Está en la página 1de 8

UNIVERSIDAD POLITCNICA SALESIANA REA DE CIENCIAS DE LA VIDA INGENIERA EN BIOTECNOLOGA DE LOS RR.NN.

Biologa Molecular Integrantes: Carrillo Gina Loayza Claudia Quishpe Karina Vinueza Felipe Sexto A DMQ, 29/04/2013

GEMOMA DE DROSOPHILA MELANOGASTER (Mosca de la Fruta)

Introduccin Thomas Hunt Morgan genetista estadounidense, estudi la historia natural, zoologa, y macromutacin en la mosca de la fruta Drosophila melanogaster. Sus contribuciones cientficas ms importantes fueron en el campo de la Gentica. Gracias a su trabajo, Drosophila melanogaster se convirti en uno de los principales organismos modelo en Gentica. Drosophila melanogaster, tambin llamada mosca del vinagre o mosca de la fruta, es una especie dptero de la familia Drosophilidae. Es una especie utilizada frecuentemente en experimentacin gentica, dado que posee un ciclo de vida muy corto, limitndose de 15 a 21 das y un reducido nmero de cromosomas, tiene 4 parejas de cromosomas: Los cromosomas sexuales X e Y (I) Tres parejas de autosomas (II, III, IV). Los cromosomas Y y IV son pequeos y telocntricos (centrmero se localiza en un extremo). Adems la mayora de los genes se localizan en los cromosomas X, II y III que son metacntricos (se encuentra en la mitad del cromosoma, dando lugar a brazos de igual longitud). Porcentaje de Anlisis Drosophila melanogaster, es un organismo modelo en el campo de la Gentica, puesto que aproximadamente el 61% de los genes de enfermedades humanas que se conocen tienen una contrapartida identificable en el cdigo gentico de las moscas de la fruta, y el 50% de las secuencias protenicas de la mosca tiene anlogos en los mamferos. Esta es la razn por la cual las moscas de la fruta, son frecuentemente utilizadas en los laboratorios de investigacin gentica, han servido como modelo para propsitos de

investigacin, fcilmente pueden reemplazar a los humanos. Por otro lado se reproducen rpidamente, de modo que muchas generaciones pueden ser estudiadas en un corto tiempo. Similitud con humanos Cerca del 75% de genes humanos vinculados con enfermedades, tienen su homlogo en el genoma de la mosca de la fruta, y el 50% de las secuencias de protenas de la mosca tiene su homlogo en mamferos. Drosophila sigue siendo usada ampliamente como modelo gentico para diversas enfermedades humanas incluyendo desrdenes neurodegenerativos como Parkinson, Ataxia, Alzheimer, entre otros. Esta mosca tambin se usa en estudios de mecanismos del envejecimiento y estrs oxidativo, sistema inmunitario, diabetes, cncer, abuso de drogas. Genes de Drosophila melanogaster Actualmente, el genoma completo de Drosophila ha sido secuenciado gracias a investigadores del grupo del Proyecto Genoma de Drosophila, dirigidos por Gerald Rubin del Instituto Mdico Howard Hughes (HHMI) en la Universidad de California, e investigadores del Celera Genomics Corporation. La secuencia del genoma de Drosophila fue publicada el 24 de marzo de 2000, por la revista Science. Se inform que fueron secuenciados cerca del 99% de los 13.600 genes estimados. Ms del 60% de su genoma es funcional al codificar ADN no codificador de protenas involucrados en el control de la expresin gnica. Los datos de la secuencia estan disponibles para los cientficos de todo el mundo a travs del Genbank, base de datos de secuencias genticas de los Institutos Nacionales de la Salud.

Estudios en Drosophila melanogaster Como se ha mencionado, es una especie utilizada comnmente en la experimentacin gentica dado su reducido nmero cromosmico, su ciclo de vida breve (15 a 21 das), el 50% de sus secuencias protenicas tienen anlogos mamferos y el 61% de los genes de los genes de enfermedades humanas que se conocen tienen contrapartida identificable en su genoma. Por tal razn fue incluida en el Proyecto Genoma Humano para probar mtodos de secuenciacin a gran escala, conocer la estructura de los genes y regiones reguladoras, predecir las protenas codificadas por el genoma, determinar las diferentes clases funcionales de protenas con las que cuenta, conocer funciones de genes conservados en distintas especies, describir la distribucin de genes y secuencias no codificantes a lo largo de los cromosomas e inferir la evolucin del genoma a partir de la conservacin del orden de genes y los cambios de la secuencia. Mtodos

Los cromosomas de la mosca de la fruta se encuentran formados aproximadamente un tercio de heterocromatina y dos tercios de eucromatina, esta ltima codifica aproximadamente el 98% de las protenas, la heterocromatina se compone de repeticiones de secuencia simple. El ADN satlite no puede clonarse en su forma estable por lo que se estudiaron la heterocromatina y eucromatina por separado. Se emple la tcnica del ADN recombinante 1. Digestin del ADN con enzimas de restriccin 2. Electroforesis en gel de agarosa para la obtencin de fragmentos de gran tamao (100 300 kb) 3. Digestin del vector de clonacin (cromosomas artificiales bacterianos) 4. Extraer las bandas de inters del gel de agarosa y ligar con el vector de clonacinSe siembra el producto de la transformacin Se obtuvo: Pudo replicarse con xito el 99% de la eucromatina La heterocromatina corresponde al 30% del genoma de la mosca, aproximadamente 59Mb en la hembra y 100 Mb en el macho, la regin central de cada cromosoma est constituida por estas secuencias principalmente La transicin de heterocromatina a eucromatina es gradual, la densidad de elementros transponibles en la eucormatina aumenta continuamente hacia los centrmeros Las secuencias satlite heterocromatina constituyen dos terceras partes de la

Secuencias repetitivas LINEs y SINEs

Son secuencias de ADN que se repiten de modo disperso por todo el genoma, constituyendo el 45% del genoma Drosophila melanogaster . Tiene una potencialidad de autopropagarse al transcribirse a un ARNm intermediario, retrotranscribirse e insertarse en otro punto del genoma. Drosophila melanogaster contiene 0.7% Los elementos LINE completos son codificantes. En concreto LINE-1 codifica dos protenas: 1) Protena de unin a ARN (RNA-binding protein): codificada por el marco de lectura abierto 1 (ORF1)

2) Enzima con actividad retrotranscriptasa y endonucleasa: codificada por el ORF2. Ambas protenas son necesarias para la retrotransposicin.

Estos elementos mviles estn flanqueados por 2 regiones no codificantes, denominados como 5UTR y 3UTR. Por lo tanto, se consideran retrotransopsones autnomos, ya que codifican las protenas que necesitan para propagarse. La ARN polimerasa II presente en el medio transcribe el LINE, y este ARNm se traduce en ambos marcos de lectura produciendo una retrotranscriptasa que acta sobre el ARNm generando una copia de ADN del LINE, potencialmente capaz de insertarse en el genoma. SINE (Elementos nucleares dispersos cortos) .- Son secuencias cortas, generalmente de unos pocos cientos de bases, que aparecen repetidas miles de veces en el genoma. Tienen una considerable riqueza en G+C (56%) LINE (Elementos nucleares dispersos largos). Constituyen el 20% del genoma. Su riqueza en G+C es del 42%. HERV (retrovirus endgenos humanos).- son virus cuyo genoma est compuesto por ARN, capaces de retrotranscribirse e integrar su genoma en el de la clula infectada. Drosophila melanogaster contiene 1.5% Transposones de ADN .- Su mecanismo de transposicin se basa en cortar y pegar, moviendo su secuencia a otra localizacin distinta del genoma. Drosophila melanogaster contiene 0.7%

Estudio de mutantes del cromosoma III de Drosophila melanogaster: el gen ash-2 como regulador de diferenciacin celular Tcnicas y estrategias para el estudio de colecciones de mutantes Coleccin de mutantes generada por insercin de un elemento P-lacW en el cromosoma III de Drosophila melanogaster. En organismos modelo como Drosophila se han realizado estudios a gran escala sobre colecciones de mutantes (Shearn y col. 1971; Stewart y col. 1972; Shearn 1974; Shearn y Garen 1974; Kiss y col. 1976; Gatti y Baker 1989; Trk y col. 1993; Roch y col. 1998b; Rrth y col. 1998; Spradling y col. 1999). La principal ventaja de esta aproximacin es que permite el anlisis de genes importantes para un determinado proceso sin que sea necesario un conocimiento a priori sobre su identidad o naturaleza molecular. En screenings genticos convencionales, el genoma se mutageniza utilizando agentes qumicos o radiacin ionizante para crear mutaciones al azar. Cada uno

de estos mutgenos produce tpicamente mutaciones que reducen o eliminan la funcin gnica. Los elementos transponibles se han convertido en un elemento mutagnico ms eficaz debido a que facilitan la clonacin del gen afectado. Se asume de forma general que la insercin de los elementos transponibles se produce de forma aleatoria en las zonas eucromticas del genoma. Sin embargo, es conocido por los datos disponibles, que los elementos P se insertan preferencialmente en las zonas 5 no traducidas de los genes, generando en la mayora de los casos, mutaciones letales recesivas (Kelley y col. 1987; Spradling y col. 1995). ol. 1995). El objetivo de nuestro trabajo ha sido la identificacin de genes implicados en los procesos de proliferacin y diferenciacin de los discos imaginales, centrndonos fundamentalmente en el disco del ala como modelo de estudio. Para ello, de un conjunto de 2368 lneas mutantes, se seleccionaron aquellas que presentaban una fase de letalidad en larva III/pupa y las lneas semiletales y viables. De esta forma pretendamos identificar genes requeridos especficamente para el desarrollo de los discos imaginales, que tendran un efecto muy pequeo o nulo sobre el desarrollo embrionario.

La tcnica del anlisis clonal En Drosophila existen mutaciones que cambian la diferenciacin final de los tricomas y quetas que pueden ser utilizadas como marcadores. Garca-Bellido y Meriam en 1971 realizaron un estudio del desarrollo del disco imaginal del ala mediante anlisis clonal utilizando estos marcadores celulares. Los parmetros de crecimiento pueden ser estudiados en un organismo mediante la utilizacin de la recombinacin mittica, que puede inducirse en diferentes etapas del desarrollo y los clones de clulas homozigticas para el marcador celular mutante pueden ser analizados en trminos de frecuencia, tamao, forma y La frecuencia de clones incrementa exponencialmente desde las larvas ms jvenes tratadas hasta las 21 horas tras la formacin del pupario. La duracin del ciclo mittico de una divisin a la siguiente es constante y puede ser medida por el tiempo necesario para doblar el nmero de clones por cada disco imaginal (8.5 horas en promedio) (Garca-Bellido y Merriam 1971). A las 21 horas tras la formacin del pupario, las clulas del ala ya no son sensibles a la induccin de recombinacin mittica. En este momento se estn produciendo las ltimas divisiones antes de la diferenciacin celular. Al incrementar la edad de las larvas en el momento de la irradiacin, el tamao de los clones decrece y recprocamente, el nmero de clones por disco imaginal crece. Esto es as porque el tamao de un clon es inversamente proporcional al nmero de clulas en el disco imaginal en el momento de la irradiacin. Los clones ms grandes que pueden conseguirse contienen alrededor de 1000 clulas. Clones grandes inducidos en larvas jvenes muestran una forma alargada (10 veces ms largos que anchos). La orientacin general sigue el eje proximo-distal. Esto presumiblemente muestra cambios en la orientacin de los husos mitticos

(Garca-Bellido y Meriam 1971). Los lmites de los clones son indeterminados y presentan muchas indentaciones.

Los Minutes son una clase de mutaciones recesivas que presentan un fenotipo dominante que consiste en que los individuos heterozigotos para la mutacin crecen ms lentamente. La tcnica introducida por Morata y Ripoll (1975) que consista en marcar clones Minute+ inducidos por recombinacin mittica en animales heterozigotos para Minute, permiti el descubrimiento de los compartimentos en Drosophila. Se trata de regiones del adulto que se forman a partir de grupos de clulas que se van dividiendo durante el desarrollo y que quedan confinadas en reas especficas del disco imaginal. Estos compartimentos representan unidades de crecimiento y determinacin (GarcaBellido y col. 1973; Morata y Lawrence 1975). Un clon Minute+ producido en un animal Minute crece ms rpidamente como consecuencia de su tasa de crecimiento. Sin embargo, estos clones siempre respetan unas fronteras, que constituyen los lmites de los compartimentos. En primer lugar, los clones no cruzan una lnea virtual que separa la zona anterior de la zona posterior. Ms tarde, aparecen otras restricciones de linaje, la dorso-ventral y la proximodistal. A veces es til generar 2 clones al mismo tiempo marcados de forma diferente, esta tcnica se conoce como clones gemelos o twin spots y se utiliza cuando se quieren hacer comparaciones precisas entre la tasa de crecimiento de un clon experimental y un clon control. Clsicamente, la recombinacin mittica ha sido inducida mediante rayos X. Sin embargo, la irradiacin con rayos X presenta 3 problemas principales: 1. Existe un elevado nmero de marcadores cuticulares, pero el nmero de marcadores para otros tejidos es muy limitado. 2. Los rayos X causan un nivel considerable de muerte celular a las dosis utilizadas (10Gy (1000rad)). 3. Para algunas localizaciones gnicas la frecuencia de recombinacin es muy baja. Estos problemas tcnicos han sido solucionados en Drosophila utilizando una recombinasa especfica de lugar de levaduras (FLP). Se pueden generar clones en el 95% de los genes, incluyendo el estudio de clones en tejidos internos (Golic y Lindquist 1989; Golic 1991; Chou y Perrimon 1992; Xu y Rubin 1993). La FLP cataliza la recombinacin entre unas secuencias llamadas FRTs (del ingls flippase recombination target). Para generar recombinacin mittica mediante FRTs, stos han de estar situados en posicin idntica en cromosomas homlogos y adems orientados en la misma direccin. As, la induccin de la expresin de la FLP va un promotor ubicuo (heat-shock, hs) es capaz de incrementar significativamente la frecuencia de mosaicismo sin la letalidad asociada a la irradiacin con rayos X. Sin embargo, como en el caso de la irradiacin con rayos X, esta aproximacin tiene an limitaciones. La induccin ubicua de la FLP va choque trmico permite un grado de control espacial y

temporal limitado. En ocasiones la induccin de clones mediante esta tcnica puede producir letalidad, debido al gran nmero de clones que se obtienen. Para superar las limitaciones de este sistema, se ha aprovechado el sistema de expresin gnica GAL4 (Brand y Perrimon 1993). Este sistema de activacin gnica binaria utiliza el activador de levadura GAL4 para controlar la transcripcin de los genes diana tanto cuantitativamente como cualitativamente. Fusionando el gen de inters al promotor de respuesta a GAL4 (UAS), su expresin puede ser dirigida con una lnea GAL4 apropiada. Construyendo un GAL4-responsible FLP (UAS-FLP), se puede proveer un alto nivel de control espacial y temporal sobre la recombinacin.

Anlisis de PCR y secuenciacin Para secuenciar las zonas flanqueantes al elemento P-lacW se utiliz un cebador derivado de la repeticin invertida terminal del elemento P (28 mer). La insercin del elemento P-lacW en la secuencia genmica se determin secuenciando los rescates del plasmidio con 2 cebadores localizados en la secuencia interna del elemento P-lacW. Para el rescate Eco RI el cebador era 5' TCACTCGCACTTATTGCAAGCATACG 3'. Y para el rescate Bam HI 5' ACACAACCTTTCCTCTCAACAA 3'. A partir de las secuencias genmicas obtenidas, se disearon toda una serie de cebadores que nos permitieron ir avanzando en el conocimiento de la secuencia del gen en ambas direcciones. Conclusiones 1. El mutante l(3)112411 de Drosophila melanogaster, semiletal y estril, presenta toda una serie de fenotipos asociados, que se localizan fundamentalmente en el ala, el halterio y la pata. Las alas son de menor tamao, presentan venas transversales ectpicas y en ocasiones pierden parcialmente el margen posterior. Adems se detectan transformaciones parciales del halterio a ala y del primer segmento torcico en segundo. 2. El elemento P-lacW, responsable de la mutacin, se encuentra insertado en el intrn de mayor tamao del gen absent, small or homeotic discs-2 (ash-2). El mutante l(3)112411 es un alelo hipomorfo, mientras que el alelo ash-2I1, letal en fase de pupa, es probablemente un alelo de falta de funcin (nulo). 3. El anlisis clonal de los alelos l(3)112411 y ash-2I1 demuestra que los clones homozigotos para estas mutaciones en el ala provocan una reduccin drstica de las regiones de intervena, un ensanchamiento de las venas (a excepcin de la vena L4), la disrupcin de la morfologa de las clulas del borde del ala y la aparicin de efectos no autnomos celulares. En muchos casos, los tricomas que presentan las clulas que constituyen el clon son mltiples. Los clones homozigotos para la mutacin en la pata provocan la desaparicin de los peines tarsales, la reduccin en la longitud e incremento de la amplitud de la extremidad y anomalas en las articulaciones de las patas.

4. ash-2 parece estar implicado en el mantenimiento de la condicin de intervena, actuando de forma directa o indirecta sobre la expresin de blistered e interaccionando con las rutas de los genes plexus y crossveinless-2. 5. Los alelos l(3)112411 y ash-2I1 se comportan como alelos clsicos de ash-2, modificando el fenotipo asociado al alelo AntpNs y regulando de forma positiva la expresin de Ubx. En conjunto, los datos muestran que el gen absent, small or homeotic discs-2 es requerido para regular procesos de diferenciacin celular, adems de regular genes hometicos.

BIBLIOGRAFIA URL.TDX.28-04-13 (http://www.tdx.cat/bitstream/handle/10803/1844/TesisMontseAmoro s.pdf?sequence=1)


Brusca, R., Brusca, G. (2005). Invertebrados. Ed. 2da. Edit. Mc Graw Hill. Madrid, Espaa. Strinckberger, M. W. (1962). Experiments in genetics with Drosophila. New York.

Celniker, Susan. Rubin, Gerald. The Drosophila melanogaster Genome. Science, 287, 2185-2195 (2000) REFERENCIAS BIBLIOGRFICAS http://www.hhmi.org/news/rubin3-esp.html http://ciber-genetica.blogspot.com/2011/02/secuencia-del-genoma-dedrosophila.html http://bancodemoscas.fciencias.unam.mx/Investigacion_cientifica.html http://explorerbiogen.blogspot.com/2011/06/drosophila-melanogaster-comomodelo.html