Documentos de Académico
Documentos de Profesional
Documentos de Cultura
BIOTECOLOGIA
BIOTECOLOGIA
Rocío Cruz Muñoz1*, Ana B. Piña-Guzmán1, Jorge Yáñez-Fernández1, Gustavo Valencia-Del Toro1,
Silvia Bautista-Baños2, Ramón Villanueva Arce1
1
Unidad Profesional Interdisciplinaria de Biotecnología (UPIBI), Instituto Politécnico Nacio-
nal (IPN). Laboratorio de Biotecnología Alimentaria. 07340. Avenida Acueducto s/n, Barrio
La Laguna Ticomán, México. (rocum@hotmail.com) (rarce@ipn.mx). 2Centro de Desarrollo
de Productos Bióticos (CeProBi), IPN. Km 8.5 Carretera Yautepec-Jojutla.
Resumen Abstract
347
AGROCIENCIA, 16 de mayo - 30 de junio, 2015
F
mango pH7.0 de 55.6 y 57.1 mg, para H1 y H2, respecti- ungi produce a wide range of products
vamente (p0.05). derived from secondary metabolism (Calvo
et al., 2002), such as antibiotics, enzymes and
Palabras clave: Pycnoporus sanguineus, actividad biológica, colorants (Villanueva-Arce et al., 2013). There are
Casuarina equisetifolia, Mangifera indica, biocolorante, fe- almost 75 000 known species of filamentous fungi,
noxacina. but it is likely that there are more than five million
(Blackwell, 2011). The fungus species belonging
Introducción to the Monascus genus are potential producers of
natural pigments (Carvalho et al., 2007; Domínguez-
L
os hongos producen una amplia gama de Espinosa et al., 2002). Basidiomycete fungi produce
productos derivados del metabolismo se- white rot in nature and form an important ecological
cundario (Calvo et al., 2002), como anti- group (Lomascolo et al., 2011). Of this group, the
bióticos, enzimas y colorantes (Villanueva-Arce species of the genus Trametes are the most efficient
et al., 2013). Hay casi 75 000 especies de hongos degraders of lignin because they produce the
filamentosos conocidas, pero es probable que sean lignolytic enzymes (Cilerdzic et al., 2011) laccase,
más de cinco millones (Blackwell, 2011). Las espe- peroxidase manganase, lignin peroxidase, cellobiose
cies de hongos pertenecientes al género Monascus dehydrogenase and pyranose 2-oxidase (Nyanhongo
son productores potenciales de pigmentos natura- et al., 2007).
les (Carvalho et al., 2007; Domínguez-Espinosa Some species of fungi from the Polyporaceae
et al., 2002). Los hongos basidiomicetos produ- family degrade wood and produce pigments generally
cen pudriciones blancas en la naturaleza y forman derived from polyporic acids and terpenylquinones
un grupo ecológico importante (Lomascolo et al., (Velíšek and Cejpek, 2011). Of this family,
2011). De éstos, las especies del género Trametes Pycnoporus is a representative genus of saprophytic
son las más eficientes degradadoras de lignina por homobasidiomycetes that have lignocellulytic
su producción de las enzimas lignolitícas (Ciler- potential (Alexopoulos et al., 1996) and it is linked to
dzic et al., 2011) lacasa, peroxidasa manganasa, pe- the genus Trametes because they have similar traits,
roxidasa lignina, celobiosa deshidrogenasa y 2-oxi- except for the bright red color that is characteristic
dasa piranosa (Nyanhongo et al., 2007). of Pycnoporus (Ryvarden, 1991). According to
Algunas especies de hongos de la familia Poly- Lomascolo et al. (2011), there are four species of this
poraceae degradan madera, producen pigmentos, genus: P. cinnabarinus, P. puniceus, P. sanguineus and
generalmente derivados de ácidos polipóricos y P. coccineus. The red or orange pigments characteristic
terpenilquinones (Velíšek y Cejpek, 2011). De esta of the fruiting bodies (basidiocarps) of this fungus are
familia, Pycnoporus es un género representativo de compounds derived from cinnabarin (cinnabarinic
los homobasidiomicetos saprófitos que tienen un acid and tramesanguine) (Eggert et al., 1996).
potencial lignocelulítico (Alexopoulos et al., 1996) The species of the genus Pycnoporus produce
el cual se vincula con el género Trametes por sus ca- pigments and have biotechnological potential
racteres similares, excepto el color rojo brillante ca- because of their lignocellulytic capacity and because
racterístico de Pycnoporus (Ryvarden, 1991). Según they produce laccases, tyrosinases, cellobiose
Lomascolo et al. (2011), hay cuatro especies de este dehydrogenases, quinases, invertases, and xylases
género: P. cinnabarinus, P. puniceus, P. sanguineus y (Lomascolo et al., 2011). There is a growing search for
P. coccineus. Los pigmentos rojos o anaranjados ca- antiviral, antioxidant, antifungal and antibacterial
racterísticos de los cuerpos fructíferos (basidiocar- compounds in the secondary metabolites of this
pos) de este hongo son compuestos derivados de la fungus (Hwang et al., 2004). In Brazil, basidiocarps
cinabarina (ácido cinabarínico y la tramesanguina) of P. sanguineus are used to stop hemorrhaging
(Eggert et al., 1996). (Rosa et al., 2003). Laccases reduce the severity of
Las especies del género Pycnoporus produ- dermatitis and help heal skin lesions caused by poison
cen pigmentos y tienen potencial biotecnológico ivy (Madhavi and Lele, 2009). Smânia et al. (2003)
por su poder lignocelulítico y por la producción analyzed antiviral activity of the crude extracts of P.
de lacasas, tirosinasas, celobiosadeshidrogena- sanguineus against the rabies virus and showed that
sas, quinasas, invertasas y xilasas (Lomascolo et the crude extracts do not cause detectable systemic
al., 2011). Por ello aumenta la búsqueda de com- lesion or death in animals. Moreover, Borderes
puestos antivirales, antioxidantes, antifúngicos, et al. (2011) observed antioxidant activity of the
y antibacterianos en los metabolitos secundarios secondary metabolites of P. sanguineus extracts.
de este hongo (Hwang et al., 2004). En Brasil From the perspective of controlling diseases caused
se usan los basidiocarpos de P. sanguineus como by phytopathogenic fungi, aqueous and methanol
antihemorrágicos (Rosa et al., 2003). Las laca- extracts of P. sanguineus are used as biological
sas reducen el efecto de la dermatitis y ayudan a control agents against fungi of the genera Trametes,
disminuir lesiones de la piel provocadas por hie- Lentinus, Microporus, Gloeophyllum and Eariella,
dra venenosa (Madhavi y Lele, 2009). Smânia et which damage rubber trees and cause economic
al. (2003) analizaron la actividad antiviral de los losses in the manufacture of rubber articles (Teoh et
extractos crudos de P. sanguieneus contra el virus al., 2011).
de la rabia, y mostraron que no causa lesión sis- The principal compounds produced by P.
témica detectable o la muerte en animales. Ade- sanguineus are polyporin, cinnabarin, cinnabarinic
más, Borderes et al. (2011) observaron actividad acid and tramesanguine (Rosa et al., 2003; Acosta-
antioxidante a los metabolitos secundarios de los Urdapilleta et al., 2010). Polyporin affects Gram
extractos de P. sanguineus. Respecto al control positive and Gram negative bacteria and has not
de enfermedades causadas por hongos fitopató- caused toxic effects in animals (Rosa et al., 2003).
genos, los extractos acuosos y metanólicos de P. Cinnabarin is an orange pigment with a basic
sanguineus se usan como agentes de biocontrol 3-phenoxazine structure that has a carbonyl group
contra hongos de los géneros Trametes, Lentinus, in C-1, an amino group in C-2 and a hydroxyl
Microporus, Gloeophyllum y Eariella, los cuales da- group in C-9 (Achenback et al., 1991; Gripenberg,
ñan a los árboles de caucho y causan pérdidas eco- 1951). It acts as an antibiotic against Bacillus
nómicas en la elaboración de artículos (Teoh et al., cereus, Enterococcus faecalis, E. faecium, Escherichia
2011). coli, Klebsiella pneumoniae, Listeria mesenteroides,
Los principales compuestos producidos por P. Lactobacillus plantarum, Pseudomonas aeruginosa,
sanguineus son poliporin, cinnabarina, ácido ci- Salmonella sp., S. typhi, Staphylococcus aureus
nabarínico y tramesanguina (Rosa et al., 2003; and Streptococcus spp., and has greater antibiotic
Acosta-Urdapilleta et al., 2010). El poliporin afec- activity against Gram positive than Gram negative
ta bacterias Gram positivas y Gram negativas, sin bacteria (Smânia et al. 1995, 1997). The objective
efectos tóxicos en animales de experimentación of this study, therefore, was to assess the growth and
(Rosa et al., 2003). La cinnabarina es un pigmen- pigment production of P. sanguineus in four solid
to naranja con una estructura básica 3-fenoxazina, culture media.
con un grupo carbonilo en C-1, un grupo amino
en C-2 y un grupo hidroxilo en C-9 (Achenbach et Materials and Methods
al., 1991 y Gripenberg, 1951). Tiene actividad anti-
biótica contra Bacillus cereus, Enterococcus faecalis, Biological material
E. faecium, Escherichia coli, Klebsiella pneumoniae,
Listeria mesenteroides, Lactobacillus plantarum, Samples of decomposing plant material exhibiting fruiting
Pseudomonas aeruginosa, Salmonella sp., S. typhi, bodies (basidiocarps) of saprophytic basidiomycete fungi were
Staphylococcus aureus y Streptococcus spp., así como collected from January to September of 2010. The basidiocarps
una mayor actividad antibiótica contra bacterias of the first isolate (H1) were obtained from casuarina (Casuarina
Gram positivas que negativas (Smânia et al. 1995, equisetifolia L.) trees in the La Finca ejido, Villa Guerrero, Estado
1997). Por lo tanto, el objetivo de este estudio fue de México (18° 53’ 07” N, 99° 37’ 36” W, 1839 masl). The
evaluar el crecimiento y la producción del pigmen- second isolate (H2) was obtained from mango (Mangifera indica
tos de P. sanguineus en cuatro medios de cultivo L.) trees in Parácuaro, Michoacán (19° 08’ 44” N, 102° 13’ 09”
sólido. W, 600 masl). The collected basidiocarps were taken to the Food
fueron depositados en el centro de cajas petri (100 mm de diá- extracted pigment was taken and its absorbance measured at 490
metro) con 25 mL de medio de cultivo. Las cajas inoculadas nm in a Lambda XLS spectrophotometer (Perkin Elmer, USA).
se incubaron 30 d a temperatura ambiente (233 °C) con To determine pigment concentration (mg mL1), a curve was
luz blanca continua (850 lm). Cada tratamiento tuvo cinco constructed with known concentrations of methyl red chemical dye
repeticiones. Las variables de respuesta fueron: diámetro de (Sigma-Aldrich, MA, USA). Pigment concentration was calculated
colonia (mm); velocidad específica de crecimiento (; calcu- with the obtained regression equation (y107.19x0.0001). The
lada como rr0 et, r es el radio en mm, t es tiempo en horas amount of extracted pigment was determined by the difference in
y es velocidad específica de crecimiento, según Baumer et mass (mg) of the dry layer of agar before and after the extraction
al. (2008); concentración del pigmento naranja (mg mL1); process. The dry samples were placed in vials and stored at room
y cantidad de pigmento extraído (mg). El crecimiento de la temperature (233 °C) until use.
colonia se midió cada día hasta los 30 d; y la concentración With the extracts in ethyl acetate, the retardation factor (Rf ) of
y cantidad del pigmento se determinaron al finalizar el trata- the pigment produced by the P. sanguineus isolates was compared
miento (30 d). with that of the methyl red dye using thin-layer chromatography.
Al finalizar el período de evaluación, el medio sólido se secó The samples were placed on a chromatographic plate 60 F254
en un horno de convección HCM-A45 (TecniLab Equiment, (Merck, Germany) treated with ethyl-methanol acetate (1:2) as
México) a 352 °C por 14 d. Después se agregaron 50 mL the mobile phase. In addition, a spectrophotometric scan was
de acetato de etilo sobre la superficie de la capa seca de agar done of the obtained pigment in a wavelength of 200 to 700 nm.
y se raspó hasta obtener el pigmento producido por el hongo. Finally, absorbance of aliquots of 400 L per sample (extracts
Este extracto reposó 4 d en oscuridad, se tomó una muestra H1 and H2) diluted with 400 L ethyl acetate were read in a
del pigmento extraído y se midió la absorbancia a 490 nm en Lambda XLS spectrophotometer (Perkin Elmer, USA).
un espectrofotómetro Lambda XLS (Perkin Elmer, EE.UU.).
Para determinar la concentración del pigmento (mg mL1), se Statistical data analysis
realizó una curva tipo con concentraciones conocidas del colo-
rante químico rojo de metilo (Sigma-Aldrich, MA, EE.UU.) The results were analyzed with an ANOVA and the treatment
y la concentración de pigmento se calculó con la ecuación de means (principal effects) were compared with orthogonal
regresión obtenida (y107.19x0.0001). La cantidad de pig- contrasts (p0.05, 0.01, 0.001). For these analyses, SAS (version
mento extraído se determinó por diferencia de masas (mg) de 9.0 for Windows) was used.
la capa seca de agar antes y después del proceso de extracción.
Las muestras secas se colocaron en viales y se almacenaron a Results and Discussion
temperatura ambiente (233 °C) hasta su uso.
Con los extractos en acetato de etilo se realizó una croma- Isolation, purification and identification of
tografía de capa fina para comparar los frentes de retención Pycnoporus sanguineus
(Rf ) del pigmento producido por los aislamientos de P. sangui-
neus con el colorante rojo de metilo. Las muestras se colocaron The P. sanguineus isolates (H1 and H2) (Figure
en una placa cromatográfica 60 F254 (Merck, Alemania), y 1) showed a variable growth of the colony. In the
tratadas con acetato de etilo-metanol (1:2) como fase móvil. H1 isolate the fungus covered the entire surface of
Además, se hizo un barrido espectrofotométrico en una longi- the culture medium in the Petri dish with white
tud de onda de 200 a 700 nm del pigmento obtenido. Final- mycelia from days 10-15 (5.3-8.0 mm d1), whereas
mente, se leyó la absorbancia de alícuotas de 400 L de cada the H2 isolate did so on days 10.12 (6.7-8.0 mm
muestra (extractos H1 y H2) diluídas con 400 L de acetato d1). The morphology of the colonies and of the
de etilo en un espectrofotómetro Lambda XLS (Perkin Elmer, basidiocarps coincide with the description reported
EE.UU.). by Papinutti (2013) for the species P. sanguineus.
This was compared with the results of the molecular
Análisis estadístico de datos characterization (Table 1) of the ITS1 intergenic
region of the ribosomal DNA and its alignment
Los resultados se analizaron mediante ANDEVA y las medias with the database of the NCBI GenBank, and it
de los tratamientos (efectos principales) se compararon por me- showed 98 % identity and a similarity index of 787
dio de contrastes ortogonales (p0.05, 0.01, 0.001). Para estos for isolate H1, whereas for H2 identity was 97 %
análisis se usó SAS (Versión 9.0 para Windows). and the similarity index was 822. Both isolates were
Resultados y Discusión H1 H2
Cuadro 1. Secuencia de pares de bases de la región ITS1 del ADNr de Pycnoporus sanguineus aislados en Villa Guerrero, Estado
de México (H1), y Parácuaro, estado de Michoacán (H2).
Table 1. Pair sequence of ITS1 base region of rDNA of Pycnoporus sanguineus isolated in Villa Guerrero, Estado de México (H1)
and Parácuaro, state of Michoacán (H2).
Secuencia de H1
GGTCTTACGAGTTCTGAAAGGGGTTGTAGCTGGCCTTCCGGGGCATGTGCACACCCTGCTCATCCACTCTACACCTGTGCACTTA
CTGTAGGTTTGGCGTGGGCCTCTCGAGGCCTCTCCGGGTCTTGAGGCATTCTGCCGGCCTATGTATCACTACAAACACTTAAAGT
AAAAGAATGTATTCGCGTCTAACGCATCTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCG
AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGNAG
CATGCCTGTTTGAGTGTCATGGAATTCTCAACCCACACATCCTTGTGATGCTGCGGNCTTGGATTTGGAGGCTTGCTGNNCCTCT
GCGGTCGGCTCCTCTTGAATGCATTAGCTTGATTCGGTGCGGATCGNCTCTCAGTA
Secuencia de H2
CCTGCGGAAGGATCTTAACGAGTTCTGAAAGGGGTTGTAGCTGGCCTTCCGGGGCATGTGCACACCCTGCTCATCCACTCTACAC
CTGTGCACTTACTGTAGGTTTGGCGTGGGCCTCTCGAGGCCTCTCCGGGTCTTGAGGCATTCTGCCGGCCTATGTATCACTACAA
ACACTTAAAGTAAAAGAATGTATTCGCGTCTAACGCATCTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGA
AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGT
ATTCCGAGNAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCCACACATCCTTGTGATGCTGCGGGCTTGGATTTGGAGGCTT
GCTGGCCCTCTGCGGTCGGCTCCTCTTGAATGCATTAGCTTGATTCCGTGCGGATCGGCT
Producción de pigmento de Pycnoporus data differ from those of Baumer et al. (2008) who
sanguineus en medio de cultivo sólido observed that the MIP 95001, MIP 95002 and
MIP 20001 P. sanguineus strains filled the Petri
Los aislamientos H1 y H2 de P. sanguineus dishes 5 das, but the diameter of the inoculum disc
cubrieron toda la caja petri a los 13 d después de la was 14 mm.
siembra (dds). Estos datos difieren con lo reportado Regarding colony diameter, the evaluated culture
por Baumer et al. (2008) quienes observaron que las media and pH had a significant effect on the two
cepas MIP 95001, MIP 95002 y MIP 20001 de P. isolates. The best conditions for colony growth were:
sanguineus llenaron las cajas petri 5 ddd pero el diá- 1) for H1, casuarina extract agar with a radial growth
metro del disco de inóculo inicial fue 14 mm. rate of 6.1 mm d1, pH 7.0 and 9.0 (growth rate 4.8
Respecto al diámetro de las colonias, el me- mm d1 and 4.7 mm d1, respectively; and 2) for
dio de cultivo y pH evaluados tuvieron un efecto H2, mango extract agar, pH 7.0 and a radial growth
significativo en los dos aislamientos y las mejores rate of 6.1 mm d1 and 4.6 mm d1, respectively
condiciones para el crecimiento de las colonias fue- (Tables 2 and 3). This is due to the affinity of the
ron: 1) para H1, agar extracto de casuarina con una isolates to the source from which they were isolated.
velocidad de crecimiento radial de 6.1 mm d1 y Acosta-Urdapilleta et al. (2010) tested the same
pH 7.0 y 9.0 (velocidad de crecimiento de 4.8 mm culture mediums, except for the casuarina and
d1 y 4.7 mm d1, respectivamente); 2) para H2, mango extracts, for growth of P. sanguineus strains
agar extracto de mango, pH 7.0, y una velocidad (HEMIM-52, HEMIM-53 and HEMIM-54). They
de crecimiento radial de 6.1 mm d1, y 4.6 mm reported growth characteristic of the fungus, but
d1, respectivamente (Cuadro 2 y 3). Esto se debe with no significant differences between the PDA
a una afinidad por las fuentes de donde ellos fueron and WWFA media for the production of biomass.
aislados. Smânia et al. (1998) also showed culture conditions
Acosta-Urdapilleta et al. (2010) probaron los for the P. sanguineus strain MIP 89007 in potato
mismos medios de cultivo, excepto los extractos broth, pH 9.0 and 25 °C under light for 20 d. In our
de casuarina y mango, en el crecimiento de cepas study, although growth of the isolates H1 and H2
de P. sanguineus (HEMIM-52, HEMIM-53 y HE- (Figure 1) was better in casuarina and mango agar
MIM-54) y reportan un crecimiento característico for 30 d, pigmentation was less than that obtained in
del hongo pero sin diferencia significativa entre los PDA (Figure 2).
Cuadro 2. Efecto del medio de cultivo y pH en el crecimiento y producción de pigmento de Pycnoporus sanguineus aislado en
Villa Guerrero, Estado de México (H1).
Table 2. Effect of the culture medium and pH on Pycnoporus sanguineus growth and pigment production of the isolate from Villa
Guerrero, Estado de México (H1).
†
Letras diferentes indican diferencias estadísticas entre tratamientos (p0.05, 0.01, 0.001). ¶La comparación se realizó entre niveles de
cada factor y las diferencias se presentan verticalmente (n5) †Different letters indicate statistical differences between treatments
(p0.05, 0.01, 0.001). ¶Comparisons were carried out between levels of each factor and the differences are presented vertically (n5).
Cuadro 3. Efecto del medio de cultivo y pH en el crecimiento y producción de pigmento de Pycnoporus sanguineus aislado en
Parácuaro, estado de Michoacán (H2).
Table 3. Effect of the culture medium and pH on Pycnoporus sanguineus growth and pigment production of the isolate from
Parácuaro, state of Michoacán (H2).
†
Letras diferentes indican diferencias estadísticas entre tratamientos (p0.05, 0.01, 0.001). ¶La comparación se realizó entre niveles de
cada factor y las diferencias se presentan verticalmente (n5) †Different letters indicate statistical differences between treatments
(p0.05, 0.01, 0.001). ¶Comparisons were carried out between levels of each factor and the differences are presented vertically (n5).
medios PDA y HTIA para la producción de biomasa. Because of their affinity to the extracts of the
Además, Smânia et al. (1998) muestran condiciones material from which they were isolated, the highest
de cultivo para la cepa MIP 89007 de P. sanguineus specific growth rates at 3, 5 and 10 d occurred in
en caldo papa, pH 9.0 y 25 °C bajo luz por 20 d. En the CEA for isolate H1, whereas for H2 it occurred
nuestro estudio, el crecimiento de los aislamientos in MaEA (Tables 2 and 3). For H1, there were no
H1 y H2 (Figura 1) en extractos de casuarina y man- differences between growth in CEA and WWFA
go agar de 30 d mostraron una pigmentación menor during the first few days. In all cases, H1 and H2
al obtenido en PDA (Figura 2). growth rates were lower than those reported by
De acuerdo con la afinidad mostrada por los ais- Baumer et al. (2008) for the strains MIP 95002
lamientos del hongo sobre los extractos del material (0.0164 h1) and MIP 95001 and 20001
del cual fueron aislados, las mayores velocidades es- (0.0147 and 0.0145 h1, respectively) in PDA.
pecíficas del crecimiento a los 3, 5 y 10 d se presen- The highest concentrations and the largest
taron en el ECA para el aislamiento H1, mientras quantity of pigment produced by H1 occurred in
B1 B2 B3
que para H2 fue EMaA (Cuadro 2 y 3). En H1, the culture media PDA and MEA, regardless of pH
durante los primeros días no hubo diferencias entre (Table 2), whereas those produced by H2 occurred
ECA y HTIA. En todos los casos, las velocidades in PDA, regardless of pH (Table 3). This result
para H1 y H2 fueron menores a las reportadas por reveals that high growth rates of the fungus do not
Baumer et al. (2008) para las cepas MIP 95002 necessarily lead to higher production of the orange
(0.0164 h1) y MIP 95001 y 20001 (0.0147 pigment. This coincides with Baumer et al. (2008),
y 0.0145 h1, respectivamente) en PDA. who mention that mycelial growth is not always
En el aislamiento H1 las mayores concentracio- related to production of secondary metabolites
nes del pigmento producido así como la cantidad (cinnabarin). In addition, according to the data on
total extraída, se presentaron en el medio de cul- concentration and extracted pigment, the quantity of
tivo PDA y EMA sin importar el pH (Cuadro 2), methyl red chemical dye does not correlate with that
mientras que para el aislamiento H2 lo fue en PDA of the orange dye produced by the fungus because the
y pH indistinto (Cuadro 3). Lo anterior muestra quantities of extracted pigment surpass estimates (the
que las mayores velocidades de crecimiento del quantity extracted should be 50 times the estimated
hongo, no de manera necesaria, implican una ma- concentration). This could mean that the total
yor producción del pigmento naranja. Esto coincide extract may contain other pigments of components
con Baumer et al. (2008), quienes mencionan que that were leached out by the ethyl acetate (Figure 3).
el crecimiento micelial, no de manera obligatoria, According to Acosta-Urdapilleta et al. (2010), the
está relacionado con la producción de metabolitos best substrate for producing cinnabarin in primordia
secundarios (cinabarina). Además, de acuerdo con was pine, followed by oak and cedar, regardless of the
los datos de concentración y pigmento extraído, no strain used. The average content of the cinnabarin
hay correlación entre el colorante químico rojo de pigment in fungus primordia was 56 mg g1 and
metilo con el colorante naranja producido por el there were no differences in the cinnabarin produced
hongo, porque las cantidades del pigmento extraído by well developed fruiting bodies (basidiocarps),
rebasan la cantidad estimada (debería ser 50 veces la which was 68 mg g1. The advantage to using
concentración estimada). Esto puede significar que fruiting bodies is that two or more harvests can be
la cantidad total extraída contiene otros pigmentos obtained, but 242 to 356 d are required.
o componentes que fueron arrastrados por el aceta- Cinnabarin, which belongs to the phenoxazine
to de etilo (Figura 3). group, can be produced in vitro in solid or liquid media,
Según Acosta-Urdapilleta et al. (2010), el mejor or in vivo with the production of basidiocarps. In our
sustrato para producir cinnabarina en primordios study, the results may be lower than those reported in
fue pino, seguido por encino y cedro sin importar the literature, but the main advantages were shorter
la cepa utilizada. El contenido promedio del pig- time and ease of management. According to Acosta-
mento cinnabarina en primordios del hongo fue Urdapilleta et al. (2010), the primary and secondary
56 mg g1 y no hubo diferencias entre la cinnaba- metabolites produced by the genus Pycnoporus are
rina producida por los cuerpos fructíferos bien de- different and depend on the species and culture
sarrollados (basidiocarpos) que fue 68 mg g1. La conditions. The orange pigment produced by P.
ventaja de usar los cuerpos fructíferos es obtener sanguineus may have important applications in the
hasta dos o más cosechas, pero se requieren 242 a food, pharmaceutical or biotechnological industry
356 d. because of its antiviral, antioxidant, antifungal, and
La producción de la cinnabarina, perteneciente antibacterial biological activity, as well as in the
al grupo de las fenoxacinas, puede realizarse in vitro industry of dyes from biological sources. Natural dyes
en medios sólidos y líquidos, o bien in vivo con la have increased in availability and use due to consumer
producción de basidiocarpos. En nuestro estudio los preferences for natural over synthetic dyes, which can
resultados pueden ser menores que los reportados give off undesirable flavors and are harmful to health.
pero las ventajas principales fueron menor tiempo y In addition, legislation has excluded artificial dyes
facilidad en el manejo. Según Acosta-Urdapilleta et (Rymbai et al., 2011).
al. (2010), los metabolitos primarios y secundarios The retardation factor (Rf ) obtained by fine-
producidos por el género Pycnoporus son diferentes layer chromatography with the P. sanguineus extracts,
0.7
H1
0.6
0.5
0.4
Absorbancia (A)
0.3
0.2
0.1
-0.1
-0.2
200 300 400 500 600 700
Longitud de onda (nm)
H2
0.8
0.6
Absorbancia (A)
0.4
0.2
-0.2
200 300 400 500 600 700
Longitud de onda (nm)
Figura 3. Espectrogramas del pigmento extraído con acetato de etilo del ais-
lamiento de árbol de casuariana (H1) y árbol de mango (H2) de
Pycnoporus sanguineus.
Figure 3. Spectrograms of pigment extracted with ethyl acetate from
Pycnoporus sanguineus isolated from casuarina (H1) and mango
(H2) trees.
y dependen de la especie y condiciones de cultivo. relative to the methyl red, was 0.83 (Figure 4).
El pigmento anaranjado producido por P. sangui- Acosta-Urdapilleta et al. (2010) report a type curve
neus puede tener aplicaciones importantes dentro with cinnabarin at 265 nm (y0.235x0.398)
de las industrias alimentaria, farmacéutica o biotec- with concentrations of 2 to 10 mg mL1 of
nológica por su actividad biológica: antiviral, antio- aqueous P. sanguineus extract; besides cinnabarin,
xidante, antifúngica, y antibacteriana; además de la they also detected cinnabarinic acid. Fine-layer
importancia en la industria de los biocolorantes ob- chromatography of H1 and H2 was performed with
tenidos de fuentes biológicas. La disponibilidad y el the eluents hexane:acetate, 2:1, and the results were,
uso de colorantes naturales han aumentado debido a for H1, Rf0.77 and, for H2, 0.33, 0.77 and 0.88
las preferencias de los consumidores por colorantes (Figure 4). Smânia et al. (1995), who made four
de origen natural con respecto a los sintéticos que fractions of the extracts of this fungus, reported
imparten sabores indeseables y son perjudiciales a la values of RfFA0.78, RfFB0.54, RfFC0.48 and
salud; además, la acción legislativa ha excluido a los RfFD0.78. Of these fractions, FB contained 3-1
colorantes artificiales (Rymbai et al., 2011). phenoxazine as the principal component detected
El frente de retención (Rf ) obtenido por croma- at 264 nm. Scanning of the extracts from P.
tografía de capa fina con los extractos de P. sanguineus sanguineus isolates was done with ethyl acetate
con respecto al rojo de metilo fue 0.83 (Figura 4). from 200 to 700 nm. This range was used because
Acosta-Urdapilleta et al. (2010) reportan una curva there are compounds, such as cinnabarin and 3-1
tipo con cinnabarina a 265 nm (y0.235x0.398) phenoxazine, with absorbance of 265 and 264
con concentraciones de 2 a 10 mg mL1 del extracto nm, according to Restrepo (2007), and because
acuoso de P. sanguineus; y además de la cinnabarina there was a relationship between wavelengths and
detectaron el ácido cinabarínico. La cromatografía perceived colors: yellow (565-590 nm), orange
de capa fina de H1 y H2 se efectuó con los eluyentes (590-625 nm) and red (625-740 nm). The extracts
hexano:acetato 2:1, y los resultado fueron para H1 from H1 and H2 were perceived by the naked eye
Rf0.77, y para H2 0.33, 0.77 y 0.88 (Figura 4). in this range of colors. For H1, there were peaks
Smânia et al. (1995) realizaron cuatro fracciona- at 214, 266, 431 and 450 nm, and for H2 at 228,
mientos de los extractos de este hongo y reportan 257, 431 and 451 nm (Figure 3) This coincides with
valores de RfFA0.78, RfFB0.54, RfFC0.48 y Acosta-Urdapilleta et al. (2010), who found a band
RfFD0.78; la fracción FB contenía 3-1 fenoxacina characteristic of cinnabarin at 265 nm and the scan
como componente principal detectado a 264 nm. with ethyl acetate showed other pigments at 290,
El barrido de los extractos de los aislamientos de P. 400, 440 and 450 nm.
sanguineus se hizo con acetato de etilo de 200 a 700 The above suggests that the extracts obtained in
nm. Este intervalo se usó porque hay compuestos this study are made up of several orange pigments,
como la cinnabarina y 3-1 fenoxacina con una ab- results that are similar to those of Méndez-Zavala
sorbancia de 265 y 264 nm, según Restrepo (2007), et al. (2007), who reported two peaks at 505 and
y mostró una relación de las longitudes de onda y 425 nm in the 400 to 600 nm scan of the red
los colores percibidos: amarillo (565-590nm), na- pigment produced by Penicillium purpurogenum.
ranja (590-625 nm) y rojo (625-740 nm). Los ex- According to Domínguez-Espinosa et al. (2002),
tractos de H1 y H2 se perciben a simple vista en there are combinations of two or more pigments
1
Rf0.83
H1
RM
Figura 4. Cromatografía en capa fina mos-
trando en 1 el Rf de 0.83 de los
extractos obtenidos de H1, H2 y
H2
rojo de metilo (RM), y en 2 la se-
paración de los compuestos en H1
2 y H2.
Rf0.77 Figure 4. Fine-layer chromatography show-
H1 ing, in 1, Rf of 0.83 of the extracts
obtained from H1, H2 and methyl
red (RM) and, in 2, separation of
the compounds in H1 and H2.
H2
este rango de colores. Para H1 hubo picos a 214, ranging from yellow to orange (405 nm) and of red
266, 431 y 450 nm; y 228, 257, 431 y 451 nm para pigments (495 nm) in the Monascus pigments. This
H2 (Figura 3). Esto coincide con lo reportado por is in agreement with Carvalho et al. (2007), who
Acosta-Urdapilleta et al. (2010), quienes encontra- state that as fermentation of monascus advances,
ron una banda característica de cinnabarina a 265 red-yellow pigments are produced, but the red
nm y el barrido con acetato de etilo mostró otros pigments also absorb light at 400 nm. As indicated
pigmentos a 290, 400, 440 y 450 nm. above, it is possible that the extracts obtained in this
Lo anterior implica que los extractos obtenidos study are formed by a mixture of several pigments
en nuestro estudio están conformados por varios that are in the same wavelength (264 and 265 nm)
pigmentos anaranjados, resultados similares a los and there are also pigments that range from red to
de Méndez-Zavala et al. (2007) quienes repor- orange and are generated by the phenoxazine group.
tan dos picos a 505 y 425 nm en el barrido de
400 a 600 nm del pigmento rojo producido por Conclusions
Penicillium purpurogenum. Según Domínguez-
Espinosa et al. (2002), hay una combinación de In vitro growth and pigment production of
dos o más pigmentos que van del amarillo al na- Pycnoporus sanguineus in solid culture mediums with
ranja (405 nm) y de pigmentos rojos (495 nm) en agar was viable because these was better pigment
los pigmentos de Monascus. Esto concuerda con extraction. The P. sanguineus H1 isolate produced the
Carvalho et al. (2007) quienes mencionan que al highest amount of pigment in potato dextrose agar,
avanzar la fermentación de Monascus, se producen whereas H2 did so in the mango extract agar. Growth
pigmentos rojos-amarillos, pero los pigmentos ro- of P. sanguineus and extraction of the orange pigments
jos también absorben luz a 400 nm. Como ya se in these culture mediums has advantages, such as the
indicó, es posible que los extractos obtenidos en reduction in the amount of medium used (25 mL)
nuestra investigación estén conformados por una and the ease of handling and storing samples.
mezcla de varios pigmentos que están en la misma
longitud de onda (264 y 265 nm), y también hay —End of the English version—
otros que van de rojo a naranja y son generados por
el grupo fenoxacina. pppvPPP
Conclusiones
Subdirección de Investigación y Posgrado (proyectos 20113692,
20120572, 20131830), y a la Comisión de Operación y Fomen-
La producción de pigmentos y crecimiento in vitro
to de Actividades Académicas del Instituto Politécnico Nacional
de Pycnoporus sanguineus en medios de cultivo con
(IPN-COFAA) por el apoyo económico otorgado para la realiza-
agar fue viable porque hubo extracción mayor de los
ción de este estudio.
pigmentos. En los pigmentos obtenidos por el ais-
lamiento H1 de P. sanguineus, la mayor producción
fue en agar papa dextrosa, mientras que para H2 Literatura Citada
fue en agar extracto de mango. El crecimiento de
Achenbach, H., and E. Blümm. 1991. Investigation of the
P. sanguineus y la extracción de los pigmentos ana- pigments of Pycnoporus sanguineus -picnosanguin and new
ranjados en estos medios de cultivo tiene ventajas, phenoxazin-3-ones. Arch. Pharm. 324: 3-6.
como la reducción de la cantidad de medio utilizada Acosta-Urdapilleta, L., G. A. Alonso-Paz, A. Rodríguez, M.
(25 mL), además de la facilidad de manejo y alma- Adame, D. Salgado, M. Montiel-Peña, F. Medrano-Vega,
y E. C. Villegas-Villarreal. 2010. Pycnoporus sanguineus, un
cenamiento de las muestras. hongo con potencial biotecnológico In: Martínez-Carrera,
D., N. Cuvetto, M. Sobal, P. Morales, y V. M. Mora (eds).
Agradecimientos Hacia un Desarrollo sustentable de Producción-Consumo
de los Hongos Comestibles y Medicinales en Latinoa-
mérica: Avances y Perspectivas en el siglo XXI. Puebla.
Cruz-Muñoz agradece al Consejo Nacional de Ciencia y Tec-
2010. Red Latinoamericana de Hongos Comestibles y
nología (CONACyT) por el apoyo económico otorgado para la Medicinales. COLPOS-UNS-CONACYT-AMC-UAEM-
realización de sus estudios de posgrado. Además, se agradece a la UPAEP-IMINAP. pp: 531-562.
Alexopoulos C. J., C. W. Mims, and M. Blackwell. 1996. fúngica de un pigmento rojo empleando la cepa xerofilica
Phylum Basidiomycota order Aphyllophorales, polypores, Penicillium purpurogenum GH-2. Rev. Mex. Ing. Quím. 6:
Chantharelles, tooth fungi, coral fungi and corticioids. In: 267-273.
Harris, D. (ed). Introductory Mycology 4th Ed. New York, Nyanhongo, G. S., G. Gübitz, P. Sukyai, C. Leitner, D. Haltrich,
U. S. A. Wiley and Sons Inc. pp: 563-597. and R. Ludwing. 2007. Oxidoreductases from Trametes
Baumer, J. D., S. M. Mas Diego, S. M. V. Pacheco, A. F. M. spp. in Biotechnology: a wealth of catalytic activity. Food
Morgado, and A. F. Jr. Furigo. 2008. Comparative study of Technol. Biotechnol. 45: 250-268.
mycelial growth and production of cinnabarin by different Papinutti, L. 2013. Pycnoporus sanguineus. Fichas Micológicas.
strains of Pycnoporus sanguineus. Biofar Rev. Biol. Farm. Rev. Boletín Biol. 7: 31-32.
2:1-5. Restrejo G.M. 2007. Sustitución de colorantes en alimentos.
Blackwell, M. 2011. The fungi: 1, 2, 3…5.1 million species? Am. Rev. Lasallista Investig. 4: 35-39.
J. Bot. 98: 426-438. Rosa, L. E., M. K. M. Gomes, J. C. Cristina, M. Capelari, R.
Borderes, J., A. Costa, A. Guedes, and T. L. B. Ballod. 2011. C. Augusto, and Z. C. Leomar. 2003. Screening of Brazilian
Antioxidant activity of the extracts from Pycnoporus basidiomycetes for antimicrobial activity. Mem. Inst.
sanguineus mycelium. Braz. Arch. Biol. Technol. Int. J. 54: Owaldo Cruz 98: 967-974.
1167-1174. Rymbai, H., R. R. Sharma, and Manish Srivastav. 2011.
Calvo, A. M., R. A. Wilson, J. Woo-Bok, and N. P. Keller. 2002. Biocolorants and its implications in health and food
Relationship between secondary Metabolism and fungal industry- A review. Int. J. Pharm. Tech. Res. 3: 2228-2244.
development. Microbiol. Mol. Biol. Rev. 66: 447-459. Ryvarden, L. 1991. Genera of polypores, nomenclature and taxo-
Carvalho, J. C., B. O. Oishi, A.L. Woiciechowski, A. Pandey, nomy. Syn. Fungorum. 5: 1-373.
S. Babitha, and C. R. Soccol. 2007. Effect of substrates Smânia, A. Jr., C. J. S. Marques, E. F. A. Smânia, C. R. Zanetti,
on the production of Monascus biopigments by solid- S. G. Carobrez, R. Tramonte, and C. Loguercio-Leite. 2003.
state fermentation and pigment extraction using different Toxicity and antiviral activity of cinnabarin obtained from
solvents. Indian J. Biotechnol. 6: 194-199. Pycnoporus sanguineus (Fr.) Murr. Phytother Res. 17: 1069-
Cilerdzic, J., M. Stajic, J. Vukojevic, S. Duletic-Lausevic, and 1072.
A. Knezevic. 2011. Potential of Trametes hirsuta to produce Smânia, A. Jr., F. Delle -Monache, E. F. A. Smânia, M. L. Gil,
ligninolytic enzymes during degradation of agricultural L. C. Benchetrit, and F. S. Cruz. 1995. Antibacterial activity
residues. BioRes. 6: 2885-2895. of a substance produced by the fungus Pycnoporus sanguineus
Domínguez-Espinosa, R. M., R. Wang, y J. D. Pacho-Carrillo. (Fr.) Murr. J. Ethnopharmacol. 45: 177-181.
2002. Residuos agroindustriales como materia prima para la Smânia, E. F. A., A. Jr. Smânia, C. Loguercio-Leite, and M. L.
producción de compuestos químicos finos. Tecnol. Ciencia Gil. 1997. Optimal parameters for cinnabarin synthesis by
Ed. (IMIQ) 17: 77-83. Pycnoporus sanguineus. J. Chem. Biotechnol. 70: 57-59.
Eggert, C., U. Temp, and K. E. L. Eriksson. 1996. The lignolytic Smânia, E. F. A., A. Jr. Smânia, and L.C. Loguercio. 1998.
system of the white-rot fungus Pycnoporus cinnabarinus: pu- Cinnabarin synthesis by Pycnoporus sanguineus strains and
rification and characterization of the laccase. Appl. Environ. antimicrobial activity against bacteria from food products.
Microbiol. 62: 1151-1158. Rev. Microbiol. 29: 129-136.
Gripenberg, J. 1951. Fungus pigment. I. Cinnabarin, a colouring Statistical Analysis System, Version 9.0 for Windows. 2002. SAS
matter from Trametes cinnabarina Jacq. Acta Chem. Scand. User’s Guide: Statistics. Release 6.1 Copyright© 1995-2002
12: 590-59. by SAS Institute Inc., Cary, NC, USA.
Hwang, H. J., S. W. Kim, C. P. Xu, J. W. Choi, and J. W. Yun. Teoh, Y. P., M.M. Don, and S. Ujang. 2011. Media selection for
2004. Morphological and rheological properties of the three mycelia growth, antifungal activity against wood-degrading
different species of basidiomycetes Phellinus in submerged fungi, and Gc-Ms study by Pycnoporus sanguineus. BioRes.
cultures. Appl. Microbiol. Biotechnol. 96: 1296-1305. 6: 2719-2731.
Lomascolo, A., E. Uzan-Boukhris, I. Herpoël-Gimbert, J. C. Velísek, J., K. Cejpek. 2011. Pigments of higher fungi: A review.
Sigoillot, and L. Lesage-Meessen. 2011. Peculiarities of Czech J. Food Sci. 29: 87-102.
Pycnoporus species for applications in biotechnology. Appl. Villanueva-Arce, R., C. A. Aguilar-Pompa, Y de las M. Gómez y
Microbiol. Biotechnol. 92: 1129-1149. Gómez, G. Valencia del Toro, A. B. Piña-Guzmán, y S. Bau-
Madhavi, V., and S. S. Lele. 2009. Laccase properties use. tista-Baños. 2013. Control de las bacterias patógenas y hon-
BioRes. 4:1694-1717. gos de postcosecha con extractos del pigmento de Gibberella
Méndez-Zavala, A., J. C. Contreras-Esquivel, F. Lara-Victoriano, zeae (Fusarium graminearum). Agrociencia 47: 691-705.
R. Rodríguez-Herrera, y C. N. Aguilar. 2007. Producción