction
between PCSK9 and LDLr have been described (38), and a possible role of the CTD for proper
intracellular sorting of the PCSK9-LDLr complex has been suggested, although it still remains
puzzling how PCSK9 CTD governs LDLr degradation. Some data suggest that once the
PCSK9-LDLr complex reaches the trans-Golgi network (TGN), PCSK9 possibly interacts with
a co-receptor through its CTD, which would lead the LDLr to the lysosomes (39). These
mechanism seems to explain the GOF activity of p.(Ser127Arg) and p.(Asp129Gly) PCSK9
variants (39). Our observation that the secretion of the WT-ED-LDLR in culture medium was
markedly decreased if cells are co-transfected with the p.(Arg499His) PCSK9 variant respect to
the WT PCSK9 supports the hypothesis of an intracellular action of the p.(Arg499His) PCSK9
variant. Therefore, the p.(Arg499His) variant located in the CTD could have a similar GOF
mechanism of action thereby increasing the mutant PCSK9 mobility from ER to TGN and
reducing intracellular LDLr concentration.
Our study has some limitations: in Case 2, no family member was available to study the
segregation of hypercholesterolemia with the mutation. However, we had the chance to study
the large family of Case 1, in which the association is clearly evident with strong penetrance in
adults and less severe in young individuals. The functionality of the new mutation has been
extensively studied “in vitro” with techniques that are considered to be a very close
approximation to the “in vivo” situation, although they cannot fully reflect the real metabolism
of PCSK9.
16
Conclusions
p.(Arg499His) is a new GOF PCSK9 mutation located at the CTD. Although the molecular
mechanism underlying its pathogenicity is not fully clarified, the GOF activity occurs through
an intracellular effect, demonstrating the important role of this domain in the intracellular
metabolism of the LDLr/PCSK9 complex.
Conflict of interest:
The authors declare that they have no conflicts of interest.
Acknowledgements:
Rocío Alonso and Ana Expósito are gratefully acknowledged for excellent technical assistance.
We sincerely thank Haziq Siddiqi (Johns Hopkins University) for his critical reading and
editing of this manuscript.
Funding:
This work was supported by the Basque Government (Grupos Consolidados IT849-13). A.B.-V.
was supported by a grant PIF (2014–2015), Gobierno Vasco. This work was also supported by a
grant of The Spanish Atherosclerosis Society (Clínico-Epidemiológica 2015) and a grant of
Colegio Oficial de Médicos de Las Palmas (González-Jaraba 2015).
Author Contributions
R.M.S.H. and M.D.D.T. performed the genetic screening, recruited patients, collected samples
and co-wrote the paper. F.J.N. recruited patients. A.B.-V. performed western blot and FACS
assays. K.B.U. performed solid-phase immunoassays I.L.M. performed the genetic screening.
M.B. and A.W. analysed data and co-wrote the paper. F.C, C.M and G.F. participated in the
study design, conceived experiments, analysed data and co-wrote the paper. All authors have
read and approved the manuscript.
17
References:
1. Goldstein JL, H. H., Brown MS. 2001. Familial hypercholesterolemia. In The Metabolic
and Molecular Bases of Inherited Disease. B. A. Scriver CR, Sly WS, Valle D, editor. McGraw-
Hill, New York. 2863-2913.
2. Seidah, N. G. 2011. The proprotein convertases, 20 years later. Methods Mol Biol 768:
23-57.
3. Benjannet, S., D. Rhainds, R. Essalmani, J. Mayne, L. Wickham, W. Jin, M. C. Asselin,
J. Hamelin, M. Varret, D. Allard, M. Trillard, M. Abifadel, A. Tebon, A. D. Attie, D. J. Rader,
C. Boileau, L. Brissette, M. Chretien, A. Prat, and N. G. Seidah. 2004. NARC-1/PCSK9 and its
natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor
and LDL cholesterol. J Biol Chem 279: 48865-48875.
4. Abifadel, M., M. Varret, J. P. Rabes, D. Allard, K. Ouguerram, M. Devillers, C. Cruaud,
S. Benjannet, L. Wickham, D. Erlich, A. Derre, L. Villeger, M. Farnier, I. Beucler, E. Bruckert,
J. Chambaz, B. Chanu, J. M. Lecerf, G. Luc, P. Moulin, J. Weissenbach, A. Prat, M. Krempf, C.
Junien, N. G. Seidah, and C. Boileau. 2003. Mutations in PCSK9 cause autosomal dominant
hypercholesterolemia. Nat Genet 34: 154-156.
5. Cohen, J., A. Pertsemlidis, I. K. Kotowski, R. Graham, C. K. Garcia, and H. H. Hobbs.
2005. Low LDL cholesterol in individuals of African descent resulting from frequent nonsense
mutations in PCSK9. Nat Genet 37: 161-165.
6. Bruikman, C. S., G. K. Hovingh, and J. J. Kastelein. 2017. Molecular basis of familial
hypercholesterolemia. Curr Opin Cardiol.
7. Dron, J. S., and R. A. Hegele. 2017. Complexity of mechanisms among human
proprotein convertase subtilisin-kexin type 9 variants. Curr Opin Lipidol 28: 161-169.
8. Zhang, D. W., T. A. Lagace, R. Garuti, Z. Zhao, M. McDonald, J. D. Horton, J. C.
Cohen, and H. H. Hobbs. 2007. Binding of proprotein convertase subtilisin/kexin type 9 to
epidermal growth factor-like repeat A of low density lipoprotein receptor decreases receptor
recycling and increases degradation. J Biol Chem 282: 18602-18612.
18
9. Holla, O. L., J. Cameron, K. Tveten, T. B. Strom, K. E. Berge, J. K. Laerdahl, and T. P.
Leren. 2011. Role of the C-terminal domain of PCSK9 in degradation of the LDL receptors. J
Lipid Res 52: 1787-1794.
10. Bendl, J., M. Musil, J. Stourac, J. Zendulka, J. Damborsky, and J. Brezovsky. 2016.
PredictSNP2: A Unified Platform for Accurately Evaluating SNP Effects by Exploiting the
Different Characteristics of Variants in Distinct Genomic Regions. PLoS Comput Biol 12:
e1004962.
11. Adzhubei, I. A., S. Schmidt, L. Peshkin, V. E. Ramensky, A. Gerasimova, P. Bork, A. S.
Kondrashov, and S. R. Sunyaev. 2010. A method and server for predicting damaging missense
mutations. Nat Methods 7: 248-249.
12. Schwarz, J. M., C. Rodelsperger, M. Schuelke, and D. Seelow. 2010. MutationTaster
evaluates disease-causing potential of sequence alterations. Nat Methods 7: 575-576.
13. Richards, S., N. Aziz, S. Bale, D. Bick, S. Das, J. Gastier-Foster, W. W. Grody, M.
Hegde, E. Lyon, E. Spector, K. Voelkerding, H. L. Rehm, and A. L. Q. A. Committee. 2015.
Standards and guidelines for the interpretation of sequence variants: a joint consensus
recommendation of the American College of Medical Genetics and Genomics and the
Association for Molecular Pathology. Genet Med 17: 405-424.
14. Di Taranto, M. D., M. N. D'Agostino, and G. Fortunato. 2015. Functional
characterization of mutant genes associated with autosomal dominant familial
hypercholesterolemia: integration and evolution of genetic diagnosis. Nutr Metab Cardiovasc
Dis 25: 979-987.
15. Benito-Vicente, A., K. B. Uribe, S. Jebari, U. Galicia-Garcia, H. Ostolaza, and C.
Martin. 2018. Validation of LDLr Activity as a Tool to Improve Genetic Diagnosis of Familial
Hypercholesterolemia: A Retrospective on Functional Characterization of LDLr Variants. Int J
Mol Sci 19.
16. Defesche, J. C., P. J. Lansberg, M. A. Umans-Eckenhausen, and J. J. Kastelein. 2004.
Advanced method for the identification of patients with inherited hypercholesterolemia. Semin
Vasc Med 4: 59-65.
19
17. Maglio, C., R. M. Mancina, B. M. Motta, M. Stef, C. Pirazzi, L. Palacios, N. Askaryar,
J. Boren, O. Wiklund, and S. Romeo. 2014. Genetic diagnosis of familial hypercholesterolaemia
by targeted next-generation sequencing. J Intern Med 276: 396-403.
18. Romano, M., M. D. Di Taranto, M. N. D'Agostino, G. Marotta, M. Gentile, G. Abate, P.
Mirabelli, R. Di Noto, L. Del Vecchio, P. Rubba, and G. Fortunato. 2010. Identification and
functional characterization of LDLR mutations in familial hypercholesterolemia patients from
Southern Italy. Atherosclerosis 210: 493-496.
19. McNutt, M. C., T. A. Lagace, and J. D. Horton. 2007. Catalytic activity is not required
for secreted PCSK9 to reduce low density lipoprotein receptors in HepG2 cells. J Biol Chem
282: 20799-20803.
20. Etxebarria, A., A. Benito-Vicente, A. C. Alves, H. Ostolaza, M. Bourbon, and C. Martin.
2014. Advantages and versatility of fluorescence-based methodology to characterize the
functionality of LDLR and class mutation assignment. PLoS One 9: e112677.
21. Holla, O. L., J. Cameron, K. E. Berge, T. Ranheim, and T. P. Leren. 2007. Degradation
of the LDL receptors by PCSK9 is not mediated by a secreted protein acted upon by PCSK9
extracellularly. BMC Cell Biol 8: 9.
22. Qian, Y. W., R. J. Schmidt, Y. Zhang, S. Chu, A. Lin, H. Wang, X. Wang, T. P. Beyer,
W. R. Bensch, W. Li, M. E. Ehsani, D. Lu, R. J. Konrad, P. I. Eacho, D. E. Moller, S. K.
Karathanasis, and G. Cao. 2007. Secreted PCSK9 downregulates low density lipoprotein
receptor through receptor-mediated endocytosis. J Lipid Res 48: 1488-1498.
23. Cunningham, D., D. E. Danley, K. F. Geoghegan, M. C. Griffor, J. L. Hawkins, T. A.
Subashi, A. H. Varghese, M. J. Ammirati, J. S. Culp, L. R. Hoth, M. N. Mansour, K. M.
McGrath, A. P. Seddon, S. Shenolikar, K. J. Stutzman-Engwall, L. C. Warren, D. Xia, and X.
Qiu. 2007. Structural and biophysical studies of PCSK9 and its mutants linked to familial
hypercholesterolemia. Nat Struct Mol Biol 14: 413-419.
24. Francke, U., M. S. Brown, and J. L. Goldstein. 1984. Assignment of the human gene for
the low density lipoprotein receptor to chromosome 19: synteny of a receptor, a ligand, and a
genetic disease. Proc Natl Acad Sci U S A 81: 2826-2830.
20
25. Soutar, A. K., and R. P. Naoumova. 2007. Mechanisms of disease: genetic causes of
familial hypercholesterolemia. Nat Clin Pract Cardiovasc Med 4: 214-225.
26. Cariou, B., C. Le May, and P. Costet. 2011. Clinical aspects of PCSK9. Atherosclerosis
216: 258-265.
27. Abifadel, M., S. Elbitar, P. El Khoury, Y. Ghaleb, M. Chemaly, M. L. Moussalli, J. P.
Rabes, M. Varret, and C. Boileau. 2014. Living the PCSK9 adventure: from the identification of
a new gene in familial hypercholesterolemia towards a potential new class of anticholesterol
drugs. Curr Atheroscler Rep 16: 439.
28. Naoumova, R. P., I. Tosi, D. Patel, C. Neuwirth, S. D. Horswell, A. D. Marais, C. van
Heyningen, and A. K. Soutar. 2005. Severe hypercholesterolemia in four British families with
the D374Y mutation in the PCSK9 gene: long-term follow-up and treatment response.
Arterioscler Thromb Vasc Biol 25: 2654-2660.
29. Hopkins PN, Defesche J, Fouchier SW, Bruckert E, Luc G, Cariou B, Sjouke B, Leren
TP, Harada-Shiba M, Mabuchi H, Rabès JP, Carrié A, van Heyningen C, Carreau V, Farnier
M, Teoh YP, Bourbon M, Kawashiri MA, Nohara A, Soran H, Marais AD, Tada H, Abifadel
M, Boileau C, Chanu B, Katsuda S, Kishimoto I, Lambert G, Makino H, Miyamoto Y, Pichelin
M, Yagi K, Yamagishi M, Zair Y, Mellis S, Yancopoulos GD, Stahl N, Mendoza J, Du
Y, Hamon S, Krempf M, Swergold GD. 2015. Characterization of Autosomal Dominant
Hypercholesterolemia Caused by PCSK9 Gain of Function Mutations and Its Specific
Treatment With Alirocumab, a PCSK9 Monoclonal Antibody. Circ Cardiovasc Genet 8: 823-
831..
30. Varret, M., M. Abifadel, J. P. Rabes, and C. Boileau. 2008. Genetic heterogeneity of
autosomal dominant hypercholesterolemia. Clin Genet 73: 1-13.
31. Timms, K. M., S. Wagner, M. E. Samuels, K. Forbey, H. Goldfine, S. Jammulapati, M.
H. Skolnick, P. N. Hopkins, S. C. Hunt, and D. M. Shattuck. 2004. A mutation in PCSK9
causing autosomal-dominant hypercholesterolemia in a Utah pedigree. Hum Genet 114: 349-
353.
21
32. Di Taranto, M. D., A. Benito-Vicente, C. Giacobbe, K. B. Uribe, P. Rubba, A.
Etxebarria, O. Guardamagna, M. Gentile, C. Martin, and G. Fortunato. 2017. Identification and
in vitro characterization of two new PCSK9 Gain of Function variants found in patients with
Familial Hypercholesterolemia. Sci Rep 7: 15282.
33. Alves, A. C., A. Etxebarria, A. M. Medeiros, A. Benito-Vicente, A. Thedrez, M.
Passard, M. Croyal, C. Martin, G. Lambert, and M. Bourbon. 2015. Characterization of the first
PCSK9 gain of function homozygote. J Am Coll Cardiol 66: 2152-2154.
34. Abifadel, M., M. Guerin, S. Benjannet, J. P. Rabes, W. Le Goff, Z. Julia, J. Hamelin, V.
Carreau, M. Varret, E. Bruckert, L. Tosolini, O. Meilhac, P. Couvert, D. Bonnefont-Rousselot, J.
Chapman, A. Carrie, J. B. Michel, A. Prat, N. G. Seidah, and C. Boileau. 2012. Identification
and characterization of new gain-of-function mutations in the PCSK9 gene responsible for
autosomal dominant hypercholesterolemia. Atherosclerosis 223: 394-400.
35. Fasano, T., X. M. Sun, D. D. Patel, and A. K. Soutar. 2009. Degradation of LDLR
protein mediated by 'gain of function' PCSK9 mutants in normal and ARH cells.
Atherosclerosis 203: 166-171.
36. Cameron, J., O. L. Holla, T. Ranheim, M. A. Kulseth, K. E. Berge, and T. P. Leren.
2006. Effect of mutations in the PCSK9 gene on the cell surface LDL receptors. Hum Mol
Genet 15: 1551-1558.
37. Seidah, N. G., M. Abifadel, S. Prost, C. Boileau, and A. Prat. 2017. The Proprotein
Convertases in Hypercholesterolemia and Cardiovascular Diseases: Emphasis on Proprotein
Convertase Subtilisin/Kexin 9. Pharmacol Rev 69: 33-52.
38. Poirier, S., G. Mayer, V. Poupon, P. S. McPherson, R. Desjardins, K. Ly, M. C. Asselin,
R. Day, F. J. Duclos, M. Witmer, R. Parker, A. Prat, and N. G. Seidah. 2009. Dissection of the
endogenous cellular pathways of PCSK9-induced low density lipoprotein receptor degradation:
evidence for an intracellular route. J Biol Chem 284: 28856-28864.
39. Poirier, S., H. A. Hamouda, L. Villeneuve, A. Demers, and G. Mayer. 2016. Trafficking
Dynamics of PCSK9-Induced LDLR Degradation: Focus on Human PCSK9 Mutations and C-
Terminal Domain. PLoS One 11: e0157230.
22
Tables
WT
Table 1: EC50 values for the binding of PCSK9 variants to LDLr, as determined by solid-phase
immunoassay at pH 7.2 and pH 5.2.
23
Figures
Figure 1. Case 1 family tree showing the carriers of p.(Arg499His) PCSK9 variant. Half-
blackened indicates carriers of the p.(Arg499His) variant. The crossed line indicates deceased
patients. The arrow represents the proband. Age (in years) at lipid measurement, total cholesterol
(TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C),
triglycerides (TG) in mg/dl and in (mmol/l) measured in the absence of lipid-lowering therapy, and
history and age of onset of coronary heart disease (CHD) are given.
24
is)
)
yr
9H
4T
37
49
sp
rg
A
(A
(A
tT
W
w
p.
p.
75 kDa
PCSK9
50 kDa
GADPH 40 kDa
B 50
B wt
is)
)
yr
45
9H
p.(Asp374Tyr)
4T
ng PCSK9 / Total PCSK9 mRNA
37
p.(Arg499His)
49
40
sp
rg
35
(A
tT
(A
wW
30
p.
p.
25 *
20
PCSK9 *
15
*
10
0
0 6 12 18 24
Time (h)
Figure 2. Intracellular expression and secretion in the culture medium of WT, p.(Asp374Tyr) and
p.(Arg499His) PCSK9 variants. HEK293 cells were transiently transfected with plasmid encoding
the PCSK9 variant. (A) Intracellular expression of PCSK9 was analysed by Western blot. (B)
PCSK9 secretion to the culture medium was determined by ELISA and relativized to total PCSK9
mRNA of transfected cells. A representative experiment from three independently performed assays
is shown in (A). (B) The values represent the mean of triplicate determinations (n = 3); error bars
represent ±SD. * p < 0.01 compared to wt PCSK9.
25
A LDLR expression ( % wt)
125
100
75
*
50 *
25
LDLr
0
T
d
)
w
yr
is
te
9H
4T
c
fe
37
49
an
sp
rg
tr
(A
(A
n
p.
p.
no
B
125
LDL uptake ( % wt)
100
75
50 * *
25
0
ed
T t
)
W w
yr
is
ct
9H
4T
fe
37
49
an
sp
rg
tr
(A
(A
n
p.
p.
no
Figure 3. LDLr expression and LDL uptake in transiently-transfected HEK293 cells with wt,
p.(Asp374Tyr) or p.(Arg499His) PCSK9 variants. The assay was performed on HEK293 cells
transfected with WT, p.(Asp374Tyr) or p.(Arg499His). LDLR expression and LDL uptake were
measured as described in the Methods section. Values represent the mean ± standard deviation of 3
independent experiments performed by triplicate. *p < 0.01 compared to wt PCSK9. The
p.(Asp374Tyr) GOF mutant was used as internal control.
26
d T d
te te
T
ea W ea
W
r r
nt nt
U U
Figure 4. Effect of purified WT, p.(Asp374Tyr) and p.(Arg499His) PCSK9 variants on LDL uptake.
HEK293 (A) or HepG2 (B) cells were incubated with the purified PCSK9 variants at 2 µg/mL for 2 h
prior FITC-LDL addition. LDL internalization was determined after 4 h incubation at 37 °C as
described in Materials and Methods. Values represent the mean ± standard deviation of 3
independent experiments performed by triplicate. *p < 0.01 versus WT PCSK9. The p.(Asp374Tyr)
GOF mutant was used as internal control.
27
A
Control WT p.(Arg499His)
150 kDa
Medium
Lysates
100 kDa
GAPDH 40 kDa
B
1,20
Rela%ve ED-LDLr seccre%on
1,00
0,80
0,60
*
0,40
0,20
0,00
control WT +ED-LDLr p.(Arg499His) + LDLr
Figure 5. Effect of p.(Arg499His) PCSK9 variant on the secretion of LDLr ectodomain (ED-LDLr).
Stably PCSK9 transfected HEK293 cells were transiently co-transfected with ED-LDLr plasmid.
(A) The amount of the ED-LDLr was determined in lysates and in media by Western blot analysis. A
representative experiment from three independently performed assays is shown. (B) Quantification
by densitometry of the ED-LDLr secretion relative to intracellular protein. The values represent the
mean of triplicate determinations (n = 3); error bars represent ±SD. *p < 0.01 versus WT + ED-LDLr.
Control refers HEK293 non transfected with PCSK9 but transfected with ED-LDLr.
28
157
158
CONCLUSIONES FINALES
1. La frecuencia de pacientes con HFHo en España es mayor de la esperada, con una
prevalencia de 1:450,000. Muchos pacientes con diagnóstico genético de HFHo no
cumplen criterios clínicos. El fenotipo es más grave en homocigotos verdaderos
portadores de mutaciones nulas y menos agresivo en heterocigotos compuestos y
dobles. Hay que pensar en formas homocigóticas en sujetos con niveles de c-LDL
inferiores a los que se han considerado diagnósticos hasta ahora.
2. La HAR tiene una prevalencia similar a descrita en otras poblaciones, de
aproximadamente de 1:6,500,000, con sólo 7 casos diagnosticados en España que
presentan una alta variabilidad genética. El fenotipo es similar a la HFHo por
mutaciones del LDLR en cuanto a niveles de c-LDL con menor incidencia de ECV.
La respuesta al tratamiento con estatinas y ezetimibe es alta con reducciones
marcadas del c-LDL, pero sin llegar a estar adecuadamente controlados.
3. En Gran Canaria la mutación p. [Tyr400_Phe402del] en el gen LDLR es la mutación
responsable del 43% de los casos con diagnóstico clínico de HF y del 68% de los
pacientes con diagnóstico genético positivo. No hay estudios previos que hayan
descrito una frecuencia tan alta de la misma mutación en ningún gen causante de HF
en España, por lo que Gran Canaria podría considerarse una región de aislamiento
genético para esta enfermedad. Por tanto, el estudio genético en la isla debería
iniciarse descartando la mutación p. [Tyr400_Phe402del].
4. La cosegregación de esta mutación con el fenotipo de la enfermedad demuestra su
naturaleza patogénica.
5. La mutación p.(Arg499His) localizada en el dominio C-terminal del la PCSK9 es
una mutación con ganancia de función que genera HF.
159
160
ANEXOS
Publicaciones secundarias
1. ‘Value of the Definition of Severe Familial Hypercholesterolemia for
Stratification of Heterozygous Patients’.
Autores: Sofia Pérez-Calahorra, Rosa María Sánchez-Hernández, Núria Plana,
Victoria Marco-Benedi, Juan Pedro-Botet, Fátima Almagro, Angel Brea, Juan
Francisco Ascaso, Carlos Lahoz, and Fernando Civeira, on behalf of the
Dyslipidemia Registry of Spanish Arteriosclerosis Society.
Revista: Am J Cardiol, 2017;119:742-748
2. ‘Autosomal Recessive Hypercholesterolemia. Long-Term Cardiovascular
Outcomes’
Autores: Laura D’Erasmo, Ilenia Minicocci, Antonio Nicolucci, Paolo Pintus,
Janine E. Roeters Van Lennep, Luis Masana, Pedro Mata, Rosa María Sánchez-
Hernández, Pablo Prieto-Matos, Josè T. Real, Juan F. Ascaso, Eduardo Esteve
Lafuente, Miguel Pocovi, Francisco J. Fuentes, Sandro Muntoni, Stefano Bertolini,
Cesare Sirtori, Laura Calabresi, Chiara Pavanello, Maurizio Averna, Angelo
Baldassare Cefalu, Davide Noto, Adolfo Arturo Pacifico, Giovanni Mario Pes,
Mariko Harada-Shiba, Enzo Manzato, Sabina Zambon, Alberto Zambon, Anja
Vogt, Marco Scardapane, Barbara Sjouke, Renato Fellin, Marcello Arca.
Revista: J Am Coll Cardiol, 2018;71:279–88.
3. ‘National Dyslipidemia Registry of the Spanish Arterioesclerosis Society:
Current status’
161
Autores: Sofía Pérez-Calahorra, Rosa M. Sánchez-Hernández, Núria Plana, Pedro
Valdivielso, Fernando Civeira.
Revista: Clin Investig Arterioscler, 2017;29(6):248-253.
4. ‘Real-World Outcomes with Lomitapide Use in Paediatric Patients with
Homozygous Familial Hypercholesterolaemia’
Autores: Tawfeg Ben-Omran, Luis Masana, Genovefa Kolovou, Gema Ariceta, F.
Javier Nóvoa, Allan M. Lund, Martin P. Bogsrud, María Araujo, Osamah Hussein,
Daiana Ibarretxe, Rosa M. Sanchez-Hernández, Raul D. Santos.
Revista: Adv Ther, 2019 May 17.
Comunicaciones a congresos
! Alta prevalencia de la mutación p. p. [Tyr400_Phe402del] en el LDLR en una
población de Gran Canaria con hipercolesterolemia familiar. 31 Congreso
Nacional de la Sociedad Española de Arterioesclerosis. Girona, 2018.
! Characteristics of homozygous familial hypercholesterolemia in Spain. 84
Congreso de la Sociedad Europea de Arterioesclerosis. Innsbruck. Atherosclerosis
252 (2016) e197-e235
! Complete regression of xanthomas and decreased of intima-media thickness with
LDL apheresis in a severe homozygous familial hypercholesterolemia patient. 17
Congreso Internacional de la Sociedad Internacional de Arterioesclerosis.
Ámsterdam, 2015.
Cursos de especialización
! Curso realizado: Actualización en el manejo de la Hipercolesterolemia Familiar.
162
Value of the Definition of Severe Familial
Hypercholesterolemia for Stratification of Heterozygous
Patients
Sofia Pérez-Calahorra, RD, MSca,*, Rosa María Sánchez-Hernández, MDb, Núria Plana, MD, PhDc,
Victoria Marco-Benedi, RDa, Juan Pedro-Botet, MD, PhDd, Fátima Almagro, MD, PhDe,
Angel Brea, MD, PhDf, Juan Francisco Ascaso, MD, PhDg, Carlos Lahoz, MD, PhDh, and
Fernando Civeira, MD, PhDa, on behalf of the Dyslipidemia Registry of Spanish Arteriosclerosis Society
Familial hypercholesterolemia (FH) is characterized by high low-density lipoprotein (LDL)

cholesterol with co-dominant transmission and high risk of cardiovascular disease (CVD),
although with high variability among subjects. Currently, CVD stratification tools for
heterozygous FH (HeFH) are not available. A definition of severe HeFH has been recently
proposed by the International Atherosclerosis Society (IAS), but it has not been validated.
Our study aims to see clinical characteristics and prevalence of CVD in subjects defined as
severe HeFH by IAS criteria. Probable or definite HeFH introduced in the Dyslipidemia
Registry of Spanish Arteriosclerosis Society were analyzed by the IAS criteria. Univariate
and multivariate analysis was used to assess the association of CVD with the IAS criteria.
About 1,732 HeFH cases were analyzed. Severe HeFH had higher prevalence of familial
history of CVD, personal history of tendon xanthomas, LDL cholesterol, and CVD than
nonsevere HeFH. A total of 656 (77.1%) and 441 (50.1%) of men and women, respectively,
fulfilled the IAS criteria of severe HeFH. In the univariate analysis, subjects defined as
severe HeFH showed odds ratio 3.016 (95% CI 3.136 to 4.257, p <0.001) for CVD. However,
when traditional risk factors were included in the multivariate analysis, only the presence of
cholesterol >400 mg/dl had a statistically significant association with CVD odds ratio 8.76
(95% CI 3.90 to 19.69, p <0.001). In conclusion, the IAS definition of severe HeFH is not
significantly associated with CVD when adjusted for classic risk factors. Risk stratification
in HeFH is an important issue, but the proposed criteria do not seem to solve this prob-
lem. ! 2016 Elsevier Inc. All rights reserved. (Am J Cardiol 2017;119:742e748)
Familial hypercholesterolemia (FH) is a monogenic coronary heart disease (CHD).1,2 Without lipid-lowering
disorder characterized by elevated plasma concentration therapy about 52% of heterozygous FH (HeFH) men
of low-density lipoprotein (LDL) cholesterol with co- and 31.8% of HeFH women will have a cardiovascular
dominant transmission in the family and high risk of event before age 60.3 However, this high cardiovascular
risk was described before the statin era. The advent of
statins has been a landmark for HeFH, has substantially
reduced LDL cholesterol levels in these patients and has
a
Unidad Clínica e Investigación en Lípidos y Arteriosclerosis, Hospital changed the natural history of disease.4e6 Hence, scien-
Universitario Miguel Servet, IIS Aragón, Universidad de Zaragoza, Zar- tific societies consider a priority statin therapy in this
agoza, Spain; bEndocrinology Department, Hospital Universitario Insular population.7,8 The intensity of the lipid-lowering treat-
de Gran Canaria, Instituto Universitario de Investigaciones Biomédicas y
ment in general population is determined by the subject’s
Sanitarias, Las Palmas de Gran Canaria, Spain; cUnitat de Medicina
Vascular i Metabolism, Hospital Universitari Sant Joan, Institut d’Investi-
baseline cardiovascular risk.9e11 However, in patients
gación Sanitaria Pere Virgili (IISPV), Reus, Tarragona, Spain; dLipid and with HeFH there are not validated equations to calculate
Vascular Risk Unit, Department of Endocrinology and Nutrition, Hospital cardiovascular risk, especially on statin. Actually, the
del Mar, Universitat Autónoma de Barcelona, Barcelona, Spain; eHospital equations used in the general population are not recom-
Donostia, Unidad de Lípidos, San Sebastián, Spain; fHospital San Pedro, mended in patients with FH.7e11 Criteria to define severe
Unidad de Lípidos, Logroño, La Rioja, Spain; gServicio de Endocrinología HeFH have recently proposed by the International
y Nutrición, Hospital Clínico Universitario, Universitat de Valencia, Atherosclerosis Society (IAS) in an attempt to select
Valencia, Spain; and hAtherosclerosis Unit, Hospital Carlos III, Madrid, those subjects who may be subsidiaries of measures
Spain. Manuscript received September 2, 2016; revised manuscript received different to statins.12 However, this definition has not
and accepted November 3, 2016.
been previously applied to any HeFH population. Our
This study was supported by grants PI12/01087, PI12/01703, and PI12/
01321from the Spanish Ministry of Economy and Competitiveness and
study aimed to assess the clinical characteristics, fre-
RD12/0042/0055 from the Red de Investigación Cardiovascular (RIC). quency and prevalence of cardiovascular disease (CVD)
See page 747 for disclosure information. of subjects defined as severe HeFH according to IAS
*Corresponding author: Tel: (34) 976765500x2895. criteria in the Dyslipidemia Registry of the Spanish
E-mail address: sperezc@iisaragon.es (S. Pérez-Calahorra). Arteriosclerosis Society.
0002-9149/16/$ - see front matter ! 2016 Elsevier Inc. All rights reserved. www.ajconline.org
http://dx.doi.org/10.1016/j.amjcard.2016.11.025
Preventive Cardiology/Value of the Definition of Severe FH 743
Figure 1. Enrollment and eligibility in the study. Of 3,102 subject with genetic hypercholesterolemias included in the registry with the clinical diagnosis of
genetic hypercholesterolemia, 727 subjects were excluded for DLCN score <6 points. A total of 2,375 patients met inclusion criteria. Of these, 643 were
excluded for missing values. Some subjects (95) missed more than 1 value. DLCN ¼ Dutch Lipid Clinic Network; GFR ¼ glomerular filtration rate.
Methods From the total 3,102 cases with the clinical diagnosis of
genetic hypercholesterolemia included in the register on
At the end of 2013, the Dyslipidemia Registry of the
June 15, 2016, all cases that met the probable (6 to 8 points)
Spanish Arteriosclerosis Society was created. It is an active
and definite (>8 points) HeFH diagnosis according to the
on-line registry, where 50 certified lipid units distributed
Dutch Lipid Clinic Network criteria were selected.7 A total
throughout all Spanish regions introduce cases with
of 1,732 cases met the HeFH definition, and all data defining
different types of primary hyperlipidemias. These lipid units
severe HeFH definition were available. The main reasons for
are the sites in the Spanish Public National Health System
exclusion in the analysis were lack of data on lipoprotein(a)
where most primary hyperlipidemias are referred for diag-
concentration, age of statin onset, and family history of
nosis and treatment. The registry has been approved by a
premature CVD in a first-degree relative (Figure 1).
central ethical committee to include anonymous clinical
The criteria for severe HeFH were those defined by the
data. The criteria for inclusion of data were previously
IAS as follows:
standardized with 5 different training sessions that took
place before entering cases. Minimum essential for the in- 1. At presentation (untreated LDL cholesterol): total
clusion of cases include age; gender; smoking; personal cholesterol >10 mmol/L (400 mg/dl); or LDL
history of hypertension, diabetes, and CVD with age of the cholesterol >8.0 mmol/L (310 mg/dl) and 1 high-risk
first event; body mass index; waist circumference; choles- feature; or LDL cholesterol >5 mmol/L (190 mg/dl)
terol, triglycerides and high-density lipoprotein (HDL) and 2 high-risk features. High-risk features are: age
cholesterol without lipid-lowering treatment; and clinical >40 years without treatment; smoking; male gender;
diagnosis. The definition of CVD in the registry includes: lipoprotein(a) [Lp(a)] >75 nmol/L (50 mg/dl); HDL
CHD (myocardial infarction, acute coronary syndrome with cholesterol <1 mmol/L (40 mg/dl); hypertension;
stenosis greater than 50% of a main coronary artery, and diabetes mellitus; family history of early CVD in first-
coronary revascularization); stroke (ischemic and hemor- degree relatives (age <55 years in men and <60 years
rhagic); aortic aneurism; and ischemia of lower extremities in women); chronic kidney disease (i.e., estimated
(intermittent claudication with ankle/braquial index <0.90 glomerular filtration rate <60 ml/min per 1.73 m2; and
or revascularization of lower limb arteries). BMI >30 kg/m2.
744 The American Journal of Cardiology (www.ajconline.org)
Table 1
Clinical and biochemical baseline characteristics of heterozygous familial hypercholesterolemia included in the study
Variable Probable HeFH Definite HeFH P-Value Total
(N ¼ 354) (N ¼ 1,378) (N ¼ 1,732)
Males 177 (50.0%) 674 (48.9%) 0.715 851 (49.1%)

Age (years) 55 (46-64) 51 (39-61) <0.001 52 (41-61)
Body mass index (kg/m2) 26.1 (23.8-29.0) 25.5 (22.8-28.7) 0.006 25.7 (23-28.7)
Xanthomas 11 (3.3%) 472 (35.2%) <0.001 483 (28.8%)
Personal history of CVD 41 (11.6%) 185 (13.4%) 0.356 226 (13.1%)
Age first CVD event (years) 49.5 " (8.27) 48.3 " 10.9 0.438 48.5 " (10.5)
Familial premature CVD 112 (31.6%) 468 (34%) 0.409 580 (33.5%)
Current smoker 74 (20.9%) 304 (22.1%) 0.638 378 (21.8%)
Hypertension 93 (26.4%) 244 (17.7%) <0.001 337 (19.5%)
Diabetes Mellitus 32 (9.1%) 71 (5.2%) 0.006 103 (6.0%)
Total Cholesterol (mg/dL) 315 (283-354) 337 (295-394) <0.001 332 (292-385)
HDL Cholesterol (mg/dL) 53 (44-62.8) 53 (44-64) 0.753 53 (44-64)
LDL Cholesterol (mg/dL) 230 (195-266) 260 (214-315) <0.001 253 (210-301)
Triglycerides (mg/dL) 140 (97-203) 104 (75-150) <0.001 108 (79-160)
Lipoprotein(a) (mg/dL) 31.2 (11.2-79) 26 (10-66) 0.116 27 (10-70)
Age of statin onset (years) 46 (35-53) 38 (26-48) <0.001 40 (28-49)
Values are numbers (%), mean " SD or median (25th percentile to 75th percentile) as applicable. p Value refers to differences calculated by the chi-square,
Mann-Whitney, Wilcoxon, or Student t tests, as appropriate.
CVD ¼ cardiovascular disease; HDL ¼ high-density lipoprotein; HeHF ¼ heterozygous familial hypercholesterolemia; LDL ¼ low-density lipoprotein.
2. The presence of clinical atherosclerotic CVD defined high LDL cholesterol concentrations, common risk factors
as previous myocardial infarction, angina, coronary were family history of premature CVD in first-degree rela-
revascularization, nonembolic ischemic stroke, or tives, age >40 years without treatment, Lp(a) >50 mg/dl,
transitory ischemic attack, and intermittent and current smoker. The prevalence of CVD was higher in
claudication. men that in women, and HDL cholesterol <40 mg/dl was
also more common in men. Up to 77.1% of men and 50.1%
All statistical analyses were performed using the SPSS
of women met the criteria for severe HeFH according to the
software, version 20 (SPSS Inc., Chicago, Illinois), except
applied criteria. The criterion of LDL cholesterol >190 mg/dl
when noted. Data are presented as mean " SD for contin-
and 2 or more high-risk features were the criterion most
uous variables, as median and interquartile range for vari-
frequently found: 55.5% (Table 3).
ables with a skewed distribution, and as a frequency or
In Table 4, family history of CVD, presence of tendon
percentages for categorical variables. Differences in mean
xanthomas, and LDL cholesterol concentration before and
values of variables with a normal distribution were assessed
after at least 6 months of initiation of lipid-lowering therapy
using t tests and the Mann-Whitney U test or Kruskal-Wallis
are shown. All risk groups for severe HeFH had higher
H test were used for variables with a skewed distribution. prevalence of familial history of CVD and greater presence
Categorical variables were compared using the chi-square
of tendon xanthomas than nonsevere HeFH. Baseline LDL
test. To evaluate the association of severe HeFH definition
cholesterol was also greater in those defined as severe HeFH
with CVD, a univariate and multivariate binary logistic criteria. However, LDL cholesterol levels after treatment
regression analysis was carried out by stepwise regression,
showed no statistical difference between the subjects cate-
introducing as covariates: gender, age, hypertension, dia-
gorized as severe and those nonsevere HeFH. The preva-
betes, tobacco, LDL cholesterol, and HDL cholesterol. If
lence of personal history of CVD in the different subgroups
taking 95% of confidence level (Za2 ¼ 1.962) and precision
of severe and in nonsevere HeFH is presented in Figure 2.
level of 3% and assuming a 10% prevalence of CVD, the
All risk groups for severe HeFH had higher prevalence of
sample size would be 314 subjects. We have studied around
CVD than nonsevere HeFH.
1,700 patients so the sample size is enough to achieve the
To know whether the criteria for severe HeFH were
scheduled objective.
associated with the presence of CVD, the odds ratio (OR)
for CVD were analyzed before and after adjustment for the
Results
traditional cardiovascular risk factors for each group of se-
Table 1 lists the distribution of the main clinical and vere HeFH. In the univariate analysis, subjects with LDL
biochemical variables included in this study. As expected cholesterol >400 mg/dl had 4.46 times more risk (95% CI
probable HeFH subjects had lower frequency of xanthomas, 1.68 to 3.33), p <0.001 of CVD. Subjects defined as severe
and lower total cholesterol, and LDL cholesterol than defi- HeFH by any of the 3 lipid subgroups showed an OR 3.016
nite HeFH. Probable HeFH were older and had higher body (95% CI 3.136 to 4.257), p <0.001 for CVD (Table 4).
mass index and triglycerides concentrations than subjects However, when traditional risk factors were included in the
with definite HeFH. analysis only the presence of LDL cholesterol >400 mg/dl
The presence of the different criteria used in the defini- had a statistically significant association with CVD OR 8.76
tion of severe HeFH is described in Table 2. In addition to (95% CI 3.90 to 19.69).
Table 2
Frequency of the different criteria used in the severe heterozygous familial hypercholesterolemia definition by gender
Variable Women Men P-value Total
(N ¼ 881) (N ¼ 851) (N ¼ 1,732)
Body mass index > 30 (kg/m2) 148 (16.8%) 144 (16.9%) 0.946 292 (16.9%)
History of CVD 65 (7.4%) 161 (18.9%) <0.001 226 (13.1%)
Familial premature CVD 273 (31.0%) 307 (36.1%) 0.025 580 (33.5%)
Current smoker 175 (19.9%) 203 (23.9%) 0.044 378 (21.8%)
Hypertension 178 (20.3%) 159 (18.7%) 0.418 337 (19.5%)
Diabetes Mellitus 43 (4.9%) 60 (7.1%) 0.057 103 (6.0%)
LDL cholesterol >400 (mg/dL) 46 (5.2%) 33 (3.9%) 0.180 79 (4.6%)
HDL cholesterol <40 (mg/dL) 62 (7.0%) 201 (23.6%) <0.001 263 (15.2%)
Age of statin onset >40 (years) 281 (31.9%) 234 (27.5%) 0.045 515 (29.7%)
Lipoprotein(a) >50 (mg/dL) 225 (25.5%) 197 (23.1%) 0.227 422 (24.5%)
GFR <60 (ml/min/1.73) 12 (1.4%) 17 (2.0%) 0.303 29 (1.7%)
Values are numbers (%), as applicable. p Value refers to differences calculated by the chi-square test.
CVD ¼ cardiovascular disease; GFR ¼ glomerular filtration rate; HDL ¼ high-density lipoprotein; LDL ¼ low-density lipoprotein.
Table 3
Distribution of subjects that met criteria for severe heterozygous familial hypercholesterolemia
Variable Women Men P-value Total
(N ¼ 881) (N ¼ 851) (N ¼ 1,732)
LDL cholesterol > 400 (mg/dL) 46 (5.2%) 33 (3.9%) 0.149 79 (4.6%)

LDL cholesterol > 310 (mg/dL) þ one or more 153 (17.4%) 180 (21.2%) 0.046 333 (19.2%)
high-risk features
LDL cholesterol > 190 (mg/dL) þ two or more 356 (40.4%) 605 (71.7%) <0.001 961 (55.5%)
high-risk features
Personal history of CVD 65 (7.4%) 161 (18.9%) <0.001 226 (13.1%)
Any of the above 441 (50.1%) 656 (77.1%) <0.001 1097 (63.3%)
Values are numbers (%). p Value refers to differences calculated by the chi-square test.
CVD ¼ cardiovascular disease; LDL ¼ low-density lipoprotein.
Table 4
Family history of premature cardiovascular disease, presence of tendon xanthomas, and low-density lipoprotein cholesterol concentration before and after at
least 6 months of lipid-lowering therapy according to subgroups of severe heterozygous familial hypercholesterolemia definition
Variable LDL cholesterol LDL cholesterol LDL cholesterol Any LDL None LDL P-value
>400 mg/dL >310 mg/dL þ one or >190 mg/dL þ 2 or cholesterol criterion cholesterol criterion
more high-risk features more high-risk features
Familial premature CVD 41 (51.9%) 145 (43.5%) 451 (46.9%) 483 (44.0%) 97 (15.3%) <0.001
Tendon xanthomas 46 (58.2%) 144 (46.6%) 289 (31.0%) 342 (32.3%) 141 (23.0%) <0.001
LDL cholesterol 435 (413-485) 354 (330-390) 267 (229-319) 271 (229-331) 221 (182-264) <0.001
pre-treatment (mg/dL)
LDL cholesterol 160 (129-193) 149 (119-183) 130 (107-162) 131 (108-163) 134 (108-167) 0.423
post-treatment (mg/dL)
Values are numbers (%) or median (25th percentile to 75th percentile), as applicable. p Value refers to differences calculated by the chi-square or
Kruskal-Wallis tests as appropriate between Any LDL cholesterol criterion and non-LDL cholesterol criterion.
CVD ¼ cardiovascular disease; LDL ¼ low-density lipoprotein.
The definition of severe HeFH by any criterion at pre- subjects with HeFH, except those with well-defined con-
sentation cardiovascular did not provide meaningful infor- traindications, should start treatment with potent statins to
mation in the model (Table 5). lower their LDL cholesterol.7,8,11,14 However, stratification
is important when deciding treatment in association with
statins. The benefit of combination therapy with statins has
Discussion
only been established in subjects with very high short-time
Risk stratification in FH is a clinical problem of enor- risk,15 and we do not have clinical evidence in other pop-
mous magnitude.13 At this time, it is well established that ulations included HeFH. The benefit of any intervention,
Figure 2. Prevalence of CVD according to subgroups of severe heterozygous familial hypercholesterolemia.
Table 5
Odds ratio (OR) for cardiovascular disease in the different subgroups of severe heterozygous familial hypercholesterolemia
OR 95% CI p-value R2
Model 1
LDL cholesterol > 400 mg/dL 4.457 2.767 7.178 <0.001 0.034
LDL cholesterol > 310 mg/dL þ one 1.677 1.216 2.314 0.002 0.010
or more high-risk features
LDL cholesterol >190 mg/dL þ 2 or more high-risk features 3.327 2.386 4.637 <0.001 0.062
Severe FH at presentation (any of above) 3.016 2.136 4.257 <0.001 0.049
Model 2
LDL cholesterol >400 mg/dL 8.761 3.899 19.688 <0.001 0.304
LDL cholesterol > 310 mg/dL þ one or more high-risk features 1.102 0.629 1.930 0.734 0.277
LDL cholesterol >190 mg/dL þ 2 or more high-risk features 1.426 0.922 2.206 0.110 0.280
Severe HeFH at presentation (any of above) 1.416 0.884 2.268 0.148 0.279
Model 1: univariate analysis.

Model 2: after adjustment for gender, age, hypertension, diabetes, tobacco, LDL cholesterol, and HDL cholesterol.
including the number of subjects to treat to avoid a car- mortality ratio was calculated before and from January 1,
diovascular event, and the cost-effectiveness of the combi- 1992. In patients without CHD at registration, all-cause
nation will depend on the baseline risk of the population to mortality from 1992 was significantly lower than in the
treat.11 general population. In patients aged 20 to 79 years, CHD
CVD in HeFH is extremely variable, even in subjects mortality decrease significantly by 37% (95% CI 7 to 56)
sharing the same pathogenic mutation.16 The classic risk from 3.4- to 2.1-fold excess.4 In a cohort of 14,283 patients
factors also play a role in explaining differences in the with molecularly defined HeFH from the Netherlands, the
presentation of CVD in FH population12 and specific HeFH prevalence of CVD was 9.2%,19 similar to the observed in
risk factors such as the type of mutation or the presence of our cohort. In summary, CVD in HeFH, at present time and
tendon xanthomas.17 However, we have little information with the current treatment mostly with statins, is lower than
about the risk factors associated with CVD in HeFH under previously reported and is improving especially in subjects
prolonged treatment with statins. Nevertheless, recent without overt clinical disease at presentation.
observational studies show that CVD has substantially Current and previous studies do not support the use of
improved with current management.18 In a registry-based severe FH proposed definition by the IAS for 2 main rea-
study from Norway, with information about 4,688 treated sons. First, over 3/4 of men and more than 50% of women
patients with genetic diagnosis of HeFH, there were 113 fulfilled the criteria of severe HF. Given the current preva-
deaths (2.4%) in the period 1992 to 2010, 46% of cardio- lence of CVD in HeFH with statins, those percentages seem
vascular origin, and the standardized mortality ratio was disproportionate and invalidate the definition. Second, the
2.29 (95% CI 1.65 to 3.19).5 The Simon Broome Familial severe HeFH definition adds nothing significant to classic
Hyperlipidaemia Register Group, a large long-term pro- risk factors such as diabetes, hypertension, and age that have
spective registry including 3,382 patients with HeFH, been used regularly; thus, it makes little sense to complicate
demonstrated a reduction in coronary mortality of about 1/3 the management and generate unnecessary worries to these
since the widespread use of statins. The standardized patients with useless tags.
It is essential to define those subjects with HeFH who need 6. Huijgen R, Kindt I, Defesche JC, Kastelein JJ. Cardiovascular risk in
further LDL cholesterol reduction beyond statins, with or relation to functionality of sequence variants in the gene coding for the
low-density lipoprotein receptor: a study among 29,365 individuals
without ezetimibe, because they will be subsidiaries of new tested for 64 specific low-density lipoprotein-receptor sequence vari-
lipid-lowering treatments, especially PCSK9 inhibitors. ants. Eur Heart J 2012;33:2325e2330.
These drugs have shown great effectiveness in patients with 7. Nordestgaard BG, Chapman MJ, Humphries SE, Ginsberg HN,
HeFH.19,20 The proposed IAS definition could be interpreted Masana L, Descamps OS, Wiklund O, Hegele RA, Raal FJ,
Defesche JC, Wiegman A, Santos RD, Watts GF, Parhofer KG,
to guide the selection of those subjects who would be subject Hovingh GK, Kovanen PT, Boileau C, Averna M, Borén J, Bruckert E,
to an additional lipid-lowering therapy. Our data do not Catapano AL, Kuivenhoven JA, Pajukanta P, Ray K, Stalenhoef AF,
support that strategy. The dramatic declines obtained with the Stroes E, Taskinen MR, Tybjærg-Hansen A; European Atherosclerosis
new drugs,19,20 the high hopes in cardiovascular prevention Society Consensus Panel. Familial hypercholesterolaemia is under-
deposited in them,21 and the commercial pressure for their diagnosed and undertreated in the general population: guidance for
clinicians to prevent coronary heart disease: consensus statement of the
prescription cannot make us forget that with their current European Atherosclerosis Society. Eur Heart J 2013;34:3478e3490.
costs they should be restricted to patients with a high car- 8. Ito MK, McGowan MP, Moriarty PM; National Lipid Association
diovascular risk in the short term or unacceptably high levels Expert Panel on Familial Hypercholesterolemia. Management of fa-
of LDL cholesterol after maximal doses of statins. milial hypercholesterolemias in adult patients: recommendations from
the National Lipid Association Expert Panel on Familial Hypercho-
Our study has several limitations. First, this is a cross- lesterolemia. J Clin Lipidol 2011;5(3 Suppl):S38eS45.
sectional analysis, which limits the predictive temporal 9. Jacobson TA, Ito MK, Maki KC, Orringer CE, Bays HE, Jones PH,
interpretation of the IAS definition. Second, our sample is McKenney JM, Grundy SM, Gill EA, Wild RA, Wilson DP,
composed of middle-aged men and women from a Medi- Brown WV. National lipid association recommendations for patient-
terranean country, with traditionally lower CHD rates than centered management of dyslipidemia: part 1—full report. J Clin Lip-
idol 2015;9:129e169.
other populations, and for this reason, our results should be 10. Authors/Task Force Members; Piepoli MF, Hoes AW, Agewall S,
validated in other cohorts. Third, 20% of the subjects Albus C, Brotons C, Catapano AL, Cooney MT, Corrà U, Cosyns B,
included in the registry were excluded because Lp(a) was Deaton C, Graham I, Hall MS, Hobbs FD, Løchen ML, Löllgen H,
not available. However, the clinical and lipid characteristics Marques-Vidal P, Perk J, Prescott E, Redon J, Richter DJ, Sattar N,
Smulders Y, Tiberi M, van der Worp HB, van Dis I, Verschuren WM,
of this latter group did not differ from the whole group; so, Additional Contributor: Simone Binno (Italy); Document Reviewers;
we do not think that the exclusion of these subjects has any De Backer G, Roffi M, Aboyans V, Bachl N, Bueno H, Carerj S,
effect in the results of the study. Finally, the patients Cho L, Cox J, De Sutter J, Egidi G, Fisher M, Fitzsimons D,
included in this study are treated in highly specialized lipid Franco OH, Guenoun M, Jennings C, Jug B, Kirchhof P, Kotseva K,
units with a standardized protocol promoting the use of Lip GY, Mach F, Mancia G, Bermudo FM, Mezzani A, Niessner A,
Ponikowski P, Rauch B, Rydén L, Stauder A, Turc G, Wiklund O,
high-intensity lipid-lowering treatment14; thus, the extrapo- Windecker S, Zamorano JL. 2016 European Guidelines on cardiovas-
lation of these results to other clinical settings could not be cular disease prevention in clinical practice: the Sixth Joint Task Force
appropriated. of the European Society of Cardiology and other societies on Cardio-
vascular Disease prevention in Clinical Practice (constituted by rep-
resentatives of 10 societies and by invited experts): developed with the
Disclosures special contribution of the European Association for Cardiovascular
Prevention & Rehabilitation (EACPR). Atherosclerosis 2016;252:
Dr. Pérez-Calahorra receives grants from Amgen, Sanofi, 207e274.
and Pfizer. Dr Civeira receives grants, consulting fees, and/ 11. Stone NJ, Robinson JG, Lichtenstein AH, Bairey Merz CN, Blum CB,
Eckel RH, Goldberg AC, Gordon D, Levy D, Lloyd-Jones DM,
or honoraria from Amgen, Merck, Pfizer, and Sanofi- McBride P, Schwartz JS, Shero ST, Smith SC Jr, Watson K,
Aventis. Dr Pedro-Botet has received lecture honoraria, Wilson PW; American College of Cardiology/American Heart Asso-
consultancy fees, and/or research funding from Astra- ciation Task Force on Practice Guidelines. 2013 ACC/AHA guideline
Zeneca, Esteve, Merck, Mylan, and Sanofi-Aventis. All on the treatment of blood cholesterol to reduce atherosclerotic car-
authors have approved the final article. The other authors diovascular risk in adults: a report of the American College of Cardi-
ology/American Heart Association Task Force on Practice Guidelines.
have no conflicts of interest to disclose. J Am Coll Cardiol 2014;63:2889e2934.
12. Santos RD, Gidding SS, Hegele RA, Cuchel MA, Barter PJ, Watts GF,
1. Goldstein JL, Hobbs HH, Brown MS. Familial hypercholesterolemia. Baum SJ, Catapano AL, Chapman MJ, Defesche JC, Folco E,
In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The Metabolic & Freiberger T, Genest J, Hovingh GK, Harada-Shiba M, Humphries SE,
Molecular Bases Oh Inherited Disease. 8th edition. New York: Jackson AS, Mata P, Moriarty PM, Raal FJ, Al-Rasadi K, Ray KK,
McGraw-Hill, 2001:2863e28913. Reiner Z, Sijbrands EJ, Yamashita S; International Atherosclerosis
2. Hobbs HH, Brown MS, Goldstein JL. Molecular genetics of the LDL Society Severe Familial Hypercholesterolemia Panel. Defining severe
receptor gene in familial hypercholesterolemia. Hum Mutat 1992;1: familial hypercholesterolaemia and the implications for clinical man-
445e466. agement: a consensus statement from the International Atherosclerosis
3. Stone NJ, Levy RI, Fredrickson DS, Verter J. Coronary artery disease Society Severe Familial Hypercholesterolemia Panel. Lancet 2016;4:
in 116 kindred with familial type II hyperlipoproteinemia. Circulation 850e861.
1974;49:476e488. 13. Gidding SS, Champagne MA, de Ferranti SD, Defesche J, Ito MK,
4. Neil A, Cooper J, Betteridge J, Capps N, McDowell I, Durrington P, Knowles JW, McCrindle B, Raal F, Rader D, Santos RD, Lopes-
Seed M, Humphries SE. Reductions in all-cause, cancer, and coronary Virella M, Watts GF, Wierzbicki AS; American Heart Association
mortality in statin-treated patients with heterozygous familial hyper- Atherosclerosis, Hypertension, and Obesity in Young Committee of
cholesterolaemia: a prospective registry study. Eur Heart J 2008;29: Council on Cardiovascular Disease in Young, Council on Cardiovas-
2625e2633. cular and Stroke Nursing, Council on Functional Genomics and
5. Mundal L, Sarancic M, Ose L, Iversen PO, Borgan JK, Veierød MB, Translational Biology, and Council on Lifestyle and Cardiometabolic
Leren TP, Retterstøl K. Mortality among patients with familial hy- Health. The agenda for familial hypercholesterolemia: a scientific
percholesterolemia: a registry-based study in Norway. 1992-2010. J Am statement from the American Heart Association. Circulation 2015;132:
Heart Assoc 2014;3:e001236. 2167e2192.
14. Masana L, Civeira F, Pedro-Botet J, de Castro I, Pocoví M, Plana N, 18. Scientific Steering Committee on behalf of the Simon Broome Register
Mateo-Gallego R, Jarauta E, Pedragosa À. Expert consensus on the Group. Mortality in treated heterozygous familial hyper-
detection and clinical management of familial hypercholesterolemia. cholesterolaemia: implications for clinical management. Atheroscle-
Clin Investig Arterioscler 2013;25:182e193. rosis 1999;142:105e112.
15. Cannon CP, Blazing MA, Giugliano RP, McCagg A, White JA, 19. Besseling J, Kindt I, Hof M, Kastelein JJ, Hutten BA, Hovingh GK.
Theroux P, Darius H, Lewis BS, Ophuis TO, Jukema JW, De Severe heterozygous familial hypercholesterolemia and risk for car-
Ferrari GM, Ruzyllo W, De Lucca P, Im K, Bohula EA, Reist C, diovascular disease: a study of a cohort of 14,000 mutation carriers.
Wiviott SD, Tershakovec AM, Musliner TA, Braunwald E, Califf RM; Atherosclerosis 2014;233:219e223.
IMPROVE-IT Investigators. Ezetimibe added to statin therapy after 20. Raal FJ, Stein EA, Dufour R, Turner T, Civeira F, Burgess L,
acute coronary syndromes. N Engl J Med 2015;372:2387e2397. Langslet G, Scott R, Olsson AG, Sullivan D, Hovingh GK, Cariou B,
16. Ferrieres J, Lambert J, Lussier-Cacan S, Davignon J. Coronary artery Gouni-Berthold I, Somaratne R, Bridges I, Scott R, Wasserman SM,
disease in heterozygous familial hypercholesterolemia patients with the Gaudet D; for the RUTHERFORD-2 Investigators. PCSK9 inhibition
same LDL receptor gene mutation. Circulation 1995;92:290e295. with evolocumab (AMG 145) in heterozygous familial hyper-
17. Civeira F, Castillo S, Alonso R, Meriño-Ibarra E, Cenarro A, Artied M, cholesterolaemia (RUTHERFORD-2): a randomised, double-blind,
Martín-Fuentes P, Ros E, Pocoví M, Mata P. Tendon xanthomas in placebo-controlled trial. Lancet 2015;385:331e340.
familial hypercholesterolemia are associated with cardiovascular risk 21. Giugliano RP, Sabatine MS. Are PCSK9 inhibitors the next break-
independently of the low-density lipoprotein receptor gene mutation. through in the cardiovascular Field? J Am Coll Cardiol 2015;65:
Arterioscler Thromb Vasc Biol 2005;25:1960e1965. 2638e2651.
JOURNAL OF THE AMERICAN COLLEGE OF CARDIOLOGY VOL. 71, NO. 3, 2018
ª 2018 BY THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION ISSN 0735-1097/$36.00
PUBLISHED BY ELSEVIER https://doi.org/10.1016/j.jacc.2017.11.028
Autosomal Recessive
Hypercholesterolemia
Long-Term Cardiovascular Outcomes
Laura D’Erasmo, MD, PHD,a Ilenia Minicocci, BSC, PHD,a Antonio Nicolucci, MD,b Paolo Pintus, MD,c
Janine E. Roeters Van Lennep, MD, PHD,d Luis Masana, MD, PHD,e Pedro Mata, MD,f
Rosa Maria Sánchez-Hernández, MD,g Pablo Prieto-Matos, MD, PHD,h Josè T. Real, MD, PHD,i
Juan F. Ascaso, MD, PHD,i Eduardo Esteve Lafuente, MD, PHD,j Miguel Pocovi, PHD,k Francisco J. Fuentes, MD, PHD,l
Sandro Muntoni, MD, PHD,m Stefano Bertolini, MD,n Cesare Sirtori, MD, PHD,o Laura Calabresi, PHD,o
Chiara Pavanello, PHD,o Maurizio Averna, MD,p Angelo Baldassare Cefalu, MD, PHD,p Davide Noto, MD, PHD,p
Adolfo Arturo Pacifico, MD,q Giovanni Mario Pes, MD,r Mariko Harada-Shiba, MD, PHD,s Enzo Manzato, MD,t
Sabina Zambon, MD,t Alberto Zambon, MD, PHD,t Anja Vogt, MD,u Marco Scardapane, MSC,b Barbara Sjouke, MD,v
Renato Fellin, MD,w Marcello Arca, MDa
ABSTRACT
BACKGROUND Autosomal recessive hypercholesterolemia (ARH) is a rare lipid disorder characterized by premature
atherosclerotic cardiovascular disease (ASCVD). There are sparse data for clinical management and cardiovascular
outcomes in ARH.
OBJECTIVES Evaluation of changes in lipid management, achievement of low-density lipoprotein cholesterol (LDL-C)
goals and cardiovascular outcomes in ARH.
METHODS Published ARH cases were identified by electronic search. All corresponding authors and physicians known to
treat these patients were asked to provide follow-up information, using a standardized protocol.
RESULTS We collected data for 52 patients (28 females, 24 males; 31.1 ! 17.1 years of age; baseline LDL-C: 571.9 !
171.7 mg/dl). During a mean follow-up of 14.1 ! 7.3 years, there was a significant increase in the use of high-intensity
statin and ezetimibe in combination with lipoprotein apheresis; in 6 patients, lomitapide was also added. Mean LDL-C
achieved at nadir was 164.0 ! 85.1 mg/dl ("69.6% from baseline), with a better response in patients taking lomitapide
("88.3%). Overall, 23.1% of ARH patients reached LDL-C of <100 mg/dl. During follow-up, 26.9% of patients had
incident ASCVD, and 11.5% had a new diagnosis of aortic valve stenosis (absolute risk per year of 1.9% and 0.8%,
respectively). No incident stroke was observed. Age ($30 years) and the presence of coronary artery disease at diagnosis
were the major predictors of incident ASCVD.
CONCLUSIONS Despite intensive treatment, LDL-C in ARH patients remains far from targets, and this translates into a
poor long-term cardiovascular prognosis. Our data highlight the importance of an early diagnosis and treatment and
confirm the fact that an effective treatment protocol for ARH is still lacking. (J Am Coll Cardiol 2018;71:279–88)
© 2018 by the American College of Cardiology Foundation.
From the aDepartment of Internal Medicine and Clinical Specialties, Sapienza University of Rome, Rome, Italy; bCenter for
Listen to this manuscript’s
Outcomes Research and Clinical Epidemiology, Coreresearch, Inc., Pescara, Italy; cDipartimento Internistico, Centro per le
audio summary by
Malattie Dismetaboliche e l’Arteriosclerosi, Cagliari, Italy; dDepartment of Internal Medicine, Erasmus Medical Center, Rotterdam,
JACC Editor-in-Chief
the Netherlands; eResearch Unit on Lipids and Atherosclerosis, Vascular Medicine and Metabolism Unit, Sant Joan University
Dr. Valentin Fuster.
Hospital, Universitat Rovira i Virgili, IISPV, Reus, Spain, and Spanish Biomedical Research Centre in Diabetes and Associated
Metabolic Disorders (CIBERDEM), Madrid, Spain; fFundación Hipercoesterolaemia Familiar, Madrid, Spain; gSección de Endo-
crinología y Nutrición, Complejo Hospitalario Universitario Insular Materno Infantil de Gran Canaria, Instituto Universitario de
Investigación Biomédica y Sanitaria (IUIBS) de la Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, Spain;
h
Unidad de Endocrinología Pediátrica Hospital Universitario de Salamanca Instituto de Investigación Biomédica de Salamanca,
Salamanca, Spain; iServicio de Endocrinología y Nutrición, Hospital Clínico Valencia, Valencia, Spain, and Department of
280 D’Erasmo et al. JACC VOL. 71, NO. 3, 2018
Cardiovascular Risk in ARH JANUARY 23, 2018:279–88
A utosomal recessive hypercholester- hypercholesterolemia (typically, LDL-C >400 mg/dl),

ABBREVIATIONS
AND ACRONYMS olemia (ARH; Online Mendelian is phenotypically characterized by cutaneous xantho-
Inheritance in Man [OMIM] catalog mas, premature atherosclerotic coronary vascular dis-
ARH = autosomal recessive
hypercholesterolemia
number 603813) is a rare genetic disease ease (ASCVD), and atheromatous involvement of the
caused by disruptive variants in both alleles aortic valve. It was also reported that in ARH, LDL-C
ASCVD = atherosclerotic
coronary vascular disease of the low-density lipoprotein receptor may be lowered up to 65% by statin monotherapy
CHD = coronary heart disease (LDLR) adaptor protein-1 (LDLRAP1) gene (9–11) and up to 58% to 85% when more potent statins
HoFH = homozygous familial
(1). This gene, located on chromosome were combined with ezetimibe (9,12).
hypercholesterolemia 1p36.1, encodes a liver-specific LDLR chap- Despite this wealth of knowledge, several questions
LA = LDL-C apheresis erone that plays a crucial role in the endo- in the management and prognosis of ARH remain
LLM = lipid-lowering cytic internalization of LDLR-LDL complex unanswered. It is not known whether LDL-C control
medication in liver cells (2). Therefore, the lack of also is improved over time, considering the availability
LDL-C = low-density the functional LDLRAP1 protein markedly of novel lipid-lowering drugs. More importantly, it is
lipoprotein cholesterol impairs the removal of LDL (3) and, thereby, unknown how LDL lowering may influence the occur-
LDL-R = low-density raises plasma concentration of low-density rence of ASCVD and aortic valve stenosis. Although
lipoprotein receptor
lipoprotein cholesterol (LDL-C) up to 3 to 4 randomized studies assessing the impact of therapy on
LDLRAP1 = low-density
times above average (4–7). ARH is a genetic clinical events in this disorder are not feasible and
lipoprotein receptor adaptor
protein-1 gene disease with clinical similarity to homozy- unethical, analysis of changes in outcomes by using
LOF = loss of function
gous familial hypercholesterolemia (HoFH; real-life clinical data may be helpful in answering these
OMIM number 143890), a disorder caused questions. Therefore, the goals of the present study
by the presence of biallelic disruptive mutations in were to evaluate the changes and long-term effects of
the LDLR gene. Unlike HoFH, ARH is typically charac- lipid-lowering therapies (LLT) and their impact on
terized by a recessive mode of inheritance as both cardiovascular risk in the largest cohort of ARH patients
parents of index cases are normocholesterolemic (8). collected throughout a worldwide collaboration.
ARH is considered a rare disease with a worldwide
estimated prevalence of <1 in 106 population (8). METHODS
SEE PAGE 289
PATIENT EVALUATION. Available electronic data-
However, early investigations revealed a frequency bases (e.g., PubMed and MEDLINE) were searched up
of ARH heterozygotes of approximately 1:143 individ- to December 2015 for published ARH cases by using
uals among Sardinians, thus making ARH very com- the queries autosomal recessive hypercholesterolemia
mon in that population (8). Fellin et al. (9) recently (ARH) and LDLRAP1. The only inclusion criterion was
carried out a careful review of published cases that molecular confirmation of ARH. This search yielded
confirmed that ARH, in addition to severe several publications. All corresponding authors and
Medicine, University of Valencia, INCLIVA, CIBERDEM, Madrid, Spain; jServicio Endocrinología y Nutrición, Hospital Universitario
Josep Trueta, Girona, Spain; kDepartamento de Bioquímica y Biología Molecular y Celular, Facultad de Ciencias, Universidad de
Zaragoza & IIS Aragón, CIBERCV, Zaragoza, Spain; lInstituto Maimónides de Investigación Biomédica de Córdoba, Hospital Uni-
versitario Reina Sofía, Universidad de Córdoba, Córdoba, Spain, and Centro de Investigación Biomédica en Red de Fisiopatolgía de
m
la Obesidad y Nutrición, Instituto de Salud Carlos III, Madrid, Spain; Department of Biomedical Sciences, University of Cagliari
and Centre for Metabolic Diseases and Atherosclerosis, The ME.DI.CO Association, Cagliari, Italy; nDepartment of Internal Med-
icine, University of Genova, Genova, Italy; oCenter E. Grossi Paoletti, Dipartimento di Scienze Farmacologiche e Biomolecolari,
Universita’ degli Studi di Milano, and Dyslipidemia Center, Niguarda Hospital, Milan, Italy; pDipartimento Biomedico di Medicina
Interna e Specialistica, Università di Palermo, Palermo, Italy; qUnità Operativa Diabetologia e Malattie Metaboliche, Azienda
Ospedaliero Universitaria, Sassari, Italy; rDepartment of Clinical and Experimental Medicine, University of Sassari, Sassari, Italy;
s
Department of Molecular Innovation in Lipidology, National Cardiovascular Center Research Institute, Suita, Osaka, Japan;
t
University of Padova, Padova, Italy; uMedizinische Klinik und Poliklinik IV, Ludwig-Maximilians-Universität (LMU) Klinikum der
Universität München, Munich, Germany; vDepartment of Internal and Vascular Medicine, Academic Medical Center, University of
Amsterdam, Amsterdam, the Netherlands; and the wDepartment of Medical Sciences, University of Ferrara, Ferrara, Italy. This
work was partially supported by a grant from Aegerion Pharmaceuticals to Dr. Minicocci. Dr. Harada-Shiba has received grants
from Astellas Pharm, Takeda, Merck Sharp and Dohme, and Kaneka Medics. Dr. Roeters Van Lennep has received personal fees
from Aegerion through her institution; and grants from Dutch Heart Foundation. Dr. Masana has received personal fees from
Amgen, Sanofi, and Merck Sharp and Dohme. Dr. Cefalù has received personal fees from Aegerion. Dr. Arca has received grants
and personal fees from Aegerion, Amgen, and Sanofi. Dr. Averna has received grants and personal fees from Aegerion, Amgen,
and Sanofi. All other authors have reported that they have no relationships relevant to the contents of this paper to disclose.
Manuscript received July 7, 2017; revised manuscript received October 16, 2017, accepted November 6, 2017.
JACC VOL. 71, NO. 3, 2018 D’Erasmo et al. 281
JANUARY 23, 2018:279–88 Cardiovascular Risk in ARH
physicians known to treat HoFH were contacted and

T A B L E 1 Baseline Clinical Characteristics of ARH Patients
asked to provide clinical and follow-up information
about their published or unpublished ARH patients. Whole Cohort Men Women
(N ¼ 52) (n ¼ 24, 46.2%) (n ¼ 28, 53.8%)
The flowchart for patients’ identification is shown in
Age at first visit, yrs 31.1 ! 17.1 (2–70) 33.1 ! 17.6 (8–70) 29.1 ! 16.8 (2–59)
Online Figure 1. The collection of data was carried out
BMI, kg/m2 24.4 ! 5.0 (15.4–36.1) 25.4 ! 4.7 (16–33) 23.4 ! 5.2 (15.4–36.2)
according to a pre-specified protocol, as described Number of xanthomas 47 (90.4) 22 (91.7) 25 (89.3)
below. Smokers 5 (9.6) 2 (8.3) 3 (10.7)
Hypertension 9 (20.5) 5 (20.8) 4 (14.3)
DATA COLLECTION. Demographic characteristics,
Diabetes mellitus 2 (3.8) 1 (4.2) 1 (3.6)
medical history (with specific reference to previously ASCVD
diagnosed ASCVD and aortic valve stenosis), major CHD 9 (17.6) 5 (20.8) 4 (14.3)
coronary risk factors, medications both at referral Stroke 0 (0.0) 0 (0.0) 0 (0.0)
(baseline) and during follow-up, and information on Carotid artery stenosis* 1 (3.5) 0 (0.0) 1 (3.5)
new ASCVD events were collected. In patients who Aortic valve stenosis
Moderate 8 (15.4) 4 (16.7) 4 (14.3)
were referred before the discovery of the LDLRAP1
Severe 3 (5.8) 2 (8.3) 1 (3.6)
gene, the date of definitive diagnosis of ARH was
Plasma lipids, mg/dl
considered part of the baseline data. Plasma lipids Total cholesterol 638.9 ! 174.0 625.8 ! 162.4 650.1 ! 185.6
obtained at baseline and the best values observed (282–1,200) (381–1,040) (282–1,200)
during follow-up (defined as nadir value) were LDL-C 571.9 ! 171.7 563.7 ! 165.4 578.9 ! 179.6
(208–1,135) (299–986) (208–1,135)
collected. For those patients who were receiving
HDL-C 43.2 ! 11.5 40.9 ! 10.7 45.0 ! 11.9
LDL-C apheresis (LA) therapy, pre-apheresis lipid (19–71) (26–62) (19–71)
profile was considered. Triglycerides 131.5 ! 77.7 114.3 ! 61.1 146.1 ! 87.9
(29–522) (29–329) (57–522)
The follow-up period was defined as the time be-
tween the first and last available visit. The mean Values are mean ! SD (range) or n (%). *Patient showed left carotid artery stenosis >70%. The severity of aortic
follow-up was 14.0 ! 7.3 years (range: 1.0 to 28.0 years). valve stenosis was defined by ultrasonographic examination according to local protocols. CHD was defined as any
of the following: myocardial infarction, angina pectoris, or coronary revascularization.
ASCVD was defined as any of the following: 1) ARH ¼ autosomal recessive hypercholesterolemia; ASCVD ¼ atherosclerotic cardiovascular disease;
myocardial infarction; 2) newly diagnosed angina BMI ¼ body mass index; CHD ¼ coronary heart disease; HDL-C ¼ high-density lipoprotein cholesterol; LDL-
C ¼ low-density lipoprotein cholesterol.
pectoris; 3) coronary revascularization (percutaneous
transluminal coronary angioplasty and/or coronary
artery bypass grafting; also grouped as coronary heart
(SPSS Inc., Chicago, Illinois). Descriptive statistics
disease [CHD]); 4) severe (>70% stenosis) carotid
such as mean ! SD and ranges were estimated for all
atherosclerosis; 5) nonhemorrhagic stroke; and 6)
variables. Continuous variables were compared by
cardiovascular death. The aortic valve status was
Student’s t-test, whereas categorical variables were
evaluated by standard ultrasonographic examination
compared by chi-square or Fisher exact test. Differ-
as well as medical history of valve replacement. No
ences in lipid levels between therapies were tested
data for safety parameters or side effects during
for significance by using regression analysis,
treatment were collected.
including baseline values as covariates. To estimate
All procedures were followed in accordance with
the incident rate of ASCVD, the first event occurred
the ethical standards of the local institutional com-
during follow-up was considered. We estimated the
mittees on human experimentation and according to
time to first ASCVD event by using Kaplan-Meier
tenets of the Helsinki Declaration of 1964, as revised
survival curves. Survival curves were compared by
in 2013. No specific consent was provided for this
age and previous ASCVD events by using the log-rank
study, but living patients were appropriately
test. Cox proportional hazards model was applied to
informed and agreed to share their anonymous data
investigate the independent predictive role of the
for scientific purposes.
following characteristics: sex, age at first visit, pre-
GENETIC AND BIOCHEMICAL ANALYSES. Genetic vious CHD event, baseline LDL-C value, and smoking.
analyses were carried out at each collaborating site by Survival curves for aortic stenosis were not estimated
using standard sequencing protocols. Plasma lipids due to the small number of observed events. Results
were measured by standard techniques at each site. were expressed as hazard ratios (HR) with their 95%
LDL-C values were calculated by using the Friedewald confidence intervals (CIs). Finally, incidence rates
formula or direct assay according to local procedures. (IRs) for ASCVD were calculated and expressed as
No other biochemical analytes were provided. number of events per 10,000 patient-years with their
STATISTICAL ANALYSIS. All statistical analyses were 95% CI. IRs were calculated for the whole study
performed using SPSS/WIN software version 18.0 cohort and after categorization for sex, age, and
previous ASCVD events. IRs in the ARH cohort were

TABLE 2 Changes in Treatment
compared to those in the Italian general population
ARH (13). Due to the exploratory nature of our survey, we
Whole Cohort Men Women did not a priori determine a specific primary
Follow-up, yrs 14.1 ! 7.3 13.4 ! 7.8 14.6 ! 7 endpoint. Therefore, we used a 2-sided p value
First evaluation
of <0.05 as the level of statistical significance for all
No Tx 13 (26.5) 4 (19.0) 9 (32.1)
comparisons.
Only LA 27 (55.1) 13 (54.2) 14 (50)
Only LLM 8 (16.3) 4 (19) 4 (14.3)
LA plus LLM 1 (2.0) 0 (0.0) 1 (3.6) RESULTS
Number of medications NA NA NA
Follow-up BASELINE CHARACTERISTICS OF ARH COHORT. The
No Tx 0 (0.0) 0 (0.0) 0 (0.0) study cohort consisted of 52 genetically defined ARH
Only LA 1 (1.9) 0 (0.0) 1 (3.6) patients (24 men and 28 women) with complete lipid
Only LLM 24 (46.2) 7 (29.2) 17 (60.7)
and outcome data. Thirty-three subjects (63.5%) were
LA plus LLM 27 (51.9) 17 (70.8) 10 (35.7)
from Italy, 5 (9.6%) were from the Netherlands,
Medications
Rosuvastatin (mean dosage: 33.9 mg/day; 10 (19.2) 4 (16.7) 6 (21.4)
4 (7.7%) were from Spain, 4 (7.7%) were from Turkey,
range: 5–60 mg/day) 3 (5.8%) were from the Turkish–Syrian border, and
Atorvastatin (mean dosage: 55.7 mg/day; 14 (26.9) 4 (16.7) 10 (35.7) 3 (5.8%) were from Japan. Genotypes of patients are
range: 20–80 mg/day)
reported in Online Table 1. None of the patients was
Simvastatin (mean dosage: 40 mg/day; 6 (11.5) 1 (4.2) 5 (17.8)
range: 40–40 mg/day) carrying mutations in the LDLR and APOB genes.
Ezetimibe, 10 mg/day 23 (44.2) 8 (33.3) 15 (53.6) Twelve different LDLRAP1 mutations (including
Lomitapide (mean dosage: 15.8 mg/day; 6 (11.5) 1 (4.2) 5 (17.9) 2 major rearrangements) in LDLRAP1 were detected;
range: 5–40 mg/day)
8 of them predict the presence of a truncated ARH
Resins, g/day 6 (11.5) 3 (12.5) 3 (10.7)
protein. Thirty-nine patients were simple homozy-
Values are mean ! SD or n (%). Follow-up therapies are those prescribed at a nadir of low-density lipoprotein gotes, and 13 were compound heterozygotes. The
cholesterol. Data for LLT at baseline were not available in 4 patients. Types of statins prescribed during follow-up
were reported in 35 subjects.
most common pathogenic variants were p.(Trp22*)
ARH ¼ autosomal recessive hypercholesterolemia; LA ¼ lipoprotein apheresis; LLM ¼ lipid-lowering and p.(Ala145Serfs*26), which were present in 26.9%
medications; LLT ¼ lipid-lowering therapies; NA ¼ not available; Tx ¼ therapies.
and 53.8% of patients, respectively. This is because
these genetic variants are common among Sardinian
cases of ARH (4,14), which represented the largest
subgroup in our cohort.
Table 1 summarizes the baseline clinical features of
study cohort. Age at first visit was 31.3 ! 17.1 years,
F I G U R E 1 Individual LDL-C Reduction at Nadir
46.2% of patients were men, and 90% showed xan-
thomas. Moreover, 17.6% reported a history of CHD,
0 with a numerically but not statistically higher preva-
lence in men than in women. Eleven patients (21.1%)
showed aortic valve stenosis, which was reported to
LDL-C Reduction from Baseline (%)
–20
be severe in 5.8%. As expected, baseline LDL-C levels
were markedly elevated without significant differ-
–40
ences between sexes. Compared to ARH patients
without ASCVD, ARH patients with ASCVD at baseline
were older (49.2 ! 15.1 years of age vs. 27.1 ! 15.0
–60 years of age; p < 0.001), more often had diabetes
(20.0% vs. 0%, respectively; p ¼ 0.006), had lower
LDL-C concentrations (467.4 ! 138.2 mg/dl vs. 598.0
–80 ! 170.9 mg/dl, respectively; p ¼ 0.03), and reported
higher usage of LLT (100.0% vs. 68.4%, respectively;
p ¼ 0.05).
–100
EVOLUTION OF TREATMENT AND LIPID CONTROL.

Data are reported as individual percentage reduction from baseline to nadir of LDL-C, The evolution of treatment in ARH patients is
observed during follow-up. LDL-C ¼ low-density lipoprotein cholesterol. described in Table 2. At baseline, 55.1% were receiving
only LA, and 16.3% were receiving only lipid-lowering
medications (LLM). Approximately one-fourth of

FIGURE 2 LDL-C Changes by Lipid-Lowering Therapies
subjects were not receiving any LLT. No information
about the type of medications at baseline could
be retrieved. During follow-up, a progressive 1.200
improvement of treatment was observed. At last visit,
51.9% of ARH patients were taking LLMs in addition
to LA, and the remaining 46.2% were treated only 1.000
with LLMs; in 1 patient, only LA monotherapy was
used. In many patients, a high-intensity statin
regimen alone or in combination with ezetimibe was 800
used. Six patients were receiving lomitapide in com-
LDL-C (mg/dl)
bination with the other LLMs; the mean duration of
this combined treatment was 1.3 ! 0.9 years with a 600
mean dosage of 15.8 mg/day (range: 5 to 40 mg/day).
It is noteworthy that women were preferentially
treated only with LLTs (including lomitapide), 400
whereas the combination with LA was more

commonly used in men (p ¼ 0.05).
The more intensive treatment was associated with 200
a significant improvement of lipid profile. The nadir

of LDL-C during follow-up in the whole ARH cohort
0
was 164.0 ! 85.1 mg/dl, corresponding to a mean
reduction of 69.6 ! 16.9% from baseline. The benefit
LLM LLM Plus LA LLM Plus Lomitapide
of LLT extended to the whole lipid profile with a
Baseline Nadir During Follow-Up
significant reduction of total cholesterol (61.9 !
16.9%; p < 0.001) and total triglycerides (21.4 !
45.3%; p < 0.01) at nadir. HDL-C showed a slight LDL-C values at baseline and at nadir during follow-up were reported. The box plots give
the median levels (middle horizontal line in each box), the interquartile ranges (top and
improvement, with a nadir mean value of 45.9 !
bottom of each box), and outliers falling below the fifth percentile or above the 95th
11.2 mg/dl compared to the baseline value of 43.1 ! percentile (points below or above the vertical lines, respectively). LLM indicate statins,
11.5 mg/dl (p ¼ 0.07). However, only 23.1% and 11.5% ezetimibe, and resins. LA ¼ lipoprotein apheresis; LLM ¼ lipid-lowering medications;
of ARH patients achieved the LDL-C goals of <100 and other abbreviations as in Figure 1.
70 mg/dl as recommended for primary and secondary

prevention, respectively (15). Comparable changes
were observed in men and women (data not shown).
However, a large interindividual variability in the that 100% and 83.3% of ARH patients in group 3
lipid-lowering response was seen, as the nadir of reached a nadir LDL-C value of <100 and 70 mg/dl,
LDL-C percentage of reduction ranged from 18.9% to respectively. In contrast, in group 1, only 16.7%
94.3% (Figure 1). reached an LDL-C of <100 mg/dl (none: <70 mg/dl),
To explore the effects of different LLTs on LDL-C whereas in group 2, 10.7% and 3.6%, respectively,
reduction, we divided the cohort into 3 groups ac- achieved these targets.
cording to the use of statin alone or in association
with ezetimibe (group 1: n ¼ 18), statin with or CARDIOVASCULAR OUTCOMES. During follow-up,
without ezetimibe together with LA (group 2: n ¼ 28), 12 nonfatal and 2 fatal ASCVD events were recorded
and the addition of lomitapide to the other LLTs in the ARH cohort, giving an overall incidence of
(group 3: n ¼ 6). It must be noted that 2 of these pa- 26.9% (1.9% per year) (Table 3). Six new events were
tients stopped LA 2 to 3 months after the addition of observed in ARH patients without ASCVD at baseline,
lomitapide and that the reported nadir lipid results thus providing an incidence rate of 14.2% (i.e., 1.0%
were without LA treatment. Compared to baseline, per year) in this subgroup. One Italian patient died
LDL-C nadir values were 62.0 ! 22.3% (range: 18.9 to due to the progression of aortic valve stenosis and
88.4) lower in group 1, 70.6 ! 10.3% lower (range: complications related to replacement surgery,
36.2 to 89.1) in group 2, and 88.3 ! 5.0% (range: 82.7 whereas 1 patient from Japan died of non-ASCVD-
to 94.3) lower in group 3 (Figure 2). The differences in related cause. The rates of incident ASCVD were
LDL-C lowering among groups were statistically sig- comparable in men and women (29.2% and 25%,
nificant (p ¼ 0.002 for trend). It is interesting to note, respectively; p ¼ 0.73). The mean age at the time of
Kaplan-Meier survival analyses showed that the

TABLE 3 Cardiovascular Outcomes in ARH Cohort During Follow-Up
overall median event-free survival in the ARH cohort
Whole Cohort Men Women was 24 years, and this did not differ between men and
ASCVD 14 (26.9) 7 (29.2) 7 (25.0) women (Online Figure 2). However, when patients
Fatal 2 (3.8) 0 (0.0) 2 (7.1)
were categorized according to age and the presence of
Nonfatal 12 (23.1) 7 (29.2) 5 (17.9)
ASCVD at baseline, event-free survival time was
Type
MI 5 (9.6) 2 (8.3) 3 (10.7)
lower in patients at 30 years of age or younger (log-
Coronary procedures rank test: p ¼ 0.0003) (Figure 3A) and in patients with
PCI 3 (5.8) 3 (12.5) - ASCVD at baseline (Figure 3B) (log-rank test:
CABG 8 (15.4) 4 (16.7) 4 (14.3) p < 0.0001). Finally, the results of the multivariate
Cerebrovascular events (TIA, stroke) 0 (0.0) 0 (0.0) 0 (0.0) Cox regression analysis including age, sex, smoking,
Carotid artery stenosis* 1 (3.5) 0 (0.0) 1 (3.5)
baseline LDL-C, and history of ASCVD (Online Table 2)
Estimated ASCVD IRs
demonstrated that age was the only significant inde-
Overall ARH 203 (97–310) 227 (59–394) 184 (48–321)
pendent predictor of recurrent ASCVD (p ¼ 0.001),
ARH without ASCVD 85 (11–160) 90 (0–193) 78 (0–187)
ARH with ASCVD 882 (306–1,459) 833 (17–1650) 926 (114–1,738)
with risk increasing by 8% for each year increase in
General population NA 33.9 9.5 age. Baseline history of ASCVD was associated with
Overall relative risk ratio – 6.7 (1.7–11.6) 19.4 (5.1–33.8) almost 3-fold higher risk of a recurrent ASCVD event,
Without ASCVD – 2.7 (0–5.7) 8.2 (0–19.7) although this association did not reach statistical
With ASCVD – 24.6 (0.5–48.7) 97.5 (12–182.9) significance (p ¼ 0.09).
Aortic valve stenosis†
During follow-up, 6 new cases of aortic valve ste-
Moderate 1 (1.9) – 1 (3.6)
nosis were recorded (1 classified as moderate and 5 as
Severe 5 (9.6) 1 (4.9) 4 (14.3)
severe), thus giving an overall incidence of this
Death from complications related to 1 (1.9) – 1 (3.4)
aortic valve stenosis complication of 11.5% (0.8% per year). Among these
patients, 3 underwent valve replacement surgery. For
Values are n (%), n (range), or %. *Patient showed severe bilateral carotid stenosis (>70%) and underwent
revascularization. †Evaluation of aortic valve status during follow-up was available in 45 patients. IRs are re- the remaining 3 patients, we were not able to retrieve
ported per 10,000 person-years (95% confidence interval). Relative risk was calculated as ARH IRs/IRs general
information about the clinical management of aortic
population.
CABG ¼ coronary artery bypass graft; IRs ¼ incidence rates; MI ¼ myocardial infarction; PCI ¼ percutaneous stenosis. Of note, 3 times more women than men
coronary intervention; TIA ¼ transient ischemic attack; other abbreviations as in Table 1.
developed this complication (14.2% vs. 4.2%,
respectively; p ¼ NS).
the new ASCVD episode was 50.6 ! 13.8 years of age DISCUSSION
(range: 31 to 72 years). In our population, the most
common incident ASCVD event was coronary revas- The results of this study, involving a large cohort of
cularization (21.2%). For 2 patients with CHD, we did ARH patients, highlighted 2 major findings. First, the
not have information about the treatment given; study demonstrated the poor cardiovascular prog-
another patient who experienced CHD during follow- nosis of these patients. During the 14-year follow-up,
up was currently treated only with medical therapy 26.9% of them had a new episode of ASCVD, and
due to the high risk associated with surgical revas- 11.5% had a new diagnosis of aortic valve stenosis,
cularization. No incident stroke was recorded. All corresponding to an absolute risk of 1.9% per year and
fatal cardiovascular events occurred in women; 2 died 0.8% per year, respectively (Central Illustration).
of fatal coronary heart disease and 1 because of pro- Moreover, the median ASCVD event-free survival was
gression of aortic valve stenosis. The mean age of 24 years in the overall cohort and was dramatically
death in these patients was 52.0 ! 9.1 years. lower (10 years) in ARH patients who had established
To estimate the actual ASCVD risk associated with CHD at entry. Compared to the general Italian popu-
ARH, we compared the incidence rate of ASCVD in our lation, treated ARH patients showed a 6-fold and 19-
cohort with that reported in the Italian general pop- fold higher risk of ASCVD in men and women,
ulation standardized for a comparable follow-up respectively. The explanation for this sex difference
period (13). Because the data in the whole general is unclear. The apparently less aggressive LLT in
population were not available, we performed the women seems unlikely as the percentage of LDL-C
comparison after categorization for sex (Table 3). ARH reductions were not different between sexes. The
males showed a 6-fold and females a 19-fold higher most plausible explanation is that ARH abolishes the
risk of incident ASCVD than individuals in the general cardiovascular protection usually observed in pre-
population. menopausal women.
FIGURE 3 Kaplan-Meier Survival Curves for Incident ASCVD
A B
1 1
0.9 0.9
0.8 0.8
Survival Probability
Survival Probability
0.7 0.7
0.6 0.6
0.5 0.5
0.4 0.4
0.3 0.3
0.2 0.2
0.1 0.1
0 0
0 5 10 15 20 25 30 0 5 10 15 20 25 30
Years Years
<30 ≥30 No CHD CHD
Kaplan-Meier survival curves for incident ASCVD according to (A) age and (B) CHD at baseline. Log-rank test p ¼ 0.0003 for ASCVD according to age at first visit;
log-rank test p < 0.0001 for ASCVD according to previous CHD. Label “years” defines the time free of new ASCVD event during follow-up. ASCVD ¼ atherosclerotic
cardiovascular disease; CHD ¼ coronary heart disease.
ARH shares clinical similarities with HoFH due to during the follow-up. This provided an estimated
LDLR mutations, and previous studies have sug- incidence rate of 0.8% per year. Remarkably, this
gested that the ASCVD risk in ARH may be lower than complication appeared to be more frequent in women
in HoFH (7,16). A direct comparison between these 2 than in men. Comparable estimates in HoFH patients
disorders is not available. However, the exploration are scanty. In the SAFEHEART registry, the preva-
for published data may be useful in addressing this lence of aortic stenosis was found to be 19%, but no
question. In a retrospective study by Thompson et al. incidence data were reported (18). In the UK (United
(17), which included 44 HoFH patients (7 with ARH) Kingdom) HoFH cohort, 21 patients developed aortic
followed for 50 years, CAD occurred in 33 patients valve stenosis during the 50 years of follow-up, with
(75%), thus providing an estimated incident rate an estimated incidence rate of 0.9% per year (21). This
of approximately 1.5% per year. Moreover, the figure is comparable to that in the present study,
SAFEHEART (Spanish Familial Hypercholesterolemia strongly suggesting that the risk of aortic valve ste-
Cohort Study) registry (including also 3 ARH patients) nosis in ARH is similar to that in HoFH.
reported ASCVD events in 3 HoFH patients (9.7%) It is interesting to note that none of the ARH pa-
during a follow-up of about 7 years thus giving an tients experienced stroke during follow-up. To some
incidence rate of about 1.4% per year (18). Finally, in a extent, this may be surprising, but the lack of a
recent French report considering 53 HoFH patients detailed evaluation of atherosclerosis in carotid or
followed for almost 30 years, the new ASCVD events cerebral arteries prevents drawing any convincing
were 28 (53%), translating into an incidence rate of explanation for this finding. Further studies are
1.8% per year (19). The study by Raal et al. (20) pro- needed to clarify this point.
vided higher ASCVD incidence rates (3.1% per year), Age and history of ASCVD were found to be
but it must be considered that in that study no HoFH significant predictors of incident ASCVD in ARH.
patient received LA and their mean LDL-C concen- In particular, cardiovascular prognosis was the worst
trations during follow-up remained markedly in patients who were referred at $30 years of age.
elevated (451.6 ! 131.2 mg/dl). Taken together with Conversely, baseline LDL-C did not predict the recur-
our results, these findings suggest that treated ARH rence of ASCVD. Similar findings have been observed
have incident rates of ASCVD, comparable to those of in HoFH (19) and may be explained by the fact that the
classic HoFH patients. cumulative cholesterol exposure rather than baseline
Another clinical complication that has been re- LDL-C levels determine the risk of new ASCVD
ported to be in common between ARH and HoFH is in severe forms of hypercholesterolemia (19,22).
aortic valve stenosis. In our retrospective analysis, we Unfortunately, we were unable to estimate the total
found that 21.2% of patients showed aortic stenosis at cholesterol burden in our ARH patients. Nevertheless,
baseline and that approximately 11.5% developed it considering that the best achieved LDL-C was
C E NTR AL IL L USTR AT IO N Long-Term Outcomes in Patients With Autosomal Recessive Hypercholesterolemia:

Retrospective Analysis of a Worldwide Cohort
D’Erasmo, L. et al. J Am Coll Cardiol. 2018;71(3):279–88.
A summary of clinical and biochemical characteristics of ARH is shown. The role of ARH protein is shown in the liver. The LDLRAP1 gene is located on chromosome
1p36.11 (exome 9) and encodes an adaptor protein that interacts with the cytoplasmic tail of LDLR, phospholipids, and components of the clathrin mediating the
positioning of LDLR to coated pit. It is involved in the endocytic machinery of the LDL-LDLR complex in the liver, mediating internalization of the LDL-LDLR complex (Left).
The prevalence of worldwide ARH is estimated to be <1 in 5 $ 106 population, but in the selected population of Sardinia, Italy, a frequency of ARH heterozygotes
of approximately 1:143 individuals has been reported. As few clinical data are available for outcomes in these patients, we decided to perform a retrospective
collaborative study to answer this question. (Middle) The best LDL-C value achieved by each patient during follow-up is reported in Figure 1. As represented, there is
large interindividual variability in the response to lipid-lowering therapies, and only the 23.1% of ARH patients achieved the LDL-C target of <100 mg/dl. (Right) We
reported the prevalence of new ASCVD events and aortic valve stenosis progression during follow-up (Figure 2). AP-2 ¼ adaptor protein complex 2; ARH ¼ autosomal
recessive hypercholesterolemia; ASCVD ¼ atherosclerotic cardiovascular disease; CCP ¼ clathrin-coated pit; CCV ¼ clathrin-coated vesicle; LDL-C ¼ low-density
lipoprotein cholesterol; LDL-LDLR ¼ low-density lipoprotein–low-density lipoprotein receptor complex; LDLR ¼ low-density lipoprotein receptor.
approximately 164 mg/dl and that only 23.1% of reported in HoFH subjects, where the addition of
patients reached LDL-C of at least <100 mg/dl, we lomitapide to conventional treatments allowed
could speculate that these patients remained exposed achievement of mean percentage of LDL-C changes
to an exceedingly high level of atherogenic LDL-C. ranging between "45.5% to "68.2% and an LDL-C
Despite the improvement in lipid-lowering treat- level of <70 mg/dl in 47% to 58% of treated patients
ment during recent years, the management of LDL-C (23,24). The finding that lomitapide might be a useful
levels in ARH patients remains far from being satis- drug for improving LDL-C control in ARH warrants
factory. However, ARH patients showed a great vari- further evaluation. An alternative therapeutic option
ability in their lipid-lowering response as some would be the use of PCSK9 inhibitors, but none of the
patients displayed up to 90% reduction of their LDL-C patients in our cohort received these medications. It is
levels whereas others did not reach the 20% LDL-C noteworthy that the TAUSSIG (Trial Assessing Long
level despite maximum therapy. Given the retrospec- Term USe of PCSK9 Inhibition in Subjects With Genetic
tive nature of this study, there were no reliable data LDL Disorders) trial reported an LDL-C reduction of
for compliance, which could explain this phenome- 15% in 5 ARH patients receiving 420 mg of evolocumab
non. Nevertheless, it is worth mentioning that ARH subcutaneously monthly (25), and more recently, a
patients who received the microsomal triglyceride 32.7% decrease in LDL-C was seen in 1 ARH patient
transfer protein inhibitor lomitapide in addition to treated with evolocumab, 140 mg twice monthly (26).
the maximal LLM showed a mean LDL-C nadir
level of 55.7 ! 17.5 mg/dl ("88% from baseline). STUDY LIMITATIONS. We must acknowledge some
Moreover, 83% of them achieved a LDL-C nadir strengths and limitations of the present study. To our
level of <70 mg/dl. These figures are higher than those knowledge, this is the largest longitudinal study
involving ARH that reflects real-life clinical care, and The demonstration that cardiovascular prognosis
it is the first study to provide information about the significantly deteriorates when the diagnosis and
ASCVD risk in this rare lipid disorder. Nevertheless, therapy are initiated after 30 years of age support this
there are several limitations that deserve to be taken indication. Although the clinical management of ARH
into account. Limitations are related mainly to the has significantly improved in recent years, it is far
retrospective nature of our analysis. Clinical data from optimal. Our findings reinforce the importance of
were obtained from medical records, and in some evaluating the effects of new treatments, in addition
patients, we were not able to retrieve complete clin- to optimized established therapies, to improve the
ical data. However, we did not have the possibility to cardiovascular prognosis in these high-risk patients.
estimate the adherence to treatments as well, as we ACKNOWLEDGMENTS The authors thank all physi-
did not consider that lipid-lowering regimens might cians worldwide who are following patients with ARH
have been changed during the observation. ASCVD disease and patients who contributed to this study.
events were not diagnosed according to a standard- Dr. D’Erasmo received a fellowship to complete the
ized protocol, but they were confirmed by a careful PhD program in Biotechnology in Clinical Medicine,
review of clinical records. Moreover, the study design Sapienza University, Rome, Italy.
has also limited the use of sophisticated statistical
modeling to evaluate the ASCVD risk. We did not a ADDRESSES FOR CORRESPONDENCE: Dr. Laura
priori identify specific primary endpoints. However, D’Erasmo, Dipartimento di Medicina Interna e
it must be considered that our survey was aimed at Specialità Mediche, Sapienza Università di Roma,
describing the natural history of ARH, and it is very Azienda Policlinico Umberto I, Viale del Policlinico,
difficult to establish a priori power analysis for out- 155, 00161 Rome, Italy. E-mail: derasmolaura@gmail.
comes in an ultrarare disease such as ARH. The com. OR laura.derasmo@uniroma1.it. OR Dr. Marcello
largest proportion of enrolled patients was from Sar- Arca, Dipartimento di Medicina Interna e
dinia, thus limiting the possibility to extrapolate Specialità Mediche, Sapienza Università di Roma,
present results to all ARH patients. Furthermore, Azienda Policlinico Umberto I, Viale del Policlinico, 155,
given the rarity of the disease and its recessive in- 00161 Rome, Italy. E-mail: marcello.arca@uniroma1.it.
heritance, a subset of patients was related and this
may have weakened conclusions about clinical man-
agement and outcomes. Finally, the crude compari- PERSPECTIVES
son between ASCVD risk in ARH and that in the
general population should be considered with caution COMPETENCY IN SYSTEMS-BASED PRACTICE: ARH is a
because there are several confounders with this kind rare, genetic form of severe hypercholesterolemia caused by
of approach. Our rationale for this choice was that mutations in the gene encoding the adaptor protein LDLRAP1
most patients included in the study cohort were from that modulates internalization of the LDL-LDLR. Patients with
Italy. We have standardized the comparison for sex ARH have inadequate responses to lipid-lowering therapy, which
and time period but not for medications or concomi- translates to an elevated residual risk of ischemic events.
tant cardiovascular diseases.
TRANSLATIONAL OUTLOOK: Clinical trials are needed to
CONCLUSIONS
determine the optimum long-term management strategy for
patients with ARH, including evaluation of novel lipid-lowering
Our observations indicate that ARH is a serious con-
therapies.
dition that requires early diagnosis and prompt
initiation of an aggressive lipid-lowering therapy.
REFERENCES
1. Garcia CK, Wilund K, Arca M, et al. Autosomal 3. Zuliani G, Arca M, Signore A, et al. Characterization 5. Soutar AK, Naoumova RP, Traub LM. Genetics,
recessive hypercholesterolemia caused by muta- of a new form of inherited hypercholesterolemia: clinical phenotype, and molecular cell biology of
tions in a putative LDL receptor adaptor protein. familial recessive hypercholesterolemia. Arterioscler autosomal recessive hypercholesterolemia. Arte-
Science 2001;292:1394–8. Thromb Vasc Biol 1999;19:802–9. rioscler Thromb Vasc Biol 2003;23:1963–70.
2. Garuti R, Jones C, Li WP, et al. The modular 4. Arca M, Zuliani G, Wilund K, et al. 6. Fellin R, Zuliani G, Arca M, et al. Clinical
adaptor protein autosomal recessive hypercho- Autosomal recessive hypercholesterolaemia in and biochemical characterization of patients
lesterolemia (ARH) promotes low-density lipo- Sardinia, Italy, and mutations in ARH: a clinical with autosomal recessive hypercholesterolemia
protein receptor clustering into clathrin-coated and molecular genetic analysis. Lancet 2002;359: (ARH). Nutr Metab Cardiovasc Dis 2003;13:
pits. J Biol Chem 2005;280:40996–1004. 841–7. 278–86.
7. Pisciotta L, Priore Oliva C, Pes GM, et al. Auto- 15. Cuchel M, Bruckert E, Ginsberg HN, et al. Eu- 22. Schmidt HH, Hill S, Makariou EV, et al. Relation
somal recessive hypercholesterolemia (ARH) and ropean Atherosclerosis Society Consensus Panel on of cholesterol-year score to severity of calcific
homozygous familial hypercholesterolemia (FH): a familial hypercholesterolaemia. Homozygous fa- atherosclerosis and tissue deposition in homozy-
phenotypic comparison. Atherosclerosis 2006; milial hypercholesterolaemia: new insights and gous familial hypercholesterolemia. Am J Cardiol
188:398–405. guidance for physicians to improve detection and 1996;77:575–80.
clinical management. A position paper from the
8. Sniderman AD, Tsimikas S, Fazio S. The severe 23. D’Erasmo L, Cefalù AB, Noto D, et al. Efficacy
Consensus Panel on familial hypercholesterolaemia
hypercholesterolemia phenotype, clinical diag- of lomitapide in the treatment of familial homo-
of the European Atherosclerosis Society. Eur Heart
nosis, management, and emerging therapies. J Am zygous hypercholesterolemia: results of a real-
J 2015;35:2146–57.
Coll Cardiol 2014;63:1935–47. world clinical experience in Italy. Adv Ther 2017;
16. Naoumova RP, Neuwirth C, Lee P, et al. 34:1200–1.
9. Fellin R, Arca M, Zuliani G, et al. The history of Autosomal recessive hypercholesterolaemia: long- 24. Blom DJ, Averna MR, Meagher EA, et al.
autosomal recessive hypercholesterolemia (ARH). term follow-up and response to treatment. Long-term efficacy and safety of the microsomal
From clinical observations to gene identification. Atherosclerosis 2004;174:165–72. triglyceride transfer protein inhibitor lomitapide
Gene 2015;555:23–32.
17. Thompson GR, Seed M, Naoumova RP, et al. in patients with homozygous familial hypercho-
10. Marais AD, Raal FJ, Stein EA, et al. A dose- Improved cardiovascular outcomes following lesterolemia. Circulation 2017;136:332–5.
titration and comparative study of rosuvastatin temporal advances in lipid-lowering therapy in a 25. Raal FJ, Hovingh GK, Blom D, et al. Long-term
and atorvastatin in patients with homozygous fa- genetically-characterized cohort of familial treatment with evolocumab added to conven-
milial hypercholesterolaemia. Atherosclerosis hypercholesterolaemia homozygotes. Atheroscle- tional drug therapy, with or without apheresis, in
2008;197:400–6. rosis 2015;243:328–33. patients with homozygous familial hyper-
11. Muntoni S, Pisciotta L, Muntoni S, et al. Phar- cholesterolaemia: an interim subset analysis of the
18. Alonso R, Díaz-Díaz JL, Arrieta F, et al. Clinical
macological treatment of a Sardinian patient open-label TAUSSIG study. Lancet Diabetes
and molecular characteristics of homozygous fa-
affected by autosomal recessive hypercholester- Endocrinol 2017;5:280–90.
milial hypercholesterolemia patients: insights
olemia (ARH). J Clin Lipidol 2015;9:103–6. from SAFEHEART registry. J Clin Lipidol 2016;10: 26. Fahy EF, McCarthy E, Steinhagen-Thiessen E,
12. Lind S, Olsson AG, Eriksson M, et al. Autosomal 953–61. et al. A case of autosomal recessive hypercholes-
recessive hypercholesterolemia: normalization of terolemia responsive to proprotein convertase
19. Bruckert E, Kalmykova O, Bittar R, et al. Long
plasma LDL cholesterol by ezetimibe in combina- subtilisin/kexin 9 inhibition. J Clin Lipidol 2017;11:
term outcome in 53 patients with homozygous
tion with statin treatment. J Intern Med 2004; 287–8.
familial hypercholesterolaemia in a single centre in
256:406–12. France. Atherosclerosis 2017;257:130–7.
13. National Centre for Disease Prevention and 20. Raal FJ, Pilcher GJ, Panz VR, et al. Reduction KEY WORDS atherosclerotic cardiovascular
Control, Ministry of Health, Rome. [The heart in mortality in subjects with homozygous familial disease, autosomal recessive
project: epidemiology and prevention of cerebral hypercholesterolemia associated with advances in hypercholesterolemia, follow-up,
and cardiovascular diseases.] Available at: http:// lipid-lowering therapy. Circulation 2011;124: lipid-lowering therapies, retrospective
www.cuore.iss.it/. Accessed March 1, 2017. 2202–7. analysis
14. Filigheddu F, Quagliarini F, Campagna F, et al. 21. France M, Rees A, Datta D, et al., for the HEART
Prevalence and clinical features of heterozygous UK Medical Scientific and Research Committee.
carriers of autosomal recessive hypercholester- HEART UK statement on the management of A PPE NDI X For supplemental figures and
olemia in Sardinia. Atherosclerosis 2009;207: homozygous familial hypercholesterolaemia in the tables, please see the online version of
162–7. United Kingdom. Atherosclerosis 2016;255:128–9. this paper.
Clin Investig Arterioscler. 2017;29(6):248---253
www.elsevier.es/arterio
ORIGINAL
Registro Nacional de Dislipemias de la Sociedad

Española de Arteriosclerosis: situación actual
Sofía Pérez-Calahorra a,∗ , Rosa M. Sánchez-Hernández b , Núria Plana c , Pedro Valdivielso d
y Fernando Civeira a,e
a
Unidad Clínica y de Investigación en Lípidos y Arteriosclerosis, Hospital Universitario Miguel Servet, Instituto de Investigación
Sanitaria (IIS) Aragón, Centro de Investigación Biomédica en Red de Enfermedades Cardiovasculares (CIBERCV), Zaragoza, España
b
Servicio de Endocrinología y Nutrición, Hospital Universitario Insular de Gran Canaria, Instituto Universitario de Investigaciones
Biomédicas y Sanitarias de la Universidad de Las Palmas de Gran Canaria, Las Palmas de Gran Canaria, España
c
Unitat de Medicina Vascular i Metabolisme, Hospital Universitari Sant Joan de Reus, Universitat Rovira i Virgili, Institut
d’Investigació Sanitària Pere Virgili (IISPV), Centro de Investigación Biomédica en Red de Diabetes y Enfermedades Metabólicas
Asociadas (CIBERDEM), Reus, Tarragona, España
d
Servicio de Medicina Interna, Departamento de Medicina y Dermatología, Hospital Universitario Virgen de la Victoria, Instituto
de Biomedicina de Málaga (IBIMA), Universidad de Málaga, Málaga, España
e
Universidad de Zaragoza, Zaragoza, España
Recibido el 2 de agosto de 2017; aceptado el 13 de septiembre de 2017

Disponible en Internet el 2 de noviembre de 2017
PALABRAS CLAVE Resumen

Registro; Introducción: Los registros clínicos son una herramienta muy eficaz para comprobar la práctica
Dislipemias; clínica habitual, comparar estrategias y mejorar el conocimiento de diferentes procedimientos
Hipercolesterolemia diagnósticos y terapéuticos.
familiar; Métodos: El Registro Nacional de Dislipemias de la Sociedad Española de Arteriosclerosis (SEA)
Sociedad Española de es una base de datos on-line, retrospectiva y prospectiva, donde las diferentes unidades de
Arteriosclerosis lípidos españolas acreditadas por la SEA introducen datos de pacientes con trastornos del
metabolismo lipídico.
Resultados: El registro fue creado en 2013, y desde entonces datos clínicos, analíticos, gené-
ticos y evolutivos de 4.449 pacientes han sido introducidos hasta junio de 2017. En el último
año el registro ha dado pie a un número considerable de publicaciones internacionales y exis-
ten varias más en desarrollo. Se ha iniciado un ambicioso plan de incentivación de inclusión
de pacientes para conseguir que el registro de la SEA sea un referente mundial que ayude a
mejorar el conocimiento y el manejo clínico de estos pacientes.
Conclusión: Desde el grupo coordinador del registro animamos a todos los socios de la SEA a
colaborar en el mismo en las múltiples formas que el registro permite, y conseguir que sea una
referencia científica internacional.
© 2017 Publicado por Elsevier España, S.L.U. en nombre de Sociedad Española de Arterioscle-
rosis.
∗ Autor para correspondencia.

Correo electrónico: sperezc@iisaragon.es (S. Pérez-Calahorra).
http://dx.doi.org/10.1016/j.arteri.2017.09.001
0214-9168/© 2017 Publicado por Elsevier España, S.L.U. en nombre de Sociedad Española de Arteriosclerosis.
Registro Nacional de Dislipemias de la Sociedad Española de Arteriosclerosis 249
KEYWORDS National Dyslipidemia Registry of the Spanish Arteriosclerosis Society: Current status
Registry;
Abstract
Dyslipidemias;
Introduction: Clinical registries are a very effective tool to verify the usual clinical practice,
Familial hypercholes-
to compare clinical strategies and to improve the knowledge of diagnostic and therapeutic new
terolemia;
procedures.
Spanish
Methods: The National Registry of Dyslipemias of the Spanish Society of Arteriosclerosis (SEA)
Atherosclerosis
is an on-line, retrospective and prospective database where the different Spanish lipid units
Society
accredited by the SEA introduce data from patients with disorders of lipid metabolism
Results: The registry was created in 2013, and since then clinical, analytical, genetic and evo-
lutionary data of 4,449 patients have been introduced until June 2017. In the last year the
registry has given rise to a considerable number of international publications and there are
several more in progress. An ambitious incentive plan for inclusion of patients has been ini-
tiated to get the SEA registry as a global reference that helps to improve the knowledge and
clinical management of these patients.
Conclusions: From the coordinating group of the registry we encourage all SEA partners to
collaborate in the multiple forms that the registry allows, and to make it an international
scientific reference.
© 2017 Published by Elsevier España, S.L.U. on behalf of Sociedad Española de Arteriosclerosis.
Introducción estructura, los proyectos, la situación actual de inclusión de

pacientes y los planes para un futuro próximo.
El Registro Nacional de Dislipemias de la Sociedad Española El Registro permite disponer de una herramienta cien-
de Arteriosclerosis (SEA) es un registro nacional, online tífica para mejorar el conocimiento de los trastornos
(http://www.rihad.es), anonimizado y multicéntrico, donde del metabolismo de los lípidos en España. Está diseñado
un número importante de unidades de lípidos distribuidas para que, de forma sencilla y con una metodología
a lo largo de las diferentes comunidades autónomas de común para todos los proyectos y todas las unidades de lípi-
España introducen la información de pacientes atendidos en dos, permita obtener una información objetiva de calidad,
dichas unidades con algún trastorno en el metabolismo de retrospectiva y prospectiva. Registrar simultáneamente por
los lípidos. Todas las unidades de lípidos participantes en parte de las unidades de lípidos una gran cantidad de
el registro han sido acreditadas por la SEA y al menos su información online ---datos sociodemográficos, antecedentes
responsable debe ser miembro activo de dicha sociedad. El de historia familiar y personal, datos analíticos con y sin
actual registro de dislipemias tiene como precedente aquel tratamiento, datos genéticos, datos del tratamiento hipoli-
que fue creado en 2011 con el acrónimo «RIHAD», cuyo pemiante y otros tratamientos del paciente---, hacerlo bajo
objetivo fue crear un único registro de pacientes con hiper- unos criterios de calidad al ser obtenida en las diferentes
colesterolemia autosómica dominante con estudio genético unidades de lípidos por profesionales clínicos cualificados, y
del gen del receptor LDL (LDLR), y que fue concebido y abarcar todas las comunidades españolas hacen que el Regis-
puesto en marcha por el Prof. Miguel Pocoví, de Zaragoza, tro Nacional de Dislipemias de la SEA sea en este momento
con una beca patrocinada entonces por Progénika Biop- una herramienta con alto valor científico.
harma, y soporte informático de una empresa especializada
denominada INFOZARA. A lo largo de 2012 la SEA tomó la
decisión de transformar dicho registro en una plataforma Objetivos
más amplia y dinámica que incluyera otras alteraciones
lipoproteicas, datos prospectivos y retrospectivos, y la par- El objetivo general es disponer de una base de datos que
ticipación de la mayor parte de unidades acreditadas por la permita mejorar el conocimiento de los trastornos del meta-
SEA. Así surgió el actual registro, que pasó a denominarse bolismo de los lípidos en España. Los objetivos secundarios
Registro Nacional de Dislipemias de la Sociedad Española son mejorar el diagnóstico y el tratamiento de dichos tras-
de Arteriosclerosis, donde la única depositaria de los datos tornos; realizar estudios clínicos; crear una estructura de
pasó a ser la SEA. A partir de ese momento se establecieron colaboración en la asistencia e investigación con otras socie-
las normas, los objetivos generales y los proyectos asocia- dades científicas, empresas o grupos de investigación; y
dos, se nombró un coordinador, el Prof. Fernando Civeira, el colaborar con otras bases de datos semejantes en el mundo.
proyecto fue aprobado por el Comité Ético de Investigación Los objetivos operativos se van actualizando anualmente
Clínica de Aragón en septiembre del 2012, y fue presentado y para este año 2017 son los siguientes:
en el xxvi congreso de la SEA en mayo del 2013, celebrado
en Zaragoza. 1. Inclusión en el Registro de hasta un total de 5.000
Este artículo pretende informar a la comunidad cientí- pacientes a 31 de diciembre de 2017. Se pueden incluir
fica, y especialmente a todos los miembros de la SEA, de la todo tipo de dislipemias, pero queremos potenciar
250 S. Pérez-Calahorra et al.
preferentemente la inclusión de sujetos con hipercoles- 7. Las publicaciones que utilicen datos procedentes
terolemia familiar, incluidos niños, hipertrigliceridemias del Registro serán aprobadas por el comité científico del
severas, dislipemia diabética o sujetos con hiperlipopro- mismo.
teinemia (a). 8. Anualmente se realizará un control de calidad, evalua-
2. Replanteamiento de los proyectos de investigación aso- ción de la información e implementación de novedades.
ciados al registro, de sus responsables y actualización de
la metodología. Situación actual del Registro
3. Elaboración de un listado con los responsables y miem-
bros de las unidades que participan en el registro y su La evolución del Registro ha sido muy positiva en estos casi
inclusión en las publicaciones derivadas del registro. 5 años de funcionamiento, tanto por el número de unidades
4. Publicación de al menos 3 artículos en revistas de ámbito participantes como por el número de casos introducidos, la
internacional con datos derivados del registro. variedad de dislipemias analizadas y los resultados científi-
5. Mantener 2 reuniones a lo largo del año con asistencia cos obtenidos.
del mayor número posible de representantes de las uni- A fecha de 15 de junio del 2017, el Registro Nacional de
dades de lípidos coincidiendo con la Reunión Anual de Dislipemias de la SEA cuenta con la participación de 60 uni-
Unidades de Lípidos y el Congreso Nacional de la SEA. dades distribuidas por todo el territorio nacional (fig. 1),
y con un total de 4.449 pacientes registrados. Desde 2013
el número registrado de pacientes ha ido aumentando de
manera progresiva (fig. 2). Hay que destacar que durante el
Normas generales de funcionamiento del año 2013 el aumento en el número de pacientes registra-
dos fue muy significativo, con 1.306 pacientes registrados,
registro los cuales pertenecían a 15 unidades nacionales. En el 2014
y 2015, el número de nuevos pacientes fue menor, aunque
1. El registro pertenece a la SEA, que es depositaria de los importante, y pertenecían a 17 unidades. Durante el 2016
datos y se encarga de su mantenimiento y financiación. hubo un incremento significativo con respecto a los 2 años
2. La gestión y explotación de los datos los delega la SEA en previos, gracias a una campaña de incentivación de inclu-
un comité científico que actualmente está compuesto por sión. El número de nuevos pacientes registrados en 2017
5 miembros y que son los firmantes del presente informe. está siendo algo inferior al de 2016, pero es probable que se
3. La composición del comité científico lo establece la junta consiga el objetivo planteado para final de este año 2017.
directiva de la SEA a propuesta del coordinador, nom-
brado por la junta.
4. Todas las unidades de lípidos participantes deberán estar
Unidades de lípidos participantes
homologadas por la SEA, y al menos su coordinador ser
miembro activo de la misma. Existe un total de 60 unidades de lípidos registradas por
5. Cada unidad será responsable de introducir los datos en la SEA, de las cuales a día de hoy 37 han registrado como
el registro de forma anónima, de la integridad de los mínimo un paciente (fig. 3). El hecho de que el 38,3% de
mismos y de dar el consentimiento para su utilización de nuestras unidades no hayan registrado ningún caso en el
acuerdo con las normas de publicación. momento actual debemos considerarlo como una de nues-
6. Las publicaciones derivadas de la explotación de los tras limitaciones actuales y será objetivo preferente revertir
datos se regirán por las normas siguientes: esta situación en un futuro inmediato. Desde el Comité del
a) Descripción periódica de las novedades en el funcio- Registro hemos planteado una serie de incentivos para la
namiento del Registro: los autores serán los miembros inclusión de datos, que incluyen compensaciones económi-
del comité científico. cas por caso válido y la posibilidad de realizar trabajos de
b) Estudios derivados de la explotación de los datos tesis doctoral, fin de grado o máster con datos del Regis-
del Registro: los autores serán 3 investigadores del tro por la inclusión de un número determinado de casos
estudio concreto, incluyendo las autorías primera y completos.
última, y 5 autores más entre los investigadores de las
unidades de acuerdo con el número de casos válidos Diagnósticos
utilizados en el estudio.
c) Estudios con utilización de datos del Registro y datos El Registro está diseñado para introducir al menos un
generados de forma independiente por otros estudios diagnóstico por cada caso introducido. La lista de diag-
(grupos cooperativos, consorcios, proyectos coordina- nósticos posibles figura en la tabla 1. Gran parte de los
dos): los autores serán un miembro del comité del pacientes registrados hasta el momento tienen un diagnós-
Registro y un número variable de investigadores de tico de hipercolesterolemia familiar genético y/o clínico.
las unidades de acuerdo con el peso de los datos del Otros diagnósticos que acumulan un número importante de
Registro. pacientes son: hiperlipemia familiar combinada, hipertrigli-
La distribución de autores entre los investigadores de ceridemias graves, síndrome de quilomicronemia familiar,
las unidades se hará de acuerdo con la Ley D’Hondt, con hipercolesterolemia familiar homocigota, disbetalipoprotei-
listados separados para artículos. También se contempla nemia o dislipemia diabética, entre otros. La variedad de
la realización de estudios para comunicaciones a con- diagnósticos convierte al Registro en una herramienta útil
gresos. Se utilizará el mismo procedimiento que para los y válida para cualquier unidad, independientemente de la
artículos científicos, pero con listados independientes. cantidad de pacientes y diagnósticos frecuentes atendidos
Figura 1 Distribución de unidades de lípidos en el Registro de Dislipemias de la Sociedad Española de Arteriosclerosis.
1400 1306 1285
1200
1000
832
800
631
600
395*
400
200
0
2013 2014 2015 2016 2017
Figura 2 Número total de pacientes registrados anualmente.
Figura 3 Número de pacientes registrados por unidades de lípidos.

252 S. Pérez-Calahorra et al.
Tabla 1 Listado de diagnósticos potenciales del Registro Nacional de Dislipemias de la Sociedad Española de Arteriosclerosis
Diagnósticos
Hipercolesterolemia familiar
Hipercolesterolemia familiar dependiente del receptor LDLR, APOB, PCSK9 y APOE
Hipercolesterolemia familiar no dependiente del receptor LDLR, APOB, PCSK9 y APOE
Hipercolesterolemia familiar sin diagnóstico genético (desconocido o pendiente)
Hipercolesterolemia familiar homocigota (Registro Nacional)
Hipercolesterolemia poligénica
Hiperlipemia familiar combinada
Disbetalipoproteinemia
Hipoalfalipoproteinemia
Hipobetalipoproteinemia
Hipertrigliceridemia
Hipertrigliceridemia familiar
Hipertrigliceridemia esporádica
Síndrome de quilomicronemia familiar
Enfermedades raras
Abetalipoproteinemia
Déficit de Apo A1
Déficit de lipasa hepática
Déficit LAL
Déficit LCAT
Déficit de LPL, Apo CII e inhibidor LPL
Enfermedad de Tangier
Xantomatosis cerebrotendinosa
Sitosterolemia
Dislipemia secundaria
Otros
en las diferentes unidades de lípidos, y permite la colabo- Publicaciones del Registro

ración en una u otra línea de investigación llevadas a cabo.
Las publicaciones llevadas a cabo con datos derivados de
la explotación sobre el estudio de la hipercolesterolemia
Proyectos de investigación
familiar se pueden consultar en la bibliografía recomen-
dada, disponible al final del trabajo. Además, hay una serie
El Registro pretende aumentar el conocimiento de todas las
de artículos en preparación en la actualidad que incluyen:
dislipemias en nuestro medio. Para ello existen 12 proyectos
hipercolesterolemia autosómica recesiva en España; geno-
de investigación sobre diferentes afecciones del metabo-
tipo de las hipertrigliceridemias severas e impacto de las
lismo de los lípidos (tabla 2). Estos 12 proyectos (líneas de
estatinas en la enfermedad cardiovascular en la hipercoles-
trabajo) están en vigor desde finales del 2014 y cuentan
terolemia familiar. Todos ellos están previstos para enviar a
con el aval y el liderazgo de investigadores y subinves-
publicar durante el año 2017.
tigadores de reconocido prestigio, encargados de llevar a
cabo tanto la realización como la exportación de los datos
y los resultados. Existen 3 proyectos sobre hipercoleste- Conclusiones y reflexiones finales
rolemia familiar, que ya cuentan con un número de 2.855
casos. Los proyectos de hiperlipemia familiar combinada, El Registro Nacional de Dislipemias de la SEA se está posicio-
dislipemia aterogénica en la diabetes (Estudio PREDISAT) e nando como una de las bases de datos más relevantes sobre
hipertrigliceridemias graves, con 810, 391 y 245 pacientes, trastornos del metabolismo lipídico a nivel mundial. Nuestro
respectivamente, son proyectos con especial interés cientí- excelente sistema sanitario, que abarca de forma homogé-
fico para los años 2017-2018. Otros proyectos en vigor son: nea a la casi totalidad de la población, el liderazgo de la SEA
intolerancia a estatinas, disbetalipoproteinemia, hipoalfali- en el campo de las dislipemias y el papel de la unidades de
poproteinemia, dislipemia en la enfermedad cardiovascular lípidos como unidades de excelencia lo están haciendo posi-
muy prematura, entre otros. Debido al dinamismo en el ble. El Registro está diseñado para facilitar la participación
diseño y al desarrollo de nuevos proyectos, podemos gene- de todos los miembros de la SEA, pertenecientes o no a uni-
rar y continuar con proyectos en un futuro, y ser referentes dades de lípidos. La contribución al mismo puede hacerse
en el estudio de enfermedades lipídicas a nivel nacional, o liderando proyectos, introduciendo casos, aportando ideas,
incluso a nivel mundial. dirigiendo estudiantes, escribiendo artículos, etc. Desde el
Tabla 2 Proyectos de investigación en vigor del Registro Nacional de Dislipemias de la Sociedad Española de Arteriosclerosis
Proyectos Investigador Subinvestigador/es
Enfermedad cardiovascular en la hipercolesterolemia familiar Dr. Fernando Civeira Dr. José Puzo
heterocigota
Prevalencia de la enfermedad cardiovascular en la Dr. Juan F. Ascaso Dr. Luis Álvarez
hiperlipemia familiar combinada
Objetivos lipídicos en la hipercolesterolemia familiar Dr. Emilio Ros Dra. Fátima Almagro
heterocigota. Grado de control de la dislipemias y fármacos
utilizados
Estratificación del riesgo en la hipercolesterolemia familiar. Dra. Núria Plana Dra. Clotilde Morales
Factores independientes asociados al desarrollo de
enfermedad clínica y subclínica
Intolerantes a estatinas. Prevalencia, manifestaciones clínicas, Dr. José Mostaza Dr. Ángel Brea
grado de control de su dislipemias y riesgo basal
Dislipemias aterogénica en diabetes. Estudio PREDISAT Dr. Jesús Millán Dr. Antonio Hernández
Mijares
Hipertrigliceridemias graves Dr. Pedro Valdivielso Dr. Emilio Ruíz
Disbetalipoproteinemia Dr. Francisco Pérez Fuentes Dr. Juan Ferrando
Dislipemia en la enfermedad cardiovascular muy prematura Dr. Xavier Pintó Dr. Manuel Suárez
Dra. Marta Mauri
Dislipemias raras Dr. Leonardo Reinares Dr. Juan de Dios García
Hipercolesterolemia familiar homocigota. Registro Nacional Dra. Rosa M. Dr. Francisco Javier Novoa
Sánchez-Hernández
Hipoalfalipoproteinemia Dr. Juan Pedro-Botet Dr. Jacinto Fernández
Comité del Registro os animamos a todos a trabajar en él, a Agradecimientos

ayudar a engrandecerlo y mejorarlo, con el principal obje-
tivo de mejorar nuestro conocimiento y proporcionar una Los autores agradecemos a las diferentes unidades partici-
asistencia cada mejor a nuestros pacientes. pantes el esfuerzo en la inclusión de datos.
Responsabilidades éticas Bibliografía
Protección de personas y animales. Los autores declaran Climent E, Pérez-Calahorra S, Marco-Benedí V, Plana N, Sánchez
que para esta investigación no se han realizado experimen- R, Ros E, et al. Effect of LDL cholesterol, statins and presence of
tos en seres humanos ni en animales. mutations on the prevalence of type 2 diabetes in heterozygous
familial hypercholesterolemia. Sci Rep. 2017;7:5596.
Masana L, Plana N, Pérez-Calahorra S, Ibarretxe D, Lamiquiz-
Confidencialidad de los datos. Los autores declaran que
Moneo I, Pedro-Botet J, et al., Dyslipidemia Registry of the Spanish
han seguido los protocolos de su centro de trabajo sobre Arteriosclerosis Society. How many familial hypercholesterole-
la publicación de datos de pacientes. mia patients are eligible for PCSK9 inhibition? Atherosclerosis.
2017;262:107---12.
Derecho a la privacidad y consentimiento informado. Los Pérez-Calahorra S, Sánchez-Hernández RM, Plana N, Marco-
autores declaran que en este artículo no aparecen datos de Benedi V, Pedro-Botet J, Almagro F, et al., Dyslipidemia Registry of
pacientes. Spanish ArteriosclerosiS Society. Value of the definition of severe
familial hypercholesterolemia for stratification of heterozygouS
patients. Am J Cardiol. 2017;119:742---8.
Financiación Sánchez-Hernández RM, Civeira F, Stef M, Perez-Calahorra S,
Almagro F, Plana N, et al. Homozygous familial hypercholestero-
El Registro Nacional de Dislipemias recibe financiación de un lemia in Spain: Prevalence and phenotype-genotype relationship.
proyecto de la Sociedad Española de Arteriosclerosis. Circ Cardiovasc Genet. 2016;9:504---10.
Conflicto de intereses
Los autores declaran no tener ningún conflicto de intereses.

Adv Ther
https://doi.org/10.1007/s12325-019-00985-8
CASE SERIES
Real-World Outcomes with Lomitapide Use

in Paediatric Patients with Homozygous Familial
Hypercholesterolaemia
Tawfeg Ben-Omran . Luis Masana . Genovefa Kolovou .
Gema Ariceta . F. Javier Nóvoa . Allan M. Lund . Martin P. Bogsrud .
Marı́a Araujo . Osamah Hussein . Daiana Ibarretxe . Rosa M. Sanchez-Hernández .
Raul D. Santos
Received: April 12, 2019

! The Author(s) 2019
ABSTRACT triglyceride transfer protein inhibitor lomi-

tapide. Lomitapide is not licensed for use in
Introduction: Homozygous familial hyperc- children, but has been made available through
holesterolaemia (HoFH) is a rare, autosomal an expanded access programme or on a named
disease affecting the clearance of low-density patient basis.
lipoprotein cholesterol (LDL-C) from circula- Methods: This case series includes 11 HoFH
tion, and leading to early-onset atherosclerotic patients in 10 different centres in eight coun-
cardiovascular disease (ASCVD). Treatment tries, less than 18 years of age (mean
consists mainly of statins, lipoprotein apheresis 11.6 ± 1.1 years, 64% male), with signs of
(LA) and, more recently, the microsomal ASCVD, and who have received treatment with
lomitapide (mean dose 24.5 ± 4.3 mg/day;
mean exposure 20.0 ± 2.9 months). Back-
Tawfeg Ben-Omran, Luis Masana, Genovefa Kolovou, ground lipid-lowering therapy was given
Gema Ariceta, F. Javier Nóvoa, Allan M. Lund, Martin P. according to local protocols. Lomitapide was
Bogsrud, Marı́a Araujo, Osamah Hussein, Daiana commenced with a stepwise dose escalation
Ibarretxe, Rosa M. Sanchez-Hernández and Raul D.
Santos contributed equally to this work.
from 2.5 mg or 5 mg/day; dietary advice and
vitamin supplements were provided as per the
Enhanced Digital Features To view enhanced digital product label for adults. Laboratory analysis was
features for this article go to https://doi.org/10.6084/ conducted as part of regular clinical care.
m9.figshare.8076275.
T. Ben-Omran F. J. Nóvoa ! R. M. Sanchez-Hernández

Division of Clinical and Metabolic Genetics, Endocrinology Department, University Hospital
Department of Pediatrics, Hamad Medical Insular de Gran Canaria, University Institute of
Corporation and Sidra Medicine, Doha, Qatar Biomedical and Health Research of the University of
Las Palmas de Gran Canaria, Las Palmas, Spain
L. Masana ! D. Ibarretxe
Vascular Medicine and Metabolism Unit, A. M. Lund
Universitat Rovira i Virgili, IISPV, CIBERDEM, Reus, Center for Inherited Metabolic Diseases,
Spain Departments of Paediatrics and Clinical Genetics,
Copenhagen University Hospital, Rigshospitalet,
G. Kolovou Copenhagen, Denmark
Onassis Cardiac Surgery Center, Athens, Greece
M. P. Bogsrud
G. Ariceta National Advisory Unit for Familial
Pediatric Kidney Diseases, University Hospital Vall Hypercholesterolemia, Oslo University Hospital,
d’ Hebron, Barcelona, Spain Oslo, Norway
Adv Ther
Results: In the 11 cases, mean baseline LDL-C apolipoprotein B (ApoB) and pro-protein con-
was 419 ± 74.6 mg/dL and was markedly vertase subtilisin/kexin type 9 (PCSK9), and the
reduced by lomitapide to a nadir of recessive LDL-R adapter protein 1 (LDLRAP1).
176.7 ± 46.3 mg/dL (58.4 ± 6.8% decrease). Six Patients with the HoFH phenotype present
patients achieved recommended target levels with very high LDL cholesterol (LDL-C) levels
for children below 135 mg/dL, five of whom from birth [1]. This leads to early onset
had LA frequency reduced. In one case, LDL-C atherosclerotic cardiovascular disease (ASCVD),
levels were close to target when lomitapide was as well as aortic or supra aortic valve disease,
started but remained stable despite 75% reduc- which in turn causes a range of associated life-
tion in LA frequency (from twice weekly to threatening cardiac conditions [1]. If HoFH goes
biweekly). Adverse events were mainly gas- undetected or untreated, the average age at
trointestinal in nature, occurred early in the which patients develop ASCVD is 12.5 years and
treatment course and were well managed. Three mean survival is 18 years [2].
patients with excursions in liver function tests Clearly, there is a need to not only diagnose
were managed chiefly without intervention; HoFH promptly in childhood but also to pro-
two patients had decreases in lomitapide dose. vide effective treatments. For paediatric patients
Conclusions: Lomitapide demonstrated with HoFH, this is particularly problematic.
promising effectiveness in paediatric HoFH Statins can be used, and recent data have shown
patients. Adverse events were manageable, and that there are no concerns regarding growth
the clinical profile of the drug is apparently rate and plasma levels of creatinine kinase, ala-
similar to that in adult patients. nine aminotransferase (ALT) and aspartate
Funding: Amryt Pharma. aminotransferase (AST) in children receiving
these drugs [3]. However, as a result of the
Keywords: Adverse events; Atherosclerosis; genetic profile of HoFH whereby some patients
Cardiology; Homozygous familial hypercholes- can have extremely low levels of LDL-R func-
terolaemia; Lipidology; Lomitapide; Low-density tionality [1], statins may not be as effective as
lipoprotein cholesterol; Paediatric; Real-world they would be in an individual with residual
data; Patient cases LDL-R activity. Furthermore, non-statin lipid-
lowering therapies like ezetimibe and PCSK9
inhibitors seldom bring LDL-C to recom-
INTRODUCTION mended levels despite additional cholesterol
lowering [4].
Homozygous familial hypercholesterolaemia Lipoprotein apheresis (LA) is a mainstay of
(HoFH) is a rare, genetic autosomal co-domi- lipid-lowering therapy (LLT) for patients with
nant disease, with mutated alleles in the genes HoFH. The procedure involves the extracorpo-
involved in the low-density lipoprotein receptor real removal of cholesterol and in children this
(LDL-R) pathway, including LDL-R, can present technical, clinical and social chal-
lenges such as mild hypotension, pain, venous
access, iatrophobia, trypanophobia and time
M. Araujo away from normal activities [5]. Nevertheless,
Nutrition Service, Hospital Nacional de Pediatrı́a LA has been successfully applied in children as
‘Dr Juan P. Garrahan’, Buenos Aires, Argentina
young as 3 years [5].
O. Hussein LA is an effective treatment, and can reduce
Internal Medicine Department ‘A, Ziv Medical LDL-C levels by more than 50% and delay the
Centre, Azreili Faculty of Medicine, Bar Ilan
onset of ASCVD [6–8]. However, LDL-C levels
University, Safed, Israel
rebound to baseline within 2 weeks of an LA
R. D. Santos (&) procedure [9]. A systematic analysis of LA in
Lipid Clinic, Heart Institute (InCor), University of children found that only selective LA tech-
Sao Paulo and Hospital Israelita Albert Einstein, São
Paulo, Brazil niques were capable of enabling patients to
e-mail: raul.santos@incor.usp.br reach at least 70% acute reduction in LDL-C per
Adv Ther
session [10]. Therefore, even with the applica- presence of ASCVD, lack of sufficient response
tion of LA, patients will experience long-term to standard-of-care treatment, and inability to
elevated levels of LDL-C, which continually wait for a paediatric trial that is due to com-
exposes them to risks of developing premature mence in 2019 and enrol patients from at least 5
ASCVD [11]. For this reason, clinical recom- to at most 18 years of age.
mendations suggest weekly LA regimens. How-
ever, for some HoFH patients, LA is a
tremendous burden on time, school and work- METHODS
ing patterns. There can be additional problems
with the ability to attend treatment centres, and Physicians involved in the treatment of HoFH
in some countries, LA is not available at all [12]. requested access to treat their paediatric
Although not in full-time work, as children patients with lomitapide either as part of an
become older, they need to be able to devote expanded access programme or on a named
increasing amounts of time to schooling, social patient basis. Some of the physicians had prior
activity and sports. Given the problems of experience of lomitapide use in adult patients.
applying LA in the very young, increasing time Patients were treated in 10 different centres in
commitments as age advances, and the reduced eight countries (Qatar, Spain, Greece, Denmark,
effectiveness of statins, other therapies are Norway, Argentina, Israel and Brazil).
needed in paediatric patients with HoFH. In all cases, lomitapide was commenced at a
Lomitapide is a microsomal triglyceride low dose, and gradually escalated. The starting
transfer protein (MTP) inhibitor that reduces dose was as low as 2.5 mg/day in some children
plasma LDL-C levels independently of LDL-R (e.g. those below 10 years of age) and was selec-
activity. Lomitapide is approved as an adjunct to ted on the basis of the protocol of the planned
lipid-lowering treatment, with or without paediatric study using the calculated doses of
apheresis, in adult patients with HoFH [13, 14]. both physiologically based pharmacokinetic
In clinical trials, patients receiving lomitapide, modelling and allometric scaling, based on adult
added to standard of care, achieved mean references. Lomitapide administration does not
reductions in LDL-C from 40% to 50% and a involve weight-based dosing. Efficacy, hepatic
mean reduction of up to 76.5% in patients in safety and tolerability guide dose escalation.
‘real-world’ use [15–17]. Up to 51–68% patients Therefore, any differences in exposure that may
achieved the European Atherosclerosis Society be affected by body weight are accommodated in
(EAS) recommended LDL-C target for adults of the dosing schedule. Background LLT was pro-
less than 100 mg/dL; 40–42% patients achieved vided according to local protocols and treatment
less than 70 mg/dL [1, 15, 18, 19]. Notably, in the availability. Dietary counselling and vitamin E,
extension phase of the lomitapide phase 3 clini- omega 3 and omega 6 supplements were pro-
cal trial, 14 (74%) and 11 (58%) of the 19 patients vided as per the adult product label for lomi-
who remained in the extension study after tapide, but at lower doses of vitamin E in some
week 126 reached LDL-C targets of 100 mg/dL cases, as required. Patients and carers were
and 70 mg/dL, respectively, at least once during advised that lomitapide should be accompanied
the study period [20]. Lomitapide has been made with a low-fat diet whereby less than 20% of total
available to paediatric patients in response to daily energy is derived from fat. Patients also
requests from physicians as part of an expanded underwent regular monitoring of liver function,
access programme or on a named patient basis. and had laboratory measurements, including
Recently the first case of lomitapide use for over lipid panels recorded during the normal course
4 years in a HoFH child was published [21]. of their treatment.
In this paper, we have gathered data from Data were recorded according to local prac-
some of the paediatric patients treated with tice; therefore, there is some variation in the
lomitapide and evaluated the overall effective- type, presentation and time period of data
ness. The cases described here have been between the patients. For this reason, data are
deemed ‘urgent to treat’ due to the early presented chiefly as individual patient profiles
Adv Ther
Fig. 1 Evolution of LDL-C values in case 1 with lomitapide children with HoFH. Dotted line on lower panel indicates 39
therapy. Upper panel shows mean interval LDL-C levels for upper limit of normal for LFTs; ALT alanine aminotransferase,
patient 1. Middle panel shows lomitapide dose changes over AST aspartate aminotransferase, EAS European Atherosclero-
time. Lower panel shows corresponding ALT (closed circles) sis Society, HoFH homozygous familial hypercholesterolaemia,
and AST (open squares) levels over the same period. Dotted LDL-C low-density lipoprotein cholesterol, LFTs liver func-
line on upper panel shows EAS targets for LDL-C levels in tion tests, Q2W every 2 weeks, ULN upper limit of normal
Adv Ther
Fig. 2 Evolution of LDL-C values in case 2 with lomi- line on lower panel indicates 39 upper limit of normal for
tapide therapy. Upper panel shows mean interval LDL-C LFTs; ALT alanine aminotransferase, AST aspartate
levels for patient 2. Middle panel shows lomitapide dose aminotransferase, EAS European Atherosclerosis Society,
changes over time. Lower panel shows corresponding ALT HoFH homozygous familial hypercholesterolaemia, LDL-
(closed circles) and AST (open squares) levels over the C low-density lipoprotein cholesterol, LFTs liver function
same period. Dotted line on upper panel shows EAS tests, Q2W every 2 weeks, ULN upper limit of normal
targets for LDL-C levels in children with HoFH. Dotted
Adv Ther
rather than cohort-based statistics. Baseline Fig. 3 Evolution of LDL-C values in case 3 with lomi- c
LDL-C readings were recorded from samples tapide therapy. Upper panel shows mean interval LDL-C
taken at the clinic visit immediately prior to the levels for patient 3. Middle panel shows lomitapide dose
commencement of lomitapide. LDL-C nadir changes over time. Lower panel shows corresponding ALT
reading values were defined as the lowest level (closed circles) and AST (open squares) levels over the
achieved after commencement of lomitapide. same period. Dotted line on upper panel shows EAS
targets for LDL-C levels in children with HoFH. Dotted
line on lower panel indicates 39 upper limit of normal for
Compliance with Ethics Guidelines
LFTs; ALT alanine aminotransferase, AST aspartate
aminotransferase, EAS European Atherosclerosis Society,
The cases described in this paper were treated in HoFH homozygous familial hypercholesterolaemia, LDL-
the normal course of care, and not as part of a C low-density lipoprotein cholesterol, LFTs liver function
clinical trial requiring IRB or ethical committee tests, Q2W every 2 weeks, Q3W every 3 weeks, ULN upper
approval. All of the included patients have limit of normal
provided verbal consent for the data to be
published, and a consent form has been lodged
in the patient case notes for parental/guardian
been treated for over 18 months with no alter-
consent documentation.
ation in liver enzymes (Fig. 1).
RESULTS Case 2
Case 1 This is a 12-year-old boy with a homozygous

LDLR c.682G[T mutation. Both parents have
This is 13-year-old girl with a homozygous HeFH. The patient has left ventricle dilatation,
LDLR c.313?5G[A mutation and evidence of mild aortic regurgitation and atherosclerotic
an aortic root plaque. Her parents are first-de- plaques (1.5–2.1 mm thick) in both carotid
gree cousins, both with heterozygous FH bulbs, and in the common and internal carotid
(HeFH). arteries. Imaging revealed diffuse atheroscle-
This patient was initially treated with statins, rotic involvement of all coronary arteries, but
ezetimibe and biweekly LA but the patient this was not clinically significant.
remained with increased LDL-C and evidence of The patient was treated with rosuvastatin
atherosclerotic disease in the form of an aortic 20 mg/day, ezetimibe 10 mg/day, LA Q2W, but
root plaque. Evolocumab was tried, but only for mean interval LDL-C levels remained increased
3 months because of lack of response. With a at approximately 300 mg/dL. The patient was
background therapeutic regimen of atorvastatin commenced on lomitapide 5 mg/day following
40 mg/day, ezetimibe 10 mg/day and biweekly a normal FibroScan test. Rosuvastatin
(Q2W) LA, mean interval LDL-C levels were 20 mg/day, ezetimibe 10 mg/day and LA Q2W
263 mg/dL. The patient was commenced on were maintained.
lomitapide 5 mg/day. The patient initially suf- Mean interval LDL-C levels decreased mod-
fered from nausea, occasional vomiting, estly over 2 months (Fig. 2). The patient then
reduced appetite and increased stool frequency; took a vacation with no LA, and experienced an
however, these symptoms became tolerable and increase in LDL-C levels that was gradually
no other adverse events were observed. Liver brought under control with escalating doses of
enzymes remained within normal limits. The lomitapide. Overall, LDL-C levels decreased by
patient was gradually escalated to lomitapide 50–70%. There has been no evidence of adverse
20 mg/day and atorvastatin 40 mg/day with events to lomitapide, and liver function tests
cessation of LA. Mean interval LDL-C levels are (LFTs) remain normal (Fig. 2). Gastrointestinal
now maintained at 72 mg/dL (76% decrease) (GI) complaints were only present when dietary
without the need for LA (Fig. 1). The patient has advice was not followed. The patient achieved
an LDL-C nadir of 98 mg/dL (70% reduction).
Adv Ther
Adv Ther
LA intervals have been gradually extended to Case 4

Q4W with a modest increase in LDL-C levels to
184 mg/dL (44% reduction from baseline). This patient is a 7-year-old boy with compound
heterozygote mutations in LDLR c.666C[A and
Case 3 c.1646C[A. The patient has a sister with HoFH
who is on LA and not part of this patient series.
This is a 16-year-old boy diagnosed with HoFH Both parents have HeFH. The patient has a large
at the age of 10 months on the basis of devel- aortic plaque extending the length of the tho-
opment of xanthomas, LDL-C levels 981 mg/dL, rax with 25–50% narrowing of the lumen.
and LDLR genotyping with the finding of Before lomitapide, the patient was treated
homozygosity for the LDLR mutation with rosuvastatin 40 mg/day, ezetimibe
c.119_1207del. Both parents have HeFH, and 10 mg/day and colesevelam 625 mg/day. No LA
the patient has a right coronary lesion evident was used as a result of venous access issues. LDL-
on computed tomography, which has been C levels were increased at 866 mg/dL. The
treated with percutaneous revascularisation (at patient underwent dose reduction of rosuvas-
the age of 14 years). The patient was com- tatin (20 mg) and was commenced on lomi-
menced on statins at the age of 2 years, which tapide 2.5 mg/day, which was gradually
was gradually escalated to rosuvastatin escalated to 30 mg/day in 5-mg increments.
20 mg/day, ezetimibe 10 mg/day and coleseve- LDL-C levels reduced by 78% to 360 mg/dL
lam 3250 mg/day. At the age of 5 years, weekly (Fig. 4). Notably, this patient has been treated
LA was commenced, which resulted in regres- for over 18 months and has not experienced
sion of xanthomas by the age of 10 years, but any side effects of lomitapide.
without complete control of LDL-C levels
(mean interval LDL-C 168 mg/dL). Case 5
In 2016, at age 14 years, the patient was
commenced on evolocumab 420 mg QW with This patient is an 11-year-old girl with a
no effect on LDL-C levels. The following year, homozygous duplication spanning the pro-
lomitapide was commenced at 5 mg/day, and moter region to exon 6 of LDLR (c.-187-? 940??
gradually escalated to 40 mg/day. Mean interval Dup) [21]. Family history includes sudden death
LDL-C levels were reduced to 75–83 mg/dL, in an older brother aged 17. Another brother
which represents a greater than 60% reduction has HoFH with aortic stenosis and a non-critical
in LDL-C (Fig. 3). obstruction of the right coronary artery. The
The patient began to have some recurrent patient presented with non-critical aortic
issues with elevated liver enzymes, possibly stenosis/supra aortic stenosis, and non-ob-
related to rosuvastatin, which had caused this structive plaques in the carotid arteries. Her
in the past. Lomitapide dose was reduced to computed tomography angiography showed no
30 mg/day, and rosuvastatin briefly stopped signs of coronary artery disease.
while the LFTs resolved. Eventually, LA intervals The patient commenced LLT at the age of
were extended to every 2–3 weeks and rosuvas- 2 years when LDL-C levels were 1009 mg/dL. Up
tatin was permanently stopped. The patient until the age of 7, she was treated with ator-
remained on lomitapide 40 mg/day. Increasing vastatin 40 mg/day and ezetimibe 10 mg/day
lomitapide dose to 45 mg/day was associated and her LDL-C level was 453 mg/dL. LA is not
with an increase in LFTs that was brought under available in the patient’s home country.
control with dose reduction and gradual re- At age 7, atorvastatin dose was decreased to
escalation. The patient is now doing well on 10 mg/day, and lomitapide was commenced at
lomitapide 60 mg/day with an LDL-C level of a dose of 5 mg/day. Over the next year, lomi-
just 90.8 mg/dL and LA Q2W. There has been tapide was escalated to 30 mg/dL but this dose
no evidence of GI adverse events apart from was reduced back to 20 mg/day as a result of
mild flatulence. diarrhoea. LDL-C levels were effectively reduced
Adv Ther
Fig. 4 Evolution of LDL-C values in case 4 with lomitapide children with HoFH. Dotted line on lower panel indicates
therapy. Upper panel shows mean interval LDL-C levels for 39 upper limit of normal for LFTs; ALT alanine amino-
patient 4. Middle panel shows lomitapide dose changes over transferase, AST aspartate aminotransferase, EAS European
time. Lower panel shows corresponding ALT (closed circles) Atherosclerosis Society, HoFH homozygous familial hyper-
and AST (open squares) levels over the same period. Dotted cholesterolaemia, LDL-C low-density lipoprotein choles-
line on upper panel shows EAS targets for LDL-C levels in terol, LFTs liver function tests, ULN upper limit of normal
Adv Ther
with treatment (nadir 231 mg/dL; 40.7% consequent increase in LDL-C levels. Following
reduction) with no elevations in LFTs (Fig. 5). A resolution of the issues, reintroduction of
trip to a remote region of Brazil led to brief lomitapide resulted in the expected decrease in
discontinuation of lomitapide with a LDL-C levels.
Adv Ther
b Fig. 5 Evolution of LDL-C values in case 5 with lomi- evolocumab 420 mg Q2W was added to the back-
tapide therapy. Upper panel shows mean interval LDL-C ground LLT. However, as a result of the mutation
levels for patient 5. Middle panel shows lomitapide dose profile of the patient, evolocumab did not work
changes over time. Lower panel shows corresponding ALT (mean interval LDL-C 329 mg/dL), and the deci-
(closed circles) and AST (open squares) levels over the sion was taken to prescribe lomitapide. The patient
same period. Dotted line on upper panel shows EAS was commenced on lomitapide at 5 mg/day with
targets for LDL-C levels in children with HoFH. Dotted escalation to 15 mg/day over 3 months (Fig. 6).
line on lower panel indicates 39 upper limit of normal for Apheresis was stopped, lomitapide was increased
to 20 mg, rosuvastatin was increased to 40 mg and
ezetimibe doses were maintained. LDL-C levels
HoFH homozygous familial hypercholesterolaemia, LDL-
remained at approximately 190 mg/dL for more
C low-density lipoprotein cholesterol, LFTs liver function
than 6 months and therefore lomitapide was
tests, ULN upper limit of normal
increased to 30 mg/day and rosuvastatin reduced
to 35 mg/day. Figure 6 shows that LDL-C levels
The patient is now maintained on atorvas- continued to rise after commencement of lomi-
tatin 60 mg/day, ezetimibe 10 mg/day and tapide, followed by a subsequent marked decrease.
lomitapide 20 mg/day and has been treated There is no direct explanation for this other than
with lomitapide for 4.5 years. She continues to the cessation of apheresis.
develop normally and had her menarche at the Mean interval LDL-C levels are now at
age of 11 years. LDL-C levels are 266 mg/dL 34.8 mg/dL (a remarkable 85.7% decrease), with
(38% reduction from pre-lomitapide values). A no LA currently ongoing. Early GI issues
routine check-up revealed no calcification in resolved. There were no other adverse events,
the coronary arteries; however, there were signs other than slightly depressed alkaline phos-
of aortic stenosis and supra aortic stenosis, and phatase levels. Alanine aminotransferase briefly
some non-obstructive plaques in the carotid increased by more than three times the upper
arteries, but these are not considered to be life- limit of normal (ULN) on two occasions, and
threatening. There were no elevations of liver reduced to less than three times the ULN with-
enzymes during treatment. A detailed history of out intervention. All other laboratory parame-
this patient has been published by Chacra et al. ters remain normal and there is no evidence of
[21]. hepatic steatosis.
Case 6 Case 7
This is a 16-year-old boy with compound This is a 4-year-old girl with a homozygous
heterozygote mutations LDLR c.131G[A and c.2043C[A mutation who presented at the age
c.2043C[A and a history of HeFH in both parents of 3 with an LDL-C level of 739 mg/dL. Her
(LDL-C levels at 271 mg/dL and 387 mg/dL). The father has a severe form of HeFH. At diagnosis,
patient has carotid plaques occluding 25–30% of the patient had normal echocardiography; but,
the carotid lumina, but with no impairment of by 2016, she had mild aortic thickening and
perfusion. The patient was diagnosed with HoFH some mild aortic valve regurgitation. There was
at the age of 9 years with Achilles’ xanthomata evidence of a pedunculated atheroma at the
and LDL-C levels at 900 mg/dL. LLT with rosu- aortic arch that had potentially embolised as it
vastatin 20 mg/day, ezetimibe 10 mg/day and was no longer apparent on a later scan. For this
weekly apheresis was started, with dietary mod- reason, the treating physician decided that the
ifications to reduce fat intake to 15% of total patient was a candidate for aggressive LLT, but
energy. On this regimen, mean interval LDL-C low body weight meant that LA was not suit-
levels reduced to 206 mg/dL. able. LDL-C levels were reduced very slightly to
As the patient got older, issues with schooling 685 mg/dL with atorvastatin 10 mg/day and
meant that there was a desire to extend the LA ezetimibe 10 mg/day, and the decision was
interval to biweekly. This change was made, and
Adv Ther
Adv Ther
b Fig. 6 Evolution of LDL-C values in case 6 with lomi- At this point, lomitapide was initiated as
tapide therapy. Upper panel shows mean interval LDL-C add-on to the previous treatment regimen,
levels for patient 6. Middle panel shows lomitapide dose escalating from 5 to 10 mg/day. LDL-C levels
changes over time. Lower panel shows corresponding ALT decreased to almost 100 mg/dL (Fig. 8). Lomi-
(closed circles) and AST (open squares) levels over the tapide dose was increased to 15 mg/day and
same period. Dotted line on upper panel shows EAS then briefly escalated to 20 mg, but the patient
targets for LDL-C levels in children with HoFH. Dotted experienced elevated transaminases, so the dose
line on lower panel indicates 39 upper limit of normal for was reverted with consequent normalization of
LFTs. The LA frequency was altered a number of
times in this patient (Q2W–Q6W), and was
eventually stopped once the patient was on the
15 mg dose of lomitapide. The response to
tests, Q2W every 2 weeks, ULN upper limit of normal
lomitapide was a 66.4% reduction, and aphere-
sis has been discontinued, apart from two
emergency sessions when an insurance issue
taken to intensify LLT with lomitapide. Doses interrupted the lomitapide dosing (Fig. 8).
were escalated gradually from 2.5 mg/day in
2.5-mg increments given the young age of the
Case 9
patient and low body weight, and LDL-C levels
became reduced. By the time the dose was
escalated to 15 mg/day in August 2018 (patient This is a 15-year-old boy with compound
now 5 years old), LDL-C had reached a nadir of heterozygous LDLR c.313?1G[A and a deletion
235 mg/dL (Fig. 7). There have been no side spanning exon 1–6. Both parents have HeFH
effects in this patient apart from one episode of with no evidence of cardiovascular disease
a loose stools when pancakes were eaten. No (CVD). The patient was diagnosed at the age of
liver pathology is evident on ultrasound. The 2 years old as a result of the presence of xan-
patient has recently had a significant reduction thomas. LDL-C levels were found to be elevated
in triglycerides to 21 mg/dL, and so the levels of to 982 mg/dL, and diagnosis was confirmed via
fat-soluble vitamins are being checked prior to genetic testing. Asymptomatic aortic insuffi-
any further dose increase given the young age of ciency was evident. Medication was commenced
the child. with atorvastatin 40 mg/day plus ezetimibe
10 mg/day. The patient received once-weekly
lipoprotein apheresis, but LDL-C levels remained
Case 8
elevated (mean interval LDL-C 197 mg/dL). At
the age of 8.5 years, chest pain led to a diagnosis
This is a 14-year-old boy with an extensive family of angina and a coronary bypass operation. LA
history of HeFH and a brother with HoFH. The was intensified to two times per week.
boy has a compound heterozygous for the LDLR At 13.5 years of age, prior to the initiation of
mutations c.1846-? 2311??del and c.1895A[T lomitapide, mean interval LDL-C levels were at
(variant of unknown significance). The boy pre- 85 mg/dL with LA twice weekly, and therefore
sented with xanthomas and hypercholes- well below current treatment target. Unlike the
terolemia at 4.8 years of age. High dose (for age) other patients in this case series, the treatment
statins and ezetimibe were started (atorvastatin plan for this patient was to attempt to maintain
20–30 mg/day; ezetimibe 10 mg/day). At the age the LDL-C levels at target but to reduce the
of 8 years, mild aortic regurgitation was evident. apheresis burden. Lomitapide was commenced
Treatment with plasma exchange (PE) was com- at a dose of 5 mg/day and apheresis was
menced every 15–20 days. Three years later, the decreased to once weekly. After 6 months, the
patient required composite graft replacement of lomitapide dose was intensified to 10 mg/day
the aortic valve, aortic root and ascending aorta, followed by 15 mg/day and after an additional
with re-implantation of the coronary arteries 5 months, apheresis was reduced to Q2W.
(Bentall procedure).
Adv Ther
Adv Ther
b Fig. 7 Evolution of LDL-C values in case 7 with lomi- investigations revealed that the parents were
tapide therapy. Upper panel shows mean interval LDL-C not administering the medication regularly to
levels for patient 7. Middle panel shows lomitapide dose the children. After counselling the parents on
changes over time. Lower panel shows corresponding ALT the burden of HoFH and the need to adhere to
(closed circles) and AST (open squares) levels over the therapy, LDL-C levels have decreased but
same period. Dotted line on upper panel shows EAS remained above 440 mg/dL in November 2018.
targets for LDL-C levels in children with HoFH. Dotted Lomitapide has not been associated with side
line on lower panel indicates 39 upper limit of normal for effects in either patient. In the female patient,
an echocardiogram conducted in March 2018
revealed a supra aortic stenosis with a peak of
gradient of 50 mmHg, mild tricuspid regurgita-
tion with normal right ventricular systolic
pressure and normal biventricular function.
Ultrasound Doppler of carotid arteries was nor-
mal at the same date. For the male patient, there
Through these modifications, LDL-C levels was aortic insufficiency evident in 2011 that
remained under control (nadir 62 mg/dL) progressed slightly to 2013 but remained
(Fig. 9). stable and mild. An ultra-sounded Doppler of
No adverse events have been reported for carotid arteries in 2013 showed focal intimal
lomitapide, liver enzymes and imaging are thickening of the right common carotid artery.
normal, and the patient has reported improved An echocardiogram conducted in March 2018
quality of life due to less disruption from showed thickened tricuspid aortic valve leaflets.
apheresis sessions resulting in less time away Development has been normal in the girl. The
from school, sports and other leisure activities. boy is in second grade school with below aver-
As a result, the LDL-C target levels have been age performance.
maintained despite reducing apheresis burden
by 75%. Summary of the Case Series
Cases 10 and 11 A summary of baseline, nadir and current LDL-

C values is presented in Table 1. Patients 1–8
These two patients (both homozygous for the show substantial reductions in LDL-C levels.
LDLR c.1731G[T mutation) are siblings born to Patient 9 was at target LDL-C levels, and the aim
consanguineous parents with HeFH. They have of treatment with lomitapide was to reduce LA
one other sibling with HeFH, and without the frequency from twice per week, so the LDL-C
disease. The girl presented at age 2 with high decrease is more modest than for other patients.
LDL-C and xanthomas, but with normal cardiac In patients 10 and 11 compliance with lomi-
status. Her brother with HoFH was referred at tapide therapy was suboptimal, and they have
age 9 on the basis of the family history, and has yet to reach stable LDL-C levels.
mild, stable aortic insufficiency and focal Table 2 provides summary descriptive statis-
thickening of the right common carotid artery. tics for all 11 patients. Baseline LDL-C was
Development was normal in both patients. The 419.9 ± 74.6 mg/dL. The mean at nadir was
patients were managed with atorvastatin 176.7 ± 46.3 mg/dL, representing a
40 mg/day, ezetimibe 10 mg/day, a low-fat diet, 58.4 ± 6.8% reduction in LDL-C. Note that
cholestyramine 4 g/day and aspirin 75 mg QD. patients 9–11 had modest decreases in LDL-C
In September 2017 (girl aged 11 with LDL-C levels (patient 9 was treated to reduce LA fre-
684 mg/dL, boy aged 9 with LDL-C 705 mg/dL) quency, and patients 10 and 11 had compliance
the children commenced lomitapide with rapid issues). These LDL-C reductions were achieved
escalation from 5 to 20 mg/day. Initial LDL-C with a mean dose of lomitapide
decreases were modest (Figs. 10 and 11), and 24.5 ± 4.3 mg/day over a mean period of
Adv Ther
Adv Ther
b Fig. 8 Evolution of LDL-C values in case 8 with lomi- \ 2%) [23]. This is borne out by data from
tapide therapy. Upper panel shows mean interval LDL-C patients 1, 2 and 6 where LDL-C levels remained
levels for patient 8. Middle panel shows lomitapide dose very high (263–430 mg/dL), despite use of a
changes over time. Lower panel shows corresponding ALT PCSK9 inhibitor; patients 2 and 6 had null
(closed circles) and AST (open squares) levels over the mutations.
same period. Dotted line on upper panel shows EAS Exposure to high levels of LDL-C for an
targets for LDL-C levels in children with HoFH. Dotted extended period presents a high risk of ASCVD.
line on lower panel indicates 39 upper limit of normal for In patients with HoFH, the LDL-C levels are so
high that the threshold exposure level whereby
cardiovascular disease can occur is reached by
the age of 12 years, in contrast to 55 years for
individuals without FH [2]. All of the patients in
the present report were 16 years of age or
younger at the start of treatment (range 4–-
16 years), and all but case 10 had evidence of
20.0 ± 2.9 months. Most adverse events cardiovascular disease. The youngest patient
(Table 2) resolved without intervention. was case 7, and even she had evidence of
thickened aortic cusps and a possible mobile
atheroma at the age of 3 years old. Case 9 was
DISCUSSION diagnosed at the age of 2 years, when there was
already subclinical aortic insufficiency.
This report is the first available of a case series in The early-onset cardiovascular and valvular
paediatric patients with HoFH receiving lomi- heart diseases in HoFH demand early lipid-
tapide, and it shows that, as in adult patients, lowering intervention such as statins, ezetim-
marked reductions in LDL-C are possible in ibe, PCSK9 inhibitors and LA that are never-
these patients. In all cases, the LDL-C values at theless often not sufficient to achieve proposed
diagnosis were very high—some as high as target LDL-C levels in HoFH patients. Early
1000 mg/dL. Even with the use of statins, eze- access to lomitapide, either through an expan-
timibe and in some cases LA, LDL-C levels ded access programme or on a named patient
remained highly elevated in most cases. Nota- basis, has provided unique opportunities for
bly, some patients received the PCSK9 inhibitor early-life access to this MTP inhibitor. Intro-
evolocumab, with little effect. The failure of duction and dose escalation of lomitapide was
evolocumab to lower LDL-C levels in some associated with marked decreases in LDL-C
patients with HoFH is likely to be due to its levels. For cases 1–8, percentage reductions
mechanism of action. PCSK9 inhibitors prevent (nadir) were in the range 46–91%. Six of the
the binding of PCSK9 to the LDL-C/LDL recep- patients (cases 1–3, 6, 8 and 9) were able to
tor complex and thereby prevent the degrada- achieve EAS targets for LDL-C levels in children
tion of the LDL receptors, ultimately increasing with HoFH (nadir \ 135 mg/dL) [1]. For case 9,
their recycling to the cell surface [22]. This baseline LDL-C values were already at target but
means that PCSK9 inhibitors require a func- the patient needed to undergo LA twice weekly
tional LDL-R to exert their effect. Since LDL-R which was very burdensome on the patient and
activity is impaired or absent in HoFH, PCSK9 became problematic with increasing demands
inhibitors have reduced effectiveness in com- of schooling (Table 1). This patient was able to
parison to that seen in heterozygous familial reduce his LA frequency from an unmanageable
hypercholesterolaemia or other dyslipidaemia twice weekly to a more satisfactory biweekly
patients in whom LDL receptor functionality is (75% reduction in apheresis) and still maintain
maintained. In the TAUSSIG study of evolocu- target levels.
mab in FH patients, LDL-C was reduced on Case 9 was not the only patient able to
average by 25%, but with no effect in patients maintain control of LDL-C levels with extended
with null mutations (i.e. LDL-R functionality LA intervals. Case 1 has stopped LA, and
Adv Ther
Fig. 9 LDL-C levels per therapy period for case 9. Values LDL-C levels in children with HoFH. LDL-C low-density
are mean interval LDL-C ± SD for each apheresis lipoprotein cholesterol, BIW twice weekly, QW once
treatment period. Dotted line shows EAS targets for weekly, Q2W once every 2 weeks
continues to do well. Case 2 has extended patients and their families. This would particu-
intervals from Q2W to Q4W with LDL-C levels larly affect children who need to increase their
at about 150 mg/dL. Case 3 extended intervals involvement in education and other activities
from QW to Q2W. No LA was used in cases 4 as they get older. Development of additional
and 5; and case 6 has stopped LA for a year, and effective pharmacotherapies has the potential
has LDL-C levels of 34.8 mg/dL (86% reduction to reduce or eliminate the constraints of regular
from baseline). Case 8 had multiple changes to LA on patients [27]. The data from this case
LA frequency prior to lomitapide, but was able series suggest that lomitapide may be useful to
to stop the therapy between April 2017 and July reduce LA frequency in this particularly diffi-
2018 with the availability of lomitapide. Alter- cult-to-treat patient population.
ations to LA frequency have been observed in
the phase 3 clinical trial of lomitapide and in
Fig. 10 Evolution of LDL-C values in case 10 with c
real-world, adult case series of lomitapide use in lomitapide therapy. Upper panel shows mean interval
HoFH [15, 24]. In the phase 3 study, six of the LDL-C levels for patient 10. Middle panel shows
13 patients on LA from weeks 26 to 78 under- lomitapide dose changes over time. Lower panel shows
went permanent changes to their LA regimens corresponding ALT (closed circles) and AST (open
[25], some of whom were able to stop LA squares) levels over the same period. Dotted line on upper
entirely [26]. Similarly, in a real-word cohort of panel shows EAS targets for LDL-C levels in children with
HoFH adult patients undergoing lomitapide HoFH. Dotted line on lower panel indicates 39 upper
therapy, eight of the 10 patients (80%) on LA limit of normal for LFTs; ALT alanine aminotransferase,
were able to stop the treatment, and a further AST aspartate aminotransferase, EAS European
patient was able to reduce LA frequency by 50% Atherosclerosis Society, HoFH homozygous familial hyper-
[15]. LA presents a huge burden of time, dis- cholesterolaemia, LDL-C low-density lipoprotein choles-
comfort and expense on patients with HoFH terol, LFTs liver function tests, ULN upper limit of
[12], and is also a psychological burden for the normal
Adv Ther
Adv Ther
Blunted LDL-C responses in cases 10 and 11 Fig. 11 Evolution of LDL-C values in case 11 with c
underscore the need for patients to remain lomitapide therapy. Upper panel shows mean interval
compliant with all aspects of their therapy, LDL-C levels for patient 11. Middle panel shows
including low-fat diet, lifestyle modifications lomitapide dose changes over time. Lower panel shows
and lomitapide dosing. corresponding ALT (closed circles) and AST (open
In the phase 3 clinical trial of lomitapide, squares) levels over the same period. Dotted line on upper
there was a dose escalation protocol that panel shows EAS targets for LDL-C levels in children with
increased lomitapide doses until the maxi- HoFH. Dotted line on lower panel indicates 39 upper
mum tolerated dose up to 60 mg/day was limit of normal for LFTs; ALT alanine aminotransferase,
reached. This resulted in a median dose of AST aspartate aminotransferase, EAS European
40 mg/day (mean 44.0 ± 3.8 mg/day) and a Atherosclerosis Society, HoFH homozygous familial hyper-
cholesterolaemia, LDL-C low-density lipoprotein choles-
mean reduction in LDL-C of 50% versus
terol, LFTs liver function tests, ULN upper limit of
baseline (baseline 336.4 ± 112.1 mg/dL;
normal
26 weeks 116.3 ± 96.7 mg/dL) [25]. In the
present case series, there was no such driver to
increase lomitapide dose. Five of the patients
described here are maintained on 20 mg/day, later to 60 mg/day. In patient 6, LFT excursions
two on 15 mg/day, one on 10 mg/day, one on resolved without intervention. Patient 8 had
30 mg/day, one on 40 mg/day and one on one episode controlled by a lomitapide dose
60 mg/day. The mean dose was 24.5 mg/day reduction, and the second episode was due to a
(median 20 mg/day) resulting in a mean peritoneal infection.
58.4% reduction in LDL-C at nadir. In a real- This paediatric case series—the first of its
world study where the treatment strategy was kind for lomitapide in HoFH—demonstrates
similar—i.e. to titrate the dose of lomitapide that lomitapide has been effective in reducing
to LDL-C levels as opposed to a maximum LDL-C in paediatric patients with HoFH, and
tolerated dose—the mean LDL-C levels in a suggests that the drug has a similar adverse
cohort of 15 Italian patients was 19 mg/day event and usage profile to that observed in
with a mean LDL-C reduction at nadir versus adult patients. Consistent with real-world data
baseline of 76.5% (baseline 426.0 ± 204.0 mg/ from adult patients [15, 28], this paediatric
dL; nadir 81.9 ± 56.0 mg/dL) [15]. In the pre- case series shows a greater reduction in LDL-C
sent paediatric case series, the LDL-C lowering at a lower mean dose of lomitapide than in the
is similar to the Italian cohort at a similar phase 3 study. This is a curious finding but is
mean dose. replicated across data sets and may be
Through its mechanism of action, lomi- explained by the titration of the dose of
tapide results in a reduced absorption of fats in lomitapide to desired LDL-C reduction as
the intestine, resulting in the possibility of GI opposed to the ‘forced’ escalation protocol
adverse effects. A corresponding block on the based on tolerability as used in the phase 3
release of VLDL from the liver can result in study. Irrespective of rationale, these data show
increases in hepatic fat [16]. In the present case a reduced level of adverse effects related to the
series, adverse events were consistent with those lower mean dose and an improved benefit-to-
seen in the phase 3 study in adults and in real- risk profile compared with data from formal
world use. Those that did occur were nearly all clinical trials.
GI complaints, presented early in the treatment A further benefit of lomitapide in HoFH is
course, and resolved with minimal active man- the ability for patients to reduce or stop LA,
agement. There were some increases in LFTs which is an important and positive outcome for
with patients 3, 6 and 8 experiencing transient many of the children in this case series. The
elevations in LFTs above three times the ULN. efficacy and safety of lomitapide will be
In patient 3, the LFT increases were managed explored in a formal phase 3 study (registration
with a brief dose reduction to 30 mg/day, fol- pending) in patients from at least 5 to at most
lowed by gradual restoration to 40 mg/day, and 18 years old, and will provide further evidence
Adv Ther
to explore the efficacy, tolerability and safety of 12–48 months). The phase 3 study will employ
lomitapide in this cohort. Mean exposure in an efficacy period of 24 weeks and a safety phase
this case series was 19.9 months (range of an additional 80 weeks, total study duration
Table 1 Individual data for the 11 patients
Parameter Patient
1 2 3 4 5 6 7 8 9 10 11
Sex Female Male Male Male Female Male Female Male Male Female Male
Age, years 13 12 16 7 11 16 3 14 15 8 8
Genetic variant LDLR LDLR LDLR c.119_1207del LDLR c.-187-? LDLR LDLR LDLR c.1846-? LDLR LDLR LDLR
c.313?5G[A c.682G[T c.666C[A, 940?? c.131G[A, c.2043C[A 2311??del, c.313?1 c.1731G[T c.1731G[T
c.1646C[A Dup c.2043C[A c.1895A[T
G[A, del
exon 1–6
LDL-C at 799 672 981 1008 1009 901 739 474 965 1002 824
diagnosis,
mg/dL
LLT prior to Statins, ezetimibe, Statins, Statins, ezetimibe, LA Statins, Statins, Statins, ezetimibe Statins, Statins, ezetimibe Statins, Statins, Statins,
lomitapide LA ezetimibe, ezetimibe ezetimibe ezetimibe ezetimibe, ezetimibe ezetimibe
LA LA
Duration of 11 2 14 3 8 6 5 6 11 8 8
therapy prior
to
lomitapide,
years
LDL-C prior to 299 326 187 833 443 243 649 223 81 630 705
lomitapide,
mg/dL
LDL-C at nadir, 56 93 73 466 231 23 236 75 62 441 460
mg/dL
Concomitant Atv 20 mg Ro 20 mg Ro 20 mg Ro 40 mg Atv 40 mg Ro 20 mg Atv 10 mg Atv 5 mg Atv 40 mg Atv 40 mg Atv 40 mg
LLT
Ez 10MG Ez 10 mg Ez 10 mg Ez 10 mg Ez 10 mg Ez 10 mg Ez 5 mg Ez 5 mg Ez 10 mg Ez 10 mg Ez 10 mg
LA Q2W LA Q15D Co 3250 mg Co 625 mg LA Q2W LA 2xW
LA Q1W
Maximal 81 70 61 77 48 91 64 66 24 27 34
reduction
with
lomitapide,
%
Maximum dose 20 40 60 30 20 30 15 15 15 20 20
of
lomitapide,
mg/day
Length of 16 15 20 15 48 15 12 22 18 19 19
lomitapide
exposure,
months
Change in Ev stoppedb Ev stoppedb Ev stoppedb None At 10 mga Ev stoppedb None Ro 30 mg LA reduced None None
concomitant a 75%
LA stopped LA Q4W Ro paused At 40 mg Ro 30 mg Ez stoppedb
LLT
Ev stoppedb
Adv Ther
LA Q2W Ro 40 mg LA stopped
Adv Ther
of 2 years and will assess growth, bone devel-
AE adverse events, ALT alanine aminotransferase, At atorvastatin, Co colesevelam, Ev evolocumab (all Ev stopped prior to lomitapide), Ez ezetimibe, GI gastrointestinal, LA lipoprotein apheresis, LDL-C low-density lipoprotein
Liver enzymes
opment and reproductive maturation which are

normal
all important safety aspects to consider in

None
11
treating children from the ages of 5 to 18 years.

One patient in this series underwent treatment
Liver enzymes
normal
during puberty and had a normal menarche,

None
but further safety data are warranted.

10
In this paediatric case series, all the patients

except cases 10 and 11 already had atheroscle-
and liver
enzymes
imaging
normal
rosis on screening and patients 3 and 9 already

None
Liver
had revascularisation procedures at the ages of

9
12 and 8.5 years respectively. Modelling data in

dose reduction
managed with
adult patients have shown that early interven-

minasaemia
ALT increases
lomitapide
Hypertransa-
tion with lomitapide has the potential to

increase life expectancy and delay the time to
first major adverse cardiovascular event (MACE)
8
[29]. Treatment of HoFH patients from very

Liver enzymes
early life may have the potential to realise fur-

normal
Diarrhoea
ther outcome benefits through the prevention

of atherosclerosis development and progres-
7
sion, thereby underscoring that effective treat-

Gastrointestinal
intervention
hypertransa-
minasaemia
Minimal ALT
ments that can significantly lower LDL-C are

resolved
without
increase
valuable tools in the management of this severe,

pain,
progressive and life-threatening condition.

6
This study, however, has several limitations:

Patient had also received evolocumab (no response), which had been stopped before commencement on lomitapide
enzymes
normal
Diarrhoea
(1) the wide variations in underlying standard

of care among the different centres, (2) the
Liver
5
variability in time of exposure to lomitapide

Liver enzymes
treatment, (3) issues with access and compli-

normal
ance to lomitapide therapy and (4) a non-ran-

None
domized open design. However, despite these

4
factors, this case series highlights the effective-

hypertransaminasaemia
ness of lomitapide in children with HoFH, and

Elevated liver enzymes
resolved after Ro
suggests that robust LDL-C reduction can be

achieved with lower doses than used in the
stopped
phase 3 clinical trial in adults and with gener-

Flatulence,
ally good tolerability. With the exception of one

case report [21], there are currently no data on
3
the use of lomitapide in children with HoFH.

vomiting
enzymes
Diarrhoea,
normal
Given that these patients have an urgent need

Liver
for effective medical intervention, the infor-

2
cholesterol, LLT lipid-lowering therapies
mation provided here is valuable to guide

frequent bowel
Nausea, vomiting,
physicians considering lomitapide for paedi-

movements
Liver enzymes
diarrhoea,
atric patients. Further data are necessary to

normal
All oral drug doses are daily

Table 1 continued
Atorvastatin dose changes
MedDRA preferred term

Patient
more fully determine the long-term efficacy

tolerability and safety of lomitapide in this rare,
1
life-threatening condition. A phase 3 study is

Adverse eventsc
planned for lomitapide in paediatric HoFH and

Liver status
Parameter
this may result in a change to the licensed

indication for the drug.
b
a
c
Adv Ther
Table 2 Summary data for the 11 patients

Parameter Age Baseline Nadir LDL- Percentage reduction in LDL-C Lomitapide Lomitapide
LDL-C, mg/ C, mg/dL from baseline to nadir, % dose, mg/day exposure,
dL months
Mean 11.6 419.9 176.7 58.4 24.5 20.0
Median 12.0 325.5 98.0 63.7 20.0 18.2
SD 3.8 247.5 153.4 22.4 14.2 9.5
LDL-C low-density lipoprotein cholesterol, SD standard deviation
CONCLUSIONS Editors (ICMJE) criteria for authorship for this

article, take responsibility for the integrity of
This case series of the real-world use of lomi- the work as a whole, and have given their
tapide in paediatric HoFH patients suggests that approval for this version to be published.
lomitapide can be efficacious as a treatment for
HoFH, and that adverse events can be success- Disclosures. Luis Masana received lectures
fully managed by adjusting the patient’s diet and advisory fees from Amgen, Sanofi, MSD,
and modifying the dose of lomitapide according Myland and Daichii Sankyo. Genovefa Kolovou
to tolerability and safety. Overall, the data show has given talks, attended conferences sponsored
that the clinical profile of lomitapide in paedi- by Amgen, Angelini, MSD, Lilly, Vianex and
atric patients is similar to that in adults patients Sanofi. Martin P. Bogsrud received honoraria
with HoFH. relating consulting from Amgen, Sanofi, MSD,
Boehringer Ingelheim and Kaneka. Osamah
Hussein received honoraria relating to consult-
ing for Megapharma. Daiana Ibarretxe received
ACKNOWLEDGEMENTS honoraria related speaker activities for Sanofi,
MSD and Rubio. Raul D. Santos received hono-
The authors would also like to thank the raria related to consulting and speaker activities
patients who contributed data for the paper and from AstraZeneca, Amgen, Akcea, Kowa, Espe-
provided kind permission for publication. rion, MSD, Novo Nordisk and Sanofi. Raul D.
Santos is a recipient of a scholarship from the
Funding. Amryt Pharma was not involved in Conselho Nacional de Pesquisa e Desenvolvi-
design, data collection or decision to publish. mento Tecnologico (CNPq) process #
Access to lomitapide was supported by Amryt 303734/2018-3. Tawfeg Ben-Omran, Gema
Pharmaceuticals DAC. Article processing char- Ariceta, F. Javier Nóvoa, Allan M. Lund, Marı́a
ges and open access fee were funded by Amryt Araujo and Rosa M. Sanchez-Hernández have
Pharma. All authors had full access to all of the nothing to disclose.
data in this study and take complete responsi-
bility for the integrity of the data and accuracy Compliance with Ethics Guidelines. This
of the data analysis. case series was not subject to ethic board
approval as it includes cases treated in the nor-
Medical Writing and/or Editorial Assis- mal course of care, but all patients provided
tance. The authors would like to thank Nigel permission for their data to be published.
Eastmond of Eastmond Medicomm Ltd for edi-
torial support and data analysis that was funded Data Availability. All data generated or
by Amryt Pharma. analyzed during this study are included in this
published article/as supplementary information
Authorship. All named authors meet the files.
International Committee of Medical Journal
Adv Ther
Open Access. This article is distributed 7. Hudgins LC, Kleinman B, Scheuer A, White S,
under the terms of the Creative Commons Gordon BR. Long-term safety and efficacy of low-
density lipoprotein apheresis in childhood for
Attribution-NonCommercial 4.0 International homozygous familial hypercholesterolemia. Am J
License (http://creativecommons.org/licenses/ Cardiol. 2008;102(9):1199–204. https://doi.org/10.
by-nc/4.0/), which permits any noncommercial 1016/j.amjcard.2008.06.049.
use, distribution, and reproduction in any
8. Thompson GR, Barbir M, Davies D, et al. Efficacy
medium, provided you give appropriate credit criteria and cholesterol targets for LDL apheresis.
to the original author(s) and the source, provide Atherosclerosis. 2010;208(2):317–21. https://doi.
a link to the Creative Commons license, and org/10.1016/j.atherosclerosis.2009.06.010.
indicate if changes were made.
9. Kroon AA, van’t Hof MA, Demacker PN, Stalenhoef
AF. The rebound of lipoproteins after LDL-aphere-
sis. Kinetics and estimation of mean lipoprotein
levels. Atherosclerosis. 2000;152(2):519–26. https://
REFERENCES doi.org/10.1016/s0021-9150(00)00371-3.
10. Luirink IK, Determeijer J, Hutten BA, et al. Efficacy

1. Cuchel M, Bruckert E, Ginsberg HN, et al. Homozy- and safety of lipoprotein apheresis in children with
gous familial hypercholesterolaemia: new insights homozygous familial hypercholesterolemia: a sys-
and guidance for clinicians to improve detection and tematic review. J Clin Lipidol. 2018. https://doi.org/
clinical management. A position paper from the 10.1016/j.jacl.2018.10.011.
Consensus Panel on Familial Hypercholesterolaemia
of the European Atherosclerosis Society. Eur Heart J. 11. Thompson GR, Catapano A, Saheb S, et al. Severe
2014;35(32):2146–57. https://doi.org/10.1093/eur hypercholesterolaemia: therapeutic goals and eligi-
heartj/ehu274. bility criteria for LDL apheresis in Europe. Curr
Opin Lipidol. 2010;21(6):492–8. https://doi.org/10.
2. Nordestgaard BG, Chapman MJ, Humphries SE, 1097/MOL.0b013e3283402f53.
et al. Familial hypercholesterolaemia is underdiag-
nosed and undertreated in the general population: 12. Bruckert E, Saheb S, Bonté JR, Coudray-Omnès C.
guidance for clinicians to prevent coronary heart Daily life, experience and needs of persons suffering
disease: consensus statement of the European from homozygous familial hypercholesterolaemia:
Atherosclerosis Society. Eur Heart J. insights from a patient survey. Atheroscler Suppl.
2013;34(45):3478–3490a. https://doi.org/10.1093/ 2014;15:46–51.
eurheartj/eht273.
13. Aegerion Pharmaceuticals Inc. Juxtapid prescribing
3. Humphries SE, Cooper J, Dale P, Ramaswami U, FH information 2013. http://www.juxtapid.com/sites/
Paediatric Register Steering Group. The UK paedi- default/files/downloads/Prescribing_Information.
atric familial hypercholesterolaemia register: statin- pdf. Accessed 3 May 2019.
related safety and 1-year growth data. J Clin Lipidol.
2018;12(1):25–32. https://doi.org/10.1016/j.jacl. 14. Amryt Pharmaceuticals DAC. Lojuxta summary of
2017.11.005. product characteristics 2015. https://www.
medicines.org.uk/emc. Accessed 3 May 2019.
4. Santos RD, Gidding SS, Hegele RA, et al. Defining
severe familial hypercholesterolaemia and the 15. D’Erasmo L, Cefalu AB, Noto D, et al. Efficacy of
implications for clinical management: a consensus lomitapide in the treatment of familial homozy-
statement from the International Atherosclerosis gous hypercholesterolemia: results of a real-world
Society Severe Familial Hypercholesterolemia Panel. clinical experience in Italy. Adv Ther.
Lancet Diabetes Endocrinol. 2016;4(10):850–61. 2017;34(5):1200–10. https://doi.org/10.1007/
https://doi.org/10.1016/S2213-8587(16)30041-9. s12325-017-0531-x.
5. Stefanutti C, Di Giacomo S, Vivenzio A, et al. Low- 16. Amryt Pharmaceuticals DAC. Lojuxta summary of
density lipoprotein apheresis in a patient aged product characteristics 2017. https://www.
3.5 years. Acta Paediatr. 2001;90(6):694–701. medicines.org.uk/emc. Accessed 3 May 2019.
6. Gagné C, Gaudet D, Bruckert E, Ezetimibe Study 17. Cuchel M, Blom DJ, Averna M, et al. Sustained LDL-
Group. Efficacy and safety of ezetimibe coadminis- C lowering and stable hepatic fat levels in patients
tered with atorvastatin or simvastatin in patients with homozygous familial hypercholesterolemia
with homozygous familial hypercholesterolemia. treated with the microsomal transfer protein inhi-
Circulation. 2002;105(21):2469–75. https://doi.org/ bitor lomitapide: results of an ongoing long-term
10.1161/01.cir.0000018744.58460.62. extension study. American Heart Association
Adv Ther
Scientific Sessions, Dallas, Texas. 2013. Abstract TAUSSIG study. Lancet Diabetes Endocrinol. 2017.
16516. https://doi.org/10.1016/s2213-8587(17)30044-x.
18. Underberg J, Cannon CP, Larrey D, Makris L, Jur- 24. Roeters van Lennep J, Averna M, Alonso R. Treating
ecka A, Blom D. Long-term safety and efficacy of homozygous familial hypercholesterolemia in a
lomitapide in patients With homozygous familial real-world setting: experiences with lomitapide.
hypercholesterolemia: three-year data from the J Clin Lipidol. 2015;9(4):607–17. https://doi.org/10.
Lomitapide Observational orldwide Evaluation 1016/j.jacl.2015.05.001.
Registry (LOWER). ACC18 67th Annual Scientific
Session and Expo, 10–12 March, Orlando, FL. 25. Cuchel M, Meagher EA, du Toit Theron H, et al.
2018. Efficacy and safety of a microsomal triglyceride
transfer protein inhibitor in patients with
19. Blom DJ, Averna MR, Meagher EA, et al. Long-term homozygous familial hypercholesterolaemia: a sin-
efficacy and safety of the microsomal triglyceride gle-arm, open-label, phase 3 study. Lancet.
transfer protein inhibitor lomitapide in patients 2013;381(9860):40–6. https://doi.org/10.1016/
with homozygous familial hypercholesterolemia. S0140-6736(12)61731-0.
Circulation. 2017;136(3):332–5. https://doi.org/10.
1161/circulationaha.117.028208. 26. Averna M, Cefalu AB, Stefanutti C, Di Giacomo S,
Sirtori CR, Vigna GB. Individual analysis of patients
20. Blom DJ, Cuchel M, Ager M, Phillips H. Target with HoFH participating in a phase 3 trial with
achievement and cardiovascular event rates with lomitapide: the Italian cohort. Nutr Metab Cardio-
lomitapide in homozygous familial hypercholes- vasc Dis. 2015;26(1):36–44. https://doi.org/10.
terolaemia. Orphanet J Rare Dis. 2018;13(1):96. 1016/j.numecd.2015.11.001.
https://doi.org/10.1186/s13023-018-0841-3.
27. Moriarty PM, Parhofer KG, Babirak SP, et al. Alir-
21. Chacra AP, Ferrari MC, Rocha VZ, Santos RD. Case ocumab in patients with heterozygous familial
report: the efficiency and safety of lomitapide in a hypercholesterolaemia undergoing lipoprotein
homozygous familial hypercholesterolemic child. apheresis: the ODYSSEY ESCAPE trial. Eur Heart J.
J Clin Lipidol. 2019. https://doi.org/10.1016/j.jacl. 2016. https://doi.org/10.1093/eurheartj/ehw388.
2019.03.001 (in press).
28. Real J, Arbona C, Goterris R, Ascaso JF. Manage-
22. Horton JD, Cohen JC, Hobbs HH. PCSK9: a con- ment of homozygous familial hypercholestero-
vertase that coordinates LDL catabolism. J Lipid laemia in two brothers. BMJ Case Rep 2018. 2018.
Res. 2009;50(Suppl):S172–7. https://doi.org/10. https://doi.org/10.1136/bcr-2017-222155.
1194/jlr.R800091-JLR200.
29. Leipold R, Raal F, Ishak J, Hovingh K, Phillips H.
23. Raal FJ, Hovingh GK, Blom D, et al. Long-term The effect of lomitapide on cardiovascular outcome
treatment with evolocumab added to conventional measures in homozygous familial hypercholes-
drug therapy, with or without apheresis, in patients terolemia: a modelling analysis. Eur J Prev Cardiol.
with homozygous familial hypercholesterolaemia: 2017;24(17):1843–50. https://doi.org/10.1177/204
an interim subset analysis of the open-label 7487317730473.
Abstracts / Atherosclerosis 252 (2016) e197ee235 e203
identified 10 single nucleotide polymorphisms (SNPs) in the promoter

EAS16-0200, GENETIC, OMICS AND IN SILICO APPROACHES.
region, 26 in exons, and 35 in the nearby introns. The genotype distri-
CLINICAL CHARACTERISTICS AND PREVALENCE OF CARDIOVASCULAR
bution and the frequency of the functional polymorphism rs2231142
DISEASE RISK FACTORS IN SUBJECTS SCREENED FOR FAMILIAL
(421C>A) or the other two common SNPs, which are in linkage with the
HYPERCHOLESTEROLEMIA e A CROSS SECTIONAL STUDY IN THE
421C>A SNP, were significantly different in the good and poor re-
NETHERLANDS
sponders (A variant: 51.3% vs. 21.3%, P<0.001). We also found several rare
variants in one group (n!2), but not the other, suggesting that these
M.L. Hartgers 1, J. Besseling 1, B. Lucius 2, L. Kutikova 3, G.K.
variants may contribute to the differences in LDL-C response to
Hovingh 1. 1 Academic Medical Centre, Department of Vascular Medicine,
rosuvastatin.
Amsterdam, Netherlands; 2 Amgen B.V., Value Access & Policy, Breda,
Conclusions: This preliminary analysis confirmed the importance of the
Netherlands; 3 Amgen Europe GmbH, Global Health Economics, Zug,
421C>A polymorphism in ABCG2 in determining the LDL-C response to
Switzerland
rosuvastatin and identified several novel rare variants in ABCG2 which
might also be important in pharmacogenetic phenotypes.
Objectives: Patients with familial hypercholesterolemia (FH) present with
a wide range of low-density lipoprotein cholesterol (LDL-C) levels and
EAS16-0730, GENETIC, OMICS AND IN SILICO APPROACHES. other cardiovascular disease (CVD) risk factors, but the extent of this
CHARACTERISTICS OF HOMOZYGOUS FAMILIAL variability is largely unknown. We aimed to describe the cardiovascular
HYPERCHOLESTEROLEMIA IN SPAIN risk factor profile of heterozygous FH (HeFH) patients at time of diagnosis.
R.M. Sa!nchez-Herna !ndez 1, 2, M. Stef 3, S. Perez-Calahorra 4, F. Almagro 5, P. Methods: Data were collected at screening from all individuals who un-
aenz-Aranzubía 6, N. Plana 7, J.T. Real 8, F. Blanco-Vaca 9, J.F. Ascaso 10, F.
S! derwent DNA testing for FH in the Dutch national screening program
Civeira 11, M. Pocovi 12. 1 Complejo Hospitalario Universitario Insular (1994e2014). Clinical characteristics of HeFH patients, including CVD risk
Materno Infantil, Servicio de Endocrinología y Nutricio !n, Las Palmas de factors and lipid-modifying therapy (LMT), were analyzed.
Gran Canaria, Spain; 2 Instituto Universitario de Investigacio !n Biom!edica y Results: Of 26,144 HeFH patients (mean age, 38.1 years), 21% were
Sanitaria IUIBS, Universidad de Las Palmas de Gran Canaria, Las Palmas, smokers, 2% had diabetes, 8% had hypertension, and 29.5% were receiving
Spain; 3 Prog!enika Biopharma SA, Derio, Vizcaya, Spain; 4 Hospital LMT. In patients who had an LDL-C measurement, the mean untreated
Universitario Miguel Servet, Unidad Clínica y de Investigacio !n en Lípidos y plasma LDL-C level was 5.28 mmol/L. In those receiving LMT, the mean
Arterioesclerosis, Zaragoza, Spain; 5 Hospital Donostia de San Sebastia !n, plasma LDL-C was 3.67 mmol/L. Of 2,031 patients (8%) receiving high-in-
Servicio de Medicina Interna, Guipúzcoa, Spain; 6 Hospital de M! erida, tensity statin therapy (HIST) with an LDL-C goal of 2.5 mmol/L, 84% did not
Servicio de Medicina Interna, Badajoz, Spain; 7 Hospital Universitari Sant achieve this goal, nor did 89% of those receiving moderate-intensity statin
Joan, Unitat de Medicina Vascular i Metabolisme-Unitat de Investigacio ! therapy (MIST; n¼2,883 [11%]). Of those receiving ezetimibe + HIST (n¼572
Clínica UIC, Reus, Spain; 8 Hospital Clínico Universitario de Valencia, [2%]) or ezetimibe + MIST (n¼398 [2%]), 72% and 81%, respectively, did not
Servicio de Endocrinología y Nutricio !n, Valencia, Spain; 9 Hospital Sant achieve their 2.5 mmol/L treatment goal.
Pau-Universitat Auto "noma de Barcelona, Servicio de Bioquímica, Barcelona, Conclusions: Based on observed LDL-C levels and expected maximal
Spain; 10 Hospital Clínico Universitario de Valencia-Universidad de Valencia, LDL-C reductions with current LMT options (including HIST), many pa-
Servicio de Endocrinología y Nutricio !n, Valencia, Spain; 11 Hospital tients are unlikely to reach their treatment goal. To improve outcomes in
Universitario Miguel Servet-Universidad de Zaragoza, Unidad Clínica y de HeFH patients, additional LMT options are needed, which can be used
!n en Lípidos y Arterioesclerosis, Zaragoza, Spain; 12 Universidad
Investigacio alongside current therapies, dietary management, and smoking inter-
de Zaragoza, Departamento de Bioquímica-Biologia Molecular y Celular. ventions.
Facultad de Ciencias, Zaragoza, Spain
EAS16-0461, GENETIC, OMICS AND IN SILICO APPROACHES.

Objectives: Homozygous familial hypercholesterolemia (HoFH) is an
LOOKS LIKE FH BUT IT'S NOT FH e EXTENDED LIPID PROFILE OF
uncommon inherited disease caused by mutations in the LDL receptor
PAEDIATRIC CLINICAL FH PATIENTS REVEALS A DIFFERENT LIPID
(LDLR), apolipoprotein B (APOB), proprotein convertase subtilisinekexin
PROFILE IN FH NEGATIVE PATIENTS
type 9 (PCSK9) or LDL protein receptor adaptor 1 (LDLRAP1) genes. No
epidemiological studies assessing the prevalence of HoFH are available in
A.M. Medeiros 1, 2, M. Bourbon 1, 2, P. Aguiar 3. 1 Instituto Nacional de Saude
Spain. Therefore, we investigated the characteristics of this disease in
Doutor Ricardo Jorge, Departamento de Promoça ~o da Saúde e Prevença ~o de
Spain.
Doenças Na ~o Transmissíveis-Unidade de I&D-Grupo de Investigaça ~o
Cardiovascular, Lisboa, Portugal; 2 BioISI e Biosystems & Integrative
Methods: Data from the Dyslipidemias Registry of the Spanish Athero-
Sciences Institute, Faculdade de Ci^ encias-Universidade de Lisboa, Lisboa,
sclerosis Society and all molecular diagnosis performed in Spain (12.669)
Portugal; 3 National School of Public Health - Universidade NOVA de Lisboa,
between 1995 and 2015 from University of Zaragoza, Progenika Biopharma
Public Health Research Center, Lisboa, Portugal
(Vizcaya), Hospital Clínico de Valencia and Hospital Santa Creu i Sant Pau
(Barcelona), using DLCN diagnostic criteria, were included. Clinical data
Objectives: Familial Hypercholesterolemia (FH) is a common autosomal
included baseline lipid levels and CVD events.
dominant disorder, caused by mutations in genes involved in cholesterol’s
Results: 89 subjects were identified with genetically defined HoHF: 40
clearance. Clinical diagnosis is usually based on high total cholesterol or
true homozygotes: 1 for APOB. 2 for LDLRAP1 and 37 for LDLR; 44
LDL-Clevels and family history of premature coronary heart disease. Using
compound heterozygotes for LDLR; 3 double heterozygotes for LDLR and
an extended lipid profile of paediatric dyslipidemic patients, we aim to
PSCK9; and 2 double heterozygotes for LDLR and APOB. No homozygotes
identify biomarkers for a better diagnosis of FH in clinical settings.
for PSCK9 were identified.Baseline LDL-c in true homozygotes was 574.4
(SD 257.21) mg/dL and 40% suffered clinical CVD. Median LDL-c was 320
Methods: A cohort of 218 children with clinical diagnosis of FH was ana-
[197.6-823] mg/dL in compound heterozygotes and 24% suffered
lysed, including an extended lipid profile (automatic biochemical equip-
from CVD. There were LDL-c differences between both groups
ment) and the molecular study of LDLR, APOB and PCSK9 (PCR and Sanger
(p¼0.009). 64% of the compound heterozygotes did not met HoFH
sequencing). Data was analysed by SPSS using Student’s t-test and Mann-
clinical criteria.
Whitney test.
Conclusions: The frequency of HoFH in Spain is higher than in previous
Results: Children were divided according to the genetic diagnosis: FH-
calculations. These data show that the clinical criteria would be under-
positive (n¼96) and FH-negative (n¼122). In FH-positive group mean TC,
estimating the real prevalence of individuals with genetic HoFH, what
LDL-C, apoB, apoB/apoA1 ratio (p<0.001 for all) and sdLDL (p¼0.013) levels
highlights the importance of genetic analysis to improve the accuracy of
were statistically significant higher; mean HDL-C, apoA1 and apoA2 levels
FH diagnosis.
were statistically significant lower (p<0.001 for all); mean apoE levels
Certificate poster presentation
This is to certify that
Rosa M Sánchez-Hernández
has presented a poster at ISA2015 that took place on May 24 - 26, 2015
in Amsterdam, The Netherlands
Titles:
- Complete regression of xanthomas and decreased of intima-media thickness with
LDL apheresis in a severe homozygous familial hypercholesterolemia patient
4S[IVIHF]8'4(* [[[XGTHJSVK
Agradecimientos
Esta parte de la tesis es la más importante para mí, no quisiera dejarme a nadie atrás o
no agradecer en la suficiente medida, porque he tenido la suerte de recorrer este largo
camino en muy buena compañía.
Antes que nada quiero agradecer a la persona que siempre confió en mi y quiso que,
como el suyo, los lípidos fueran mi camino y el tema de la presente tesis. Gracias Javier
por todo; por tus enseñanzas, tus consejos, tu ayuda siempre que me ha hecho falta, tu
tiempo y tu apoyo incondicional. Has sido parte fundamental de esta tesis, creo que
nunca podré agradecerte lo suficiente.
A Mauro y Ana, que he tenido la gran suerte de que sean mi directores y amigos, he
aprendido mucho de ellos.
A Mauro, por su ayuda en esta tesis y siempre, desde mi primer día en el Hospital.
Gracias por ser así, por todo el tiempo que me has dedicado, todas las charlas, consejos,
ánimos cuando me hacían falta, correos a deshora y por tu ayuda cuando Yeray nació.
Has sido parte fundamental en este camino y poder contar contigo ha sido un privilegio.
Gracias por tu apoyo en cada momento.
A Ana, que ya desde sexto me despertó el gusanillo de la investigación y ha estado a mi
lado desde el principio, ayudándome con cada póster, cada proyecto, cada artículo y con
esta tesis. No sólo en el lado profesional, también en el personal, siempre has estado ahí
en los momentos buenos y malos, con esa generosidad que te caracteriza y siempre que
lo he necesitado. Gracias por ser como eres y por todo lo que me has ayudado.
A Fernando, sin ti esta tesis no hubiera sido posible, todavía me pregunto cómo un mes
de rotación dio para tanto, para tener un gran amigo en Zaragoza y poder aprender tanto
de uno de los grandes. Gracias por estar siempre que te he necesitado, por animarme y
aconsejarme, por ayudarme con todo y en cualquier momento. Ha sido una gran suerte
haberte conocido.
A Miguel Pocovi, por toda su ayuda en cada trabajo de esta tesis. Gracias por acogerme
en Zaragoza, por tu generosidad, por tu cariño, por transmitirme mucho en poco tiempo
y hacerme fáciles las cosas difíciles.
A mis amigos de mi grupo de investigación del CULP y del IUIBS, han sido todos un
apoyo y un aliciente muy importante, con los que he compartido cafés, charlas y buenos
momentos que hemos pasado juntos y que sólo me pudo dar esta etapa. A Roberto,
Borja, Laura P, Haidée, Merci, Joaquín, Jose, Nico, Moi, Miguel, Cristina, Elena,
Silvia, Carlos, Laura R, Marian, Carmen, Paloma, Tina. A Patri, por ser tan buena
persona y poder contar contigo cuando se te necesita. A Anita, siempre dispuesta a
ayudar con una sonrisa, sin ti no hubiese sido posible. A Dácil, porque estos años no
han sido fáciles para mi, pero he tenido la suerte de tenerte cerca, siempre dispuesta a
hablar, echarme una mano, aconsejarme, gracias bella.
A Antonio Tugores, por tu ayuda incondicional desde el principio, gracias por tu
entusiasmo y hacer de la genética algo un poco menos complicado para mí.
A mi servicio, porque tengo la suerte de contar con buenos compañeros y mejores
personas. Todos me han ayudado y animado en momentos malos, y han compartido con
cariño mis alegrías. Gracias a Nuria, Carlos, Dunia, Yaiza L, Yaiza G, María, Antonio,
Armando, Fátima, Carol, Elisa, Xabi, Marta, Ana, Adriana, Fernando, Julia, Angelines,
Paula, Sara, Magnolia y a Mapi, gracias por tu ayuda incondicional. Y también a mis
compañeros de San Roque, mi otra familia de endocrinos, que son un gran equipo,
Herminia, Dani, Ana, Sara, Claudia, Pablo, Carmen, Javier, Belén, Cristina, Tania.
A mis amigas de Zaragoza, que me “adoptaron” en el laboratorio desde el principio y
me han hecho sentir siempre como una más. A Rocío y Sofía, que en tan poco tiempo se
han convertido en tanto para mí. Su alegría contagiosa es capaz de animarme siempre y
su ayuda incondicional no tiene precio. Gracias por todos los buenos momentos en este
tiempo. A Itzi y Ana Bea, que son un ejemplo del trabajo bien hecho, además de
personas increíbles, su ayuda ha sido fundamental. También a Estíbaliz, Ana Cenarro,
Lucía, Rosa.
A mis amigos de toda la vida, por poder contar siempre con ellos, Jose Luis, Ómar,
Saray, Marta, Alicia, Sara, Lianna, Abraham, Carmen, Tamara, Silvia, Yure.
Por último quiero dar las gracias a mi familia, que son mi pilar fundamental y sin ellos
no habría llegado hasta aquí. A mi padre, que ha sido para mí un ejemplo de constancia,
esfuerzo, bondad y es una de las personas que más me ha apoyado. Siempre
animándome a seguir adelante. A mi madre, que es la persona más cariñosa, generosa y
sensata que conozco, gracias por todos tus consejos y tu ayuda en cada etapa de esta
tesis y de mi vida. A mi hermana, que con su alegría, ayuda, ánimos y apoyo continuo
ha sido parte fundamental en estos años. No te puedes imaginar lo orgullosa que estoy
de ti Pimi, gracias por estar siempre ahí.
A mis abuelos, que han sido y son muy importantes en mi vida. A mis tíos, Conchi,
Chano, Manolo, Juan, tía Mey, a mis primos, siempre están ahí para todo. En especial a
ti, mi Dear, que tu ayuda en esta etapa ha contribuido a que pueda acabar este
manuscrito.
A Mariana, Dara, Nati, Meme, Lelo, Ruth, Raúl, Pablo, Moi, Gabi, Bernardo y a Lord
Rudy por tus consejos.
A ti Yeray, que, aparte de darme lo más importante de mi vida, ha sido la persona que
más me ha ayudado en estos años. Gracias por haberle dado forma a esta tesis, por tu
paciencia, cariño, bondad, tu tiempo, por todo lo que me has aportado y por todo lo que
hemos compartido.

Bases Genéticas de La Hipercolesterolemia Familiar en España: El Caso Particular de La Isla de Gran Canaria

Cargado por

Información del documento

Título original

Derechos de autor

Formatos disponibles

Compartir este documento

Compartir o incrustar documentos

Opciones para compartir

¿Le pareció útil este documento?

¿Este contenido es inapropiado?

Copyright:

Formatos disponibles

Bases Genéticas de La Hipercolesterolemia Familiar en España: El Caso Particular de La Isla de Gran Canaria

Cargado por

Copyright:

Formatos disponibles

UNIVERSIDAD DE LAS PALMAS DE GRAN CANARIA

BASES GENÉTICAS DE LA HIPERCOLESTEROLEMIA

Rosa María Sánchez Hernández

D JUAN FRANCISCO LORO FERRER,

Que la Comisión Académica del programa de doctorado Autoriza la

Y para que así conste, y a efectos de lo previsto en el Artº 11 del

UNIVERSIDAD DE LAS PALMAS DE GRAN CANARIA

ESCUELA DE DOCTORADO DE LA ULPGC

Departamento de Ciencias Clínicas

INVESTIGACIÓN APLICADA A LAS CIENCIAS SANITARIAS

Bases gené cas de la hipercolesterolemia familiar en España: el caso

par cular de la isla de Gran Canaria

Rosa María Sánchez Hernández

Dirigida por los Dres. Ana Mª Wägner y Mauro Boronat Cortés

Los Directores La Doctorando

Que el trabajo de investigación “Bases genéticas de la

Que el trabajo de invesgación tulado “Bases gené$cas de la

ÍNDICE DE TABLAS Y FIGURAS ....................................................................................... 19

JUSTIFICACIÓN DE LA UNIDAD TEMÁTICA DE LA TESIS........................................ 93

CONCLUSIONES FINALES ................................................................................................159

ABCG5: transportador de casete de HCHOLA4: cuarto locus autosómico

1. Metabolismo de las lipoproteínas

precursor de hormonas esteroideas suprarrenales y gonadales, vitamina D, ácidos

biliares, oxiesteroles y lipoproteínas; componente de membranas; participación en

distintos procesos celulares. El colesterol es una molécula de

ciclopentanoperhidrofrenantreno (esterano) con una cabeza polar (grupo hidroxilo) y

lipoproteínas. Puede estar en forma libre, como lo encontramos en la mayoría de tejidos

La forma esterificada es más frecuente en el plasma y es insoluble en agua, pero no en

el núcleo de las lipoproteínas (1).

El colesterol plasmático procede de la absorción intestinal en un 15-20% (dieta, bilis y

descamación intestinal), mientras que el resto procede de biosíntesis endógena, a través

de su precursor (acetil coenzima A), mediante la acción de la enzima intracelular

hidroximetilglutaril coenzima A (HMG-CoA) reductasa. Esto ocurre principalmente en

elevados de colesterol a nivel intracelular inhiben la HMG-CoA reductasa y la

transcripción del receptor de LDL (LDLR) a nivel nuclear y, por el contrario, la

depleción intracelular de colesterol activa la síntesis a través de esta enzima y aumenta

la transcripción de LDLR (2, 3).

La absorción de colesterol a nivel intestinal se lleva a cabo por varios transportadores, el

principal de los cuales es la proteína 1 similar a la proteína C1 de Niemann-Pick

transportadores de casete de unión al ATP G5 y G8 (ABCG5 y ABCG8), que

la célula el colesterol libre es esterificado en el retículo endoplasmático.

El colesterol puede eliminarse a nivel hepático como colesterol libre, en la bilis, o

metabolizarse a ácidos biliares mediante la 7α-hidroxilasa. La mayoría de los ácidos

biliares segregados y la mitad aproximadamente del colesterol que llega al intestino, se

reabsorben y van nuevamente al hígado. Esta recirculación de ácidos biliares y

colesterol se denomina circulación enterohepática. La cantidad que no se reabsorbe se

iguales o diferentes (triglicéridos simples o complejos). Los triglicéridos de la dieta son

en su mayoría complejos y contienen ácidos grasos de cadena larga (oleico y palmítico

principalmente). Su función principal es el almacenamiento de energía. Además de la

dieta, proceden de la síntesis endógena en el hígado y, al igual que el colesterol, son

transportados en plasma por lipopoteínas. Los triglicéridos procedentes de la dieta se

los tejidos se produce su hidrólisis por la enzima lipoprotein-lipasa (LPL) en el

donde se produce β-oxidación o almacenamiento en forma de gotas de lípidos en el

tejido adiposo (5).

colesterol esterificado y triglicéridos (figura 1). El contenido en lípidos y proteínas

determina la densidad de las lipoproteínas. Se han identificado cinco tipos de

lipoproteínas plasmáticas. De mayor a menor tamaño y de menor a mayor densidad

(figura 2): QM, VLDL, lipoproteínas de densidad intermedia o IDL (Intermediate

Density Lipoprotein), lipoproteínas de baja densidad o LDL (Low Density Lipoprotein)

menor densidad. Ambas transportan principalmente triglicéridos, en el caso de los QM

de origen intestinal, y en el de las VLDL de origen hepático. El colesterol plasmático es

Figura 1. Estructura de una lipoproteína. Extraído de Douglas et al,

Las apoproteínas o apoliproteínas constituyen el componente proteico de las

Que el trabajo de invesgación tulado “Bases gené$cas de la