Tesis Doctoral de Genes

UNIVERSIDAD POLITÉCNICA DE MADRID
ESCUELA TÉCNICA SUPERIOR
DE INGENIEROS DE MONTES
GENES IMPLICADOS EN LA RESPUESTA MOLECULAR
AL ESTRÉS HÍDRICO EN Pinus pinaster Ait.
TESIS DOCTORAL
PEDRO PERDIGUERO JIMÉNEZ

Licenciado en Ciencias Ambientales
2012
DEPARTAMENTO DE SILVOPASCICULTURA
ESCUELA TÉCNICA SUPERIOR

DE INGENIEROS DE MONTES
GENES IMPLICADOS EN LA RESPUESTA MOLECULAR
AL ESTRÉS HÍDRICO EN Pinus pinaster Ait.
PEDRO PERDIGUERO JIMÉNEZ

Licenciado en Ciencias Ambientales
DIRECTORES:
CARMEN COLLADA COLLADA ÁLVARO SOTO DE VIANA

Doctora en Ciencias Químicas Doctor Ingeniero de Montes
UNIVERSIDAD POLITÉCNICA DE MADRID
Tribunal nombrado por el Magfco. Y Excmo. Sr. Rector de la Universidad

Politécnica de Madrid, el día …. de ……………….. de 201…
Presidente: .…………………………………………………………………
Vocal: ………………………………………………………………………..
Vocal: ………………………………………………………………………..
Vocal: ………………………………………………………………………..
Secretario: …………………………………………………………………..
Suplente: ..…………………………………………………………………..
Suplente: ..…………………………………………………………………..
Realizado el acto de defensa y lectura de tesis el día …. de ……………….. de

201… en la E.T.S.I. Montes
EL PRESIDENTE LOS VOCALES
EL SECRETARIO
MENCIÓN DE DOCTORADO INTERNACIONAL
INTERNATIONAL DOCTORATE MENTION
Esta Tesis ha sido informada positivamente para su defensa en exposición

pública por los siguientes investigadores:
This Ph.D. Thesis has been positively evaluated for its defense by the next
external reviewers:
Dr. Célia Maria Miguel

Instituto de Tecnologia Química e Biológica (ITQB)
Instituto de Biologia Experimental e Tecnológica (IBET)
Universidade Nova de Lisboa, Portugal
Dr. Pablo Fuentes Utrilla

ARK- Genomics. The Roslin Institute
University of Edinburg
Agradecimientos
Deseo expresar mi más sincero agradecimiento a todas las personas que de

alguna manera han participado en el largo camino que ha supuesto, no solo la
realización de este trabajo, sino cada paso que he dado hasta llegar al mismo.
A mi familia, porque jamás cuestionaron ninguna de las decisiones que tomé en

mi vida y dejaron que fuera yo el que eligiera mi propio camino. Creo que el ensayo-
error es tan importante en la vida como en la ciencia, a ellos les debo la mayoría de
mis aciertos.
A mi Rous, mi pareja, mi mejor amiga, mi confidente; porque a su lado todo me

parece más fácil y su compañía es un aliciente para rendir más en el trabajo y en la
vida. Gracias por apoyarme desde el principio en mi decisión de “subirme al carro de la
ciencia” aun sabiendo que tiene numerosas “averías” lo que se traduce en una
constante economía de subsistencia… al final tendremos que ir a buscar “piezas” al
extranjero. Gracias por escuchar mis despotriques de esa PCR que se resiste, esas
plantas que no crecen, mi ataque frontal a la lengua inglesa… en resumen, gracias por
estar ahí siempre.
A mis directores Álvaro Soto y Carmen Collada, porque sin apenas conocernos
me concedieron la oportunidad de entrar en un proyecto que me interesó desde que lo
vi en la larga lista de FPIs. Gracias por vuestra entrega y apoyo durante todos estos
años; esperemos seguir recogiendo frutos después de tantos esfuerzos.
A toda la unidad de Anatomía al completo; a Luis Gil por su apoyo científico,

técnico y logístico, gracias a este apoyo he podido acabar la tesis con relativa
tranquilidad. A Unai, Pilar, Nikos, Mamen, Guille, Martin, Jesús, Rosa Ana, Javi, David
Victoria, Chechu, Ricardo… por intercambiar inquietudes y dar ánimos en los
momentos de agobio. Y por supuesto a mi queridísima red de la buhardilla; la niña del
moño, Zaiduqui, el Rober, Paulita, la pies sucios, mi supuesto doble Víctor, la
morocha, er Hose y mi añorado y querido calvito, “capag que” sin vosotros
seguramente esta tesis sí hubiese sido posible pero seguro que no tan, tan, tan
gratificante. Es difícil decir los por… gracias por todo.
A Célia Miguel y todo su grupo del ITQB, por su calidad humana y por abrirme de
par en par las puertas de su laboratorio. Gracias por darme la posibilidad de trabajar
con nuevas y apasionantes técnicas que me han permitido “ponerle la guinda al
pastel”.
A Carmen Díaz-Sala y su grupo de la Universidad de Alcalá por sus consejos

para la realización y análisis de las RT-PCRs, y una mención especial a Elena
Carneros por compartir conmigo todo su conocimiento sobre embriogénesis somática
de pinos, parte de los resultados obtenidos están directamente relacionados con sus
buenos consejos.
A mis compañeros de laboratorio en mis inicios en el laboratorio de Bioquímica;

Ángela, Irene, Víctor, Raquel y Rosa, por facilitarme la adaptación, por los buenos
consejos y por las largas conversaciones en comidas y cañeos.
A toda mi gente de Villalba, por cada “miernes”, “juernes” y fines de semana

intentando desconectar la neurona y por escuchar pacientemente mis desvaríos a
pesar de no entender “por qué quiero poner pinos en el desierto”.
A toda mi gente de Ávila, Elche y Salamanca, que aunque sea en la distancia

siempre me han transmitido palabras de ánimo.
A mis compañeros de “Rûa da Quintinha” Josep, Marcelo y Liliana, por esas

cervecitas en “o quiosque” y por las cenas en la cocina rodeados de goteras.
ÍNDICE
RESUMEN……………………………………………………………………………………. i
ABSTRACT…………………………………………………………………………………... ii
1. Introducción…………………………………………………………………………….... 1
1.1 Respuesta de las plantas al estrés hídrico...…………….………………………. 5
1.1.1 Proteínas reguladoras en respuesta a estrés hídrico…...……………… 6
1.1.2 Proteínas funcionales implicadas en la tolerancia al estrés hídrico…... 9
1.2 El estudio de la respuesta al estrés hídrico en coníferas………………………. 10
1.2.1 Las especies modelo utilizadas en este trabajo………………………… 13
2. Objetivos………………………………………………………………………………...... 19
3. Identificación de genes inducidos por estrés hídrico……………………………. 23

3.1 Material y métodos…………………………………………………………………. 26
3.1.1 Material vegetal y condiciones de cultivo………………………………… 26
3.1.2 Tratamiento de estrés hídrico……………………………………………... 27
3.1.3 Extracción de ARN y construcción de la genoteca sustractiva………... 27
3.1.4 Preselección de genes inducidos……………..………………………...... 28
3.1.5 Análisis de secuencias……………………………………………………... 28
3.2 Resultados y discusión…………………………………………………………….. 29
3.2.1 Construcción de la genoteca sustractiva………………………………… 29
3.2.2 Anotación y clasificación funcional de los genes obtenidos…………… 30
4. Análisis de expresión durante el estrés hídrico…………………………………… 37

4.1.2 Tratamiento de estrés hídrico en sustrato……………………………...... 40
4.1.3 Tratamiento de estrés hídrico con PEG………………………………….. 40
4.1.4 Análisis de expresión con microarray…………………………………..... 40
4.1.5 PCR a tiempo real………………………………………………………….. 41
4.1.6 Análisis de datos……………………………………………………………. 42
4.1.6.1 Normalización e identificación de genes inducidos…………….. 42
4.1.6.2 Expresión diferencial entre órganos y especies……………....... 42
4.1.6.3 Análisis funcional…………………………………………………... 43
4.2 Resultados y discusión……………………………………………………………... 43
4.2.1 Análisis de la expresión de los genes durante el tratamiento de PEG.. 43
4.2.2 Tratamiento de sequía en sustrato sólido………………………………... 52
4.2.2.1 Genes inducidos por la suspensión de riego en P. pinaster y
P. pinea……………………………………………………………… 52
4.2.2.2 Patrón de expresión en respuesta a sequía en P. pinaster y
P. pinea……………………………………………………………… 59
5. Caracterización molecular de la familia de las deshidrinas en P. pinaster..…. 71

5.1.1 Material vegetal y tratamiento de estrés hídrico………………………… 75
5.1.3 Extracción de ADN y ARN y amplificación de los genes completos….. 76
5.1.4 PCR a tiempo real………………………………………………………….. 76
5.1.5 Análisis estadístico…………………………………………………………. 76
5.2.1 Búsqueda de deshidrinas in silico y amplificación de genes
completos……………………………………………………………………. 77
5.2.2 Identificación de nuevos segmentos conservados……………………… 78
5.2.3 Análisis de la estructura de las deshidrinas de P. pinaster...………….. 79
5.2.4 Análisis de la expresión por RT-PCR…………………………………….. 82
6. Caracterización molecular de genes inducidos por estrés hídrico en

P. pinaster..……………………………………………………………………………….. 87
6.1.1 Amplificación de los genes completos y de la su promotora…………... 92
6.1.3 Construcción del vector de sobreexpresión……………………………… 93
6.1.4.1 Arabidopsis thaliana……………………………………………….. 94
6.1.4.2 Células embrionárias de Pinus pinaster…………………………. 94
6.1.5 Transformación genética mediada por Agrobacterium tumefaciens….. 94
6.1.5.1 Transformación de Arabidopsis thaliana………………………… 94
6.1.5.2 Transformación de células embrionarias de Pinus pinaster…... 95
6.2.1 Análisis de la secuencias………………………………………………….. 95
6.2.1.1 Ppter_dhn_ESK2 …………………………………………………... 95
6.2.1.2 Nodulina…………………………………………………………….. 97
6.2.1.3 Factor de transcripción tipo AP2………………………………..... 101
6.2.2 Transformación de Arabidopsis thaliana……………………………........ 105
6.2.3 Transformación de Pinus pinaster……………………………………....... 106
7. Conclusiones/Conclusions…………………………………………………………..... 113
8. Bibliografía……………………………………………………………………………….. 117
ANEXOS……………………………………………………………………………………… 137
I. Aranda I., Gil-Pelegrín E., Gascó A., Guevara M.A., Cano J., de Miguel M.,
Ramírez-Valiente J.A., Peguero-Pina J.J., Perdiguero P., Soto Á., Cervera M.T.,
Collada C. 2012. Drought response in forest trees: from the species to the gene.
En Ricardo Aroca (Ed): Plant Responses to Drought Stress: From Morphological
to Molecular Features (2012) 293-333. Springer.
II. Fernández-Pozo N., Canales J., Guerrero-Fernández D., Villalobos D., Díaz-
Moreno S., Bautista R., Flores-Monterroso A., Guevara M.A., Perdiguero P.,
Collada C., Cervera M.T., Soto Á., Ordás R., Cantón F., Ávila C., Cánovas F.,
Claros M.G., EuroPineDB: a high-coverage Web database for maritime pine
transcriptome, BMC Genomics 12 (2011) 366.
III. Perdiguero P., Collada C., Barbero M.C., García Casado G., Cervera M.T.,
Soto Á., Identification of water stress genes in Pinus pinaster Ait. by controlled
progressive stress and suppression-subtractive hybridization, Plant Physiology
and Biochemistry 50 (2012) 44-53.
IV. Perdiguero P., Barbero M.C., García Casado G., Cervera M.T., Collada C.,
Soto Á., Molecular response to water stress in two contrasting Mediterranean
pines (Pinus pinaster and Pinus pinea). Manuscrito
V. Perdiguero P., Barbero M.C., Cervera M.T., Soto Á., Collada C., Novel
conserved segments are associated with differential expression patterns for
Pinaceae dehydrins, Planta 236 (2012) 1863-1874.
ÍNDICE DE FIGURAS
Figura 1.1 Predicciones climáticas en Europa para los años 2070-2100………….. 4

Figura 1.2 Respuestas de las plantas al estrés hídrico……………………………… 7
Figura 1.3 Área de distribución de Pinus Pinaster……………………………………. 14
Figura 1.4 Área de distribución de Pinus pinea………………………………………. 15
Figura 3.1 Banco clonal de P. pinaster del SERIDA...……………………………….. 26
Figura 3.2 Esquema del tratamiento de estrés hídrico aplicado……………………. 27
Figura 3.3 Amplificación de los clones de la genoteca sustractiva…………………. 29
Figura 3.4 Preselección de clones inducidos….……………………………………… 30
Figura 3.5 Clasificación funcional de los genes obtenidos en la genoteca
sustractiva…………………………………………………………………………………. 31
Figura 4.1 Número de transcritos sobreexpresados de manera significativa en
cada órgano estudiado durante el tratamiento de sequía inducida con PEG……… 44
Figura 4.2 Análisis de enriquecimiento de aquellos genes identificados
específicamente durante el tratamiento de PEG……………………………………… 45
Figura 4.3 Patrones de expresión de los genes sobreexpresados a lo largo del
tratamiento de PEG………………………………………………………………………. 46
Figura 4.4 RT-PCR de diez genes inducidos en el tratamiento de PEG…………... 50
Figura 4.5 Potencial hídrico medido al mediodía en acícula a lo largo del
experimento de sequía con P. pinaster y P. pinea……………………………………. 52
cada órgano estudiado durante el tratamiento de sequía en sustrato con
P. pinea..…………………………………………………………………………………… 53
cada órgano estudiado durante el tratamiento de sequía en sustrato con
P. pinaster…….......................................................................................................... 54
ambas especies para un mismo órgano ………………………………………………. 54
Figura 4.9 Análisis de enriquecimiento de los genes candidatos seleccionados…. 55
Figura 4.10 Clasificación funcional de los genes seleccionados como candidatos
para estrés hídrico en pinos……………………………………………………………... 55
cada tratamiento de sequía aplicado…………………………………………………… 59
tratamiento de P. pinaster en sustrato sólido..………………………………………… 60
tratamiento de P. pinea en sustrato sólido…..………………………………………… 63
Figura 4.14 RT-PCR de los 16 genes seleccionados para los tratamientos de
estrés hídrico con P. pinaster y P. pinea.………………………………………………. 66
Figura 5.1 TCs correspondientes a posibles deshidrinas de Pinus sp. agrupadas
de acuerdo con el número de segmentos conservados……………………………… 77
Figura 5.2 Alineamiento de la secuencia de aminoácidos deducida para las 8
deshidrinas identificadas en P. pinaster…..……………………………………………. 79
Figura 5.3 Productos de PCR correspondientes a los diferentes loci de
Ppter_dhn_K2 y Ppter_dhn_SK3 amplificados mediante ADN genómico haploide
de megagametofito……………………………………………………………………….. 80
Figura 5.4 Análisis de la expresión por RT-PCR de las ocho deshidrinas
identificadas en P. pinaster…...…………………………………………………………. 83
Figura 6.1 Vector de sobreexpresión pK7WG2.0 utilizado en la transformación
de Arabidopsis thaliana…………………………………………………………………... 93
Figura 6.2 Vector de sobreexpresión pMBb7Fm21GW-UBIL utilizado en la
transformación de Pinus pinaster……………………………………………………….. 93
Figura 6.3 Estructura de la deshidrinas Ppter_dhn_ESK2…………………………... 96
Figura 6.4 Secuencia de nucleótidos correspondiente al gen completo y región
promotora de la deshidrina Ppter_dhn_ESK2 y secuencia de aminoácidos
deducida para la misma………………………………………………………………….. 96
Figura 6.5 Alineamiento de la secuencia de aminoácidos de la nodulina con
genes homólogos en otras especies (transportadores de azucares tipo Sweets)… 98
Figura 6.6 Estructura del gen de la nodulina………………………………………….. 99
promotora de la nodulina y secuencia de aminoácidos deducida para el
mismo…………………………………………………………………………………........ 100
Figura 6.8 Alineamiento de la secuencia de aminoácidos del factor de
transcripción tipo AP2 frente a genes homólogos en otras especies,
correspondientes a la familia ERF………………………………...……………………. 102
promotora del factor de transcripción tipo AP2 y secuencia de aminoácidos
deducida para el mismo………………………………………………………………….. 104
Figura 6.10 Plantas de Arabidopsis transformadas con diferentes genes
correspondientes a la primera generación t0…………………………………………... 105
Figura 6.11 Plantas de Arabidopsis correspondientes a la generación t2 y
comprobación de la transformación por PCR …………………………………..…….. 106
Figura 6.12 Comprobación por PCR de la colonia de Agrobacterium empleada
en la transformación……………………………………………………………............... 107
Figura 6.13 Selección de líneas transformantes con crecimiento visible en medio
selectivo con PPT………………………………………………………………………… 108
Figura 6.14 Proliferación de líneas transformantes…………………………………... 108
Figura 6.15 Comprobación por PCR de las líneas transformantes………………… 109
Figura 6.16 Obtención de falsos positivos…………………………………………….. 110
Figura 6.17 Maduración y germinación de las líneas transformantes……………… 111
ÍNDICE DE TABLAS
Tabla 5.1 Descripción de las deshidrinas de P. pinaster analizadas en la

presente tesis……………………………………………………………………………... 81
Tabla 6.1 Selección de líneas transformantes con crecimiento en medio de
selección con PPT………………………………………………………………………... 107
Tabla 6.2 Líneas transformantes que fueron transferidas a medio de
proliferación……………………………………………………………………………….. 109
Tabla 6.3 Maduración de las líneas transformantes seleccionadas………………… 110
ÍNDICE MATERIAL SUPLEMENTARIO
Tabla S1. Correspondencia entre los distintos identificadores para los 351
unigenes nucleares identificados en la genoteca sustractiva………………………... MS-3
Tabla S2. Clasificación funcional de los 351 unigenes nucleares identificado en
la librería sustractiva en base a su homología con proteínas de Arabidopsis
thaliana…………………………………………………………………………………….. MS-8
Tabla S3. Términos GO y EC asociados con los unigenes identificados………….. MS-14
Tabla S4. Valores de expresión del experimento de P. pinaster con PEG...……… MS-35
Tabla S5. Valores de expresión del experimento de P. pinea en sustrato
sólido……………………………………………………………………………………….. MS-40
Tabla S6. Valores de expresión del experimento de P. pinaster en sustrato
sólido……………………………………………………………………………………….. MS-45
Tabla S7. Selección de 113 genes candidatos sobreexpresados de manera
significativa en ambas especies y para el mismo órgano/s………………………….. MS-51
Tabla S8: Combinaciones de cebadores empleados en las distintas actividades
desarrolladas en la tesis doctoral……………………………………………………….. MS-53
Tabla S9. Motivos de unión para diferentes factores de transcripción identificados
en las regiones promotoras de los genes de estudio…………………………………. MS-55
Tabla S10. Generación de líneas transformantes de Arabidopsis thaliana con el 偐MS-
gen de la nodulina………………………………………………………………………... MS-57
Tabla S11. Generación de líneas transformantes de Arabidopsis thaliana con el
factor de transcripción AP2……………………………………………………………… MS-58
Tabla S12. Generación de líneas transformantes de Arabidopsis thaliana con
Ppter_dhn_ESK2………………………………………………………………………..... MS-59
Figura S1. Alineamiento de las deshidrinas identificadas en P. pinaster frente a
otras de gimnospermas y angiospermas disponibles en las bases de datos
públicas…………………………………………………………………………………….. MS-60
RESUMEN
La presente tesis doctoral se centra en el estudio de la respuesta molecular de

las coníferas mediterráneas al estrés hídrico. Para ello se ha escogido como especie
modelo Pinus pinaster Ait., la conífera más abundante en España, y que habita un
amplio rango de situaciones ecológicas, especialmente en lo relativo a la disponibilidad
de agua.
En primer lugar, se ha aplicado un estrés hídrico controlado en cultivo

hidropónico y se ha generando una genoteca sustractiva con objeto de identificar los
genes inducidos por el estrés, analizando su expresión en raíces, tallos y acículas.
A continuación, se ha analizado, la expresión de los genes anteriormente

obtenidos así como de otros seleccionados de las bases de datos disponibles, durante
una sequía prolongada en tierra, similar a las que las plantas deben afrontar en la
naturaleza. Se ha utilizado en este caso, además de P. pinaster, P. pinea, otra
conífera mediterránea adaptada a las sequías recurrentes. Este trabajo ha permitido
identificar genes candidato expresionales, presumiblemente comunes en la respuesta
molecular de las coníferas al déficit hídrico. Se han detectado diferencias notables en
la expresión de determinados genes, que podrían ser los responsables de las
diferencias exhibidas por ambas especies en el comportamiento frente a la sequía.
Entre los genes identificados como inducidos por el estrés hídrico se encuentran
varios miembros de la familia de las deshidrinas. Trabajos previos han utilizado
deshidrinas como genes candidato; no obstante, la falta de especificidad de ciertos
fragmentos y marcadores utilizados, debido a la complejidad estructural de esta
familia, resta fiabilidad a algunos de los resultados publicados. Por este motivo, se ha
estudiado en detalle esta familia en P. pinaster, se han identificado y caracterizado 8
miembros y se ha analizado su patrón de expresión frente a sequía. Este estudio ha
permitido describir por primera vez unos segmentos conservados en la secuencia de
aminoácidos de las deshidrinas de pináceas, cuya presencia y número de repeticiones
parece estar relacionado con su especificidad.
Por último, se han escogido tres genes implicados en distintas fases de la

respuesta al estrés hídrico para su análisis exhaustivo: una deshidrina, una nodulina y
un factor de transcripción tipo AP2. Se ha caracterizado su estructura exón/intrón y
secuenciado su región promotora. Además, se han obtenido líneas transformadas que
sobreexpresan estos genes tanto de forma heteróloga, en la especie modelo
Arabidopsis thaliana, como en el propio P. pinaster. Este material facilitará la
realización de futuros estudios sobre la función y el mecanismo de actuación de estos
genes en la respuesta al estrés hídrico.
i
ABSTRACT
This thesis focuses in the study of the molecular response to water stress in
Mediterranean conifers. For this purpose, P. pinaster was selected as model species.
It’s the most abundant conifer in Spain, living in a wide range of ecological conditions,
especially regarding water availability.
First, we have applied a controlled polyethylene glycol-induced water stress in

hydroponic culture and obtained a suppression subtractive hybridization (SSH) library,
with the aim of identifying genes induced by water stress, analysing their expression in
roots, stems and needles.
We have then analysed the expression patterns of the identified genes, together
with other genes selected from public databases. This study was conducted throughout
a prolonged drought stress in soil, similar to the ones plants have to face in nature. In
this case not only P. pinaster was analysed but also P. pinea, another Mediterranean
conifer well adapted to recurrent droughts. This work has enabled us to identify of
reliable candidate genes, presumably shared with other conifers in the response to
water stress. We observed remarkable differences in the expression of some genes,
which could be involved in the differential behaviour that these species show in the
water stress response.
Within the genes induced by water stress, several members of the dehydrin gene
family were identified. Due to the structural complexity of the family, certain ambiguities
and inconsistencies have been detected in previous works that have used dehydrins as
candidate genes. For this reason, we have analysed thoroughly this gene family in P.
pinaster, and have identified and characterized eight different members, whose
expression patterns during drought have also been assessed. This study has allowed
us to identify for the first time novel conserved segments in the amino acids sequences
of Pinaceae. The presence and number of repetitions of these segments could be
associated with the functional specificity of these proteins.
Finally, three genes involved in different steps of the water stress response were
selected for an exhaustive analysis: a dehydrin, a nodulin and an AP2 transcription
factor. For all of them, the exon/intron structure was established and their promoter
region was sequenced. Also, transformed lines were obtained both in Arabidopsis
thaliana and in P. pinaster for the constitutive overexpression of these genes. This
material will facilitate the development of further studies to investigate the function of
these genes during the water stress response.
ii
1. INTRODUCCIÓN
Introducción
1. INTRODUCCIÓN
A lo largo de la evolución y diversificación de las plantas vasculares desde su

aparición en el Silúrico (hace 420 millones de años) la adaptación a ambientes secos
ha sido sin duda una de las condiciones que ha ejercido mayor presión selectiva. El
paso del hábitat acuático al terrestre fue asociado al desarrollo de un complejo abanico
de adaptaciones anatómicas y moleculares tanto para la adquisición y transporte del
agua como para hacer frente a la pérdida de la misma hacia una atmósfera insaturada.
Algunas de estas adaptaciones tienen un carácter constitutivo, mientras que otras se
inducen como mecanismos de emergencia para hacer frente a los periodos de sequía.
Estas adaptaciones presentan mayor relevancia en especies perennes, que tienen que
hacer frente a la escasez de agua en numerosas ocasiones a lo largo de su ciclo de
vida.
En la actualidad la Tierra vuelve a enfrentarse a un importante cambio climático

a nivel global. Durante el siglo pasado ya se observaron importantes modificaciones
sobre la mayoría de parámetros meteorológicos, con el aumento de la temperatura
media mundial del aire y del océano, la fusión incrementada de nieves y hielos y el
aumento medio del nivel del mar. Este calentamiento se ve especialmente agravado
por el aumento de los gases de efecto invernadero (CO2, CH4 y N2O) de origen
antrópico así como por la deforestación de montes y bosques para convertirlos en
tierras de cultivo y pastoreo. Según diferentes modelos climáticos este cambio global
será especialmente intenso en regiones concretas del planeta, como el arco
mediterráneo (IPCC, 2007).
Según el informe Clivar España 2010 (Pérez et al., 2010), ya los registros
instrumentales del siglo XX muestran un aumento progresivo de la temperatura que
fue especialmente acusado en las tres últimas décadas cuando se registró una tasa
media de calentamiento de ~0,5ºC/década (un 50% superior a la media continental en
el Hemisferio Norte y casi el triple de la media global). Igualmente, la precipitación
anual en las dos últimas décadas disminuyó de forma significativa en relación a las
décadas de los 60 y 70, especialmente a finales de invierno. La mayoría de las
predicciones muestran un incremento en las temperaturas medias diarias de
aproximadamente 3º- 5.5ºC en invierno y verano respectivamente. Los cambios en la
precipitación estacional mostrarían una estructura norte-sur en invierno, con aumentos
3
Genes implicados en la respuesta molecular a estrés hídrico en Pinus pinaster Ait.
ligeros en la mitad norte y descensos en la parte sur, mientras que en verano

pronostican un descenso significativo en toda la Península Ibérica (Figura 1.1).
Figura 1.1 Predicciones climáticas en Europa para los años 2070-2100. Se muestra a la izquierda la
predicción sobre el incremento de las temperaturas medias anuales. A la derecha los cambios en la
precipitación media de los meses de verano en %. (Fuente; Plataforma europea de adaptación al clima)
Las especies mediterráneas deben afrontar la dificultad añadida que supone la

coincidencia del período más favorable para la actividad fisiológica en cuanto a luz y
temperatura con el de máxima restricción hídrica. Por consiguiente, la creciente sequía
que sufren los ecosistemas que integran el suroeste europeo limitará el crecimiento y
probablemente la supervivencia de las actuales poblaciones naturales y
reforestaciones pudiendo provocar una importante simplificación estructural de la
vegetación acompañada de migraciones altitudinales de especies así como
extinciones locales (Mestre y de Cara, 2009).
Si el cambio del clima es tan rápido como se espera los seres vivos más
longevos, entre ellos los árboles, estarán obligados a hacer frente a las condiciones
adversas con sus estructuras genéticas actuales, sin tiempo disponible para que los
procesos selectivos permitan la definición de otras estructuras adaptadas a las nuevas
condiciones ambientales (Jump y Peñuelas, 2005). Ante estas predicciones y debido a
la importancia de las especies forestales desde un punto de vista de conservación, uso
sostenible y productividad, se están realizando grandes esfuerzos para conocer los
mecanismos tanto moleculares como fisiológicos de adaptación a la sequía a todos los
4
Introducción
niveles, desde las poblaciones en su conjunto hasta la función de un gen concreto

(Anexo I).
1.1 Respuesta de las plantas al estrés hídrico
El agua es el principal factor limitante para el crecimiento y la reproducción de

las plantas, y el déficit hídrico puede suponer un grave riesgo para el equilibrio
homeostático, alterando el metabolismo; aumenta la producción de radicales libres y
especies reactivas del oxígeno (reactive oxygen species, ROS), tales como iones
oxígeno, superóxido y peróxidos, que pueden dañar las membranas celulares,
especialmente la maquinaria fotosintética, así como el ADN, llegando incluso a
suponer un serio riesgo para la propia supervivencia de la planta. Las plantas a lo
largo de la evolución han desarrollado tres diferentes estrategias que han permitido la
supervivencia ante las sucesivas sequías (Valladares et al., 2004). Así una primera
estrategia sería la elusiva o de escape, mediante la cual las plantas completarían su
ciclo vital antes de la llegada del estrés hídrico, pasando el período desfavorable en
forma de semilla. Otra estrategia sería la de tolerancia del estrés: un conjunto de
modificaciones fisiológicas permiten a estos individuos soportar un notable grado de
deshidratación de los tejidos, protegiendo de manera eficaz sus estructuras celulares o
reconstruyéndolas una vez restablecidos los niveles hídricos apropiados. Es el caso de
las conocidas como “plantas resurrección” (pertenecientes a géneros como
Craterostigma, Eragrostis, Myrothamnus, Selaginella, Sporobolus, o Xerophyta),
propias de territorios extremadamente áridos. Sin embargo, la estrategia más común, y
a partir de la cual presumiblemente evolucionaron las otras dos (Levitt, 1980), es la
denominada evitadora. En este caso las plantas previenen o minimizan la penetración
del estrés en sus tejidos, maximizando la absorción de agua (por ejemplo mediante
sistemas radicales profundos) y/o minimizando las pérdidas de agua (por ejemplo con
un rápido cierre de estomas). Estas tres estrategias no son excluyentes las unas de
las otras, y en la práctica las plantas suelen combinarlas (Ludlow, 1989); así, por
ejemplo, los mecanismos de tolerancia complementan los mecanismos evitadores en
las plantas resurrección, y se aprecian también mecanismos evitadores en plantas
anuales que eludirán la peor fase del estrés hídrico.
Las respuestas de las plantas al estrés son dinámicas y engloban una serie de
complejos mecanismos interconectados para la regulación a diferentes niveles,
incluyendo ajustes del metabolismo así como la expresión de genes implicados en la
adaptación fisiológica y morfológica (Farooq et al., 2009) (Figura 1.2). La identificación
5
de los caracteres genéticos responsables de los mecanismos de resistencia a sequía

en plantas resulta especialmente difícil debido a la complejidad de la variación de
factores climáticos, la diversidad de ambientes hidrológicos, las relaciones
establecidas entre el suelo y planta, la disponibilidad de nutrientes y las distintas
interacciones que se generan en cada ambiente. Además, otros factores que inciden
en la respuesta deben ser considerados, ya que la falta de agua puede estar asociada
a otros tipos de estrés, como el térmico o el salino.
Desde el punto de vista molecular, la respuesta al estrés hídrico incluye

numerosos mecanismos de control a distintos niveles como la regulación post-
transcripcional, post-traduccional o epigenética (Floris et al., 2009; Hirayama y
Shinozaki, 2010; Vaahtera y Brosché, 2011). Los productos génicos asociados a la
respuesta al estrés hídrico pueden clasificarse en dos grupos (Wang et al., 2003;
Shinozaki y Yamaguchi-Shinozaki, 2007): el primero incluye proteínas implicadas en
la regulación de la transducción de señales (proteínas reguladoras) y el segundo
engloba proteínas con diferentes funciones biológicas implicadas en la tolerancia al
estrés (proteínas funcionales).
1.1.1 Proteínas reguladoras en respuesta a estrés hídrico
Las proteínas reguladoras controlan la expresión génica y la transducción de

señal en respuesta al estrés; este grupo incluye factores de transcripción, quinasas y
fosfatasas y enzimas implicadas en el metabolismo de los fosfolípidos.
Los resultados de numerosos estudios desarrollados en especies modelo, todas

ellas angiospermas, describen una serie de etapas sucesivas que formarían la ruta
general de transducción en respuesta a un estrés abiótico. El primer paso corresponde
a la percepción de la señal, el cual sigue siendo el menos claro dado que aún no se
han identificado los sensores responsables de la misma. Posteriormente intervienen
mensajeros secundarios como el Ca++, ROS e inositol fosfatasas. Estos mensajeros
intermedios están involucrados en la regulación de los niveles de calcio en el
citoplasma celular, cuya perturbación cambia la conformación de proteínas sensoras
de calcio. Este cambio activa una cascada de fosforilación que finaliza con la
activación directa de genes de respuesta o con la activación de factores de
transcripción que a su vez regulan la expresión de genes de respuesta al estrés
(Huang et al., 2012).
6
Introducción
El estudio en especies modelo herbáceas ha permitido identificar al menos

cuatro rutas independientes de transducción de señal inducida por la sequía, cada una
de ellas mediada por un tipo de factor de transcripción (Figura 1.2);
Figura 1.2 Respuestas de las plantas al estrés hídrico. La parte superior representa un
esquema de la respuesta molecular de las plantas al estrés hídrico; se inicia con la percepción de
la señal y posterior activación de las distintas rutas de señalización. Estas finalizan con la expresión
de genes de respuesta al estrés implicados en las distintas respuestas metabólicas y fisiológicas.
[Adaptado de Valladares et al. (2004) y García y Capiati (2011)].
7
 Una primera ruta se caracteriza por la acción de los factores de transcripción tipo
DREB (“Drought response element binding factor”) que regulan aquellos genes
de respuesta poseen en sus promotores elementos DRE (“Dehydratation
Responsive Element”).
 En la segunda ruta intervienen factores de transcripción con dominios tipo NAC

(NAM, ATAF1, 2 y CUC2) así como los ZF-HD (Zinc finger homeodomain) que
actúan de forma generalmente conjunta.
 Una tercera ruta estaría regulada por factores de transcripción tipo bZIP “ABRE
binding protein” (AREB/ABF); se caracteriza por la presencia de genes que se
sobreexpresan en condiciones de sequía y salinidad, los cuales contienen en
sus promotores elementos de activación en cis ABRE (“ABA responsive
Element”).
 La cuarta ruta estaría regulada por la acción combinada de varios factores de

transcripción tipo MYC y MYB.
Otros tipos de factor de transcripción también han sido relacionados con

respuestas a estrés abiótico como los NF-Y (Nuclear factor Y) o los factores de
transcripción tipo WRKY pero aún no se han determinado las posibles rutas que
controlan (ver (Agarwal y Jha, 2009; Cramer et al., 2011; Fujita et al., 2011; Qin et al.,
2011; Huang et al., 2012) y referencias citadas en ellos). Las dos primeras rutas
descritas anteriormente son independientes de los niveles de ácido abcísico (ABA) en
la célula, mientras que las otras dos parecen estar reguladas por dichos niveles. Las
hormonas vegetales, especialmente el ABA, etileno y jasmonatos, varían sus niveles a
lo largo de la sequía y su presencia puede amplificar la señal inicial e incluso activar
nuevas rutas de respuesta (Vanková, 2010). La activación de las rutas podría ser
secuencial, iniciándose la activación de las rutas independientes de ABA como
respuesta rápida de emergencia; si el estrés hídrico se mantiene, la acumulación de
ABA endógeno provoca la activación de las rutas dependientes de ABA, comenzando
con el sistema bZIP/ABRE y por último la ruta que requiere la producción de las
proteínas MYB y MYC en respuesta a ABA. En todo caso las rutas descritas no
funcionan de forma independiente, sino que se han identificado numerosas
interacciones no sólo entre rutas dependientes e independientes de ABA, sino entre
rutas activadas por otros tipos de estrés tanto abiótico como biótico (Fujita et al.,
2006).
8
Introducción
1.1.2 Proteínas funcionales implicadas en la tolerancia al estrés hídrico
Encontramos en este grupo proteínas que actúan minimizando la deshidratación

o protegiendo las estructuras celulares de los efectos de ésta, como por ejemplo
enzimas implicadas en la biosíntesis y transporte de osmoprotectores, proteínas LEA,
chaperonas y enzimas de detoxificación (Oliver et al., 2010; dos Reis et al., 2012).
Osmoprotectores
Las plantas se enfrentan a la deshidratación mediante la producción y

acumulación de osmolitos lo que les permite realizar un ajuste osmótico y minimizar la
pérdida de agua y con ello la deshidratación de los tejidos. Muchos de los genes
activados durante la respuesta a estrés hídrico codifican enzimas que catalizan los
diferentes pasos en la biosíntesis de solutos compatibles. Los osmoprotectores
comúnmente acumulados durante la deshidratación corresponderían con aminoácidos
como prolina y GABA, aminas como poliaminas y glicin-betaínas, y azúcares como
fructanos, tri-rafinosa y almidón, mono y disacáridos (dos Reis et al., 2012; Krasensky
y Jonak, 2012). Otro grupo de genes directamente relacionados con los
osmoprotectores son aquéllos que codifican proteínas de membrana implicadas en el
transporte de los compuestos generados.
Proteínas LEA
Las proteínas LEA (Late Embryogenesis Abundant proteins) forman un

numeroso grupo identificado inicialmente durante los últimos pasos del desarrollo
embrionario, aunque en los últimos años se ha descrito una importante acumulación
de estos transcritos en tejidos vegetativos ante diferentes estreses ambientales.
Generalmente presentan bajos pesos moleculares y diferentes motivos conservados,
en muchas ocasiones con numerosas repeticiones a lo largo de la secuencia de
aminoácidos. Aunque no se conoce claramente su modo de acción durante
condiciones de sequía, está aceptado su papel como moléculas capaces de conferir
cierto grado de tolerancia a la deshidratación en las células de la planta. Se ha
demostrado su implicación en procesos como secuestro de iones y estabilización de
membranas plasmáticas así como de otras proteínas (Shih et al., 2008; Olvera-Carrillo
et al., 2011).
9
Chaperonas
Las chaperonas, dentro de las cuales encontramos las proteínas de choque

térmico (heat shock proteins, HSP) colaboran naturalmente en el plegado de otras
proteínas, uniéndose de forma reversible a las zonas desplegadas de los polipéptidos.
Evitan de este modo interacciones que conllevarían la adquisición de estructuras
tridimensionales incorrectas o incluso la formación de agregados insolubles. La
síntesis y acumulación de proteínas HSP juega un papel central en la respuesta y
tolerancia de las plantas ante diferentes estreses ambientales, ya que están
implicadas en el restablecimiento de la conformación nativa de las proteínas y con ello
de la homeostasis celular. (Wang et al., 2004; dos Reis et al., 2012).
Enzimas de detoxificación
La disminución en los niveles intracelulares de CO2 da lugar a una

sobrereducción de los componentes de la cadena de transporte electrónico generando
ROS. Estos compuestos, como se mencionó anteriormente, son una parte importante
en la respuesta a estrés hídrico ya que pueden actuar como mensajeros secundarios
en la transducción de la señal de respuesta. Sin embargo pueden llegar a niveles
tóxicos para la planta y deben ser eliminados para evitar que afecten al correcto
funcionamiento de algunas enzimas como por ejemplo las de la maquinaria
fotosintética. Los niveles de transcrito de algunos antioxidantes como catalasas,
superoxido dismutasas o del ciclo ascorbato-glutatión aumentan durante el déficit
hídrico protegiendo la célula de la oxidación producida por ROS (Oliver et al., 2010).
1.2 El estudio de la respuesta al estrés hídrico en coníferas
Desde el año 2000 se han logrado importantes avances en el conocimiento de

los mecanismos por los cuales las plantas controlan distintos caracteres de interés,
debido en gran parte a la mejora de las técnicas de secuenciación de DNA y la
obtención a raíz de ello de genomas completos de diferentes plantas; la primera
especie vegetal secuenciada fue Arabidopsis thaliana (Lin et al., 1999; Mayer et al.,
1999; Salanoubat et al., 2000; Tabata et al., 2000; Theologis et al., 2000), seguida por
Oryza sativa (Goff et al., 2002; Yu et al., 2002), y Vitis vinífera (Velasco et al., 2007),
siendo Populus trichocarpa la primera especie forestal secuenciada por completo
(Tuskan et al., 2006).
10
Introducción
En los últimos años se ha producido una nueva revolución en las técnicas de

secuenciación, tras la aparición de los secuenciadores de segunda generación y de
las nuevas plataformas de secuenciación 454-FLX (Roche), SOLiD (Applied
Byosistem), Illumina (Solexa) e Ion Torrent (Life Tecnologies). La mayor ventaja de
estas técnicas es que a partir de una única muestra de ADNc se puede obtener una
robusta colección de secuencias consenso para genes completos con una buena
proporción de transcritos poco representados. Los primeros resultados de estas
técnicas de secuenciación empiezan a incorporarse a la información obtenida durante
la última década mediante métodos tradicionales de secuenciación. Recientemente se
han desarrollado los denominados secuenciadores de tercera generación, basados en
la secuenciación de una única molécula de ADN., con los que se prevé la obtención de
secuencias altamente fiables con un menor coste, lo que se traducirá en la
disponibilidad de numerosas secuencias para un número mayor de especies.
Sin embargo, la complejidad del genoma de las coníferas, especialmente de las

pináceas, con un elevado porcentaje de secuencias altamente repetitivas y con un
gran tamaño (28.9 pg/C para P. pinaster y 28.6 pg/C para P. pinea (Zonneveld, 2012),
que equivale a más de 100 veces el genoma de Arabidopsis y más de tres veces el
humano) continúa dificultando la obtención del genoma completo de una especie
modelo de esta división.
Por este motivo, la mayor parte de los proyectos de genómica desarrollados

hasta fechas recientes en coníferas se han encaminado a la caracterización del
transcriptoma; la obtención de numerosas ESTs (Expressed Sequenced Tags) se
presentó como una eficiente aproximación para la caracterización de parte del
genoma, contribuyendo rápidamente al conocimiento de caracteres de interés en la
especie estudiada, así como a la obtención de nuevas herramientas moleculares para
la mejora genética (Kirst et al., 2003). El número de ESTs de gimnospermas ha ido
aumentando de manera considerable hasta alcanzar 1.204.091 secuencias en las
bases de datos del GenBank (3 de Diciembre de 2012) de las cuales casi el 89%
pertenecen a la familia de las pináceas. Centrándonos en las especies estudiadas en
esta tesis, el número de ESTs de P. pinaster alcanza 34.911 mientras que únicamente
han sido depositadas 327 secuencias de P. pinea, lo que demuestra el escaso
conocimiento genómico sobre esta especie.
La gran cantidad de información redundante observada entre las secuencias

hace necesario un procesado de las mismas; se han habilitado diferentes bases de
11
datos que emplean distintas técnicas de alineamiento para obtener una secuencia
consenso que represente cada gen. Entre ellas PlantGDB, (Duvick et al., 2008) hace
alineamientos individualizados por especie; en la última versión para Pinus pinaster
(177a del 25 de mayo de 2010) obtiene 15.648 posibles unigenes a partir de 35.139
ESTs empleadas en el alineamiento. Llama la atención el número de transcritos únicos
obtenidos en la última actualización de Pinus sylvestris (versión 187a, de 1 de febrero
de 2012): 73.609 unigenes desde 76.256 ESTs, frente a Pinus taeda (157a, de 1 de
febrero de 2007), para el que se obtuvo un número de unigenes ligeramente inferior,
72.829 pero a partir de 329.584 ESTs, lo que da una idea del alto grado de
redundancia en las genotecas obtenidas para esta especie.
Otra base de datos destacable es la PGI (Pine Gene Index database;

http://compbio.dfci.harvard.edu/tgi/plant.html) la cual contiene un catálogo de posibles
transcritos únicos para un género concreto a partir de una colección de ESTs de
diferentes. En la última actualización para Pinus sp (Pine 9.0, de 26 de marzo de 2011)
obtuvieron 77.195 genes únicos a partir de 452.256 ESTs, números muy similares a
los obtenidos para P. taeda en PlantGDB.
La base de datos EuroPineDB se centra en tres de las especies de mayor

importancia en el ámbito mediterráneo (P. pinaster, P. sylvestris y P. pinea) (Anexo II).
La especie con mayor peso en esta base de datos es P. pinaster que presenta
secuencias procedentes de distintos experimentos, entre ellas las producidas en la
presente tesis, e incluye los primeros resultados obtenidos mediante técnicas de
secuenciación masiva. Gracias a ello el número de secuencias válidas asciende
considerablemente hasta 877.523, de las que se obtienen 55.332 unigenes. Esta base
de datos incluye también dos genotecas de P. sylvestris que contienen 2466
secuencias de las que se obtienen 679 unigenes. P. pinea únicamente aporta 266
unigenes, obtenidos a partir de 306 ESTs empleadas en el alineamiento. EuroPineDB
ha evolucionado en los últimos años a una nueva base de datos, SustainPineDB, que
incorpora los resultados del proyecto europeo Sustainpine dedicado exclusivamente al
estudio de P. pinaster. La última versión de esta base de datos (SustainPineDB v.2.0,
del 16 de abril de 2012) incorpora numerosos resultados procedentes de
secuenciadores de segunda generación alcanzando 2.905.300 secuencias que dan
como resultado 92.478 unigenes para esta especie. Esto supone casi 77.000 unigenes
más que los obtenidos en PlantGDB a partir únicamente de las ESTs disponibles, lo
que da una idea de la importancia que empiezan a tener las técnicas de secuenciación
masiva en las investigaciones con coníferas.
12
Introducción
El rápido avance de las técnicas de secuenciación convierte la caracterización

funcional de los genes en el cuello de botella actual en la investigación molecular con
gimnospermas. Entre el 35 y el 40% de las secuencias contenidas en las bases de
datos no muestran homología con genes previamente descritos, y la anotación de
aquellos que presentan homología generalmente se basa en la información descrita
para angiospermas. Dado que angiospermas y gimnospermas divergieron hace 300
millones de años (Magallóan y Sanderson, 2005) muchos genes podrían estar
implicados en procesos diferentes a los descritos en especies modelo. Es por tanto
necesaria la utilización de gimnospermas como especies modelo para el estudio de la
actividad de muchos genes identificados en esta división.
1.2.1 Las especies modelo utilizadas en este trabajo
Con el objetivo de profundizar en el conocimiento de la respuesta molecular al

estrés hídrico en coníferas hemos escogido como especies de estudio dos pinos
mediterráneos, P. pinaster y P. pinea.
El pino rodeno, marítimo o negral, Pinus pinaster Aiton, se distribuye por la

cuenca occidental del Mediterráneo, costa atlántica de la Península Ibérica y suroeste
de Francia. En España es la conífera más abundante, ocupando más de 1.500.000 ha
debido, en gran medida, a su empleo en la reforestación de grandes superficies. De
hecho, algo más del 50% de la superficie ocupada serían el resultado de
repoblaciones llevadas a cabo entre los años 1940 y 1982 (Alía et al., 1995) mientras
que el resto corresponderían a poblaciones naturales (Alía y Martín, 2009). (Figura
1.3).
A pesar de presentar una distribución natural relativamente reducida, P. pinaster

presenta una elevada diversidad genética. A finales de los años ochenta se
identificaron hasta 18 razas geográficas en función de la composición en terpenos, que
quedaban agrupadas en tres grandes grupos: el atlántico, el mediterráneo occidental y
el magrebí (Baradat y Marpeau-Bezard, 1988). Estudios posteriores con marcadores
moleculares establecieron seis grandes grupos dentro de la especie: zona francesa
continental (Landas), Córcega, zona del noroeste y centro de España, zona sur de
España, Marruecos y Túnez (Bucci et al., 2007; Eveno et al., 2008).
13
Figura 1.3 Área de distribución de Pinus Pinaster (fuente; Euforgen)
Asociada a esta diversidad genética, P. pinaster muestra una gran valencia

ecológica, desarrollándose en una gran diversidad de suelos y condiciones
ambientales. Se encuentra en llanuras, regiones de costa y cadenas montañosas,
alcanzando altitudes de aproximadamente 2000 m (Gil et al., 1990; Alía et al., 1990,
1991 y 1996) . Es capaz de sobrevivir bajo condiciones ambientales muy severas,
mostrando una buena resistencia a la sequía y las heladas (Alía et al., 1996).
Por el contrario, el pino piñonero, Pinus pinea L., ocupa una mayor área de
distribución, a lo largo de toda la orla mediterránea (Figura 1.4). Sin embargo,
presenta una casi nula variabilidad genética, siendo un caso excepcional entre las
especies forestales. Así, no se han descrito razas geográficas, ecotipos o cultivares.
Los estudios con marcadores de ADN de cloroplasto (Vendramin et al., 2008) o
isoenzimas (Fallour et al., 1997) han confirmado esta virtual ausencia de diversidad.
El hábitat de ambas especies solapa en gran medida, si bien P. pinea suele

encontrarse en las zonas más cálidas, sometidas a sequías frecuentes, y sobre todo
en los suelos con menor capacidad de retención de agua. De hecho, los pinares de P.
pinea (puros o en mezcla con P. pinaster) están considerados como hábitat prioritario
para su conservación por la Directiva Hábitat europea (1992/43/CEE), y la especie se
utiliza ampliamente para la fijación de dunas, conservación de suelos y protección de
cultivos agrícolas en zonas costeras.
14
Introducción
Figura 1.4 Área de distribución de Pinus pinea (fuente; Euforgen)
Numerosos trabajos han estudiado el comportamiento hídrico de Pinus pinaster

en condiciones de sequía midiendo distintos parámetros ecosifiológicos, generalmente
en ensayos con diferentes procedencias adaptadas a ambientes contrastados y en
algunos casos en estudios intrapoblacionales (p. ej.(Hopkins, 1971; Alía et al., 1991;
Correia et al., 2008). Un proceso común observado durante los periodos de sequía es
la reducción de la tasa de crecimiento muchas veces acompañada de cambios en el
balance entre el crecimiento radicular y aéreo. En un estudio con plántulas de cuatro
meses de edad sometidas a una sequía prolongada se observó una clara correlación
entre el diámetro, la altura y la distribución de biomasa de las plantas (Fernández et
al., 2006). Se han descrito diferencias entre procedencias en cuanto al reparto de
biomasa raíz-tallo, encontrando la mayor inversión en biomasa de raíz para
procedencias del norte de África mientras que las procedencias españolas y francesas
mostraron mayor inversión en biomasa aérea (Aranda et al., 2010). Este amplio grado
de variación interpoblacional también se ha visto reflejado en otros caracteres como el
contenido hídrico de la planta y el intercambio gaseoso (Fernandez et al., 1999, 2000),
el ajuste osmótico (Nguyen-Queyrens y Bouchet-Lannat, 2003; Lopez et al., 2009), la
discriminación isotópica (Guehl et al., 1995; Correia et al., 2008; Aranda et al., 2010;
Corcuera et al., 2010) o el embolismo del xilema (Corcuera et al., 2011; Lamy et al.,
2011). En algunos casos se han observado diferencias significativas en algunos de
estos caracteres a escala intrapoblacional o incluso intrafamiliar (Sánchez-Gómez et
al., 2010; de Miguel et al., 2012).
15
A nivel molecular, P. pinaster ha sido empleada como especie modelo en

diversos estudios centrados en la respuesta al estrés hídrico (Costa et al., 1998;
Dubos y Plomion, 2001, 2003; Dubos et al., 2003). Varios trabajos han empleado
genes presumiblemente implicados en esta respuesta en estudios de diversidad
relacionados con los niveles de sequía. Por ejemplo, se ha analizado la variabilidad en
la secuencia de ADN de varios genes implicados en la respuesta a sequía en
diferentes poblaciones de P. pinaster a lo largo de un gradiente tanto latitudinal como
de precipitaciones (Eveno et al., 2008; Grivet et al., 2011). Igualmente se han
empleado otras metodologías como la cuantificación del nivel de determinadas
hormonas u osmolitos como la prolina, en la búsqueda de comportamientos
diferenciales entre procedencias de ambientes contrastados (Pedranzani et al., 2007;
Corcuera et al., 2012). Esta variación adaptativa hace de P. pinaster un material de
gran interés para el estudio de la respuesta al estrés hídrico.
Por el contrario, no conocemos ningún trabajo que aborde la respuesta de P.

pinea al estrés hídrico a nivel molecular e incluso la información acerca de su
comportamiento hídrico es bastante escasa. Estudios de germinación han concluido
que inducción por polietilenglicol de un estrés hídrico leve reduce al 70% el porcentaje
de germinación, inhibiéndose completamente a altas dosis de PEG (Muscolo et al.,
2007; Sidari et al., 2008), sugiriendo que una sequía prolongada podría provocar
serios problemas en la regeneración natural de la especie. Un estudio detallado del
reparto de biomasa durante un tratamiento de sequía con diferentes procedencias de
varios pinos mediterráneos, entre ellos P. pinea y P. pinaster, determinó una menor
variabilidad debida al tratamiento en el piñonero, que en ningún caso presentó
diferencias significativas entre procedencias a lo largo de la sequía, frente a P.
pinaster que fue la especie que presentó mayor variabilidad durante el estrés hídrico
con marcadas diferencias entre las procedencias estudiadas. A pesar de que P. pinea
no vio afectado su crecimiento durante el tratamiento de estrés, todas las
procedencias empleadas presentaron los valores más altos de plasticidad en el reparto
de biomasa frente al resto de especies (Chambel et al., 2007). Recientemente, un
estudio centrado en la variación entre clones de P. pinea en caracteres funcionales
relacionados con la sequía también ha señalado la elevada plasticidad fenotípica de la
especie en cuanto a eficacia intrínseca en el uso del agua, conductancia estomática y
tasa neta de fotosíntesis (Sánchez-Gómez et al., 2011).
16
Introducción
Lograr una adecuada comprensión de los mecanismos moleculares a través de

los cuales las plantas perciben y responden al estrés es vital para lograr un mayor
éxito en los programas de mejora genética de la resistencia frente a estas situaciones
y para la gestión apropiada de los recursos genéticos. Los pinos mediterráneos
constituyen un modelo especialmente relevante para el estudio de la respuesta al
estrés hídrico, tanto desde el punto de vista científico, como de cara a la gestión ante
unas condiciones ambientales de creciente xericidad.
17
2. OBJETIVOS
Objetivos
2. OBJETIVOS
El objetivo principal de este trabajo consiste en analizar la respuesta molecular a

estrés hídrico en pinos mediterráneos. Este objetivo general se divide en los siguientes
objetivos específicos;
1.- Identificación de genes inducidos en respuesta al estrés hídrico en plántulas

de P. pinaster Ait.
2.- Estudio del patrón de expresión durante el estrés hídrico en P. pinaster y P.

pinea de los genes previamente identificados
3.- Caracterización molecular de diferentes genes implicados en la respuesta a

estrés hídrico en P. pinaster.
21
3. IDENTIFICACIÓN DE GENES INDUCIDOS POR ESTRÉS HÍDRICO
Identificación de genes inducidos por estrés hídrico
A lo largo de la última década diferentes trabajos se han centrado en la

identificación de genes implicados en la respuesta a estrés hídrico en pinos,
especialmente en P. taeda, P. halepensis y P. pinaster.
Los primeros estudios con P. taeda (Chang et al., 1996; Lorenz et al., 2006) o
con P. halepensis (Sathyan et al., 2005) se basaron en la secuenciación de
fragmentos incluidos en genotecas de expresión (ESTs), a menudo obtenidas a partir
de raíces de plantas estresadas. Los primeros trabajos de identificación de genes de
respuesta a sequía en P. pinaster emplearon técnicas de proteómica: mediante
electroforesis bidimensional con geles de poliacrilamida Costa et al. (1996)
identificaron 38 spots diferenciales en plantas de dos años sometidas a sequía,
obteniendo secuencias parciales para 11 de ellas. Posteriormente, Dubos et al. (2003)
y Dubos y Plomion (2003) aplicaron la técnica cDNA-AFLP para identificar genes cuya
expresión estuviese alterada en acículas y raíces de plántulas sometidas a un estrés
hídrico suave. Este análisis reveló la existencia de 48 fragmentos con expresión
diferencial al compararlos con plántulas control. Todos estos trabajos se limitaban a un
único punto de muestreo y generalmente con un estrés leve, lo que podría simplificar
en exceso los resultados teniendo en cuenta la cantidad de rutas de respuesta
temprana y tardía que intervienen a lo largo de la respuesta a estrés hídrico.
En la presente parte del trabajo se empleó polietilenglicol (PEG) como agente

osmótico para inducir un estrés hídrico controlado en plantas de P. pinaster en cultivo
hidropónico. Se recogió material desde las primeras fases del estrés, con la intención
de identificar genes de respuesta rápida y con bajos niveles de inducción que pudieran
no haber sido detectados en los trabajos previos. Para la identificación de genes se
construyó una genoteca sustractiva, una metodología a priori más exhaustiva y fiable
que las empleadas anteriormente, y que estaba dando buenos resultados en otras
especies.
25
3.1 Material y métodos
3.1.1 Material vegetal y condiciones de cultivo
Para el desarrollo del experimento se empleó material del banco clonal del
SERIDA (Servicio Regional de Investigación y Desarrollo Agroalimentario del
Principado de Asturias, Grado) (Figura 3.1) de la procedencia Oria (Almería). Dicha
procedencia muestra un buen comportamiento en condiciones de déficit hídrico
(Sánchez-Salguero et al., 2010), coherente con la adaptación a las bajas e irregulares
precipitaciones, con frecuentes sequías, que se producen en esta zona del Sureste
peninsular. Considerando la variabilidad intrapoblacional observada en el
comportamiento frente a la sequía y con objeto de optimizar la detección de genes
inducidos por el estrés hídrico, se emplearon diez genotipos diferentes para la
construcción de la genoteca.
Las plantas crecieron en invernadero en condiciones controladas (24ºC día

/22ºC noche; 12/12 horas de fotoperiodo; humedad relativa del 60% de día y 80% de
noche) en cultivo hidropónico con una solución nutritiva (30 litros para 45 plantas; NPK
90:41:72 pH~6.5) debidamente aireada y renovada dos veces por semana.
Figura 3.1 Banco clonal de P. pinaster del SERIDA (Grado, Asturias)
26
3.1.2 Tratamiento de estrés hídrico
El estrés hídrico fue aplicado mediante la adición de polietilenglicol (PEG, PM

8000) en el medio de cultivo. Durante el primer día del tratamiento se cambió la
solución cada cuatro horas, disminuyendo cada vez en 0.4 MPa el potencial hídrico de
la solución. Tras el cuarto cambio de solución se alcanzó un potencial hídrico de -
1.6MPa, que se mantuvo hasta el final del tratamiento. Se cosechó una planta de cada
genotipo una hora después de cada cambio de solución (muestras S1-S4) así como a
las 24 horas (S5), 48 horas (S6), 10 días (S7) y 21 días (S8) desde el inicio del
tratamiento (Figura 3.2) . Como control se recogieron plantas de cada genotipo
mantenidas sin PEG. Las raíces, tallos y acículas de cada planta fueron procesadas
de manera independiente, congeladas inmediatamente en nitrógeno líquido y
guardadas a -80ºC.
Potencial hídrico (MPa)
Figura 3.2 Esquema del tratamiento de estrés hídrico aplicado. Se muestran los
puntos de muestreo así como los cambios de solución realizados.
3.1.3 Extracción de ARN y construcción de la genoteca sustractiva
La extracción de ARN total se realizó de manera independiente para cada

órgano (raíz, tallo y acícula) y cada planta muestreada, siguiendo el protocolo descrito
por Chang et al. (1993). Se mezclaron cantidades equivalentes de ARN de cada
órgano y punto de muestreo y se obtuvo ADNc mediante el “Super SMARTTM PCR
ADNc Synthesis Kit” (Clontech, CA, USA). Se construyeron dos colecciones de ADNc
utilizando el “PCR-SelectTM Subtraction kit” (Clontech, CA, USA): una enriquecida en
27
genes que se inducen y otra enriquecida en genes que se reprimen durante el estrés.
La muestra enriquecida en genes inducidos por el estrés fue amplificada mediante
PCR, ligadas en el vector pGEM®-T easy (Promega, WI, USA) y transferidas a
Escherichia coli DH5α. Después de crecer estas bacterias en medio selectivo se
picaron de forma individualizada y se comprobó la presencia y tamaño de los insertos
por PCR.
3.1.4 Preselección de genes inducidos
Una vez construida la genoteca sustractiva se utilizó el “PCR-SelectTM differential

screening kit” (Clontech, CA, USA) para realizar una selección inicial de los clones
positivos. Los productos de PCR correspondientes a cada clon fueron fijados sobre
membranas de nylon Hybond-N+ (GE Healthcare BioSciences, WI, USA). Se
generaron cuatro réplicas y cada una fue hibridada con una de las cuatro muestras
obtenidas durante la construcción de la genoteca (ADNc de plantas control, ADNc de
plantas estresadas, muestra enriquecida en ADNc de plantas control y muestra
enriquecida en ADNc de plantas estresadas). Se utilizó el “DIG DNA labelling and
detection Kit” (Roche, Basilea, Suiza) para el marcaje de las sondas con digoxigenina-
dUTP y la posterior detección. Las intensidades de la señales de hibridación fueron
cuantificadas mediante el analizador de imágenes “ChemiDocTMXRS System” (Bio-
Rad, CA, USA). Aquellos clones que presentaron una ratio de expresión mayor a 1.5
entre la muestra enriquecida en genes inducidos y el control fueron seleccionados
como expresados de manera diferencial y posteriormente secuenciados empleando el
analizador de DNA 3730 XL (Applied Biosystems; Life Technologies, CA, USA) de
Macrogen (Seúl, Corea).
3.1.5 Análisis de secuencias
Las secuencias obtenidas fueron procesadas eliminando posibles

contaminaciones, artefactos y secuencias correspondientes al vector. Posteriormente
se realizó un alineamiento para obtener los genes únicos, que fueron anotados según
la información contenida en las bases de datos del NCBI mediante los programas
BLASTN y BLASTX considerando significativos los e-valores inferiores a 10-05 para
más de 100 nucleótidos. Igualmente se realizó una anotación según las bases de
datos de Pinus y Picea del Gene Index Project (http://compbio.dfci.harvard.edu/cgi-
bin/tgi/Blast/index.cgi). La clasificación funcional de los genes se realizó de acuerdo a
las categorías establecidas para proteínas de Arabidopsis thaliana en la base de datos
28
FunCat (http://mips.helmholtz-muenchen.de/proj/funcatDB/) (Ruepp et al., 2004).

Asimismo, se empleó el programa Blast2GO (Conesa et al., 2005) para identificar los
términos GO (Gene Ontology) asociados a los genes identificados.
3.2 Resultados y discusión
3.2.1 Construcción de la genoteca sustractiva
Aunque los resultados previos de Watkinson et al. (2003) y Lorenz et al.(2006)

muestran que la respuesta a sequía implica tanto la inducción como la inhibición de
genes, nuestro estudio se centró en la identificación de genes candidato
sobreexpresados en respuesta al estrés. Se cosecharon diferentes muestras a lo largo
del tratamiento en el que se aumentó de forma progresiva el grado de estrés hasta
alcanzar valores de severidad moderada que fueron mantenidos en el tiempo. Este
diseño experimental, que no había sido empleado en ningún trabajo anterior, estaba
dirigido a la identificación de genes implicados en diferentes patrones de respuesta
que podrían están iniciadas por diferentes niveles de estrés (Watkinson et al., 2003).
Empleando una mezcla de muestras cosechadas a lo largo del tratamiento se obtuvo
la genoteca de ADNc enriquecida en genes inducidos por el estrés.
Se picaron 4.940 colonias de E.coli que fueron transformadas con la muestra

enriquecida en genes de estrés y se amplificaron los insertos por PCR para comprobar
el tamaño y calidad de los mismos (Figura 3.3).
Figura 3.3 Amplificación de los clones de la genoteca sustractiva. Se

amplificaron por PCR los insertos incorporados en el vector pGEM-Teasy
(Promega). En la línea central se muestra el marcador 1 Kb DNA ladder (Invitrogen)
29
Posteriormente, se preseleccionaron 1718 clones presumiblemente inducidos

por estrés hídrico (Figura 3.4).
Exploración con ADNc sin enriquecimiento
Exploración con ADNc enriquecido
Figura 3.4 Preselección de clones inducidos. Se seleccionaron aquellos clones que

presentaban en la muestra enriquecida una señal al menos 1.5 veces superior a la
correspondiente al ADNc de las plantas control.
3.2.2 Anotación y clasificación funcional de los genes obtenidos
Se secuenciaron los 1718 clones preseleccionados, de los que se obtuvieron

1099 secuencias válidas tras eliminar secuencias contaminantes o de baja calidad. Se
obtuvieron 386 unigenes tras realizar el ensamblaje de las secuencias. Utilizando su
secuencia de nucleótidos y la secuencia de aminoácidos obtenida en su traducción se
llevó a cabo una búsqueda de homología en las bases de datos no redundantes de
ácidos nucleicos (ADN) y de proteínas del NCBI y en las bases de datos de pino y
pícea del Gene Index. De los 386 unigenes, 351 fueron considerados nucleares y 35
mostraron homología con secuencias procedentes de ADN de plastidios celulares.
De los 351 genes nucleares, 124 aparecen en otras colecciones de EST

obtenidas de pinos sometidos a estrés hídrico, mientras que 40 genes no mostraron
homología con ninguna secuencia procedente de pináceas. Respecto a la homología
30
con proteínas, las secuencias obtenidas para 170 genes no presentaron homología
con ninguna secuencia de aminoácidos (48% de los unigenes). Para incrementar la
anotación se realizó una asignación del posible gen completo (TC; Tentative
consensus sequence) presente en las bases de datos de pino y pícea del Gene Index,
identificador que se empleó durante las siguientes etapas de la tesis (Material
suplementario Tabla S1). Esta asociación redujo el número de genes sin homología
hasta el 17%, lo que demuestra la importancia de unificar la información depositada en
diferentes bases de datos. La secuencia de cada clon de la genoteca fue incluida en la
base de datos dedicada a pinos mediterráneos EuropineDB (Anexo II, Material
suplementario Tabla S1).
Las secuencias para las que se había obtenido una homología significativa
fueron clasificadas según las categorías funcionales de la base de datos FunCatDB
(Figura 3.5, Material suplementario Tabla S2) y se asociaron los términos GO (Gene
ontology) utilizando el programa Blast2GO (Material suplementario Tabla S3).
Figura 3.5 Clasificación funcional de los genes obtenidos en la genoteca sustractiva. En total,
351 unigenes fueron agrupados de acuerdo con las categorías funcionales establecidas en la base
datos FunCatDB para Arabidopsis thaliana. Se muestra el valor porcentual para cada grupo.
31
Genes implicados en metabolismo
El grupo más representado corresponde a genes involucrados en metabolismo.

Dentro de este grupo, el 42% corresponde a genes implicados en el metabolismo de
hidratos de carbono (hasta un 42%). La acumulación de azúcares en las células de la
planta durante periodos de sequía interviene en el ajuste osmótico, protegiendo a las
estructuras celulares del estrés, tanto mecánico como metabólico, producido durante
la deshidratación. Este mecanismo está relacionado con la adquisición de tolerancia a
estrés hídrico (Oliver et al., 2010). Muchos de los genes incorporados en este
subgrupo tienen homología con proteínas descritas previamente en respuesta a estrés
hídrico como α-galactosidasas (Hara et al., 2008), malato sintasa (Micheletto et al.,
2007), glicosiltransferasas (Wang y Hou, 2009) o quitinasas (Rabello et al., 2008). Otro
gen incluido en este grupo presenta homología con la aldehído deshidrogenasa. Este
enzima podría estar involucrado en la detoxificación de los aldehídos producidos
durante el metabolismo del etanol, y su sobreexpresión resulta coherente con la
acumulación de etanol en plántulas de coníferas sometidas a sequía descrita por
Manter y Kelsey (2008). La expresión heteróloga en plantas de tabaco de la aldehído-
deshidrogenasa de maíz ZmALDH22A1 confiere a las plantas transformadas una
elevada tolerancia al estrés (Huang et al., 2008).
El segundo subgrupo, con un 18%, corresponde al metabolismo de lípidos,

ácidos grasos e isoprenoides. Estos genes podrían estar implicados en la síntesis de
hormonas vegetales que se acumulan en los tejidos mediando o intensificando las
rutas de señalización activadas durante el estrés hídrico. Los genes clasificados dentro
del metabolismo de aminoácidos alcanzan el 16%. Dentro del cuarto subgrupo (9%),
correspondiente al metabolismo secundario, aparecen algunos genes que presentan
homología con enzimas que también han sido relacionadas en estudios previos con la
respuesta a sequía. Así, la enzima ácido 12-oxofitodienoico reductasa (12-oxo-PDA
reductasa, OPR) se induce durante estrés osmótico en maíz y su expresión heteróloga
en plantas de Arabidopsis confiere resistencia al estrés osmótico y salino producido
durante la germinación de la semilla (Gu et al., 2008). También dentro de este grupo
se encuentra un gen homólogo a la ACC oxidasa, implicada en la respuesta mediada
por etileno y jasmonatos.
32
Genes implicados en la transducción de la señal
Aunque este grupo representa tan sólo el 2% del total, contiene genes que
presentan homología con proteínas de interés dentro de la transducción de la señal de
estrés hídrico. Por ejemplo, aparecen varias quinasas que podrían intervenir en la
activación de la cascada de fosforilación. Una de ellas tiene homología con una CBL-
interacting quinasa relacionada con la regulación de la transducción de la señal
mediada por calcio durante el estrés hídrico (Beck et al., 2007). Batistic y Kudla (2009)
sugirieron que estas proteínas podrían constituir un grupo único de sensores de calcio
característico de vegetales, interactuando de forma específica con un grupo de
quinasas tipo CIPKs. Otro gen incorporado en este grupo, una calmodulina, podría
estar igualmente implicada en la regulación de la transducción de la señal por calcio.
La sobreexpresión de una calmodulina de arroz en Arabidopsis produjo un incremento
de la tolerancia ante el estrés hídrico y salino, aumentando también la sensibilidad al
ABA de las plantas transformadas (Xu et al., 2012).
Factores de transcripción
Al menos tres genes presentan dominios característicos de los factores de

transcripción tipo AP2. Dos de ellos muestran homología con factores de transcripción
DREB, implicados en la respuesta a deshidratación independiente de ABA (Agarwal et
al., 2006) y cuya sobreexpresión puede incrementar la tolerancia al estrés hídrico
(Chen et al., 2007). El tercer factor de transcripción con dominio AP2 presenta
homología con la subfamilia ERF (Ethylene responsive factor). Aún se desconocen las
rutas de señalización de estos factores de transcripción, aunque se ha propuesto que
podrían participar en una ruta independiente y en otra dependiente de la presencia de
etileno (Mizoi et al., 2012). Otro gen incluido en este grupo presenta homología con un
factor de transcripción tipo NAC, una de las familias más numerosas de factores de
transcripción específicos de plantas, que también están involucrados en tolerancia a la
sequía (Tran et al., 2004) y podrían regular la segunda ruta independiente de ABA.
También se incluyeron en este grupo varios factores de transcripción tipo bZIP

que podrían estar involucrados en una de las rutas de señalización mediadas por ABA.
En cambio, no se encontró en la genoteca sustractiva ningún factor de transcripción
homólogo a un MYB o MYC, característicos de la otra ruta de señalización mediada
por ABA descrita en herbáceas. Otros genes agrupados como factores de
transcripción, como por ejemplo varios “Dead- box RNA helicasa” no se corresponden
33
con ninguna de las rutas previamente descritas pero sí han sido relacionados con la
respuesta a varios estreses (Rocak y Linder, 2004).
Genes implicados en transporte
Los mecanismos de transporte, actuando de manera coordinada con genes

relacionados con el metabolismo, pueden jugar un papel importante en la tolerancia a
la sequía, ayudando al ajuste osmótico a través de la movilización y acumulación de
hormonas y solutos compatibles, así como participando en mecanismos de
detoxificación celular que se suceden a lo largo del estrés. Se encuentra dentro de
este grupo un gen homólogo a un transportador de inositol que podría estar implicado
en el transporte de azúcares a través de las membranas. También dentro de este
grupo encontramos diferentes genes homólogos con transportadores tipo ABC que
están involucrados en la respuesta a diferentes estreses tanto bióticos como abióticos
(Wanke y Üner Kolukisaoglu, 2010).
Otros dos genes incluidos dentro de este grupo presentan homología con
proteínas de membrana del peroxisoma y podrían estar implicados en el
establecimiento del mecanismo de limpieza de las ROS acumuladas en el citoplasma
celular.
Genes de defensa y rescate celular
Dentro de este grupo se encuentran varios genes que presentan homología con
proteínas LEA, chaperonas o enzimas de detoxificación. Las proteínas LEA forman un
numeroso grupo con conocidas implicaciones en la tolerancia al estrés hídrico
((Battaglia et al., 2008) y referencias citadas). Una de las LEA identificadas presenta
homología con AtLEA14, gen incluido dentro de un grupo de 10 genes de Arabidopsis
thaliana que se presentan sobreexpresión por alta intensidad de luz, sequía, frio y
salinidad, lo que parece indicar una importante función general durante la respuesta a
estreses ambientales (Kimura et al., 2003).
Al menos tres proteínas de choque térmico de diferentes pesos moleculares han

sido identificadas en este grupo. Dos de ellos presentan homología con HSP90; este
tipo de chaperonas podrían estar implicadas en la estabilización de quinasas y
hormonas implicadas en las rutas de señalización de diferentes estreses abióticos
(Wang et al., 2004). Dentro de los genes que presentan homología con enzimas de
34
detoxificación encontramos como ejemplo una fenilalanina amonio-liasa, una catalasa

y una glutatión S-transferasa; podrían estar implicadas en la regulación del estrés
oxidativo producido por el aumento de ROS durante episodios de sequía. Las glutatión
S-transferasas forman un grupo de genes que se inducen en respuesta a la sequía en
Arabidopsis (Kumar et al., 2010).
Dentro de la clasificación funcional, los genes sin homología, con homología

pero sin funcionalidad asignada o de los que únicamente se conoce su probable
localización celular alcanzan el 39%, lo que pone de manifiesto el importante
desconocimiento aún existente sobre la genómica de gimnospermas.
Los resultados presentados en este capítulo han dado origen a los siguientes artículos:
EuroPineDB: a high-coverage Web database for maritime pine transcriptome, BMC

Genomics 12 (2011) 366 (Anexo II)
Identification of water stress genes in Pinus pinaster Ait. by controlled progressive

stress and suppression-subtractive hybridization, Plant Physiology and Biochemistry 50
(2012) 44-53 (Anexo III)
35
4. ANÁLISIS DE EXPRESIÓN DURANTE EL ESTRÉS HÍDRICO
Análisis de expresión durante el estrés hídrico
Desde que fue descrita por Diatchenko et al. (1996) la construcción de

genotecas sustractivas se mostró como una poderosa herramienta para la obtención
de genotecas enriquecidas en genes expresados de manera diferencial. Sin embargo,
con esta técnica se pueden obtener falsos positivos así como artefactos ocasionados
en las secuencias durante la construcción de las genotecas. Por tanto, una vez
identificados los genes presumiblemente implicados en la respuesta al estrés hídrico
mediante el análisis de la genoteca sustractiva se procedió a estudiar su expresión en
diferentes situaciones de déficit de agua, para lo que se diseñó una micromatriz o
microarray que incluía dichos genes, así como otros genes candidato descritos en la
literatura. La fiabilidad de los perfiles de expresión obtenidos con esta técnica se
comprobó mediante PCR cuantitativa.
En primera instancia se comprobó su perfil de expresión durante el estrés hídrico

inducido por PEG en P. pinaster y utilizado para hacer la genoteca. El PEG, además
de actuar como agente osmótico, presenta cierto grado de toxicidad para las plantas,
pudiendo inducir una respuesta específica frente a este compuesto, por lo que a
continuación se procedió a estudiar los patrones de expresión a lo largo de un
tratamiento prolongado de falta de riego en sustrato sólido. Este estudio permite no
sólo analizar la expresión durante un estrés más parecido a episodios de sequía que
deben afrontar las plantas en el medio natural, sino también discriminar aquellos
genes identificados en el capítulo anterior más relacionados con la respuesta
específica al PEG que con el estrés hídrico.
Para realizar un análisis más general de la respuesta al estrés hídrico en pinos

mediterráneos, el tratamiento de sequía en sustrato se aplicó de forma paralela en P.
pinaster y P. pinea. Ambas especies, a pesar de ser muy cercanas filogenéticamente,
muestran ciertas diferencias en su comportamiento ante situaciones de estrés hídrico.
Por tanto, este análisis permitiría identificar los patrones de respuesta comunes en los
pinos mediterráneos, así como las bases moleculares de las diferencias de
comportamiento observadas.
39
Para llevar a cabo el experimento de estrés hídrico en sustrato se utilizaron

plantas de P. pinaster de la procedencia Oria (Almería) y plantas de P. pinea de la
procedencia Meseta Central (Tordesillas, Valladolid). Como sustrato se empleó turba:
perlita:vermiculita (3:1:1 en peso). Las plantas de un año de edad fueron aclimatadas
durante dos meses en cámara de cultivo. Se mantuvieron con un fotoperiodo 16/8
día/noche, con 24ºC de temperatura y 60% de humedad relativa durante el día y 20ºC
de temperatura y 80% de humedad relativa durante la noche, realizando riegos hasta
la capacidad de campo.
4.1.2 Tratamiento de estrés hídrico en sustrato
Como control se recogió material sin estresar una hora después del riego. Las
plantas sometidas a estrés permanecieron sin riego durante 50 días, tomando las
muestras cada diez días. La recogida de material se realizó a mediodía, midiendo en
ese momento el potencial hídrico de las plantas empleando una cámara de
Scholander. Las raíces, tallos y acículas fueron recogidas de manera independiente,
congeladas inmediatamente en nitrógeno líquido y guardadas a -80ºC.
4.1.3 Tratamiento de estrés hídrico con PEG
El tratamiento de estrés hídrico inducido por polietilenglicol se describe en el

apartado 3.1.2. En la hibridación del microarray se emplearon las muestras S1, S2, S4,
S6 y S8 frente a las plantas sin estresar.
4.1.4 Análisis de expresión con microarray
Se diseñó un microarray (Agilent 8x15K, Agilent Technologies, CA, USA) con

1124 genes conteniendo los unigenes obtenidos en la genoteca sustractiva y otros
genes seleccionados de trabajos previos. Para cada unigen se diseñaron entre una y
cuatro sondas de 60 pares de bases, que fueron fijadas sobre el cristal por triplicado.
Igualmente se incorporaron en el diseño otros genes seleccionados de trabajos
previos realizados en el grupo de investigación, así como genes depositados en las
40
bases de datos de pinos y otras especies, que fueron empleados como controles
positivos y negativos.
El ARN total fue purificado empleando el “Qiagen RNeasy kit” (QIAGEN, CA,
USA) y posteriormente amplificado y marcado según el protocolo descrito por Adie et
al. (2007). Las hibridaciones se hicieron de acuerdo a “The manual two-colour
microarray based gene expression analysis” (Agilent Technologies, CA, USA). Las
imágenes de ambos canales (Cy3 y Hyper5) fueron equilibradas y capturadas con un
GenePix 4000B (Axon, CA, USA), cuantificando la intensidad de la señal mediante el
programa GenePix (Axon, CA, USA). En todos los casos se emplearon cuatro réplicas
biológicas
4.1.5 PCR a tiempo real
El ARN fue tratado con DNAsa Turbo (Ambion; Applied Biosystems, Life
Technologies, CA, USA). Se realizó la transcripción inversa a ADNc para cada
muestra a partir de 2 µg de ARN total empleando la retrotranscriptasa PowerScriptIII
(Invitrogen) y siguiendo el manual del fabricante. Como control se empleó el
ribosómico 18S una vez comprobado que la intensidad de la señal permanece
constante a lo largo del tratamiento. Se utilizó el programa Primer Express 3.0.0
(Applied Biosystems, Life Technologies, CA, USA) para el diseño de los cebadores.
Las PCR se realizaron utilizando EvaGreen para monitorizar la síntesis de ADN en
cada ciclo en placas ópticas de 96 pocillos, cuantificando la señal emitida mediante el
sistema de detección CFX 96 (BIO-RAD). Las reacciones con 2x SsoFast EvaGreen
Supermix (BIO-RAD, CA, USA), 12.5 ng de ADNc y 500 nM de cada cebador en un
volumen final de 10 µl se llevaron a cabo siguiendo las siguientes condiciones: 3
minutos a 95ºC, 40 ciclos de 10 segundos a 95ºC y 10 segundos a 60ºC. Se realizaron
tres réplicas técnicas para cada reacción. Los valores CT medios junto con la
eficiencia de la reacción fueron utilizados para hallar la cantidad relativa de transcrito
en cada muestra respecto al control. Los valores de expresión fueron obtenidos
empleando el método ΔΔCT (Pfaffl, 2001) normalizando los datos en función de la
cantidad relativa de transcrito obtenida para el 18S.
41
4.1.6 Análisis de datos
4.1.6.1 Normalización e identificación de genes inducidos
La corrección de la señal de fondo y la normalización de los datos fue realizada

empleando el programa LIMMA (Linear Models for Microarray Data) (Smyth, 2005). Se
utilizaron los métodos “normexp” y “loess” para la corrección de la señal de fondo local
y la normalización respectivamente. Posteriormente los logaritmos del ratio se
corrigieron en función del valor absoluto de la mediana para obtener una distribución
comparable para todos los arrays. La expresión de un gen en cada punto de estrés
respecto al control fue calculada como la intensidad media de los cuatro genotipos
empleados como réplicas. Para identificar aquellos genes diferencialmente expresados
se utilizó “RankProd” (Hong et al., 2006). Así mismo, un gen fue considerado
sobreexpresado de forma significativa cuando cumplía los siguientes criterios:
1) El nivel de expresión fue al menos 1.6 veces el del control en alguno de los
puntos de muestreo y en algún órgano
2) El valor de FDR (False Discovery Rate) calculado con RankProd era inferior
a 0.05
3) La tendencia se mantuvo para todas las réplicas de la prueba presentes en el

array.
Se agruparon los genes sobreexpresados con un patrón de expresión similar

utilizando el programa MeV 4.4 (Saeed et al., 2006), según un agrupamiento jerárquico
empleando el método de la distancia máxima y estableciendo un umbral basal de 2.5.
4.1.6.2 Expresión diferencial entre órganos y especies
Se realizaron comparaciones multiclases para identificar aquellos genes que

mostraban un comportamiento diferencial entre los órganos estudiados para cada
especie, así como comparaciones entre dos clases para identificar aquellos genes que
mostraban una expresión diferencial entre ambas especies para un órgano concreto.
Para ello se utilizó la implementación de LIMMA (Smyth, 2005) incluida en
www.babelomics.org (Al-Shahrour et al., 2006).Tras el análisis de la expresión en cada
punto de muestreo se obtiene un p valor corregido mediante FDR para cada gen.
42
Aquellos genes que mostraban un p valor inferior a 0.05 fueron identificados como
diferencialmente expresados entre las clases estudiadas.
4.1.6.3 Análisis funcional
Se utilizó FatiGO (Al-Shahrour et al., 2004) en www.babelomics.org (Al-Shahrour

et al., 2006) para identificar términos GO significativamente sobrerrepresentados en
los genes seleccionados como sobreexpresados. Arabidopsis thaliana fue empleada
como especie modelo para realizar la comparación entre los genes seleccionados
respecto al resto del genoma anotado. Se realizó un test de corrección múltiple para
analizar las hipótesis probadas, una por cada término funcional. Se consideraron
enriquecidos de manera significativa aquellos GO con un p valor inferior a 0.05.
4.2.1 Análisis de la expresión de los genes durante el tratamiento de PEG
La hibridación de las muestras seleccionadas del tratamiento de PEG dio como

resultado 192 genes significativamente sobrerrepresentados en al menos un punto de
muestreo y órgano (Material Suplementario, Tabla S4). De estos genes, 67 forman
parte de los 351 unigenes nucleares identificados previamente en la genoteca
sustractiva, un porcentaje similar a los obtenidos en estudios previos con otras
especies forestales, como por ejemplo Populus (Bae et al., 2009). De estos 192
unigenes sobreexpresados de manera significativa durante el tratamiento de estrés
hídrico inducido por PEG, se identificaron 71 genes sobreexpresados en acícula, otros
101 genes inducidos en tallo y 106 en raíz, de los cuales 54 presentan inducción
únicamente en este órgano; esta mayor respuesta en raíz no es sorprendente,
teniendo en cuenta el papel principal de las raíces en la percepción de la señal de
estrés. Se identificaron 22 genes con inducción significativa en los tres órganos
estudiados (Figura 4.1).
43
Figura 4.1 Número de transcritos sobreexpresados de manera significativa en cada órgano

estudiado durante el tratamiento de sequía inducida con PEG. En total se identificaron192 genes
inducidos en algún punto de muestreo/órgano a lo largo del tratamiento.
Los genes identificados como sobreexpresados en respuesta al tratamiento con

PEG pertenecen mayoritariamente a las categorías principales descritas para la
genoteca. La Figura 4.2 muestra los términos GO más representativos entre estos
genes.
Los genes identificados en cada órgano fueron agrupados en “clusters” en

función del patrón de expresión a lo largo del tratamiento (Figuras 4.3 a, b, y c).
44
Figura 4.2 Análisis de enriquecimiento de genes identificados específicamente durante el tratamiento de PEG. Además de términos GO relacionados
con respuesta a estreses abióticos se aprecia enriquecimiento en términos GO asociado a otros estímulos o procesos biológicos.
45
Figura 4.3a Patrones de expresión de los genes sobreexpresados en raíz a lo largo del tratamiento de PEG
46
Figura 4.3b Patrones de expresión de los genes sobreexpresados en tallo a lo largo del tratamiento de PEG
47
Figura 4.3c Patrones de expresión de los genes sobreexpresados en acícula a lo largo del tratamiento
de PEG
48
Del análisis de estos perfiles de expresión se pueden extraer las siguientes

pautas generales:
La mayor parte de los genes inducidos por PEG alcanzan el máximo nivel de
transcripción en el punto S6 (48 horas tras el comienzo del tratamiento y 36
horas a -1.6 MPa.
Algunos de estos genes presentan una inducción más rápida en raíces,

alcanzando el máximo en el punto S4 (1 hora a -1.6 MPa). Estos genes incluyen
genes presumiblemente relacionados con procesos de defensa, como HSP o
glutatión S-transferasas o factores de transcripción. Este patrón es coherente
con el papel de las raíces en la percepción e inicio de la respuesta al estrés.
Varios genes presentan una respuesta rápida, con un máximo en el punto S2 (1

hora a -0.8 MPa), como varias deshidrinas detectadas en raíces (cluster 12), así
como otras LEA y varias taumatinas en acícula (cluster 12) y tallo (cluster 10). En
este último órgano se observó una importante inducción de proteínas plastídicas
en este punto del estrés (clusters 7, 8 Y 9).
Por el contrario, el nivel de transcripción de otros genes aumenta de manera

continua durante todo el tratamiento. En este grupo se incluyen
fundamentalmente genes relacionados con el metabolismo de carbohidratos.
Para validar los perfiles detectados con los microarrays, se analizó mediante RT-
PCR el patrón de expresión de 10 genes, representativos de los principales “clusters”
de expresión y grupos funcionales (Figura 4.4).
49
Figura 4.4 RT-PCR de diez genes inducidos en el tratamiento de PEG. El grafico de barras representa
el valor observado en la RT-PCR y la línea representa el valor observado en el microarray para el genotipo
estudiado.
50
Figura 4.4 (continuación) RT-PCR de diez genes inducidos en el tratamiento de PEG. El grafico de barras
representa el valor observado en la RT-PCR y la línea representa el valor observado en el microarray para el
genotipo estudiado
51
4.2.2 Tratamiento de sequía en sustrato sólido
Si bien es conocido que P. pinea y P. pinaster presentan diferencias en sus

requerimientos hídricos, siendo la primera capaz de sobrevivir y reproducirse en
condiciones incluso más xéricas que la segunda, el análisis del potencial hídrico
durante el experimento no ha reflejado diferencias apreciables, como se muestra en la
Figura 4.5.
Figura 4.5 Potencial hídrico medido al mediodía en acícula a lo largo del experimento de
sequía con P. pinaster y P. pinea. La línea continua muestra el potencial hídrico medio de las
cuatro réplicas de P. pinea. La línea discontinua muestra el potencial hídrico medio de las cuatro
réplicas de P. pinaster. Las barras de error representan el error estándar asociado a cada punto de
muestreo.
4.2.2.1 Genes inducidos por la suspensión de riego en P. pinaster y P. pinea
El alto grado de conservación que habitualmente presentan las regiones

codificantes de los genes permite la utilización de los microarrays diseñados sobre una
especie para el análisis de la expresión génica en otra especie cercana, como se ha
descrito en pináceas y otras familias (van Zyl et al., 2002; Brinker et al., 2004; Davey et
al., 2009). En este caso, el microarray de oligonucleótidos diseñado a partir de genes
candidato de P. pinaster fue empleado de manera satisfactoria para el análisis de
52
expresión de los genes durante un tratamiento de sequía en P. pinea. Si bien en

algunos casos la especificidad de las pruebas puede dificultar en la hibridación
heteróloga la detección de determinados genes sobreexpresados (clasificados así
como “falsos negativos”), la fiabilidad de los genes “positivos” es equivalente a la
otorgada en la especie para la que fue diseñado el array. En este caso, se identificaron
218 genes sobreexpresados en P. pinea (Material Suplementario, Tabla S5). Entre
los genes identificados 67 presentan sobreexpresión en los tres órganos estudiados.
El número de genes inducidos en acícula y raíz es similar, 144 y 140, respectivamente.
40 genes se indujeron de manera exclusiva en acícula y 33 en raíz. Por su parte, en
tallo se identificaron 123 genes inducidos, 23 de los cuales no fueron detectados en
los otros órganos (Figura 4.6).

estudiado durante el tratamiento de sequía en sustrato con P. pinea. En total se identificaron
218 genes inducidos en algún punto de muestreo/órgano a lo largo del tratamiento.
Se identificaron 181 genes sobreexpresados significativamente en P. pinaster en

algún punto del tratamiento y para alguno de los órganos estudiados (Material
Suplementario, Tabla S6). Entre ellos, se han detectado 53 genes inducidos de
manera significativa en los tres órganos. En tallo se encontró el mayor número de
genes sobreexpresados, 116, de los cuales 41 se detectaron exclusivamente en este
órgano. En acícula se identificaron 107 genes, 44 de ellos no detectados en los otros
órganos. Por último, 88 genes se indujeron significativamente en raíz, y 19 de ellos de
manera exclusiva (Figura 4.7).
53

estudiado durante el tratamiento de sequía en sustrato con P. pinaster. En total se
identificaron181 genes inducidos en algún punto de muestreo/órgano a lo largo del tratamiento.
En total 113 genes mostraron sobreexpresión significativa en ambas especies y

en el mismo órgano (Figura 4.8), y se perfilan como un buen conjunto de genes
candidatos para el análisis de la respuesta a estrés hídrico en pináceas (Material
suplementario Tabla S7).
Figura 4.8 Número de transcritos sobreexpresados de manera significativa en ambas especies

para un mismo órgano.
54
Entre los genes

sobreexpresados en ambas
especies se aprecia un
enriquecimiento en dos términos
GO directamente relacionados
con la respuesta a estrés
hídrico: GO:0009415, respuesta
a estímulos por agua, y
GO:0009725, respuesta a
estímulos hormonales, y en su
mayoría pertenecen a las
principales clases funcionales
descritas para la genoteca Figura 4.9 Análisis de enriquecimiento de los
genes candidatos seleccionados
sustractiva (Figuras 4.9 y 4.10).
Figura 4.10 Clasificación funcional de los genes seleccionados como candidatos para
estrés hídrico en pinos. En total, 113 genes que presentaron inducción significativa en
ambas especies fueron agrupados de acuerdo con las categorías funcionales establecidas en
la base datos FunCatDB para Arabidopsis thaliana. Se muestra el valor porcentual para cada
grupo.
55
Genes implicados en metabolismo
Un cuarto de los genes inducidos de forma significativa en ambas especies están

presumiblemente implicados en metabolismo y, dentro de este grupo, hasta un tercio
estaría relacionado con el metabolismo de carbohidratos. Entre ellos encontramos, por
ejemplo, genes también inducidos por el tratamiento con PEG, como es el caso de la
alfa-galactosidasa (TC181331), la malato sintasa (TC155104), la glicosiltransferasa
(TC156369), la quitinasa (TC157851) y la aldehído deshidrogenasa(TC158839). Otros
dos genes incluidos en este grupo presentan homología con diferentes sacarosas
sintasas (TC188296 y TC176883), una beta-galactosidasa (TC156138) y la
gliceraldehido-3-fosfato deshidrogenasa (TC177891). Todos estos genes podrían estar
implicados en la acumulación de azúcares y prolina, solutos que favorecen el
mantenimiento de la presión osmótica y la protección de estructuras celulares, como
ya se ha comentado. Igualmente se seleccionaron varios genes implicados en el
metabolismo de lípidos y metabolismo secundario, incluyendo algunos genes
relacionados con la síntesis de etileno (TC182140, ACC sintasa y TC174045, ACC
oxidasa) o jasmonatos (TC188679, 12-oxo PDA reductasa).
Factores de transcripción
Un 9% de los genes inducidos en ambas especies muestran homología con

factores de transcripción de diferentes familias. Entre ellos, encontramos
representantes de la mayoría de las rutas de señalización. Dentro de los factores de
transcipción con dominios tipo AP2 se incluyen el TC157919, homólogo a un factor de
transcripción correspondiente a la subfamilia DREB (Drought responsive element
binding proteins) y los TC158167 y TC178542, presumiblemente miembros de la
subfamilia ERF (Ethylene responsive factor). También se incluye en este grupo un
factor de transcripción tipo WRKY (TC163430). Estos factores están muy conservados
en plantas, y se ha propuesto para ellos un papel central en la respuesta regulada por
ABA (Rushton et al., 2010); su sobreexpresión podría incrementar la tolerancia al
estrés hídrico (Zhou et al., 2008). También se identificó un factor de transcripción tipo
bZIP (TC161257), que mostró inducción significativa en todos los órganos estudiados.
Dentro de este grupo se incluye un factor de transcripción con un homeodominio
correspondiente a la familia BEL (TC170594) que podría cumplir un papel de
señalización a larga distancia (Campbell et al., 2008). Resulta destacable que este tipo
de factores de transcripción nunca ha sido relacionado con la respuesta a estrés
56
abiótico, mientras que en este trabajo ha sido detectado con inducción significativa en
todos los órganos, tanto en P. pinea como en P. pinaster y tanto en el tratamiento con
PEG como en la suspensión del riego.
Genes implicados en transporte
Otro 9% de los genes identificados fueron incluidos en el grupo de

transportadores; la mayoría podrían estar relacionados con el transporte de azúcares,
aniones y aminoácidos a través de membranas. Entre ellos se encuentran, por
ejemplo, dos transportadores de hexosas (TC170434 y DR099938) así como dos
transportadores de inositol (TC170498 y TC171882). Otro gen incluido en este grupo,
el TC176635, presenta homología con una permeasa de aminoácidos que podría
mediar en la acumulación de aminoácidos libres como la prolina (Bruria, 2010). Este
aminoácido aporta resistencia a la desecación, como sugiere su presencia en altas
concentraciones en procedencias de P. pinaster adaptadas a ambientes secos
(Corcuera et al., 2012). Estos resultados son coherentes con la alta capacidad que
muestra P. pinaster para realizar ajustes osmóticos (Lopez et al., 2009). Por otro lado,
TC173812 y TC167700 muestran homología con proteínas de membrana del
peroxisoma, posiblemente involucradas en el establecimiento del mecanismo de
detoxificación de ROS (Mathur, 2009).
Genes de defensa y rescate celular
Los genes más relevantes dentro de esta categoría se corresponden con

proteínas LEA y chaperonas. Por ejemplo, TC182917 y TC180126 son homólogos de
HSP de bajo peso molecular, que posiblemente estén implicadas en el mantenimiento
de la integridad de membrana plasmática (Nakamoto y Vígh, 2007). Aunque estos
genes han sido habitualmente relacionados con otros estreses abióticos como calor o
frio (Soto et al., 1999; Sun et al., 2002; Savić et al., 2012), algunos trabajos han
mostrado que pueden conferir tolerancia a sequía y salinidad (Jiang et al., 2009).
TC194781 tiene homología con un miembro de la familia HSP70, descritos
previamente en respuesta a estrés hídrico (Cho y Choi, 2009; Vásquez-Robinet et al.,
2010).
Entre las proteínas LEA, cuatro genes (TC162509, TC179486, TC193003 y

TC176703) presentan homología con diferentes deshidrinas, una familia multigénica
muy compleja implicada en la respuesta a diferentes estreses abióticos así como
57
procesos ontogénicos (Ver capítulo 5). Por su parte, TC168999 es homólogo al gen
AtLEA14, uno de los 10 genes que se sobreexpresan por luz, sequía, frio y salinidad
en Arabidopsis (Kimura et al., 2003).
Otras funciones y proteínas sin anotación
Muchos genes incluidos en otras categorías funcionales han sido identificados

en todos los órganos en ambos tratamientos y en muchos casos también en el
tratamiento de PEG. En esta situación se encuentran otras proteínas LEA (TC174716
y TC156877) incluidas dentro del grupo de genes implicados en el desarrollo de la
planta. En el grupo que incluye genes relacionados con una respuesta sistémica a
estímulos ambientales aparecen dos proteínas homólogas a taumatinas (TC182741 y
TC180421), que igualmente podrían regular la presión osmótica. También en este
grupo aparecen varios genes que podrían estar regulados por diferentes hormonas
como giberelinas (TC196029), auxinas (TC167447) y ácido indol-3-acético (AIA)
(TC175790). La ralentización del crecimiento como consecuencia del estrés hídrico va
asociada a una disminución de los niveles de estos reguladores del crecimiento, lo que
podría desencadenar nuevas respuestas adaptativas.
El 19% de los genes inducidos por sequía en ambas especies muestran

homología con genes de función desconocida e incluso sin homología con las
proteínas presentes en las bases de datos. Por ejemplo, TC188788 y TC163698, que
presentaron sobreexpresión en los tres órganos en ambas especies y también en P.
pinaster en respuesta al tratamiento con PEG, tienen homología con nodulinas de la
familia MtN3. Estos genes no tienen asignada una función en la base de datos FunCat;
sin embargo, estudios recientes en Arabidopsis y Oryza han identificado esta familia
génica como un nuevo tipo de transportador de azúcares denominados “Sweet” (Chen
et al., 2010). La sobreexpresión de TC188788, uno de los genes que presentó valores
más altos de inducción en los tratamientos estudiados, ya había sido descrita en
trabajos centrados en la respuesta a estrés hídrico en P. pinaster y P. taeda (Dubos et
al., 2003; Dubos y Plomion, 2003; Lorenz et al., 2006), así como en respuesta al frio
en Cupressus sempervirens (Pedron et al., 2009). Otro dos genes presentan marcada
sobreexpresión en todos los tratamientos: TC154582 presenta homología con una
proteína regulada por ABA y TC197470 fue anotada como una proteína rica en
hidroxiprolina. La expresión de estas proteínas está estimulada por heridas y
diferentes estreses ambientales. Saythan et al. (2005) identificaron otra PRP con alta
inducción durante estrés hídrico en P.halepensis.
58
De los genes sobreexpresados durante el tratamiento con PEG, 86 no se

indujeron significativamente durante el estrés por falta de riego (Figura 4.11). Este
hecho podría deberse a las diferencias en el nivel de estrés y tiempos de muestreo
utilizados en un experimento y otro, pero también a la respuesta a la toxicidad
producida por el PEG, más allá de su actuación como agente osmótico. Las plantas
pueden absorber el PEG por la raíces, especialmente las formas de bajo peso
molecular (por debajo de 6000), desarrollando una respuesta específica y adicional a
la causada por la bajada del potencial hídrico. Así, el análisis de enriquecimiento en
términos GO realizado para este grupo de genes mostró una representación
significativa tanto de términos asociados a estrés abiótico (por ejemplo; GO:0006970
Estrés osmótico, GO:0009414 Respuesta a privación de agua) como asociado a
respuesta a estímulos químicos (GO:0010038 respuesta a iones metálicos) (Figura
4.2, Pagina 42). Este es el caso de una metionina sintasa (TC157740) o una
pirofosfatasa inorgánica soluble (TC178028). El término GO:0006457 (Plegamiento de
proteínas) también está sobrerrepresentado entre los genes inducidos por PEG,
incluyendo 7 HSP no identificadas en la sequía en sustrato.
Figura 4.11 Número de transcritos sobreexpresados de manera significativa en cada

tratamiento de sequía aplicado. En total se identificaron 364 genes inducidos en algún
punto de muestreo/órgano/tratamiento.
4.2.2.2 Patrón de expresión en respuesta a sequía en P. pinaster y P. pinea
Las Figuras 4.13 (a,b y c) y Figuras 4.14 (a,b y c) muestran el agrupamiento de

los genes sobreexpresados en cada especie y órgano, según la similitud en sus
patrones de expresión. Los resultados obtenidos por microarray son comúnmente
59
validados por RT-PCR debido a la mayor precisión atribuida a esta técnica,

especialmente para aquellos genes con bajos niveles de inducción. Se realizó RT-PCR
para 16 genes cubriendo la mayoría de grupos funcionales y patrones de expresión.
La expresión observada con ambas técnicas fue bastante consistente, con valores de
correlación de Pearson superiores al 80% en la mayoría de los casos (Figura 4.15).
Figura 4.12a Patrones de expresión de los genes sobreexpresados en raíz a lo largo del tratamiento
de P. pinaster en sustrato sólido
60
Figura 4.12b Patrones de expresión de los genes sobreexpresados en tallo a lo largo del tratamiento
de P. pinaster en sustrato sólido
61
Figura 4.12c Patrones de expresión de los genes sobreexpresados en acícula a lo largo del
tratamiento de P .pinaster en sustrato sólido
62
Figura 4.13a Patrones de expresión de los genes sobreexpresados en raíz a lo largo del tratamiento
de P. pinea en sustrato sólido
63
Figura 4.13b Patrones de expresión de los genes sobreexpresados en tallo a lo largo del tratamiento
64
Figura 4.13c Patrones de expresión de los genes sobreexpresados en acícula a lo largo del tratamiento
65
Figura 4.14 RT-PCR de los 16 genes seleccionados para los tratamientos de estrés hídrico con P. pinaster
y P. pinea
66
Figura 4.14 (continuación) RT-PCR de los 16 genes seleccionados para los tratamientos de estrés hídrico
con P. pinaster y P. pinea
67
En cuanto al momento de la inducción de los genes sobreexpresados en

ambas especies, éstos se pueden agrupar en 3 clases:
a) genes que se inducen en los primeros pasos de la sequía (10 y 20 días),

descendiendo o manteniéndose constante su nivel de expresión durante el resto
del tratamiento,
b) genes que muestran unos niveles de inducción que aumentan constantemente a

lo largo del tratamiento
c) genes altamente inducidos en los últimos puntos del estrés, a los 30 días y
especialmente a los 40 y 50 días. Como se ha comentado anteriormente, no es
sorprendente que muchos de los genes sobreexpresados en ambas especies se
induzcan más rápidamente en raíces que en las partes aéreas.
Sin embargo, se identificaron ciertas diferencias entre P. pinaster y P. pinea:
Se identificó un mayor número de genes con inducción significativa en P. pinea

(218 genes) respecto a P. pinaster (181 genes), especialmente en raíz y acícula.
Los valores de sobreexpresión observados en los genes inducidos en ambas

especies fueron en general más altos en P. pinea que en P. pinaster. Así, se
registraron valores de expresión más de 10 veces superiores a los de las plantas
control en 83 genes en P. pinea con un máximo de 72 veces el valor del control
para una proteína rica en hidroxiprolina (TC197470), mientras que sólo 43 genes
presentaron una expresión más de 10 veces superior al control para P. pinaster,
presentando el valor máximo (62x) una deshidrina (TC162509).
P. pinea mostró una mayor proporción de genes inducidos en los primeros

puntos del estrés, especialmente en el primer punto de muestreo a los 10 días
sin riego.
Por el contrario, algunos genes mostraron una respuesta más retrasada en P.

pinea, con marcadas inducciones a los 40 y 50 días de estrés, mientras que en
P. pinaster se observa una importante inducción a los 20 o 30 días sin riego.
Este es el caso de los clusters 8, 9, 10, 11 y 12 de acícula, clusters 1 y 9 en tallo
o clusters 4, 6 y 8 de raíz en P. pinea y los clusters 2,4 y 6 de acícula, clusters 4
68
y 8 de tallo y los clusters 1, 2, 3 y 4 de raíz en P. pinaster. Este resultado se

confirmó en los genes seleccionados para RT-PCR, especialmente en tallo y
acícula; es el caso de TC162509 (deshidrina), TC157851 (posible quitinasa),
TC197470 (proteína rica en hidroxiprolina), TC188679 (posible 12-oxo-PDA
reductasa) y TC156369 (posible glicosiltransferasa).
Todos estos resultados indican que P. pinea es una especie con alta capacidad
de respuesta, mostrada a nivel transcripcional de manera mucho más rápida e intensa
que en P. pinaster. No obstante, el retraso en la inducción de ciertos genes en P.
pinea podría ser coherente con los resultados expuestos recientemente por Sánchez-
Gómez et al. (2011), según los cuales durante las primeras etapas de un estrés hídrico
moderado los mejores clones mostraron una estrategia de gasto de agua. Esta
estrategia podría aportar una ventaja competitiva en ambientes secos, privando del
recurso limitante a otros árboles competidores que siguen una estrategia de ahorro de
agua (Cohen, 1970; Zhang et al., 1997; Nguyen-Queyrens et al., 1998), como es el
caso de P. pinaster (Picon et al., 1996; Fernandez et al., 2000). Al persistir el estrés
hídrico, las plantas de P. pinea pasarían a adoptar una estrategia de ahorro de agua,
tal y como se ha descrito en otras especies “derrochadoras” (Levitt, 1980; Kozlowski y
Pallardy, 1996). Se requerirán nuevos experimentos para la comprobación de esta
hipótesis
Por otra parte, varios genes presentaron un patrón de expresión opuesto entre
ambas especies. El más claro ejemplo corresponde al TC177528, que muestra una
fuerte inducción en P. pinea (59 veces superior al de las plantas control en tallo y 32
veces en acícula a los 40 días sin riego) mientras que en P. pinaster mostró una
importante represión (15 y 5 veces inferior a los controles en los mismos puntos de
muestreo). Este gen codifica un péptido posiblemente implicado en la asimilación del
amonio en P. pinaster (Canales et al., 2011). La sequía puede reducir la disponibilidad
de este compuesto en el suelo; ante esta situación las plantas podrían acidificar la
rizosfera para solubilizar más amonio. Los cambios en el flujo de protones aumentan el
efecto del ABA en la reducción de la conductancia estomática (Goodger y
Schachtman, 2010). Un patrón opuesto se observó para el gen TC172144, de función
desconocida, el cual mostró una sobreexpresión moderada en P. pinaster mientras
que se reprimía en P. pinea.
También es destacable el aumento detectado en la raíz de P. pinaster de

posibles retrotransposones a los 50 días de sequía (Cluster 8; TC183415 y
69
TC194362). El estrés puede aumentar la transposición de estos elementos

probablemente debido a modificaciones epigenéticas transitorias (Mirouze y
Paszkowski, 2012). En este sentido, CDT-1, un gen inducido por sequía en la planta
de resurrección Craterostigma plantagineum que muestra similitudes con
retrotransposones confiere resistencia a la desecación posiblemente actuando como
una molécula de ARN no codificante con funciones reguladoras (Phillips et al., 2007).
Ninguno de estos elementos fue detectado como sobreexpresado en P. pinea, lo que
podría deberse a la restrictividad de los criterios utilizados, a la especificidad de las
sondas empleadas o a las propias diferencias en la respuesta entre ambas especies.
En conclusión, se ha identificado una colección de genes inducidos

significativamente en P. pinaster y P. pinea y que pueden considerarse como buenos
genes candidato para el estudio de la respuesta al estrés hídrico en las coníferas.
Mientras que los perfiles de expresión compartidos entre ambas especies pueden ser
considerados generales para los pinos mediterráneos, aquellos genes con un patrón
de expresión divergente probablemente estén relacionados con las diferentes pautas
frente al estrés hídrico mostrados por estas especies.
Parte de los resultados presentados en este capítulo están recogidos en los

Anexos III y IV;
Identification of water stress genes in Pinus pinaster Ait. by controlled progressive

(2012) 44-53 (Anexo III)
Molecular response to water stress in two contrasting Mediterranean pines (Pinus

pinaster and Pinus pinea). Manuscrito (Anexo IV).
70
5. CARACTERIZACIÓN MOLECULAR DE LA FAMILIA DE LAS
DESHIDRINAS EN P. PINASTER
Caracterización molecular de la familia de las deshidrinas en P. pinaster
Las deshidrinas forman una familia multigénica implicada en la respuesta a

diferentes estreses abióticos. En muchos casos están localizadas en QTL asociados
con importantes rasgos fenotípicos como la respuesta a la vernalización, el tiempo de
floración, la tolerancia a bajas temperaturas, la resistencia a la congelación o el
crecimiento bajo estrés osmótico o en condiciones de sequía (Campbell y Close,
1997). Por estos motivos, varios miembros de esta familia génica han sido empleados
como genes candidatos en distintos trabajos centrados en identificar patrones de
diversidad genética asociada con adaptación local a diferentes factores ambientales
en especies de pino (González-Martínez et al., 2006; Eveno et al., 2008; Grivet et al.,
2009; Wachowiak et al., 2009; Grivet et al., 2011). Además han sido utilizadas para
detectar evidencias de selección natural subyacentes a la filogenia del género Pinus
(Palmé et al., 2009).
Durante el análisis de los resultados obtenidos tras la hibridación del microarray

se observaron algunas discrepancias entre sondas diseñadas para una misma
deshidrina. En un análisis inicial de las secuencias mediante búsquedas en bases de
datos así como en un estudio de aquéllas empleadas en trabajos previos se observó la
notable complejidad que presenta esta familia génica, hecho que provoca
indeterminaciones en la nomenclatura de cada miembro de la familia y que a su vez
podría traducirse en errores en la interpretación de los resultados obtenidos en estos
trabajos. Todo ello, unido a la escasa caracterización de esta familia génica en
gimnospermas nos impulsó a realizar una caracterización de la misma, así como a
estudiar su patrón de expresión a lo largo de la sequía.
Las deshidrinas forman un grupo bien diferenciado dentro de las proteínas LEA.
La cantidad de transcritos de estas proteínas aumenta considerablemente en los
tejidos vegetativos de las plantas cuando desciende de forma considerable su
contenido hídrico. Son proteínas muy hidrofílicas con alta proporción en glicina y otros
pequeños residuos en su composición de aminoácidos. Debido a sus propiedades
físico químicas se ha propuesto que podrían cumplir un papel central preservando y
manteniendo las funciones celulares durante la deshidratación (Olvera-Carrillo et al.,
73
2011). Las proteínas LEA fueron descritas por primera vez por su acumulación durante
el desarrollo de la semilla en algodón (Dure III et al., 1981), formando en la actualidad
un complejo y diverso grupo que incluye proteínas con baja homología global. Se han
agrupado en diferentes familias atendiendo a su composición en aminoácidos (Dure
1993 y Bray 1993, Cuming (1999)). Una clasificación más reciente de las LEA de
Arabidopsis thaliana realizada en función de la presencia de dominios conservados,
incluidos en la base de datos Pfam (Wellcome Trust Sanger Institute), establece nueve
grupos diferentes. Uno de esos grupos corresponde a las deshidrinas (grupo D-11
propuesto por Dure o grupo 2 propuesto por Bray). Las deshidrinas se caracterizan por
la combinación de tres motivos conservados, los segmentos Y, S y K, que están
separados por otros segmentos denominados Φ, menos conservados y ricos en glicina
y aminoácidos polares (Close, 1997).
Todas las deshidrinas contienen al menos una copia del segmento K, el cual
consiste en un fragmento de 15 aminoácidos altamente conservados y ricos en lisina.
En angiospermas presenta la secuencia consenso EKKGIMDKIKEKLPG (Close, 1996)
y en gimnospermas (Q/E)K(P/A)G(M/L)LDKIK(A/Q)(K/M)(I/L)PG (Jarvis et al., 1996) y
se encuentra habitualmente en la región C-terminal. Los segmentos K pueden estar
involucrados en la formación de hélices anfipáticas alfa tipo A2 (Baker et al., 1988). El
segmento S es un fragmento de residuos de serina contiguos que pueden ser
fosforilados (Godoy et al., 1994; Campbell et al., 1998). Por su parte, el segmento Y
[(V/T)DEYGNP] presenta homología con dominios de unión de nucleótidos presentes
en chaperonas (Close, 1996 y 1997). Este segmento únicamente ha sido identificado
en deshidrinas de angiospermas hasta el momento. En función de la combinación de
segmentos que presentan en la secuencia de aminoácidos las deshidrinas han sido
clasificadas en 5 grupos; YnSKn, YnKn, SKn, Kn y KnS.
Las deshidrinas se consideran generalmente genes de expresión tardía en la

respuesta al estrés (Mahajan y Tuteja, 2005) y se han descrito varias funciones en las
que podrían estar implicadas. Una de ellas sería la de protección, estabilizando
membranas mediante interacciones hidrofóbicas con los segmentos K (Campbell y
Close, 1997; Danyluk et al., 1998; Koag et al., 2003). En algún caso se ha descrito
actividad chaperona, impidiendo la agregación de proteínas (Kovacs et al., 2008a;
2008b). Las deshidrinas también podrían tener la capacidad de unión a moléculas de
agua que a su vez podría influir en la protección de enzimas, como por ejemplo la alfa
amilasa durante estrés por frío (Rinne et al., 1999), al mantener una adecuada
concentración de agua a nivel local y reduciendo con ello los daños provocados por los
74
cristales de hielo durante la congelación (Wisniewski et al., 1999). Algunas deshidrinas

nucleares están involucradas en la protección de la maquinaria de transcripción
durante la desecación asociada a la formación de la semilla (Castillo et al., 2002).
Podrían tener un papel clave en este proceso y su abundancia estaría directamente
relacionada con la viabilidad y longevidad de la semilla (Hundertmark et al., 2011).
Otras deshidrinas podrían presentar una función como antioxidantes debido a su
capacidad para unir iones metálicos libres. Esto previene de una excesiva formación
de ROS (Hara et al., 2005; Sun y Lin, 2010). No obstante, a pesar de que sus
funciones han sido frecuentemente investigadas y revisadas en los últimos años,
especialmente en angiospermas (Allagulova et al., 2003; Rorat, 2006; Yuxiu et al.,
2007; Kosová et al., 2010; Eriksson y Harryson, 2011) , el mecanismo por el cual las
llevan a cabo aún está sin esclarecer.
5.1.1 Material vegetal y tratamiento de estrés hídrico
Para el análisis de expresión durante el estrés hídrico se utilizaron tres genotipos

diferentes (F1P3, F2P2 y F4P4) de Pinus pinaster de la procedencia Oria, empleando
cuatro ramets de cada uno en cada tiempo de muestreo. Las condiciones de cultivo y
desarrollo del experimento son las descritas en los Capítulos 4.1.1 y 4.1.2.
Se realizó una búsqueda de aquellos contigs tentativos (TCs) ensamblados a

partir de ESTs que estaban anotados como posibles deshidrinas en la base de datos
Pine Gene Index 9.0 (Versión marzo 2011; http://compbio.dfci.harvard.edu/tgi/cgi-
bin/tgi/gimain.pl?gudb=pine). Se utilizó el programa MUSCLE (Edgar, 2004) para
alinear las secuencias de aminoácidos deducidos a partir de cada TC y para obtener
un dendrograma empleando el método “Neighbour Joining”. Aquellos TCs que se
correspondían con deshidrinas de P. pinaster empleadas en trabajos previos fueron
seleccionados para diseñar cebadores específicos empleados en la amplificación del
ADN genómico así como del ADNc correspondiente a cada gen.
75
5.1.3 Extracción de ADN y ARN y amplificación de los genes completos
Se extrajo ADN genómico de acículas así como de megagametofitos empleando

el método propuesto por Doyle (Doyle, 1990). El ARN total fue extraído de manera
independiente desde raíces, tallos y acículas siguiendo el protocolo descrito por
(Chang et al., 1996). Se sintetizó ADNc a partir de 1µg de ARN total usando la
retrotranscriptasa PowerScriptIII (Invitrogen). Utilizando cebadores específicos se
amplificaron por PCR las secuencias completas de cada deshidrina estudiada
empleando como molde ADN genómico y ADNc. Los productos de PCR fueron
clonados en el vector pGEM®T-easy (Promega, WI, USA) y transferidos a Escherichia
coli DH5α. Posteriormente se secuenciaron los clones obtenidos y se alinearon las
secuencias para determinar su estructura de intrones y exones empleando el
programa Spidey del NCBI (http://www.ncbi.nlm.nih.gov/spidey/).
5.1.4 PCR a tiempo real
El estudio de la expresión de las deshidrinas identificadas se realizó para cada

órgano mediante RT-PCR según el apartado 4.2.5 de la presente tesis. Se
secuenciaron los fragmentos de RT-PCR, rediseñando primer siempre que fue
necesario hasta verificar la especificidad de la amplificación.
5.1.5 Análisis estadístico
Se empleó un modelo lineal para estudiar la significación del nivel de expresión

respecto al de las plantas sin estresar para cada gen y para cada órgano estudiado
(raíz, tallo y acícula);
yijk = m + gi + sj + gsij + eijk
Donde yijk es el nivel de expresión relativa de las k réplicas de los i genotipos en

el punto de estrés j, m es la media global, gi representa el efecto del genotipo, sj
representa el efecto del estrés, gsij es el efecto de la interacción y eijk representa el
error residual. Todo el experimento se llevó a cabo en una única cámara de cultivo, por
lo que no se consideró este factor en el modelo. La significación de los cambios en la
expresión fue comprobada empleando el método de la diferencia mínima significativa
(LSD), ajustado por el método de Bonferroni, con un nivel de significación del 95%.
Para este análisis se utilizó el programa Statgraphis Centurion XVI.
76
5.2.1 Búsqueda de deshidrinas in silico y amplificación de genes completos

La búsqueda de deshidrinas en la última versión disponible de la base de datos
del PGI dio como resultado 100 TCs/ESTs anotadas como miembros de esta familia
génica. Tras deducir la secuencia de aminoácidos únicamente se obtuvieron 47
secuencias que presentaban la posible región codificante completa. El resto de
secuencias o bien no estaban completas o, en muchos casos, presentaban codones
de terminación a lo largo de la región codificante. En algunos casos se observó la
presencia de contaminaciones con secuencias de ADN genómico en las bases de
datos de ESTs. Las secuencias de aminoácidos completas fueron clasificadas en seis
grupos de acuerdo con los segmentos conservados; K1, K2, SK2, SK3, SK4 y SK5.
Posteriormente se diseñaron cebadores específicos para los siete TCs que estaban
formados por ESTs de P. pinaster en algunos casos homólogos a deshidrinas que
habían sido utilizadas en trabajos previos con esta especie. Las amplificaciones por
PCR permitieron identificar 8 deshidrinas diferentes pertenecientes a los grupos Kn y
SKn (Figura 5.1).
Figura 5.1 TCs correspondientes a posibles deshidrinas de Pinus sp. agrupadas de acuerdo con el
número de segmentos conservados empleados habitualmente en el estudio de deshidrinas. Se
muestra la correspondencia con las ocho deshidrinas descritas en esta tesis y las secuencias empleadas en
trabajos previos.
77
5.2.2 Identificación de nuevos segmentos conservados
Una vez obtenidas las secuencias correspondientes a la región codificante

completa se dedujo la secuencia de aminoácidos correspondiente a cada deshidrina.
Éstas fueron alineadas con otras deshidrinas tanto de gimnospermas como de
angiospermas disponibles en las bases de datos de proteínas, algunas de ellas
deducidas a partir de ESTs (Figura 5.3). Los primeros 23 aminoácidos de la región
N-terminal presentan en P. pinaster la secuencia consenso
MAEEAPEHQDRGMFGLFGKKKED y están altamente conservados en las deshidrinas
de otras pináceas. Igualmente, este fragmento está conservado en las deshidrinas de
otras gimnospermas y en las deshidrinas tipo SKn de angiospermas, con distintas
inserciones al inicio de la secuencia. Todas las deshidrinas que presentan esta región
inicial conservada muestran un elevado porcentaje de residuos de glutamina (>13%) y
prolina (>5.9%), frente a las deshidrinas tipo Kn o YnSKn de angiospermas, que
presentan una región inicial más corta precediendo los segmentos K y S y una
composición de aminoácidos enriquecida en residuos de glicina (>21%) y treonina
(>12%).
Ninguna de las proteínas identificadas contiene el segmento Y descrito para

angiospermas. En cambio identificamos dos fragmentos que se encuentran altamente
conservados y aparecen de forma repetitiva en diferentes deshidrinas de pináceas
- Segmento A: presenta en P. pinaster la secuencia consenso EAASYYP (en

negrita los residuos también conservados en Picea) y ocupa una posición
parecida al segmento Y típico de angiospermas. Además de en numerosas
deshidrinas de Pinus y Picea también está presente en otras de Larix o
Pseudotsuga. Varios TCs obtenidos a partir de ESTs de Pinus taeda y P.
banksiana presentan este segmento repetido 4 veces (TC183122), 5 veces
(TC171685 y TC187956) y hasta 19 veces (TC191238).
- Segmento E: se encuentra precediendo al segmento S, con una secuencia

consenso en P. pinaster GHGHEGQLTPEEAEQQKH (se muestran en negrita
aquellos residuos también conservados en Picea). Este segmento aparece en
distintas deshidrinas de pináceas (Pinus, Picea, Larix y Pseudotsuga) así como
en una deshidrina identificada en Cupressus sempervirens.
78
Todos los segmentos conservados están identificados en la Figura 5.2 y la

Figura Suplementaria S1. La presencia y número de repeticiones de estos
segmentos y de los clásicos S y K se puede emplear en la clasificación de las
deshidrinas de gimnospermas, como hemos hecho en este trabajo con las
identificadas en P. pinaster.
Figura 5.2 Alineamiento de la secuencia de aminoácidos deducida para las 8 deshidrinas

identificadas en P. pinaster. Se muestran los residuos y segmentos conservados. Los segmentos S y K
clásicos son indicados con cajas de línea sólida. Cajas de puntos o rayas indican los nuevos segmentos
descritos así como la región N-terminal conservadas entre gimnospermas y las deshidrinas SKn de
angiospermas
5.2.3 Análisis de la estructura de las deshidrinas de P. pinaster
La comparación de las secuencias de ADN genómico y ADNc correspondientes

a las distintas deshidrinas de Pinus pinaster permitió establecer la estructura de
intrones y exones que presenta cada una de ellas. El análisis de los diferentes
segmentos conservados en la secuencia de las proteínas se muestra en la Tabla 5.1.
De las 8 deshidrinas identificadas dos pertenecen al grupo K2. Ppter_dhn_K2a y

Ppter_dhn_K2b están formados por 306 nucleótidos con 18 sustituciones entre ambas
que implican 10 cambios en la secuencia de aminoácidos. Ninguna de las dos
contiene intrones.
Un caso similar se da para otros tres genes que fueron identificados en el grupo
AESK3. Todos ellos muestran una región codificante con 579 nucleótidos.
79
Ppter_dhn_AESK3a y Ppter_dhn_AESK3a2 presentan mucha homología entre sí,

cambiando únicamente 11 nucleótidos, que implican el cambio de 5 aminoácidos.
La mayor diferencia entre ambas radica en que
solamente Ppter_dhn_AESK3a2 presenta un
intrón de 113 nucleótidos. El tercer gen
presente en este grupo se corresponde con
otro TC en la base de datos PGI. Contiene un
intrón de 123 nucleótidos y fue nombrado
como Ppter_dhn_AESK3b, pues presenta
notables diferencias en la secuencia de
aminoácidos: 24 aminoácidos son diferentes
respecto a los otros dos miembros de este
grupo, con cuatro cambios adicionales frente a
Ppter_dhn_AESK3a y uno frente Figura 5.3 Productos de PCR
Ppter_dhn_AESK3a2. correspondientes a los diferentes loci
de Ppter_dhn_K2 y Ppter_dhn_SK3
amplificados mediante ADN
El empleo de ADN haploide procedente
genómico haploide de
de megagametofitos permitió concluir que megagametofito.
estas variantes corresponden a diferentes 1: Marcador de Peso Molecular
duplicaciones en el genoma, descartando la 2: Ppter_dhn_K2a

3: Ppter_dhn_K2b
posibilidad de diferencias alélicas para un
4: Ppter_dhn_AESK3a y AESK3a2
mismo loci propuestas por Velasco-Conde et 5: Ppter_dhn_AESK3b
al. (2012) (Figura 5.3).
Las otras tres deshidrinas identificadas pertenecen a grupos diferentes;

Ppter_dhn_ESK2 es la única deshidrina dentro las identificadas que presenta una
inserción previa a la región de aminoácidos conservados en la zona N-terminal. La
región codificante la forman 531 nucleótidos y presenta un intrón de 99 nucleótidos.
Ppter_dhn_AESK4 tiene una región codificante de 714 nucleótidos así como un intrón
de 108 pares de bases. Por último, Ppter_dhn_A2E2SK5 es la deshidrina de mayor
tamaño, con una parte inicial muy larga comparada con el resto, donde aparecen dos
repeticiones del segmento A y otras dos del segmento E. La secuencia de la región
codificante contiene 978 nucleótidos y también presenta un intrón en este caso mayor,
con 334 nucleótidos.
Todos los intrones descritos están localizados en medio del segmento S.
80
Tabla 5.1 Descripción de las deshidrinas de P. pinaster analizadas en la presente tesis
Deshidrina Acc. genómico Acc. ARNm Descripción Estructura en intrones y exones

Contiene dos segmentos K (KEPGLVDKIKEKIPG,
Ppter_dhn_K2a HE796685 HE716959
KKPGVVDKIKEKLPG)
Contiene dos segmentos K (KKPGLVDKIKEKLPG,

Ppter_dhn_K2b HE796686 HE716960
KKPGMFDKIKEKLPG)
Contiene dos segmentos K (KKKGLKDKIKEKLPG,
Ppter_dhn_ESK2 HE796687 HE716961 KKGLVDKIKDKLPG), un segmento E (GHGHAGQFTAAEAEKQQHT)
y un segmento S con 10 residuos de serina
Contiene un segmento A (EASSYYP), un segmento E
(GHGHEGQFAPEDAKQQKH), un segmento S con ocho residuos de
Ppter_dhn_AESK3a HE796688 HE716962
serina y tres segmentos (KKKGSKDKTKEKLPG,
KKTGLVGKIKEKIPG, KKTGMLDKIKEKLPG)
Contiene un segmento A (EAASYYP), un segmento E
(GHGHEGQFAPEEAKQQKH), un segmento S con ocho residuos de
Ppter_dhn_AESK3a2 HE796689 HE716963
serina y tres segmentos K (KKKGSKDKTKEKLPG,
KKTGLVGKIKEKIPG, KKMGMLDKIKEKLPG)
(GHGYEGQFTPEEAEQQKH), un segmento S con ocho residuos de
Ppter_dhn_AESK3b HE796690 HE716964
serina y tres segmentos K (KKKGSMEKTKEKLPG,
KKTGLLDKIKEKIPG, KKTGLLDKIKEKLPG)
(GHGHEEQPTPEEAEQQKH), un segmento S con ocho residuos de
Ppter_dhn_AESK4 HE796691 HE716965
serina y cuatro segmentos K (KKKGSKDKSKEKLPG,
KKTGLLDKIKEKIPG, KKTGLLDKIKEKIPG, KKLGVLGKIKEKLPG)
Contiene dos segmentos A (EAASYYP, EAASYYP), dos segmentos
E (GHGHEGQLTPEEAEQQKR, GHGHEGQLTPEEAEQQKH), un
Ppter_dhn_A2E2SK5 HE796692 HE716966 segmento S con siete residuos de serina con una ileucina intercalada
y cinco segmentos K (KKKEAKDKTKKKVPG, KKAGLLDKFKEKLPA,
KKTGLLDKIKEKLPV, KKAGLLDKIKEKLPG, KKISLIDKIKEKLPG)
81
5.2.4 Análisis de la expresión por RT-PCR
Se analizó la expresión de todas las deshidrinas identificadas para cada órgano

de la planta (raíces, tallos y acículas) (Figura 5.4). Según el modelo lineal considerado
para los niveles de expresión, el cual explica más del 97,5% de la variación observada
para cada gen y órgano estudiado, tanto la duración de la sequía, como el genotipo y
la interacción entre ambos son factores significativos en todos los casos (p
valor<0.0005), salvo para Ppter_dhn_AESK3a2 en raíz, donde el genotipo no es
significativo (p valor=0.3142). El nivel de estrés es el factor más determinante en la
mayoría de los casos, contabilizando más del 50% de la variación observada, y
alcanzando más del 80% para Ppter_dhn_K2a en raíz y para Ppter_dhn_AESK4 en
acícula.
A pesar de las diferencias detectadas entre genotipos se pueden reconocer

tendencias generales en los patrones de expresión de las deshidrinas estudiadas. Los
niveles de transcritos de Ppter_dhn_K2a y Ppter_dhn_K2b aumentan de forma
significativa especialmente desde los 30 días sin riego, alcanzando en raíces niveles
de expresión entre 4 y 9 veces superiores respecto las plantas sin estresar. En tallo se
observa una inducción mucho menor, entre 1.5 y 2.5 veces mayores que los niveles de
las plantas control. Las mayores diferencias entre genotipos se observan en las
acículas, con valores de sobreexpresión entre 5 y 16 veces superiores al control a los
40 días de tratamiento. Ppter_dhn_A2E2SK5 muestra un patrón de expresión similar a
los genes anteriores, con valores de inducción en acículas ligeramente inferiores.
La mayor inducción la presenta Ppter_dhn_ESK2. Los niveles de transcritos de

esta deshidrina aumentan desde el primer punto de muestreo y en los tres órganos
estudiados durante todo el experimento alcanzando valores de expresión desde 1.000
hasta 10.000 veces superiores a los de las plantas control. Este resultado concuerda
con el observado por Lorenz et al. (2011) para el ortólogo en Pinus taeda, deshidrina 2
(ACA51879.1), descrito como uno de los 25 genes más sobreexpresados durante el
estrés hídrico. Este gen muestra la mayor divergencia en la secuencia de nucleótidos y
aminoácidos respecto a las otras deshidrinas identificadas y no se ha detectado
ninguna duplicación o parálogo en el genoma. Esto convierte a Ppter_dhn_ESK2 en un
buen gen candidato para su empleo en estudios de variación poblacional, siendo fácil
de desarrollar y aplicar marcadores específicos (como genotipado mediante SNP) o
técnicas de resecuenciación, evitando interferencias con otros miembros de la familia.
82
Figura 5.4 Análisis de la expresión por RT-PCR de las ocho deshidrinas identificadas en P. pinaster.
Se analizó la expresión relativa al control a lo largo del tratamiento de estrés hídrico en raíz, tallo y acícula.
Los cambios significativos en la expresión respecto a las plantas control (95% de nivel de significancia) se
indican con un asterisco.
83
Ppter_dhn_AESK4 presenta una inducción mucho menor, aunque significativa.

Los mayores niveles de sobreexpresión se dan en raíz, con valores entre 2 y 4 veces
superiores a los de las plantas sin estresar. Por otro lado, la sobreexpresión de las tres
variantes tipo AESK3 es muy baja, aunque significativa y en algunos órganos y puntos
de estrés la expresión del gen es incluso menor que en las plantas sin estresar.
Solamente en raíz o en el último punto de estrés en acícula los niveles de expresión
son aproximadamente el doble que en las plantas sin estresar.
Los bajos niveles de inducción de estas deshidrinas tipo AESKn podrían

correlacionarse con la presencia simultanea de una única copia de los segmentos
conservados A y E, identificados en las secuencias de aminoácidos de pináceas. Los
mayores niveles de inducción observados en este trabajo están presentes en el
Ppter_dhn_ESK2, deshidrina que presenta segmento E pero sin segmento A. También
muestran importante inducción las deshidrinas tipo Kn, que no presentan ninguno de
estos fragmentos. La deshidrina Ppter_dhn_A2E2SK5, que muestra una duplicación de
cada uno de estos fragmentos, vuelve a presentar unos niveles de inducción frente a
la sequía similares a los observados en las deshidrinas Kn. Aunque no es descartable
cierta funcionalidad de las deshidrinas tipo AESKn en respuesta a estrés hídrico,
teniendo en cuenta las diferencias leves pero significativas observadas en los niveles
de expresión, los resultados nos sugieren que podrían jugar un papel más importante
en otros procesos. Serían necesarios nuevos análisis para determinar una posible
implicación de los nuevos segmentos conservados descritos en la regulación de la
expresión de las deshidrinas de pináceas.
A pesar de su conocida implicación en la respuesta al estrés hídrico, los trabajos

previos encaminados a la identificación de genes inducidos por estrés hídrico en P.
pinaster no habían detectado deshidrinas (Dubos et al., 2003; Dubos y Plomion, 2003),
hecho que se repitió en la construcción de la librería sustractiva obtenida durante la
presente tesis, descrita en el capitulo 3. Únicamente se habían realizado estudios
preliminares de su expresión durante diferentes estreses abióticos con Pinus taeda
(Watkinson et al., 2003; Lorenz et al., 2011) o Pinus sylvestris (Joosen et al., 2006).
Recientemente se ha publicado un estudio de la expresión de varias deshidrinas a lo
largo de un tratamiento de sequía en varias procedencias de P. pinaster de regímenes
hídricos contrastados (Velasco-Conde et al., 2012). No obstante, nuestros resultados
difieren ligeramente de los obtenidos en dicho trabajo. La mayor diferencia reside en el
patrón divergente descrito para SK5 en dos de los genotipos coincidentes con los que
se han empleado en el presente capítulo, y en el perfil descrito para SK2, diferente
84
entre genotipos y con una apreciable represión en la primera semana con

disponibilidad de agua reducida en aquel trabajo. Distintos factores pueden haber
contribuido a estas discrepancias. En primer lugar, el tipo de estrés aplicado en el
trabajo de Velasco-Conde et al. (2012) es más corto y suave que el utilizado en el
presente trabajo y muchos genes que muestran un leve descenso en los niveles de
transcripción en las primeras etapas del tratamiento están en realidad notablemente
sobreexpresados cuando aumentan los niveles de estrés. En segundo lugar, durante
el desarrollo de esta tesis se ha analizado el patrón de expresión no sólo en acícula
sino también en tallo y raíz, órgano este último especialmente relevante durante el
estrés hídrico. Por último, Velasco-Conde et al. (2012) no aislaron y secuenciaron los
genes completos en el estudio, lo que les llevó a una interpretación incorrecta de
variación alélica, frente a la duplicación en el genoma que se ha verificado en el
presente trabajo. Esto puede llevar asociado un diseño inespecífico de los cebadores
utilizados en la RT-PCR, produciendo amplificaciones cruzadas, lo que resta fiabilidad
a los resultados de expresión obtenidos. Por el contrario, en este trabajo se han
diseñado cebadores específicos para cada forma evitando en lo posible la hibridación
cruzada. Igualmente, la secuenciación de los amplicones confirmó la especificidad de
la reacción.
Los resultados presentados en este capítulo dieron origen al artículo:
Novel conserved segments are associated with differential expression patterns for
Pinaceae dehydrins, Planta 236 (2012) 1863-1874 (Anexo V)
85
6. CARACTERIZACIÓN MOLECULAR DE GENES INDUCIDOS POR
ESTRÉS HÍDRICO EN P. PINASTER
Caracterización molecular de genes inducidos por estrés hídrico en P. pinaster
Durante el desarrollo de la tesis se ha identificado un importante número de

genes inducidos de forma significativa durante el estrés hídrico en pinos y cuya posible
función ha sido establecida de acuerdo con su homología con otras secuencias
anotadas depositadas en las bases de datos. No obstante, como se mencionó en el
capítulo 1, aunque este procedimiento es de uso común, las funciones de los genes
deben ser confirmadas experimentalmente. Esto es especialmente importante en el
caso de las gimnospermas, ya que las anotaciones en muchos casos se basan en
investigaciones previas realizadas con angiospermas, y dado el largo tiempo de
divergencia entre ambas divisiones, es probable que se den notables diferencias en la
actividad de genes homólogos. Por este motivo, se abrió una línea de investigación
que pretende caracterizar de forma más profunda algunos de estos genes: una
deshidrina y una nodulina putativa, ambas con una marcada sobreexpresión durante el
estrés hídrico, y un posible factor de transcripción del tipo AP2. Los primeros pasos de
esta línea de investigación incluyen la obtención y estudio de la secuencia completa de
los genes seleccionados así como de su región promotora y la obtención de
organismos modificados genéticamente con los genes de estudio para su empleo en
futuros experimentos, actividad que se llevó a cabo en parte durante una estancia en
el Instituto de Tecnología Química y Biológica de Oeiras (Lisboa)
Existen dos estrategias complementarias para el estudio de la acción de genes

in vivo mediante la utilización de organismos modificados genéticamente:
Pérdida de función del gen: La función del gen estudiado es alterada por la
inserción, deleción o sustitución en una zona específica, remplazando el gen funcional
por un alelo inactivo. Los métodos convencionales introducen mutaciones de forma
aleatoria en el genoma de la planta, inducidas por agentes físicos (rayos X, neutrones
rápidos, etc…) o químicos (agentes metilantes o intercalantes) (Østergaard y
Yanofsky, 2004). Otra técnica comúnmente empleada se basa en la inserción aleatoria
de fragmentos de ADN como los transposones o T-DNA. Si la inserción se produce
dentro de las regiones codificantes o reguladoras de un gen pueden dar lugar a la
pérdida de su función (Krysan et al., 1999; Ramachandran y Sundaresan, 2001). Por
89
último, otras metodologías utilizan el ARN de interferencia (ARNi) para provocar el

silenciamiento del gen.
Ganancia de función del gen: Estas técnicas buscan un incremento de los

niveles de expresión de un gen específico o bien la activación aleatoria de genes
endógenos, al incrementar los niveles de potenciadores de la transcripción. En ambos
casos el gen o el potenciador de la transcripción se expresan de forma constitutiva en
las células de la planta al ser clonados bajo el control de un fuerte promotor
(Nakazawa et al., 2003; Ichikawa et al., 2006).
Mediante la ganancia de función se puede analizar de forma independiente el

efecto del gen de interés cuando éste es miembro de una familia génica, mientras que
el silenciamiento puede inhibir la actividad de varios miembros de la familia de forma
simultánea.
La embriogénesis somática y su uso asociado a la transformación de P. pinaster
El estudio de individuos transformados genéticamente en especies alógamas,

como es el caso de los pinos, requiere de un eficiente sistema de propagación
vegetativa a partir de las células transformadas. La embriogénesis somática, a partir
de estas células, se basa en el principio de totipotencialidad celular enunciado por
Haberlandt por el cual todas las células de un organismo, al contener la misma
información genética que la célula inicial o zigoto podrían volver a expresar un patrón
de desarrollo embriogénico hasta formar auténticos embriones somáticos. La
embriogénesis somática se consigue por primera vez en los años 50 a partir de células
de parénquima de la raíz de zanahoria y ha ido ganando importancia hasta el punto de
estar considerada como la técnica más adecuada para la micropropagación de
especies forestales (Sutton, 2002). El empleo de las masas embrionarias como tejido
diana en procesos de transformación genética permite la obtención de células
modificadas genéticamente que una vez seleccionadas siguen los pasos normales de
multiplicación y maduración hasta generar individuos completos con la modificación
genética incorporada (Peña y Séguin, 2001). Las líneas transformadas pueden ser
criopreservadas en nitrógeno líquido para mantener su potencial multiplicativo.
En coníferas se consiguió por primera vez inducir embriogénesis somática en

Picea abies (Chalupa, 1985; Hakman y Arnold, 1985) y Larix decidua (Nagmani y
Bonga, 1985). La embriogésis somática en pinos ha sido ampliamente estudiada a lo
90
largo de las últimas dos décadas (Klimaszewska et al., 2007 y referencias citadas).
Los primeros resultados con P. pinaster llegaron a finales de los años 80 (Jarlet-
Hugues, 1989). Desde entonces la embriogénesis somática en esta especie ha sido
ampliamente estudiada (Bercetche y Pâques, 1994; Lelu-Walter et al., 2002; Lelu-
Walter et al., 2006), (Miguel et al., 2004), consiguiéndose importantes progresos en la
iniciación y proliferación de las masas embrionarias, así como en pasos posteriores
relativos a la maduración y conversión en planta.
Igualmente, se han conseguido importantes progresos en la transformación

genética de pinos. La mayoría de los trabajos publicados se centran en la optimización
de los protocolos de transformación empleando tanto bombardeo de partículas como
Agrobacterium tumefaciens (Trontin et al., 2007 y referencias citadas). Hasta la fecha
son pocos los trabajos publicados con pinos que han empleado genes específicos en
busca de un determinado carácter adaptativo. Se podrían destacar diferentes trabajos
de Tang et al. con P. virginiana, P. strobus o P. taeda (Tang y Tian, 2003; Tang et al.,
2005 y 2007).
En el caso de P. pinaster se están realizado importantes esfuerzos dentro del

proyecto europeo Sustainpine para obtener un protocolo eficiente que combine la
embriogénesis somática con la transformación genética a fin de obtener transgénicos
que permitan hacer una caracterización funcional profunda de un grupo de genes
seleccionados por sus implicaciones en procesos concretos como absorción de
nitrógeno, desarrollo de madera o alguno de los seleccionados en esta tesis de
respuesta a estrés hídrico.
Transformación genética de Arabidopsis thaliana como especie modelo
Dadas las dificultades aún existentes en coníferas para la transformación y

regeneración de las líneas transformadas, así como la larga duración de todo el
proceso, hasta poder realizar con las plantas los experimentos pertinentes, a menudo
se recurre a la expresión heteróloga del gen estudiado en una planta modelo, siendo
Arabidopsis thaliana la más utilizada.
Distintos trabajos han abordado con éxito la expresión heteróloga en esta

especie de genes relacionados con la sequía. Así, por ejemplo, se ha descrito la
mayor resistencia tanto a salinidad como a sequía de Arabidopsis que
sobreexpresaban un factor de transcripción de tipo MYB de crisantemo (Shan et al.,
91
2012) o una proteína con motivos estructurales del tipo “dedo de zinc” Cys2/His2, de la
misma especie (Gao et al., 2012). Zhang et al. (2007) refieren la tolerancia a sequía
conferida por la sobreexpresión en Arabidopsis de factores de transcripción tipo ERF
de Medicago trunculata. Sin embargo, la expresión heteróloga, en un entorno
molecular diferente, puede no tener el mismo efecto que en la especie de origen.
6.1.1 Amplificación de los genes completos y de su región promotora
Se empleó el ADN genómico y el ADNc, así como el procedimiento descrito en el

capítulo 5.3.3 de la presente tesis. En aquellos casos en los que no existían
secuencias en las bases de datos sobre las que diseñar cebadores específicos se
realizó la búsqueda a partir de RNA total empleando el “SMARTTM RACE ADNc
Amplification Kit” (Clontech, CA, USA). Una vez obtenida la secuencia del gen se
diseñaron dos cebadores específicos y consecutivos hacia la región N-terminal. Se
utilizó el “GenomeWalkerTM Universal Kit” (Clontech, CA, USA) para amplificar la
región correspondiente al promotor. Aquellos productos de amplificación que
mostraban tamaño y calidad suficiente fueron clonados en el vector pGEM®T-easy
(Promega, WI, USA) y transferidos a Escherichia coli DH5α. Las secuencias obtenidas
fueron alineadas con el gen para corroborar que correspondía a la región promotora.
Una vez obtenida la secuencia completa del gen se realizó una nueva búsqueda
en las bases de datos del NCBI para determinar la homología del gen completo e
identificar posibles dominios o regiones conservadas mediante la base de datos CDD
(Conserved domain database) (Marchler-Bauer et al., 2011). Se analizó la estructura
de intrones y exones de los genes alineando las secuencias correspondientes al ADN
genómico y el ADNc con el programa Spidey (http://www.ncbi.nlm.nih.gov/spidey/). Se
identificaron y analizaron posibles regiones reguladoras presentes en la región
promotora de los genes empleando la base de datos TransFac (Wingender et al.,
1996).
92
6.1.3 Construcción del vector de sobreexpresión
La construcción de los vectores de sobreexpresión se llevó a cabo utilizando el

kit “Gateway® Technology with clonaseTM II” (Invitrogen). Los vectores con los genes
completos fueron empleados como molde para construir el producto de PCR
flanqueado por los adaptadores attB. Como vector donador se utilizó el pDONRTM 201
(Invitrogen). Se utilizaron vectores de sobreexpresión diferentes en función de la
especie a transformar. En el caso de Arabidopsis thaliana de utilizó el vector de
sobreexpresión pK7WG2.0 (Figura 6.1) y para la transformación de P. pinaster se
empleó el vector pMBb7Fm21GW-UBIL (Figura 6.2), ambos comercializados por el
Departamento de Biología de Sistemas de Plantas de la Universidad de Gante
(Bélgica). Las zonas de inserción de las construcciones finales fueron secuenciadas
para corroborar la posición de los genes en el vector final de sobreexpresión.
Figura 6.1 Vector de sobreexpresión

pK7WG2.0 utilizado en la transformación
de Arabidopsis thaliana. Contiene genes
que confieren resistencia a espectinomicina
y kanamicina. El gen de estudio se inserta
entre las regiones attR1 y attR2, y se induce
su expresión por la acción del promotor 35S
del virus de la coliflor. La cepa de
Agrobacterium contiene un plásmido sin T-
DNA pero con los genes Vir que actúan
durante la infección de las células vegetales.
Figura 6.2 Vector de sobreexpresión

pMBb7Fm21GW-UBIL utilizado en la
transformación de Pinus pinaster. Contiene
genes que confieren resistencia a espectinomicina
y fosfinotricina. El gen de estudio se inserta entre
las regiones attR1 y attR2, y se induce su
expresión por la acción del promotor de la
ubiquitina del maíz. El vector también incorpora el
gen GFP (Green Fluorescence Protein) que
puede emplearse como marcador fluorescente de
las células transformantes. La cepa de
Agrobacterium contiene un plásmido sin T-DNA
pero con los genes Vir que actúan durante la
infección de las células vegetales.
93
6.1.4.1 Arabidopsis thaliana
Se utilizaron semillas de Arabidopsis thaliana del ecotipo Columbia (Col-0) para

generar plantas. La esterilización de las semillas se realizó mediante un lavado de 5
minutos con 1ml de hipoclorito sódico al 35%, seguido de tres lavados consecutivos
con agua estéril. Tras el último lavado las semillas se dejaron en agua estéril y en
oscuridad a 4ºC durante 4 días para su vernalización. Las plantas que iban a ser
empleadas en la transformación fueron sembradas directamente en maceta con una
mezcla de sustrato turba:vermiculita:perlita (4:3:2 en volumen). Las semillas de las
líneas transformadas fueron sembradas en placas de Petri con medio Murashige and
Skoog con kanamicina (50mg/L). A los 15 días las plántulas fueron trasplantadas a
macetas con la mezcla de sustrato descrita anteriormente. Las plantas se mantuvieron
en cámara de cultivo con fotoperiodo 16/8 día/noche y a una temperatura de 22ºC por
el día y 18ºC por la noche.
6.1.4.2 Células embrionarias de Pinus pinaster
Se empleó la línea celular del genotipo PN519 procedente de cruzamientos

controlados entre arboles élite de familias no relacionadas, que fue proporcionada por
el FCBA (Forêt Cellulose Bois-Construction Ameublement; Francia) dentro del
proyecto europeo Sustainpine. La línea fue cultivada en oscuridad a 23ºC en placas de
Petri con medio de proliferación mLV descrito por el FCBA (Francia) realizando sub-
cultivo cada dos semanas seleccionando aquellas células que presentaban
crecimiento activo.
6.1.5 Transformación genética mediada por Agrobacterium tumefaciens
6.1.5.1 Transformación de Arabidopsis thaliana
Las construcciones con el plámido pK7WG2.0 fueron transferidas a la cepa de

Agrobacterium tumefaciens LBA4404. La transformación de las plantas se llevo a cabo
siguiendo el protocolo descrito por Clough y Bent (1998). Se dejaron de regar las
plantas días antes de realizar la transformación, cuando presentaban
mayoritariamente flores inmaduras y pocas silicuas fertilizadas que fueron eliminadas
antes del tratamiento. Las plantas fueron sumergidas durante 30 segundos con
94
agitación constante en una solución fresca de sacarosa al 5%, 10mM de MgCl2 y

0.05% de Silwet L-77 con la que se resuspendieron las bacterias crecidas durante una
noche hasta alcanzar una densidad óptica a 600nm próxima a 1. Las plantas
impregnadas con la solución de Agrobacterium fueron envueltas y mantenidas en
posición horizontal durante 24 horas y posteriormente continuaron su crecimiento en
condiciones normales hasta completar el ciclo vital.
6.1.5.2 Transformación de células embrionarias de Pinus pinaster
En el caso de la transformación de células embrionarias de P. pinaster las

construcciones con el plásmido pMBb7Fm21GW-UBIL fueron transferidas a la cepa de
Agrobacterium tumefaciens C58Pmp90. Se empleó el protocolo proporcionado por el
FCBA (Nangis; Francia) dentro del proyecto europeo Sustainpine realizando ligeras
modificaciones. En primer lugar, en el proceso de descontaminación en lugar de vacío
se situó el filtro con la masa embrionaria tratada con Agrobacterium sobre una torre de
toallas de papel y se realizaron tres lavados consecutivos de 1ml de DM líquido,
según el protocolo del ITQB (Lisboa, Portugal). En segundo lugar, durante el proceso
de selección se aumentó progresivamente la concentración de fosfinotricina (PPT)
(0,1mg/L las primeras 2 semanas; 0,5 mg/L de la segunda a la sexta semana y 1 mg/L
se la sexta a la décima semana) y se intercalaron los antibióticos en cada cambio de
medio (Augmentine 300mg/L o timentine 400mg/l) para la eliminación de
Agrobacterium. Las líneas transformadas fueron seleccionadas y subcultivadas cada
dos semanas hasta completar un mínimo de 12 semanas en medio de selección.
Posteriormente se cultivaron en medio de proliferación mLV para su multiplicación. La
maduración y germinación de las líneas se realizó siguiendo el protocolo descrito por
Lelu-Walter et al. (2006).
6.2.1 Análisis de la secuencias
6.2.1.1 Ppter_dhn_ESK2
Ppter_dhn_ESK2 es la deshidrina que presentó, con diferencia, mayores niveles

de sobreexpresión en todos los tratamientos estudiados. Como se describe en el
capítulo 5.3.3 de la presente tesis, la región codificante de este gen la forman 531
nucleótidos y presenta un intrón de 99 nucleótidos (Figura 6.3). La secuencia
95
deducida para la proteína está compuesta por 177 aminoácidos, entre los que
encontramos un segmento E (GHGHAGQFTAAEAEKQQHT), un segmento S con 10
residuos de serina y dos segmentos K (KKKGLKDKIKEKLPG, KKGLVDKIKDKLPG).
Figura 6.3 Estructura de la deshidrina

Ppter_dhn_ESK2. Los exones son
identificados en color naranja; se señala
el nucleótido de inicio y final de cada
exón en la parte superior.
Durante la búsqueda de la secuencia promotora se obtuvo un fragmento de

372pb en dirección 5´ desde el punto de inicio de la transcripción. A pesar de que este
fragmento no se corresponde con el promotor completo del gen se han encontrando
diferentes motivos reguladores para factores de transcripción implicados en estrés
hídrico (Figura 6.4):
En la posición -352(+) se encontró un elemento de unión para factores de

transcripción tipo NAC.
Se identificó un elemento de unión para factores de transcripción tipo DREB en

la posición -219(+).
Figura 6.4 Secuencia de nucleótidos correspondiente al gen completo y región promotora de la

deshidrina Ppter_dhn_ESK2 y secuencia de aminoácidos deducida para la misma. Se diferencia
la región codificante en mayúsculas y se identifica el codón de inicio __, el codón de terminación __ y la
secuencia de aminoácidos correspondiente los segmentos E __, S __ y K __. En la región promotora
se señalan posibles elementos de unión para factores de transcripción según código de colores
descrito en la Tabla S9 del Material Suplementario.
96
En la posición -213(-) se identificó la secuencia CCACGT, descrita como un

elemento de reconocimiento para el factor de transcripción ABI5, del tipo bZIP.
En la posición -163(+) aparece otro motivo de reconocimiento para factores de

transcripción tipo bZIP para el que se ha descrito regulación por luz y hormonas.
6.2.1.2 Nodulina
Este gen presentó alta inducción en todos los tratamientos y órganos durante el
análisis de la expresión mediante microarrays. En la genoteca sustractiva se habían
obtenido dos fragmentos para este gen; uno de ellos con un solo clon de 351pb
correspondiente a la región 3´ del gen que presentaba el poliA (SI_Ppin_R4_311) y
otro fragmento de 547pb compuesto por dos clones (SI_Ppin_R1_59 y
SI_Ppin_R8_711) que codificaba una secuencia parcial del gen. Se obtuvo la
secuencia completa del mensajero mediante Smart RACE. La región codificante está
compuesta por 756pb. La secuencia de 255 aminoácidos deducida contiene dos
dominios conservados característicos de la superfamilia PQ-loop; los miembros de
esta familia génica codifican proteínas de membrana que presentan dos hélices
transmembrana unidas por un bucle.
Los dominios encontrados en la secuencia de la nodulina se corresponden

específicamente con la subclase MtN3_slv (pfam03083). Este dominio está presente
en un tipo de transportadores de azúcares denominados Sweets descritos
recientemente por Cheng et al. (Chen et al., 2010). Trabajos previos sugieren que
estas proteínas podrían estar implicadas en el desarrollo del polen, resistencia a
patógenos, senescencia, secreción de azúcar en nectarinas y en la absorción de
glucosa en raíces de Arabidopsis (Ge et al., 2000; Yang et al., 2006; Chaudhuri et al.,
2008; Guan et al., 2008). Los transportadores Sweets podrían estar localizados en la
membrana plasmática y estar implicados en el transporte bidireccional a través de la
membrana de glucosa y otros azúcares aún por determinar (Slewinski, 2011). (Figura
6.5).
97
Figura 6.5 Alineamiento de la secuencia de aminoácidos de la nodulina con genes homólogos en otras
especies (transportadores de azucares tipo Sweets). Las dos regiones que presentan mayor homología
corresponden a los dominios conservados tipo MtN3_slv. La región C-terminal presenta el menor grado de
conservación entre los genes comparados.
98
La secuencia genómica presenta seis exones de 40, 37, 223, 162, 123 y 183
nucleótidos y cinco intrones de 196, 106, 165, 266 y 106 nucleótidos (Figura 6.6).
Figura 6.6 Estructura del gen de la nodulina. Los exones son identificados en color naranja; se
señala el nucleótido de inicio y final de cada exón en la parte superior.
Durante la búsqueda de la secuencia promotora se obtuvo un fragmento de 1956

nucleótidos en dirección 5´ desde el codón de inicio de la transcripción. En esta región
se identificaron numerosos motivos de unión para factores de transcripción y muchos
de ellos han sido previamente descritos en regulación durante el estrés hídrico u otros
estreses abióticos así como regulación por diferentes hormonas (Figura 6.7).
En la posición -1654(-) y -939(+) se encontraron dos elementos de unión para

factores de transcripción tipo NAC.

la posición -1614(-) y dos elementos más para CBF1 en las posiciones -1312 (-)
y -324(+).
En la posición -1459(+) existe un elemento de unión descrito para el factor de

transcripción BCP1, el cual se induce por etileno.
En las posiciones -1181(-) y -665(-) se identificaron dos elementos de unión para

un factor de transcripción tipo bZIP regulado por luz y hormonas.
Se identificaron tres elementos de unión en las posiciones -846(+), -761(-) y

-157(+) para el factor de transcripción ASR1 (Abscisic stress ripening 1)
identificado en tomate, con alta inducción en condiciones de sequía y durante la
formación del fruto.
Se identificó en la posición -606(+) un elemento de unión para un factor de

transcripción tipo NAC involucrado en la represión de la respuesta mediada por
calmodulina.
99
En la posición -566(-) se identificó un elemento de unión para un factor de

transcripción tipo WRKY que está implicado en la activación rápida de proteínas
PR (Pathogenesis related) en situaciones de estrés.
Figura 6.7 Secuencia de nucleótidos correspondiente al gen completo y región promotora de la

nodulina y secuencia de aminoácidos deducida para el mismo. Se diferencia la región codificante
en mayúsculas y se identifica el codón de inicio __, el codón de terminación __ y la secuencia de
aminoácidos correspondiente al dominio conservado __. En la región promotora se señalan posibles
elementos de unión para factores de transcripción según código de colores descrito en la Tabla S9 del
Material Suplementario
100
6.3.1.3 Factor de transcripción tipo AP2
El factor de transcripción seleccionado presentó una inducción significativa con

valores entre 2 y 3 veces los del control en los experimentos de sequía con P. pinaster
y P. pinea. Aunque mediante microarrays no se detectó sobreexpresión significativa en
el tratamiento con PEG, el gen sí se identificó en la genoteca sustractiva, en la que se
obtuvo un fragmento de 189pb (clon SI_Ppin_R4-371). Tras realizar una búsqueda en
la base de datos del PGI se le asignó el TC178542. Se diseñaron cebadores
específicos para amplificar el gen completo a partir de ADN genómico y ADNc
respectivamente.
La región codificante del gen consta de 705pb, sin presencia de intrones. Su

traducción da lugar a una proteína de 235 aminoácidos. Esta secuencia contiene un
dominio de copia única característico de la superfamilia AP2 (Apetala 2; pfam00847),
característica asociada a factores de transcripción involucrados en la respuesta al
estrés. Este gen muestra mayor homología con factores de transcripción de la familia
EREBP (Ethylene responsive element binding protein). Se realizó un alineamiento con
genes homólogos de otras especies. El dominio más próximo a la zona N-terminal
presenta un alto grado de homología entre especies e igualmente se encontró alto
grado de conservación en dos regiones cercanas a la región C-terminal, una de ellas
compuesta por varios residuos de serina, lo que podría estar relacionado con algún
proceso de fosforilación (Figura 6.8).
El dominio de estos factores de transcripción se une de manera específica a la

secuencia de 11pb conocida como caja GCC de un elemento denominado ERE
(Ethylene response element) (Fujimoto et al., 2000); la presencia de este elemento en
la secuencia promotora de ciertos genes es determinante para regular la respuesta
mediada por etileno. No obstante, se ha descrito inducción de varios miembros de esta
familia ante diferentes estreses abióticos como sequía, salinidad o bajas temperaturas
y en diferentes especies (Nakano et al., 2006; Zhuang et al., 2008; Sharma et al.,
2010). En varios trabajos se ha observado que la sobreexpresión de factores de
transcripción de este tipo puede conferir cierto grado de resistencia a la sequía (Park
et al., 2001; Zhang et al., 2007; Zhang et al., 2009). Así, Tang et al. (2005; 2007)
describieron un aumento en la resistencia a sequía y otros estreses abióticos tanto en
Pinus strobus como en Pinus virginiana en aquellas plantas que sobreexpresaban un
ERF identificado en pimiento. Recientemente se ha descrito en Arabidopsis la
101
implicación de la respuesta mediada por etileno en la detención del ciclo celular

durante el estrés osmótico (Skirycz et al., 2011).
Figura 6.8 Alineamiento de la secuencia de aminoácidos del factor de transcripción tipo AP2
frente a genes homólogos en otras especies, correspondientes a la familia ERF. Cerca de la región
N-terminal se encuentra el dominio característico de la superfamilia AP2 con un alto grado de
conservación entre especies. La región N-terminal presenta dos zonas conservadas, una compuesta por
varios residuos de serina, por lo que podría corresponder a una zona de fosforilación y una segunda
zona conservada más próxima la región C-terminal.
102
Aunque aún se desconocen los genes que podrían estar regulados por los ERF,
todo parece indicar que podrían estar implicados en la respuesta a estrés, tanto de un
modo dependiente como independiente de etileno, similar a la regulación descrita para
las rutas de señalización mediadas por ABA (Mizoi et al., 2012).
Durante la búsqueda de la secuencia promotora se obtuvo un fragmento de 2158

nucleótidos en dirección 5´ desde el punto de inicio de la transcripción. Se identificaron
numerosos elementos de unión para diferentes factores de transcripción (Figura 6.9);
En la posición -1887(-) se identificó un elemento de unión para un factor de

transcripción tipo bZIP regulado por luz y hormonas.
En la posición -1884(+) se encuentra un elemento de unión para factores de

transcripción tipo NAC.

la posición -1775(-).
Se identificaron dos elementos de unión para factores de transcripción tipo

WRKY en las posiciones -1660(+) y -1076(+).
Es remarcable la presencia repetitiva del elemento de unión para factor de

transcripción ASR1, descrito en respuesta a estrés hídrico en tomate, repetida
hasta en 8 regiones de la secuencia estudiada; -1650(+), -1239 (-), -1137(-),
-1081(-), -1072(-), 939(-), -832(-) y -536(-).
En la posición -1570(-) se sitúa un elemento de unión descrito para RAV1, un

factor de transcripción tipo AP2/ERF que actúa como regulador negativo del
crecimiento y desarrollo de la planta.
También es llamativa la presencia de un elemento de reconocimiento tipo caja

GCC, que como se indicó anteriormente, es el reconocido por factores
transcripción de la familia del estudiado (-959(-) ERF1 o -958(-) PLT1). Esto
podría indicar una regulación en cascada para este tipo de factores de
transcripción o una autorregulación del gen de estudio durante la respuesta a
estrés hídrico.
103
Figura 6.9 Secuencia de nucleótidos correspondiente al gen completo y región promotora del
factor de transcripción tipo AP2 y secuencia de aminoácidos deducida para el mismo. Se
identifica el codón de inicio __, el codón de terminación __ y la secuencia de aminoácidos
correspondiente al dominio conservado __. En la región promotora se identifican posibles elementos
de unión para factores de transcripción según código de colores descrito en la Tabla S9 del
Material Suplementario
104
6.3.2 Transformación de Arabidopsis thaliana
Se plaquearon semillas cosechadas de las plantas tratadas con la solución de

Agrobacterium. Una vez germinadas las plantas se seleccionaron aquéllas que
presentaban un crecimiento normal en el medio selectivo con kanamicina (Figura
6.10).
Figura 6.10 Plantas de Arabidopsis transformadas con diferentes genes correspondientes a la

primera generación t0. Las plantas transformadas presentaban crecimiento normal en medio de cultivo
con kanamicina.
Estas líneas transformadas correspondientes a la primera generación o t0 fueron

cultivadas en las condiciones habituales favoreciendo la autofecundación. Se
recogieron las semillas de las plantas seleccionadas y se prosiguió con el
procedimiento de selección analizando el porcentaje de germinación hasta alcanzar la
tercera generación, t3, probablemente homocigota para el gen introducido (Material
suplementario Tablas S10, S11 y S12). A partir de la t2 el porcentaje de plantas
resistentes en todas las líneas transformantes superó el 85%; se comprobó la
incorporación del gen en el genoma de la planta mediante PCR (Figura 6.11).
En este momento se dispone de semillas de t3 de al menos tres líneas

propagadas de forma independiente desde la t0 para cada gen. Igualmente, cada una
de ellas presenta líneas independientes en la última generación (Material
suplementario Tablas S10, S11 y S12). Este material está listo para la planificación y
desarrollo de experimentos para estudiar la respuesta de las plantas transformantes a
diferentes factores abióticos.
105
Figura 6.11 Plantas de Arabidopsis correspondientes a la generación t2 y comprobación de la

transformación por PCR. A la izquierda se muestran plantas transformadas con el gen Ppter_dhn_ESK2
y con la nodulina. A la derecha se muestra la comprobación mediante amplificación por PCR de
diferentes líneas transformantes para cada gen.
6.3.3 Transformación de Pinus pinaster
Para los tres genes estudiados se realizó la construcción introduciendo el codón

de terminación. En el caso de la deshidrina se realizó también una construcción sin
codón de terminación, para comprobar el posible efecto provocado por la fusión entre
del gen de estudio y el gen GFP. Una vez obtenidas las construcciones fueron
transferidas a Agrobacterium.
Se sembró en placa desde el reservorio de células conservado a -80º para cada

una de las transformaciones (NOD, AP2, DH2_con stop y DH2_sin stop) así como los
106
controles positivos (pMb y pCbar). Se realizó una PCR para comprobar que la colonia
seleccionada contenía la construcción (Figura 6.12).
Figura 6.12 Comprobación por PCR

de la colonia de Agrobacterium
empleada en la transformación. Se
realizaron PCR con un cebador
específico del gen y otro diseñado
sobre el promotor de la Ubiquitina del
vector (Calles 1-4). También se
realizaron amplificaciones del gen de
resistencia a PPT para todas las
construcciones y los controles (Calles
6-11). En la calle central se muestra el
marcador de peso molecular.
Se emplearon 550 mg de masa celular que se cocultivaron con una suspensión

de Agrobacterium ajustado a una densidad óptica a 600nm de 0.6. Se realizó el mismo
procedimiento de transformación sobre 550 mg de masa sin poner en contacto con
Agrobacterium, que fue empleado como control negativo. Tras el proceso de
transformación se realizó la selección agrupando las células en agregados (clumps) en
el medio selectivo con PPT. Se aumentó progresivamente la concentración de PPT
hasta alcanzar 1 mg/ml en la sexta semana. A partir de este punto se seleccionaron
aquellas células que presentaban crecimiento evidente en el medio de selección
(Figura 6.13) y se realizó el cálculo de líneas positivas en medio de selección por
gramo de masa (Tabla 6.4).
Tabla 6.1 Selección de líneas transformantes con crecimiento en medio de selección con PPT
29/3/12 Clumps + Líneas
clumps 26/1/12 2/2/12 9/2/12 16/2/12 2/3/12 16/3/12
Final % P+/gr
NOD 47 16 23 34 38 41 41 41 87.2 74.5
AP2 49 2 3 6 10 14 16 19 38.7 34.5
DH2_con_stop 53 3 6 12 12 16 25 37 69.8 67.2
DH2_sin_stop 49 3 6 10 18 21 24 26 53 47.2
pMb 67 13 24 33 37 41 42 42 62.7 76.3
pCbar 52 6 10 11 20 25 31 31 59.6 56.3
Control - - - - - - - - - -
Se obtuvieron unos porcentajes muy elevados de líneas positivas en medio

selectivo con PPT con valores entre 35 y 75 líneas transformantes por gramo de masa
empleado. Los mejores resultados se consiguieron para la nodulina, con un 87% de
los clumps transformados.
107
Transformación NOD Control (-)
Figura 6.13 Selección de líneas transformantes con crecimiento visible en medio

selectivo con PPT. Se muestra como ejemplo la transformación realizada para la nodulina
que presento el mayor número de líneas transformantes.
Cada dos semanas se realizó un cambio de medio de cultivo, transfiriendo las

células más blancas con crecimiento activo a un medio selectivo fresco en el que se
fue bajando progresivamente la concentración de PPT. Doce líneas de cada
transformación que presentaban mejor proliferación en medio selectivo, fueron
transferidas a medio de proliferación (Figura 6.14, Tabla 6.5).
Proliferación NOD Proliferación DH2 con stop
Figura 6.14 Proliferación de líneas transformantes. Se pasaron a medio de proliferación doce

líneas seleccionadas de cada transformación.
108
Tabla 6.2 Líneas transformantes que fueron transferidas a medio de proliferación

NOD 1 2 3 8 9 10 11 13 15 19 29 31
AP2 1 3 4 5 7 8 2 6 9 11 12 15
TB 1 2 3 4 5 6 7 9 10 11 12 13
DH2_con_stop 1 2 3 4 5 6 7 8 11 12 14 22
DH2_sin_stop 1 2 3 4 6 7 8 10 11 14 16 18
pMb 1 3 4 8 11 12 13 15 18 19 20 23
pCbar 1 2 3 4 5 6 7 8 9 10 18 20
Control - - - - - - - - - - - - -
Se confirmó por PCR la presencia de la construcción en el 100% de las líneas

seleccionadas. También se comprobó la persistencia de Agrobacterium en las líneas
seleccionadas mediante PCR con cebadores diseñados sobre el gen VirVG (Figura
6.15).
Figura 6.15 Comprobación por

PCR de las líneas transformantes.
Se realizaron PCRs empleando
como molde ADN extraído de las
células en proliferación. Se utilizó un
cebador específico del gen y otro
diseñado sobre el promotor de la
Ubiquitina del vector (Figura
superior). También se realizó la
comprobación de la persistencia de
Agrobacterium en las líneas
transformadas (Figura inferior). En
ambos casos se empleó un control
positivo (plásmido o colonia de
Agrobacterium), células sin
transformar (WT) para descartar
amplificación inespecífica y un
control negativo para descartar
posibles contaminaciones en la
mezcla de PCR.
Se utilizó el control negativo introducido durante la transformación para la

generación de falsos positivos. Para ello se transfirieron los agregados de color pardo
durante la selección a medio de proliferación. Las células que permanecían vivas
proliferaron nuevamente en este medio (Figura 6.16).
109
Figura 6.16 Obtención de

falsos positivos. Se transfirió
el control negativo a medio de
proliferación para obtener una
línea no transformada pero
que había experimentado todo
el proceso de selección
Falsos Positivos
Falsos positivos
Finalmente, se realizó una maduración a partir de 300mg de masa celular de tres

líneas seleccionadas de cada transformación. Tras tres meses en medio de
maduración se seleccionaron los embriones maduros y se transfirieron a medio de
germinación para la obtención de plantas (Tabla 6.3, Figura 6.17).
Tabla 6.3 Maduración de las líneas transformantes seleccionadas

Embriones maduros Embriones/gr masa Plantas iniciales
NOD_1 44 146 18
NOD_3 28 93 13
NOD_15 36 120 17
AP2_1 0 - -
AP2_4 111 370 48
AP2_5 55 183 20
DH2_con_stop_4 29 96 13
DH2_con_stop_6 23 76 11
DH2_con_stop_11 22 73 14
DH2_sin_stop_3 98 326 44
DH2_sin_stop_6 56 186 15
DH2_sin_stop_14 21 70 6
pMb_1 0 - -
pMb_19 11 37 8
pMb_23 36 120 24
pCbar_1 27 90 10
pCbar_2 56 186 20
pCbar_3 35 116 15
Falsos positivos 59 196 28
Hasta la fecha, los trabajos publicados sobre la transformación genética de

P. pinaster se han centrado en la optimización de protocolos empleando transgenes
marcadores. Aunque la transformación genética de esta especie es aún una tarea
difícil se están logrando notables progresos en diferentes proyectos en curso. Por
ejemplo, en el proyecto Sustainpine se han obtenido rendimientos de transformación
de aproximadamente 90 líneas resistentes a PPT por gramo de masa embrionaria
110
utilizando el vector de referencia pCbar (Trontin et al., 2012). Estas eficiencias son
notablemente superiores a las obtenidas en trabajos anteriores (Tereso et al., 2006;
Trontin et al., 2007).
Figura 6.17 Maduración y germinación de las líneas transformantes. En la parte superior se

muestra una placa en medio de maduración y diferentes embriones en distinta fase del desarrollo.
En la parte inferior los embriones transferidos a medio de germinación comienzan a diferenciarse
en las distintas partes de la planta.
111
Las eficiencias de transformación obtenidas en la presente tesis son muy altas,

no sólo cuando se utiliza el vector de referencia, sino también cuando se utiliza el
vector de sobreexpresión con los transgenes integrados, lo que permite llegar a la
conclusión de que la construcción que porta el gen de interés no afecta negativamente
al proceso de transformación.
Respecto a la regeneración de embriones maduros, el rendimiento de referencia

para la línea PN519 no transformada es de 85 ± 16 embriones por gramo de masa
utilizada (Trontin et al., 2012). Sin embargo, la pérdida progresiva de la capacidad
embriogénica debida al envejecimiento de la línea (normalmente dentro de 6 meses de
propagación) puede provocar una reducción del rendimiento. Los procedimientos de
transformación someten a ciertas tensiones a los cultivos, y además implican el
mantenimiento de los mismos durante largos periodos de tiempo, por lo que suelen
afectar negativamente a la maduración de los embriones.
Sin embargo en este trabajo se ha obtenido un alto rendimiento de embriones

somáticos. La modificación en el proceso de selección de transformantes, aumentando
progresivamente la concentración de PPT en el medio de cultivo, podría rebajar el
estrés soportado por las células y favorecer la recuperación de las líneas
seleccionadas una vez son transferidas al medio de proliferación. En algunos casos,
como en las líneas que sobreexpresan el factor de trascripción tipo AP2 y
Ppter_dhn_ESK2, este número fue aún mayor que en los controles. Esto puede
sugerir que los genes tienen un efecto beneficioso sobre la maduración del embrión; la
regulación positiva de estos genes de respuesta a la sequía puede aumentar la
capacidad de maduración por jugar un papel fundamental en el proceso de desecación
que sufren los embriones hasta que llegan a una etapa de madurez completa. Esta
observación debe ser confirmada con experimentos adicionales.
Los resultados obtenidos en esta tesis van un paso más allá respecto los
trabajos anteriores con P. pinaster. Las plantas transformadas proporcionan una
herramienta muy importante para caracterizar el papel de estos genes frente a
diferentes situaciones de estrés, abriendo nuevas perspectivas para el análisis
funcional de los mismos en coníferas.
112
7. CONCLUSIONES/CONCLUSION
Conclusiones/Conclusions
7. CONCLUSIONS
1. We have applied a progressive, controlled PEG-induced water stress treatment

on P. pinaster plantlets in hydroponic culture and obtained a SSH library enriched in
genes overexpressed in response to stress.
2. We have analysed the expression patterns of the genes included in the library, as
well as other genes available in the public databases, during the PEG treatment in P.
pinaster and during a prolonged drought experiment in soil performed on P. pinaster
and P. pinea. Based on these experiments we have selected a collection of reliable
candidate genes for the study of molecular response to drought stress in conifers.
3. While gene expression patterns shared between both species can be reckoned
as common for Mediterranean pines, genes with divergent expression patterns are
probably related with the differences displayed by these species in their performance
under water stress.
4. We have performed an in depth analysis of the dehydrin gene family, identifying

eight different members in P. pinaster and correcting wrong allelic variation
interpretations previously reported.
5. We have analysed the transcription patterns shown by these eight dehydrin

genes during water stress, identifying highly induced members and other ones
presumably involved in the response to other abiotic stresses and/or ontological
processes.
6. We have described for the first time two amino acid motifs highly conserved in
SKn dehydrins in Pinaceae and absent in angiosperm dehydrins, and whose presence
and number is associated with the differential expression patterns described.
7. We have performed a thorough characterization of three genes induced by water

stress in P. pinaster: a dehydrin, a putative nodulin, both of them highly inducible by
water deficit, and a putative transcription factor, which could be involved in the
regulation of the response to the stress.
8. We have obtained plants of Arabidopsis thaliana and P. pinaster genetically

modified for the constitutive overexpression of each of these genes. This material will
be highly valuable for further studies on the molecular response to water stress in
plants and especially in conifers.
115
8. BIBLIOGRAFÍA
Bibliografía
Adie BAT, Pérez-Pérez J, Pérez-Pérez MM, Godoy M, Sánchez-Serrano JJ,

Schmelz EA, Solano R. 2007. ABA is an essential signal for plant resistance to
pathogens affecting JA biosynthesis and the activation of defenses in
Arabidopsis. The Plant Cell Online 19, 1665-1681.
Agarwal P, Agarwal P, Reddy M, Sopory S. 2006. Role of DREB transcription factors

in abiotic and biotic stress tolerance in plants. Plant Cell Reports 25, 1263-
1274.
Agarwal P, Jha B. 2009. Transcription factors in plants and ABA dependent and
independent abiotic stress signalling. Biologia Plantarum 54, 201-212.
Al-Shahrour F, Díaz-Uriarte R, Dopazo J. 2004. FatiGO: a web tool for finding

significant associations of Gene Ontology terms with groups of genes.
Bioinformatics 20, 578-580.
Al-Shahrour Ft, Minguez P, Tárraga J, Montaner D, Alloza E, Vaquerizas JM,

Conde L, Blaschke C, Vera J, Dopazo J. 2006. BABELOMICS: a systems
biology perspective in the functional annotation of genome-scale experiments.
Nucleic Acids Research 34, W472-W476.
Alía R, Gil L, Pardos JA. 1995. Performance of 43 Pinus pinaster Ait. provenances on
5 locations in central Spain. Silvae Genetica 44, 75-81.
Alía R, Gil L, Pardos JA, Catalan G. 1991. Interacción procedencia-edad en 52

procedencias de Pinus pinaster Ait. en España. Investigación Agraria: Sistemas
y Recursos Forestales 0, 11-24.
Alía R, Martín S. 2009. Guía técnica para la conservación genética y utilización del
pino negral (Pinus pinaster) en España. Foresta. Madrid. España.
Alía R, Martín S, De Miguel J, Galera RM, Agúndez D, Gordo J, Salvador LCG, Gil
L. 1996. Las regiones de procedencia de Pinus pinaster Aiton en España.
Madrid.: Ministerio de Medio Ambiente.
Allagulova CR, Gimalov FR, Shakirova FM, Vakhitov VA. 2003. The plant
dehydrins: structure and putative functions. Biochemistry 68, 945-951.
Aranda I, Alia R, Ortega U, Dantas AK, Majada J. 2010. Intra-specific variability in

biomass partitioning and carbon isotopic discrimination under moderate drought
stress in seedlings from four Pinus pinaster populations. Tree Genetics &
Genomes 6, 169-178.
Bae EK, Lee H, Lee JS, Noh EW. 2009. Isolation and characterization of osmotic
stress-induced genes in poplar cells by suppression subtractive hybridization
and cDNA microarray analysis. Plant Physiology and Biochemistry 48, 136-141.
Baker J, dennSteele C, Dure L. 1988. Sequence and characterization of 6 Lea

proteins and their genes from cotton. Plant Molecular Biology 11, 277-291.
119
Baradat P, Marpeau-Bezard A. 1988. Le pin maritime, Pinus pinaster Ait.. Biologie et

génétique des terpènes pour la connaissance et l'amélioration de l'espèce,
Universitè de Bordeaux I, Bordeaux, Francia. Tesis doctoral.
Batistic O, Kudla J. 2009. Plant calcineurin B-like proteins and their interacting protein
kinases. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1793,
985-992.
Battaglia M, Olvera-Carrillo Y, Garciarrubio A, Campos F, Covarrubias AA. 2008.

The enigmatic LEA proteins and other hydrophilins. Plant Physiology 148, 6-24.
Beck E, Fettig S, Knake C, Hartig K, Bhattarai T. 2007. Specific and unspecific

responses of plants to cold and drought stress. Journal of Biosciences 32, 501-
510.
Bercetche J, Pâques M. 1994. Somatic embryogenesis in maritime pine (Pinus

pinaster). Somatic embryogenesis in woody plants, 221-242.
Brinker M, van Zyl L, Liu W, Craig D, Sederoff RR, Clapham DH, von Arnold S.
2004. Microarray Analyses of Gene Expression during Adventitious Root
Development in Pinus contorta. Plant Physiol. 135, 1526-1539.
Bruria H. 2010. Role of proline in plant response to drought and salinity. En: Pessarakli
M, ed. Handbook of plant and crop stress,Third edition: CRC Press, 213-238.
Bucci G, González Martínez SC, Le Provost G, Plomion C, Ribeiro M, Sebastiani

F, Alía R, Vendramin GG. 2007. Range-wide phylogeography and gene zones
in Pinus pinaster Ait. revealed by chloroplast microsatellite markers. Molecular
Ecology 16, 2137-2153.
Campbell B, Hallengren J, Hannapel D. 2008. Accumulation of BEL1-like transcripts

in solanaceous species. Planta 228, 897-906.
Campbell SA, Close TJ. 1997. Dehydrins: genes, proteins, and associations with
phenotypic traits. New Phytologist 137, 61-74.
Campbell SA, Crone DE, Ceccardi TL, Close TJ. 1998. A ca. 40 kDa maize (Zea
mays L.) embryo dehydrin is encoded by the dhn2 locus on chromosome 9.
Plant Molecular Biology 38, 417-423.
Canales J, Avila C, Cánovas FM. 2011. A maritime pine antimicrobial peptide

involved in ammonium nutrition. Plant, Cell & Environment 34, 1443-1453.
Castillo J, Zuñiga Á, Franco L, Rodrigo MI. 2002. A chromatin-associated protein

from pea seeds preferentially binds histones H3 and H4. European Journal of
Biochemistry 269, 4641-4648.
Close TJ. 1996. Dehydrins: Emergence of a biochemical role of a family of plant

dehydration proteins. Physiologia Plantarum 97, 795-803.
120
Bibliografía
Close TJ. 1997. Dehydrins: A commonality in the response of plants to dehydration

and low temperature. Physiologia Plantarum 100, 291-296.
Clough SJ, Bent AF. 1998. Floral dip: a simplified method forAgrobacterium-mediated
transformation of Arabidopsis thaliana. The Plant Journal 16, 735-743.
Cohen D. 1970. Expected efficiency of water utilization in plants under different

compatition and selection regimes Israel Journal of Botany 19, 50-&.
Conesa A, Götz S, García-Gámez JM, Terol J, Talón M, Robles M. 2005. Blast2GO:

a universal tool for annotation, visualization and analysis in functional genomics
research. Bioinformatics 21, 3674-3676.
Corcuera L, Cochard H, Gil-Pelegrin E, Notivol E. 2011. Phenotypic plasticity in

mesic populations of Pinus pinaster improves resistance to xylem embolism (P
50) under severe drought. Trees-Structure and Function, 1-10.
Corcuera L, Gil-Pelegrin E, Notivol E. 2010. Phenotypic plasticity in Pinus pinaster

δ13 C: environment modulates genetic variation. Annals of Forest Science 67,
812-812.
Corcuera L, Gil-Pelegrin E, Notivol E. 2012. Aridity promotes differences in proline

and phytohormone levels in Pinus pinaster populations from contrasting
environments. Trees - Structure and Function 26, 799-808.
Correia I, Almeida MH, Aguiar A, Alía R, David TS, Pereira JS. 2008. Variations in
growth, survival and carbon isotope composition (δ13C) among Pinus pinaster
populations of different geographic origins. Tree Physiology 28, 1545-1552.
Costa P, Bahrman N, Frigerio JM, Kremer A, Plomion C. 1998. Water-deficit-

responsive proteins in maritime pine. Plant Molecular Biology 38, 587-596.
Cramer GR, Urano K, Delrot S, Pezzotti M, Shinozaki K. 2011. Effects of abiotic

stress on plants: a systems biology perspective. BMC Plant Biology 11, 163.
Chalupa V. 1985. Somatic embryogenesis and plantlet regeneration from cultured

immature and mature embryos of Picea abies (L.) Karst. Community Institute of
Forest Research 14, 57-63.
Chambel MR, Climent J, Alia R. 2007. Divergence among species and populations of
Mediterranean pines in biomass allocation of seedlings grown under two
watering regimes. Annals of Forest Science 64, 87-97.
Chang SJ, Puryear JD, Dias M, Funkhouser EA, Newton RJ, Cairney J. 1996.
Gene expression under water deficit in loblolly pine (Pinus taeda): Isolation and
characterization of cDNA clones. Physiologia Plantarum 97, 139-148.
Chaudhuri B, Hörmann F, Lalonde S, Brady SM, Orlando DA, Benfey P, Frommer

WB. 2008. Protonophore- and pH- insensitive glucose and sucrose
121
accumulation detected by FRET nanosensors in Arabidopsis root tips. The

Plant Journal 56, 948-962.
Chen LQ, Hou BH, Lalonde S, Takanaga H, Hartung ML, Qu XQ, Guo WJ, Kim JG,
Underwood W, Chaudhuri B, Chermak D, Antony G, White FF, Somerville
SC, Mudgett MB, Frommer WB. 2010. Sugar transporters for intercellular
exchange and nutrition of pathogens. Nature 468, 527-532.
Chen M, Wang QY, Cheng XG, Xu ZS, Li LC, Ye XG, Xia LQ, Ma YZ. 2007.
GmDREB2, a soybean DRE-binding transcription factor, conferred drought and
high-salt tolerance in transgenic plants. Biochemical and Biophysical Research
Communications 353, 299-305.
Cho E, Choi Y. 2009. A nuclear-localized HSP70 confers thermoprotective activity and

drought-stress tolerance on plants. Biotechnology Letters 31, 597-606.
Danyluk J, Perron A, Houde M, Limin A, Fowler B, Benhamou N, Sarhan F. 1998.

Accumulation of an acidic dehydrin in the vicinity of the plasma membrane
during cold acclimation of wheat. The Plant Cell Online 10, 623-638.
Davey M, Graham N, Vanholme B, Swennen R, May S, Keulemans J. 2009.

Heterologous oligonucleotide microarrays for transcriptomics in a non-model
species; a proof-of-concept study of drought stress in Musa. BMC Genomics
10, 436.
de Miguel M, Sánchez-Gómez D, Cervera MT, Aranda I. 2012. Functional and

genetic characterization of gas exchange and intrinsic water use efficiency in a
full-sib family of Pinus pinaster Ait. in response to drought. Tree Physiology 32,
94-103.
Diatchenko L, Lau Y, Siebert P. 1996. Suppression subtractive hybridization: a

method for generating differentially regulated or tissue-specific cDNA probes
and libraries. Proceedings of the National Academy of Sciences of the United
States of America 93, 6025 - 6030.
dos Reis SP, Lima AM, de Souza CRB. 2012. Recent molecular advances on
downstream plant responses to abiotic stress. International Journal of Molecular
Sciences 13, 8628-8647.
Doyle JJ. 1990. Isolation of plant DNA from fresh tissue. Focus 12, 13-15.
Dubos C, Le Provost G, Pot D, Salin F, Lalane C, Madur D, Frigerio JM, Plomion

C. 2003. Identification and characterization of water-stress-responsive genes in
hydroponically grown maritime pine (Pinus pinaster) seedlings. Tree Physiology
23, 169-179.
Dubos C, Plomion C. 2001. Drought differentially affects expression of a PR-10

protein, in needles of maritime pine (Pinus pinaster Ait.) seedlings. Journal of
Experimental Botany 52, 1143-1144.
122
Bibliografía
Dubos C, Plomion C. 2003. Identification of water-deficit responsive genes in maritime

pine (Pinus pinaster Ait.) roots. Plant Molecular Biology 51, 249-262.
Dure III L, Greenway SC, Galau GA. 1981. Developmental biochemistry of cottonseed
embryogenesis and germination: changing messenger ribonucleic acid
populations as shown by in vitro and in vivo protein synthesis. Biochemistry 20,
4162-4168.
Duvick J, Fu A, Muppirala U, Sabharwal M, Wilkerson MD, Lawrence CJ,

Lushbough C, Brendel V. 2008. PlantGDB: a resource for comparative plant
genomics. Nucleic Acids Research 36, D959-D965.
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Research 32, 1792-1797.
Eriksson SK, Harryson P. 2011. Dehydrins: Molecular Biology, Structure and

Function. En: Luttge U, Beck E, Bartels D, eds. Plant Desiccation Tolerance,
Vol. 215: Springer, 233 Spring Street, New York, Ny 10013, United States, 289-
305.
Eveno E, Collada C, Guevara MA, Leger V, Soto A, Diaz L, Leger P, Gonzalez-

Martinez SC, Cervera MT, Plomion C, Garnier-Gere PH. 2008. Contrasting
patterns of selection at Pinus pinaster Ait. drought stress candidate genes as
revealed by genetic differentiation analyses. Molecular Biology and Evolution
25, 417-437.
Fallour D, Fady B, Lefevre F. 1997. Study on isozyme variation in Pinus pinea L.:
evidence for low polymorphism. Silvae Genetica 46, 201-206.
Farooq M, Wahid A, Kobayashi N, Fujita D, Basra SMA. 2009. Plant drought stress:
effects, mechanisms and management. Agronomy for Sustainable Development
29, 185-212.
Fernandez M, Gil L, Pardos JA. 1999. Response of Pinus pinaster Ait. provenances
at early age to water supply. I. Water relation parameters. Annals of Forest
Science 56, 179-187.
Fernandez M, Gil L, Pardos JA. 2000. Effects of water supply on gas exchange in
Pinus pinaster Ait. provenances during their first growing season. Annals of
Forest Science 57, 9-16.
Fernández M, Novillo C, Pardos JA. 2006. Effects of water and nutrient availability in
Pinus pinaster Ait. open pollinated families at an early age: growth, gas
exchange and water relations. New Forests 31, 321-342.
Floris M, Mahgoub H, Lanet E, Robaglia C, Menand B. 2009. Post-transcriptional

regulation of gene expression in plants during abiotic stress. International
Journal of Molecular Sciences 10, 3168-3185.
123
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M. 2000. Arabidopsis

ethylene-responsive element binding factors act as transcriptional activators or
repressors of GCC box-mediated gene expression. The Plant Cell Online 12,
393-404.
Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y, Yamaguchi-Shinozaki K,

Shinozaki K. 2006. Crosstalk between abiotic and biotic stress responses: a
current view from the points of convergence in the stress signaling networks.
Current Opinion in Plant Biology 9, 436-442.
Fujita Y, Fujita M, Shinozaki K, Yamaguchi-Shinozaki K. 2011. ABA-mediated

transcriptional regulation in response to osmotic stress in plants. Journal of
Plant Research, 1-17.
García MNM, Capiati DA. 2011. Utilización de factores de transcripción como

herramienta biotecnológica para incrementar la tolerancia a la sequía en
plantas. Química Viva, 187-199.
Ge YX, Angenent GC, Wittich PE, Peters J, Franken J, Busscher M, Zhang LM,
Dahlhaus E, Kater MM, Wullems GJ. 2000. NEC1, a novel gene, highly
expressed in nectary tissue of Petunia hybrida. The Plant Journal 24, 725-734.
Gil L, Gordo J, Alía R, Catalán G, Pardos JA. 1990. Pinus pinaster Ait. en el paisaje
vegetal de la Península Ibérica. Ecología Fuera de Serie nº1, 469-495.
Godoy JA, Lunar R, Torres-Schumann S, Moreno J, Rodrigo RM, Pintor-Toro JA.

1994. Expression, tissue distribution and subcellular localization of dehydrin
TAS14 in salt-stressed tomato plants. Plant Molecular Biology 26, 1921-1934.
Goff SA, Ricke D, Lan TH, Presting G, Wang R, Dunn M, Glazebrook J, Sessions
A, Oeller P, Varma H. 2002. A draft sequence of the rice genome (Oryza sativa
L. ssp. japonica). Science 296, 92-100.
González-Martínez SC, Ersoz E, Brown GR, Wheeler NC, Neale DB. 2006. DNA
sequence variation and selection of tag single-nucleotide polymorphisms at
candidate genes for drought-stress response in Pinus taeda L. Genetics 172,
1915-1926.
Goodger JQD, Schachtman DP. 2010. Nitrogen source influences root to shoot
signaling under drought. En: Pareek A, Sopory SK, Bohnert HJ, eds. Abiotic
Stress Adaptation in Plants: Springer Netherlands, 165-173.
Grivet D, Sebastiani F, Alía R, Bataillon T, Torre S, Zabal-Aguirre M, Vendramin

GG, González-Martínez SC. 2011. Molecular footprints of local adaptation in
two mediterranean conifers. Molecular Biology and Evolution 28, 101-116.
Grivet D, Sebastiani F, González-Martínez SC, Vendramin GG. 2009. Patterns of

polymorphism resulting from long-range colonization in the Mediterranean
conifer Aleppo pine. New Phytologist 184, 1016-1028.
124
Bibliografía
Gu D, Liu X, Wang M, Zheng J, Hou W, Wang G, Wang J. 2008. Overexpression of

ZmOPR1 in Arabidopsis enhanced the tolerance to osmotic and salt stress
during seed germination. Plant Science 174, 124-130.
Guan YF, Huang XY, Zhu J, Gao JF, Zhang HX, Yang ZN. 2008. RUPTURED
POLLEN GRAIN1, a member of the MtN3/saliva gene family, is crucial for exine
pattern formation and cell integrity of microspores in Arabidopsis. Plant
Physiology 147, 852-863.
Guehl J, Fort C, Ferhi A. 1995. Differential response of leaf conductance, carbon

isotope discrimination and water-use efficiency to nitrogen deficiency in
maritime pine and pedunculate oak plants. New Phytologist 131, 149-157.
Hakman I, Arnold SV. 1985. Plantlet regeneration through somatic embryogenesis in

Picea abies (Norway Spruce). Journal of Plant Physiology 121, 149-158.
Hara M, Fujinaga M, Kuboi T. 2005. Metal binding by citrus dehydrin with histidine-
rich domains. Journal of Experimental Botany 56, 2695-2703.
Hara M, Tokunaga K, Kuboi T. 2008. Isolation of a drought-responsive alkaline alpha

galactosidase gene from New Zealand spinach. Plant Biotechnology 25, 497-
501.
Hirayama T, Shinozaki K. 2010. Research on plant abiotic stress responses in the

post-genome era: past, present and future. The Plant Journal 61, 1041-1052.
Hong F, Breitling R, McEntee CW, Wittner BS, Nemhauser JL, Chory J. 2006.
RankProd: a bioconductor package for detecting differentially expressed genes
in meta-analysis. Bioinformatics 22, 2825-2827.
Hopkins ER. 1971. Drought Resistance in Seedlings of Pinus Pinaster Ait:

Government Press.
Huang GT, Ma SL, Bai LP, Zhang L, Ma H, Jia P, Liu J, Zhong M, Guo ZF. 2012.
Signal transduction during cold, salt, and drought stresses in plants. Molecular
Biology Reports 39, 969-987.
Huang WZ, Ma XR, Wang QL, Gao YF, Xue Y, Niu XL, Yu GR, Liu YS. 2008.
Significant improvement of stress tolerance in tobacco plants by overexpressing
a stress-responsive aldehyde dehydrogenase gene from maize (Zea mays).
Plant Molecular Biology 68, 451-463.
Hundertmark M, Buitink J, Leprince O, Hincha DK. 2011. The reduction of seed-

specific dehydrins reduces seed longevity in Arabidopsis thaliana. Seed
Science Research 21, 165-173.
Ichikawa T, Nakazawa M, Kawashima M, Iizumi H, Kuroda H, Kondou Y, Tsuhara

Y, Suzuki K, Ishikawa A, Seki M. 2006. The FOX hunting system: an
alternative gain-of-function gene hunting technique. The Plant Journal 48, 974-
985.
125
IPCC. 2007. Climate Change 2007 - The Physical Science Basis: Working Group I
Contribution to the Fourth Assessment Report of the IPCC: Cambridge
University Press.
Jarlet-Hugues E. 1989. Recherches sur l'aptitude à l'embryogenèse somatique de

matériel juvénile et de matériel issu d'arbres adultes de Pinus pinaster Sol., Ph
Doctorate in Plant Biology and Phisiology. University Paris VI. Tesis doctoral.
Jarvis SB, Taylor MA, MacLeod MR, Davies HV. 1996. Cloning and characterisation
of the cDNA clones of three genes that are differentially expressed during
dormancy-breakage in the seeds of Douglas Fir (Pseudotsuga menziesii).
Journal of Plant Physiology 147, 559-566.
Jiang C, Xu J, Zhang HAO, Zhang X, Shi J, Li MIN, Ming F. 2009. A cytosolic class I
small heat shock protein, RcHSP17.8, of Rosa chinensis confers resistance to a
variety of stresses to Escherichia coli, yeast and Arabidopsis thaliana. Plant,
Cell & Environment 32, 1046-1059.
Joosen RVL, Lammers M, Balk PA, Bronnum P, Konings M, Perks M, Stattin E,

Van Wordragen MF, van der Geest AHM. 2006. Correlating gene expression
to physiological parameters and environmental conditions during cold
acclimation of Pinus sylvestris, identification of molecular markers using cDNA
microarrays. Tree Physiology 26, 1297-1313.
Jump AS, Peñuelas J. 2005. Running to stand still: adaptation and the response of
plants to rapid climate change. Ecology Letters 8, 1010-1020.
Kimura M, Yamamoto YY, Seki M, Sakurai T, Sato M, Abe T, Yoshida S, Manabe

K, Shinozaki K, Matsui M. 2003. Identification of Arabidopsis genes regulated
by high light-stress using cDNA microarray. Photochemistry and Photobiology
77, 226-233.
Kirst M, Johnson AF, Baucom C, Ulrich E, Hubbard K, Staggs R, Paule C, Retzel

E, Whetten R, Sederoff R. 2003. Apparent homology of expressed genes from
wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana.
Proceedings of the National Academy of Sciences of the United States of
America 100, 7383-7388.
Klimaszewska K, Trontin JF, Becwar MR, Devillard C, Park YS, Lelu-Walter MA.
2007. Recent progress in somatic embryogenesis of four Pinus spp. Tree and
Forestry science and Biotechnology 1, 11-25.
Koag MC, Fenton RD, Wilkens S, Close TJ. 2003. The binding of Maize DHN1 to
lipid vesicles. Gain of structure and lipid specificity. Plant Physiology 131, 309-
316.
Kosová K, Prásil IT, Vítámvás P. 2010. Role of dehydrins in plant stress response.
En: Pessarakli M, ed. Handbook of Plant and Crop Stress,Third Edition: CRC
Press, 239-285.
126
Bibliografía
Kovacs D, Agoston B, Tompa P. 2008a. Disordered plant LEA proteins as molecular

chaperones. Plant signaling & behavior 3, 710-713.
Kovacs D, Kalmar E, Torok Z, Tompa P. 2008b. Chaperone activity of ERD10 and

ERD14, two disordered stress-related plant proteins. Plant Physiology 147, 381-
390.
Kozlowski TT, Pallardy SG. 1996. Physiology of woody plants: Academic Press.
Krasensky J, Jonak C. 2012. Drought, salt, and temperature stress-induced metabolic

rearrangements and regulatory networks. Journal of Experimental Botany 63,
1593-1608.
Krysan PJ, Young JC, Sussman MR. 1999. T-DNA as an insertional mutagen in
Arabidopsis. The Plant Cell Online 11, 2283-2290.
Kumar B, Singla-Pareek SL, Sopory SK. 2010. Glutathione homeostasis: crucial for
abiotic stress tolerance in plants. En: Pareek A, Sopory SK, Bohnert HJ,
Govindjee, eds. Abiotic Stress Adaptation in Plants: Springer Netherlands, 263-
282.
Lamy JB, Bouffier L, Burlett R, Plomion C, Cochard H, Delzon S. 2011. Uniform

selection as a primary force reducing population genetic differentiation of
cavitation resistance across a species range. PLoS ONE 6, e23476.
Lelu-Walter MA, Bastien C, Drugeault A, Gouez ML, Klimaszewska K. 2002.

Somatic embryogenesis and plantlet development in Pinus sylvestris and Pinus
pinaster on medium with and without growth regulators. Physiologia Plantarum
105, 719-728.
Lelu-Walter MA, Bernier-Cardou M, Klimaszewska K. 2006. Simplified and improved

somatic embryogenesis for clonal propagation of Pinus pinaster (Ait.). Plant Cell
Reports 25, 767-776.
Levitt J. 1980. Responses of plants to environmental stresses. Volume II. Water,

radiation, salt, and other stresses: Academic Press.
Lin X, Kaul S, Rounsley S, Shea TP, Benito M-I, Town CD, Fujii CY, Mason T,
Bowman CL, Barnstead M, Feldblyum TV, Buell CR, Ketchum KA, Lee J,
Ronning CM, Koo HL, Moffat KS, Cronin LA, Shen M, Pai G, Van Aken S,
Umayam L, Tallon LJ, Gill JE, Adams MD, Carrera AJ, Creasy TH,
Goodman HM, Somerville CR, Copenhaver GP, Preuss D, Nierman WC,
White O, Eisen JA, Salzberg SL, Fraser CM, Venter JC. 1999. Sequence and
analysis of chromosome 2 of the plant Arabidopsis thaliana. Nature 402, 761-
768.
Lopez R, Aranda I, Gil L. 2009. Osmotic adjustment is a significant mechanism of

drought resistance in Pinus pinaster and Pinus canariensis. Investigacion
Agraria-Sistemas Y Recursos Forestales 18, 159-166.
127
Lorenz WW, Alba R, Yu Y-S, Bordeaux J, Simoes M, Dean J. 2011. Microarray

analysis and scale-free gene networks identify candidate regulators in drought-
stressed roots of loblolly pine (P. taeda L.). BMC Genomics 12, 264.
Lorenz WW, Sun F, Liang C, Kolychev D, Wang HM, Zhao X, Cordonnier-Pratt

MM, Pratt LH, Dean JFD. 2006. Water stress-responsive genes in loblolly pine
(Pinus taeda) roots identified by analyses of expressed sequence tag libraries.
Tree Physiology 26, 1-16.
Ludlow M. 1989. Strategies of response to water stress. En: K. H. Kreeb, Richter H,

Hinckley TM, eds. Structural and functional responses to environmental
stresses: water shortage: SPB Academic. The Hague, 269-281.
Magallóan SA, Sanderson MJ. 2005. Angiosperm divergence times: the effect of
genes, codon positions, and time constraints. Evolution 59, 1653-1670.
Mahajan S, Tuteja N. 2005. Cold, salinity and drought stresses: An overview. Archives
of Biochemistry and Biophysics 444, 139-158.
Manter DK, Kelsey RG. 2008. Ethanol accumulation in drought-stressed conifer

seedlings. International Journal of Plant Sciences 169, 361-369.
Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott

C, Fong JH, Geer LY, Geer RC, Gonzales NR. 2011. CDD: a Conserved
Domain Database for the functional annotation of proteins. Nucleic Acids
Research 39, D225-D229.
Mathur J. 2009. Rapid peroxisomal responses to ROS suggest an alternative

mechanistic model for post-biogenesis peroxisomal life cycle in plants. Plant
signaling & behavior 4, 787-789.
Mayer K, Schüller C, Wambutt R, Murphy G, Volckaert G, Pohl T, Düsterhöft A,

Stiekema W, Entian KD, Terryn N. 1999. Sequence and analysis of
chromosome 4 of the plant Arabidopsis thaliana. Nature 402, 769-777.
Mestre A, de Cara JA. 2009. Impactos del cambio climático en los ecosistemas
forestales ibéricos. Predicciones de cambio climático y vegetación: Libro de
Actas del 1er Seminario WCRP-DIVERSITAS, 139-166.
Micheletto S, Rodriguez-Uribe L, Hernandez R, Richins RD, Curry J, O'Connell

MA. 2007. Comparative transcript profiling in roots of Phaseolus acutifolius and
P. vulgaris under water deficit stress. Plant Science 173, 510-520.
Miguel C, Gonçalves S, Tereso S, Marum L, Maroco J, Margarida Oliveira M. 2004.

Somatic embryogenesis from 20 open-pollinated families of Portuguese plus
trees of maritime pine. Plant cell, tissue and organ culture 76, 121-130.
Mirouze M, Paszkowski J. 2012. Epigenetic contribution to stress adaptation in plants.

Current Opinion in Plant Biology 14, 267-274.
128
Bibliografía
Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K. 2012. AP2/ERF family transcription

factors in plant abiotic stress responses. Biochimica et Biophysica Acta (BBA) -
Gene Regulatory Mechanisms 1819, 86-96.
Muscolo A, Sidari M, Mallamaci C, Attinà E. 2007. Changes in germination and

glyoxylate and respiratory enzymes of Pinus pinea seeds under various abiotic
stresses. Journal of Plant Interactions 2, 273-279.
Nagmani R, Bonga J. 1985. Embryogenesis in subcultured callus of Larix decidua.

Canadian Journal of Forest Research 15, 1088-1091.
Nakamoto H, Vígh L. 2007. The small heat shock proteins and their clients. Cellular
and Molecular Life Sciences 64, 294-306.
Nakano T, Suzuki K, Fujimura T, Shinshi H. 2006. Genome-wide analysis of the ERF

gene family in Arabidopsis and rice. Plant Physiology 140, 411-432.
Nakazawa M, Ichikawa T, Ishikawa A, Kobayashi H, Tsuhara Y, Kawashima M,

Suzuki K, Muto S, Matsui M. 2003. Activation tagging, a novel tool to dissect
the functions of a gene family. The Plant Journal 34, 741-750.
Nguyen-Queyrens A, Bouchet-Lannat F. 2003. Osmotic adjustment in three-year-old

seedlings of five provenances of maritime pine (Pinus pinaster) in response to
drought. Tree Physiology 23, 397-404.
Nguyen-Queyrens A, Ferhi A, Loustau D, Guehl JM. 1998. Within-ring delta C-13

spatial variability and interannual variations in wood cellulose of two contrasting
provenances of Pinus pinaster. Canadian Journal of Forest Research-Revue
Canadienne De Recherche Forestiere 28, 766-773.
Oliver MJ, Cushman JC, Koster KL. 2010. Dehydration tolerance in plants. En:
Sunkar R, ed. Plant Stress Tolerance, Vol. 639: Humana Press, 3-24.
Olvera-Carrillo Y, Luis Reyes J, Covarrubias AA. 2011. Late embryogenesis

abundant proteins: versatile players in the plant adaptation to water limiting
environments. Plant signaling & behavior 6, 586-589.
Østergaard L, Yanofsky MF. 2004. Establishing gene function by mutagenesis in

Arabidopsis thaliana. The Plant Journal 39, 682-696.
Palmé AE, Pyhäjärvi T, Wachowiak W, Savolainen O. 2009. Selection on nuclear

genes in a pinus phylogeny. Molecular Biology and Evolution 26, 893-905.
Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH. 2001. Overexpression of the
tobacco Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances
resistance against pathogen attack and osmotic stress in tobacco. The Plant
Cell Online 13, 1035-1046.
129
Pedranzani H, Sierra-de-Grado R, Vigliocco A, Miersch O, Abdala G. 2007. Cold

and water stresses produce changes in endogenous jasmonates in two
populations of Pinus pinaster Ait. Plant Growth Regulation 52, 111-116.
Pedron L, Baldi P, Hietala AM, La Porta N. 2009. Genotype-specific regulation of

cold-responsive genes in cypress (Cupressus sempervirens L.). Gene 437, 45-
53.
Peña L, Séguin A. 2001. Recent advances in the genetic transformation of trees.

Trends in Biotechnology 19, 500-506.
Pérez FF, Boscolo R, Bladé I, Cacho I, Castro-Díez Y, Gomis D, González-

Sampériz P, Miguez-Macho G, Rodríguez-Fonseca B, Rodríguez-Puebla C.
2010. Clima en España: pasado, presente y futuro. Informe de Evaluación del
Cambio Climático Regional. Ministerio de Ciencia e Innovacion (MICINN).
Ministerio de Medio Ambiente y Medio Rural y Marino. CLIVAR.
Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Research 29, 6.
Phillips JR, Dalmay T, Bartels D. 2007. The role of small RNAs in abiotic stress.
FEBS Letters 581, 3592-3597.
Picon C, Guehl JM, Ferhi A. 1996. Leaf gas exchange and carbon isotope
composition responses to drought in a drought-avoiding (Pinus pinaster) and a
drought-tolerant (Quercus petraea) species under present and elevated
atmospheric CO2 concentrations. Plant Cell and Environment 19, 182-190.
Qin F, Shinozaki K, Yamaguchi-Shinozaki K. 2011. Achievements and challenges in

understanding plant abiotic stress responses and tolerance. Plant and Cell
Physiology 52, 1569-1582.
Rabello A, Guimaraes C, Rangel P, da Silva F, Seixas D, de Souza E, Brasileiro A,

Spehar C, Ferreira M, Mehta A. 2008. Identification of drought-responsive
genes in roots of upland rice (Oryza sativa L). BMC Genomics 9, 485.
Ramachandran S, Sundaresan V. 2001. Transposons as tools for functional

genomics. Plant Physiology and Biochemistry 39, 243-252.
Rinne PLH, Kaikuranta PLM, van der Plas LHW, van der Schoot C. 1999.
Dehydrins in cold-acclimated apices of birch (Betula pubescens Ehrh.):
production, localization and potential role in rescuing enzyme function during
dehydration. Planta 209, 377-388.
Rocak S, Linder P. 2004. DEAD-box proteins: the driving forces behind RNA
metabolism. Nature Reviews Molecular Cell Biology 5, 232-241.
Rorat T. 2006. Plant dehydrins - Tissue location, structure and function. Cellular &
Molecular Biology Letters 11, 536-556.
130
Bibliografía
Ruepp A, Zollner A, Maier D, Albermann K, Hani J, Mokrejs M, Tetko I, Guldener

U, Mannhaupt G, Munsterkotter M, Mewes HW. 2004. The FunCat, a
functional annotation scheme for systematic classification of proteins from
whole genomes. Nucleic Acids Research 32, 5539-5545.
Rushton PJ, Somssich IE, Ringler P, Shen QJ. 2010. WRKY transcription factors.
Trends in Plant Science 15, 247-258.
Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li J,
Thiagarajan M, White JA, Quackenbush J. 2006. TM4 Microarray Software
Suite. Methods in enzymology 411, 134-193.
Salanoubat M, Lemcke K, Rieger M, Ansorge W, Unseld M, Fartmann B, Valle G,

Blöcker H, Perez-Alonso M, Obermaier B. 2000. Sequence and analysis of
chromosome 3 of the plant Arabidopsis thaliana. Nature 408, 820.
Sánchez-Gómez D, Majada J, Alía R, Feito I, Aranda I. 2010. Intraspecific variation

in growth and allocation patterns in seedlings of Pinus pinaster Ait. submitted to
contrasting watering regimes: can water availability explain regional variation?
Annals of Forest Science 67, 8.
Sánchez-Gómez D, Velasco-Conde T, Cano-Martín FJ, Ángeles Guevara M,

Teresa Cervera M, Aranda I. 2011. Inter-clonal variation in functional traits in
response to drought for a genetically homogeneous Mediterranean conifer.
Environmental and Experimental Botany 70, 104-109.
Sánchez-Salguero R, Navarro RM, Camarero JJ, Fernández-Cancio A. 2010.

Drought-induced growth decline of Aleppo and maritime pine forests in south-
eastern Spain. Forest Systems 19, 458-470.
Sathyan P, Newton RJ, Loopstra CA. 2005. Genes induced by WDS are differentially
expressed in two populations of aleppo pine (Pinus halepensis). Tree Genetics
& Genomes 1, 166-173.
Savić JA, Dragićević IAA, Pantelić D, Oljača J, Momčilović I. 2012. Expression of

small heat shock proteins and heat tolerance in potato (Solanum tuberosum L.).
Archives of Biological Sciences 64, 135-144.
Sharma MK, Kumar R, Solanke AU, Sharma R, Tyagi AK, Sharma AK. 2010.
Identification, phylogeny, and transcript profiling of ERF family genes during
development and abiotic stress treatments in tomato. Molecular Genetics and
Genomics 284, 455-475.
Shih Md, Hoekstra FA, Hsing YLC, Jean-Claude K, Michel D. 2008. Late
embryogenesis abundant proteins. Advances in Botanical Research, Vol.
Volume 48: Academic Press, 211-255.
Shinozaki K, Yamaguchi-Shinozaki K. 2007. Gene networks involved in drought

stress response and tolerance. Journal of Experimental Botany 58, 221-227.
131
Sidari M, Mallamaci C, Muscolo A. 2008. Drought, salinity and heat differently affect
seed germination of Pinus pinea. Journal of Forest Research 13, 326-330.
Skirycz A, Claeys H, De Bodt S, Oikawa A, Shinoda S, Andriankaja M, Maleux K,

Eloy NB, Coppens F, Yoo SD. 2011. Pause-and-stop: the effects of osmotic
stress on cell proliferation during early leaf development in Arabidopsis and a
role for ethylene signaling in cell cycle arrest. The Plant Cell Online 23, 1876-
1888.
Slewinski TL. 2011. Diverse functional roles of monosaccharide transporters and their
homologs in vascular plants: a physiological perspective. Molecular plant 4,
641-662.
Smyth G. 2005. Limma: linear models for microarray data. En: Gentleman R, Carey
VJ, Huber W, Irizarry RA, Dudoit S, eds. Bioinformatics and computational
biology solutions using R and bioconductor: Springer New York, 397-420.
Soto A, Allona I, Collada C, Guevara M-A, Casado R, Rodriguez-Cerezo E,

Aragoncillo C, Gomez L. 1999. Heterologous expression of a plant small heat-
shock protein enhances Escherichia coli viability under heat and cold stress.
Plant Physiology 120, 521-528.
Sun W, Van Montagu M, Verbruggen N. 2002. Small heat shock proteins and stress
tolerance in plants. Biochimica et Biophysica Acta (BBA) - Gene Structure and
Expression 1577, 1-9.
Sun X, Lin HH. 2010. Role of plant dehydrins in antioxidation mechanisms. Biologia
65, 755-759.
Sutton B. 2002. Commercial delivery of genetic improvement to conifer plantations

using somatic embryogenesis. Annals of Forest Science 59, 657-661.
Tabata S, Kaneko T, Nakamura Y, Kotani H, Kato T, Asamizu E, Miyajima N,

Sasamoto S, Kimura T, Hosouchi T. 2000. Sequence and analysis of
chromosome 5 of the plant Arabidopsis thaliana. Nature 408, 823.
Tang W, Charles TM, Newton RJ. 2005. Overexpression of the pepper transcription
factor CaPF1 in transgenic Virginia pine (Pinus virginiana Mill.) confers multiple
stress tolerance and enhances organ growth. Plant Molecular Biology 59, 603-
617.
Tang W, Newton R, Li C, Charles T. 2007. Enhanced stress tolerance in transgenic

pine expressing the pepper CaPF1 gene is associated with the polyamine
biosynthesis. Plant Cell Reports 26, 115-124.
Tang W, Tian Y. 2003. Transgenic loblolly pine (Pinus taeda L.) plants expressing a
modified delta-endotoxin gene of Bacillus thuringiensis with enhanced
resistance to Dendrolimus punctatus Walker and Crypyothelea formosicola
Staud. Journal of Experimental Botany 54, 835-844.
132
Bibliografía
Tereso S, Miguel C, Zoglauer K, Valle-Piquera C, Oliveira MM. 2006. Stable

Agrobacterium-mediated transformation of embryogenic tissues from Pinus
pinaster Portuguese genotypes. Plant Growth Regulation 50, 57-68.
Theologis A, Ecker JR, Palm CJ, Federspiel NA, Kaul S, White O, Alonso J, Altafi
H, Araujo R, Bowman CL. 2000. Sequence and analysis of chromosome 1 of
the plant Arabidopsis thaliana. Nature, 816-819.
Tran L-SP, Nakashima K, Sakuma Y, Simpson SD, Fujita Y, Maruyama K, Fujita M,

Seki M, Shinozaki K, Yamaguchi-Shinozaki K. 2004. Isolation and functional
analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a
drought-responsive cis-element in the early responsive to dehydration stress 1
promoter. Plant Cell 16 2481-2498.
Trontin J, Debille S, Canlet F, Harvengt L, Lelu-Walter M, Label P, Teyssier C,

Miguel C, J. DV-B, Tonelli M, Santos R, Rupps A, Hassani SB, Zoglauer K,
Carneros E, Diaz-Sala C, Abarca D, Arrillaga I, Mendoza-Poudereux I,
Segura J, Saez CA, Rueda M, Canales J, Canovas F. 2012. Somatic
embryogenesis as an effective regeneration support for reverse genetics in
maritime pine: the Sustainpine collaborative project as an illustration. Second
international conference of the IUFRO working party 2.09.02 (somatic
embryogenesis and other vegetative propagation technologies), Integrating
vegetative propagation, biotechnology and genetic improvement for tree
production and sustainable forest management. . Brno, Czech Republic.
Trontin JF, Walter C, Klimaszewska K, Park YS, Lelu-Walter MA. 2007. Recent
progress in genetic transformation of four Pinus spp. Transgenic Plant Journal
1, 314-329.
Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N,

Ralph S, Rombauts S, Salamov A. 2006. The genome of black cottonwood,
Populus trichocarpa (Torr. & Gray). Science 313, 1596-1604.
Vaahtera L, Brosché M. 2011. More than the sum of its parts - How to achieve a
specific transcriptional response to abiotic stress. Plant Science 180, 421-430.
Valladares F, Vilagrosa A, Peñuelas J, Ogaya R, Camarero JJ, Corcuera L, Sisó

S, Gil-Pelegrín E. 2004. Estrés hídrico: ecofisiología y escalas de la sequía.
Ecología del bosque mediterráneo en un mundo cambiante: Organismo
Autónomo de Parques Nacionales. Ministerio de Medio Ambiente, Madrid.
van Zyl L, von Arnold S, Bozhkov P, Chen Y, Egertsdotter U, MacKay J, Sederoff

RR, Shen J, Zelena L, Clapham DH. 2002. Heterologous array analysis in
Pinaceae: Hybridization of Pinus taeda cDNA arrays with cDNA from needles
and embryogenic cultures of P. taeda, P. sylvestris or Picea abies. Comparative
and Functional Genomics 3, 306-318.
Vanková R. 2010. Plant hormone functions in abiotic and biotic stress responses. En:
Pessarakli M, ed. Handbook of Plant and Crop Stress,Third Edition: CRC Press,
191-211.
133
Vásquez-Robinet C, Watkinson JI, Sioson AA, Ramakrishnan N, Heath LS, Grene

R. 2010. Differential expression of heat shock protein genes in preconditioning
for photosynthetic acclimation in water-stressed loblolly pine. Plant Physiology
and Biochemistry 48, 256-264.
Velasco-Conde T, Yakovlev I, Majada J, Aranda I, Johnsen Ø. 2012. Dehydrins in

maritime pine (Pinus pinaster) and their expression related to drought stress
response. Tree Genetics & Genomes 8 957-973.
Velasco R, Zharkikh A, Troggio M, Cartwright DA, Cestaro A, Pruss D, Pindo M,

FitzGerald LM, Vezzulli S, Reid J. 2007. A high quality draft consensus
sequence of the genome of a heterozygous grapevine variety. PLoS ONE 2,
e1326.
Vendramin GG, Fady B, González-Martínez SC, Hu FS, Scotti I, Sebastiani F, Soto

Á, Petit RJ. 2008. Genetically depauperate but widespread: The case of
emblematic mediterranean pine Evolution 62, 680-688.
Wachowiak W, Balk P, Savolainen O. 2009. Search for nucleotide diversity patterns

of local adaptation in dehydrins and other cold-related candidate genes in Scots
pine (Pinus sylvestris L.). Tree Genetics & Genomes 5, 117-132.
Wang J, Hou B. 2009. Glycosyltransferases: key players involved in the modification

of plant secondary metabolites. Frontiers of Biology in China 4, 39-46.
Wang W, Vinocur B, Shoseyov O, Altman A. 2004. Role of plant heat-shock proteins

and molecular chaperones in the abiotic stress response. Trends in Plant
Science 9, 244-252.
Wang WX, Vinocur B, Altman A. 2003. Plant responses to drought, salinity and
extreme temperatures: towards genetic engineering for stress tolerance. Planta
218, 1-14.
Wanke D, Üner Kolukisaoglu H. 2010. An update on the ABCC transporter family in

plants: many genes, many proteins, but how many functions? Plant Biology 12,
15-25.
Watkinson JI, Sioson AA, Vasquez-Robinet C, Shukla M, Kumar D, Ellis M, Heath

LS, Ramakrishnan N, Chevone B, Watson LT, van Zyl L, Egertsdotter U,
Sederoff RR, Grene R. 2003. Photosynthetic acclimation is reflected in specific
patterns of gene expression in drought-stressed loblolly pine. Plant Physiology
133, 1702-1716.
Wingender E, Dietze P, Karas H, Knüppel R. 1996. TRANSFAC: a database on

transcription factors and their DNA binding sites. Nucleic Acids Research 24,
238-241.
Wisniewski M, Webb R, Balsamo R, Close TJ, Yu XM, Griffith M. 1999. Purification,

immunolocalization, cryoprotective, and antifreeze activity of PCA60: a dehydrin
from peach (Prunus persica). Physiologia Plantarum 105, 600-608.
134
Bibliografía
Xu GY, Rocha PSCF, Wang ML, Xu ML, Cui YC, Li LY, Zhu YX, Xia X. 2012. A novel
rice calmodulin-like gene, OsMSR2, enhances drought and salt tolerance and
increases ABA sensitivity in Arabidopsis. Planta 234, 47-59.
Yang B, Sugio A, White FF. 2006. Os8N3 is a host disease-susceptibility gene for
bacterial blight of rice. Proceedings of the National Academy of Sciences 103,
10503-10508.
Yu J, Hu S, Wang J, Wong GKS, Li S, Liu B, Deng Y, Dai L, Zhou Y, Zhang X.

2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica).
Science 296, 79-92.
Yuxiu Z, Zi W, Jin X. 2007. Molecular mechanism of dehydrin in response to

environmental stress in plant. Progress in Natural Science, Vol. 17: Taylor &
Francis, 237-246.
Zhang G, Chen M, Li L, Xu Z, Chen X, Guo J, Ma Y. 2009. Overexpression of the

soybean GmERF3 gene, an AP2/ERF type transcription factor for increased
tolerances to salt, drought, and diseases in transgenic tobacco. Journal of
Experimental Botany 60, 3781-3796.
Zhang JW, Feng Z, Cregg BM, Schumann CM. 1997. Carbon isotopic composition,
gas exchange, and growth of three populations of ponderosa pine differing in
drought tolerance. Tree Physiology 17, 461-466.
Zhang JY, Broeckling C, Sumner L, Wang ZY. 2007. Heterologous expression of two
Medicago truncatula putative ERF transcription factor genes, WXP1 and WXP2,
in Arabidopsis led to increased leaf wax accumulation and improved drought
tolerance, but differential response in freezing tolerance. Plant Molecular
Biology 64, 265-278.
Zhou QY, Tian AG, Zou HF, Xie ZM, Lei G, Huang J, Wang CM, Wang HW, Zhang
JS, Chen SY. 2008. Soybean WRKY-type transcription factor genes,
GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to
abiotic stresses in transgenic Arabidopsis plants. Plant Biotechnology Journal 6,
486-503.
Zhuang J, Cai B, Peng RH, Zhu B, Jin XF, Xue Y, Gao F, Fu XY, Tian YS, Zhao W.
2008. Genome-wide analysis of the AP2/ERF gene family in Populus
trichocarpa. Biochemical and Biophysical Research Communications 371, 468-
474.
Zonneveld B. 2012. Conifer genome sizes of 172 species, covering 64 of 67 genera,

range from 8 to 72 picogram. Nordic Journal of Botany.
135
ANEXOS
ANEXO I. Drought response in forest trees: From the species to the gene.
En Ricardo Aroca (Ed): Plant Responses to Drought Stress: From
Morphological to Molecular Features (2012) 293-333. Springer.
Chapter 12
Drought Response in Forest Trees:
From the Species to the Gene
I. Aranda, E. Gil-Pelegrín, A. Gascó, M. A. Guevara, J. F. Cano,

M. De Miguel, J. A. Ramírez-Valiente, J. J. Peguero-Pina,
P. Perdiguero, A. Soto, M. T. Cervera and C. Collada
Abstract Forest tree species, considering their long lifespan, symbolize one of the
best biological examples of adaptation to a frequently changing harsh terrestrial
environment. The adaptation to environments with water scarcity was the first
challenge in the evolution of terrestrial photosynthetic organisms, and prompted
the development of strategies and mechanisms to cope with drought. In this
respect, the particular evolution and life history of forest tree species have brought
about a plethora of specific adaptations to dry environments. The presence of a
hydraulic system for long distance water transport and the need of maintaining
functional tissues and organs for long periods of time are two important charac-
teristics making forest tree species singular organisms within the plant kingdom.
Selective pressure has prompted a variety of strategies in the control of water
losses to maintain the functionality of the hydraulic system without compromising
the carbon balance of the plant. These and other physiological responses focussed
I. Aranda (&) A. Gascó M. A. Guevara J. F. Cano M. De Miguel

J. A. Ramírez-Valiente M. T. Cervera
Instituto Nacional de Investigaciones Agrarias (INIA), Centro de Investigaciones Forestales
(CIFOR), Carretera de la Coruña km 7,5, 28040, Madrid, Spain
e-mail: aranda@inia.es
E. Gil-Pelegrín
Centro de Investigación y Tecnología Agroalimentaria de Aragón (CITA de Aragón), Av.
Montañana 930, 50059, Zaragoza, Spain
M. A. Guevara J. F. Cano P. Perdiguero A. Soto M. T. Cervera C. Collada
Unidad Mixta de Genómica y Ecofisiología Forestal, INIA/UPM, Madrid, Spain
J. F. Cano P. Perdiguero A. Soto C. Collada
GENFOR Grupo de investigación en Genética y Fisiología Forestal, Universidad Politécnica
de Madrid, E-28040, Madrid, Spain
J. J. Peguero-Pina
Department de Biologia, Universitat de les Illes Balears, Ctra. Valldemossa km 7.5, 07122,
Palma de Mallorca Illes Balears, Spain
R. Aroca (ed.), Plant Responses to Drought Stress, 293

DOI: 10.1007/978-3-642-32653-0_12, Ó Springer-Verlag Berlin Heidelberg 2012
294 I. Aranda et al.
to increase the dehydration tolerance of tissues (e.g., osmotic adjustment) have

played an important role in the development of specific adaptations under water
limiting conditions. The adaptive changes are observable at different scales: from
the population to the species, from the individual to the gene. The advance of high-
throughput technologies will enable to unveil the complex interplay between
phenotype and genotype. Genomic, proteomic, transcriptomic, and metabolomic
approaches are beginning to bring light to the molecular basis of adaptation to
drought in forest tree species. These new technologies, combined with more tra-
ditional approaches, will improve our current knowledge of the functional and
molecular basis underlying adaptation and evolution of forest tree species living
under dry environments. In this respect, this chapter covers some aspects of
adaptation to drought at different integrative levels, from an ecophysiological
perspective to a molecular-based point of view.
12.1 Introduction
Forest tree species are considered some of the most long-living organisms. During
their long lifetime, and considering their substantial developmental plasticity, trees
need to overcome the restrictions imposed by harsh dry land media. This is
probably one of the most relevant properties that make them ideal models to
understand the complexity of adaptive processes through the life cycle of plants.
Within the plant kingdom, forest tree species cover a particular ample range of
adaptive solutions to the challenges of terrestrial media. The mid Devonian
marked the appearance of true trees with homoisohydric lifestyle. Since then, the
maintenance of a proper water economy has been one of the main challenges for
these plant organisms in order to thrive under environments highly limited by
water availability. The importance of this factor shaping forest landscapes was
already recognized by naturalists of the nineteenth century such as Alexander von
Humboldt (von Humboldt and Bonpland 2009). Water availability was soon
viewed as the most important factor eliciting segregation of forest tree species
along gradients of soil moisture availability.
The control of the hydration of tissues within ranges that are compatible with
their functionality is important for any tree species. Though, various degrees of
tolerance to the dehydration of leaf tissues have been developed within different
phyla relying on common processes, such as osmotic adjustment or the regulation
of water losses by an efficient stomatal control. In addition, forest tree species have
required the evolutionary development of an efficient hydraulic system for trans-
porting water from soil to leaves in order to control the hydration of aerial tissues.
This system must fulfill the compromise of conductance efficiency versus security
against the loss of its functionality in response to stressful conditions (Tyree and
Sperry 1989; Aranda et al. 2005; Brodribb and Cochard 2009). The maintenance of
the hydraulic function versus an optimum carbon balance could be the basis to
12 Drought Response in Forest Trees 295
understand survival and growth in most forest tree species (Breshears et al. 2009;
McDowell 2011); but especially under dry conditions, where the optimum per-
formance of both functions may be highly threatened and conditioned by bio-
physical compromises (McDowell et al. 2008).
In the last decades, an increasing number of reports have pointed out that some
forests might become more vulnerable to drought in the close future (Seager et al.
2007; Allen et al. 2010). An increased vulnerability may not be only a conse-
quence of the direct effect of dryness intensification in some areas, but also the
result of the interaction between dry periods and other climatic factors, such as
higher temperatures (Adams et al. 2009). Drastic changes in forest species com-
position in response to intense drought events have been already reported in dif-
ferent forest ecosystems worldwide in the last decades (Breshears et al. 2005,
2009). In other cases, altitudinal displacements of drought sensitive forest tree
species, from lower and drier altitudes to higher and wetter ones, have been
observed at the retreatment area in Europe (Jump et al. 2006; Peñuelas et al. 2008;
Lindner et al. 2010). Furthermore, the increase in the recurrence and intensity of
droughts is being a motive of concern even in areas of the world where dry periods
have been considered atypical, such as temperate or tropical rain forests (van
Mantgem et al. 2009; Newbery and Lingenfelder 2009; Allen et al. 2010).
Therefore, it is important to frame the study of water use by forest trees into a
proper perspective, considering not only evolutionary and ecological consequences
of drought in drier areas, but its importance for most forest ecosystems from the
Tropics to Mediterranean environments.
The analysis of drought response in forest trees may be considered at different
scales, ranging from a species level to individuals (Aranda et al. 2000, 2010;
Sánchez-Gómez et al. 2011). In this sense, forest tree species covering broad
ranges of distribution are comprised of many local populations covering a high
degree of genetic variability and adaptive solutions to cope with multiple envi-
ronmental gradients (Zhang and Marshall 1995; Aspelmeier and Leuschner 2006;
Ducrey et al. 2008). In addition, it is expected that a high degree of phenotypic
plasticity will allow long-living sessile organisms withstand different environ-
mental conditions varying from a seasonal to an annual basis (Bradshshaw 1965;
Kremer 1995). Furthermore, forest tree species have to endure very adverse
conditions such as singular extreme droughts, and throughout their life cycles
spanning several centuries in many cases. These characteristics highlight the idi-
osyncrasy of forest tree species within the plant kingdom, and make them singular
examples of adaptation to land media by a complex inter-play between mecha-
nisms of local adaptation with a genetic basis (Linhart and Grant 1996; Savolainen
et al. 2007), and phenotypic plasticity that partially relies on epigenetic mecha-
nisms (Bossdorf et al. 2008; Nicotra et al. 2010). Both genetic variation and
phenotypic plasticity are considered as fundamental to understand the future of
forest tree species in their challenge to face the Global Change (Hamrick 2004;
Kremer et al. 2010; Benito et al. 2011; Chmura et al. 2011). As a natural selection
factor, drought may have modulated the relationship between genetic and epige-
netic adaptive changes in forest tree species under water limiting conditions
(Raj et al. 2011). This turns the analysis of drought effects and the underpinning
physiological and molecular mechanisms into a task of prime importance (Neale
and Kremer 2011).
In this chapter, some basic mechanisms related to the capacity of forest tree
species to cope with drought are summarized. The response of trees under water
limiting conditions is briefly treated at different scales, from the species-specific
performance to the molecular response. The fast development of genomic, pro-
teomic, transcriptomic and metabolomic approaches is providing new insights into
the molecular basis of adaptation to drought. The combination of these lines of
research with more traditional approaches will open new perspectives in the
understanding of the functional and molecular basis of adaptation and evolution of
forest tree species in dry environments. This chapter ends with a brief overview of
these new technological approaches applied to the study of drought responses in
forest tree species. The ability to understand and advance the adaptive potential of
forest tree species in response to the expected Climate Change requires the inte-
gration of the information gathered at different scales of study in the very close
future. This chapter itself is an exercise of analyzing some aspects of drought
response at different scales in forest tree species, but, furthermore, attempts to push
forward the limits imposed by specific fields of research and investigation to the
whole understanding of this topic.
12.2 Mechanisms of Ecophysiological Response

to Drought in Forest Tree Species
Water is one of the main environmental factors conditioning the segregation of

species into different biomes across ranges of wetness. Composition of forest
ecosystems reflects different strategies and sensitivities to water stress displayed
by each species. Even in ecosystems such as tropical rainforest or temperate
forests, which are characterized by a seasonally high rainfall over most of the
growing season, water availability can modulate community structure and function
in the long term by infrequent but intense dry periods (Ciais et al. 2005; Breda
et al. 2006; Newbery and Lingenfelder 2009).
The long-living nature of trees implies that their relationship with the envi-
ronment changes throughout their life span. Environmentally induced develop-
mental changes constitute an intrinsic process of permanent adjustment of plant
performance (Day et al. 2002). Nevertheless, living for a long period of time, and
the multiple contingencies trees must cope with in terms of extreme events, may
not be enough to adequately be buffered by its phenotypic plasticity (Grether
2005). Therefore, extrinsic modifications in the habitat, due to perturbations
or degradation (Camarero et al. 2011), changes in the silvicultural practices
(Corcuera et al. 2006), or climate fluctuations (Foster et al. 2006), might lead
forest tree species to their survival limits (Linares et al. 2009). Their capability to
withstand these changes would ultimately establish the frontier between the sur-
vival of trees and their death, and relies in the adjustment of different functional
and morphological traits, especially under water stressful conditions. These
changes sum up in modifications of biomass investment in different plant organs,
development of efficient hydraulic systems from roots to leaves, an efficient
management of water losses, and the production of leaf tissues with a high degree
of tolerance to dehydration.
12.2.1 Changes in Biomass Investment
The architecture, stratification, and lateral and vertical extent of root systems are
key factors for understanding water relations of plants. Trees and shrubs clearly
have the potential for developing deeper root systems than grasses, although the
depth to which soil water depletion occurs varies widely among species (Canadell
et al. 1996; Eggemeyer et al. 2009) and sites (Meier and Leuschner 2008a). The
understanding of root system structure and function in trees is based largely on
highly controlled seedling studies (Pemán et al. 2006). However, changes in
function and allocation to roots with ontogeny must be considered when scaling
from seedlings to mature trees (Topa 2004; Poorter et al. 2012). Root depth
influences capacity to extract water from different soil horizons, being lower at the
juvenile phase. In this way, Esteso-Martínez et al. (2006) showed that the mini-
mum seasonal water potential in a stand of Quercus faginea were much less
negative in adult trees that in seedlings, results that could explain the high per-
centage of cavitation found in seedling stems.
The investment of large amounts of reserves in the development of a large and
deep root system may be considered crucial for trees in water-limited habitats
according to the optimal partitioning theory (Bloom et al. 1985). A higher parti-
tioning of biomass to belowground organs can be adaptive in relation to water
stress, as observed from the inter-population variation within some forest tree
species (Aranda et al. 2010). However, the investment in roots may condition the
amount of reserves that can be used to produce shoots for the capture of aerial
resources (Valladares and Pearcy 2002), as those under a Mediterranean type
climate (Corcuera et al. 2005). The adjustment of the root to shoot ratio has been
early recognized as a tradeoff between growth and survival under water limitations
(Monk 1966). However, the production of a large root system does not ensure
survival of trees under an extreme water deficit. Effectively, soil drought induces a
loss of root hydraulic conductivity which can be due to changes in root anatomy
(Nobel and Lee 1991), root xylem cavitation (Sperry and Ikeda 1997; Martínez-
Vilalta and Piñol 2002), or changes in the expression of aquaporins (Secchi et al.
2007). The recovery from this lack of root conductivity usually implies the
investment of new resources for reconstructing the root system (Lo Gullo et al.
1998), except for some woody plants that can recover the hydraulic conductivity
by refilling xylem conduits through the generation of positive water pressures in
the root (Tyree and Ewers 1991; Melcher et al. 2001). Recently, other mechanisms
have also been proposed for recovering the hydraulic conductivity (see Zwieniecki
and Holbrook 2009).
In addition, the ability to survive during severe drought events by shedding
expendable organs has been pointed as other mechanism to cope with water stress.
This would be at last explained in terms of a segmented vulnerability to cavitation
across plant organs. Petioles would be more vulnerable than stems, and stems more
than roots, in forest tree species that develop a low whole-plant hydraulic resis-
tance such as Acer saccharum Marsh. (Tyree et al. 1991), Junglans regia L. (Tyree
et al. 1993) or Acer saccharinum L. (Tsuda and Tyree 1997). However, petioles of
the strict riparian Betula occidentalis Hook showed lower vulnerability to cavi-
tation than stems, and stems were less vulnerable than roots (Sperry and Saliendra
1994). On the other hand, no differences in vulnerability were reported for other
forest tree species (e.g., three Quercus species in Cochard et al. 1992).
12.2.2 Hydraulic System and Response to Water Stress
The movement of water according to a gradient of water potential through the

xylem starts as water reaches the root stele. At this point, water moves through a
path of conduits (Fig. 12.1) overcoming the hydraulic resistance imposed to water
flow by very narrow elements, as explained by the Hagen–Poiseuille law (Tyree
and Zimmermann 2002). According to Sperry et al. (2003), the restriction to flow
through the nonvascular and vascular pathway can be of similar magnitude if
expressed as conductances (volume flow rate per pressure difference) in well-
watered plants, whereas the radial barrier to water movement in the roots shows an
intrinsically low conductivity (volume flow rate per pressure gradient per cross-
sectional area).
As a consequence of tree height growth, the hydraulic path is lengthened (King
1990), so a decrease in leaf-specific hydraulic conductance results due to the
increased path length (Barnard and Ryan 2003). Accordingly, it has been proposed
that tree growth may be hydraulically limited due to the drop in water potential
through the path (Ryan and Yoder 1997; Becker et al. 2000; Ryan et al. 2006;
Sperry et al. 2008). The diameter of conduits has been reported to increase with
tree height (Zach et al. 2010), branching order (Mayr et al. 2003), or tree age
(Corcuera et al. 2004a) as a way to increase the efficiency of the xylem to transport
water. Nevertheless, drought can affect negatively the average diameter of xylem
conduits as a plastic response that induces an unbalance between demands and
flow, which may result in damaging consequences for plant survival (Corcuera
et al. 2004b).
Significant differences in the vulnerability to xylem cavitation have been
reported for a wide range of species widespread from tropical rain forests to
deserts; resulting that those species showing higher drought tolerance generally
exhibit hydraulic systems more resistant to cavitation (Maherali et al. 2004;
Fig. 12.1 Water transport pathways through trees following a classical Ohm’s Law analogical
representation. Resistances may be dynamically modified by cavitation (CAV) and refilling
(REF) processes, ion-mediated changes of hydrogel configuration in inter-conduit pits (ION), or
aquaporin gating (AQP) against environmental changes. In addition, some other components as
the extra-vascular xylem resistance (Rextra-) and the resistance of the mesophyll (Rmesophyll) may
be additionally decomposed into apoplastic (Rapo-), symplastic (Rsymp-) and trans-membrane
(Rtrans-) components as it is represented for radial root resistance (Rradial). Water storage has been
included as a series of capacitors (C) within different plant tissues (Cleaf and Cradial). Rest of
abbreviators represent: gs (stomatal conductance to water vapor), gb (boundary layer conduc-
tance), E (transpiration), VPD (vapor pressure deficit between leaf and air), Wleaf (leaf water
potential), Wsoil (soil water potential). The relative size of each element is not proportional to its
real average magnitude
Brodribb and Cochard 2009). In general, a functional tradeoff between hydraulic

efficiency and safety, comprising support and water storage, results from consid-
ering the water transport through the xylem pipeline (Tyree and Zimmermann
2002), their size distribution (Vander Willigen and Pammenter 1998), configura-
tion of pit membranes (Zwieniecki et al. 2001; Pittermann et al. 2006; Jansen et al.
2011), and the intrinsic mechanical reinforcement against lumen implosion (Hacke
et al. 2001, 2005). In short, very small dimensional changes (e.g., vessel diameter,
parenchyma cells volume, and pit structure) drive substantial changes in hydraulic
conductivity, water storage capacity, and resistance to cavitation (Fig. 12.1).
Bhaskar et al. (2007) found that closely related species may strongly differ in
terms of hydraulic conductivity, being higher in those living under drier climates.
Hence, the increase in the efficiency of the xylem would serve as a way to cope
with an extreme water flow demand through the plant under very high vapor
pressure deficit conditions. Nevertheless, very early studies on plant hydraulics
already showed that wider conduits, such as those formed during the early annual
growth in ring-porous tree species, are extremely vulnerable to freeze–thaw-
induced cavitation (e.g., Cochard and Tyree 1990; Lo Gullo and Salleo 1993).
Recently, Peguero-Pina et al. (2011) compared tracheids dimension in two Med-
iterranean fir species with a strong phylogenetic link, resulting that the better
adapted species to drier environments (Abies pinsapo) show wider tracheids than
Abies alba, which is commonly found under wetter climatic regimes (Peguero-
Pina et al. 2007). However, the size of A. pinsapo tracheids makes this species very
sensitive to frosty winters imposing a high number of freeze–thaw cycles (Mayr
et al. 2003), which is a typical characteristic of montane climatic regimes where its
congeneric species live. On the other hand, some recent evidence indicates that
these wider conduits are also more vulnerable to drought-induced cavitation
(Pittermann et al. 2006); so, a tradeoff between safety and efficiency shapes
tracheids when both drought and freeze are considered (Martínez-Vilalta et al.
2002; Peguero-Pina et al. 2011).
The resistance of xylem to functionality loss is not the only important trait for
understanding drought tolerance of forest tree species. Recovering after water
stress is also relevant in the short and long terms. This may be mediated by
development of new xylem, or by restoring the function of previously embolized
vessels (Resco et al. 2009; Brodribb et al. 2010). Although the refilling of em-
bolized vessels is still far from being completely understood, this mechanism
should be considered at least as important as the runoff of cavitation. Experimental
evidence shows that plants are able to repair embolized xylem conduits by exerting
enough root pressure during the night and/or along rainy seasons (Sperry et al.
1987; Hacke and Sauter 1996), or by pushing water from living conduit-associated
parenchyma cells into gas-filled lumina when the bulk of water-transporting xylem
is still under tension (novel refilling, Hacke and Sperry 2003; Bucci et al. 2003).
The specific mechanisms of refilling are beginning to be elucidated. It seems to
require the hydraulic isolation of embolized conduits, and some changes in the
sugar metabolism of vessel-associated cells (evidenced through an observed
consumption of starch) to provide the necessary driving force for water. In fact,
novel refilling might be simplified to a particular case of phloem unloading
(Nardini et al. 2011). A different refilling rate has been reported across several
forest trees species (e.g., Hacke and Sperry 2003); and it has been suggested that
refilling under tension might be operated somehow different in conifers, given its
markedly different wood anatomy from angiosperms (Borghetti et al. 1991). In
short, embolism repair may be more likely to occur in organs where there is a
closer contact between phloem, xylem and other involved living cells, and/or if
conduits are narrower and shorter (Clearwater and Goldstein 2005). Although
there is much research to be performed in order to fully address this hypothesis,
refilling might be more likely to occur in conifers, monocots, and protoxylem
conduits, than in dicots, angiosperms, and metaxylem; as well as in smaller distal
organs or leaf veins where cavitation vulnerability is also higher. Considering this
hypothesis, xylem structures developed under drought conditions might be also
tested for higher refilling occurrence.
Once water arrives to the leaves, it still flows through the xylem across their
veins. As they are made up of xylem tissue, petioles (Bucci et al. 2003) and leaf
veins (Nardini et al. 2001; Salleo et al. 2003) are also vulnerable to cavitation
whether water flow to the atmosphere is high enough to generate critical water
potential drops. Leaf hydraulic properties are receiving a special attention by plant
physiologists that are unraveling the mechanism for preserving the integrity of
other organs by limiting transpiration during water stress (Brodribb and Holbrook
2003; Zufferey et al. 2011). Considering the full hydraulic path, the hydraulics of
the leaf lamina accounts for about the 25 % of the whole-plant resistance to water
flow on average (Sack et al. 2003). This particular highlights the importance of any
hydraulic dynamic change to whole-plant water balance, such as molecular
mechanisms involved in aquaporin gating within the mesophyll of leaves (Shatil-
Cohen et al. 2011). For instance, regulation of leaf hydraulic conductivity by light
and mediated by aquaporin expression, would be a species-specific molecular
mechanism allowing a fine tuning of water movement into the leaf lamina
according to the light environment (Cochard et al. 2007; Baaziz et al. 2012). In
addition, the resistance against water flowing out of the xylem to the nonvascular
pathway of the leaf is also of major importance for understanding the overall
contribution of leaves to whole-plant hydraulic resistance (Sack and Holbrook
2006; Johnson et al. 2009); especially, if the conclusions supported in Brodribb
et al. (2005) relating leaf hydraulic conductivity and photosynthetic capacity are
taken into consideration. In fact, leaf hydraulic conductance itself has been also
addressed as highly coordinated with both stomatal conductance and net assimi-
lation rate (e.g., Aasamaa et al. 2001 or Brodribb and Holbrook 2006). This
coordination would be of major importance under water stress conditions (Shatil-
Cohen et al. 2011).
12.2.3 Stomatal Control of Water Loss
Plants lose at least 100 times more water than they are able to gain carbon by gas
exchange through stomata. Thus, net carbon assimilation is a very expensive
process in terms of water consumption. While most assimilated carbon dioxide is
integrated within tree biomass, water has a short lifetime inside plant tissue and
requires continuous replenishment. Though nonstomatal mechanisms such as the
leaf cuticle resistance plays an important role in limiting leaf water losses, prob-
ably stomatal regulation is the main point control in water use. Leaf stomatal
closure is a common plant mechanism for water saving in drought stress periods at
the expense of reducing net CO2 assimilation (Chaves et al. 2003; Peguero-Pina
et al. 2009). Moreover, stomata respond to very different environmental stimuli,
and even within the same forest ecosystem it is possible to find a full range of
strategies regarding water economy under drought conditions, varying from iso-
hydric or ‘‘water saving’’, to anisohydric or ‘‘water spender’’ performance (Breda
et al. 2006). However, in the last years, the idea that leaf stomatal control in forest
tree species is constrained by the need to maintain the hydraulic function versus an
optimum carbon balance has gained force (Campanello et al. 2008). In species
with secondary growth, but especially in forest trees, maintenance of the hydraulic
system within safety margins from water-stress-induced embolism is of prime
importance (Tyree and Sperry 1989). Woody plants have shown their ability to
avoid the partial cavitation of their xylem through a fine stomatal control of xylem
pressures (Jones and Sutherland 1991). This regulation would be especially rele-
vant under dry conditions where optimum in both functions is more threatened and
conditioned by biophysical compromises (McDowell 2011). This has conducted to
propose either hydraulic failure or carbon starvation (although see Sala et al.
2010), as the mechanistic basis explaining the phenomena of mortality after
intense periods of drought (McDowell et al. 2008). In both processes, the particular
strategy of forest tree species regarding stomatal regulation of water losses would
be the keystone.
A consequence of stomatal closure under water stress to prevent a catastrophic
loss of hydraulic conductance, and to minimize dehydration of leaf tissues, is an
overheating of leaves. In addition, an excess of excitation energy cannot be
directed to the photosynthetic electron transport chain (Demmig-Adams and
Adams 1996). Electrons not consumed in CO2 fixation may react with O2 gen-
erating reactive oxygen species and increasing the possibility of oxidative damage.
Under these conditions, both the pH and the de-epoxidation state of the xantho-
phyll cycle pigments increase, protecting the photosynthetic apparatus through a
mechanism that dissipates excess of light as heat (Demmig-Adams and Adams
1996; Li et al. 2000a; Morales et al. 2006). However, there is no evidence for
major sustained photodamage in water-stressed plants, as judged by the lack of
effects of drought on the maximum potential PSII efficiency (FV/FM) even for very
stressed leaves (Morales et al. 2006 and references therein). On the other hand,
recent studies show evidence of drought-mediated down regulation of FV/FM in
some Mediterranean forest tree species (Peguero-Pina et al. 2009), which seems to
be related to an additional photoprotective mechanism that may play an important
role for survival of species living in sites with long and intense summer drought
periods.
12.2.4 Increase of Tolerance to Dehydration

of Leaf Tissues
Besides mechanisms to optimize water capture, transport and control of losses under
drought, forest tree species, as other plants, have developed means to increase the
tolerance to dehydration of their tissues. Differences in leaf osmotic adjustment
capacity, a well-known mechanism to increase drought tolerance in plants, fre-
quently reflect also the dryness of the species habitat (Abrams 1988; Corcuera et al.
2002). Even within the same stand, it is possible to find forest tree species with a
marked differentiation in tolerance to dehydration of their leaf tissues, reflecting
different functional strategies regarding water economy. In this regard, Lenz et al.
(2006) found in a meta analysis a good correlation between the osmotic potential at
full and zero turgor and the degree of tolerance to drought for the pool of species
analyzed. They found a continuous range of responses, with species originating from
xeric sites showing lower values of leaf osmotic potential than those from wet sites
(Abrams 1988). Relevance of the osmotic properties in leaf tissues is present even for
ecosystems where drought is not a permanent handicap for growth and survival, as
temperate forests, but where species from the same functional group maintain a
different degree of leaf tolerance to dehydration through the same range of water
stress and according to the species drought resistance (Fig. 12.2).
Differences in leaf osmotic potential at full turgor are underpinned by a com-
plex molecular expression of different metabolites with osmotic activity. Important
variations have been observed in the kind and amount of the metabolomic profiling
according to the species and degree of water stress endured (Merchant et al. 2006;
Warren et al. 2011, 2012), and with important consequences from the point of
view of species strategy regarding drought adaptation (see Sect. 12.4.3).
12.3 Genetic and Phenotypic Variation

in Response to Drought
In the last decades, study of forest tree response to drought has focused mostly in the
functional analysis at the specific level (i.e. Breda et al. 2006). Though, in the case of
forest tree species characterised by a high intra-specific variability, analysis of the
response of different populations deserves especial consideration. The wide geo-
graphical range of many forest tree species suggests maintenance of a large adaptive
genetic variability (Aitken et al. 2008; Savolainen et al. 2007). Species-specific
response to drought would be modulated by the differential capacity of local popu-
lations to cope with water stressful environments. Consistently, differential response
to drought has been reported for different geographical origins (Burczyk and Gier-
tych 1991; Zhang et al. 1993; Lauteri et al. 1997; Ares et al. 2000; Ramírez-Valiente
et al. 2009), and even within the same local population offspring from different
Fig. 12.2 The leaf osmotic potential at full turgor (p100- MPa) is a good trait indicative of the
leaf dehydration tolerance, even for seedlings of temperate forest tree species not adapted to dry
environments. The parameter can be used as a proxy of tolerance to drought by different forest
tree species (Lenz et al. 2006). Each line depicts a decreasing trend of p100 with leaf predawn
water potential (Wpd) as surrogate of the effective water stress endured by seedlings. Fagus
sylvatica (continuous line) maintained a higher value of p100 whichever the Wpd compared to the
two oak species: Quercus petraea (dotted line) and Quercus petraea (dashed line). Redrawn from
data in Aranda et al. (2001, 2002, 2004), Robson et al. (2009), Rodríguez-Calcerrada et al. (2010)
mother trees shows dissimilar performances (Major and Johnsenn 1996; Major and
Johnsenn 1999; Aranda et al. 2010).
Changes reported recently for some forestlands seem to have been abrupt as a
consequence of sporadic, but very intense droughts that have modified the com-
petitive relation among species in a few years (Ciais et al. 2005; Breshears et al.
2005; Allen et al. 2010). Reports of drastic changes in the composition of forest
vegetation seem already to confirm current standing genetic variability would not
be enough to suit to the new environments (Hamrick 2004; Kremer 2010).
Widespread phenomena in the last decade of forest die-back, increase in mortality
rates, and altitudinal displacement are examples that seem to confirm local pop-
ulations could not keep enough adaptive potential to overcome the awkward sit-
uation brought about by an increase in the dryness at the local scale. The issue is
especially relevant for populations close to the trailing edge of the species dis-
tribution, and where larger changes in thermal and moisture regimes are expected
in the next decades (IPCC 2007). This is the case, for instance, in some countries
surrounding the Mediterranean basin where some changes in forest systems are
already beginning to be observed (Peñuelas et al. 2001; Martinez-Villalta and
Piñol 2002b; Jump et al. 2006; Peñuelas et al. 2008; Linares et al. 2010).
Therefore, knowledge of the intra-specific variation in drought response emerges
as a need for a better understanding of the microevolutive changes that could affect
the sustainability of forest tree species in new climate contexts.
12.3.1 Within-Species Variability in Functional Traits

Related to Drought
Forest tree species maintain high degrees of intra-specific adaptive variability for
traits related to growth or phenology (Jensen 1993; Meier and Leuschner 2008b;
Chambel et al. 2007; Vitasse et al. 2010), and with a wealth of examples dealing
with specific local adaptation and variability in quantitative traits responding to
different stresses, particularly drought (Aranda et al. 2005; Savolainen et al. 2007;
Kremer et al. 2010). Well known is the high within-species genetic variability in
phenotypic traits responding to water stress, such as water-use efficiency in
Populus sp (Ceulemans and Impens 1980; Bassman and Zwier 1991; Monclus
et al. 2006), Eucalyptus sp (Li et al. 2000b), Pinus sp. (Cregg and Zhang 2001;
Guy and Holowachuk 2001; Voltas et al. 2008; Aranda et al. 2010;), Pseudostuga
sp. (Zhang et al. 1993) or Quercus sp. (Arend et al. 2011). This variability has been
the point of attention for tree breeding programs from the middle of the twentieth
century (Langlet 1971; König 2005).
Although information related to the within-species functional response to water
stress is scarcer than for growth or phenology, it is enough to conclude that it
might be also under genetic control. Besides recognizing the expression of most
functional traits is mostly conditioned by the environment, the genetic variation
also underlies expression of different functional traits such as water use efficiency,
stomatal control of water losses or net photosynthesis under a common environ-
ment (Table 12.1). Variation is observed at different genetic levels from popula-
tion (Zhang and Marshall 1995; Benowicz et al. 2000; Ducrey et al. 2008) and
open pollinated families within the same population (Prasolova et al. 2001), to
clones (Aspelmeier and Leuschner 2006; De Miguel et al. 2012).
Genetic variance is high, for instance, when analyzing the expression of traits
such as carbon isotope discrimination (D13C) related with intrinsic water-use
efficiency (Zhang et al. 1993; Flanagan and Johnsen 1995; Prasolova et al. 2001;
Voltas et al. 2008). No matter the high phenotypic variance reported for drought
response, the proportion of this variance attributable to genetic factors is usually
just moderate. In general, moderate values are found for narrow sense heritability
in D13C (the proportion of total variance attributable to additive genetic variance),
as well as for other drought stress-related traits (Brendel et al. 2002). Analogously,
relatively high QST values (genetic parameter used as surrogate of distance among
populations in quantitative traits) have been also reported for morpho-functional
traits. This indicates a moderate among-population genetic differentiation for
drought tolerance in some forest tree species (Ramírez-Valiente et al. 2009).
The relationship between the expression of morpho functional and growth traits
and fitness is inferred from genetic correlations on most cases, but in general it is
recognized functional traits could be submitted to strong selective pressure (Lamy
et al. 2011). Traits such as water use efficiency, leaf size, or osmotic adjustment
capacity, would maintain a putative adaptive value according to the environment,
but especially in dry areas with a direct impact on plant fitness. The ecological and
Table 12.1 Variation within forest tree species of physiological and morphological traits related to drought response has been frequently reported at
306
different genetic levels

Species Genetic level Characters Level of Reference
variation
Pseudotsuga menziesii Population Gas exchange, carbon isotope discrimination Moderate Zhang et al. (1993)
(Douglas-fir)
Picea abies (Norway spruce) Populations Growth parameters Low Burczyk and Giertych (1991)
Castanea sativa (Chesnut) Population Gas exchange, water use efficiency Low Lauteri et al. (1997)
Pinus sylvestris (Scotch pine) Population Gas exchange Low Cregg and Zhang (2001)
Alnus sinuata (Sitka alder) Population Gas exchange, growth Moderate Benowicz et al. (2000)
Betula papyrifera (Paper
birch)
Fagus sylvatica (Beech) Population Gas exchange, metabolites, and ABA Moderate Peuke et al. (2002) and Robson et al.
(2012)
Thuja plicata (Western red Population Gas exchange, water use efficiency Low Grossnickle et al. (2005)
cedar)
Cedrus brevifolia, C. libani Population Gas exchange, carbon isotope discrimination, and Low Ducrey et al. (2008)
(Cedrus) hydraulic traits
Pinus pinaster (Maritime Population Hydraulic system and xylem embolism Low Corcuera et al. (2011)
pine)
Picea glauca (white spruce) Families Gas exchange, chlorophyll fluorescence Low Bigras (2005)
Pseudotsuga menziesii Families Hydraulic system and xylem cavitation, growth Moderate Anekonda et al. (2002)
(Douglas-fir) parameters
Picea mariana (Black spruce) Family Carbon isotope discrimination Moderate Flanagan and Johnsen (1995)
Larix occidentalis (Western Family Gas exchange Low Zhang et al. (1994)
Larch)
Fagus sylvatica (Beech) Family Gas exchange, water use efficiency Low Leonardi et al. (2006)
Pinus pinaster (Maritime Population/ Hydraulic system and xylem embolism Moderate Lamy et al. (2011)
pine) family
Populus deltoides (Poplar) Clones Osmotic adjustment Moderate Gebre et al. (1994)
(continued)
I. Aranda et al.
Table 12.1 (continued)
12
Species Genetic level Characters Level of Reference

variation
Hevea brasiliensis (Rubber Clones Gas exchange, xylem embolism Moderate Sangsing et al. (2004)
tree)
Betula pendula (Silver birch) Clones Growth parameters Moderate Aspelmeier and Leuschner (2006)
Populus deltoides 9 nigra Clones Carbon Isotope discrimination High Monclus et al. (2006)
(Poplar)
Populus tremula (Common Clones Growth parameters, Gas exchange High/ Possen et al. (2011)
Aspen) moderate
Betula pendula (Silver birch)
Pinus pinaster (Maritime Clones Gas exchange, intrinsic water use efficiency Moderate De Miguel et al. (2012)
Drought Response in Forest Trees
pine)
Although functional response is under high environmental influence, its control through experiments in common garden tests, or greenhouse and climatic
chambers where environment is standardized, allows ascertaining different functional strategies by different genetic backgrounds. Level of variation for
population was graded only as low or moderate
307
evolutionary importance of morpho-functional traits, spanning from changes in

biomass partitioning to gas exchange or water parameters, and in response to water
limiting environments, has been tested for a wide range of annual model species or
crops. Results are expressed in terms of the expression of a specific phenotype
jointly a better performance under drought, and increase in fitness by using growth,
reproductive success, or harvest index in crops as biological success indexes
(Dudley 1996; Donovan et al. 2009). However, there is currently still little
information available regarding forest tree species (Brendel et al. 2008; Scotti
et al. 2010; Ramírez-Valiente et al. 2011; Lamy et al. 2011).
12.3.2 Genetics and Phenotypic Plasticity in Tracking

Future Environmental Changes
The key point in the future maintenance of local populations coping with drier
environments will be given by both the genetic variability and phenotypic plas-
ticity facilitating adjustment to the new environmental conditions (Abrams 1994;
Hamrick 2004). New expectations have emerged during the last years in relation to
this issue in the face of climate change. Natural forest tree populations are
advocated to the extirpation, migration (by tracking the environmental change), or
adaptation in relation to the new environments (see Aitken et al. 2008 and Kremer
et al. 2010 for a compressive review). In respect to the adaptive potential, it has
been highlighted recently that adaptive differentiation between extant populations
of forest tree species can be fast (Kremer et al. 2010). However, the speed of the
expected change will likely be faster than generation turnover for most forest tree
species. Such a high speed could override the potential to generate new recom-
binants better adapted to the future conditions. This leaves phenotypic plasticity
within populations as one of the main evolutionary mechanisms to cope with the
new climate contexts (Nicotra et al. 2010). Thriving under the new climatic
contexts at the local scale will therefore rely on the degree of genetic polymor-
phism in adaptive traits, phenotypic plasticity or both within populations (Nicotra
et al. 2010). Whichever the mechanisms acting first on the process of adaptation,
both probably will play an important role for forest tree populations to adjust to
more water stressed environments in the future. Albeit, it has been outlined that the
extent of phenotypic plasticity blurs in some cases, the importance of local
adaptation when considering the functional response to drought (Baquedano et al.
2008, Gimeno et al. 2009), highlighting the major effect of the environment in the
phenotypic variance and, particularly, the strong genotype x environment inter-
actions. Thus the capability of a genotype to acclimate to different environments,
showing different phenotypes (plasticity), seems to be a noteworthy feature of
forest tree species, in which epigenetic factors likely play a key role in adaptive
terms further than the mere molecular basis of the acclimation response (see below
and Bossdorf et al. 2008 or Raj et al. 2011).
12.3.3 Interaction of Drought With Other

Environmental Factors
Differentiation among and within forest tree species in the response to drought is
given by the expression of some of the aforementioned traits, which are mainly
related to delaying or minimizing dehydration of tissues. The univariate point of view
in approaching the water-stress response has been embraced in most studies ana-
lyzing drought response, in ecological (Ogaya and Peñuelas 2007; Vilagrosa et al.
2010), functional (Aranda et al. 2000; Brodribb and Holbrook 2003; David et al.
2007), or evolutionary contexts (Eveno et al. 2008; Grivet et al. 2011). This view
avoids the biological and ecological reality of the multifactor world perceived by
most biological organisms, and tree species in particular (Niinemets 2010). How-
ever, this response, as others related with the impact of limiting nutrients, light or salt,
are commonly viewed in evolutionary and ecological terms from a single-factor
perspective, relating the observed response to the capacity to cope with scarcity of the
considered factor. Actually, from a functional and ecological point of view, we must
keep in mind there is a complex interplay between different abiotic and biotic factors
in shaping the response to drought. An example is given, for instance, by the inter-
action between light and water stress on some specific mechanisms related to drought
tolerance as the osmotic adjustment capacity (Fig. 12.3). There are other examples
showing a nonadditive action of factors such as light, water, nutrients, temperature or
atmospheric CO2 concentration over the expected expression, and assemblages of
physiological, morphological and even molecular traits (Ellsworth and Reich 1992;
Valladares and Pearcy 1997; Mittler 2006; Eller et al. 2011). This adds a new point of
complexity to the interpretation of functional and morphological traits responding to
water stress. The interaction with biotic agents, indeed potentially relevant, is out of
the scope of the present review.
12.4 Molecular Foundations of Drought Response

in Forest Tree Species
Drought response in forest tree species relies on changes at the molecular level that
represent the lowest scale in the biological integration range. However, it is an
additional step in the understanding of the overall response, maintaining important
connections with the phenotypic and genetic levels previously described. The
complexity of the interrelations between different molecular processes is now
beginning to be specifically elucidated for some model forest tree species. However,
thanks to the development of high-throughput technologies, and a higher degree of
interaction among different fields of research, more knowledge is generated about the
complex interplay between phenotype and genotype and water stress responses. In
the next years, these advances probably will impact our understanding of the
responses to drought by forest tree species in ecological and evolutionary contexts.
Fig. 12.3 A decrease in osmotic potential at full turgor (p100) has been considered traditionally a
mechanism of increasing tolerance of leaf tissues to dehydration. It is present even for temperate
forest species such as beech. However, this mechanism of drought tolerance is hindered by light
limiting conditions, eventually restraining the capacity to maintain leaf turgor under water stress
conditions. In the graph it is shown the negative relationship between osmotic potential at full turgor
versus predawn water potential, the last as a proxy of the water stress endured by beech seedlings.
Black points represent seedlings growing with high light levels in a gap of a natural stand, and white
points represent seedlings growing in the understory (modified from Robson et al. 2009)
12.4.1 Dissecting the Genetic Foundations of Response

to Drought
12.4.1.1 Identification of Quantitative Trait Loci and Candidate Genes

Involved in Drought Stress Response Using Association Analysis
in Forest Tree Species
Drought stress response is a complex biological process. Thus, combination of

genomic and physiological studies is required to advance knowledge in this field
(Fig. 12.4a, b). Two forward-genetic phenotype-based strategies have been used to
start unraveling genetic control of this complex response (Fig. 12.4b). Family
based quantitative trait loci (QTL) mapping can be applied to search for associ-
ations between markers and phenotypes in pedigrees from crosses among geno-
types with a contrasting response to drought. Alternatively, we can use population-
based association mapping, with populations of unrelated individuals to examine
associations between single nucleotide polymorphisms (SNPs) and phenotypes.
Fig. 12.4 A comprehensive understanding of plant response to environmental modification (i.e.,

drought stress) will require integrating data from different levels of biological organization,
whose study is addressed by different ‘‘omics’’ disciplines. a Schematic of the ‘‘omic’’ hierarchy
and integration. b A flow sheet summarizing the most common strategies employed to identify
and validate a candidate gene using forest tree models. Association analysis and genome-wide
association studies GWAS; QTL analysis
Detection of QTL depends on the size of the mapping progeny, genetic back-
ground, heritability of the trait under study, coverage, and saturation of the genetic
map as well as genotype by environment interactions. QTL analysis has been
applied to identify genome regions involved in the genetic control of drought
response of different model forest tree species, evaluating different phenotypic
traits of materials grown in different experimental layouts. QTL have been
detected for, among other traits, carbon isotope discrimination in F1 individuals
from intra-specific crosses of Castanea sativa (Cassasoli et al. 2004) and Quercus
robur (Brendel et al. 2008), in three consecutive years. Comparative analysis
between these two studies, based on a set of orthologous markers, revealed that no
QTL for carbon isotope discrimination was conserved between both Fagaceae
species (Casasoli et al. 2006). In Salicaceae, response to drought stress was also
analyzed in a hybrid F2 progeny of Salix dasyclados 9 Salix viminalis (Rönnberg-
Wästljung et al. 2005). In poplar, two different studies used an F2 progeny of
Populus trichocarpa 9 P. deltoides, to analyze QTL for osmotic potential
(Tschaplinski et al. 2006), and leaf coloration (chlorophyll and carotenoid con-
tent), expansion, and abscission (Street et al. 2006). The latest study also integrated
transcriptomics, searching for positional candidate genes (CGs)—genes co-local-

izing with QTL for the parameter evaluated, in many cases supported by previous
functional description in other species. In Eucalyptus sp., Teixeira et al. (2011)
have detected QTL related to drought response in a hybrid Eucalyptus gran-
dis 9 E. urophylla F1 progeny. QTL analysis for drought response in Pinaceae has
been approached in Pinus pinaster, species characterized by a significant genetic
and adaptive diversity (Eveno et al. 2008). Brendel et al. (2002) analyzed an intra-
specific F2 progeny whose grandparents showed a differential response to drought
in terms of d13C on growth rings.
A way to validate QTL is through comparative mapping. Most of the QTL
analyses described above revealed QTL for different traits, which have been
detected across different years. It is important to highlight that overlapping QTL
among drought-related traits have been observed. Such co-locations indicate that
the shared QTL clusters may indicate pleiotropic effects. Additionally, correlations
between drought-related traits have been observed which may be attributable to
either pleiotropic effects of single genes or to tight linkage of several genes that
individually influence specific traits (Pelgas et al. 2011). However, up to now,
comparison of QTL among different genetic backgrounds (families or species) has
been difficult due to the limited number of orthologous markers among unrelated
mapping families or species (Casasoli et al. 2006), as well as due to the different
experimental procedures and phenotypic/physiological parameters used to evalu-
ate drought response. The standardization of experimental procedures together
with the use of high-resolution genetic maps will allow generalizing this approach
(Neale and Kremer 2011). For instance, the work on Q. robur (Brendel et al. 2008)
revealed a major QTL for water-use efficiency in the same linkage group where
other analysis found a major linkage group for stomatal density (Gailing et al.
2008). Allelic variants, associated with mapped SNPs, may be analyzed in asso-
ciation population to unravel these two effects.
Power for QTL detection depends on the number of generations. Most forest
trees are highly heterozygous outbred plant species. Due to their long generation
time, QTL analysis of forest trees has been mainly carried out using F1 progenies
or, in the better cases, three generation populations, limiting accuracy of these
QTL analyses. Different strategies have been developed to increase the power of
QTL detection for forest tree species (Plomion et al. 2007). The relatively low
number of individuals in several forest tree mapping progenies also negatively
influences the accuracy of calculated QTL effects and the power to detect QTL
with small effects. However, this may be, to some degree, compensated by the use
of ramets of each individual that provide higher precision in the phenotypic
screening. Precision of phenotypic measurements is an important factor for QTL
mapping, because a high measurement error reduces the estimated heritability and
decreases the detection power. Nowadays, the use of high-throughput genotyping
techniques allows construction of highly dense genetic maps, most of them inte-
grating high numbers of gene-based markers, including markers transferable
across pedigrees. The use of highly dense genetic maps and more precise phe-
notyping protocols will increase precision of QTL detection by narrowing down
the intervals to small regions. Additionally, integration of complementary infor-

mation such as expression analysis (expressional QTL—eQTL), proteomics,
metabolomics, and epigenomics (i.e., Drost et al. 2010; Morreel et al. 2006; He-
nery et al. 2007; Long et al. 2011), will provide a more comprehensive view of
mechanisms underlying drought response in forest tree species, highlight putative
CGs and corresponding alleles involved in such a response.
Population-based association mapping searches for associations between
genetic markers and adaptive traits in natural populations; thus, analyzing varia-
tion accumulated during evolution of the targeted germplasm used as a discovery
population. Linkage disequilibrium (LD) usually extends over much shorter dis-
tances in association mapping populations than in family mapping population.
Therefore, high numbers of genetic markers are needed to ensure adequate cov-
erage to detect linkage between markers and a causal locus. As the cost of
genotyping has dropped dramatically, association mapping has rapidly become a
very promising approach for the genetic dissection of complex traits in plants
(Ingvarsson and Street 2011). Association mapping has been applied to analyze
Pinus taeda drought response (González-Martínez et al. 2008). It is important to
differentiate association mapping based on analysis of CGs from the genome-wide
association studies (GWAS). The first one is based on genetic markers genotyped
at loci thought to be involved in trait expression, testing for associations between
these genetic markers and the phenotype. In plants, this approach has been suc-
cessful for CGs in relatively simple pathways and for CGs with extensive prior
evidence of a role in the phenotype of interest (Thumma et al. 2005; Ingvarsson
et al. 2008). However, drought response is a complex trait that involves genetic
control of different pathways in different tissues. GWAS implies genotyping
enough markers across the genome, so that functional alleles will likely be in LD
with at least one of the genotyped markers. The number of markers and their
density is defined by genome size and LD decay, and will therefore vary con-
siderably among species, being mainly approached for those species whose gen-
ome sequence (or at least exome sequence) is already known.
12.4.1.2 Transcriptomics
A complementary approach to the identification of drought-responsive genes is the

analysis of transcriptomic response. As reviewed recently by Vaahtera and Bro-
sché (2011), there are several processes contributing to the response to a specific
abiotic stress: post-translational activation and selective nuclear import of tran-
scription factors, regulation of DNA accessibility by chromatin modifying and
remodeling enzymes, interplay between response elements, and so on. Most of
these factors have been usually analyzed independently, due to the intricacy of the
whole process.
Analysis of the expression patterns under stress and recovery allows the
identification of expressional CGs, induced by stress. This has been the most
common approach followed to explore the molecular basis of the response to biotic
and abiotic stresses, and when functional information is lacking, provides the most
reliable CGs. Expression profiles reveal not just the genes induced by the stress,
but also the genes whose transcription is inhibited. Inhibition of transcription
shares importance with transcriptional up-regulation, as suggested by the results of
Watkinson et al. (2003) and Lorenz et al. (2006). Nevertheless, first transcriptomic
approaches to the analysis of the response to drought stress have focused on the
identification of genes overexpressed during the stress.
Prior to the development of current techniques of expression analysis and high-
throughput sequencing, researchers could deal only with few genes at a time.
Chang et al. (1996) published a pioneer work where four water deficit-induced
cDNAs were identified and characterized in loblolly pine (Pinus taeda). In an
attempt to discover a higher number of genes induced by water deficit, Dubos and
Plomion (2003) used cDNA-AFLP and reverse Northern blot in maritime pine
(Pinus pinaster), and identified 48 putative genes presumably involved in the
response to drought stress in roots. Nowadays, accurate techniques such as sup-
pression subtractive hybridization (SSH), together with the capacity to check the
expression of high number of genes at a time using microarrays provide noticeable
precision for the isolation of induced genes in stressed versus control material.
Complementarily, massive sequencing technology is much more affordable, and
analysis of the whole transcriptome under control, stress, or recovery conditions is
currently feasible. Nevertheless, for many forest tree species (mainly for Gym-
nosperms) a good annotation is not available yet, and for many genes detected this
way, even putative ones, homology-based function has not been proposed.
Among angiosperm forest trees, poplars are the main model for molecular
analysis, and even more since the release in 2006 of the complete genome of
Populus trichocarpa (Tuskan et al. 2006). Poplar species show a comparatively
fast growth and a noticeable capability for vegetative propagation, which allows
undertaking experimental procedures not applicable to other tree species. Addi-
tionally, poplar was one of the first tree species successfully transformed, both
using Agrobacterium (Fillatti et al. 1987) and gene gun (McCown et al. 1991). In
the last years, many works referred to the transcriptomic response to drought stress
of Populus species. Some of those studies have focused on the identification of
genes induced by stress (Caruso et al. 2008; Bae et al. 2010), while others
examined the expression pattern and function of specific genes (Bae et al. 2009,
2011; Chen et al. 2011). Exhaustive transcriptome studies using massive
sequencing have also been published, describing the intra-specific variation (e.g.,
Hamanishi and Campbell 2011) or comparing specific genotypes (e.g., Cohen et al.
2010). The effect of drought stress on the transcriptome of the cambial region,
where wood cells are developing, has been recently published by Berta et al.
(2010). Although not in the same depth as in poplar, transcriptomic response to
drought has also been studied in other angiosperm forest tree species. For instance,
Gailing et al. (2009) have highlighted the role of Quercus sp. as a model for forest
tree species, being one of the most important forest genera in the northern
hemisphere.
Knowledge is not so advanced for gymnosperms which display peculiar char-

acteristics that make the study of their genetic adaptations difficult. They usually
have huge genomes, with a high percentage of repeated sequences and pseudo-
genes whose functions are not well known. For instance, whereas the genomes of
Arabidopsis thaliana and Populus trichocarpa are approximately 150 and
550 Mbp long, respectively, the Pinus pinaster genome is about 30,900 Mbp,
70–75 % of which is made up of highly repeated sequences (Morse et al. 2009),
and no complete genome of a reference conifer species is yet available. Further-
more, angiosperms diverged from gymnosperms more than 300 million years ago.
Thus, to a large extent, knowledge and molecular tools developed for the former
are not readily applicable to the latter. For these reasons, the selection of CGs for
the study of adaptation in gymnosperms based solely on their homology with
angiosperm genes, without further confirmation of their participation in the stress
response, is not fully reliable. Additionally, conifers are highly recalcitrant to
transformation and vegetative propagation, limiting the sort of feasible experi-
mental designs.
Picea and Pinus are the most common model genera for conifers. In Picea,
some studies have focused on the expression patterns of specific drought-related
genes or on proteomic changes induced by drought (i.e. Blödner et al. 2007). In the
case of Pinus, several genomic studies of the response to drought have been
launched in different species, in an attempt to identify genes induced by water
deficit. For instance, Heath et al. (2002) and Watkinson et al. (2003) performed a
preliminary analysis of gene expression during drought-induced stress in P. taeda.
These authors used microarrays that included cDNAs obtained from pre-existing
libraries from the xylem, male cones and shoot tips, but did not attempt to
exhaustively identify genes induced by water stress. Other noteworthy work is the
one by Dubos and Plomion (2003), based on cDNA-AFLP in P. pinaster. More
recently, several groups have used more precise techniques for the identification of
drought-induced genes, such as comparison of EST libraries generated during
drought-induced stress and drought recovery as well as from well-watered roots
(Lorenz et al. 2006, in P. taeda), or SSH libraries, followed by microarray and RT-
PCR expression analysis (Perdiguero et al. 2012, in P. pinaster).
Genes putatively involved in the response to water deficit, identified by these
techniques or by their homology with other known genes, have been used to assess
diversity and differentiation at different taxonomical and demographic levels
regarding drought response. For instance, DNA sequence variability for drought
stress CGs has been analyzed in different populations of Pinus pinaster across a
latitudinal and precipitation gradient (Eveno et al. 2008). In the same way, dif-
ferent works have focused not on the genomic diversity but on the expressed
response. Thus, Yang et al. (2010) performed a proteomic analysis of the response
in Populus kangdingensis and Populus cathayana. Comparison of the transcrip-
tomic response in different populations has also been performed in different spe-
cies (e.g., Sathyan et al. 2005 in Pinus halepensis or Hamanishi and Campbell
2011 in Populus balsamifera). In poplar, comparisons at the individual level,
among particular genotypes, have been published (Cohen et al. 2010) or even
among ramets of the same genotype acclimated to different sites (Raj et al. 2011).
The study of the transcriptomic profiles allows identification of different
functional groups of genes related to drought response. A high proportion of genes
induced by drought stress are related to metabolism, and mainly to carbohydrate
metabolism. The accumulation of sugars has been correlated with the acquisition
of desiccation tolerance in plants, probably because sugars protect the structures
from mechanical and metabolic stresses during dehydration (Oliver et al. 2010).
Within this group genes presumably involved in the detoxification of aldehydes
generated by alcohol metabolism are found. This result is consistent with the
accumulation of ethanol in conifer seedlings during drought (Manter and Kelsey
2008). This group also includes genes related to aminoacid (e.g., proline), lipid,
fatty acid and isoprenoid metabolism, which could be involved in the synthesis and
accumulation of compatible solutes and hormones during water stress.
Another important group of genes comprises those related to defence and cell
rescue. This category includes genes coding for late embryogenesis abundant
(LEA) proteins, heat shock proteins (HSP) or dehydrins, among others. HSP are
known to act as molecular chaperones, helping in the correct folding of other
proteins and protecting them from unfolding and denaturation, and are involved in
different abiotic stresses (Wang et al. 2004). LEA proteins seem to be involved in
detoxification and may also act as chaperones, and their participation in desicca-
tion tolerance is well known (Battaglia et al. 2008). Dehydrins are a complex
family of proteins directly related to the response to water deficit and included
among the LEA proteins. They are thought to act in protecting the cell metabolism
during the stress, and have been the subject of different expression analysis in
forest tree species (e.g., Bae et al. 2009; Vornam et al. 2011).
Transport processes play an important role in the mobilisation and accumula-
tion of solutes and hormones and in cell detoxification pathways during adaptation
to water stress. Thus, sugar transporters, involved in the modification of osmotic
pressure under stress, or ABC transporters, which are involved in the response to
different biotic and abiotic stresses (Wanke and Kolukisaoglu 2010) have been
detected in drought response analysis. Aquaporins deserve special mention. These
are channel proteins located in cellular membranes and mediate water flux,
maintaining proper water balance. They can be found both in the plasma mem-
brane and in the vacuole membrane, and their expression is induced by water
deficit. Several works have focused on this protein family in forest tree species and
on its role during hydric stress recovery (e.g. Almeida-Rodriguez et al. 2010; Berta
et al. 2010).
Finally, there is a major group of proteins involved in drought stress response
that corresponds to regulation processes. Two major pathways have been described
in the plant response to abiotic stresses, including water deficit: an ABA-depen-
dent pathway, and an ABA-independent one, with complex interactions (see, for
review Shinozaki and Yamaguchi-Shinozaki 2007 or Hirayama and Shinozaki
2010). Several ABA-responsive transcription factors, such as bZIPs, NACs, MYBs
and MYCs, have been described (e.g. Olsen et al. 2005). In the ABA-independent
pathways other NAC and DREB transcription factors are involved (e.g. Chen et al.
2009, 2011). Other proteins involved in post-transcriptional (alternative splicing)
and post-translational (e.g., kinases and phosphorylases) modifications are also
included in this group.
Nevertheless, there are still a number of genes responsive to drought stress
whose function is unknown and even a putative function cannot be proposed, due
to a lack of homology with annotated sequences; this situation is particularly
relevant in conifers (see, for instance, Perdiguero et al. 2012).
12.4.2 Epigenetic Foundations of Response to Drought
In addition to the genetic component, epigenetic variation has been suggested to

contribute to the phenotypic plasticity and adaptive potential of individuals and
populations (Bossdorf et al. 2008; Herrera and Bazaga 2010). Epigenetic mech-
anisms include heritable, but potentially reversible, changes in gene expression
without changing the nucleotide sequence. Three epigenetic processes have been
determined: insertion of methyl groups in cytosine bases of DNA, acetylation and
methylation of N-terminal histone tails, and generation of regulatory noncoding
RNA molecules. DNA methylation is the only epigenetic mark for which the
mechanism of inheritance has been well established, so this mark can be consid-
ered the driving force for epiallelic variation (Mirouze and Paszkowski 2011).
Regulation of gene expression is important to plant tolerance to stresses. For
this reason, epigenetic variation is gaining interest, because it may regulate the
expression of genes that have a key role in acclimation responses. Although the
number of studies concerning epigenetic variation in plants subjected to stress is
increasing, only few studies correspond to forest tree species growing under
drought stress.
In the first study of this type with a woody plant (Gourcilleau et al. 2010) six
hybrid genotypes of the genus Populus were subjected to moderate water deficit.
Significant genotype and treatment effects were detected for global DNA meth-
ylation and for morphological traits, such as height, stem biomass, leaf number and
total leaf area. A positive correlation was demonstrated between DNA methylation
percentage and productivity (stem biomass and height) under well-watered con-
ditions but no correlation between DNA methylation and morphological traits was
observed in response to water deficit. While there was a general decrease of
growth for all genotypes in response to a water deficit, variations in DNA meth-
ylation were found, suggesting different responses among hybrids. Raj et al. (2011)
studied the influence of recent individual history on the Populus transcriptome and
global DNA methylation-level response to drought. Plants of the same genotype
established in contrasting locations showed different transcript patterns and DNA
methylation levels in response to drought, which suggests an epigenomic base for
the clone history-dependent transcriptome divergence.
Trees of the white mangrove (Laguncularia racemosa) can occur naturally in

salt marsh and riverside, exhibiting significant differences in morphological traits,
thus presenting an excellent system to study natural variation in genetic and epi-
genetic marks and their relation to phenotypic variation and plasticity in trees
(Lira-Medeiros et al. 2010). Analysis of DNA methylation patterns and nucleotide
sequences detected greater epigenetic than genetic variation within and between
populations in contrasting environments, which indicates that epigenetic variation
in natural populations plays an important role in long-term adaptation to different
environments.
12.4.3 Metabolomics
Modifications in the profiling of metabolites represent one of the first outcomes at

the molecular level brought about by drought. Some molecular changes such as
accumulation of compounds with osmotic effect, triggers as a consequence of a
runway sensing system that tend to compensate the negatives effects of water
stress on processes such as turgor maintenance or growth of plants. In this respect,
the amount and kind of certain metabolites represent a by-product resulting from
the direct impact of water stress at a higher level of organization (i.e., organ or
individual). Probably, osmotic adjustment is one of the mechanisms affected in
higher degree by the accumulation of different metabolites, as it involves the active
accumulation of osmotic compounds acting directly on turgor maintenance
(Chaves et al. 2003, and Fig. 12.2 on this chapter). Increase in metabolites such as
nonstructural carbohydrates (NSC) is a classic example of response to drought
related with the adaptation to water stress of forest tree species. Thus, the increase
in NSC is a typical response for those species with a higher tolerance to water
stress (Piper 2011). Cyclitol is other important group of compounds related with
osmotic adjustment, and especially quercitol has found to increase in greater
proportion for stressed plants in several species of Quercus sp. and Eucalyptus sp.
(Merchant et al. 2006; Passarinho et al. 2006). However, important changes in
other compounds lacking of osmotic role have been observed as well, and playing
an important role in cellular processes further than the osmotic adjustment as those
involved in photorespiration, stability of membranes, or changes in compounds of
the cellular wall (Warren et al. 2011).
Differences in the specific metabolites expressed, even under constitutive
conditions without water stress, are related to ecological and evolutionary aspects
of forest tree species such as tolerance to drought (Merchant et al. 2007a, b;
Warren et al. 2012), or may result from different phylogenetic pathways (Warren
et al. 2011). In this respect, even within the same genus, such as for example
Eucalyptus sp., it is possible to find species with a trend to accumulate certain
metabolites compared to others species that do not (Fig. 12.5).
Although metabolic profiling depends on the species considered and the degree
of water stress endured, not less important is the change in metabolic profiling in
Fig. 12.5 Relative soluble organic compound to total polar organic metabolites in seven
Eucalyptus species submitted to 2 months of water stress (Wpd * -2 MPa) ordered by annual
potential water balance. Upper panel shows relative proportion of oligosaccharides (fructose,
glucose, sucrose); middle panel shows polyols (agrupping myo inositol, scyllo inisitol, galactinol;
proto quercitol and others cyclohexanepentols) and lower panel shows organic acids (shikimic
acid, quinic acid, malic acid, gallic acid and citric acid). These main metabolites accounted for
over 90 % of organic soluble metabolites in Eucalyptus leaves. Open and closed bars represent
well watered and water stressed plants, respectively. Means and standard deviation (n = 5).
Redrawn from data in Warren et al. (2011, 2012)
the recovering phase after drought release, which shows different patterns
according to the ecology of forest tree species. In a recent report, Warren et al.
(2012) observed a different pattern in the osmotic potential and osmotically active
solutes during the re-watering phase after a drought cycle for two Eucalyptus
species. The mesic E. pauciflora showed an increase in osmotic potential at full
turgor and decrease of osmotically active solutes, possibly related to a recovery of
growth; the semi-arid E. dumosa maintained an increase in osmotic compounds
such as some sugars, even after water stress relief, and that would allow plants to
endure new water stress cycles.
Until recently, assessment of metabolites involved in osmotic adjustment or
other physiological processes related to water stress was limited to the analysis of a
few specific sugars or amino acid compounds. With the fast development of more
insightful techniques, a more detailed approach to metabolites profile is possible,

with hundreds of different compounds analyzed with the same platform. In the last,
modifications in biochemical products result from a complex regulation of
molecular networks responding to an endogenous and exogenous signaling process
in response to the water stress suffered by the plant, which will be responsible of
the resulting phenotype (Fig. 12.4).
12.5 Facing the Future of the Study of Drought Response

in Trees: ‘‘Omics’’ and Interplay with Higher Scales
of Biological Integration
High-throughput technologies have made it possible to see organisms as complex

interactive systems. This new approach represents a shift toward a more holistic
perspective. Integrative functional genomics combines the molecular components
((epi)genome, transcripts, proteins, metabolites, and their interactions) of an
organism and incorporates them into functional networks or models designed to
describe the dynamic activities of that organism which are responsible for the
observed phenotype (Fig. 12.4a).
The first studies of the response to drought stress at the transcriptomic level
addressed simple experimental conditions, with a single stress level. However, an
integrated knowledge of the response to water deficit needs experimental designs
mimicking field conditions, in order to detect the various pathways initiated by
different levels of stress, as suggested by Watkinson et al. (2003). Trees in nature
often must face more than one stressful factor at a time. Interaction among
stresses, both biotic and abiotic, must be elucidated at different scales of biological
integration from ecophysiological (Aranda et al. 2005) to the molecular response
(Mittler 2006). For instance, Duan et al. (2008) analyzed the combined effects of
UV-B, ABA and water status in allometric patterns of Populus yunnanensis. In this
sense, natural populations can offer a valuable (although with evident practical
hindrances) resource for these experiments, as proven in the work of Brosché et al.
(2005). Advances in the study of drought response in forest tree species using other
‘‘omics’’ have been recently reported. In this respect, the study of metabolomic
profiling together with water relations, at the leaf or plant level, deserves new
efforts in order to better integrate both scales of study in the knowledge of
acclimation and adaptation to water stress (Sardans et al. 2011). Different
responses can take place in the diverse organs and even tissues of the tree.
Although organ-specific analysis has been performed, development of laser
microdissection capture techniques will allow in the future the analysis of the
response in differentiated tissues and cells.
Knowledge of the role played by the adaptive genetic and epigenetic variability
on the observed phenotypic variation in traits related with drought tolerance is still
limited for most forest tree species, and not conclusive when framed in an
evolutionary context. Hence, disentangling the potential adaptive value, and its
molecular control, for those characters involved in adaptation to drought will be of
prime importance in the future (Neale and Kremer 2011). Epigenetic and genetic
studies will probably open new avenues to the understanding of the evolution of
forest tree species, and the always complex interplay between genotype and
environment as the main driver in the adaptation process under water stress (Raj
et al. 2011). In this regard, and taking into account the rate of climate change,
epigenetic modifications operating as molecular basis of phenotypic plasticity,
which may be heritable, will likely play a key role that will be unraveled in the
forthcoming years (see Sect. 12.3.2).
In this game of scales, the integration of ecophysiological studies with the char-
acterization of the molecular response will break the traditional oversimplification
from the functional ecology approach focused on the species-specific response, as
well as the reductionist view that emerges from most of molecular analysis. Probably,
one clear example of oversimplification in ecophysiological studies is the frequent
tendency to forget species comprises groups of local populations. Furthermore, it is
well known that in many cases, one unique forest population embraces a high intra-
specific genetic variability for quantitative traits related with growth, phenology, or
morpho-functional traits. The genetic variability has its counterpart in a high degree
of phenotypic alternatives to the same environmental challenge.
In the future, and according to the expectations about the intensification of
droughts in wide areas all round the world, the ecophysiological studies will have
to center efforts in the analysis of those traits more related to the fitness and
survival of forest tree species facing water stress. In the next years, more detailed
studies will be necessary to improve our understanding of complex functional
traits such as the stomatal control of water losses (Leonardi et al. 2006; Voltas
et al. 2008; De Miguel et al. 2012), net photosynthesis (Major and Johnsenn 1996;
Benowicz et al. 2000; Scotti et al. 2010), or hydraulic resistance to drought-
induced cavitation (Corcuera et al. 2011; Lamy et al. 2011).
Acknowledgments This work was supported by funding from the Spanish projects ECOFISEPI
AGL2011-25365, MAPINSEQ AGL2009-10496, SUM2008-62500004-C03-01, as well as the
transnational project Plant-KBBE PLE2009-0016. We thank Drs. J. Voltas and F. Ewers for a
previous critical reading of this work. Authors are grateful to the anonymous reviewer that
improved a first version of this contribution.
References
Aasamaa K, Sober A, Rahi M (2001) Leaf anatomical characteristics associated with shoot
hydraulic conductance, stomatal conductance and stomatal sensitivity to changes of leaf water
status in temperate deciduous trees. Funct Plant Biol 28:765–774
Abrams MD (1988) Sources of variation in osmotic potentials with special reference to North
American tree species. Forest Sci 34:1030–1046
Abrams MD (1994) Genotypic and phenotypic variation as stress adaptations in temperate tree
species: a review of several case studies. Tree Physiol 14:833–842
Adams HD, Guardiola-Claramonte M, Barron-Gafford GA et al (2009) Temperature sensitivity of

drought-induced tree mortality: implications for regional die-off under global-change-type
drought. Proc Natl Acad Sci U S A 106:7066–7070
Aitken SN, Yeaman S, Holliday JA, Wang T, Curtis-McLane S (2008) Adaptation, migration or
extirpation: climate change outcomes for tree populations. Evol Appl 1:95–111
Allen CD, Macalady AK, Chenchouni H, Bachelet D, McDowell N, Vennetier M, Kitzberger T,
Rigling A, Breshears DD, Hogg EH (Ted), Gonzalez P, Fensham R, Zhangm Z, Castro J,
Demidova N, Lim J-H, Allard G, Running SV, Semerci A, Cobb N (2010) A global overview
of drought and heat-induced tree mortality reveals emerging climate change risks for forests.
For Ecol Manag 259:660–684
Almeida-Rodriguez AM, Cooke JE, Yeh F, Zwiazek JJ (2010) Functional characterization of
drought-responsive aquaporins in Populus balsamifera and Populus simonii 9 balsamifera
clones with different drought resistance strategies. Physiol Plantarum 140:321–333
Anekonda TS, Lomas MC, Adams WT, Kavanagh KL, Aitken SN (2002) Genetic variation in
drought hardiness of coastal Douglas-fir seedlings from British Columbia. Can J For Res
32:1701–1716
Aranda I, Gil L, Pardos JA (2000) Water relations and gas exchange in (Fagus sylvatica L. and
Quercus petraea (Mattuschka) Liebl. in a mixed stand at the southern limit of distribution in
Europe. Trees Struct Funct 14:344–352
Aranda I, Gil L, Pardos JA (2001) Effects of thinning in a Pinus sylvestris L. stand on foliar water
relations of Fagus sylvatica L. seedlings planted within the pinewood. Trees Struct Funct
15:358–364
Aranda I, Gil L, Pardos JA (2002) Physiological responses of Fagus sylvatica L. seedlings under
Pinus sylvestris L. and Quercus pyrenaica Willd. overstories. Forest Ecol Manag
162:153–164
Aranda I, Gil L, Pardos JA (2004) Osmotic adjustment in two temperate oak species [Quercus
pyrenaica Willd and Quercus petraea (Matt.) Liebl] of the Iberian Peninsula in response to
drought. Forest Syst (formerly Investigación Agraria: Sistemas y Recursos Forestales)
13:339–345
Aranda I, Castro L, Pardos M, Gil L, Pardos J (2005) Effects of the interaction between drought
and shade on water relations, gas exchange and morphological traits in cork oak (Quercus
suber L.) seedlings. Forest Ecol Manag 210:117–129
Aranda I, Alía R, Ortega U, Dantas A, Majada J (2010) Intra-population variability in biomass
partitioning and carbon isotopic discrimination under moderate drought stress in four
maritime pine (Pinus pinaster L.) populations. Tree Genet Genomes 6:169–170
Arend M, Kuster T, Günthardt-Goerg MS, Dobbertin M (2011) Provenance-specific growth
responses to drought and air warming in three European oak species (Quercus robur, Q.
petraea and Q. pubescens). Tree Physiol 31:287–297
Ares A, Fownes JH, Sun W (2000) Genetic differentiation of intrinsic water-use efficiency in the
hawaiian native Acacia koa. Inte J Plant Sci 161:909–915
Aspelmeier S, Leuschner C (2006) Genotypic variation in drought response of silver birch
(Betula pendula Roth): leaf and root morphology and carbon partitioning. Trees Struct Funct
20:42–52
Baaziz BK, Lopez D, Rabot A, Combes D, Gousset A, Bouzid S, Cochard H, Sakr S, Venisse J-S
(2012) Light-mediated Kleaf induction and contribution of both the PIP1s and PIP2s
aquaporins in five tree species: walnut (Juglans regia) case study. Tree Physiol 32:423–434
Bae EK, Lee H, Lee JS, Noh EW (2009) Differential expression of a poplar SK2-type dehydrin
gene in response to various stresses. BMB Rep 42:439–443
Bae EK, Lee H, Lee JS, Noh EW (2010) Isolation and characterization of osmotic stress-induced
genes in poplar cells by suppression subtractive hybridization and cDNA microarray analysis.
Plant Physiol Bioch 48:136–141
Bae EK, Lee H, Lee JS, Noh EW (2011) Drought, salt and wounding stress induce the expression
of the plasma membrane intrinsic protein 1 gene in poplar (Populus alba 9 P. tremula var.
glandulosa). Gene 483:43–48
Baquedano FJ, Valladares F, Castillo FJ (2008) Phenotypic plasticity blurs ecotypic divergence in
the response of Quercus coccifera and Pinus halepensis to water stress. Eur J For 127:495–506
Barnard HR, Ryan MG (2003) A test of the hydraulic limitation hypothesis in fast-growing
Eucalyptus saligna. Plant, Cell Environ 26:1235–1245
Bassman JH, Zwier JC (1991) Gas exchange characteristics of Populus trichocarpa, Populus
deltoides and Populus trichocarpa 9 P. deltoides clones. Tree Physiol 8:145–159
Battaglia M, Olvera-Carrillo Y, Garciarrubio A, Campos F, Covarrubias AA (2008) The
enigmatic LEA proteins and other hydrophilins. Plant Physiol 148:6–24
Becker P, Meinzer FC, Wullschleger SD (2000) Hydraulic limitation of tree height: a critique.
Funct Ecol 14:4–11
Benito M, Alía R, Robson TM, Zavala MA (2011) Intra-specific variability and plasticity influence
potential tree species distributions under climate change. Global Ecol Biogeogr 20:766–778
Benowicz A, Guy RD, El-Kassaby YA (2000) Geographic pattern of genetic variation in
photosynthetic capacity and growth in two hardwood species from British Columbia. Oecologia
123:168–174
Berta M, Giovannelli A, Sebastiani F, Camussi A, Racchi ML (2010) Transcriptome changes in the
cambial region of poplar Populus alba L. in response to water deficit. Plant Biol 12:341–354
Bhaskar R, Valiente-Banuet A, Ackerly DD (2007) Evolution of hydraulic traits in closely related
species pairs from mediterranean and non-mediterranean environments of North America.
New Phytol 176:718–726
Bigras FJ (2005) Photosynthetic response of white spruce families to drought stress. New For
29:135–148
Blödner C, Majcherczyk A, Kües U, Polle A (2007) Early drought-induced changes to the needle
proteome of Norway spruce. Tree Physiol 10:1423–1431
Bloom AJ, Chapin FS III, Mooney HA (1985) Resource limitation in plants—an economic
analogy. Annu Rev Ecol Syst 16:363–392
Borghetti M, Edwards WRN, Grace J, Jarvis PG, Raschi A (1991) The refilling of embolized
xylem in Pinus sylvestris L. Plant, Cell Environ 14:357–369
Bossdorf O, Richards CL, Pigliucci M (2008) Epigenetics for ecologists. Ecol Lett 11:106–115
Bradshshaw AD (1965) Evolutionary significance of phenotypic plasticity. Adv Genet 13:115–155
Breda N, Huc R, Granier A, Dreyer E (2006) Temperate forest trees and stands under severe
drought:a review of ecophysiological responses, adaptation processes and long-term
consequences. Ann For Sci 63:625–644
Brendel O, Pot D, Plomion C, Rozenberg P, Guehl JM (2002) Genetic parameters and QTL
analysis of d13C and ring width in maritime pine. Plant Cell Environ 25:945–953
Brendel O, Le Thiec D, Scotti-Saintagne C, Bodenes C, Kremer A, Guehl JM (2008) Quantitative
trait loci controlling water use efficiency and related traits in Quercus robur L. TGG 4:263–278
Breshears DD, Cobb NS, Rich PM, Price KP, Allen CD, Balice RG, Romme WH, Kastens JH,
Floyd ML, Belnap J, Anderson JJ, Myers OB, Meyer CW (2005) Regional vegetation die-off
in response to global-change-type drought. Proc Natl Acad Sci U S A 102:15144–15148
Breshears DD, Myers OB, Meyer CW, Barnes FJ, Zou CB, Allen CD, McDowell NG, Pockman
WT (2009) Tree die-off in response to global-change-type drought: mortality insights from a
decade of plant water potential measurements. Front Ecol Environ 7:185–189
Brodribb TJ, Cochard H (2009) Hydraulic failure defines the recovery and point of death in
water-stressed conifers. Plant Physiol 149:575–584
Brodribb TJ, Holbrook NM (2003) Stomatal closure during leaf dehydration, correlation with
other leaf physiological traits. Plant Physiol 132:2166–2173
Brodribb TF, Holbrook NM (2006) Declining hydraulic efficiency as transpiring leaves desiccate:
two types of response. Plant Cell Environ 29:2205–2215
Brodribb TJ, Holbrook NM, Zwieniecki MA, Palma B (2005) Leaf hydraulic capacity in ferns,
conifers and angiosperms: impacts on photosynthetic maxima. New Phytol 165:839–846
Brodribb TJ, Bowman DJMS, Nichols S, Delzon S, Burlett R (2010) Xylem function and growth
rate interact to determine recovery rates after exposure to extreme water deficit. New Phytol
188:533–542
Brosché M, Vinocur B, Alatalo ER, LamminmäkiA, Teichmann T, Ottow EA, Djialianov D, Afif D,
Bogeat-Triboulot MB, Altman A, Polle A, Dreyer e, Rudd S, Paulin L, Auvinen P, Kangasjärvi J
(2005) Gene expression and metabolite profiling of Populus euphratica growing in the Negev
desert. Genome Biol 6:R101
Bucci SJ, Scholz FG, Goldstein G, Meinzer FC, Sternberg LDL (2003) Dynamic changes in
hydraulic conductivity in petioles of two savanna tree species: factors and mechanisms
contributing to the refilling of embolized vessels. Plant Cell Environ 26:1633–1645
Burczyk J, Giertych M (1991) Response of Norway Spruce (Picea abies [L] Karst) annual
increments to drought for various provenances and locations. Silvae Genetica 40:146–152
Camarero JJ, Bigler C, Linares JC, Gil-Pelegrín E (2011) Synergistic effects of past historical
logging and drought on the decline of Pyrenean silver fir forests. For Ecol Manag 262:759–769
Campanello PI, Gatti MG, Goldstein G (2008) Coordination between water-transport efficiency
and photosynthetic capacity in canopy tree species at different growth irradiances. Tree
Physiol 28:85–94
Canadell J, Jackson RB, Ehleringer JB, Mooney HA, Sala OE, Schulze ED (1996) Maximum
rooting depth of vegetation types at the global scale. Oecologia 108:583–595
Caruso A, Chefdor F, Carpin S, Depierreux C, Delmotte FM, Kahlem G, Morabito D (2008)
Physiological characterization and identification of genes differentially expressed in response
to drought induced by PEG 6000 in Populus Canadensis leaves. J Plant Physiol 165:932–941
Casasoli M, Derory J, Morera-Dutrey C, Brendel O, Porth I, Guehl J-M, Villani F, Kremer A
(2006) Comparison of quantitative trait loci for adaptive traits between oak and chestnut
based on an expressed sequence tag consensus map. Genetics 172:533–546
Cassasoli M, Pot D, Plomion C, Monteverdi MC, Barreneche T, Laureti M, Villani F (2004)
Identification of QTLs affecting adaptive traits in Castanea sativa Mill. Plant Cell Environ
27:1088–1101
Ceulemans R, Impens I (1980) Leaf gas exchange processes and related characteristics of seven
poplar clones under laboratory conditions. Can J For Res 10:429–435
Chambel MR, Climent J, Alia R (2007) Divergence among species and populations of
Mediterranean pines in biomass allocation of seedlings grown under two watering regimes.
Ann For Sci 64:87–97
Chang S, Puryear JD, Dias MADL, Funkhouser EA, Newton RJ, Cairney J (1996) Gene
expression under water deficit in loblolly pine (Pinus taeda): isolation and characterization of
cDNA clones. Physiol Plantarum 97:139–148
Chaves MM, Pereira JS, Maroco J (2003) Understanding plant response to drought—from genes
to the whole plant. Funct Plant Biol 30:239–264
Chen J, Xia X, Yin W (2009) Expression profiling and functional characterization of a DREB2-
type gene from Populus euphratica. Biochem Bioph Res Co 378:483–487
Chen J, Xia X, Yin W (2011) A poplar DRE-binding protein gene, PeDREB2L, is involved in
regulation of defense response against abiotic stress. Gene 483:36–42
Chmura DJ, Anderson PD, Howe GT, Harrington CA, Halofsky JE, Peterson DL, Shaw DC,
St.Clair JB (2011) Forest responses to climate change in the northwestern United States:
ecophysiological foundations for adaptive management. For Ecol Manag 261:1121–1142
Ciais P, Reichstein M, Viovy N, Granier A, Ogee J, Allard V, Aubinet M, Buchmann N,
Bernhofer C, Carrara A, Chevallier F, De Noblet N, Friend AD, Friedlingstein P, Grunwald T,
Heinesch B, Keronen P, Knohl A, Krinner G, Loustau D, Manca G, Matteucci G, Miglietta F,
Ourcival JM, Papale D, Pilegaard K, Rambal S, Seufert G, Soussana JF, Sanz MJ, Schulze
ED, Vesala T, Valentini R (2005) Europe-wide reduction in primary productivity caused by
the heat and drought in 2003. Nature 437:529–533
Clearwater M, Goldstein G (2005) Embolism repair and long distance water transport. In: Holbrook
NM, Zwieniecki MA (eds) Vascular transport in plants. Elsevier Academic Press, USA
Cochard H, Tyree MT (1990) Xylem dysfunction in Quercus: vessel sizes, tyloses, cavitation and
seasonal changes in embolism. Tree Physiol 6:393–407
Cochard H, Breda N, Granier A, Aussenac G (1992) Vulnerability to air embolism of three

European oak species (Quercus petraea (Matt) Liebl., Q. pubescens Willd., Q. robur L.). Ann
For Sci 49:225–233
Cochard H, Venisse JS, Barigah TS, Brunel N, Herbette S, Guilliot A, Tyree MT, Sakr S (2007)
Putative role of aquaporins in variable hydraulic conductance of leaves in response to light.
Plant Physiol 143:122–133
Cohen D, Bogeat-Triboulot MB, Tisserant E, Balzergue S, Martin-Magniette ML, Lelandais G,
Ningre N, Renou JP, Tamby JP, Le Thiec D, Hummel I (2010) Comparative transcriptomics
of drought responses in Populus: a meta-analysis of genome-wide expression profiling in
mature leaves and root apices across two genotypes. BMC Genomics 11:630
Corcuera L, Camarero JJ, Gil-Pelegrin E (2002) Functional groups in Quercus species derived
from the analysis of pressure–volume curves. Trees Struct Funct 16:465–472
Corcuera L, Camarero JJ, Gil-Pelegrín E (2004a) Effects of a severe drought on Quercus ilex
radial growth and xylem anatomy. Trees Struct Funct 18:83–92
Corcuera L, Camarero JJ, Gil-Pelegrín E (2004b) Effects of a severe drought on growth and wood
anatomical properties of Quercus faginea. IAWA J 25:185–204
Corcuera L, Morales F, Gil-Pelegrín E (2005) Seasonal changes in photosynthesis and
photoprotection in a Quercus ilex subsp ballota woodland located in its upper altitudinal
extreme in the Iberian Peninsula. Tree Physiol 25:599–608
Corcuera L, Camarero JJ, Sisó S, Gil-Pelegrin E (2006) Radial-growth and wood-anatomical
changes in overaged Quercus pyrenaica coppice stands: functional responses in a new
Mediterranean landscape. Trees Struct Funct 0:91–98
Corcuera L, Cochard H, Gil-Pelegrin E, Notivol E (2011) Phenotypic plasticity in mesic
populations of Pinus pinaster improves resistance to xylem embolism (P50) under severe
drought. Trees Struct Funct 25:1033–1042
Cregg BM, Zhang JW (2001) Physiology and morphology of Pinus sylvestris seedlings from
diverse sources under cyclic drought stress. For Ecol Manag 154:131–139
David TS, Henriques MO, Kurz-Besson C, Nunes J, Valente F, Vaz M, Pereira JS, Siegwolf R,
Chaves MM, Gazarini LC, David JS (2007) Water use strategies in two co-occurring
mediterranean evergreen oaks: surviving the summer drought. Tree Physiol 27:793–803
Day ME, Greenwood MS, Diaz-Sala C (2002) Age- and size-related trends in woody plant shoot
development: regulatory pathways and evidence for genetic control. Tree Physiol 22:507–513
De Miguel M, Sánchez-Gómez D, Cervera MT, Aranda I (2012) Functional and genetic
characterization of gas-exchange and water use efficiency in a full-sib family of Pinus
pinaster Aitt. in response to drought. Tree Physiol 32:94–103
Demmig-Adams B, Adams WW III (1996) Xanthophyll cycle and light stress in nature; uniform
response to excess direct sunlight among higher plants. Planta 198:460–470
Donovan LA, Ludwig F, Rosenthal DM, Rieseberg LH, Dudley SA (2009) Phenotypic selection
on leaf ecophysiological traits in Helianthus. New Phytol 183:868–879
Drost DR, Benedict CI, Berg A, Novaes E, Novaes CR, Yu Q, Dervinis C, Maia JM, Yap J, Miles B,
Kirst M (2010) Diversification in the genetic architecture of gene expression and transcriptional
networks in organ differentiation of Populus. Proc Natl Acad Sci U S A 107:8492–8497
Duan B, Xuan Z, Zhang X, Korpelainen H, Li C (2008) Interactions between drought, ABA
application and supplemental UV-B in Populus yunnanensis. Physiol Plantarum 134:257–269
Dubos C, Plomion C (2003) Identification of water-deficit responsive genes in maritime pine
(Pinus pinaster Ait.) roots. Plant Mol Biol 51:249–262
Ducrey M, Huc R, Ladjal M, Guehl JM (2008) Variability in growth, carbon isotope composition,
leaf gas exchange and hydraulic traits in the eastern Mediterranean cedars Cedrus libani and
C. brevifolia. Tree Physiol 28:689–701
Dudley SA (1996) Differing selection on plant physiological traits in response to environmental
water availability: a test of adaptive hypotheses. Evolution 50:92–102
Eggemeyer KD, Awada T, Harvey FE, Wedin DA, Zhou X, Zanner W (2009) Seasonal changes
in depth of water uptake for encroaching trees Juniperus virginiana and Pinus ponderosa and
two dominant C4 grasses in a semiarid grassland. Tree Physiol 29:157–169
Eller ASD, McGuire KL, Sparks JP (2011) Responses of sugar maple and hemlock seedlings to
elevated carbon dioxide under altered above- and belowground nitrogen sources. Tree Physiol
31:391–401
Ellsworth DS, Reich PB (1992) Water relations and gas exchange of Acer saccharum seedlings in
contrasting natural light and water regimes. Tree Physiol 10:1–20
Esteso-Martinez J, Camarero JJ, Gil-Pelegrin E (2006) Competitive effects of herbs on Quercus
faginea seedlings inferred from vulnerability curves and spatial-pattern analyses in a
Mediterranean stand (Iberian System, northeast Spain). Ecoscience 13:378–387
Eveno E, Collada C, Guevara MA, Léger V, Soto A, Díaz L, Léger P, González-Martínez SC,
Cervera MT, Plomion C, Garnier-Géré PH (2008) Contrasting patterns of selection at Pinus
pinaster Ait. drought stress candidate genes as revealed by genetic differentiation analyses.
Mol Biol Evol 25:417–437
Fillatti JJ, Sellmer J, McCown B, Haissig B, Comai L (1987) Agrobacterium mediated
transformation and regeneration of Populus. Mol Gen Genet 206:192–199
Flanagan LB, Johnsen KH (1995) Genetic variation in carbon isotope discrimination and its
relationship to growth under field conditions in full-sib families of Picea mariana. Can J For
Res 25:39–47
Foster DR, Oswald WW, Faison EK, Doughty ED, Hansen BCS (2006) A climatic driver for
abrupt mid-Holocene vegetation dynamics and the hemlock decline in New England. Ecology
87:2959–2966
Gailing O, Langenfeld-Heyser R, Polle A, Finkeldey R (2008) Quantitative trait loci affecting
stomatal density and growth in a Quercus robur progeny: implications for the adaptation to
changing environments. Glob Change Biol 14:1934–1946
Gailing O, Vornam B, Leinemann L, Finkeldey R (2009) Genetic and genomic approaches to
assess adaptive genetic variation in plants: forest trees as a model. Physiol Plantarum
137:509–519
Gebre GM, Kuhns MR, Brandle JR (1994) Organic solute accumulation and dehydration
tolerance in tree water-stressed Populus deltoides clones. Tree Physiol 14:575–587
Gimeno TE, Pías B, Lemos-Filho JP, Valladares F (2009) Plasticity and stress tolerance override
local adaptation in the responses of Mediterranean holm oak seedlings to drought and cold.
Tree Physiol 29:87–98
González-Martínez SC, Huber D, Ersoz E, Davis JM, Neale DB (2008) Association genetics in
Pinus taeda L. II. Carbon isotope discrimination. Heredity 101:19–26
Gourcilleau D, Bogeat-Triboulot MB, Le Thiec D, Lafon-Placette C, Delaunay A, El-Soud WA,
Brignolas F, Maury S (2010) DNA methylation and histone acetylation: genotypic variations
in hybrid poplars, impact of water deficit and relationships with productivity. Ann For Sci
67:208
Grether GF (2005) Environmental change, phenotypic plasticity, and genetic compensation. Am
Nat 166:E115–E123
Grivet D, Sebastiani F, Alía R, Bataillon T, Torre S, Zabal-Aguirre M, Vendramin GG, González-
Martínez SC (2011) Molecular footprints of local adaptation in two mediterranean conifers.
Mol Biol Evol 28:101–116
Grossnickle SC, Fan SH, Russell JH (2005) Variation in gas exchange and water use efficiency
patterns among populations of western red cedar. Trees Struct Funct 19:32–42
Guy RD, Holowachuk DL (2001) Population differences in stable carbon isotope ratio of Pinus
contorta Dougl. ex Loud.: relationship to environment, climate of origin, and growth
potential. Can J Bot 79:274–283
Hacke UG, Sauter JJ (1996) Xylem dysfunction during winter and recovery of hydraulic
conductivity in diffuse-porous and ring-porous trees. Oecologia 105:435–439
Hacke UG, Sperry JS (2003) Limits to xylem refilling under negative pressure in Laurus nobilis
and Acer negundo. Plant Cell Environ 26:303–311
Hacke UG, Sperry JS, Pockman WT, Davis SD, McCulloh KA (2001) Trends in wood density
and structure are linked to prevention of xylem embolism by negative pressure. Oecologia
54:275–280
Hacke UG, Sperry JS, Pittermann JA (2005) Efficiency vs. safety trade-offs for water conduction
in angiosperm vessels vs. gymnosperm tracheids. In: Holbrook NM, Zwieniecki M (eds)
Vascular transport in plants. Elsevier Inc., Amsterdam, pp 333–353
Hamanishi ET, Campbell MM (2011) Genome-wide responses to drought in forest trees. Forestry
84:273–283
Hamrick JL (2004) Response of forest trees to global environmental changes. For Ecol Manag
197:323–335
Heath LS, Ramakrishnan N, Sederoff RR, Whetten RW, Chevone BI, Struble CA, Jouenne VY,
Chen DW, van Zyl L, Grene R (2002) Studying the functional genomics of stress responses in
loblolly pine with the Expresso microarray experiment management system. Comp Funct
Genom 3:226–243
Henery ML, Moran GF, Foley WJ (2007) Identification of quantitative trait loci influencing foliar
concentrations of terpenes and formylated phloroglucinol compounds in Eucalyptus nitens.
Herrera CM, Bazaga P (2010) Epigenetic differentiation and relationship to adaptive genetic
divergence in discrete populations of the violet Viola cazorlensis. New Phytol 187:867–876
Hirayama T, Shinozaki K (2010) Research on plant abiotic stress responses in the post-genome
era: past, present and future. Plant J 61:1041–1052
Ingvarsson PK, Street NR (2011) Association genetics of complex traits in plants. New Phytol
189:909–922
Ingvarsson PK, Garcia MV, Luquez V, Hall D, Jansson S (2008) Nucleotide polymorphism and
phenotypic associations within and around the phytochrome B2 locus in European Aspen
(Populus tremula, Salicaceae). Genetics 178:2217–2226
IPCC 2007. Climate change 2007:impacts, adaptation and vulnerability. In: Parry ML, Canziani
OF, Palutikof JP, van der Linden PJ, Hanson CE (eds) Contribution of working group II to the
fourth assessment report of the intergovernmental panel on climate change. Cambridge
University Press, Cambridge, p 976
Jansen S, Gortan E, Lens F, Lo Gullo MA, Salleo S, Schloz A, Stein A, Trifilò P, Nardini A
(2011) Do quantitative vessel and pit characters account for ion-mediated changes in the
hydraulic conductance of angiosperm xylem? New Phytol 189:218–228
Jensen JS (1993) Variation of growth in Danish provenance trials with oak (Quercus robur L and
Quercus petraea Mattuschka Liebl). Ann Sci For 50:203–207
Johnson DM, Woodruff DR, McCulloh KA, Meinzer F (2009) Leaf hydraulic conductance,
measured in situ, declines and recovers daily:leaf hydraulics, water potential and stomatal
conductance in four temperate and three tropical tree species. Tree Physiol 29:879–887
Jones HG, Sutherland RA (1991) Stomatal control of xylem embolism. Plant Cell Environ
49:607–612
Jump AS, Hunt JM, Peñuelas J (2006) Rapid climate change-related growth decline at the
southern range edge of Fagus sylvatica. Global Change Biol 12:2163–2174
King DA (1990) The adaptive significance of tree height. Am Nat 135:809–828
König A (2005) Provenance research: evaluation the spatial pattern of genetic variation. In:
Geburek T, Turok J (eds) Conservation and management of forest genetic resources in
Europe. Arbora Publishers, Zvolen and IPGRI, Rome, pp 275–334
Kremer K (1995) Phenotypic plasticity of the phenology of seven European tree species in
relation to climatic warming. Plant Cell Environ 18:93–104
Kremer A (2010) Evolutionary responses of European oaks to climate change. Irish For 67:53–66
Kremer A, Le Corre V, Petit RJ, Ducousso A (2010) Historical and contemporary dynamics of
adaptive differentiation in European oaks. In: DeWoody A, Bickham J, Michler C, Nichols K,
Rhodes G, Woeste K (eds) Molecular Approaches in natural resource conservation and
management. Cambridge University Press, Cambridge, pp 101–122
Lamy J-B, Bouffier L, Burlett R, Plomion C, Cochard H, Delzon S (2011) Uniform selection as a
primary force reducing population genetic differentiation of cavitation resistance across a
species range. PLoS ONE 6(8):e23476
Langlet O (1971) Two hundred years of genecology. Taxon 20:653–722
Lauteri M, Scartazza A, Guido MC, Brugnoli E (1997) Genetic variation in photosynthetic

capacity, carbon isotope discrimination and mesophyll conductance in provenances of
Castanea sativa adapted to different environments. Funct Ecol 11:675–683
Lenz TI, Wright IJ, Westoby M (2006) Interrelations among pressure–volume curve traits across
species and water availability gradients. Physiol Plantarum 127:423–433
Leonardi S, Piovani P, Magnani F, Menozzi P (2006) A simple general method to evaluate intra-
specific transpiration parameters within and among seedling families. Oecologia 149:185–193
Li XP, Björkman O, Shih C, Grossman AR, Rosenquist M, Jansson S, Niyogi KK (2000a) A
pigment-binding protein essential for regulation of photosynthetic light harvesting. Nature
403:391–395
Li C, Berninger F, Koskela J, Sonninen E (2000b) Drought responses of Eucalyptus microtheca
provenances depend on seasonality of rainfall in their place of origin. Aust J Plant Physiol
27:231–238
Linares JC, Camarero JJ, Carreira JA (2009) Interacting effects of climate and forest-cover
changes on mortality and growth of the southernmost European fir forests. Global Ecol
Biogeogr 18:485–497
Linares JC, Camarero JJ, Carreira JA (2010) Competition modulates the adaptation capacity of
forests to climatic stress: insights from recent growth decline and death in relict stands of the
Mediterranean fir Abies pinsapo. J Ecol 98:592–603
Lindner M, Maroschek M, Netherer S, Kremer A, Barbati A, Garcia-Gonzalo J, Seidl R, Delzon
S, Corona P, Kolstrom M, Lexer MJ, Marchetti M (2010) Climate change impacts, adaptive
capacity, and vulnerability of European forest ecosystems. Forest Ecol Manag 259:698–709
Linhart YB, Grant MC (1996) Evolutionary significance of local genetic differentiation in plants.
Annu Rev Ecol Syst 267:237–277
Lira-Medeiros CF, Parisod C, Fernandes RA, Mata CS, Cardoso MA, Ferreira PCG (2010)
Epigenetic variation in mangrove plants occurring in contrasting natural environment. PLoS
ONE 5:e10326. doi:10.1371/journal.pone.0010326
Lo Gullo MA, Salleo S (1993) Different vulnerabilities of Quercus ilex L. to freeze- and summer
drought-induced xylem embolism: an ecological interpretation. Plant Cell Environ 16:511–519
Lo Gullo MA, Nardini A, Salleo S, Tyree MT (1998) Changes in root hydraulic conductance (KR)
of Olea oleaster seedlings following drought stress and irrigation. New Phytol 140:25–31
Long Y, Xia W, Li R, Wang J, Shao M, Feng J, King GJ, Meng J (2011) Epigenetic QTL
mapping in Brassica napus. Genetics 189:1093–1102
Lorenz WW, Sun F, Liang C, Kolychev D, Wang HM, Zhao X, Cordonnier-Pratt MM, Pratt LH,
Dean JFD (2006) Water stress-responsive genes in loblolly pine (Pinus taeda) roots identified
by analyses of expressed sequence tag libraries. Tree Physiol 26:1–16
Maherali H, Pockman WT, Jackson RB (2004) Adaptive variation in the vulnerability of woody
plants to xylem cavitation. Ecology 85:2184–2199
Major JE, Johnsenn KH (1996) Family variation in photosynthesis of 22-year-old black spruce: a
test of two models of physiological response to water stress. Can J For Res 26:1922–1933
Major JE, Johnsenn KH (1999) Shoot water relations of mature black spruce families displaying a
genotype x environment interaction in growth rate. II. Temporal trends and response to
varying soil water conditions. Tree Physiol 19:375–382
Manter DK, Kelsey RG (2008) Ethanol accumulation in drought-stressed conifer seedlings. Int J
Plant Sci 169:361–369
Martínez-Vilalta J, Piñol J (2002) Drought-induced mortality and hydraulic architecture in pine
populations of the NE Iberian Peninsula. For Ecol Manag 161:247–256
Martínez-Vilalta J, Prat E, Oliveras I, Piñol J (2002) Xylem hydraulic properties of roots and
stems of nine Mediterranean woody species. Oecologia 133:19–29
Mayr S, Rothart B, Daèmon B (2003) Hydraulic efficiency and safety of leader shoots and twigs
in Norway spruce growing at the alpine timberline. J Exp Bot 54:2563–2568
McCown BH, McCabe DE, Russell DR, Robinson DJ, Barton KA, Raffa KF (1991) Stable
transformation of Populus and incorporation of pest resistance by electric discharge particle
acceleration. Plant Cell Rep 9:590–594
McDowell NG (2011) Mechanisms linking drought, hydraulics, carbon metabolism, and

vegetation mortality. Plant Physiol 155:1051–1059
McDowell N, Pockman WT, Allen CD, Breshears DD, Cobb N, Kolb T, Sperry J, West A,
Williams D, Yepez EA (2008) Mechanisms of plant survival and mortality during drought:
why do some plants survive while others succumb to drought? Transley review. New Phytol
178:719–739
Meier IC, Leuschner C (2008a) Belowground drought response of European beech: fine root
biomass and carbon partitioning in 14 mature stands across a precipitation gradient. Global
Change Biol 14:2081–2095
Meier IC, Leuschner Ch (2008b) Genotypic variation and phenotypic plasticity in the drought
response of fine roots of European beech. Tree Physiol 28:297–309
Melcher PJ, Goldstein G, Meinzer FC, Yount DE, Jones TJ, Holbrook NM, Huang CX (2001)
Water relations of coastal and estuarine Rhizophora mangle: xylem pressure potential and
dynamics of embolism formation and repair. Oecologia 126:182–192
Merchant A, Tausz M, Arndt SK, Adams MA (2006) Cyclitols and carbohydrates in leaves and
roots of 13 Eucalyptus species suggest contrasting physiological responses to water deficit.
Plant Cell Environ 29:2017–2029
Merchant A, Callister A, Arndt S, Tausz M, Adams M (2007a) Contrasting physiological
responses of six Eucalyptus species to water deficit. Ann Bot 100:1507–1515
Merchant A, Ladiges PY, Adams MA (2007b) Quercitol links the physiology, taxonomy and
evolution of 279 eucalypt species. Global Ecol Biogeogr 16:810–819
Mirouze M, Paszkowski J (2011) Epigenetic contribution to stress adaptation in plants. Curr Opin
Plant Biol 14:267–274
Mittler R (2006) Abiotic stress, the field environment and stress combination. Trends Plant Sci
11:15–19
Monclus R, Dreyer E, Villar M, Delmotte FM, Delay D, Petit J-M, Barbaroux C, Le Thiec D,
Bréchet C, Brignolas F (2006) Impact of drought on productivity and water-use efficiency in
29 genotypes of Populus deltoides 9 Populus nigra. New Phytol 169:765–777
Monk C (1966) Ecological importance of root/shoot ratios. B Torrey Bot Club 93:402–406
Morales F, Abadía A, Abadía J (2006) Photoinhibition and photoprotection under nutrient deficiencies,
drought and salinity. In: Demmig-Adams B, Adams III WW, Mattoo AK (eds) Photoprotection,
photoinhibition, gene regulation, and environment. Springer, The Netherlands, pp 65–85
Morreel K, Goeminne G, Storme V, Sterck L, Ralph J, Coppieters W, Breyne P, Steenackers M,
Georges M, Messens E, Boerjan W (2006) Genetical metabolomics of flavonoid biosynthesis
in Populus: a case study. Plant J 47:224–237
Morse AM, Peterson DG, Islam-Faridi MN, Smith KE, Magbanua Z, Garcia SA, Kubisiak TL,
Amerson HV, Carlson JE, Nelson CD, Davis JM (2009) Evolution of genome size and
complexity in Pinus. PLoS ONE 4:e4332
Nardini A, Tyree MT, Salleo S (2001) Xylem cavitation in the leaf of Prunus laurocerasus and its
impact on leaf hydraulics. Plant Physiol 125:1700–1709
Nardini A, Lo Gullo MA, Salleo S (2011) Refilling embolized xylem conduits: is it a matter of
phloem unloading? Plant Sci 180:604–611
Neale DB, Kremer A (2011) Forest tree genomics: growing resources and applications. Nat Rev
Genet 12:111–122
Newbery DM, Lingenfelder M (2009) Plurality of tree species responses to drought perturbation
in Bornean tropical rain forest. Plant Ecol 201:147–167
Nicotra AB, Atkin OK, Bonser SP, Davidson A, Finnegan EJ, Mathesius U, Poot P, Purugganan
MD, Richards CL, Valladares F, van Kleunen M (2010) Plant phenotypic plasticity in a
changing climate. Trends Plant Sci 15:684–692
Niinemets Ü (2010) Responses of forest trees to single and multiple environmental stresses from
seedlings to mature plants: past stress history, stress interactions, tolerance and acclimation.
For Ecol Manag 260:1623–1639
Nobel PS, Lee CH (1991) Variations in root water potentials: influence of environmental factors
for two succulent species. Ann Bot 67:549–554
Ogaya R, Peñuelas J (2007) Tree growth, mortality, and above-ground biomass accumulation in a
holm oak forest under a five-year experimental field drought. Plant Ecol 189:291–299
Oliver MJ, Cushman JC, Koster KL (2010) Dehydration tolerance in plants. In: Sunkar R (ed)
Plant stress tolerance, vol 639. Humana Press, New York, pp 3–24
Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NAC transcription factors: structurally
distinct, functionally diverse. Trends Plant Sci 10:79–87
Passarinho JAP, Lamosa P, Baeta JP, Santos H, Ricardo CPP (2006) Annual changes in the concentration
of minerals and organic compounds of Quercus suber leaves. Physiol Plant 127:100–110
Peguero-Pina JJ, Camarero JJ, Abadía A, Martín E, González-Cascón R, Morales F, Gil-Pelegrín E
(2007) Physiological performance of silver-fir (Abies alba Mill.) populations under contrasting
climates near the south-western distribution limit of the species. Flora 202:226–236
Peguero-Pina JJ, Sancho-Knapik D, Morales F, Flexas J, Gil-Pelegrín E (2009) Differential
photosynthetic performance and photoprotection mechanisms of three Mediterranean
evergreen oaks under severe drought stress. Funct Plant Biol 36:453–462
Peguero-Pina JJ, Sancho-Knapik D, Cochard H, Barredo G, Villarroya D, Gil-Pelegrín (2011)
Hydraulic traits are associated with the distribution range of two closely related
Mediterranean firs, Abies alba Mill. and Abies pinsapo Boiss. Tree Physiol 31:1067–1075
Pelgas B, Bousquet J, Meirmans PG, Ritland K, Isabel N (2011) QTL mapping in white spruce:
gene maps and genomic regions underlying adaptive traits across pedigrees, years and
environments. BMC Genomics 12:145
Pemán J, Voltas J, Gil-Pelegrín E (2006) Morphological and functional variability in the root
system of Quercus ilex L. subject to confinement: consequences for afforestation. Ann For Sci
63:425–430
Peñuelas J, Lloret F, Montoya R (2001) Severe drought effects on mediterranean woody flora in
Spain. Forest Sci 47:214–218
Peñuelas J, Ogaya R, Hunt JM, Jump AS (2008) 20th century changes of tree-ring d13C at the
southern range-edge of Fagus sylvatica. Increasing water-use efficiency does not avoid the
growth decline induced by warming at low altitudes. Glob Change Biol 14:1076–1088
Perdiguero P, Collada C, Barbero MC, García-Casado G, Cervera MT, Soto A (2012)
Identification of water stress genes in Pinus pinaster Ait. by controlled progressive stress and
suppression-subtractive hybridization. Plant Physiol Biochem 50:44–53
Peuke AD, Hartung W, Schraml C, Rennenberg H (2002) Identification of drought sensitive
beech ecotypes by physiological parameters. New Phytol 154:373–388
Piper FI (2011) Drought induces opposite changes in the concentration of non-structural
carbohydrates of two evergreen Nothofagus species of differential drought resistance. Ann For
Sci 68:415–424
Pittermann J, Sperry JS, Hacke U, Wheeler JK, Sikkema EH (2006) Inter-tracheid pitting and the
hydraulic efficiency of conifer wood: the role of tracheid allometry and cavitation protection.
Am J Bot 93:1265–1273
Plomion C, Chagné D, Pot D, Kumar S, Wilcox PL, Burdon RD, Prat D, Peterson DG, Paiva J,
Chaumeil P, Vendramin GG, Sebastiani F, Nelson CD, Echt CS, Savolainen O, Kubisiak TL,
Cervera MT, de María N, Islam-Faridi MN (2007) Pines. In: Kole C (ed) Forest trees.
Genome mapping and molecular breeding in plants, vol 7. Springer, Berlin. Paper 44
Poorter H, Niklas KJ, Reich PB, Oleksyn J, Poot P, Mommer L (2012) Biomass allocation to
leaves, stems and roots: meta-analyses of interspecific variation and environmental control.
Possen BJHM, Oksanen E, Rousi M, Ruhanen H, Ahonen V, Tervahauta A, Heinonen J, Heiskanen J,
Kärenlampi S, Vapaavuori E (2011) Adaptability of birch (Betula pendula Roth) and aspen (Populus
tremula L.) genotypes to different soil moisture conditions. For Ecol Manag 262:1387–1399
Prasolova NV, Xu ZH, Farquhar GD, Saffigna PG, Dieters MJ (2001) Canopy carbon and oxygen
isotope composition of 9-year-old hoop pine families in relation to seedling carbon isotope
composition, growth, field growth performance, and canopy nitrogen concentration. Can J For
Res 31:673–681
Raj S, Bräutigama K, Hamanishi ET, Wilkins O, Thomas BR, Schroederf W, Mansfield SD,
Planth AL, Campbell MM (2011) Clone history shapes Populus drought responses. Proc Natl
Acad Sci U S A 108:12521–12526
Ramírez-Valiente JA, Lorenzo Z, Soto A, Valladares F, Gil L, Aranda I (2009) Elucidating the
role of genetic drift and natural selection in cork oak differentiation regarding drought
tolerance. Mol Ecol 18:3803–3815
Ramírez-Valiente JA, Valladares F, Delgado A, Granados A, Aranda I (2011) Factors affecting
cork oak growth under dry conditions: local adaptation and contrasting additive genetic
variance within populations. Tree Gen Genom 7:285–295
Resco V, Ewers BE, Sun W, Huxman TE, Weltzin JF, Williams DG (2009) Drought-induced
hydraulic limitations constrain leaf gas exchange recovery after precipitation pulses in the C3
woody legume, Prosopis velutina. New Phytol 181:672–682
Robson TM, Rodríguez-Calcerrada J, Sánchez-Gómez D, Aranda I (2009) Summer drought
impedes beech seedlings performance more in a sub-Mediterranean forest understory than in
small gaps. Tree Physiol 29:249–259
Robson TM, Sánchez-Gomez D, Cano FJ, Aranda I (2012) Differences in functional leaf traits
among beech provenances during a Spanish summer reflect the differences in their origin.
Tree Gen Genom. doi: 10.1007/s11295-012-0496-5
Rodríguez-Calcerrada J, Cano FJ, Valbuena-Carabaña M, Gil L, Aranda I (2010) Functional
performance of oak seedlings naturally regenerated across different understory microhabitats in
a sub-Mediterranean forest: influence of light and water availability. New Forest 39:245–259
Rönnberg-Wästljung AC, Glynn C, Weih M (2005) QTL analyses of drought tolerance and
growth for a Salix dasyclados 9 Salix viminalis hybrid in contrasting water regimes. Theor
Appl Genet 110:537–549
Ryan MG, Yoder BJ (1997) Hydraulic limits to tree height and tree growth. Bioscience 47:235–242
Ryan MG, Phillips N, Bond BJ (2006) The hydraulic limitation hypothesis revisited. Plant Cell
Environ 29:367–381
Sack L, Holbrook NM (2006) Leaf hydraulics. Annu Rev Plant Biol 57:361–381
Sack L, Cowan PD, Jaikumar NJ, Holbrook NM (2003) The ‘hydrology’ of leaves: coordination
of structure and function in temperate woody species. Plant Cell Environ 26:1343–1356
Sala A, Piper F, Hoch G (2010) Physiological mechanisms of drought-induced tree mortality are
far from being resolved. New Phytol 186:274–281
Salleo S, Raimondo F, Trifilo P, Nardini A (2003) Axial-to-radial water permeability of leaf
major veins: a possible determinant of the impact of vein embolism on leaf hydraulics? Plant
Cell Environ 26:1749–1758
Sánchez-Gómez D, Velasco-Conde T, Cano FJ, Guevara MA, Cervera MT, Aranda I (2011)
Stone pine, a genetically homogeneous species that displays inter-clonal variation in
functional traits related to differential growth under drought. Environ Exp Bot 70:104–109
Sangsing K, Kasemsap P, Thanisawanyangkura S, Sangkhasila K, Gohet E, Thaler P, Cochard H
(2004) Xylem embolism and stomatal regulation in two rubber clones (Hevea brasiliensis
Muell. Arg.). Trees 18:109–114
Sardans J, Peñuelas J, Rivas-Ubach A (2011) Ecological metabolomics: overview of current
developments and future challenges. Chemoecology 21:191–225
Sathyan P, Newton RJ, Loopstra CA (2005) Genes induced by WDS are differentially expressed
in two populations of aleppo pine (Pinus halepensis). Tree Genet Genom 1:166–173
Savolainen O, Pyhajarvi T, Knurr T (2007) Gene flow and local adaptation in trees. Annu Rev
Ecol Syst 38:595–619
Scotti I, Calvo-Vialettes L, Scotti-Saintagne C, Citterio M, Degen B, Bonal D (2010) Genetic
variation for growth, morphological, and physiological traits in a wild population of the
Neotropical shade tolerant rainforest tree Sextonia rubra (Mez) van der Werff (Lauraceae).
Tree Genet Genomes 6:319–329
Seager R, Ting M, Held I, Kushnir Y, Lu J, Vecchi G, Huang H-P, Harnik N, Leetmaa A, Lau N-
C, Li C, Velez J, Naik N (2007) Model projections of an imminent transition to a more arid
climate in southwestern North America. Science 316:1181–1184
Secchi F, Lovisolo C, Uehlein N, Kaldenho R, Schubert A (2007) Isolation and functional

characterization of three aquaporins from olive (Olea europaea L.). Planta 225:381–392
Shatil-Cohen A, Attia Z, Moshelion M (2011) Bundle-sheath cell regulation of xylem-mesophyll
water transport via aquaporins under drought stress: a target of xylem-borne ABA? Plant J
67:72–80
Shinozaki K, Yamaguchi-Shinozaki K (2007) Gene networks involved in drought stress response
and tolerance. J Exp Bot 58:221–227
Sperry J, Ikeda T (1997) Xylem cavitation in roots and stems of Douglas fir and white fir. Tree
Physiol 17:275–280
Sperry JS, Saliendra NZ (1994) Intra- and inter-plant variation in xylem cavitation in Betula
occidentalis. Plant Cell Environ 17:1233–1241
Sperry JS, NM Holbrook NM, Zimmermann MH, Tyree MT (1987) Spring filling of xylem
vessels in wild grapevine. Plant Physiol 83:414–417
Sperry JS, Stiller V, Hacke UG (2003) Xylem hydraulics and the soil-plant-atmosphere
continuum: opportunities and unresolved issues. Agron J 95:1362–1370
Sperry JS, Meinzer FC, McCulloh KA (2008) Safety and efficiency conflicts in hydraulic
architecture: scaling from tissues to trees. Plant Cell Environ 31:632–645
Street NR, Skogstrom O, Sjodin A, Tucker J, Rodriguez-Acosta M, Nilsson P, Jansson S, Taylor
G (2006) The genetics and genomics of the drought response in Populus. Plant J 48:321–341
Teixeira J, Missiaggia A, Dias D, Scarpinati E, Viana J, Paula N, Paula R, Bonine C (2011) QTL
analyses of drought tolerance in Eucalyptus under two contrasting water regimes. BMC Proc 5:40
Thumma BR, Nolan MR, Evans R, Moran GF (2005) Polymorphisms in Cinnamoyl CoA
Reductase (CCR) are associated with variation in microfibril angle in Eucalyptus spp.
Genetics 171:1257–1265
Topa MA (2004) Tree physiology: root system physiology. In: Burley J, Evans J, Youngquist J
(eds) The encyclopedia of forest sciences. Elsevier Science Ltd., London, pp 1606–1616
Tschaplinski TJ, Tuskan GA, Sewell MM, Gebre GM, Todd DE, Pendley CD (2006) Phenotypic
variation and quantitative trait locus identification for osmotic potential in an interspecific hybrid
inbred F2 poplar pedigree grown in contrasting environments. Tree Physiol 26:595–604
Tsuda M, Tyree MT (1997) Whole-plant hydraulic resistance and vulnerability segmentation in
Acer saccharinum. Tree Physiol 17:351–357
Tuskan GA, DiFazio S, Jansson S, Bohlmann J et al (2006) The genome of black cottonwood,
Populus trichocarpa (Torr. & Gray). Science 313:1596–1604
Tyree MT, Ewers FW (1991) The hydraulic architecture of trees and other woody plants. New
Phytol 119:345–360
Tyree MT, Sperry JS (1989) Vulnerability of xylem to cavitation and embolism. Ann Rev Plant
Physiol Plant Mol Biol 40:19–38
Tyree MT, Zimmermann MH (2002) Xylem structure and the ascent of sap, 2nd edn. Springer, Berlin
Tyree MT, Snyderman DA, Wilmot TR, Machado JL (1991) Water relations and hydraulic
architecture of a tropical tree (Schefflera morototoni): data, models, and a comparison with
two temperate species (Acer saccharum and Thuja occidentalis). Plant Physiol 96:1105–1113
Tyree MT, Cochard H, Cruiziat P, Sinclair B, Ameglio T (1993) Drought-induced leaf shedding
in walnut: evidence for vulnerability segmentation. Plant Cell Environ 16:882–979
Vaahtera L, Brosché M (2011) More than the sum of its parts. How to achieve a specific
transcriptional response to abiotic stress. Plant Sci 180:421–430
Valladares F, Pearcy RW (1997) Interactions between water stress, sun-shade acclimation, heat
tolerance and photoinhibition in the sclerophyll Heteromeles arbutifolia. Plant Cell Environ
20:25–36
Valladares F, Pearcy RW (2002) Drought can be more critical in the shade than in the sun: a field
study of carbon gain and photo-inhibition in a Californian shrub during a dry El Niño year.
Plant Cell Environ 25:749–759
van Mantgem PJ, Stephenson NL, Byrne JC, Daniels LD, Franklin JF, Fulé PZ, Harmon ME,
Larson AJ, Smith JM, Taylor AH, Veblen TT (2009) Widespread increase of tree mortality
rates in the western United States. Science 323:521–524
Vander Willigen C, Pammenter NW (1998) Relationship between growth and xylem hydraulic
characteristics of clones of Eucalyptus spp. at contrasting sites. Tree Physiol 18:595–600
Vilagrosa A, Morales F, Abadía A, Bellot J, Cochard H, Gil-Pelegrin E (2010) Are symplast
tolerance to intense drought conditions and xylem vulnerability to cavitation coordinated? An
integrated analysis of photosynthetic, hydraulic and leaf level processes in two Mediterranean
drought-resistant species. Env Exp Bot 69:233–242
Vitasse Y, Bresson CC, Kremer A, Michalet R, Delzon S (2010) Quantifying phenological
plasticity to temperature in two temperate tree species. Funct Ecol 24:1211–1218
Voltas J, Chambel MR, Prada MA, Ferrio JP (2008) Climate-related variability in carbon and
oxygen stable isotopes among populations of Aleppo pine grown in common-garden tests.
Trees Struct Funct 22:759–769
Von Humboldt A, Bonpland A (2009) Essay on the geography of plants. In: Jackson ST (ed)
Translated by Romanowski S. The University of Chicago Press, Chicago, p 274
Vornam B, Gaitling O, Derory J, Plomion C, Kremer A, Finkeldey R (2011) Characterisation and
natural variation of a dehydrin gene in Quercus petraea (Matt.) Liebl. Plant Biol 13:881–887
Wang WX, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock proteins and
molecular chaperones in the abiotic stress response. Trends Plant Sci 9:244–252
Wanke D, Kolukisaoglu HU (2010) An update on the ABCC transporter family in plants: many
genes, many proteins, but how many functions? Plant Biol 12:15–25
Warren CR, Aranda I, Cano FJ (2011) Responses to water stress of gas exchange and metabolites
in Eucalyptus and Acacia spp. Plant Cell Environ 34:1609–1629
Warren CR, Aranda I, Cano FJ (2012) Metabolomics demonstrates divergent responses of two
Eucalyptus species to water stress. Metabolomics 8:186–200
Watkinson JI, Sioson AA, Vasquez-Robinet C, Shukla M, Kumar D, Ellis M, Heath LS,
Ramakrishnan N, Chevone B, Watson LT, van Zyl L, Egertsdotter U, Sederoff RR, Grene R
(2003) Photosynthetic acclimation is reflected in specific patterns of gene expression in
drought-stressed Loblolly pine. Plant Physiol 133:1702–1716
Yang F, Wang Y, Miao LF (2010) Comparative physiological and proteomic responses to
drought stress in two poplar species originating from different altitudes. Physiol Plantarum
139:388–400
Zach A, Schuldt B, Brix S, Hornaa V, Culmsee H, Leuschner C (2010) Vessel diameter and
xylem hydraulic conductivity increase with tree height in tropical rainforest trees in Sulawesi,
Indonesia. Flora 205:506–512
Zhang JW, Marshall JD (1995) Variation in carbon isotope discrimination and photosynthetic gas
exchange among populations of Pseudotsuga menziessi and Pinus ponderosa in different
environments. Funct Ecol 9:402–412
Zhang JW, Marshall JD, Jaquish BC (1993) Genetic differentiation in carbon isotope
discrimination and gas exchange in Pseudotsuga menziesii. Oecologia 93:80–87
Zhang JW, Fins L, Marshall JD (1994) Stable carbon isotope discrimination, photosynthetic gas
exchange, and growth differences among wetern larch families. Tree Physiol 14:531–539
Zufferey V, Cochard H, Ameglio T, Spring JL, Viret O (2011) Diurnal cycles of embolism
formation and repair in petioles of grapevine (Vitis vinifera cv. Chasselas). J Exp Bot
62:3885–3894
Zwieniecki MA, Holbrook NM (2009) Confronting Maxwell’s demon: biophysics of xylem
embolism repair. Trends Plant Sci 14:530–534
Zwieniecki MA, Melcher PJ, Holbrook NM (2001) Hydrogel control of xylem hydraulic
resistance. Science 291:1059–1062
ANEXO II. EuroPineDB: a high-coverage Web database for maritime pine
transcriptome, BMC Genomics 12 (2011) 366
Fernández-Pozo et al. BMC Genomics 2011, 12:366
http://www.biomedcentral.com/1471-2164/12/366
DATABASE Open Access
EuroPineDB: a high-coverage web database for

maritime pine transcriptome
Noé Fernández-Pozo1, Javier Canales1, Darío Guerrero-Fernández2, David P Villalobos1, Sara M Díaz-Moreno1,
Rocío Bautista2, Arantxa Flores-Monterroso1, M Ángeles Guevara3, Pedro Perdiguero4, Carmen Collada3,4,
M Teresa Cervera3,4, Álvaro Soto3,4, Ricardo Ordás5, Francisco R Cantón1, Concepción Avila1, Francisco M Cánovas1
and M Gonzalo Claros1,2*
Abstract
Background: Pinus pinaster is an economically and ecologically important species that is becoming a woody
gymnosperm model. Its enormous genome size makes whole-genome sequencing approaches are hard to apply.
Therefore, the expressed portion of the genome has to be characterised and the results and annotations have to
be stored in dedicated databases.
Description: EuroPineDB is the largest sequence collection available for a single pine species, Pinus pinaster
(maritime pine), since it comprises 951 641 raw sequence reads obtained from non-normalised cDNA libraries and
high-throughput sequencing from adult (xylem, phloem, roots, stem, needles, cones, strobili) and embryonic
(germinated embryos, buds, callus) maritime pine tissues. Using open-source tools, sequences were optimally pre-
processed, assembled, and extensively annotated (GO, EC and KEGG terms, descriptions, SNPs, SSRs, ORFs and
InterPro codes). As a result, a 10.5× P. pinaster genome was covered and assembled in 55 322 UniGenes. A total of
32 919 (59.5%) of P. pinaster UniGenes were annotated with at least one description, revealing at least 18 466
different genes. The complete database, which is designed to be scalable, maintainable, and expandable, is freely
available at: http://www.scbi.uma.es/pindb/. It can be retrieved by gene libraries, pine species, annotations,
UniGenes and microarrays (i.e., the sequences are distributed in two-colour microarrays; this is the only conifer
database that provides this information) and will be periodically updated. Small assemblies can be viewed using a
dedicated visualisation tool that connects them with SNPs. Any sequence or annotation set shown on-screen can
be downloaded. Retrieval mechanisms for sequences and gene annotations are provided.
Conclusions: The EuroPineDB with its integrated information can be used to reveal new knowledge, offers an
easy-to-use collection of information to directly support experimental work (including microarray hybridisation),
and provides deeper knowledge on the maritime pine transcriptome.
1 Background Given that trees are the great majority of conifers, they
Conifers (Coniferales), the most important group of provide a different perspective on plant genome biology
gymnosperms, represent 650 species, some of which are and evolution taking into account that conifers are sepa-
the largest, tallest, and oldest non-clonal terrestrial rated from angiosperms by more than 300 million years
organisms on Earth. They are of immense ecological of independent evolution. Studies on the conifer genome
importance, dominating many terrestrial landscapes and are revealing unique information which cannot be
representing the largest terrestrial carbon sink. Currently inferred from currently sequenced angiosperm genomes
present in a large number of ecosystems, they have (such as poplar, Eucaliptus, Arabidopsis or rice): around
evolved very efficient physiological adaptation systems. 30% of conifer genes have little or no sequence similar-
ity to plant genes of known function [1,2]. Unfortu-
* Correspondence: claros@uma.es nately, conifer genomics is hindered by the very large
1
Departamento de Biología Molecular y Bioquímica, Facultad de Ciencias,
Campus de Teatinos s/n, Universidad de Málaga, 29071 Málaga, Spain genome (e.g. the pine genome is approximately 160
Full list of author information is available at the end of the article times larger than Arabidopsis and seven times larger
© 2011 Fernández-Pozo et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Fernández-Pozo et al. BMC Genomics 2011, 12:366 Page 2 of 11
than the human genome; in fact, it is larger than any be highly contaminated or incorrectly pre-processed [9],
other genome sequenced to date) that is replete with there is a need for more reliable pre-processing, cluster-
highly repetitive, non-coding sequences [3]. ing, assembly and annotation pipelines to yield reliable
Conifers include the economically and ecologically information. ConiferEST [15] (now part of ConiferGDB
important species of spruces (Picea sp) and pines http://www.conifergdb.org/coniferEST.php) was the first
(Pinus), Pinus being the largest extant genus with attempt to rationalise pine sequences by more precise
approximately 115 species. The importance of pines is pre-processing dedicated to Pinus taeda traces only.
due to the fact that: (i) their timber and paper pulp are The DFCI Pine Gene Index http://compbio.dfci.harvard.
used for the construction of buildings and furniture; (ii) edu/cgi-bin/tgi/gimain.pl?gudb=pine, a subset of the dis-
they are used in reforestation due to their rapid growth continued TGI Gene Indices [16], is a non-redundant
and drought tolerance as compared to other tree spe- database of all putative Pinus genes. This is a very large
cies; (iii) they help stabilise sandy soils and indirectly act compilation of pine sequences, but only GO and KEGG
as an atmospheric CO 2 sink, helping to reduce global annotations are available and no separation by species is
warming; (iv) some pine nuts are widely used in Medi- provided, P. taeda is highly over-represented, and its
terranean cuisine. Consequently, the genus Pinus is interface only allows limited interaction. ForestTreeDB
becoming a woody gymnosperm model. The main pine was created to centralise large-scale ESTs from diverse
model species in Europe are Pinus pinaster and Pinus tissues of conifer and poplar trees [1], but it is no longer
sylvestris, whereas Pinus taeda and Pinus contorta are available. The TreeGenes database http://dendrome.
the equivalent in North America. Therefore, it is rele- ucdavis.edu/treegenes/ is composed of a wide range of
vant to investigate and increase our knowledge of the forest tree species [17]. This effort to combine and
content of the pine genome as this would allow the inter-relate a great variety of different information
exploitation of natural genetic resources and the use of should be acknowledged, even though EST pre-proces-
new forest reproductive material appropriate to adapt sing is not optimal. TreeSNPs [18] and PineSAP [19]
these trees to a changing climate. are databases exclusively devoted to single nucleotide
The application of genome-based science is playing an polymorphisms (SNPs) in Picea and Pinus species,
important role in understanding the genome content and respectively. Recently, Parchman and co-workers [2]
structure of different organisms. Since whole-genome described the first high-throughput analysis of a pine
sequencing approaches are hard to apply to large genomes species, but no database was created for this. It should
such as the pine genome, scientists have focused on the be noted that none of the above databases are linked to
expressed portion of the genome using dedicated technol- the pine microarrays described in literature.
ogies. For example, the sequencing of clones obtained by Our group has been working on pine genomics for
suppression subtractive hybridisation (SSH) [4-6] provides many years (e.g., EMBL accession numbers AM982822-
gene-enriched sequences that are specific to a particular AM983454, BX248593-BX255804, BX682240-BX683073,
condition. However, the dominant approach to character- BX784033-BX784385, EC428477-EC428747, FM945441-
ising the transcriptionally active portions of pine genomes FM945999 or FN256437-FN257130) and wish to provide
has been expressed sequence tags (ESTs) [7,8] due to the high-quality sequences and annotations of pine genomes
absence of non-coding DNA (mainly introns and inter- by means of EuroPineDB. Taking advantage of next-gen-
genic regions). Classic ESTs are subject to artefacts during eration sequencing methods, recently released pre-pro-
cDNA library construction and are highly error prone dur- cessors [20], reliable sequence annotators [21], and the
ing sequencing procedures. As a result, erroneous cluster- bioinformatics infrastructure of the University of Málaga
ing and assembling occur during reconstruction of (Spain), EuroPineDB was designed to gather the most
putative transcripts and may ultimately lead to inaccurate reliable re-pre-processed, assembled, and annotated P.
gene annotation [9]. However, next-generation sequencing pinaster sequences using different technologies. Retrieval
technologies have removed many drawbacks and time- systems based on sequence similarity, description
consuming steps involved in classic ESTs and have facili- matches or microarray positions are also included, as
tated transcriptome sequencing of many species at a frac- well as browsing by species, experimental process, and
tion of the total time and cost previously required [10]. annotation. As a new feature, many of its sequences
ESTs have also driven the development of pine microar- have been printed on a microarray for expression analy-
rays [11-14], although there is no easy way to relate the sis [22] and can be freely browsed.
data printed on these microarrays to the corresponding
pine sequences. 2 Construction and content
Sequencing projects should store, organise, and 2.1 Pine sequences
retrieve sequences by means of user-friendly databases. Although EuroPineDB is mainly devoted to the P. pina-
Since many sequences in EST databases are reported to ster (maritime pine) genome, several sequences from
two other species (P. sylvestris and P. pinea) are also SAM/COMPLETE/index.php?ID=gemini – an EST-
included since their sequences were printed in a pine based microarray was designed containing 3456 spots
microarray (see below). printed twice with clones taken from the Pin, Gemini
2.1.1 Gene libraries and CK16 gene libraries only (Table 2) [22]. Spots were
Different gene libraries, all of which were constructed distributed on the chip into 16 blocks of 16 × 14 dots.
using different tissues and different strategies (described The microarray also included some full-length cDNA
in Table 1) were included. All libraries were sequenced sequences of genes related to nitrogen metabolism, such
using Sanger’s dideoxynucleotide method except for the as aspartate aminotransferase, asparagine synthetase, L-
sequences generated from Pp-454, which were obtained asparaginase, glutamine synthetase a and b, NADP+ iso-
with a GS-FLX pyrosequencer using Titanium technol- citrate dehydrogenase and ornithine aminotransferase,
ogy. Pp-454 was the main contributor to the database (55 which can be found in the EMBL v102 set. The inclu-
431 UniGenes and 844 737 curated reads). Frequency sion of microarray information in EuroPineDB facilitates
distributions of reads and contigs are shown in Figure 1. accessing the most complete information on each
2.1.2 EMBL sequences sequence printed on it. In the near future, microarrays
Gene library reads were completed with 13 206 implemented with sequences contained in EuroPineDB
sequences from the EMBL v. 102 database including the will be also included.
plant EST (Expressed Sequence Tag) and plant STD
(Standard) sets for sequences whose ‘source organism’ 2.2 Database architecture
field contained P. pinaster, P. sylvestris or P. pinea, pro- The EuroPineDB was built using Ruby On Rails 2.0
vided that the sequence was not already included as a http://rubyonrails.org/, a web development framework
member of one of the gene libraries, and discarding any that uses a model-view-controller pattern to maintain
organellar sequence or sequences whose length was strict separation between the web interface (views) code,
below 100 bp. The idea was to gather all sequence data database tables (models), and all methods that handle
on the three species, including their annotations. With interactions between views and database (controllers). It
P. pinaster as the main contributor (12 673 out of 13 also maintains different environments for each develop-
206 EMBL entries), EMBL entries only provided 5667 ment phase (development, production and testing). This
different UniGenes. enabled EuroPineDB to be developed and tested in a
2.1.3 Microarray redundant Oracle RAC (Real Application Cluster) data-
Before EuroPineDB was constructed – based on the base. Bulk imports, updates, and database managements
existing putative UniGenes http://cbi.labri.fr/outils/ were automated by means of Ruby scripts.
Table 1 Gene libraries providing sequences for EuroPineDB

Gene Tissue Species Experimental conditions
library
Pp-454 Roots, stem, embryos, callus, cones, male and female strobili, P. pinaster ESTs from several different tissues
buds, xylem, phloem.
LG0BCA Buds P. pinaster ESTs, adult buds
GEMINIa Xylem P. pinaster ESTs from normal, compression, opposite,
early and late wood
SSH Xylem P. pinaster SSH, compression vs. opposite, and juvenile vs.
Xylem mature
UPM Roots, stem, needles P. pinaster SSH, drought stress
ARG Roots P. pinaster SSH, ammonium excess vs. ammonium
deficiency
SSH Lac- Roots P. pinaster SSH, inoculated with Laccaria bicolor vs. not
Pine inoculated
SSH Mic Roots P. pinaster SSH, mycorrhizal vs. not mycorrhizal
CK16b Cotyledons P. pinea SSH, adventitious shoot induction
SSH Embryos P. sylvestris SSH, lack of N vs. normal N
Embryos
Pin Cotyledons P. sylvestris ESTs from photosynthetic tissues
EMBL v. - P. pinaster, P. pinea, P. Miscellaneous
102 sylvestris
a
GEMINI gene library was described in [8]
b
CK16 gene library was described in [4]
from the Pp-454 gene library were discarded due to low

quality. The EMBL v. 102 subset included in EuroPi-
neDB was also pre-processed with SeqTrim in order to
remove uninformative, contaminant or erroneous
sequences, even though these sequences lack a QV.
Curated sequences, i.e. those longer than 100 bp for
Sanger’s reads and 60 bp for 454 reads that exceed Seq-
Trim pre-processing, were assembled to produce puta-
tive pine transcriptional units (UniGenes) as contigs and
singletons. Sanger’s reads were de novo assembled with
a web version of CAP3 [http://www.scbi.uma.es/cap3,
[23]] since it has been described as a highly reliable
sequence assembler for establishing UniGenes [24] with
these types of reads. CAP3 assembly was conducted
with default parameters using 85% as the cut-off for
overlap percent identity to deal with the sequence varia-
tion due to the high heterozygosity of pine genes and
genome heterogeneity between samples (Table 1). The
454 reads were de novo assembled with a web version of
MIRA3 [http://www.scbi.uma.es/mira, [25]] using 454
settings for ESTs, which enormously reduces the num-
ber of misassembled contigs; moreover, this assembly
Figure 1 A, Size distribution of pre-processed 454 and Sanger’s contains 99.94% of curated reads and provides as few as
reads used for EuroPineDB. As expected, Sanger reads were 471 singletons (0.06%). Each library sequence set (Table
longer than 454 reads in length. B, Contig size distribution within 1) was assembled separately to obtain specific UniGene
EuroPineDB. assemblies for every gene library and every pine species
(Table 2); P. pinaster comprehensive assembly was also
An automated pipeline that combines all the tools performed with MIRA3 with mixed 454-Sanger settings.
described here is executed on every EuroPineDB update. A collection of all UniGenes is available for every
An update incorporates new pine sequence retrieval assembly and the distribution of contig lengths is shown
from dbEST and EMBL databases, new user reads, and in Figure 1, where the longest reads correspond to San-
the re-execution of bioinformatics tools with every new ger reads and the mean length of GS-FLX Titanium
UniGene. reads are below the expected mean length due to the
extremely high number of low quality nucleotides
2.3 Pre-processing and assembling entries (52.5%, Table 2). SSH libraries account for the small
Most problems for automated sequence assembly shoulder on 200 bp in Figure 1A for Sanger reads.
resulted from chimerical clones in the plasmid libraries,
bacterial DNA contamination, low-quality sequences, 2.4 Annotation
and low-complexity repeats. Since ESTs in databases are The annotation of pine sequences is especially challen-
commonly inaccurately pre-processed, any data ging since, phylogenetically, pine is distantly related to
sequence contained in EuroPineDB whose quality values angiosperm plant models, for which significantly more
(QV) for each nucleotide are available was pre-processed data and tools are already available [26]. EuroPineDB
using SeqTrim http://www.scbi.uma.es/seqtrim with contains detailed and reliable annotations on UniGenes.
parameter customisation for each type of library [20]. This was achieved by combining the results of several
High-quality pre-processed EST and SSH sequences annotation processes (described below). The redundant
guarantee that only non-chimerical, good-quality bioinformatics approach makes the curation and annota-
sequences (i.e., reads devoid of vectors, adaptors, poly- tion processes highly reliable. During every EuroPineDB
A/T tails, contaminants, and potential cloning artefacts) update, new sequences and new contigs will be re-anno-
are included in the database, while sequences consisting tated to provide the correct link and annotation as
of cloning vectors (AC BX676903) or containing poly-A knowledge increases. Each sequence and UniGene has a
(AC BX676940) were removed. The better the quality of specific page to display its annotation together with the
the trimmed sequences, the more reliable the final E value associated with it to enable the empirical assess-
assembly. It should be noted that 52.5% of nucleotides ment of annotation quality. The current version of
Table 2 Statistics for the gene libraries shown in Table 1

Gene library Raw Curated Mean Singletons Contigs UniGenes Discarded nt (%) by
lengtha (% annotated)
QV Vector Artefactsb
Pp-454 913 786 844 737 227 471 54 960 55 431 (59.5%) 52.5% NA 3.03%
LG0BCA 8766 8766 608 3834 1363 5197 (68.2%) NA NA 0.24%
GEMINI 13 057 7916 458 3066 1124 4190 (49.9%) 9.4% 10.4% 2.9%
SSH Xylem 992 790 474 385 142 527 (49.5%) 5.35% 31.8% 2.5%
UPM 2806 1115 465 258 157 415 (31.8%) 3.2% 15.9% 21.04%
ARG 218 148 394 127 7 134 (47.8%) 22.5% 5.1% 5.3%
SSH Lac-Pine 351 231 350 210 8 218 (34.4%) 18.5% 4.7% 2.64%
SSH Mic 294 194 314 149 13 162 (38.3%) 15.3% 13.4% 5.75%
CK16 358 282 575 221 24 245 (65.3%) NA 0.05% 6.6%
SSH Embryos 96 57 437 34 6 40 (57.5%) 1.7% 20.6% 8.8%
Pin 863 617 532 335 86 421 (68.9%) 10.2% 9% 2.9%
EMBL v. 102 13 206 12 673 502 3704 1963 5667 (NA) NA 0.1% 0.58%
TOTAL 954 793 880 295
P. pinaster 951 641 877 523 597 684 54 648 55 332 (59.5%)
P. sylvestris 2770 2466 730 476 203 679 (65.9%)
P. pinea 382 306 574 239 27 266 (63.2%)
QV, quality value. NA, not applicable.
a
Mean lengths are calculated with gene library reads. Nevertheless, they are calculated for contigs in the last three rows corresponding to the three species.
b
Artefacts include poly-A, poly-T, adaptors, contaminant sequences, and chimerical inserts.
EuroPineDB includes annotations for 59.5% of pine script was designed to assign the corresponding meta-
UniGenes. bolic pathway (a KEGG map) to each EC key provided
2.4.1 Putative description by Blast2GO. InterPro codes obtained from Blast2GO
A sequence description is a user-friendly manner to were included to add other high-valued annotations
offer information about putative functions. Every Sanger (such as functional sites, protein families or conserved
sequence in EuroPineDB is given a definition from up domains) since it is an integrated documentation
to four different sources, with the advantage that incon- resource [27]. Entries without annotations are candi-
sistent descriptions are evidence of misannotation. dates for re-annotation with every database update.
Descriptions were obtained from: (i) the original 2.4.3 SSRs, SNPs and ORFs
description, if the sequence has one in the EMBL; (ii) Plant cDNAs contain a high frequency of polymorph-
the user definition, provided by the sequence owner isms whose main sources are single nucleotide poly-
when downloading sequences; (iii) the description morphisms (SNPs) and single sequence repeats (SSRs).
retrieved by Blast2GO (see below); and (iv) the PGI defi- They serve to build molecular markers that form an
nition obtained by the best hit in a low stringency essential starting point for association studies and other
BLAST (E < 10-3). Each UniGene contains only the defi- genome scan applications such as comparative geno-
nition provided by Blast2GO (see below). mics. SNPs and SSRs can also be used as templates to
2.4.2 GO terms, EC keys, KEGG maps, and interpro codes design primers that amplify specific genomic DNA in
Every UniGene sequence was annotated using Blast2GO diverse populations [28]. SSRs have been assessed with
[21] using the best 10 sequences providing hits of at MREPS (http://bioinfo.lifl.fr/mreps/ [29]). SNPs have
least 150 nt with a threshold E-value of 10-10 against the been calculated with an adapted version of AlignMiner
non-redundant GeneBank in order to remove spurious [28]. The tentative (complete or incomplete) ORFs were
annotations. In addition, GO terms with experimental inferred from the results of Full-Lengther [30].
evidence codes were the most preferred, while computa-
tional evidence codes and codes inferred by curator 3 Utility and discussion
were half-weighted for the final annotation; GO terms Molecular sequence databases are fundamental
without biological evidence data or inferred from elec- resources for modern bioscientists. The development
tronic annotation were discarded. This provided annota- of such a genomic resource for Pinus pinaster should
tions with a high degree of confidence for UniGenes facilitate basic and applied research on the genetics
using an E-value for evidence codes of 10 -6 . A Ruby and evolution of this species, its role in maintaining
forest health and ecosystem function, and the genetic sequences. Information on tool versions and database
traits that are desirable for the paper pulp and wood releases used for obtaining the last update is shown on
industry. the right of the home page.
There is an option to download files containing Uni-
3.1 Web interface Gene sequences or sequences displayed on a page in
EuroPineDB has been designed with a user-friendly FASTA format (including their QV when available),
interface (Figure 2) that can be browsed anonymously, which facilitates further analyses by laboratories. Cross-
although an authentication process has been considered links to the EMBL database are always provided by
to grant sequence owners the necessary permissions to means of the accession numbers.
browse their sequences privately, or browse through 3.1.1 Navigation tabs
other authorised-while-private unpublished data. It has By means of the ‘Gene Libraries’ tab, the user can see
five top tabs and a menu on the left that enable data- gene libraries, UniGenes and annotations for every gene
base mining from different entry points. Two types of library included in EuroPineDB. Each one contains a
search tabs have also been implemented to perform short description and some characteristics, including the
queries and to retrieve and browse the resulting statistical distribution of the relevant GO terms. The
Figure 2 An example of microarray page in EuroPineDB Web. The upper part contains general information about the microarray as well as
some statistical representation of the GO term distribution. The lower part is a representation of all sequences printed in a selected block. The
colour codes are defined at the bottom of the Web page (not shown) and in the text.
UniGene dataset consists of a consensus sequence of includes the aligned sequences, their orientation, the
each contig and the singletons (see above). contig alignment (as a simple-text), a description for the
Gene library clones are stored in 96-well and/or 384- consensus sequence, and the putative description of
well plates in the laboratory. Navigation using the ‘96- each included Sanger sequence.
Well plates’ and ‘384-Well plates’ tabs displays the plate Clicking on the name of a clone provides access to all the
organisation of the libraries. Users can download the information about it (e.g. EMBL accession number,
sequences of all clones in a plate or browse the plate in sequence length, the plate(s) in which it can be found,
which red clones are useless sequences, green clones are annotations, original and pre-processed sequences, gene
those that have successfully passed SeqTrim pre-proces- library source, etc). From the sequence entry, users can
sing, and black ones are printed controls. return to any previously described browsing page (Figure 3).
Currently, only one microarray (Pinarray1) has been At the home page, a menu on the left enables filtered
designed with EuroPineDB sequences [22]. The ‘Micro- browsing by microarray, pine species, or annotation. Fil-
array’ tab displays general and statistical information tered browsing only displays entries sharing the same
about Pinarray1 (Figure 2), whose printed sequences selected annotation. Each item in the list opens a new
and annotations can be downloaded. Each microarray page with the EuroPineDB entries that share this speci-
block organisation is displayed in the lower part of the fic annotation. For example, based on nitrogen metabo-
page. Coordinates refer to a single sequence. The col- lism (KEGG 00910), it is possible to know how many
ours green, red and black have the same meaning as in sequences are present in the database, since by clicking
the plates (see above). The graphic representation offers on 00910 every enzyme from this pathway can be seen,
the possibility of retrieving information from specific as well as the entries that are annotated as being one of
clones after analysis of any experimental result using these enzymes. As an additional example, all UniGenes
this microarray. involved in photosynthesis (GO:0015979) that belong to
Sequences in EuroPineDB have been assembled by a particular library or pine species can be identified by
gene library and pine species, and can be accessed using means of GO term filtering.
the ‘Assemblies’ tab. Each assembly can be inspected in 3.1.2 Database retrieval
detail, showing a paged list of UniGenes and a summary In addition to a guided browsing, EuroPineDB contents
description. The detailed view of every UniGene can be retrieved by means of text search or sequence
Search Home BLAST
Gene libraries 96-Well plates 384-Well plates Microarrays Assemblies
Each library Each 96w_plate Each 384w_plate Each microarray block List of assemblies
All sequences Each clone/sequence
External links Annotations Each UniGene
Descriptions GO EC KEGG InterPro SNP SSR ORF
Figure 3 Navigating through EuroPineDB. Arrowheads indicate the direction of navigation. Green boxes correspond to available views from
all pages (thus, no incoming arrowhead is specified). Violet text indicates the option of downloading sequences in FASTA format.
similarity. A text search engine has been implemented. synthesis in all gene libraries guarantees the best
It can look for words in annotations (i.e. descriptions approach for gene discovery, instead of using total RNA.
for sequences, GOs, ECs and InterPro) or for specific The reduced amount of repetitive DNA found in the
codes (i.e. accession numbers or EuroPineDB identi- coding sequences and the relatively long reads obtained
fiers). Search results can be restricted to different data- by the sequencing procedures have enabled an accurate
base subsets (displayed on the Web page as de novo assembly and a reliable UniGene collection of
checkboxes), and they are then grouped by common maritime pine. A relative high proportion of reads (876
characteristics and displayed in tabs which show/hide 839 out of 877 523, 99.92%) was assembled into reliable
the list of elements that match the request. Results are contigs (containing less than 9% mismatches), which is
also linked to their respective description pages. in agreement with other high-coverage assemblies [32].
A low-stringent (E < 10-3) BLAST-based search engine
enables users to look for EuroPineDB entries similar to 3.4 EuroPineDB shed light on pine transcriptome
their amino acid or nucleotide sequence. The type of Since estimating the number of genes and the level of
sequence (amino acid or nucleotides) is automatically transcript coverage represented in an EST collection is
detected, and either BLASTN or BLASTX will be used an important issue for transcriptome sequencing pro-
from the latest BLAST+ version [31]. BLAST searches jects, functional information of EuroPineDB UniGenes
may be conducted against different subsets of EuroPi- was included by means of the widely-used Blast2GO
neDB: by species (P. pinaster, P. sylvestris and/or P. annotator [21]. A wide range of GO terms was assigned
pinea, which can be chosen and combined as desired); to EuroPineDB UniGenes indicating that a wide diver-
and by single sequence or UniGenes. BLAST executions sity of transcripts is represented in the database (results
are queued and the results are accessible for up to 1 not shown). Therefore, 32 919 (59.5%) out of 55 332
month with a custom URL that is sent to the user. UniGenes of P. pinaster were annotated and corre-
sponded to at least 18 466 different genes (which is the
3.2 EuroPineDB is a large maritime pine sequence number of unique UniProt hits). Assuming that Uni-
collection Genes inferred from contigs longer than 500 bp are a
EuroPineDB is mainly devoted to P. pinaster since its reliable view of a transcriptome and observing that the
877 523 curated reads (99.7% of total reads) have pro- number of P. pinaster UniGenes longer than 500 bp (20
duced approximately 5.24 × 108 nt in 55 332 UniGenes 928, including annotated and unannotated UniGenes) is
(Table 2), 24 937 being > 500 bp. Assuming that a simi- slightly greater than the number of different UniGenes
lar number of genes occur in P. pinaster as in Arabidop- regarding unique UniProt hits (18 466), it can be
sis thaliana (25 000, which is close to the number of inferred that much of the P. pinaster genes have been
UniGenes > 500 bp) and a similar average transcript identified with the gene libraries described in Table 1,
length (2000 nt), average transcriptome coverage was since both numbers (18 466 and 20 928) are close to
estimated at 10.5×. This amount of data and the high the 25 000 genes that are supposed to form the A. thali-
coverage represent a substantial sequence resource for ana genome.
P. pinaster that will contribute significantly to its geno- The 59.5% of annotated maritime pine UniGenes is
mic analysis and make EuroPineDB one of the largest consistent with the 63.6% (20 928 out of 32 919 Uni-
sequence collections available for a pine species. Further Genes) obtained when considering only UniGenes
evidence of the high coverage is that the number of P. longer than 500 bp. Both percentages are only slightly
pinaster UniGenes is slightly lower than the number of lower than the 65% annotated in Eucawood [33] and the
UniGenes in the Pp-454 library (55 431, Table 2). This 67.8% in Melogen [34], but clearly more than the 32%
indicates that UniGenes from the other gene libraries, of annotated sequences of P. contorta [2]. In total, 935
which are also longer in size (Figure 1), have served to (1.7%) UniGenes were annotated with another pine
gather together apparently independent contigs from the sequence and 16 113 (29.1%) were annotated with a
454 sequencing, and that most ESTs revealed by capil- conifer (mainly Picea), which reflects the paucity of
lary (Sanger) analyses of cDNA libraries (Table 1) were information on conifers in databases. This is further
also encountered in the 454-sequenced pooled RNA. highlighted by the fact that the 12 057 (31%) annotated
pine genes are qualified as “unknown” proteins, even
3.3 EuroPineDB sequences include a low occurrence of though most of these unknown proteins correspond to
repetitive and retrotransposon-like sequences non-annotated full-length transcripts from Picea glauca
The percentage of retrotransposon-like sequences in [35]. The predicted putative ORF could perhaps provide
EuroPineDB is quite low (127 [0.0001%] reads and 20 further support to any future functional annotation. The
[0.0003%] UniGenes), in contrast with the 6.2% found in 40.5% of unannotated UniGenes may then correspond
P. contorta, indicating that mRNA isolation for cDNA to one or more of the following possibilities: (i) putative
new pine genes that do not have an orthologue; (ii) non- database offers distinct analytical approaches, enabling
coding RNAs (including pseudogenes, antisense tran- EuroPineDB to contain sequence relationships that can-
scripts, structured RNAs, microRNAs, etc) that have not be found elsewhere. Moreover, EuroPineDB only
recently been found in abundance when deep transcrip- includes sequences that have passed stringent quality fil-
tome analysis is performed [36,37]; (iii) short sequences tering and only reliable annotations are assigned. Such a
from the UTR part that are difficult to match, even procedure provides a high level of confidence in the
though 36.4% (11 991) of annotated UniGenes are putative function and characteristics of P. pinaster Uni-
shorter than 500 bp; and (iv) artefactual assemblies that Genes. Whereas the final aim of TreeGenes is to com-
do not correspond to valid protein-coding sequences, as pare the different Pinaceae species, EuroPineDB, like
occurs in 15% of entries in the human gene catalogue ConiferEST [15], is more focused on deep information
[38]. about a single species. In contrast to PGI and to Coni-
Each UniGene also includes information about puta- ferEST, EuroPineDB differentiates pine species, contains
tive SSRs and SNPs, since the development of SSR and the highest number of ESTs for a single conifer species,
SNP markers in pine species could serve to dissect com- and provides insights on every gene library used to seed
plex traits given that linkage disequilibrium is low or the database. ConiferEST attempted to provide reliable
declines rapidly within the length of an average-sized P. taeda EST pre-processing, anticipating the finding
gene [39]. A total of 4740 SSRs have been found in that at least 4.8% of ESTs in dbEST are contaminated
EuroPineDB for P. pinaster; tri-nucleotide repeats were by vectors, linkers, E. coli DNA and mitochondrial
found to be the most common SSRs in EuroPineDB sequences [9]. TreeGenes does not fully pre-process
(55.7%), with tetra-nucleotide (12.6%) and di-nucleotide chromatograms, since it was started using the high-qual-
(10.5%) repeats being present at much smaller frequen- ity sequence provided by PHRED; this has been
cies. This contrasts with P. contorta in which di-nucleo- described as a suboptimal strategy since it over-trims in
tide repeats were the most abundant. A total of 44 185 relation to terminal structures, representing a loss of
SNPs were also identified. Most SSRs and SNPs (3546 directional, positional and structural information on
[74.8%] and 41 152 [93.1%], respectively) occur in Uni- cDNA termini [20]. Since Pine Gene Index 7.0 extracted
Genes with a putative ORF (2966 and 10 756, respec- the sequences directly from databases, it contains
tively), and 1% occurs in start/end codons. These untrimmed terminus parts, which has a detrimental
numbers are difficult to compare to other conifers impact on many downstream EST applications, thereby
because of the different algorithms used for detection compromising the reliability of their resulting tentative
[2,18,39]. Due to the enormous size of the pine genome, contigs.
ORF-based SSRs and SNPs are advantageous since they Early pre-processing of some gene libraries consid-
will reduce the mapping efforts required for the devel- ered in EuroPineDB [40] have proven to be incorrectly
opment of high-density maps and association studies. processed and annotated (e.g. accession numbers
The development of SSR/SNP molecular markers, as BX252344, BX255382, BX252627, BX252630 or
well as the ORF predictions contained in EuroPineDB, BX251344), and this is mainly due to using the now-
will facilitate comparative genomics with other well- outdated StackPack [41] workflows based on PHRED
known conifers like P. taeda, P. contorta, P. glauca and and PHRAP algorithms. EuroPineDB was pre-pro-
P. sitchensis, and will be very useful to scientists inter- cessed with SeqTrim [20] and assembled using CAP3
ested in different aspects of pine genomics. In contrast [23] and MIRA3 [25]. The use of SeqTrim was advan-
to other plant databases, the SSRs and SNPs included in tageous in obtaining reliable trimmed sequences,
EuroPineDB are downloadable and can be used within which is preferable to tailor-made scripts for every
any research project. kind of sequence. An example of this improvement is
indicated by the fact that EMBL v. 102 provided 12
3.5 EuroPineDB differential features 673 out of 13 206 sequence entries (Table 2) devoid of
EuroPineDB is a dynamic structure since its content is any class of contaminant/artefactual sequences.
re-assembled and re-annotated when new sequences are Although this percentage could be considered too high
added. It is designed to include new tables that display for the EMBL database, it is clearly under the 4.8%
other pine genomic features in the near future. Its pur- reported for ESTs [9] because EMBL sequences have a
pose is to make UniGenes and their annotations avail- more detailed curation process than ESTs. The use of
able to the scientific community involved in pine SeqTrim is also devoid of the original reads of contam-
genomics by means of a flexible interface for developing inating sequences from several bacteria and fungi gen-
queries. Although overlaps exist with the content of the omes. Since contigs established with MIRA3 are highly
Pine Gene Index (PGI) [16] and TreeGenes [17], each reliable (the maximal mismatch percent in a contig is
below 9%), EuroPineDB assemblies for P. pinaster MAG, PP, CC, MTC and AS and RO conceived, designed and constructed the
different gene libraries. AFM performed sequencing reactions. RB tested the
would provide highly reliable UniGenes that would functioning and created different case studies. FRC conceived and designed
reflect a realistic set of pine genes. libraries and the microarray. RO, CA and FMC conceived and designed
libraries and contributed to the interpretation of data. FRC and FMC were
involved in drafting the manuscript. MGC conceived and designed the
4 Conclusion database, checked its functioning and wrote the manuscript. All authors
EuroPineDB can be browsed intuitively (Figures 2 and 3) read and approved the final manuscript.
using several tabs, and data can be retrieved by text
Conflict of interests statement
terms or sequence similarity using a stand-alone BLAST The authors declare that they have no competing interests.
implementation. As a new feature, location information
on sequences in microarrays is provided (Figure 2). Uni- Received: 26 May 2011 Accepted: 15 July 2011 Published: 15 July 2011
Genes and its annotations can be browsed and down-
References
loaded (Figure 3) by pine species as well as by gene 1. Pavy N, Johnson JJ, Crow JA, Paule C, Kunau T, MacKay J, Retzel EF:
library, thus providing scientists with a comprehensive ForestTreeDB: a database dedicated to the mining of tree
source of information on genomics and transcriptomics transcriptomes. Nucleic Acids Res 2007, , 35 Database: D888-894.
2. Parchman TL, Geist KS, Grahnen JA, Benkman CW, Buerkle CA:
of P. pinaster. All this, together with the detailed Transcriptome sequencing in an ecologically important tree species:
sequence information and annotation, user-friendly assembly, annotation, and marker discovery. BMC Genomics 2010, 11:180.
Web-interface (Figure 2), regular updates, as well as 3. Ahuja MR, Neale DB: Evolution of genome size in conifers. Silvae Genetica
2005, 54:126-137.
connection to printed microarrays, make EuroPineDB 4. Alonso P, Cortizo M, Cantón FR, Fernández B, Rodríguez A, Centeno ML,
extremely valuable to researchers using pine as a model Cánovas FM, Ordás RJ: Identification of genes differentially expressed
organism, since its annotations and UniGenes cannot be during adventitious shoot induction in Pinus pinea cotyledons by
subtractive hybridization and quantitative PCR. Tree Physiol 2007,
found elsewhere. Finally, the current EuroPineDB 27(12):1721-1730.
assembly could also be used to design a new generation 5. Paiva JAP, Garnier-Géré PH, Rodrigues JC, Alves A, Santos S, Graça J, Le
of pine microarrays comprising more UniGenes that Provost G, Chaumeil G, Da Silva-Perez D, Bosc A, Fevereiro P, Plomion C:
Plasticity of maritime pine (Pinus pinaster) wood-forming tissues during
would cover more transcriptome elements. Any scien- a growing season. New Phytol 2008, 179(4):1080-1094.
tists wishing to incorporate their sequences in EuroPi- 6. Wang X, Feuerstein GZ: Suppression subtractive hybridisation: application
neDB should contact the administrator to upload the in the discovery of novel pharmacological targets. Pharmacogenomics
2000, 1(1):101-108.
data and obtain a private user account. 7. Allona I, Quinn M, Shoop E, Swope K, St Cyr S, Carlis J, Riedl J, Retzel E,
Campbell MM, Sederoff R, Whetten RW: Analysis of xylem formation in
Availability and requirements pine by cDNA sequencing. Proc Natl Acad Sci USA 1998, 95(16):9693-9698.
8. Cantón F, Le Provost G, Garcia V, Barré A, Frigerio J-M, Paiva J, Fevereiro P,
Project name: EuroPineDB; Web site: http://www.scbi. Ávila C, Mouret J-F, Brach J, de Daruvar A, Cánovas FM, Plomion C:
uma.es/pindb; Operating system(s): platform indepen- Transcriptome analysis of wood formation in maritime pine. Sustainable
dent; Programming language: Ruby, HTML; Other Forestry, Wood Products & Biotechnology BIOFOR. Vitoria: DFA-AFA Press;
2003, 333-347.
requirements: Ruby on Rails; Licence: e.g. GNU Affero 9. Lee B, Shin G: CleanEST: a database of cleansed EST libraries. Nucleic
Public License; Any restrictions to use by non-aca- Acids Res 2009, , 37 Database: D686-689.
demics: licence needed. 10. Wang Z, Gerstein M, Snyder M: RNA-Seq: a revolutionary tool for
transcriptomics. Nat Rev Genet 2009, 10(1):57-63.
11. Adomas A, Heller G, Olson A, Osborne J, Karlsson M, Nahalkova J, Van Zyl L,
Sederoff R, Stenlid J, Finlay R, Asiegbu FQ: Comparative analysis of
Acknowledgements
transcript abundance in Pinus sylvestris after challenge with a
The authors gratefully acknowledge the computer resources and technical
saprotrophic, pathogenic or mutualistic fungus. Tree Physiol 2008,
support provided by the Plataforma Andaluza de Bioinformática of the
28(6):885-897.
University of Málaga, Spain. This study was supported by the Spanish
12. Brinker M, van Zyl L, Liu W, Craig D, Sederoff RR, Clapham DH, von
Ministerio de Ciencia e Innovación [AGL2009-12139-C02-02, BIO2009-07490],
Arnold S: Microarray analyses of gene expression during adventitious
the European Union [PLE2009-0016] and the Junta de Andalucía [CVI-6075
root development in Pinus contorta. Plant Physiol 2004, 135(3):1526-1539.
and BIO-114].
13. Heller G, Adomas A, Li G, Osborne J, van Zyl L, Sederoff R, Finlay RD,
Stenlid J, Asiegbu FO: Transcriptional analysis of Pinus sylvestris roots
Author details
1 challenged with the ectomycorrhizal fungus Laccaria bicolor. BMC Plant
Departamento de Biología Molecular y Bioquímica, Facultad de Ciencias,
Biol 2008, 8:19.
Campus de Teatinos s/n, Universidad de Málaga, 29071 Málaga, Spain.
2 14. Lorenz WW, Yu Y-S, Simões M, Dean JFD: Processing the loblolly pine
Plataforma Andaluza de Bioinformática, Edificio de Bioinnovación, C/Severo
PtGen2 cDNA microarray. J Vis Exp 2009, 25:1182.
Ochoa 34, Universidad de Málaga, 29590 Málaga, Spain. 3Departamento de
15. Liang C, Wang G, Liu L, Ji G, Fang L, Liu Y, Carter K, Webb JS, Dean JFD:
Ecología y Genética Forestal, CIFOR-UNIA, Carretera de La Coruña, km 7,5,
ConiferEST: an integrated bioinformatics system for data reprocessing
28040 Madrid, Spain. 4UM Genómica y Ecofisiología Forestal INIA-UPM,
and mining of conifer expressed sequence tags (ESTs). BMC Genomics
Universidad Politécnica de Madrid, Madrid, Spain. 5Área de Fisiología Vegetal,
2007, 8:134.
Departamento BOS, Instituto Universitario de Biotecnología de Asturias,
16. Lee Y, Tsai J, Sunkara S, Karamycheva S, Pertea G, Sultana R, Antonescu V,
Universidad de Oviedo, 33071 Oviedo, Spain.
Chan A, Cheung F, Quackenbush J: The TIGR Gene Indices: clustering and
assembling EST and known genes and integration with eukaryotic
Authors’ contributions
genomes. Nucleic Acids Res 2005, , 33 Database: D71-74.
NFP analysed and annotated sequences, developed the database interface
17. Wegrzyn JL, Lee JM, Tearse BR, Neale DB: TreeGenes: A Forest Tree
and put all information in the database. DGF designed and constructed the
Genome Database. Int J Plant Genomics 2008, 2008:412875.
database and contributed to input/output scripting. JC, DPV, SDM, AFM,
18. Clément S, Fillon J, Bousquet J, Beaulieu J: TreeSNPs: a laboratory 39. Pavy N, Parsons LS, Paule C, MacKay J, Bousquet J: Automated SNP
information management system (LIMS) dedicated to SNP discovery in detection from a large collection of white spruce expressed sequences:
trees. Tree Genetics & Genomics 2010, 6(3):435-438. contributing factors and approaches for the categorization of SNPs. BMC
19. Wegrzyn JL, Lee JM, Liechty J, Neale DB: PineSAP–sequence alignment Genomics 2006, 7:174.
and SNP identification pipeline. Bioinformatics 2009, 25(19):2609-2610. 40. Gion J-M, Lalanne C, Le Provost G, Ferry-Dumazet H, Paiva J, Chaumeil P,
20. Falgueras J, Lara AJ, Fernandez-Pozo N, Canton FR, Perez-Trabado G, Frigerio J-M, Brach J, Barré A, de Daruvar A, Claverol S, Sommerer N,
Claros MG: SeqTrim: a high-throughput pipeline for preprocessing any Negroni L, Plomion C: The proteome of maritime pine wood forming
type of sequence reads. BMC Bioinformatics 2010, 11(1):38. tissue. Proteomics 2005, 5(14):3731-3751.
21. Gotz S, Garcia-Gomez JM, Terol J, Williams TD, Nagaraj SH, Nueda MJ, 41. Christoffels A, van Gelder A, Greyling G, Miller R, Hide T, Hide W: STACK:
Robles M, Talon M, Dopazo J, Conesa A: High-throughput functional Sequence Tag Alignment and Consensus Knowledgebase. Nucleic Acids
annotation and data mining with the Blast2GO suite. Nucleic Acids Res Res 2001, 29(1):234-238.
2008, 36(10):3420-3435.
22. Canales J, Flores-Monterrosso A, Rueda-Lopez M, Avila C, Canovas FM: doi:10.1186/1471-2164-12-366
Identification of genes regulated by ammonium availability in the roots Cite this article as: Fernández-Pozo et al.: EuroPineDB: a high-coverage
of maritime pine trees. Amino Acids 2010, 39(4):991-1001. web database for maritime pine transcriptome. BMC Genomics 2011
23. Huang X, Madan A: CAP3: A DNA Sequence Assembly Program. Genome 12:366.
Research 1999, 9:868-877.
24. Liang F, Holt I, Pertea G, Karamycheva S, Salzberg SL, Quackenbush J: An
optimized protocol for analysis of EST sequences. Nucleic Acids Research
2000, 28(18):3657-3665.
25. Chevreux B, Pfisterer T, Drescher B, Driesel AJ, Muller WE, Wetter T, Suhai S:
Using the miraEST assembler for reliable and automated mRNA
transcript assembly and SNP detection in sequenced ESTs. Genome Res
2004, 14(6):1147-1159.
26. Kirst M, Johnson AF, Baucom C, Ulrich E, Hubbard K, Staggs R, Paule C,
Retzel E, Whetten R, Sederoff R: Apparent homology of expressed genes
from wood-forming tissues of loblolly pine (Pinus taeda L.) with
Arabidopsis thaliana. Proc Natl Acad Sci USA 2003, 100(12):7383-7388.
27. Apweiler R, Attwood TK, Bairoch A, Bateman A, Birney E, Biswas M,
Bucher P, Cerutti L, Corpet F, Croning MD, Durbin R, Falquet L,
Fleischmann W, Gouzy J, Hermjakob H, Hulo N, Jonassen I, Kahn D,
Kanapin A, Karavidopoulou Y, Lopez R, Marx B, Mulder NJ, Oinn TM,
Pagni M, Servant F, Sigrist CJ, Zdobnov EM: The InterPro database, an
integrated documentation resource for protein families, domains and
functional sites. Nucleic Acids Res 2001, 29(1):37-40.
28. Guerrero D, Bautista R, Villalobos DP, Canton FR, Claros MG: AlignMiner: a
Web-based tool for detection of divergent regions in multiple sequence
alignments of conserved sequences. Algorithms Mol Biol 2010, 5:24.
29. Kolpakov R, Bana G, Kucherov G: mreps: Efficient and flexible detection of
tandem repeats in DNA. Nucleic Acids Res 2003, 31(13):3672-3678.
30. Lara A, Pérez-Trabado G, Villalobos D, Díaz-Moreno S, Cantón F, Claros MG:
A Web Tool to Discover Full-Length Sequences: Full-Lengther. In
Innovations in Hybrid Intelligent Systems. Edited by: Corchado E, Corchado
JM, Abraham A. Berlín Springer; 2007:361-368.
31. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K,
Madden TL: BLAST+: architecture and applications. BMC Bioinformatics
2009, 10:421.
32. Meyer E, Aglyamova GV, Wang S, Buchanan-Carter J, Abrego D,
Colbourne JK, Willis BL, Matz MV: Sequencing and de novo analysis of a
coral larval transcriptome using 454 GSFlx. BMC Genomics 2009, 10:219.
33. Rengel D, San Clemente H, Servant F, Ladouce N, Paux E, Wincker P,
Couloux A, Sivadon P, Grima-Pettenati J: A new genomic resource
dedicated to wood formation in Eucalyptus. BMC Plant Biol 2009, 9:36.
34. Gonzalez-Ibeas D, Blanca J, Roig C, González-To M, Picó B, Truniger V,
Gómez P, Deleu W, Caño-Delgado A, Arús P, Nuez F, García-Más J,
Puigdomènech P, Aranda MA: MELOGEN: an EST database for melon
functional genomics. BMC Genomics 2007, 8:306.
35. Ralph SG, Chun HJ, Kolosova N, Cooper D, Oddy C, Ritland CE, Kirkpatrick R,
Moore R, Barber S, Holt RA, Jones SJ, Marra MA, Douglas CJ, Ritland K, Submit your next manuscript to BioMed Central
Bohlmann J: A conifer genomics resource of 200,000 spruce (Picea spp.) and take full advantage of:
ESTs and 6,464 high-quality, sequence-finished full-length cDNAs for
Sitka spruce (Picea sitchensis). BMC Genomics 2008, 9:484.
• Convenient online submission
36. Mardis ER: Next-generation DNA sequencing methods. Annu Rev
Genomics Hum Genet 2008, 9:387-402. • Thorough peer review
37. Harrow J, Nagy A, Reymond A, Alioto T, Patthy L, Antonarakis SE, Guigo R: • No space constraints or color figure charges
Identifying protein-coding genes in genomic sequences. Genome Biol
2009, 10(1):201. • Immediate publication on acceptance
38. Clamp M, Fry B, Kamal M, Xie X, Cuff J, Lin MF, Kellis M, Lindblad-Toh K, • Inclusion in PubMed, CAS, Scopus and Google Scholar
Lander ES: Distinguishing protein-coding and noncoding genes in the
• Research which is freely available for redistribution
human genome. Proc Natl Acad Sci USA 2007, 104(49):19428-19433.
Submit your manuscript at

www.biomedcentral.com/submit
ANEXO III. Identification of water stress genes in Pinus pinaster Ait. by
controlled progressive stress and suppression-subtractive hybridization
Plant Physiology and Biochemistry 50 (2012) 44-53
Plant Physiology and Biochemistry 50 (2012) 44e53
Contents lists available at SciVerse ScienceDirect
Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy
Research article
Identification of water stress genes in Pinus pinaster Ait. by controlled progressive

stress and suppression-subtractive hybridization
Pedro Perdiguero a, b, Carmen Collada a, b, María del Carmen Barbero a, b, Gloria García Casado c,
María Teresa Cervera a, b, d, Álvaro Soto a, b, *
a
GENFOR Grupo de investigación en Genética y Fisiología Forestal, Universidad Politécnica de Madrid, E-28040 Madrid, Spain
b
Unidad Mixta de Genómica y Ecofisiología Forestal, INIA/UPM, Madrid, Spain
c
Centro Nacional de Biotecnología, CNB, Madrid, Spain
d
Departamento de Ecología y Genética Forestal, CIFOR-INIA, Madrid, Spain
a r t i c l e i n f o a b s t r a c t
Article history: Climate change is a major challenge particularly for forest tree species, which will have to face the severe
Received 18 July 2011 alterations of environmental conditions with their current genetic pool. Thus, an understanding of their
Accepted 30 September 2011 adaptive responses is of the utmost interest.
Available online 8 October 2011
In this work we have selected Pinus pinaster as a model species. This pine is one of the most important
conifers (for which molecular tools and knowledge are far more scarce than for angiosperms) in the
Keywords:
Mediterranean Basin, which is characterised in all foreseen scenarios as one of the regions most dras-
Pinus pinaster
tically affected by climate change, mainly because of increasing temperature and, particularly, by
Drought stress response
SSH
increasing drought.
Microarray We have induced a controlled, increasing water stress by adding PEG to a hydroponic culture. We have
Polyethylene glycol generated a subtractive library, with the aim of identifying the genes induced by this stress and have
searched for the most reliable expressional candidate genes, based on their overexpression during water
stress, as revealed by microarray analysis and confirmed by RT-PCR.
We have selected a set of 67 candidate genes belonging to different functional groups that will be
useful molecular tools for further studies on drought stress responses, adaptation, and population
genomics in conifers, as well as in breeding programs.
! 2011 Elsevier Masson SAS. All rights reserved.
1. Introduction wood production [1], display peculiar characteristics that make the
study of their genetic adaptations difficult. For instance, they usually
Climate change is a highly topical question nowadays. In view of have huge genomes, with a high percentage of repeated sequences
the current climatic forecasts for the next hundred years, the need and pseudogenes whose functions are not well known. As an illus-
to study the adaptive responses of living organisms is broadly tration, whereas the genomes of Arabidopsis thaliana and Populus
acknowledged among the scientific community. This is particularly trichocarpa are approximately 150 and 550 Mbp long, respectively,
relevant for tree species, which are sessile individuals and thus the Pinus pinaster genome is about 30,900 Mbp, 70e75% of which is
cannot flee from adverse conditions. Moreover, because of their made up of highly repeated sequences [2]. Furthermore, angio-
longevity, similar to the predicted time-frame for climate change, sperms diverged from gymnosperms more than 300 million years
they will have to face these perturbations with the same genetic ago. Thus, to a large extent, the knowledge and molecular tools
makeup they currently possess. developed for the former are not fully applicable to the latter. For
Conifers, which represent approximately 34% of the world’s these reasons, the selection of candidate genes for the study of
forests (up to 61%, including mixed forest) and 60% of plantations for adaptation in gymnosperms based solely on their homology with
angiosperm genes, without further confirmation of their participa-
tion in the stress response, is not fully reliable.
The aim of this study was to identify and select for genes
* Corresponding author. GENFOR, G.I. Genética y Fisiología Forestal, Universidad
involved in the response to water stress in conifers. We used the
Politécnica de Madrid, Ciudad Universitaria s/n, E-28040 Madrid, Spain. Tel.: þ34 91
336 63 92; fax: þ34 91 336 55 56. maritime pine (P. pinaster Ait.), which is one of the most common
E-mail address: alvaro.soto.deviana@upm.es (Á. Soto). conifer species in the western Mediterranean basin, as a model
0981-9428/$ e see front matter ! 2011 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.plaphy.2011.09.022
P. Perdiguero et al. / Plant Physiology and Biochemistry 50 (2012) 44e53 45
species. According to current models, this region will be dramati- expression analysis using a macroarray technique detected 156
cally affected by climate change, with an increase of 3.0e3.5 " C in transcripts that were likely to be induced by drought. This result
the annual average temperature and a decrease of 10e20% in the was confirmed by qRT-PCR for 14 genes.
annual rainfall, with increasingly long and more intense periods of In P. pinaster, Dubos et al. [11,12] used the cDNAeAFLP technique
drought [3]. Mediterranean species face an additional difficulty to identify 48 differentially expressed fragments in the needles and
because the most favourable physiological period in terms of light roots of seedlings subjected to a mild water stress, checking their
and temperature, coincides with the period of maximum water expression by reverse northern blot. Recently, 13 P. pinaster and
restriction. P. taeda candidate genes selected from these works were evaluated
Notwithstanding its relatively small geographical range, the for genetic variation in P. pinaster to detect patterns of selection and
maritime pine has a large ecological amplitude, particularly in adaptation to local climatic conditions [13].
relation to rainfall regimes and water availability. Several works In this work we report the identification of 67 candidate genes
have revealed striking differences among maritime pine pop- (including 37 that had not been described in previous water stress
ulations in growth and survival under drought-induced stress, and studies), obtained from an SSH library from plants subjected to
different strategies to face drought ([4,5] and references therein). a progressive, controlled water deficit, and that were selected based
These reasons make the maritime pine a uniquely suitable model on their expression patterns during this stress, analysed by
species for the analysis of adaptation to drought-induced stress. microarrays and confirmed by RT-PCR. This set of genes constitutes
Genomic studies of the response to drought have been launched a valuable molecular tool for further studies on adaptation to
in different pine species. For instance, Heath et al. [6] and Wat- drought-induced stress in gymnosperms with important implica-
kinson et al. [7] performed a preliminary analysis of gene expres- tions for breeding programs.
sion during drought-induced stress in Pinus taeda. These authors
used microarrays that included cDNAs obtained from pre-existing 2. Results and discussion
libraries from the xylem, male cones and shoot tips, but did not
attempt to exhaustively identify genes induced by drought-induced 2.1. Construction and differential screening of a subtracted cDNA
stress. library
In addition, the comparison of EST libraries generated from the
roots of loblolly pines during drought-induced stress and drought A cDNA library enriched in genes that are induced by water
recovery as well as from well-watered roots led to the identification stress was constructed, with the aim of identifying and character-
of 24 transcripts that were significantly induced by drought [8]. ising genes involved in the drought response in P. pinaster Ait. Our
Very recently, this research group used a microarray to analyse the work differs from previous analyses of the water stress response in
expression of 25,848 genes obtained from different libraries in the pines in terms of experimental design and methodology. First, we
roots of P. taeda after seven days of withholding water and after two applied a progressive and more severe stress that is more similar to
days of recovery. They identified up to 2445 genes that were the first steps of natural drought-induced stress, with the aim of
responsive to drought-induced stress in this organism [9]. detecting genes involved in the different response pathways initi-
Sathyan et al. [10] generated an EST library from the roots of ated by different levels of stress, as suggested by Watkinson et al.
Pinus halepensis during drought-induced stress, and a preliminary (2003). Although the inhibition of transcription shares importance
Fig. 1. Funtional distribution of genes obtained from the SSH library. In total, 351 unique ESTs were grouped according to MIPS functional categories for Arabidopsis thaliana. The
percentage of gene transcripts in each group is listed.
46 P. Perdiguero et al. / Plant Physiology and Biochemistry 50 (2012) 44e53
Table 1 Table 1 (continued)

Functional classification of the 67 selected candidate genes induced during the
treatment. ID_sequence Accession No. Annotation
99. Unclassified or unknown proteins
ID_sequence Accession No. Annotation Ppter_DR_6 FR846542 Unknown
1. Metabolism Ppter_DR_51 FR846587 Plasmodesmata-Located Protein 8
1.1. Amino Acid Metabolism Ppter_DR_115 FR846651 Nodulin MtN3 Family Protein
Ppter_DR_61 FR846597 Prephenate Dehydrogenase Ppter_DR_122 FR846658 Unknown
Family Protein Ppter_DR_160 FR846696 Unknown
1.4. Phosphate metabolism Ppter_DR_163 FR846699 Nodulin MtN3 Family Protein
Ppter_DR_227 FR846763 Pyrophosphorylase 4 Ppter_DR_194 FR846730 Unknown
1.5. C-compound and carbohydrate metabolism Ppter_DR_283 FR846819 Dormancy/Auxin Associated
Ppter_DR_4 FR846540 Aldehyde Dehydrogenase 7B4 Family Protein
Ppter_DR_33 FR846569 Seed Imbibition 2 Ppter_DR_303 FR846839 Acyl-Activating Enzyme 18
Ppter_DR_52 FR846588 Quitinase IV Ppter_DR_341 FR846877 Unknown
Ppter_DR_99 FR846635 Glyceraldehyde-3-Phospate Ppter_DR_342 FR846878 Oxidoreductase, 2OG-Fe(II) Oxigenase
Dehydrogenase Family Protein
Ppter_DR_101 FR846637 Glycosyltransferase Family 14 Protein Ppter_DR_349 FR846885 Unknown
Ppter_DR_120 FR846656 Seed Imbibition 2 No hits found
Ppter_DR_276 FR846812 Malate Synthase Ppter_DR_63 FR846599 No Hits Found
Ppter_DR_305 FR846841 Beta-Galactosidase 3 Ppter_DR_107 FR846643 No Hits Found
1.6. Lipid, fatty acid and isoprenoid metabolism Ppter_DR_112 FR846648 No Hits Found
Ppter_DR_48 FR846584 Lipase_3 Ppter_DR_200 FR846736 No Hits Found
Ppter_DR_90 FR846626 Myo-Inositol-1-Phostpate Synthase 2 Ppter_DR_223 FR846759 No Hits Found
Ppter_DR_244 FR846780 Sugar-Dependent 1 Ppter_DR_284 FR846820 No Hits Found
Ppter_DR_278 FR846814 Cytochrome P450 Like_TPB Ppter_DR_307 FR846843 No Hits Found
1.7. Metabolism of intercellular mediators Ppter_DR_327 FR846863 No Hits Found
Ppter_DR_180 FR846716 Lesion Initiation 2; Copropophyrogen
Oxidase
1.20. Secondary metabolism
Ppter_DR_77 FR846613 Acc Oxidase 2
with transcriptional upregulation during acclimation to stress, as
Ppter_DR_274 FR846810 12-Oxophytodienoate Reductase
11. Transcription indicated by the results of Watkinson et al., (2003) and Lorenz et al.,
Ppter_DR_213 FR846749 NAC Domain Containing Protein 28 (2005), our goal in this study was to identify reliable candidate
Ppter_DR_254 FR846790 AP2 Domain Containing genes induced by water deficit. For this purpose, we generated an
Transcription Factor SSH library using clonal material, which is a more exhaustive
Ppter_DR_296 FR846832 DEAD-Box Rna Helicase
technique for the isolation of such candidate genes than has been
Ppter_DR_315 FR846851 BEL1-Like Homeodomain 1
Ppter_DR_319 FR846855 AP2 Domain Containing used in previous works. We picked 4940 colonies that were
Transcription Factor transformed with the forward-subtractive PCR and amplified the
14. Protein fate inserts using nested primers. In all cases, the amplified inserts were
Ppter_DR_136 FR846672 DNAJ Heat Shock N-Terminal Domain
more than 200 bp long. Differential screening by macroarray led us
Containing Protein
Ppter_DR_287 FR846823 DEGP Protease 9
to the identification of 1718 clones that were presumably induced
16. Protein with binding function or cofactor requirement by water stress.
Ppter_DR_13 FR846549 Accelerated Cell Death 1
Ppter_DR_242 FR846778 Unusual Floral Organs
2.2. Annotation and functional classification of ESTs
Ppter_DR_275 FR846811 (R)-Mandelonitrile Lyase,
Putative/(R)-Oxynitrilase, Putative
20. Transport We proceeded with the sequencing of the 1718 candidate
Ppter_DR_123 FR846659 Inositol Transporter 2 clones. In total, 1099 good sequences were clustered into 386
Ppter_DR_162 FR846698 Pleiotropic Drug Resistance 12
unigenes. We used these nucleotide sequences and their translated
Ppter_DR_187 FR846723 Farnesylated Protein 3
Ppter_DR_239 FR846775 Peroxisomal Adenine Nucleotide Carrier 1 amino acid sequences for annotation by performing homology
Ppter_DR_329 FR846865 General Control Non-Repressible 1 searches with non-redundant databases from NCBI and the Gene
30. Cellular communication/signal transduction Index (Pine and Spruce). Thirty-five unigenes showed a significant
Ppter_DR_137 FR846673 WD 40 Repeat Family Protein homology with plastid sequences. Of the 351 presumably nuclear
Ppter_DR_198 FR846734 CBL-Interacting Protein Kinase 20
sequences (included in the EST database of EMBL with accession
32. Cell rescue, defence, cell death and ageing
Ppter_DR_41 FR846577 Nonphotochemical Quenching numbers FR846537 to FR846887, as well as in EuroPineDB [14];
Ppter_DR_72 FR846608 Late Embryogenesis Abundant 14 Supplementary Table S1), 124 have been reported in previous
Ppter_DR_106 FR846642 Tau Class Glutatione S-Transferase works that focused on water stress in Pinus, whereas other 40 have
Ppter_DR_152 FR846688 Heat Shock Protein 90.5
not been formerly described in Pinaceae. Based on the translated
Ppter_DR_159 FR846695 Phenylalanine Ammonia-Lyase 2
Ppter_DR_235 FR846771 Heat Shock Protein 90
sequences, no significant homology was detected for up to 170
32. Systemic interaction with the environment amino acid sequences (48% of the putative nuclear unigenes),
Ppter_DR_262 FR846798 Aluminium Induced LP1 which illustrates the current lack of genomic knowledge for
38. Transposables elements gymnosperms. Putative functional categories were assigned to the
Ppter_DR_37 FR846573 Retrotransposon Protein
other 181 amino acid sequences using FuncatDB [15] and Blast2GO
40. Cell fate
Ppter_DR_22 FR846558 Tetraspanin 3 [16] (Fig. 1, Supplementary Table S2, Supplementary Table S3).
41. Plant development The largest group corresponded to genes involved in metabo-
Ppter_DR_95 FR846631 Late Embryogenesis Abundant Protein, lism (16%). Up to 42% of these were related to carbohydrate
Putative
metabolism, whereas lipid, fatty acid and isoprenoid metabolism
70. Subcellular localisation
Ppter_DR_44 FR846580 Metallo-Beta-Lacmatasa
related sequences, which could be related with the synthesis and
Ppter_DR_80 FR846616 Unknown accumulation of hormones during water stress, comprised the 18%
Ppter_DR_334 FR846870 Unknown of the metabolism group. Another important group contained
proteins involved in the transcription process. Some ESTs showed
Fig. 2. Expression profiles obtained with microarray (histograms) and RT-PCR (lines) techniques for ten selected genes.
Fig. 2. (continued).
a high homology with transcription factors linked to environmental factors, which are one of the largest families of plant specific factors
stresses, such as DREB, bZIP and NAC. The library also includes ESTs that are also involved in drought tolerance [32]. Ppter_DR_296 has
putatively involved in cell rescue and defence, such as RD21 and homology with a DEAD-box ATP-dependent RNA helicases, which
heat shock proteins. have been reported to play a key role in stress responses in various
organisms [33].
2.2.1. Metabolism related genes Nevertheless, almost one third (20) of the 67 selected ESTs (see
One third of the ESTs with a putative function according to below) were either homologous to sequences coding for unknown or
FunCat correspond to this group. Half of them (8) are included in unclassified proteins or lacked homologous sequences in the available
the carbohydrate metabolism group. The accumulation of sugars databases. However, their high inducibility makes them interesting
has been correlated with the acquisition of desiccation tolerance in candidate genes. For instance, Ppter_DR_115 and Ppter_DR_163 are
plants, probably because the sugars protect the structures from homologous to different members of the nodulin MtN3 family from
mechanical and metabolic stresses during dehydration [17]. Arabidopsis, which has not yet been assigned to any functional cate-
Several ESTs in this group share homology with genes that have gory. Nodulin-like proteins are plasmatic membrane aquoporins, and
been previously reported to be related to drought stress tolerance, could be involved in the maintenance of water balance in plants. Both
such as alkaline a-galactosidases (Ppter_DR_33 and Ppter_DR_120; microarray and RT-PCR analyses showed a continuous accumulation
[18]), malate synthases (Ppter_DR_276; [19]), glycosyltransferases of the Ppter_DR_115 transcript during the water stress experiment,
(Ppter_DR_101; [20]) or chitinases (Ppter_DR_52; [21]). This group with levels reaching 20-fold higher than in control samples. Another
also includes a putative aldehyde dehydrogenase (Ppter_DR_4), example is Ppter_DR_107, which was highly overexpressed in needles
which is presumably involved in the detoxification of aldehydes during long-term stress, and did not share homology with any
generated by alcohol metabolism. This result is consistent with the angiosperm genes. Tentative annotation suggests it could represent
accumulation of ethanol in conifer seedlings during drought [22]. a hydroxyproline-rich protein (PRP). Another proline-rich product
Similarly, the heterologous expression of maize ZmALDH22A1 was reported by Sathyan et al. (2005) to be induced by water stress in
confers elevated stress tolerance in tobacco [23]. Ppter_DR_274, P. halepensis. Other upregulated ESTs include Ppter_DR_160,
which was highly induced in the needles, stems and roots, is Ppter_DR334 and Ppter_DR_341, which were homologous to
homologous to 12-oxo-phytodienoic acid reductase (OPR). This unknown proteins in Picea.
gene is induced by osmotic stress in Zea mays, and its heterologous
expression in Arabidopsis improves the resistance to osmotic and 2.3. Microarray analysis and RT-PCR
salt-induced stress during seed germination [24].
Since its description by Diatchenko et al. [34] the SSH approach
2.2.2. Cell rescue and defence genes has proved to be a powerful tool for enriching libraries with
This category includes putative late embryogenesis abundant differentially expressed genes. However, this approach generates
(LEA) proteins (Ppter_DR_51, Ppter_DR_72 and Ppter_DR_95), which quite a few false positives, and ESTs are subject to artefacts during
is a group of proteins whose involvement in desiccation tolerance is construction of the cDNA library. For this reason, a careful analysis
well known (f. i., Battaglia et al. (2008) [25] and references therein). of the fragments obtained is needed. In this study, the selection of
Ppter_DR_136, Ppter_DR_152 and Ppter_DR_235 show homology candidate genes from among the 351 nuclear unigenes was based
with heat shock proteins of the HSP90 family, which are known as on their overexpression during PEG-induced water stress. For this
molecular chaperones and are related to different abiotic stresses purpose we examined the transcription levels during the treatment
(heat, cold, salt and heavy metals) [26]. Also in this group appeared in the needles, stems and roots of four genotypes independently
an EST (Ppter_DR_106) putatively corresponding to a glutathione S- using a customised microarray.
transferase, which are a group of genes induced by drought in Ara-
bidopsis [27].
2.2.3. Transport
Transport processes play an important role in the mobilisation
and accumulation of solutes and hormones and in cell detoxifi-
cation pathways during adaptation to water stress. Among the
selected ESTs, several putative transporters were also found. For
instance, Ppter_DR_123 shows high homology with an inositol
transporter, which could be involved in the transport of sugars
through membranes to modify osmotic pressure under stress,
a function that is consistent with the high capacity of maritime
pine for osmotic adjustment as reported by López et al. [28].
Ppter_DR_162 shows homology with certain ABC transporters,
which are involved in the response to different biotic and abiotic
stresses [29].
2.2.4. Transcription-related genes

The expression of many of the genes mentioned above is likely
controlled by different transcriptional regulatory pathways. Among
the ESTs selected based on their expression patterns there were
several putative transcription factors. For example, Ppter_DR_254
and Ppter_DR_319 show high homology with DREB2 factors, which
are involved in an ABA-independent pathway induced by dehy- Fig. 3. Transcripts that are significantly upregulated by PEG stress in needles, stems
dration [30] and whose overexpression can increase water stress and roots by PEG stress. In total, 67 unique ESTs were significantly upregulated in
tolerance [31]. Ppter_DR_213 is homologous to NAC transcription response to treatment.
Table 2
Fold change in the expression of the 67 selected candidate genes upregulated in different organs during treatment. The table shows data with a significant difference
(FDR < 0.05 and fold change # 1.6) in relative level.
ID_sequence Roots Stems Needles
S1/US S2/US S4/US S6/US S8/US S1/US S2/US S4/US S6/US S8/US S1/US S2/US S4/US S6/US S8/US
Ppter_DR_101 1,96 1,95 2,54
Ppter_DR_115 2,82 6,24 2,27 10,34 45,22
Ppter_DR_120 3,01 3,94 2,75 2,92 7,84 10,16
Ppter_DR_160 2,46 3,35 6,07 3,94
Ppter_DR_274 4,46 10,28 7,97 8,10 3,19
Ppter_DR_276 3,49 3,99 2,36 1,95 4,03 4,92
Ppter_DR_305 3,42 3,09 1,97 4,16 2,97 4,04
Ppter_DR_33 2,80 2,63 5,50 5,08
Ppter_DR_349 2,87 3,55 2,52
Ppter_DR_6 2,46 3,75 3,22 2,61 2,32
Ppter_DR_61 2,71 3,36 4,27 2,61
Ppter_DR_72 2,51 3,40 3,62 8,67
Ppter_DR_112 2,45
Ppter_DR_122 2,41 $2,92 $4,65
Ppter_DR_136 2,18
Ppter_DR_152 2,15
Ppter_DR_278 2,90
Ppter_DR_41 2,25
Ppter_DR_77 $1,92 1,61
Ppter_DR_90 2,15
Ppter_DR_107 1,74 6,38
Ppter_DR_239 2,61
Ppter_DR_244 2,68
Ppter_DR_284 2,35 2,39
Ppter_DR_303 2,27
Ppter_DR_315 2,35
Ppter_DR_342 2,97
Ppter_DR_4 3,20
Ppter_DR_48 2,31
Ppter_DR_51 3,24 5,41
Ppter_DR_80 2,38
Ppter_DR_95 3,46 2,49
Ppter_DR_123 2,27 3,33
Ppter_DR_200 3,18 1,95 2,52 2,71
Ppter_DR_235 2,14 2,32
Ppter_DR_242 2,99 2,43
Ppter_DR_334 2,43 4,33 6,11 4,75 2,14
Ppter_DR_37 1,88 5,22 2,36
Ppter_DR_63 2,00 6,75 2,06
Ppter_DR_106 2,52 1,95
Ppter_DR_13 2,09
Ppter_DR_137 2,97
Ppter_DR_162 2,30
Ppter_DR_163 2,16
Ppter_DR_180 2,00
Ppter_DR_187 2,12
Ppter_DR_194 2,69
Ppter_DR_198 3,33
Ppter_DR_213 2,84
Ppter_DR_22 2,08
Ppter_DR_223 1,86
Ppter_DR_227 2,25
Ppter_DR_254 2,04
Ppter_DR_262 3,07
Ppter_DR_287 2,74
Ppter_DR_296 2,16
Ppter_DR_307 2,29
Ppter_DR_319 2,38
Ppter_DR_327 2,20 2,76
Ppter_DR_329 1,76
Ppter_DR_341 2,86
Ppter_DR_99 2,10
Ppter_DR_275 $2,63 2,01 3,58 2,66
Ppter_DR_283 3,16 3,20
Ppter_DR_44 2,64 3,43 2,90 4,56
Ppter_DR_159 2,74 3,72
Ppter_DR_52 2,95 5,44 3,67 4,10
We selected 67 positive candidate genes whose average 3. Conclusion

expression for the four genotypes, in at least one sampling point
and in at least one organ, was more than 1.6 fold higher than in the Here, we have identified a set of 67 reliable expressional candi-
control (Table 1). This represents 19% of the presumed 351 nuDNA date genes that may be useful for further studies on water stress
ESTs identified, which is a proportion similar to that obtained in response in conifers, which is a plant division for which reliable
previous studies with forest trees, as reported by Bae et al. in molecular tools are still scarce and for which transfer from angio-
Populus [35]. The largest functional groups among the 67 selected sperms is difficult and very often impossible. Of 67 candidate genes,
genes coincided with those for the complete 351 EST set. 37 correspond to new genes that were not reported in previous
To validate the expression patterns detected by microarray, 10 works on water stress in this genus. The expression patterns of these
candidate genes covering the main functional groups and expres- genes revealed by microarray analysis were confirmed by RT-PCR for
sional clusters (see below) were subjected to RT-PCR. This time, a subset of genes, including the most abundant expression clusters
only a single genotype was used in the analysis. RT-PCR analysis and functional groups.
confirmed the microarray expression patterns (Fig. 2). For most As a follow-up to this study, the expression of these candidate
genes, both techniques had a Pearson correlation value higher than genes under drought stress induced by soil water depletion will be
90%, although lower values were found for a few genes. This kind of examined, allowing us to discriminate between water stress effects
discrepancy has been previously reported, mainly for genes with and the effects derived specifically from the treatment with PEG.
low induction levels, and has been attributed to the different
dynamic range of the two techniques, with a higher accuracy 4. Materials and methods
attributed to RT-PCR [36].
4.1. Plant materials and treatment conditions
2.4. Expression pattern of candidate genes
We have used clonal material from the Oria provenance (Almería,
Of the 67 unigenes that were significantly upregulated by PEG- southeastern Spain). This provenance has been previously shown to
induced water stress, 29 were identified in needles, 29 in stems and have a good inducible response to water stress because it has adapted
45 (two thirds of the total) in roots (half of them, i. e., 23, exclusively to low and irregular annual precipitations and frequent droughts (f. i.,
in this organ), which is consistent with the key role played by roots Sánchez-Gómez et al.,2010). Taking into account the individual vari-
in water stress (Fig. 3). Significant overexpression levels are re- ability found within populations, which is common for conifers (see, f.
flected in Table 2. i., [37] and references therein), ten different genotypes were included
Hierarchical clustering of the expression patterns detected with in this study. The plants were grown in a greenhouse in hydroponic
microarrays (from the four genotypes) established six groups in the culture with an aerated nutrient solution under controlled conditions
stems, and five groups in the roots and needles (Supplementary (24 " C day/22 " C night, 12 h photoperiod, relative humidity: 60% by
data Fig. 1). Differences among the genotypes regarding these day and 80% by night). The nutrient solution (30 l/45 plants; NPK
profiles were also detected. Nevertheless, the expression profiles 90:41:72; pHw6.5) was changed twice a week.
were fairly consistent between the microarray and qRT-PCR tech- Water stress was induced by adding polyethylene glycol (PEG,
niques within the same genotype. MW 8000) to the culture solution. For this purpose the hydroponic
The following general considerations can be drawn from an solution was changed every 4 h, with progressively increasing
analysis of the expression clusters: concentrations of PEG added and a 0.4 MPa decrease in the water
potential of the solution each time until a final water potential
- Most PEG-induced genes reached a maximum transcription of $1.6 MPa was reached. One plant per genotype was collected
level at S6 (48 h from the beginning of the experiment, and separately 1 h after every change of the hydroponic solution
after 36 h at $1.6 MPa). In this group, the most noticeable (sampling points S1-S4), and 24 h (S5), 48 h (S6), 10 days (S7) and
induction was seen for Ppter_DR_274 in the roots and stems. 21 days (S8) after the beginning of the treatment (for a total of 8
- Some of these genes were induced faster in the roots, with the sampling points). The needles, stem and roots from each plant were
maximum induction seen at S4 (1 h after reaching $1.6 MPa). collected separately, immediately frozen in liquid nitrogen and
These include genes putatively involved in cell rescue and stored at $80 " C. Plants of each genotype kept without PEG in the
defence based on their homology with heat shock proteins hydroponic solution were harvested as controls.
(Ppter_DR_235) or glutathione S-transferases (Ppter_DR_106),
and the putative transcription factor Ppter_DR_254. This 4.2. Isolation of RNA and the subtraction technique
pattern is consistent with the role of roots in detecting and
triggering the response to water stress. The total RNA for each sampling point was extracted separately
- Several genes showed a fast response, reaching their maximum from the roots, stem and needles of each sampled plant following
induction at S2 (1 h after the second change of hydroponic the CTABeLiCl precipitation method [38]. Equal amounts of the total
solution, at $0.8 MPa). Among them, a putative transcription RNA from the roots, stems and needles of all of the plants were
factor was detected in the roots (Ppter_DR_319) and several mixed to form an RNA pool. To identify sequences putatively regu-
sequences had high homology with the HSP90 heat shock lated by water stress more efficiently, we constructed a subtractive
protein family (Ppter_DR_136, 152). cDNA library using a PCR-Select" cDNA Subtraction kit (Clontech,
- The induction of other genes continued to increase until the CA, USA) and following the manufacturer’s protocols. A mix of cDNA
end of the experiment. This group mainly includes genes from plants treated with PEG for 1 h to 21 days was used as tester and
putatively related to carbohydrate metabolism, as well as some the cDNA from control plants was used as driver. Subtracted PCR
putative transcription factors in the roots (Ppter_DR_296, products were ligated into the pGEM# T-easy vector (Promega, WI,
Ppter_DR_213). USA) and transformed into Escherichia coli DH5a cells. We then
- The prolonged and even increasing induction of most of these picked 4940 clones. The presence and size of the inserts were
genes during the water stress treatment is consistent with the determined by direct amplification from crude bacterial lysates
conditions faced by Mediterranean trees during a real drought using the nested PCR primers 1 and 2R, which were provided in the
in nature. PCR-selected cDNA subtraction kit.
4.3. Differential screening of the subtracted library by cDNA used, respectively. To achieve a similar distribution across arrays
macroarray and consistency among arrays, log-ratio values were scaled using
the median-absolute-value as scale estimator. Differentially
As a first selection of positive clones, differential screening was expressed genes were evaluated by the non-parametric algorithm
performed using a PCR-Select" differential screening kit (Clontech, ‘Rank Products’ available as the “RankProd” package at “Bio-
CA, USA). Amplified inserts from each clone were spotted onto conductor, an R language project” [42,43]. This method detects
Hybond-Nþ nylon membranes (GE Healthcare BioSciences, WI, genes that are consistently high ranked in a number of replicated
USA). Membranes were screened with four probes labelled with experiments independently of their numerical intensities. The
dioxigenin-dUTP (Roche, Basel, Switzerland), i.e., two subtracted results are provided in the form of p-values defined as the proba-
cDNA probes (forward and reverse subtractions) and two un- bility that a given gene is ranked in the observed position by
subtracted probes (PEG-stressed and unstressed). Detection was chance. The expected false discovery rate was controlled to be less
performed using the DIG DNA labelling and detection kit (Roche, than 5%.
Basel, Switzerland). The intensities of the hybridisation signals Changes in the expression of a gene relative to control plants
were visualised using a Molecular Imager#ChemiDoc"XRS System were estimated using the average signal intensity across the four
(BioRad, CA, USA). Clones with a mean expression ratio (forward data sets (four genotypes). Based on the statistical analysis, a gene
subtracted probe intensity divided by reverse probe intensity) of was considered to be significantly upregulated if it met all three of
more than 1.5 were selected as upregulated genes. All clones of the following criteria: (1) FDR RankProd < 0.05; (2) the fold change
differentially expressed genes were selected for sequencing. was #1.6 at any sampling point and in any organ and (3) the trend
was consistent for all data. Hierarchical clustering of upregulated
4.4. Sequence analysis genes in the different organs was performed using the log-ratio
data and the Euclidean distance (complete linkage and threshold
The selected positive clones were sequenced using a 3730 XL 2.5) options of the MeV 4.4 software [44].
DNA analyser (Applied Biosystems; Life Technologies, CA, USA)
at Macrogen (Seoul, Korea). All unique ESTs were annotated on 4.7. Real-time quantitative PCR
the basis of the existing annotation of non-redundant databases
at the NCBI using BLASTN and BLASTX. ESTs without significant The expression pattern of several genes was confirmed by RT-PCR
protein homology were then compared with the pine and using RNA from one of the genotypes used as a biological replicate in
spruce databases included in the Gene Index Project (http:// the microarrays. For this purpose, the RNA was treated with DNAse
compbio.dfci.harvard.edu/cgi-bin/tgi/Blast/index.cgi) and Euro- Turbo (Ambion; Applied Biosystems, Life Technologies, CA, USA).
PineDB (http://www.scbi.uma.es/pindb/). Homologies with e- First-strand cDNA was synthesised from 2 mg total RNA from each
values lower than 1e-05 for more than 100 nucleotides were sample using PowerScriptIII reverse transcriptase (Invitrogen)
considered significant. Functional classification of the ESTs was according to the supplier’s manual. 18S rRNA was used as a control,
performed according to the functional categories of A. thaliana after verifying that the signal intensity remained unchanged across
proteins (http://mips.helmholtz-muenchen.de/proj/funcatDB/) all treatments. The primers for experimental genes were designed
[15]. Blast2GO was used to identify gene ontology (GO) terms using Primer Express version 3.0.0 (Applied Biosystems Life Tech-
associated with identificated genes [16]. nologies, CA, USA) and are shown in Supplementary Table S4. Poly-
merase chain reactions were performed in an optical 96-well plate
4.5. Microarray design and hybridation with a CFX 96 Detection system (BIO-RAD), using EvaGreen to
monitor dsDNA synthesis. Reactions containing 2% SsoFast EvaGreen
In total, 351 unigenes selected from the SSH library were Supermix reagent (BIO-RAD, CA, USA), 12.5 ng cDNA and 500 nM of
included in the microarray design (Agilent 8 % 15 K, Agilent primers in a final volume of 10 ml were subjected to the following
Technologies, CA, USA). For each unigene, one to four 60-bp-long standard thermal profile: 95 " C for 3 min, 40 cycles of 95 " C for 10 s
probes were designed and spotted at least three times on the slide. and 60 " C for 10 s. Three technical replicates were performed for each
Probes designed for other pine, spruce and human ESTs available in PCR run. To compare the data from different PCR runs or cDNA
public databases were included as negative controls. To select samples, the mean of the CT values of the three technical replicates
reliable candidate genes that would be widely useful for future was normalised to the mean CT value of Ri18S. The expression ratios
studies, four unrelated genotypes from the Oria provenance were were then obtained using the DDCT method corrected for the PCR
used as experimental biological replicates. RNA from sampling efficiency for each gene [45].
points S1, S2, S4, S6 and S8 and control plants was hybridised to the
microarrays. RNA amplification and labelling were performed as Acknowledgements
described by Adie et al. [39]. RNA was purified by using the Qiagen
RNeasy kit (QIAGEN, CA, USA). “The manual two-colour microarray The authors would like to thank Dr. Luis Gil, for technical and
based gene expression analysis” protocol (Agilent Technologies, CA, scientific support, Dr. Juan Majada and Dr. Tania Velasco, from
USA) was followed for hybridisations. Images from Cy3 and Hyper5 SERIDA for providing the plant material and helping us with the
channels were equilibrated and captured with a GenePix 4000B hydroponic treatments, and Dr. Carmen Díaz-Sala (UAH) for help
(Axon, CA, USA), and spots were quantified using the GenPix soft- with RT-PCR analysis. This work has been funded through the
ware (Axon, CA, USA). projects AGL2006-03242/FOR (Spanish Ministry of Education and
Science), CCG07-UPM/AMB-1932 and CCG10-UPM/AMB-5038
4.6. Data analysis (Madrid Regional Government e UPM). PP has a pre-doctoral
fellowship from the Spanish Ministry of Education and Science.
Background correction and normalisation of expression data
were performed using LIMMA (Linear Models for Microarray Data) Appendix. Supplementary data
[40,41]. LIMMA is part of “Bioconductor, an R language project”
(www.bioconductor.org). For local background correction and Supplementary data related to this article can be found online at
normalisation, the methods “normexp” and loess in LIMMA were doi:10.1016/j.plaphy.2011.09.022.
References [22] D.K. Manter, R.G. Kelsey, Ethanol accumulation in drought-stressed conifer
seedlings, International Journal of Plant Sciences 169 (2008) 361e369.
[23] D. Huang, W. Wu, S.R. Abrams, A.J. Cutler, The relationship of drought-related
[1] FAO, Situacion de los Bosques del Mundo 2007 (2007) Roma.
gene expression in Arabidopsis thaliana to hormonal and environmental
[2] A.M. Morse, D.G. Peterson, M.N. Islam-Faridi, K.E. Smith, Z. Magbanua,
factors, Journal of Experimental Botany 59 (2008) 2991e3007.
S.A. Garcia, T.L. Kubisiak, H.V. Amerson, J.E. Carlson, C.D. Nelson, J.M. Davis,
[24] D. Gu, X. Liu, M. Wang, J. Zheng, W. Hou, G. Wang, J. Wang, Overexpression of
Evolution of genome size and complexity in Pinus, PLoS ONE 4 (2009) e4332.
ZmOPR1 in Arabidopsis enhanced the tolerance to osmotic and salt stress
[3] IPCC, Climate change 2007. in: S. Salomon, D. Qin, M. Manning, Z. Chen,
during seed germination, Plant Science 174 (2008) 124e130.
M. Marquis, K.B. Averyt, M. Tignor, K.L. Mille (Eds.), The Physical Science Basis.
[25] M. Battaglia, Y. Olvera-Carrillo, A. Garciarrubio, F. Campos, A.A. Covarrubias,
Contribution of Working Group I to the Fourth Assessment Report of the
The enigmatic lea proteins and Other hydrophilins, Plant Physiology 148
Intergovernmental Panel on Climate Change. Cambridge University Press, UK
(2008) 6e24.
and New York, NY, USA, 2007, p. 996.
[26] W.X. Wang, B. Vinocur, O. Shoseyov, A. Altman, Role of plant heat-shock
[4] I. Aranda, R. Alia, U. Ortega, A.K. Dantas, J. Majada, Intra-specific variability in
proteins and molecular chaperones in the abiotic stress response, Trends in
biomass partitioning and carbon isotopic discrimination under moderate
Plant Science 9 (2004) 244e252.
drought stress in seedlings from four Pinus pinaster populations, Tree Genetics
[27] B. Kumar, S.L. Singla-Pareek, S.K. Sopory, Glutathione homeostasis: crucial for
and Genomes 6 (2010) 169e178.
abiotic stress tolerance in plants. in: A. Pareek (Ed.), Abiotic Stress Adaptation
[5] D. Sánchez-Gómez, T. Velasco-Conde, F.J. Cano-Martín, M. Ángeles Guevara,
in Plants. Springer, Netherlands, 2010, pp. 263e282.
M. Teresa Cervera, I. Aranda, Inter-clonal variation in functional traits in
[28] R. Lopez, I. Aranda, L. Gil, Osmotic adjustment is a significant mechanism of
response to drought for a genetically homogeneous Mediterranean conifer,
drought resistance in Pinus pinaster and Pinus canariensis, Investigacion
Environmental and Experimental Botany 70 (2010) 104e109.
Agraria-Sistemas Y Recursos Forestales 18 (2009) 159e166.
[6] L.S. Heath, N. Ramakrishnan, R.R. Sederoff, R.W. Whetten, B.I. Chevone,
[29] D. Wanke, H.U. Kolukisaoglu, An update on the ABCC transporter family in
C.A. Struble, V.Y. Jouenne, D.W. Chen, L. van Zyl, R. Grene, Studying the
plants: many genes, many proteins, but how many functions? Plant Biology
functional genomics of stress responses in loblolly pine with the expresso
12 (2010) 15e25.
microarray experiment management system, Comparative and Functional
[30] P. Agarwal, P. Agarwal, M. Reddy, S. Sopory, Role of DREB transcription factors
Genomics 3 (2002) 226e243.
in abiotic and biotic stress tolerance in plants, Plant Cell Reports 25 (2006)
[7] J.I. Watkinson, A.A. Sioson, C. Vasquez-Robinet, M. Shukla, D. Kumar, M. Ellis,
1263e1274.
L.S. Heath, N. Ramakrishnan, B. Chevone, L.T. Watson, L. van Zyl,
[31] M. Chen, Q.-Y. Wang, X.-G. Cheng, Z.-S. Xu, L.-C. Li, X.-G. Ye, L.-Q. Xia, Y.-Z. Ma,
U. Egertsdotter, R.R. Sederoff, R. Grene, Photosynthetic acclimation is reflected
GmDREB2, a soybean DRE-binding transcription factor, conferred drought and
in specific patterns of gene expression in drought-stressed loblolly pine, Plant
high-salt tolerance in transgenic plants, Biochemical and Biophysical Research
Physiology 133 (2003) 1702e1716.
Communications 353 (2007) 299e305.
[8] W.W. Lorenz, F. Sun, C. Liang, D. Kolychev, H.M. Wang, X. Zhao,
[32] L.-S.P. Tran, K. Nakashima, Y. Sakuma, S.D. Simpson, Y. Fujita, K. Maruyama,
M.M. Cordonnier-Pratt, L.H. Pratt, J.F.D. Dean, Water stress-responsive genes
M. Fujita, M. Seki, K. Shinozaki, K. Yamaguchi-Shinozaki, Isolation and func-
in loblolly pine (Pinus taeda) roots identified by analyses of expressed
tional analysis of Arabidopsis stress-inducible NAC transcription factors that
sequence tag libraries, Tree Physiology 26 (2006) 1e16.
bind to a drought-responsive cis-element in the early responsive to dehy-
[9] W.W. Lorenz, R. Alba, Y.-S. Yu, J. Bordeaux, M. Simoes, J. Dean, Microarray
dration stress 1 promoter, Plant Cell 16 (2004) 2481e2498.
analysis and scale-free gene networks identify candidate regulators in
[33] S. Rocak, P. Linder, DEAD-box proteins: the driving forces behind RNA
drought-stressed roots of loblolly pine (P. taeda L.), BMC Genomics 12 (2011)
metabolism, Nature Reviews. Molecular Cell Biology 5 (2004) 232e241.
264.
[34] L. Diatchenko, Y. Lau, P. Siebert, Suppression subtractive hybridization:
[10] P. Sathyan, R.J. Newton, C.A. Loopstra, Genes induced by WDS are differen-
a method for generating differentially regulated or tissue-specific cDNA
tially expressed in two populations of aleppo pine (Pinus halepensis), Tree
probes and libraries, Proceedings of the National Academic Sciences of the
Genetics and Genomes 1 (2005) 166e173.
United States of America 93 (1996) 6025e6030.
[11] C. Dubos, G. Le Provost, D. Pot, F. Salin, C. Lalane, D. Madur, J.-M. Frigerio,
[35] E.-K. Bae, H. Lee, J.-S. Lee, E.-W. Noh, Isolation and characterization of osmotic
C. Plomion, Identification and characterization of water-stress-responsive
stress-induced genes in poplar cells by suppression subtractive hybridization and
genes in hydroponically grown maritime pine (Pinus pinaster) seedlings,
cDNA microarray analysis, Plant Physiology and Biochemistry 48 (2009) 136e141.
Tree Physiology 23 (2003) 169e179.
[36] P. Dallas, N. Gottardo, M. Firth, A. Beesley, K. Hoffmann, P. Terry, J. Freitas,
[12] C. Dubos, C. Plomion, Identification of water-deficit responsive genes in
J. Boag, A. Cummings, U. Kees, Gene expression levels assessed by oligonu-
maritime pine (Pinus pinaster Ait.) roots, Plant Molecular Biology 51 (2003)
cleotide microarray analysis and quantitative real-time RT-PCR e how well do
249e262.
they correlate? BMC Genomics 6 (2005) 59.
[13] E. Eveno, C. Collada, M.A. Guevara, V. Leger, A. Soto, L. Diaz, P. Leger,
[37] E.T. Hamanishi, M.M. Campbell, Genome-wide responses to drought in forest
S.C. Gonzalez-Martinez, M.T. Cervera, C. Plomion, P.H. Garnier-Gere, Con-
trees, Forestry 84 (2011) 273e283.
trasting patterns of selection at Pinus pinaster Ait. drought stress candidate
[38] S. Chang, J. Puryear, J. Cairney, A simple and efficient method for isolating RNA
genes as revealed by genetic differentiation analyses, Molecular Biology and
from pine trees, Plant Molecular Biology Reporter 11 (1993) 113e116.
Evolution 25 (2008) 417e437.
[39] B.A.T. Adie, J. Perez-Perez, M.M. Perez-Perez, M. Godoy, J.J. Sanchez-Serrano,
[14] N. Fernández-Pozo, J. Canales, D. Guerrero-Fernández, D.P. Villalobos, S. Díaz-
E.A. Schmelz, R. Solano, ABA is an essential signal for plant resistance to
Moreno, R. Bautista, A. Flores-Monterroso, M.A. Guevara, P. Perdiguero,
pathogens affecting JA biosynthesis and the activation of defenses in Arabi-
C. Collada, M.T. Cervera, A. Soto, R. Ordás, F.R. Cantón, C. Avila, F.M. Cánovas,
dopsis, Plant Cell 19 (2007) 1665e1681.
M.G. Claros, EuroPineDB: a high-coverage web database for maritime pine
[40] G.K. Smyth, T. Speed, Normalization of cDNA microarray data, Methods 31
transcriptome, BMC Genomics 12 (2011) 366.
(2003) 265e273.
[15] A. Ruepp, A. Zollner, D. Maier, K. Albermann, J. Hani, M. Mokrejs, I. Tetko,
[41] G.K. Smyth, Linear Models and Empirical Bayes Methods for Assessing
U. Guldener, G. Mannhaupt, M. Munsterkotter, H.W. Mewes, The FunCat,
Differential Expression in Microarray Experiments. The Berkeley Electronic
a functional annotation scheme for systematic classification of proteins from
Press, 2004.
whole genomes, Nucleic Acids Research 32 (2004) 5539e5545.
[42] R. Breitling, P. Armengaud, A. Amtmann, P. Herzyk, Rank products: a simple,
[16] A. Conesa, S. Götz, J.M. García-Gómez, J. Terol, M. Talón, M. Robles, Blast2GO:
yet powerful, new method to detect differentially regulated genes in repli-
a universal tool for annotation, visualization and analysis in functional
cated microarray experiments, FEBS Letters 573 (2004) 83e92.
genomics research, Bioinformatics 21 (2005) 3674e3676.
[43] F. Hong, R. Breitling, C.W. McEntee, B.S. Wittner, J.L. Nemhauser, J. Chory,
[17] M.J. Oliver, J.C. Cushman, K.L. Koster, Dehydration tolerance in plants. in:
RankProd: a bioconductor package for detecting differentially expressed
R. Sunkar (Ed.), Plant Stress Tolerance, vol. 639. Humana Press, 2010, pp.
genes in meta-analysis, Bioinformatics 22 (2006) 2825e2827.
3e24.
[44] A.I. Saeed, N.K. Bhagabati, J.C. Braisted, W. Liang, V. Sharov, E.A. Howe, J. Li,
[18] M. Hara, K. Tokunaga, T. Kuboi, Isolation of a drought-responsive alkaline
M. Thiagarajan, J.A. White, J. Quackenbush, K. Alan, O. Brian, TM4 Microarray
alpha galactosidase gene from New Zealand spinach, Plant Biotechnology 25
Software Suite, Methods in Enzymology, vol. 411, Academic Press, 2006, pp.
(2008) 497e501.
134e193.
[19] S. Micheletto, L. Rodriguez-Uribe, R. Hernandez, R.D. Richins, J. Curry,
[45] M.W. Pfaffl, A new mathematical model for relative quantification in real-time
M.A. O’Connell, Comparative transcript profiling in roots of Phaseolus acuti-
RT-PCR, Nucleic Acids Research 29 (2001) e45.
folius and P. vulgaris under water deficit stress, Plant Science 173 (2007)
510e520.
[20] J. Wang, B. Hou, Glycosyltransferases: key players involved in the modification
of plant secondary metabolites, Frontiers of Biology in China 4 (2009) 39e46. Further readings
[21] A. Rabello, C. Guimaraes, P. Rangel, F. da Silva, D. Seixas, E. de Souza,
A. Brasileiro, C. Spehar, M. Ferreira, A. Mehta, Identification of drought- [46] http://compbio.dfci.harvard.edu/cgi-bin/tgi/Blast/index.cgi
responsive genes in roots of upland rice (Oryza sativa L), BMC Genomics 9 [47] http://www.scbi.uma.es/pindb/
(2008) 485. [48] http://mips.helmholtz-muenchen.de/proj/funcatDB/
ANEXO IV. Molecular response to water stress in two contrasting
Mediterranean pines (Pinus pinaster and Pinus pinea). Manuscrito
Molecular response to water stress in two contrasting Mediterranean pines (Pinus
pinaster and Pinus pinea)
Pedro Perdiguero1, 2, María del Carmen Barbero1, 2, Gloria García Casado3, María
Teresa Cervera1, 2, 4, Carmen Collada1, 2, †, Álvaro Soto1,2, †, *
1
GENFOR Grupo de investigación en Genética y Fisiología Forestal, Universidad
Politécnica de Madrid. E-28040 Madrid, Spain.
2
Unidad Mixta de Genómica y Ecofisiología Forestal, INIA/UPM, Madrid, Spain
3
Centro Nacional de Biotecnología. CNB. Madrid, Spain.
4
Departamento de Ecología y Genética Forestal. CIFOR-INIA, Madrid, Spain
†
: CC and AS co-directed this work
* Address for correspondence:
Álvaro Soto de Viana

GENFOR, G.I. Genética y Fisiología Forestal
Universidad Politécnica de Madrid
Ciudad Universitaria s/n
E-28040 Madrid, Spain
T: 34 91 336 63 92
Fax: 34 91 336 55 56
Email: alvaro.soto.deviana@upm.es
Date of submission:
Number of tables: -
Number of figures: 4
Short running title: Transcriptional response to water stress in pines

Abstract
Adaptation to water stress has determined the evolution and diversification of vascular
plants. This stress is forecasted to increase drastically in the next decades in certain
regions, such as the Mediterranean basin. Consequently, a proper knowledge of the
response and adaptations to drought stress is essential for the correct management of
plant genetic resources. However, most of the advances in the understanding of the
molecular response to water stress have been attained in angiosperms, and are not
always applicable to gymnosperms.
In this work we analyze the transcriptional response of two emblematic Mediterranean
pines, P. pinaster and P. pinea, which show noticeable differences in their performance
under water stress. Up to 113 genes have been detected as significantly induced by
drought in both species. While induced genes with similar profiles in both species can
be considered as general candidate genes for the study of drought response in conifers,
genes with diverging expression patterns can underpin the differences displayed by
these species under water stress. Additionally, differences in the molecular response to
drought and polyethylene-glycol-induced water stress are also discussed.

1. Introduction
Undoubtedly, one of the major driving factors of evolution and diversification of
vascular plants since the Silurian (~430 MYA) is the adaptation to dry land
environments, involving the development of water uptake and transport mechanisms
and minimization of water losses. Terrestrial plants display a whole panoply of
constitutive and inducible anatomical and molecular adaptations to drought stress.
These are particularly relevant in certain regions, and for perennial species such as trees,
which most likely have to face water shortage several times during their lifespan.
According to the current climatic forecast, drought stress will become even a more
defining factor in great part of the planet in the near future. For instance, Mediterranean
regions will suffer a decrease of 10-20% of annual precipitations, with more frequent
and severe drought periods, together with an increase in 3-3.5ºC in the mean annual
temperature by the end of this century [1]. Thus, an understanding of the adaptive
responses with which tree species will have to face these situations is of the utmost
interest.
Drought stress can limit plant growth and reproduction, and can lead to serious and
eventually insurmountable difficulties to keep the homeostatic equilibrium in cells:
metabolism can be disrupted, leading to an increased production of free radicals and
reactive oxygen species (ROS) that damage the membranes, especially the
photosynthetic machinery. Higher order plants display protection mechanisms
addressed to avoid desiccation and its deleterious effects.
It is well known that, at the molecular level, inducible response to drought, as well as to
other abiotic stresses, is controlled by several genes, comprising multiple signalling

pathways [2]. Most of the advances in the comprehension of the molecular response to
drought stress have been performed in angiosperms, which display peculiar
characteristics that ease this kind of studies. For instance, they have smaller and simpler
genomes than gymnosperms, so that the complete genome sequences of several
herbaceous and woody angiosperm species are available, with a better annotation; there
are also short-lived model species which allow the faster performance of repeated and
serial experiments, etc. On the contrary, no such a model species is available among
gymnosperms. Additionally, due to the long time elapsed since both groups diverged
(300 MYA), different genes and mechanisms can be expected to be involved in the
response of gymnosperms to drought. The aim of this work is to help covering the gap
in the current knowledge of the molecular response of conifers to water stress. Over the
last decade several works have reported on the identification of genes induced by
drought stress in conifers, mainly Pinus, performing preliminary expression pattern
analysis under moderate water stress [3-10], usually applying a moderate stress. Other
works have focused in the analysis of certain gene families presumably involved in the
response of water stress, such as dehydrins [11-14]. In this work we compare the
transcriptional response of two closely related pine species, P. pinaster and P. pinea,
which show, however, noticeable differences in their performance under water deficit..
Both species thrive under the drought-prone conditions of the Mediterranean basin, and
can be found on sandy soils, with low water retention capacity, where they play a major
role in a characteristic, priority conservation habitat of the European Union, the
“wooded dunes with P. pinea and/or P. pinaster”. Their ecological requirements
overlap to a great extent, and mixed stands of both species are frequent. Nevertheless, P.
pinaster, although occupying a relatively small geographical range, in the Western

Mediterranean basin, shows larger ecological amplitude, particularly in relation to water
availability and has been used as model species for the study of the molecular response
to drought stress in conifers in several works [3, 4, 8, 13, 15]. Differences among
provenances have been detected for this species, regarding mass allocation, water use
efficiency under water stress [16, 17] but, in general, it is considered as a drought-
avoiding species which shows sensitive stomata and fast osmotic adjustment in response
to water stress [18, 19].
On its side, stone pine, P. pinea, shows a wider distribution, all around the
Mediterranean sea, although displaying an extremely low neutral diversity [20] . P.
pinea is a more thermophilic and xerophytic species, and is usually found in poorer
soils. Additionally, and contrarily to P. pinaster, tolerates also shade rather well [21] ,
being the combination of shade and drought one of the most restrictive conditions for
plants in Mediterranean-type ecosystems [22].
In this work we have used microarray and RT-PCR techniques to analyse the expression
pattern in both species of 1124 genes presumably involved in the response to water
stress during a severe and prolonged drought stress, similar to the ones these trees have
to face in nature, in order to identify the expression profiles associated to higher drought
resistance in conifers.
2. Result and discussion
2.1 Water potential in leaves of P. pinaster and P. pinea during drought stress
Fig. 1 shows the evolution of leaf water potential (Ψ) in P. pinaster and P. pinea plants
throughout the drought experiment. Notwithstanding the known differences in hydric
requirements shown by both species, the evolution of Ψ during the stress is noticeably
similar in P. pinaster and P. pinea.

2.2 Genes induced by drought stress in P. pinaster and P. pinea
A total of 181 genes were significantly upregulated in needles, stems and/or roots in P.
pinaster in response to the non-irrigation treatment (Supplementary table S1). 53 out of
these genes were upregulated in the three organs. The highest number of overexpressed
genes was found in stems with 116 genes, and 41of they appeared significantly induced
exclusively in this organ. 44 out of the 107 genes significantly overexpressed in needles
were not detected as significantly induced in the other organs. Finally, 88 genes were
significantly overexpressed in roots, and only 19 of them were identified exclusively for
this organ (Supplementary Fig. S1).
On its side, the drought treatment in P. pinea led to the significant induction of 218
genes (Supplementary table S2), and 67 out of them were upregulated in the three
organs. 123 genes were significantly upregulated in stems, and 23 of them exclusively
in this organ. 144 genes were significantly induced in needles, and 40 out of them were
not significantly induced in stems nor in roots. Finally, up to 140 genes were
significantly upregulated in roots, and 33 of them exclusively in this organ
(Supplementary Fig. S2).
An enrichment analysis of the 113 genes significantly induced for both species (Fig. 2,
Supplementary Table S3) yielded overrepresented GO terms as response to water
stimulus (GO:0009415) or response to hormone stimulus (GO:0009725). Most of them
can be classified into four functional categories, according to FuncatDB [23]: i)
metabolism, ii) cell rescue and defence, iii) transport and iv) transcription related genes.
2.2.1 Metabolism related genes

A quarter of the genes significantly induced in both species corresponds to metabolism
related genes, and up to one third of them are related to carbohydrate metabolism.
Accumulation of sugars and other solutes is supposed to maintain turgor pressure and to
protect structures from mechanical and metabolic stresses during dehydration,
contributing to the acquisition of desiccation tolerance in plants. Some of these genes
have also been reported to be induced by PEG-induced water stress in P. pinaster [8], as
for example an alkaline α-galactosidase (TC181331), a malate synthase (TC155104), a
glycoyltransferase (TC156369), a beta-galactosidase (TC156138), a chitinase
(TC157851) or an aldehyde dehydrogenase (TC158839). Other abundant group of genes
is related to secondary metabolism, including genes involved in the synthesis of
hormones as ethylene (TCC182140, 1-aminocyclopropane-1-carboxylate (ACC)
synthase; TC174045, ACC oxidase) or jasmonate (TC188679, 12-oxo-phytodienoic
acid reductase).
2.2.2 Cell rescue and defence genes
The most relevant genes within this category putatively encode late embryogenesis
abundant (LEA) proteins and heat shock proteins (HSP). For instance, TC182917 and
TC180126 are homologous to small HSP (sHSP), which are presumably involved in the
maintenance of membrane integrity [24]. Although these genes have usually been
related to other abiotic stresses such as heat or cold stress [25-27],, it has also been
reported that they can confer tolerance to drought and salt stress [28]. On its side,
TC194781 corresponds to a HSP70, a type of HSP related to water stress resistance [29,
30]. Among LEA genes, four different dehydrin genes (TC162509, TC179486,
TC193003 and TC176703) have been detected as significantly upregulated in both
species. Dehydrins are a complex, multigenic family involved in different stress

response and ontogenic processes. An analysis of their structure and expression under
drought stress in P. pinaster has recently been published [13].. TC168999 is
homologous to AtLEA14, one of 10 genes that is upregulated by high light, drought,
cold, and salt stresses in Arabidopsis [31].
Also in this category can be included TC176662, a putative U-box containing protein.
This family, very abundant and diversified in plants, are supposed to be involved in
ubiquitination under different conditions [32]. Thus, TC176662 could play a role in the
degradation of proteins damaged under water stress. Interestingly, a recent rangewide
study of P. pinaster populations has revealed a strong association of SNP allele
frequencies for this gene (as well as for a putative heat shock factor, TC171120, see
below) with temperature variables, suggesting the existence of variants adapted to local
climatic conditions (González-Martínez et al., pers. comm.).
2.2.3 Transport
Approximately 9% of the genes induced by drought stress in both species are
presumably related to the transport of sugars, anions and amino acid. These genes could
act co-ordinately with inducible genes involved in metabolism, helping in adjusting
osmotic pressure. For instance, two different hexose transporters (TC170434 and
DR099938) and two inositol transporters (TC170498 and TC171882) can be found in
this group. TC176635 corresponds to an amino acid permease, which could mediate the
accumulation of free amino acids as proline, reported to confer resistance to
desiccation[33]. Consistently, higher proline content in P. pinaster from xeric
provenances has recently been reported [34]. On their side, TC173812 and TC167700
show homology with peroxisomal membrane proteins, which could be involved in the
establishment of a ROS scavenging mechanism [35].

2.2.4 Transcription related genes
Another 9% of the genes induced both in P. pinea and P. pinaster show homology with
transcription factors from different families, and could therefore be considered to play a
key role in the transcriptional response of pines to drought. Thus, TC157919 is
homologous to the DREB (drought responsive element binding proteins) subfamily.
TC158167 and TC178542 correspond to the ERF (ethylene response factor) subfamily,
which is supposed to be involved in gene regulation in both ethylene dependent and
independent pathways [36]. A putative WRKY factor has also been detected
(TC163430). These conserved plant transcription factors have been shown to play a
critical role in ABA response [37] and their overexpression can increase water stress
tolerance [38]. On its side, TC161257, significantly induced in the three organs of both
species, has been identified as a bZIP transcription factor. It is noteworthy the detection
of a putative BEL1-like homeodomain transcription factor (TC170594) also induced in
roots, stems and needles of both species. These regulatory elements, with a potential
role as long distance signals [39], had never been described before as involved in the
response to abiotic stress; however, TC170594 was also significantly upregulated in
response to PEG-induced water stress in P. pinaster [8].
2.2.5 Other functions, unclassified or unknown proteins
Up to a 19% of the genes induced by drought in both species show homology with
genes of unknown function or even lack homologous in the databases. For instance,
TC188788 and TC163698, which are overexpressed in the three organs both by drought
and by PEG-induced water stress [8], are homologous to genes of the MtN3 nodulin
family. No functional classification has been assigned to this family; however, recent
studies on Arabidpsis and rice have reported their activity as sugar transporter,
supporting import and efflux of sugars from the cells [40]. Overexpression of
TC188788 has already been reported in response to drought in P. pinaster and P. taeda
[3, 4, 6], as well as in response to cold in Cupressus sempervirens [41]. Therefore, this
family could play an important role in the capacity of osmotic adjustment shown by
many conifers, as P. pinaster [18]. On the contrary, this gene family never has been
reported as drought responsive genes in angiosperms. Another remarkable example is
the overexpression of TC197470, also induced by PEG treatment in P. pinaster [8] and
corresponding to a tentatively annotated hydroxyproline-rich protein. The expression of
proline rich proteins is stimulated by wounding and environmental stresses [42];
consistently, overexpression of a PRP under drought stress has been reported in P.
halepensis [9].
These results are consistent with the ones reported previously for a water stress induced
in P. pinaster by the addition of polyethylene glycol (PEG) to a hydroponic culture [8].
However, several differences have also been detected. 24 out of the 67 genes reported as
significantly induced by PEG in that work have not been detected here. A feasible
explanation to this point could be related to the toxicity of PEG. This substance,
especially in its low molecular weight forms, can be absorbed by the roots, eliciting a
specific response, in addition to the effect related to the decrease in water potential in
the substrate. For example, significant overexpression of a putative soluble inorganic
pyrophosphatase (Ppter_DR_227 ~ TC178028), gene associated to GO term
GO:0010038 “response to metallic ions” was detected in roots during PEG-induced
water stress but not in the experiments reported here, neither in P. pinaster nor in P.
pinea. Similar results were observed for a gene (Ppter_DR_162 ~ TC160632)

homologous to PDR ABC transporters, which are presumably involved in the response
to different stresses [43]. In the same way, a significant enrichment in the GO term
“binding unfolded ER proteins” (GO:0051082) has been detected among those 24 genes
induced by PEG treatment. This term is related to chaperone activity, probably involved
in the response to toxicity. Within this category, three high molecular weight heat shock
proteins induced by PEG treatment (Ppter_DR_136 ~ spruceTC171037, Ppter_DR_152
~ TC187027 and Ppter_DR_235 ~TC183705) were not detected here. Nevertheless, the
failure to detect some of these 24 genes as significantly induced by the drought
treatment could be also related to their time of response and to the different sampling
schemes used in both works, since the PEG treatment lasted for three weeks, with a
more intensive sampling in the first 48 h. This could be the case of a putative heat-shock
factor (TC171120), not detected as significantly induced by the drought treatment in
any organ of P. pinaster, but in roots and stems of P. pinea, as well as in roots of P.
pinaster under PEG treatment. In the same way, an embryo-abundant protein
(Ppter_DR_51 ~ TC178394) showed overexpression in needles during the first steps of
PEG-induced water stress, whereas remarkable repression has been detected in this
work, especially in roots (-25 to -45-fold the values of the unstressed plants). This gene
could be involved in signal reception and modulation of changes in needles during the
very first stages of water deficit.
2.3 Expression patterns in P. pinaster and P. pinea
Hierarchical clustering of the expression levels detected with microarray led to the
identification of 10 clusters in roots, 14 in stems and 9 in needles of P. pinaster, and of
15 clusters in roots, 19 in stems and up to 22 in needles of P. pinea (Supplementary Fig.
S3 y S4). Microarray data are commonly validated by RT-PCR due to the higher
accuracy attributed to this tool, especially for genes with low induction levels [44]. We
have performed RT-PCR analysis for 16 genes, covering the main functional groups and
expression patterns, and including some genes responsive to PEG-induced water stress
[8] but not detected as significantly induced here, using microarrays (TC183705;
HSP90 and TC166071; unknown) (Fig. 3). Expression patterns detected with both
techniques were fairly consistent, with Pearson correlation values higher than 80% for
35 (P. pinaster) and 33 (P. pinea) of the 48 gene-organ combinations. As expected,
lower correlations were obtained for the genes-organs with lower induction levels,
including those not identified as significantly overexpressed according to microarray
analysis.
Genes overexpressed in both species can be grouped in three categories, according to
their induction patterns detected by microarrays: a) genes induced in the first steps of
the drought, (S1 and S2), whose expression level can decrease in further steps or can be
kept stable during the rest of the treatment, b) genes whose expression constantly
increases throughout the treatment and c) genes highly induced in later steps, S3 and,
particularly, S4 and S5. In both species many genes are induced earlier in the roots than
in the aerial parts, which is consistent with the role of roots in detecting and triggering
the response to water stress. However, several differences can be observed between P.
pinaster and P. pinea:
- A higher number of genes are significantly induced by drought stress in P.
pinea, compared to P. pinaster, especially for roots and needles.
- Stronger inductions levels are detected in overexpressed genes in P. pinea,
compared to P. pinaster. Thus, 83 inductions higher than 10-fold were
detected for P. pinea, with a miximum of 72-fold for a putative
hydroxyproline-rich protein (TC197470), whereas 43 inductions higher than

10-fold were detected for P. pinaster, with a maximum of 62-fold for a
dehydrin (TC162509).
- A higher proportion of genes are induced in the first steps of the drought in
P. pinea compared to P. pinaster, particularly for S1 (10 days without
watering).
- On the contrary, certain genes show a delayed response in P. pinea, with
higher inductions in S4-S5, compared to P. pinaster, with higher inductions
in S2-S3. This is the case, for instance, of genes included in clusters 8, 9, 10,
11 and 12 in needles, cluster 1 and 9 in stems or clusters 4, 6 and 8 in roots
of P. pinea and clusters 2, 4 and 6 in needles, clusters 4 and 8 in stems, and
clusters 1, 2, 3 and 4 of roots in P. pinaster. These observations were
confirmed, especially stems and needles, in some genes studied with RT-
PCR. This is the case of TC162509 (Pper_dhn_ESK2 [13]), TC156369
(putative glycosiltransferase), TC197470 (putative hydroxyproline rich-
protein), TC157851 (putative quitinase) y TC188679 (putative OPR)
Altogether, these results suggest P. pinea is a highly responsive species, displaying a
faster and more intense transcriptional response to drought, compared to P. pinaster.
Notwithstanding, several genes show a delayed induction in P. pinea. This result could
be is consistent with the ones reported recently by Sánchez-Gómez et al. (2011)[45],
according to which, during the first steps of a moderate drought stress, the best
performing clones of P. pinea showed a water-spending strategy, which could provide
functional advantage in dry environments, out-competing other water-saving trees [46-
48] as P. pinaster [19, 49]. As the stress situation persists, P. pinea plants would turn
out swiftly to a water-saving behaviour, as reported for other water-spending species
[50, 51]. Further studies will be required to confirm this hypothesis.
It is also noteworthy the opposite expression pattern shown by some genes in both
species. TC177528 is strongly upregulated in P. pinea (59-fold in stems and 32-fold in
needles at S4), while repressed in P. pinaster (-15-fold and -5-fold for the same points).
This gene encodes a peptide presumably involved in ammonium nutrition in P. pinaster
[52], which can have an indirect effect in the ABA-mediated reduction of stomatal
conductance during drought [53]. On contrary, TC172144, a gene of unknown function,
shows a moderate overexpression in P. pinaster in response to drought stress, whereas it
seems repressed in P. pinea.
Increase in transcription of putative retrotransposons elements detected in roots of P.
pinaster at 50 days of drought (Cluster 8; TC194362 and TC183415) is also remarkable.
Enhanced transposition of such elements induced by stress, probably due to epigenetic
transient modifications, is a well known phenomenon ([54] and references therein).
Interestingly, CDT-1, a dehydration-inducible gene of resurrection plant Craterostigma
plantagineum showing similarities with retrotransposons, has been reported to confere
dessication tolerance, putatively acting as regulatory non-coding RNA molecule [55].
None of these elements was detected as overexpressed in P. pinea, which could be due
to the stringency of the criteria used, the specificity of the probes employed or own
differences in response between the two species.
3. Conclusion
Since its employ by Schema et al. [56] microarray technology has been used for the
analysis of gene expression in different processes. Due to the high degree of

conservation frequently found in coding regions, heterologous array analysis has often
been applied in Pinaceae and other species [57-59]While failure to detect significant
overexpressions due to specificity of the probes, which would not hybridize properly
with the heterologous cDNA, cannot be discarded, significant inductions revealed by
microarray are as reliable as for homologous samples. In this study, the oligo-array
designed with drought candidate genes from maritime pine was successfully employed
to study and compare the response to water stress displayed by P. pinaster and P. pinea.
No matter both P. pinaster and P. pinea are closely related and well adapted to drought,
they display different patterns in the response to water stress, with P. pinea thriving
even in more xeric conditions than P. pinaster. P. pinea appears as a more sensitive
species, displaying a faster and stronger transcriptional response. Notwithstanding this
fact, several genes show strong delayed induction compared to P. pinaster, or even
show opposite expression patterns in both species. While induced genes with similar
profiles between both species can be considered as general candidate genes for the study
of drought response in conifers, genes with diverging expression patterns can underpin
the differences displayed by these species in their performance under water stress
Further research must focus in the regulation of the expression of inducible genes, as
well as in the epigenetic modifications surely involved in such regulation as well as in
the intraspecific variability in the response. We can expect that fast adaptation to an
increasingly drought-prone environment in the following decades will rely to a major
extent in these epigenetic modifications, underlying plastic responses.
4. Material and methods
4.1. Plant materials and treatment conditions

Plant material from Oria provenance (37º30’30”N 2º20’20”W, south eastern Spain) and
Tordesillas (41° 30′ 6″ N, 4° 59′ 57″ W, central Spain)) provenances was used for P.
pinaster and P. pinea, respectively. Both species were grown using containers with
peat:perlite:vermiculite (3:1:1 by weight). One year old plants were kept in a growth
chamber for two months prior to the drought experiment, with a photoperiod of 16/8
(day/night), with a temperature of 24ºC and 60% of relative humidity during the day
and 20ºC and 80% of relative humidity during the night, and watered at field capacity.
Unstressed plants were harvested one hour after the last watering. The remaining plants
were maintained without irrigation and collected at midday every ten days (five
sampling points, S1-S5). Water potential in needles was measured at each sampling
point (at midday) using a Scholander pressure chamber. Needles, stem and roots from
each plant were collected separately, immediately frozen in liquid nitrogen and stored at
-80 ºC.
4.2. Microarray design and hybridisation
A total of 1124 unigenes, 351 from water stress SSH library reported by Perdiguero et
al. (2012) [8] and 773 genes selected from other libraries, were included in the
microarray design (Agilent 8 x 15K, Agilent Technologies, CA, USA). Genes are
identified in this work with the code of the most homologous TC (Tentative Consensus
Sequence) from Pine Gene Index. For each unigene, one to four 60-bp-long probes were
designed and spotted at least three times on the slide. Probes designed for other pine,
spruce and human ESTs available in public databases were included as negative
controls. Four different genotypes for P.pinaster or full-sib families for P.pinea
collected at each sampling point were used as biological replicates during the
experiment. RNA from sampling points S1-S5 and control plants was hybridised to the
microarrays. RNA amplifications, labelling and hybridisations, as well as data analysis
was carried out as described elsewhere [8]
RNA amplification and labelling were performed as described by Adie et al. [60]. RNA
was purified by using the Qiagen RNAeasy kit (QIAGEN, CA, USA). “The manual
two-color microarray based gene expression analysis” protocol (Agilent Technologies,
CA, USA) was followed for hybridisations. Images from Cy3 and Hyper5 channels
were equilibrated and captured with a GenePix 4000B (Axon, CA, USA), and spots
were quantified using the GenPix software (Axon, CA, USA).
4.3. Data analysis
Background correction and normalisation of expression data were performed using
LIMMA (Linear Models for Microarray Data) [61, 62]. LIMMA is part of
“Bioconductor, an R language project” (www.bioconductor.org). For local background
correction and normalisation, the methods "normexp" and loess in LIMMA were used,
respectively. To achieve a similar distribution across arrays and consistency among
arrays, log-ratio values were scaled using the median-absolute-value as scale estimator.
Differentially expressed genes were evaluated by the non-parametric algorithm 'Rank
Products' available as the "RankProd" package at “Bioconductor, an R language
project” [63, 64]. This method detects genes that are consistently high ranked in a
number of replicated experiments independently of their numerical intensities. The
results are provided in the form of p-values defined as the probability that a given gene
is ranked in the observed position by chance. The expected false discovery rate was
controlled to be less than 5%.
Changes in the expression of a gene relative to control plants were estimated using the
average signal intensity across the four data sets (four genotypes). Based on the
statistical analysis, a gene was considered to be significantly up-regulated if it met all

three of the following criteria: (1) FDR Rank Prod <0.05; (2) the fold change was ≥1.6
at any sampling point and in any organ and (3) the trend was consistent for all data.
Hierarchical clustering of upregulated genes in the different organs was performed
using the log ratio data and the Euclidean distance (complete linkage and threshold 2.5)
options of the MeV 4.4 software [65].
4.3 Statistical analysis
4.3.1 Differential gene expression
Differential expression was performed to find the difference in the mean expression
among the three organs (multi-class) or among species (two class) by using limma
package [66] implemented in Babelomics suite [67]. The gene expression pattern for
each sample point was analysed, obtaining P values for each gene in the experiment. To
account for multiple testing effects, P values were corrected using the false discovery
rate. Significant differential expression was considered for P values < 0.05.
4.3.2 Functional analysis
GO term enrichment for upregulated genes was analysed by using FatiGO software [68]
implemented in Babelomics suite [67]. This program executes a Fisher's exact test for
2×2 contingency tables is used to check for significant over-representation of GO
annotations. Arabidopsis thalina was used as model species in order to identified over-
representation of GO term from upregulated genes respect the rest of annotated genome.
Multiple test correction to account for the multiple hypotheses tested (one for each
functional term) is applied. Significant enrichment of GO terms was considered for P
values < 0.01
4.4. Real-time quantitative PCR

The expression pattern of several genes was confirmed by RT-PCR using RNA from
one of the genotypes used as a biological replicate in the microarrays. For this purpose,
the RNA was treated with DNAse Turbo (Ambion; Applied Biosystems, Life
Technologies, CA, USA). First-strand cDNA was synthesised from 2 μg total RNA
from each sample using PowerScriptIII reverse transcriptase (Invitrogen) according to
the supplier’s manual. 18S rRNA was used as a control, after verifying that the signal
intensity remained unchanged across all treatments. The primers for experimental genes
were designed using Primer Express version 3.0.0 (Applied Biosystems Life
Technologies, CA, USA) and are shown in Supplementary Table S4. For those genes
that showed low efficiency for P.pinea new pair of primers was designed with specific
sequences. Polymerase chain reactions were performed in an optical 96-well plate with
a CFX 96 Detection system (BIO-RAD), using EvaGreen to monitor dsDNA synthesis.
Reactions containing 2x SsoFast EvaGreen Supermix reagent (BIO-RAD, CA, USA),
12.5 ng cDNA and 500 nM of primers in a final volume of 10 μl were subjected to the
following standard thermal profile: 95 °C for 3 min, 40 cycles of 95 °C for 10 s and 60
°C for 10 s. Three technical replicates were performed for each PCR run. To compare
the data from different PCR runs or cDNA samples, the mean of the CT values of the
three technical replicates was normalised to the mean CT value of Ri18S. The
expression ratios were then obtained using the ΔΔCT method corrected for the PCR
efficiency for each gene [69].
SUPPLEMENTARY DATA
Table S1: Fold change in the expression of the 181 genes upregulated in different
organs during P.pinaster treatment.

Table S2: Fold change in the expression of the 219 genes upregulated in different
organs during P.pinea treatment
Table S3: Selection of 113 water stress candidate genes in conifers.
Table S4: Primer pairs used in RT-PCR
Figure S1: Transcripts significantly up-regulated shared between needles, stems and
roots in Pinus pinaster. A total of 181 genes significantly overexpressed were identified
Figure S2: Transcripts significantly up-regulated shared between needles, stems and
roots in Pinus pinea. A total of 219 genes significantly upregulated were identified
Figure S3a, S3b and S3c: Hierarchical cluster analysis of the expression patterns of
water stress induced genes for each organ in P.pinaster
Figure S4a, S4b and S4c: Hierarchical cluster analysis of the expression patterns of
water stress induced genes for each organ in Pinus pinea
ACKNOWLEDGEMENTS
The authors would like to thank Dr. Luis Gil and Dr Santiago Gonzalez-Martinez for
technical support. This work has been funded through the projects AGL2006-
03242/FOR (Spanish Ministry of Education and Science), CCG07-UPM/AMB-1932
and CCG10-UPM/AMB-5038 (Madrid Regional Government– UPM). PP has a pre-
doctoral fellowship from the Spanish Ministry of Education and Science.
References
[1] IPCC, Climate Change 2007 - The Physical Science Basis: Working Group I
Contribution to the Fourth Assessment Report of the IPCC, Cambridge University
Press, 2007.
[2] Huang G.T., Ma S.L., Bai L.P., Zhang L., Ma H., Jia P., Liu J., Zhong M., Guo
Z.F., Signal transduction during cold, salt, and drought stresses in plants, Molecular
Biology Reports 39 (2012) 969-987.
[3] Dubos C., Le Provost G., Pot D., Salin F., Lalane C., Madur D., Frigerio J.M.,
Plomion C., Identification and characterization of water-stress-responsive genes in
hydroponically grown maritime pine (Pinus pinaster) seedlings, Tree Physiol. 23 (2003)
169-179.
[4] Dubos C., Plomion C., Identification of water-deficit responsive genes in
maritime pine (Pinus pinaster Ait.) roots, Plant Molecular Biology 51 (2003) 249-262.
[5] Heath L.S., Ramakrishnan N., Sederoff R.R., Whetten R.W., Chevone B.I.,
Struble C.A., Jouenne V.Y., Chen D.W., van Zyl L., Grene R., Studying the functional
genomics of stress responses in loblolly pine with the Expresso microarray experiment
management system, Comparative and Functional Genomics 3 (2002) 226-243.
[6] Lorenz W.W., Alba R., Yu Y.-S., Bordeaux J., Simoes M., Dean J., Microarray
analysis and scale-free gene networks identify candidate regulators in drought-stressed
roots of loblolly pine (P. taeda L.), BMC Genomics 12 (2011) 264.
[7] Lorenz W.W., Sun F., Liang C., Kolychev D., Wang H.M., Zhao X.,
Cordonnier-Pratt M.M., Pratt L.H., Dean J.F.D., Water stress-responsive genes in
loblolly pine (Pinus taeda) roots identified by analyses of expressed sequence tag
libraries, Tree Physiol. 26 (2006) 1-16.
[8] Perdiguero P., Collada C., Barbero M.C., García Casado G., Cervera M.T., Soto
Á., Identification of water stress genes in Pinus pinaster Ait. by controlled progressive
(2012) 44-53.
[9] Sathyan P., Newton R.J., Loopstra C.A., Genes induced by WDS are
differentially expressed in two populations of aleppo pine (Pinus halepensis), Tree
Genet. Genomes 1 (2005) 166-173.
[10] Watkinson J.I., Sioson A.A., Vasquez-Robinet C., Shukla M., Kumar D., Ellis
M., Heath L.S., Ramakrishnan N., Chevone B., Watson L.T., van Zyl L., Egertsdotter
U., Sederoff R.R., Grene R., Photosynthetic acclimation is reflected in specific patterns
of gene expression in drought-stressed loblolly pine, Plant Physiology 133 (2003) 1702-
1716.
[11] Dubos C., Plomion C., Drought differentially affects expression of a PR-10
protein, in needles of maritime pine (Pinus pinaster Ait.) seedlings, Journal of
Experimental Botany 52 (2001) 1143-1144.
[12] Padmanabhan V., Dias D.M.A.L., Newton R.J., Expression analysis of a gene
family in loblolly pine (Pinus taeda L.) induced by water deficit stress, Plant Molecular
Biology 35 (1997) 801-807.
[13] Perdiguero P., Barbero M.C., Cervera M.T., Soto Á., Collada C., Novel
conserved segments are associated with differential expression patterns for Pinaceae
dehydrins, Planta 236 (2012) 1863-1874.
[14] Velasco-Conde T., Yakovlev I., Majada J., Aranda I., Johnsen Ø., Dehydrins in
maritime pine (Pinus pinaster) and their expression related to drought stress response,
Tree Genet. Genomes 8 (2012) 957-973.
[15] Eveno E., Collada C., Guevara M.A., Leger V., Soto A., Diaz L., Leger P.,
Gonzalez-Martinez S.C., Cervera M.T., Plomion C., Garnier-Gere P.H., Contrasting
patterns of selection at Pinus pinaster Ait. drought stress candidate genes as revealed by
genetic differentiation analyses, Molecular Biology and Evolution 25 (2008) 417-437.
[16] Aranda I., Alia R., Ortega U., Dantas A.K., Majada J., Intra-specific variability
in biomass partitioning and carbon isotopic discrimination under moderate drought
stress in seedlings from four Pinus pinaster populations, Tree Genet. Genomes 6 (2010)
169-178.
[17] de Miguel M., Sánchez-Gómez D., Cervera M.T., Aranda I., Functional and
genetic characterization of gas exchange and intrinsic water use efficiency in a full-sib
family of Pinus pinaster Ait. in response to drought, Tree Physiol. 32 (2012) 94-103.
[18] Lopez R., Aranda I., Gil L., Osmotic adjustment is a significant mechanism of
drought resistance in Pinus pinaster and Pinus canariensis, Investigacion Agraria-
Sistemas Y Recursos Forestales 18 (2009) 159-166.
[19] Picon C., Guehl J.M., Ferhi A., Leaf gas exchange and carbon isotope
composition responses to drought in a drought-avoiding (Pinus pinaster) and a drought-
tolerant (Quercus petraea) species under present and elevated atmospheric CO2
concentrations, Plant Cell and Environment 19 (1996) 182-190.
[20] Vendramin G.G., Fady B., González-Martínez S.C., Hu F.S., Scotti I., Sebastiani
F., Soto Á., Petit R.J., Genetically depauperate but widespread: The case of emblematic
mediterranean pine Evolution 62 (2008) 680-688.
[21] Awada T., Radoglou K., Fotelli M.N., Constantinidou H.I.A., Ecophysiology of
seedlings of three Mediterranean pine species in contrasting light regimes, Tree Physiol.
23 (2003) 33-41.
[22] Valladares F., Pearcy R.W., Drought can be more critical in the shade than in the
sun: a field study of carbon gain and photo-inhibition in a Californian shrub during a
dry El Nino year, Plant Cell and Environment 25 (2002) 749-759.
[23] Ruepp A., Zollner A., Maier D., Albermann K., Hani J., Mokrejs M., Tetko I.,
Guldener U., Mannhaupt G., Munsterkotter M., Mewes H.W., The FunCat, a functional
annotation scheme for systematic classification of proteins from whole genomes,
Nucleic Acids Research 32 (2004) 5539-5545.
[24] Nakamoto H., Vígh L., The small heat shock proteins and their clients, Cellular
and Molecular Life Sciences 64 (2007) 294-306.
[25] Savić J.A., Dragićević I.A.A., Pantelić D., Oljača J., Momčilović I.,
Expression of small heat shock proteins and heat tolerance in potato (Solanum
tuberosum L.), Archives of Biological Sciences 64 (2012) 135-144.
[26] Soto A., Allona I., Collada C., Guevara M.-A., Casado R., Rodriguez-Cerezo E.,
Aragoncillo C., Gomez L., Heterologous expression of a plant small heat-shock protein
enhances Escherichia coli viability under heat and cold stress, Plant Physiology 120
(1999) 521-528.
[27] Sun W., Van Montagu M., Verbruggen N., Small heat shock proteins and stress
tolerance in plants, Biochimica et Biophysica Acta (BBA) - Gene Structure and
Expression 1577 (2002) 1-9.
[28] Jiang C., Xu J., Zhang H.A.O., Zhang X., Shi J., Li M.I.N., Ming F., A cytosolic
class I small heat shock protein, RcHSP17.8, of Rosa chinensis confers resistance to a
variety of stresses to Escherichia coli, yeast and Arabidopsis thaliana, Plant, Cell &
Environment 32 (2009) 1046-1059.
[29] Cho E., Choi Y., A nuclear-localized HSP70 confers thermoprotective activity
and drought-stress tolerance on plants, Biotechnology Letters 31 (2009) 597-606.
[30] Vásquez-Robinet C., Watkinson J.I., Sioson A.A., Ramakrishnan N., Heath L.S.,
Grene R., Differential expression of heat shock protein genes in preconditioning for
photosynthetic acclimation in water-stressed loblolly pine, Plant Physiology and
Biochemistry 48 (2010) 256-264.
[31] Kimura M., Yamamoto Y.Y., Seki M., Sakurai T., Sato M., Abe T., Yoshida S.,
Manabe K., Shinozaki K., Matsui M., Identification of Arabidopsis genes regulated by
high light-stress using cDNA microarray, Photochemistry and Photobiology 77 (2003)
226-233.
[32] Azevedo C., Santos-Rosa M.J., Shirasu K., The U-box protein family in plants,
Trends in Plant Science 6 (2001) 354-358.
[33] Bruria H., Role of proline in plant response to drought and salinity, in:
Pessarakli M. (Ed.), Handbook of plant and crop stress,Third edition, CRC Press, 2010,
pp. 213-238.
[34] Corcuera L., Gil-Pelegrin E., Notivol E., Aridity promotes differences in proline
and phytohormone levels in Pinus pinaster populations from contrasting environments,
Trees - Structure and Function 26 (2012) 799-808.
[35] Cruz de Carvalho M.H., Drought stress and reactive oxygen species: production,
scavenging and signaling, Plant signaling & behavior 3 (2008) 156-165.
[36] Mizoi J., Shinozaki K., Yamaguchi-Shinozaki K., AP2/ERF family transcription
factors in plant abiotic stress responses, Biochimica et Biophysica Acta (BBA) - Gene
Regulatory Mechanisms 1819 (2012) 86-96.
[37] Rushton P.J., Somssich I.E., Ringler P., Shen Q.J., WRKY transcription factors,
Trends in Plant Science 15 (2010) 247-258.
[38] Zhou Q.Y., Tian A.G., Zou H.F., Xie Z.M., Lei G., Huang J., Wang C.M., Wang
H.W., Zhang J.S., Chen S.Y., Soybean WRKY-type transcription factor genes,
GmWRKY13, GmWRKY21, and GmWRKY54, confer differential tolerance to abiotic
stresses in transgenic Arabidopsis plants, Plant Biotechnology Journal 6 (2008) 486-
503.
[39] Campbell B., Hallengren J., Hannapel D., Accumulation of BEL1-like transcripts
in solanaceous species, Planta 228 (2008) 897-906.
[40] Chen L.Q., Hou B.H., Lalonde S., Takanaga H., Hartung M.L., Qu X.Q., Guo
W.J., Kim J.G., Underwood W., Chaudhuri B., Chermak D., Antony G., White F.F.,
Somerville S.C., Mudgett M.B., Frommer W.B., Sugar transporters for intercellular
exchange and nutrition of pathogens, Nature 468 (2010) 527-532.
[41] Pedron L., Baldi P., Hietala A.M., La Porta N., Genotype-specific regulation of
cold-responsive genes in cypress (Cupressus sempervirens L.), Gene 437 (2009) 45-53.
[42] Deepak S., Shailasree S., Kini R.K., Muck A., Mithöfer A., Shetty S.H.,
Hydroxyproline-rich Glycoproteins and Plant Defence, Journal of Phytopathology 9999
(2010).
[43] Crouzet J., Trombik T., Fraysse Å.S., Boutry M., Organization and function of
the plant pleiotropic drug resistance ABC transporter family, FEBS Letters 580 (2006)
1123-1130.
[44] Dallas P., Gottardo N., Firth M., Beesley A., Hoffmann K., Terry P., Freitas J.,
Boag J., Cummings A., Kees U., Gene expression levels assessed by oligonucleotide
microarray analysis and quantitative real-time RT-PCR - how well do they correlate?,
BMC Genomics 6 (2005) 59.
[45] Sánchez-Gómez D., Velasco-Conde T., Cano-Martín F.J., Ángeles Guevara M.,
Teresa Cervera M., Aranda I., Inter-clonal variation in functional traits in response to
drought for a genetically homogeneous Mediterranean conifer, Environmental and
Experimental Botany 70 (2011) 104-109.
[46] Cohen D., Expected efficiency of water utilization in plants under different
compatition and selection regimes Israel Journal of Botany 19 (1970) 50-&.
[47] Nguyen-Queyrens A., Ferhi A., Loustau D., Guehl J.M., Within-ring delta C-13
spatial variability and interannual variations in wood cellulose of two contrasting
provenances of Pinus pinaster, Can. J. For. Res.-Rev. Can. Rech. For. 28 (1998) 766-
773.
[48] Zhang J.W., Feng Z., Cregg B.M., Schumann C.M., Carbon isotopic
composition, gas exchange, and growth of three populations of ponderosa pine differing
in drought tolerance, Tree Physiol. 17 (1997) 461-466.
[49] Fernandez M., Gil L., Pardos J.A., Effects of water supply on gas exchange in
Pinus pinaster Ait. provenances during their first growing season, Annals of Forest
Science 57 (2000) 9-16.
[50] Kozlowski T.T., Pallardy S.G., Physiology of woody plants, Academic Press,
1996.
[51] Levitt J., Responses of plants to environmental stresses. Volume II. Water,
radiation, salt, and other stresses, Academic Press., 1980.
[52] Canales J., Avila C., Cánovas F.M., A maritime pine antimicrobial peptide
involved in ammonium nutrition, Plant, Cell & Environment 34 (2011) 1443-1453.
[53] Goodger J.Q.D., Schachtman D.P., Nitrogen source influences root to shoot
signaling under drought, in: Pareek A., Sopory S.K., Bohnert H.J. (Eds.), Abiotic Stress
Adaptation in Plants, Springer Netherlands, 2010, pp. 165-173.
[54] Mirouze M., Paszkowski J., Epigenetic contribution to stress adaptation in
plants, Current Opinion in Plant Biology 14 (2012) 267-274.
[55] Phillips J.R., Dalmay T., Bartels D., The role of small RNAs in abiotic stress,
FEBS Letters 581 (2007) 3592-3597.
[56] Schena M., Shalon D., Davis R.W., Brown P.O., Quantitative Monitoring of
Gene Expression Patterns with a Complementary DNA Microarray, Science 270 (1995)
467-470.
[57] Brinker M., van Zyl L., Liu W., Craig D., Sederoff R.R., Clapham D.H., von
Arnold S., Microarray Analyses of Gene Expression during Adventitious Root
Development in Pinus contorta, Plant Physiol. 135 (2004) 1526-1539.
[58] Davey M., Graham N., Vanholme B., Swennen R., May S., Keulemans J.,
Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a
proof-of-concept study of drought stress in Musa, BMC Genomics 10 (2009) 436.
[59] van Zyl L., von Arnold S., Bozhkov P., Chen Y., Egertsdotter U., MacKay J.,
Sederoff R.R., Shen J., Zelena L., Clapham D.H., Heterologous array analysis in
Pinaceae: Hybridization of Pinus taeda cDNA arrays with cDNA from needles and
embryogenic cultures of P. taeda, P. sylvestris or Picea abies, Comparative and
Functional Genomics 3 (2002) 306-318.
[60] Adie B.A.T., Perez-Perez J., Perez-Perez M.M., Godoy M., Sanchez-Serrano
J.J., Schmelz E.A., Solano R., ABA is an essential signal for plant resistance to
pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis, Plant
Cell 19 (2007) 1665-1681.
[61] Smyth G.K., Speed T., Normalization of cDNA microarray data, Methods 31
(2003) 265-273.
[62] Smyth G.K., Linear Models and Empirical Bayes Methods for Assessing
Differential Expression in Microarray Experiments, The Berkeley Electronic Press,
2004.
[63] Breitling R., Armengaud P., Amtmann A., Herzyk P., Rank products: a simple,
yet powerful, new method to detect differentially regulated genes in replicated
microarray experiments, FEBS Letters 573 (2004) 83-92.
[64] Hong F., Breitling R., McEntee C.W., Wittner B.S., Nemhauser J.L., Chory J.,
RankProd: a bioconductor package for detecting differentially expressed genes in meta-
analysis, Bioinformatics 22 (2006) 2825-2827.
[65] Saeed A.I., Bhagabati N.K., Braisted J.C., Liang W., Sharov V., Howe E.A., Li
J., Thiagarajan M., White J.A., Quackenbush J., Alan K., Brian O., TM4 Microarray
Software Suite, Methods in Enzymology, vol. Volume 411, Academic Press, 2006, pp.
134-193.
[66] Smyth G., Limma: linear models for microarray data, in: Gentleman R., Carey
V.J., Huber W., Irizarry R.A., Dudoit S. (Eds.), Bioinformatics and computational
biology solutions using R and bioconductor, Springer New York, 2005, pp. 397-420.
[67] Al-Shahrour F.t., Minguez P., Tárraga J., Montaner D., Alloza E., Vaquerizas
J.M., Conde L., Blaschke C., Vera J., Dopazo J., BABELOMICS: a systems biology
perspective in the functional annotation of genome-scale experiments, Nucleic Acids
Research 34 (2006) W472-W476.
[68] Al-Shahrour F., Díaz-Uriarte R., Dopazo J., FatiGO: a web tool for finding
significant associations of Gene Ontology terms with groups of genes, Bioinformatics
20 (2004) 578-580.
[69] Pfaffl M.W., A new mathematical model for relative quantification in real-time
RT-PCR, Nucleic Acids Research 29 (2001) e45.
Figure legends
Fig 1. Average midday water potential in needles along the drought treatment. P.
pinaster: dashed line; P. pinea: continuous line. Bars represent standard errors.
Fig. 2. Transcripts significantly up-regulated shared between needles, stems and roots
for both species. A total of 113 genes significantly upregulated were selected.
Fig. 3. Verification of microarray results by RT-PCR. Expression profiles along the
drought stress treatment in roots, stems and needles from 16 genes involved in different
functionalities.
Fig. 4. Functional distribution of selected candidate genes obtained. A total of 113
genes were grouped according MIPS functional categories of Arabidopsis thaliana. The
percentage of gene transcripts in each group is listed.

Fig 1
Fig 2
Fig 2(cont.)
Fig 3
Fig 4
ANEXO V. Novel conserved segments are associated with differential
expression patterns for Pinaceae dehydrins
Planta 236 (2012) 1863-1874.
Author's personal copy
Planta (2012) 236:1863–1874
DOI 10.1007/s00425-012-1737-4
ORIGINAL ARTICLE
Novel conserved segments are associated with differential

expression patterns for Pinaceae dehydrins
Pedro Perdiguero • M. Carmen Barbero •
M. Teresa Cervera • Álvaro Soto • Carmen Collada
Received: 17 April 2012 / Accepted: 3 August 2012 / Published online: 26 August 2012
Ó Springer-Verlag 2012
Abstract Dehydrins are thought to play an essential role two amino acid motifs highly conserved and repeated in
in the response, acclimation and tolerance to different abi- Pinaceae dehydrins and absent in angiosperms, presumably
otic stresses, such as cold and drought. These proteins have related to the divergent expression profiles observed.
been classified into five groups according to the presence of
conserved and repeated motifs in their amino acid sequence. Keywords Dehydrin Drought Gene expression
Due to their putative functions in the response to stress, Pinus qRT-PCR Sequence analysis
dehydrins have been often used as candidate genes in
studies on population variability and local adaptation to Abbreviations
environmental conditions. However, little is still known EST Expressed sequence tag
regarding the differential role played by such groups or the LEA proteins Late embryogenesis abundant proteins
mechanism underlying their function. Based on the qRT-PCR Quantitative reverse transcription
sequences corresponding to dehydrins available in public polymerase chain reaction
databases we have isolated eight different dehydrins from TC Tentative contig
cDNA of Pinus pinaster. We have obtained also their
genomic sequences and identified their intron/exon struc-
ture. Quantitative RT-PCR analysis of their expression
pattern in needles, stems and roots during a severe and Introduction
prolonged drought stress, similar to the ones trees must face
in nature, is also reported. Additionally, we have identified Terrestrial plant species have developed a complex array of
strategies and responses to surmount the restrictive condi-
tions of dry land. Particularly, anatomical and physiologi-
Electronic supplementary material The online version of this
article (doi:10.1007/s00425-012-1737-4) contains supplementary cal adaptations and molecular responses allow them to
material, which is available to authorized users. endure drought stresses, which can affect plant growth,
regeneration and even survival. This is especially important
P. Perdiguero M. C. Barbero Á. Soto (&) C. Collada
in forest trees, which most likely, have to face such situ-
GENFOR Grupo de investigación en Genética y Fisiologı́a
Forestal, Universidad Politécnica de Madrid, ations more than once during their long lifespan.
28040 Madrid, Spain Within molecular responses, many genes as transcrip-
e-mail: alvaro.soto.deviana@upm.es tion factors, late embryogenesis abundant (LEA) proteins
or enzymes for the biosynthesis of hormones and sugars
P. Perdiguero M. C. Barbero M. T. Cervera Á. Soto
C. Collada have been described as principal components conferring
Unidad Mixta de Genómica y Ecofisiologı́a Forestal, dehydration tolerance in plants (Sunkar et al. 2010).
INIA/UPM, Madrid, Spain In particular, LEA proteins accumulate in vegetative
plant tissues when a marked decrease in water content
M. T. Cervera
Departamento de Genética y Fisiologı́a Forestal, takes place. They are highly hydrophilic proteins with a
CIFOR-INIA, Madrid, Spain high proportion of Gly and other small residues in their
123
1864 Planta (2012) 236:1863–1874
amino acid composition. Due to their physiochemical function as antioxidants due to their capacity to bind free
properties, they have been proposed to play a key role in metal ions, thus preventing excessive ROS (reactive oxygen
preserving and maintaining cell functions during dehydra- species) formation (Hara et al. 2005; Sun and Lin 2010).
tion (Olvera-Carrillo et al. 2011). LEA proteins constitute a Although their functions have been frequently investigated
complex, diverse group, first described by their accumu- and revised in the last years, mostly in angiosperm species
lation during seed formation (Dure et al. 1981), and include (Allagulova et al. 2003; Rorat 2006; Yuxiu et al. 2007;
proteins with low global homology. Different classifica- Kosová et al. 2010; Eriksson and Harryson 2011), the
tions based on their amino acid sequence and composition mechanism underlying these roles remain unclear.
have been attempted, establishing four (Bray 1993) to ten Dehydrins have been located within QTL intervals for
(Dure 1993) groups. The most recent classification was important phenotypic traits related with drought tolerance
proposed by Hundertmark and Hincha (2008) according (growth under osmotic stress, vernalization response,
to the conserved domains included in Pfam database flowering time, low temperature tolerance, frost resistance,
(Wellcome Trust Sanger Institute). Dehydrins (name kept yield under drought stress) (Campbell and Close 1997). For
in this last classification), corresponding to Dure’s D-11 this reason, as well as for their putative roles described
group and to Bray’s group 2, are characterized by the above, different dehydrins have been used as candidate
combination of three different conserved motifs described genes in several works aimed to identify nucleotide diver-
by Close (1997), and traditionally used to classify them: sity patterns associated with local adaptation to different
the Y, S, and K-segments, separated by the less conserved abiotic factors in Pinus species (González-Martı́nez et al.
U-segments, rich in polar amino acids, mainly glycine. 2006; Eveno et al. 2008; Wachowiak et al. 2009; Grivet
All the dehydrins contain one to multiple K-segments, et al. 2009, 2011). Additionally, dehydrins have been pro-
which consist in highly conserved lysine rich 15-mers posed as nuclear genes to investigate natural selection in a
[EKKGIMDKIKEKLPG in angiosperms (Close 1996), and pine phylogeny (Palmé et al. 2009). However, in depth
(Q/E)K(P/A)G(M/L)LDKIK(A/Q)(K/M)(I/L)PG in gym- characterization of these genes in gymnosperms has not
nosperms (Jarvis et al. 1996)]; they usually locate near the been performed yet. Furthermore, previous works focused
C-terminal region and may be involved in the formation in the identification of genes induced by water deficit in
of class A2 amphipathic a-helix (Baker et al. 1988). The Pinus pinaster Ait. have not detected dehydrins (Dubos
S-segment is a stretch of contiguous Ser residues, which may et al. 2003; Dubos and Plomion 2003; Perdiguero et al.
be phosphorylated (Godoy et al. 1994; Campbell et al. 1998). 2012); notwithstanding, preliminary results referred to their
The last feature are the Y-segments [(V/T)DEYGNP], which induction under different abiotic stresses were obtained
have similarities with nucleotide-binding domains described by their inclusion in microarray studies in Pinus taeda
in plant chaperones (Close 1996, 1997). Interestingly, this (Watkinson et al. 2003; Lorenz et al. 2011) or Pinus syl-
segment has only been described so far in angiosperm spe- vestris (Joosen et al. 2006), and very recently Velasco-Conde
cies. According to the different combination of segments, et al. (2012) have published a paper focused in the expression
dehydrins have been classified into five groups; YnSKn, of dehydrins during a drought treatment in Pinus pinaster.
YnKn, SKn, Kn and KnS. Here we report the identification and structural charac-
Dehydrins are considered as late expressed genes in the terization of eight dehydrin genes in Pinus pinaster, a species
stress-signalling pathway (Mahajan and Tuteja 2005), and well adapted to water deficit. We have also analysed by
different functions have been reported for them. It has been quantitative RT-PCR their expression pattern during a severe
proposed that they play important protective roles via sta- and prolonged drought stress, similar to the one trees of this
bilization of membranes due to hydrophobic interactions Mediterranean species have to face in nature. Additionally,
with the K-segments (Campbell and Close 1997; Danyluk we describe for the first time two motifs highly conserved in
et al. 1998; Koag et al. 2003). Chaperone activity has Pinaceae SKn dehydrins, whose presence and number could
also been reported for these proteins (Kovacs et al. 2008a, be related with the different transcription patterns observed.
2008b). Water-binding capacity of dehydrins may account
for their role in protecting enzymes such as alpha-amylase
during cold stress (Rinne et al. 1999), maintaining an ade- Materials and methods
quate local water concentration and decreasing the damages
done by ice crystals during freeze (Wisniewski et al. 1999). Plant material and treatment conditions
Nuclear dehydrins protect transcription machinery from the
desiccation associated with seed formation (Castillo et al. Three genotypes (F1P3, F2P2 and F4P4) from the Pinus
2002). Dehydrins play a key role in this process, and their pinaster Oria provenance (37° 300 3000 N 2° 200 2000 W,
abundance is directly related to seed viability and longev- southeastern Spain) have been used in this study. Each
ity (Hundertmark et al. 2011). Some dehydrins could also genotype comes from a different open-pollinated mother
123
Planta (2012) 236:1863–1874 1865
CTTGACAAAATCAAAACAATAGCGA
tree. Clonal material (cuttings), kindly provided by
CTTGTAACACAACACATTACTAATC
Dr. J. Majada (SERIDA, Spain), was grown at nursery for a
CAGACGCTCAGGTACGCTTGTA
year using containers with peat:perlite:vermiculite (3:1:1,
ATTCTCATCCATGCTCCATGC
CAAAACCCCACAACACGCA
CAAAACCCCACAACACGCA
AAATACCGACCTCACCATC
TTGGAACCCCGTTCATGAA
by weight). One-year-old cuttings were kept in a growth
chamber for two months prior to the drought experiment,
with a photoperiod of 16/8 (day/night), with a temperature
of 24 °C and 60 % of relative humidity during the day and
20 °C and 80 % of relative humidity during the night, and
Sequence (50 –30 )

watered at field capacity.
Four ramets per genotype were collected at each sam-
pling point. Unstressed plants were harvested 1 h after the
last watering. The remaining plants were maintained
without irrigation and collected at midday every 10 days
along 50 days. Water potential in needles was measured at
each sampling point (at midday) using a Scholander bomb.
A2E2SK5_ORF_RV
AESK3a2_ORF_RV
Needles, stem and roots from each plant were collected
AESK3b_ORF_RV
AESK3a_ORF_RV
AESK4_ORF_RV
ESK2_ORF_RV
separately, immediately frozen in liquid nitrogen and
K2b_ORF_RV
K2a_ORF_RV
stored at -80 °C.
Reverse
Sequence analysis
Tentative contigs (TCs) assembled from ESTs correspond-

ing to putative dehydrins were searched in the Pine Gene
Index 9.0 (http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/
TCATTCTGCAATTTGTTGTTTGAGA
gimain.pl?gudb=pine; released March 2011). MUSCLE
ATTAGTATTAAGATGGCGGAAGA
ATTAGTATTAAGATGGCGGAAGA
CTATATCGTCTGCAAATTTTACC
TGGTTATTAAGATGGCGGAAGA
TGGTTATTAAGATGGCGGAAGA
CTGTTCATATCTGCACTCGCTC
ATCTCTGCCGATTATCGTTTCA
software (Edgar 2004) was used to align deduced amino acid
sequences and to obtain a dendrogram using the neighbour
joining method. TCs corresponding to P. pinaster dehydrins
reported in the literature were selected to design primers for
PCR amplification in gDNA and cDNA in the following steps.
DNA and RNA isolation and gene searching

Table 1 Specific primers used to amplify the full ORF for each dehydrin
Genomic DNA was extracted from needles and megaga-

metophytes following Doyle (1990) with slight modifica-
tions. Total RNA was isolated separately from roots, stem
and needles following a CTAB–LiCl precipitation method
(Chang et al. 1993). cDNA was synthesised from 1 lg of
A2E2SK5_ORF_FW
AESK3a2_ORF_FW
total RNA using PowerScriptIII reverse transcriptase (Invit-

AESK3b_ORF_FW
AESK3a_ORF_FW
AESK4_ORF_FW
ESK2_ORF_FW
rogen). Complete sequences for each studied dehydrin were

K2b_ORF_FW
K2a_ORF_FW
amplified by PCR, using cDNA and genomic DNA as tem-

plates and specific primers (Table 1). PCR conditions are
Forward
provided in Supplementary Table S1. The PCR products

were cloned into pGEMÒT-easy vector (Promega) and
transformed into Escherichia coli DH5a cells. The obtained
clones were sequenced and aligned using Spidey mRNA-
to-genomic program at the NCBI (http://www.ncbi.nlm.nih.
Ppter_dhn_AESK3a2
Ppter_dhn_A2E2SK5
gov/spidey/) to reveal the exon–intron structure of the genes.

Ppter_dhn_AESK3a
Ppter_dhn_AESK3b
Ppter_dhn_AESK4
Ppter_dhn_ESK2
Ppter_dhn_K2a
Ppter_dhn_K2b
Real-time quantitative PCR

Dehydrin
Total RNA from roots, stem and needles of each plant was
treated with DNAse Turbo (Ambion). First-strand cDNA
123
1866 Planta (2012) 236:1863–1874
was synthesised from 2 lg of total RNA from each sample
Length (bp)
using PowerScriptIII reverse transcriptase (Invitrogen)
according to the supplier’s manual. 18S rRNA was used as a
76
69
76
76
108
113
157
209
control, after verifying that the signal intensity remained
unchanged across all treatments. Primer Express v. 3.0.0
CAAACATAGAGACGAACACAAAGACTT
(Applied Biosystems) software was used to design PCR
primers. Amplified fragments were sequenced to check
reaction specificity, and primers were modified when nee-
CGGTGAAGCTTTCCCATCAAA
CGGGAATACTGCTTTTCATGC
CGGGAATACTGCTTTTCATGC
ded in order to avoid cross amplification. Final primers are
AGAGGAGGAGCCTGATCACA
CAGTCCGAGGAGGAGCCTG
TTTCCGCCTTCCTCCTCTTC
TTGGAACCCCGTTCATGAA
shown in Table 2. Polymerase chain reactions were per-
formed in an optical 96-well plate with a CFX 96 Detection
system (Bio-Rad), using EvaGreen to monitor dsDNA
synthesis. Reactions containing 29 SsoFast EvaGreen Su-

permix reagent (Bio-Rad), 12.5 ng cDNA and 500 nM of
primers in a final volume of 10 ll were subjected to the
specific thermal profile. PCR conditions are provided in
Supplementary Table S1. Three technical replicates were
performed for each PCR run. The expression ratios were
then obtained using the DDCT method corrected for the
PCR efficiency for each gene (Pfaffl 2001).
A2E2SK5_RT_RV
AESK3a2_RT_RV
AESK3b_RT_RV
AESK3a_RT_RV
AESK4_RT_RV
ESK2_RT_RV
K2b_RT_RV
K2a_RT_RV
Sequences deposition Reverse
The sequences of P. pinaster dehydrin genes obtained in

this study were submitted to GenBank with the following
accessions numbers; HE716959–HE716966 for mRNA and
HE796685–HE796692 for genomic DNA.
CCATGATAAGGAATAGAAGGGAAGAG
Statistical analysis
GGTAAGAAGACGGGACTGGTA
CGCGGTATGTTCGGCTTATTA
GGTATGTTCGGCTTATTCGGC
GAAGACGGGACTGGTGGGTA
AATGTGAGCCGACGGATCC
CTGCTCCTACGTATGGAGC
A general lineal model has been considered for the

CGGTTTGTTCGGCTTAGGA
expression level (relative to unstressed plants) of each gene

at each organ (root, stem, needle):
yijk ¼ m þ gi þ sj þ gsij þ eijk
where yijk is the relative expression level of the kth replicate of

the ith genotype at the jth sampling point (stress point), m is
the global mean, gi represents the effect of the genotype, sj
stands for the effect of the stress (sampling point), gsij is the
effect of their interaction and eijk represents the residual error.
Since the whole experiment was performed in the same
A2E2SK5_RT_FW
AESK3a2_RT_FW
AESK3b_RT_FW
AESK3a_RT_FW
growth chamber, its effect has not been included in the model.
AESK4_RT_FW
Table 2 Specific primers used in RT-PCR
ESK2_RT_FW
Significance of expression changes has been tested using LSD

K2b_RT_FW
K2a_RT_FW
and Bonferroni tests at 95 % confidence level. Statgraphis

Forward
Centurion XVI software was used for statistical analysis.
Results
Ppter_dhn_AESK3a2
Ppter_dhn_A2E2SK5
Ppter_dhn_AESK3a
Ppter_dhn_AESK3b
Ppter_dhn_AESK4
Ppter_dhn_ESK2
In silico searching and isolation of Pinus pinaster

Ppter_dhn_K2a
Ppter_dhn_K2b
dehydrin genes
Dehydrin
A total of 47 full amino acid sequences were deduced

from 100 TC/ESTs sequences corresponding to putative
123
Planta (2012) 236:1863–1874 1867
Fig. 1 Tentative contigs (TC) corresponding to putative dehydrins dehydrins described in this work, and with the sequences used in
from Pinus spp., grouped according to the presence and number of previous works is shown
classical conserved motifs. Correspondence with the eight P. pinaster
dehydrins from pines available in the last version of Pine In the same way, three different genes have been iden-
Gene Index. According to the presence of the conserved tified in the group SK3, all of them with a 579-nucleotide
segments usually considered, sequences were classified in long ORF. Ppter_dhn_AESK3a has no intron in its genomic
six different groups: K1, K2, SK2, SK3, SK4 and SK5. sequence, while Ppter_dhn_AESK3a2 has an intron of 113
We designed specific PCR primers for the seven TCs nucleotides, and 11 nucleotide substitutions, producing five
constructed with P. pinaster ESTs and/or homologous to changes in the deduced amino acid sequence. Also in this
P. pinaster dehydrins used as candidate genes in previous case amplification and sequencing from haploid megaga-
works (Fig. 1). PCR amplification from genomic DNA and metophyte DNA suggest these two sequences correspond
cDNA from water stressed P. pinaster plants have led to to a duplication of the locus in the genome (Fig. 3).
the identification of 8 different dehydrins, described in Ppter_dhn_AESK3b, corresponding to another TC in the
Table 3 and aligned in Fig. 2. Pine Gene Index database, has an intron of 123 nt and
Two different sequences were found within the K2 shows considerable differences in the deduced amino acid
group. Haploid DNA from several megagametophytes, sequence: 24 aa are different from both of the other two
processed individually, was used for amplification and sequences of the group, and additional four aa are different
sequencing, confirming these sequences correspond to a from the deduced sequence for Ppter_dhn_AESK3a and
duplication of the locus in the genome (Fig. 3). No intron one aa from Ppter_dhn_AESK3a2.
has been detected for these genes, and both ORFs are Comparison of the genomic and the cDNA sequences
306-nucleotide long, with 18 nucleotide substitutions, of Ppter_dhn_ESK2 shows the presence of an intron of
entailing 10 changes in the deduced amino acid sequence, 99 nucleotides, while the ORF is 531-nucleotide long.
differentiating them. Ppter_dhn_AESK4 has an ORF of 714 nucleotides. One
123
1868 Planta (2012) 236:1863–1874
Table 3 Description of Pinus pinaster dehydrins genes analysed in this study

Dehydrin Acc. Acc. Description Intron–exon structure
genomic mRNA
seq. seq.
Ppter_dhn_K2a HE796685 HE716959 Contains two K-segments

(KEPGLVDKIKEKIPG,
KKPGVVDKIKEKLPG)
Ppter_dhn_K2b HE796686 HE716960 Contains two K-segments
(KKPGLVDKIKEKLPG,
KKPGMFDKIKEKLPG)
Ppter_dhn_ESK2 HE796687 HE716961 Contains one E-segment
(GHGHAGQFTAAEAEKQQHT), one
S-segment with ten serine residues, and two
K-segments (KKKGLKDKIKEKLPG,
KKGLVDKIKDKLPG).
Ppter_dhn_AESK3a HE796688 HE716962 Contains one A-segment (EASSYYP), one
E-segment (GHGHEGQFAPEDAKQQKH),
one S-segment with eight serine residues and
three K-segments (KKKGSKDKTKEKLPG,
KKTGLVGKIKEKIPG,
KKTGMLDKIKEKLPG)
Ppter_dhn_AESK3a2 HE796689 HE716963 Contains one A-segment (EAASYYP), one
E-segment (GHGHEGQFAPEEAKQQKH),
three K-segments (KKKGSKDKTKEKLPG,
KKTGLVGKIKEKIPG,
KKMGMLDKIKEKLPG)
Ppter_dhn_AESK3b HE796690 HE716964 Contains one A-segment (EAASYYP), one
E-segment (GHGYEGQFTPEEAEQQKH),
three K-segments (KKKGSMEKTKEKLPG,
KKTGLLDKIKEKIPG,
KKTGLLDKIKEKLPG)
Ppter_dhn_AESK4 HE796691 HE716965 Contains one A-segment (EAASYYP), one
E-segment (GHGHEEQPTPEEAEQQKH),
four K-segments (KKKGSKDKSKEKLPG,
KKTGLLDKIKEKIPG,
KKTGLLDKIKEKIPG,
KKLGVLGKIKEKLPG)
Ppter_dhn_A2E2SK5 HE796692 HE716966 Contains two A-segments (EAASYYP,
EAASYYP), two E-segments
(GHGHEGQLTPEEAEQQKR,
GHGHEGQLTPEEAEQQKH), one S-segment
with seven serine residues and one interleaved
ileucine and five K-segments
(KKKEAKDKTKKKVPG,
KKAGLLDKFKEKLPA,
KKTGLLDKIKEKLPV,
KKAGLLDKIKEKLPG,
KKISLIDKIKEKLPG)
intron of 108 bp was identified aligning the genomic and Structure analysis of dehydrin genes from Pinus
cDNA sequences. The longest sequence corresponds to pinaster and other gymnosperms. Identification
Ppter_dhn_A2E2SK5, with an ORF of 978 nucleotides and a of novel conserved segments
very long initial part, compared with the others. Analysis of
the genomic sequence also reveals a large intron, of 334 Complete amino acid sequences of these 8 P. pinaster
nucleotides. dehydrins were aligned with the ones from gymnosperms
All the introns described are located in the middle of the and angiosperms available in public databases (Supple-
S segment. mentary Figure S1). The first 23 aa in the N-terminal
123
Planta (2012) 236:1863–1874 1869
Fig. 2 Optimized alignment of the eight deduced amino acid E-segment. Dotted line box indicate A-segment. Dotted-dashed line
sequences of Pinus pinaster dehydrin, performed with MUSCLE box indicates the conserved fragment at the N-terminal region of
software. Conserved residues and segments are shown up. Solid line gymnosperm and SKn angiosperm dehydrins
boxes indicate K and S-segments. Dashed line box indicate
Fig. 3 PCR products corresponding to different Ppter_dhn_K2 and

Ppter_dhn_AESK3 loci amplified from haploid genomic DNA (isolated Fig. 4 Midday water potential in needles along the drought treat-
from megagametophytes). 1: 100 bp DNA Ladder, 2: Ppter_dhn_K2a, ment. Genotype F1P3 dashed line, genotype F2P2 dotted line,
3: Ppter_dhn_K2b, 4: Ppter_dhn_AESK3a and Ppter_dhn_AESK3a2, genotype F4P4 thin continuous line, average thick continuous line. At
5: Ppter_dhn_AESK3b each point water potential has been measured in four replicates of
each genotype. Bars represent standard deviation
region are highly conserved in Pinaceae dehydrins,

with MAEEAPEHQDRGMFGLFGKKKED as consensus QQKH as consensus sequence in P. pinaster (in bold,
sequence in P. pinaster. This fragment is also conserved in conserved residues in Picea). These conserved segments
the other gymnosperm dehydrins and, interestingly, SKn are highlighted in Fig. 2 and Supplementary Figure S1.
angiosperm dehydrins, although with diverse indels at its The 8 dehydrins identified in this work in P. pinaster
beginning. have been named according to the number of repeats of
Gymnosperm dehydrins lack the Y-segment described conserved A, E, S and K-fragments.
for angiosperm dehydrins. On the contrary, two fragments
have been found to be highly conserved and repeated Expression of dehydrin genes of Pinus pinaster
among Pinaceae dehydrins but absent in angiosperms. The
first one, which we have called A-segment, appears in A drought experiment was performed, withholding water-
dehydrins from groups SKn and its consensus sequence in ing for up to 50 days (Fig. 4) Quantitative RT-PCR anal-
P. pinaster is EAASYYP (in bold the residues also con- ysis of the expression patterns of the eight P. pinaster
served in Picea). The other fragment, named E-segment, dehydrin genes were carried out independently in roots,
appears also in dehydrins from groups SKn, very close stems and needles of three genotypes from Oria (Fig. 5).
upstream the S-segments, with GHGHEGQLTPEEAE This provenance, in southeastern Spain, has previously
123
1870 Planta (2012) 236:1863–1874
123
Planta (2012) 236:1863–1874 1871
b Fig. 5 qRT-PCR expression profiles of the eight Pinus pinaster Discussion

dehydrin genes in roots, stems and needles of three different
genotypes along a drought stress treatment, relative to unstressed
(control) plants. Four ramets per genotype where processed at each Dehydrins have been reported to play a crucial role in the
sampling point, and three technical replicates of each qRT-PCR response and acclimation to adverse abiotic conditions,
reaction were performed. Significant changes in expression relative to such as cold or water deficit (Rorat 2006; Kosová et al.
unstressed plants (95 % significance level) are indicated with an 2010); consistently, their expression is also related to
asterisk. Standard errors are shown
ontogenic processes linked to environmental conditions,
such as bud burst (Yakovlev et al. 2008) or desiccation
been shown to have a good inducible response to water associated with seed development (Castillo et al. 2002). In
stress (Sánchez-Gómez et al. 2010) and has been used for pines, certain dehydrins have been often used as candidate
the selection of candidate genes involved in the response to genes in studies on variability and local adaptation to water
water deficit (Perdiguero et al. 2012). stress (Eveno et al. 2008; Palmé et al. 2009; Grivet et al.
According to the general lineal models considered for 2009, 2011). However, an in depth characterization of this
gene expression levels (which explain more than 97.5 % of complex and multigenic family has not been performed yet
the observed variation for each gene and organ studied), in the genus, and only very recently their expression during
drought duration (stress level), genotype and their inter- a drought treatment has been reported (Velasco-Conde
action are significant factors (p \ 0.0005) in all the cases, et al. 2012). Additionally, in a previous work we did not
but for Ppter_dhn_AESK3a2 in roots, for which genotype detect dehydrins among the genes overexpressed during a
is not significant (p = 0.3142). Stress level is the stron- polyethyleneglycol-induced water stress in Pinus pinaster
gest factor in most cases, accounting for more than 50 % (Perdiguero et al. 2012). These facts pushed us to perform a
of the observed variation (even more than 80 % for more complete search of dehydrins and to characterize
Ppter_dhn_K2a in roots and for Ppter_dhn_AESK4 in their expression pattern during a real and severe drought
needles). stress.
Notwithstanding the differences detected among Forty-seven out of the 100 TCs/ESTs corresponding to
genotypes, general trends in expression patterns can be putative dehydrin genes present in the Pine Gene Index
acknowledged: a significant increase of Ppter_dhn_K2a database provide a complete ORF. The other sequences are
and Ppter_dhn_K2b transcripts is detected especially from incomplete or include a stop codon in the coding region.
the third sampling point (30 days without watering) Contamination with genomic DNA cannot be discarded for
onwards in roots of the three genotypes (4- to 9-fold higher some of these sequences, for which the stop codon is
levels, compared to unstressed plants). Induction is much located in regions corresponding to putative introns, or the
lower in stems, ranging between 1.5- and 2.5-fold higher typical dehydrin amino acid motifs appear in different
levels than in control plants. Higher differences among reading frames along the sequence (f. i., TC178971 or
genotypes have been detected in needles, with overex- TC188683). Using specific primers designed for the TCs
pression ranging from 5- to 16-fold transcription levels constructed with P. pinaster ESTs and/or homologous to P.
among genotypes in the fourth sampling point (40 days pinaster dehydrins used as candidate genes in previous
without watering). Ppter_dhn_A2E2SK5 shows a similar works, we have identified 8 different dehydrins in the
induction pattern, although overexpression in needles is species, belonging to the classical groups Kn and SKn, and
slightly lower than for the previous genes. Much lower have determined their intron/exon structure. We have
induction has been detected for Ppter_dhn_AESK4, mainly detected two variants within the Kn group, Ppter_dhn_
in roots, with levels around 2- and 4-fold higher than in K2a and Ppter_dhn_K2b, and three variants of SK3
unstressed plants. dehydrins, Ppter_dhn_AESK3a, Ppter_dhn_AESK3a2 and
The highest induction has been detected for Ppter_dhn_ Ppter_dhn_AESK3b. The presence of these variants in
ESK2. Transcription levels of this dehydrin increases from haploid tissues (megagametophytes) has led us to conclude
the first sampling point onwards in the three organs all they are actually duplications of the genes in the genome,
throughout the experiment, reaching values 1,000 to 10,000- discarding they correspond to different alleles of the same
fold higher than in control plants. On the contrary, over- loci, as proposed by Velasco-Conde et al. (2012).
expression of Ppter_dhn_AESK3a, Ppter_dhn_AESK3a2, Comparison of the deduced amino acid sequences with
Ppter_dhn_AESK3b is very low, although significant, and the ones corresponding to angiosperm and gymnosperm
even in certain organs and sampling points expression of dehydrins has revealed that the N-terminal region is highly
these genes is lower than in unstressed plants. Only in roots conserved among the latter, with a fragment of 23 residues
or in the last sampling points in needles transcription levels also conserved in angiosperm SKn dehydrins. Additionally,
reach values approximately 2-fold higher than in unstressed both groups show a comparatively high percentage of
plants. glutamine and proline residues, while angiosperm Kn and
123
1872 Planta (2012) 236:1863–1874
YnSKn dehydrins show a much shorter N-terminal region On the contrary, no remarkable induction has been
preceding the classical conserved motifs and an amino acid detected for AESKn dehydrins neither in stems nor in
composition enriched in glycine and threonine residues. needles. Only Ppter_dhn_AESK4 transcription increases in
We have also confirmed that the classical Y-segment, roots as the water depletion persists, and always at much
typical of angiosperm dehydrins, is absent in gymnosperm lower levels than for the other induced dehydrins. This
dehydrins. Conversely, we have identified two motifs pattern seems to be linked to the simultaneous presence of
highly conserved and repeated in SKn dehydrins in Pina- the newly described A and E-segments in the amino acid
ceae, and absent in angiosperm dehydrins. The so-called sequence. Nevertheless, when these segments are dupli-
A-segment is similar in length and position to the angio- cated, as in the case of Ppter_dhn_A2E2SK5, transcription
sperm Y-segment; we have detected it in many Pinus and increases with drought, with a pattern similar to that of Kn
Picea dehydrins as well as in dehydrins from Larix and genes, and the highest induction has been found for
Pseudotsuga. TCs assembled from P. taeda and P. bank- Ppter_dhn_ESK2, in which E-segment appears without
siana ESTs show this segment repeated 4 (TC183122), 5 A-segment. Given the role and mechanisms usually sug-
(TC171685, TC187956) and up to 19 times (TC191238). gested for dehydrin activity, we believe AESKn genes
The other, which we have named E-segment, locates very could have a major role in other processes different
close to the S-segment; we have detected it in Cupressus from drought stress. Nevertheless, their implication in the
sempervirens sequences, as well as in Pinaceae (Pinus, response to drought stress cannot be discarded, accordingly
Picea, Larix, Pseudotsuga). Both segments appear in the to the significant differences in their expression levels
N-terminal half of the sequence, before the S-segment, and reported here. These dehydrin transcripts could be required
their presence and number could be used to classify but effective in protection against drought stress at lower
the gymnosperm dehydrins, similarly as the Y-segment is concentrations than the other ones. Further studies in this
used in angiosperm dehydrins, together with the S and and other species are needed to confirm this point.
K-segments. Our results differ slightly from the ones reported by
We have applied a severe drought treatment, withhold- Velasco-Conde et al. (2012). These authors perform RT-
ing watering for up to 50 days and reaching water potential PCR to describe the expression pattern of five dehydrin
values in needles at midday of around -3.86 MPa, in order genes in needles of maritime pine during a drought
to examine the expression pattern of dehydrin genes in experiment and discuss the possible role of dehydrins in
roots, stems and needles. No noticeable induction and drought response. The most noticeable divergences are
even slight repression of some dehydrin genes have been found in the contrasting patterns described for SK5 in two
detected for the first sampling point (10 days without of the genotypes used also here, and the profile described
watering), when no strong differences in the midday water for SK2, divergent among genotypes an with an appreciable
potential in needles respect control plants have been repression in the first week of reduced water availability.
measured. We have detected a clear increase in the tran- Several factors can account for these discrepancies. First,
scription levels of Ppter_dhn_K2a, Ppter_dhn_K2b and the stress induced in the work of Velasco-Conde et al. is
Ppter_dhn_A2E2SK5 in roots, as the water potential goes shorter and milder than the one applied here, and some
under -2.0 to -2.5 MPa (20–30 days without watering). genes showing a slight decrease in transcription levels in
Induction is lower and/or belated in stems and needles, the first stages of the treatment are actually noticeably
highlighting the role played by roots in detecting and overexpressed as the stress increases. Secondly, we have
triggering the response to water stress. The highest induc- analysed the expression patterns not only in needles but
tion in response to water depletion has been detected for also in stems and, particularly, roots, taking into account
Ppter_dhn_ESK2 in the three organs. This result is con- the key role played by this organ in the response to
sistent with the ones reported by Lorenz et al. (2011) for drought. Furthermore, Velasco-Conde et al. do not isolate
the orthologous in Pinus taeda, dehydrin 2 (ACA51879.1), and sequence the genes, so that incorrect interpretation of
which appears among the 25 most-upregulated genes dur- allelic variation instead of gene duplications in the genome
ing water stress. Additionally, this gene shows the highest leads them to design primer pairs that can produce cross
divergence in nucleotide and amino acid sequence with the amplification, yielding not reliable RT-PCR results. Con-
other ones reported here, and we have not detected any versely, we have identified such duplications by sequenc-
duplication or paralog in the genome. These facts make ing in haploid material (megagametophytes), and have
Ppter_dhn_ESK2 a very suitable candidate gene for further designed specific primers for each form, avoiding cross
studies on population variation, etc., being easier to amplification. Even more, sequencing of amplicons have
develop and apply specific markers (such as SNP geno- confirmed specificity of the reaction.
typing) or re-sequencing approaches avoiding interferences In conclusion, we have identified and characterized
from other loci. eight different dehydrin genes in Pinus pinaster, and
123
Planta (2012) 236:1863–1874 1873
analysed their expression in roots, stems and needles under Dubos C, Le Provost G, Pot D, Salin F, Lalane C, Madur D, Frigerio
a severe and prolonged drought treatment, pinpointing the J-M, Plomion C (2003) Identification and characterization of
water-stress-responsive genes in hydroponically grown maritime
genes most likely involved in water stress response. Addi- pine (Pinus pinaster) seedlings. Tree Physiol 23:169–179
tionally, we have identified for the first time two motifs in Dure L III (1993) A repeating 11-mer amino acid motif and plant
the deduced amino acid sequence, highly conserved in SKn desiccation. Plant J 3:363–369
dehydrins in Pinaceae and absent in angiosperm dehydrins, Dure L III, Greenway SC, Galau GA (1981) Developmental
biochemistry of cottonseed embryogenesis and germination:
and whose presence and number is associated with the changing messenger ribonucleic acid populations as shown by in
differential expression patterns described. Our results sup- vitro and in vivo protein synthesis. Biochemistry 20:4162–4168
port the idea that the different members of this complex Eriksson SK, Harryson P (2011) Dehydrins: molecular biology,
gene family play different and specialized roles in response structure and function. In: Lüttge U, Beck E, Bartels D (eds)
Plant desiccation tolerance. Springer, New York, pp 289–305
to environmental or endogenous stimuli. Detailed studies in Eveno E, Collada C, Guevara MA, Leger V, Soto A, Diaz L, Leger P,
promoter region from these genes to identify regulatory Gonzalez-Martinez SC, Cervera MT, Plomion C, Garnier-Gere
motifs and new experiments are needed to determine the PH (2008) Contrasting patterns of selection at Pinus pinaster
structure–function relationships, as well as the differential Ait. Drought stress candidate genes as revealed by genetic
differentiation analyses. Mol Biol Evol 25:417–437
expression and functions of these genes during water stress Godoy JA, Lunar R, Torres-Schumann S, Moreno J, Rodrigo RM,
or under other environmental or ontogenic conditions. Pintor-Toro JA (1994) Expression, tissue distribution and
subcellular localization of dehydrin TAS14 in salt-stressed
Acknowledgments The authors would like to thank Dr. Luis Gil tomato plants. Plant Mol Biol 26:1921–1934
from UPM for technical and scientific support. We also thank González-Martı́nez SC, Ersoz E, Brown GR, Wheeler NC, Neale DB
Dr. Jesús Rodrı́guez-Calcerrada and three anonymous reviewers (2006) DNA sequence variation and selection of tag single-
for their helpful comments and suggestions. This work has been nucleotide polymorphisms at candidate genes for drought-stress
funded through the projects AGL2006-03242/FOR (Spanish Ministry response in Pinus taeda L. Genetics 172:1915–1926
of Education and Science), CCG07-UPM/AMB-1932 and CCG10- Grivet D, Sebastiani F, González-Martı́nez SC, Vendramin GG
UPM/AMB-5038 (Madrid Regional Government–UPM). PP has a (2009) Patterns of polymorphism resulting from long-range
pre-doctoral fellowship from the Spanish Ministry of Education and colonization in the Mediterranean conifer Aleppo pine. New
Science. Phytol 184:1016–1028
Grivet D, Sebastiani F, Alı́a R, Bataillon T, Torre S, Zabal-Aguirre
M, Vendramin GG, González-Martı́nez SC (2011) Molecular
footprints of local adaptation in two Mediterranean conifers. Mol
Biol Evol 28:101–116
References Hara M, Fujinaga M, Kuboi T (2005) Metal binding by citrus
dehydrin with histidine-rich domains. J Exp Bot 56:2695–2703
Allagulova CR, Gimalov FR, Shakirova FM, Vakhitov VA (2003) Hundertmark M, Hincha D (2008) LEA (Late Embryogenesis Abun-
The plant dehydrins: structure and putative functions. Biochem- dant) proteins and their encodinggenes in Arabidopsis thaliana.
istry (Moscow) 68:945–951 BMC Genomics 9:118
Baker J, DennSteele C, Dure L (1988) Sequence and characterization Hundertmark M, Buitink J, Leprice O, Hincha D (2011) The
of 6 Lea proteins and their genes from cotton. Plant Mol Biol reduction of seed-specific dehydrins reduces seed longevity in
11:277–291 Arabidopsis thaliana. Seed Sci Res 21:165–173
Bray EA (1993) Molecular responses to water deficit. Plant Physiol Jarvis SB, Taylor MA, McLeod MR, Davies HV (1996) Cloning and
103:1035–1040 characterisation of the cDNA clones of three genes that are
Campbell SA, Close TJ (1997) Dehydrins: genes, proteins, and differentially expressed during dormancy-breakage in the seeds
associations with phenotypic traits. New Phytol 137:61–74 of Douglas fir (Pseudotsuga menziensii). J Plant Physiol 147:
Campbell SA, Crone DE, Ceccardi TL, Close TJ (1998) A ca. 40 kDa 559–566
maize (Zea mays L.) embryo dehydrin is encoded by the dhn2 Joosen RVL, Lammers M, Balk PA, Brønnum P, Konings MCJM,
locus on chromosome 9. Plant Mol Biol 38:417–423 Perks M, Stattin E, van Wordragen MF, van der Geest AHM
Castillo J, Zúñiga A, Franco L, Rodrigo MI (2002) A chromatin- (2006) Correlating gene expression to physiological parameters
associated protein from pea seeds preferentially binds histones and environmental conditions during cold acclimation of Pinus
H3 and H4. Eur J Biochem 269:4641–4648 sylvestris, identification of molecular markers using cDNA
Chang S, Puryear J, Cairney J (1993) A simple and efficient method microarrays. Tree Physiol 26:1297–1313
for isolating RNA from pine trees. Plant Mol Biol Rep 11:113– Koag M-C, Fenton RD, Wilkens S, Close TJ (2003) The binding of
116 maize DHN1 to lipid vesicles. Gain of structure and lipid
Close TJ (1996) Dehydrins: emergence of a biochemical role of a specificity. Plant Physiol 131:309–316
family of plant dehydration proteins. Physiol Plant 97:795–803 Kosová K, Prásil IT, Vı́támvás P (2010) Role of dehydrins in plant
Close TJ (1997) Dehydrins: a commonality in the response of plants stress response. Handbook of plant and crop stress, 3rd edn,
to dehydration and low temperature. Physiol Plant 100:291–296 pp 239–285
Danyluk J, Perron A, Houde M, Limin A, Fowler B, Benhamou N, Kovacs D, Kalmar E, Torok Z, Tompa P (2008a) Chaperone activity
Sarhan F (1998) Accumulation of an acidic dehydrin in the of ERD10 and ERD14, two disordered stress-related plant
vicinity of the plasma membrane during cold acclimation of proteins. Plant Physiol 147:381–390
wheat. Plant Cell 10:623–638 Kovacs D, Agoston B, Tompa P (2008b) Disordered plant LEA
Dubos C, Plomion C (2003) Identification of water-deficit responsive proteins as molecular chaperones. Plant Signal Behav 3:710–713
genes in maritime pine (Pinus pinaster Ait.) roots. Plant Mol Lorenz WW, Alba R, Yu Y-S, Bordeaux J, Simoes M, Dean J (2011)
Biol 51:249–262 Microarray analysis and scale-free gene networks identify
123
1874 Planta (2012) 236:1863–1874
candidate regulators in drought-stressed roots of loblolly pine Sun X, Lin HH (2010) Role of plant dehydrins in antioxidation
(P. taeda L.). BMC Genomics 12:264 mechanisms. Biologia 65:755–759
Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an Sunkar R, Oliver MJ, Cushman JC, Koster KL (2010) Dehydration
overview. Arch Biochem Biophys 444:139–158 tolerance in plants. Plant stress tolerance. Humana Press, pp 3–24
Olvera-Carrillo Y, Luis Reyes J, Covarrubias AA (2011) Late Velasco-Conde T, Yakovlev I, Majada J, Aranda I, Johnsen Ø (2012)
embryogenesis abundant proteins: versatile players in the plant Dehydrins in maritime pine (Pinus pinaster) and their expression
adaptation to water limiting environments. Plant Signal Behav related to drought stress response. Tree Genet Genom. doi:
6:586–589 10.1007/s11295-012-0476-9
Palmé AE, Pyhäjärvi T, Wachowiak W, Savolainen O (2009) Wachowiak W, Balk P, Savolainen O (2009) Search for nucleotide
Selection on nuclear genes in a Pinus phylogeny. Mol Biol diversity patterns of local adaptation in dehydrins and other cold-
Evol 26:893–905 related candidate genes in Scots pine (Pinus sylvestris L.). Tree
Perdiguero P, Collada C, Barbero MC, Garcı́a Casado G, Cervera Genet Genom 5:117–132
MT, Soto Á (2012) Identification of water stress genes in Pinus Watkinson JI, Sioson AA, Vasquez-Robinet C, Shukla M, Kumar D,
pinaster Ait. by controlled progressive stress and suppression- Ellis M, Heath LS, Ramakrishnan N, Chevone B, Watson LT,
subtractive hybridization. Plant Physiol Biochem 50:44–53 van Zyl L, Egertsdotter U, Sederoff RR, Grene R (2003)
Pfaffl MW (2001) A new mathematical model for relative quantifi- Photosynthetic acclimation is reflected in specific patterns of
cation in real-time RT-PCR. Nucleic Acids Res 29:e45 gene expression in drought-stressed loblolly pine. Plant Physiol
Rinne PLH, Kaikuranta PLM, van der Plas LHW, can der Schoot C 133:1702–1716
(1999) Dehydrins in cold-acclimated apices of birch (Betula Wisniewski M, Webb R, Balsamo R, Close TJ, Yu XM, Griffith M
pubescens Ehrh.): production, localization and potential role (1999) Purification, immunolocalization, cryoprotective, and
in rescuing enzyme function during dehydration. Planta 209:377– antifreeze activity of PCA60: a dehydrin from peach (Prunus
388 persica). Physiol Plant 105:600–608
Rorat T (2006) Plant dehydrins—Tissue location, structure and Yakovlev I, Asante D, Fossdal C, Partanen J, Junttila O, Johnsen Ø
function. Cell Mol Biol Lett 11:536–556 (2008) Dehydrins expression related to timing of bud burst in
Sánchez-Gómez D, Velasco-Conde T, Cano-Martı́n FJ, Guevara MA, Norway spruce. Planta 228:459–472
Teresa Cervera M, Aranda I (2010) Inter-clonal variation in Yuxiu Z, Zi W, Jin X (2007) Molecular mechanism of dehydrin in
functional traits in response to drought for a genetically homoge- response to environmental stress in plant. Progress Natural
neous Mediterranean conifer. Environ Exp Bot 70:104–109 Science. Taylor and Francis, pp 237–246
123

Tesis Doctoral de Genes

Cargado por

Información del documento

Título original

Derechos de autor

Formatos disponibles

Compartir este documento

Compartir o incrustar documentos

Opciones para compartir

¿Le pareció útil este documento?

¿Este contenido es inapropiado?

Copyright:

Formatos disponibles

Tesis Doctoral de Genes

Cargado por

Copyright:

Formatos disponibles

UNIVERSIDAD POLITÉCNICA DE MADRID

ESCUELA TÉCNICA SUPERIOR

GENES IMPLICADOS EN LA RESPUESTA MOLECULAR

AL ESTRÉS HÍDRICO EN Pinus pinaster Ait.

PEDRO PERDIGUERO JIMÉNEZ

ESCUELA TÉCNICA SUPERIOR

GENES IMPLICADOS EN LA RESPUESTA MOLECULAR

AL ESTRÉS HÍDRICO EN Pinus pinaster Ait.

PEDRO PERDIGUERO JIMÉNEZ

CARMEN COLLADA COLLADA ÁLVARO SOTO DE VIANA

Tribunal nombrado por el Magfco. Y Excmo. Sr. Rector de la Universidad

Realizado el acto de defensa y lectura de tesis el día …. de ……………….. de

EL PRESIDENTE LOS VOCALES

Esta Tesis ha sido informada positivamente para su defensa en exposición

Dr. Célia Maria Miguel

Dr. Pablo Fuentes Utrilla

Deseo expresar mi más sincero agradecimiento a todas las personas que de

A mi familia, porque jamás cuestionaron ninguna de las decisiones que tomé en

A mi Rous, mi pareja, mi mejor amiga, mi confidente; porque a su lado todo me

A toda la unidad de Anatomía al completo; a Luis Gil por su apoyo científico,

A Carmen Díaz-Sala y su grupo de la Universidad de Alcalá por sus consejos

A mis compañeros de laboratorio en mis inicios en el laboratorio de Bioquímica;

A toda mi gente de Villalba, por cada “miernes”, “juernes” y fines de semana

A toda mi gente de Ávila, Elche y Salamanca, que aunque sea en la distancia

A mis compañeros de “Rûa da Quintinha” Josep, Marcelo y Liliana, por esas

3. Identificación de genes inducidos por estrés hídrico……………………………. 23

4. Análisis de expresión durante el estrés hídrico…………………………………… 37

5. Caracterización molecular de la familia de las deshidrinas en P. pinaster..…. 71

6. Caracterización molecular de genes inducidos por estrés hídrico en

Figura 1.1 Predicciones climáticas en Europa para los años 2070-2100………….. 4

Tabla 5.1 Descripción de las deshidrinas de P. pinaster analizadas en la

La presente tesis doctoral se centra en el estudio de la respuesta molecular de

En primer lugar, se ha aplicado un estrés hídrico controlado en cultivo

A continuación, se ha analizado, la expresión de los genes anteriormente

Por último, se han escogido tres genes implicados en distintas fases de la

First, we have applied a controlled polyethylene glycol-induced water stress in

A lo largo de la evolución y diversificación de las plantas vasculares desde su

En la actualidad la Tierra vuelve a enfrentarse a un importante cambio climático

ligeros en la mitad norte y descensos en la parte sur, mientras que en verano

Las especies mediterráneas deben afrontar la dificultad añadida que supone la

niveles, desde las poblaciones en su conjunto hasta la función de un gen concreto

1.1 Respuesta de las plantas al estrés hídrico

El agua es el principal factor limitante para el crecimiento y la reproducción de

de los caracteres genéticos responsables de los mecanismos de resistencia a sequía

Desde el punto de vista molecular, la respuesta al estrés hídrico incluye

1.1.1 Proteínas reguladoras en respuesta a estrés hídrico

Las proteínas reguladoras controlan la expresión génica y la transducción de

Los resultados de numerosos estudios desarrollados en especies modelo, todas

El estudio en especies modelo herbáceas ha permitido identificar al menos

 En la segunda ruta intervienen factores de transcripción con dominios tipo NAC

 La cuarta ruta estaría regulada por la acción combinada de varios factores de

Otros tipos de factor de transcripción también han sido relacionados con

1.1.2 Proteínas funcionales implicadas en la tolerancia al estrés hídrico

Encontramos en este grupo proteínas que actúan minimizando la deshidratación

Las plantas se enfrentan a la deshidratación mediante la producción y

Las proteínas LEA (Late Embryogenesis Abundant proteins) forman un

Las chaperonas, dentro de las cuales encontramos las proteínas de choque

La disminución en los niveles intracelulares de CO2 da lugar a una

1.2 El estudio de la respuesta al estrés hídrico en coníferas

Desde el año 2000 se han logrado importantes avances en el conocimiento de

En los últimos años se ha producido una nueva revolución en las técnicas de

Sin embargo, la complejidad del genoma de las coníferas, especialmente de las

Por este motivo, la mayor parte de los proyectos de genómica desarrollados