Está en la página 1de 52

Año 3, Nº 4 - 2013

ISSN 1853 -7677

CIENCIA Y TECNOLOGIA
DE LOS CULTIVOS INDUSTRIALES

Tabaco
Coordinador Programa Nacional de Cultivos Industriales:
Ing. Agr. (MSc.) Alejandro Valeiro

Director Centro Regional Salta-Jujuy


Ing. Agr. (MSc) Mario De Simone

Editor Ejecutivo:
Ing. Agr. (MSc) Alejandro M. Rago (IPAVE, CIAP, Córdoba

Editores Adjuntos:
Ing. Agr. (Dr) Luis Erazzú (EEA Famaillá, Tucumán).
Ing. Agr. (MSc) Diana Piedra (CR Chaco-Formosa, Chaco).
Ing. Agr. (PhD) Rodolfo Bongiovanni (EEA Manfredi, Córdoba).
Ing. Agr. (MSc) Roberto Sopena (EEA Famaillá, Tucumán).
Ing. Agr. (MSc) Valeria Etchart (Instituto de Genética, CICVyA, Buenos Aires).
Ing. Agr. (Dr) Martin Acreche (EEA Famaillá, Tucumán).
Ing. Agr. (MSc) Marcelo Mayol (EEA Cerro Azul, Misiones).
Ing. Agr. (Dra) Eva Cafrune (IPAVE, CIAP, Córdoba)
Ing. Agr. (MSc) Mario Mondino (EEA Santiago del Estero, Santiago del Estero)
Ing. Agr. (MSc) Mariano Cracogna (EEA Reconquista, Santa Fe)
Ing. Agr. Guillermo J. March (CIAP, Córdoba)
Ing. Agr. (MSc) Alejandro Valeiro (PNIND)

INTA – CIAP. Av. 11 de septiembre 4755 (5020), Córdoba, Argentina

Impresión: Biglia Impresores, Corrientes 3362, Córdoba


Diseño de tapa: Mariano Matías
Fotos de tapa: Rodolfo Bongiovanni, Adriana Ortega y Guadalupe Mercado Cárdenas.
Diagramación de texto: Enrique Biglia

La información que consta en los distintos artículos es de responsabilidad exclusiva de los autores
de los trabajos, los que no necesariamente manifiestan el punto de vista del Instituto Nacional de
Tecnología Agropecuaria.
El contenido puede reproducirse dejando expresa constancia de la fuente.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 1


2 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013
CONTENIDO
SECCIONES Página

OPINIÓN/REVISIÓN

Problemas ambientales y coaliciones sociales. 5


Cristina Biaggi y Alejandro Valeiro.

INVESTIGACIÓN

Nutrición del tabaco en condiciones variables de humedad edáfica y materia orgánica. 13


Josefina Diez, María E. Toncovich y Mónica B. Rodriguez.

Herramientas moleculares para la caracterización de Rhizoctonia spp. causales de patologías 17


en tabaco Tipo Virginia, en Salta y Jujuy (Argentina).
Guadalupe Mercado Cárdenas, Marta Galván y Marcela Rodriguero.

Variabilidad genética en germoplasma de tabaco Tipo Virginia empleando marcadores 24


moleculares.
Daniela Cuellar, Mónica Aparicio, Guadalupe Mercado Cárdenas, Marta Galván, Gisel Taboada,
Juan Galli, Mario Martínez, Luis Ibarra, María del Carmen Menéndez Sevillano y María Elena Toncovich.

Aportes para el manejo del corcovo del tabaco en la región del NOA. 29
Ana C. Ramallo, Paola López Lambertini, Daniel Ducasse.

INFORMES ESPECIALES y TECNOLOGÍAS

Estimación del tamaño óptimo de parcela experimental para ensayos de rendimientos 35


de tabaco tipo Virginia.
Adriana Elina Ortega.

Comportamiento de variedades de tabaco Virginia en la localidad de Chicoana (Salta). 40


María Elena Toncovich, Juan Galli, Josefina Diez, José Sulca y Alejandra Guaymás.

Desarrollo de sustratos para almácigos flotantes de tabaco. 46


Carlos Herrando, Susana Krieger, Silvia Gómez, María E. Acosta y Fernando Lacci.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 3


4 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013
OPINIÓN/REVISIÓN

Problemas ambientales y coaliciones sociales


Cristina Biaggi y Alejandro Valeiro
INTA, Estación Experimental Agropecuaria Famaillá
Correo-e: biaggi@correo.inta.gov.ar

INTRODUCCION Este artículo intenta desarrollar la pregunta


“¿qué ocurre en los territorios cuando se im-
La magnitud y gravedad creciente de los pone realizar cambios en las prácticas o tec-
problemas ambientales en relación con el nologías agrícolas por los impactos ambien-
cambio climático, la pérdida de diversidad tales que estas generan, y sin que surjan de
biológica y la degradación de los servicios de una necesidad de los/as productores/as?”.
los ecosistemas provocan reacciones de la El caso que se analiza para intentar respon-
sociedad tanto a nivel local como global. derla es el de la eliminación del bromuro de
Estas reacciones repercuten en los Estados metilo en los almácigos de tabaco, un agro-
Nacionales y derivan en una nueva gober- químico responsable del adelgazamiento de
nanza ambiental expresándose -en lo glo- la capa de ozono.
bal- en numerosos acuerdos multilaterales A través de este ejemplo, se intenta sinte-
(Convenciones y Protocolos) firmados y ra- tizar el trabajo que el Instituto Nacional de
tificados durante los últimos 30 años por la Tecnología Agropecuaria (INTA) desarrolla
mayoría de los países Algunos ejemplos son: desde hace más de diez años en la búsqueda
la Convención sobre la Biodiversidad Bioló- de una mayor sustentabilidad ambiental en
gica (1992-93) y su Protocolo de Cartagena; la producción de los cultivos industriales en
la Convención Marco de Naciones Unidas el norte de Argentina (4).
sobre los Cambios Climáticos (1992-94) y el
Protocolo de Kyoto; la Convención de Na- 1. LA ELIMINACIÓN DEL BROMURO DE ME-
ciones Unidas sobre el combate contra la TILO EN LOS ALMÁCIGOS DE TABACO
desertificación (1994-96), etc.. Muchos de
estos acuerdos establecen compromisos En 1987, el reconocimiento de que el cloro
concretos de cambio en los comportamien- y el bromo tenían el potencial de destruir el
tos de las sociedades nacionales respecto del ozono estratosférico llevó a las naciones del
ambiente. A nivel nacional, los compromisos mundo a firmar el “Protocolo de Montreal
se concretan en legislación y reglamentacio- sobre las Sustancias que Agotan la Capa de
nes que intentan asegurar esos cambios. Por Ozono”, con el objetivo de reducir la produc-
otro lado, la conciencia cada vez mayor del ción y consumo mundial de esas sustancias.
problema, hace que las sociedades locales En el sector agrícola, el único producto de
también presionen por un mayor cuidado en extendido uso a nivel mundial, en un listado
el uso de los recursos naturales y una mejor de más de 100 gases a ser controlados, es el
calidad del ambiente en el que viven (5). bromuro de metilo. A partir del Protocolo
Los productores agropecuarios –entre otros de Montreal, se estableció un calendario de
sectores- reciben el impacto de esas presio- eliminación de este producto que definía el
nes para modificar sus prácticas, la tecnolo- fin de la producción y consumo en los países
gía que usan o los insumos que consumen en desarrollados en 2005 y para los países en
el proceso productivo. desarrollo en 2015 (3).

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 5


Independientemente de los plazos acorda- marco de sus leyes provinciales de agro-
dos inicialmente, muchos países en desa- químicos- el uso de bromuro de metilo en
rrollo -entre ellos la Argentina- realizaron tabaco (Corrientes y Tucumán) y para to-
importantes esfuerzos en el ajuste y difusión dos los usos (Salta y Misiones) a partir de
de alternativas y se comprometieron frente del 2007.
a la comunidad internacional a anticipar la
eliminación, realizando un aporte fundamen- 2. LA RESISTENCIA DE LOS/AS PRODUCTO-
tal para la recuperación de la capa de ozono. RES/AS
En nuestro país, el INTA inició su trabajo en
este tema en 1998, en el marco del Proyecto Los cambios tecnológicos o de prácticas agrí-
INTA PROZONO para la eliminación de bromu- colas por externalidades ambientales se ca-
ro de metilo en los almácigos de tabaco (6). racterizan por no surgir como una necesidad
Las propuestas para el reemplazo del bro- de los/as productores/as. Por lo tanto, estos/
muro de metilo en los almácigos de tabaco as no priorizan las mudanzas indispensables
fueron las bandejas flotantes y el metam so- para una producción más sustentable, sobre
dio. Ambas alternativas controlan o evitan todo cuando sus economías son precarias. El
eficientemente las plagas, enfermedades y cambio “les viene de afuera” perciben los/as
malezas en los almácigos de tabaco, adap- agricultores/as, y por un tema que es nuevo:
tándose -al mismo tiempo- a las específicas el cuidado del ambiente.
condiciones climáticas de las provincias taba- En el caso de la eliminación del bromuro de
caleras y a los tipos de productores/as de las metilo, existieron resistencias desde varios
diferentes regiones. frentes durante los diez años de vida del pro-
Las actividades del proyecto se desarrolla- yecto.
ron en siete provincias del norte argentino Desde el sector de las empresas que im-
-Jujuy, Salta, Catamarca, Tucumán, Chaco, portaban y comercializaban el bromuro en
Corrientes y Misiones-, que se caracterizan el mercado, las resistencias fueron muy im-
porque los sistemas productivos tabacaleros portantes hasta casi el final del proyecto. Sin
están en su mayor parte a cargo de peque- embargo, fue en la primera etapa cuando or-
ños/as productores/as y de agriculturas cam- ganizaron un fuerte “lobby” con algunos pro-
pesinas, aunque existe un porcentaje menor ductores de tabaco, frutilla y hortalizas para
pero muy importante de productores/as em- que no se adelantara la fecha del reemplazo
presariales capitalizados en las provincias de del bromuro de metilo.
Salta y Jujuy. La principal tecnología propuesta por el pro-
Hacia el final del proyecto, en términos de yecto -los almácigos flotantes- presentó al-
eliminación concreta del uso de bromuro de gunas resistencias específicas. Por un lado,
metilo los logros pueden resumirse de la si- porque la producción de plantines sin sue-
guiente forma: lo implica un cambio tecnológico de enver-
a) el consumo de bromuro de metilo en el gadura para el sector. Por otro, por algunas
sector disminuyó en un 94%; experiencias previas fallidas en las provincias
b) 20.200 productores de tabaco (93,7% del noroeste, por deficiencias en la transfe-
del total) dejaron de utilizar bromuro y rencia de la tecnología y porque la calidad
adoptaron las alternativas propuestas; del agua en algunas zonas no era la más ade-
c) se generaron nuevas tecnologías que cuada para el sistema.
permitieron reducir los costos de las al- Las estrategias para modificar estas resisten-
ternativas; y cias fueron numerosas, y no solo desde INTA
d) cuatro provincias prohibieron -en el PROZONO. Por ejemplo, en Catamarca don-

6 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


de se demoró en aceptar la necesidad del Esto trajo aparejado que en algunas zonas
cambio por parte de todos los sectores invo- se sustituyera con solo una opción de las
lucrados, el gobierno de la provincia impulsó promovidas por el proyecto; en otras, con
una medida para premiar con un subsidio a dos; y en Salta, por ejemplo, se innovó con
aquellos/as productores/as que reemplaza- tecnologías no planteadas originalmente
ran el BM. De esa manera se dinamizó el pro- como opciones.
ceso logrando un 100 % de sustitución (2). 3.Los recursos que el proyecto tenía para fa-
vorecer el cambio fueron entregados a los/
3. ESTRATEGIAS PARA LA ELIMINACION DEL as productores/as en forma de insumos. La
BROMURO DE METILO distribución de insumos subsidiados por el
proyecto aseguró -al menos- la prueba
Aunque el universo de productores/as es inicial de las nuevas tecnologías por par-
especialmente amplio en este cultivo (tanto te de los productores. Ellos/as reconocen
por la cantidad y tipología de explotaciones que éste fue un incentivo muy importan-
como por la diferencias entre las regiones), el te, sobre todo porque los insumos fueron
hecho de que el sector estuviera organizado acompañados de asistencia técnica para
favoreció el trabajo en terreno. En todas las asegurar un uso correcto. También se va-
provincias existen cámaras, asociaciones y/o loró como muy acertada la estrategia del
cooperativas de productores/as de tabaco proyecto de no entregar recursos en efec-
con una amplia trayectoria. tivo sino en insumos, hecho que aportó
Desde el comienzo del proyecto, fue necesa- a generar transparencia y confiabilidad
rio tomar decisiones estratégicas. Las princi- respecto del manejo y administración de
pales son presentadas a continuación: los fondos. El aporte complementario de
empresas, cooperativas e instituciones gu-
1.Se firmaron convenios entre el INTA y los bernamentales como contrapartes, permi-
gobiernos de cada una de las siete pro- tió que los insumos alcanzaran a la mayor
vincias tabacaleras para la implementa- parte de productores/as, ya que los fon-
ción del proyecto. Como parte de estos dos de la donación internacional no eran
convenios, se debía constituir un Comité suficientes para abarcar toda la superficie
Coordinador Provincial conformado por en cuestión.
representantes de los productores/as
(cooperativas, cámaras y gremios), de los Los Comités Coordinadores Provinciales
ministerios o secretarías de producción
provinciales y, en algunos casos, de las em- La conformación de los Comités tenía como
presas tabacaleras. Estos comités tomaron objetivo que el sector se articulara para lle-
las principales decisiones estratégicas del var adelante este proceso en cada territorio
proyecto en cada provincia. de una manera ajustada a las características
2.Las tecnologías de reemplazo del bromu- particulares de sus sistemas productivos.
ro de metilo se decidieron en cada una Además, que se lograra una coordinación
de las provincias, según las características desde la cual productores/as y otros actores
de los sistemas productivos locales. Por lo del sector pudieran utilizar los recursos de
tanto, aunque el INTA había investigado INTA PROZONO (2).
y experimentado previamente las mejo- El funcionamiento de cada comité en las dis-
res opciones para el cambio, la selección tintas provincias reflejó las particularidades
de las alternativas para cada provincia se socio-organizativas propias de cada territorio.
dió en el seno de cada uno de los comités. En los casos de Misiones, Tucumán y Chaco,
Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 7
existían previamente entidades que reunían Estas decisiones implicaron la discusión de
a la pluralidad de actores con relevancia y cuáles eran las tecnologías más adecuadas
participación en las respectivas áreas ta- para el reemplazo del bromuro de metilo,
bacaleras provinciales. Por lo cual, en lugar más allá de lo que el proyecto recomendaba.
de generarse un espacio específico a partir Por ejemplo, el Comité de Misiones decidió
de la llegada del proyecto, los equipos del que la única tecnología de reemplazo en su
INTA PROZONO convergieron en aquellas territorio sería el almácigo flotante. Salta,
instituciones y desde allí se asumieron las que se presentó como la provincia más inno-
funciones correspondientes a los comités. vadora, promovió una producción de plan-
En la provincia de Misiones, por ejemplo, la tines concentrada en la cooperativa local y
actuación se dio en el seno de la Comisión sumó el metam sodio y otras alternativas
Técnica de Tabaco de la Provincia de Misio- originales, como el uso del vapor para la des-
nes (COTTAPROM), en Tucumán en el ámbi- infección de los suelos.
to de la Unidad Ejecutora Provincial (UEP), y Un tema que era importante resolver era
en Chaco dentro de la Unidad Coordinadora cómo obtener más recursos para el cambio
Provincial (2). tecnológico, que complementaran los del
En cambio, en las provincias de Salta, Jujuy, proyecto. Fueron muy variadas las estrate-
Corrientes y Catamarca los comités se con- gias en cada una de las provincias: en Tucu-
formaron en función de la implementación mán INTA PROZONO subsidiaba las bandejas
del proyecto. Se convocó en cada caso a la para los almácigos flotantes y el gobierno de
multiplicidad de actores necesaria para ga- la provincia -con recursos provenientes del
rantizar que todas las partes tuvieran una mismo sector tabacalero- compraba el sus-
participación lo más directa posible en el de- trato y lo entregaba a los productores/as en
sarrollo de la propuesta de sustitución. forma de fondo rotatorio (2).
A excepción de Misiones y Jujuy, en los res- Otra de las acciones que trabajaron algunos
tantes casos y por voluntad de los delegados de los comités, fue la promoción de instru-
de las organizaciones e instituciones repre- mentos legales que restringieran el uso del
sentativas de los productores/as- se resolvió bromuro de metilo a nivel local. Misiones fue
no incluir en el seno de los comités la par- la primera provincia del país que prohibió su
ticipación de las empresas acopiadoras de comercialización a partir del 1 de enero de
tabaco. Esta resolución se fundamentó en 2005. Más tarde y con este antecedente, en
que la toma de decisiones hacia el interior de Salta también se firmó un decreto que pro-
los comités podía verse influenciada por los hibió todos los usos del bromuro de metilo,
intereses específicos que atañen a las com- mientras que en Corrientes y en Tucumán se
pañías tabacaleras, y que éstos podían coli- vedó su utilización específica en tabaco. Ju-
sionar con los de las cámaras y gremios de juy recién promulgó la prohibición en 2013.
los productores/as. Otras decisiones que tomaron los comités y
Las principales decisiones de los comités que favorecieron al desarrollo del proyecto
giraron en torno a cómo sería el uso de los fueron las que se presentan a continuación:
fondos que el proyecto subsidiaba en cada •El proyecto tenía una propuesta para la
provincia en forma de insumos. Esto implicó transferencia de las tecnologías y recursos
discutir qué era necesario comprar (bande- para llevarla adelante. Sin embargo, algu-
jas, sustrato, etc.), qué cantidades era po- nos comités decidieron modificarla. Por
sible adquirir con los fondos del proyecto y ejemplo, mientras que Tucumán contrató
cuáles serían las formas y criterios de distri- un equipo de extensionistas durante toda
bución entre los beneficiarios/as. la vida del proyecto, los comités provincia-

8 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


les de Corrientes, Chaco y Salta lo hicieron búsqueda de intereses comunes. Esto per-
únicamente en el primer año, y en el caso mitió una mayor apropiación del proyecto
de Misiones se decidió que la transferen- por parte de los actores intentando inte-
cia de la tecnología fuera realizada por téc- grar las diferencias en la búsqueda de inte-
nicos de las empresas tabacaleras. reses comunes. En este caso, el comité se
• Independientemente de como fue desa- reunía como mínimo una vez al mes, pero
rrollada la transferencia, en la mayoría de en determinadas épocas lo hizo quincenal
las provincias se consiguió -a partir de la y hasta semanalmente.
articulación dada en los comités- que hu- En los casos de Tucumán, Catamarca y Ju-
biera un “discurso único” entre los profe- juy, los comités se reunieron con periodi-
sionales de las empresas, cooperativas, ex- cidad durante los primeros años del pro-
tensionistas del gobierno y del INTA, tanto yecto (2002-2006). En esas instancias se
en la necesidad de eliminar el bromuro discutían y buscaban acuerdos sobre las
de metilo como en cómo implementar las estrategias para eliminar el bromuro de
alternativas de reemplazo, en especial la metilo, y a partir de ellos se decidía el des-
tecnología de almácigos flotantes que era tino de los recursos que llegaban desde
la más innovadora. el proyecto a cada una de las provincias.
• El funcionamiento y la periodicidad del tra- Luego de este primer período, se fueron
bajo realizado por cada comité tomaron disolviendo hasta desaparecer.
distintas dimensiones y características en
cada caso, ajustándose a las actividades ANALISIS Y CONCLUSIONES
y al desarrollo del proyecto en los territo-
rios. En Misiones la sostenibilidad del es- La experiencia del caso analizado muestra
pacio respondió a su convergencia dentro que los cambios necesarios para alcanzar
de la COTTAPROM, comisión que reporta- una mayor sustentabilidad se encuentran
ba un mecanismo de trabajo y una agenda con un escenario donde confluyen resisten-
de encuentros que existía previamente y cias de los/as productores/as, la presencia de
más allá de lo planteado en el marco del una institucionalidad muy heterogénea en
proyecto. los diferentes territorios y una desigualdad
En Salta el comité se conformó como un de los sistemas productivos que implican, en
espacio técnico que tenía como objetivo algunos casos, diferentes proyectos de desa-
discutir y decidir los aspectos más específi- rrollo territorial.
cos de las alternativas de sustitución. Pero Por otro lado, también expresan un cambio
luego se fue transformando en un ámbito de paradigma: no se ofrece una tecnología
de reflexión, decisión y acción sobre estra- que los productores/as hayan expresado
tegias más extensivas y/o políticas inhe- como necesidad; y tampoco se espera que
rentes al desarrollo del sector tabacalero. sólo la adopten los/as interesados/as en las
El fortalecimiento del comité requirió de mismas, sino todos. Tampoco es posible es-
un trabajo permanente de relaciones pú- perar que cada predio realice los cambios en
blicas y articulación. Según algunos testi- lapsos de tiempo indefinidos, ni se ofrece a
monios de quienes participaron del espa- cambio una promesa de mejora en sus ren-
cio, se generó un proceso de aprendizaje dimientos y/o ingresos por las nuevas inver-
que devino en la construcción de mecanis- siones realizadas.
mos de consenso para compartir decisio- Todo lo contrario: se trata de un cambio tec-
nes, “abriendo el juego” a la participación nológico “obligado” que deben hacerlo to-
e intentando integrar las diferencias en la dos/as los/as productores/as en un lapso de
Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 9
tiempo establecido. sible, sobre todo incluyendo a los sectores
Para poder superar estos obstáculos es, en- con menos oportunidades.
tonces, un requisito fundamental la confor- A la vez, es necesario que estén presentes en
mación de coaliciones sociales consistentes las coaliciones los actores con poder de deci-
en los territorios, que permitan transformar sión. En el caso del proyecto INTA PROZONO,
esas restricciones en oportunidades de desa- la no participación de las empresas tabacale-
rrollo por medio de: la oferta de tecnologías ras en algunos Comités Provinciales en parte
innovadoras, la diversificación económica de obstaculizó las acciones relacionadas con la
sus productos, el ingreso a nuevos merca- provisión de insumos (2).
dos, y el mejoramiento de la imagen de estos • Los cambios son más factibles cuando hay
sectores productivos. participación no sólo de la parte de la so-
Las coaliciones sociales que surgieron de ciedad del territorio directamente vincula-
esta experiencia –los Comités Provinciales da a agricultura, sino también la que será
para la eliminación del bromuro de metilo- beneficiada cuando el cambio se produz-
muestran además los siguientes aspectos: ca. No sólo como una manera “de presión”
hacia los/as productores/as, sino también
• Constituyeron un espacio privilegiado en para que la sociedad conozca y reconozca
la concertación intereses para la solución el esfuerzo que el sector realiza para me-
del problema ambiental que se planteaba. jorar la salud ambiental”.
Las actividades vinculadas con la gestión • Finalmente, que estas coaliciones sociales
ambiental implican una mirada en tiempo terminaron teniendo un poder –simbólico
y espacio que no todos/as ponen en consi- o no, dependiendo de los casos- que no se
deración, ya que en general se privilegian esperó cuando se organizaron.
los resultados y beneficios del corto plazo.
Este espacio colectivo permite una mirada Además, como lo mostraron los Comités con-
a con más largo alcance y orientada a la formados para la eliminación del bromuro de
protección de la fuente de producción y metilo, las pautas y capacidades construidas
no solo del “propio bolsillo”. en ese marco instalaron nuevos dispositivos
• Pueden convertirse en espacios de fortale- y herramientas replicables a la hora de enca-
cimiento de la institucionalidad local, que rar otros procesos.
es casi un requisito imprescindible para Por ejemplo, en algunas provincias surgieron
el desarrollo territorial porque significa la con posteridad al proyecto nuevas comisio-
existencia de una red social con actores de nes de trabajo, luego de capitalizar positiva-
muy diversa procedencia (gubernamen- mente la experiencia de articulación y fun-
tales, empresas privadas, instituciones de cionamiento de los comités. Por ejemplo, la
atención a la sociedad, etc.) que se conoce, articulación para la eliminación del uso del
que se tiene confianza, que discute y que bromuro de metilo se continúo con la discu-
construye dentro del conflicto. Además, sión para enfrentar otras problemáticas am-
puede lograr una identidad y convertirse bientales locales, como la implementación
en un “responsable de origen social” para del Manejo Integrado de Plagas y Enferme-
solucionar los problemas ambientales del dades y la centralización de plásticos residua-
territorio. les provenientes de la producción (Proyecto
• Sin embargo, para asegurar que todos los “Punto Limpio”).
actores del territorio se beneficien de los Sin embargo, es importante destacar que
logros de estas coaliciones es necesario las capacidades de estas coaliciones socia-
que la participación sea lo más amplia po- les no fueron iguales en los diferentes terri-

10 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


torios. Los Comités conformados en Salta y acceso a las tecnologías de reemplazo (almá-
Misiones resultaron más consistentes y más cigos flotantes) una “vía de modernización”,
innovadores al momento de buscar estrate- como ellos/as mismos dicen. En efecto, los/
gias para lograr el reemplazo del bromuro de as pequeños productores/as que accedieron
metilo. Podría decirse que el factor humano a los almácigos flotantes dijeron al finalizar el
(quien motorizó la conformación del Comité proyecto que veían el cambio como un sím-
en Salta y quien se sumó al Comité que ya bolo de mayor status, que habían implemen-
funcionaba en Misiones) y la institucionali- tado una tecnología moderna que parecía
dad existente en cada caso (en comparación, exclusiva para los productores/as capitaliza-
por ejemplo, a la presente en Jujuy) tuvieron dos apoyados por las empresas privadas (2).
influencia en el éxito del proyecto en cada En este caso -donde “la capa de ozono queda
territorio (1). tan lejos”- es verdad que el cambio fue más
Estas diferencias entre las coaliciones deter- motivado por razones económico-producti-
minaron que no todos los territorios tuvieran vas (calidad del plantín, desarrollo del culti-
la misma capacidad para convertir el reem- vo, tiempo de trabajo y ocupación de mano
plazo del bromuro de metilo en una oportu- de obra) y por expectativas materiales-tec-
nidad. nológicas (cambio modernizador) antes que
El caso del bromuro también muestra la im- por la preocupación ambiental.
portancia que la legislación ambiental tiene Las dinámicas territoriales que desencadenó
en estas situaciones. Los decretos y leyes de esta experiencia lograron que fueran modifi-
prohibición del uso de este agroquímico sur- cadas acciones o prácticas usadas desde ha-
gieron durante el desarrollo del proyecto y cía décadas, y las actividades desarrolladas
con el aval de los Comités. Es decir, hubo un con estos fines dinamizaron los territorios
apoyo de las coaliciones sociales para asegu- porque aumentaron los espacios y eventos
rar la sustentabilidad del cambio por medio de discusión, las demostraciones, visitas a
de una legislación que se adecuó a cada te- campo e instancias de capacitación. Además,
rritorio (tal como se explicó anteriormente). hubo oferta de tecnologías relacionadas con
Estos cambios en las reglas de juego con el las propuestas de reemplazo y se abrieron
fin de preservar el ambiente también pue- posibilidades de nuevos mercados y de uti-
den tener consecuencias no buscadas rela- lizar las innovaciones para otras actividades
cionadas –por ejemplo– con la exclusión de productivas (1).
la pequeña producción, sobre todo si este Sin embargo, para que ocurra lo anterior es
sector no logra acceder a las innovaciones una condición necesaria que exista concien-
propuestas. Es por esto que ambas expe- cia en los diferentes sectores de que la acti-
riencias tienen una “mirada” especial a la vidad principal del territorio (en este caso ta-
agricultura familiar. En el proyecto de reem- baco) debe ser producida sustentablemente
plazo del bromuro, en todos los territorios para mantenerse en los mercados actuales.
se priorizó que los insumos subsidiados por Si no hubiera existido este convencimiento
los recursos del Protocolo de Montreal fue- tanto en el sector privado como público de
ran siempre destinados, en primer término, la producción de tabaco del norte de Argen-
a los pequeños/as productores y que además tina no hubiera sido posible conformar las
existiera un más estrecho acompañamiento coaliciones sociales descriptas ni obtener los
técnico de los mismos durante el proceso de resultados mencionados.
transferencia. Del proyecto de eliminación de bromuro de
En este caso, resulta importante señalar que metilo, al ser un proceso finalizado, se pue-
los pequeños productores/as vieron en el den rescatar además otros aspectos:
Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 11
1.Por un lado, la posibilidad de pactar con sultan imprescindibles para la construcción
los actores la fecha tope para el cambio de un nuevo “sentido común” en el territorio,
tecnológico. Esto facilitó el trabajo con el donde la sustentabilidad forme parte del ac-
sector y lo comprometió al reemplazo, so- cionar cotidiano de la producción agrícola y
bre todo cuando esta información era co- donde el discurso de desarrollo sostenible se
nocida por la sociedad local. vaya legitimando y difundiendo, sobre todo
2.La entrega de insumos a los productores/ cuando los procesos de cambio son lentos o
as fue fundamental para dinamizar el cam- necesitan un lapso de tiempo importante.
bio propuesto (es posible decir que “aho-
rró muchas horas de capacitación y de BIBLIOGRAFIA CITADA
extensión” y que “acortó” el tiempo ne-
cesario para el logro de la eliminación del 1. Berdegue J., Ospina P., Favareto A., Aguirre
BM). Los/as tabacaleros/as fueron curio- F., Chiriboga M., Escobal J., Fernández I.,
sos, probaron la tecnología a partir de los Gomez I., Modrego F., Ramírez E., Ravnborg
insumos subsidiados y, aunque no exenta H.M., Schejtman A. y Trivelli C. 2011. Deter-
minantes de las Dinámicas de Desarrollo Te-
de problemas, fue la mejor manera de in-
rritorial Rural en América Latina. Documento
sertarla en los territorios.
de Trabajo N°101. Programa Dinámicas Terri-
3.Se trabajó con el sector solo el problema toriales Rurales. Rimisp, Santiago, Chile
del bromuro de metilo. Es decir, no se 2. Biaggi C., Mondzack F. y Valeiro A. 2011.
pretendió ejecutar acciones ni implemen- Problemas ambientales, oportunidades de
tar estrategias integrales de producción, desarrollo: la experiencia del Proyecto INTA
comercialización y/u organización para la PROZONO. Ediciones INTA; Tucumán. 117 pp.
actividad tabacalera. Esto resultó de fun- 3. Valeiro A. 2002. Proyecto ARG/02/G61/
damental importancia, ya que permitió A/2G99 para la eliminación del Bromuro de
establecer una intervención puntual en el Metilo en almácigos de tabaco y hortalizas
seno de un sector estructurado por diná- a campo. Proyecto presentando por INTA,
OPROZ y PNUD al Fondo Multilateral del Pro-
micas preexistentes y altamente institu-
tocolo de Montreal.
cionalizadas.
4. Valeiro A. 2008. El reemplazo del bromuro
4.Se respetaron las entidades preexistentes de metilo en el sector tabacalero argentino.
para conformar las coaliciones sociales en IDIA XXI Año VII. Vol 8. N°10 Cultivos Indus-
el territorio. triales; pp.58-62.
5.Resultó fundamental la complementarie- 5. Valeiro A. 2009. Hacia una sustentabilidad
dad de recursos en insumos, técnicos y Global: la eliminación del bromuro de meti-
humanos que se planteó en los Comités, lo. Foro Internacional Científico Tecnológico
sobre la base de una concertación general de la Estación Experimental Agrícola Obispo
de no suministrar más bromuro de meti- Colombres. Tucumán, Argentina. pp. 34-39.
lo por un lado, y en otros casos sobre la 6. Valeiro A. y Biaggi C. 2001. Agricultura y am-
biente global: el problema de la capa de ozo-
coincidencia de visualizar al reemplazo por
no y el bromuro de metilo. In: Informe final
almácigos flotantes como un símbolo de proyecto demostrativo alternativas al bro-
modernidad. muro de metilo para el sector tabacalero ar-
Para finalizar es importante señalar que en gentino. Proyecto PNUD/ARG/98/G63 INTA.
este tipo de casos, las coaliciones sociales re- Argentina. pp. 9-19.

12 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


INVESTIGACION

Nutrición del tabaco en condiciones variables de humedad edáfica y


materia orgánica
Josefina Diez1, María E. Toncovich1 y Mónica B. Rodriguez2
1- INTA EEA Salta. 2- Cátedra de Fertilidad y Fertilizantes, Facultad de Agronomía, Universi-
dad de Buenos Aires.
Correo-e: jdiez@correo.inta.gov.ar

INTRODUCCIÓN cientemente amplia como para condicionar


significativamente la respuesta.
Diagnósticos realizados en el departamento El objetivo del trabajo fue establecer la res-
Chicoana (Salta) sugieren que el aprovecha- puesta del cultivo de tabaco a la fertilización,
miento de los nutrientes y el agua en lotes calculada en base a un modelo desarrollado
de pequeños productores tabacaleros puede en la zona, bajo dos niveles de materia orgá-
ser optimizado (4, 5, 9). Para lograr dicho ob- nica inicial del suelo y disponibilidad de agua.
jetivo es preciso ajustar los niveles apropia-
dos de nutrientes y agua en base a criterios MATERIALES Y MÉTODOS
desarrollados para suelos de la zona. Sin em-
bargo, la respuesta a la fertilización puede Descripción general del ensayo
verse afectada por factores como la mate- Durante la campaña 2007/08 se realizó en la
ria orgánica del suelo y la disponibilidad de Estación Experimental Agropecuaria de INTA
agua que, en dicha zona varían de un modo Salta (24º 54´ Sur, 65º 29´ Oeste) un experi-
particular. mento bajo cubierta. Las plantas de tabaco
El tabaco es considerado tolerante a la se- tipo Virginia variedad K326 fueron cultiva-
quía y sensible al exceso de agua. Es por ello, das en macetas plásticas de 27,5 kg. Se se-
que el agua debe ser aplicada en el momen- leccionaron dos suelos del departamento
to oportuno y en la cantidad apropiada para Chicoana cuyos niveles de materia orgánica
una respuesta óptima del cultivo y máximo (MO) fueron medio-bajo (1,4 %) y adecua-
beneficio económico para el productor (12). do (2,2 %) para el cultivo del tabaco (1). Los
En Chicoana, el riego del cultivo es de tipo suelos fueron mezclados con arena en una
complementario, convirtiéndose en ocasio- relación de 3:1 (8). A principios de octubre
nes en un factor crítico que influye en el ren- se trasplantó una plántula por maceta (10).
dimiento y calidad del cultivo. Por otra parte, Las macetas se regaron al trasplante con un
el nivel de materia orgánica en el suelo pue- nivel de agua equivalente a la capacidad de
de condicionar la capacidad de retención de campo (CC). Para asegurarse este nivel se re-
agua útil (6) además de incidir en la dispo- garon las macetas hasta saturación y se las
nibilidad de nutrientes. En Chicoana, los ni- pesó una vez que dejó de drenar agua.
veles de materia orgánica son considerados
adecuados a medios-bajos acorde a los nive- Diseño experimental y tratamientos
les de interpretación para tabaco Flue Cured Se aplicó un diseño en bloques al azar con
propuestos por Ballari (1). No se dispone de experimentación factorial (2x2x2) con cuatro
datos que aseguren que la variación de la repeticiones por cada tratamiento, el cual
MO del suelo dentro de Chicoana sea sufi- permitió respetar el marco de plantación del

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 13


cultivo a campo (1,20m x 0,40m). La unidad Cuadro 1. Dosis de N, P y K según materia orgánica
experimental fue una maceta con una plan- en suelo.
ta. Los tres factores evaluados fueron, 1)
contenido de MO en el suelo (Medio-bajo:
MOm y Adecuado: MOa); 2) dosis de fertili-
zante NPK calculado por modelo (testigo sin
fertilizar: f y fertilizado: F) y 3) disponibilidad
B: base, R: repique, MOa: materia orgánica adecuada,
hídrica (media: H y baja: h). Para evaluar el Mom: materia orgánica media a baja.
efecto del riego y de la fertilización se con-
tó con los testigos correspondientes de cada
tipo de suelo seleccionado. Determinaciones
Durante el período de adaptación, la dispo- La cosecha del ensayo se realizó de forma es-
nibilidad hídrica se mantuvo por encima del calonada y al final de la misma se registró el
umbral para los dos niveles evaluados, hasta peso seco total de hojas. y se determinó:
el establecimiento de las plantas. A partir del a) Materia seca (MS) acumulada (secado en
período de rápido crecimiento, las láminas estufa gravimetría a 70 ºC hasta constancia
de agua aplicadas comenzaron a diferenciar- en peso) (3).
se con el objetivo de mantener dos niveles b) Nutrientes: N total (micro-Kjeldahl), P to-
de disponibilidad hídrica: media (H: por en- tal (extracción “vía húmeda” y cuantificación
colorimétrica), K total (extracción “vía húme-
DDT da” y cuantificación por fotometría de llama)
0 50 100 150 200 250
(11).
Agotamiento de la lámina (mm)

Análisis estadístico
20 LTU (mm)
LFU (mm)
Los efectos de tratamientos sobre los pará-
Bajo metros analizados se determinaron por aná-
40 Medio lisis de la varianza (ANOVA). Las medias de
los tratamientos fueron comparadas por el
60 test de mínima diferencia significativa (LSD;
Figura 1. Agotamiento en la zona radical para niveles de p< 0,05) (7).
riego medio y bajo (línea llena oscura y clara respectiva-
mente), LFU- lámina fácilmente utilizable (líneas puntea- RESULTADOS Y DISCUSIÓN
da), lámina total utilizable (línea cortada)

Los niveles de MS y K absorbido mostraron


cima o en el nivel del umbral o de la lámina diferencias significativas entre suelos con
fácilmente utilizable o LFU) y baja (h: por de- diferente contenido inicial de MO. La inte-
bajo del umbral o LFU) (Figura 1). racción entre los efectos de nivel de riego y
Las fuentes de fertilizantes utilizadas fueron fertilización fue significativa para todas las
nitrato de amonio (sólido, granulado, 32-0- variables estudiadas Dado que no se detectó
0), nitrato de potasio (sólido, granulado, 13- interacción entre los diferentes contenidos
0-44) y superfosfato triple (sólido, granulado, de MO, la fertilización y los niveles de dispo-
0-46-0) en 2 momentos: base (al trasplante) nibilidad hídrica, se evaluó la interacción en-
y repique (30DDT). En cada momento, se tre la disponibilidad hídrica y la fertilización,
aplicó una mezcla física seca cuyas dosis fue- teniendo en cuenta el efecto del nivel inicial
ron calculadas según el modelo propuesto de materia orgánica del suelo por separado.
por Ballari (1) para la zona (Cuadro 1). Los valores de MS y absorción de K en hoja

14 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


mostraron diferencias significativas entre drica media con respecto a las de disponibi-
ambos suelos con diferente contenido inicial lidad baja (Figura 3.b.). Similares resultados
de MO las cuales (10% MS hoja y K absorbi- se observaron para tabaco Virginia, donde la
do) (Figura 2). absorción de N en hoja se duplicó para los
diferentes tratamientos de riego en compa-
ración con el testigo no regado (14).
60 1,2
(a) a
a (b)
b
La absorción de P en hoja fue mayor para los
a
Hoja (g/pl) a niveles hídricos cercanos al umbral. Además,
40 0,8
b
la fertilización incrementó en 1,5 veces la ab-
Hoja (g/pl)

sorción de P (Figura 3.c.). La menor absorción


20 0,4 observada en los niveles con menores conte-
a a nidos hídricos pudo deberse a la disminución
0 0 de la disponibilidad de P en razón de la for-
MS N P K mación de fosfatos de Ca (14). Nuestros datos
corresponden a valores de pH cercanos 7,8 y
Figura 2. Materia seca (a) y nutrientes absorbidos en hoja 8 para ambos suelos en correspondencia con
(b) (g/pl) para dos tipos de suelo con adecuados ( ) y la presencia de carbonatos de Ca y Mg.
medio-bajo ( ) contenido de materia orgánica.
Letras diferentes indican diferencias significativas (p<0,05). La absorción de K en hoja presentó la misma
tendencia que el N, siendo sus valores supe-
El nivel de K absorbido es un parámetro que riores en aquellas plantas fertilizadas y con
depende más de la presencia de iones con disponibilidad hídrica media, mientras que el
los cuales puede mantener interacciones, contenido de K en tallo y raíz se vio reduci-
tales como carbonatos de Ca y Mg, que del do (Figura 3.d.). Estos resultados coinciden
nivel de MO del suelo. En este experimento, con Hudson (6) quienes observaron que el
los suelos con moderados contenidos de MO aumento de la cantidad de K absorbido fue
mostraron también mayores niveles de Ca explicado por el incremento en la disponibi-
y Mg, lo cual produjo una disminución en la lidad hídrica en razón del aumento en la tasa
absorción de K, situación que se acentúa en de difusión del K y por lo tanto su absorción.
suelos con baja disponibilidad de agua (1).
La producción de MS y la absorción de nu- CONCLUSIONES
trientes en hoja fueron superiores para
aquellas plantas fertilizadas con niveles de Independientemente del nivel de MO se ob-
disponibilidad hídrica media. La aplicación de servó que el nivel de disponibilidad hídrica en
fertilizantes resultó en un incremento de la combinación con la fertilización incrementó
MS en hoja de 1,2 a 1,8 veces para los dos ni- el crecimiento de la planta, la producción de
veles de disponibilidad hídrica, mientras que MS y la absorción de N, P y K en hoja de taba-
el incremento de la disponibilidad hídrica en co tipo Virginia variedad K326. La respuesta
las plantas fertilizadas aumentó la produc- del cultivo a la aplicación del fertilizante no
ción de MS de hoja en un 40 % (Figura 3.a.). dependió del nivel de MO para ninguno de
Resultados similares fueron observados por los 2 niveles de humedad estudiados ya que
(13) quienes informaron aumentos en la MS no se detectó interacción entre los factores:
del tabaco entre 1,4 a 2,7 veces en respuesta nivel de MO del suelo, fertilización y disponi-
a la aplicación del N solo al ser regado. bilidad hídrica.
De manera similar a la MS, la absorción de Los resultados obtenidos muestran que las
N en hoja fue dos veces superior para las dosis de nutrientes ajustadas en base a un
plantas fertilizadas y con disponibilidad hí- modelo de fertilización calculado en función
Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 15
80 2
(a) (b)
a
a
60 1,5
MS hoja (g/pl)

N hoja (g/pl)
b

40 1
b
c
d 0,5
20 c c

0
0
FH fH Fh fh
FH fH Fh fh
Fertilización*Nivel de riego Fertilización*Nivel de riego

0,25 2
(c) a (d)
0,2
a 1,5
P hoja (g/pl)

K hoja (g/pl)

0,15
b 1
b
0,1 b
c c
c 0,5
0,05

0 0
FH fH Fh fh FH fH Fh fh
Fertilización*Nivel de riego Fertilización*Nivel de riego
Figura 3. Materia seca de hoja (a), N (b), P (c) y K (d) absorbido en hoja (g/pl) de tabaco para las combinaciones entre los
factores de fertilidad (fertilizada: F, sin fertilizar: f) y nivel de riego (medio: H y bajo: h).
Letras diferentes indican diferencias significativas (p<0,05).

de las características del suelo y en combina- rrios, Federico Chocobar y Matías Zavaleta
ción con un riego suficiente y sincronizado con por su participación en la parte experimental.
el ciclo del cultivo permitieron incrementar la
producción de MS en un 40%. Estos datos su- BIBLIOGRAFÍA CITADA
gieren que existe un potencial para mejorar
el aprovechamiento de los recursos hídricos 1. Ballari M.H. (Ed). 2005. Tabaco Virginia as-
y nutricionales en los lotes tabacaleros de los pectos ecofisiológicos y de la nutrición en
pequeños productores de Chicoana. condiciones de cultivo. Ed. M.H. Ballari.
224pp.
2. Brady N. and Weil R.R. 2002. Nature and Pro-
AGRADECIMIENTOS
perty of Soils. Mc Millan (N Cork). 514pp
3. Chapman y Pratt. 1973. Métodos de análisis
Los autores agradecen al grupo de Horticul- para suelos, plantas y aguas. Ed. Trillos, Méji-
tura de la Estación Experimental del INTA Ce- co. 39pp.
rrillos por su gran colaboración en el armado 4. Diez J., Toncovich M.E. & Rodríguez M.B..
del invernáculo y a los señores José Luis Ba- 2008. Eficiencia de la fertilizacion nitrogena-

16 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


da en lotes tabacaleros de Chicoana (Salta). 10. Pierik R., Voesenek L., Kroon H., and Visser
In: XXI Congreso Argentino de la Ciencias del E.J.W.. 2004. Density - induced plant size
Suelo (San Luis). 589pp. reduction and size inequalities en ethylene
5. Diez J., Toncovich M.E. & Rodríguez M.B.. - sensing and ethylene - insensitive tobacco.
2010. Dinámica del fósforo y el potasio en Plant Biology 6: 201-205.
suelos fertilizados bajo cultivo de tabaco Vir- 11. Quiroga I.R. & Corvalán E.R.. 1988. Análisis
ginia en Chicoana (Salta). In: XXII Congreso químico de suelos y de aguas. 1º Curso para
Argentino de la Ciencias del Suelo. 447pp. auxiliares de laboratorio – Zona Norte. EEA
6. Hudson B.D. 1994. Soil organic matter and Salta. 101pp.
available water capacity. Journal of Soil and 12. Salehzade H., Mogaddam A.F., Bernosi I, hi-
Water Conservation 49 (2): 189-194. yas M., and Amini R.. 2009. The effect of irri-
7. InfoStat. 2008. Grupo InfoStat, FCA, Univer- gation regimes on yield and chemicals qua-
sidad Nacional de Córdoba, Argentina. lity of oriental tobacco in West Azerbaijan.
8. Karaivazoglou NA, DK Papakosta & S Diva- Biological Sciences 4 (5): 632-636.
nidis. 2005. Effect of chloride in irrigation 13. Sifola M.I., and Postiglione L. 2003. The
water and form of nitrogen fertilizer on Virgi- effect of nitrogen fertilization on nitrogen
nia (flue-cured) tobacco. Field Crop Research use efficienty of irrigated and non-irrigated
92, 61-74. tobacco (Nicotiana tabacum L.). Plant and
9. Nadir A., Osinaga R., Zapater M.A. & Mattalia Soil 252: 313-323.
M.C.. 2004. Diagnóstico para el programa de 14. Tso T.C. 1990. Production, Physiology, and
desarrollo para pequeños productores taba- Biochemistry of Tobacco Plant. Institute of
caleros. Administración Fondo especial del International Development & Education in
tabaco, Secretaría de la producción. Salta, Agricultural and Life Sciences (Maryland,
Argentina. 80 pp. USA). 753pp.

Herramientas moleculares para la caracterización de Rhizoctonia spp.


causales de patologías en tabaco Tipo Virginia, en Salta y Jujuy
(Argentina)
Guadalupe Mercado Cárdenas1, Marta Galván2 y Marcela Rodriguero3
1- Sanidad Vegetal, INTA EEA Salta, Argentina. 2- CONICET-Biotecnología, INTA EEA Salta,
Argentina.3- Laboratorio de Genética Evolutiva, Departamento de Ecología, Genética y Evo-
lución, FAUBA, Buenos Aires, Argentina.
Correo-e: gmercado@correo.inta.gov.ar

INTRODUCCIÓN de raíces con podredumbre, y muchas veces


necrosis total o parcial del cuello.de la planta
Desde fines de los años noventa el cultivo En las campañas 2008/09/10 en las provin-
de tabaco se encuentra afectado por una cias de Salta y Jujuy se relevaron 80 lotes
enfermedad que se manifiesta con síntomas comerciales de tabaco en cada ciclo de pro-
como: marchitamiento de la parte aérea de ducción, diagnosticándose Rhizoctonia sola-
la planta, amarillamiento y posterior necro- ni como agente causal de la podredumbre
sis de los tejidos que puede terminar con la radicular, como la enfermedad con mayor
muerte de la planta. Coincidente con los sín- prevalencia e incidencia, siendo este pató-
tomas en la parte aérea, en el sistema radi- geno uno de los responsables del complejo
cular se observa escaso desarrollo, presencia del amarillamiento en tabaco (3, 10).

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 17


En sus comienzos esta enfermedad se mani- AG permitiendo una caracterización más rá-
festaba en forma aislada, pero en los últimos pida y precisa que los tests de anastomosis
años se diseminó por toda la zona tabacalera convencionales ya que estos últimos pueden
transformándose en uno de los problemas fi- dar falsos positivos (15). Entre los métodos
tosanitarios más importantes de este sector moleculares más utilizados para la clasifica-
productivo, por lo cual surge la necesidad de ción de Rhizoctonia spp. se destaca el análi-
implementar medidas de manejo para miti- sis de secuencias ITS o espaciadores internos
gar esta dolencia. transcritos (internal transcribed spacers).
Uno de los pilares más importantes para el Los ITS son regiones de ADN no codificantes
manejo de una enfermedad, es el diagnós- que separan las regiones que codifican las
tico correcto del agente causal y su caracte- unidades de ADN ribosómico. Estas regiones
rización. El sistema de clasificación para los muestran mayor polimorfismo de secuencia
aislamientos de R. solani está basado en la que las regiones codificantes y por lo tanto
capacidad de anastomosis o fusión de las hi- son útiles como fuente de marcadores gené-
fas, siendo el criterio más usado para sepa- ticos y se utilizaron para estudios filogenéti-
rarlo en grupos relativamente homogéneos. co en Rhizoctonia spp. (15, 19, 7).
Se ha clasificado a este hongo en 14 grupos El objetivo de este trabajo fue caracterizar
de anastomosis y varios subgrupos (5). En ta- aislamientos de Rhizoctonia spp. colectados
baco los grupos de anastomosis AG1, AG2.2, en diferentes lotes comerciales de tabaco
AG4 y AG5 causan damping off en plantines desde suelo y plantas que presentaban las
bajo almácigo y en plantas jóvenes posterior sintomatologías descriptas en las provincias
al transplante al campo y podredumbre radi- de Salta y Jujuy empleando marcadores ITS-
cular en planta adulta (14, 8). Mientras que rDNA.
AG2.2 y AG3 producen la mancha foliar o
target spot (17, 12, 18). MATERIALES Y MÉTODOS
Por otra parte, es importante tener en con-
sideración que muchos aislamientos de R. Material biológico
solani de otros hospedantes causan tizón de En las campañas 2009/10/11 se realizaron
plántulas y podredumbre radicular en taba- muestreos aleatorios de 80 lotes de cultivo
co, por lo cual es de interés un análisis que de tabaco georeferenciados en diferentes lo-
incluya aislamientos de otros hospedantes calidades de las provincias de Salta y Jujuy.
que se incluyen en rotaciones de la región En los lotes se extrajeron plantas con sínto-
para determinar si los aislados de Rhizocto- mas de la enfermedad y muestras de suelo
nia de esos hospedantes pueden ser pato- (rizósfera). Las plantas se procesaron por
génicas de tabaco (16). La técnica de rutina técnicas de aislamientos de rutina en Agar
utilizada en fitopatología en las ultimas dé- Papa Glucosado (APG) pH=5 para obtener
cadas para la determinación de grupos de aislamientos del patógeno. Para las mues-
anastomosis es la reacción de anastomosis tras de suelo se utilizó el método de cebo
hifal que consiste en enfrentar el asilamiento cuali-cuantitativo para Rhizoctonia spp. (1).
desconocido con un tester (patrón de AG co- Posteriormente se transfirieron puntas hifa-
nocido), existiendo diferentes terminologías les a nuevas placas con medio, las cuales se
según que autor se tome para su estudio (2). incubaron cinco días en oscuridad a 25±2ºC.
Recientemente los marcadores molecula- De estas se tomaron discos de 1cm de diá-
res y estudios de secuenciación de ADN de- metro y se depositaron en tubos de 1,5 ml
mostraron ser herramientas de gran utilidad con glicerol al 50% y se llevaron a -20ºC para
para la caracterización de aislamientos en su conservación. Además se realizaron aisla-

18 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


mientos provenientes de otros hospedantes electroforésis en geles de agarosa 1,5% teñi-
(poroto, sorgo, maní y garbanzo). dos con GelRedTM. Se realizó la purificación
de los productos de PCR para su posterior se-
Prueba de patogenicidad cuenciación empleando el kit QIAquick®PCR
Para cada aislamiento se realizó una prueba Purification Kit (Qiagen).
de patogenicidad empleando plantines de Análisis de datos
8 semanas de la variedad susceptible K326. Los fragmentos secuenciados se analizaron
Las plantas se mantuvieron en cámara de utilizando el programa BioEdit y se deposita-
crecimiento con control de temperatura 25 ron en el GenBank (Cuadro 1). Las secuencias
± 2°C y 12 h de fotoperíodo. Por cada aisla- se compararon con secuencias de R. solani
miento fueron inoculadas 10 plantas, depo- de diferentes grupos de anastomosis dispo-
sitando en la base del cuello y en hoja granos nibles en la base de datos del NCBI (Natio-
de trigo colonizados. Plantas sin el patógeno nal Center for Biotechnology Information). A
se utilizaron como control. Las plantas se as- partir del análisis de las secuencias se gene-
perjaron con agua destilada estéril y se man- ró un árbol de Neighbour Joining (NJ) utili-
tuvieron cubiertas con bolsas de polietileno zando el programa PAUP v. 4.0 y se visuali-
a fin de simular una cámara húmeda. A las zó empleando TreeView v. 1.6.6. El análisis
24 h se removieron las bolsas y las plantas incluyó un total de 107 taxa. El soporte de
fueron llevadas a invernadero. A los cinco los grupos fue evaluado mediante bootstrap
días se evaluó la severidad (% de tejido afec- con 1000 repeticiones, indicándose única-
tado) para mancha en hoja y damping off, mente los valores superiores a 50.
empleando a escala, 0 (sin infección), 1 (1-
25%), 2 (26-50%), 3 (51-75%) y 4 (76-100%). RESULTADOS Y DISCUSIÓN

Amplificación y secuenciación de regiones A partir del relevamiento en los diferentes


ITS-rDNA lotes comerciales tabacaleros de Salta y Ju-
La extracción de ADN se realizó a partir de juy, se obtuvo un total de 110 aislamientos
micelio empleando el protocolo con bromu- que forman parte de la colección de hon-
ro de cetil-trimetil amonio (CTAB). A partir gos conservada en el Laboratorio de Sani-
del ADN extraído se amplificaron las regiones dad Vegetal del INTA, Estación Experimental
ITS-rDNA mediante PCR utilizando los pri- Agropecuaria Salta. Del total de aislamientos
mers ITS1 e ITS4. Dichos primers fueron utili- obtenidos se destinaron 49 para el análisis
zados por diferentes autores para la identifi- filogenético (Cuadro 1).
cación molecular de grupos de anastomosis Para todos los aislamientos se obtuvieron
en Rhizoctonia spp (15, 16, 17). patrones de bandas amplificadas entre los
Las reacciones de PCR se realizaron en un vo- 650 y 800 pb (Figura 1).
lumen final de 10 µl, utilizando 50 ng de ADN La técnica de análisis de secuencias ITS resul-
genómico, 3 mM Cl2Mg, 0,2 µM de cada pri- tó una herramienta de utilidad para la identi-
mer (forward y reverse), 20 mM de Tris-HCl, ficación de la mayoría de los aislamientos de
50 mM de ClK, 0,2 mM de dNTP y 0,4 U de Rhizoctonia analizados como fue reportado
Taq polimerasa. Los ciclos de amplificación en otros estudios (11, 12, 13).
consistieron en una desnaturalización inicial En el árbol de Neighbour Joining construido
de 1 min a 94°C seguida de 30 ciclos de 15 a partir de las secuencias ITS-rDNA se obser-
seg a 94°C, 15 seg a 58°C y 15 s a 72°C, con vó que el 61% de los aislamientos analizados
una extensión final de 7 min a 72°C. Los frag- fueron identificados como Rhizoctonia sola-
mentos amplificados se separaron mediante ni AG2, AG4 y AG6 (Figura 2). El resto de los
Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 19
Cuadro 1. Aislamientos de Rhizoctonia spp. de Salta y Jujuy (Argentina) caracterizados empleando secuencias ITS (inter-
nal transcribed sequences).

AGa Aislamiento Síntomas/Origen/ Localidad/provincia Severidadc N°


b
Hospedante GenBank
AG2-1 Rs66 MH/hoja/N. tabacum Cerrillos/Salta 3.1 JQ616852
AG2-1 Rs67 MH/hoja/N. tabacum Cerrillos/Salta 0.0 JQ616853
AG2-1 Rs59 MH/hoja/N. tabacum La Silleta/Salta 4.2 JQ616867
AG2-1 RS59b MH/hoja/N. tabacum La Silleta/Salta 4.2 JQ616874
AG2-1 RS68 MH/hoja/N. tabacum Cerrillos/Salta 3.1 JQ616870
AG2-1 RS69 MH/hoja/N. tabacum Cerrillos/Salta 1.1 JQ616871
AG2-1 RS70 MH/hoja/N. tabacum Cerrillos/Salta 1.2 JQ616872
AG2-1 Rs59c MH/hoja/N. tabacum La Silleta/Salta 4.2 -
AG2-1 RS25 PR/raíz/N. tabacum La Merced/Salta 0.1 JQ616864
AG2-1 Rs25b PR/raíz/N. tabacum La Merced/Salta 1.1 JQ616849
AG2-1 RS36 PR/raíz/N. tabacum La Merced/Salta 0.0 JQ616865
AG2-1 RS36b PR/raíz/N. tabacum La Merced/Salta 0.1 JQ616854
AG2-1 RS58 DO/raíz/N. tabacum La Silleta/Salta 2.4 JQ616866
AG4-HGI RS46 PR/raíz/N. tabacum Rosario de Lerma/Salta 0.1 JQ616862
AG4-HGI RS46b PR/raíz/N. tabacum Rosario de Lerma/Salta 0.1 JQ616868
AG4-HGI RS47 PR/raíz/N. tabacum Rosario de Lerma/Salta 1.4 JQ616860
AG4-HGI Rs47b PR/raíz/N. tabacum Rosario de Lerma/Salta 1.4 JQ616855
AG4-HGI RS79 PR/raíz/N. tabacum El Carmen/Jujuy 1.0 JQ616856
AG4-HGI RS80 PR/raíz/N. tabacum El Carmen/Jujuy 0.0 JQ616857
AG4-HGI Rs44 PR/raíz/N. tabacum Rosario de Lerma/Salta 0.4 -
AG4-HGI RS60 -/suelo/- Cerrillos/Salta 1.0 JQ616850
AG4-HGI RS61 -/suelo/- Cerrillos/Salta 1.0 JQ616848
AG4-HGI RS63 -/suelo/- Cerrillos/Salta 1.1 JQ616851
AG4-HGI RS12 caja/Arachis hypogaea Las Lajitas/Salta 0.0 JQ616861
AG4-HGIII RS74 DO/raíz/N. tabacum Coronel Moldes/Salta 0.1 JQ616869
AG4-HGIII Rs75 DO/raíz/N. tabacum Coronel Moldes/Salta 0.0 JQ616859
AG4-HGIII RS81 RR/raíz/Sorghum sp. Guachipas/Salta 1.0 JQ616858
AG4-HGIII RS72 -/suelo/- Rosario de Lerma/Salta 1.1 JQ616873
AG4 RS49 RR/raíz/Cicer arietinum Cerrillos/Salta 1.2 JQ616863
AG6 Rs77 PR/raíz/N. tabacum Ovejería/Jujuy 0.0 -
NI RS1 DO/raíz/N. tabacum Cerrillos/Salta 0.1 -
NI RS6 DO/raíz/N. tabacum La Caldera/Salta 0.0 -
NI RS6b DO/raíz/N. tabacum La Caldera/Salta 0.0 -
NI RS10 DO/raíz/N. tabacum Puesto Viejo/Jujuy 0.0 -
NI RS26 PR/raíz/N. tabacum Monterrico/Jujuy 0.0 -
NI RS53 PR/raíz/N. tabacum Cerrillos/Salta 2.2 -
NI RS53b PR/raíz/N. tabacum Cerrillos/Salta 2.3 -
NI RS54 PR/raíz/N. tabacum Rosario de Lerma/Salta 2.4 -
NI Rs73 PR/raíz/N. tabacum Rosario de Lerma/Salta 0.1 -
NI RS57 -/semilla/Phaseolus vulgaris Cerrillos/Salta 1.4 -
NI RS12b caja/Arachis hypogaea Las Lajitas/Salta 0.0 -
NI RS22a -/suelo/- Los Lapachos/Jujuy 0.0 -
NI Rs22b -/suelo/- Los Lapachos/Jujuy 0.0 -
NI RS34 -/suelo/- Monterrico/Jujuy 0.1 -
NI RS35 -/suelo/- Los Lapachos/Jujuy 0.0 -
NI RS65 -/suelo/- Cerrillos/Salta 0.0 -
NI RS71 -/suelo/- Rosario de Lerma/Salta 2.0 -
NI Rs71b -/suelo/- Rosario de Lerma/Salta 2.0 -
NI Rs56 -/semilla/Phaseolus vulgaris Cerrillos/Salta 1.0 -

a
AG: Grupos de anastomosis determinados a partir de las secuencias ITS. NI: especies de Rhizoctonia no identificadas.
b MH: mancha en hoja (leaf spot), PR: podredumbre radicular (sore shine), DO: damping off.
c Para mancha en hoja y damping off, escala 0-4 (0, sin infección; 1, 1-25% ; 2, 26-50%; 3, 51-75%; and 4, 76-100%).

20 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


Figura 2. Arbol de Neibour Joining de 49 aislamientos de Rhizoctonia spp. de Salta y Jujuy.

aislamientos correspondieron a Rhizoctonia mancha en hoja y damping off en almácigo y


spp. podredumbre radicular en plantación. Estos
En la provincia de Salta se identificaron aisla- aislamientos fueron los que mostraron ma-
mientos pertenecientes a los grupos AG2.1, yor severidad en la prueba de patogenicidad
AG4-HGI, AG4-HGIII. Mientras que en la pro- (Cuadro 1). Este representó el primer repor-
vincia de Jujuy los grupos fueron AG4-HGI y te a nivel mundial del grupo AG2.1 causando
AG6. En ambas provincias se identificaron mancha en hoja en tabaco (18) ya que sólo
aislamientos de Rhizoctonia spp. existen referencias de esta enfermedad cau-
Se observó asociación entre enfermedad sada por el grupo AG3 (6, 8, 19).
y grupo de anastomosis. Los aislamientos Los aislamientos pertenecientes al grupo
pertenecientes al grupo AG2.1 causaron AG4-HGI causaron podredumbre radicular

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 21


Los aislamientos Rs81, Rs49 y Rs56 obteni-
dos a partir de otros hospedantes (sorgo,
garbanzo y poroto) resultaron virulentos
para plantas de tabaco, mientras que Rs12 y
Rs12b obtenido de maní no mostraron viru-
lencia. Cabe mencionar que los tres prime-
ros aislamientos virulentos corresponden a
rotaciones en lotes de tabaco en el Valle de
Lerma, mostrando el amplio rango de hospe-
dante del patógeno.

CONCLUSIÓN
Figura 1. Amplificación de secuencias ITS-rDNA a partir de
ADN de aislamientos de Rhizoctonia spp. de Salta y Jujuy.
Estos resultados representan el primer aná-
mientras que los del grupo AG4-HGIII se en- lisis molecular del patógeno en el noroeste
contraron asociados a damping off. Resul- argentino y revelan la existencia de gran va-
tados similares fueron reportados por (13) riabilidad en los aislamientos analizados. Los
sin embargo este sería el primer reporte de mismos representan una importante una he-
AG4-HGIII infectando tabaco. rramienta para el manejo integrado de en-
El 64% de los aislamientos obtenidos a partir fermedades, dado que los grupos de anasto-
de muestras de suelo mostraron resultados mosis de Rhizoctonia solani difieren en su
positivos en las pruebas de patogenicidad sensibilidad a fungicidas (20) y pueden tener
con baja virulencia. De los mismos el 43% diferente rango de hospedante.
correspondió al grupo AG4-HGI, el 14% a
AG4-HGIII y el resto a Rhizoctonia spp. Estos BIBLIOGRAFÍA CITADA
resultados indican que se estaría trasladan-
1. Alfenas A., Valverde Zauza E., Gomeide Mi-
do inóculo desde almácigo al campo ya que
zubuti E., Ferreira A., Murilo Zerbini F., Pe-
AG4-HGIII se lo encontró asociado a dam- reira F., Rogeiro de Olivera J., Grassi de Frei-
ping off. tas L., Maffia L., Pereira O., Alfenas Zerbini
El grupo de anastomosis que mostró los P., Gonçalves Mafia R., Gonçalves R., D’Arc
mayores valores de virulencia para mancha de Lima Oliveira R., & Dos Santos Neves W.
foliar fue AG2.1. Además se observó mayor 2007. Métodos em Fitopatologia. Editora
severidad en los aislamientos provenientes Universidade de Visçosa. p. 382.
de hoja y menor en los de raíz. 2. Carling D.E. 1996. Grouping in Rhizoctonia
Para damping off AG4-HGI fue el grupo más solani by hyphal anastomosis reaction. In:.
virulento de los aislamientos obtenidos a Rhizoctonia Species: Taxonomy, Molecular
partir de raíz. (13) a partir del análisis de 19 Biology, Ecology, Pathology and Disease Con-
trol. (B Sneh, S. Jabaji-Hare, S. Neate, and
aislamientos provenientes de Turquía repor-
G. Dijst, eds). Dordrecht, The Netherlands,
tó altos niveles de virulencia para damping Kluwer Academic Publishers. pp. 37-47.
off en todos los grupos de anastomosis en- 3. Gimenez Monge J.L., Mercado Cárdenas
contrados (AG2.1, AG4-HGI y AG4-HG-II). G.E., Ortega A., Lacci F., Arzeno J.L.. 2009. Un
Del total de los aislamientos identificados enfoque integral del amarillamiento en taba-
como Rhizoctonia spp. el 53% resultó virulen- co. Panorama Agropecuario de Salta y Jujuy.
to para mancha en hoja y damping off, mos- 10(52): 4-7.
trando mayores valores para esta última. 4. Godoy-Lutz G., Kuninaga S., Steadman J.R.,

22 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


and Powers K.. 2008. Phylogenetic analysis pathology 158: 236-243.
of Rhizoctonia solani subgroups associated 14. Nicoletti R., and Lahoz E. 1995. Recovery
with web blight symptoms on common bean of Rhizoctonia solani AG-5 from tobacco in
based on ITS-5.8s rDNA. Journal of General Italy. Plant Disease 79: 540.
Plant Pathology 74: 32-40. 15. Sharon M., Kuninaga S., Hyakumachi M., and
5. González-Hernández D. 2002. Estado actual Sneh B. 2006. The advancing identification
de la taxonomía de Rhizoctonia solani Kühn. and classification of Rhizoctonia spp. using
Revista mexicana de Fitopatología Volumen molecular and biotechnological methods
20 (2): 200-205. compared with the classical anastomosis
6. González M., Merardo P., Metraux J.P., Gon- grouping. Mycoscience 47: 299–316
zález-García V., Bolton M., Borrás-Hidalgo O. 16. Shew H.D., and Lucas G.B. 1991. Compen-
2011. Tobacco Leaf spot and root rot caused dium of Tobacco Diseases. The American
by Rhizoctonia solani Künh. Molecular Plant Phytopathological Society. p. 68.
Pathology 12(3): 209-216. 17. Shew H.D., and Main C.E. 1985. Rhizoctonia
7. Gurkanli C, Ozkoc I., and Islam G. 2009. Mo- Leaf Spot of Flue-Cured Tobacco in North Ca-
lecular and conventional identification and rolina. Plant Disease 69: 901-903.
pathogenicity of Rhizoctonia solani isolates 18. Shew H.D., and Melton, T.A. 1995. Target
from tobacco (Nicotiana tabacum L.) in Sam- spot of tobacco. Plant Disease 79: 6-11.
sun, Turkey. Journal of Phytopathology 157: 19. Stodart B. J., Harvey P. R., Neat S. M., Melan-
686-696. son D. L., and Scott E. S. 2007. Genetic varia-
8. Gutierrez W.A., Shew H.D., and Melton tion and pathogenicity of anastomosis group
T.A.1997. Sources of inoculum and manage- 2 isolates of Rhizoctonia solani in Australia.
ment for Rhizoctonia solani damping-off on Mycological Research 111: 891-900.
Tobacco transplants under greenhouse con- 20. Woodhall J.W., Lees A.K., Edwards S.G., and
ditions. Plant Disease 81: 604-606. Jenkinson P. 2007. Characterisation of Rhi-
9. Mercado Cárdenas, G., Aciar M. y Sanchez C. zoctonia solani from potato in Great Britain.
2011. Análisis espacial con aplicación de tran- Plant Pathology 56: 286-295.
sectas de la distribución de una enfermedad
radicular y su relación con variables de suelo
en el cultivo de tabaco en Salta (Argentina).
In: Actas del Primer Seminario Nacional de
Cartografía Digital, San Luis, formato digital.
10. Mercado Cárdenas G. E., Alfaro R., Gimenez
Monge J. L. 2010. Prevalencia e incidencia de
las enfermedades radiculares y virales de Ni-
cotiana tabacum en las provincias de Salta y
Jujuy, Argentina. In: Actas del XXI Congreso
Peruano de Fitopatología, Tarapoto, p.8.
11. Mercado Cárdenas G., Galván M., Barrera V.,
and Carmona M. 2012. First report of target
spot of tobacco caused by RRhizoctonia sola-
ni (AG-2.1). Plant Disease 96(3): 456.
12. Meyer J.C., Van Wyk R.J., and Phillips A.J.
1990. Rhizoctonia leaf spot of tobacco in
South Africa. Plant Pathology 39: 206-207.
13. Nerey Y., Pannecoucque J., Hernandez H.
P., Diaz M., Espinosa R., De Vos S., Van Be-
neden S., Herrera L., Höfte M. 2010. Rhizoc-
tonia spp. causing root and hypocotyl rot in
Phaseolus vulgaris in Cuba. Journal of Phyto-

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 23


Variabilidad genética en germoplasma de tabaco Tipo Virginia
empleando marcadores moleculares
Daniela Cuellar1, Mónica Aparicio1,5, Guadalupe Mercado Cárdenas2, Marta Galván1,5, Gisel
Taboada1,5, Juan Galli4, Mario Martínez4, Luis Ibarra3, María del Carmen Menéndez Sevilla-
no3 y María Elena Toncovich4.
1- EEA INTA Salta, Laboratorio de Biotecnología. 2- EEA INTA Salta, Sanidad Vegetal. 3- EEA
INTA Salta, Banco de germoplasma. 4- EEA INTA Salta, Grupo Tabaco y diversificación. 5- CO-
NICET.
Correo: martazgalvan@gmail.com

INTRODUCCIÓN últimos años se expandió por toda la zona


tabacalera transformándose en uno de los
Dentro de la actividad agraria de la provincia problemas fitosanitarios más importantes de
de Salta, el cultivo de tabaco (Nicotiana ta- este sector productivo. Además, entre otros
bacum L.), tiene una apreciable participación factores la manifestación de esta patología
en la economía regional, tanto desde el pun- es atribuida a la degradación de los suelos
to de vista de la producción y exportaciones producto del sistema de labranza convencio-
provinciales, como por su relevancia en la nal y monocultivo (12). La estrecha base ge-
generación de empleo. nética de los cultivares comerciales también
Desde fines de los años noventa la actividad condiciona el estado sanitario del cultivo.
tabacalera se vio afectada por una sintoma- Las variedades comerciales que se utilizan en
tología que se visualiza con distintas mani- la producción tabacalera del NOA tienen ori-
festaciones externas como: marchitamien- gen en Brasil y EE.UU, por lo cual presentarían
to de la parte aérea de la planta, clorosis o baja adaptación a las condiciones agroeco-
amarillamiento y posterior necrosis de los te- lógicas de la zona. El manejo sanitario que
jidos, que puede terminar con la muerte de comúnmente se realiza es la aplicación de
la planta. Coincidente con aquella manifesta- agroquímicos, que además de encarecer la
ción aérea, el sistema radicular se presenta producción, contaminan el medio ambiente.
con escaso desarrollo y en su mayoría con Por lo tanto, la incorporación de resistencia
presencia de raíces con podredumbre, visua- genética en las variedades comerciales es
lizándose muchas veces en el cuello necrosis una estrategia de interés para incrementar
total o parcial (7). la producción en el marco de un desarrollo
Recientemente se detectaron diferentes pa- agrícola sustentable.
tógenos que desencadenan enfermedades Actualmente el mejoramiento genético con-
radicales, además de la presencia de nemato- vencional para resistencia a factores bióticos
dos y gusano minador como vectores (produc- y abióticos puede ser asistido por técnicas
tores de heridas) de las mismas. El marchita- moleculares que hacen más eficiente y con-
miento bacteriano (Ralstonia solanacearum) fiable al proceso. El desarrollo de las técnicas
y podredumbre radicular (Rhizoctonia sola- empleadas actualmente en Biología Molecu-
ni), son las enfermedades con mayor preva- lar permite a genetistas y mejoradores rea-
lencia e incidencia que conforman el comple- lizar estudios de variabilidad a nivel de ADN
jo del amarillamiento en tabaco (11). de una manera sistemática. Los marcadores
En sus comienzos esta sintomatología se moleculares basados en la amplificación del
manifestaba en forma aislada, pero en los ADN mediante PCR (reacción en cadena de la

24 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


polimerasa) demostraron ser herramientas del genoma y permite la amplificación de
de utilidad para la identificación y estudios segmentos de ADN de distinta longitud (20).
de similitud genética entre variedades, con la El objetivo del trabajo fue conocer la variabi-
ventaja de no ser afectados por el medio am- lidad genética existente entre variedades de
biente. Diferentes marcadores moleculares tabaco Virginia conservadas en el Banco de
fueron utilizados para estudios de diversidad germoplasma del NOA (BANOA) y variedades
genética y caracterización de variedades en comerciales para aportar nuevos materiales
tabaco, como ser RAPD (Random Amplified a los programas de mejoramiento.
Polymorphic DNA)(18, 14) y AFLP (Amplified
Fragment Length Polymorphism) (19, 17, 8). MATERIALES Y MÉTODOS
La técnica de SSR o microsatélites consiste
en la amplificación de regiones del ADN que Material biológico
contienen secuencias simples (1 a 4 nucleóti- Se analizaron 12 variedades comerciales de
dos) repetidas y adyacentes. Para ello se uti- tabaco Tipo Virginia de importancia para la
lizan “primers” de una secuencia específica región (Cuadro 1) y 5 variedades conserva-
de 20 a 30 bases, que son complementarios das en el BANOA: BANOA29 (INTA Güemes
a las secuencias únicas que flanquean al mi- 74), BANOA33 (Virginia San Pedro INTA), BA-
crosatélite (15). Actualmente se dispone de NOA49 (INTA Cerrillos 90A), BANOA50 (INTA
numerosas secuencias de SSR que fueron re- Cerrillos 91B) y BANOA51 (INTA Cerrillos 69).
cientemente reportadas para N. tabacum las Estas últimas fueron generadas como resul-
cuales son de dominio público y pueden ser tado de 30 años de trabajo (entre 1960 y
de gran utilidad para estudios de variabilidad 1990) en el programa de mejoramiento de
genética y caracterización de variedades (1, tabaco del INTA EEA Salta por el Ing. Agr. Da-
2). Los marcadores ISSR (inter simple sequen- río Fernandez de Ulivarri.
ce repeats), que utilizan secuencias de micro- Para el análisis se emplearon plántulas de ta-
satélites como primers y amplifican regiones baco de 100-120 días, mantenidas en almáci-
inter-microsatelitales, también demostraron go flotante.
ser una técnica altamente reproducible para
el análisis de variabilidad genética en N. ta- Análisis molecular
bacum (16). La técnica de ISSR emplea un La extracción de ADN se realizó a partir de
único primer que hibrida en múltiples sitios hojas de plántulas de tabaco empleando el
Cuadro 1. Variedades de tabaco Tipo Virginia analizadas en el presente trabajo. TMV: Tobacco Mosaic Virus; PVY: Potato
Virus Y; R: Resistente; T: tolerante; S: Susceptible; nd: dato no disponible.

Variedades TMV PVY Black Shank Nematodos Marchitez Bacteriana


Comerciales P. parasitica M. incognita R. solanacearum
MB 47 nd nd nd T T
PVH 2299 R S T R T
MB 37 nd nd nd T T
PVH 2248 nd nd nd nd nd
NC 567 R R T R T
K 394 S S R S T
K 149 S S T R R
PVH 2291 S S S R R
K 326 S S T R T
PVH 2241 R S T R T
K 346 S S R R R
PVH 2254 R S T R T

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 25


protocolo de CTAB de Doyle y Doyle (5) mo- sa (INBIO, Tandil). La amplificación del ADN
dificado (3). La calidad y cantidad de ADN se consistió en una desnaturalización inicial de
midió en geles de agarosa 0.8% utilizando un 7 min. a 94° C seguida de 33 ciclos de 1 min.
marcador de peso molecular (DNA Ladder, a 94° C, 1 min.15 seg. a T° de annealing del
Genbiotech). A partir del ADN extraído se primer y 4 min. a 72° C, con una extensión
realizó la amplificación mediante PCR em- final de 7 min. a 72° C.
pleando marcadores ISSR y microsatélites Se analizó un total de 24 marcadores micro-
distribuidos en todo el genoma de tabaco (2). satélites distribuidos en todos los grupos de
Se probaron 8 primers ISSR con bases selec- ligamiento de N. tabacum según el mapa
tivas en los extremos 5` (anclaje 5`) o 3` (an- publicado por Bindler et al. (2). Las reac-
claje 3`) y sin anclaje (Cuadro 2). Las reaccio- ciones de PCR se realizaron en un volumen
nes de ISSR-PCR se realizaron en un volumen final de 10 µl utilizando 20 ng de ADN genó-
final de 25 µl utilizando 20-50 ng de ADN ge- mico, 2,5 mM Cl2Mg, 0,2 µM de cada primer
nómico, 2,5 mM Cl2Mg, 0,7 µM de primer, 10 (forward y reverse), 10 mM de Tris-HCl (pH
mM de Tris-HCl (pH 7.2), 50 mM de ClK, 200 7.2), 50 mM de ClK, 125 µM de cada dNTP
µM de cada dNTP y 1,25 U de Taq polimera- y 1 U de Taq polimerasa (INBIO, Tandil). La
amplificación consistió en una desnaturali-
Cuadro 2. Primers ISSR y miscrosatélites utilizados para el
análisis de 17 variedades de tabaco Tipo Virginia. zación inicial de 7 min. a 94° C seguida de 30
ciclos de 1 min. a 94° C, 1 min. a 62-65° C y
Primer Secuencia (5’-3’) Tº annealing (ºC) 2 min. a 72° C, con una extensión final de 7
ISSR min. a 72° C.
Los productos de amplificación se separaron
AA3 (AC)8TA 52 por electroforesis en geles de agarosa 1,5%
para los marcadores ISSR y de poliacrilami-
C (AG)8CG 52
da 10% (29:1 acrilamida: bis-acrilamida) para
LA5 CAG(AAC)5 53 los microsatélites, utilizando para el revela-
do la tinción con GelRedTM. Los geles fueron
G GAG(CAA)5 58 fotografiados para la documentación y ge-
BA5 GAG(GAA)5 53
notipado de los materiales con cada uno de
los marcadores probados. El tamaño de las
FA5 TAC(GA)8 56 bandas amplificadas se determinó utilizando
como patrón de comparación un marcador
microsatélites
de peso molecular (Marcador de ADN, INBIO,
50610 F: CACATTTGACCGTTCAACCA 62 Tandil). Se realizaron repeticiones tanto de
R: CTACACGGTAACTGCTCCAAA las extracciones de ADN como de las reaccio-
51838 F: TTGCTGTGAGTAGCTGCTGAG 64
nes de PCR.
R: TTGAGACATGCCATAACCACA
52260 F: GCCAACAAATAAGGTACGGG 64
R: CCACTTGGCGAAATGAGAAT Análisis de datos
61512 F: TCGGACCCAAAGTTTAAGAAA 63 Con los patrones de bandas obtenidos se
R: CAAATGACGACCAGGGAAAT
60209 F: TGCACAAATTAAAGGCAACTCA 64 construyó una matriz que fue utilizada para
R: ACGACAAGACGTCAAACGAA generar un árbol de Neighbor-Joining usando
52643 F: ACAGGGCATCAGAATTGTTT 64 el programa Powermarker (9) y la distancia
R: CATGACATACTACAGGTGACCCA
52858 F: TGAATTATGCGGTGCACATT 65 de Cavalli-Sforza y Edwards (4). Para deter-
R: ATATTCCAACGTGGGCTGAA minar la robustez de los agrupamientos se
52838 F: CCATTTCGATTGTGATGCAA 65 generó un arbol consenso a partir de 1000
R: AACATCATCCGAGGCCTAAA
repeticiones de bootstrap (7).

26 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


RESULTADOS Y DISCUSIÓN Cuadro 3. Polimorfismo detectado por cada marcador mi-
crosatelite utilizado en el análisis de 17 variedades de ta-
baco Tipo Virginia del NOA.
Se analizó un total de 17 variedades de taba-
co Tipo Virginia empleando marcadores ISSR Marcador Grupo de Nro de Alelo más PIC
y microsatélites. ligamiento alelos frecuente
Los mismos mostraron patrones de bandas 51838 3 2 0.5294 0.37
repetibles con tamaños entre 250 pb y 3 Kb. 61512 7 3 0.5882 0.48
El promedio de bandas amplificadas por pri- 52260 8 3 0.5882 0.50
mer fue de ocho. Sin embargo no se observa- 60209 11 4 0.3750 0.67
ron patrones polimórficos que permitieran 50610 13 3 0.8824 0.20
mostrar diferencias entre los materiales ana- 52643 17 3 0.6667 0.41
lizados (Figura 1). Por ello se optó por utilizar 52838 21 2 0.6471 0.35
marcadores SSR para el análisis ya que se ca- 52828 24 3 0.7500 0.37
racterizan por mostrar elevado polimorfismo Media 3 0.6284 0.42
debido a la variación en el número de repeti-
ciones de los microsatélites y permitir la de- mitieron diferenciar a todas las variedades
tección de individuos heterocigotas para los estudiadas mostrando la existencia de varia-
diferentes loci. Tales características hacen bilidad genética entre las mismas (Figura 2).
que los microsatélites sean muy útiles como La existencia de una estrecha base genética
marcadores genéticos, aún en materiales al- en las variedades de tabaco comúnmente
tamente relacionados. utilizadas a nivel mundial fue reportada por
El tamaño de las bandas amplificadas em- diferentes autores (13, 19, 17). Es probable
pleando marcadores SSR varió entre 100 que una gran proporción de germoplasma
y 250 pb. En todos los casos se obtuvieron de tabaco se haya perdido por la mayor po-
bandas del tamaño esperado según la bi- pularidad de ciertas variedades comerciales
bliografía. Del total de primers analizados y la constante selección artificial (19). Para
el 33% mostró polimorfismo entre las varie- ampliar la base genética de los cultivares
dades estudiadas (Figura 1). El promedio de elite es necesario realizar cruzamientos con
alelos amplificados por primer fue de tres y variedades genéticamente distantes o espe-
los valores de PIC (contenido de información cies silvestres (10). Por esto la variabilidad re-
polimórfica) variaron entre 0,20 y 0,67 con velada entre las variedades estudiadas en el
un promedio de 0,42, evidenciándose que el presente trabajo es un gran aporte para los
marcador 50610 fue el menos polimórfico programas de mejoramiento.
(Cuadro 3). Los marcadores utilizados per- El árbol de Neighbor-Joining generado em-

Figura 1. Amplificación de ADN de variedades de tabaco Tipo Virginia del NOA empleando marcadores moleculares.
a) ISSR AA3, b) microsatélite 51838. Para la nomenclatura ver Cuadro 1.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 27


I PVH2291 BIBLIOGRAFÍA CITADA
PVH2241
MB 47 1. Bindler G., Hoeven R., Gunduz I., Plieske J.,
PVH2248 Ganal M., Rossi L., Gadani F. and Donini P.
K149 2007. A microsatellite marker based linkage
II
PVH2254 map of tobacco. Theoretical and Applied Ge-
BANOA49 netics 114: 341-349.
PVH2299 2. Bindler G., Plieske J., Bakaher N., Gunduz I.,
NC567 Ivanov N., Van der Hoeven R., Ganal M., and
K394 Donini P. 2011. A high density genetic map
BANOA29 of tobacco (Nicotiana tabacum L.) obtained
BANOA51 from large scale microsatellite marker deve-
BANOA33 lopment. Theoretical and Applied Genetics
K346 123: 219-230.
III
K326 3. Bornet B., and Branchard M. 2001. Nonan-
MB37 chored inter simple sequence repeat (ISSR)
0.1 BANOA50 markers: reproducible and specific tools for
Figura 2. Árbol de Neighbor-Joining de 17 variedades de genome fingerprinting. Plant Molecular Bio-
tabaco Tipo Virginia analizadas empleando marcadores logy Reporter 19: 209-215.
microsatélites. 4. Cavalli-Sforza L.L., and Edwards A.W. 1967.
Phylogenetic analysis: models and estima-
tion procedures. American Journal of Human
pleando los datos moleculares agrupó a las Genetics 19: 233–257
variedades con buen rendimiento a campo y 5. Doyle J. J., and Doyle J.L. 1990. Isolation of
conservación de calidad en estufado (K326, plant DNA from fresh tissue. Focus 12: 13-15.
K346) en el mismo grupo o cluster (cluster 6. Felsenstein, J. 1985. Confidence limits on
III) (Figura 2). Mientras que el resto de las fylogenies: An approach using the bootstrap.
variedades que presentan mediano a bajo Evolution 39:783- 791.
rendimiento, pero son resistentes a nema- 7. Gimenez Monge J.L., Mercado Cárdenas
todos, virosis y enfermedades radiculares, se G.E., Ortega A., Lacci F., y Arzeno J.L.. 2009.
agruparon en clusters separados (clusters I y Un enfoque integral del amarillamiento en
tabaco. Panorama Agropecuario de Salta y
II). BANOA 49 y BANOA 51 mostraron gran
Jujuy. 10(52): 4-7.
divergencia genética con el resto de las va-
8. Jessada D., Tianrat P., and Matchima N. 2010.
riedades revelado por la mayor longitud de Genetic Polymorphism between Tobacco
las ramas del árbol. Las mismas evidenciaron Cultivar-groups Revealed by Amplified Frag-
mayor tolerancia a Rhizoctonia solani en en- ment Length Polymorphism Analysis. Journal
sayos de patogenicidad utilizando diferentes of Agricultural Science 2(2): 41-48.
variedades comerciales (com. pers. Mercado 9. Liu K., and Muse S. 2005. PowerMarker: In-
Cárdenas). El empleo de las variedades BA- tegrated analysis environment for genetic
NOA en programas de mejoramiento (princi- marker data. Bioinformatics 21: 2128–2129.
palmente en cruzamientos con K326 y K346) 10. Liu X., and Zhang H. 2008. Advance of mo-
sería de gran interés para generar materiales lecular marker application in the tobacco
research. African Journal of Biotechnology
con probada adaptación a las condiciones
7(25): 4827-4831.
del NOA y a las exigencias del mercado.
11. Mercado Cárdenas G. E., Alfaro R., y Gimenez
El presente trabajo representa el primer re- Monge J. L. 2010. Prevalencia e incidencia de
porte de marcadores moleculares aplicados las enfermedades radiculares y virales de Ni-
al análisis de variedades de tabaco Tipo Vir- cotiana tabacum en las provincias de Salta y
ginia en el país. Jujuy, Argentina. In: Actas del XXI Congreso

28 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


Peruano de Fitopatologia, Tarapoto, p.8. peat and inter-retrotransposon amplification
12. Mercado Cárdenas, G., Aciar M. y Sánchez C. polymorphism markers. Annals of Applied
2011. Análisis espacial con aplicación de tran- Biology 150: 393–401.
sectas de la distribución de una enfermedad 17. Zhang H., Liu X., He C., and Yang Y. 2008. Ge-
radicular y su relación con variables de suelo netic diversity among Flue-cured tobacco
en el cultivo de tabaco en Salta (Argentina). cultivars based on RAPD and AFLP markers.
In: Actas del Primer Seminario Nacional de Brazilian Archives of Biology and Technology
Cartografía Digital, San Luis, formato digital. 51(6): 1097-1101.
13. Ren N., and Timko MP (2001). AFLP analysis 18. Zhang H.Y., Liu X.Z., He C.S., and y Zheng C.M.
of genetic polymorphism and evolutionary 2005. Random amplified DNA polymorphism
relationships among cultivated and wild Ni- of Nicotiana tabacum L. cultivars. Biologia
cotiana species. Genome. 44(4): 559-571. Plantarum. 49: 605-607.
14. Saraka K., and Rao R.V. 2008. Genetic diversi- 19. Zhang H.Y., Liu X.Z., Li T.S., and Yang Y.M.
ty in Indian FCV and burley tobacco cultivars. 2006. Genetic diversity among flue-cured
Journal of Genetics. 87(2): 159-163. tobacco (Nicotiana tabacum L.) revealed by
15. Tautz D. 1989. Hypervariability of simple se- amplified fragment length polymorphism.
quence as a general sources for polymorphic Botanical Studies 47: 223-229.
DNA markers. Nucleic Acids Research. 17: 20. Zietkiewicz E., Rafalski A., and Labuda D.
6463-6471. 1994. Genome fingerprinting by simple se-
16. Yang B, Xiao B, Chen X. and Shi C. 2007. quence repeat (SSR)-anchored polymerase
Assessing the genetic diversity of tobacco chain reaction amplification. Genomics 20:
germplasm using intersimple sequence re- 176–183.

Aportes para el manejo del corcovo del tabaco en la región del NOA R

Ana C. Ramallo1, Paola M. López Lambertini2, Daniel A. Ducasse2


1-GEA Agronegocios S.R.L. 2-Instituto de Patología Vegetal (IPAVE), CIAP-INTA (ex-IFFIVE).
Correo-e: ana.ramallo@gea-ide.com.ar

INTRODUCCIÓN wilt virus (TSWV), Groundnut ringspot virus


(GRSV), Tomato chlorotic spot virus (TCSV),
El corcovo del tabaco o “vira-cabeça” como Impatiens necrotic spot virus (INSV) e Iris ye-
también se denomina a esta enfermedad, es llow spot virus (IYSV) (4, 7, 12, 13). Con excep-
uno de los principales problemas sanitario de ción del IYSV, las demás especies presentes
este cultivo en la Argentina y está causado en Argentina tienen capacidad de infectar
por diferentes especies virales pertenecien- tabaco, ya sea natural o experimentalmente.
tes al género Tospovirus. Sus síntomas más El corcovo del tabaco ha sido reportado en
conspicuos son amarillamiento, detención Argentina desde la primera mitad del siglo
de crecimiento, estrías necróticas en tallos, pasado (3, 5). Estudios posteriores deter-
dibujos necróticos en hojas y un encorva- minaron al TSWV como el agente causal de
miento característico del cogollo. esta virosis (23) y a los trips Thrips tabaci y
Actualmente, existen por lo menos 24 espe- Frankliniella paucispinosa, como sus vectores
cies de tospovirus citadas a nivel mundial (1, (24). Actualmente esta última especie se de-
19). En la Argentina han sido reportados cin- nomina Frankliniella schultzei (9). En el 2002,
co especies de tospovirus: Tomato spotted se confirmó al GRSV como el nuevo agente
R Datos extraídos del trabajo de Tesis Doctoral de la primera autora: Relevamiento y evaluación de la variabilidad de Tospo-

virus en cultivos comerciales y malezas más comunes de Tucumán, Argentina.2008.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 29


causal del corcovo del tabaco (22). Virginia (en las localidades de Salta y Jujuy).
Los resultados de un relevamiento efectua- Si bien la manifestación de síntomas está
do en lotes de tabaco tipo Burley durante las condicionada por la especie o variedad, las
campañas 2001 al 2004 en Tucumán, esta- condiciones ambientales, el estado de desa-
blecieron una incidencia promedio del cor- rrollo o nutrición de la planta y la co-infec-
covo del 36,2%, variando entre el 8 y el 83% ción con otros agentes virales, los síntomas
en los diferentes lotes según el manejo del considerados fueron los siguientes: amarilla-
cultivo, independientemente de las varieda- miento y retorcimiento del brote apical (co-
des plantadas (21). gollo); en hojas adultas, presencia de lesiones
El incremento de la prevalencia del corcovo cloróticas y necróticas en forma de anillos o
del tabaco en diferentes regiones produc- diseños arabescos que bordean las nervadu-
toras de la Argentina motivó el objetivo del ras primarias y secundarias; deformación y
presente trabajo: realizar un relevamiento asimetría del limbo foliar y necrosis. En ta-
de TSWV, GRSV y TCSV y de la o las especies llos, estrías necróticas que avanzan hacia las
de trips vectoras de los mismos en cultivos nervaduras con depresiones en el envés de
de tabaco y malezas aledañas como aporte las hojas.
para el desarrollo de estrategias de manejo Se tomaron muestras de hojas y/o brotes
de esta enfermedad. tiernos de las plantas que presentaron la sin-
tomatología descripta, total o parcialmente.
MATERIALES Y MÉTODOS Se colocaron en bolsas plásticas, se identi-
ficaron según hospedante y localidad, y se
Recolección de muestras de tabaco y rele- realizó una breve descripción de los sínto-
vamiento del TSWV, GRSV y TCSV mas. Las muestras se refrigeraron hasta su
Entre los años 2000 y 2004 se muestrearon análisis en laboratorio.
plantas con síntomas típicos de tospovirus Las muestras recolectadas se analizaron me-
en cultivos comerciales de tabaco (Nicotiana diante DAS-ELISA empleando antisueros po-
tabacum) ubicados en diferentes localidades liclonales producidos contra la proteína de la
de las provincias de Tucumán, incluyéndose nucleocápside (N) del TSWV, GRSV y TCSV.
también muestreos en Salta y Jujuy (Tabla 1). Los antisueros contra TSWV y GRSV fueron
La toma de muestras se realizó durante los producidos por este grupo de trabajo (11,
meses de producción del tabaco, desde el 25), mientras que el antisuero contra TCSV
transplante hasta la cosecha (septiembre a fue gentilmente cedido por el Dr. C. A. De
enero). Se recolectaron 282 muestras corres- Ávila (CNPH-EMBRAPA, Brasil).
pondientes a tabaco tipo Burley (variedades Debido a que los antisueros contra las tres
TN 90, TN 86, Ky 14 y 8959) en Tucumán y tipo especies de tospovirus relevados presentan
reacciones cruzadas y con la finalidad de in-
Tabla 1. Localidades incluidas en el relevamiento de plan- crementar la especificidad de las identifica-
tas con síntomas producidos por tospovirus por provincias
durante el período 2000-2004. ciones, se utilizó un diseño de placa optimi-
zado para tal fin (26). Cada muestra se analizó
Zona Provincias Departamentos (Localidades) en la misma placa contra los tres antisueros
Valle Jujuy El Carmen (El Carmen, Perico) para determinar con cuál de ellos presenta
de
Salta General Güemes (Güemes); el mayor valor de absorbancia determinando
Lerma Metán (Metán) así la identidad de la especie problema.
Centro Tucumán La Cocha (La Invernada, Las concentraciones de las IgG fueron:
de Alto el Puesto, La Florida, La Cruz) TSWV(1:1500), GRSV (1:1500) y TCSV (1:1000)
Tucumán Alberdi (Los Arroyos, Marapa, La Calera).
y de los conjugados enzimáticos TSWV

30 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


(1:2000), GRSV (1:1500) y TCSV (1:500). La di- Para facilitar las tareas de identificación y re-
lución de las muestras en tampón extracción cuento de los especímenes se los agrupó en
fue de 1g en 10ml. morfo-especies según los siguientes caracte-
Las placas se leyeron a los 45 minutos en lec- res: sexo, color, tamaño y estadio observa-
tor de placas Metrolab 980 con filtro de 405 dos bajo lupa 10-20X. Por cada morfo-espe-
nm. Las muestras se consideraron positivas cie se seleccionaron algunos individuos que
cuando los valores de absorbancia fueron su- fueron clarificados para remover los conte-
periores a tres veces el valor promedio de los nidos corporales y facilitar su caracterización
controles negativos. taxonómica. Las preparaciones semiperma-
nentes fueron observadas en microscopía
Recolección de malezas aledañas a cultivos para identificación de las especies en base a
de tabaco y relevamiento de TSWV, GRSV y claves taxonómicas (2, 15, 16, 18).
TCSV en las mismas
Durante los años 2002 a 2004 se recolecta- RESULTADOS
ron muestras de malezas de diferentes lotes,
donde la infección de tospovirus había sido El 79,1% de las muestras de tabaco recolecta-
previamente confirmada. das resultaron positivas para GRSV mediante
En cada lote relevado se seleccionaron las DAS-ELISA. No se detectó TSWV ni TCSV en
cinco malezas más frecuentes, según recuen- ninguna de las muestras analizadas y conse-
to visual, tanto del interior de cultivo como cuentemente tampoco infecciones mixtas
de los terrenos o caminos adyacentes a los de dos o más especies de tospovirus (Tabla
mismos, y por cada especie se colectaron al 2). Un 20,9% de muestras sintomáticas no
azar 100 muestras de hojas (1 hoja/planta) reaccionó contra ninguno de los anticuerpos
y se separaron en 10 sub-muestras en una empleados en el relevamiento. En Tucumán
combinación de 10 hojas/muestra (8). En se presentó durante los años en que reali-
algunos casos la presencia de síntomas en zaron los muestreos, una alta incidencia de
determinadas malezas fue el criterio de se- corcovo, lo que condujo a un relevamiento
lección prevaleciente a pesar de que su fre- más intensivo de la enfermedad respecto de
cuencia en el campo fuera baja. Salta y Jujuy.
Las malezas fueron clasificadas mediante el Tabla 2. Número de plantas positivas y negativas para las
empleo de manuales para la identificación especies de tospovirus analisadas en las distintas provin-
de las malezas (14) y la colaboración de la Cá- cia del NOA ( 2001-2004).
tedra de Botánica Sistemática de la Facultad Provincia Departamentos Totales TSWV GRSV TCSV
de Agronomía y Zootecnia de la Universidad (Lotes)
Nacional de Tucumán. TABACO
Las malezas muestreadas fueron analizadas Tucumán 4 (45) 257 0 214 0
para el diagnóstico de TSWV, GRSV y TCSV me- Salta 3 (3) 13 0 4 0
diante la técnica de DAS-ELISA con los reactivos Jujuy 1 (7) 12 0 5 0
y metodología descriptas en el punto anterior. 282 0 223 0

Recolección e identificación de especies de Se confirmó mediante DAS-ELISA la presencia


trips vectores de tospovirus de GRSV en 5 de las 13 especies de malezas
Los trips se recolectaron directamente de colectadas aledañas a los cultivos de taba-
plantas y de flores de lotes de Tucumán. Fue- co. Estas fueron: Portulaca oleracea, Croton
ron conservados y montados según protoco- lobatus, Canna sp., Solanun chacoënse y Eri-
los descripto en la bibliografía (18, 20). chtites hieracifolia (Tabla 3). P. oleracea (ver-

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 31


Tabla 3. Especies de malezas evaluadas como potenciales hospedantes alternativos de tospovirus. Tucumán. 2002-2004.

(*) Plantas con síntomas característicos de virosis. (+) resultados de DAS ELISA positivos contra GRSV.

dolaga) fue la maleza más frecuente en el consecuentemente la responsable de las se-


cultivo de tabaco y presentó una incidencia veras pérdidas causadas por esta virosis en
de GRSV del 50% (132 plantas positivas/265 la región del NOA mientras que las citas ori-
plantas analizadas). Esta elevada incidencia ginales (3, 5, 23, 24) señalaban al TSWV como
podría indicar a esta maleza como un hospe- responsable del corcovo del tabaco. Este
dante alternativo del GRSV con un importan- cambio en la etiología del corcovo se corres-
te rol epidemiológico en la aparición de co- ponde con una distribución diferencial de
rocovo en tabaco. Sin embargo, para asignar especies de tospovirus en la Argentina, que
dicho rol, deberían haberse encontrado trips ya ha sido reportada para tomate (26) y que
o colonias de trips en las plantas infectadas, señala que la especie de tospovirus presen-
lo cual no ocurrió al momento de realizarse te en la región central y del NOA es el GRSV.
el muestreo. Este papel de hospedante alter- Este predominio casi absoluto de GRSV en
nativo está mejor justificado en el caso de detrimento del TSWV en las provincias del
Solanun chacoënse, que resultó positiva para noroeste argentino coincide con una situa-
GRSV y a su vez presentó un promedio de en- ción similar a la observada en Brasil, donde
tre 1 y 50 individuos de trips colonizando las también se determinó una rápida expansión
plantas analizadas. de GRSV, siendo hoy considerada una de las
Del total de trips recolectados e identificados especies más ampliamente distribuida y per-
en cultivos de tabaco en los departamentos judicial en las regiones del centro y noroeste
de La Cocha y Alberdi, un 55,4% resultó F. brasilero (10).
schultzei. En toda el área tabacalera relevada, la es-
pecie vectora de tospovirus predominante
DISCUSIÓN fue F. schultzei. Esta especie presenta una
alta eficiencia en la transmisión de GRSV y
Los resultados de este relevamiento con- una muy baja eficiencia en la transmisión de
firman al GRSV como la única especie de TSWV (17), lo cual la señala como responsa-
tospovirus causal del corcovo del tabaco y ble de la alta frecuencia de infecciones con

32 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


GRSV en detrimento del originalmente pre- ce una atención especial Solanum chacoënse
sente TSWV. Estas características en la trans- por su potencial importancia epidemiológica.
misión de tospovirus por F. schultzei fueron Como aportes para el manejo del corcovo
confirmados en la Argentina con especies del tabaco en la región del NOA merece des-
locales de trips y tospovirus, determinándo- tacarse que el GRSV es el único agente cau-
se que este vector transmite GRSV con una sal lo cual es importante en el momento de
eficiencia del 61, 7% al 75% mientras que no establecer programas de mejoramiento para
transmite TSWV (20). generar resistencia genética a este patógeno
Otro aporte de este trabajo está relaciona- deben profundizarse los estudios sobre ma-
do con las malezas hospedantes del GRSV. lezas como hospedantes alternativos y estra-
Se sumaron cinco malezas hospedantes de tegias de manejo contra F. schultzei que sería
GRSV a las citadas por Feldman et al. (6). A el principal responsable de la dispersión de
pesar de que Portulaca oleracea fue la male- la enfermedad.
za con más alta incidencia de GRSV, no se en-
contraron trips colonizándola. A fin de con- BIBLIOGRAFÍA CITADA
firmar su rol en el ciclo de esta enfermedad,
sería necesario establecer la presencia de co- 1. Chen T.C., Li J.T., Fan Y.S., Yeh Y.C., Yeh S.D.,
lonias de F. schultzei sobre dicho hospedante and Kormelink R. 2013. Molecular characte-
alternativo. Diferente es el caso de Solanun rization of the full-length L and M RNAs of
chacoënse, la cual además de resultar positi- Tomato yellow ring virus, a member of the
genus Tospovirus. Virus Genes 46:487–495.
va para GRSV, fue encontrada colonizada por
2. De Santis L., Gallego de Sureda A.E, y Merlo
F. schultzei. Esta maleza es perenne lo cual
Z.E. 1980. Estudio sinóptico de los tisanóp-
implica su permanencia en el campo durante teros argentinos. Obra del Centenario del
todo el año. Esta característica le permitiría Museo de La Plata 4:91-166.
actuar de puente entre cultivos mantenien- 3. Delle Coste A.C. y Zabala S. 1946. La peste
do el inóculo y proveyendo vectores virulí- negra del tomate o “corcova” del tabaco en
feros a los cultivos de tabaco. De cualquier la República Argentina. Inst. de Sanidad Ve-
manera esta hipótesis debe ser confirmada, getal. 17:23 pp.
y su rol epidemiológico evaluado en compa- 4. Dewey R.A., Semorile L.C., and Grau O.
ración por ejemplo, con el cultivo de lechu- 1996. Molecular diversity of tospovirus
ga, el cual es abundante en la misma zona from Argentina. Acta Horticulturae 431:261.
5. Fawcett G.L. 1938. La corcova del tabaco y
durante la época invernal, es susceptible al
su presencia en las plantaciones de toma-
GRSV y abundantemente colonizada por F. tes. Circular Estación Experimental Agrícola
schultzei. de Tucumán, Argentina. 60:1-10.
6. Feldman J.M., García Lampasona S., Iglesias
CONCLUSIONES V., y Gracia O. 1990. Nuevos hospedantes
del virus de la peste negra del tomate en Ar-
Se determinó al GRSV como la especie de gentina. RIA 22:140-146.
tospovirus causante del corcovo del tabaco 7. Gracia O., De Borbón C.M., Granval de Mi-
en la región del NOA y a F.schultzei como la llan N., and Cuesta G.V. 1999. Occurrence of
especie de trips vector predominante. different tospoviruses in vegetable crops in
Portulaca oleracea, Solanum chacoënse, Cro- Argentina. Journal of Phytopatholy. 147:223-
227.
ton lobatus, Canna sp. y Erichtites hieracifolia
8. Groves R.L., Walgenbach J.F., Moyer J.F., and
fueron las únicas malezas en las que se de- Kennedy G.G. 2002. The role of weed host
tectó la infección de GRSV en los cultivos de and tobacco thrips, Frankliniella fusca in the
tabaco en Tucumán. De estas malezas, mere-
Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 33
epidemiology of Tomato spotted wilt virus. 19. Pappua H.R., Jonesb R.A.C., and Jaind R.K.
Plant Disease. 86:573-582. 2009. Global status of tospovirus epide-
9. Hoddle M.S., Mound L.A., and Paris D. 2008. mics in diverse cropping systems: Successes
Thrips of California. CD-ROM published by achieved and challenges ahead. Virus Re-
CBIT, Brisbane. search 141:219–236.
10. Lima M.F., de Ávila A.C., Resende R. de O., 20. Ramallo A.C. 2008. Relevamiento y evalua-
Nagata T. 2000. Levantamento e identifi- ción de la variabilidad de Tospovirus en cul-
cação de espécies de tospovirus em toma- tivos comerciales y malezas más comunes
teiro e pimentão no submedio do vale São de Tucumán, Argentina. Tesis Doctoral en
Francisco e no Distrito Federal. Summa Ciencias Biológicas, Facultad de Agronomía
Phytopatolica. 26:205-210. y Zootecnia, Univ. Nac. Tucumán.
11. López Lambertini P.M., Helguera P., Figliolo 21. Ramallo A.C. y Ramallo J.C. 2005. Estado ac-
C., Biderbost E., y Ducasse D.A. 1996. Incre- tual de las enfermedades del cultivo de ta-
mento de la especificidad en la determina- baco (Nicotiana tabacum L.) en la provincia
ción de especies de tospovirus mediante el de Tucumán. Avance Agroindustrial, EEAOC.
uso de un antisuero contra la proteína “N” 24:24-27.
recombinante de GRSV. En: V Congreso Ar- 22. Ramallo A.C., Weht S., Ducasse D.A., y Ra-
gentino de Virología. II Encuentro de Virólo- mallo J.C. 2002. Presencia de GRSV (Ground-
gos Latinoamericanos Tandil, Buenos Aires, nut ringspot virus) en cultivos de tabaco (Ni-
Argentina pp 41. cotiana tabacum L.) en Tucumán, Argentina.
12. López Lambertini P.M., Puyané N., Ranieri XI Jornadas Fitosanitarias Argentinas Rio
V., Mata D., Morisigue D., y Ducasse D.A. Cuarto, Córdoba, Argentina. Pag. 112.
2007. Primera identificación del Impatiens 23. Ramallo J.C. 1973. Virus determinados en
necrotic spot virus en begonia en Argentina. cultivos de tabaco en la Provincia de Tucu-
En: 9a Jornadas Nacionales de Floricultura. mán (Argentina). Revista Agronómica del
Salta, Argentina. pp155 . Noroeste Argentino 10:45-59.
13. López Lambertini P.M., Puyané N., Ranieri 24. Ramallo J.C., García A., y Weht S. 1975. Con-
V.V., Marcattini G., y Ducasse D.A. 2009. De- trol químico del vector del corcovo del ta-
tección del Iris yellow spot virus en cultivos baco (TSWV) en la Provincia de Tucumán
de cebolla en Argentina. En: XIII Jornadas Fi- (R.A.). Rev. Agron. N.O. Argent. 12:119-139.
tosanitarias Argentinas, Termas de Río Hon- 25. Ramos M.L., Nome S.F., y Ducasse D.A. 1998.
do, Argentina. E059. Purificación de la proteína N recombinante
14. Marzocca A. 1979. Manual de Malezas. Ed. del aislamiento LP2 del tospovirus Tomato
Hemisferio Sur. Argentina.143-507. spotted wilt virus. En: III Encuentro Latino
15. Monteiro R.C., Mound L.A., Zucchi R.A. Americano de Biotecnología Vegetal. y Red
2001. Espécies de Frankliniella (Thysanop- Latinoamericana de Biotecnología (REDBIO)
tera: Thripidae) de Importância Agrícola no La Habana, Cuba.
Brasil. Neotropical Entomology 1:65-72. 26. Williams L.V., Lopez Lambertini P.M., Shoha-
16. Mound L.A., and Kibby G. 1998 Thysanop- ra K., and Biderbost E.B. 2001. Occurrence
tera: An Identification Guide (2nd edition) and geographical distribution of Tospovirus
CAB. 70pp. species infecting tomato crops in Argentina.
17. Nagata T., Almeida A.C.L., Resende R. de O., Plant Disease 85:1227-1229.
and De Avila A.C. 2004. The competence of
four thrips species to transmit and replicate
four tospoviruses. Plant Pathology 53:136–
140.
18. Palmer J.M., Mound L.A., and Du Heaume
G.J. 1989. Guides to Insects of Importan-
ce to Man No. 2, Thysanoptera CABI ISBN:
085198634X.

34 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


INFORMES ESPECIALES Y TECNOLOGIA

Estimación del tamaño óptimo de parcela experimental para


ensayos de rendimientos de tabaco tipo Virginia
Adriana Elina Ortega
INTA, EEA Salta.
Correo-e: aortega@correo.inta.gov.ar

INTRODUCCIÓN el tamaño de parcela útil pero no el área de


bordes (1) y su determinación debe ser hecha
Los experimentos de campo son el método para cada condición de cultivo y no puede ser
biológico más utilizado y pertinente para dar generalizada para otras situaciones (2).
respuestas al estudio de los problemas teóri- El empleo de parcelas demasiados pequeñas,
cos y prácticos agrícolas; estos deben garan- con un pequeño número de plantas, tiende
tizar datos precisos y veraces. En experimen- a ofrecer resultados sesgados con una in-
tos de tabaco (Nicotiana tabacum L.) tipo fluencia mayor de la heterogeneidad propia
Virginia en el área tabacalera del noroeste del cultivo. El empleo de parcelas grandes
argentino, se utilizan parcelas netas de eva- trae como consecuencia la necesidad de una
luación de rendimiento que generalmente gran extensión de terreno y, por lo tanto, un
tienen dimensiones que oscilan entre 24 y 36 predominio mayor de la heterogeneidad del
m2, dos surcos distanciados a 1,2 m de 10 a suelo que hace disminuir la exactitud del ex-
15 m de longitud y entre 50 y 75 plantas para perimento (12). El tamaño óptimo de parcela
ensayos en manejos convencionales. Con varía con la variable de estudio evaluada en
el fin de promover la sustentabilidad de los cada cultivo (7)
sistemas productivos ha surgido una nueva El tamaño de la parcela se puede determinar
tecnología de manejo conservacionista de utilizando varios métodos como el del error
suelo, con plantación directa de tabaco, en probable, curvatura máxima, procedimiento
la cual se están realizando experimentacio- de Smithy el procedimiento de Hatheway y
nes que tienen parcelas muy variables que Williams. Varios investigadores al calcular el
van de 24 a 150 m2, dos surcos distanciados tamaño de parcelas han usado sus propios
a 1,2 m o 1,5 m (surcos dobles) de 10 m a 50 métodos basados en modificaciones de es-
m de longitud y entre 24 a 250 plantas (13, tos (6, 10, 2).
9). Las variedades y el manejo de cultivo han El tamaño de la parcela experimental tiene
variado a través del tiempo pero las parce- mayor influencia que la forma sobre el va-
las experimentales, en términos generales, lor del coeficiente de variación. Frolov et al.
siguen siendo las mismas. (1977) citado por Pérez Cabrera y Redonet
En experimentación agrícola es necesario de- Ferret (12) proponen, por la comodidad de
terminar el tamaño y la forma adecuados de realizar los trabajos, parcelas rectangulares
la parcela que permita obtener datos de bue- con proporciones múltiplo de 1:4 a 1:10. Se-
na calidad y precisión. Desde los inicios del gún Federer (1963) citado por Escobar Soto
presente siglo se han ensayado una serie de et al. (5) cuando el gradiente en el terreno es
técnicas y procedimientos estadísticos para desconocido, las parcelas rectangulares pro-
la determinación de la unidad experimental ducen en promedio una varianza por parcela
(6, 11). Los métodos disponibles establecen más pequeña que las parcelas cuadradas del

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 35


mismo tamaño Para determinar la forma de puede ser una variable de respuesta válida
la parcela estadísticamente se puede usar la y mejor por la capacidad de detectar meno-
prueba de homogeneidad de la variancia de res diferencias entre los tratamientos y hacer
Bartlett y la prueba de F (6). más económicos y fáciles los ensayos. Cuando
Los ensayos de uniformidad son los más re- la evaluación se hace sobre hoja estufada y/o
comendables para el estudio de tamaños óp- clasificada, los CV obtenidos fueron mayores.
timos de parcela en diversos cultivos (6) Se realiza el presente trabajo con el fin de es-
Para la estimación del tamaño óptimo de tablecer la forma y el tamaño óptimo de la
parcela experimental Escobar Soto (5) em- parcela experimental para llevar a cabo en-
pleó la metodología empleada por Pablos sayos comparativos de rendimiento de taba-
y Castillo (1976) y por Briseño y Castillo, la co tipo Virginia, en manejos convencionales
cual consiste en estimar una ecuación de re- y conservacionistas.
gresión, de la forma CVij= b0 + b1Li + b2Aj
+ b11Li2 + b22Aj2 + b12 LiAj, a partir de los MATERIALES Y MÉTODOS
arreglos de parcelas de diferentes tamaños,
en términos de unidades básicas del ensayo Se realizaron dos ensayos en el campo ex-
en blanco. En esta ecuación de regresión, la perimental de la EEA Salta del INTA, en el
variable dependiente es el coeficiente de va- sitio que se realizan los estudios de tabaco
riación (CVij) y las variables independientes en plantación directa de tabaco (PD) y junto
son el largo (L) y el ancho (A) de las parcelas a los de fertilización en cultivo convencional
de cada arreglo. Para valores fijos del coefi- (CC).
ciente de variación y de número de surcos En PD se estudió un lote de 12 surcos dobles
(ancho de parcela) se calculó la longitud de y plantas a tres bolillos separados a 1,56 m
la parcela experimental, empleando la me- (Figura 1) y en CC de 12 surcos de ancho se-
todología de superficie de respuesta. Esta parados a 1.2 m y en ambos casos de 33 m
metodología es una variación del método de de largo. Fueron divididos en unidades bási-
curvatura máxima. cas (UB) de 1 surco de 1.5 m de largo. Cada
Pérez Cabrera y Redonet Ferret (12) estudia- UB se identificó y se cosechó por separado,
ron el tamaño de las parcelas de experimen- en total fueron 264 UB en cada tipo de ma-
tación de tabaco en Cuba, obteniendo como nejo.
resultado que entre 8 y 120 m2 de tamaño de Se plantó el cultivar PVH09 y el tipo de suelo
parcela se encontraba por debajo del 10% el Ustocrepte udico serie Cerrillos.
coeficiente de variación (CV), que había una La variable medida fue el peso verde de
zona de estabilidad comprendida entre 27 hojas cosechado por UB transformado en
y 90 m2 con un mínimo del 4% de CV y que rendimiento por hectárea usando un factor
fuera de esta zona, con parcelas más chicas medio de 13.7 (% peso de hojas estufadas/
o más grandes se aumentaba el CV. El tabaco peso de hojas verdes) obtenido a partir de
usado fue criollo y con distancia de planta- pruebas pilotos del mismo ensayo en cada
ción de 0,75 m entre surcos y 0,25 m entre cosecha (muestras estufadas).
plantas. Se generaron diferentes tamaños y formas
En varios ensayos realizados en la EEA Salta de parcelas reuniendo UB contiguas en arre-
de INTA (8) se han evaluado diferentes tec- glos desde 1x1 (matriz original) hasta 11 x 12
nologías a través del peso verde y del peso (entre 1,8 y 237,6 m2), y se les asignó a cada
estufado clasificado y siempre estas varia- parcela el rendimiento que resultó de la su-
bles de respuesta se encontraron correlacio- matoria de las UB correspondientes y sin su-
nadas. Así, el peso verde de hoja cosechada perponer parcelas en la sumatoria (siempre

36 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


d a= 10 cm d
a b= 30 cm a
b b
c
c= 51 cm c
d= 39 cm

Diseño: Dr. José Luis Arzeno


Dibujo: Ing. Agr. Josefina Diez
1.20 m

1.56 m

Figura 1. Distribución de plantas y surcos dobles en la parcela experimental de tabaco tipo Virginia en cultivo de planta-
ción directa

fueron unidades independientes). largo (L, en m) y ancho (A, en número de


Para cada uno de los tamaños y formas de surcos) de la parcela experimental de taba-
parcelas generadas se calculó el coeficiente co tipo Virginia en plantación directa con la
de variación (CVij en porcentaje) y se estimó Ecuación 2 (R2= 0.78) y en plantación con-
el tamaño óptimo de la parcela experimental vencional con la Ecuación 3 (R2= 0.79).
utilizando la ecuación de regresión de Esco-
bar Soto (5), Ecuación 1. CV (%)PD = 42.90-1.55*L-4.94*A+0.027*(L)2
+0.202*(A)2+0.0394*A*L Ecuación 2
CVij= b0 + b1 Li + b2 Aj + b11 Li2 + b22 Aj2
+ b12 LiAj Ecuación 1 C V (%)CC = 14.77-0.55*L-1.556*A+0.011*(L)2
+0.081*(A)2+0.0009*A*L Ecuación 3
Donde: Li: Largo de las parcelas (m)
Aj: Ancho de las parcela (números de surcos) A partir del modelo de regresión encontra-
do, para valores constantes del coeficiente
Se realizó la prueba de F del rendimiento en de variación y número de surcos se estimó
relación a la forma de la parcela para cada la longitud de los mismos y con todos estos
tamaño particular evaluado y para cada ma- datos generó una familia de curvas, de tal
nejo de cultivo. manera que para un valor deseado de CV se
Los análisis estadísticos se realizaron con el puede escoger entre varias alternativas de
programa CoHort Software (3). tamaño de parcela, dependiendo de factores
como disponibilidad de terreno, de semilla o
RESULTADOS presupuesto.

Los resultados se presentan en las Ecuacio- DISCUSIÓN


nes 2 y 3, Cuadro 1 y en las Figuras 2, 3, 4 y 5.
No se encontraron diferencias significativas Se determinó que no hay cambios significa-
en la variabilidad del rendimiento en relación tivos en la variabilidad del rendimiento en
a la forma de la parcela para cada tamaño relación a la forma de la parcela para cada
particular evaluado (P>0,05) y para cada ma- tamaño particular evaluado (P>0,05) y para
nejo de cultivo Se estimó la relación entre el cada manejo de cultivo.
coeficiente de variación (CV) y las variables A medida que aumenta el tamaño de la par-

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 37


Cuadro 1. Rendimiento, población de plantas y cantidad de hojas de tabaco tipo Virginia. INTA EEA Salta, campaña
2006-07

Variables Unidades PD CC
Rendimiento Kg/ha 2484 ± 1073 4274 ± 803
Plantas/ha 17385 ± 5754 22722 ± 3667
Población de plantas Plantas/1 surco de 4.07 ± 1.35 4.09 ± 0.66
1.5 m
Cantidad de hojas Hojas /planta 23.7 ± 2.7 23.7 ± 2.7

40 14

35 12

30
10

25
8
CV (%)

CV (%)
20 1
1
6
15 2
2
3 3
10 4
4 4
12 5 5
6
5 7 2 7 12 6
8 8 11
9 9 10
11 10
0 0
0 5 10 15 20 25 30 35 0 5 10 15 20 25 30 35
Largo de surco (m) Largo de surco (m)

Figura 2. Coeficiente de variación (CV) para el rendimiento Figura 3 Coeficiente de variación (CV) para el rendimiento
de tabaco tipo Virginia obtenido en parcelas de diferentes de tabaco tipo Virginia obtenido en parcelas de diferentes
tamaños en un ensayo de plantación directa, INTA, EEA tamaños en un ensayo de plantación convencional, INTA,
Salta, campaña 2006-07. Los números de las líneas en las EEA Salta, campaña 2006-07. Los números de las líneas en
figura corresponden al número de surcos las figura corresponden al número de surcos

Figura 4. Rango de coeficientes de variación (CV) para el Figura 5. Rangos de coeficientes de variación (CV) para el
rendimiento de tabaco tipo Virginia obtenido en parcelas rendimiento de tabaco tipo Virginia obtenido en parcelas
de diferentes tamaños en un ensayo de plantación direc- de diferentes tamaños en un ensayo de plantación con-
ta, INTA, EEA Salta, campaña 2006-07. vencional, INTA, EEA Salta, campaña 2006-07.

38 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


cela disminuye el CV. Con las dimensiones y los ensayos de uniformidad, guía de estu-
estudiadas de la parcela se llegó a la estabi- dio para ser usada como complemento de la
lización del mismo tanto para el número de Unidad Audiotutorial sobre el mismo tema.
surcos como para su longitud a los 21 m de Contenido científico: Escobar, JA. Produc-
ción: Ospina HF. CIAT (Serie A4SB-03.02).
largo y a los 9 surcos de ancho. En el caso de
Cali, Colombia. 24 p.
PD el CV fue de alrededor de 4.5 % y para el
2. Cocco C., Augusti Boligon A., Andriolo J.L.,
cultivo convencional de 1.8 %. Silva Oliveira C. e Homrich Lorentz L. 2009.
Se observó mayor variabilidad en los rendi- Tamanho e forma de parcela em experimen-
mientos para el ensayo de PD. En la parcela tos com morangueiro cultivado em solo ou
comúnmente utilizada en CC, con un tamaño em hidroponia. Pesquisa agropecuária brasi-
de 2 surcos de 10 m de longitud, se estima leira, Brasília, 44 (7): 681-686.
un CV de 7.56% para convencionales y 21.8 3. CoHort Software. 1998-2005. CoStat and
% para PD si se evaluaran lo ensayos en peso CoStat Pro Manual, Version 6.311, Graphics
verde de hojas. La variabilidad relativa resul- and Statistics Software for Scientists and En-
tó cerca de 2,6 veces mayor en PD que en CC. gineers.
4. Escobar Soto C. 1981. Estimación del tama-
La parcela en PD debe ser más grande que la
ño óptimo de parcela experimental para en-
de CC para obtener el mismo coeficiente de
sayos de rendimientos con maiz (Zea mays.
variación en los ensayos. L.). Revista Facultad Nacional de Agronomía,
El tamaño de las parcelas de experimenta- Medellín. 34 (1): 31-36.
ción que se encontraba por debajo del 10% 5. Escobar Soto C., Buitrago A.I. y Jaramillo G.J.
CV en PD fueron las de 4 o más surcos y ma- 1990. Tamaño de parcela experimental y nú-
yores a 40 y 93 m2 (12 a 4 surcos respectiva- mero de repeticiones para ensayos de rendi-
mente) y en CC fueron las de 3 o más surcos y miento con caupí, Vigna ungiculata (L) Walp.
mayores a 7,2 m2 y las de menos de 3 surcos Revista Facultad Nacional de Agronomía,
mayores a 10,8 m2. Medellín, 43 (1Y 2): 73-91.
Valores similares fueron encontrados por 6. Mamani Arias L. 1971. Determinación del ta-
maño, forma y repetición de la parcela para
Pérez Cabrera y Redonet Ferret (12) para CC
ensayos de rendimiento en frijol (Phaseolus
pero con valores más del doble para el mí-
vulgaris L.). Tesis de Magister Scientiae del
nimo del CV; valores éstos, semajantes a los Instituto Interamericano de Ciencias Agríco-
de PD. las de la OEA, Centro Tropical de enseñanza e
Con las ecuaciones obtenidas en el presente investigación, Dpto de Cultivos y suelos tro-
trabajo el experimentador podrá estimar los picales. Turrialba, Costa Rica. 83 pp.
CV % esperados según los diferentes anchos 7. Meneses Márquez I., Villanueva Verduzco C.,
y largos de parcelas seleccionadas. Esto per- Mejía Contreras J.A., Molina Galán J.D. y Mi-
mite trabajar flexiblemente, fijando su máxi- randa Colín S. 2006. Tamaño óptimo de par-
mo nivel de variación aceptado y obtenien- cela en calabaza asociada con maíz. Revista
do varias combinaciones de forma y tamaño Chapingo. Serie Horticultura, Universidad
Autónoma de Chapingo, México, enero-ju-
de parcela para estimar rendimiento. A esta
nio, 12 (001): 27-31.
parcela se le deberán agregar las borduras
8. Ortega A. 1997-2012. Informes de ensa-
consideradas necesarias según los factores yos de fertilización de tabaco tipo Virginia.
en estudio. Proyectos PROSIS, PR SALJU 09, PR SALJU
320122. INTA EEA Salta.
BIBLIOGRAFÍA CITADA 9. Ortega, A. 2009. Producción y manejo sus-
tentable de sistemas tabacaleros en los va-
1. CIAT (Centro Internacional de Agricultura lles templados de Salta y Jujuy. Proyecto Re-
Tropical). 1982. La heterogeneidad del suelo gional INTA, EEA Salta, SALJU-320122.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 39


10. Párraga J.. Carlos E. y Franklin Chacín L. 2000. AGRADECIMIENTOS
Comparación de metodologías univariadas
en la determinación de unidades experimen- Se agradece al Ing. Agr. Manuel Alfaro por el
tales de campo: renglón maíz (Zea mays L.) cultivo de tabaco, al Agr. Gregorio Viñabal y
Revista de la Facultad de Agronomía, Mara-
a los auxiliares de campo por su dedicación
cay, 26:175-190.
en las tareas de toma de datos y al Ing. Agr.
11. Peiretti D.A., Biderbost E.B., Carreras J.J. y
Nazar M.C. 1990. Tamaño y forma de la par- Fernando Ledesma por su colaboración en
cela experimental de ajo (Allium sativum L.) las evaluaciones y en la organización de da-
Revista de Ciencias Agropecuarias, Córdoba, tos. Se agradece al Dott. Giampaolo Zanin de
Argentina, VII: 45-48. la Universidad de Padua por su ayuda para
12. Pérez Cabrera O. y Redonet Ferret J.L. 2005. realizar el análisis estadístico de los datos. Se
Significación del tamaño de la parcela en la agradece el apoyo como Jefa de Grupo a Ma-
precisión de las investigaciones con el cultivo ría Elena Toncovich, a Silvia Sühring por la co-
del tabaco. Cuba Tabaco 6 (1 y 2): 42-46. rrección del escrito y a Carolina Sánchez por
13. Toncovich ME. 2006. Proyecto Regional de el asesoramiento en el diseño experimental.
Producción y Manejo Sustentable en los Va-
Financiado por INTA – Proyecto Regional de
lles Templados de Salta y Jujuy. Proyecto Re-
Tabaco (SALJU 09)
gional INTA, EEA Salta, SALJU09.

Comportamiento de variedades de tabaco Virginia en la localidad de


Chicoana (Salta)
María Elena Toncovich1, Juan Galli1, Josefina Diez1, José Sulca1 y Alejandra Guaymás2
1-INTA, EEA Salta. 2-Productora tabacalera
Correo-e: mtoncovich@correo.inta.gov.ar

INTRODUCCIÓN En la cadena de valor tabacalera la primera


clasificación del producto se realiza a nivel
El tabaco es el cultivo industrial no alimen- de finca, luego que la hoja ha sido cosechara
tario líder en el mundo, debido a su gran y estufada. El tabaco tipo Virginia comienza
adaptabilidad a las diferentes condiciones a madurar cuando las hojas verdes pierden
climáticas y de suelos. Por ello, se cultiva en color y se transforman en hojas amarillo-
más de cien países distribuidos en todos los verdosas. A medida que las hojas maduran
continentes (3). En Argentina, la industria del son cosechadas en lotes de 3 a 5 hojas por
tabaco representa una importante actividad planta por cosecha (12). La cosecha es una la-
en términos productivos, económicos y so- bor que debe realizarse respetando la opor-
ciales para las distintas economías regiona- tunidad para obtener una buena calidad de
les. En la campaña 2009/10 el ingreso bruto producto. Implica un elevado costo en mano
por ha de tabaco fue 2,91 veces superior al de obra, empleándose 26 jornales/ha por lo
poroto blanco y 9,51 veces más que la soja. El que generalmente se debe contratar mano
72.53% del tabaco producido es de tipo Vir- de obra extrapredial (7).
ginia y se cultiva principalmente en las pro- Una vez cosechada la hoja se inicia el proce-
vincias de Salta y Jujuy (8). so de curado, el mismo tiene dos objetivos

40 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


principales. Primero, crear condiciones de MATERIALES Y MÉTODOS
temperatura y humedad para ayudar a que
se produzcan en la hoja los cambios químicos Descripción general del ensayo
y biológicos deseados. Segundo, conseguir Dentro de la serie de Ensayos de Variedades
que la hoja, por medio de un secado ade- con tabaco tipo Virginia se realizó por segun-
cuado, pueda mantener su calidad potencial. do año consecutivo, campaña 2009-2010, la
Curar es algo más que un simple secado, im- evaluación de variedades en la localidad de
plica cambios químicos y físicos, que son ne- Chicoana (Finca Los Los).
cesarios para obtener tabaco de alta calidad De las 11 variedades ensayadas (Cuadro 1),
(4). El primer proceso de curado realizado dos son variedades de INTA conservadas en
por el productor tiene como objetivo preser- el Banco de Germoplasma del INTA EEA Sal-
var las hojas de tabaco al generar, vía calor, ta (BANOA) y nueve son comerciales (9). Las
condiciones organolépticas adecuadas para variedades comerciales utilizadas represen-
conservar la calidad potencial de la hoja (8). tan el 90 % de las cultivadas por los produc-
Posteriormente el productor realiza una pre- tores en la campaña 2009/10.
clasificación de las hojas y las dispone en Cabe destacar que en la mencionada campa-
fardos de 45/50kg según calidad y posición ña se continuó evaluando la variedad PVEH
foliar que serán entregados en las acopiado- 206, con el nombre de PVH 2248. Este cam-
ras (4). El precio de cada fardo va a depender bio de nombre se debió a que dejó de ser
de la calidad del mismo de acuerdo al patrón una variedad experimental para ser una va-
tipo establecido por el Ministerio de Agricul- riedad comercial. Se dejó de trabajar con las
tura Ganadería y Pesca en la Resolución Nº variedades NC 471, NC 196 y PVEH 189, en
1102-1994. En dicho patrón se consideran el caso de ésta última el semillero de origen
diferentes grados de calidad de acuerdo al dejó de desarrollarla.
color de la hoja, intensidad del mismo, la es- Las plántulas utilizadas para el transplante
tructura foliar, cantidad de aceite, cuerpo y fueron realizadas en almácigos flotantes en
largo de la hoja, porcentaje de tolerancia en el INTA EEA Salta, siguiendo el cronograma
manchas, % de faltante de lámina y unifor- operativo y el protocolo de almácigos flotan-
midad. tes (2). El transplante se realizó el 6/10/09.
Existe escasa información disponible con res- El ensayo fue fertilizado con 800 kg/ha de
pecto a la respuesta de variedades en cuan- Hidrocomplex (12-11-18) como base al mo-
to a su rendimiento y calidad, la mayoría de mento de rayar y el repique se aplicó al mo-
las evaluaciones realizadas con diferentes mento del trasplante con 300 kg/ha utilizan-
variedades de tabaco estudian la resistencia
Cuadro 1. Variedades de tabaco tipo Virginia.
o tolerancia a diferentes factores bióticos y
formas de curado (1, 11, 12). Las especies Variedad
cultivadas llevan información, adquirida du- IC 69 (BANOA 51)
rante su evolución y mejora, que definen su IC 91 A (BANOA 50)
comportamiento en campos agrícolas (6). PVH 2299
Esta información está contenida en el ma- PVH 2248
PVH 2241
terial genético, es por ello que el presente
PVH 2254
trabajo tiene como objetivo evaluar el ren- PVH 2291
dimiento cultural, económico y la adaptación MB 47
de un conjunto de variedades y selecciones MB 37
de germoplasma bajo determinadas condi- K 394
ciones ambientales en Chicoana (Salta). K 326

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 41


do el mismo fertilizante, de acuerdo a los Muestreos, determinaciones y estimacio-
resultados obtenidos en el análisis de suelo. nes
Cuando las variedades llegaron al estado de Muestreos y determinaciones en planta
botón floral se realizó el desflore manual Se realizaron mediciones fenométricas sobre
acompañado con aplicaciones de desbrota- cinco plantas de cada unidad experimental.
dor y aceite graso. Se les midieron entre otras variables, la altu-
La cosecha del ensayo se realizó de manera ra del tallo principal (desde la base hasta la
escalonada en función de la madurez del cul- inserción de la última hoja de 15 cm de lar-
tivo en cada tratamiento. go) y el número de hojas. Estas mediciones
Las hojas cosechadas se curaron en las es- se realizaron cuando el 20 % de las plantas
tufas del productor Esteban Pérez Kralik y la de la unidad experimental presentaron bo-
clasificación y pesado se realizó en el predio tón floral.
del INTA EEA Salta. La cosecha se realizó en forma escalonada
semanalmente. Cada corte fue pesado en
Diseño experimental verde y luego curado. Los diferentes cortes
El diseño fue en bloques completos al azar fueron clasificados según las reglamentacio-
con tres repeticiones (Figura 1). Las unidades nes del Patrón Oficial y las clases obtenidas
experimentales correspondientes a cada va- fueron pesadas cada una por separado.
riedad fueron dos surcos separados a 1,20 m
entre ellos y de 12 m de largo. El marco de Estimación
plantación utilizado fue de 1,20 m por 0,40 Para el cálculo del ingreso bruto de las dife-
m entre plantas, totalizando 60 plantas por rentes variedades se consideraron los distin-
unidad experimental. La superficie total del tos cortes realizados para determinar la po-
ensayo, incluyendo borduras y pasillos fue de sición de cada uno de ellos. Se detalla en el
2.433,6 m2. cuadro 2, la posición que se estableció para
cada corte.

Altura de planta (cm) Nº de hojas

200
Altura
a Nº de hojas 30
150 b b b b b
b b b b
b 20
100 a
d b b
c d b b c c b b b
c c d c 10
50 d d
d d

0 0
IC91A PVH K 394 PVH PVH MB 47 PVH PVH MB 37 K 326 IC69
2291 2254 2299 2241 2248

Variedades

Figura 1. Altura de planta y número de hojas para diferentes variedades de tabaco tipo Virginia en el departamento Chi-
coana, Salta.
Letras diferentes indican diferencias estadísticamente significativas entre variedades (p<0,05).

42 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


Cuadro 2. Posición de hojas de tabaco y número de cortes RESULTADOS Y DISCUSIÓN
durante la cosecha de la campaña 2009/10

La variedad PVH2299 fue la que presentó


Posición de la hoja Cortes
Bajera 1, 2 y 3 mayor altura y número de hojas (, dentro
Mediana 4, 5 y 6 de los híbridos de Profigen es uno de los
Superior 7y8 que ofrece el más alto potencial para la pro-
ducción de ésta última variable (10). Si bien
Se utilizó la tabla de precios de la campa- entre las restantes variedades se observa-
ña 2009-2010 para calcular el ingreso bruto ron diferencias significativas en la altura de
por venta del tabaco cosechado (incluyendo plantas, el número de hojas fue similar para
el negro y gris). Se tomó como referencia el todas (Figura 1).
precio de la clase B1F de $13,38/kg de taba- Con respecto al peso fresco, las variedades
co Virginia. En el caso del scrap, que no reci- PVH2299 y PVH2291 fueron las de mayor
ben las empresas acopiadoras, se consideró producción, aunque también se destacaron
como valor indicativo $ 2,40 por kg. las variedades PVH2241, PVH2254, K394,
K326 e INTA Cerrillos 69 (IC69) (Figura 2).
Análisis estadístico Las variedades evaluadas presentaron simi-
El comportamiento de las diferentes va- lar rendimiento (Figura 3), a pesar de que en
riedades se evaluó mediante un análisis de peso fresco se observó que las variedades
varianza (ANOVA), teniendo en cuenta en PVH2299 y PVH2291 superaron a las otras
las variables fenométricas el submuestreo en un 15% aproximadamente. Teniendo en
y considerando como covariable el número cuenta que la hoja curada presenta aproxi-
de plantas por unidad experimental. Las me- madamente un 16% de humedad se puede
dias de los tratamientos fueron comparadas inferir que las hojas de estas dos variedades
por el test de mínima diferencia significativa presentan mayor contenido de agua.
(LSD) (p<0,05). El programa utilizando para el La producción de hojas naranjas no se dife-
análisis fue Infostat (5). renció entre los diferentes materiales genéti-

Peso fresco (kg/ha)


40000

a
30000 a ab
ab
b b ab ab ab b
b
20000

10000

0
MB 37 PVH PVH K 394 PVH IC69 PVH PVH MB 47 K 326 IC91A
2248 2241 2254 2299 2291
Variedades

Figura 2. Peso fresco para diferentes variedades de tabaco tipo Virginia en el departamento Chicoana, Salta.
Letras diferentes indican diferencias estadísticamente significativas entre variedades (p<0,05).

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 43


Rendimiento(kg/ha)

8000
Limón
Naranja
Rendimiento
Ingreso

6000 a a a
a
a a a
a a
a a

4000
a a
a a a
a a a
a a a

a
2000 bc ab
bc b bc bc
bc bc bc c
a a a
a a a
a a
a a a

0
MB 37 PVH PVH K 394 PVH IC69 PVH PVH MB 47 K 326 IC91A
2248 2241 2254 2299 2291

Variedades
Figura 3. Rendimiento, producción de hojas naranja y limón e ingreso para diferentes variedades de tabaco tipo Virginia
en el departamento Chicoana, Salta.
Letras diferentes indican diferencias estadísticamente significativas entre variedades (p<0,05).

MB 47
100
IC91A PVH 2299
80

60

IC69 MB 37
40

20

K 326 PVH 2248

PVH 2291 PVH 2241

PVH 2254 K 394

Figura 4. Cosecha acumulada para los distintos cortes (%) de diferentes variedades de tabaco tipo Virginia en el departa-
mento Chicoana

44 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


cos, mientras que en hojas limón la variedad cured. Principios básicos de su cultivo y cu-
IC69 fue la que se destacó. Estos resultados rado. Versión española de H Perez Carbonell
muestran que esta variedad sigue destacán- y E Cabrera Martínez. Secretaría General
dose por la producción de este tipo de hoja Técnica.Ministerio de Agricultura, Pesca y
Alimentación, Madrid. 408pp.
(Figura 3).
5. InfoStat. 2008. Grupo InfoStat, FCA, Univer-
El ingreso económico entre variedades no
sidad Nacional de Córdoba, Argentina.
presentó diferencias significativas (Figura 3), 6. Loomis R.S. y Connor D.J. 2002. Ecología de
sin embargo se debe destacar que las medias cultivos. Productividad y manejo en sistemas
de las variedades de mayor ingreso llegan a agrarios. Mundiprensa. España. 591pp.
superar en un •30% a las de menor ingreso. 7. Nadir A., Osinaga R., Zapater M.A. y Mattalia
La proporción de hojas entregadas en los di- M.C. 2004. Diagnóstico para el programa de
ferentes cortes muestra que la variedad IC69 desarrollo para pequeños productores taba-
es la que se entrega más rápidamente ya que caleros. Administración Fondo especial del
en el quinto corte se cosechó aproximada- tabaco, Secretaría de la producción. Salta,
mente el 65% de la producción. El comporta- Argentina.
8. Ministerio de Agricultura, Ganadería y Pes-
miento de las restantes variedades fue simi-
ca de la Nación. 2011. Impacto regional del
lar (Figura 4). En la zona de estudio el período
convenio macro para el control del tabaco.
de cosecha coincide con las precipitaciones 1a ed. Buenos Aires. Ministerio de Agricultu-
estivales, por lo que esta característica po- ra Ganadería y Pesca de la Nación. 112pp.
dría beneficiar el ingreso por ser este cultivo 9. ProfiGen do Brasil Ltda.2008. Semillas de Ta-
muy sensible al exceso de humedad. baco con valor agregado. 6pp.
Los resultados obtenidos representan un 10. ProfiGen do Brasil. Sementes de Tabaco.
aporte de una campaña evaluada de la red http://profigen.com.br/1/jornal/s/1/1. Visi-
de ensayos del comportamiento de Varieda- tada en Septiembre de 2013.
des de Tabaco Virginia en diferentes locali- 11. Przybys M. 2011. Amino acid sequence of
dades del área de influencia de la EEA Salta. virus protein genome-linked (VPg) of pota-
to virus Y (PVY) influences on overcoming of
tobacco resistance CORESTA Meeting Agro.-
AGRADECIMIENTOS
Phyto Groups, Santiago de Chile. 31pp.
12. Rodríguez Marrero Y., Pino Pérez L.A., Ca-
Agradecemos la colaboración de los auxilia- brera Esmory M. y Torrecilla Guerra G. 2012.
res de campo por su buena disposición en la Líneas promisorias de tabaco negro resisten-
toma de datos y seguimiento del cultivo. tes a la necrosis ambiental y a las principales
enfermedades para la región central y orien-
BIBLIOGRAFÍA CITADA tal de cuba. Cuba Tabaco Vol. 13, No. 1,
13. Tso T.C. 1990. Production, Physiology, and
1. Crespo Romero J.A., Dominguez Molina M., Biochemistry of Tobacco Plant. Institute of
Torrecilla Guerra G. 2012. Comportamiento International Development & Education in
de variedades de tabaco y especies del gene- Agricultural and Life Sciences (Maryland,
ro Nicotiana al Virus del Grabado del tabaco, USA). 753pp.
Virus del Mosaico del tabaco y Virus Y de la
papa. Cuba Tabaco. Vol. 13, No. 1,
2. Galli J. 2009.Guía de Producción de Almáci-
gos Flotantes. INTA CRS-J. EEA Salta.
3. González Martín J.A. 2001. La hoja de tabaco
y su consumo. Prevención del Tabaquismo. 3
(4):257-261.
4. Hawks S.N., Collins W.K. 1986. Tabaco flue-

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 45


Desarrollo de sustratos para almácigos flotantes de tabaco
Carlos Herrando1, Susana Krieger1, Silvia Gómez1, María E. Acosta1 y Fernando Lacci2
1-UNSa Facultad de Ciencias Naturales, Salta. 2- EEA INTA-Cerrillos Salta.
Correo-e: herrando@unsa.edu.ar

INTRODUCCIÓN entre el agua retenida y la aireación en el


medio de crecimiento, es un aspecto esen-
De las exportaciones de productos primarios cial. Por otra parte el sustrato debe ser lo
correspondientes a la provincia de Salta, el suficientemente pesado (densidad aparente)
tabaco ocupa el tercer lugar luego de la soja para mantener la planta en posición vertical,
y las legumbres (4). y al mismo tiempo sin exceso de peso que
Los sustratos utilizados para la obtención de dificulte el manipuleo de las plantas e incre-
plantines de tabaco en almácigos flotantes, mente los costos de transporte (6). Desde
están formulados en base a turba, material el año 2007 se investiga la utilización de los
no renovable y de elevado costo (1,12). Ac- compost de bagazo y cachaza provenientes
tualmente se trabaja en la búsqueda de ma- de la industrialización de la caña de azúcar,
teriales locales renovables, de buena calidad y en mezclas combinados con otros abonos
y de costo accesible, que permitan sustituirla (urea, vermicompuesto), para la formulación
parcial o totalmente. Los compost en base a de sustratos alternativos en la producción de
fibra de coco, cáscara de arroz, chips de ma- plantines sin suelo, o como componentes de
dera, lombricompuesto y corteza de pino, sustratos orgánicos, en bandejas flotantes o
representan alternativas viables para la for- apoyadas (7,8).
mulación de sustratos (11). El objetivo de este trabajo fue comparar el
El compostaje es una técnica amigable con crecimiento y desarrollo de plantines de ta-
el ambiente, que permite transformar los re- baco en sustratos formulados en base a com-
siduos orgánicos en un producto que puede post de bagazo y cachaza, frente a un testigo
ser usado en la agricultura principalmente comercial de turba.
como abono orgánico, enmienda orgánica, o
sustrato de cultivo. El contenido de nutrien- MATERIALES Y MÉTODOS
tes, materia orgánica, pH y conductividad
eléctrica de los compost son parámetros va- La preparación de los compost se realizó con
riables, pero fundamentales para determinar bagazo y cachaza, cuyas características físicas,
su uso en la formulación de sustratos. Por químicas y biológicas constan en el cuadro 1.
otro lado, la presencia de microorganismos Se compostaron los residuos de bagazo y
incrementa y favorece el desarrollo de la ac- mezclas de bagazo con cachaza en diferentes
tividad biológica y el efecto supresor de algu- proporciones, en pilas de volteo de 3 m3 cada
nos patógenos (2,5). una, cuatro por cada compost, formando un
Los sustratos usados en la producción de cuadro equidistante a fin que en cada volteo
plantas en recipientes tienen la función de que se realiza cada 10 a 15 días, se unan de
proveer soporte físico, a la vez de proporcio- a dos. Esto se debió a que la pila decrece en
nar agua, aire y nutrientes para el apropiado tamaño (de 1,5 m de alto, se reduce a 1 m
funcionamiento de las raíces. El equilibrio aproximadamente) debido a su descomposi-

46 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


Cuadro 1. Propiedades físico-químicas de las materias Luego de la caracterización físico-química de
primas del compost
los diferentes compost obtenidos en la plan-
Propiedades Bagazo Cachaza ta de compostaje de la Universidad Nacional
Físicas de Salta (UNSa), se seleccionó el compost ba-
Da (g /cm3) 0,07 0,5 gazo 100% y las mezclas de bagazo-cachaza
Químicas 90:10 y 95:5 por presentar características or-
M. O. (%) 64 21 ganolépticas adecuadas, una conductividad
Nitrógeno (%) 0,24 1,73
Fósforo (%) 1,82 0,14
eléctrica y un pH posibles de ser corregidos
Potasio (%) 0,28 1,20 dentro de los valores extremos de bagazo
Sodio (%) 0,02 0,02 100% y bagazo-cachaza 85:15. Cuadro 2.
Calcio (%) 0,45 1,75 Maduración
Magnesio (%) 0,18 1,70
Relación C:N 133:1 6:1 Cuadro 2. Propiedades físico, químicas y biológicas de
CE* (mS/cm.) 0,5 7,7 compost extremos en pH y CE
pH 7,6 7,5
Propiedades Bagazo 100% Ba-Ca 85:15 %
ción, mediante la cual se eliminan gases a la Físicas
atmósfera, como dióxido de carbono (CO2), Da (g /cm3) 0,10 0,20
vapor de agua (H2O) y amoníaco (NH3). CHS* (%) 620 110
Químicas
Esta técnica (cuatro pilas del mismo com-
Materia Org. (%) 82,9 62,1
post) facilitó el volteo, homogeneizó el ma- Nitrógeno total (%) 0,51 0,75
terial compostado parcialmente, mezclando Fósforo total (%) 0,15 1,02
las partes expuestas a la superficie frías, con Potasio total (%) 0,30 1,02
las del núcleo (termófilo) y con aquellas zo- Sodio total (%) 0,01 0,02
nas bajas con características indeseables por Calcio total (%) 1,31 1,77
Magnesio total (%) 0,34 1,34
exceso de humedad. Luego del primer volteo Relación C:N 81:1 61:1
de las pilas, durante el segundo y tercero se CE** (mS/cm.) 0,5 1.20
unieron de a dos, de manera de mantener pH 7,5 8.0
una pila única de 3 m3. Biológicas
Las proporciones de materias primas a com- Coli. tot (NMP/g) 4 90
Coli fecal (NMP/g) Ausencia Ausencia
postar fueron:

1. Bagazo 100 % Los compost mezclas se almacenaron en dis-


2. Bagazo 95 % + Cachaza 5 % tintos estados de maduración para su uso es-
3. Bagazo 90 % + Cachaza 10 % pecífico en bandejas flotantes.
4. Bagazo 85 % + Cachaza 15 % Estabilización, corrección pH y conductividad
5. Bagazo 100 % + Urea (4 kg en la pila) eléctrica
6. Bagazo 90 % + Vermicompuesto 10% Una vez obtenidos los compost, se corrigie-
ron el pH y la conductividad eléctrica por
Manejo del compostaje medio de lavados con agua y ácido fosfórico
Se basó en el monitoreo del proceso durante (H3PO4) a valores aptos para el crecimiento y
las etapas mesofílica y termofílica, con vol- desarrollo de los plantines. Se colocaron en
teos, humectación y aireación. Se siguió la di- la mezcladora, en una proporción de 50 l de
námica del proceso térmico observando las compost mezclas con 60 l de agua (conducti-
poblaciones microbianas en sus diferentes vidad eléctrica conocida). Se agregó entre 10
etapas, las que aseguran la “pasteurización” a 20 cm3 de H3PO4 por cada lavado, según el
termófila. pH medido hasta lograr un pH aproximado

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 47


de 6 a 6,5 y una conductividad eléctrica por ratorio San Pablo. Se semillaron las bandejas
debajo de 0,40 dS/m. Cuadro 3. flotantes con semilla peleteada de tabaco
Luego de 15 a 20 min. de batido, se vació la Virginia variedad K 394.
Cuadro Nº 3. Conductividad eléctrica y pH inicial - final del
El ensayo fue llevado a cabo en un diseño
compost corregido. de bloques completos al azar, con seis tra-
tamientos y tres repeticiones, dónde cada
Compost Conductividad eléctrica unidad experimental estaba compuesta por
mS/cm pH
INICIAL FINAL INICIAL FINAL
bandejas de 288 celdas cada una. El manejo
Ba 100% 0,50 0,48 7,5 6.0 de las piletas fue llevado a cabo según proto-
Ba-Ca 90:10 0.90 0.54 7.8 6.4 colo EEA INTA (9), sin aplicaciones fitosanita-
Ba-Ca 95:5 0.75 0.50 7.6 6.2 rias de base, procurando mantener la recir-
culación continua del agua.
mezcladora filtrando con una malla de 2 mm. Se evaluaron las siguientes variables de res-
Posteriormente se colocó el compost mezcla puesta:
en una centrífuga para eliminar el excedente
de agua, hasta lograr un 50% de humedad. 1. Celda seca: indica problemas físicos del
Formulación de sustratos sustrato (formulación).
Se procedió a formular los sustratos con 2. Raíz espiralada: indica problemas de
(inertes) perlita expandida (20%), vermiculi- conductividad eléctrica y pH del sustra-
ta media (10%) y gruesa (10%), para conseguir to.
las características físicas, químicas y biológi- 3. Malezas: indica problemas de manejo
cas que permitieron utilizarlos en ensayos co- del compost (pasteurización)
merciales en la EEA INTA Salta y COPROTAB. 4. Altura al cogollo: indica uniformidad del
Se formularon los sustratos con inertes, en las plantín al desmoche.
siguientes proporciones (Tratamientos): 5. Diámetro de tallo: indica grosor del tallo
(resistencia del plantín al trasplante).
1. Bagazo 100 % (60 % + Inertes 40%) 6. Altura de planta: indica apariencia del
2. Bagazo 100 % (60 % + Inertes 40%) tra- plantín al desmoche.
tado con vapor 7. Número de hojas al trasplante: indica
3. Bagazo 95 % + Cachaza 5 % (60 % + Iner- crecimiento y desarrollo del plantín.
tes 40 %) 8. Peso seco total de planta útil: la materia
4. Bagazo 90 % + Cachaza 10 % (50 % + seca total nos indica mayor masa vege-
Inertes 50 %) tal por PGPM
5. Testigo turba comercial 9. Plantas útiles: plantas por bandeja aptas
para el trasplante.
Ensayo
El ensayo comparativo para evaluar la in- Las variables que expresan cantidad, como
fluencia de distintos sustratos en el creci- celda seca, raíz espiralada, malezas y plantas
miento y desarrollo de plantines de tabaco útiles al transplante, se cuantificaron en por-
se realizó en el invernadero de la EEA INTA centajes.
Salta, en el marco del convenio UNSa-INTA, Para las variables que expresan calidad de
Previamente los sustratos fueron inocula- plantín, se llevó a cabo el análisis de la va-
dos con un microorganismo promotor del rianza (ANOVA) y para las comparaciones en-
crecimiento vegetal (Azospirillum brasilense) tre tratamientos se utilizó el test de Tukey,
PGPM y un biocontrolador (Trichoderma viri- con un nivel de significancia de α= 0,05. El
de), ambos productos comerciales del Labo- software utilizado fue el Infostat.

48 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


RESULTADOS to bagazo-cachaza 90:10 y la turba comercial
presentaron una altura promedio significati-
Celda seca. Los sustratos en base a bagazo vamente mayor con respecto a los otros sus-
100 % (3,47%) y tratado con vapor (3,93%) tratos (Figura 2).
junto a la turba comercial (3,01%), presenta- Diámetro de tallo. Existen diferencias signifi-
ron valores de celdas secas similares entre si, cativas entre los sustratos; el bagazo-cachaza
e inferiores al bagazo-cachaza 90:10 (5,78%) 90:10 y testigo comercial presentan valores
y 95:5 (4,51%) (Figura 1). superiores a bagazo 100% y bagazo-cachaza
Raíz espiralada. Se verificó que en los sustra- 95:5 (Figura 2).
tos ensayados el número de plantas con raíz Altura al cogollo. El bagazo-cachaza 90:10 y
espiralada fue diferente. El bagazo-cachaza la turba comercial no presentan diferencias
90:10 presentó el menor valor (1,27%) con significativas entre sí (α=0,05), aunque se ob-
respecto al resto de los sustratos (Figura 1). servan diferencias con respecto a los sustra-
Malezas. El sustrato bagazo 100 % tratado tos bagazo 100%, bagazo tratado con vapor
con vapor no registró aparición de malezas, y bagazo-cachaza 95: 5 (Figura 2).
mientras que los porcentajes en el resto de Número de hojas. No existen diferencias sig-
los sustratos fueron relativamente bajos nificativas entre los sustratos (α=0,05) (Figu-
(0,12% a 1,50%) (Figura 1). ra 2).
Plantas útiles. El total de plantas útiles al Peso seco total. No hay diferencias signifi-
trasplante de todos los sustratos ensayados, cativas (α=0,05) entre los sustratos bagazo
fue mayor al 94% en relación al número de 100%, bagazo-vapor, bagazo-cachaza 95:5 y
plantas posibles (Figura 1). 90:10. El peso seco total de los plantines de
Altura de planta. Existen diferencias signifi- la turba comercial es significativamente infe-
cativas entre los sustratos (α=0,05). El sustra- rior a los sustratos de bagazo (Figura 2).

100.0 96.5 96.1 95.5 97.0


94.2
90.0
80.0

70.0
60.0

50.0
40.0

30.0
20.0
8.7 6.8
10.0 3.5 3.9 4.1 4.5 5.8 3.0 3.4
0.3 0.0 1.5 1.3 1.3 0.1
0.0
Bagazo 100 % Bagazo 100 % Ba95%+Ca5% Ba90%+Ca10% Turba comercial
Vapor

Celdas secas Raiz espiralada Maleza Planta útiles

Figura 1. Plantas útiles de tabaco al trasplante según sustratos.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 49


16.0

14.0
c c

12.0
b
10.0
a a
8.0
c
6.0 a a a a a
a b bc bc c
4.0 ab a
a
a
2.0
b b ab b a
0.0
Bagazo 100 % Bagazo 100 % Ba95%+Ca5% Ba90%+Ca10% Turba comercial
Vapor

Altura de planta Diámetro de tallo Altura al cogollo Número de hojas Peso seco

* Medias seguidas con una misma letra en cada columna no son significativamente diferentes (p≤0,005)

Figura 2. Altura de plantas, diámetro de tallo, altura al cogollo, número de hojas y peso seco total de plantas de tabaco, en
función de los tratamientos (sustratos).

DISCUSIÓN podrían retrasar el desarrollo del plantín


(energía germinativa, nutrición, pH, conduc-
Los trabajos de compostaje con residuos tividad eléctrica, compactación, condiciones
derivados de la industria azucarera para la ambientales y mal manejo entre otros), por
formulación de sustratos para almácigos flo- lo que la diferencia encontrada del sustrato
tantes en la obtención de plantines de taba- bagazo-cachaza 90:10 se puede atribuir al
co, representan una alternativa nueva, por mayor porcentaje de cachaza que provee de
lo que es difícil encontrar antecedentes; por nitrógeno, fósforo y potasio.
lo tanto nuestra discusión se centrará en el Respecto a las variables celda seca, raíz espi-
análisis de las variables evaluadas en esta ralada, malezas y plantas útiles, si bien existen
primera fase de experimentación. valores superiores de celda seca en el sustra-
La variable cualitativa peso seco total me- to bagazo-cachaza 90:10 y raíz espiralada en
dido en gramos es mayor en los sustratos el bagazo-cachaza 95:5, los que en un primer
inoculados con PGPM que en el testigo co- momento pudieron retrasar el desarrollo del
mercial en base a turba, lo cual coincide con plantín, no implicaron una disminución sobre-
Carrizo de Bellone et al (3); sin embargo, se saliente del número de plantas útiles al tras-
desconoce si estas diferencias se deben a la plante. Estos resultados contrastan con los
acción benéfica de los microorganismos pro- valores encontrados en sustratos comerciales
motores del crecimiento vegetal usados, y/o en base a turba por Mayol y Molina (10)
a la acción preventiva de los biocontrolado- Si bien se comprobaron diferencias significa-
res, o bien a un aspecto de la nutrición. tivas en algunas de las variables estudiadas
La altura al cogollo es una variable cualitativa entre los sustratos, como peso seco total,
que nos define la uniformidad del plantín al celda seca y raíz espiralada, esto no se com-
trasplante, luego de haber realizado los des- probó al considerar el desarrollo y cantidad
moches necesarios, que robustecen y engro- de plantas útiles al transplante. No obstan-
san el cuello haciéndolos resistentes al estrés te, no encontrar diferencias significativas en
de plantación. Son muchos los aspectos que esta variable, nos está señalando que es fac-

50 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013


tible y promisorio la utilización de sustratos directorio-de-prosalta/ .
formulados en base a bagazo y cachaza prin- 5. Hoitink J. y Boehm MJ. 2001. Manejo Inte-
cipalmente en la proporción 90:10 y 95:5. grado de Plagas (Costa Rica) No. 62 p. 4 -17.
Si bien se ha avanzado en la formulación de 6. Jiménez R. y Caballero M. 1990. El Cultivo In-
dustrial en Macetas. Ediciones de Horticultu-
sustratos para almácigos flotantes de tabaco,
ra. Reus, España Nº de p. 664.
es necesario continuar trabajando para me-
7. Krieger S., Herrando C., Gómez S. y Quero E.
jorar el manejo del compostaje para corre- 2008. Análisis de compost de bagazo para
gir la aparición de malezas, la conductividad su uso potencial como sustrato. In: Actas
eléctrica y el pH durante el proceso formu- IV Congreso Iberoamericano de Medio Am-
lación, para disminuir el número de plantas biente y Calidad de Vida. Catamarca, Argen-
con raíz espiralada, y por último la porosi- tina. p. 200.
dad, para reducir el número de celdas secas 8. Krieger S., Herrando C. y Gómez Molina S.
en algunos de los sustratos. 2007. Estudio preliminar de compost prove-
nientes de la industria azucarera para formu-
BIBLIOGRAFÍA CITADA lación de sustratos. In: Libro de Resúmenes
VI Reunión de Biología del Suelo del Noroes-
te Argentino. Córdoba. p. 132.
1. Aquino J.E. 1997. Commercial substrates. In:
9. Manual de producción de plantas de tabaco
Alternatives to Methyl Bromide in Agricul-
en bandejas flotantes. Proyecto PROZONO.
ture (J.J.V.Müller, ed.). Brasilian Meeting on.
Alternativas al bromuro de metilo. 2003. Edi-
EPAGRI, Palestra, Florianópolis, Brasil, pp.
ciones INTA. p. 139.
274-276.
10. Mayol M. y Molina S. 2010 Ensayos de almá-
2. Asciutto, K et al 2006. Effect of vermicom-
cigos flotantes para producción de plantines
post on the growth and health of Impatiens
de tabaco. In: Informe del Programa Nacio-
wallerana. Φyton International Journal of Ex-
nal de Cultivos Industriales. INTA. Tucumán.
perimental Botany Nº 75: p.115-123.
Argentina.
3. Carrizo de Bellone S., Cometto A., Mentel
11. Valenzuela O. y Gallardo C. 2005. Caracterís-
M. I. y Vg Ganem J. 2009. Efecto PGPM con
ticas de los sustratos usados en viveros fo-
Azospirillum brasilense en cultivo de tabaco.
restales. IDIA XXI. Nº 8 p. 57-59.
In: Libro de resúmenes VII REBIOS. Tucumán.
12. Valeiro A et al 2008. Producción de plantas
4. Dirección de estadística de la provincia de
de tabaco en bandejas flotantes. IDIA XXI. Nº
Salta.2010 (ProSalta). In: http://www.prosal-
ta.org.ar/oferta/institucional/mensaje-del- 10 p. 64-68.

Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013 51


52 Ciencia y Tecnología de los Cultivos Industriales, Año 3 Nº 4 - 2013