Está en la página 1de 61

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

1.- INTRODUCCIN
La Gentica es una materia diversa que trata de la variacin y la herencia de todos los organismos vivos. Desde la antigedad se tena la idea de que las caractersticas de los neonatos eran heredadas de los padres, as como la idea de que stas podran ser afectadas por factores externos durante la concepcin. Sin embargo, el primer avance significativo hacia el entendimiento de la herencia surgi al final del Renacimiento, con el trabajo de William Harvey (1578)-1657) y la invencin del microscopio. Harvey propuso una nueva idea sobre la importancia relativa de la contribucin de animales machos y hembras en la creacin de su descendencia. Anteriormente se crea que la hembra proporcionaba el huevo slo como soporte y que ste tomaba una forma especfica dictada por el semen del macho. Harvey propuso que ambos, huevo y semen, guiaban el desarrollo de la descendencia. Las ideas acerca de la herencia probablemente no habran avanzado ms all de la que Harvey propuso de no haber sido por la invencin del microscopio compuesto, invento acreditado a Zacharias Jansen en 1609. Otro hombre del renacimiento, fundador de la microscopa (pequeos dibujos, Robert Hoke (1635-1709) public en 1665 un libro llamado Micrographia en la que demostraba la estructura del corcho, compuesto de cavidades a las que llam clulas (del latn cella, pequeo cuarto). Antonie van Leeuwenhoek (1632-1723), en 1676, con la ayuda de un microscopio simple, observ en la espuma de charcos organismos pequeos a los que llam animlculos. Nehemiah Grew (1641-1712) public en 168, su libro The anatomy of Plants en el cual se muestra que los tejidos de las plantas estn formados por agregados de clulas. Las observaciones de estos naturalistas dieron inicio a la biologa celular que culmin en la teora celular, desarrollada por el botnico Mattias Jakob Schleiden y el zologo Theodor Schwann, quienes en 1839, integrando los conocimientos previos y los propios, propusieron que todos los organismos estn compuestos de clulas. Los estudiosos de la poca, quienes ya tenan la certeza de que la clula era la unidad estructural y funcional de todos los organismos, observaron la gran diversidad de formas y tamaos celulares, as como de algunos de sus componentes internos, como el ncleo. As surgi la clasificacin de organismos eucariotas, los que posean ncleo, y procariotas, los que carecan de ste.
-1CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

En 1858, el mdico alemn Rudolph Carl Virchow (1821- 1902), en su libro Cellular pathologie (Patologa celular), propuso que todos los organismos procedan de clulas preformadas por clulas (ovnis cellula e cellula) y que no aparecan por generacin espontnea a partir de materia desorganizada. Posteriormente se lleg a la conclusin de que los espermatozoides y los vulos eran clulas especializadas en transmitir informacin de una generacin a la siguiente. Esta evolucin de las ideas llev a proponer la ley de la continuidad gentica, que probablemente fue el avance ms importante en su tiempo del entendimiento de los seres vivos: la vida viene slo de la vida por medio de las clulas. Durante este mismo siglo, Gregor Johan Mendel encuentra mediante experimentos de apareamiento, que los caracteres hereditarios del chcharo ( Pisium sativum) estaban presentes y eran transmitidos a la progenie como unidades discretas; cada chcharo deba poseer un par homlogo de esas unidades, de las cuales recibi uno del polen y uno del ovario y, de stas, una era dominante y la otra, recesiva. A fines de 1880, se lleg a la conclusin de que la informacin hereditaria estaba localizada en elementos intranucleares que se podan ver con la ayuda del microscpio durante la fase mittica del ciclo celular, fase que culmina en la divisin celular. Estos elementos fueron llamados cromosomas. Continuando con los estudios microscpicos, en la segunda mitad del siglo XIX se observ la divisin celular y su efecto sobre los cromosomas. Las clulas somticas sufren divisin por mitosis, dando lugar a dos clulas hijas con el mismo nmero diploide de cromosomas, al igual que la clula madre. Tambin se observ que las clulas precursoras de los gametos llevaban a cabo una divisin celular mucho ms compleja que la mitosis, la meiosis, que involucra dos divisiones celulares sucesivas, produciendo cuatro gametos, cada uno con la mitad de cromosomas de la clula precursora. Con los conocimientos adquiridos hasta ese momento se inici un estudio intensivo de la herencia, a la cual se le llam gentica. Se llam gen a la unidad hereditaria descrita por Mendel y genoma, a la suma total de los genes de un individuo. En esta ltima dcada, se han secuenciado diversos genomas, incluyendo el del Humano y se ha avanzado en la capacidad, el diseo, la manipulacin y el uso generalizado de nuevas tecnologas, lo cual ha permitido el desarrollo de la gentica mdica.
-2CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

En la actualidad, es fundamental desarrollar un adecuado balance, entre la ciencia bsica y la investigacin aplicada, en beneficio de las mltiples necesidades de salud. Si bien, esta relacin empieza a tener un desarrollo notable, es primordial fortalecer el impulso de tales tecnologas para avanzar, no solo en el conocimiento bsico requerido, sino tambin para conocer las caractersticas genticas de diferentes poblaciones y desarrollar una mejor medicina preventiva. Pensando en lo importante que es para el estudiante de las ciencias de la salud el conocimiento de la gentica aplicada y como apoyo prctico a los conocimientos tericos adquiridos en la unidad de aprendizaje de Gentica se disea una serie de prcticas en el Laboratorio de Gentica. El Laboratorio de Gentica le permitir conocer algunas de las tecnologas que son utilizadas para la manipulacin gnica, las prcticas son diseadas en coordinacin temtica a la unidad de aprendizaje de Gentica. Las actividades generalmente estn diseadas en varias etapas, en cada una de las cuales se pretende que el estudiante desarrolle habilidades y destrezas que le sern tiles para su futuro trabajo profesional. Al inicio se pretende que sean guiadas por el docente responsable de la prctica hasta lograr una total responsable independencia de su aprendizaje

-3CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

2. PROPSITO DEL SISTEMA DE PRCTICAS


2.1. Encuadre del sistema de prcticas dentro de la profesin. El uso de las tcnicas bsicas de biologa molecular, como herramienta para el desarrollo de la gentica mdica y la comprensin de sus principios, son capacidades que debe de tener en la actualidad un profesional en ciencias de la salud. Las capacidades que se pretende desarrolle el estudiante a travs de la utilizacin de las diferentes tcnicas de biologa molecular son varias, por ejemplo: aprender las bases de la Tecnologa del DNA recombinante como la PCR, el uso de distintos vectores para el estudio de la funcin y expresin de genes, transformacin bacteriana y mutacin, adems de conocimientos bsicos para apoyar el desarrollo de habilidades y destrezas en unidades posteriores de la licenciatura que el estudiante est cursando. 2.2. Cuadro de competencia
rea de Competencia Profesional: Ciencias Disciplinares Bsico Biolgicas
Necesidad de formacin profesional Laborales: Una de las habilidades requeridas por el profesional de la salud actual es que conozca las diferentes tcnicas de biologa molecular, as como su aplicacin en diferentes mbitos de la gentica mdica. Competencia integrada Perfil Profesional Unidades de aprendizaje Unidades de competencia 1. El futuro profesional conoce el uso y el fundamento de las tcnicas de biologa molecular. 2. Le permite estudiar la estructura, funcin de un gen de inters. 3. Le permite la identificacin de genes involucrados con algunas enfermedades. 4. Le permita plantear una estrategia adecuada para la obtencin de productos gnicos que tengan inters a nivel mdico (ej. vacunas) o industrial
D.C. NORMA URTIZ ESTRADA

Los conocimientos de las tcnicas de biologa molecular le permiten al profesional de la Disciplinar: La tendencia salud desarrollar disciplinar del aprendizaje de la competencia, la Gentica, es integrar el entre otras, de conocimiento de las tcnicas mejorar los de biologa molecular y su mtodos de aplicacin en la gentica diagnostico de mdica. enfermedades genticas, Profesional: Que el adems de que estudiante como un futuro le permiten el integrante de los profesionales planteamiento de de las ciencias de la salud tratamientos desarrolle la competencia del preventivos. uso de la tecnologa del DNA recombinante, para adquirir una de las competencias que en la actualidad deben formar
-4CIENCIAS QUIMICAS

Es necesario que el profesional de la salud tenga Gentica conocimiento del Molecular uso de las tcnicas de biologa molecular en la gentica medica.

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

parte del perfil profesional.

(ej. enzimas).

Sociales: Que el estudiante como futuro integrante del grupo de los profesionales de la salud tenga las competencias bsicas de la tecnologa del DNA recombinante que le permitan proponer nuevas metodologas para la solucin de los problemas de salud (especialmente las enfermedades de carcter hereditario) y la industria actuales.

2.3 Niveles de desempeo _______________________________________________________________________ Nivel 1. Se realizan funciones rutinarias de baja complejidad. Se reciben instrucciones. Se requiere baja autonoma. Nivel 2. Se realizan un conjunto significativo de actividades de trabajo, variadas y aplicadas en diversos contextos. Algunas actividades son complejas y no rutinarias. Presenta un bajo grado de responsabilidad y autonoma en las decisiones. A menudo requiere colaboracin con otros y trabajo en equipo. Nivel 3. Se requiere un importante nivel de toma de decisiones. Tiene bajo su

responsabilidad recursos materiales con los que opera su rea. As como control de recursos financieros para adquisicin de insumos. Nivel 4. Se desarrolla un conjunto de actividades de naturaleza diversa, en las que se tiene que mostrar creatividad y recursos para conciliar intereses. Se debe tener habilidad para motivar y dirigir grupos de trabajo. Nivel 5. Se desarrollan un conjunto de actividades de naturaleza diversa, en las que se tiene que mostrar un alto nivel de creatividad, as como buscar y lograr la cooperacin entre grupos e individuos que participan en la implantacin de un problema de magnitud institucional.

-5CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Las prcticas del Laboratorio de Gentica tendrn un nivel de desempeo del Conocer planteado en el NIVEL 2 a. Los contextos son varios: 1. Aula: con los conocimientos aprendidos en su unidad de aprendizaje de Gentica. 2. Laboratorio de Gentica: aplicar y reforzar los conocimientos tericos con el manejo de las tcnicas de biologa molecular. 3. Otros ambientes de aprendizaje: cuando desarrolle trabajos de investigacin que en cada prctica se les dejara, la finalidad es buscar una aplicacin prctica profesional de lo aprendido en el laboratorio. 4. La complejidad de las prcticas estarn directamente relacionadas con su aprendizaje del aula. 5. Su grado de responsabilidad y autonoma ser determinado con su compromiso de aprender. 6. Se requiere trabajo en equipo para el desarrollo de cada prctica sealada.

3. DESCRIPCIN DEL SISTEMA DE PRCTICAS


3.1 Estructura y programa del Sistema de prcticas Las prcticas en el Laboratorio de Gentica se harn mediante el uso de tcnicas de biologa molecular estandarizadas con el equipo disponible para tales fines, se pretende que el alumno integre los conocimientos tericos aprendidos en el aula. Una de las finalidades de este sistema de prcticas es que el estudiante desarrolle las habilidades de familiarizacin y manejo de tcnicas de biologa molecular, adems de que conozca su aplicacin en la gentica mdica. El programa de prcticas del Laboratorio de Gentica tiene una duracin total aproximada de 30 horas; las prcticas sern secuenciales y coordinadas con la parte terica revisada en el aula. (Unidad de aprendizaje de Gentica).

-6CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Unidad de competencia

Semana en el semestre

Prcticas necesarias para la Unidad de Competencia

Bibliografa

Aprender distintas tcnicas de biologa molecular esenciales para la manipulacin de genes.

1 prctica:
2 semana del curso Comportamiento dentro del laboratorio de gentica 2 prctica Programa de Prcticas del Laboratorio de Gentica. Copia del Resumen de las Normas Oficiales. Reglamento del Laboratorio. Principios de Gentica. James Lewin. Gentica en Medicina Nussbaum-McinnesWillard Molecular cloning. Sambrook y Russell. Tomo I Tomo II Tomo III

Conocer las bases de la tecnologa del DNA recombinante.

Aislamiento de DNA cromosmico 3 y 4 semana del y anlisis mediante curso electroforesis. 3 prctica Amplificacin de genes mediante PCR., y anlisis mediante electroforesis. 4 prctica Aislamiento de DNA plasmdico y anlisis mediante electroforesis. 5 prctica Preparacin de clulas competentes, Transformacin gentica de bacterias, y Seleccin de clones transformados

Enterarse del uso de estas tcnicas en investigacin mdica o industrial.

5 y 6 semana del curso

7 y 8 semana del curso

9, 10 ,11 y 12 semanas del curso

-7CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

4. PRCTICAS GENERALES DE SEGURIDAD. REGLAMENTOS


4.1 Reglamento aplicable a la prctica y el mbito donde se desempean El Laboratorio de Gentica debe seguir prcticas generales de seguridad basadas en la Normas Oficiales Mexicanas de las cuales se han seleccionado algunas que determinan el buen funcionamiento del mismo y estas son:

ESPECIFICACIONES

NORMAS OFICIALES MEXICANAS

CONDICIONES DEL MEDIO AMBIENTE


--El laboratorio cuenta con las condiciones y niveles de iluminacin suficientes y adecuados para el tipo de actividad que realiza. --Se cuenta con normas de Seguridad e Higiene que permitan reducir el riesgo de accidentes en el rea de trabajo. --En los contenedores se indica el tipo de desecho para el cual estn destinados y estn sealizados --Se prohbe en zonas controladas el consumo de alimentos, bebidas y tabaco, el uso de cosmticos y sustancias para ser aplicadas en la piel, as como el empleo de pauelos que no sean desechables.

NOM-025-STPS-1999 NOM-017-STP-2001 NOM-087-ECOL-1995

SISTEMA CONTRA INCENDIOS


--Se instalarn equipos contra incendio de acuerdo al grado de riesgo de incendio, a la clase de fuego que se pueda presentar en el laboratorio y a la cantidad de materiales en el almacn y proceso. --De las salidas normales y de emergencia la distancia a recorrer desde el punto ms lejano del interior de una edificacin a un rea de salida no debe ser mayor de 40 mts. --En caso que la distancia sea mayor a la sealada por el punto anterior, el tiempo mximo en la que debe evacuarse al personal a un lugar seguro es de 3minutos. Lo anterior, deber comprobarse en los registros de simulacros de evacuacin. --La puertas de salida normales de las rutas de evacuacin y de las salidas de emergencia, debern ser libres de obstculos, candados, picaportes o cerraduras con seguros puestos durante las horas laborales Las puertas de salida normales de ruta de evacuacin y de salida de emergencia, deben ser de materiales resistentes al fuego y capaces de impedir el paso del humo entre rea de trabajo. --En las instalaciones de sistemas fijos contra incendios, se deben colocar en sitios visibles y de fcil acceso, libres de obstculos, protegidas de la intemperie y sealar su ubicacin. --Los extintores deben ser revisados al momento de su instalacin y, posteriormente, a intervalos no mayores de un mes.

NOM-002-STPS-2000 NOM-002-STPS-2000 NOM-002-STPS-2000

NOM-002-STPS-2000 NOM-002-STPS-2000 NOM-002-STPS-2000 NOM-002-STPS-2000

EQUIPOS DE PROTECCIN
--Se tiene del conocimiento con capacitacin del personal, para el uso,

limpieza, mantenimiento, limitaciones y almacenamiento del equipo de proteccin personal.

Reglamento Federal de Higiene y Medio Ambiental del Trabajo.. Cap. 5to. Art. 135 al 141

INSTALACIONES ELCTRICAS
-8CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Las instalaciones elctricas deben tener protecciones de seguridad y sealarse de acuerdo al voltaje y corriente elctrica de la carga instalada. NOM-OO1-SEDE-1999, ART. 1 - 34
--El bloqueo de energa para el control de riesgos, estar en tableros,

controles y equipos, a fin de desemergizar, desactivar y/o impedir la operacin normal de la maquinaria y equipo.
--Se ubican las seales de seguridad e higiene de tal manera que

NOM-OO1-SEDE-1999, ART. DEL 384 SEALES, AVISOS DE SEGURIDAD Y CODIGO DE COLORES NOM-026-STPS-1998 Apto 5 y 5.4 NOM-026-STPS-1998 Apto 9 y 9.1 NOM-026-STPS-1998 Apto 5 y 5.3 NOM-001-STPS-1999. Aptdo. 11

pueden ser observadas e interpretadas por los trabajadores a los que estn destinados y se evita que sean obstruidos. --Se utiliza el cdigo de colores en el sistema de tuberas conforme a lo que establece la norma correspondiente. Se garantiza que la aplicacin del color, sealizacin y la identificacin en la cubierta estn sujetas a un mantenimiento que asegure en todo momento su visibilidad y legibilidad.

PLANTA FSICA
--Se realizan verificaciones oculares peridicas a las instalaciones y Reglamento Federal de Higiene y elementos estructurales. Medio Ambiental del Trabajo. Ttulo -Los resultados de dichas verificaciones son anotados en un registro, siempre y cuando se detecten signos de ruptura, agrietamiento, pandeo, fatiga de material, deformacin, hundimiento u otra condicin similar, se deben solicitar las reparaciones correspondientes. --Se establecen lugares limpios, adecuados y seguros destinados al personal, para sanitarios, consumo de alimentos y en su caso, regaderas y vestidores.

2do. Cap. 1ero. Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap. 1ero.

Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap.1 y Cap. 7mo. --Se mantienen las reas de trabajo libres de obstculos y lo suelos Reglamento Federal de Higiene y limpios. As como objetos no debern obstaculizar la iluminacin y Medio Ambiental del Trabajo. ventilacin en las zonas en que stas se requieran. Cap. 8 mo. Y 12 do.
--Se conservan las reas limpias y en orden, permitiendo el desarrollo de

las actividades para las que fueron destinadas, asimismo, se les da mantenimiento preventivo y correctivo. --Las reas de trabajo deben delimitarse mediante franjas amarillas de al menos 5 cm. de ancho de tal manera que se disponga de espacios seguros para la realizacin de actividades. --Los techos del centro de trabajo, cuentan con un sistema que evite el estancamiento de agua. --Las paredes del centro de trabajo, se mantienen con colores que no afecten la visin del trabajador. --Los pisos del centro de trabajo, se mantienen limpios y cuentan con un sistema que evite los estancamientos de lquidos.

NOM-025-STPS-1999, apdo. 7 NOM-001-STPS-1999, NOM-001-STPS-1999, apdo.11 NOM-026-STPS-1998 NOM-026-STPS-1998, apdo.

ORDEN, LIMPIEZA Y SERVICIOS


--De los laboratorios/talleres, el equipo y las instalaciones deben NOM-001-STPS-1999, fracc. 7.1 mantenerse limpias. La limpieza debe hacerse por lo menos al trmino NOM-005-STPS-1998 de cada turno. NOM-087-ECOL-SSA1-2002 --Los servicios sanitarios destinados a los trabajadores, debern Reglamento Federal de Higiene y conservarse permanentemente en condiciones de uso higinicos. Medio Ambiental del Trabajo. Cap. 12,

Art. 108
--Debern existir excusados y mingitorios con agua corriente, separados Reglamento Federal de Higiene y de los hombres de los de las mujeres. Medio Ambiental del Trabajo. Cap. 12,

Art. 103 CONDICIONES GENERALES --Se cuenta con un manual de primeros auxilios en el que se definen los NOM-005-STPS-1998
medicamentos y, materiales de curacin, que requiera el centro de trabajo, as como los procedimientos para la atencin de emergencias mdicas. --Se cuenta con un botiqun de primeros auxilios, en el rea, laboratorio NOM-005-STPS-1998 taller, en la que se deban incluir los materiales de curacin que se -9CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

requieran de conformidad con el anlisis de riesgos. --Se capacita al personal para prestar los primeros auxilios, por lo menos una vez al ao. --Se proporciona a todos los trabajadores, capacitacin y adiestramiento para la prevencin y, proteccin de incendios y combate de conato de incendios. --Se realizan simulacros una vez al ao. --Se organizan y capacitan simulacros de evacuacin del personal y de atencin de primeros auxilios. --Se efecta y registra el reconocimiento, evaluacin y control de los niveles de iluminacin del rea de trabajo.

NOM-005-STPS-1998 NOM-002-STPS-2000, CAP. 5.8 NOM-002-STPS-2000, CAP. 5.9 NOM-002-STPS-2000, CAP. 5.9 NOM-025-STPS-1999, CAP. 8, 9, 10

El laboratorio de Gentica tambin cuenta con un Reglamento Interno que pretende guiar su conducta dentro del mismo, las normas ah sealadas son actitudes que Usted debe conocer, aprender y acatar para un mejor desempeo y desarrollo de competencias. 4.2 Reglamento interno del laboratorio de gentica 1. Ingreso al Laboratorio de Gentica puede ser bajo 2 condiciones: 1) El grupo de estudiantes que tenga asignada una prctica debe llegar al laboratorio de Gentica acompaados del docente responsable de la Unidad de aprendizaje. (la ausencia del docente ocasiona la suspensin de la prctica y sta se reprograma en horarios que no interfiera con alguna actividad del propio laboratorio). 2) El estudiante o grupo de estudiantes (mximo 10) que le interese realizar una prctica para reforzar el aprendizaje. sta actividad puede ser realizada en los horarios determinados por el propio laboratorio. 2. En cualquiera de las 2 condiciones antes sealadas, al ingresar al Laboratorio los estudiantes dejarn en los casilleros que se encuentran en la entrada del mismo, sus mochilas y solo pasaran al Laboratorio con un cuaderno, lpiz, pluma y colores. 3. Adems del uniforme que portan para sus clases diarias, utilizaran bata blanca de manga larga, traern cubierta su cabeza con gorro o turbante que mantenga sus cabellos recogidos y cubiertos. 4. Los estudiantes traern las uas de sus manos cortas y sin esmalte 5. Cada estudiante traer un par de guantes de ciruga para el manejo de los equipos y reactivos, el no portarlos les impedir el manejo de los mismos.

- 10 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

6. Mantendrn sus celulares apagados para no interrumpir el desarrollo de la prctica. El no acatar sta disposicin se har acreedor a una sancin. 7. No podrn ingerir alimentos, bebidas o fumar cuando se encuentren dentro del Laboratorio. 8. Al ingresar al Laboratorio los estudiantes permanecern en el interior del mismo no se permite la salida, sino hasta finalizar la prctica excepto, cuando se organice, alguna actividad que as lo requiera. 9. La asistencia del laboratorio se rige con el Reglamento General, por lo tanto para lograr acreditar ste laboratorio el estudiante debe contar con el 80% de asistencias a sus prcticas programadas. 10. Los reportes de prctica y tareas estarn integradas a una carpeta que se le nombrar Bitcora de Laboratorio. 11. Al finalizar cada una de las prcticas Usted elaborar un reporte de las mismas de acuerdo como le sea indicado. 12. Cada tarea que sea sealada debe entregar una copia a la siguiente prctica, para su revisin, posteriormente se les regresa y se integra a su Bitcora del Laboratorio. 13. Las tareas sealadas en este manual sern obligatorias para todos los grupos que realicen las prcticas sin importan de cual licenciatura provengan. Las cuales se integran en la Bitcora del Laboratorio el cual ser revisado por el docente responsable de la unidad de aprendizaje y el responsable del laboratorio. 14. Las primeras prcticas sern guiadas por el docente responsable de la prctica (docente de la unidad de aprendizaje de Gentica). 15. El grupo de estudiantes se organizarn en equipos de trabajo (puede ser de manera independiente o por indicaciones del docente) y estar en relacin directa a: 3 factores importantes: 1) Nmero total de estudiantes (preferentemente en nmero que no exceda a 6 integrantes). 2) Cantidad de material y equipo disponibles. 3) Duracin de cada prctica. 16. El docente responsable del grupo junto con los estudiantes son responsables del cuidado y conservacin del equipo del laboratorio.
- 11 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

17. Cada equipo de trabajo nombra a uno de sus integrantes como coordinador de la prctica. 18. El responsable del Laboratorio le entregar a cada docente y coordinador de equipo el material necesario para que realicen su prctica mediante la firma de un vale, en el que se seala la integridad del material entregado y el estado general del mismo. 19. Para el manejo de todo el equipo, materiales y reactivos docente y los integrantes de cada equipo deben utilizar guantes, quin no los porte, se le impedir el manejo de los mismos. 20. Durante y al final de la prctica, el docente, Usted y sus compaeros de equipo, son los responsables de la integridad del equipo y material utilizados. 21. La entrega del material perteneciente a ste laboratorio que haya sido utilizado durante la prctica se le har al responsable del laboratorio el cul previa revisin minuciosa, certificar la integridad del mismo y les regresa el vale que firmaron al inicio de la prctica. 22. El funcionamiento del Laboratorio de Gentica est basado en los lineamientos que las Normas Oficiales Mexicanas sealan, las cuales debe conocer y acatar la normalizacin. 23. El Laboratorio de Gentica cuenta con una serie de sealizaciones las cuales Usted debe conocer y cumplir pues fueron diseadas para su proteccin y seguridad personal, el no respetar su significado ser acreedor a una sancin. (Normas Oficiales Mexicanas).

- 12 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

UNIVERSIDAD JUAREZ DEL ESTADO DE DURANGO


Escuela de Ciencias Qumicas

PRIMERA PRCTICA

COMPORTAMIENTO DENTRO DEL LABORATORIO DE GENTICA

Diseada por: DC. NORMA URTIZ ESTRADA.


- 13 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

6. NMERO DE ALUMNOS POR UNIDAD DE PRCTICA


En sta primera prctica el nmero de estudiantes no es limitante para el buen desarrollo de la actividad acadmica pero considerando el espacio el nmero ideal es de 10 estudiantes pero es factible trabajar con 15 como mximo.

7. INTRODUCCIN DE LA PRIMERA PRCTICA


La primera prctica que se realiza en el Laboratorio de Gentica es una actividad que permite que todos los integrantes se conozcan como personas, sus expectativas, las experiencias previas de conocimientos sobre el rea, as como las Normas y Reglamentos que son necesarias conocer y cumplir para que la Competencia se logre. .8. PROPSITO ESPECFICO DE LA PRIMERA PRCTICA: 8.1 Criterios de desempeo 1 PRACTICA: COMPORTAMIENTO DENTRO DEL LABORATORIO DE GENTICA USTED SER COMPETENTE PARA DESENVOLVERSE DENTRO DE UN LABORATORIO CUANDO: a. Al ingresar al laboratorio lo haga puntual y ordenadamente. b. Porte el uniforme reglamentario. c. Identifique, aplique y respete las Normas Oficiales Mexicanas que existen para el funcionamiento del Laboratorio de Gentica. d. Acate el Reglamento Interno del Laboratorio de Gentica. e. Conozca los diversos compartimentos que conforman el Laboratorio de Gentica. f. Use adecuadamente los diferentes equipos y materiales que se encuentran dentro del Laboratorio. g. Conozca el funcionamiento de los equipos. h. Utilice adecuadamente los instrumentos de trabajo. i. Entregue el material y los instrumentos utilizados en cada una de las prcticas completo y en buen estado.

- 14 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Utilizar bata blanca de manga larga. Utilizar guantes para el manejo del equipo, material y reactivos.

Integrar prcticas del Laboratorio de Gentica a la investigacin mdica.

Realizar un reporte de cada prctica Elaborar las tareas Integrar informacin a la Bitcora

El laboratorio de Gentica para su buen funcionamiento requiere que: - Se cumplan los lineamientos de las Normas Oficiales Mexicanas - Se observen las normas del Reglamento Interno del Laboratorio

8.2 Resultado final de la primera prctica


El estudiante que se comporta segn las Normas Oficiales Mexicanas y el Reglamento Interno del Laboratorio.
- 15 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

9. NORMAS DE SEGURIDAD ESPECFICAS DE LA PRIMERA PRCTICA


9.1 Normas Oficiales Mexicanas Especficas para la primera Prctica ESPECIFICACIONES CONCICIONES DEL MEDIO AMBIENTE SISTEMAS CONTRA INCENDIOS EQUIPOS DE PROTECCIN INSTALACIONES ELCTRICAS SEALES, AVISOS DE SEGURIDAD Y CODIGO DE COLORES NORMAS OFICIALES MEXICANAS
NOM-025-STPS-1999 NOM-017-STPS-2001 087-ECOL-1995 NOM-012-STPS-1999 NOM-002-STPS-2000 Reglamento Federal de Higiene y Medio Ambiental del Trabajo.. Cap. 5to. Art. 135 al 141
NOM-001-SEDE-1999, ART.1-34 NOM-001-SEDE-1999,ART. DEL 384

NOM-

NOM-026-STPS-1998 Apto 5 y 5.4 NOM-026STPS-1998 Apto 9 y 9.1 NOM-026-STPS-1998 Apto 5 y 5.3 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap.1 y Cap. 7mo. Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 8 mo. Y 12 do. NOM-025-STPS-1999, apdo. 7 NOM-001-STPS1999, NOM-026-STPS-1998 NOM-026-STPS-1998, apdo NOM-001-STPS-1999, fracc. 7.1 NOM-005STPS-1998 NOM-087-ECOL-SSA1-2002 NOM-087-ECOL-SSA1-2002 Apdo. 4, 5, y 6 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 12, art. 109 y 110. OM-005-STPS-1998 NOM-005-STPS1998 NOM-005-STPS-1998 NOM-002-STPS-2000, CAP. 5.8, 5.9 NOM025-STPS-1999, CAP. 8, 9, 10

PLANTA FISICA

ORDEN, LIMPIEZA Y SERVICIOS

CONDICIONES GENERALES

- 16 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

10. DESARROLLO DE LA PRIMERA PRCTICA


El desarrollo de la primera prctica tendr varios momentos; cada uno de los cuales permitir al docente y estudiante conocer las expectativas que cada unos de ellos tiene respecto del Laboratorio de Gentica.
ACTIVIDADES A) Lineamientos generales para el ingreso al laboratorio de Gentica. TIEMPO REQUERIDO 15 minutos RESULTADO DE LA ACTIVIDAD Conocimiento del Reglamento Interno del Laboratorio de Gentica. Identifique sus conocimientos sobre la gentica, manejo del material y equipo del laboratorio, sus expectativas sobre el programa de prcticas. Como est distribuido el laboratorio. Que reas lo conforman. Que sealizacin es la correcta, y que Normas Oficiales Mexicanas lo determinan A partir del conocimiento de las Normas defina y mencione por escrito en un resumen cules son las que rigen la sealizacin y el buen funcionamiento del Laboratorio de Gentica.

B) Encuadre

120 minutos

C) Identificacin de las diversas reas que conforman el Laboratorio de Gentica y su sealizacin.

15 min.

D) Lectura y anlisis de las Final de la Prctica y diferentes Normas Oficiales Tarea para la siguiente Mexicanas requeridas para el sesin buen funcionamiento del Laboratorio de Gentica.

A).

Primera parte de la prctica:

LINEAMIENTOS GENERALES PARA EL

INGRESO AL LABORATORIO DE GENETICA CADA VEZ QUE TENGAN UNA ACTIVIDAD. 1 El grupo de estudiantes llegara al Laboratorio de Gentica con su maestro responsable de la Unidad de aprendizaje de Gentica. 2 Al ingresar al Laboratorio los estudiantes dejarn con un cuaderno, lpiz, pluma y colores. 3 Adems del uniforme que utilizan para sus clases diaria, utilizaran bata blanca de manga larga, traern cubierta su cabeza con gorro que mantenga sus cabellos recogidos y cubiertos.
- 17 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

en los casilleros que se

encuentran en la entrada del mismo, sus mochilas y solo pasaran al Laboratorio

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

4 Los estudiantes traern las uas de sus manos cortas y sin esmalte. 5 Cada estudiante traer un par de guantes de ciruga para el manejo del material, equipo y reactivos, el no portarlos les impedir el manejo de los mismos. 6 Mantendrn sus celulares apagados para no interrumpir el desarrollo de la prctica. El no acatar sta disposicin se har acreedor a una sancin. 7 No podrn ingerir alimentos, bebidas o fumar cuando se encuentren dentro del Laboratorio. 8 Al ingresar al Laboratorio los estudiantes permanecern en el interior del mismo no se permite la salida, sino hasta finalizar la prctica excepto, cuando se organice, alguna actividad que as lo requiera. 9 Al finalizar cada una de las prcticas Usted elaborar un reporte de las mismas de acuerdo como le sea indicado y la presentar en la prctica siguiente.

B). Segunda parte de la primera prctica: DESARROLLO DE LA ACTIVIDAD DIDCTICA CONOCIDA COMO ENCUADRE. El Encuadre como tcnica de trabajo es muy importante para el desarrollo de cualquier Unidad de aprendizaje, consta de varias actividades y cada una de ellas pretende lograr objetivos que sustenten el xito del aprendizaje. En el manejo y desarrollo de sta tcnica de trabajo, el docente puede utilizar las estrategias que considere conveniente sin olvidar que ste se integra por lo menos de 5 actividades siguientes: 1. Presentacin de los participantes. 2. Anlisis de expectativas. 3. Presentacin del programa 4. Plenario de acuerdos y de organizacin operativa 5. Prueba diagnstica Cada una de stas actividades tiene objetivos explcitos e implcitos; los primeros el propio coordinador se los explicar, los segundos conforme se desarrolle sta actividad los ir descubriendo Usted mismo.
- 18 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

ACTIVIDAD DEL ENCUADRE ES POSIBLE CON STE TIPO DE DISTRIBUCIN DE LOS ESTUDIANTES? -La distribucin que presenta la imagen no permite que la actividad cumpla con las expectativas para lo que fue diseada. sta actividad permite que docente coordinador y estudiantes se conozcan

ACTIVIDAD DEL ENCUADRE CMO DEBEN STAR ORGANIZADOS LOS ESTUDIANTES PARA QUE LA ACTIVIDAD LOGRE EL XITO? CON LA FORMACIN DE EQUIPOS DE TRABAJO Para sta tcnica de trabajo el docente puede utilizar las estrategias que considere pertinente, sin olvidar el objetivo principal: el estudiante debe tener claro: -Qu se va a hacer. Para qu se va hacer. -Como se va hacer. -Es establecer un acuerdo formal entre el docente y los estudiantes

1. Presentacin de los participantes: Este rubro permite que los estudiantes se conozcan entre s, y en docente conozca algo ms de cada uno de ellos. (objetivo explcito) 1) La estrategia para sta primera parte del encuadre ser la de: PRESENTACIN PROGRESIVA. a) Se solicitar a los participantes que se junten en parejas que no se conozcan o que deseen conocerse. (La duracin de la actividad 5 a 10 minutos). Cada participante de sta pareja se presentara con su otro compaero y le contar lo principal de su persona. Es necesario escuchar con suma atencin lo que el compaero le diga de si mismo, porque posteriormente l lo presentar a sus dems compaeros. b) Posteriormente el Coordinador solicita que cada pareja se rena con otra para formar una cuarteta, es mejor que se juntes las duplas que menos se conozcan. Se les indica que en este grupo cada uno de ellos presente a su primera pareja ante los dems compaeros. (10 minutos). c) En este tercer momento el Coordinador solicitar que cada cuarteta se rena con otra de las menos conocidas y formar grupos de ocho. De cada
- 19 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

uno de las cuartetas uno presentara a sus tres compaeros restantes y luego uno de ellos lo presentara a l. (10 a 15 minutos) d) El cuarto momento de esta estrategia, se rene todo el grupo en plenario, lo mejor es sentados en crculo, el Coordinador pedir a uno de cada de las octetos presente al resto de sus compaeros y luego uno de ellos los presente a l. El Coordinador solicitar a un integrante de otro equipo que repita el nombre de los integrantes que acaban de ser presentados. Se repite sta actividad con el resto de los dems equipos. actividad la realizar el Coordinador. (10 15 minutos) 2. Anlisis de las expectativas: ste apartado permite al docente responsable conocer las expectativas que sobre el Laboratorio tiene el estudiante, adems identifica algunas de las habilidades previas en el manejo del equipo e instrumentos que cada estudiante pueda poseer. (objetivo explcito). La actividad tendr el siguiente orden: 1) Se organizarn varios equipos de trabajo utilizando el mtodo que se crea conveniente segn el nmero de estudiantes que asistan a la prctica. 2) Se les reparten una serie de preguntas o situaciones las cuales permiten al docente responsable as como al grupo conocer las expectativas que se tienen sobre las actividades que se realizarn en el Laboratorio de Gentica o tambin la aplicacin que en el ejercicio profesional les ofrecer la unidad de aprendizaje de Gentica y los conocimientos adquiridos en el Laboratorio. La serie de preguntas o situaciones pueden ser: Describa tres situaciones ficticias del trabajo del profesional (aqu se les est solicitando de acuerdo a la licenciatura que est cursando el estudiante) en las que se requiera los conocimientos de Gentica. Y con respecto a las actividades del laboratorio: Qu esperan de ste Laboratorio? Los conocimientos adquiridos en el Laboratorio como les apoyar en su prctica profesional futura?
- 20 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

Al final varios

alumnos elegidos al azar repetirn los nombres de todos y tambin sta

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Que les gustara que pasara en este curso prctico? Que espera del docente coordinador, de sus compaeros y de Usted mismo? A que se compromete Usted mismo? Todas sus respuestas de equipo las plasmarn en una cartulina u otro material didctico El tiempo utilizado es sta actividad no debe de excederse de 20 min.

3) Posteriormente se realizar una plenaria donde un representante de cada equipo expondr las conclusiones a la que llegaron. (20 25 minutos) 3. Presentacin del programa: sta actividad es realizada por el docente donde les presenta en plenaria el programa de debe contener:

Los objetivos Explcitos: Estos objetivos se refieren a: Propuesta de trabajo del docente. Ubicacin de la unidad de aprendizaje en el plan de estudio. Los contenidos que se van a estudiar. Presentacin del programa por escrito

sta actividad se realizar con la presentacin de los anteriores puntos por el docente permitiendo que los estudiantes cuestionen si existe alguna duda, y conformados como se encuentran los equipos puedan hacer sugerencias para modificar, completar o enriquecer alguno de los planteamientos anteriores. (5 20 minutos) 4. Plenario de acuerdos y de organizacin operativa: Esta actividad est muy relacionada con la anterior en la cul cada uno de los equipos expondr sus propuestas; lo que es importante recordar en que en este tipo de negociacin no solo estn involucrados el docente y los estudiantes sino tambin la Institucin, las normas acadmico-administrativas y el plan de estudios vigente y cualquier modificacin o propuesta no debe contradecir a stos. (Objetivo explcito) minutos) 5. Prueba de diagnstico: (10 15

- 21 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

La funcin de sta ltima actividad del encuadre tiene como objetivo explcito el conocer el nivel de conocimientos previos que Usted posee de la unidad de aprendizaje de Gentica, del manejo del equipo, el material y el comportamiento en un Laboratorio. (Como mximo 20 minutos) C. Tercera parte de la primera de la prctica: IDENTIFICACIN DE LAS

DIVERSAS REAS QUE CONFORMAN EL LABORATORIO Y SU SEALIZACIN. Terminando su prueba diagnstica, el docente responsable de la prctica le muestra los espacios que conforman el Laboratorio de Gentica. Es importante que Usted identifique los diversos sealamientos que se encuentran dentro y fuera del Laboratorio (En su cuaderno de trabajo Usted debe anotar las sealizaciones observadas y su ubicacin). El docente le entrega una sntesis de las Normas Oficiales Mexicanas y del Reglamento Interno del Laboratorio para su posterior lectura en casa que le permite a Usted una mejor comprensin de: Los diversos sealamientos que identific en el Laboratorio de Gentica. El comportamiento que tiene que seguir dentro del mismo. D. Tarea para la prxima prctica: LECTURA Y ANLISIS DE LAS NORMAS MEXICANAS OFICIALES Y DEL REGLAMENTO INTERNO DEL LABORATORIO DE MORFOLOGA. o Despus de conocer las diferentes reas del Laboratorio de Gentica Usted elabore un croquis del mismo. o Mencione y describa las caractersticas de las diversas sealizaciones que Usted identifico dentro del Laboratorio. o Relacione stas sealizaciones con las Normas Oficiales Mexicanas (resumen que se le entreg en el Laboratorio). o Realice una resea de los acontecimientos de la primera prctica con los siguientes puntos:.

La explicacin del docente respecto al Reglamento Interno del Laboratorio fue la adecuada? Si tiene alguna duda mencinela.
- 22 -

CIENCIAS QUIMICAS

D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

La actividad del Encuadre segn su opinin le fue til? Si no es as, qu detalles o sugerencias no fueron las adecuadas? A partir del conocimiento de las Normas Oficiales Mexicanas identifique y mencione por escrito cules de ellas estn relacionadas con las sealizaciones que Usted encontr en el Laboratorio?

11. SISTEMA DE EVALUACIN DE LA PRIMERA PRCTICA


11.1 Lineamientos Generales para la Evaluacin. En ste apartado se refiere a la observacin que el docente responsable hace a su desempeo dentro del laboratorio. Para sta primera prctica su evaluacin ser a travs de los siguientes parmetros: Examen diagnstico: aplicado en laboratorio. Conocimiento, observacin y aplicacin de los lineamientos del Reglamento Interno del Laboratorio. Conocimiento, observacin y aplicacin a lo establecido en las Normas Oficiales Mexicanas. Reporte Escrito: Elaboracin de una resea: que se anexara a una carpeta que se le conocer de aqu en adelante como Bitcora del Laboratorio . 11.2 Resultados esperados en relacin con los Criterios de desempeo especficos de la primera prctica. Examen diagnstico: con sta serie de preguntas el docente responsable puede conocer su aprendizaje previo de Gentica, manejo de equipo, materiales y su conducta dentro de un laboratorio. Conocimiento, observacin y aplicacin de los lineamientos del Reglamento Interno del Laboratorio. El aplicar de manera correcta la serie de lineamientos le permite a Usted normar su conducta en un laboratorio que representa una parte
- 23 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

importante para desarrollar sus habilidades y actitudes necesarias para lograr la competencia. Conocimiento, observacin y aplicacin de lo establecido en las Normas Oficiales Mexicanas. El conocimiento de stas Normas le permiten a Usted comprender la razn del porque de las diversas sealizaciones que identifico tanto dentro y fuera del laboratorio, el porque de su ubicacin, su significado y la importancia de que un Laboratorio trabaje basndose en estas Normas. 11.3 Mtodo de asignacin de calificaciones de la primera prctica

En sta primera prctica los conocimientos previos no tiene una significacin preponderante ya que el desarrollo del resto de las prcticas de ste laboratorio una de sus principales finalidades es mejorar el aprendizaje de la Gentica, por lo tanto la ponderacin no ser alta. Por el contrario el conocimiento del Reglamento Interno del Laboratorio as como, las Normas Oficiales Mexicanas son bsicamente los conocimientos necesarios e indispensables para adquirir la competencia prevista en sta primera prctica; por lo tanto la calificacin y ponderacin de sta primera prctica es la siguiente:

ACTIVIDAD A CALIFICAR Examen diagnstico Conocimiento, observacin y aplicacin de los lineamientos del Reglamento Interno del Laboratorio.

PONDERACIN 20% 30% 30% 20%

Conocimiento, observacin y aplicacin a lo establecido en las Normas Oficiales Mexicanas .


Bitcora de Laboratorio (Resea de la primera prctica)

12. BIBLIOGRAFA: Reglamento Interno del Laboratorio de Gentica Resumen de las Normas Oficiales Mexicanas

- 24 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

13. PARA SABER MS Realizar una bsqueda en Internet las caractersticas de otros laboratorios de Gentica de Facultades de Medicina y sealar algunas diferencias respecto a nuestro Laboratorio

UNIVERSIDAD JUAREZ DEL ESTADO DE DURANGO


ESCUELA DE CIENCIAS QUMICAS
SEGUNDA PRCTICA

EXTRACCIN DE DNA CROMOSMICO

- 25 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Diseada por: DC. NORMA URTIZ ESTRADA

15. NMERO DE ALUMNOS POR UNIDAD DE PRCTICA


La organizacin de la segunda prctica ser directamente condicionada al nmero de estudiantes, el espacio en el laboratorio y el material disponible.

16. INTRODUCCIN DE LA SEGUNDA PRCTICA


Una de las funciones de ste laboratorio es ofrecer a Usted la oportunidad de realizar un aprendizaje prctico a travs del manejo de tcnicas estandarizadas de biologa molecular que le permiten familiarizarse con la manipulacin gentica, adems de que refuerza los conocimientos tericos estudiados en el aula de la unidad de aprendizaje de Gentica. La primera prctica que se realiza en el Laboratorio de Gentica es la de Extraccin de DNA Cromosmico. Con sta prctica usted inicia el aprendizaje de las tcnicas de biologa molecular. El DNA de doble cadena es qumicamente inerte. Sus grupos potencialmente reactivos se encuentran hacia la parte interna de la hlice, unidos por puentes de hidrgeno. Sus pares de bases estn protegidas exteriormente por una formidable envoltura de fosfatosazcares y estn reforzadas por grandes fuerzas internas agrupadas. Gracias a esta gran proteccin y andamiaje, el DNA se mantiene qumicamente inalterado en ubicaciones tan inapropiadas como en la escena de un crimen o lugares de entierro antiguos. Sin embargo, a pesar de su estabilidad qumica, el DNA es fsicamente frgil. Su gran extensin y sinuosidad, su baja estabilidad lateral y alto peso molecular, lo hacen vulnerable a fuerzas hidrodinmicas simples. El DNA de doble cadena en solucin se enrolla azarosamente y se tensa por las interacciones agrupadas entre los pares de bases y la repulsin electrosttica entre los grupos fosfato cargados del esqueleto, por lo tanto, el flujo hidrodinmico simple, resultado del pipeteo o agitacin, puede romperlo.

17. PROPSITO ESPECFICO DE LA SEGUNDA PRCTICA:


17.1 Criterio de desempeo
- 26 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

2 PRCTICA: EXTRACCIN DE DNA CROMOSMICO. EL ESTUDIANTE ESTAR CAPACITADO PARA AISLAR Y ANALIZAR EL DNA OBTENIDO DE CLULAS BACTERIANAS U OTROS MODELOS DE ESTUDIO CUANDO: a. Se asegure de tener a la mano todo el material requerido para realizar la prctica. b. Trabaje de manera ordenada, segura y limpia. c. Siga cada uno de los pasos indicados para el desarrollo exitoso de la tcnica, teniendo cuidado de no omitir, o equivocarse en alguno. d. Pueda observar un resultado favorable.

17.2 Resultado final de la segunda prctica


El estudiante asla DNA cromosmico, lo observa y lo analiza.

18. NORMAS DE SEGURIDAD ESPECFICAS DE LA PRCTICA


18.1 Cuadro de Normas Oficiales Mexicanas Especficas de la segunda Prctica ESPECIFICACIONES CONCICIONES DEL MEDIO AMBIENTE SISTEMAS CONTRA INCENDIOS EQUIPOS DE PROTECCIN INSTALACIONES ELCTRICAS SEALES, AVISOS DE SEGURIDAD Y CODIGO DE COLORES NORMAS OFICIALES MEXICANAS
NOM-025-STPS-1999 NOM-017-STPS-2001 087-ECOL-1995 NOM-012-STPS-1999 NOM-002-STPS-2000 Reglamento Federal de Higiene y Medio Ambiental del Trabajo.. Cap. 5to. Art. 135 al 141
NOM-001-SEDE-1999, ART.1-34 NOM-001-SEDE-1999,ART. DEL 384

NOM-

NOM-026-STPS-1998 Apto 5 y 5.4 NOM-026STPS-1998 Apto 9 y 9.1 NOM-026-STPS-1998 Apto 5 y 5.3 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap.1 y Cap. 7mo. Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 8 mo. Y 12 do. NOM-025-STPS-1999, apdo. 7 NOM-001-STPS1999, NOM-026-STPS-1998 NOM-026-STPS-1998, apdo

PLANTA FISICA

- 27 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

ORDEN, LIMPIEZA Y SERVICIOS

CONDICIONES GENERALES

NOM-001-STPS-1999, fracc. 7.1 NOM-005STPS-1998 NOM-087-ECOL-SSA1-2002 NOM-087-ECOL-SSA1-2002 Apdo. 4, 5, y 6 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 12, art. 109 y 110. OM-005-STPS-1998 NOM-005-STPS1998 NOM-005-STPS-1998 NOM-002-STPS-2000, CAP. 5.8, 5.9 NOM025-STPS-1999, CAP. 8, 9, 10

19. DESARROLLO DE LA SEGUNDA PRCTICA


El mtodo a seguir para la obtencin de DNA cromosmico, comprende la lisis o rompimiento enzimtico (con lisozima) de las clulas bacterianas en presencia de EDTA (para secuestrar los cationes divalentes e inactivar DNAsas), solubilizacin de membranas y desnaturalizacin de protenas con el detergente inico SDS (Dodecil Sulfato de Sodio). Enseguida, el DNA es purificado en diversas fases por extraccin con solventes orgnicos y el RNA contaminante es eliminado por digestin con RNAsa. Por ltimo el DNA obtenido mediante este mtodo es analizado en un gel de agarosa al 1% teido con bromuro de etidio. 19.1 Metodologa Esta tcnica fue descrita por Cutting y Van Der Horn, en 1990. Se toma una asada de una colonia aislada de B. subtilis 168 e inocula en un tubo de ensaye conteniendo 2.5 ml de medio LB (Luria Bertani). Se deja crecer hasta llegar a saturacin (aproximadamente 8 h). Se cosechan las clulas por centrifugacin en un microtubo (13,000 rpm) y se lavan con 1 ml de buffer de lisis (EDTA, 0.05M; NaCl, 0.1M; pH 7.5). Las clulas se resuspenden en 300 l de buffer de lisis. Se aade 100l de lisozima (10 mg/ml en buffer de lisis) gota a gota y se agita la mezcla en el vortex. Se procede a incubar la muestra a 37 0 C durante 5 min. Se aaden 30 l de SDS al 20% (p/v), se mezcla e incuba la muestra a 37 0C durante 5 min. A continuacin se procede a extraer el lisado celular con un volumen igual de fenol: cloroformo: alcohol isoamlico (24: 25: 1, v/v), se mezcla en el agitador de vrtice y se centrifuga a 14 000 rpm (revoluciones por minuto). Este paso se repite hasta que la interfase no es visible. La fase acuosa se precipita con 45 l de acetato de sodio 3 M (pH 7.0) y 2 volmenes de etanol al 95%, fro. El tubo se invierte suavemente, y se deja reposar hasta que el DNA genmico forma un ovillo. Se espera hasta que el DNA se
- 28 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

deposite en el fondo del tubo y se decanta el sobrenadante cuidadosamente. Se procede a lavar la muestra de DNA con etanol al 95%, se deja secar al aire, y se resuspende en 10 l de amortiguador T10 E1 (Tris-HCl 10 mM, EDTA 1 mM, pH 8). Se agrega a la muestra 1 L de RNAsa para degradar el RNA contaminante. El DNA se analiza en un gel de agarosa al 1% (p/v) teido con 0.1 % (p/v) de bromuro de etidio. 19.2 Programa de actividades El desarrollo de la segunda prctica ser manejado en 3 etapas. El cuidado y manejo del equipo y reactivos sern responsabilidad del docente y de Usted.

ACTIVIDADES 1) El docente explicar de manera breve el manejo de los equipos y materiales que se utilizarn para el desarrollo de la prctica. 2) Cada subgrupo de estudiantes obtendr y analizar DNA cromosmico.

TIEMPO REQUERIDO

RESULTADO ESPERADO A travs de la observacin guiada por el docente, el estudiante se familiariza con el equipo y el material que se utilizara para el desarrollo de la prctica, adems conoce los puntos clave para el resultado exitoso de la misma. El estudiante aprender de manera prctica la obtencin de DNA cromosmico, que es uno de los materiales esenciales para iniciar el estudio de genes de inters, y es la base para el desarrollo de la siguiente prctica. El estudiante por medio de la lectura, conocer algunas de las tecnologas del DNA recombinante, dems de su aplicacin prctica en la gentica mdica.

20 min.

2 das.

3) Investigacin de: Tarea

Tcnicas de Southernblot, Northernblot, Westernblot y PCR. La utilizacin en la gentica mdica de las anteriores.

- 29 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

19.3 EQUIPOS, INSTRUMENTOS Y REACTIVOS


EQUIPOS Incubador orbital Estufa Vortex Cmara de electroforsis INSTRUMENTOS Tubos de ensaye Pipetas Micropipetas Matraces Microtubos REACTIVOS T10E1 TAE 1X Fenol Cloroformo Alcohol isoamlico Agarosa Bromuro de etidio Nota: Todos los reactivos deben ser manejados de forma cuidadosa y con el uso de guantes de ltex, no pipetear y tener cuidado de no inhalar.

20. SISTEMA DE EVALUACIN DE LA SEGUNDA PRCTICA


20.1 Lineamientos generales para la evaluacin de la segunda prctica La evaluacin de sta prctica es responsabilidad del docente encargado de la actividad. Son varios los aspectos que se le evaluar: Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Manejo adecuado de los equipos materiales y reactivos. El resultado de la prctica. Elaboracin de la tarea de investigacin. 20.2 Resultados esperados relacionados con los Criterios de Desempeo Especficos de la segunda prctica. Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Este parmetro forma parte de los conocimientos formativos necesarios para lograr la capacidad del comportamiento adecuado en un laboratorio. ste parmetro aunque no se seale en las siguientes prcticas es
- 30 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

importante que recuerde que siempre es calificado por el docente responsable de la prctica. Manejo adecuado de los equipos, materiales y reactivos: Este parmetro se refiere a seguir con varios de los lineamientos sealados por el Reglamento Interno del Laboratorio. Resultado de la prctica: Indicador de su capacidad para seguir una tcnica, cuyo resultado favorable es esencial para el desarrollo de la siguiente prctica. Elaboracin de la tarea de investigacin: sta parte de la actividad en el laboratorio tiene la finalidad para que Usted: Desarrolle la habilidad de investigacin bibliogrfica. Logre identificar la aplicacin prctica en su actividad profesional futura. 20.3 Mtodo de asignacin de calificaciones:
ACTIVIDAD A CALIFICAR -- Comportamiento responsable de acuerdo a los lineamientos del laboratorio -- Manejo adecuado del equipo, material y reactivos --Resultado de la prctica -- Tarea de investigacin

PONDERACIN
20% 30% 30% 20 %

21. BIBLIOGRAFA
Molecular cloning. A laboratory manual. J. Sambrook. E.F. Fritsch y T. Maniatis (Eds.) Cold Spring Harbor Laboratory Press. New York 1989. Current Protocols in Molecular Biology. F. Ausbel, R. Brent, R. Kingston, D.D. Moore, J.G. Seidman, J.G. Smith, y K. Struhl (Eds.) John Wiley & Sons Inc. 19941995. Gentica en Medicina. R.L. Nussbaum, R.R. McInnes, H.F. Williard. 5a Edicin. Editorial MASSON. 2004.

- 31 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

22. PARA SABER MS


La revisin detallada de los textos de la bibliografa que le permitan conocer ms detalladamente las tcnicas empleadas en biologa molecular.

23. GLOSARIO DE TERMINOS


Investigar el significado de la siguiente lista de palabras utilizadas en gentica mdica.
ADN complementario (ADNc). Cebador. Clonar. Hibridacin. Inserto. Oligonucletido. Vector. Biblioteca Genmica. Clon. Endonucleasas de restriccin. Husped. Ligacin. Sonda.

ACTIVIDAD Indique con una flecha, en que direccin migraran las muestras de DNA del gel de ectroforsis y explique por qu?

Muestras

- 32 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

UNIVERSIDAD JUAREZ DEL ESTADO DE DURANGO


ESCUELA DE CIENCIAS QUMICAS

TERCERA PRCTICA

AMPLIFICACIN DE GENES MEDIANTE PCR

Diseada por:
- 33 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

DC. NORMA URTIZ ESTRADA

25. NMERO DE ALUMNOS POR UNIDAD DE PRCTICA


La organizacin de la tercera prctica ser directamente condicionada al nmero de estudiantes, el espacio en el laboratorio y el material disponible.

26. INTRODUCCIN DE LA TERCERA PRCTICA


La reaccin en cadena de polimerasa o PCR (de sus siglas en ingls Polymerase Chain Reaction) fue descubierta en 1985 por Karry Mullis en el laboratorio de Cetus Corporation, California, USA, lo que le represent el premio Nobel en 1993. Su nombre lo debe a que la actividad de la enzima DNA polimerasa permite fabricar una cadena de DNA complementaria a otra ya existente. Es una tcnica empleada en Biologa Molecular que permite la copia in vitro de fragmentos especficos de DNA; consiste en la separacin por calor de las dos cadenas del DNA que se quiere amplificar a partir de un punto marcado por dos segmentos pequeos de DNA conocidos como cebadores (primers o iniciadores), que estn constituidos de 10 a 30 nucletidos e indican el inicio y el final del fragmento a duplicar. Mediante la accin de una enzima denominada DNA polimerasa, se van agregando en forma complementaria los nucletidos necesarios para obtener una replica exacta de la cadena original. Este procedimiento se repite varias veces y se obtienen mltiples copias del fragmento de DNA escogido. Sus nicos requerimientos son que existan nucletidos en el medio (adenina, guanina, citosina y timina), cebadores, DNA original y la enzima DNA polimerasa. Debido a que para el desarrollo de la tcnica se emplean temperaturas mayores de 70, se requiere de una enzima que no se inactive a temperaturas elevadas, por lo que se emplea la DNA polimerasa de la bacteria Thermus aquaticus que vive en aguas termales y cuya enzima puede trabajar a altas temperaturas. La reaccin en cadena de polimerasa se desarrolla en tres etapas: 1. Desnaturalizacin del DNA.

- 34 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Por medio de la aplicacin de calor a 94C, se produce la separacin de las dos cadenas de la molcula de DNA que se quiere amplificar. Al romperse los enlaces de hidrgeno, cada cadena acta como molde para fabricar su complementaria. 2. Hibridacin con cebadores. La temperatura se disminuye rpidamente a 55 C, para lograr que los cebadores o primers reconozcan sus secuencias complementarias en las cadenas de DNA correspondientes y se unan con ellas. Los primers no deben ser complementarios entre s y deben corresponder a los extremos del fragmento del DNA que se quiere amplificar. 3. Extensin con Taq polimerasa. Para esta etapa, la temperatura se eleva a 72 C, con lo que la taq polimerasa agrega los diferentes nucletidos complementarios siguiendo el orden de la cadena que sirve de molde. El proceso se repite un nmero determinado de veces o ciclos, generalmente 30, y se consigue un aumento o amplificacin exponencial del nmero de copias del fragmento de DNA que sirvi como molde. (1, 2, 3) Una ventaja de la tcnica es que amplifica nicamente el fragmento de DNA que queremos, aunque est en cantidades mnimas (alta sensibilidad) o en presencia de grandes cantidades de DNA semejantes (alta especificidad). La reaccin es eficaz incluso si se parte de muestras de DNA muy poco purificadas, es decir, que se encuentran en presencia de otros componentes. Una vez amplificada la molcula del DNA que se desea, se coloca la muestra en gel de agarosa, en el que se agrega azul de bromofenol que nos permitir visualizar cmo la muestra corre a travs del gel, para lo que se emplea corriente elctrica a 100 mV, durante 30 a 40 minutos. De acuerdo con el tamao de la molcula de DNA, ser la distancia que correr en el gel; posteriormente este se tie con bromuro de etidio que permite visualizar la extensin en forma de bandas con el empleo de luz ultravioleta. La banda obtenida se compara con un
- 35 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

marcador de peso molecular para poder establecer su tamao y as verificar si corresponde al fragmento que se busca o se puede correr al mismo tiempo que un control conocido y establecer comparaciones entre ambas bandas. El material biolgico a partir del cual se pueden obtener muestras para el anlisis del DNA es mltiple e incluye sangre, piel, semen, cabellos, material de biopsia, o puede conseguirse a partir de los instrumentos utilizados para la recoleccin de las muestras como son cotonetes o cepillos. La PCR se aplic inicialmente como una tcnica de laboratorio de investigacin, pero su gran especificidad y sensibilidad ha permitido el desarrollo de tcnicas especficas basadas en ella con aplicacin en muchos campos de la investigacin y el anlisis. As, se ha convertido en una herramienta fundamental en campos tan diversos como la investigacin (clonacin de genes, deteccin de clones recombinantes, estudio de DNA de fsiles), medicina forense y criminalstica (determinacin de paternidad, identificacin de individuos y de sospechosos, as como en el anlisis de la evidencia en casos de asesinato, violacin, etc.), sanidad animal y mejora gentica (deteccin de enfermedades genticas e infecciosas, pureza de razas, etc.) y medicina (diagnstico de enfermedades).

27. PROPSITO ESPECFICO DE LA TERCERA PRCTICA:


27.1 Criterio de desempeo 3 PRCTICA: AMPLIFICACIN DE GENES MEDIANTE PCR. EL ESTUDIANTE ESTAR CAPACITADO PARA AMPLIFICAR UN GEN DE INTERS Y ANALIZARLO CUANDO: e. Se asegure de tener a la mano todo el material requerido para realizar la prctica. f. Trabaje de manera ordenada, segura y limpia. g. Siga cada uno de los pasos indicados para el desarrollo exitoso de la tcnica, teniendo cuidado de no omitir, o equivocarse en alguno. h. Pueda observar la banda de amplificacin esperada.

27.2 Resultado final de la tercera prctica


El estudiante logra amplificar un gen de inters, lo observa y lo analiza.
- 36 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

28. NORMAS DE SEGURIDAD ESPECFICAS DE LA PRCTICA


28.1 Cuadro de Normas Oficiales Mexicanas Especficas de la Tercera Prctica ESPECIFICACIONES CONCICIONES DEL MEDIO AMBIENTE SISTEMAS CONTRA INCENDIOS EQUIPOS DE PROTECCIN INSTALACIONES ELCTRICAS SEALES, AVISOS DE SEGURIDAD Y CODIGO DE COLORES NORMAS OFICIALES MEXICANAS
NOM-025-STPS-1999 NOM-017-STPS-2001 087-ECOL-1995 NOM-012-STPS-1999 NOM-002-STPS-2000 Reglamento Federal de Higiene y Medio Ambiental del Trabajo.. Cap. 5to. Art. 135 al 141
NOM-001-SEDE-1999, ART.1-34 NOM-001-SEDE-1999,ART. DEL 384

NOM-

NOM-026-STPS-1998 Apto 5 y 5.4 NOM-026STPS-1998 Apto 9 y 9.1 NOM-026-STPS-1998 Apto 5 y 5.3 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap.1 y Cap. 7mo. Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 8 mo. Y 12 do. NOM-025-STPS-1999, apdo. 7 NOM-001-STPS1999, NOM-026-STPS-1998 NOM-026-STPS-1998, apdo NOM-001-STPS-1999, fracc. 7.1 NOM-005STPS-1998 NOM-087-ECOL-SSA1-2002 NOM-087-ECOL-SSA1-2002 Apdo. 4, 5, y 6 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 12, art. 109 y 110. OM-005-STPS-1998 NOM-005-STPS1998 NOM-005-STPS-1998 NOM-002-STPS-2000, CAP. 5.8, 5.9 NOM025-STPS-1999, CAP. 8, 9, 10

PLANTA FISICA

ORDEN, LIMPIEZA Y SERVICIOS

CONDICIONES GENERALES

29. DESARROLLO DE LA TERCERA PRCTICA


La tcnica descrita a continuacin para la amplificacin de un gen mediante PCR sigue el prototipo de la PCR descrita por Karry Mullis en 1990. Tambin se describen
- 37 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

algunas consideraciones especiales para la preparacin de reactivos y el uso de los materiales tpicos de la PCR.

29.1 Metodologa 1.- En un microtubo de 0.5 ml estril mezcle en el siguiente orden: 10 x Buffer de amplificacin 20 mM dNTPs 20 M Oligonucletido directo 20 M Oligonucletido reverso DNA polimerasa termoestable 100 x BSA H2O HPLC estril DNA templado Volumen total 5 l 1 l 2.5 l 2.5 l 0.5 l 0.5 l 37.5 l 0.5 l 50 l

Nota: de preferencia se debe hacer la mezcla sobre un recipiente con hielo.

Si no se est utilizando un termociclador de gradiente, se debe cubrir la mezcla de reaccin con una gota de aceite mineral para evitar la evaporacin del agua durante los ciclos repetidos de calentamiento y enfriamiento. 3.- Los tiempos y temperaturas de desnaturalizacin, alineamiento y polimerizacin, se listan a continuacin: # DE CICLOS 30 ciclos ltimo ciclo DESNATURALIZACIN 30 segundos/ 94 C 1 minuto/ 94C ALINEAMIENTO 30 segundos/ 65C 30 segundos/ 65C POLIMERIZACIN 1 minuto/ 72C 1 minuto/ 72C

Nota: Estos tiempos son apropiados para un volumen de reaccin de 50 l. La polimerizacin debe de ser de un minuto por cada 1000 pares de bases de longitud del DNA a amplificar.

- 38 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

3.- Si en el paso 2 agreg aceite mineral, asegrese de eliminarlo cuidadosamente con la micropipeta. 4.- Tome una muestra de la reaccin (5-10 l), y analizarla en un gel de agarosa al 1% (p/v) asegurndose de incluir en el gel marcadores de tamao del DNA. 5.- Tia el gel con bromuro de etidio al 0.1% (p/v) para visualizar la banda de amplificacin.
Nota: Una amplificacin exitosa debe observarse como una banda claramente visible del tamao esperado.

29.2 Programa de actividades El desarrollo de la tercera prctica ser manejado en 3 etapas. El cuidado y manejo del equipo y reactivos sern responsabilidad del docente y de Usted.
ACTIVIDADES 1) El docente explicar de manera breve el manejo de los equipos y materiales que se utilizarn para el desarrollo de la prctica. 2) Cada subgrupo de estudiantes amplificar mediante la PCR un gen de interes, lo observar y analizar. 3) Investigacin de las siguientes variantes de la tcnica PCR:

TIEMPO REQUERIDO 20 min.

RESULTADO ESPERADO A travs de la observacin guiada por el docente, el estudiante se familiariza con el equipo y el material que se utilizara para el desarrollo de la prctica, adems conoce los puntos clave para el resultado exitoso de la misma. El estudiante aprender una de las tcnicas de Biologa Molecular ms sencillas y verstiles.

2 das. El estudiante por medio de la lectura, conocer algunas de las variantes de la tcnica PCR, adems de su aplicacin prctica en la gentica mdica.

Tarea

AFLP, RT-PCR, PCRSSCP, PCR de tiempo real, PCR-RFLP, RAPD. La utilizacin en la gentica mdica de las anteriores.

29.3 EQUIPOS, INSTRUMENTOS Y REACTIVOS


EQUIPOS Termociclador
CIENCIAS QUIMICAS

INSTRUMENTOS Micropipetas
- 39 -

REACTIVOS DNA
D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Cmara de electroforsis

Microtubos

BSA T10E1 (estril) Agua grado HPLC (estril) Taq polimerasa o Vent polimerasa. Nota: Los Oligonucletidos. microtubos deben Agarosa ser esterilizados y Bromuro de etidio manejarse con guantes. Nota: Todos los reactivos deben ser manejados de forma cuidadosa y con el uso de guantes de ltex, no pipetear y tener cuidado de no inhalar.

30. SISTEMA DE EVALUACIN DE LA TERCERA PRCTICA


30.1 Lineamientos generales para la evaluacin de la tercera prctica La evaluacin de sta prctica es responsabilidad del docente encargado de la actividad. Son varios los aspectos que se le evaluar: Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Manejo adecuado de los equipos materiales y reactivos. El resultado de la prctica. Elaboracin de la tarea de investigacin. 30.2 Resultados esperados relacionados con los Criterios de Desempeo especficos de la tercera prctica. Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Este parmetro forma parte de los conocimientos formativos necesarios para lograr la capacidad del comportamiento adecuado en un laboratorio. ste parmetro aunque no se seale en las siguientes prcticas es importante que recuerde que siempre es calificado por el docente responsable de la prctica. Manejo adecuado de los equipos, materiales y reactivos: Este parmetro se refiere a seguir con varios de los lineamientos sealados por el Reglamento Interno del Laboratorio.

- 40 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Resultado de la prctica: Indicador de su capacidad para seguir una tcnica, cuyo resultado favorable es esencial para el desarrollo de la siguiente prctica. Elaboracin de la tarea de investigacin: sta parte de la actividad en el laboratorio tiene la finalidad para que Usted: Desarrolle la habilidad de investigacin bibliogrfica. Logre identificar la aplicacin prctica en su actividad profesional futura.

30.3 Mtodo de asignacin de calificaciones:


ACTIVIDAD A CALIFICAR -- Comportamiento responsable de acuerdo a los lineamientos del laboratorio -- Manejo adecuado del equipo, material y reactivos --Resultado de la prctica -- Tarea de investigacin

PONDERACIN
20% 30% 30% 20 %

31. BIBLIOGRAFA
Molecular cloning. A laboratory manual. J. Sambrook. E.F. Fritsch y T. Maniatis (Eds.) Cold Spring Harbor Laboratory Press. New York 1989. Current Protocols in Molecular Biology. F. Ausbel, R. Brent, R. Kingston, D.D. Moore, J.G. Seidman, J.G. Smith, y K. Struhl (Eds.) John Wiley & Sons Inc. 19941995. Gentica en Medicina. R.L. Nussbaum, R.R. McInnes, H.F. Williard. 5 a Edicin. Editorial MASSON. 2004.

32. PARA SABER MS


La revisin detallada de los textos de la bibliografa que le permitan conocer ms detalladamente las tcnicas empleadas en biologa molecular.

33. GLOSARIO DE TERMINOS


Investigar el significado de lo siguiente:
- 41 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

DNA. Codn. Anticodn. mRNA. tRNA. Cadena codificante. Mutacin.

Mutacin de trmino de cadena. Mutacin puntual. Mutacin por transicin. Mutacin de cambio de marco. Mutacin de cambio de significado. Mutacin sin sentido.

ACTIVIDAD La secuencia de aminocidos que se presenta a continuacin representa parte de una protena. Consultando la tabla, determine la secuencia de doble cadena que corresponde al gen. Indique Qu cadena es la que lee - 42 la - RNA pol? y Cul sera la secuencia del mRNA? D.C. NORMA URTIZ ESTRADA CIENCIAS QUIMICAS -lys-arg-his-his-tyr-leu-

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

UNIVERSIDAD JUAREZ DEL ESTADO DE DURANGO


ESCUELA DE CIENCIAS QUMICAS

CUARTA PRCTICA

AISLAMIENTO DE DNA PLASMDICO

Diseada por:
- 43 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

DC. NORMA URTIZ ESTRADA

35. NMERO DE ALUMNOS POR UNIDAD DE PRCTICA


La organizacin de la cuarta prctica ser directamente condicionada al nmero de estudiantes, el espacio en el laboratorio y el material disponible.

36. INTRODUCCIN DE LA CUARTA PRCTICA


Los plsmidos son molculas de DNA extracromosmico que varan en tamao de 1 kb hasta ms de 200 kb. La mayora son molculas de doble cadena, covalentemente cerrados y circulares, que pueden aislarse de las clulas bacterianas en una forma superenrollada. Se encuentran en una amplia variedad de especies bacterianas; la mayora tienen un bajo rango de hospedero y solo pueden ser mantenidos por un grupo limitado de especies muy relacionadas. Se comportan como unidades genticas accesorias que se replican y transmiten de forma independiente del DNA cromosmico bacteriano. Han desarrollado una variedad de mecanismos para mantener un nmero estable de copias en sus bacterias hospederas, son dependientes en mayor o menor grado, de las enzimas y protenas codificadas por su hospedero para su replicacin y transcripcin. Frecuentemente contienen genes que codifican enzimas que son tiles para su hospedero. Estos genes especifican una gran variedad de caractersticas, muchas de las cuales tienen importancia mdica y comercial. Entre los fenotipos conferidos por los plsmidos son la resistencia a antibiticos o produccin de los mismos, degradacin de compuestos orgnicos, la produccin de enterotoxinas restriccin. Los vectores plasmdicos contienen marcadores genticos que le confieren una gran ventaja de crecimiento a las bacterias que los contienen, bajo condiciones de seleccin. En biologa molecular estos marcadores son usados para seleccionar los y enzimas de modificacin o

- 44 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

clones bacterianos que los portan ya que ofrecen resistencia especfica a antibiticos como la kanamicina, ampicilina, carbenicilina, entre otros. Los primeros plsmidos usados como vectores de clonacin fueron pSC101 (Cohen y col., 1973), colE1 (Hershfield y col., 1974) y pCR1 (Covey y col., 1976), sin embargo no eran verstiles, se replicaban pobremente, posean marcadores de seleccin inapropiados y ninguno de ellos posea mas de dos sitios de restriccin que pudieran ser usados para clonacin. El primer plsmido que combinaba todas las caractersticas deseables disponibles en aquel tiempo fue el pBR313 (Bolivar y col., 1977 a), sin embargo, este era innecesariamente largo; ya que mas de la mitad de su DNA no era esencial para su papel como vector. Sin embargo, la primera fase del desarrollo de un plsmido que pudiera ser usado como vector de clonacin termina con la construccin de pBR322 (Bolivar y col., 1977 b), un plsmido de 4.36 kb al cual se le haban eliminado la mayora de estas secuencias innecesarias. pBR322 fue en aquel tiempo el vector de clonacin ms ampliamente utilizado, y muchos de los vectores plasmdicos utilizados en la actualidad son sus descendientes lejanos.

37. PROPSITO ESPECFICO DE LA CUARTA PRCTICA:


37.1 Criterio de desempeo 4 PRCTICA: Aislamiento de DNA plasmdico. EL ESTUDIANTE ESTAR CAPACITADO PARA OBTENER DNA PLASMDICO Y ANALIZARLO CUANDO: i. Se asegure de tener a la mano todo el material requerido para realizar la prctica. j. Trabaje de manera ordenada, segura y limpia. k. Siga cada uno de los pasos indicados para el desarrollo exitoso de la tcnica, teniendo cuidado de no omitir, o equivocarse en alguno. l. Pueda observar el resultado esperado.

37.2 Resultado final de la cuarta prctica


- 45 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

El estudiante logra obtener DNA plasmdico y lo analiza mediante restriccin enzimtica.

38. NORMAS DE SEGURIDAD ESPECFICAS DE LA PRCTICA


38.1 Cuadro de Normas Oficiales Mexicanas Especficas de la Cuarta Prctica ESPECIFICACIONES CONCICIONES DEL MEDIO AMBIENTE SISTEMAS CONTRA INCENDIOS EQUIPOS DE PROTECCIN INSTALACIONES ELCTRICAS SEALES, AVISOS DE SEGURIDAD Y CODIGO DE COLORES NORMAS OFICIALES MEXICANAS
NOM-025-STPS-1999 NOM-017-STPS-2001 087-ECOL-1995 NOM-012-STPS-1999 NOM-002-STPS-2000 Reglamento Federal de Higiene y Medio Ambiental del Trabajo.. Cap. 5to. Art. 135 al 141
NOM-001-SEDE-1999, ART.1-34 NOM-001-SEDE-1999,ART. DEL 384

NOM-

NOM-026-STPS-1998 Apto 5 y 5.4 NOM-026STPS-1998 Apto 9 y 9.1 NOM-026-STPS-1998 Apto 5 y 5.3 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap.1 y Cap. 7mo. Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 8 mo. Y 12 do. NOM-025-STPS-1999, apdo. 7 NOM-001-STPS1999, NOM-026-STPS-1998 NOM-026-STPS-1998, apdo NOM-001-STPS-1999, fracc. 7.1 NOM-005STPS-1998 NOM-087-ECOL-SSA1-2002 NOM-087-ECOL-SSA1-2002 Apdo. 4, 5, y 6 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 12, art. 109 y 110. OM-005-STPS-1998 NOM-005-STPS1998 NOM-005-STPS-1998 NOM-002-STPS-2000, CAP. 5.8, 5.9 NOM025-STPS-1999, CAP. 8, 9, 10

PLANTA FISICA

ORDEN, LIMPIEZA Y SERVICIOS

CONDICIONES GENERALES

- 46 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

39. DESARROLLO DE LA CUARTA PRCTICA


La tcnica descrita a continuacin para aislar DNA plasmdico ha sido usada por ms de 20 aos (Birnboim y Doly 1979), e involucra tres pasos: 1) crecimiento del cultivo bacteriano, 2) cosecha y lisis alcalina de las bacterias en combinacin con el detergente SDS y 3) purificacin del DNA plasmdico.

La exposicin de la suspensin celular al detergente aninico fuerte SDS a un alto pH, abre la pared celular, desnaturaliza el DNA cromosmico y las protenas y libera el DNA plasmdico. Durante la lisis, las protenas bacterianas, paredes celulares rotas, y el DNA cromosmico desnaturalizado, se amasan en grandes complejos que son recubiertos con el dodecil sulfato de sodio. Estos complejos, se precipitan eficientemente de la solucin cuando los iones de sodio son remplazados por iones de potasio (Horowicz y Burke 1981). Por ltimo, el DNA plasmdico se recupera del sobrenadante, despus de que el material desnaturalizado ha sido removido por centrifugacin. 39.1 Metodologa 1).- En un tubo de ensaye estril conteniendo 3 ml de medio LB (Luria Bertani), suplementado con ampicilina (100 g/ ml) depositar una colonia transformante de Escherichia coli con la ayuda de un asa metlica. Crecer el cultivo a 37 C durante toda la noche. 2).- Cosechar las clulas por centrifugacin durante 2 min a 4 C y 13,000 rpm, en 2 microtubos estriles. Eliminar completamente el medio de cultivo.
NOTA: es muy importante no dejar residuos de medio, por ello se recomienda limpiar las paredes del tubo con un padazo de papel higienico.

3).- Resuspender perfectamente las pastillas celulares, en 50 l de una solucin de Tris/HCl 25 mM, pH 8.0; Glucosa 50 mM; EDTA 10 mM. Para obtener una suspensin homognea utilice el vortex.
- 47 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

4).- Adicionar 200 l de una solucin de NaOH 0.1 N, SDS 1% (p/v) (esta solucin debe prepararse al momento de su utilizacin) y mezclar suavemente, invirtiendo el microtubo de 2 a 3 veces. Incubar la mezcla en hielo durante 5 min. Es muy importante no dejar proceder la lisis por ms de 5 min, ya que esto puede afectar la estructura del DNA plasmdico. 5).- Adicionar a la mezcla 150 l de una solucin de Acetato de potasio 3 M, agitando el microtubo 3 veces (de 5 segundos cada una) en el vortex. Incubar la mezcla 5 min en hielo. 6).- Centrifugar los microtubos a 13000 rpm durante 8 min. Tomar cuidadosamente el sobrenadante (aproximadamente 450 l) con la micropipeta de 1 ml y depositarlo en un microtubo limpio. 7).- Adicionar 500 l de una mezcla de Cloroformo: Alcohol Isoamlico (1:1). Mezclar durante 20 seg en el vortex y centrifugar 5 min a 13000 rpm. 8).- Tomar la fase superior (fase acuosa) y depositarla en un microtubo limpio. Adicionar 1 ml de etanol absoluto, mezclar en el vortex y centrifugar durante 18 min a 13000 rpm. 9).- Eliminar el sobrenadante por decantacin, (se debe tener cuidado de no tirar la pastilla de DNA), se enjuaga la pastilla 3 veces con 1 ml de etanol absoluto fro. 10).- Se deja secar la pastilla a temperatura ambiente (10 min). Se resuspende en 30 l de buffer T10E1. Se analiza una alcuota de 3 l por electroforesis en un gel de agarosa al 1% (p/v) y se tie con bromuro de etidio. 11).- Se toma una alcuota de 2 l del DNA plasmdico y se determina su patrn de restriccin con la enzima EcoRI, de acuerdo al siguiente protocolo: DNA plasmdico
CIENCIAS QUIMICAS

2 l
- 48 D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Buffer 10X Agua estril EcoRI

1 l 6.5 l 0.5 l

Incubar la reaccin 1 h a 37 C. Mezclar con buffer de carga y analizar la reaccin en un gel de agarosa teido con bromuro de etidio. 39.2 Programa de actividades El desarrollo de la cuarta prctica ser manejado en 3 etapas. El cuidado y manejo del equipo y reactivos sern responsabilidad del docente y de Usted.
ACTIVIDADES 1) El docente explicar de manera breve el manejo de los equipos y materiales que se utilizarn para el desarrollo de la prctica. 2) Cada subgrupo de estudiantes obtendr DNA plasmdico, lo observar y analizar por restriccin. 3) Investigacin de los siguientes vectores de clonacin:

TIEMPO REQUERIDO 20 min.

RESULTADO ESPERADO A travs de la observacin guiada por el docente, el estudiante se familiariza con el equipo y el material que se utilizara para el desarrollo de la prctica, adems conoce los puntos clave para el resultado exitoso de la misma. El estudiante aprender la tcnica de lisis alcalina con SDS para la obtencin de DNA plasmdico de la bacteria intestinal E. coli. El estudiante por medio de la lectura, conocer la utilizacin de otros vectores distintos a los plsmidos y las ventajas que ofrecen estos para el estudio de genes.

2 das.

Tarea

Csmidos, bacterifagos. BAC y YAC. La utilizacin de estos en ingeniera gentica.

39.3 EQUIPOS, INSTRUMENTOS Y REACTIVOS


EQUIPOS Vortex Microcentrfuga Estufa Cmara de electroforsis INSTRUMENTOS Micropipetas Microtubos REACTIVOS

Nota:
CIENCIAS QUIMICAS

DNA T10E1 (estril) Acetato de Sodio SDS NaOH Agua grado HPLC (estril) Enzima de restriccin EcoRI Los Agarosa
- 49 D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

microtubos deben Bromuro de etidio estar estriles y deben manejarse Nota: Todos los reactivos deben ser manejados con guantes. de forma cuidadosa y con el uso de guantes de ltex, no pipetear y tener cuidado de no inhalar.

40. SISTEMA DE EVALUACIN DE LA CUARTA PRCTICA


40.1 Lineamientos generales para la evaluacin de la cuarta prctica La evaluacin de sta prctica es responsabilidad del docente encargado de la actividad. Son varios los aspectos que se le evaluar: Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Manejo adecuado de los equipos materiales y reactivos. El resultado de la prctica. Elaboracin de la tarea de investigacin. 40.2 Resultados esperados relacionados con los Criterios de Desempeo especficos de la cuarta prctica. Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Este parmetro forma parte de los conocimientos formativos necesarios para lograr la capacidad del comportamiento adecuado en un laboratorio. ste parmetro aunque no se seale en las siguientes prcticas es importante que recuerde que siempre es calificado por el docente responsable de la prctica. Manejo adecuado de los equipos, materiales y reactivos: Este parmetro se refiere a seguir con varios de los lineamientos sealados por el Reglamento Interno del Laboratorio. Resultado de la prctica: Indicador de su capacidad para seguir una tcnica, cuyo resultado favorable es esencial para el desarrollo de la siguiente prctica. Elaboracin de la tarea de investigacin: sta parte de la actividad en el laboratorio tiene la finalidad para que Usted:
- 50 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Desarrolle la habilidad de investigacin bibliogrfica. Logre identificar la aplicacin prctica en su actividad profesional futura.

40.3 Mtodo de asignacin de calificaciones:


ACTIVIDAD A CALIFICAR -- Comportamiento responsable de acuerdo a los lineamientos del laboratorio -- Manejo adecuado del equipo, material y reactivos --Resultado de la prctica -- Tarea de investigacin

PONDERACIN
20% 30% 30% 20 %

41. BIBLIOGRAFA
Molecular cloning. A laboratory manual. J. Sambrook. E.F. Fritsch y T. Maniatis (Eds.) Cold Spring Harbor Laboratory Press. New York 1989. Current Protocols in Molecular Biology. F. Ausbel, R. Brent, R. Kingston, D.D. Moore, J.G. Seidman, J.G. Smith, y K. Struhl (Eds.) John Wiley & Sons Inc. 19941995. Gentica en Medicina. R.L. Nussbaum, R.R. McInnes, H.F. Williard. 5 a Edicin. Editorial MASSON. 2004.

42. PARA SABER MS


La revisin detallada de los textos de la bibliografa que le permitan conocer ms detalladamente las tcnicas empleadas en biologa molecular.

43. GLOSARIO DE TERMINOS


Investigar el significado de los siguientes terminos:
- 51 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Sitio de clonacin mltiple Origen de replicacin Casete de resistencia Gen de la galactosidasa Opern pUC19 Extremos cohesivos o pegajosos

Extremos romos o rasurados Recombinacin homloga Recombinacin tipo Campbell alfa complementacin X- Gal Transformacin Clulas competentes

ACTIVIDAD Un paciente con una enfermedad gentica tiene una mutacin (T por G) en el exn 18 de un gen. Diga que consecuencia tiene esta mutacin en la funcin gnica (cada tres nucletidos de las secuencias constituyen un codn del gen).

SECUENCIA DEL GEN DE UNA PERSONA NORMAL CTGTGCCGTATGAAAAGACCAATCCGAGAAGTTCCTGTTACCAAACTCATAGAC SECUENCIA DEL GEN DEL PACIENTE CTGTGCCGTATGAAAAGACCAATCTGAGAAGTTCCTGTTACCAAACTCATAGAC

- 52 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

UNIVERSIDAD JUAREZ DEL ESTADO DE DURANGO


ESCUELA DE CIENCIAS QUMICAS

5 prctica

Preparacin de clulas competentes, Transformacin gentica de bacterias, y Seleccin de clones transformados


- 53 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Diseada por: DC. NORMA URTIZ ESTRADA

45. NMERO DE ALUMNOS POR UNIDAD DE PRCTICA


La organizacin de la quinta prctica ser directamente condicionada al nmero de estudiantes, el espacio en el laboratorio y el material disponible.

46. INTRODUCCIN DE LA QUNTA PRCTICA.


En la presente el estudiante aprender de manera prctica uno de los procesos esenciales en la manipulacin de genes conocido con el nombre de transformacin gentica. Se deben de cumplir dos requisitos en el proceso de la transformacin, 1) La introduccin de DNA homlogo o heterlogo al interior de un organismo, y, 2) Que este material gentico sea replicado en el interior del husped, ya sea de manera autnoma o bien mediante la integracin al cromosoma. Los procedimientos para llevar a cabo la transformacin gentica pueden variar dependiendo del autor, sin embargo, todos ellos tienen un comn denominador, utilizan como base procedimientos enzimticos o qumicos seguidos de un choque trmico, los cuales alteran la estructura de la pared celular de los organismos que la poseen permitiendo con ello el paso del DNA. En una segunda etapa, se lleva a cabo la regeneracin de la pared celular del organismo transformado y posteriormente se selecciona en medios de cultivo que permiten asegurar que la transformacin haya sido exitosa, por ejemplo mediante la adquisicin de la resistencia a un antibitico. En este protocolo que se desarrollar en estas prcticas, se utilizar como modelo de estudio a la bacteria E. coli.

- 54 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

47. PROPSITO ESPECFICO DE LA QUINTA PRCTICA:


47.1 Criterio de desempeo

Preparacin de clulas competentes, Transformacin gentica de bacterias, y Seleccin de clones transformados.


5 PRCTICA:

EL

ESTUDIANTE

ESTAR

CAPACITADO

PARA

OBTENER

CLULAS

COMPETENTES, TRANSFORMARLAS Y ANALIZARLAS CUANDO: m. Se asegure de tener a la mano todo el material requerido para realizar la prctica. n. Trabaje de manera ordenada, segura y limpia. o. Siga cada uno de los pasos indicados para el desarrollo exitoso de la tcnica, teniendo cuidado de no omitir, o equivocarse en alguno. p. Obtenga como resultado final, clulas transformadas genticamente.

47.2 Resultado final de la quinta prctica


El estudiante conduce a las clulas al estado de competencia, las transforma genticamente y analiza los clones transformados.

48. NORMAS DE SEGURIDAD ESPECFICAS DE LA PRCTICA


Cuadro de Normas Oficiales Mexicanas Especficas de la Quinta Prctica ESPECIFICACIONES CONCICIONES DEL MEDIO AMBIENTE SISTEMAS CONTRA INCENDIOS EQUIPOS DE PROTECCIN INSTALACIONES ELCTRICAS NORMAS OFICIALES MEXICANAS
NOM-025-STPS-1999 NOM-017-STPS-2001 087-ECOL-1995 NOM-012-STPS-1999 NOM-002-STPS-2000 Reglamento Federal de Higiene y Medio Ambiental del Trabajo.. Cap. 5to. Art. 135 al 141
NOM-001-SEDE-1999, ART.1-34 NOM-001-SEDE-1999,ART. DEL 384

NOM-

- 55 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

SEALES, AVISOS DE SEGURIDAD Y CODIGO DE COLORES

NOM-026-STPS-1998 Apto 5 y 5.4 NOM-026STPS-1998 Apto 9 y 9.1 NOM-026-STPS-1998 Apto 5 y 5.3 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Ttulo 2do. Cap.1 y Cap. 7mo. Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 8 mo. Y 12 do. NOM-025-STPS-1999, apdo. 7 NOM-001-STPS1999, NOM-026-STPS-1998 NOM-026-STPS-1998, apdo NOM-001-STPS-1999, fracc. 7.1 NOM-005STPS-1998 NOM-087-ECOL-SSA1-2002 NOM-087-ECOL-SSA1-2002 Apdo. 4, 5, y 6 Reglamento Federal de Higiene y Medio Ambiental del Trabajo. Cap. 12, art. 109 y 110. OM-005-STPS-1998 NOM-005-STPS1998 NOM-005-STPS-1998 NOM-002-STPS-2000, CAP. 5.8, 5.9 NOM025-STPS-1999, CAP. 8, 9, 10

PLANTA FISICA

ORDEN, LIMPIEZA Y SERVICIOS

CONDICIONES GENERALES

49. DESARROLLO DE LA QUINTA PRCTICA


La tcnica descrita a continuacin es simple y rpida. Es una variacin de la tcnica publicada por Cohen y col., (1972) y se utiliza frecuentemente para preparar lotes de clulas competentes que producen 5 X 10 6 a 2 X 107 colonias transformantes/ g de DNA plasmdico superenrollado, una eficiencia de transformacin bastante alta. Las clulas competentes hechas por ste procedimiento pueden conservarse a -70 C, sin embargo, si se almacenan durante periodos de tiempo prolongados, hay cierta deterioracin en la eficiencia de transformacin. 49.1 Metodologa 1).- En un tubo de ensaye estril conteniendo 2 ml de medio LB (Luria Bertani), suplementado con ampicilina (100 g/ ml) depositar una colonia de E. coli DH5 con la ayuda de un asa metlica. Agitar el cultivo a 37 C durante toda la noche, en un incubador metablico. 2).- Inocular 25 ml de medio LB (sin antibitico) en un matrz Erlenmeyer de 125 ml con 0.2 ml del cultivo descrito en el punto anterior. Incubar el matraz en un agitador
- 56 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

metablico ajustado a 250 rpm y 37 C. Tomar lecturas (muestras de 1 ml) en un espectrofotmetro ajustado a 600 nm, hasta llegar a una lectura de 0.5. 3).- Incubar el matraz en hielo, durante 10 min. Transferir el cultivo a tubos estriles para rotor JA-20 (o equivalente), previamente enfriados en hielo. Centrifugar el cultivo durante 5 min a 4000 rpm y 4 C. 4).- Eliminar el sobrenadante y resuspender suavemente las clulas en 10 ml de una solucin estril de CaCl2 50 mM en Tris/HCl 10 mM. pH 8.
NOTAS: a).- La solucin de calcio debe de estar ajustada a una temperatura de 4 C. b).- Durante la resuspensin de las clulas no utilizar la micropipeta, as como tampoco el vortex.

5).- Centrifugar nuevamente el cultivo, bajo las condiciones descritas en el punto 3. Eliminando el sobrenadante. 6).- Resuspender suavemente las clulas en aproximadamente 1.5 ml de la solucin fra de calcio. 7).- Tomar 2 alcuotas de 0.2 ml y depositarlas en microtubos estriles. Adicionar a uno de los tubos 0.01 ml de la muestra de DNA plasmdico (el obtenido en la cuarta prctica). Dejar el otro tubo como control. 8).- Incubar los tubos en hielo durante 30 min. 9).- Calentar los tubos durante 2 min en un bao ajustado a 42 C. 10).- Transferir los tubos a hielo, adicionarles 1 ml de LB lquido estril, transferir las clulas a tubos de ensaye estriles y agitarlas durante 45 min a 37 C y 220 rpm. 11).- En microtobos estriles efectuar diluciones seriadas (10 en 10) de 0.5 ml, hasta un factor de 1 X 106.
- 57 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

12).- Sembrar por duplicado 0.1 ml de la resuspensin original y 0.1 ml de las diluciones 10-2, 10-3, 10-4, en placas de LB slido conteniendo ampicilina a 100 g/ ml. 13).- Incubar las cajas a 37 C durante 24 h. Contar las colonias y calcular la eficiencia de transformacin en # de clulas transformantes/ g de DNA. 14).- Se toman muestras de las colonias transformantes, se cultivan, se cosechan y se analizan por restriccin del DNA plasmdico obtenido (tcnica descrita en la cuarta prctica). 49.2 Programa de actividades El desarrollo de la cuarta prctica ser manejado en 3 etapas. El cuidado y manejo del equipo y reactivos sern responsabilidad del docente y de Usted.
ACTIVIDADES 1) El docente explicar de manera breve el manejo de los equipos y materiales que se utilizarn para el desarrollo de la prctica. 2) Cada subgrupo de estudiantes obtendr clulas competentes, las transformar y analizar las colonias transformantes mediante restriccin enzimtica de los plasmidos extrados. 4) Investigacin de los siguientes mecanismos de resistencia a antibiticos:

TIEMPO REQUERIDO 20 min.

RESULTADO ESPERADO A travs de la observacin guiada por el docente, el estudiante se familiariza con el equipo y el material que se utilizara para el desarrollo de la prctica, adems conoce los puntos clave para el resultado exitoso de la misma. El estudiante aprender la tcnica de obtencin de clulas competentes de la bacteria intestinal E. coli y su transformacin con DNA plasmdico.

6 das.

Tarea

El estudiante por medio de la lectura, conocer algunos de los mecanismos mediante los cuales las bacterias adquieren resistencia a ciertos antibiticos.

Cloranfenicol, Kanamicina, Tetraciclina y Ampicilina.

49.3 EQUIPOS, INSTRUMENTOS Y REACTIVOS


- 58 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

EQUIPOS Vortex Ultracentrfuga Bao mara Cmara de electroforsis

INSTRUMENTOS Micropipetas Microtubos Tubos de ensaye

REACTIVOS DNA plasmdico Solucin de CaCl2 en Tris/HCl 10 mM pH 8 Enzimas de restriccin. Agarosa Bromuro de etidio

Nota: Los microtubos deben Nota: Todos los reactivos deben ser manejados estar estriles y de forma cuidadosa y con el uso de guantes de deben manejarse ltex, no pipetear y tener cuidado de no inhalar. con guantes.

50. SISTEMA DE EVALUACIN DE LA QUINTA PRCTICA


50.1 Lineamientos generales para la evaluacin de la cuarta prctica La evaluacin de sta prctica es responsabilidad del docente encargado de la actividad. Son varios los aspectos que se le evaluar: Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Manejo adecuado de los equipos materiales y reactivos. El resultado de la prctica. Elaboracin de la tarea de investigacin. 5.2 Resultados esperados relacionados con los Criterios de Desempeo especficos de la quinta prctica. Comportamiento responsable de Usted de acuerdo a los lineamientos del Laboratorio. Este parmetro forma parte de los conocimientos formativos necesarios para lograr la capacidad del comportamiento adecuado en un laboratorio. ste parmetro aunque no se seale en las siguientes prcticas es importante que recuerde que siempre es calificado por el docente responsable de la prctica. Manejo adecuado de los equipos, materiales y reactivos: Este parmetro se refiere a seguir con varios de los lineamientos sealados por el Reglamento Interno del Laboratorio. Resultado de la prctica: Indicador de su capacidad para seguir una tcnica, cuyo resultado favorable es esencial para el desarrollo de la siguiente prctica.
- 59 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Elaboracin de la tarea de investigacin: sta parte de la actividad en el laboratorio tiene la finalidad para que Usted: Desarrolle la habilidad de investigacin bibliogrfica. Logre identificar la aplicacin prctica en su actividad profesional futura.

51.3 Mtodo de asignacin de calificaciones:


ACTIVIDAD A CALIFICAR -- Comportamiento responsable de acuerdo a los lineamientos del laboratorio -- Manejo adecuado del equipo, material y reactivos --Resultado de la prctica -- Tarea de investigacin

PONDERACIN
20% 30% 30% 20 %

52. BIBLIOGRAFA
Molecular cloning. A laboratory manual. J. Sambrook. E.F. Fritsch y T. Maniatis (Eds.) Cold Spring Harbor Laboratory Press. New York 1989. Current Protocols in Molecular Biology. F. Ausbel, R. Brent, R. Kingston, D.D. Moore, J.G. Seidman, J.G. Smith, y K. Struhl (Eds.) John Wiley & Sons Inc. 19941995. Gentica en Medicina. R.L. Nussbaum, R.R. McInnes, H.F. Williard. 5 a Edicin. Editorial MASSON. 2004.

53. PARA SABER MS


La revisin detallada de los textos de la bibliografa que le permitan conocer ms detalladamente las tcnicas empleadas en biologa molecular.

54. GLOSARIO DE TERMINOS


- 60 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA

MANUAL DE PRCTICAS DE LABORATORIO

GENTICA

06/2006

Investigar el significado de los siguientes terminos:


Transcripcin Traduccin Factores sigma alternativos Intrn Edicin de genes Secuencias consenso Regin regulatoria

- 61 CIENCIAS QUIMICAS D.C. NORMA URTIZ ESTRADA