Está en la página 1de 12

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

DISEÑO DE UN SISTEMA DE CONTROL PARA MEJORAR RENDIMIENTO DE PROCESOS EN LA PRODUCCIÓN DE cerveza de sorgo

Catalina Maware, Meng

Departamento de Ingeniería de Producción, Universidad Tecnológica de Chinhoyi, Zimbabue

Norman Gwangwava, Meng

Departamento de Ingeniería Industrial y de Ingeniería de Fabricación,

Universidad Nacional de Ciencia y Tecnología, Zimbabwe

Raphel M Jingura, PhD

Departamento de Control de Calidad y Estudios de Posgrado,

Universidad Tecnológica de Chinhoyi, Zimbabue

Abstracto

La calidad de los productos producidos en los últimos años ha sido la principal preocupación para muchas industrias.

En elaboración de la cerveza, la introducción de los sistemas de elaboración de la cerveza automatizados ha ayudado a reducir la

variabilidad de la cerveza producida. Las razones de la introducción de los sistemas automatizados son reducir el consumo de

energía y el tiempo de procesamiento por lotes mediante el aumento de la utilización del equipo. El objetivo principal del trabajo

es diseñar un sistema de control que ayuda en el seguimiento y el control del proceso de maceración, la temperatura y controlar

el nivel de agua que se pone en las cocinas durante la elaboración de cerveza sorgo. La investigación llevada a cabo mostró que

las empresas de Zimbabwe usan termómetros de bulbo seco para medir la temperatura de puré en la olla. Las empresas también

no tienen sensores de medición de nivel que miden la cantidad de agua que se vierte en la olla a enfriar principalmente el puré. El

diseño del circuito de control se realizó utilizando sensores y controladores. Para el control de la temperatura se utiliza un

controlador PID. El modelo para el sistema de control de la temperatura fue construido y procesada en la caja de herramientas de

identificación del entorno Matlab. El puré se elevó a 50ºC durante 50 minutos y la hidrólisis de proteínas, glucons beta y

pentasons por enzimas proteolic. A continuación, la temperatura se elevó a 80 ° C y se mantuvo constante durante 10 minutos en

esta etapa para la actividad óptima de la β-amilasa. A continuación, se elevó a 95 ° C para la actividad óptima de la amilasa α-.

109

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

Finalmente, la temperatura se elevó a 100ºC y se mantuvo constante durante 60 minutos para la inactivación de la enzima

palabraspalabras clave:clave: SistemaSistema dede control,control, maceración,maceración, cervezacerveza dede sorgosorgo

Introducción

Los sistemas de control son útiles en el proceso de elaboración de la cerveza. Cervecerías en Zimbabwe necesitan mejorar su

sostenibilidad, en particular, el uso de agua y energía. Cerveceros han respondido a la necesidad de mejorar la eficiencia de los procesos

mediante la adopción de las tecnologías de la reingeniería de sus procesos para ahorrar costes y reducir los residuos.

cerveza de sorgo se elabora a partir de maíz y sorgo. Cerveceras están experimentando variación en la viscosidad de la

cerveza que producen. Esta variación se debe a diferencias en el proceso de fabricación y cantidades de insumos utilizados en el

procesoprocesoproceso dedede elaboraciónelaboraciónelaboración dedede lalala cerveza.cerveza.cerveza. EnEnEn Zimbabwe,Zimbabwe,Zimbabwe, lalala viscosidadviscosidadviscosidad dedede lalala cervezacervezacerveza debedebedebe estarestarestar entreentreentre 808080 --- 100100100 nsnsns /// mmm 222 despuésdespuésdespués dedede lalala

primeraprimera conversiónconversión yy 60-80Ns60-80Ns // mm 22

despuésdespuésdespués dedede lalala adiciónadiciónadición dedede levadura.levadura.levadura. LasLasLas viscosidadesviscosidadesviscosidades dedede lalala cervezacervezacerveza producidaproducidaproducida enenen ZimbabweZimbabweZimbabwe estánestánestán generalmentegeneralmentegeneralmente enenen elelel rangorangorango dedede 110Ns110Ns110Ns /// mmm 222 despuésdespuésdespués

dedede lalala primeraprimeraprimera procesoprocesoproceso dedede conversiónconversiónconversión yyy 90ns90ns90ns /// mmm 222 AdemásAdemásAdemás levadura.levadura.levadura. EstosEstosEstos problemasproblemasproblemas puedenpuedenpueden atribuirseatribuirseatribuirse aaa lalala faltafaltafalta dedede sistemassistemassistemas dedede controlcontrolcontrol

eficaces que regulan los procesos de producción. Por ejemplo, en la mayoría de las fábricas de cerveza no hay seguimiento y control de

ebullición en el cocinas. Sin embargo, este es un proceso crítico que debe ser regulada dentro de parámetros específicos [Bélgica Brewing

Company, (2008)].

Hay nueve pasos importantes en el proceso de elaboración de cerveza de sorgo. Estos son la molienda en seco,

maceración, ebullición, refrigeración para primera conversión, calefacción, el esfuerzo, la pasteurización, segunda conversión y el

embalaje [Chikezie I, (2012)]. El proceso de molienda en seco implica moler los granos de sorgo y maíz en un molino motorizado para

obtener harina gruesa [Roger D, 2013]. Estos granos se mezclan con agua para hidrolizar ellos. Después de que el proceso de

maceración, el mosto se lleva a ebullición con el fin de esterilizar el mosto, coagula proteína del grano, se detiene la actividad

enzimática, se marcha compuestos volátiles, hace que los iones metálicos, sustancias de tanino y lípidos a ser insoluble [Olajire A,

(2012)]. El primer proceso de conversión implica la adición de la cebada y el sorgo de malta con el fin de solubilizar el adyuvante y la

malta física y enzimáticamente [Taylor J, et al, (2012)]. El grano gastado se elimina mediante el proceso conocido como el esfuerzo. A

continuación se añade levadura para permitir que la fermentación se produzca. La fermentación es un proceso en el que la levadura

singularizado unicelular convertir los azúcares en el mosto en dióxido de carbono y alcohol, sigue [Tabernash, (2012)]. La cerveza se

enfría entonces y se deja fermentar durante doce horas.

Los procesos críticos que requieren sistemas de control están hirviendo, la fermentación, enfriamiento, calentamiento y

pasteurización [Christna G, (2003); Emmerson, (2008) y Jacobs E, (2012)]. por

110

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

ebullición los parámetros críticos son 50 ° C, 80 ° C y 95 ° C. El proceso de maceración se puede optimizar utilizando un programa de

maceración con stands de temperatura-tiempo de 50 ° C x 50 min, 80 ° C x 10 minutos y 95 ° C x 40 minutos [Declan G, (2002)]. El

proceso de todo-grano elaboración de la cerveza requiere el cervecero para golpear temperaturas específicas y mantener esas

temperaturas durante un período prolongado de tiempo [Crandal et al, (2008)].

Los tipos de controladores usados ​​en los procesos de elaboración de la cerveza de cerveza son controladores lógicos

programables (PLC), microcontroladores y OMRON CPM2A. PLC se utilizan debido a su simplicidad, robustez, la interfaz de E / S y

un rendimiento fiable [Normanyo E, (2011)]. Microcontroladores han incorporado fiable en el programador de hardware, lenguaje de

programación simplificado y base de usuarios viva que ofrecen un montón de códigos de muestra. El objetivo de este estudio era

diseñar sistemas de control adecuados que ayuda en el seguimiento de los parámetros en el proceso de fabricación de la cerveza

tales como la temperatura, el proceso y el nivel de agua de maceración en la olla que a su vez afecta a la viscosidad de la cerveza

producida. El control correcto del proceso de elaboración asegura la producción de una cerveza coherente que a su vez satisfaga

los consumidores.

métodos

La siguiente sección ilustra cómo el sistema fue diseñado y el software que ayudó a crear el

sistema de control.

Controlador para la cervecería

VersaMax Modular PLC CPUE05, OMRON CPM2A y el microcontrolador PIC 16872 fueron los tipos de

controladores seleccionados para la fábrica de cerveza. VersaMax PLC modular CPUE05 fue elegido porque tenía puntos

2048Input / salida. El sistema diseñado tenía 30 entradas y 19 salidas y el sistema puede ser capaz de expandirse por lo tanto

se podrían utilizar puntos 2048I / S. El sistema también puede interactuar con SCADA a través de Ethernet usando pin RJ45.

Modelización de la sección de control para el proceso de maceración

Esto es donde el maíz molido y el sorgo se mezclan con ácido láctico y agua. Una solución de ácido láctico a una

concentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentración dedededededede dododododododo fffffff ======= 8.58.58.58.58.58.58.5 molesmolesmolesmolesmolesmolesmoles /////// dmdmdmdmdmdmdm 3333333 sesesesesesese mezclamezclamezclamezclamezclamezclamezcla conconconconconconcon aguaaguaaguaaguaaguaaguaagua paraparaparaparaparaparapara obtenerobtenerobtenerobtenerobtenerobtenerobtener unaunaunaunaunaunauna corrientecorrientecorrientecorrientecorrientecorrientecorriente dedededededede flujoflujoflujoflujoflujoflujoflujo dedededededede salidasalidasalidasalidasalidasalidasalida conconconconconconcon lalalalalalala concentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentración dedededededede

ácidoácidoácidoácido lácticolácticolácticoláctico dededede dodododo 0.0.0.0. FigFigFigFig 1111 muestramuestramuestramuestra cómocómocómocómo lalalala agitaciónagitaciónagitaciónagitación sesesese llevallevallevalleva aaaa cabo.cabo.cabo.cabo.

agitadoragitador xx vv

QQQQ ElElElEl ácidoácidoácidoácido lácticolácticolácticoláctico F;F;F;F; dodododo FFFF Para la olla QQQQ
QQQQ ElElElEl ácidoácidoácidoácido lácticolácticolácticoláctico F;F;F;F; dodododo FFFF
Para la olla
QQQQ 0,0,0,0, dodododo 0000
aguaagua QQ ww

FiguraFigura 11 tanquetanque dede maceraciónmaceración

111

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde:Dónde: QQQQQQQQQQQQQ fffffffffffff ============= CaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudal dedededededededededededede ácidoácidoácidoácidoácidoácidoácidoácidoácidoácidoácidoácidoácido lácticolácticolácticolácticolácticolácticolácticolácticolácticolácticolácticolácticoláctico enenenenenenenenenenenenen elelelelelelelelelelelelel tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque, QQQQQQQQQQQQQ wwwwwwwwwwwww ============= CaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudalCaudal dedededededededededededede aguaaguaaguaaguaaguaaguaaguaaguaaguaaguaaguaaguaagua enenenenenenenenenenenenen elelelelelelelelelelelelel tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque, QQQQQQQQQQQQQ 0000000000000 ============= FlujoFlujoFlujoFlujoFlujoFlujoFlujoFlujoFlujoFlujoFlujoFlujoFlujo dedededededededededededede masamasamasamasamasamasamasamasamasamasamasamasamasa fuerafuerafuerafuerafuerafuerafuerafuerafuerafuerafuerafuerafuera deldeldeldeldeldeldeldeldeldeldeldeldel tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque, dododododododododododododo fffffffffffff ============= LaLaLaLaLaLaLaLaLaLaLaLaLa

concentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentración dedededededededede ácidoácidoácidoácidoácidoácidoácidoácidoácido láctico,láctico,láctico,láctico,láctico,láctico,láctico,láctico,láctico, dododododododododo 000000000 ========= corrientecorrientecorrientecorrientecorrientecorrientecorrientecorrientecorriente dedededededededede flujoflujoflujoflujoflujoflujoflujoflujoflujo dedededededededede salidasalidasalidasalidasalidasalidasalidasalidasalida conconconconconconconconcon lalalalalalalalala concentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentraciónconcentración dedededededededede ácidoácidoácidoácidoácidoácidoácidoácidoácido láctico,láctico,láctico,láctico,láctico,láctico,láctico,láctico,láctico, VVVVVVVVV ========= VolumenVolumenVolumenVolumenVolumenVolumenVolumenVolumenVolumen deldeldeldeldeldeldeldeldel tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque, metrometrometrometrometrometrometrometrometro iiiiiiiii ========= TasaTasaTasaTasaTasaTasaTasaTasaTasa

dedededededede ácidoácidoácidoácidoácidoácidoácido lácticolácticolácticolácticolácticolácticoláctico dedededededede flujoflujoflujoflujoflujoflujoflujo enenenenenenen elelelelelelel tanque,tanque,tanque,tanque,tanque,tanque,tanque, metrometrometrometrometrometrometro aaaaaaa ======= TasaTasaTasaTasaTasaTasaTasa dedededededede acumulaciónacumulaciónacumulaciónacumulaciónacumulaciónacumulaciónacumulación dedededededede ácidoácidoácidoácidoácidoácidoácido lácticolácticolácticolácticolácticolácticoláctico enenenenenenen elelelelelelel tanque,tanque,tanque,tanque,tanque,tanque,tanque, metrometrometrometrometrometrometro 0000000 ======= TasaTasaTasaTasaTasaTasaTasa dedededededede flujoflujoflujoflujoflujoflujoflujo dedededededede salidasalidasalidasalidasalidasalidasalida dedededededede

ácidoácidoácidoácidoácidoácidoácido lácticolácticolácticolácticolácticolácticoláctico desdedesdedesdedesdedesdedesdedesde elelelelelelel tanque,tanque,tanque,tanque,tanque,tanque,tanque, XXXXXXX vvvvvvv ======= VolumenVolumenVolumenVolumenVolumenVolumenVolumen dedededededede aguaaguaaguaaguaaguaaguaagua enenenenenenen elelelelelelel tanque,tanque,tanque,tanque,tanque,tanque,tanque, KKKKKKK vvvvvvv ======= coeficientecoeficientecoeficientecoeficientecoeficientecoeficientecoeficiente dedededededede lalalalalalala válvulaválvulaválvulaválvulaválvulaválvulaválvula

QQQQQQ wwwwww ======

KKKKKK vvvvvv ****** XXXXXX vvvvvv

QQQQQQQ 0000000 ======= QQQQQQQ wwwwwww +++++++ QQQQQQQ FFFFFFF

(1)

(2)

TasaTasaTasa dedede entradaentradaentrada dedede ácidoácidoácido lácticolácticoláctico enenen elelel tanquetanquetanque ((( metrometrometro yo)yo)yo)

metrometrometrometrometrometrometrometrometrometrometro iiiiiiiiiii =========== QQQQQQQQQQQ FFFFFFFFFFF dododododododododododo fffffffffff ((((((((((( metrometrometrometrometrometrometrometrometrometrometro 33333333333 /////////// sssssssssss *********** molesmolesmolesmolesmolesmolesmolesmolesmolesmolesmoles /////////// mmmmmmmmmmm 33333333333 =========== molesmolesmolesmolesmolesmolesmolesmolesmolesmolesmoles /////////// s)s)s)s)s)s)s)s)s)s)s)

metrometrometrometrometrometro 000000 ====== QQQQQQ 000000 dodododododo 000000

(3)

(4)

TasaTasaTasa dedede acumulaciónacumulaciónacumulación dedede ácidoácidoácido lácticolácticoláctico enenen elelel depósitodepósitodepósito ((( metrometrometro un)un)un)

metrometrometro ununun •••

•••••••••••••••• [[[[[[[[ •••••••• dodododododododo 00000000 (((((((( t)]t)]t)]t)]t)]t)]t)]t)] ======== •••••••• •••••••••••••••• ••••••••

(5)

DóndeDóndeDóndeDóndeDóndeDóndeDónde ••••••• dododododododo 0000000 ((((((( t)t)t)t)t)t)t) eseseseseseses elelelelelelel ácidoácidoácidoácidoácidoácidoácido lácticolácticolácticolácticolácticolácticoláctico sesesesesesese sostienesostienesostienesostienesostienesostienesostiene paraparaparaparaparaparapara elelelelelelel tanquetanquetanquetanquetanquetanquetanque enenenenenenen elelelelelelel tiempotiempotiempotiempotiempotiempotiempo dedededededede ttttttt

Tenga en cuenta la ley de la conservación:

QQQQQQ FFFFFF dodododododo ffffff ====== •••••• ••••••

dodododo 0000 oooo

ττ ••

•••••••••••••••• dodododododododo 00000000 ++++++++ dodododododododo 00000000 ======== KKKKKKKK xxxxxxxx vvvvvvvv

DondeDondeDondeDondeDondeDondeDondeDonde KKKKKKKK ======== CCCCCCCC FFFFFFFF KKKKKKKK vvvvvvvv //////// QQQQQQQQ 00000000 yyyyyyyy ττττττττ ======== VVVVVVVV //////// QQQQQQQQ 00000000

La función de transferencia del sistema:

••• ••• ((( •)•)•) •••• •••• (((( •)•)•)•) ==== •.••••.••••.••••.•••

••• + •

(6)

(7)

La ecuación para el sistema fue probado más tarde para la respuesta de paso unidad usando Matlab.

La elección de la sonda de temperatura adecuada para la fábrica de cerveza

termómetros de resistencia de platino (Pt100) se eligieron debido a su elevada capacidad de respuesta mejorado, alta

sensibilidad y estabilidad a largo plazo en condiciones de humedad. RTD también son fáciles de instalar y también tienen la

temperatura más alta precisión con un promedio de lo que los hace la mejor adecuada a pesar de los RTD son caros.

Modelado para la temperatura

Fig 2 muestra un sistema de mando de cocina. La señal de salida de un dispositivo de detección de temperatura

que es Pt100 se compara con la temperatura deseada. El error hace que el controlador envíe una señal de control a la

válvula de gas de solenoide que produce el movimiento lineal del vástago de la válvula, ajustando así el flujo de vapor a la

cocina.

112

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431 FiguraFigura 22 SistemaSistema dede

FiguraFigura 22 SistemaSistema dede mandomando dede cocinacocina

El controlador de sistema PID está conectado al actuador de presión current-. El actuador está conectado a la

válvula de solenoide de gas que acciona continuamente para abrir o cerrar de manera que la cantidad correcta de vapor

fluirá en la olla a fin de subir o bajar la temperatura. La temperatura en la olla se mide por el Pt100 que proporciona

retroalimentación al controlador del sistema para ajuste y control. La perturbación dará cuenta de las pérdidas de calor,

fugas de vapor y otras fluctuaciones no ideales.

La figura 3 muestra un diagrama de bloques para el bucle de control de la temperatura usando el controlador PID.

controlador PID 11 (1(1 ++ •• •• Válvula R Resistencia •• •)•) Potenciómetro térmica (t)
controlador PID
11 (1(1 ++ •• ••
Válvula
R Resistencia
•• •)•)
Potenciómetro
térmica (t)
KKKK 1111 (((( 1+1+1+1+ 1111
••••• ••••• +++++ TTTTT ••••• •)•)•)•)•)
•• 22
dede etereter KK 11
111 +++ ••• ••• ((( •)•)•)
HHH 111 IDTIDTIDT

Fig.Fig. 33 ElEl controlcontrol dede temperaturatemperatura queque usausa elel reguladorregulador PIDPID

DondeDondeDondeDondeDondeDondeDondeDonde CCCCCCCC tttttttt ======== capacitanciacapacitanciacapacitanciacapacitanciacapacitanciacapacitanciacapacitanciacapacitancia térmica,térmica,térmica,térmica,térmica,térmica,térmica,térmica, RRRRRRRR tttttttt ======== LaLaLaLaLaLaLaLa resistenciaresistenciaresistenciaresistenciaresistenciaresistenciaresistenciaresistencia térmica,térmica,térmica,térmica,térmica,térmica,térmica,térmica, KKKKKKKK 11111111 ======== ConstanteConstanteConstanteConstanteConstanteConstanteConstanteConstante paraparaparaparaparaparaparapara PID,PID,PID,PID,PID,PID,PID,PID, KKKKKKKK 22222222

======= VálvulaVálvulaVálvulaVálvulaVálvulaVálvulaVálvula dedededededede vaporvaporvaporvaporvaporvaporvapor dedededededede controlcontrolcontrolcontrolcontrolcontrolcontrol constante,constante,constante,constante,constante,constante,constante, θθθθθθθ re(re(re(re(re(re(re( t)t)t)t)t)t)t) ======= temperaturatemperaturatemperaturatemperaturatemperaturatemperaturatemperatura deseada,deseada,deseada,deseada,deseada,deseada,deseada, θθθθθθθ metro(metro(metro(metro(metro(metro(metro( t)t)t)t)t)t)t) ======= TemperaturaTemperaturaTemperaturaTemperaturaTemperaturaTemperaturaTemperatura medidamedidamedidamedidamedidamedidamedida (V),(V),(V),(V),(V),(V),(V), θθθθθθθ 0000000 ((((((( t)t)t)t)t)t)t) ======= TemperaturaTemperaturaTemperaturaTemperaturaTemperaturaTemperaturaTemperatura realrealrealrealrealrealreal

(C),(C),(C),(C),(C),(C), uuuuuu (t)(t)(t)(t)(t)(t) ====== SeñalSeñalSeñalSeñalSeñalSeñal dededededede control,control,control,control,control,control, VVVVVV (t)(t)(t)(t)(t)(t) ====== velocidadvelocidadvelocidadvelocidadvelocidadvelocidad dededededede flujoflujoflujoflujoflujoflujo dededededede vaporvaporvaporvaporvaporvapor (m(m(m(m(m(m 333333 ////// s),s),s),s),s),s), QQQQQQ yo(yo(yo(yo(yo(yo( t)t)t)t)t)t) ====== velocidadvelocidadvelocidadvelocidadvelocidadvelocidad dededededede flujoflujoflujoflujoflujoflujo dededededede calorcalorcalorcalorcalorcalor enenenenenen lalalalalala ollaollaollaollaollaolla aaaaaa (J(J(J(J(J(J ////// ssssss ====== W),W),W),W),W),W), QQQQQQ OOOOOO

(((((( t)t)t)t)t)t) ====== flujoflujoflujoflujoflujoflujo dededededede calorcalorcalorcalorcalorcalor aaaaaa travéstravéstravéstravéstravéstravés dededededede laslaslaslaslaslas paredesparedesparedesparedesparedesparedes dededededede lalalalalala ollaollaollaollaollaolla (W),(W),(W),(W),(W),(W), CCCCCC TTTTTT ====== capacitanciacapacitanciacapacitanciacapacitanciacapacitanciacapacitancia térmica,térmica,térmica,térmica,térmica,térmica, RRRRRR TTTTTT ====== LaLaLaLaLaLa resistenciaresistenciaresistenciaresistenciaresistenciaresistencia térmicatérmicatérmicatérmicatérmicatérmica dededededede laslaslaslaslaslas paredes.paredes.paredes.paredes.paredes.paredes.

113

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

ecuaciones del sistema

Controlador:Controlador: LaLa acciónacción dede controlcontrol eses PIDPID dede lala formaforma dede 1+1+ 11

UUUU (s)(s)(s)(s) ==== KKKK 1111 [[[[ 1+1+1+1+ 1111

•••••••••••••••• (•)(•)(•)(•)(•)(•)(•)(•) ++++++++ •••••••• •••••••• (((((((( s)]s)]s)]s)]s)]s)]s)]s)] [θ[θ[θ[θ[θ[θ[θ[θ re(re(re(re(re(re(re(re( s)s)s)s)s)s)s)s) -------- θθθθθθθθ metro(metro(metro(metro(metro(metro(metro(metro( s)s)s)s)s)s)s)s)

()()()()() +++++ ((((( )))))

La válvula de solenoide de gas tiene una primera dinámica de orden de la forma;

•2•2•2•2•2•2 111111 ++++++ •••••••••••• (•)(•)(•)(•)(•)(•) dondedondedondedondedondedonde KKKKKK 222222 eseseseseses lalalalalala constanteconstanteconstanteconstanteconstanteconstante dededededede válvulaválvulaválvulaválvulaválvulaválvula mmmmmm 333333 ////// ssssss

••

(( s)s) ==

la dinámica de las habitaciones

QQQQQQQ yo(yo(yo(yo(yo(yo(yo( t)t)t)t)t)t)t) ------- QQQQQQQ 0000000 ((((((( t)t)t)t)t)t)t) ======= CCCCCCC TTTTTTT •θ•θ•θ•θ•θ•θ•θ

CalorCalorCalorCalorCalorCalorCalorCalor aaaaaaaa travéstravéstravéstravéstravéstravéstravéstravés dededededededede laslaslaslaslaslaslaslas paredesparedesparedesparedesparedesparedesparedesparedes dededededededede lalalalalalalala cocinacocinacocinacocinacocinacocinacocinacocina eseseseseseseses comocomocomocomocomocomocomocomo sesesesesesesese dadadadadadadada enenenenenenenen lalalalalalalala ecuaciónecuaciónecuaciónecuaciónecuaciónecuaciónecuaciónecuación (12)(12)(12)(12)(12)(12)(12)(12) QQQQQQQQ 00000000 (((((((( t)t)t)t)t)t)t)t) ======== [[[[[[[[ θθθθθθθθ 00000000 (t)(t)(t)(t)(t)(t)(t)(t) -------- θθθθθθθθ SSSSSSSS

t)]

SustituyendoSustituyendoSustituyendo lalala ecuaciónecuaciónecuación (11)(11)(11) enenen (12)(12)(12) QQQ yo(yo(yo( t)t)t) ---

[[[[[ θθθθθ 00000 (t)(t)(t)(t)(t) ----- θθθθθ SSSSS t)t)t)t)t)

]]]] ==== dodododo TTTT •θ•θ•θ•θ

••

multiplicandomultiplicandomultiplicando porporpor ••• •••

••••••••••• ••••••••••• QiQiQiQiQiQiQiQiQiQiQi (t)(t)(t)(t)(t)(t)(t)(t)(t)(t)(t) +++++++++++ θθθθθθθθθθθ sssssssssss (t)(t)(t)(t)(t)(t)(t)(t)(t)(t)(t) =========== θθθθθθθθθθθ 00000000000 ((((((((((( t)t)t)t)t)t)t)t)t)t)t) +++++++++++ ••••••••••• ••••••••••• ConnecticutConnecticutConnecticutConnecticutConnecticutConnecticutConnecticutConnecticutConnecticutConnecticutConnecticut •θ•θ•θ•θ•θ•θ•θ•θ•θ•θ•θ

••

Tomando transformadas de Laplace

•••••••••••••• •••••••••••••• QiQiQiQiQiQiQiQiQiQiQiQiQiQi (s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s) ++++++++++++++ θθθθθθθθθθθθθθ ssssssssssssss (s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s)(s) ============== [[[[[[[[[[[[[[ 1+1+1+1+1+1+1+1+1+1+1+1+1+1+ •••••••••••••• •••••••••••••• •••••••••••••• •]•]•]•]•]•]•]•]•]•]•]•]•]•] θθθθθθθθθθθθθθ 00000000000000 (((((((((((((( s)s)s)s)s)s)s)s)s)s)s)s)s)s)

La ecuación termómetro

θθθθθθθ ••••••• ((((((( s)s)s)s)s)s)s) ======= HHHHHHH 1111111 θθθθθθθ 0000000 ((((((( s)s)s)s)s)s)s)

El diagrama de bloques se puede reducir a:

•1•2•••••1•2•••••1•2•••••1•2•••••1•2•••• ••••••••••••••• (•)(•)(•)(•)(•) +++++ 1)1)1)1)1) [[[[[ θθθθθ ••••• (s)(s)(s)(s)(s) ----- 1+1+1+1+1+ θθθθθ 00000 (s)(s)(s)(s)(s)

•• (•) (1 + •1 (•)

+

θθθθθθθθθθθ 00000000000 ((((((((((( s)s)s)s)s)s)s)s)s)s)s) =========== 11111111111 +++++++++++ ••••••••••• ••••••••••• ••••••••••• ••••••••••• θθθθθθθθθθθ 00000000000 ((((((((((( s)s)s)s)s)s)s)s)s)s)s)

PorPorPorPorPorPorPorPor lolololololololo tantotantotantotantotantotantotantotanto lalalalalalalala gananciagananciagananciagananciagananciagananciagananciaganancia haciahaciahaciahaciahaciahaciahaciahacia delantedelantedelantedelantedelantedelantedelantedelante KKKKKKKK ffffffff ======== KKKKKKKK 11111111 KKKKKKKK 22222222 RRRRRRRR TTTTTTTT

RRRRR TTTTT ===== 0,750,750,750,750,75 CCCCC TTTTT ===== 11J11J11J11J11J

/// KTKTKT 111 === 2.26342.26342.2634

La función de transferencia del sistema:

Tiene)

V1 (s) =

0.95

1 + 411.255•

(8)

(9)

(10)

(11)

(12)

(13)

(14)

(15)

(dieciséis)

(17)

(19)

La ecuación para el sistema fue probado más tarde para la respuesta de paso unidad usando Matlab.

Modelado para el sistema de control de nivel de agua

El sensor de nivel asegura la cantidad correcta de agua se vierte en la olla. Greyline LIT25 sensor se eligió porque el

relé de señal es programable para el control ON / OFF de la bomba, el nivel, la temperatura o la alarma de pérdida de eco. La

Figura 4 muestra un sistema de control de nivel para la cocina.

114

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

T HH rere controlador PLC HH metrometro VALVULAVALVULA DEDE CONTROLCONTROL (K(K v)v) VV 11 Greyline
T
HH rere
controlador
PLC
HH metrometro
VALVULAVALVULA DEDE CONTROLCONTROL (K(K v)v)
VV 11
Greyline LIT25
HH 11
HH unun
DEPÓSITODEPÓSITO DEDE ÁREA,ÁREA, UNUN
V

FigFig 44 ModelandoModelando elel sistemasistema dede controlcontrol parapara elel nivelnivel dede aguaagua

dondedondedondedondedondedondedondedondedondedondedonde KKKKKKKKKKK vvvvvvvvvvv =========== coeficientecoeficientecoeficientecoeficientecoeficientecoeficientecoeficientecoeficientecoeficientecoeficientecoeficiente dedededededededededede flujoflujoflujoflujoflujoflujoflujoflujoflujoflujoflujo paraparaparaparaparaparaparaparaparaparapara elelelelelelelelelelel agua,agua,agua,agua,agua,agua,agua,agua,agua,agua,agua, RRRRRRRRRRR fffffffffff =========== 15s15s15s15s15s15s15s15s15s15s15s /////////// mmmmmmmmmmm 2,2,2,2,2,2,2,2,2,2,2, TTTTTTTTTTT ttttttttttt =========== SeñalSeñalSeñalSeñalSeñalSeñalSeñalSeñalSeñalSeñalSeñal deldeldeldeldeldeldeldeldeldeldel controlador,controlador,controlador,controlador,controlador,controlador,controlador,controlador,controlador,controlador,controlador, VVVVVVVVVVV 11111111111 =========== VolumenVolumenVolumenVolumenVolumenVolumenVolumenVolumenVolumenVolumenVolumen deldeldeldeldeldeldeldeldeldeldel tanquetanquetanquetanquetanquetanquetanquetanquetanquetanquetanque cuandocuandocuandocuandocuandocuandocuandocuandocuandocuandocuando sesesesesesesesesesese

hahahahaha alcanzadoalcanzadoalcanzadoalcanzadoalcanzado elelelelel nivelnivelnivelnivelnivel requerido,requerido,requerido,requerido,requerido, VVVVV 22222 ===== VolumenVolumenVolumenVolumenVolumen dedededede depósitodepósitodepósitodepósitodepósito enenenenen ununununun momentomomentomomentomomentomomento determinado,determinado,determinado,determinado,determinado, AAAAA ===== ÁreaÁreaÁreaÁreaÁrea dedededede tanque,tanque,tanque,tanque,tanque, HHHHH aaaaa ===== AlturaAlturaAlturaAlturaAltura deldeldeldeldel

tanque,tanque,tanque,tanque,tanque,tanque,tanque,tanque, RRRRRRRR ffffffff ======== resistenciaresistenciaresistenciaresistenciaresistenciaresistenciaresistenciaresistencia dededededededede salidasalidasalidasalidasalidasalidasalidasalida dededededededede agua.agua.agua.agua.agua.agua.agua.agua. VVVVVVVV 11111111 (((((((( t)t)t)t)t)t)t)t) ======== KKKKKKKK vvvvvvvv TTTTTTTT tttttttt

la dinámica de tanques

VVVVVV 111111 (((((( televisióntelevisióntelevisióntelevisióntelevisióntelevisión 222222 (((((( t)t)t)t)t)t) ====== •••••••••••• •••••• hhh ununun

ParaParaParaPara linealizarlinealizarlinealizarlinealizar elelelel flujoflujoflujoflujo VVVV 2222 (((( t)t)t)t) ==== ℎ•ℎ•ℎ•ℎ• (•)(•)(•)(•)

ElElElElElEl cabezalcabezalcabezalcabezalcabezalcabezal dededededede medidamedidamedidamedidamedidamedida hhhhhh mmmmmm ====== HHHHHH 1.1.1.1.1.1. hhhhhh unununununun

VVVV 1111 (((( s)s)s)s) ----

ℎ•ℎ•ℎ•ℎ• (•)(•)(•)(•)

•••••••••• (•)(•)(•)(•)(•) ===== UNUNUNUNUN sssss HHHHH ununununun

•• (•) •1 (•) - •• (•)

•• (•)

==== AAAA ssss HHHH unununun

•• (•) •1 (•)

•• (•)

•• (•) •1 (•)

•• (•)

•• (•)

•1 =

====== AAAAAA ssssss HHHHHH unununununun ++++++ •••••••••••• (•)(•)(•)(•)(•)(•) ••

()

====== HHHHHH un(un(un(un(un(un( UNUNUNUNUNUN ssssss ++++++ 111111

•• 1 + • (•)

•• (•))

•• (•)

(20)

(21)

(22)

(23)

(24)

(25)

(26)

(27)

(28)

115

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

VVV 111 ((( s)s)s) •• 1 + • (•) sssss KK vv HHHHH re(re(re(re(re( sssss
VVV 111 ((( s)s)s)
•• 1 + • (•)
sssss
KK vv
HHHHH re(re(re(re(re(
sssss HHHHH metro(metro(metro(metro(metro(
•• (•)
FigFig 55 sistemasistema dede buclebucle abiertoabierto
••• ••• ((( •)•)•)
••• 111 ((( •)•)•) ===
•••• ••••
•••• ••••
1 + 411.255•

KKK vvv === 0.10.10.1

RRRRR fffff ===== 9.5m9.5m9.5m9.5m9.5m 33333 ///// sssss

La función de transferencia del sistema:

••• ••• ((( •)•)•) ••• 111 ((( •)•)•) ===

0.95

1 + 411.255•

(29)

El sistema fue probado más tarde para la respuesta de paso unidad usando Matlab.

Resultados y discusión

La investigación se centró en el diseño del sistema de control para el proceso de fabricación de la cerveza de sorgo. La

investigación se ilustra en el diseño del sistema a partir de primeros principios y la simulación del sistema de control de temperatura

se realiza mediante Matlab.

Resultados para el tanque de maceración

La función de transferencia para el proceso de maceración se obtuvo a partir de primeros principios. La función de transferencia

para el proceso obtenido fue:

••• ••• ((( •)•)•) •••• •••• (((( •)•)•)•) ==== •.••••.••••.••••.•••

••• + •

(7)

El sistema se probó entonces para bucle abierto respuesta de paso unidad y produjo una señal de respuesta de entrada

amplificada por un factor de 3,25. A continuación, el algoritmo de control PID se implementó y el sistema fue probada usando un

controlador proporcional. El sistema logró conseguir una función escalón unitario sin rebasamientos, sin embargo, el tiempo de

subida era 105 segundos. El sistema se probó de nuevo con la ayuda del controlador derivativo proporcional a fin de reducir el

tiempo de subida y el tiempo de respuesta del sistema. El tiempo de subida del sistema fue de 0,5 segundos y el sistema alcanza

el punto de ajuste deseado sin sobreimpulso. El controlador Derivada Proporcional fue seleccionado para la sección de

maceración. Esto se puede ver en la figura 6 se muestra a continuación.

116

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431 FigFig 66 gráficosgráficos combinadoscombinados

FigFig 66 gráficosgráficos combinadoscombinados parapara elel sistemasistema dede controlcontrol PIDPID

El nivel del agua controlar el sistema

LaLaLaLa funciónfunciónfunciónfunción dededede transferenciatransferenciatransferenciatransferencia quequequeque sesesese obtuvoobtuvoobtuvoobtuvo aaaa partirpartirpartirpartir dededede primerosprimerosprimerosprimeros principiosprincipiosprincipiosprincipios sesesese •••• •••• (((( •)•)•)•)

••• 111 ((( •)•)•) ===

0.95

11 ++ 411.255•411.255• (( 19)19)

El sistema fue probado para la respuesta de bucle abierto paso unidad. La ganancia de la función de transferencia

fue de 0,95. El tiempo de subida fue 1,500 segundos y el tiempo de establecimiento era 500 segundos. El controlador

proporcional se introdujo a fin de reducir el tiempo de subida. La ganancia del sistema fue 0,865 y el tiempo de establecimiento

era 250 segundos. Esto demostró que el controlador proporcional reduce la ganancia de 0,95 hasta 0,865. El derivado

proporcional fue el introducido. Se reduce la ganancia del controlador a 0.815 y el tiempo de subida era 250 segundos. La

integral proporcional también se introdujo a fin de aumentar la ganancia del sistema. La amplitud obtenido mostró que el

sistema era ahora inestable. Un rebasamiento de 0,8 se logró y el tiempo de establecimiento aumentó a 500 segundos. El

sistema de control proporcional integral derivativo se introdujo y el sistema fue probado para la respuesta de paso unidad. El

tiempo de respuesta para el sistema se redujo de 500 segundos a 10 segundos. La Figura 7 muestra las gráficas combinado

para el sistema de control.

117

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431 FigFig 77 gráficosgráficos combinadoscombinados

FigFig 77 gráficosgráficos combinadoscombinados parapara elel sistemasistema dede controlcontrol PIDPID

Resultados para el sistema de control de temperatura

El modelo que fue diseñado usando Simulink se realizó para comprobar si la temperatura se elevaría de la manera

deseada. Se obtuvo el gráfico mostrado en la Figura 8 después de ejecutar el modelo. El sistema fue capaz de realizar como

por respuesta deseada. El puré se elevó a 50ºC durante 50 minutos y la hidrólisis de proteínas, glucons beta y pentasons por

enzimas proteolic. A continuación, la temperatura se elevó a 80 ° C y se mantuvo constante durante 10 minutos para la

actividad óptima de la β-amilasa. A continuación, se elevó a 95ºC y se mantuvo durante 40 minutos para la actividad óptima

de la amilasa α-. Finalmente, la temperatura se elevó a 100ºC y se mantuvo constante durante 60 minutos para inactivar las

enzimas.

constante durante 60 minutos para inactivar las enzimas. FigFig 88 gráficográfico dede controlcontrol dede

FigFig 88 gráficográfico dede controlcontrol dede temperaturatemperatura

118

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

Conclusiones y Recomendaciones

El objetivo principal de la investigación fue diseñar un sistema de control que habría que supervisar y controlar el

proceso de maceración, la ebullición de la masa en la olla y la cantidad de agua añadida en la olla durante el proceso de

fabricación de la cerveza. El sistema de control de la temperatura fue diseñado que dio a los responde deseados para elevar

la temperatura inicialmente a 50 ° C y mantenerla durante 50 minutos, para elevar la temperatura a 80 ° C y mantener

durante 10 minutos. El sistema logró elevar la temperatura a 95 ° C y mantenerla durante 40 minutos y, finalmente, también

se elevó la temperatura a 100 ° C y se mantiene a esa etapa de 60 minutos.

referencias:

Belgium Brewing Company. (2008). Opto 22 SNAP PAC sistema de ayuda a la cervecería a mejorar los procesos de producción y

los efectos de sostenibilidad.

http://www.automation.com/pdf_articles/1800_Case_Study_New_Belgium_Brewing.pdf. Consultado el 20 de marzo de

2012, disponible.

Chikezie I Owuama. (2012). Fabricación de la cerveza con el sorgo. Revista del Instituto de elaboración de la cerveza, Volumen 105, Número

1.

Roger D. (2013) Tratamiento de Amgba, cerveza base de maíz el sorgo elaborada en Camerún. Diario de elaboración de la cerveza y

la destilación, Volumen 4 (1), pp 11-18.

Olajire A. (2012). La industria cervecera y cambios ambientales. Diario de producción más limpia (2012), doi:

10.1016 / j.jclepro.2012.03.003.

Normanyo E, A y Pokua Isaac A. (2012). Automatización de etiquetadora protomatic de una fábrica de cerveza usando el software de

SiemensSiemens SteoSteo 77 dede control,control, unun estudioestudio dede casocaso dede ACCRAACCRA cervecería.cervecería. http:http: //// wwwwww

arpia.press.com/volumes4. Número 4 / IJRRAS-6-4-10.pdf. Consultado el 21 de abril de 2013, disponible. Leuchner K, (1996).

EnEnEn 'Cultivos'Cultivos'Cultivos ResistenteResistenteResistente aaa lalala sequíasequíasequía paraparapara ÁfricaÁfricaÁfrica deldeldel Sur,Sur,Sur, 444 ººº Edición,Edición,Edición, ICRISAT,ICRISAT,ICRISAT, Patancheru,Patancheru,Patancheru, India,India,India, pp7-18.pp7-18.pp7-18.

Smith C y Corripio A, (2006). Principios y Práctica de control automático del proceso, tercera ed. Hoboken: John

Wiley & Sons.

Whitehurst J. R y Maarten van ORT. Las enzimas en Tecnología de los Alimentos (2010), segunda edición: Blackwell Publishing

Limited, Nueva Delphi, India.

Leuchner K, (1996). En Cultivos Resistente a la sequía para África del Sur, cuarta edición, ICRISAT, Patancheru, India,

pp7-18.

ARC Advisory Group (2004). La globalización de la industria cervecera: Un nuevo paisaje

http://literature.rockwellautomation.com/idc/groups/literature/documents/wp/bev-wp001-en-

p.pdf. Consultado el 20 de marzo de 2012, disponible.

119

Científico Europeo 2013 de la revista podrá vol.9 edición, No. 15 ISSN: 1857 - 7881. (La impresión) e - ISSN 1857- 7431

BCS (2012). http://www.embeddedcontrolconcepts.com/ 012. Consultado el 29 de enero de 2012, disponible.

diccionario de la cerveza y el glosario de términos, 2012, http://www.craftbeer.com/pages/beer-studies consultado el 21 de febrero de

2012 disponible.

120