Está en la página 1de 314

El Agro Veracruzano 2015

Compilacin: Ana Lid del Angel Prez


Academia Veracruzana de Ciencias Agrcolas, Pecuarias, Forestales,
Acucolas y Pesqueras, A.C.

Dra. Ana Lid del Angel Prez


Presidente 2013-2015

M.C. Ramiro Snchez Uranga


Presidente 2015

Dra. Fabiola Lango Reynoso


Vicepresidente

Dr. Juan Guillermo Cruz Castillo


Secretario del Interior

Dr. Felipe Gallardo Lpez


Tesorero

Dra. Jacel Adame Garca


Dra. Mara Elena Galindo Tovar
Vocales Agrcolas

M.C. Baldomero Molina Snchez


Vocal Pecuario

Dra. Mara del Refugio Castaeda Chvez


Vocal Acucola y Pesquera

Dr. Otto Ral Leyva Ovalle


Vocal Forestal

Dr. Juan Salazar Ortz


Dra. Hilda Eulalia Lee Espinoza
Vocales de Desarrollo Rural

M.C. Enrique Mercado Rodrguez


Presidente del Consejo de Vigilancia

Dra. Mara de Jess Martnez Hernndez


Secretaria del Consejo de Vigilancia

M.C. Martn Pavn Rivera


Presidente de la Junta de Honor y Justicia

Dr. Manuel Villarruel Fuentes


Secretario de la Junta de Honor y Justicia

M.C. Martha Eugenia Valdovinos Tern


Secretaria de la Junta de Honor y Justicia
Comit Institucional de la XXVII Reunion Cientfica, Tecnolgica,
Forestal y Agropecuaria, Veracruz 2014 Y VI del Trpico Mexicano

Instituto Tecnolgico Superior de Zongolica M.C. Miguel ngel de la Torre


Loranca
Academia Veracruzana de Ciencias Agrcolas, Pecuarias, Dra. Ana Lid del ngel Prez
Forestales, Acucolas y Pesqueras, A.C.

Instituto Nacional de Investigaciones Forestales, Agrcolas M.C. Sergio Alberto Curti Daz
y Pecuarias INIFAP. CIR-Golfo Centro
Universidad Veracruzana (UV), Facultad de Biologa, M.C. Hctor Venancio Narave
Xalapa, Ver. Flores
Universidad Veracruzana (UV), Facultad de Ciencias Dr. Otto Ral Leyva Ovalle
Biolgicas y Agropecuarias, Peuela, Ver.
Universidad Veracruzana (UV), Facultad de Ciencias Dr. Gustavo Ortiz Ceballos
Agrcolas, Xalapa, Ver.
Universidad Veracruzana (UV), Facultad de Ingeniera en M.C. Carlos Serna Garca
Sistemas de Produccin, Acayucan, Ver.
Universidad Veracruzana (UV), Instituto de Ciencias Dra. Ma. de Lourdes Jimnez
Marinas Y Pesqueras Badillo
Universidad Veracruzana (UV), Facultad de Medicina M.C. Francisco Velzquez
Veterinaria y Zootecnia Veracruz, Ver. Sarmiento
Universidad Autnoma Chapingo, Centro Regional Dr. Benigno Rodrguez Padrn
Universitario Oriente (CRUO)
Universidad Politcnica de Huatusco M.A. Catalina Ortz Muiz
Colegio de Postgraduados (CP), Campus Crdoba. Dr. Victorino Morales Ramos
Colegio de Postgraduados (CP), Campus Veracruz. Dr. Juan Lorenzo Reta Mendiola
Colegio Estatal de Mdicos Veterinarios Zootecnistas de MVZ. Oswaldo Fernndez Sols
Veracruz, A.C.
Colegio Estatal de Ingenieros Agrnomos de Veracruz, M.C. Martn Pavn Rivera
A.C.
Unidad de Capacitacin para el Desarrollo Rural Ing. Enrique Reyes Altamirano
(UNCADER)
Instituto Tecnolgico de rsulo Galvn M.A. Marco Antonio Daz Ramos
Instituto Tecnolgico de Alvarado Ing. Toms Hiplito Tiburcio
Instituto Tecnolgico Superior de Huatusco Ing. David Gerardo Velasco
Gonzlez
Instituto Tecnolgico de Boca del Ro (ITBOCA) M.C. Jos Manuel Rosado Prez
Instituto Tecnolgico Superior de Jess Carranza Ing. Carlos Zamudio Osorio
Instituto Tecnolgico Superior de Juan Rodrguez Clara M.D. Williams Quiroz Lopz
Direccin de Educacin Tecnolgica Agropecuaria Dr. Cesar Turrent Fernndez
(DGETA)
Confederacin Nacional de Organizaciones Ganaderas Ing. Oswaldo Chazaro Montalvo
(CNOG)
El Agro Veracruzano 2015
Vol. I

Academia Veracruzana de Ciencias Agrcolas, Pecuarias, Forestales,


Acucolas y Pesqueras, A.C.

Boca del Ro Ver., Mxico


Septiembre, 2015
Academia Veracruzana de Ciencias Agrcolas, Pecuarias, Forestales,
Acucolas y Pesqueras, A.C.

El Agro Veracruzano 2015

ISBN: 978-607-96939-2-3

Primera Edicin 2015

No est permitida la reproduccin total o parcial de esta publicacin, ni la


transmisin de ninguna forma o por cualquier medio, ya sea electrnico, mecnico,
fotocopia, por registro u otros mtodos, sin el permiso previo y por escrito de la
Institucin.
El Agro Veracruzano 2015
NDICE
VOLUMEN I

INTRODUCCIN...........1

AMBIENTE Y RECURSOS NATURALES2

POTENCIAL GERMINATIVO DE SEMILLAS DE Ceratozamia mexicana BRONGN.


PROVENIENTES DE DOS SITIOS CONTRASTANTES. Andrs Rivera Fernndez, Cristina
Elizabeth Ziga Castaeda, Ana Isabel Surez Guerrero, Celia Cecilia Acosta Hernndez, Mara
Encarnacin Vzquez Vzquez3

BIOMASA FNGICA CON RESPECTO A LA LNEA BASE DE DOS SISTEMAS DE


PRODUCCIN DE BAJO IMPACTO AMBIENTAL. ngel Roberto Reyes Aguilar, Ana Lid del
Angel Prez, Jacel Adame Garca, Jeremas Natarn Velzquez,
Jos Antonio Fernndez Viveros...........16

PERCEPCIN DE LA BIODIVERSIDAD POR PARTE DE LA COMUNIDAD


GANADERA. EL CASO DEL ESTADO DE VERACRUZ. Carlos Nahin Castro Jose, Ana Lid
del Angel Prez, Carmen Aridai Hernndez
Estrada............................................................................................................ 30

VEGETACIN HERBACEA EN ZONAS DE GANADERIA EXTENSIVA EN EL


CENTRO DE VERACRUZ. Carmen Aridai Hernndez Estrada, Ana Lid Del ngel Prez, Carlos
Nahin Castro Jos, Marcos V. Vzquez Hernndez, Jess Gustavo Salazar
Garca...................................................................................................... .......................48

VERTEBRADOS DE LA SIERRA MONTE DE ORO, ALTO LUCER0, VERACRUZ.


Csar Viveros colorado, Miguel de Jess Chzaro Bazez60

EVALUACIN POST-APROVECHAMIENTO DE LA RESERVA DE SAN JUAN DEL


MONTE, LAS VIGAS, VERACRUZ EFECTO DE LA CORTA SELECTIVA. Daniel
Rodrguez Sols, Celia Cecilia Acosta Hernndez, Pascual Linares Mrquez, Ana Isabel Suarez Guerrero,
Joaqun Jimnez Huerta 78

CONSERVACIN DE LA BIODIVERSIDAD EN BOSQUES ALTERADOS Y


REFORESTADOS. Felipe de Jess Ortega Hernndez, Ana Isabel Surez Guerrero, Celia
Cecilia Acosta Hernndez, Andrs Rivera
Fernndez.... 91
El Agro Veracruzano 2015
ACTITUD DE CAFETICULTORES SOBRE MANEJO Y CONSERVACIN DE
SUELOS DEL SITIO RAMSAR CASCADAS DE TEXOLO. Juan Carlos Moreno Secea,
Martha Elena Nava Tablada, Mara Isabel Hernndez
Snchez105

BIODIVERSIDAD DEL ORDEN ESCORPIONES C.L. KOCH, 1837 EN LAS


LOCALIDADES: LA LAGUNA, BOCA DEL RO Y SOLEDAD DE DOBLADO,
VERACRUZ. Ofelia Gonzlez Ramos, Julio Marcos Cruz-Gmez, Luis Ricardo Silo Vzquez, Vctor
Alejandro Jimnez Arrioja Montoro, Perla K. Montero Ramrez , Eduardo Palacio
Prez....................................................................................................................... .....................................119

APLICACIN DE EXTRACTOS ETANLICOS DE Tagetes erecta L. y Tanacetum


parthenium L. PARA EVALUAR LA ACTIVIDAD FUNGICIDA. Luis Felipe Jimnez Cruz,
Carlos Alberto Cruz Cruz, Marina
GuevaraValencia......142

EFECTO DE EXTRACTOS ETANLICOS DE Piper auritum KUTH SOBRE Anastrepha


ludens LOEW. Mara Luisa Vzquez Vzquez, Marycruz Abato Zrate, Noel Reyes Prez,
Francisco Daz Fleischer, Fernando Rechy
Gmez.160

BIOTECNOLOGA.170

EMISIONES VOLTILES DE RIZOBACTERIAS, ESTIMULAN EL CRECIMIENTO


DE Fusarium oxysporum f. sp. Vanillae. Jacel Adame Garca, Mauricio Luna Rodrguez, Lourdes
Georgina Iglesias Andreu........171

DIVERSIDAD GENTICA DE Zamia furfuracea L. f: UNA CCADA ENDMICA DEL


ESTADO DE VERACRUZ. Enrique Favin-Vega , Rubn H. Andueza-Noh, y Lourdes G. Iglesias
Andreu, Andrs Rivera Fernndez...............................................................184

MICROINJERTOS EN Vanilla planifolia. Jos Roberto Bautista Aguilar, Marco Antonio Ramrez
Mosqueda, Lourdes Georgina Iglesias Andreu, Vernica Borbolla Prez..200

USO DE BIORREACTORES DE INMERSIN POR GRAVEDAD (BIG) PARA LA


PROPAGACIN in vitro DE Stanhopea tigrina: UNA ORQUDEA ENDMICA
AMENAZADA. Eduardo Martnez Estrada, Jeric J. Bello Bello, Victorino Morales
Ramos..211
El Agro Veracruzano 2015
ESTABLECIMIENTO DE UN PROTOCOLO DE DESIFECCION PARA EL CULTIVO
IN VITRO DE ESTEVIA (Stevia rebaudiana Bertoni) MEDIANTE EL USO DE
NANOPARTICULAS DE PLATA (NPsAg). Jeric Jabn Bello Bello y Jos Luis Spinoso
Castillo.218

EVALUACIN DEL RENDIMIENTO DE MATERIAL PECTNICO DEL ALBEDO DE


CUATROS ESPECIES DEL GNERO Citrus. Diego Antonio Maruri Mundo, Jos Luis Cordero
Snchez, Lzaro Gabriel Trujillo Jurez..........224

PROLIFERACIN DE CLULAS MADRE HEMATOPOYETICAS DE CORDN


UMBILICAL DE ORIGEN BOVINO TRATADAS CON GHRELINA. Arabia Denisse
Zamora Pardo, Belisario Domnguez Mancera, Manuel Barrientos-Morales, Patricia Cervantes Acosta,
Antonio Hernndez Beltrn..245

POLIMORFISMO DEL GEN KAPPA CASENA Y SUS EFECTOS EN LA


COMPOSICIN DE LA LECHE EN GANADO HOLSTEIN Y HOLSTEIN-CEB DE
VERACRUZ, MXICO. Patricia Cervantes Acosta, Guadalupe Vega Rubio, Antonio Hernndez
Beltrn, Belisario Domnguez Mancera, cMara Elisa Salazar Caldern, Manuel Barrientos
Morales.268

FORESTAL...........................................................................................................287

IMPACTO SOCIOECONMICO Y AMBIENTAL DEL PROGRAMA PRORBOL


DESDE LA PERSPECTIVA DE LOS BENEFICIARIOS EN EL MUNICIPIO DE XICO,
VERACRUZ. Carmen Amanda Almendarez Campos, Martha Elena Nava Tablada, Juan Carlos Moreno
Secea......288
INTRODUCCIN

Como parte de las reformas estructurales promovidas por el Presidente de la Republica


Mexicana el Lic. Enrique Pea Nieto, ha surgido un gran reto para el campo Veracruzano,
Como evolucionar un sistema productivo rural secuestrado por la Globalizacin?. La
respuesta podra centrarse a los grandes tratados de Libre Comercio con Norteamrica o la
Alianza del Pacfico con Chile, Colombia y Per. Sin embargo, el reciente Acuerdo de
Asociacin Transpacfico (TPP, por sus siglas en ingls), que une Alianza del Pacfico y la
Asociacin de Naciones del Sudeste Asitico (ANSEA), se anuncia como un acuerdo
histrico, los firmantes representan alrededor de 40% del PIB y un tercio del comercio
mundial, lo que nos habla de su trascendencia. El campo Veracruzano es uno de los pilares
fundamentales que permitir que Mxico cumplir con estos compromisos internacionales,
teniendo como meta que sea uno de los pases que mayor provecho obtenga por sus
exportaciones de productos Pesqueros, Agropecuarios y Forestales.

Para que los grandes tratados antes mencionados sean un verdadero motor de desarrollo,
generador de bienestar para los Mexicanos, necesitamos un campo competitivo, basado en
la innovacin tecnolgica permanente de cara a la globalizacin de los comercios. Aqu,
radica la importancia de las Reuniones Cientficas, Tecnolgicas, Forestales y
Agropecuarias, la conjuncin de los que participamos, permite el intercambio de ideas,
avances tecnologicos y experiencias de xito que deben ser replicadas en el territorio
Veracruzano, con el nico objetivo, atender las demandar mundiales como generadoras de
bienestar local para nuestros productores rurales.

Hoy, Veracruz siendo potencia nacional en el nmero de estudiantes de educacin superior


que estudian una ingeniera, estamos sentando las bases para que ms tecnlogos se formen
en localidades rurales como polos de desarrollo del campo. Con ms de 70, 000 jvenes
veracruzanos estudiando ingenieras en Veracruz, la transformacin a la globalizacin se
esta potencializando, siendo un gran reto para la Academia Veracruzana incorporar al
sector campesino y empresarial, a reuniones de trabajo donde se vean beneficiados por
nuestros avances tecnolgicos.

Cuando respetemos a la Naturaleza, entenderemos por que la Evolucin, nos permiti ser
parte de la Biodiversidad

Miguel ngel de la Torre Loranca


Director General
Tecnolgico de Zongolica

1
El Agro Veracruzano 2015

AMBIENTE Y RECURSOS
NATURALES

2
El Agro Veracruzano 2015

1
POTENCIAL GERMINATIVO DE SEMILLAS DE Ceratozamia mexicana
BRONGN., PROVENIENTE DE DOS SITIOS CONTRASTANTES

Andrs Rivera Fernndez1, Cristina Elizabeth Ziga Castaeda2, Ana Isabel Surez
Guerrero3, Celia Cecilia Acosta Hernndez4, Mara Encarnacin Vzquez Vzquez5
1
Facultad de Ciencias Agrcolas-Xalapa, Universidad Veracruzana, arivera@uv.mx Dr. en
Ecologa y Biotecnologa. Profesor de Tiempo Completo Titular C, Integrante del Cuerpo
Acadmico Biotica y Conservacin de los Recursos Naturales dentro de la Lnea de
Generacin y Aplicacin del Conocimiento del mismo nombre, con perfil PROMEP.
2
Facultad de Ciencias Agrcolas-Xalapa, Universidad Veracruzana, zcce@hotmail.com
M:C. y Candidata a Doctora. Tcnico Acadmico de Tiempo Completo del Laboratorio de
Gentica. Integrante de la Lnea de Generacin y Aplicacin del Conocimiento Anlisis de
los Recursos Fitogenticos y Organismos asociados.
3
Facultad de Ciencias Agrcolas-Xalapa. Universidad Veracruzana, asuarez@uv.mx Dra.
en Ecologa y Manejo de Recursos Naturales. Profesor de Tiempo Completo Titular C,
Integrante del Cuerpo Acadmico Biotica y Conservacin de los Recursos Naturales
dentro de la Lnea de Generacin y Aplicacin del Conocimiento del mismo nombre, con
perfil PROMEP.
4
Facultad de Biologa-Xalapa. Universidad Veracruzana. ceacosta@uv.mx Dra. en
Ecologa y Biotecnologa. Profesor de Tiempo Completo Titular C, Integrante del Cuerpo
Acadmico Biotica y Conservacin de los Recursos Naturales dentro de la Lnea de
Generacin y Aplicacin del Conocimiento del mismo nombre, con perfil PROMEP.
5
Facultad de Ciencias Agrcolas-Xalapa, Universidad Veracruzana.
marienn12@hotmail.com Ing. Agrnoma. Colaboradora del Laboratorio de Gentica.

Resumen

1. Mxico es el segundo pas con mayor diversidad de ccadas despus de Australia.


Estas gimnospermas amenazadas, son las ms antiguas plantas seminferas
conocidas. Se caracterizan por ser de lento crecimiento, longevas y dioicas. Su
dispersin es por gravedad y la fertilidad de algunas poblaciones de tamao
pequeo puede verse comprometida.
2. El objetivo de este trabajo fue determinar de manera indirecta la viabilidad de
semillas de Ceratozamia mexicana Brongn., colectada en dos sitios, con y sin

3
El Agro Veracruzano 2015
perturbacin antrpica, mediante la aplicacin de cloruro de tetrazolio en
diferentes concentraciones.
3. Se delimitaron sitios con y sin perturbacin antrpica utilizando criterios
ecolgicos, y con base en las caractersticas de semillas, de los ciclos 2010 y 2011.
Las cuales fueron expuestas a refrigeracin y temperatura ambiente. Las pruebas
de viabilidad se realizaron de manera indirecta utilizando cloruro de tetrazolio en
diferentes concentraciones y se analizaron bajo un diseo de parcelas sub
subdivididas.
4. Se encontraron diferencias estadsticas significativas entre los sitios y las
dimensiones de las semillas; sin embargo, no hubo diferencia en la germinacin
por tipo de ambiente o ao, pero si entre las concentraciones de la solucin de
tetrazolio. Los mejores resultados se presentaron en concentraciones de 1% y
1.5%.
5. Este trabajo constituye una aportacin al estado del arte de la reproduccin ex situ
de C. mexicana dentro de una serie de actividades tendientes a evitar la reduccin
de sus poblaciones.
Palabras clave: Ccadas, ex situ, viabilidad.

Abstract

1. Mexico is the second country with the highest diversity of cycads after Australia.
These threatened gymnosperms are the oldest known seminiferous plants. They
are characterized by their slow-growing and long-living dioecious. Their
dispersion is by gravity and in some small populations may be compromised their
fertility.
2. The aim of this study was to determine in an indirect way the viability of seeds
Ceratozamia mexicana Brongn. this type of seed was collected in two places, with
and without human interference, by applicating tetrazolium chloride in different
concentrations.
3. There were delimited some sites with and without human disturbance with
ecological criteria and based on the characteristics of the seeds; the seeds came
from the 2010 and 2011 cycles. Which were stored under refrigeration and room
temperature, respectively. Viability tests were made indirectly with tetrazolium
chloride in different concentrations and they were analyzed under a split split
plots design.
4. There were found significant differences between the sites and between the
dimensions of the seeds. There were no significant differences in the germination
of seeds coming from different environments neither the years; but it happened
between the concentrations of tetrazolium solution; the best results were presented
at concentrations of 1% and 1.5%.
5. This work is an important contribution to the ex situ reproduction of C. mexicana
in a serie of activities to avoid reducing their populations.
Keywords: Cycads, ex situ, viability.

4
El Agro Veracruzano 2015

Introduccin
Mxico es uno de los pases que ms contribuyen a la diversidad de ccadas con
ms de 53 de las 326 especies conocidas a nivel mundial (Vovides et al., 2003;
Haynes, 2011). Los gneros presentes en el pas son: Ceratozamia, Dioon y Zamia.
De estos, Ceratozamia es el ms importante por el nmero de especies que posee
(26) seguido de Zamia (14) y Dioon (13) (Haynes, 2011).
Ceratozamia mexicana es la especie tipo del gnero y es endmica del pas; habita
en el sotobosque de hbitats forestales como bosque de encinos, bosque de pino-
encino y el bosque mesfilo de montaa (Vovides et al., 1983; Alejandre-Rosas et
al., 1990; Rzedowski, 2006); al igual que la gran mayora de las ccadas, es una
especie declarada como vulnerable y con poblaciones decrecientes, principalmente
por la fragmentacin y por la prdida de su hbitat (NOM-059-SEMARNAT,
2010; IUCN, 2011).
Uno de los sitios con mayor densidad de C. mexicana es Coacoatzintla, Veracruz,
donde el factor principal de alteracin de su hbitat es el cambio de uso del suelo,
impulsado por un acelerado crecimiento de la actividad ganadera. La superficie
agrcola reportada para el municipio fue de 750 ha, mientras que la superficie
dedicada al pastoreo o a la produccin de pastos fue de 2605 ha; por su parte la
superficie boscosa tan solo cubre 145 ha (INEGI, 2005). Otra actividad que afecta
la viabilidad del bosque lo constituye la extraccin de piedra basltica para su uso
en la construccin, aunque esta actividad no est consignada en las estadsticas
municipales o federales. El crecimiento de la frontera agropecuaria del municipio
involucra una tala inmoderada con la consecuente fragmentacin del bosque
mesfilo de montaa.
La fragmentacin del hbitat es una de las principales amenazas a la diversidad de
especies (Bennett, 2003; Fischer y Lindenmayer, 2007), puede afectar la estructura
gentica y demogrfica de las poblaciones, favorece la deriva gentica, aumenta la
endogamia, reduce la capacidad de apareamiento, altera la interaccin con los
polinizadores y modifica las condiciones ambientales (Honnay et al., 2005;
Octavio-Aguilar et al., 2008).
C. mexicana es una especie dioica; las plantas femeninas inician la diferenciacin
de sus estructuras reproductivas femeninas (megastrbilos) de julio a febrero y
requieren de doce meses para madurar. Los conos masculinos o microstrbilos
maduran en un perodo menor (Vovides et al., 1983; Snchez-Tinoco et al., 2000).
La dispersin del polen es efectuada por pequeos escarabajos (curculinidos y
langridos), que polinizan la planta femenina cuando su cono est receptivo. La
semilla presenta un perodo de posmaduracin de hasta un ao despus de la
desintegracin del megastrbilo (Snchez-Tinoco et al., 2000).

5
El Agro Veracruzano 2015

El cambio de uso del suelo que afecta significativamente las poblaciones de


C.mexicana disminuye la cantidad de individuos reproductivos y altera los
patrones de dispersin. Este fenmeno se debe a que en los sitios con perturbacin
las plantas estn ms expuestas a los factores ambientales y por lo tanto se
favorece la mortalidad por desecacin de las semillas y las plntulas (Rivera-
Fernndez et al., 2012).
Una forma de analizar la viabilidad de semillas de plantas es con la prueba de
tetrazolio que se basa en la actividad de las enzimas deshidrogenasas las cuales
catalizan las reacciones respiratorias en las mitocondrias durante la gliclisis y el
ciclo de Krebs. Estas enzimas, particularmente las deshidrogenasas del cido
mlico, reducen la sal de tetrazolio en los tejidos vivos. Cuando la semilla es
inmersa en la solucin incolora de tetrazolio, se produce en las clulas vivas la
reaccin de reduccin que da como resultado la formacin de un compuesto rojo
conocido por trifenilformazn (Moore, 1962).
Cuando el tetrazolio se reduce indica que existe actividad respiratoria en las
mitocondrias, esto significa que hay viabilidad celular y del tejido. El color
resultante de la reaccin es un indicador positivo de la viabilidad a travs de la
deteccin de la respiracin a nivel celular. Las semillas no viables no reaccionan y
consecuentemente no se tien. Cuando el tejido es vigoroso, se formar el color
rojo carmn claro. La observacin de diferencias de color y el conocimiento de las
caractersticas de las semillas, permiten la determinacin de la presencia,
localizacin y naturaleza de trastornos que pueden ocurrir en los tejidos
embrionarios (Moore, 1962, 1966).
El presente trabajo tuvo como objetivo evaluar la viabilidad de semillas con el
mtodo de cloruro de tetrazolio (TZ) en C. mexicana Brongn., provenientes de dos
sitios con ambientes contrastantes, uno perturbado dentro de un potrero y otro
conservado con acceso restringido a personas y animales.

Materiales y mtodos

Sitios de colecta. La semilla utilizada en el presente trabajo fue colectada en el


municipio de Coacoatzintla, Ver., localizado en la zona montaosa central del
Estado de Veracruz, en las coordenadas 19 39 37 latitud norte y 96 57
longitud oeste. El clima de la regin es templado hmedo con una temperatura
media anual de 18 C y precipitacin 1780 mm (INEGI, 2005). Las colectas se
efectuaron en los ciclos 2010 y 2011. El sitio denominado conservado estuvo

6
El Agro Veracruzano 2015
representado por 8 parcelas y se localiz en una propiedad privada que no ha
sufrido ninguna perturbacin reciente debido a que tiene un acceso restringido;
mientras que el sitio perturbado, con 5 parcelas, se localiz en las inmediaciones
de un potrero, en un corredor con fragmentos de vegetacin nativa.
Los sitios fueron comparados a partir de diferentes parmetros con el propsito de
determinar las diferencias entre ellos mediante la medicin de: cobertura de dosel
(porcentajes transformados al arcsen 2), profundidad del suelo, contenidos de
materia orgnica, anlisis de nutrientes de acuerdo a los criterios usados por
Rivera-Fernndez et al. (2012). La comparacin de los sitios se llev a cabo con el
estadstico Kruscal-Wallis utilizando el programa InfoStat 2011.1 (Di Rienzo et
al., 2011).
Obtencin de semillas. Los megaestrbilos, comnmente conocidos como conos,
que se utilizaron en el presente trabajo, fueron colectados completamente maduros
en cada sitio, y trasladados a las instalaciones de la Facultad de Ciencias
Agrcolas-Xalapa de la Universidad Veracruzana. All se dejaron desintegrar y la
sarcotesta de la semilla se dej fermentar a la intemperie. Posteriormente las
semillas fueron lavadas y se dejaron secar a la sombra hasta alcanzar un 10% de
humedad. Las semillas del ciclo 2010 se conservaron en frigorfico a 5 C hasta su
utilizacin 14 meses despus. Las semillas por cono se contaron, pesaron y
midieron; con esta informacin se compararon sus caractersticas para verificar la
existencia de posibles diferencias entre sitios y entre aos, mediante la prueba de
Wilcoxon.
Anlisis de la viabilidad de semillas. La evaluacin de la viabilidad de la semilla
se realiz en el Laboratorio de Gentica de la Facultad de Ciencias Agrcolas de la
Universidad Veracruzana en Xalapa, Veracruz. Para ello se utiliz un diseo de
parcelas subsubdivididas con una distribucin completamente aleatorizada. Donde
las parcelas grandes estuvieron constituidas por las caractersticas de los sitios
(conservado y perturbado); las parcelas medianas por los aos de de colecta (2010
y 2011) y las parcelas chicas por las concentraciones de cloruro de tetrazolio
(0.5%, 1.0% y 1.5%) con 4 repeticiones y 15 semillas por repeticin. El anlisis de
varianza aplicado se efectu a partir de los porcentajes de viabilidad detectados
(Tabla 1) transformados al arcsen2x.
Previo a la aplicacin de los tratamientos con tetrazolio las semillas fueron
sanitizadas con hipoclorito de sodio al 1% durante 3 minutos; para romper la
tensin superficial se aplicaron 2 gotas de tween 20 a la solucin de hipoclorito.
En seguida, se lavaron dos veces con agua destilada para eliminar los restos del
desinfectante. El siguiente paso fue colocar las semillas previamente separadas por
sitio, ciclo y tratamiento de hidroacondicionamiento, es decir, se depositaron en un
matraz Erlenmeyer y se cubrieron con agua destilada. Posteriormente se les inyect
aire con una bomba para pecera para su oxigenacin y reblandecer su tegumento

7
El Agro Veracruzano 2015
durante 48 horas. Al transcurrir este perodo fueron liberadas de la esclerotesta y
seccionadas longitudinalmente sin daar al embrin y colocadas en las soluciones
de cloruro de tetrazolio de 1.5, 1.0 y 0.05% durante 3 horas.
Para la interpretacin de la viabilidad de la semilla se estableci un criterio basado
en el cambio de coloracin del color cremoso normal hacia diferentes tonalidades
que van desde rosado hasta ligeramente rojo. Para ello se cre una escala
colorimtrica en la que la mayor tonalidad corresponda a las semillas viables y la
ausencia de pigmentacin se interpret como semilla inviable o muerta (Tabla 1).

Tabla 1. Escala de pigmentacin de las semillas de C.mexicana embebidas en cloruro


de tetrazolio e interpretacin de la reaccin en trminos de viabilidad.

Categora Descripcin de la pigmentacin Interpretacin


Embrin Tegumento
0 0 Hasta 75% sin No viable
1 75% 50% No viable
2 100% 50% viable
3 100% 75% viable
4 100% 100% viable
Modificado de: Ruiz, 2009

Tabla 2. Caractersticas observadas en los sitios de estudio. Coacoatzintla,


Ver. Datos registrados durante el perodo 2010/2011.

Caracterstica Sitio Conservado Sitio Perturbado


Cobertura dosel (%) 78.1/86.75 71.6/78.5
Materia Orgnica (%) 22.9 14.6
Distancia a caminos 300 m 5m
Veredas 1 10
Nitrgeno % 1.15 0.75
Fosforo ppm 25.03 22.26
Potasio Me/100gr 0.44 0.51
Calcio Me/100gr 32.43 26.11
Magnesio Me/100gr 16.04 9.91
Humedad % 45.8 30.6
Profundidad cm 37 23

8
El Agro Veracruzano 2015

Resultados

Comparacin de los sitios de obtencin de las semillas. Las caractersticas de los


sitios son descritas en la Tabla 2 donde se observan las condiciones entre cada
sitio.
Caractersticas de las semillas. La comparacin de los valores por sitio, en los
aos 2010 y 2011, para las variables peso, longitud y grosor de semillas, arroj
diferencias altamente significativas (p < 0.0001). Es decir los dos sitios son
diferentes, con base en las diferencias en semilla (Tabla 3).
En ambas tablas, se observa que el tamao de semilla del sitio conservado es
inversamente proporcional al nmero de semillas de cada cono. En 2010 es 44.6%
ms pesada que en 2011 y el nmero de semillas fue menor en 50.1%. En 2011,
cuando la comparacin se realiza entre sitios el efecto es similar, es decir, no
importa la condicin, conservado o perturbado, al tener ms semillas el cono tiende
a producir semillas de menor tamao. En 2010 la semilla del sitio conservado fue
ms pesada que en el perturbado en 22.7%, an cuando casi dobla la cantidad de
semilla respecto al sitio perturbado. En el sitio conservado, los conos colectados
en 2011 tuvieron 3.04 veces ms semillas que en el perturbado pero pesaron 20.5%
menos.

Tabla 3. Caractersticas de la semilla de Ceratozamia mexicana para el sitio


conservado.

Parmetro Peso (g) Largo (mm) Ancho (mm)


2010 2011 2010 2011 2010 2011
Media 4.05 2.8 23.96 25.09 16.03 14.24
Desviacin estndar 0.56 0.45 2.58 1.11 2.72 1.31
Valor mnimo 2.77 1.07 15.2 19.04 6.70 10.51
Valor mximo 5.28 4.06 30.0 27.42 20.30 17.58
Nmero de conos/planta 3 4
Nmero de semillas 309 822
Semillas/cono 103 205.5

El largo de semilla, observ una tendencia irregular entre aos y entre sitios,
aunque sin muchas variaciones. Al comparar los valores promedio entre aos
(2010 y 2011), el sitio conservado mostr valores de 3.42 g, 24.53 mm, y 15.14
mm para las variables peso, largo y ancho de semilla, respectivamente. En el sitio
perturbado los valores promedio entre aos fueron de 3.41 g, 24.54 mm y 16.2
mm, para peso, largo y ancho de semillas, respectivamente. Esto seala que las
9
El Agro Veracruzano 2015
poblaciones muestran caractersticas mtricas en semillas prcticamente iguales.
La nica diferencia verdaderamente notoria entre sitios, corresponde al nmero de
semillas por megaestrbilo. Es evidente, con la informacin disponible, que 2011
fue ao semillero en ambos sitios. La desviacin estndar observa, que existe
menos variacin en el sitio perturbado que en el conservado, con excepcin de la
variable ancho de semilla en 2011 (Tablas 3 y 4). Con base en la cantidad de
semilla que fueron localizadas en cada caso. Los conos del sitio conservado
presentaron en promedio, 3 veces ms semillas que las del sitio perturbado y por lo
tanto la competencia al interior del megastrbilo es mucho mayor. Los anlisis de
las caractersticas de la semilla para cada sitio, se encuentran en las Tablas 3 y 4.

Tabla 4. Caractersticas de la semilla de Ceratozamia mexicana para el sitio


perturbado.

Parmetro Peso (g) Largo (mm) Ancho (mm)


2010 2011 2010 2011 2010 2011
Media 3.30 3.52 24.33 24.75 17.11 15.29
Desviacin estndar 0.52 0.32 1.24 1.27 1.11 1.64
Valor mnimo 0.86 1.54 20.61 22.60 14.9 11.52
Valor mximo 4.02 4.86 28.01 28.40 19.3 19.34
Nmero de conos/planta 3 5
Nmero de semillas 168 338
Semillas/cono 56 67.6

Concentraciones de cloruro de tetrazolio. El anlisis de varianza del efecto de


las concentraciones 1.5 y 1.0% de cloruro de tetrazolio sobre la germinacin de
semillas no mostr diferencia significativa. Los valores de la concentracin de
0.5% no fueron analizados debido a que no provocaron reaccin de las semillas de
ambos sitios, conservado y perturbado, colectadas en 2010 (Tablas 5 y 6).

Tabla 5. Anlisis de varianza para la variable concentracin del cloruro de tetrazolio

Fuente de variacin df SS MS F P-value

Concentraciones 1 0.0008 0.0008 0.0223 0.8860


Dentro de grupos 6 0.2319 0.0386
Total 7 0.2328

10
El Agro Veracruzano 2015
Tabla 6. Germinacin de semillas de C. mexicana en porcentaje, obtenida en dos aos
consecutivos y en dos condiciones ambientales contrastantes.

Concentracin Viabilidad de la semilla por sitio ao-1 (%)


Cloruro tetrazolio (%) Conservado Perturbado
2010 2011 2010 2011
1.5 71.8 89.1 67.3 79.2
1.0 70.9 94.1 64.8 79.4
0.5 0 72.9 0 57.5
Promedio 71.4 85.4 66.1 72.1

Interaccin concentracin-ao-sitio de colecta. El anlisis de varianza para la


interaccin concentracin por sitio de colecta arroj diferencias significativas (p =
0.0025) indicando que el sitio influye de manera importante sobre la viabilidad de
las semillas (Tabla 7).

Tabla 7. Anlisis de varianza para la interaccin concentracin de cloruro de


tetrazolio por sitio con diferente condicin de perturbacin.

Fuente de variacin df SS MS F p- value


Concentracin*sitio 3 0.2242 0.0747 34.8329 0.0025
Dentro de grupos 4 0.0085 0.0021
Total 7 0.2328

Se encontraron diferencias altamente significativas en la interaccin concentracin


por ao (p = 0.0146) (Tabla 8).

Tabla 8. Anlisis de varianza para la interaccin concentracin por ao de colecta de


semilla

Fuente de variacin df SS MS F P-value


Concentracin*ao 1 0.07900855 0.07900855 67.0577936 0.01458702
Dentro de grupos 2 0.00235643 0.00117822
Total 3 0.08136498

11
El Agro Veracruzano 2015
La interaccin concentracin por ao por sitio de colecta fue significativa (p =
0.02). Este comportamiento permite dilucidar que fue ms importante el ao de
colecta que el efecto sitio de colecta.

Discusin

La viabilidad de la semilla de C. mexicana son recalcitrantes (Norstog y Nicholls


1997), es decir no pueden ser almacenadas por largos periodos de tiempo (Prez-
Farrera y Vovides 1997), en este caso se observ prdida de viabilidad despus de
su refrigeracin por ms de doce meses; el sitio de colecta tambin afecta la
capacidad germinativa de C. mexicana por lo que se sugiere efectuar las colectas
en sitios sin perturbacin antrpica.
En muchas semillas el tamao juega un papel importante en la rapidez para
germinar y en el vigor de las plantulas por lo que es probable que su potencial de
viabilidad pueda incrementarse (Bonner et al., 1994; Kolotelo et al., 2001); sin
embargo, para el presente estudio no se encontr esa relacin, puesto los resultados
manifestaron tendencias diferentes. Coincidentemente las semillas ms pesadas y
anchas correspondieron al ao 2010 y estas tendieron a germinar en menor escala.
Es de esperarse que el peso y tamao de semillas est asociado con las reservas de
la misma y en ello proporcione una ventaja en el vigor de la germinacin (ISTA,
2004). Sin embargo deben ser considerados otros factores asociados con el
potencial de viabilidad de las estructuras seminales de las ccadas dado a que en
ocasiones no ha ocurrido la fecundacin y por ende no hay formacin del embrin
y la semilla no es frtil (Vovides et al. 1997). Por ello se consider en un inicio del
presente trabajo que un diferencial en las condiciones de produccin de semillas
como es el caso de un ambiente perturbado pudiera disminuir la fertilidad de estas.
Debido quizas por limitaciones en el proceso de polinizacin (disminucin de
polinizadores, cambios en las condiciones de temperatura y humedad que
restringieran la receptibilidad de los vulos, etc.). En concordancia con esto Lpez-
Gallego y ONeil (2010) en Colombia encontraron en Zamia fairchildiana que un
cambio en la calidad del hbitat se traduca en una disminucin en la biologa
reproductiva de esa ccada. Por otra parte, Snchez-Tinoco et al. (2000) reportan
que para el caso de C. mexicana se presenta un perodo de posmaduracin de la
semilla motivado por un incompleto proceso de maduracin del embrin. Esta
situacin pudiera considerarse contradictoria; por un lado, la semilla tiene que
madurar o ser fecundada y si este proceso se llega a prolongar, se puede perder su
capacidad germinativa por el envejecimiento de la misma.
Las condiciones degradadas del hbitat, pueden tener un mayor efecto sobre la
viabilidad de la poblacin en Zamia melanorrhachis (Lpez-Gallego 2008) que
sobre la capacidad germinativa de las semillas. Situacin que se reafirma en el
12
El Agro Veracruzano 2015
presente estudio. Esto indica que una condicin perturbada limita ms bien el
reclutamiento de plntulas o de juveniles que la viabilidad de las semillas. Por lo
tanto un cambio de hbitat comprometera la permanencia a mediano y largo plazo
de las ccadas y se aproximara a un proceso de extincin (IUCN 2011).
Se encontraron diferencias, en trminos cualitativos, en la concentracin del
cloruro de tetrazolio (1%) en la intensidad de la coloracin de las semillas de C.
mexicana, lo cual coincide con muchas otras especies vegetales como es el caso de
Coffea arabica, pero difiere con otras (Anethum graveolens) donde la mejor
respuesta se encontr al 0.5% (Victoria et al. 2006).

Agradecimientos

Este trabajo fue financiado por el Consejo Nacional de Ciencia y Tecnologa


(CONACYT) a travs del proyecto: Estructura y dinmica poblacional de tres
ccadas endmicas de Veracruz: Zamia furfuracea L. f., Zamia inermis Vovides,
Rees & Vzquez-Torres y Ceratozamia mexicana Brongn. No. 152073
Convocatoria: CB-CONACYT 2010

Literatura Citada

Alejandre-Rosas, J.A., M.Y. Snchez-Tinoco, y M. Vzquez-Torres, 1990. Estructura


Poblacional de Ceratozamia mexicana Brongn. (Zamiaceae) en un bosque del
centro de Veracruz. La Ciencia y el Hombre, 5(1): 93-112.
Bennett, A.F., 2003. Linkages in the landscape: the role of corridors and connectivity in
wildlife conservation. IUCN, Gland, Switzerland and Cambridge, UK. 262 pp.
Bonner, F. T., J. A. Vozzo, W. W. Elam y S.B. Land, Jr., 1994. Tree Seed Technology
Training Course. Instructors Manual. USDA, Forest Service. New Orleans,
Louisiana, 160 pp.
Fischer, J., and B.D. Lindenmayer, 2007. Landscape modification and habitat
fragmentation: a synthesis. Global Ecology and Biogeography, 16(3): 265280.
Haynes, J.L., 2011. World list of cycads: a historical review. IUCN/ SSC Cycad Specialist
Group. 37 pp. <cycadsg.org/publications/Haynes-Historical-Review-of-World-List-
of-Cycads-2011.pdf> Consultado el 6 de marzo de 2012.
Honnay, O., H. Jacquemyn, B. Bossuyt and M. Hermy., 2005. Forest fragmentation effects
on patch occupancy and population viability of herbaceous plant species. New
Phytologist, 166(3): 723-736.
INEGI, 2005. Instituto Nacional de Estadstica Geografa e Informtica. Sistema para la
consulta del anuario estadstico para el Estado de Veracruz de Ignacio de la Llave.
http://www3.inegi.org.mx/sistemas/mexicocifras.

13
El Agro Veracruzano 2015
Di Rienzo, J. A., Casanoves, F., Balzarini, M. G., Gonzalez, L., Tablada, M., y Y.C.
Robledo. 2011. InfoStat versin 2011. Grupo InfoStat, FCA, Universidad Nacional
de Crdoba, Argentina. URL http://www. infostat. com. ar.
International Seed Testing Association (ISTA), 2004. International Rules for Seed Testing
Edition 2004. Zurich, Switzerland.
IUCN. 2011. International Union for the Conservation of the Nature Red List of
Threatened Species. Version 2011.2. <www.iucnredlist.org>. Consultado el 22 de
septiembe de 2014.
Kolotelo, D., E. V. Steenis, M. Peterson, R. Bennett, D. Trotter and J. Dennis, 2001. Seed
Handling Guidebookinistry of Forests. British Columbia. Canada. 106 pp.
Lpez-Gallego, C., 2008. Demographic variation in cycad populations inhabiting
contrasting forest fragments. Biodiversity and Conservation, 17(5):12131225
Lpez-Gallego, C. and P. ONeil., 2010. Life-history variation following habitat
degradation associated with differing fine-scale spatial genetic structure in a
rainforest cycad. Population Ecology, 52(1): 191201.
Moore, R.P., 1962. Tetrazolium as a universally acceptable quality test of viable seed.
Proceedings of the International Seed Testing Association, Copenhagen. 27(3): 795-
805.
Moore, R.P., 1966. Tetrazolium best method for evaluating seed life. Seedsmens Digest,
17(11): 38-40.
Secretara de Medio Ambiente y Recursos Naturales 2010. NOM-059-SEMARNAT.
Proteccin ambiental-Especies nativas de Mxico de flora y fauna silvestres-
Categoras de riesgo y especificaciones para su inclusin, exclusin o cambio-Lista
de especies en riesgo. SEMARNAT,
Mxico.http://www.agua.org.mx/h2o/index.php?option=com_content&view=article
&id=26183:-norma-oficial-mexicana-nom-059-semarnat-2010-proteccion-
ambiental-especies-nativas-de-mexico-de-flora-y-fauna-silvestres-categorias-de-
riesgo-y-especificaciones-para-su-inclusion-exclusion-o-cambio-lista-de-especies-
en-riesgo&catid=1337:manglares&Itemid=99.
Norstog, K. J., and T. J. Nicholls, 1997. The biology of the Cycads. Cornell University
Press, Ithaca. 363 pp.
Octavio-Aguilar, P., J. Gonzlez-Astorga, and A.P. Vovides, 2008. Population dynamics of
the Mexican cycad Dioon edule Lindl. (Zamiaceae): life history stages and
management impact. Botanical Journal of the Linnean Society, 157 (3): 381-391.
Prez- Farrera, M.A. y A.P. Vovides, 1997. Manual para el cultivo y propagacin de
cycadas. Instituto Nacional de Ecologa. Mxico. 63 pp.
Rivera-Fernndez, A., P. Octavio-Aguilar, N. Snchez-Coello, L. Snchez-Velsquez, S.
Vzquez-Torres y L.G. Iglesias. 2012. Population Structure and spatial distribution
of Ceratozamia mexicana Brongn. (Zamiaceae) in preserved and disturbed
environments. Tropical and Subtropical Agroecosystems, 15 (2): 110-117.
Ruiz, M. A., 2009. El anlisis de tetrazolio en el control de calidad de semillas. EE INTA
Publicacin Tcnica 77: 1-19. Argentina.
Snchez-Tinoco, M.Y., E.M. Engleman, y A.P Vovides. 2000. Cronologa reproductora de
Ceratozamia mexicana (Cycadales). Boletn de la Sociedad Botnica de Mxico,
66:15-23.
14
El Agro Veracruzano 2015
Rzedowski, J. 2006. Vegetacin de Mxico. Comisin Nacional para el Conocimiento y
Uso de la Biodiversidad. Mxico. 432 pp.
Victoria T., J., C. Bonilla, y O.M. Snchez. 2006. Viabilidad en tetrazolio de semillas de
calndula y eneldo. Acta Agronmica, 55 (1): 23 -30.
Vovides, P. A., J.D., Rees, y M. Vzquez-Torres. 1983. Zamiaceae. Flora de Veracruz.
Fascculo 26. Instituto Nacional de Investigaciones Sobre Recursos Biticos. 34pp.
Vovides A. P., N. Ogata, V. Sosa and E. Pea-Garca. 1997. Pollination of endangered
Cuban cycad Microcycas calocoma (Miq.) A. DC. Botanical Journal of the Linnean
Society, 125(3): 201-210.
Vovides, P.A., M. A. Perez-Farrera, J. Gonzlez-Astorga, D. Gonzlez, T. Gregory, J.
Chemnic, C. Iglesias, P. Octavio-Aguilar, S. Avendao, C. Brcenas and S. Salas-
Morales. 2003. An outline of our current knowledge on Mexican cycads
(Zamiaceae, Cycadales). Current Topic in Plant Biology, 4: 159-174.

15
El Agro Veracruzano 2015

2
BIOMASA FNGICA CON RESPECTO A LA LNEA BASE DE DOS
SISTEMAS DE PRODUCCIN DE BAJO IMPACTO AMBIENTAL

ngel Roberto Reyes Aguilar1, Ana Lid del Angel Prez2, *Jacel Adame
Garca3, Jeremas Natarn Velzquez4, Jos Antonio Fernndez Viveros5
1
Instituto Tecnolgico de rsulo Galvn Km. 4.5 Carretera CardelChachalacas, rsulo
Galvn Veracruz. reyes.aguilar.angel.roberto@hotmail.com Ingeniero en Industrias de
Alimentos.
2
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) campo
experimental Cotaxtla. Km. 34.5 Carretera Federal VeracruzCrdoba Medellin de Bravo,
Veracruz. delangel.analid@inifap.gob.mx Dra. En Agroecosistemas Tropicales, Miembro
del Sistema Nacional de Investigadores Nivel 1, lnea de investigacin Servicios
ambientales y Agricultura Urbana.
3
Instituto Tecnolgico de rsulo Galvn Km. 4.5 Carretera CardelChachalacas, rsulo
Galvn Veracruz. jadameg@gmail.com Dra. En Biotecnologa y Ecologa, Miembro del
Sistema Nacional de Investigadores 20142016, candidata, responsable del Cuerpo de
Acadmico ITURG-CA-1 Estrategias Biotecnolgicas para el Aprovechamiento de los
Recursos Naturales, lder de la lnea de investigacin Biotecnologa en la produccin
alimentaria, agrcola y agroindustrial, Perfil Promep 20122015.
4
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) campo
experimental Cotaxtla. Km. 34.5 Carretera Federal VeracruzCrdoba Medellin de Bravo,
Veracruz. Jere_:465@hotmail.com Ing. Agrnomo, Especialidad Fitotecnia. Investigador
del Campo Experimental Cotaxtla, programa de Manejo Forestal y Servicios Ambientales.
5
Instituto Tecnolgico de rsulo Galvn Km. 4.5 Carretera CardelChachalacas, rsulo
Galvn Veracruz. jose.antonio.itug@gmail.com Maestro en Comunicaciones y
Tecnologas Educativas. Jefe del Laboratorio de Agua, Suelo, Planta del ITUG, lder de la
lnea de investigacin Bioprocesos, anlisis, transformacin y conservacin de los
productos y suplementos alimenticios

Resumen

1. Las comunidades microbianas del suelo son las ms diversas de la tierra y el suelo,
representa un hbitat favorable para ellas. En la mayora de los suelos alterados o
cultivados los hongos forman la mayor parte del total de la biomasa de
microorganismos. Los hongos constituyen un grupo de microorganismos de gran
inters econmico, industrial y cientfico.

16
El Agro Veracruzano 2015

2. En el presente trabajo se evalu el comportamiento de la biomasa fngica con


respecto a la lnea base del 2012 en un sitio en el cul se cambi su sistema
productivo a otro con menor impacto ambiental.
3. Las muestras de suelo se tomaron de la localidad Loma Iguana en sistemas
ganaderos extensivos con 2 diferentes escenarios (especies arbreas y especies
frutales), se determin la biomasa fngica en dos medios de cultivo: Papa
Dextrosa Agar y Rosa de Bengala. El anlisis de datos se realiz con el software
StatView (versin 5.0) mediante ANOVA y para el contraste de los datos se
utiliz la prueba de Tukey (p 0.05).
4. Al determinar la biomasa fngica en los sitios evaluados se observ que el nmero
de unidades formadoras de colonias (UFC) fngicas por gramo de suelo present
de manera general variacin en los sitios evaluados durante el 2013 con respecto a
la evaluacin realizada durante el 2012.
5. Los cambios en cuanto a la biomasa de microorganismos se deben a que los sitios
que presentan rboles frutales y/o maderables son sitios con alta diversidad, donde
se llevan a cabo relaciones complejas entre la fauna, flora y microflora y
mantienen la riqueza estructural del hbitat. Con base en lo anterior, se puede
decir que existe una interdependencia entre la ausencia y presencia de
comunidades de plantas y la abundancia de hongos.
Palabras clave: Suelo, diversidad, hongos.

Introduccin

Los microorganismos del suelo se encuentran en grandes cantidades, generalmente


por gramo de suelo se presentan de uno a diez millones donde predomina un gran
nmero de bacterias y hongos (Barns et al., 1999). Las poblaciones microbianas
del suelo estn inmersas en un marco de interaccin que afecta el desarrollo de las
plantas y la calidad del suelo. Ellas estn involucradas en actividades
fundamentales que aseguran la estabilidad y productividad, tanto de los
agroecosistemas como de los ecosistemas naturales. Investigaciones estratgicas y
aplicadas han demostrado el inters de ciertas actividades de cooperacin
microbiana para ser explotadas como una biotecnologa de bajo impacto y costo
para contribuir con prcticas agro-tecnolgicas sustentables y amigables con el
ambiente (Richardson et al., 2009).
As mismo, se ha comprobado que la microbiota es la encargada de mantener la
integridad de los ecosistemas (Whitford, 1996), debido a que est involucrada en
todos los ciclos biogeoqumicos, adems de la formacin de nuevo suelo, as como
de mantener la permeabilidad del sustrato y proporcionar caractersticas de paisaje
(Bhatnagar y Bhatnagar, 2005). En la mayora de los suelos alterados o cultivados
los hongos forman la mayor parte del total de la biomasa de microorganismos. Los

17
El Agro Veracruzano 2015
hongos constituyen un grupo de microorganismos de gran inters econmico,
industrial y cientfico, numerosos patgenos de plantas y microorganismos
promotores del crecimiento son hongos (Bossio et al., 1998; Lpez et al., 2006;
Steiner, 1992; Wainwrit, 1992). Con base en lo anterior, el objetivo de este trabajo
fue evaluar el comportamiento de la biomasa fngica con respecto a la lnea base
del 2012 en un sitio en el cual se cambi su sistema productivo a otro con menor
impacto ambiental.

Materiales y mtodos

Se tomaron muestras de suelo en la localidad Loma Iguana municipio de la


Antigua, Ver. ubicada a N19 1415 y W96 1915y a 20 msnm, en predios
donde se establecieron dos escenarios de bajo impacto ambiental en potreros; uno
de ellos con especies forestales: cedro (Cedrela odorata L.), caoba (Swietenia
macrophylla King.), roble (Ehretia tinifolia L.) y primavera (Tabebuia donnell-
smithii Rose) y el otro con especies frutales: naranja (Citrus sinensis), mango
(Mangifera indica), guanbana (Anona muricata), limn persa (Citrus latifolia), y
aguacate (Persea Americana). Y como referencia muestras de un acahual de 30
aos de edad. Fue evaluado el cambio o adicionalidad de la biomasa fngica de 19
tratamientos (Tabla 1) con respecto a la biomasa de la lnea base del 2012 (inicio
del proyecto).
Para determinar la biomasa fngica, se emplearon dos medios de cultivo: a) Agar
Rosa de Bengala (5.0 g Peptona, 10.0 g de Glucosa, 1.0 g de K2HPO4, 3.3 ml de
Rosa Bengala y 8.0 g de Agar bacteriolgico en 1 L agua destilada) y se esteriliz
en autoclave a 121 C, 15 libras de presin durante 15 minutos; y b) Agar Dextrosa
y Papa.
Las muestras de suelo se procesaron empleando el mtodo de dilucin en placa. Se
colocaron 10 g de suelo en 90 ml de agua destilada estril. Posteriormente se tom
1 ml de la dilucin y se coloc en 9 ml de agua destilada estril hasta obtener las
diluciones 10-5 y 10-6. Se inocularon 100 l de cada dilucin (10-5,| 10-6) en cajas
petri que contenan los medios de cultivo Papa Dextrosa Agar y Rosa de Bengala.
Se inocularon dos repeticiones (cajas petri) por cada medio. Las cajas se incubaron
a 25C durante 48 horas en una incubadora microbiolgica (memmert ). Posterior
al periodo de incubacin se contabiliz el nmero total de crecimientos miceliales.
Para el anlisis de datos se realiz un ANOVA empleando el software StatView
(versin 5.0) y para el contraste de medias se utiliz la prueba de Tukey (p<0.05).

18
El Agro Veracruzano 2015
Tabla 1. Tratamientos evaluados con respecto a la lnea base del 2012

Nombre Descripcin Abreviatura

Frutales Alta Densidad Orgnico 8 m x 14 m FRADO


Frutales Alta Densidad Mineral 8 m x 14 m FRADM
Frutales Baja Densidad Orgnico 14 m x 14 m FRBDO
Frutales Baja Densidad Mineral 14 m x 14 m FRBDM
Frutales Alta Densidad Testigo 8 m x 14 m FRADT
Frutales Baja Densidad Testigo 14 m x 14 m FRBDT
Forestal Mineral Cedro 1a 100g/rbol (100-25-25) FOMCE
2 100g/rbol (12-8-12)
Forestal Mineral Caoba 1a 100g/rbol (100-25-25) FOMCA
2a 100g/rbol (12-8-12)
Forestal Mineral Roble 1a 100g/rbol (100-25-25) FOMR
2a 100g/rbol (12-8-12)
Forestal Mineral Primavera 1a 100g/rbol (100-25-25) FOMP
2a 100g/rbol (12-8-12)
Forestal Testigo Cedro FOTCE
Forestal Testigo Caoba FOTCA
Forestal Testigo Roble FOTR
Forestal Testigo Primavera FOTP
Forestal Materia Orgnica Cedro 3 kg lomb./planta FOMOCE
Forestal Materia Orgnica Caoba 3 kg lomb./planta FOMOCA
Forestal Materia Orgnica Roble 3 kg lomb./planta FOMOR
Forestal Materia Orgnica Primavera 3 kg lomb./planta FOMOP
Acahual A2

Resultados

Al determinar la biomasa fngica en los sitios evaluados se observ que el nmero


de unidades formadoras de colonias fngicas por gramo de suelo (UFC/g)
present variacin en los tres sitios evaluados durante el 2013 con respecto a la
evaluacin realizada durante el 2012 (lnea base).
En el sitio donde se establecieron rboles frutales con baja y alta densidad adems
de fertilizacin qumica y orgnica, la biomasa fngica en medio de cultivo PDA
present diferencias significativas.
El mejor tratamiento fue el que se establecieron rboles frutales en baja densidad y
donde se aplic fertilizacin mineral (FRBDM) (P=0.0072), y el testigo con baja
densidad de rboles frutales (FRBDT) y sin fertilizacin qumica ni orgnica
(P=0.0267).
En los dems tratamientos aunque no se observ diferencia estadstica
significativa, si fueron superiores en cuanto al nmero de UFC/g, con respecto al

19
El Agro Veracruzano 2015
nmero determinado en el sitio antes de establecer los tratamientos (Lnea base
FR) (Figura 1).

a)

Inte raction Bar Plot for H PDA


Effe ct: Colum n 1
Error Bars : 1 Standard Error(s )
1E8
9E7
8E7
a
7E7 b
6E7 c
UFC/g

5E7
4E7 d
3E7 d
d
2E7
1E7 d
0

FRBDM

FRBDT
FRBDO
FRADM

FRADT
FRADO
FR

SITIOS

Inte raction Bar Plot for H RB


Effe ct: Colum n 1
b) 6E7
Error Bars : 1 Standard Error(s )

5E7
a

4E7
UFC/g

3E7 b b
b b
b
2E7

1E7 b

0
FRBDM

FRBDT
FRBDO
FRADM

FRADT
FRADO
FR

SITIOS

Figura 1. Cantidad de cepas fngicas/g de suelo en a) PDA y b) Rosa de Bengala en


sitio con frutales. Lnea base 2012 (FR), alta densidad, fertilizacin mineral
(FRADM), alta densidad, fertilizacin orgnica (FRADO), testigo alta densida
(FRADT), baja densidad, fertilizacin mineral (FRBDM), baja densidad, fertilizacin
orgnica (FRBDO) y testigo baja densidad (FRBDT).
Las barras representan el error estndar y letras distintas diferencias significativas (Tukey, 0.05).

20
El Agro Veracruzano 2015
La biomasa fngica en medio PDA en el sitio donde se establecieron rboles
forestales, muestra que solo el testigo donde se encontraban los rboles de cedro
fue significativamente superior (P=0.0062), con respecto a la biomasa obtenida en
la lnea base del 2012 y a los otros tratamientos (Figura 2a).

Inte r action Bar Plot for H PDA


Effe ct: Colum n 1
a) 5E6
Er r or Bar s : 1 Standar d Er r or (s )

4E6 a

3E6
UFC/g

b
2E6
b
b
1E6 b b b b
b b
b b b
0

FOMOCE
FOMCE

FOMOP

FOTCE
FOMOR
FOMP

FOTP
FOMOCA

FOMR

FOTR
FOMCA

FOTCA
FO

SITIOS

Inte r action Bar Plot for H RB


Effe ct: Colum n 1
Er r or Bar s : 1 Standar d Er r or (s )
4E6

4E6

3E6 a
b
3E6
UFC/g

2E6

2E6 c
c
b) 1E6 c c c
c

5E5 c c
c c c
0
FOMOCE
FOMCE

FOMOP

FOTCE
FOMOR
FOMP

FOTP
FOMOCA

FOMR

FOTR
FOMCA

FOTCA
FO

SITIOS

Figura 2. Cantidad de cepas fngicas/g de suelo en: a) PDA y b) Rosa de bengala, en


el sitio rboles maderables. Lnea base 2012 (FO), caoba-fertilizacin mineral
(FOMCA), cedro-fertilizacin mineral (FOMCE), roble-fertilizacin mineral
(FOMR), primavera- fertilizacin mineral (FOMP), caoba-fertilizacin orgnica
(FOMOCA), cedro- fertilizacin orgnica (FOMOCE), roble-fertilizacin orgnica
(FOMOR), primavera-fertilizacin orgnica (FOMOP), caoba-testigo (FOTCA),
cedro-testigo (FOTCE), roble-testigo (FOTR) y primavera-testigo (FOTP).
Las barras significan error estndar y letras distintas diferencias significativas (Tukey, 0.05).

21
El Agro Veracruzano 2015
Por otra parte, al emplear el medio de cultivo Rosa de bengala, se observ que el
tratamiento donde se encuentran establecidos los rboles de primavera con
fertilizacin orgnica (FOMOP) y el tratamiento con rboles de cedro y
fertilizacin mineral (FOMCE) tambin fueron superiores significativamente
(P=0.0009) a la lnea base (FO) y a los dems tratamientos (Figura 2b). Es
importante destacar el comportamiento de la biomasa fngica de los sitios
estudiados (frutales y forestales) tanto en medio PDA como en Rosa de Bengala.
En las Figuras 3a y 3b se puede observar como el nmero de UFC/g vara
significativamente (P<0.0001).
En el sitio donde se establecieron los frutales la biomasa fngica flucta entre los
valores de 2 x107 hasta 7x107 UFC/g en cambio en el sitio con rboles forestales
este nmero es considerablemente menor (3x106 hasta 4x105).
a)
Inte r action Bar Plot for H PDA
Effe ct: Colum n 1
Er r or Bar s : 1 Standar d Er r or (s )
1E8
9E7
8E7
a a
7E7
6E7 a
UFC/g

5E7
4E7
a
3E7 a
a
2E7
1E7 b b b
b b b b b b b b b b b
b b
0
FOMOCE
FOMCE

FOMOP

FOTCE
FOMOR
FOMP

FOTP
FOMOCA

FRBDM
FOMR

FOTR

FRBDT
FRBDO
FOMCA

FOTCA

FRADM

FRADT
FRADO
FR
FO
A1
A2

SITIOS

b)

Figura 3. Cantidad de cepas fngicas/g de suelo en: a) PDA y b) Rosa de bengala, en


sitio frutales y maderables. Las barras significan error estndar y letras distintas diferencias
significativas (Tukey,l 0.05).

22
El Agro Veracruzano 2015
Finalmente en el acahual se observa diferencia significativa (P=0.0249) con
respecto a la lnea base del 2012 del mismo sitio. Al determinar la biomasa de las
cepas fngicas en medio PDA (Figura 4a) y Rosa de Bengala (Figura 4b), se
observa una disminucin en cuanto al nmero de UFC por gramo de suelo.

a)
Inte r action Bar Plot for H PDA
Effe ct: Colum n 1
Er r or Bar s : 1 Standar d Er r or (s )
7E6

6E6
a
5E6
UFC/g

4E6

3E6

2E6

1E6 b

0
A1 A2
SITIOS

b)

Inte r action Bar Plot for H RB


Effe ct: Colum n 1
Er r or Bar s : 1 Standar d Er r or (s )
7E6

6E6
a
5E6
UFC/g

4E6

3E6

2E6

1E6 b
0
A1 A2
SITIOS

Figura 4. Nmero de cepas fngicas por gramo en medios: a) PDA y b) Rosa de


Bengala. Sitio Acahual: Lnea base 2012 (A1), Segunda evaluacin del Acahual (A2).
Las barras de error representan el error estndar de 8 repeticiones por muestra. Letras distintas
indican diferencias significativas para la prueba de Tukey a un nivel de significancia p<0.05.

23
El Agro Veracruzano 2015

Discusin

Los resultados obtenidos podran deberse a que los cambios en la diversidad de


plantas modifican la disponibilidad de recursos para las comunidades microbianas
hetertrofas en el suelo, modificando as su actividad, biomasa y composicin
(Habekost et al., 2008; Benizri y Amiaud, 2005). Tambin se ha sugerido que la
composicin de especies microbianas en el suelo est determinada por factores
abiticos y biticos, en funcin de la disponibilidad de nichos ecolgicos
diferentes (Zul et al., 2007).
Estos factores, adems de controlar la diversidad microbiolgica, muestran que la
biomasa microbiana est significativamente correlacionada con la diversidad de
plantas (Zak et al., 2003). Esta correlacin es atribuida a un alto nivel de
produccin primaria asociada a la diversidad de especies vegetales. Por otra parte
se coincide en parte con Marschner et al., (2001). Estos autores concluyeron que la
composicin de la comunidad microbiana en la rizsfera se afecta por una
interaccin compleja entre el tipo de suelo, las especies de plantas y la ubicacin
de la raz.
Los resultados de este trabajo concuerdan con estudios realizados anteriormente
(Ruiz y Febles 2001; Acosta et al., 2006; Ibrahim et al., 2006; Lok et al., 2006) en
los que se ha estimado la biomasa microbiana de dos sitios con giro extensivo
ganadero. Los resultados reportados muestran que existe una diferencia
significativa en las zonas siendo mayor el nmero de aislamientos de los sitios en
qu han sido insertadas especies forestales a manera de mejorar el dosel presente y
as disminuir el impacto ambiental que los sistemas ganaderos representan a la vez
de recuperar fertilidad en los suelos.
Tambin coincide con lo expresado por Hafich et al. (2012) cuando seala que la
introduccin de rboles en zonas de pastizales tropicales modifica de manera
significativa la cantidad y variedad de ADNr fngico, as como la biomasa
microbiana en general. La sombra del dosel de rboles genera microclimas mejores
y aumenta la cantidad de materia orgnica con lo cual aumenta la actividad
microbiolgica de hongos (Sadeghian et al., 1998; Machecha, 2002; Snchez et al.,
2003).
Los cambios en cuanto a la biomasa de microorganismos se deben a que los sitios
que presentan rboles frutales y/o maderables son sitios con alta diversidad, donde
se llevan a cabo relaciones complejas entre la fauna, flora y microflora y
mantienen la riqueza estructural del hbitat. Los microorganismos del suelo son
componentes esenciales de la comunidad bitica en estos sitios, y son responsables
de la funcionalidad de los ecosistemas porque participan en la mayora de las
transformacin de nutrientes (Hackl et al., 2004).
24
El Agro Veracruzano 2015

Con base en lo anterior, se puede decir que existe una interdependencia entre la
ausencia y presencia de comunidades de plantas y la abundancia de hongos, lo que
sugiere que el mecanismo ms importante a travs del cual los cambios en la
diversidad de plantas afectan las comunidades microbianas del suelo y las
actividades del ciclo del carbono, puede ser a travs de alteraciones en la
abundancia fngica ms que en la composicin de la comunidad (Carney y
Matson, 2005).
Se ha comentado que una de las partes fallidas de los sistemas de reforestacin es
lograr la sobrevivencia de las especies cuando son plantadas. De ah la importancia
de los microorganismos que aportan beneficios a los rboles, por ejemplo,
aumentan su desarrollo, brindan mayor adaptabilidad cuando se trasplantan y
aportan agua del subsuelo ante situacin de estrs hdrico (OlaldePortugal, 2013).
Estudios recientes realizados por OlaldePortugal (2013) demuestran que los
hongos al estar en contacto con las races comienza una comunicacin bioqumica
que permite a los rboles adaptarse sin problema cuando se trasplantan. Adems, el
microorganismo se encarga de explorar el suelo ms all de lo que pueden alcanzar
las races para llevarles elementos tiles para su desarrollo, como el fsforo.
Es importante sealar el resultado del sitio forestal que en comparacin con el sitio
con frutales el cual present una biomasa fngica mayor. Al introducir rboles
forestales se ha observado que especies como la Caoba (Swietenia macrophylla) y
Tectonagrandis L. tienen una alta actividad microbiolgica en sus rizsferas sin
embargo dicha actividad se enfoca ms hacia especies de hongos micorrzicos
arbusculares (Alvarado et al., 2004; Dhar y Mridha, 2006; Rodrguez et al., 2010).
Por otra parte, al observar el comportamiento de la biomasa fngica en el sitio con
el Acahual se present un fenmeno contrario a lo que se esperaba, mayor
diversidad vegetal mayor biomasa fngica. Sin embargo aunque se tiene
conocimiento de los cambios en las asociaciones forestales tropicales durante el
proceso de sucesin, no se puede decir lo mismo de la manifestacin de este
fenmeno a nivel de los cambios que ocurren en la biota del suelo, a pesar de la
gran importancia que estos organismos tienen en el mantenimiento de los ciclos
biogeoqumicos, en la conservacin del suelo y en el equilibrio general del
ecosistema (Foumier, 1970; Fraser, 1955; Fassbender, 1975).
Los hongos y las bacterias en asociacin con ciertos grupos de invertebrados son
fundamentales para el proceso de descomposicin del mantillo. Esto exige que el
conocimiento sobre la variacin en las asociaciones de estos organismos durante el
proceso de sucesin sea fundamental para una mejor comprensin de muchos de
los cambios fsicos y qumicos que ocurren en el suelo (Blaseo, 1970).
La estimacin de la microbiota edfica es de suma importancia, lo cual ha
generado en los ltimos aos un incremento en el estudio de esta. Se le considera

25
El Agro Veracruzano 2015

como uno de los principales indicadores de calidad en los suelos agrcolas (Parr et
al., 1992; Astier y Caldern, 2002), y ha sido uno de los principales puntos de
mejora para los agricultores orgnicos (Kandeler et al., 1996).
La biomasa microbiana est directamente ligada a la disponibilidad de nutrientes
para las plantas debido a que los microorganismos son los principales productores
de las enzimas que degradan la materia orgnica (Kandeler et al., 1996).
Los sitios son extensivos y con pastos perennes, lo que puede ser influyente en una
alta cantidad de microbiota en el suelo, en especial especies de hongos (Acosta,
2004; Gardner et al, 2004) aunados a las emisiones de bacterias provenientes de
los desechos del ganado (Hutchison et al., 2004).
En zonas tropicales las gramneas son altamente atacadas por el hongo
Colletotrichum gramincola (Valrio et al., 2005), y tambin ha sido aislado e
identificado el hongo Trichoderma hamatum el cual presenta actividad antagonista
a hongos fitopatgenos y promueve el crecimiento vegetal (Brewer y Taylor,
1981). Se han aislado tambin hongos de los gneros Fusarium, Phytium,
Rhizoctonia entre otros (Thornton, 1960) lo cual genera una idea de los aislados
que pueden llegar a identificarse.
Si bien las caractersticas morfolgicas de crecimiento micelial as como la
formacin y coloracin de colonia permiten diferenciar y, mediante observacin,
estimar el nmero diferente de cepas aisladas, nuevas tcnicas moleculares que se
han venido desarrollando en los ltimos aos son herramientas muy valiosas para
determinar las especies existentes en los ecosistemas y tambin las relaciones
filogenticas entre estas en las poblaciones edficas (Gardner et al., 2004).
Algunas de estas tcnicas son: identificacin molecular (Landerweert et al., 2003;
Anderson et al., 2004; Wei et al., 2011); anlisis de fosfolpidos de cidos grasos
(PLFA) (Zelles et al., 1999; Miethling et al., 2000; 2000; Yao et al., 2010) y ms
recientemente la pyrosecuensiacin (Gardner et al., 2004). Esto permitir un
anlisis ms amplio y concreto de la biodiversidad de microbiota edfica.

Conclusiones

El nmero de UFC fngicas por gramo de suelo present de manera general


variacin en los tres sitios evaluados durante el 2013 con respecto a la lnea base.
La biomasa fngica en medio de cultivo PDA del tratamiento donde se
establecieron rboles frutales en baja densidad y donde se les aplic fertilizacin
mineral y en el testigo con baja densidad de rboles frutales fue superior a los
dems tratamientos.

26
El Agro Veracruzano 2015
En el sitio con rboles frutales, todos los tratamientos presentaron un nmero de
UFC fngicas superior al obtenido en el sitio antes de establecer los tratamientos

en los dos medios de cultivo empleados. En el sitio forestal el testigo donde se


encontraban los rboles de cedro la biomasa obtenida en medio PDA fue
significativamente superior a la de la lnea base y a los otros tratamientos.
Por otra parte, al emplear el medio de cultivo rosa de bengala, se observ que el
tratamiento donde se encuentran establecidos los rboles de primavera con
fertilizacin orgnica y el tratamiento con rboles de cedro y fertilizacin mineral
(tambin fueron superiores significativamente a la lnea base (FO) y a los dems
tratamientos.
La biomasa fngica de los sitios estudiados (frutales y forestales) tanto en medio
PDA como en Rosa de Bengala vari fluctu entre los valores de 2 x107 hasta
7x107 UFC/g en el sitio donde se establecieron los frutales en cambio en el sitio
con rboles forestales este nmero fue considerablemente menor (3x106 hasta
4x105).

Literatura Citada

Brewer, D., Taylor, A. 1981. Ovine III thrift in Nova Scotia. 7. Trichodermahamatum
isolated from pasture soil. Mycopathologia76: 167 173.
Carney, K. M., and P. A. Matson. 2005. Plant Communities, Soil Microorganisms, and Soil
Carbon Cycling: Does Altering the World Belowground Matter to Ecosystem
Functioning?. Ecosystems. 8: 928940.
Dhar, P.P., Mridha M.A.V., 2006, Biodiversity of arbuscularmycorrhizal fungi in different
trees of madhupur forest, Bangladesh. Journal of Forestry Research 17: 201
205.
Fassbender, H. W. 1975. Qumica de Suelos; con nfasis en suelos de Amrica Latina.
Instituto Interamericano de Ciencias Agrcolas de la OEA. Turrialba, Costa Rica.
398 p.
Fournier, L. A, & Mara Eugenia Herrera de Foumier. 1977. La sucesin ecolgica como
un mtodo eficaz para la recuperacin del bosque en Costa Rica. Agronoma
Costarricense, 1: 23-29.
Frazier, W.C., D.C. Westhoff. 1985 Microbiologa de los Alimentos, Ed. Acribia,
Barcelona.
Gardner T., Acosta-Martinez V., Senwo Z. and Dowd S. E. 2001.Soil Rhizosphere
Microbial Communities and Enzyme Activities under Organic Farming in
Alabama.Diversity. 3:308-328. doi:10.3390/d3030308.
Habekost, M., N. Eisenhauer, S. Scheu, S. Steinbeiss, A. Weigelt, G. Gleixner. 2008.
Seasonal changes in the soil microbial community in a grassland plant diversity
gradient four years after establishment. Soil Biology and Biochemistry. 40: 2588
2595.
27
El Agro Veracruzano 2015
Hackl E., Zechmeister-Boltenstern S., Bodrossy L., Sessitsch A. 2004.Comparison of
diversities and compositions of bacterial populations inhabiting natural forest
soils.Applied Environmental Microbiology. 70:50575065.
Hafich, K., Perkins E.J., Hauge, J.B., Barry, D., Eaton, W.D., 2012.Implications of land
management on soil microbial communities and nutrient cycle dynamics in the
lowland tropical forest of northern Costa Rica.Tropical Ecology 53: 215 224.
Hutchison, M.L., Walters L.D., Moore, A., Crookes, K.M., Avery, S.M., 2004, Effect of
Length of Time before Incorporation on Survival of Pathogenic Bacteria Present
in Livestock Wastes Applied to Agricultural Soil. Applied and
EnvironmentalMicrobiology. 70: 5111 5118.
Ibrahim, M., Villanueva, C., Casasola, F. & Rojas, J. 2006. Sistemas silvopastoriles como
una herramienta para el mejoramiento de la productividad y la restauracin de la
integridad ecolgica de paisajes ganaderos. IV Congreso Latinoamericano de
Agroforestera para la Produccin Pecuaria Sostenible. Seccin de Conferencias.
La Habana, Cuba. 23 p.
Kandeler, E.; Kampichler, C.; Horak, O. Influence of heavy metals on the functional
diversity of soil communities.Biol. Fertil. Soils 1996, 23, 299306.
Landeweert, R., Leeflang, P., Kuyper, T.W., Hoffland, E., Rosling, A., Wernars, K., Smit,
E., 2003. Molecular identification of ectomycorrhizical mycelium in soils
horizons. Appl. Environ, Microbiol. 69: 327 333.
Lok, S., Crespo, G., Frmeta, E., Torres, V. & Fraga, S. 2006. Estudio y seleccin de
indicadores de sostenibilidad en pastizales silvopastoriles. IV Congreso
Lationoamericano de Agroforestera para la Produccin Pecuaria Sosternible.
Seccin de Psters. La Habana, Cuba. 4p.
Lpez-Ros, C.A.; Zuluaga-Meneses, A.; Herrera-Penagos, S.N.; Ruiz-Colorado, A.A.;
Medina de Prez, V.I. 2006. Production of citric acid with Aspergillus niger
NRRL 2270 from milk whey. Dyna 73:39-57.
Machecha, L. 2002. El silvopastoreo: una alternativa de produccin que disminuye el
impacto ambiental de la ganadera bovina. Rev. Col. Cienc. Pec. 15:226.
Marschner, P., C. H. Yang, R. Lieberei, and D.E. Crowley. 2001. Soil and plant specific
effects on bacterial community composition in the rhizosphere. Soil Biology and
Biochemistry. 33:14371445.
Miethling, R.; Wieland, G.; Backhaus, H.; Tebbe, C.C. 2000. Variation of microbial
rhizosphere communities in response to crop species, soil origin, and inoculation
with Sinorhizobiumnelitoti L33. Microb. Ecol. 41: 43 56.
Olalde-Portugal V., 2013. Potencian con bacterias el crecimiento de rboles frutales hasta
en un 40%. Agencia Iberoamericana para la Difusin de la Ciencia y la
Tecnologa (Verificado Abril 2014) (http://www.dicyt.com/noticias ).
Parr, J.F., Papendick, R.I., Hornick S.B., Meyer R.E.1992. Soil quality: Attributes and
relationships to alternative and sustainable agriculture. American Journal of
Alternative Agriculture 7: 5 11.
Richardson AE, Barea JM, McNeill AM, Prigent-Combaret C. 2009. Acquisition of
phosphorus and nitrogen in the rhizosphere and plant growth promotion by
microorganisms. Plant and Soil 321: 305-339.

28
El Agro Veracruzano 2015
Rodrguez, M.V.H., 2010 Diversidad de hongos micorrzicosarbusculares y su interaccin
con factores ambientales y fisiolgicos en la produccin de plntulas de Caoba
(Swieteniamacrophylla King). Tesis de maestra. Colegio de Postgraduados.
Ruiz, T. & Febles, G. 2001. Factores que influyen en la produccin de biomasa durante el
manejo del sistema.
Sadeghian, J., Rivera, J.M. & Gmez, M.E. 1998. Importancia de sistemas de ganadera
sobre las propiedades fsicas, qumicas y biolgicas de los suelos en los andes de
Colombia. Disponible en:
http://www.fao.org/WAICENT/FaoInfo/Agricult/AGA/AGAP/FRG/AGROFOR1/
Siavosh.pdf. Consultado: 29/01/13.
Snchez, M., Rosales, M. & Murgueitio, E. 2003. Agroforestera pecuaria en Amrica
Latina. En: Agroforestera para la produccin animal en Amrica Latina. Eds.
D.M Snchez y M. Rosales. FAO. Roma. 10 p.
Steiner, R.Y., Ingraham, J.L.; Wheelis, M. L.; Painter, R. P. 1992. Microbiologa. 2da
edicin editorial Reverte.pp.724-725.
Thornton, R.H., 1960. Fungi of some forest and pasture soils. New Zealand Journal of
Agricultural Research.
Valrio, H.M., Resende, M.A., Weikert, O., Casela, C.R., 2005. Virulence and molecular
diversity in Colletotrichum graminicolafrom Brazil.Mycopathologia 159: 449
459.
Wainwright, M. 1992: introduccin a la biotecnologa de los hongos. Ed. Acribia, S.A.
Wei, G.J., Yongl, Z., Cai, B.Y., 2011. Molecular identification of the fungi in the
rizosphheric soil of soybean. Soybean Science 2011 03.
Whitford, W.G., 1996. The importance of the biodiversity on soil in arid ecosystems.
Biodiversity and Conservation. 5: 185-195.
Yao, H.; Wu, F. 2010. Soil microbial community structure in cucumber rhizosphere of
different resistance cultivars to fusarium wilt. FEMS Microbiol.Ecol.72. 456
463.
Zak, D. R., W. E. Holmes, D. C. White, A. D. Peacock, and D. Tilman. 2003. Plant
diversity, soil microbial communities, and ecosystem function: are there any
links? Ecology 84:20422050.
Zelles, L. 1999. Fatty acid patterns of phospholipids and lipopolysaccharides in the
characterisation of microbial communities in soil: A review. Biol. Fertil. Soils 29:
111129.
Zul, D., S. Denzel, A. Kotz, and J. Overmann. 2007. Effects of Plant Biomass, Plant
Diversity, and Water Content on Bacterial Communities in Soil Lysimeters:
Implications for the Determinants of Bacterial Diversity. Applied and
Environmental Microbiology. 73 (21): 69166929.

29
El Agro Veracruzano 2015

3
PERCEPCIN DE LA BIODIVERSIDAD POR PARTE DE LA
COMUNIDAD GANADERA. EL CASO DEL ESTADO DE VERACRUZ

Carlos Nahin Castro Jose1, Ana Lid del Angel Prez2, Carmen Aridai Hernndez
Estrada3
1
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) km 34.5
de la Carretera Federal Veracruz- Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270.
e-mail: nahin.castro@gmail.com. Asistente tcnico de investigacin en Servicios
Ambientales.
2
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) km 34.5
de la Carretera Federal Veracruz- Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270.
e-mail: delangel.analid@inifap.gob.mx. Investigadora titular de Socioeconoma y Servicios
Ambientales. Doctora en Ciencias en agroecosistemas tropicales.
3
Instituto Nacional de Investigaciones Forestales Agrcolas y Pecuarias. (INIFAP) km.
34.5 de la Carretera Veracruz-Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270. e-
mail: hernandez.carmen@inifap.gob.mx. Investigadora de Socioeconoma. Maestra en
Ciencias.

Resumen
1. El tipo de ganadera practicada en el estado de Veracruz requiere de grandes
extensiones de terreno para el pastoreo de los animales; la ampliacin de estas
reas trae consigo una serie de impactos directos que afectan el medio en el que se
desarrolla; destacan la perdida de flora y fauna, tanto en riqueza como en
abundancia de especies, la compactacin del suelo debido al pisoteo constante, la
contaminacin y destruccin de cuerpos de agua. La participacin de la
comunidad ganadera en esta problemtica debe ser vista como parte fundamental
de las actividades de conservacin de tales reas y tambin un pblico objetivo
cuyas percepciones deben definir el potencial de las lneas de conservacin en la
zona.
2. El objetivo del trabajo fue determinar las especies animales y vegetales
reconocidas y percibidas por los ganaderos dentro de sus terrenos en tres
diferentes zonas del estado de Veracruz para obtener una visin general de la
riqueza de los hbitats ganaderos del estado.

30
El Agro Veracruzano 2015
3. Se aplicaron 200 cedulas estructuradas, con preguntas abiertas a los ganaderos
sobre la flora y fauna que tienen o han visto en sus terrenos.
4. La fauna se agrupo por clase taxonmica (Mammalia, Aves, Sauropsida) siendo
las aves las que tuvieron mayor porcentaje de registros, 53.94, 44.95 y 38.53%
para cada una de la zonas. La flora se agrupo por usos (forraje, consumo humano,
maderable) la vegetacin para consumo humano tuvo el mayor porcentaje de
registros para las tres zonas con valores de 42.55, 34.82 y 42% respectivamente.
No se mencionaron insectos y organismos de menor tamao.
5. Los ganaderos reconocen especies de mayor tamao, principalmente mamferos,
pero desconocen en su totalidad organismos menores que tambin son
fundamentales en los ecosistemas donde se desarrolla la ganadera extensiva. En
cuanto a vegetacin, los rboles frutales fueron los ms mencionados, aunque no
destacan como un cultivo, se encuentran intercalados en los cercos. La vegetacin
herbcea no fue mencionada, debido principalmente a la dominancia que tienen
los pastos forrajeros en los terrenos.
Palabras Clave: Vegetacin nativa- suelos- conservacin.

Abstract
1. The type of livestock practiced in the state of Veracruz require large tracts of land
for grazing animals; extending these areas brings a number of direct effects
affecting the environment in which it operates; stand the loss of flora and fauna,
both in wealth and abundance of species, soil compaction due to constant
trampling, pollution and destruction of water bodies. The participation of the
livestock community on this issue should be seen as an essential part of
conservation activities such areas and also a target audience whose perceptions
must define the potential of the lines of conservation in the area.
2. The objective was to determine recognized animal and plant species and perceived
by farmers in their fields in three different areas of the state of Veracruz to get an
overview of the wealth of livestocks habitats Veracruz.
3. Two hundred structured surveys were applied with open and close questions to
the livestock producers about the plants and animals that have or have seen in their
fields
4. Animals was grouped by taxonomic class (mammalia, birds, Sauropsida) where
the birds which had higher percentage of records, 53.94, 44.95 and 38.53% for
each of the areas. The plants of uses (fodder, drinking, and timber) vegetation for
human consumption had the highest percentage of records for the three zones with
values of 42.55, 34.82 and 42% respectively grouped. The insects and smaller
organism not were mentioned.
5. Livestock producers recognize larger species, mainly mammals, but the smaller
organisms are unknown that are also fundamental in ecosystems where livestock is
developed. As for vegetation, fruit trees were the most mentioned, but not stand

31
El Agro Veracruzano 2015
out as a crop, are interspersed in the fences. Herbaceous vegetation was not
mentioned, mainly due to the dominance with forage grasses on land.
Keywords: Native vegetation-soil-conservation

Introduccin

La ganadera es una de las actividades econmicas ms importantes a nivel


mundial, en Mxico tiene un importante desarrollo en las zonas tropicales en
donde se desarrolla principalmente bajo el sistema de produccin extensivo (Oroz
et al., 2011, Guevara et al., 2008, Landeros-Snchez, 2011) en el cual, se ven
comprometidas grandes extensiones de terreno que deben de cambiar parcial o
totalmente para dar cabida a determinado nmero de cabezas de ganado, las cuales,
en la mayora de los casos, superan la capacidad de carga que el ecosistema puede
sostener (Figura 1).

Figura 1. En la ganadera veracruzana el nmero de cabezas de ganado supera en


ocasiones el rea mnima de pastoreo. Fotografa: Ana Lid del Angel Prez

En Mxico la ganadera es la actividad productiva ms comn en el medio rural


abarca un total de 110 millones de hectreas, es decir, 56 % del territorio nacional
(Mora et al., 2013). En el estado de Veracruz, ocupa cerca del 69 % de la tierra
laborable, con un total de 3,757,487 hectreas (INEGI 2013), donde se encuentran
un total de 1,736,656 cabezas de ganado bajo el sistema de libre pastoreo

32
El Agro Veracruzano 2015
distribuidas en 115,996 unidades de produccin (INEGI, 2007), estas reas en gran
medida deforestadas debido a que estn bajo el monocultivo de pastos exticos
(Landeros-Snchez, 2011), entre los que destacan los gneros Cynodon y Panicum
(Romn et al., 2009).

Actividades agroipecuarias en las que se modifica el paisaje de manera parcial o


total, ocasionan un fuerte impacto, debido a que el hbitat natural de una gran
diversidad de organismos tanto vegetales como animales, as como
microorganismos, se ve perturbado de tal manera que la fauna se ve obligada a
buscar refugio dentro de los parches de vegetacin que quedan a manera de islas
(Figura 2) en los potreros, o siguen la lnea de avance de los pastizales, (Loening et
al., 2003) por lo que es comn ver reducidas sus poblaciones y por consiguiente
sus avistamientos. Desde esta perspectiva se puede considerar que los parches de
vegetacin (acahuales) en los potreros constituyen islas con fauna silvestre, a
manera de ltimas fronteras.

Figura 2. En zonas manejadas con ganadera extensiva, es comn ver parches de


vegetacin tambin conocidos como islas en los que se desarrollan especies de los
diferentes niveles del bosque y sirven de refugio para ciertas especies animales.
Fotografa: Carlos Nahin Castro Jose

Adems de la carga animal, algunas prcticas tecnolgicas que son ampliamente


utilizadas en el trpico mexicano, carecen de controles de calidad, como en el caso
de los desparasitantes externos por ejemplo, cuyos daos son en primer lugar al
33
El Agro Veracruzano 2015
semoviente, al productor, el cual muchas veces no cuenta con el equipo ms
elemental para su proteccin a la hora de aplicar este tipo de tratamientos; aunado
a esto se encuentran los herbicidas que daan la fauna edfica, por los residuos
qumicos que se infiltran en el suelo y a los cuerpos de agua internos (Martnez y

Cruz 2009) (Guevara et al., 2011), esta cadena de contaminacin no se detiene a


nivel de suelo, sino que es capaz de llegar a ros, lagunas, estuarios y dems
ecosistemas acuticos que se encuentran muy apartados de donde se inici el
proceso contaminante.

Figura 3. El monocultivo de pastos en reas ganaderas, reduce los procesos de


sucesin, por lo que se ve afectada la germinacin de semillas de otras especies
vegetales y por lo tanto una reduccin en la riqueza y diversidad. Fotografa: Carlos
Nahin Castro Jose

Para el caso de la vegetacin, se sabe que el manejo de praderas en las que se


establecen los monocultivos de pastos (Figura 3), generalmente no nativos,
reducen considerablemente los procesos de sucesin ecolgica (Ortega et al.,
2011), en los que se establecen especies de los diferentes estratos de la vegetacin
que en estas condiciones se ven desfavorecidos, la introduccin de este tipo de
especies exticas ejercen impactos negativos en la composicin de las especies,
estructura y funcionamiento de los ecosistemas invadidos (Peralta-Pelez, 2007),
(De la O et al., 2012) en el sentido de la cadena trfica, una gran cantidad de
organismos que dependen de la vegetacin y de los diferentes escenarios vegetales

34
El Agro Veracruzano 2015
se ven afectados, ya que en estas, no solo no encuentran condiciones para su
alimentacin, sino tambin sitios de refugio, anidamiento y reproduccin.
Todos estos componentes, refirindonos a plantas, animales, ganado y productores,
son parte de un agroecosistema que est siendo afectado cada vez ms por diversos
factores, el cambio climtico, como ejemplo ms conocido, ha provocado que los
patrones de lluvia se vuelvan irregulares, causando una reaccin en cadena en la
que se afecta a todos por igual (Siavosh et al., 1999). Con lo anterior cualquier
solucin dentro de los mbitos de conservacin, desarrollo y aplicacin de
tecnologa requiere considerar todos los componentes que integran este medio y no
visualizarlo como si fueran independientes entre s, sino como partes que se
complementan unas con otras (Guevara et al., 2011). Si bien, todos los
componentes son importantes, para el caso de actividades que ayuden a mitigar el
incuestionable impacto que genera la ganadera en los ecosistemas del estado de
Veracruz, en donde el impacto tambin se considera de ndole social, ya que el
afectado final no es solo el ambiente (suelo, agua biodiversidad) si no tambin la
sociedad en su conjunto (Del Angel et al., 2006), sobre todo al sector de la
poblacin ms vulnerable, empobrecido y necesitado, como lo son los pescadores,
pequeos agricultores, nios y mujeres de las zonas rurales (Moreno et al., 2007)
es de suma importancia considerar a los propios ganaderos como pieza clave en la
bsqueda de solucin por ser los protagonistas de dicha actividad (Guevara et al.,
2011, Osbahr y Morales, 2012). Los pobladores locales muchas veces tienen
informacin de considerable importancia sobre la historia natural y la presencia o
ausencia de plantas y animales en el ambiente que los rodea. Esta informacin
existente en la memoria colectiva de los comunarios puede ser de mltiple utilidad
para los planes de manejo de la fauna (Delgado et al, 2011), pues el imaginario del
protagonista muestra la interiorizacin de conceptos selectivos que definen la
importancia de los mismos. La experiencia personal, as como la cercana relacin
que tienen los habitantes de este medio, les proporcionan conocimientos que
pueden ser de gran ayuda para diagnosticar el estado de del ecosistema (Guevara et
al.,2011) (Vergara et al., 2009), de la misma manera, el diagnstico de la
percepcin de ciertos componentes biticos, en especial, plantas y animales puede
contribuir a reconocer cuales son los puntos que deben ser fortalecidos al momento
de realizar acciones de conservacin, en las que se incluya a los productores como
ejecutores de estas, y as, se beneficie a todos los componentes del medio donde se
incluyan desde los organismos ms pequeos, hasta los ms conspicuos.
Considerando lo anterior, el objetivo del presente trabajo fue identificar la
diversidad faunstica y florstica de tres diferentes zonas en el estado de Veracruz,
a travs de las percepciones de los ganaderos, como una manera de conocer la
importancia del tipo de flora y fauna en reas ganaderas.

35
El Agro Veracruzano 2015
Materiales y mtodos

Ubicacin del rea de trabajo.El estado de Veracruz se localiza a 22 28-17


9N y 93 36-9839 O cuenta con una superficie total de 71 820.40 Km2 de los
cuales 32 309.83 Km 2 estn cubiertos con pastizales (INEGI, 2005).

El rea de trabajo se distribuy a lo largo de la planicie costera del estado,


definiendo tres zonas que abarcaron un total de 12 localidades. La zona norte
contemplo los municipios de Nautla, Palma Sola, San Rafael y Vega de Alatorre,
la zona Centro a La Antigua, Medelln, Paso de Ovejas y Veracruz; finalmente,
para la zona Sur se seleccion a Acayucan, Isla, San Andrs Tuxtla y Santiago
Tuxtla (Figura 4).

Figura 4. reas de trabajo a lo largo del estado de Veracruz, en donde se realizan


actividades de ganadera extensiva. Fuente: INEGI (2005) con modificaciones propias.

Las reas de estudio tienen diferentes tipos de clima, la zona Norte y Centro est
caracterizada por un clima clido subhmedo con lluvias en verano y una marcada
estacin de secas. La zona Sur, que comprende la regin de Los Tuxtlas, se
caracteriza por un clima clido hmedo con lluvias prcticamente todo el ao, esto,
junto con las caractersticas del suelo, propician el desarrollo de pastizales y
vegetacin arbustiva de poca altura y rboles de ms de 20 m. de altura con buena
definicin de los estratos de vegetacin (Lira et al., 2007, Barradas et al., 2011).

36
El Agro Veracruzano 2015
En todas las zonas, las actividades ganaderas se desarrollan de manera extensiva,
permitiendo a los animales pastorear libremente, ingiriendo pasturas, y
ramoneando las especies de los diferentes niveles vegetales si las hubiere.
Las modificaciones realizadas en este tipo de paisajes, que van desde el cambio de
uso de suelo, eliminacin de la vegetacin nativa y el desplazamiento de especies
animales de mayor tamao, es el motivo por el cual se deben realizar acciones que
contribuyan a mantener un equilibrio entre medio ambiente y el sistema
productivo. De la misma forma considerando lo que seala Cingolani et al.,
(2008), no es viable inclinarse de manera total hacia alguno de estos aspectos,
debido a la imposibilidad de realizar acciones de conservacin en todas las reas
de ganadera porque causara afectaciones al medio de subsistencia de muchas
personas, tampoco es posible dejar de lado los efectos que causa este tipo de
actividad productiva, ya que, si en el corto plazo no se atienden las necesidades del
medio, en los aos siguientes veremos el agotamiento de una gran diversidad de
recursos naturales as como de los servicios ambientales proporcionados por el
ecosistema.
Colecta de datos. Durante el ao 2012 se aplicaron 200 cedulas estructuradas, 40
en la zona Norte, 85 en la zona Centro y 75 en la zona Sur para medir y cuantificar
las percepciones de los recursos naturales, utilizando escalas tipo Likert (donde 1
es muy malo y 5 muy bueno) se solicit informacin socioeconmica y se
pregunt de forma directa sobre el tipo de fauna observada de forma regular dentro
de los terrenos destinados a actividades de ganadera extensiva, as como la flora
que se encuentra dentro de los mismos. Para analizar la fauna se establecieron tres
diferente grupos taxonmicos (Mammalia, Aves y Sauropsida); los resultados se
organizaron en matrices y se les realizo un anlisis simple registrndose los
nombres de las especies animales y el uso de las especies vegetales, los valores
obtenidos fueron analizados respecto al nmero total de registros (Osbahr y
Morales., 2012), en el caso de la fauna se determin a que familia pertenecan y
para la flora, las especies y el uso que se les da. Tambin se contabilizo el nmero
de especies registradas para cada grupo.

Resultados

Percepcin de la diversidad faunstica por parte de la comunidad ganadera.


Los resultados mostraron que el grupo de las aves fue el que obtuvo el mayor
nmero de registros, as como el porcentaje ms alto respecto al total de registros
en las tres zonas (Tabla 1).

37
El Agro Veracruzano 2015
Tabla 1. Porcentaje de registros por grupo taxonmico respecto al total de fauna
registrada en cada una de las zonas de estudio

Registros por rea de estudio


Clase Zona norte Zona centro Zona sur
taxonomica No. % No. % (TR=347) No. % (TR=
(TR*=152) 327)
Mammalia 43 28.28 142 40.92 126 38.53
Aves 82 53.94 156 44.95 126 38.53
Sauropsida 27 17.76 49 14.12 75 22.93

Se determin un total de 8 familias mencionadas por los productores ganaderos


para la zona norte y 10 para la zona Centro y Sur (Figura 5).

Figura 5. Nmero de familias-especies identificadas por los productores en sus reas


ganaderas.

Tabla 2. Nmero de familias faunsticas ms representativas en las zonas con


actividades ganaderas.
Zona norte Zona centro Zona sur
Mammali Aves Sauro Mammalia Aves Sauropsi Mamma Aves Sauropsi
a psida da lia da
Leporidae Icteridae Colub Canidae Tyran Colubri Leporid Craci Colubri
(14) (13) ridae (40) nidae dae (22) ae (42) dae dae (32)
(9) (26) (20)
Tyranni
dae (13)

38
El Agro Veracruzano 2015
Percepcin de la diversidad florstica. Para el caso de las especies vegetales que
se encuentran en las zonas ganaderas, las especies que son destinadas para el
consumo humano registraron el mayor porcentaje de registros para las tres zonas
de estudio (Tabla 3).

Tabla 3. Nmero de registros para las especies vegetales identificadas por la


comunidad ganadera.

Registros por rea de estudio


Zona Norte Zona Centro Zona Sur
Usos de la flora No. % (TR=329) No. % (TR=962) No. % (TR=588 )
Forraje 84 25.53 301 31.28 169 28.74
Consumo humano 140 42.55 335 34.82 247 42.00

Maderables 105 31.91 326 33.88 172 29.25

* TR= Total de registros de flora

Tabla 4. Nmero de menciones de las especies de flora ms representativas en reas


de ganadera extensiva

Zona norte Zona centro Zona sur

Consumo Consumo Consumo


Forraje Maderables Forraje Maderables Forraje Maderables
humano humano humano

Bursera Cedrela Bursera Mangifera Cedrela Gliricidia Mangifera Cedrela


Mangifera
simaruba odorata simaruba indica odorata sepium indica odorata
indica (20)
(23) (26) (58) (48) (69) (36) (34) (46)

Musa
paradisiaca
(20)

Discusin

Las familias faunsticas ms representativas se muestran en la Tabla 2. Es


importante mencionar que para el caso de las aves el nmero de especies en las
zonas ganaderas est muy por debajo de lo que muestran(Bojorges y Lpez,
2006)., donde se registraron un total de 99 especies en pastizales ganaderos de
Veracruz, ante esta situacin se debe considerar que los encuestados tienen poco o
nulo conocimiento acerca de la diversidad de especies que habitan en sus terrenos

39
El Agro Veracruzano 2015
as como si estas son residentes o migratorias, esto pudo haber contribuido a que
hallan mencionado una baja cantidad de especies de avifauna. Para lo anterior se
debe considerar que las descripciones realizadas por los entrevistados son muy
generales y no describen con exactitud la especie del individuo, por ello los
registros se establecieron a nivel familia.

Figura 6. Nmero total de especies vegetales registradas en las reas de estudio.

Si bien, el nmero de aves a pesar de ser inferior a lo reportado por Bojorges y


Lpez, 2006 el autor, se sugiere que existen condiciones que favorecen la
presencia de estas, ya que en algunas reas de ganadera extensiva, se utilizan
cercos vivos o conservan parches de vegetacin nativa que funcionan como zonas
de alimentacin, anidamiento y ocultamiento que favorecen la presencia de estos
organismos (Zapata et al., 2007, Murgueitio y Calle, 1998). Es muy probable que
las aves encuentren una fuente de alimento en las islas de vegetacin,
particularmente insectos, los cuales tambin encuentran refugio en estas zonas y
que sin embargo no fueron mencionados por los entrevistados debido al
desconocimiento de los mismos.
Para la zona costera de Veracruz Central, los primeros conquistadores espaoles
reportaron frondosos bosques de galera, con grandes rboles en los que la vida
silvestre nativa de estos ambientes primarios era rica en variedad (Del Angel et al.,
2006), el paisaje actual dista mucho de aquellos parajes que existan antes de la
introduccin de la actividad ganadera. En la actualidad Veracruz es uno de los
estados con mayor diversidad de ecosistemas, y es tambin el principal productor
40
El Agro Veracruzano 2015
ganadero bajo el sistema extensivo el cual se ha favorecido incrementado los
territorios de pastura al punto de modificar de forma total la estructura del paisaje,
stas modificaciones reducen el hbitat de animales terrestres que a diferencia de
las aves, utilizan el ecosistema como zonas de refugio, alimentacin y
reproduccin de forma ms directa. As mismo, cuando los organismos necesitan
reproducirse o alimentarse, se desplazan en busca de lugares idneos, muchos de
ellos son de hbitos nocturnos, por lo que es ms difcil tener contacto visual con
ellos y puede ser la razn por la cual los registros obtenidos para las clases
taxonmicas Mammalia y Sauropsida muestran los valores ms bajos del total de
registros en las tres zonas (ver Tabla 1). A pesar de que aparentemente el nmero
de avistamientos es menor, las cifras encontradas muestran que an se mantiene un
contacto visual con este tipo de fauna, pero no es debido a su abundancia, si no por
que estos se ven en la necesidad de movilizarse en bsqueda de reas adecuadas
para ellos al ver reducidas sus reas de desarrollo.
Al no haber una descripcin exacta por parte de los entrevistados, los individuos
mencionados se clasificaron por familias taxonmicas ms representativas de las
zonas y el total de registros para cada una (ver Tabla 2). La zona Centro y Sur
presentaron el mayor nmero y porcentaje de registro de mamferos con un total de
7 especies, la clase Sauropsida observ los valores ms bajos en comparacin con
los otros grupos taxonmicos, as como un nmero menor de especies con un total
de 4; pese a esto es interesante observar para esta clase que la zona Sur es la que
presento el mayor registro de las tres zonas estudiadas (ver Tabla 1).
El grupo de los insectos no est dentro de las percepciones que tienen la
comunidad ganadera dentro de sus terrenos, por lo que no forman parte de su
imaginario y por lo mismo carecen de la importancia que tienen para el
funcionamiento adecuado de los ecosistemas. Al ser un grupo con organismos de
pequeo tamao, no son considerados como importantes, al respecto, los
productores ganaderos desconocen los beneficios que pueden aportar este tipo de
fauna al ecosistema; caso particular el de los escarabajos estercoleros, los cuales se
pueden ver afectados por actividades como la aplicacin de antiparasitarios y
herbicidas, sin embargo dichas actividades no solo afectan a los escarabajos, sino a
toda la fauna edfica en general (Martnez y Cruz, 2009).
Se registr un total de 20 especies frutales de consumo humano y 17 maderables
mencionadas en las entrevistas, siendo la zona Sur la que mostro el mayor nmero
de frutales (Figura 6). Las especies maderables ocupan el segundo sitio en cuanto a
porcentaje de registros siendo Cedrela odorata la especie que ms se mencion,
(Tabla 4), los resultados muestran que los ganaderos conocen el valor del cedro
rojo y por ello lo consideran parte importante de sus terrenos, el cedro rojo
(Cedrela odorata L.) junto con la caoba (Swietenia macrophylla King) son

41
El Agro Veracruzano 2015
conocidas como dos de las especies preciosas ms importantes para el trpico
mexicano (Ramrez et al., 2008).
Finalmente las especies forrajeras obtuvieron el menor porcentaje de registros para
las tres zonas; para la zona Norte y Centro destaca Bursera simaruba fue la que
obtuvo mayores registros y para la zona Sur Gliricidia sepium. Vale la pena
agregar que, si bien ambas especies son ampliamente utilizadas como
complemento nutricional del ganado bovino, sobre todo en la estacin seca, su uso
depende de la recoleccin, sobre todo en el caso de Gliricidia sepium ya que se
considera que la naturaleza las produce sin la necesidad de cultivarlas (Moreno et
al., 2011). Pese a la importancia de estas especies consideradas forrajeras, no se
producen de manera constante, y los ganaderos dependen de las que se encuentran
formando parte de los cercos vivos de los terrenos, siendo la reproduccin a partir
de esquejes la forma ms comn de multiplicarla.
Respecto a esto, la difusin y capacitacin a los ganaderos, enfocada a la
reproduccin y establecimiento adecuado de este tipo de fuentes de forraje, podra
contribuir a generar zonas en las que el ganado pueda obtener una fuente de forraje
adicional a las pasturas. Adems, como consecuencia de esto se tendra un
beneficio ambiental, al favorecer el establecimiento de nuevas especies, ya que,
como sealan Muiz et al., (2006), el factor determinante para el inicio de los
procesos de sucesin primaria en campos ganaderos es la distancia a la que se
encuentren de la fuente de propgulos (De la O et al., 2012), como las zonas
arbreas ya establecidas, que en el caso de Veracruz seran los acahuales que se
encuentran en los alrededores (Figura 7).
Lo anterior apoya la idea de que la siembra de especies como Gliricidia sepium de
forma estructurada dentro de los potreros, puede contribuir a que se establezcan
semillas de diferentes plantas en los estratos vegetales inferiores, a travs de
mecanismos como la anemocoria (dispersin de semillas a trtaves del viento) y la
zoocoria (dispersin de semillas llevada a cabo por animales), generndose un
escenario diferente al pastizal que atraer una amplia diversidad de aves e insectos,
y que puede generar lugares de ocultamiento para diversos organismos.
En estas condiciones hay que remarcar que las especies consideradas forrajeras en
las zonas de estudio serian un complemento, y no un sustituto de la alimentacin
proporcionada por los pastos, aunque hay que mencionar que la utilizacin de
sistemas silvopastoriles en los que se utilizan especies como, Gliricidia sepium,
Leucaena leucocephala y otras, ms all de su utilizacin en los cercos vivos,
podra contribuir de manera significativa a incrementar los rendimientos y reducir
la reas degradadas (Olivares et al., 2011, Zapata et al., 2007), y con esto
incrementar la diversidad vegetal.

42
El Agro Veracruzano 2015

Figura 7. En reas de ganadera extensiva, los procesos de sucesin se ven influidos


por la distancia a la fuente de propgulos, en el caso de Veracruz estas fuentes son los
acahuales. Fotografa: Ana Lid del Angel Prez

Snchez et al.,(2005) sealan que los cercos vivos presentan mayores abundancias
de rboles debido a que son reas manejadas con un objetivo, el de sostener cercos
de alambre perimetrales, pero son ms pobres en especies que los bosques riparios
y nativos, los cuales albergan mayor diversidad y que se regeneran de forma
natural como en el caso de los acahuales; aunque los cercos vivos son de menor
valor para la conservacin arbrea, contienen especies de las que se obtiene
madera, lea, frutas, forraje y flores y son importante fuente de recursos para los
habitantes de la regin (Zamora et al., 2001) .Lo anterior concuerda con las
caractersticas de las zonas de estudio, en donde generalmente son dos las especies
que se encuentran establecidas en los bordes de los terrenos, Bursera simaruba,
Gliricidia sepium y algunos rboles frutales.
La utilizacin de ciertas especies al interior de los potreros puede aportar
beneficios para el aspectos productivo y de conservacin, sin embargo, es
necesario darle difusin a los beneficios que aportan este tipo de sistemas al sector
ganadero para que los productores lo adopten, convencidos de las ventajas tienen,
y que no solo beneficiaran a sus animales sino tambin al rea en la que se estn
desarrollando.

43
El Agro Veracruzano 2015
Conclusiones

Los resultados del trabajo permiten observar que los potreros favorecen aun la
presencia de fauna y flora silvestre.
Los ganaderos tienen conocimiento solamente sobre las especies de mayor tamao
que se encuentran dentro de sus terrenos, algunas de ellas no son residentes
permanentes debido principalmente a la falta de reas de refugio y anidamiento,
como el caso de las aves y rboles frutales y maderables. Los organismos de
tamao menor, como los insectos y dems invertebrados no Figuraron entre las
respuestas de los entrevistados, esto pudo deberse en gran parte primero, por el
tamao, y segundo porque no obtienen un beneficio directo de ellos, de alguna
manera para un productor son especies no deseadas en sus pastizales, para esto,
una mejora en la difusin de los beneficios que obtiene el ecosistema a travs de
estos organismos puede contribuir a aumentar el conocimiento local y poder
mejorar las condiciones ambientales en las que se desarrollan.
En el caso de la flora, los frutales fueron los ms mencionados, aunque no se
encuentran establecidos como cultivo, forman parte de los paisajes ganaderos
como proveedores de alimento para los habitantes de la zona, de manera general,
especies consideradas dentro del estrato herbceo no fueron mencionadas, siendo
especies del tipo arborescente las que predominaron en las respuesta de los
entrevistados, esto puede deberse , a que el monocultivo con pastos forrajeros
limita el desarrollo de especies nativas en este estrato, disminuyendo as la
diversidad florstica.
Se puede decir que la interiorizacin por parte del ganadero de la importancia de
ciertas especies es la que determina la percepcin de su presencia. Por lo anterior
en el caso de la vegetacin, domina la percepcin de la presencia de rboles
frutales o de consumo humano, seguido por los maderables y finalmente los
forrajeros, es decir especies de utilidad con valor de uso y econmico.
Las percepciones por parte de los ganaderos de las especies que subsisten en los
predios muestran una oportunidad para cualquier intento de realizacin de
actividades de conservacin o produccin sostenible, ya que si bien actualmente
los ganaderos solo observan y contabilizan especies de importancia econmica, es
necesario incluir aquellas acciones que favorezcan a la fauna y flora silvestre , lo
cual se facilitar si los dueos de los predios los perciben como importantes dentro
de una cadena de vida, donde la presencia de cada especie favorece la continuidad
regular de la naturaleza y las funciones de los ecosistemas, y por lo tanto la
economa y sus ingresos.

44
El Agro Veracruzano 2015
Literatura Citada

Barradas, V., L. Tapia, J. Cervantes, 2011. Consecuencias del cambio climtico en la


ecofisiologa vegetal de un bosque templado en Veracruz. Revista Mexicana de
Ciencias Agrcolas, 2:183-194.
Bojorges, J., L. Lpez. 2006. Asociacin de la riqueza y diversidad de especies de aves y
estructura de la vegetacin en una selva subperennifolia en el Centro de Veracruz,
Mxico. Revista Mexicana de Biodiversidad 77(2):235-249.
Cingolani, A., I. Noy, D. Renison, M. Cabido. 2008 .La ganadera extensiva, es
compatible con la conservacin de la biodiversidad y delos suelos? Ecologa
Austral, 18 (3): 253-271.
De la O, J., B. Maldonado, C. Martnez. 2012. Efecto de la perturbacin en la comunidad
de herbceas nativas y ruderales en una selva estacional mexicana. Botanical
Sciences. 90 (4): 469-480.
Del Angel, A., J. Villagmez, M. Mendoza, A. Rebolledo.2006. Valoracin de recursos
naturales y ganadera en la zona Centro del Veracruz, Mxico. Madera y bosques,
12 (2): 29-48.
Delgado, M.C., F. Bautista y A. Snchez. 2011. Tcnicas de muestreo para manejadores de
recursos naturales. Centro de Investigaciones en Geografa Ambiental de la
Universidad Nacional Autnoma de Mxico, Mxico, D.F. 790 pp.
Guevara S. P. Moreno. 2008. El dilema de los recursos naturales: La ganadera en el
Trpico de Mxico. Revista Guaraguao, 29: 9-23.
Guevara, F., R. Pinto, L. Rodrguez, H. Gmez, R. Ortiz, M. Ibrahim, G. Cruz. 2011.
Precepciones locales de la degradacin en una comunidad ganadera de Chiapas,
Mxico. Revista Cubana de Ciencia Agrcola, 45 (3): 311-319.
Instituto Nacional de Estadstica Geografa e Informtica. (INEGI). 2005. Superficie
continental y de pastizal, Mxico. [Base de datos] Base de datos disponible en:
http://www3.inegi.org.mx/sistemas/mexicocifras/default.aspx?e=30. [Consultado
el 29 de septiembre 2014].
Instituto Nacional de Estadstica Geografa e Informtica.2007.Unidades de produccin y
existencias totales de ganado bovino segn sistemas de produccin por entidad y
municipio [Base de datos]. Base de datos disponible en:
http://www3.inegi.org.mx/sistemas/tabuladosbasicos/default.aspx?c=17177&s=est
[Consultado el 29 de septiembre 2014]
Instituto Nacional de Estadstica, Geografa e Informtica (INEGI). 2013. Anuario
estadstico y geogrfico de Veracruz de Ignacio de la Llave. Mxico. 1067 pp.
Landeros- Snchez, C., 2011. Sistemas productivos y alternativas econmicas sustentables.
Pp. 451-452. In: Comisin Nacional para el Conocimiento y Uso de la
Biodiversidad, Gobierno del Estado de Veracruz, Universidad Veracruzana,
Instituto de Ecologa, A.C. Mxico. La biodiversidad en Veracruz: Estudio de
Estado. Comisin Nacional para el Conocimiento y Uso de la Biodiversidad,
Gobierno del Estado de Veracruz, Universidad Veracruzana, Instituto de Ecologa,
A.C., Mxico. 541 pp.

45
El Agro Veracruzano 2015
Lira A., S. Sada, J. Laborde, G. Ros. 2007. Composicin florstica en potreros de los
Tuxtlas, Veracruz, Mxico. Acta Botnica Mexicana, (80): 59-87.
Loening, L., M. Markussen. 2003. Pobreza, deforestacin y sus eventuales implicaciones
para la biodiversidad en Guatemala. Economa, Sociedad y Territorio, 4 (14): 279-
315.
Martnez, I., M. Cruz. 2009. El uso de qumicos veterinarios y agrcolas en la zona
ganadera de Xico, Centro de Veracruz, Mxico y el posible impacto ambiental.
Acta Zoolgica Mexicana, 25 (3): 673-681.
Mora C., J. Jimnez, E. Alans, E. Rubio, J. Yarena, M. Gonzlez. 2013. Efecto de la
ganadera en la composicin-diversidad arbrea arbustiva del matorral espinoso
Tamaulipeco. Revista Mexicana de Ciencias Forestales, 4(17): 124-137.
Moreno, P., D. Infante, C. Madero. 2011. Germinacin y supervivencia de dos especies de
acahual de selva baja para restaurar dunas costeras. Revista Mexicana de Ciencias
Forestales, 2 (6): 19-36
Moreno, P., K. Paradowsca, S. Sada, G. Salinas, 2007. Los conflictos de la conservacin, el
caso de la mancha. Halffter, Gonzalo, Sergio Guevara Sada y Antonio Melic (eds)
Hacia una cultura de conservacin de la biodiversidad biolgica, Zaragoza:
Sociedad Entomolgica Aragonesa, 222-236.
Muiz, M., G. Williams, J. Rey. 2006. Distance effect from cloud forest fragments on plant
community structure in abandoned pastures in Veracruz, Mexico. Journal of
Tropical Ecology, 22:431-440.
Murgueitio, E., y Z. Calle, 1998. Diversidad biolgica en sistemas de ganadera bovina en
Colombia. pp. 1-11 In: C. Pomareda y H. Steinfeld (eds.). Intensificacin de la
ganadera en Centroamrica, beneficios econmicos y ambientales. FAO-
CATIESIDE. Editorial Nuestra Tierra, Costa Rica., 334 pp.
Olivares, J., F. Avils, B. Albarrn, S. Rojas, O. Casteln. 2011. Identificacin, uso y
medicin de leguminosas arbreas en ranchos ganaderos del Sur del estado de
Mxico. Tropical and Subtropical Agroecosystems, 14 (2): 739-748.
Oros, V., P. Daz, J. Vilaboa, J. Martnez, G. Torres 2011. Caracterizacin por grupos
tecnolgicos de los hatos ganaderos doble propsito en el municipio de las
Choapas, Veracruz, Mxico. Revista Cientfica, 21(1): 57-63
Ortega, A., F. Lpez, N. Ramrez, J. Garca. 2011. Early seedling establishment of two
tropical montane cloud forest tree species: The role of native and exotic grasses.
Forest Ecology and Management, 261 (7): 1336-1343.
Osbahr, K., N. Morales, 2012. Conocimiento local y usos de la fauna silvestre en el
municipio de San Antonio del Tequendama (Cundinamarca, Colombia). Revista
UDCA Actualidad & Divulgacin Cientfica, 15(1), 187-197.
Peralta-Pelez, L. A. 2007. Diseo de un ndice de integridad bitica para los lagos
interdunarios de la regin costera central del estado de Veracruz, Mxico. Tesis de
Doctorado. Instituto de Ecologa A.C., Xalapa, Ver., Mxico. 130 pp.
Ramrez, C., G. Vera, F. Carrillo, O. Magaa. 2008. El cedro rojo (Cedrela odorata L.)
como alternativa de reconversin en terrenos abandonados por la agricultura
comercial en el Sur de Tamaulipas. Agricultura Tcnica en Mxico, 34 (2): 243-
250.

46
El Agro Veracruzano 2015
Romn, P. H., L. Ortega R., L. Hernndez., E. Daz A., J.A. Espinosa G., G. Nuez H., H.
R. Vera A., M. Medina C. y F. J. Ruz L. (comps.). 2009. Produccin de leche de
bovino en el sistema de doble propsito. Libro tcnico nm., 22.
INIFAP.CIRGOC. Veracruz, Mxico. 355p.
Snchez, D., C. Harvey, A. Grijalva, A. Medina, S. Vlchez, B. Hernndez. 2005.
Diversidad, composicin y estructura de la vegetacin en un agropaisaje ganadero
en Matiagus, Nicaragua. International Journal of Tropical Biology, 53 (3-4):387-
414.
Siavosh, S., J. Rivera., M. Gmez. 1999. Impacto de sistemas de ganadera sobre las
caracteristicas fsicas, qumicas y biolgicas de suelos en los Andes de Colombia.
In Agroforestera para la produccin animal en Latinoamrica.
Vergara, M. y J. Cervantes. 2009. Riesgo, ambiente y percepciones en una comunidad rural
totonaca. Economa, Sociedad y Territorio, 9 (29): 145-163.
Zamora, S., J. Garca, G. Bonilla, H. Aguilar, C. Harvey, M. Ibrahim. 2001. Uso de frutos y
follaje arbreo en la alimentacin de vacunos en la poca seca en Boaco,
Nicaragua. Agroferestera en las Amricas, 8 (31): 31-38.
Zapata, A., E. Murgueitio, C. Meja, A. Felipe, M. Ibrahim. 2007. Efecto del pago por
servicios ambientales en la adopcin de sistema silvopastoriles en paisajes
ganaderos de la cuenca media del ro La Vieja, Colombia. Agroferestera en las
Amricas, 45: 86-92.

47
El Agro Veracruzano 2015

4
VEGETACIN HERBACEA EN ZONAS DE GANADERIA EXTENSIVA
EN EL CENTRO DE VERACRUZ

Carmen Aridai Hernndez Estrada 1, Ana Lid del ngel Prez2, Carlos Nahin Castro
Jos3, Marcos Ventura Vzquez Hernndez4, Jess Gustavo Salazar Garca5
1
Instituto Nacional de Investigaciones Forestales Agrcolas y Pecuarias. (INIFAP) km.
34.5 de la Carretera Veracruz-Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270. e-
mail: hernandez.carmen@inifap.gob.mx. Investigadora de Socioeconoma. Maestra en
Ciencias.
2
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) km 34.5
de la Carretera Federal Veracruz- Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270.
e-mail: delangel.analid@inifap.gob.mx. Investigadora Titular de Socioeconoma y
Servicios Ambientales. Doctora en Ciencias.
3
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) km 34.5
de la Carretera Federal Veracruz- Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270.
e-mail: nahin.castro@gmail.com. Asistente tcnico de investigacin.
4
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) km 34.5
de la Carretera Federal Veracruz- Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270.
e-mail: vazquez.marcos@inifap.gob.mx, investigador Titular de Recursos Genticos.
Doctor en Ciencias.
5
Instituto Nacional de Investigaciones Forestales, Agrcolas y Pecuarias (INIFAP) km 34.5
de la Carretera Federal Veracruz- Crdoba. Mpio. de Medelln de Bravo, Ver. C.P. 94270.
e-mail: Salazar.gustavo@inifap.gob.mx. Investigador Titular del rea de plantaciones
forestales. Mestro en Ciencias.

Resumen

Las zonas de ganadera extensiva en el estado de Veracruz, se caracterizan por


grandes extensiones de pasto que han agotado la vegetacin natural de las regiones de
influencia ganadera, las cuales se localizan en toda la planicie costera. El presente
estudio tuvo como objetivo la identificacin y cuantificacin las especies vegetales
que se propagan en potreros ganaderos de la comunidad de Loma Iguana en el
municipio de La Antigua, Veracruz; mediante la evaluacin de los niveles de
biodiversidad de especies herbceas en las diferentes condiciones de los potreros. Se
establecieron cuadrantes de 1 metro2, cada uno se consider como una unidad

48
El Agro Veracruzano 2015

experimental, contando con 3 repeticiones en cada zona que comprenda Zona Alta o
de Loma, Zona Baja o llano y Zona Rparia, se realizaron tres observaciones
mensuales durante 2013 y tres observaciones bimestrales en 2014, basado en la
sobrevivencia de especies herbceas. Como resultados se observ que los cuadrantes
ubicados en las partes altas de las dunas de los potreros, muestran una poblacin
vegetal hasta la temporada de lluvias con nueve especies presentes, la zona baja de 8
a 17 especies dependiendo la fecha de medicin y la zona ripara con 2 a7 especies.
Las diferentes condiciones dejan ver la influencia de la orografa y pequeos
microclimas dentro de una localidad para la variabilidad, adaptabilidad y
supervivencia de las diferentes especies vegetales en las zonas ganaderas as como el
impacto en la biodiversidad vegetal por el manejo intensivo de pastos sin alternativas
de propagacin para otras especies vegetales y animales. El conocimiento de las
especies reproducidas de forma natural y sus ciclos, ayudara a evaluar el proceso de
regeneracin natural de zonas con ganadera extensiva, comparndolo con la
construccin de corredores biolgicos.
Palabras clave: Sotobosque, malezas, biodiversidad vegetal

Abstract

Ranching areas in the state of Veracruz, are characterized by large expanses of grass
that have exhausted the natural vegetation of the regions of livestock influence, which
are located throughout the coastal plain. This study aimed to identify and quantify the
plant species that spread in livestock pastures community Loma Iguana in the town of
La Antigua, Veracruz; by assessing levels of biodiversity of herbaceous species in
different conditions of pastures. meter2 quadrants were established, each is considered
as an experimental unit, with 3 replications in each zone comprising or Zona Alta
Loma, Zona Baja or plain and riparian zone, three monthly observations were made
during 2013 and three points bimonthly in 2014, based on the survival of herbaceous
species. As results we observed that the dials located on the tops of dunes pastures
show a plant population until the rainy season with nine species present, the lower
area of 8-17 species depending on the measurement date and the area riparian 2 a7
species. The different conditions reveal the influence of orography and small
microclimates within a locality for variability, adaptability and survival of different
plant species in the pastoral areas and the impact on plant biodiversity by intensive
pasture management without alternatives spread to other plant and animal species.
The knowledge of the species reproduced naturally and its cycles, help evaluate the
process of natural regeneration of areas with extensive livestock, comparing with the
construction of biological corridors.
Keywords: herbaceous vegetation, weeds, plant biodiversity

49
El Agro Veracruzano 2015

Introduccion

La ganadera extensiva ha fomentado la perdida de la vegetacin natural; los


patrones de deforestacin en Amrica Central muestran que las reas en expansin
del bosque se han convertido a usos agrcolas en pasturas o en ganadera, y estos
paisajes estn caracterizados por pequeos parches de fragmentos de bosque
(Ibrahim et al., 2006). Si bien la conversin de bosque a pasturas y otros usos
agrcolas ha ocurrido durante dcadas, no siempre se ha cuantificado el impacto de
la fragmentacin del bosque (Harvey et al., 2005a). Un estudio a largo plazo de la
fragmentacin en la Amazona brasilera sugiere que cierto grupo de animales son
ms vulnerables a la fragmentacin que otros, incluyendo aves del sotobosque,
primates, mariposas de sombra y avispas (Bierregaard et al., 2001).
El incremento de plantacin de cercas vivas o rboles dispersos en potreros o
permitir que ocurra la regeneracin natural, pudiera ser til para contrarrestar la
perdida de la diversidad vegetal. Harvey et al. (2005) encontraron que las cercas
vivas en potreros pueden mostrar una riqueza total entre 27 y 85 especies arbreas
y una densidad entre 67 y 242 rboles km-1 pases como Nicaragua y Costa Rica.
La mayora de las especies que se encuentran en los cercos vivos de los potreros
son nativas, lo cual representa la oportunidad de regeneracin y conservacin de la
biodiversidad, al servir como hbitat, sitios de alimentacin, pernoctacin y
corredores biolgicos para especies de plantas y trnsito de animales.
En Mxico existen pocos estudios sobre biodiversidad vegetal, Barajas (2005),
Martnez y Garca (2007), sealan algunos el comportamiento de las especies
vegetales en espacios naturales como campo abierto y en lo que se refiere a zonas
de agostadero Ibrahim et al., (2006) sealan la importancia de diversidad vegetal a
travs de la creacin de corredores biolgicos en terrenos ganadero. El objetivo de
este estudio fue identificar las especies herbceas de regeneracin natural en los
linderos de potreros y cuantificar la diversidad mediante ndices de biodiversidad
de Shannon, Simpson y Margalef (Moreno, (2001), Barajas, (2005)). Esta
informacin permitir orientar recomendaciones hacia el sector ganadero, con
objeto de que puedan realizar prcticas de conservacin, en la forma de
aprovechamiento

Materiales y mtodos

Se trabaj en el municipio de La Antigua, Veracruz el cual se localiza en la zona


costera central del Estado de Veracruz, en las coordenadas 19 22' latitud norte y
96 22' longitud oeste, a 20 metros sobre el nivel del mar. Su clima es clido-
regular con una temperatura promedio de 25.3 C; su precipitacin pluvial media
50
El Agro Veracruzano 2015

anual es de 1500 mm. Se caracteriza por una flora: compuesta por selva mediana
subcaducifolia y selva baja caducifolia, destacando especies como chaca o mulato
(Bursera simaruba), cedro (Cedrela Odorata L), Ceiba (Ceiba pentandra),
higueras (Ricinus communis), guaje (Leucaena leucocephala), chijol (Acasia aff.
Cochiliacanhta) y tepame o huizache (Acacia pennatula). Su fauna: est
representada conejos (Oryctolagus cuniculus), zorros (Vulpes vulpes), coyotes
(Canis latrans), armadillos (Novemcintus) y mapaches (Procyon cancrivorus);
reptiles como vboras sabaneras (Coluber Masticophis) y aves como calandrias
(Mimus saturninus), palomas (Columba livia), cotorros (INAFED, 2014). El
municipio cuenta con 4,452 hectreas dedicadas a la ganadera, en donde se
ubican alrededor de 514 unidades de produccin rural con actividad de cra y
explotacin de animales. Cuenta con 2,257 cabezas de ganado bovino, produce
254 t de ganado en pie 136 t de carne en canal 422 miles de litros de leche (DDR
SAGARPA, 2011). Se establecieron cuadrantes de 1 metro2, en tres zonas
orogrficas de terrenos ganaderos, loma, valle y zona riparia en el municipio de La
Antigua, Veracruz .Se realiz un muestreo aleatorio simple con tres repeticiones
metodologas sealadas por Barajas (2005). Los terrenos ganaderos se ubican en
reas de dunas costeras del Centro de Veracruz, lo que genera relieves
discontinuos dentro de los potreros y microambientes especficos (Figura 1).
Se realizaron mediciones peridicas cada dos meses durante un ao y se tomaron
fotografas de las plantas, as como de las formas de las hojas, tallos, flores y frutos
para su identificacin en gabinete, la identificacin en diferentes pocas del ao
fue la metodologa utilizada por Couttolenc et al., (2005). De la misma manera se
contabilizaron las especies vegetales presentes dentro de cada cuadrante, se
identificaron en el catlogo de la CONABIO (2009), descripcin Toval y Rueda
(2009). Al final de su ciclo las que no se haban identificado fueron arrancadas
para su identificacin Couttolenc et al., (2005). Los datos de especies y cantidad
fueron analizados con el Software Past versin 2.03 para la obtencin de ndices de
Shannon tiene un rango de 0-3 diversidad baja y 3-5 diversidad alta (Santa, et.al.,
2009)., Margalef permite medir la riqueza especfica de cada uno de los
corredores, valores menores de 2, identifican una diversidad baja, mayores de 5
diversidad alta (Moreno, 2001), Simpson asigna mayor peso a especies comunes,
este ndice tiene rangos dentro de la escala 0-1, lo que significa, que cero es la
mnima diversidad posible, y 1 o aproximado a este valor, la mxima diversidad.

51
El Agro Veracruzano 2015

Figura 1. Zonas de ganadera extensiva de la localidad de Loma Iguana, La antigua,


Ver. Fotografa: Carmen A. Hernndez Estrada

Resultados

Con la suma de especies de las tres repeticiones de cada zona se obtuvieron los
ndices por poca de muestreo. El ndice de Margalef muestra (Figura 2), que el
incremento total de especies presentes en cada zona es mayor en la zona baja, la
riqueza especfica por nmero de especies se reduce en la temporada seca, entre
febrero y abril y comienza el ascenso nuevamente al iniciar la temporada de
lluvias.

Los datos muestran un comportamiento estacional similar debido la situacin


agroecolgica, destacando el hecho de los ciclos de las plantas herbceas presentes
en la zona, y las condiciones del clima.

52
El Agro Veracruzano 2015

Figura 2. Total de especies mediante el ndice de Margalef en serie de tiempo valor


promedio en cada muestreo por zona.

Figura 3. Total de especies mediante el ndice de Margalef en serie de tiempo valor


promedio en cada muestreo por zona.

El ndice de Shannon (Figura 3), presenta el mismo comportamiento que el de


Margalef en tiempo y por poca de muestreo y representa la uniformidad en
cantidad de especies por cada muestreo, es decir hay equidad entre las especies
53
El Agro Veracruzano 2015

pues casi todas tienen el mismo nmero de individuos, siendo ms equitativa la


zona baja. El ndice de Simpon se muestra en la Figura 4, nos indica que en la zona
baja hay mayor probabilidad de que dos o ms individuos pertenezcan a la misma
especie, en la zona alta y zona riparia hay menos especies y menos cantidad de
cada una, es decir haya ms de dos individuos de la misma especie.

Figura 4. ndice de Simpson en serie de tiempo valor promedio en cada muestreo por
zona.

Figura 5. Hierba de Toro Tridax procumbens.


54
El Agro Veracruzano 2015

La especie que estuvo presente todo el ao fue la Hierba de Toro Tridax


procumbens (Figura 5). Principalmente en la zona baja (ZB).
El Cadillo de bolsa Priva lappulacea (L.) Pers. (Figura 6), tanto en cantidad como
en distribucin en temporadas, as tambin est presente en la zona baja y zona
alta.

Figura 6. Cadillo de bolsa Priva lappulacea (L.) Pers.

Otra especie de gran incidencia a lo largo del ao es Pica Pica Mucuna pruriens,
(Figura 7) para la zona baja.

Figura 7. Pica Pica Mucuna pruriens.

55
El Agro Veracruzano 2015

De la zona riparia aunque en menor cantidad y distribucin, fue posible encontrar 7


especies a lo largo del ao se encontraron especies nicamente en esta zona Figura
8.

Figura 8. Cucharita o platanito Pontederia sagittata

Las especies se muestran fueron las ms representativas en las diferentes zonas en


la Tabla 1 se muestran el resto de especies encontradas en al menos uno de los
muestreos realizados.

Discusin

La riqueza especfica o ndice de margalef es alto para la zona baja, as mismo la


poca de muestreo repercute en el valor de ndice, pero se mantiene en el rango de
alta en la ZB de acuerdo al rango de ndice que seala Moreno (2001). La
diversidad de especies en la ZA y ZR es baja, sin embargo en la zona alta se da un
descenso ms abrupto en la poca seca al estar expuesta a erosin elica y
exposicin al sol, mientras que la zona riparia tiene un descenso paulatino la
presencia de mayor humedad, favorece la germinacin de semillas; en la ZA la
exposicin directa a la erosin elica, hdrica y exposicin directa al sol genera una
baja germinacin y mayor mortalidad de las semillas de especies herbceas
(Chapman et al., 2002). El ndice de Shannon indica una mayor equidad entre
especies, por lo que encontramos un nmero similar en cantidad para cada una de
las especies, al menos durante los meses de lluvia. Este ndice tambin se ve
56
El Agro Veracruzano 2015

afectado por la zona de muestreo como por la estacin, y posiblemente por el tipo
de actividad, ya que Martnez y Garca (2007), sealan la reduccin de la
germinacin de semillas en pastizales ganaderos. Lo que muestra la Figura 4, es
que la posibilidad de que ms de dos individuos pertenezcan a la misma especie es
ms probable en la zona baja (ZB); la zona alta y zona riparia (ZR) tienen menos
individuos por especie. Este comportamiento tambin fue observado por Barajas
(2005) al evaluar diversidad de flora en el campus Juriquilla de la Universidad
Autonoma de Mxico, ubicado en el estado de Quertaro. Conforme se realizaron
los muestreos en la poca de inicio y durante la temporada de lluvias el ndice de
Simpson muestra la dominancia de la Hierba de Toro Tridax procumbens especie.
La zona alta (ZA) puede llegar a tener valores de cero especies en la poca seca y
hasta 9 en la temporada de lluvias, la zona baja de 8 hasta 17 especies
dependiendo la fecha de medicin y la zona riparia desde 2 y hasta 7 especies. La
que apareci con mayor frecuencia fue la Mucuna pruriens (80 individuos) y se
encuentra presente en todas las pocas en la zona baja en sus diferentes estadios
vegetativa, flor y en fructificacin.La diferencia en cantidad de especies e
individuos en las diferentes zonas est muy relacionada con el relieve de los
terrenos, la estacin, y la presencia del ganado, lo cual incrementa el impacto
negativo del pastoreo sobre la propagacin de especies vegetales (Chara et al-.
2007).

Tabla 1. Vegetacin herbcea encontrada en la zona de potreros de la localidad de


Loma Iguana, La antigua, Ver.

Nombre comn Nombre cientfico


Hierba de Toro Tridax procumbens
Quiebra piedra, coquito Phyllanthus amarus
Platanillo Arivela viscosa (L.) Raf
Palo zorrillo, hediondilla Senna obtusifolia
Hierba del pollo Commelina diffusa
Gusanillo, Chinahuate Acalypha setosa
Golondrina grande o matas del chicle Chamaesyce hirta
Escoba Sida rhombifolia
Confitillo amargosa Parthenium bipinnatifidum
Dormilona Mimosa pdica
Cardo santo Argemone mexicana L
Anisillo Mollugo verticillata
Grano de terciopelo, picapica o frijol de terciopelo Mucuna pruriens
Bolsa de coyote Cardiospermum halicacabum
L.
Quelite macho, Quelite de puerco o quintonil espinoso Amaranthus spinosus L
Hierba de la golondrina, golondrina chica Euphorbia prostrata Aiton
Trbol blanco Trifolium repens L
Venenillo, falsa noche buena, Picachali Euphorbia heterophylla
57
El Agro Veracruzano 2015

Lechecillo, lechera Euphorbia nutans Lag


Cornizuelo Acacia collinsii Saff
Hierba buena Mentha piperita L.
Hierba del gusano o hierba del cncer Acalypha arvensis
Borreria Borreria suaveolens G. Mey.
Cundeamor Momordica charantia L
Campanitas, quiebraplato Ipomoea purpurea (L.) Roth
Pipin silvestre Cucrbita argyrosperma K.
Koch
Flor amarilla Baltimora recta L.
Cadillo de bolsa Priva lappulacea (L.) Pers.
Caperonia Caperonia palustris (L.) A. St.-
Hil.
Clavel de pozo o botoncillo blanco Eclipta prostrata (L.) L.
Tomate de milpa, milpero, temporalero, tomatillo, tomatillo Physalis philadelphica
cimarrn
Sombrerillo de agua Hydrocotyle vulgaris L.
Cucharita o platanito Pontederia sagittata
Maanita Portulaca pilosa L.

Conclusiones

El valor del ndice de Margalef deja claro que la zona baja es la que presenta
mayor diversidad a lo largo del ao y que las diferentes condiciones de la orografa
y pequeos microclimas influyen en la supervivencia de las diferentes especies
vegetales en las zonas ganaderas. Los cambios de estacin o diferentes pocas de
muestreo tienen influencia en el comportamiento de los tres ndices de diversidad
medidos, pero sobre todo el manejo intensivo de pastos es el que reduce la
propagacin de otras especies vegetales en las zonas ganaderas. La presencia de
ganado en las zonas de anlisis, es indudable que ha determinado la ausencia del
banco de semillas, as, por ejemplo la zona riparia a pesar de que es objeto de
pastoreo directo, recibe menor presin de pastoreo precisamente por mantenerse
inundado y con humedad ms tiempo, lo cual a la vez favorece la recuperacin del
banco de semilla propio de la zona.

Literatura Citada

Barajas G., C.I., 2005. Evaluacin de la diversidad de la flora en el campus Juriquilla de la


UNAM. Evaluacin de la Biodiversidad, 1(2):1-10.
Bierregaard R. O., F. Laurence W., C. Gascon, J. Benitez-Malvido, M. Fearnside P., R.
Fonseca C., G. Ganade, R.Malcom J., B, G, Martina M., S. Mori, M. Oliveira,
Rankin.De Merona, A. Scariot, W. Spironello y B. Williamson. 2001. Principles

58
El Agro Veracruzano 2015

of forest fragmentation and conservation in the Amazon. Pp.20-25 En: Bierregaard


R. O, C. Gascon, E. Lovejoy y R Mesquita. (eds). Lessons from Amazonia: the
ecology and conservation of a fragmented forest.. Yale University Press. New
Haven 271 pp.
Comisin nacional para el conocimiento y uso de la biodiversidad (CONABIO). 2009.
Trifolium repens: ficha informativa. Disponible en web:
http://www.conabio.gob.mx/malezasdemexico/fabaceae/trifoliumrepens/fichas/fic
ha.htm Consultada el 09 de Diciembre de 2013.
Chapman C.A., J. Chapman L., A. Zanne y A. Burgess, M. 2002. Does weeding promote
regeneration of an indigenous tree community in felled pine plantations in
Uganda. Restauration Ecology 10 (1):408-415
Chara J., G. Pedraza, L. Giraldo y D. Hincapie. 2007. Efecto de los corredores ribereos
sobre el estado de las quebradas en la zona ganadera del ro La Vieja, Colombia.
Agroforesteria en las Amricas, 46 (1):72-78
Couttolenc B., J.A. Cruz R., E. Cedillo P. y M.A. Muslem. 2005. Uso local y potencial de
las especies arbreas en Camarn de Tejeda, Veracruz. Revista Chapingo, Serie
ciencias forestales y del ambiente. 11(1):45-50
Hammer, O., A. T, Harper D. y D. Ryan P. 2001 PAST. Paleontological Statistics software
package for education and data analysis. Palaeontologia Electronica 4(1):9 pp.
Harvey C., F. Alpizar, M. Chacon y R. Madrigal. 2005. Assessing linkages between
agricultura and biodiversity in Central America: Historical overview and future
perspectives. Mesoamerian and Caribbean Region. Conservatrion Science
Program. The Nature Conservancy (TNC). San Jose Costa Rica. 140 pp.
Harvey C., C. Villanueva, J. Villacs, M. Chacn, D. Muoz, M. Lpez, M. Ibrahim, R.
Gmez, R. Taylor, J. Martnez, A. Navas, J. Sanz, D. Snchez, A. Medina, S.
Vilches. B. Hernndez, A. Prez, E. Ruz, F. Lpez, I. Lang y F. Sinclair. 2005.
Contributiion of live fences to the ecoloical integrity of agricultural landscape.
Agricultural Ecosystems y Enviroment, 111(1):200-230.
Ibrahim M. C. Villanueva, F. Cassasola y J. Rojas. 2006. Sistemas silvopastoriles como
una herramienta para el mejoramiento de la productividad y restauracin de la
integridad ecolgica de paisajes ganaderos. Pastos y Forrajes, 29(4):383-419
INAFED e-local 2014. Sistemas de Informacin Municipal: Enciclopedia de los
municipios. http://www.e-local.gob.mx/wb2/ELOCAL/ELOC_Enciclopedia.
Consultado el 20 de julio de 2014.
Martnez R. M. y X. Garca O. 2007. Sucesin ecolgica y restauracin de las selvas
hmedas. Sociedad Botanica de Mxico. Sup., (80):69-84
Moreno, C. E. 2001. Mtodos para medir la biodiversidad. M&T-Manuales y Tesis SEA,
Vol. 1. Zaragoza, Espaa. 84 pp
Secretaria de Agricultura, Ganaderia, Desarrollo Rural, Pesca y Alimentacin. SAGARPA.
Delegacin en el Estado. Distritos de Desarrollo Rural. 2011. Anuario de la
Ganadera de Veracruz. http://www.veracruz.gob.mx/finanzas/files/2011/11/12-
Ganaderia-2011.pdf
Toval H. N. y Rueda P. R. 2009. Malezas comunes de Len, Nicaragua. Santo Domingo de
Heredia, Costa Rica: Instituto Nacional de Biodiversidad. INBio 128 pp

59
El Agro Veracruzano 2015

5
VERTEBRADOS DE LA SIERRA MONTE DE ORO, ALTO LUCER0,
VERACRUZ

Csar Viveros Colorado, Miguel de Jess Chzaro Bazez

Resumen

1. La biodiversidad de Mxico y en especial de Veracruz, guarda un estatus


preponderante, sin embargo, en sitios estratgicos ecolgicamente como la sierra
Monte de oro se requiere informacin precisa de la fauna regional donde es
evidente la escasez y muchas veces ausencia de fuentes documentales
actualizadas.
2. En objetivo del estudio fue analizar la vegetacin y flora que sustenta el hbitat,
contribuir al conocimiento de la composicin de la biodiversidad de vertebrados,
las especies que se encuentran en la sierra incluidas dentro de la NOM-059-
SEMARNAT-2010 y determinar especies migratorias, endmicas, cinegticas o
comerciales.
3. Se realizaron excursiones para el registro botnico y caracterizacin de la
vegetacin. Se realiz el registro de especies de vertebrados en recorridos por
transectos en forma visual, huellas, rastros y capturas, complementados con
entrevistas a cazadores locales.
4. El hbitat de la sierra se determin como bosque de encino en la parte alta y
elementos de selva mediana subperennifolia en las caadas. Fueron registrados 1
anfibio, 10 reptiles, 51 aves y 20 mamferos.
5. Este trabajo es un acercamiento a la biodiversidad de la sierra Monte de oro y
sus alrededores, cuyo hbitat mantiene especies de vertebrados migratorias,
endmicas, amenazadas y en peligro, especies de importancia social y la especie
de mayor de importancia cinegtica en Mxico. El presente, subsana en parte la
falta de informacin de la biodiversidad para el rea de estudio.
Palabras Clave: Fauna, biodiversidad, hbitat.

Abstract

1. Biodiversity in Mexico and Veracruz state (this last one in Eastern-Central


Mexico), it is outstanding, the biological research are uneven in diferent parts of
the country, in adition there are certain strategic region that have been overlooked
60
El Agro Veracruzano 2015

and poorly known in its biota, for Veracruz, such it is the case of the Sierra Monte
de Oro, a volcanic range close to the Gulf of Mexico sea, with peaks barely over
the 700 masl., with tropical deciduos forest and tropical subperennial forest in the
base and oak forest in the upper parts.
2. Several field trips were carried it out in order to determined the floristic
composition of the vegetation as well and as a main scope to study the endemic,
endangered, threatened and migratory fauna, through visual records, footprints,
feces, nets, capture and interview with the local hunters about the vertebrates, this
one in a altitudinal transect; as a preliminary result of this activities one
anphibian, 10 reptiles, 51 birds and 20 mammals were recorded at the study site.

Introduccin

Mxico alberga una de las biotas ms diversas del planeta, por lo que se incluye en
el grupo de pases llamados megadiversos que en conjunto, aglutinan entre 60%
y 70% de la diversidad biolgica conocida en el mundo. En Mxico, la cifra de
especies se estima entre las 180 mil y las 216 mil, es decir, entre 10 y 12% de las
especies descritas en el mundo; sin embargo, estas estimaciones varan entre
grupos, dado que, por ejemplo, los vertebrados se conocen relativamente bien. Con
base en esa acotacin, se calcula que Mxico posee alrededor de 23, 424 especies
de plantas vasculares, 535 especies de mamferos, 804 especies de reptiles, 361 de
anfibios y 1, 107 especies de aves (Llorente y Ocegueda, 2008).
Adems de la alta diversidad de especies, muchos de los grupos taxonmicos se
distribuyen exclusivamente en Mxico. Ejemplo de ello es que entre 50 y 60% de
las especies conocidas de plantas en Mxico son endmicas, entre ellas 21 especies
de pinos, 146 especies de agaves y 715 de cactceas. Por otra parte, encontramos
163 especies endmicas de peces de agua dulce (42% del total), 174 anfibios (48%
del total), 368 reptiles (45% del total), 125 aves (11% del total) y 169 mamferos
(31% del total) exclusivos de Mxico (CONABIO, 2008 y Sarukhn et al., 2009).
Veracruz, con una biodiversidad calculada segn la Comisin Nacional para el
Conocimiento y Uso de la Biodiversidad, de 213 especies de peces, 109 especies
de anfibios, 214 especies de reptiles, 635 especies de aves y 190 especies de
mamferos (CONABIO, 2008 y Sarukhn et al., 2009), cuenta con una naturaleza
biogeogrfica y riqueza biolgica que lo distinguen. Su localizacin en la zona de
transicin entre dos grandes regiones la nertica y la neotropical (Rzedowski,
1992), cada una con su componente florstico y faunstico y su posicin geogrfica
frente al Golfo de Mxico, han producido un complejo mosaico de ecosistemas
naturales y tipos de vegetacin (Gmez-Pompa, 1965; Rzedowski, 1988;
Pennington y Sarukhn, 1998). Uno de los ejemplos de este mosaico natural, lo
representa la regin central del estado donde la sierra Monte de oro localizada en

61
El Agro Veracruzano 2015

la vertiente del golfo de Mxico, es sitio de importante biodiversidad, con


ecosistemas primarios que pueden estar aislados pero que a nivel local son de gran
importancia porque de ellos depende su estabilidad ambiental (Mrquez y
Mrquez, 2009). En estos escenarios, se han realizado estudios en los vertebrados,
como la fauna asociada a la laguna La Mancha por Cervantes y Hortelano (1991);
Morales y Guzmn (1994) con el estudio de los Mamferos pequeos de la estacin
biolgica El Morro de La Mancha, Gonzlez y Lara (2006) con los vertebrados
terrestres (Anfibios, reptiles y mamferos) en la cuenca hidrolgica La Mancha, y
en el grupo de las aves, anteceden al presente los trabajos de Gonzlez (2006),
Ruelas y Montejo (1999) y Tarabini (2006), entre los ms importantes .
No obstante que la diversidad biolgica que se encuentra en la entidad veracruzana
es importante, existe un problema fundamental, cuando se requiere informacin
precisa de faunas regionales, es evidente la carencia y muchas veces ausencia de
fuentes documentales actualizadas. Por lo anterior El Instituto Tecnolgico de
rsulo Galvn, con la idea de dar cumplimiento a los requisitos de conformar un
marco referencial actualizado, se ha interesado en analizar preliminarmente el
componente vegetacin y flora importante para el hbitat, contribuir a la
composicin de la biodiversidad de vertebrados, las especies existentes incluidas
dentro de la NOM-059-SEMARNAT-2010, determina especies de vertebrados
migratorias, endmicas, cinegticas o comerciales. Este trabajo es un acercamiento
a la iodiversidad de la sierra Monte de oro y sus alrededores desde luego deber
continuar con el inventario faunstico y florstico.

Materiales y mtodos

El estudio comprendi trabajo intensivo en los meses de abril y mayo de 2012. Se


realizaron campamentos y visitas frecuentes en 2013 y 2014 bajo metodologa de
Ojasti y Dallmeier (2000) y Balderrama et al., (2005).
Ubicacin del rea de estudio. Se consider un macizo de cerros denominado
localmente como sierra Monte de oro de aproximadamente 7 000 ha., en la zona
montaosa que comprende el parteaguas entre dos cuencas, la del rio Palma sola
y la del rio El Limn, mismas que desembocan en el golfo de Mxico,
ubicndose dentro, el complejo nucleoelctrico Laguna Verde (Figura 1).
Determinacin del hbitat (vegetacin). Se reconoci la topografa en campo y
las caractersticas de vegetacin, a partir de donde se hicieron posteriormente
recorridos para el registro visual y colecta de ejemplares de herbario y su
identificacin (con nfasis en la experiencia del segundo autor) potencialmente
relevantes en la alimentacin de la fauna que forman parte fundamental del hbitat
y se caracteriz por el tipo de vegetacin principal, tomando como base lo referido
por Gmez-Pompa (1978), Rzedowski (1992) y Candymin (2011).
62
El Agro Veracruzano 2015

Mtodos de estudio de los vertebrados. Anfibios y reptiles. Se realizaron


recorridos sistemticos caminando por senderos y en transectos de 100 a 300
metros de longitud y 10 metros de ambos lados, de acuerdo a las condiciones de
accesibilidad del terreno de caadas y laderas de los cerros para observar,
fotografiar y registrar organismos, en horarios de 08:00 a 14:00 y 19:00 a 21:00. Se
consider el registro visual de acuerdo a la gua tcnica de Perovic et al., (2008)
como una de las metodologas ms utilizadas, que consiste en la bsqueda y
registro de los anfibios y reptiles a lo largo de caminatas. Estas se orientaron E-W
siguiendo en muchos casos el curso de las caadas que cubren una determinada
rea o tipo de hbitat. Se removieron troncos y rocas, y se incluy la observacin
de animales sobre sendero, hojarasca, en las ramas de los rboles y en cuerpos de
agua. La identificacin de los organismos se realiz siguiendo lo propuesto por
Flores et al., (comp. 1995) y se consult la gua de reptiles de Guzmn (2011).
Aves. Para el registro de especies se consider como base el listado realizado por
la CAM (2011), y la nomenclatura cientfica de las Aves de Mxico de Escalante
et al., (1996) y Navarro y Gordillo (2006). Se realizaron transectos a pie en 300
metros de longitud en promedio con un esfuerzo de 120 horas y observaciones
casuales con esfuerzo no medido durante el transporte vehicular. Asimismo, para
corroborar especies y alimentacin de las aves, se aplic la observacin focal, con
un total 60 horas de esfuerzo (Ralph et al, 1996). Los senderos fueron de mucha
utilidad para recorridos con horario de 6:30 a 14:00 y de 16:00 a 20:00, en especial
el sendero que baja desde el cerro de la cruz hasta el poblado de Arroyo agrio.
Para identificacin se utiliz un binocular 10X50 y las guas Sibley (2000) y
Peterson y Chalif (1989), y con la ayuda de cmara fotogrfica Nikon de 42X/16.1
para su anlisis y determinacin taxonmica en gabinete.
Mamferos. Se realizaron recorridos diurnos y nocturnos, realizando para este
grupo recorridos hasta la madrugada a diferencia de reptiles y aves. Se registraron
y fotografiaron huellas, y para murcilagos se colocaron redes de niebla a lo largo
de caminos y caadas, con un esfuerzo 72 horas/red. Los roedores pequeos con
un esfuerzo de 40 trampas de jaula cebadas con cacahuate con vainilla y pan
blanco con atn, durante 7 noches, en lnea a 10 metros entre trampas. En todos los
casos de captura de organismos (murcilagos y roedores) una vez determinada su
especie con ayuda de la literatura (Ceballos y Oliva, eds-2005) tomado sus datos y
fotografiados, se liberaron inmediatamente en el mismo sitio de captura.

63
El Agro Veracruzano 2015

Figura 1. Sierra Monte de oro, el estudio comprendi desde los mrgenes del Ro El
Limn, las primeras estribaciones, y hasta la cima del Cerro Blanco (700 m.s.n.m.).
Imagen Satelital de Google earth (arriba) y Fotografa de Viveros Colorado (abajo).

Para mamferos medianos se observaron huellas y rastros, se us un reclamo para


depredadores Rabit marca Primos y se hicieron recorridos a pie, para bsqueda de
rastros y avistamientos, de acuerdo a Ralph et al (1996) para especies que no caen
en las trampas de huellas, o cuya identificacin a travs de huellas es compleja.
Colateralmente se acompaaron y entrevistaron a cazadores locales e
investigadores que tienen experiencia en la zona, para confirmar la existencia de
especies que no se observaron directamente.

64
El Agro Veracruzano 2015

Resultados

Anlisis del hbitat. A partir de la tipificacin de vegetacin y flora, se determin


un bosque de encino que domina en la parte alta y el parteaguas de las dos cuencas,
as como fragmentos de Selva Baja en elevaciones menores y en zonas riparias y
costeras. Existen pequeos parches de vegetacin original en zonas de difcil
acceso, como caadas y reas de pendientes casi verticales, que se encuentran en
los distintos cerros, cuyo estado de conservacin se asocia a la dificultad para el
manejo ganadero.
Se caracteriz una mono-dominancia del genero Quercus, representado por las
especies Q. oleoides y Q. sapotifolia, y en encinares secundarios localizados en
elevaciones bajas se observ la presencia de Byrsonima crassifolia y Dendropanax
arboreus. En el matorral de encino, distribuidos en las laderas altas al sureste, se
refieren las mismas dos especies de Quercus arriba sealadas, y adicionalmente en
matorrales de encino se arbustos como Bejaria aestuans. Se determin tambin un
hbitat definido por Bosque de Quercus-Sabana que se tipifica por la presencia de
Byrsonima crassifolia-Quercus oleioides, y algunas pates de la sierra presentan
elementos del Bosque Tropical Subcaducifolio con la caracterstica peculiar de la
presencia de Schelea liebmanii (Figura 2).

Figura 2. Palmas de Schelea liebmanii caracterizan el hbitat en una pequea caada


rodeada de encinos en la sierra monte de oro, municipio Alto Lucero, Veracruz.
Fotografa: Csar Viveros Colorado.

65
El Agro Veracruzano 2015

Resaltan algunas especies vegetales, por su importancia en la alimentacin


potencial de aves y mamferos, el nanche (Byrsonima crassifolia), la pitaya
(Epiphyllum phyllanthus), el capuln de mayo (Ardisia compresa), la palma real
(Schelea liebmanii), Guarumbo (Cecropia obtusifolia) y el jinicuil (Inga vera) y
los encinos que aportan bellotas como alimento importante en poca de su
fructificacin, que tienen especial importancia en el hbitat (Anexo 1).
Se encontr un hbitat relevante para los vertebrados, en especial para las aves
como los psitcidos, especficamente en las partes bajas cercanas a las cuencas,
donde tambin se observ una zona de reproduccin de Amazona oratrix, pues esta
especie se registr en un hbitat de terrenos bajos a las mrgenes del ro El
Limn en reas ms abiertas, perchando sobre sauces (Salix humboldtiana) y
palmas de apachite (Sabal mexicana), (Figura 3). La sierra Monte de oro en
general es fragmentada por potreros de Panicum maximum e Hiparrhenia rufa
como lo ms frecuente, donde los vertebrados encuentran hbitat temporal,
mientras que los ganaderos no introduzcan hatos de vacunos. El venado
(Odocoileus virginianus) es tolerante a este hbitat modificado; en l se observaron
ejemplares alimentndose, encamados y lamiendo el sustrato en la ladera de un
cerro.

Figura 3. Amazona oratrix perchado en un sauce Salix humboldtiana (derecha) y su


nido en un rbol de la misma especie (izquierda) a la mrgen del ro EL Limn
frente a la sierra Monte de oro municipio Alto Lucero, Veracruz. Fotografa: Csar
Viveros Colorado.

Diversidad especfica de los vertebrados en la Sierra Monte de Oro


Fueron registradas las siguientes especies: una de anfibios, 10 de reptiles, 51 de
aves y 20 de mamferos, que aun sin constituir una lista definitiva ni completa,
66
El Agro Veracruzano 2015

permite inferir que la mayor diversidad faunstica de vertebrados son las aves,
seguidos por los mamferos los reptiles y los anfibios en una mnima proporcin
(Figura 4).
Anfibios y Reptiles. Con relacin a los anfibios solo se reporta en este trabajo a
Litobathes berlandieri encontrada en una olla de captacin de agua en lo alto de la
sierra.
En reptiles se encontr 1 orden, 9 familias, 10 gneros y 10 especies (Tabla 1). Un
dato relevante es haber registrado a Gerrhonotus liocephalus (Anguidae) y
Plestiodon lynxe (Scincidae), especies que no se haban reportado en trabajos
anteriores.
De acuerdo a referencia de la NOM-059-SEMARNAT-2010, son endmicas
Micrurus diastema, Ctenosaura acanthura y Plestiodon lynxe; en estatus de
proteccin (Pr) 5 especies como, Ctenosaura acanthura, Iguana iguana,
Gerrhonotus liocephalus, Leptodeira annulata Plestiodon lynxe y Micrurus
diastema. CITES (2012) por su parte incluye a Iguana iguana, Crotalus simus y
Micrurus diastema en apndice III.
Dentro de los vertebrados de la sierra Monte de oro fue muy importante la
referencia de algunos ganaderos acerca de Ctenosaura acanthura como
depredadora de las nidadas de loro cabeza amarilla (Amazona oratrix) que ocupan
los sauces en las mrgenes del Rio El Limn.

Anfibios
Mamferos % Reptiles
25% %

Aves
62%

Figura 4. Distribucin porcentual de las especies de vertebrados en la sierra "Monte


de oro" municipio Alto Lucero, Veracruz.

67
El Agro Veracruzano 2015

Tabla 1. Registro de Reptiles en la Sierra Monte de oro municipio Alto Lucero,


Veracruz

Orden Familia Especies

Squamata Iguanidae Ctenosaura acanthura


Iguana iguana
Polichrotidae Anolis sericeus
Phrynosomatidae Sceloporus variabilis
Teiidae Ameiva undulata
Scincidae Plestiodon lynxe
Anguidae Gerrhonotus liocephalus
Viperidae Crotalus simus
Colubridae Leptodeira annulata
Elapidae Micrurus diastema

Aves. Se registraron 51 especies, que de acuerdo a la literatura son el 21 % de las


aves con probabilidad de encontrarse, y representaron 2 rdenes, 25 Familias, 42
Gneros y 51 especies (Tabla 2). Las familias con mayor nmero de especies
registradas fueron, Columbidae, Parulidae y Psittacidae con 5 especies cada una;
Tyrannidae y Cuculidae con 4 y Cardinalidae y Picidae con 3 especies, el resto
observ menor cantidad. Como reportes nuevos de campo de acuerdo a listas de
otros estudios, se encuentran: Eudocimus albus, Coccyzus minor, Dendroica fusca,
Dryocopus lineatus, Amazona viridigenalis, Ara militaris y Trogon violaceus.
El endemismo en las aves registradas se expresa en 3 especies cuasiendmicas,
Amazilia yucatanensis e Icterus graduacauda y dos especies endmicas
Campylorhinchus rufinucha y Amazona viridigenalis que se registraron en la parte
baja de la sierra.
El 76 % de las aves registradas y abordadas en el estudio son residentes, el 16%
migratorias y el 8 % son migratorias transitorias. Se not una concentracin de
especies migratorias y migratorias transitorias en las partes altas de la sierra como
las especies del gnero Dendroica, fenmeno que ya ha sido analizado
detalladamente por Gmez y Bayly (2011), para este gnero.
En cuanto a la consideracin de las especies en la NOM 059 SEMARNAT 2010,
se encontr en condicin de Peligro de extincin (P), a Amazona oratrix, Amazona
viridigenalis y Ara militaris, amenazadas (A), Campylorhyncus rufinucha y
Ranphastos sulfuratus y en Proteccin (Pr) a Falco peregrinus, Psarocolius
montezuma, Aratinga nana y Melanerpes formicivorus.

68
El Agro Veracruzano 2015

Tabla 2. Registro de Aves en la Sierra Monte de oro municipio Alto Lucero,


Veracruz

Orden Familia Especies


Apodiformes Trochilidae Amazilia yucatenensis
Ciconiiformes Ardeidae Bubulcus ibis
Threskiornithidae Eudocimus albus
Falconiformes Cathartidae Cathartes aura
Coragyps atratus
Accipitridae Buteo nitidus
Buteo jamaicensis
Falconidae Caracara cheriwuay
Falco peregrinus
Columbiformes Columbidae Columbina inca
Columbina paserina
Leptotila verreauxi
Patagioenas flavirrostris
Zenaida asitica
Momotiformes Momotidae Momotus momota
Cuculiformes Cuculidae Coccyzus minor
Crotophaga sulcirrostris
Geococcyx velox
Piaya cayana
Galliformes Cracidae Ortalis vetula
Phasianidae Colinus virginianus
Passeriformes Cardinalidae Cardinalis cardinalis
Saltator atriceps
Corvidae Cyanocompsa parellina
Cyanocorax morio
Euphonia hirundinacea
Hirundinidae Hirundo rustica
Icteridae Icterus graduacauda
Psarocolius montezuma
Parulidae Dendroica magnolia
Dendroica petechia
Dendroica coronata
Dendroica virens
Dendroica fusca
Troglodytidae Campylorhinchus rufinucha
Turdidae Turdus grayi
Tyranniformes Tyrannidae Empidonax alnorum
Pitangus sulfurous
Tyrannus tyrannus

69
El Agro Veracruzano 2015

Tityra semifasciata
Piciformes Picidae Melanerpes formicivorus
Melanerpes aurifrons
Dryocopus lineatus
Ranphastidae Ranphastos sulfuratus
Psittaciformes Psittacidae Amazona autumnalis
Amazona oratrix
Amazona viridigenalis
Aara militaris
Aratinga nana
Strigiformes Strigidae Glacidium brasilianum
Trogoniformes Trogonidae Trogon violaceus

Mamferos. Se registraron 20 especies que se acreditan al rea de estudio,


representan 6 rdenes, 14 Familias y 20 gneros. Los rdenes Carnvora,
Chiroptera y Rodentia presentaron mayor composicin de especies con 7, 5 y 4
especies respectivamente, mientras que Xenarthra 2 y el resto de los rdenes slo
present una especie. La familia Phyllostomidae present 4 especies, siendo la
familia mastozoolgica de mayor diversidad en este estudio (Tabla 3).

Tabla 3. Registro de Mamferos en la Sierra Monte de oro municipio Alto Lucero,


Veracruz

Orden Familia Especies


Didelphimorpha Didelphidae Didelphis virginiana
Xenarthra Dasypodidae Dasypus novemcinctus
Myrmecofagidae Tamandua tetradactyla
Rodentia Muridae Peromyscus mexicanus
Sciuridae Sciurus aureogaster
Heretizontidae Coendu mexicanum
Agutidae Cuniculus paca
Chiroptera Phyllostomidae Artibeus jamaicensis
Carollia sowelli
Sturnira lilium
Desmodus rotundus
Mormoopidae Mormoops megalophylla
Carnivora Mustelidae Conepatus leuconotus
Procyonidae Nasua narica
Potos flavus
Canidae Procyon lotor
Canis latrans
Urocyon cinereoargenteus
Felidae Leopardus wiedii
Artiodactyla Cervidae Odocoileus virginianus
70
El Agro Veracruzano 2015

A partir de la NOM 059 SEMARNAT 2010, se encontr en condicin de Peligro


de extincin (P), a Leopardus wiedii y en Proteccin (Pr), Potos flavus, especie que
habita la sierra solo en caadas boscosas. De las especies reportadas en este
informe, de acuerdo a CITES (2012), Leopardus wiedii es la nica especie que est
en apndice I en situacin de mayor grado de peligro; Nasua narica, Potos flavus,
Procyon lotor y Cuniculus paca en el apndice III; de las dems especies de
mamferos no hay consideracin por CITES (2012).
Especies de caza local y cinegticas. Dentro de las especies hoy reportadas, se
considera como especie de inters de caza local en los reptiles a Iguana iguana.
Aves cinegticas incluidas en el calendario cinegtico de las pocas hbiles de caza
desde 2012 a 2015, estn Colinus virginianus y Ortalis vetula (SEMARNAT,
2014).
Dentro de los mamferos Dasypus novemcinctus, Procyon lotor, Nasua narica,
Cuniculus paca y Odocoileus virginianus, estn incluidos en calendario cinegtico.
El armadillo (Dasypus novemcinctus), fue registrado como una especie cinegtica
y para alimento muy popular entre cazadores locales, que lo refieren con una
marcada preferencia, al igual que el tepescuintle (Cuniculus paca) especie que est
entre las ms cotizadas como alimento regional (SEMARNAT, 2014). Nasua
narica es popular, y distingue a la regin como especie emblemtica por su
abundancia y por la aceptacin que tiene en la alimentacin humana. El venado
cola blanca (Odocoileus virginianus) es la especie ms importante en el carcter
cinegtico, se caza legal e ilegalmente, y por su fcil avistamiento se asume que es
relativamente abundante, lo que ha permitido desarrollar diversas Unidades de
Manejo Ambiental de Vida Silvestre (UMA) en esta regin.

Discusion

El hbitat se define por Bosque de Quercus-Sabana tipificado por Byrsonima


crassifolia-Quercus oleioides. En algunos sitios, elementos del Bosque Tropical
Subcaducifolio estn presentes como Schelea liebmanii, lo que hace ser un sitio
biolgicamente interesante. Las caadas en la sierra, son relevantes tanto por la
alimentacin que aqu encuentra la fauna en una diversidad amplia de rboles
frutales, como por el refugio que ofrece el escarpado terreno, zona idnea para
nidos y madrigueras. Adems, el hbitat en partes bajas de la sierra es fundamental
para especies como Amazona oratrix, que congruente con la definicin altitudinal
de su hbitat acotado hasta los 500 msnm (Macas e Iigo, 2003), se le encuentra al
igual que Amazona viridigenalis y Aratinga nana. Sin embargo, es importante
referir como altamente probable que estas especies busquen alimento en lo alto de
la sierra.
71
El Agro Veracruzano 2015

Llam la atencin que Ctenosaura acanthura pueda estar depredando las nidadas
de loro cabeza amarilla (Amazona oratrix) en los sauces en los mrgenes del ro
El Limn, lo que sugiere corroborar con un estudio ms profundo tal situacin y
plantear alternativa de control.
Acerca de la diversidad de especies de vertebrados encontrados, la tendencia en la
proporcin de las aves ya se demostr en otros estudios (Candymin, 2011). Hoy
son reportes nuevos de campo a las listas determinadas en otros trabajos, 2
especies de reptiles Gerrhonotus liocephalus y Plestiodon brevirostris y 7 especies
de aves Eudocimus albus, Coccyzus minor, Dendroica fusca, Dryocopus lineatus,
Amazona viridigenalis, Ara militaris y Trogon violaceus.
Existen reptiles endmicos y en estatus de proteccin que justifica plenamente
insistir en el estudio situacional de las especies en esta zona.
La sierra es estratgica para la conservacin de las aves, a partir de las especies
consideradas en la NOM-059-SEMARNAT-2010 como cuasiendmicas y
endmicas deberan realizarse esfuerzos en la investigacin, manejo y
conservacin de la avifauna. En la lista hoy reportada, el 76 % de las aves
registradas son residentes, el 16% migratorias y el 8 % son migratorias transitorias,
percibindose mayor porcentaje de migratorias en las partes altas de la sierra como
las especies del gnero Dendroica.
Debido a que aves como los Parulidae (Dendroica spp) que se alimentan
normalmente en las partes ms altas de matorral y encinos chaparros y aquellas
especies que aun siendo residentes dependen de la diversidad botnica y
microambientes en la sierra, es necesario incorporar aspectos de zonificacin
especfica a su manejo potencial que favorezca sus hbitos; sin embargo deber
continuarse con el anlisis y monitoreo en campo. As, la sierra Monte de oro
guarda un germoplasma sui generis que debe conservarse, como se ratifica con la
presencia de especies en peligro de extincin como Amazona oratrix, Amazona
viridigenalis y Ara militaris; amenazadas como Campylorhyncus rufinucha y
Ranphastos sulfuratus y en proteccin como Falco peregrinus, Psarocolius
montezuma, Aratinga nana y Melanerpes formicivorus.
La mastofauna es relevante con 20 especies hoy reportadas que se acreditan al rea
de estudio y que por considerarse en la NOM 059 SEMARNAT 2010 y CITES
(2012), algunos deben protegerse como Leopardus wiedii. Respecto a la fauna
cinegtica, es preponderante la atencin que debiera darse a especies de caza
menor y en especial a la nica de caza mayor, el venado cola blanca, especie que
gracias a su valor merece un esfuerzo para diagnosticar sus poblaciones y elevar la
eficiencia del manejo que hasta ahora se le est dando.

72
El Agro Veracruzano 2015

Conclusiones

El hbitat de la sierra Monte de Oro se caracteriz por una dominancia Quercus


oleoides y Q. sapotifolia; Quercus-Sabana tipificada por Byrsonima crassifolia-
Quercus oleioides, y Bosque Tropical Subcaducifolio con presencia de Schelea
liebmanii; con especies de importancia en la alimentacin como Byrsonima
crassifolia, Epiphyllum phyllanthus, Ardisia compresa, Schelea liebmanii,
Cecropia obtusifolia, Inga vera y Quercus spp.
Se registraron 82 especies de vertebrados con una riqueza de 62% aves, 25%
mamferos, 2% reptiles y 1% anfibios; de las cuales son 5 endmicas, 3
cuasiendemicas, 6 protegidas, 5 en peligro de extincin y 8 cinegticas con la
especie de caza ms importante de Mxico.

Literatura Citada

Balderrama, J. A., L.F. Aguirre, R. Aguayo, F. Alfaro, D. Rejas y L. Zuiga, 2005.


Tcnicas de Colecta y Censo de Fauna. Fundacin Nacional para la Ciencia -
Servicio de Pesca y Vida Silvestre, Estados Unidos. 39 pp.
http://es.scribd.com/eduardomolinov/d/33807021-Tecnicas-de-Colecta-y-Censo-
de-Fauna. Consultado el 15 abril 2012.
Ceballos, G. y G. Oliva, 2005(eds). Los Mamferos Silvestres de Mxico. CONABIO y
fondo de. Cultura Econmica. 987 pp.
Cervantes, A.F. y Y. Hortelano M., 1991. Mamferos pequeos de la estacin biolgica El
Morro de La Mancha, Veracruz, Mxico. Anales del Instituto de Biologa,
UNAM. Ser. Zoologa, 62 (1): 129-136.
CITES, 2012. Apndices I, II y III en vigor a partir del 3 de abril de 2012. Convencin
sobre el comercio Internacional de especies amenazadas de fauna y flora
silvestres. Ginebra, Suiza. 47 pp. http://www.cites.org/esp/app/2012/S-
20120403.pdf. Consultado el 6/junio 2012.
CONABIO, 2008. Capital natural de Mxico, vol. I: Conocimiento actual de la
biodiversidad. Comisin Nacional para el Conocimiento y Uso de la
Biodiversidad, Mxico. 30 pp.
http://www.biodiversidad.gob.mx/pais/pdf/CapNatMex/Vol%20I/I00_PrefacioGui
a.pdf. Consultado el 6/junio 2012.
Sarukhn, J., P. Koleff, J. Carabias, J. Sobern, R. Dirzo, J. Llorente-Bousquets, G.
Halffter, R. Gonzlez, I. March, A. Mohar, S. Anta, y J. de la Maza, 2009. Capital
natural de Mxico. Sntesis: conocimiento actual, evaluacin y perspectivas de
sustentabilidad. Comisin Nacional para el Conocimiento y Uso de la
Biodiversidad, Mxico. 100 pp.
http://www.biodiversidad.gob.mx/pais/pdf/CapNatMex/Capital%20Natural%20de
%20Mexico_Sintesis.pdf. Consultado el Consultado el 6/junio 2012.

73
El Agro Veracruzano 2015

Candymin, 2011. Manifestacin de Impacto ambiental Modalidad B. Estudio de Fauna,


Anexo 5. Candymin S.A. de C.V. Alto Lucero, Ver. 547 pp.
http://sinat.semarnat.gob.mx/dgiraDocs/documentos/ver/estudios/2011/30VE2011
M0043.pdf.
Escalante, P. P., A. M. Sada y J. Robles G., 1996. Listado de nombres comunes de las aves
de Mxico. CONABIO/ Agrupacin sierra Madre. Mxico, D.F. 32 pp.
Flores, O., F. Mendoza Q. y G. Gonzlez P. (Comps.), 1995. Recopilacin de claves
dicotmicas para la determinacin de anfibios y reptiles de Mxico. Facultad de
Ciencias, Departamento de Biologa, UNAM, Mxico, D.F., Publ. esp. Mus. Zool.
10: 1-285.
https://www.academia.edu/4027619/Recopilaci%C3%B3n_de_Claves_Taxon%C
3%B3micas_de_la_Herpetofauna_Mexicana. Consultado el 27 octubre 2014.
Gmez, C. y N.J. Bayly, 2011. La migracin de aves en la Reserva El Dorado, Sierra
Nevada de Santa Marta, Colombia. Proyecto Cruzando el Caribe: Identificacin
de sitios de parada crticos para aves migratorias Neotropicales en el norte de
Colombia. SELVA: Investigacin para la Conservacin en el Neotrpico. Bogot.
Informe tcnico No. CEC05, 12 pp.
http://avesmigratoriascolombia.files.wordpress.com/2012/01/cec05_informe-final-
la-migracic3b3n-de-aves-en-la-reserva-el-dorado.pdf Consultado el 27 octubre
2014.
Gmez-Pompa, A. 1978. Ecologa de la Vegetacin del Estado de Veracruz. Edit.
C.E.C.S.A. INIREB, A.C. Xalapa, 91 pp.
Gmez-Pompa, A. 1965. La vegetacin de Mxico. Bol. Soc. Bot. Mxico, (29): 76-120
Gonzlez, G. F, 2006. Las Aves. pp. 423-447. En: P. Moreno-Casasola (ed.), Entornos
veracruzanos: la costa de La Mancha. Instituto de Ecologa, A.C., Xalapa, Ver.
Mxico, 576 pp.
Gonzlez, R. A., y M.S. Lara L., 2006. Los anfibios, reptiles y mamferos. pp. 422. En: P.
Moreno-Casasola (ed.), Entornos veracruzanos: la costa de La Mancha. Instituto
de Ecologa, A.C., Xalapa, Ver. Mxico, 576 pp.
Guzmn, G. S., 2011. Anfibios y Reptiles de Veracruz. Gua Ilustrada. Consejo
Veracruzano de Investigacin Cientfica y Desarrollo Tecnolgico. Gobierno del
Estado de Veracruz, Xalapa, Veracruz, 231 pp.
Llorente, J. y S. Ocegueda, 2008. Estado de conocimiento de la biota de Mxico. pp. 283-
322. En: J. Sobern, G. Halffter y J. Llorente (eds.) Capital natural de Mxico,
Conocimiento actual de la biodiversidad. Vol. I Comisin Nacional para el
Conocimiento y Uso de la Biodiversidad, Mxico. 621 pp.
Macas, C. C. y E. E. Iigo E., 2003. Evaluacin del estado de conservacin actual de las
poblaciones de loro cabeza amarilla (Amazona oratrix) en Mxico. Instituto
Tecnolgico y de Estudios Superiores de Monterrey. Centro de Calidad
Ambiental. Informe final SNIB-CONABIO proyecto No. AS002. Mxico D. F.,
50 pp. http://www.conabio.gob.mx/institucion/proyectos/resultados/InfAS002.pdf
. Consultado el 28 mayo de 2012.
Mrquez, R. W. y J. Mrquez R., 2009. Municipios con mayor biodiversidad en Veracruz.
Foresta Veracruzana, 11 (2): 43-50.

74
El Agro Veracruzano 2015

Morales, M. J. E. y S. Guzmn G., 1994. Fauna silvestre de la zona de la Mancha,


Veracruz. Mxico. La Ciencia y el Hombre, (16): 77-103.
Navarro, S. A. y A. Gordillo, 2006. Catlogo de Autoridades Taxonmicas de las Aves de
Mxico. Facultad de Ciencias, UNAM. Base de datos del Sistema Nacional de
Informacin sobre Biodiversidad. Comisin Nacional para el Conocimiento y Uso
de la Biodiversidad. Proyecto CS010. Mxico, D.F. 38 pp.
http://www.biodiversidad.gob.mx/especies/gran_familia/animales/aves/doc/Aves.
pdf. Consultado el 27 de octubre de 2014.
Ojasti J., y F. Dallmeier (editor), 2000. Manejo de Fauna Silvestre Neotropical. SI/MAB
Series # 5. Smithsonian Institution/MAB Biodiversity Program, Washington D.C.
290 pp. http://nationalzoo.si.edu/SCBI/MAB/DOCUMENTS/SIMAB5.pdf.
Consultado el 28 de mayo de 2012.
Pennington, T.D. y J. Sarukhn, 1998. rboles tropicales de Mxico: manual para la
identificacin de las principales especies. Universidad Nacional Autnoma de
Mxico-Fondo de Cultura Econmica. Mxico, D. F. 2 da edicin 498 pp.
Perovic, P., C. Trucco, A. Tlamo, V. Quiroga, D. Ramallo, A. Lacci, A. Baungardner y F.
Mohr, 2008. Gua tcnica para el monitoreo de la biodiversidad. Programa de
Monitoreo de Biodiversidad - Parque Nacional Copo, Parque y Reserva
Provincial Copo, y Zona de Amortiguamiento. APN/GEF/BIRF. Salta, Argentina.
74 pp. http://www.sib.gov.ar/archivos/guia_monitoreo_copo.pdf Consultado el 27
de octubre de 2014.
Peterson, R. T. y E. L. Chalif, 1989. Aves de Mxico. Gua de Campo. 2da impresin,
edicin del WWF. Editorial Diana. 83 pp. Ralph, C. John, G. R. Geupel, P. Pyle,
T. E. Martin, D. F. DeSante y B. Mil, 1996. Manual de mtodos de campo para
el monitoreo de aves terrestres. Gen. Tech. Rep. PSW-GTR-159. Albany, CA:
Pacific Southwest Research Station, Forest Service, U.S. Department of
Agriculture, 46 pp.
http://www.fs.fed.us/psw/publications/documents/psw_gtr159/psw_gtr159.pdf.
Consultado el 28 de mayo de 2012.
Rzedowski, J., 1988, Vegetacin de Mxico. LIMUSA. 4a reimpresin. Mxico, D.F. 432
pp.
Rzedowski, J., 1992, Diversidad y orgenes de la flora fanerogmica de Mxico. Ciencias.
No. esp. (6): 47-56.
SEMARNAT, 2010. Compendio de estadsticas ambientales 2010. Secretara de Medio
Ambiente y Recursos Naturales.
http://aplicaciones.semarnat.gob.mx/estadisticas/compendio2010/00_intros/presen
tacion.html. Consultado el 4 de julio de 2011.
SEMARNAT, 2010. NORMA Oficial Mexicana NOM-059-SEMARNAT-2010, Proteccin
ambiental-Especies nativas de Mxico de flora y fauna silvestres-Categoras de
riesgo y especificaciones para su inclusin, exclusin o cambio-Lista de especies
en riesgo. Diario Oficial de la Federacin. Secretara de Gobernacin.
http://biblioteca.semarnat.gob.mx/janium/Documentos/Ciga/agenda/DOFsr/DO24
54.pdf Consultado el 4 de julio de 2011.

75
El Agro Veracruzano 2015

SEMARNAT, 2011. Calendario de pocas habiles de caza 2011-2012.


http://www.semarnat.gob.mx/TEMAS/GESTIONAMBIENTAL/VIDASILVEST
RE/Paginas/epocashabiles.aspx. Consultado el 4 de julio de 2011.
SEMARNAT, 2014. Calendario de pocas hbiles de caza 2014-2015.
ttp://www.semarnat.gob.mx/sites/default/files/documentos/vidasilvestre/eh2014-
15/veracruz.pdf. Consultado el 27 de octubre 2014.
Sibley D. A. 2000. National Audubon Society The Sibley Guide to Birds. Alfred A. Knopf,
New York, E.U.A. 545 pp.
Tarabini, S., 2006. Las aves acuticas y vadeadoras. pp 363-380. En: P. Moreno-Casasola
(ed.), Entornos veracruzanos: la costa de La Mancha. Instituto de Ecologa, A.C.,
Xalapa, Ver. Mxico, 576 pp.

ANEXO 1. Lista de especies de flora identificados en el hbitat de los vertebrados en la Sierra


Monte de oro, municipio Alto Lucero, Veracruz.

FAMILIA ESPECIE NOMBRE COMUN


Anacardiaceae Tapiriria mexicana cacao
Araliaceae Dendropanax arobreus palo cucharo
Bromeliaceae Tillandsia alvarezii tencho- epfita
Bromelicea Tillandsia fasciculata tencho-epifita
Bromeliaceae Tillandsia ionantha tencho-epifita
Bromeliaceae Tillandsia juncea tencho-epifita
Bromeliaceae Tillandsia schiedeana tencho- epfita
Bromeliaceae Tillandsia streptophylla tencho- epfita
Bromeliaceae Tillandsia usneoides paxtle- epfita
Bromeliaceae Tillandsia utriculata tencho epfita
Bromeliaceae Aechmea bracteata tencho-epifita
Crassulaceae Sedum adolphii siempreviva
Cactaceae Rhipsalis baccifera dedos de muerto-epifita
Euphorbiaceae Alchornea latifolia palo verde
Ericaceae Agarista mexicana
Ericaceae Lyonia squamulosa
Ericaceae Befaria glauca
Fagaceae Quercus oleioides encino
Fagaceae Quercus sapoteifolia encino
Fabaceae Calliandra houstoniana cabellos de angel
Fabaceae Inga laurina jinicuil
Fabaceae Calliandra erubescens rezumbador
Fabaceae Acacia cornigera cornizuelo
Heliconiaceae Heliconia schiedeana platanillo
Moraceae Ficus pertusa higuera
Moraceae Castlla elastica arbol de hule
Myricaceae Myrica cerifera cerilla
Myrsinaceae Ardisia compresa capulin de mayo
Orchidaceae Oncidium cebolleta orquidea- epifita
Orchidacea Prostechea radiata orquidea-epifita
Orchidaceae Prostechea cochleata orqudea- epifita

76
El Agro Veracruzano 2015

Phoenicaceae Schelea liebmanii coyol real


Piperaceae Piper sanctum
Piperaceae Piper umbellatum
Piperaceae Piper auritum acuyo
Piperaceae Peperomia magnoliifolia
Rubiaceae Faramea occidentalis cafetillo
Rubiaceae Psychotria sp
Simarubaceae Picrasma andicola
Theaceae Terstroemia tepezaopte trompillo
Thelipteridaceae Thelipteris sp helecho
Vitaceae Parthenocissus quinqueifolia parra cimarrona
Zamiaceae Zamia lodigesii palma ccada

77
El Agro Veracruzano 2015

6
EVALUACIN POST-APROVECHAMIENTO DE LA RESERVA DE SAN
JUAN DEL MONTE, LAS VIGAS, VERACRUZ EFECTO DE LA CORTA
SELECTIVA

Daniel Rodrguez Sols*1, Celia Cecilia Acosta Hernndez2, Pascual Linares


Mrquez3, Ana Isabel Suarez Guerrero4, Joaqun Jimnez Huerta5
1
Facultad de Biologa, Universidad Veracruzana, Circuito Gonzalo Aguirre Beltrn s/n,
Zona Universitaria, C.P. 91090, Tel. Fax (228)8421748/8421700 Ext. 11748, Xalapa,
Veracruz, Mxico. E-mail: dani_rguez5@hotmail.com. Bilogo, Tcnico en el Consejo
Civil Mexicano para la Silvicultura Sostenible, A. C.
2
Universidad Veracruzana, Circuito Gonzalo Aguirre Beltrn s/n, Zona Universitaria, C.P.
91090, Tel. Fax (228)8421748/8421700, Xalapa, Veracruz, Mxico. E-mail:
ceacosthdez@yahoo.com.mx. Dra. en Ecologa y Biotecnologa. Perfil PROMEP-2013.
3
Universidad Veracruzana, Circuito Gonzalo Aguirre Beltrn s/n, Zona Universitaria, C.P.
91090, Tel. Fax (228)8421748/8421700, Xalapa, Veracruz, Mxico. E-mail:
linaresbiologo@hotmail.com. Dr. en Biologa (Biotica), Perfil PROMEP-2012.
4
Universidad Veracruzana, Circuito Gonzalo Aguirre Beltrn s/n, Zona Universitaria, C.P.
91090, Tel. Fax (228)8421748/8421700, Xalapa, Veracruz, Mxico. E-mail:
anabel@gmail.com. Dra. en Ecologa y manejo de recursos naturales, Perfil PROMEP:
2009 a la fecha.
5
Universidad Veracruzana, Circuito Gonzalo Aguirre Beltrn s/n, Zona Universitaria, C.P.
91090, Tel. Fax (228)8421748/8421700, Xalapa, Veracruz, Mxico. E-mail:
joako81@hotmail.com. Maestro en Ciencias en Desarrollo Rural Sustentable. Nuevo PTC
PROMEP 2012.

Resumen
1. En Mxico, el aprovechamiento forestal de reas Naturales Protegidas, est
regulado por la Ley General de Desarrollo Forestal Sustentable, LGDFS (2003), y
restringido a cortas de saneamiento, y limpia de materiales combustibles para la
prevencin de plagas e incendios. En Veracruz, la reserva de San Juan del Monte,
estuvo bajo aprovechamiento forestal del 2003-2010, bajo el Mtodo de
Desarrollo Silvcola, con el fin de combatir la presencia de Dendroctonus spp.
2. El objetivo fue evaluar el post-aprovechamiento, la condicin sanitaria y
dasomtrica del bosque en la reserva de San Juan del Monte, Veracruz.
3. El levantamiento dasomtrico se realiz en cinco rodales mediante un muestreo
sistemtico estratificado. Se establecieron sitios circulares de 1000 m2, para cubrir
el 3% de la superficie de cada rodal.

78
El Agro Veracruzano 2015

4. Los resultados evidencian un cambio en la estructura horizontal y vertical del


bosque. La mayora de los individuos de P. patula, P. teocote y P. pseudostrobus
son codominantes, de ligeramente torcidos a torcidos, con dimetros entre 10 y 15
cm; y alturas 10 m. El rea basal y volumen residual fueron afectados por la
corta selectiva. La regeneracin natural es alta y no se registr presencia de
descortezadores.
5. El aprovechamiento forestal fue selectivo, dirigido a los rboles fenotpicamente
superiores y no se regul la regeneracin natural. Los resultados obtenidos, podrn
ser considerados en la toma de decisiones para la elaboracin de futuros
programas de manejo forestal para la Reserva.
Palabras clave: Bosque de conferas, reserva natural, evaluacin post-aprovechamiento
forestal.

Abstract
1. In Mexico, the logging of protected areas is regulated by the LGDFS, and
restricted to harvesting sanitation, and cleaning of combustible materials to
prevent pests and fire. At Veracruz, the reserve of San Juan del Monte, was under
logging from 2003-2010 by the Forestry Development Method, in order to combat
the presence of Dendroctonus spp.
2. The objective of the investigation was the post-harvesting evaluation as well as the
forest health and dasometric condition at San Juan del Monte protected area.
3. Dasometric survey was conducted at five stands by stratified systematic sampling.
1000 m2 circular sites were established to include 3% of each stand surface.
4. The results show a change in the horizontal and vertical structure of the forest.
Most individuals of P. patula, P. teocote and P. pseudostrobus are codominant,
slightly crooked to crooked, and with diameters between 10 and 15 cm; and
heights 10 m. The residual basal area and the remaining volume were affected by
selective cutting. The natural regeneration is high and no presence of bark beetle
was recorded.
5. The forest harvesting programme was selective, addressed to phenotypically
superior trees and natural regeneration was not regulated.
Keywords: Conifer forest, natural reserve, forest post-harvest assessment.

Introduccin
Los ecosistemas forestales pueden ser afectados en la composicin de sus especies,
estructura, dinmica y funcionamiento cuando son manejados, ms aun cuando el
aprovechamiento forestal es centrado en un slo recurso como la madera y en unas
pocas especies de inters comercial (Chapela, 2012).
La evaluacin post-aprovechamiento es bsica en sistemas de aprovechamiento
selectivo, para reformular los tratamientos silviculturales y reorientar las prcticas
de manejo forestal. Cuidar que los volmenes que se extrajeron no sobrepasen los
79
El Agro Veracruzano 2015

lmites aceptables de sostenibilidad, es importante para disear medidas correctivas


y de mitigacin pertinentes (Manzanero y Pinelo, 2004).
En Mxico, el manejo forestal en reas Naturales Protegidas est regulado por los
artculos 121 y 124 de la Ley General de Desarrollo Forestal Sustentable (LGDFS,
2003), y est limitado a trabajos de saneamiento para combatir plagas y
enfermedades forestales y de limpia de materiales combustibles para prevenir
incendios (LGDFS, 2003), y los ingresos que se obtengan sern dirigidos a trabajos
de preservacin, conservacin, cuidado y restauracin de los recursos naturales
(LGEEPA, 2012).
En el rea Natural Protegida de San Juan del Monte (SJM), Municipio de Las
Vigas de Ramrez, Veracruz, del 2003 y hasta el 2010 con el objetivo de sanear y
combatir la presencia de Dendroctonus sp., se ejecut el programa de manejo
forestal bajo el Mtodo de Desarrollo Silvcola (MDS), para la extraccin de 23
958.43 m3 de madera de pino e ilite (Los Pinos A. C., 2003).
El MDS represent un avance importante en la silvicultura de nuestro pas, no
obstante su aplicacin generalizada a todo tipo de ecosistema a tenido
consecuencias en la estructura de los bosques, ya que es un mtodo intensivo y
comercial, contradiciendo el objetivo del programa de manejo forestal en cual se
mencion que ser un saneamiento (Jardel, 2012). Por tales motivos, diversos
autores sealan que en el manejo de reas forestales importantes se requiere
evaluar la dinmica del bosque antes y despus del aprovechamiento forestal, en
aspectos tales como la regeneracin natural, el crecimiento de la masa forestal, la
sanidad y los tratamientos silviculturales aplicados. Por lo tanto las evaluaciones
son importantes ya que permiten tomar nuevas decisiones para reorientar las
prcticas de manejo forestal sostenible (Jackson et al., 2000; Lozada y Arends,
2000; Toledo et al., 2001; Manzanero y Pinelo, 2004).
Por lo antes expuesto, resulta pertinente evaluar la condicin del bosque en la
reserva de San Juan del Monte post-aprovechamiento forestal, a fin de analizar los
probables impactos ecolgicos que haya provocado dicha intervencin. Los
resultados que se obtengan, podran ser considerados en la toma de decisiones para
la elaboracin de futuros programas de manejo forestal para la Reserva.

Materiales y mtodos
La Reserva de San Juan del Monte se localiza en el municipio de Las Vigas de
Ramrez, Veracruz, con un rango altitudinal que va desde de los 2 327 a 2 600
msnm. La superficie es de 584 - 62 - 52 hectreas. La vegetacin est representada
por asociaciones de pinos (P. teocote, P. patula, P. montezumae, P. ayacahuite, P.
pseudostrobus), especies hojosas (Alnus jorullensis, Arbutus xalapensis) y diversos
encinos (Quercus spp.), (Los Pinos A. C., 2003).
80
El Agro Veracruzano 2015

En sta reserva del 2003 y hasta el 2010 se ejecut el programa de manejo forestal
bajo el Mtodo de Desarrollo Silvcola (MDS), con el objetivo de sanear y
combatir la presencia de Dendroctonus sp. En ste periodo se extrajeron 23 958.43
m3 de madera de pino e ilite (Los Pinos A. C., 2003). El programa fue autorizado
por la Secretara de Medio Ambiente y Recursos Naturales (SEMARNAT) a
solicitud de la Secretara de Desarrollo Regional (SEDERE), quien adquiri los
servicios del Despacho Los Pinos A. C. para elaborar y ejecutar dicho programa
(SEDESMA, 2009).
Con el fin de evaluar el aprovechamiento de la Reserva se seleccionaron cinco
rodales donde se aplicaron diferentes tratamientos silvcolas (Tabla 1). El
levantamiento dasomtrico se hizo en el 3% de la superficie de cada rodal
mediante un muestreo sistemtico en sitios circulares de 1000 m2 (radio de 17.84
m), (Romahn et al., 1994).

Tabla 1. Caractersticas de los Rodales muestreados.

Rodal Tratamiento Superficie Superficie No. Sitios


Silvicultural (ha) muestreada muestreados
(ha)
III Corta de regeneracin 18 0.54 6
VI Corta selectiva 14.10 0.42 4
VIII Corta de liberacin 15 0.45 5
X Tercer aclareo 8.5 0.25 3
XII Corta de liberacin 21.50 0.65 7

Las variables dasomtricas se registraron por gnero en arbolado con dimetro


normal 10 cm. La altura total del rbol se midi con clinmetro marca Suunto y
el dimetro a la altura del pecho (DAP = 1.30m) con cinta mtrica. El tiempo de
paso se determin en una viruta de 5 cm, extrada con el taladro de Pressler en 3 a
4 rboles por rodal con DAP 20 cm, sellando los orificios con cera de Campeche
para evitar que llegue alguna plaga (Klepac, 1983). Se tom en cuenta la
regeneracin natural contando el nmero de rboles con dimetro <10 cm.
Para la estructura vertical los rboles se evaluaron visualmente tomando como
referencia la posicin de la copa de los rboles caracterizados dasomtricamente.
Se clasificaron en 4 categoras (Tabla 2).

81
El Agro Veracruzano 2015

Tabla 2. Estructura vertical del bosque segn la posicin de la copa.

Categora Caractersticas
Dominantes Individuos cuya copa est totalmente expuesta y libre de competencia lateral.

Codominantes Individuos que tienen la copa totalmente expuesta a la luz vertical, pero se
encuentran adyacentes a otras de igual o mayor altura que impiden la luz
lateral.

Bajo el dosel La copa recibe luz superior en forma parcial ya que son sombreados
parcialmente por otras copas.
Suprimidos La copa se encuentra totalmente sombreada tanto vertical como lateralmente.

Para determinar la calidad fenotpica del arbolado remanente se evalo forma de


fuste de acuerdo a las categoras establecidas por Quirs (1988), (Tabla 3).

Tabla 3. Categoras de forma de fuste.

Categora Recto Ligeramente Torcido Bifurcado


torcido

Valoracin
visual

Fuente: Salazar y Boshier (1989)

Para el estado sanitario, se evalo el color de la acculas para identificar la


presencia o ausencia de Dendroctonus mexicanus (Cibrin et al., 1995).
El anlisis de la estructura horizontal se hizo por clases diamtricas (CD) de 5 cm
y clases de altura de 5 m, considerando slo al gnero Pinus. Se estim: rea

82
El Agro Veracruzano 2015

basal/gnero (m2) y hectrea (m2/ha), volumen con corteza/sitio (Vm3rta/sitio de


inventario) y hectrea (Vm3rta/ha), con las ecuaciones de volumen validadas por el
INIFAP (Borja, 2012) y teniendo en cuenta la especie ms representativa de cada
rodal:
Pinus patula (R: III, VI y VIII - 80 a 100%): V= 0.08885655 - 0.536223981 * D +
0.390316182 * D2 * A
Pinus pseudostrobus (R X - 90%): V = -0.0823754652 * D + 0.3504136412 * D 2 * A
Pinus teocote (R XII - 78%): V = 0.448675931 * D2 * A
Donde: V = Volumen en metros cbicos con corteza. D = Dimetro normal en centmetros.
A = Altura total en metros.
Incremento Corriente Anual (ICA m3vta):

Donde: ICA = Incremento Corriente Anual. ER (HA) = Existencias reales en una hectrea.
TP = tiempo de paso. DN = Dimetro Normal.

La regeneracin natural se report en nmero promedio de rboles por hectrea.


Para la estructura vertical se report por nmero de rboles de acuerdo con las
categoras establecidas. Para las causas de remanencia y estado sanitario, se
report el nmero de rboles por sitio de acuerdo con las valoraciones de
remanencia y estado sanitario correspondientes.

Resultados
En los rodales se identific la presencia de: Pinus patula, P. pseudostrobus, P.
teocote, Cupresus sp., y Abies sp. Latifoliadas: Arbutus xalapensis (madroo),
Quercus sp., y Alnus sp (Tabla 2). La abundancia relativa promedio observada fue:
P. patula 80% (R: III, VI y VIII); P. pseudostrobus 90% (R X) y P. teocote 78%
(R XII) (Tabla 4).
Tabla 4. Abundancia de Pinus por especie/rodal y densidad por sitio.

Rodal Sup No. De P. P. P. Densidad


(ha) individuos/sitio Patula Pseudostrobus Teocote No./ha

III 18 356 310 46 0 590


VI 14.1 64 59 4 1 160
VIII 15 138 110 20 8 280
1X 8.5 155 15 140 0 520
XII 21.5 373 75 7 291 530
Total 1086 569 217 300 ---

83
El Agro Veracruzano 2015

Para las especies de Pinus el dimetro mximo fue 70.6 cm y mnimo 10.03 cm;
altura mxima 27 m y mnima 5.0 m. Las CD de 10 y 15 cm agrupan 739
individuos (68%). La mayora de los rboles con CD de 20 a 35 cm. se encuentran
en los rodales III, VIII y X (101, 67 y 53 respectivamente). En todos los rodales se
tienen rboles con dimetro 40 cm: mnimo 1 (R XII); mximo 19 (R X) (Fig. 1).
En las clases de 5 y 10 m de altura estn distribuidos 920 individuos (Fig. 2).

Figura 1. Categoras diamtricas del gnero Pinus en la Reserva de San Juan del
Monte, Veracruz.

En el anlisis de rea basal y existencias volumtricas se excluy a Abies sp y


Cupresus sp. del grupo de las conferas. El AB m2promedio/sitio es mayor a 5 m2
en cuatro rodales (III, VIII, X y XII). Tambin el volumen residual result mayor a
100 m3rta/ha en cuatro rodales (III, VI, VIII, y X) (Tabla 5).
En los rodales III, VIII y X se observa una mejor condicin del bosque, ya que su
AB m2 est dada principalmente por los rboles de las CD entre 20 y 35 cm. En
cambio el volumen residual de los rodales III, VI y X est dado por el nmero de
rboles de las CD ms bajas. El tiempo de paso se increment post-
aprovechamiento (R III y XII), lo que significa que los rboles tardarn de 3 a 4.5
aos ms para pasar a la siguiente clase diamtrica. En contraste para los rodales
VI, VIII y X el tiempo de paso disminuy (2, 0.5 y 4.5 aos respectivamente). El
ICA m3rta es superior al reportado en el Programa de Manejo, excepto para el
rodal XII (Tabla 6).
84
El Agro Veracruzano 2015

Figura 2. Categoras de altura del gnero Pinus en la reserva de San Juan del
Monte, Veracruz.

Tabla 5. rea basal y existencias volumtricas en los rodales muestreados.

Rodal Sup. rea Basal rea Volumen Volumen


(Ha) Promedio/Sitio Basal (m3rta/ha) (m3rta/Rodal)
(m2) (m2/ha)

III 8.84 8.70 87.08 141.71 1252.79


VI 14.1 3.63 36.28 107.99 1522.71

VIII 15 5.65 56.58 127.72 1915.92

X 5 8.92 89.17 162.37 811.90

XII 21.5 6.28 62.80 56.32 1211.04

Al considerar el crecimiento real en dimetro (cm), a partir de la intervencin


(T.I.), se observan crecimientos equivalentes a casi 1 cm/ao (R VI y X). El
incremento en dimetro vari de aproximadamente 0.26 cm/ao (R XII) a 0.50
cm/ao (R III, y VIII). La regeneracin natural es alta, misma que se encuentra
suprimida, dbil y doblada por la altura (R III, VI y XII). El gnero con mayor
abundancia es Pinus spp., seguido por Prunus sp., y Alnus sp. (Ver Tabla 7).
85
El Agro Veracruzano 2015

Tabla 6. Tiempo de paso e Incremento Corriente Anual (ICA).

Rodal T.p. (aos) Icam3rta T. I. Crd (cm)


(aos)
2003* 2012 2003* 2012

III 9.3 12 02.2 2.17 4 2.38


VI 7.5 5.5 02.3 5.36 7 6.68

VIII 7.5 7 03.0 4.51 7 4.84

X 9.5 5 03.0 7.14 3 2.98

XII 12 16.5 02.0 0.52 10 2.61

T.P. = Tiempo de paso (aos); ICA=Incremento Corriente Anual; T.I=Tiempo transcurrido desde la
intervencin; CRd=Crecimiento real en dimetro; *datos de Tiempo de paso e ICA reportados en el
Programa de Manejo.

Tabla 7. Abundancia absoluta de la regeneracin natural/hectrea.

Rodal Pinus spp. Prunus sp. Alnus sp. Cupresus sp. Abies sp.

III 2351 180 100 0 0


VI 4585 0 85 0 10

VIII 204 10 40 0 0

X 340 330 50 20 0

XII 1130 10 10 0 0

En la estructura del bosque los rboles dominantes slo contribuyen con un poco
ms de la cuarta parte (Fig. 3), lo que es correspondiente de acuerdo al nmero
elevado de individuos dentro de las categoras ms pequeas de dimetro y altura.

86
El Agro Veracruzano 2015

Figura 3. Estructura vertical del bosque de la Reserva de San Juan del Monte

De acuerdo a la valoracin de forma de fuste el 49% de los individuos se


encuentran en las categoras de ligeramente torcido, torcido y bifurcado (Fig. 4).

Figura 4. Nmero de individuos por categora de forma de fuste en conferas.

87
El Agro Veracruzano 2015

Durante el muestreo realizado en los cinco rodales no se advirti presencia de


descortezadores, pero en el recorrido para ubicar los rodales se observ un rbol
con sntomas que indican la posible presencia de Dendroctonus sp.
Discusin
Los resultados muestran un cambio en la estructura horizontal posterior al
aprovechamiento forestal. De acuerdo al inventario del programa de manejo de la
reserva, el dimetro normal promedio de los cinco rodales era de 20 a 46 cm, con
alturas de 10 a 22 m (R-VIII y III, respectivamente). Esto indica que el bosque
corresponda a joven fustal ( normal entre 20 y 35 cm) y fustal medio ( normal
entre 35 y 50 cm) (Burschel y Huss, 1987). El bosque actual tiene forma de J-
invertida, con un gran nmero de individuos en las tres primeras categoras
diamtricas ( normal de 5 cm a 20 cm), y corresponde al estado de bajo latizal (
normal inferior a 10 cm) y alto latizal ( normal entre 10 y 20 cm).
Este tipo de estructura nos indica un rodal incoetneo completo, donde existen
todas las clases de edad, desde la ms joven hasta la edad del turno (Muslem y
Fierros, 1996). La forma de J-invertida es caracterstica de rodales intervenidos
mediante los mtodos de seleccin y de un bosque en un estado de sucesin
avanzada (Louman et al., 2001; Manzanero y Pinelo, 2004). Desde el punto de
vista econmico hay una prdida de valor maderero en la productividad y
crecimiento del bosque (Pinazo y Gasparri, 2003). Es decir, no hay disponibilidad
de recursos forestales suficientes de las medidas comerciales ( normal 25 cm)
requeridas por el mercado.

Conclusiones

De acuerdo con las dimensiones dasomtricas registradas, la estructura del bosque


muestra una forma de J-invertida y corresponde a un bajo latizal ( normal 10
cm) y alto latizal (entre 10 y 20 cm). El bosque de la reserva muestra una prdida
en su productividad (rea basal m2 y volumen m3) y un incremento en el tiempo de
paso. No se regul la densidad de la regeneracin natural. El estado fitosanitario
del bosque es bueno, sin embargo an persiste el riesgo de la presencia de
Dendroctonus mexicanus.

Literatura Citada
Chapela, M. F., 2012. Escenario para el Manejo Forestal Sostenible en Mxico. En:
Chapela, M. F. (Coordinador). Estado de los bosques de Mxico. Consejo Civil
Mexicano para la Silvicultura Sostenible, A.C. Mxico, D. F. 217 pp.

88
El Agro Veracruzano 2015

Cibrin, T. D., T. M. Montiel, B. R. Campos, H.O. Yates III, y L. J. Flores, 1995. Insectos
Forestales de Mxico. Universidad Autnoma de Chapingo, SARH Subsecretara
Forestal y de Fauna Silvestre, USDA Forest Service, Natural Resources, Canada,
Comisin Forestal de Amrica del Norte. Chapingo, Mxico, 453 pp.
Borja, L. G. 2012. Programa de Manejo Forestal Nivel Intermedio para el Predio Ejido
Justo Sierra, Perote, Veracruz. Documento Personal.
Burschel, Peter y J. Huss, 1987. Grundriss des Waldbaus. Verlag Paul Parey, Hamburg.
352 pp.
Jackson, S. M., T. S. Fredericksen, y J. R. Malcolm, 2000. Evaluacin de los disturbios y
daos causados al bosque residual durante el aprovechamiento por seleccin en
un bosque tropical de Bolivia. BOLFOR. Santa Cruz, Bolivia, 26 pp.
Jardel, E, J., 2012. El manejo forestal en Mxico: estado actual y perspectivas. En:
Chapela, M. F. (Coordinador). Estado de los bosques de Mxico. Consejo Civil
Mexicano de Silvicultura Sostenible, A. C. Mxico, D. F. 217 pp.
Klepac, D., 1983. Crecimiento e incremento de rboles y masas forestales. Universidad
Autonma de Chapingo. Chapingo, Mxico, 279 pp.
Ley General de Desarrollo Forestal Sustentable (LGDFS). 2003.
Ley General de Desarrollo Forestal Sustentable (LGDFS). 2003. Reglamento.
Ley General de Equilibrio Ecolgico y Proteccin al Ambiente (LGEEPA). 2012.
Los Pinos A. C. (Despacho Forestal), 2003. Programa de Manejo Forestal. Reserva San
Juan del Monte. Perote, Ver. 25 pp.
Louman, B., J. Valerio, y W. Jimnez, 2001. Bases ecolgicas para la silvicultura. En:
Fredericksen, T., Contreras, F., y Pariona, W., (eds). Gua de silvicultura de para
bosques tropicales de Bolivia. BOLFOR. Santa Cruz, Bolivia, 81 pp.
Lozada, J. R., y E. Arends, 2000. Impacto de diferentes intensidades de aprovechamiento
forestal sobre la masa remanente, en la estacin experimental Caparo. Forestal
Venezolana, 44(1): 73-80.
Manzanero, M., y G. Pinelo, 2004. Plan silvicultural en unidades de manejo forestal. San
Francisco de Dos Ros, Costa Rica, 49 pp.
Muslem, A., y G. M. Fierros, 1996. Curso de silvicultura de bosques naturales.
Universidad Autnoma de Chapingo. Chapingo, Mxico, 80 pp.
Pinazo, A. M., y N. I. Gasparri, 2003. Cambios estructurales causados por el
aprovechamiento selectivo en el bosque montano del norte de Salta, Argentina.
Ecologa Austral, 13(2):160-172.
Quirs, H. R., 1988. Seleccin de rodales semilleros de ciprs (Cupressus lusitanica Mill)
en el valle central, Costa Rica. Tesis de Licenciatura. Universidad Nacional.
Heredia, Costa Rica, 83 pp.
Romahn, V. F., R. H. Maldonado, y G. L. Trevio, 1994. Dendrometra. Universidad
Autnoma de Chapingo. Chapingo, Mxico, 354 pp.
Salazar, R., y D. Boshier, 1989. Establecimiento y manejo de rodales semilleros de
especies prioritarios en Amrica Central. Turrialba, C.R.: Centro Agronmico
Tropical de Investigacin y Enseanza (CATIE). Programa de Produccin y
Desarrollo Agropecuario Sostenido. Serie Tcnica. Informe Tcnico No. 148, 80
pp.

89
El Agro Veracruzano 2015

SEDESMA (Secretara de Desarrollo Social y Medio Ambiente). 2009. Espacios Naturales


Protegidos del Estado de Veracruz. Coordinacin General de Medio Ambiente
(CGMA). Documento Interno, 4 pp.
Toledo, M., T. Fredericksen, J. C. Licona, y B. Mostacedo, 2001. Impactos del
aprovechamiento forestal en la flora de un bosque semideciduo pluviestacional de
Bolivia. BOLFOR. Santa Cruz, Bolivia, 29 pp.

90
El Agro Veracruzano 2015

7
CONSERVACIN DE LA BIODIVERSIDAD EN BOSQUES ALTERADOS
Y REFORESTADOS

Felipe de Jess Ortega Hernndez1, Ana Isabel Surez Guerrero2, Celia Cecilia
Acosta Hernndez3, Andrs Rivera Fernndez4
1
Facultad de Biologa. Universidad Veracruzana, felipe_02052@hotmail.com. Bilogo.
2
Facultad de Ciencias Agrcolas-Xalapa. Universidad Veracruzana, asuarez@uv.mx
Doctora en Ecologa y Manejo de Recursos Naturales. Profesor de Tiempo Completo
Titular C, Integrante del Cuerpo Acadmico Biotica y Conservacin de los Recursos
Naturales dentro de la Lnea de Generacin y Aplicacin del Conocimiento del mismo
nombre, con perfil PROMEP.
3
Facultad de Biologa-Xalapa. Universidad Veracruzana. ceacosta@uv.mx Doctora en
Ciencias en Ecologa y Biotecnologa. Profesor de Tiempo Completo Titular C, Integrante
del Cuerpo Acadmico Biotica y Conservacin de los Recursos Naturales dentro de la
Lnea de Generacin y Aplicacin del Conocimiento del mismo nombre, con perfil
PROMEP.
4
Facultad de Ciencias Agrcolas-Xalapa, Universidad Veracruzana, arivera@uv.mx
Doctor en Ciencias en Ecologa y Biotecnologa. Profesor de Tiempo Completo Titular C,
Integrante del Cuerpo Acadmico Biotica y Conservacin de los Recursos Naturales
dentro de la Lnea de Generacin y Aplicacin del Conocimiento del mismo nombre, con
perfil PROMEP.

Resumen
1. La mayora de los proyectos de reforestacin en nuestro Estado se realizan con
pocas (2 o 3) especies nativas a pesar de la poltica oficial. Por otro lado, siguen
desapareciendo los bosques originales por la expansin urbana y ganadera.
Pequeos parches de vegetacin original y secundaria se alternan en extensas
reas de pastizales y cultivos agrcolas y algunas pocas reforestadas, lo que puede
comprometer la conservacin de la biodiversidad.
2. Con el propsito de analizar el potencial de conservacin de bosques alterados
(por la tala selectiva y pastoreo), respecto a reforestados, se compararon sus
estructuras, composicin y diversidad arbrea, arbustiva y herbcea en la regin
montaosa del centro de Veracruz, en Coyopolan, Ixhuacn.
3. En cada tipo de bosque (alterado o reforestado) se establecieron 5 cuadrantes de
100 m2 en los que se muestrearon todos los rboles; arbustos y hierbas en cuadros
91
El Agro Veracruzano 2015

de 16 m2 y 1 m2, respectivamente, dentro de los cuadrantes. Se registraron las


especies y alturas (clinmetro o flexmetro); en rboles, DAP; en arbustos, rea
de la copa (flexmetro); y cobertura de las hierbas con un bastidor de hilos
(abertura de 25 cm2).
4. Ambos bosques presentaron un dimetro y altura (20.5 2 m; 22 5 cm)
similares a los de bosques mesfilos en sucesin intermedia (30 aos). Los
arbustos y hierbas son sumamente escasos en ambos bosques, y de mayor tamao
en el bosque reforestado. En ninguno se registr la regeneracin de las especies
del dosel. La composicin es muy distinta en los bosques comparados; la riqueza
arbrea de especies de sitios alterados triplica la de sitios reforestados.
5. La evidencia encontrada sugiere que para una mayor eficiencia en la conservacin
de la diversidad es crucial el mantenimiento de fragmentos alterados y la
exclusin del ganado, a la par de la reforestacin para provisin de lea, madera y
servicios ambientales.
Palabras clave: Bosque mesfilo de montaa, estructura de la comunidad, composicin
florstica

Abstract
1. In spite of official policies the majority of reforestation projects in our State sow
only few (2 or 3) native tree species. At the same time deforestation continues on
forest lands due to urban and pasture growth. Very small patches of secondary and
mature vegetation alternate among extensive grassland, and agriculture and
reforested areas, which could severely endanger biodiversity conservation.
2. With the aim to compare the conservation potential of altered (due to selective cut
and pasture areas expantion) vs reforested forests, vegetation structure, plant
species composition and trees, shrubs and herbs diversity and density were
analysed at two sites on the mountainous region of central Veracruz, at Coyopolan
region, Ixhuacan.
3. At each type of forest 5 sample areas of 10 x 10 m (100 m2) were established; all
the tree, shrub and herb species were registered, the last two on sample areas of 4
and 1 m2, correspondingly. Species identity, heights and breast height diameters
(BHD) were recorded with clinometer and flexometer; shrubs crown area were
calculated on the basis of the measure of the largest orthogonal diameters
(assuming an elliptic form). Cover percentage of herbs was measured with a 100
cm2 thread frame (opening of 25 cm2).
4. Both forests showed diameters and heighs (20.5 2 m; 22 5 cm) similar to
intermediate stages of secondary cloud forests (30 year old). Shrubs and herbs are
scarce on both forests, and higher in the reforested one. In none of the sites canopy
tree regeneration was found. Species composition of altered sites is three times
bigger than in the reforested one.
5. Evidence suggests that towards the most effective conservation of plant diversity
the maintenance of altered fragments should be guaranteed, as well as cattle
exclusion. Simultaneously dendroenergetic and forest plantations must be
established to provide wood, firewood and environmental services.
92
El Agro Veracruzano 2015

Keywords: Cloud forest, community structure, floristic composition.

Introduccin
La caracterizacin de la estructura en ecosistemas forestales constituye una
condicin bsica para la toma de decisiones sobre el manejo de sus recursos. Su
adecuado conocimiento es necesario para garantizar una gestin apropiada (Corral
et al., 2005). Lo anterior, tanto en sitios reforestados, como en reas drsticamente
impactadas por actividades antropognicas, en las que pueden observarse procesos
de sucesin natural en un lapso acotado.
El mantenimiento y conservacin de los pocos fragmentos de vegetacin original
de bosque mesfilo de montaa (BMM) se perfilan como medidas de suma
importancia, en virtud de la reunin de condiciones nicas que favorecen la
coexistencia de flora de afinidad nertica y neotropical, en su mayora exclusivas a
estos ecosistemas (Williams-Linera et al., 2002). Evidencia preliminar (Surez-
Guerrero, en preparacin) sugiere que remanentes muy alterados de bosque
mesfilo pueden albergar una mayor riqueza de especies de macrofauna del suelo,
de epfitas, de aves, reptiles y anfibios, que los reforestados. La conservacin de
sitios alterados de bosque, ligada a una restauracin ecolgica (y enriquecimiento
de especies), se perfila como una alternativa que podra revertir o mitigar las
alteraciones emulando la estructura, funcin, diversidad y dinmica del ecosistema
(Ramrez Marcial et al., 2012).
Por otro lado, el BMM en Mxico es uno de los ecosistemas mayormente
amenazados, debido a su fragilidad al ser transformados (Arriaga, 2000; Toledo,
2009). Los suelos en que se reduce la cobertura arbrea tienen una alta
probabilidad de erosionarse, ya que la mayora de los fragmentos remanentes de
estos bosques se encuentran en laderas pronunciadas. Por otro lado, Arriaga (2000)
estim que su recuperacin podra tardar cerca de 150 aos, en localidades donde
se retir la vegetacin para realizar actividades agropecuarias. Muz-Castro et al.
(2006) determinaron en pastizales abandonados, adyacentes a fragmentos de
bosque, que la estructura de la vegetacin (respecto a la del bosque maduro) puede
recuperarse en un periodo ms corto, de entre 40 y 50 aos. Otros autores,
mediante modelacin de varios escenarios de extraccin de lea de baja intensidad,
estimaron que el rea basal podra estabilizarse en un lapso de entre 80 y 90 aos, a
partir de reas denudadas (Rger et al., 2007). La comunidad de
macroinvertebrados, as como las funciones ecosistmicas del sistema suelo,
podran recuperarse en cerca de 100 aos, que es un tiempo mayor que el que se
llevara la restitucin de la composicin de la comunidad arbrea (Negrete-
Yankelevich et al., 2007).

93
El Agro Veracruzano 2015

Entre las medidas que se han tomado para la conservacin y recuperacin de estos
bosques estn la reforestacin y la restauracin. La primera tiene como propsito
la recuperacin de la cubierta vegetal con el fin de mantener los servicios
ambientales que presta, entre los que se cuentan la captura de CO2, la recarga de
mantos acuferos, la retencin del suelo y la fertilidad, entre otros. Sin embargo,
estas medidas no consideran como prioridad la restitucin de la diversidad, aunque
las recomendaciones oficiales indican que las reforestaciones deben hacerse con
especies nativas (CONAFOR, 2010). Por otro lado, la restauracin (sensu
CONAFOR, 2009) enfatiza el establecimiento de especies leosas nativas, as
como la ejecucin paralela de medidas de conservacin de suelos (acomodo de
material muerto o barrera de piedras en curvas a nivel, excavacin de zanjas
trincheras, terrazas de muro vivo, etc.). En los proyectos de restauracin o
reforestacin la diversidad de especies debe ser amplia, ya que las plantas que se
encuentran por debajo de los rboles, en ocasiones dependen de aquellas especies
arbreas que crean las condiciones adecuadas para su establecimiento,
incrementando con ello la probabilidad de que la regeneracin del bosque sea lo
ms parecido a un ecosistema original (Surez Guerrero y Equihua, 2005).
En la realidad los proyectos de restauracin apoyados por CONAFOR (Comisin
Nacional Forestal) pocas veces incluyen el establecimiento de ms de cuatro
especies. Incluso, en los viveros forestales y particulares que abastecen dichos
proyectos se propagan escasas especies del bosque mesfilo, notablemente,
Liquidambar macrophylla, Quercus spp., Juglans pyriformis, Platanus mexicana y
Carpinus carolineana; rara vez Ulmus mexicana, Magnolia spp., Clethra spp.,
entre muchas otras. Lo anterior obedece a que hay un escaso conocimiento del
manejo de las especies, o no se encuentran disponibles (Wightman y Santiago,
2003). No obstante, se ha sealado que la recuperacin del bosque es ms exitosa
donde se han establecido ensambles de numerosas especies (n=10) (Surez y
Equihua, 2005).
Es as que las obras de restauracin rara vez incluyen ms de cuatro especies,
dando lugar a bosques casi monoespecficos. Esta situacin se agrava en las reas
reforestadas que se encuentran aisladas y muy distantes de los bosques originales,
que podran aportar propgulos que se dispersen a las zonas restauradas (Muiz-
Castro et al., 2006). Aunado a lo anterior son escasos los reportes que den
seguimiento a los procesos de sucesin y recuperacin de la estructura en las reas
restauradas (Hernndez-Salas, 2001 y Fernndez-Prez et al., 2013, en bosque de
pino encino; Corral-Rivas et al., 2002 y 2005, en BMM), por lo que casi se
desconoce el destino de la diversidad. Sin embargo, se ha sugerido que la
reforestacin no est favoreciendo en su totalidad a la regeneracin del bosque
(Zamora et al., 2001), ni a la reposicin de su diversidad. Algunos remanentes de

94
El Agro Veracruzano 2015

bosque, aun cuando han sido drsticamente impactados, pueden mostrar una mayor
integridad bitica que los sitios reforestados.
El presente estudio tiene como propsito la comparacin de la estructura y la
composicin florstica de dos reas boscosas en el rea de distribucin del BMM,
una de ellas es un bosque muy alterado por el pastoreo y disposicin para lea de
rboles secos; el otro es una reforestacin de 30 aos con Liquidambar
macrophylla.

Materiales y mtodos
reas de trabajo. El rea de distribucin de BMM se encuentra entre 1,200 a
2,100 msnm en lomeros con suelos volcnicos en una gran heterogeneidad
topogrfica y ambiental. Esta heterogeneidad ha favorecido que se presenten
considerables diferencias en la composicin y estructura entre fragmentos
relativamente cercanos (Garca et al., 2008). En el centro de Veracruz el BMM
est representado por remanentes (fragmentos) inmersos en un paisaje compuesto
por una matriz de campos agrcolas, potreros, cafetales y asentamientos humanos
(Williams-Linera, 1993). Su fragmentacin puede afectar la diversidad de especies
ya que sta est directamente asociada al tamao del fragmento y a la distancia del
bosque continuo (MacArthur y Wilson, 1967; Muiz-Castro et al., 2006; Gonzlez
Espinosa et al., 2008). Dentro de estos remanentes o fragmentos las alteraciones
pueden ocurrir a diferentes escalas e intensidades, en funcin del tamao del rea
considerada, ya que alteraciones naturales y antrpicas suceden con mayor
frecuencia que en un bosque continuo (Williams-Linera, 2007).
Los bosques en las dos reas de estudio se encuentran en la regin de Coyopolan,
enclavada en las estribaciones del Cofre de Perote, en la zona central de Veracruz,
por lo que es una zona de origen volcnico reciente. Se encuentra en la parte
noreste del municipio de Ixhuacn de los Reyes, Veracruz. Es una zona muy
accidentada, montaosa, en cuyo paisaje se alternan fragmentos de bosque
mesfilo, cultivos de subsistencia y reas marginales de pastoreo. La altitud
promedio es de 1600 msnm, con clima semiclido hmedo ((A)C(fm)) con lluvias
todo el ao y precipitacin anual de 1650 mm; andosoles profundos y ricos en
materia orgnica. La regin es relevante para los propsitos del estudio ya que hay
remanentes de bosque alternados con zonas de reforestacin uniespecfica de
Liquidambar, establecidos despus de la degradacin del bosque por la tala,
cultivo agrcola y pastoreo. Los remanentes de bosque estn degradados y
constituyen masas poco diversas dominadas por Clethra o Alnus, rara vez Quercus
spp. (Jimnez et al., 2013).
Coyopolan (bosque alterado) se ubica en una ladera con una pendiente de entre 40
a 60% con orientacin norte y coordenadas: de 1922 00.8N y 960401.5O, a
95
El Agro Veracruzano 2015

1602 msnm. El sitio tiene una superficie de cerca de dos ha. La vegetacin es de
bosque mesfilo de montaa, rodeada de potreros sin proteccin para evitar el paso
de animales. El bosque muestra signos de entresaca selectiva de rboles, ya que se
aprecian tocones de rboles y no hay presencia de encinos, que es la especie ms
apreciada para lea. An cuando el bosque est muy alterado se aprecia una
notable riqueza de especies arbreas, entre las que se encuentran con mayor
abundancia Magnolia dealbata, Clethra mexicana y Hedyosmum mexicanun. La
mayora de los rboles tienen dimetros menores a 35 cm.
Tlalchi (bosque reforestado) se ubica en una ladera de 30 a 50% al oeste del sitio
anterior, con la misma orientacin (norte) y en la ubicacin geogrfica de
192253.5N y 970425.6O. Su extensin es de poco ms de dos ha.
Histricamente el uso de suelo fue bosque mesfilo de montaa, el cual fue
derribado y reforestado con Liquidambar y est cercado por alambre de pas. Esta
especie es muy abundante y el bosque es casi uniespecfico. Los tallos no exceden
los 30 cm de DAP. Al pie de la ladera se encuentra un potrero con animales.
En cada sitio (alterado o reforestado) fueron delimitados cinco cuadrantes de 10
por 10 m (100 m2) en un transecto de banda, siguiendo la curva del mismo nivel,
con una distancia entre cada uno de 10 m. Se censaron todos los rboles dentro del
cuadrante, registrando la especie, el DAP y la altura de cada uno. Los arbustos y
hierbas fueron muestreados en cuadros de 4 y 1 m2, respectivamente, dentro de los
cuadrantes.
Se midieron las alturas (con clinmetro o flexmetro); en rboles: DAP; en
arbustos: rea de la copa (flexmetro); y porcentaje de cobertura de las hierbas con
un bastidor de hilos (abertura de 25 cm2). De forma simultnea se realiz la
recolecta, prensado y secado de ejemplares botnicos de cada especie para su
posterior identificacin con claves y depsito en el herbario XALU de la Facultad
de Biologa (UV) en Xalapa, Ver. Los datos obtenidos en campo se capturaron en
una base de datos en Excel (Microsoft, Office 2007). Se calcularon los valores de
dimetros, alturas, dominancias, densidades y frecuencias, as como el ndice de
Valor de Importancia (IVI) de las arbreas (Bautista et al., 2004). Se aplicaron
sendos ANDEVAs y comparacin de medias para identificar las posibles
diferencias de altura y rea basal arbrea entre los dos sitios, asegurndose que se
cumplieron los supuestos de normalidad y homocedasticidad.

Resultados
Composicin florstica arbrea. Slo una de las 21 especies arbreas registradas
es comn a ambos bosques (Tabla 1). Coyopolan tiene el triple de especies que el
bosque reforestado con menos de la mitad de individuos.

96
El Agro Veracruzano 2015

Todos los gneros estn representados por una sola especie. Las arbustivas y
herbceas presentan una situacin inversa, siendo ms rico el sitio reforestado que
el alterado (Tabla 2). Solamente Selaginella, una Poaceae y una especie
indeterminada ocurren en los dos sitios y no hay ninguna otra especie en comn.
Es notable la prevalescencia de Piper auritum en el reforestado, que es sumamente
abundante y se caracteriza por ocurrir en ambientes degradados.
En la comparacin de aspectos estructurales, la densidad de individuos es mayor
en el bosque reforestado (Tabla 3), salvo por las plntulas y los rboles chicos que,
adems, presentan un riqueza mucho mayor que en el bosque alterado. El rea
basal es consistente con lo anterior ya que los rboles del sitio reforestado casi
duplican la del sitio alterado (F(1,76) = 3.06; p = 0.05).

Tabla 1. Lista florstica y cantidad de individuos arbreos por especie de un bosque


alterado (Coyopolan) y uno reforestado (Tlalchi) en Ixhuacn de los Reyes, Ver.
Especie Coyopolan Tlalchi total
(alterado) (reforestado)
(15 especies) (5 especies) (20 sp.)
ARBOLES
Acacia farnesiana L. 1 1
Clethra mexicana A. DC. 7 5 12
Viburnum microcarpum Cham & Schuldl 1 1
Magnolia dealbata Zucc. 4 4
Laurus nobilis L. 1 1
Styrax glabrescens Benth 1 1
Hedyosmum mexicanun Corden 6 6
Vernonia patens Kunth. 1 1
Telanthophora grandifolia Less. 1 1
Saurauia pedunculata Hook. 1 1
Rhamnus capraeifolia John & Johnston 9 9
Cnidoscolus multilobus Pax. 1 1
Alnus acuminata Kunth 1 1
Palicourea padifolia Taylor & Lorence 1 1
Indeterminada 1 2 2
Liquidambar macrophylla Oerst. 33 33
Quercus sp. 1 1
Indeterminada 2 4 4
Indeterminada 3 1 1
TOTAL de individuos 38 44 81

97
El Agro Veracruzano 2015

Alturas. Ambos bosques presentan una altura similar del dosel, excepto por un
individuo de Acacia farnesiana en el bosque alterado, valor atpico cuyo peso
posiblemente determina la diferencia estadstica (F(1,76) = 13.926; p = 0.00036). La
mayora de las especies en ambos bosques se encuentran concentradas en los
rangos ms pequeos (de 0 a 10 m), y an cuando ambos son bosques intermedios,
es posible que se deba a las presiones a las que han sido sometidos a lo largo de su
desarrollo (fig. 1).

Tabla 2. Lista florstica y cantidad de individuos arbustivos y herbceos por especie


de un bosque alterado (Coyopolan) y uno reforestado (Tlalchi) en Ixhuacn de los
Reyes, Ver.

Familias Coyopolan Tlalchi Total


(alterado) (reforestado)
ARBUSTOS
Flacourtiaceae 13 13
Melastomataceae 2 5 5
Malvaceae 7 7
Indeterminada 1 1 1
Lauraceae 9 9
Piperaceae 42 42
Indeterminada 2 12 12
TOTAL de individuos 23 68 91

HIERBAS
Selaginellaceae 1098 611 1709
Poaceae 97 110 207
Indeterminada 1 68 68
Indeterminada 2 38 38
Indeterminada 3 100 27 127
Indeterminada 4 7 7
Indeterminada 5 9 9
Indeterminada 6 9 9
Total de cobertura 1295 879 2174

ndices estructurales. Notablemente el sitio alterado (Coyopolan) est dominado


por Clethra mexicana, mientras que el reforestado con Liquidambar (Tabla 4).

98
El Agro Veracruzano 2015

Las 3 especies que le siguen en Coyopolan son rboles medianos y sus


importancias, junto con la de Clethra alcanzan poco ms del 70%; en Tlalchi L.
macrophylla sola representa casi 75%. Lo que muestra que la reforestacin con
una sola especie, en este caso L. macrophylla, no ha favorecido a la regeneracin
con nuevas especies arbreas (Tabla 4).

Figura 1. Promedio EE de alturas de rboles en dos bosques (alterado y


reforestado).

Discusin
Es notable que ambos bosques son aproximadamente similares en la mayora de
los atributos estructurales, y diferentes en los aspectos relativos a las especies. Esta
situacin se relaciona particularmente con el manejo a que han sido sometidos.
La conservacin de la biodiversidad vegetal, particularmente de la arbrea, es
mucho ms alta en el bosque alterado, pese a que la mayora de las especies
emblemticas del BMM, notablemente encinos y otras especies tiles
prcticamente han desaparecido por la extraccin selectiva para uso domstico de
lea y construccin. Williams-Linera (1996) ha sealado que la mitad de la
biomasa del BMM es contenida por los encinos, por lo que este bosque realmente
est muy degradado y poco representa a los bosques sin alterar. No obstante, al
compararlo con el bosque reforestado, conserva numerosas especies de la sucesin
intermedia, lo que sugiere que podra albergar ms especies caractersticas del
dosel alto (Garcia et al., 2008) con un manejo restaurativo de enriquecimiento de
especies (Gonzlez-Espinosa et al., 2008) disponibles en algunos viveros
99
El Agro Veracruzano 2015

asociados a centros de investigacin, como el del INECOL (Instituto de Ecologa,


A.C.).

Tabla 3. Riqueza total de especies, densidad y rea basal para las distintas categoras
de tamao de plantas registradas en el bosque alterado (Coyopolan) y el reforestado
(Tlalchi) en Ixhuacn de los Reyes, Ver.

Coyopolan Tlalchi
(Alterado) (Reforestado)
Riqueza
Arboles grandes 3 3
Arboles medianos 4 2
Arboles chicos 10 2
Plntulas 3 4
Arbustos 4 6
Hierbas 3 9
TOTAL 27 26
Densidad (No. ind. ha-1)
Arboles grandes 140 300
Arboles medianos 160 340
Arboles chicos 300 100
Plntulas 160 140
Arbustos 460 1420
Hierbas 300 460
Area Basal (m2 ha-1)
Arboles grandes 8.0 14.6
Arboles medianos 2.5 6.0
Arboles chicos 1.2 0.4
Plntulas 0.1 0.1
Arbustos 937.9 718.3
Hierbas 9457.9 5355.0

Los estratos arbustivos y herbceos de ambos bosques estn muy pobremente


representados, presentan pocas especies, lo cual puede atribuirse a la lejana de los
sitios de reas de bosque prstino de donde podran llegar propgulos (Muiz-
Castro et al., 2006). El bosque reforestado, por su parte, est dominado por la
especie sembrada deliberadamente y en el lapso transcurrido desde su
establecimiento hace 30 aos ha duplicado en rea basal al bosque alterado, y ha
sido exitosa en recuperar la cobertura del sitio y albergar algunas pocas especies
que no se encuentran en sitios deforestados. Esta situacin es comn en las

100
El Agro Veracruzano 2015

reforestaciones, como en el caso de Cupressus lusitanica en los Altos de Chiapas,


que muestra caractersticas estructurales de dominancia, altura y pocas especies
acompaantes (Fernndez-Prez et al., 2013) similares a las del bosque reforestado
de Tlalchi.
Se ha documentado que los aprovechamientos forestales del BMM impactan en un
sentido parecido al de las reforestaciones ya que en ambos se disminuye la
diversidad de especies y se modifica la distribucin espacial de los rboles (Corral-
Rivas et al., 2005), as como la composicin del estrato arbreo (Hernndez-Salas
et al., 2013).

Tabla 4. ndices de valor de importancia de las especies arbreas en ambos bosques,


Especie Coyopolan Coyopolan Tlalchi Tlalchi
(alterado) (alterado) (reforestado) (reforestado)
IVI IVI (%) IVI IVI (%)

Clethra mexicana 111.91 37.3 31.92 10.64


Rhamnus capraeifolia 46.50 15.5
Hedyosmum mexicanum 36.26 12.1
Magnolia dealbata 22.82 7.6
Indeterminada 1 13.35 4.4
Acacia farnesiana 8.49 2.8
Viburnum microcarpum 7.69 2.6
Alnus acuminata 6.84 2.3
Laurus nobillis 6.65 2.2
Telanthoohora grandifolia 6.64 2.2
Styrax glabrescens 6.62 2.2
Saurauia pedunculata 6.57 2.2
Vernonia patens 6.57 2.2
Cnidoscolus multilobus 6.50 2.2
Palicourea paddifolia 6.49 2.2
Liquidambar macrophylla 223.13 74.38
Indeterminada 2 20.40 6.80
Indeterminada 3 12.27 4.09
Quercus sp. 12.27 4.09
Total 300 100 300 100
valores absolutos y porcentajes

101
El Agro Veracruzano 2015

La relevancia de esta investigacin reside en dos aspectos. Incursiona en el poco


abordado seguimiento de la biodiversidad en reas reforestadas que, aunque
cumplen con el propsito de recuperar la cobertura y prestar servicios ambientales,
no se ha considerado su potencial en la conservacin de la biodiversidad, como se
ha explorado, por ejemplo, en cafetales a la sombra (Manson et al., 2008). Por otro
lado, la mayor parte de la literatura analiza remanentes de bosques conservados y
poco se pone atencin a la oportunidad que representan en la conservacin de la
biodiversidad los bosques alterados, si se someten a prcticas de enriquecimiento
de especies y exclusin de ganado.

Conclusiones

La composicin de especies difiere casi totalmente entre ambos bosques, alterado y


reforestado.
La riqueza arbrea del bosque alterado triplica la del bosque reforestado aunque es
sumamente pobre comparada con bosques prstinos, siendo escasos los elementos
caractersticos de la sucesin avanzada.
Ambos bosques presentaron atributos estructurales similares en trminos de altura
y la representacin de especies en los seis estratos analizados; aunque las
densidades arbrea y arbustiva son mucho mayores en el bosque reforestado, lo
mismo que el rea basal arbrea.
Los estratos arbustivos y herbceos de ambos bosques estn muy pobremente
representados.
En el sitio reforestado predomina la especie sembrada Liquidambar con IVI de
cerca del 70%, mientras que la importancia en el sitio alterado se reparte entre 4
especies y slo alcanza poco ms del 70%, el 30% restante se distribuye entre 11
especies arbreas.
Se recomienda documentar los aspectos estructurales, de diversidad y
composicin en otros bosques alterados y reforestados y explorar el impacto de
enriquecimiento con especies nativas. Es fundamental impedir el acceso de ganado
a ambos bosques, as como evitar la entresaca para lea, por lo que puede
promoverse el establecimiento de plantaciones dendroenergticas para abastecer de
lea a la poblacin.

102
El Agro Veracruzano 2015

Literatura Citada
Arriaga, L., 2000. Gap building phase regeneration in a tropical montane cloud forest of
north-eastern Mexico. Journal of Tropical Ecology 16(4):535-562.
Bautista, F., D. Gonzlez, J.L. Palacio y M. Delgado (Eds.)., 2004. Tcnicas de muestreo
para manejadores de recursos naturales. UNAM - UADY - CONACYT - INE.
Mxico. 303-327 pp.
Corral-Rivas, J, O.A. Aguirre-Caldern, J. Jimnez-Prez y J.J. Nvar-Chidez., 2002.
Muestreo de diversidad y observaciones ecolgicas del estrato arbreo del bosque
mesfilo de montaa El Cielo, Tamaulipas, Mxico. Revista Chapingo Series
Ciencias Forestales y del Ambiente, 8(2):125-131.
Corral-Rivas, J, O.A. Aguirre-Caldern, J. Jimnez-Prez y S. Corral., 2005. Un anlisis
del efecto del aprovechamiento forestal sobre la diversidad estructural en el bosque
mesfilo de montaa El Cielo, Tamaulipas, Mxico. Forest Systems, 14(2):217-
228.
CONAFOR (Comisin Nacional Forestal)., 2009. Restauracin de ecosistemas forestales,
gua bsica para comunicadores. CONAFOR. Mxico. 68 pp.
CONAFOR (Comisin Nacional Forestal)., 2010. Prcticas de reforestacin, manual
bsico. CONAFOR. Mxico. 64 pp.
Fernndez-Prez, L., N. Ramrez-Marcial Y M. Gonzlez-Espinosa., 2013. Reforestacin
con Cupressus lusitanica y su influencia en la diversidad del bosque de pino-encino
en los Altos de Chiapas, Mxico. Botanical Sciences, 91(2):207-216.
Garcia, J, G. Castillo-Campos, K. Mehltreter, M.L. Martnez y G. Vzquez., 2008.
Composicin florstica de un bosque mesfilo del centro de Veracruz, Mxico.
Boletn de la Sociedad Botnica de Mxico, 83:37-52.
Gonzlez-Espinosa, M., J.M. Rey-Benayas y N. Ramrez-Marcial (editores). 2008.
Restauracin de bosques en Amrica Latina. Editorial Mundi-Prensa Mxico,
Mxico, D.F., Mxico. 252 pp.
Hernndez-Salas, J., O. Aguirre-Caldern, E. Alans-Rodrguez, J. Jimnez-Prez, Javier,
E.J. Trevio-Garza, M.A.Gonzlez-Tagle, C. Lujn-lvarez, J.M. Olivas-Garca y
L.A. Domnguez-Pereda., 2013. Efecto del manejo forestal en la diversidad y
composicin arbrea de un bosque. Revista Chapingo. Serie Ciencias Forestales y
del Ambiente ,19(2):189-199
Jimnez-Huerta J., A.I. Surez-Guerrero, S. Guzmn, P. Linares, C.C. Acosta Hernndez,
A. Rivera, N. Viveros., 2013. Diagnstico ambiental de la regin de Coyopolan,
Mpio. de Ixhuacn de los Reyes, Veracruz. Reporte tcnico. Facultad de Biologa.
Universidad Veracruzana.
MacArthur, R.H. and E.O.Wilson., 1967. The theory of island biogeography. Princeton,
N.J. Princeton University Press.
Manson R.H., V. Hernndez-Ortiz, S. Gallina y K. Mehltreter (editores)., 2008.
Agroecosistemas cafetaleros de Veracruz: biodiversidad, manejo y conservacin.
Instituto de Ecologa A.C. (INECOL) e Instituto Nacional de Ecologa (INE-
SEMARNAT), Mxico, 348 p.

103
El Agro Veracruzano 2015

Muz-Castro, M.A., G. Williams-Linera y J.M. Rey-Benayas., 2006. Distance effect from


cloud forest fragments on plant community structure in abandoned pastures in
Veracruz, Mxico. Journal of Tropical Ecology, 22(4):431-440.
Negrete-Yankelevich, C. Fragoso and A.C. Newton., 2007. The impact of logging and
secondary succession on the below ground system of a cloud forest in Mexico.
Pages 181-199 in A.C. Newton, editor. Biodiversity loss and conservation in
fragmented forest landscapes. CABI. UK.
Rger, N., J.J. Armesto, A.G. Gutirrez, G. Williams-Linera and A. Huth., 2007. Process-
based modelling of regeneration dynamics and sustainable use in species-rich
rainforests. Pages 244- 275 in A.C. Newton, editor. Biodiversity loss and
conservation in fragmented forest landscapes. CABI. UK.
Santiago, A.L., E.J. Jardel, R. Cuevas, F.M. Huerta., 2009. Vegetacin de bordes en un
Bosque Mesfilo de Montaa del Occidente de Mxico. Boletn Sociedad Botnica
de Mexico, 85:31-49.
Surez-Guerrero, A.I. y M. Equihua., 2005. Experimental tree assemblages on the
ecological rehabilitation of a cloud forest in Veracruz, Mexico. Forest ecology and
management, 218(1):329-341.
Toledo, T., 2009. El bosque de niebla. CONABIO. Biodiversitas, 83:1-6.
Wightman, K.E. y B. Santiago., 2003. La cadena de la reforestacin y la importancia en la
calidad de las plantas. Foresta Veracruzana, 5(1):45-51.
Williams-Linera, G., 1993. Bordes de bosque nublado en el Parque Ecolgico Clavijero,
Xalapa, Veracruz, Mxico. Revista de Biologa Tropical, 41(1): 107-117.
Williams-Linera, G., 1996. Crecimiento diamtrico de rboles caducifolios y perennifolios
del bosque mesfilo de montaa en los alrededores de Xalapa. Madera y bosques,
2(2):53-65.
Williams-Linera, G., R.H. Manson y E. Isunza., 2002. La fragmentacin del bosque
mesfilo de montaa y patrones de uso del suelo en la regin oeste de Xalapa,
Veracruz, Mxico. Madera y Bosques, 8(1):73-89.
Williams-Linera, G. 2007. El bosque de niebla del centro de Veracruz: ecologa, historia y
destino en tiempos de fragmentacin y cambio climtico. Instituto de Ecologa, A.
C. Mxico. 204 p.
Zamora, R., J. Castro, J.M. Gmez, D. Garca, J.A. Hdar, L. Gmez y E. Barraza., 2001.
El papel de los matorrales en la vegetacin forestal. Quercus, 187:41-47.

104
El Agro Veracruzano 2015

8
ACTITUD DE CAFETICULTORES SOBRE MANEJO Y
CONSERVACIN DE SUELOS DEL SITIO RAMSAR CASCADAS DE
TEXOLO

Juan Carlos Moreno Secea1, Martha Elena Nava Tablada2, Mara Isabel Hernndez
Snchez3
1
Doctorado en Agroecosistemas Tropicales. Carrillo Puerto 26, Centro, Xalapa, Veracruz,
CP 91000. jmoreno_sece@hotmail.com Lnea de investigacin: manejo y conservacin de
agua y suelo.
2
Doctorado en Sociologa Rural. Carrillo Puerto 26, Centro, Xalapa, Veracruz, CP 91000.
menavata@yahoo.com.mx. Lnea de investigacin: desarrollo rural, SNI I.
3
Carrillo Puerto 26, Centro, Xalapa, Veracruz, CP 91000. lebasi_hs@hotmail.com.
Licenciado en economa. Maestra en Desarrollo Regional Sustentable. Lnea de
investigacin: Desarrollo Regional.

Resumen
1. El cultivo del caf (Coffea arabica L.) es de importancia econmica, cultural y
ambiental en el Sitio Ramsar Cascadas de Texolo y su entorno, decretado como
rea Natural Protegida. La degradacin del suelo en esta zona debido a las
actividades antropognicas se ha incrementado; por lo que es prioridad realizar
investigacin tendiente a su manejo y conservacin.
2. El objetivo fue conocer el historial y la actitud de cafeticultores del Sitio
RAMSAR Cascadas de Texolo hacia la adopcin de prcticas de manejo y
conservacin del suelo.
3. El estudio se realiz de enero a julio de 2014, esto en cuatro localidades de Xico y
cuatro de Teocelo Veracruz, mediante una encuesta aplicada a 40 cafeticultores
cuyas parcelas se ubican dentro del polgono del Sitio Ramsar.
4. Se encontr que las obras y prcticas de conservacin de suelo fueron impulsadas
al inicio de los aos setentas por el desaparecido Instituto Mexicano del Caf
(INMECAF) algunas de las cuales se siguen manteniendo y practicando. La edad
promedio de los encuestados super los 61 aos, de los cuales el 60% son
pequeos propietarios, 22% medianos y 18% grandes. Actualmente slo 45%
sigue realizando prcticas de conservacin de suelo dentro del Sitio, a pesar de
haber sido denominado Ramsar. Se encontr una actitud ligeramente positiva
(3.3), en escala Likert, hacia la conservacin del agroecosistema cafetalero.
105
El Agro Veracruzano 2015

5. El impulso de futuras obras y prcticas de conservacin de suelo, dependen, en


gran medida, de la disposicin de las instituciones y que de emprender un trabajo
tendiente a la conservacin de suelo, es recomendable iniciarlo con productores de
caf con mayor superficie cultivada.
Palabras clave: Coffea arabica L., conservacin de suelo, agroecosistema.
Abstract
1. The cultivation of coffee (Coffea arabica L.) has economic, cultural and
environmental importance at the Texolo Waterfall on the Ramsar Site and the
surrounding area, now declared as a protected natural area. Soil degradation in this
area due to anthropogenic activities has increased; making it a priority to conduct
research aimed towards management and conservation.
2. The objective was to find out the history and attitude of coffee growers at the
Texolo Waterfall on the Ramsar Site, concerning the adoption of management
practices and soil conservation.
3. The study was conducted from January to July, 2014, in four locations in Xico
and four in Teocelo, Veracruz, by applying a survey to 40 coffee growers, whose
plots are located within the polygon of the Ramsar Site.
4. It seems that projects for soil conservation were promoted at the beginning of the
seventies by the Mexican Coffee Institute (INMECAFE) that existed at the time,
some of which are still maintained and ongoing. The average age of respondents
was over 61, of whom 60% are smallholders, 22% medium land owners and 18%
large scale. Currently, only 45% are still conducting soil conservation practices at
the site. A slightly positive indication (3.3), on the Likert scale was apparent in
terms of conservation of the coffee agroecosystem.
5. The impetus for future works and soil conservation practices depends largely on
the willingness of institutions and producers, cultivating larger areas.
Keywords: Coffea arabica L., soil conservation, agroecosystem.

Introduccin
La produccin de caf (Coffea arabica L.) en Mxico representa una actividad de
importancia ambiental, actualmente el 40% de la produccin se realiza en reas
con selvas altas y medianas, 23% en bosques de pino-encino, 21% en selvas bajas
caducifolias y 15% en bosques mesfilos de montaa (AMECAF, 2012). En la
zona de Xico y Teocelo, el caf tiene gran importancia econmica, cultural y
ambiental (Nava-Tablada, 2012). Las reas del cultivo en esta regin se
extendieron con gran rapidez durante el inicio de la dcada de 1940 (Hoffmann,
1986) y (Biarnes y Duchenne, 1987) invadiendo espacios naturales del bosque
mesfilo de montaa caracterstico del lugar, por lo que hoy da predomina el
agroecosistema con caf bajo sombra. En el ao 2006, se denomin Sitio Ramsar
a un polgono territorial de 500 ha que involucran las Cascadas de Texolo y
predios de su entorno que pertenecen a los municipios de Xico y Coatepec
106
El Agro Veracruzano 2015

(Secretara de la Convencin Ramsar, 2007). Actualmente en este Sitio (Figura 1),


oficialmente no se cuenta con un plan de manejo de los recursos a pesar de ser
Ramsar, algunos propietarios carecen de conocimiento de que sus terrenos se
encuentran sobre un rea Natural Protegida, adems de que la zona residencial, la
actividad ganadera y turstica principalmente, han invadido el polgono (Rojo,
2011). Al respecto Flores en 2011, inici algunos trabajos tendientes a aplicar
estrategias de sensibilizacin a los habitantes y usufructuarios, para lograr afrontar
los problemas antes citados, sin lograr resultados alentadores, debido a que stas
estrategias terminaron siendo un diagnstico de la problemtica donde slo
involucr la participacin de turistas y habitantes que no necesariamente tienen
propiedades en el sitio.

Figura 1. Ubicacin geogrfica del Sitio Ramsar, Cascadas de Texolo y su entorno.

Con relacin a la produccin de caf en el sitio, en los ltimos 14 aos se ha


desarrollado una produccin que pudiera considerarse orgnica (aunque carente
de certificacin), ya que por el impacto de la crisis cafetalera han disminuido
considerablemente las prcticas de fertilizacin, control qumico de plagas y
enfermedades principalmente, lo cual ha sido favorable para conservar el Sitio,
pero tambin ha derivado en una baja de la productividad y calidad del caf

107
El Agro Veracruzano 2015

(Noriega et al; 2014). Aunado a lo anterior, el uso inadecuado del recurso suelo y
la falta de atencin intencionada a su conservacin y mantenimiento ha provocado
su degradacin fsica, qumica y biolgica (lvarez et al., 2014). Es por ello que
el presente trabajo de investigacin tuvo como objetivo general conocer el historial
y la actitud de cafeticultores del sitio Ramsar Cascadas de Texolo hacia la
adopcin de prcticas de manejo y conservacin de suelo. La actitud se considera
como la posicin que adopta una persona ante una situacin de naturaleza variada,
que la hace reaccionar ante ella, generando una atraccin, repulsin o indiferencia
y que se traduce en la posterior aceptacin o rechazo de la misma (Altamirano et
al., 2004). Este tipo de estudios de actitud alcanz relevancia despus de los
trabajos de Likert (1932). Para el presente trabajo se plante la hiptesis de que las
prcticas de conservacin y manejo de suelo que hoy imperan fueron producto de
capacitaciones anteriores que an tienen influencia y que han ido reducindose
considerablemente a pesar de existir una actitud positiva entre los cafetaleros hacia
el manejo y conservacin del recurso suelo.

Materiales y mtodos
rea de estudio. El presente estudio se realiz durante el primer semestre de 2014
en el sitio Ramsar Cascadas de Texolo y su entorno, el cual se ubica entre los
lmites de los municipios de Xico y Teocelo, en la zona centro del estado de
Veracruz, sobre las estribaciones Orientales del Cofre de Perote (Arriaga, et al;
2002). Se localiza entre 1,400 y 1,100 m de altitud, los suelos presentes van desde
andosoles diferenciados y hmicos (profundos, muy porosos, limosos), hacia
suelos ferralticos (profundos, arcillosos, poco porosos) con varios integrados, tales
como andosoles empardecidos y ferralticos ndicos; se encuentran tambin los
litosoles. Adems, existen barrancas profundas, con afloramientos rocosos (Torres,
2005). Para el estudio se incluyeron cuatro localidades de Xico y cuatro de
Teocelo para el objeto de entrevistas y recorridos en campo.
La primera fase del proyecto consisti en el anlisis del historial de prcticas de
manejo del suelo en la regin, para ello; se identificaron trabajos en campo y
anlisis de informacin documental relacionada con el estudio. Adems se us la
tcnica del sondeo, mediante recorridos de campo y entrevistas con informantes
clave (Folgueiras, 2007). En la segunda fase, se realiz una encuesta aplicando un
cuestionario mediante la tcnica bola de nieve, para ello, se cont con un padrn
georeferenciado de las parcelas con los nombres de los cafeticultores propietarios.
El cuestionario se aplic a 40 productores que tuvieran sus predios en el polgono
del Sitio Ramsar; lo anterior tomando como base tres estratos de productores
(Sadn, 2003), en relacin al nmero de hectreas de su parcela, esto es: a) 5.0; b)

108
El Agro Veracruzano 2015

5.1-10; c) > 10. El cuestionario se estructur con 16 preguntas abiertas y nueve


cerradas, con tres apartados: 1) datos generales del productor y la finca, 2) aspectos
tcnicos-productivos e histricos sobre conservacin de suelo, y 3) aspectos de
actitud del productor.
Anlisis de la actitud. Para estimar la actitud se us el ndice de Likert
considerando el promedio de las respuestas de nueve reactivos con cinco opciones
de respuesta: 5 indica Totalmente de acuerdo; 4 De acuerdo; 3 Indiferente; 2
En desacuerdo; 1 Totalmente en desacuerdo. Para interpretarla se consider el
criterio de Hartley (2014), (Tabla 1).

Tabla 1. Rangos de valor en escala de Likert y significado de cada uno de ellos.

ndice de Likert Interpretacin


< 1.5 Negativa baja
1.6-2.2 Ligeramente negativa
2.3-3.0 Indiferente
3.1-3.8 Ligeramente positiva
>3.9 Altamente positiva

Anlisis estadsticos. Los datos obtenidos se capturaron en el programa Microsoft


Office Excel (versin 2010) obtenindose estadsticas descriptivas, coeficiente de
correlacin y diagramas de frecuencia.

Resultados y discusin

Historial del manejo y conservacin del suelo en el Sitio. La regin de Xalapa-


Coatepec -Xico fue una de las primeras reas de Mxico donde se introdujo el
cultivo de caf va la zona de Crdoba, a fnales del siglo XVIII. Los primeros
trabajos de conservacin del suelo en el Sitio se remontan a finales del siglo XIX
cuando el cultivo se empieza a introducir (Ejea, 2009). El desmonte provocado en
el lugar para dar cabida a la plantacin de caf en terrenos accidentados, rocosos y
reas de barrancas con niveles de precipitacin de 1,200 1500 mm, present la
necesidad de llevar acabo prcticas de conservacin de suelo. Las primeras
prcticas de conservacin eran muy rudimentarias, consistan en: uso de cobertura
vegetal viva, fajas de contencin, barreras muertas (piedra, madera o montculos de
suelo) e incorporacin de residuos orgnicos. Durante el periodo de 1965-1985 las
prcticas de conservacin de suelo fueron ms especializadas, esto es,
considerando el tipo de suelo, incluso se llegaron a construir obras de
109
El Agro Veracruzano 2015

conservacin. Dichas obras y prcticas fueron promovidas mediante capacitacin y


financiamiento por el INMECAF, pudindose detectar: Uso de barreras vivas,
implementacin de terrazas individuales, terrazas de banco, muros de concreto,
ollas de captacin entre otras.
De acuerdo a las entrevistas con productores, sus familias, con asesores de
organizaciones y lugareos, se detect que la mayora de las transformaciones que
la cafeticultura del Sitio experiment, se consolidaron entre los aos setentas y
mediados de los ochentas. Transformaciones que se manifiestan concretamente en
la vida regional y que algunas han seguido presentes en el modo de produccin que
actualmente impera. Las cuales fueron impulsadas por conocimientos tcnicos-
productivos difundidos por el Instituto Mexicano del Caf (INMECAF), el cual
tena una visin productivista que promova el uso de insumos, agroqumicos,
fertilizantes, crditos, proteccin del suelo y paquetes tecnolgicos modernos.
Despus de la cada del precio del caf en 1989 esta imagen fue cambiando,
deteriorndose el nivel de ingreso y la dinmica de movilizacin regional del
cafeticultor y sus familias. La dinmica movilidad de mano de obra dentro de la
regin se redujo y dio lugar a la migracin laboral hacia otros lugares del pas y
Estados Unidos. Lo anterior impact adems en las prcticas a nivel parcelario
(Nava-Tablada, 2012).
Las prcticas de conservacin de suelo se dejaron de realizar por escasez de mano
de obra familiar, por lo que a inicios del ao 2000 se tiende a regresar a la
produccin de cero insumos, reducindose incluso las prcticas de fertilizacin y
de conservacin de suelo que demandaban inversin de recurso econmico para el
productor. Actualmente las prcticas de conservacin de suelo que se realizan son
aquellas que no implican excesivo uso de mano de obra e inversin econmica, por
lo que se observan en la regin prcticas usuales como: uso de barreras vivas
(intercalado de cultivos frutales y forestales), aplicacin de barreras muertas
(muros de piedra, adicin de hojarascas y materia orgnica al suelo).
Perfil del productor. La edad media del productor fue 61.3 aos (s= 13.9), con
escolaridad promedio de 7.9 aos (s= 6.4) (ver Tabla 2). El 75 % de los cafetaleros
son del gnero masculino y 25 % femenino. Se observa que un 60 % de los
cafetaleros encuestados poseen una superficie de produccin menor a 5.0 ha. La
mayor escolaridad corresponde a productores con mayor extensin de terreno.
Aspectos tcnicos, productivos e histricos sobre conservacin de suelo. El
productor tiene sembrada en su finca diversidad de variedades de caf, de los
cuales, el 20% tiene una sola, otro 20% dos, el 40% tiene tres y el resto ms de
cuatro.

110
El Agro Veracruzano 2015

Tabla 2. Edad y escolaridad de los productores cafetaleros del Sitio Ramsar


Cascadas de Texolo y su entorno.

Superficie Edad Escolaridad


(ha) n % (aos) (aos)
X X
1 5.0 24 60 64.0 (14.9) 6.2 (5.7)
2 5.1 10.0 9 22.5 58.3 (9.2) 6.5 (6.5)
3 10.0 7 17.5 55.7 (14.6) 15.6 (3.0)
Total 40 100 61.3 (13.9) 7.9 (6.4)

El 62.5% de cafetaleros posee ms de 30 aos de experiencia en la cafeticultura. Al


respecto Salas (2002) seala que la experiencia es clave para la adopcin y puesta
en prctica de las innovaciones, y Prez et al., (1997) sostienen que cuando el
agricultor tiene ms experiencia en la realizacin de sus labores es ms propenso a
la adopcin de tecnologas. Los aos que posee un agricultor en sus labores diarias,
le permiten llegar a manejar con habilidad y destreza la mayora de las condiciones
del medio que lo rodean y tomar decisiones con conocimiento de causa. Slo el
22.5% de los productores encuestados fertiliza, de stos, la dosis de fertilizacin
media general anual aplicada, es de 54-8508 kg ha-1 (N, P y K). El 80 % de los
productores que aplican fertilizantes son de fuentes inorgnicas, a base de urea
(46-0-0), fosfato diamnico (DAP) (18-46-0), y mezclas como 20-10-10. En
relacin al historial de conservacin de suelos, el 80% realiz consecutivamente
prcticas de conservacin de suelos. Actualmente slo un 45% realiza ste tipo de
prcticas. La anterior reduccin obedece al nulo impulso de programas de manejo
a nivel parcelario, la crisis cafetalera que disminuy los ingresos para poderlos
destinar a ste tipo de prcticas y adems se suma el desconocimiento de las
acciones tradicionales de conservacin por parte de las nuevas generaciones que se
vienen insertando al sistema productivo del caf (Cotler et al., 2007).
De acuerdo con la encuesta aplicada, del 45% que realiza prcticas a favor del
suelo, se enlistaron (ver Tabla 3) y se constataron algunas, mediante visitas a la
finca, tales como: barreras muertas, barreras vivas, aplicacin de hojarasca,
terrazas, curvas de nivel y ollas de captacin. Existen otras prcticas que desde la
percepcin del productor las considera de conservacin de suelo tales como:
chapeo con machete, despiedre, cero aplicacin de agroqumicos, siembra de
especies arbreas. Se logr observar que existen an obras de concreto que fueron
construidas durante la dcada de los setenta.

111
El Agro Veracruzano 2015

Tabla 3. Principales prcticas de conservacin de suelos que se realizan en el Sitio.

Prctica Frecuencia %
Curvas de nivel 7 17.5
Incorporacin de hojarasca 9 22.5
Barreras Vivas 7 17.5
Barreras Muertas 6 15.0
Terrazas 6 15.0
Despiedre 2 5.0
Ollas de captacin 3 7.5
Total 40 100.0

As mismo se logr notar que los productores que poseen una superficie mayor a
10 ha son los que, actualmente realizan ms prcticas de conservacin de suelos
(85.7%), mientras que en productores con superficie menor, es poco comn
(41.6%). Lo anterior, muestra una correspondencia con los productores que
realizan anlisis de suelos; lo que puede estar asociado a que los productores
considerandos como grandes son aquellos que presentan menor edad y mayor
escolaridad y adems tienen mayor conocimiento sobre los beneficios que conlleva
el atender al recurso suelo como elemento importante del agroecosistema.
Respecto a la edad, Betancourt-Ynez y Pulido (2006) mencionan que una
poblacin con un alto porcentaje de agricultores jvenes, presenta un amplio
potencial para mejorar el sistema productivo local debido a que se observa por lo
general menor resistencia a los cambios de produccin. Esta condicin podra
incidir positivamente en la adopcin de tecnologa y enseanzas ambientales. Por
su parte, Salas (2002) agrega que las actitudes se aprenden a travs de la
observacin e imitacin de personas mayores.
Aspecto actitudinal. Al abordar el aspecto actitudinal, la primera afirmacin que
se present fue la siguiente: Estoy dispuesto a conservar el medio ambiente y sus
recursos en beneficio del Sitio Ramsar donde se encuentra mi finca de caf. Al
respecto, de manera general se registr en la poblacin una actitud ligeramente
positiva (3.3) en la escala de Likert, se observ que al hacer el anlisis por estratos
(ver Figura 2) los productores del estrato tres (grandes en superficie producida de
caf) fueron aquellos que alcanzaron la mayor actitud (3.9), seguido por los
medianos (3.7) y finalmente los pequeos (2.9). Lo anterior puede estar
relacionado con que los productores de los estratos dos y tres presentan un grado
de escolaridad superior al resto de los estratos.

112
El Agro Veracruzano 2015

Figura 2. Actitud media en cada estrato, respecto a la conservacin del


agroecosistema cafetalero en el Sitio Ramsar.

Los ocho reactivos restantes, para efectos de anlisis se presentan en la Tabla 4,


todos se abordan en forma de afirmacin positiva y se enlistan a continuacin:
1. La conservacin del suelo es necesaria para mi trabajo en la
produccin de caf;
2. Se debe evitar prcticas agrcolas que produzcan erosin del suelo;
3. Las charlas de conservacin de suelos y agua son de gran inters;
4. Estoy dispuesto a realizar anlisis de suelo a mi parcela tendientes a su
conservacin;
5. Estoy dispuesto a realizar obras y/o prcticas de conservacin de suelo
en mi parcela;
6. Estoy dispuesto a realizar prcticas de conservacin siempre y cuando
se me capacite;
7. Estoy dispuesto a conservar el suelo aunque tenga que desembolsar
dinero;
8. Estoy dispuesto a emprender labores en beneficio de la conservacin
del Sitio Ramsar.

113
El Agro Veracruzano 2015

Tabla 4. Posicin de cafeticultores en relacin al manejo y conservacin del


recurso suelo.

Categoras (%) Media (actitud) por estratos


TDA DA I ED TED 1 2 3
React.
A 32.5 32.5 27.5 7.5 - 3.9 3.6 4.1 3.9
B 45.0 32.5 20.0 2.5 - 4.2 4.2 4.3 4.2
C 37.5 25.0 15.0 2.5 20.0 3.0 4.1 4.4 3.5
D 7.5 25.0 35.0 17.5 15.0 2.5 3.4 3.9 2.9
E 40.0 37.5 22.5 - - 4.1 4.2 4.4 4.2
F 50.0 37.5 12.5 - - 4.3 4.4 4.4 4.4
G 7.5 27.5 35.0 20.0 10.0 3.0 2.4 4.0 3.0
H 20.0 32.5 10.0 30.0 7.5 3.0 3.0 4.6 3.3
Promedio 3.5 3.7 4.3 3.7
TDA: Totalmente de acuerdo; DA: De acuerdo; I: Indiferente, ED: En desacuerdo y TED:
Totalmente en desacuerdo. Se presentan valores medios basados en la escala de Likert.

De acuerdo a los datos presentados, se puede observar que existi una diversidad
de actitudes respecto a los reactivos presentados, obteniendo los tres mayores
porcentajes de totalmente de acuerdo en las afirmaciones B, E y F, esto es, sobre
las afirmaciones que se deben evitar las prcticas agrcolas que produzcan erosin
en los suelos (45.0%), y con una actitud altamente positiva en cada uno de los
estratos estudiados, un 40.0% sobre estar dispuesto a realizar obras y/o prcticas de
conservacin de suelo en la parcela, con una actitud altamente positiva para cada
estrato; y finalmente un 50.0% sobre realizar obras y/o prcticas de conservacin
de suelos siempre y cuando se les capacite, registrando una actitud de altamente
positiva para cada estrato. Es evidente la intencin y aceptacin de todos los
cafetaleros hacia la conservacin del suelo. Al respecto, la FAO (1990) indica que
el deseo de participacin de los agricultores se constituye en un elemento esencial
del xito en cualquier programa de conservacin de suelo, y que
independientemente de lo correcto que sea el plan, no puede aplicarse con buen
resultado sin el apoyo y la participacin de los mismos. Garry et al., (2007)
sealan que en cualquier programa lo ms importante es el inters de los
agricultores para efectuar labores de conservacin.

114
El Agro Veracruzano 2015

Los tres mayores porcentajes de totalmente en desacuerdo se dieron sobre los


reactivos C, D y G, esto es; un 20.0% est en total desacuerdo sobre que las
charlas de conservacin de suelos y agua sean de gran inters, sin embargo; a la
hora de realizar el anlisis por estratos se observa que quienes tienen esa actitud de
indiferencia, en su mayora, son los pequeos productores (3.0), mientras que los
medianos y grandes productores presentan una actitud altamente positiva (4.1) y
(4.4) respectivamente. Un 15.0% tambin manifest total desacuerdo sobre estar
dispuesto a realizar anlisis de suelo en la parcela tendientes a su conservacin,
encontrando posiciones diversas por estratos: indiferente (2.4) para pequeos
productores, ligeramente positiva (3.4) para medianos y altamente positiva (3.9)
para los grandes. Finalmente un 10.0% tambin manifest estar en total desacuerdo
sobre el hecho de estar dispuesto a conservar el suelo aunque tenga que
desembolsar dinero, y precisamente en esta posicin fue donde se registraron las
menores actitudes en los tres estratos siendo de 3.0, 2.4 y 4.0 para pequeos,
medianos y grandes productores respectivamente. Al respecto, Herrera (2004)
menciona que el individuo por naturaleza piensa pretender el beneficio ambiental,
sin embargo; al momento de invertir algn tipo de recurso las intenciones se ven
frenadas, aunque en la mayora de los casos las causas no derivan de la falta de
recursos econmicos sino de falta de visin estratgica. La Figura 3 ilustra lo antes
citado.
Es importante mencionar que los productores del estrato 3 grandes en superficie
producida de caf registraron en todos los reactivos actitudes altamente positivas,
respecto al proceso de conservacin del suelo, a pesar de que esto conlleve a
invertir recursos econmicos. Lo anterior puede deberse a que de acuerdo con
Romero et al., (2005), al realizar un estudio en la Cuenca del ro Conchos,
concluyeron que los productores con superficies mayores a 10.0 ha presentan una
actitud ms positiva hacia la adopcin de un nuevo sistema de riego.
Lo anterior podra deberse a que tales productores poseen una visin ms
empresarial y su capacidad de ingresos es mayor, por lo que hay ms capacidad
econmica para adoptar nueva tecnologa. Sin embargo, por el parmetro de
escolaridad medido en este estudio, se observa adems que los grandes productores
presentan una escolaridad mayor al resto de los estratos.
Otro dato importante y de gran utilidad a destacar es sobre la afirmacin H, donde
los pequeos y medianos productores mostraron indiferencia (3.0) con relacin a
estar dispuesto a emprender labores en beneficio de la conservacin del Sitio
Ramsar. Al respecto se encontr que los cafetaleros de las comunidades del
municipio de Teocelo presentan una actitud altamente positiva (4.1) contra una
actitud indiferente (2.3) sobre los de Xico. Lo anterior puede deberse a que en
Teocelo, las autoridades municipales de los ltimos aos se han ocupado de dar
difusin entre los habitantes sobre la importancia de conservar al Sitio Ramsar. Lo
115
El Agro Veracruzano 2015

mencionado concuerda con lo expuesto por Brejda et al., (2000) y Cotler et al.,
(2007) quienes indican que la conservacin de suelos debe ser un asunto de inters
pblico impulsado por sus gobernantes a nivel regin y para que esto tenga efecto,
los principales actores involucrados deben ser sus habitantes.

Figura 3. Comparacin de la disposicin a aportar recursos econmicos para la


conservacin de suelo.

Conclusiones

Este es un trabajo pionero que evala en uno de los Sitios Ramsar ms importante
de Mxico la actitud de los cafetaleros respecto al manejo y conservacin del
suelo. Se encontr una tendencia hacia la reduccin de las prcticas y obras de
conservacin del suelo en el tiempo a partir de 1989 debido a la desaparicin de la
influencia que tuvo el INMECAF, respecto a la recomendacin tcnica y apoyo
econmico sobre la implementacin de obras y prcticas de manejo y conservacin
del suelo. Sin embargo, con la crisis cafetalera, se ha dado la oportunidad de
reducir insumos e incrementar algunas prcticas a nivel parcelario que han logrado
eventualmente beneficios ambientales para el agroecosistema cafetalero.
Los cafeticultores mostraron una actitud ligeramente positiva (3.3) hacia conservar
el medio ambiente y sus recursos en beneficio del Sitio Ramsar.
La actitud respecto al manejo y conservacin del recurso suelo mediante la
implementacin de obras y/o prcticas fue altamente positiva para toda la
116
El Agro Veracruzano 2015

poblacin, sin embargo; al expresar la condicionante de si estaran dispuestos a


conservar el suelo aunque implique desembolso econmico, la actitud positiva fue
disminuyendo y muestra una relacin directa con respecto al nmero de hectreas
que posee cada productor, ya que productores con mayor superficie cultivada
tuvieron una mayor actitud positiva hacia afirmacin.

Literatura Citada

Altamirano, M., G. Galloway, B. Louman, K. Prins y L. Ortega, 2004. Actitudes,


conocimientos, manejo de fincas y percepcin de los campesinos hacia el uso del
recurso bosque en comunidades aledaas a la Reserva Biolgica Indio Maz, El
Castillo, Ro San Juan, Nicaragua. Rev. Recursos Naturales y Ambiente, 43: 49-61.
lvarez-Morales, Y., E. Troyo Diguez., A. Nieto., F. Beltrn., A. Murillo., A. Cruz.,
Arturo, y J. Navejas, 2014. Vulnerabilidad hidroclimtica y degradacin del suelo
en regiones agrcolas semiridas. Terra Latinoamericana, 7 (4): 47-58.
AMECAF. Asociacin Mexicana de la Cadena Productiva del Caf, A.C. 2012. Plan
Integral de Promocin del Caf de Mxico 2012, 63p.
Arriaga, L., V. Aguilar, y J. Alcocer, 2002. Aguas continentales y diversidad biolgica de
Mxico. Comisin Nacional para el Conocimiento y Uso de la Biodiversidad.
Mxico. CONABIO 320 p.
Betancourt-Ynez, P., P. Pulido, 2006. Actitud de los agricultores hacia el manejo y
conservacin del suelo y agua en dos comunidades rurales del Estado Lara,
Venezuela. Bioagro, 18(3): 155-161.
Biarnes, O., A. y T. Duchenne , 1987. El corte del caf en los municipios de Coatepec,
Xico, Teocelo y Cosoutln. Estado de Veracruz. Documento de trabajo. 45 p.
Consultado en: http://horizon.documentation.ird.fr/exl-doc/pleins_textes/doc34-
05/27005.pdf
Brejda, J. M., T. Douglas y H. Thanh, 2000. Identification of Regional Soil Quality
Factors and Indicators I. Central and Southern High Plains. In Soil Science Society
of America Journal, 6 (46): 2115-2124.
Cotler, H., E. Sotelo., J. Dominguez., M. Zorrilla., S. Cortina., y L. Quiones, 2007. La
conservacin de suelos: un asunto de inters pblico. Gaceta Ecolgica, 2 (8) 5-71.
Ejea, M., 2009. Caf y cultura productiva en una regin de Veracruz. Nueva Antropologa,
22(70): 33-56.
FAO. Organizacin de las Naciones Unidas para la Alimentacin y la Agricultura, 1990.
Conservacin de suelos para los pequeos agricultores en las zonas tropicales
hmedas. Boletn de Suelos de la FAO. N 60. Roma. 122 p.
Flores, N., 2011. Estrategias de sensibilizacin a habitantes y usufructuarios del Sitio
Ramsar Cascadas de Texolo y su entono, municipio de Xico, Ver. Tesis de
Licenciatura. Facultad de Biologa Xalapa. Universidad Veracruzana. 99 p.
Folgueiras, P., 2007. La evaluacin participativa de un programa de formacin para una
participacin intercultural. Revista de Investigacin Educativa 25 (2): 491-511.

117
El Agro Veracruzano 2015

Schaefer, G.L., M. Cosh., y T. Jackson, 2007. The USDA Natural Resources Conservation
Service Soil Climate Analysis Network (SCAN).J. Atmos. Oceanic Technol., 24,
20732077.
Hartley, J., 2014. Some thoughts on Likert-type scales. International Journal of Clinical
and Health Psychology, 8 (3):83-86.
Herrera, L., 2004. Investigacin cientfica: inversin para conservar. Interciencia, 29(9):
30-45.
Hoffman. O., 1986. Movimientos demogrficos y economa cafetalera en el centro del
Estado de Veracruz. (Xalapa-Coatepec). Cuadernos del IIESE. 13: 57-84p.
Likert, R. 1932. A technique for the measurement of attitudes. Archives of Psychology
140: 1-55.
Microsoft Office Excel (versin 2010).
Nava-Tablada. M.E. 2012. Migracin Internacional y Cafeticultura en Veracruz, Mxico.
Migraciones internacionales, 6 (3): 139-171.
Noriega, A. G., R. Crcamo. M. Gmez-Cruz., S. Rindermann, S. Cruz-Hernndez., J.
Leyva., E. Garca., L. Reyes., y A. Martnez-Hernndez., 2014. Intensificacin de la
produccin en la agricultura orgnica: caso caf. Revista Mexicana de Ciencias
Agrcolas, 8 (2): 163-169.
Prez, O., O. Ramrez, L. Hilje y J. Karremans 1997. Potencial de adopcin de dos
opciones tecnolgicas de manejo integrado de plagas (MIP) aplicando tres tcnicas
de extensin con productores de tomate en el Valle Central Occidental, Costa Rica.
Manejo Integrado de Plagas, 43 (2): 9-30.
Rojo, R., 2011. Anlisis de la situacin actual del Sitio Ramsar Cascadas de Texolo y su
entorno, Municipio de Xico, Ver. Tesis de Licenciatura. Facultad de Biologa.
Xalapa. Universidad Veracruzana. 104 p.
Romero, P., J. Monnier, y R. Miquel, 2005. Organizacin social y conflictos por el agua en
los distritos de riego de la cuenca del Ro Conchos. In: Vargas, S. y Mollard, E.
Problemas socioambientales y experiencias organizativas en las cuencas de Mxico.
IMTA-IRDCONACYT, Mxico. 76p.
Salas, J., 2002. Actitud del productor agrcola de comunidades del Valle de Qubor,
Venezuela, hacia el manejo integrado de plagas en tomate. Desarrollo Rural, 4 (5):
183-213
Sandn, M. P., 2003. Investigacin Cualitativa en Educacin. Fundamentos y Tradiciones.
Madrid: Mc Graw-Hill.133 p.
Secretara de la Convencin de Ramsar, 2007. Designacin de sitios Ramsar: Marco
estratgico y lineamientos para el desarrollo futuro de la Lista de Humedales de
Importancia Internacional. Manuales Ramsar para el uso racional de los humedales,
3a edicin, vol. 14. Secretara de la Convencin de Ramsar, Gland (Suiza), 122 p.
Torres, N. C., 2005. Ficha Informativa de los Humedales de Ramsar (fir). Sitio Ramsar
Cascada de Texolo y su entorno. COEPA, Gobierno del Estado de Veracruz. En
Coordinacin con la oficina de la Convencin de Ramsar. Gland, Suiza. Xalapa,
Veracruz, Mxico, 77 p.

118
El Agro Veracruzano 2015

9
BIODIVERSIDAD DEL ORDEN ESCORPIONES C.L. KOCH, 1837 EN
LAS LOCALIDADES: LA LAGUNA, BOCA DEL RO Y SOLEDAD DE
DOBLADO, VERACRUZ.

Ofelia Gonzlez Ramos1, Julio Marcos Cruz Gmez1, Luis Ricardo Silo Vzquez1,
Vctor Alejandro Jimnez Arrioja Montoro1, Perla K. Montero Ramrez1, Eduardo
Palacio Prez1
1
Instituto Tecnolgico de Boca del Ro. Docentes Investigadores. Licenciatura en Biologa.
gonzalez_ofe@hotmail.com.
Resumen
1. Los alacranes o escorpiones representan uno de los once rdenes de Arcnidos, de
inters mdico por la conocida toxicidad de su picadura. Existen alrededor de
2090 especies en el mundo, y 270 en Mxico, agrupados en 8 familias. Todas las
especies txicas poseen un veneno neurotxico, y pertenecen a la familia
Buthidae. En Mxico se reconocen 12 especies peligrosas del gnero Centruroides
y ciertas especies de este gnero se caracterizan por la peligrosidad de su veneno.
2. Determinar y conocer la biodiversidad de las familias del orden Scorpiones en las
localidades La Laguna, Cotaxtla, Los Robles, Boca del Ro y Soledad de Doblado,
Veracruz.
3. En el perodo 2009-2014 fueron realizadas diferentes colectas de arcnidos en las
localidades mencionadas. Localizados debajo de las piedras, troncos, hojarasca, y
aledaas o dentro de las casas; en las salidas de colecta se utilizaron frascos,
pinzas, lmpara de mano, y guantes, y fueron depositados en alcohol etlico al
70%. La identificacin taxonmica se bas en la metodologa de Armas y Martin-
Fras (2008), Francke y Santibez (2013) y Contreras, (2013), Mille at al. (1993)
4. En la localidades de estudio, las familias que representan al orden Scorpiones son:
Buthidae, Vaejovidae y Diplocentridae. La familia Buthidae representada por el
Gnero Centruroides y la especie, Centruroides gracilis estuvo presente en todas
las localidades. C. infamatus fue encontrado en Boca del Ro y en La Laguna,
Medelln, mientras que C. ochraceus en Boca del Ro y C. nigrimanus en La
Capilla, Cotaxtla. De la familia Vaejovidae con Vaejovis sp solo se localiz un
ejemplar en Boca del Ro.As mismo en el caso de las familias Diplocentridae,
Gnero Diplocentrus sp secolecto un ejemplar en Quiahuiztln, Actopan. Se

119
El Agro Veracruzano 2015

reportan datos por fecha, sexo, localidad y se ilustran con fotografas las
principales caractersticas.
5. Se obtuvieron nuevos registros y que permiten confirmar que C. gracilis es de
amplia distribucin y es la especie ms abundante en el rea de estudio, lo cual es
importante en trminos de salud pblica.
Palabras Clave: alacranes, Buthidae, escorpiones, Centruroides, biodiversidad.

Abstract
1. Scorpions represent one of the eleven orders of Arachnids of medical interest
because of their well-known toxicity. There are about 2090 species widespread
around the world and 270 occur in Mexico, grouped in 8 families. All toxic
species belong to the Buthidae family and possess a neurotoxic venom. In
Mexico 12 dangerous species of the genus Centruroides are recognized, some of
them are characterized by the danger of their venom.
2. Identifying and understanding the biodiversity of the families of the order
Scorpiones in the localities: The Laguna, Cotaxtla, Los Robles, Boca del Ro and
Soledad de Doblado, Veracruz is the main objective of this work.
3. During the period 2009-2014 there were made different arachnid collections in
these towns. The arachnids were found under rocks, logs, leaf litter, and areas
around houses, and were collected with the aid of vials, tweezers, flashlight and
gloves. The organisms were preserved in 70% ethyl alcohol. The taxonomic
identification was based on Armas and Martin-Fras (2008), Francke and
Santibez (2013) and Contreras, (2013), Mille et al. (1993).
4. The families included in the order Scorpiones were Buthidae, Vaejovidae and
Diplocentridae. The Buthidae family was represented by the species Centruroides
gracilis, present in all locations; C. infamatus found in Boca del Rio and La
Laguna; C. ochraceus was only collected in Boca del Ro; C. nigrimanus the
Buthidae family collected at La Capilla, Cotaxtla. The family Vaejovidae was
represented by only one specimen Vaejovis sp from Boca del Ro.. The family
Diplocentridae was represented by one specimen: Diplocentrus sp. collected at
Quiahuiztln, Actopan. Data are reported by date, gender and location are
illustrated with photographs and key features.
5. The broad coastal distribution of C. gracilis is confirmed. It was also the most
abundant species for the entire study area. These are the first records for the
different locations.
Keywords: Scorpions Buthidae, Centruroides, biodiversity.

120
El Agro Veracruzano 2015

Introduccin.

El Orden Scorpionida incluye a los llamados comnmente alacranes o escorpiones,


los cuales son artrpodos de la Clase Arachnida, y son los ms antiguos que se
conocen. Invadieron la tierra a mediados del perodo Silrico, hace casi 400
millones de aos, y han sobrevivido hasta nuestros das, segn datos fsiles, y su
origen procede de escorpiones marinos de enormes proporciones llamados
Euriptridos.
Se han descrito hasta el momento 2,090 especies de escorpiones, distribuidas en
todo el mundo, y conforman el Orden Scorpionida, uno de los 12 rdenes de
arcnidos vivientes, a la que tambin pertenecen los caros, las araas y las
garrapatas entre otros, compuesto por 11 familias y 112 gneros.
En Mxico han sido registradas 270 especies de alacranes pertenecientes a varios
gneros, de las cuales slo 7 poseen veneno mortal al hombre: Centruroides
noxius, C. elegans, C. gracilis, C. limpidus tecumanos, C. suffusus y C. infamatus
infamatus presentan esternn triangular, y sus venenos son neurotxicos.
La distribucin geogrfica se encuentra de la siguiente manera: C. elegans elegans
es llamado Alacrn de la costa de Jalisco, aunque se distribuye en la parte
occidental de Jalisco, Costas de Nayarit y Sur de Sinaloa. C. exilicauda se localiza
en Sonora, Baja California Norte y Sur, mientras que C. infamatus infamatus:
Alacrn de Michoacn, es de amplia distribucin en Michoacn, Guanajuato,
Zacatecas y Veracruz. C. infamatus ornatus se encuentra en Sinaloa, Durango,
Nayarit y Jalisco, y C. limpidus limpidus o Alacrn de Iguala, se distribuye en
Guerrero, Morelos, Puebla, estado de Mxico, Oaxaca y Chiapas. Tambin dentro
de la misma familia C. limpidus tecomanus, Alacrn de Colima, se distribuye en
Tecomn y el sureste de Jalisco y Nayarit; C. meisei, Alacrn de la costa de
Guerrero, se puede encontrar en la costa sur de Guerrero y Norte de Oaxaca, y C.
noxius, Alacrn de Nayarit en Nayarit y Sinaloa, mientras que C. suffusus:
Alacrn de Durango, en la ciudad de Durango, noroeste de Zacatecas y este de
Sinaloa; finalmente, C. sculpturatus se encuentra en Sonora y Norte de Baja
California Norte (Ahora considerado dentro de la especie de C. noxius) y
Centruroides gracilis en la costa del Golfo, CNA, Instituto de Biologa UNAM,
2014
En Mxico los escorpiones que con mayor frecuencia encontramos en las
habitaciones o en sus alrededores son: Centruroides, Vaejovis, Hadrurus y
Diplocentrus.
Las especies descritas para el estado de Veracruz suman 16. La familia Buthidae
con el Gnero Centruroides se compone por C. schmidti, C. orizaba, C. limpidus,
C. ochraceus, C. margaritatus, C. flavopictus, C. nigrimanus, C. gracilis, C.

121
El Agro Veracruzano 2015

infamatus. La familia Diplocentridae con tres especies descritas. Diplocentrus


melici, D. berei y D. perezi.
El estudio de la biologa del alacrn es un fenmeno que integra implicaciones
mdicas, epidemiolgicas, ecolgicas, sociales y culturales, derivadas de la
toxicidad en la picadura del alacrn (Castillo, et al. 2002). Aunque existe un gran
subregistro, en el 2011 el nmero de casos de intoxicacin por picadura de alacrn
en Mxico fue de 296 392 personas, afectando a ncleos de poblaciones rurales y
urbanas. Las entidades con mayor nmero de casos en el perodo 2006-2011
fueron Jalisco, Guerrero y Morelos; Veracruz ocup el lugar 22.
Dentro de los Procedimientos para la Vigilancia Epidemiolgica en Intoxicacin
por picadura de alacrn y uno de los propsitos del Sistema Nacional de Salud es
fortalecer y actualizar la investigacin entomolgica a travs de la seleccin y
tipificacin de especies de alacrn en el territorio nacional (Secretara de Salud,
2012).
El Hbitat de los escorpiones es diverso, pues se localizan en zonas tropicales,
subtropicales, y zonas desrticas; la mayora viven enterrados, debajo de las
piedras, escombros o de la corteza de los rboles, en cavidades del suelo, y son de
hbitos nocturnos.
Morfologa externa. El tamao de los escorpiones vara entre 1,3 a 20 cm de
longitud; tienen el cuerpo dividido en dos regiones, prosoma o cefalotrax,
cubierto por un caparazn insegmentado que se continua en el cuerpo de doce
segmentos que es el opistosoma o abdomen, este a su vez se subdivide en
mesosoma con siete segmentos o preabdomen y metasoma o postabdomen con
cinco segmentos llamado "cola", siendo el ltimo segmento el telson (Fig. 1).

Figura 1. Morfologa externa de un alacrn. Vista dorsal.

122
El Agro Veracruzano 2015

El Prosoma, es la regin anterior del cuerpo, donde se producen las funciones de


locomocin, captura de presas, alimentacin, apareamiento y percepcin sensorial;
est cubierto por un escudo esclerosado, con el borde anterior ms estrecho que el
posterior. En la parte media hay un par de grandes ojos, cada uno sobre un
pequeo tubrculo y en los bordes laterales anteriores se destacan 2 a 5 pares de
pequeos ojos, un par de quelceros, un par de pedipalpos quelados y cuatro pares
de patas locomotoras.
Los quelceros, son el primer par de apndices localizados a los lados de la boca
cuya funcin es sujetar la presa y perforarle el tegumento; son pequeos,
triarticulados y quelados, formados por 3 artejos, uno basal y la mano + el dedo
fijo y el mvil.
Los pedipalpos estn bien desarrollados, los segmentos basales estn modificados
y tienen funcin masticatoria, y los segmentos distales son usualmente tctiles pero
tambin intervienen en la captura de las presas; son quelados, formados por 6
artejos: coxa, trocnter, pre-fmur, fmur, tibia + tarso, que forman la mano con
un dedo fijo y el pretarso o dedo mvil; en el fmur, tibia y tarso se localizan los
tricobotrios como receptores sensoriales (Fig. 2).

Figura 2. Quelceros, pedipalpos, apndices locomotores, nombres de artejos.


Los apndices locomotores o patas se ubican en el prosoma, compuesto por 8
segmentos, que se numeran I a IV de adelante hacia atrs. Su funcin bsica es la
locomocin, y tambin se pueden emplear para excavar, para el apareamiento o
sostn. Las patas estn conformadas por las siguientes artejos: coxa, trocnter,
fmur, patella, tibia, pretarso, basitarso y telotarso y terminan en uas tarsales.
Las coxas son las estructuras que sirven de base a las patas ambulatorias y a los
pedipalpos. Forman parte de la cavidad bucal y entran en contacto con las coxas
de las patas ambulatorias. Las coxas son progresivamente ms largas hacia las

123
El Agro Veracruzano 2015

patas posteriores, as como tambin lo son el resto de los segmentos, es decir, el


trocnter, fmur, tibia, pretarso, basitarso y telotarso. El telotarso es el segmento
distal de las patas, el lado ventral posee desde cerdas densamente agrupadas hasta
espinas gruesas ampliamente separadas y tiene adems dos uas. Ventralmente se
observa que las coxas del 1 y 2 par de patas forman las enditas o lminas
masticatorias que rodean la boca. El espacio entre las coxas del 4 par de patas est
ocupado por una placa impar, el esternn.
El opistosoma, es la regin posterior del cuerpo, est compuesta por 12 segmentos.
Se divide en dos regiones, el mesosoma o preabdomen y el metasoma o
postabdomen. En el opistosoma se realizan las funciones digestivas, respiratorias y
de reproduccin. El dorso del mesosoma est cubierto por siete placas
transversales, denominadas tergitos. Su ornamentacin es variada, los seis
primeros pueden tener o no carenas o sagitales y el resto puede presentar grnulos,
puntuacin o reas lisas, el tergito VII difiere de los otros por su forma y
ornamentacin (Fig. 3).

Figura 3. Prosoma y Opistosoma. Vista dorsal.


La regin estrecha y cilndrica, del opistosoma se denomina metasoma, y est
formado por 5 segmentos, ms el telson (aguijn), donde estn ubicadas las
glndulas de veneno. Comnmente se conoce como cola, y es una espina hueca en
forma de aguja, situada en el extremo del telson, que utilizan para inocular el
veneno en las presas (Fig. 4).

124
El Agro Veracruzano 2015

Figura 4. Metasoma o postabdomen, segmentos y telson.

En el Prosoma vista ventral se localizan: el esternn, y placa pectnea. Esternn. Se


localiza en el lado ventral del alacrn. ste es una placa mediana nica, situada
entre las coxas de las patas ambulatorias III y IV. Su forma tiene importancia
taxonmica en la separacin de las familias (Fig. 5).

Figura 5. Anatoma externa del alacrn. Vista ventral.


La placa pectnea es endurecida y est situada ventralmente en el prosoma, justo
delante del oprculo genital. Esta placa tiene importancia en la determinacin de
algunas familias y en aspectos evolutivos de los escorpiones Mille et al. (1993)
(Fig. 6).
125
El Agro Veracruzano 2015

Figura 6. Esternn, oprculo genital, placa pectinifera.

En el Mesosoma, se localizan: el oprculo genital, los peines y los estigmas


respiratorios; el primer segmento es el genital, lleva el oprculo genital y los
peines. En posicin ventral, abajo del esternn, se encuentra el 2 segmento, y se
sita el orificio genital, cubierto por un oprculo formado por placas (apndices
modificados).
En los lados, se pueden observar los estilos genitales de los ejemplares machos o la
fenda genital femenina. En el tercer segmento hay una placa pectinfera que
sostiene a un par de peines o apndices sensoriales. Los peines o pecten son
rganos sensoriales que contienen mecanoreceptores y quimioreceptores, tienen
funciones sensoriales, de aireacin de los pulmones, de atraccin sexual, y de
equilibrio, y estn situados uno en cada lado de la placa pectnea, en la zona
ventral del escorpin (Fig. 7).
Cada uno de los peines est integrado por 3 hileras de placas quitinosas
longitudinales: una serie de escleritos forman las placas dorsales, otra la placa
mediana y finalmente los fulcros que sostienen los dientes o lamelas. La placa
basal media y los fulcros son significativos para la sistemtica de los gneros y las
especies. Perpendiculares a stas estn situados los dientes pectneos, en parte
cubiertos por otras estructuras sensoriales muy pequeas llamadas sencillas.

126
El Agro Veracruzano 2015

Figura 7. Oprculo genital placa pectinfera y peines. Estigmas respiratorios.

El lado ventral del mesosoma posee cinco placas transversales, los esternitos. stos
generalmente tienen poca ornamentacin entre la I y la IV placa, es justo a cada
lado de ellas en donde se sitan los estigmas o aberturas respiratorias. El esternito
V puede tener carenas paramedianas y laterales poco acentuadas. Del 3 al 6
segmento abdominal se observan en cada uno un par de espirculos que se abren
en pulmones en libro, los estigmas son aberturas respiratorias que tienen diversa
forma, desde circulares hasta lineales, y permiten el acceso a los sacos pulmonares.
Sobre antecedentes de la escorpiofauna del estado de Veracruz, Armas y Martin-
Fras, (2008) dan una resea sobre los estudios desarrollados en esta entidad
bastante completos enfatizando en el Gnero Centruroides de la Familia Buthidae,
mismos que se transcriben: Hasta el presente se han registrado 19 especies que
pertenecen a seis gneros y cinco familias (Fet, et al., 2000); Beutelspacher Baigts,
2000; Armas y Martn-Fras, 2003, 2004) el gnero Centruroides Marx, 1890 es
uno de los ms diversos y de ms amplia distribucin geogrfica, as como el de
mayor importancia mdico-sanitaria, debido a la toxicidad de algunas de sus
especies (Hoffmann, 1997; Daz Njera, 1975; Martn-Fras & Armas, 2001; Ponce
Saavedra & Moreno Barajas, 2005). Pocock (1898) describi Centrurus
flavopictus (actualmente en el gnero Centruroides), de Jalapa y poco despus
(Pocock, 1902) registr la presencia de Centruroides margaritatus (Gervais, 1841)
en Crdoba, de C. nigrescens (Pocock, 1898) en Orizaba y de C. nitidus (Thorell,
1876) en Veracruz. Hoffmann (1997), en su clsico estudio sobre los Alacranes de
Mxico, mencion para el estado de Veracruz a Centruroides infamatus C. L.
Koch, 1844, C. flavopictus flavopictus y C. gracilis, Daz Njera (1975) reconoci
cinco especies (incluida C. nigrescens), cifra que en las dos ltimas dcadas se
increment con los registros de C. schmidti Sissom, 1995 (Armas et al., 1995) y C.
ochraceus (Pocock, 1898) (Beutelspacher Baigts, 2000) y la descripcin de C.
orizaba Armas y Martn-Fras, (2003). Como acertadamente sealara Hoffmann
(1997), tanto en Veracruz como en otros estados mexicanos se pueden observar
ejemplares de C. gracilis confundibles con C. nigrescens.

127
El Agro Veracruzano 2015

Armas y Martn-Fras, 2000 incluyen los primeros registros de C. limpidus


(Karsch, 1879) y C. nigrimanus (Pocock, 1898), a la vez que se revisa el estatus
taxonmico de otras dos especies relacionadas con esta fauna. (Pocock, 1898)
(Beutelspacher Baigts, (2000) registra Centruroides ochraceus en Veracruz. Armas
& Martn-Fras, 2003, realizan un listado de especies de alacranes del genero
Centruroides y menciona que Veracruz cuenta con 7 especies del gnero, y poseen
un endemismo local con Centruroides orizaba, colectado en Acultzingo, Veracruz.
Martn-Fras et al., 2010 registran la presencia de Centruroides limpidus (Karsch,
1879) recolectado en Catemaco, estado de Veracruz, Mxico. Tambin se aportan
nuevos datos sobre la variabilidad de la cantidad de dientes pectneos en esta
poblacin.
En relacin a otros alacranes no Buthidae, Armas et al. (2004), hace referencia a
que Sissom (1991) describe por primera vez para el estado de Veracruz a
Diplocentrus perezi, un macho recolectado en las faldas del volcn San Martn
Tuxtla; Armas y Martn-Fras (2000), tambin reportan en Catemaco un organismo
macho. Armas y Martn-Fras (2004), describieron ambos sexos de una segunda
especie veracruzana, la Diplocentrus bereai, hasta ahora solo conocida del
municipio de Actopan. Nuevamente Armas y Martn Fras (2004), describieron una
especie nueva del gnero Diplocentrus, a partir de dos hembras y un macho,
recolectados en el municipio de Actopan, Ver. Diplocentrus melici, con estas son
tres las especies de Diplocentrus.
Para las localidades que se contemplan en este estudio no se encontraron registros
de alacranes, solo se hace mencin que Centrurides gracilis habita las costas del
Golfo.
El objetivo de este trabajo fue determinar la biodiversidad del orden Scorpiones en
las localidades de Soledad de Doblado, los Robles, Cotaxtla y la Laguna,
Municipio de Medelln de Bravo y Boca del Ro, Veracruz; contribuir al
conocimiento de la distribucin, abundancia as como crear el primer registro de
identificacin de alacranes en la zona.

Materiales y mtodos
rea de estudio. El presente estudio se llev a cabo en el perodo 2010-2014,
donde se colectaron organismos en las localidades La Laguna, Capilla, Municipio
de Cotaxtla, Los Robles, del Municipio de Medelln de Bravo, Boca del Ro y
Soledad de Doblado, con municipios del mismo nombre, en el estado de Veracruz,
(Fig. 8).
Las caractersticas climtico agroecolgicas y colecta de datos, se observan en la
Tabla 1 para ello se utilizaron los datos registrados en el Servicio Meteorolgico

128
El Agro Veracruzano 2015

Nacional. CONAGUA Normales Climatolgicas, que estn disponibles en la Red


Internet.
Los ejemplares se trasladaron al laboratorio de Biologa del Instituto Tecnolgico
de Boca del Rio donde se conservan en alcohol etlico al 70% - glicerina. Se llev
a cabo la identificacin taxonmica utilizando las claves dicotmicas de
Santibez C. y Franckes O. (2013), Santibez, y Contreras (2014) adems del
uso de un Microscopio Estereoscpico (marca Optika) y fotografas. Las colectas
se realizaron en zonas secas con hojarasca, debajo de las piedras,

Figura 8. rea de estudio Alacranes de Veracruz. Orden Scorpiones.

El criterio de identificacin de ejemplares fue con base a cuatro claves


taxonmicas utilizadas por Santibaez, (2013), para ubicar familia y por Armas y
Martin-Fras, (2008), para identificar el gnero y especie.
La diversidad de la escorpiofauna encontrada est representado por las familias
Bhutidae, Scorpionidae (Diplocentridae) y Vaeojovidae (Figura 9).

129
El Agro Veracruzano 2015

Tabla 1. Caractersticas climtico agroecolgicas y colecta de datos.

Municipio Coordenadas Altitud Clima Temperatura Precipitacin Fecha de


o lugar geogrficas msnm. media C mm colecta
Soledad De Latitud 94 Clima 25.7 980.7 Marzo,
Doblado 1902'45"n tropical seco abril mayo
Longitud 2012.
09625'30"w
Capilla Latitud N 14 Clido 25.6 1,235.5 Sep. Oct.
Cotaxtla 1844'20" subhmedo 2012
Longitud O con lluvias Marzo,
9627'20" en verano abril 2013,
2014
Boca Del Latitud N 10 Clido- 25.0 1,694. Marzo,
Ro 1906'20'' regular abril mayo
Longitud O 2012, 2013,
9606'28'' 2014
La Laguna, Latitud N 10 Clido sub- 25.3 1,417.8 febrero a
Medelln 19.0375 hmedo, junio del
Longitud O con lluvias 2010 al
96.1347 en verano 2014
Los Robles, 1858'32.26"N 10 Clido sub- 25.3 1,900 Diciembre
Medelln 96 6'56.82"O hmedo, 2013-Mayo
con lluvias del 2014
en verano
Banus Latitud N 10 Clido sub- 25.0 1,694 Febrero
Residencial 1906'20'' hmedo, noviembre
Alvarado Longitud O con lluvias 2014. Casa
9606'28'' en verano
Fuente: Servicio Meteorolgico Nacional. CONAGUA Normales Climatolgicas

Resultados y discusin
Se examinaron un total de 55 organismos, del orden Scorpionida en el rea de
estudio.
La familia Bhutidae est representada por el Gnero Centruroides y cuatro
especies; la familia Vaeojovidae con un ejemplar y la Scorpionidae y subfamilia
Diplocentrinae gnero Diplocentrus sp., estn en proceso de identificacin (Tabla

130
El Agro Veracruzano 2015

Figura 9. Diversidad de alacranes en Soledad de Doblado, La Laguna, Capilla,


Los Robles, Boca del Ro, Veracruz. 2010-2014.

131
El Agro Veracruzano 2015

Tabla 2. Distribucin de especies de alacranes, por localidad en Veracruz. 2010-


2014.
Familia Gnero Especie Localidad
Buthidae Centruroides gracilis Soledad de Doblado, Boca del Ro
Los Robles, La Laguna, La Capilla, (Mpio.
Medelln)
Buthidae Centruroides infamatus La Capilla, Boca del Ro
Buthidae Centruroides ochraceus Boca del Ro
Buthidae Centruroides nigrimanus Boca del Ro
Vaejovidae Vaejovus sp Boca del Ro
Diplocentridae Diplocentrus sp Quiahuiztln, Actopan

C. gracilis est ampliamente distribuido en las localidades de estudio, sus


caractersticas principales se muestran en la Fig. 10.

Figura 10. Caracteres de Centruroides gracilis.

Las caractersticas morfolgicas distintivas por especie se ilustran en las Fig. 11,
12,13 y 14.

132
El Agro Veracruzano 2015

Figura 11. Caracteres de Centruroides infamatus.

Figura 12. Caracteres de Centruroides ochraceus.

133
El Agro Veracruzano 2015

Figura 13. Caracteres de Centruroides nigrimanus.

Figura 14. Caracteres de Vaejovis sp.

134
El Agro Veracruzano 2015

Figura 15. Caracteres de Diplocentrus sp.

Distribucin y abundancia. La Tabla 3 muestra los resultados obtenidos de este


estudio.

Tabla 3. Nmero de organismos Orden Scorpiones en el estado de Veracruz, por:


Localidad, Familia, Especie, Sexo. Perodo 2010 -2014.

Lon.tota Lon.tota
N de
l media l media
Localidad Familia Especie organismos
cm. cm.
Total
Soledad de Centruroide 18 6 1 8.2 7.6
Buthidae
Doblado s gracilis 2
La Laguna, Centruroide 3 1 2 6.4 9.1
Buthidae
Medelln de Bravo. s gracilis
Centruroide 3 1 2 6.4 9.1
s gracilis
La Capilla, Centruroide 1 1 - 6.0 -
Buthidae
Medelln de Bravo. s infamatus
C. 1 1 - 6.2 -
nigrimanus
Los Robles, Centruroide 9 3 6 7.1 7.8
Buthidae
Medelln de Bravo. s gracilis
Buthidae Centruroide 3 3 - 6.6 -
Boca del Ro
s gracilis

135
El Agro Veracruzano 2015

Centruroide 3 2 1 5.1 5.1


s
infamatus
Centruroide 2 1 1 6.0 6.8
s. ochraceus
Veajovidae S/Identificar 1 1 - 4.5 -
Residencial Banus Centruroide 8 1 7 8.9 8.6
Buthidae
Alvarado s gracilis
Centruroide 2 - 2 - 4.6
La Aguada, Alvarado Buthidae
s gracilis
Quiahuiztln, Actopan Diplocentrid Diplocentru 1 - 1 - 4.2
ae s sp
Total 55 2 3
1 4

Se examinaron un total de 55 ejemplares de las Familias Buthidae (53), Vaejovidae


(1), y Diplocentridae (1); Centruroides fue el gnero ms representativo, los
machos fueron los ms abundantes (34) que corresponde al 62%, y las hembras
(21) 38%.
Los machos tambin fueron los organismos ms grandes; y C. gracilis fue el
alacrn presente en todas las localidades, como se aprecia en la Tabla 4.

Tabla 4. Nmero de organismos de Centruroides gracilis (Buthidae) por localidad,


sexo y talla (cm): mnima media y mxima.

N de organismos Lon.total media cm. Lon.total media cm.


Localidad

Total

Min 7.5 Min 4.3


Soledad de
18 6 12 Med 8.2 Med 7.6
Doblado
Max 9.2 Max 9.7
Min Min 8.9
La Laguna,
3 1 2 Med 6.4 Med 9.1
Medelln de Bravo.
Max Max 9.2-
Min Min 8.5
La Capilla,
3 1 2 Med 8.4 Med 9.8
Medelln de Bravo.
Max Max 11-
Min 6.8 Min 4.0
Los Robles,
9 3 6 Med 7.1 Med 7.8
Medelln de Bravo.
Max 7.4 Max 9.5

136
El Agro Veracruzano 2015

Min 6.0 Min


Boca del Ro 3 3 0 Med 6.6 Med
Max 7.0- Max -
Min Min 5.0
Residencial Banus, Alvarado 8 1 7 Med 8,9 Med 8.6
Max Max 10-
Min Min 3.5
La Aguada, Alvarado 2 - 2 Med Med 4.6
Max - Max 5.7
Min 6.0 Min 3.5
TOTAL 44 15 31
Med 7.6 Med 8.0

Se examinaron 46 ejemplares de C gracilis, 15 hembras., con tallas de 6.4 a. 9.2


cm, y 31 machos de 3.5 a 11cm. Los ejemplares ms grandes fueron capturados en
la Capilla y Soledad de Doblado, aunque 8 se colectaron en casas de Residencial
Banus, zona habitacional recin creada.
Para C. infamatus se examinaron 4 ejemplares, 3 hembras, con tallas de 4.6 a 6.0
cm, colectadas en Boca del Rio, y un macho de 6.0 cm, capturado en La Capilla,
Cotaxtla, la Tabla 5 muestra los resultados.

Tabla 5. Nmero de organismos de C. infamatus, C, ochraceus C. nigrimanus


(Buthidae) por localidad, sexo y talla (cm): mnima media y mxima. Edo. Veracruz.

N de organismos Lon.total media cm. Lon.total media cm.


Localidad
Total
Centruroides infamatus
Min 4.6 Min
Boca del Ro 3 2 1 Med 5.1 Med 5.1
Max 5.5- Max

La Capilla, 1 1 - Med 6.0


Min 4.6 Min
GLOBAL 4 3 1 Med 5.4 Med 5.1
Max 6.0 Max
Centruroides ochraceus

2 1 1 6.0 6.8

Centruroides nigrimanus
La Capilla Medelln 1 1 - 6.2

137
El Agro Veracruzano 2015

Tabla 6. Organismos Diplocentrus sp y Vaejovis sp por localidad, sexo y talla.


Veracruz.

N de organismos Lon.total media cm. Lon.total media cm.


Localidad
Total
Centruroides infamatus
Min 4.6 Min
Boca del Ro 3 2 1 Med 5.1 Med 5.1
Max 5.5- Max
La Capilla, 1 1 - Med 6.0
Min 4.6 Min
GLOBAL 4 3 1 Med 5.4 Med 5.1
Max 6.0 Max
Centruroides ochraceus
Boca del Ro 2 1 1 6.0 6.8
Centruroides nigrimanus
La Capilla, Medelln 1 1 - 6.2

La distribucin de alacranes en el rea de estudio se ilustra en la Figura 16.

Figura 16. Biodiversidad de Alacranes en Soledad de Doblado, Los Robles, Boca


del Ro, La Laguna, La Capilla, Veracruz. 2010-2014

138
El Agro Veracruzano 2015

En la misma Tabla se dan los datos de C. ochraceus colectados en Boca del Ro.
Hembra y macho de 6.0 y 6.8 cm respectivamente, con fecha de colecta, Marzo
2014. Los organismos restantes con un solo ejemplar fueron Diplocentrus sp. y
Vaejovis sp, los cuales se muestran en la Tabla 6.

Conclusiones
La diversidad de la escorpiofauna, en las localidades La Laguna, Los Robles, La
Capilla, Boca del Ro y Soledad de Doblado, Veracruz, est representada por tres
Familias: Bhutidae, Vaeojovidae y Scorpionidae (Armas y Martin-Fras, 2008), o
Diplocentridae, (Francke y Santibez, 2013).
Se identific un Gnero, Centruroides de la Familia Bhutidae y cuatro especies,
Centruroides gracilis, C. infamatus, C. ochraceus y C. nigrimanus.
Los resultados de este estudio mostraron que C. infamatus, habita en La Capilla
Municipio de Cotaxtla y en el Municipio de Boca del Ro; C. ochraceus tambin se
localiza en el Municipio de Boca del Ro, y C. nigrimanus en La Capilla,
Municipio de Cotaxtla. C. gracilis o alacrn negro se distribuye en las localidades
La Laguna, Municipio de Medelln de Bravo; La Capilla, Municipio de Cotaxtla;
Los Robles, Municipio de Medelln de Bravo; Municipio de Boca del Ro y
Municipio de Soledad de Doblado, por lo que es el alacrn ms ampliamente
distribuido en Veracruz y presenta notable variacin de coloraciones y de algunos
caracteres morfolgicos. Podemos considerar como nuevos registros para estas
localidades, las especies de alacranes mencionados.
En relacin a la Familia Vaejovidae gnero Diplocentrus, se continuar su
identificacin.
El ejemplar de la Familia Diplocentridae y Gnero Diplocentrus alacrn pequeo
con fuertes y grandes quelas, aunque se sale de nuestra rea de estudio, ya que fue
colectado en Quiahuiztln, Actopan, se continuar con su identificacin.
Centruroides gracilis es una especie no peligrosa para el hombre, mientras que
Centruroides infamatus si se considera peligrosa.
Se hace necesario impulsar y fortalecer este tipo de estudios, que nos permitan
ampliar el conocimiento sobre la biodiversidad de los diferentes taxa en la regin.

Literatura Citada

Armas, L. F. De y E. Martn. F., 2003. Nueva especie de Centruroides Marx, 1890


(Scorpiones: Buthidae) del Estado de Veracruz, Mxico. Rev. Ibrica Aracnol., 7:
205-209.
139
El Agro Veracruzano 2015

Armas, L. F. De y E. Martn-Fras, 2004. Nueva especie de Diplocentrus Peters, 1861


(Scorpionidae: Diplocentrinae) de Veracruz, Mxico. Rev. Ibrica Aracnol., 9:
103-106.
Armas, L. F. De, C. R. Beutelspacher y E. Martn F., 1995. Notas sobre la taxonoma de
algunos Centruroides (Scorpiones: Buthidae) de Mxico. Rev. Nic. Ent. 32: 29-43.
Armas, L. F. De, E. Martn-F. y P. Berea, 2004. Nuevo Diplocentrus Peters, 1861
(Scorpionidae: Diplocentrinae) del estado de Veracruz, Mxico. Rev. Ibrica
Aracnol., 10: 275-280.
Armas, L. F., E. Martn. F. y J. Estvez-R., 2003. Lista anotada de las especies mexicanas
del gnero Centruroides Marx, 1890 (Scorpiones: Buthidae). Rev. Ibrica
Aracnol., 8: 93-98.
Armas, L.F., Martn-F., 2008. El gnero Centruroides Marx, 1890. (Scorpiones: Buthidae)
en el estado de Veracruz, Mxico. Bol. S.E.A., 41: 313-319.
Beutelspacher, B. C. R., 2000. Catlogo de los alacranes de Mxico. Universidad
Michoacana de San Nicols de Hidalgo, Morelia, Michoacn. 175 p.
Biotecnologa: la nueva generacin de antivenenos de alacrn. Agencia Informativa
Conacyt, Disponible en:
http://conacytprensa.mx/index.php/tecnologia/biotecnologia/508-reportaje.1 de
diciembre de 2014
Castillo, P. J., Esperanza V.D., ctor J.R., Enrique, E. L.-L., Mnica E. R.T. 2007.
Distribucin Geogrfica del Alacranismo en el Estado de Guanajuato Acta
Universitaria. Vol. 17, no. 2: 12-18.
Contreras, F.G.A, 2013. Clave para los grupos del gnero Vaejovis C. L. Koch, 1836.
Diversidad e identificacin de arcnidos de Mxico. Curso tericoPrctico. Fac.
Cien. Inst. Biol UNAM. 66-67.
Fet, V., W. D. Sissom, G. Lowe y M. E. Braunwalder. 2000. Catalog of the scorpions of
the world (1758- 1998). The New York Entomological Society. New York. 690 p.
Francke, O. F. 1977. Scorpions of the genus Diplocentrus from Oaxaca, Mexico
(Scorpionida, Diplocentridae). Journal of Arachnology., 4: 145-200.
Francke, O. F. 2010. Arcnidos y Aracnidisimo en Mxico. Disponible en:
http://www.Ibiologia.unam.mx/html/main.html. Accesado 30 de octubre de 2013.
Gua para reconocer a un alacrn txico en Mxico. ww.ibiologia.unam.mx/html/guia.html
Hoffman, A., 1997. El Maravilloso mundo de los Arcnidos. Fondo de Cultura Econmica
(La Ciencia para Todos). Segunda Edic., Mxico, D.F., 166 pp.
Hoffman, A., 1997. Los alacranes, mitos y realidades. El Maravilloso mundo de los
Arcnidos. Fondo de Cultura Econmica (La Ciencia para Todos). Segunda Ed.
Mxico, D.F., 166 pp. Disponible en:
http://bibliotecadigital.ilce.edu.mx/sites/ciencia/volumen3/ciencia3/116/html/sec_
7.html
http://smn.cna.gob.mx/emas/catalogo/VERACRUZob.html
http://www.epidemiologia.salud.gob.mx/doctos/infoepid/vig_epid_manuales/21_2012_Ma
nual_Pic_Alacran_vFinal_3dic12.pdf
Mille P. S. R., M. De J. Parra A., y A. Prez Ch., 1993. Gua para la identificacin de
Invertebrados. Ed. Trillas, Mxico, 465pp.
140
El Agro Veracruzano 2015

O. Francke, O. F., C.E. Santibez, L. 2013. Scorpiones. Clave para las familias de
escorpiones distribuidos en Mxico. Diversidad e identificacin de arcnidos de
Mxico. Curso tericoPrctico. Fac. Cien. Inst. Biol.- UNAM.61-62.
Santibez, L. C. E., G. Contreras, 2014. Orden Scorpiones C. L. Koch, 1837. Diversidad e
identificacin de arcnidos de Mxico. Curso tericoPrctico. Fac. Cien. Inst.
Biol. UNAM.62-63-
Santibez, L. C.E. 2013. Clave para la determinacin de especies del genero Centruroides
Marx, 1890 de importancia mdica en Mxico. Diversidad e identificacin de
arcnidos de Mxico. Curso tericoPrctico. Fac. Cien. Inst. Biol- UNAM.64-65.
Secretara de Salud, 2012. Manual de Procedimientos Estandarizados para la Vigilancia
Epidemiolgica de la Intoxicacin por Picadura de Alacrn. IEPSA. Mxico,
55pp.
Secretara de Salud, 2012. Manual de Procedimientos Estandarizados para la Vigilancia
Epidemiolgica de la Intoxicacin por Picadura de Alacrn. IEPSA. Mxico, 55pp.
Disponible en:
Servicio Meteorolgico Nacional. Conagua Normales Climatolgicas

141
El Agro Veracruzano 2015

10
APLICACIN DE EXTRACTOS ETANLICOS DE Tagetes erecta L. y
Tanacetum parthenium L. PARA EVALUAR LA ACTIVIDAD FUNGICIDA

Luis Felipe Jimnez Cruz, Carlos Alberto Cruz Cruz, Marina GuevaraValencia

Facultad de Ciencias Qumicas, Universidad Veracruzana. Prolongacin de oriente 6 N


1009, Col. Rafael Alvarado, Orizaba, Ver.
Resumen
1. Como consecuencia de la coevolucin de las plantas con microorganismos
patgenicos han desarrollado diferentes barreras de defensa, cuyo fin es detener el
ataque de agentes patgenos o contrarrestar el grado de la infeccin.
2. Evaluar la actividad fungicida in vitro de extractos etanlicos de T. erecta L. y T.
parthenium L.
3. Se obtuvieron extractos etanlicos y se aplicaron en diferentes concentraciones al
medio de cultivo para evaluar su efecto sobre los hongos fitopatgenos: Fusarium
ventricosum, Sclerotium rolfsii Sacc y Alternaria sp., comparandolos contra un
tratamiento testigo.
4. Los resultados indican que los extractos de T. erecta L. (165.93 mgmL-1) y T.
parthenium L. (124.6 mgmL-1) inhiben en un 100% el crecimiento micelial de los
tres hongos.
5. Estos resultados representan una alternativa en el control de hongos fitopatgenos
de importancia agrcola. Adems la evaluacin del crecimiento micelial se realiz
tomando fotografas digitales cuando los hongos alcanzaron su mximo
desarrollo. Se analizaron con el software de acceso libre ImageJ versin 1.45,
para calcular el porcentaje de inhibicin
Palabras clave: combate biolgico, extractos vegetales, cempaschil y flores de santa
mara

Introduccin
El ataque de fitopatgenos es una condicin desfavorable que generalmente activa
una serie de mecanismos de defensa cuyo fin es detener, aminorar o contrarrestar
la infeccin. El proceso coevolutivo planta-patgeno ha permitido el desarrollo de
un sistema de defensa complejo y variado, que abarca la produccin de metabolitos
142
El Agro Veracruzano 2015

secundarios con actividad antimicrobiana, conocidos como fitoprotectores. Los


fitoprotectores se clasifican en constitutivos e inducibles (Montes, 2009; Madriz,
2002).
Los fitoprotectores constitutivos son conocidos comnmente como anticipinas y se
definen como metabolitos secundarios preformados, con actividad antimicrobiana
in vitro; estos productos se pueden encontrar tanto en su forma activa o pueden ser
activados fcilmente a partir de un precursor. La activacin de fitoanticipinas a
menudo involucra enzimas vegetales liberadas debido al dao fsico ocasionado
por un agente abitico o por el ataque de un patgeno. Los fitoprotectores
inducibles son comnmente conocidos como fitoalexinas; estos metabolitos se
encuentran ausentes, o en concentraciones muy bajas, en plantas sanas, pero su
biosntesis y su acumulacin se incrementa dramticamente en respuesta a
condiciones de estrs bitico o abitico (Cruz-Cruz, 2011).
Las plantas destinan una cantidad significativa del carbono asimilado y de
energa a la sntesis de una amplia variedad de molculas orgnicas que no parecen
tener una funcin directa en procesos fotosintticos, respiratorios, asimilacin de
nutrientes, transporte de solutos o sntesis de protenas, carbohidratos o lpidos, y
que se denominan metabolitos secundarios, tambin denominados productos
secundarios o productos naturales. Los metabolitos secundarios tienen diversas
funciones dentro de la planta como es la interaccin con el medio ambiente que la
rodea, en la respuesta de defensa de las plantas, restringiendo la invasin y/o
matando directamente al microorganismo patgeno, o bien, por su capacidad
antioxidante contribuyen al mantenimiento del estado de xido-reduccin de la
clula (valos et al., 2009; Seplveda et al., 2003).
As mismo, actan como agentes alelopticos (sustancias liberadas por las plantas
para provocar efectos sobre otras que crecen alrededor de ellas), para atraer a
polinizadores o a los dispersadores de semillas. El reconocimiento de estas
importantes propiedades biolgicas de muchos metabolitos secundarios ha
permitido el desarrollo de este campo en la bsqueda de nuevas antibiticos,
insecticidas, fungicidas y herbicidas. Estos se pueden clasificar, de acuerdo a un
criterio biosinttico, de forma general en terpenos y terpenoides, compuestos
fenlicos como los fenilpropanoides y sus derivados y los compuestos
nitrogenados o alcaloides, todos ellos, fabricados a partir del CO2 como fuente de
carbono (Guarnizo et al., 2009).
La actividad biolgica que presentan los aceites esenciales y los extractos
vegetales, se debe a la accin que ejercen los diferentes metabolitos que los
conforman. Algunos metabolitos secundarios ejercen efecto de sinergismo entre
estos, lo que da lugar a una actividad biolgica mayor en comparacin a los
componentes aislados. A menudo se observa que los aceites esenciales son

143
El Agro Veracruzano 2015

considerablemente ms eficaces que los compuestos puros derivados de ellos


(Bertoni, 2012).
Esto nos indica que los componentes de menor concentracin tambin contribuyen
a la actividad repelente y refleja la importancia de la composicin de la mezcla de
metabolitos secundarios. Se ha sugerido que esto se debe al hecho de que las
plantas generalmente presentan defensas como un conjunto de compuestos, no
como unidades individuales. En consecuencia, los constituyentes menores que se
encuentran en un bajo porcentaje pueden actuar como sinergistas, para mejorar la
eficacia de los principales componentes a travs de una variedad de mecanismos
(Nerio et al., 2010; Bertoni, 2012).
El cempazchil (Tagetes erecta) es una planta ampliamente utilizada por la
medicina tradicional en distintas partes de la Repblica Mexicana. Se utiliza en
forma de infusin principalmente en padecimientos digestivos en los estados de
Chiapas, Estado de Mxico, Puebla, Tlaxcala, y Veracruz [1]; para la fiebre en
Yucatn, Tabasco, Oaxaca y Veracruz; para la tos en Tabasco y Guerrero as como
para tratamientos culturales como "espanto", "mal aire" y "susto" en Puebla, y
Oaxaca. Tambin se ha reportado el uso de las flores para tratar enfermedades de
la piel (Maity et al., 2011) [1].
Del mismo modo se ha reportado su uso contra el dolor de muelas, contra
enfermedades de tipo respiratorio; contra dolor de cabeza, como afrodisiaco,
aperitivo, carminativo, diafortico, diurtico, infeccin de ojos, remedio para el
rin, remedio para malaria, regulador del flujo menstrual, relajante muscular,
rituales religiosos y como estimulante (Osuna et al., 2005. Serrato, 2010).

Tabla 1. Actividad biolgica presentada en Tagetes erecta L. (Osuna et al., 2005)


Extracto o compuesto de la planta. Actividad biolgica Modelo biolgico
Hidroalcohlico de partes areas. Antibacteriana Staphylococcus aureus,
Bacillus subtilis.
Metanlico de raz y de la flor. Antibacteriana Staphylococcus aureus,
Escherichia coli.
Antifngica Candida albicans.
Etanlico de hoja. Antibacteriana Shigella dysenteriae,
Salmonella enteritidis.
Aceite esencial. Antibacteriana Pseudomona aeruginosa,
Staphylococcus aureus,
Escherichia coli.
Antifngica Candida albicans.

El cempazchil posee dos importantes actividades biolgicas; antibacteriana y


antifngica tanto a nivel de extracto como el aceite esencial de la planta. En la

144
El Agro Veracruzano 2015

Tabla 1 se describe la actividad biolgica presentada sobre diferentes modelos


biolgicos.
Se han realizado diversos estudios que confirman la actividad biolgica sobre una
gran variedad de microorganismos que provocan diversas enfermedades de
importancia para la salud humana (Osuna et al., 2005).
En la agricultura orgnica, las plantas de cempazchil se utilizan en diversas
formas, como es en la elaboracin de abono orgnico para la tierra de cultivo, no
slo para mejorar la calidad del suelo, sino tambin para controlar nemtodos en
cultivos de pia, fresa, papa, gladiolas, en general, en reas hortcolas y florcolas
afectados por ese tipo de plagas. Tambin se pueden aplicar extractos acuosos y
polvos de diferentes partes de la planta (races, tallos, hojas e inflorescencias o
toda la planta) para repeler o matar insectos y como nematicida o nematosttico,
segn el caso, para cultivos en pie o para granos almacenados (Serrato, 2004;
Osuna et al., 2005).
Las concentraciones de los metabolitos secundarios presentes en las plantas varan
de acuerdo a diferentes factores agroecolgicos a las que fue expuesta la planta
durante su crecimiento, como lo son: las condiciones climticas (temperatura,
luminosidad, humedad relativa, precipitaciones), la calidad nutrimental y pH del
suelo, la altitud en donde se encuentra, edad, la parte de la planta empleada para la
extraccin, etc.
Sefidkon et al. (2004), de T. erecta reporta 33 componentes identificados en el
aceite esencial extrado de hojas y tallos obtenido por hidrodestilacin y 34
componentes en el aceite esencial de las flores (Tabla 2); el material vegetal
utilizado fue cultivado en el Jardn Botnico Nacional de Irn. Los componentes
principales registrados son: - cariofileno (8.5 y 35.2%), terpinoleno (18.4 y
6.3%), (E)- ocimenona (12.6 y 9.8%), (Z)- - ocimeno (10.4 y 13.7%),
piperitenona (10.4 y 2.6%), (Z)- ocimenona (5.5 y el 7.7%) y limoneno (6.2 y
2.5%) en aceite esencial de hojas y tallos y flores respectivamente.
A partir de planta fresca procedente de Egipto, Balbaa et al., (2008); identific en
el aceite esencial 15 constituyentes qumicos y con mayor concentracin piperitona
(46.19%), seguido de terpinoleno (10.26%) y D- limoneno (9.49%).
En la medicina tradicional el uso ms frecuente que se registra de la hierba de
Santa Mara o tambin conocida como manzanilla grande (Tanacetum parthenium)
es para diversos malestares propios de la mujer. En los estados de Chiapas,
Oaxaca, Guerrero, Morelos, Mxico, Tlaxcala y Veracruz se toma la infusin de
las ramas o de las flores para aliviar trastornos de la menstruacin, como
emenagogo y antiespasmdico. Entre los mixes, zapotecos y totonacos tambin es
comn su uso para hacer "limpias" o "barridas" en diversas enfermedades de
filiacin cultural como es en el caso del "mal de ojo" [2]. En otras partes de la

145
El Agro Veracruzano 2015

Repblica Mexicana, se toma la infusin para la prevencin de la migraa,


controlar el reumatismo y las infecciones gastrointestinales (Oropeza, 2006).
En el caso de la composicin de los extractos de la hierba de Santa Mara, tenemos
que las diferentes partes de la planta (hojas, raz y tallos) contienen una cantidad
variable de metabolitos secundarios. As se tiene que las flores cuentan con 0.02 -
0.07% de aceite esencial, los componentes con mayor concentracin son: alcanfor,
borneol, derivados de - pineno, acetato de crisantenil, germacreno, farneseno y
sus steres (Barnes et al. 2002; LaGow B., 2004).
Faraz et al. (2007) reporta 20 compuestos identificados en el aceite esencial obtenido de las
races (Tabla 3). El aceite esencial fue obtenido mediante el mtodo de hidrodestilacin.
Las races fueron recolectadas de las Fincas de Investigacin del Instituto de Plantas
Medicinales, Karaj, Irn. El compuesto con mayor concentracin fue el alcanfor (30.2%),
seguido de acetato de crisantenil (26.5%), - farneseno (11.1%) y espatulenol (8.2%).
Por otra parte, Haziri et al. (2009) reporta 22 compuestos identificados en el
aceite esencial de T. parthenium L. (Tabla 4). El aceite esencial fue obtenido
mediante hidrodestilacin utilizando las partes areas de la planta.

Tabla 2. Composicin qumica del aceite esencial de T. erecta (Sefidkon et al., 2004).

Componentes Hojas y Flores Componentes Hojas y Flores


tallos (%) (%) tallos (%) (%)
- Tujeno t - Cimeno-8-ol 0.6
- Pineno 0.3 t Terpinen-4-ol 0.2
Canfeno t t - Terpineol 0.3
Sabineno 0.5 0.3 Verbenona 0.2
- Pineno t t ()- Ocimenona 5.5 7.7
Mirceno 0.1 0.2 ()- Ocimenona 12.6 9.8
- Felandreno 0.3 t Piperitona 4.2 0.6
- Terpineno t t Acetato de lavandulilo 0.2
- Cimeno t t Piperitenona 10.4 2.6
Limoneno 6.2 2.5 - Bourboneno 0.2
()- - Ocimeno 0.9 1.7 - Cariofileno 8.5 35.2
- Terpineno t t ()- - Farneseno 1.2 0.4
Terpinoleno 18.4 6.3 - Humuleno 0.7
Linalol 0.3 1.2 Germacreno 3.0 4.1
Fenchol 2.6 1.9 Biciclogermacreno 1.6 2.1
t- Men-2-en-1-ol 0.4 0.4 - Cadineno 0.2
Terpinen-1-ol 1.7 2.4 Espatulenol 0.3
()- Tagetona 2.2 1.3 xido de cariofileno 0.2 1.2
()- Tagetona 3.7 1.5 T- Muurolol 0.3
t: menos de 0.05%

146
El Agro Veracruzano 2015

Tabla 3. Composicin del aceite esencial de la raz de T. parthenium (Faraz et al.,


2007).

Componente % Componente %
Hexanal 1.1 Acetato de isotujil 0.1
1- Hexanol 1.7 Acetato de bornilo 3.1
- Pineno 0.3 Carvacrol 0.2
- Mirceno 0.8 7- Benzofuranol 1.3
- Cimeno 0.3 - Cariofileno 0.4
Fenchona 1.5 - Farneseno 11.1
Canfeno 30.2 - Bisaboleno 0.1
Borneol 0.1 Angelato de bornilo 3.3
Isobornil formato 0.1 Espatulenol 8.2
Acetato de crisantenil 26.5 Miristato de etilo 1.8

El material vegetal utilizado fue recolectado en la provincia de Kamenica,


Kosova. El principal componente identificado fue el alcanfor (63%) y el canfeno
(9.6%).
El sistema actual de produccin agrcola demanda la utilizacin de cantidades
considerables de insecticidas y fungicidas sintticos que no son biodegradados en
su totalidad, provocando su acumulacin en el suelo, lo que genera graves
problemas de contaminacin ambiental, as como alteraciones en el ecosistema. La
bsqueda de nuevos productos que reemplacen, de manera gradual, a los productos
qumicos sintticos utilizados en la agricultura, justifica las investigaciones que se
hacen en torno a los extractos vegetales que presentan actividad biolgica sobre los
organismos responsables de enfermedades de importancia agrcola.

Tabla 4. Composicin del aceite esencial de las hojas de Tanacetum


parthenium L. (Haziri et al., 2009).

Componente % Componente %
Tricideno 0.4 Pinacarvona 0.1
- Tujeno 0.3 Borneol 0.3
- Pineno 0.5 Terpinen-4-ol 0.9
Canfeno 9.6 - Cimen-8-ol 0.8
- Pineno 0.9 - Terpineol 0.6
- Felandreno 0.6 Mirtenal 0.5
- Terpineno 0.3 Acetato de bornilo 3.0
- Cimeno 3.3 Eugenol 0.5
- Terpineno 0.4 Acetato de trans-mirtenol 0.3
Crisantenona 1.3 Isobornilo 2-metilbutanoato 0.3
Alcanfor 63.0 xido de cariofileno 0.1

147
El Agro Veracruzano 2015

La gran diversidad que tiene Mxico en cuanto a especies vegetales y la


oportunidad de su aprovechamiento como fuentes de obtencin de productos con
actividad biolgica, es motivo para la realizacin de investigaciones con el
objetivo de buscar alternativas que sustituyan gradualmente los productos
obtenidos a travs de sntesis qumica; por lo que se evalo actividad fungicida que
presentan los extractos etanlicos obtenidos de las cabezas florares de las especies
Tagetes erecta L. y Tanacetum parthenium L. frente a los hongos fitopatgenos:
Fusarium ventricosum, Sclerotium rolfsii Sacc y Alternaria sp. causantes de
enfermedades de importancia comercial.

Materiales y mtodos
Este trabajo se realiz en el Laboratorio de Productos Naturales y Microbiologa de
la Facultad de Ciencias Qumicas de la Universidad Veracruzana, en Orizaba, Ver.
La hierba de Santa Maria (Tanacetum parthenium L.) utilizada, fue cultivada en el
municipio de Huixcolotla, Pue. Por otra parte, las plantas de cempazchil (Tagetes
erecta L.) proceden de la localidad de Ojo Zarco, Nogales, Ver. Las dos especies
vegetales fueron adquiridas en el periodo Agosto Octubre del ao 2013.
Se seleccionaron las plantas que se encontraban completas, libre de dao por
microorganismos y de marchites o manchas en las inflorescencias. Se dividieron
tomando solo las cabezas florales, estas fueron separadas desechando las hojas y
los tallos, en total se emplearon 600 g, se secaron en una estufa de secado a una
temperatura de 40 C.
El extracto etanlico se realiz por maceracin durante tres das a temperatura
ambiente, protegido de la luz. Despus de este periodo, los extracto se filtraron
empleando papel filtro Whatman N 1, posteriormente se redujo el volumen en un
rotavapor marca LABOROTA 4001- efficient. Los extractos obtenidos se
conservaron en frascos color mbar a una temperatura de 5 C hasta su utilizacin.
Las cepas Fusarium ventricosum, Sclerotium rolfsii Sacc y Alternaria sp., fueron
proporcionadas por el laboratorio de Fitopatologa del Centro de productos
Biticos (CeProBi) del Instituto Politcnico Nacional, en Yautepec, Mor.
Se prepar medio de cultivo papa dextrosa agar (PDA), el cual se esteriliz en una
autoclave vertical marca Evar, durante 15 minutos a 120C (equivalente a 1.5 Kg
de presin); a continuacin, se retir el matraz de la autoclave, cuando el medio
tuvo una temperatura previa al punto de solidificacin, se distribuy en cajas Petri
estriles. Una vez solidificado el medio, con la finalidad de tener un banco de
cultivo joven, se sembraron los hongos fitopatgenos por el mtodo de colonia
gigante, a temperatura ambiente. Se incubaron a temperatura ambiente durante 7
das. La manipulacin anterior se desarroll en un campo trmico de esterilidad
148
El Agro Veracruzano 2015

empleando dos mecheros Bunsen, dentro de una campana de flujo laminar. Las
condiciones de esterilizacin y el medio de cultivo empleados se utilizaron durante
todo el trabajo experimental.
Utilizando material estril, se tom una alcuota de cinco mL de los extractos
etanlicos obtenidos de las cabezas florales de cempazchil y de la hierba de Santa
Maria, cada uno se deposit en un vaso de precipitado de 50 mL previamente
tarado, despus se procedi a evaporar a sequedad. El concentrado se pes en una
balanza analtica y por diferencia de peso se obtuvo el peso final del extracto a
utilizar, posteriormente se reconstituyeron en 10 mL de metanol para su adicin al
medio de cultivo PDA.
Para cada uno de los extractos, se prepararon cuatro matraces Erlenmeyer, cada
uno con 70 mL de PDA, se esterilizaron como ya fue indicado. Dentro de una
campana de flujo laminar, cuando el medio de cultivo se encontraba a una
temperatura que permitiera su manipulacin, previo a su punto de solidificacin, se
le adicionaron los tratamiento con los extractos de cempazchil y de la hierba de
Santa Mara de acuerdo a la Tabla 5; a continuacin se homogeniz y se distribuy
en cajas Petri estriles, realizando tres repeticiones para cada tratamiento.
Tambin se prepar un testigo nulo, al cual se adicion el mismo volumen de
etanol de los extractos, pero sin stos ltimos.

Tabla 5. Tratamientos para la inhibicin de hongos fitopatgenos.

Tratamiento Extracto Concentracin de extracto


(mL) (mgmL-1)
Testigo 1 0 0
2 1 55.3
Cempazchil 3 3 165.9
4 6 331.9
5 1 41.5
Hierba de Santa
6 3 124.6
Mara
7 6 249.3

Se utiliz un diseo completamente al azar con tres repeticiones para cada


tratamiento. Los bioensayos se realizaron utilizando el mtodo de la caja
envenenada. Los tratamientos fueron distribuidos en cajas Petri de 60 x 15 mm en
una campana de flujo laminar. Con la ayuda de un de platino se tom, del banco
de cultivo joven, una porcin de micelio de cada uno de los hongos en estudio y se
inocul, en la superficie de la caja Petri. Se evalo la accin que provocan los
diferentes tratamientos sobre su crecimiento y desarrollo. El crecimiento micelial
total se evalu hasta que este permaneciera constante. Para esto, se tomaron
149
El Agro Veracruzano 2015

fotografas digitales y se midi el rea de crecimiento que presentaba cada


tratamiento. Esto se realiz mediante la utilizacin del software de acceso libre
para el anlisis de imgenes ImageJ, versin 1.45, desarrollado por el Instituto
Nacional de la Salud Mental de Estados Unidos.
El rea de crecimiento micelial presentada por los hongos fitopatgenos, se
compar con el rea total en el cual fueron sembrados, as como contra el testigo,
para obtener el porcentaje de crecimiento. Los resultados obtenidos se analizaron
mediante el paquete estadstico Minitab versin 16. Se llevaron a cabo anlisis de
varianza y de comparacin mltiple de medias, estas ltimas mediante pruebas de
Tukey, para determinar diferencias entre tratamientos (p < 0.05).

Resultados y discusin
Las fotografas con los resultados de la inhibicin en el crecimiento micelial de los
hongos fitopatgenos Fusarium ventricosum, Sclerotium rolfsii Sacc y Alternaria
sp., fueron analizadas mediante el software ImageJ, para determinar el efecto de
la aplicacin de las diferentes concentraciones de los extractos etanlicos
obtenidos de las cabezas florales de cempazchil y de la hierba de Santa Mara,
aplicados al medio de cultivo.
Se seleccion el rea de crecimiento micelial que presentaban los hongos
fitopatgenos en los tratamientos ensayados, as como las reas totales en el que
fueron inoculados. Posteriormente se calcul el rea seleccionada. Los resultados
sealan que la aplicacin de los extractos etanlicos fueron eficientes, como una
alternativa en el manejo de los hongos fitopatgenos estudiados en este trabajo.
El aprovechamiento de estos cultivos en el rea de fitosanidad eleva el valor
agregado de estos cultivos, adems de que la aplicacin de extractos naturales
reduce la contaminacin ocasiona por productos obtenidos a partir de sntesis
qumicas.

Tabla 6. ANOVA unidireccional para la comparacin de tratamientos utilizando el


extracto etanlico de cempazchil (Testigo, T1 Alternaria, T1 Rolfsii, T1 Fusarium,
T3, T4).

Fuente GL SC CM F P
Factor 4 22015.4 5503.9 219.65 0.000
Error 10 250.6 25.1
Total 14 22266.0
S = 5.006 R-cuad. = 98.87% R-cuad.(ajustado) = 98.42%
Los resultados obtenidos, mediante el anlisis ANOVA y la comparacin mltiple
de medias utilizando el mtodo Tukey, sealan que las pruebas de inhibicin en el
150
El Agro Veracruzano 2015

crecimiento micelial se muestran diferencias estadsticas significativas en


comparacin con el resultado presentado por el tratamiento testigo (T1).
En la Tabla 6, se muestran los resultados obtenidos comparando los tratamientos
que contienen extracto etanlico de cempazchil, mediante el mtodo ANOVA.
En la Tabla 7 se pueden observar los resultados de la comparacin mltiple de
medias utilizando el mtodo Tukey, para los tratamientos que contienen extracto
etanlico de cempazchil, donde se demuestra que todos los tratamientos presentan
diferencias estadsticamente significativas.

Tabla 7. Comparacin mltiple de medias utilizando el mtodo Tukey para los


tratamientos que contienen extracto etanlico de cempaschil.
N Media Agrupacin
T3, T4 3 100.00 A
T1 Rolfsii 3 80.10 B
T1 Fusarium 3 30.57 C
T1 Alternaria 3 15.86 D
Testigo 3 0.00 E
Las medias que no comparten una letra son significativamente diferentes.

Los resultados obtenidos en las pruebas de inhibicin en el crecimiento micelial


mostraron diferencia estadstica significativas en comparacin con el resultado
presentado por los tratamientos testigos (T1). Con respecto a los cultivos donde se
adicion etanol al medio de cultivo, en todos los casos no se present inhibicin, lo
cual demuestra que los resultados obtenidos son una respuesta de los extractos
vegetales ensayados y que el etanol empleado como disolvente no ejerce ningn
efecto.

Resultados de inhibicin aplicando extracto etanlico de cempaschil.


Empleando una concentracin del extracto de cempazchil de 165.9 mgmL-1 (T3)
y 331.9 mgmL-1 (T4), se obtuvo como resultado una inhibicin del 100% sobre el
crecimiento micelial del hongo fitopatgeno Fusarium ventricosum.
Con una concentracin del extracto de 165.93 mgmL-1 (T3) y 331.8 mgmL-1 (T4),
se present igualmente la inhibicin del 100% sobre el crecimiento micelial de
Sclerotium rolfsii Sacc y Alternaria sp (Figura 1).
Se ha reportado la inhibicin del 100% en el crecimiento micelial de Sclerotium
rolfsii Sacc y Sclerotium sp., empleando extractos acuosos obtenidos mediante la
maceracin en agua destilada de los bulbos de ajo (Allium sativum) a una
concentracin del 25% (Alcal et al., 2005; Roci et al., 2012). Resultados
comparables con el obtenido en el presente trabajo, donde se inhibi el 100% del
crecimiento micelial de Sclerotium rolfsii Sacc empleando extractos etanlicos de
cempazchil a partir de una concentracin de 165.93 mgmL-1.

151
El Agro Veracruzano 2015

Lpez et al. (2008) reporta la inhibicin en un 100% en el crecimiento micelial de


Fusarium oxysporum Schlechtend. f. sp. lycopersici (Sacc.), utilizando extractos
acuosos de clavo (Syzygium aromaticum Merr.) a una concentracin del 5% y
10%. As mismo, Ramrez (2009) reporta este mismo porcentaje de inhibicin
empleando diferentes concentraciones de extracto etanlico de clavo (S.
aromaticum), semilla de guanbana (Annona muricata) y ajo (Allium sativum)
sobre Fusarium oxysporum f. sp. Gladioli; sin embargo en este trabajo se logr
igualmente la inhibicin del 100% en el crecimiento micelial de una cepa del
gnero Fusarium, definiendo el intervalo de concentracin de extracto de
cempazchil entre 165.9 y 331.9 mgmL-1 (T3 y T4), a travs de los cuales se
consigue; reportando informacin ms precisa.
Los resultados obtenidos en el presente trabajo contrasta con los reportados por
Pupo et al. (2011) ya que indican que el extracto, elaborado al 10% en masa por
percolacin con etanol al 70%, a partir de flores de cempazchil estimulan el
crecimiento de Alternaria solani. Esto es atribuible a que el material utilizado en
este trabajo proceda de un lugar geogrfico diferente as como la poca de
recoleccin, factores que inciden en la cantidad de metabolitos secundarios
presentes en cuanto a la concentracin empleada, esta influye directamente ya que
es directamente proporcional a los compuestos presentes responsables de este
efecto biolgico.

1. Fusarium
ventricosum
2. Sclerotium
rolfsii
3. Alternaria
sp

-1 -1 -1
A) Testigo B) 55.3 mgmL C) 165.9 mgmL D) 331.9 9 mgmL

Figura 1. Inhibicin micelial aplicando extractos de cempaschil.

152
El Agro Veracruzano 2015

.
En la figura 2 se presenta el anlisis de los resultados obtenidos sobre la inhibicin
en el crecimiento micelial de los hongos fitopatgenos Fusarium ventricosum,
Sclerotium rolfsii Sacc y Alternaria sp.
Se presentaron diferencias estadsticas significativas en la inhibicin del
crecimiento micelial de los tres hongos fitopatgenos utilizando 55.3 mgmL-1 del
extracto correspondiente al T2. Con respecto a S. rolfsii present un porcentaje de
inhibicin del 80.06%, F. ventricosum un 30.57% y Alternaria sp., mostro un
15.86%. Se puede observar que a mayores concentraciones la inhibicin de los tres
hongos fitopatgenos estudiados ocurre al 100%, sin embargo cuando se emplea
una concentracin de 55.3 mgmL-1, la mejor respuesta se consigue con S. rolfsii,
con un 80.06%.

Concentracin del
extracto (mgmL-1).
0

55.3

165.9

331.9

F. ventricosum S. rolfsii Alternaria sp.

Figura 2. Efecto de la inhibicin en el crecimiento micelial de los hongos


fitopatgenos, por efecto de la aplicacin del extracto etanlico de cempazchil.
Columnas que no comparten una letra son significativamente diferentes.

Resultados de inhibicin aplicando extracto etanlico de la hierba de Santa


Mara. La Tabla 8, muestra los resultados obtenidos al comparar, mediante
ANOVA, los tratamientos en los que se emplea extracto etanlico de hierba de
Santa Mara.

153
El Agro Veracruzano 2015

Tabla 8. ANOVA unidireccional para la comparacin de tratamientos utilizando el


extracto etanlico de hierba de Santa Mara (Testigo, T5 Rolfsii, T5 Fusarium, T5
Alternaria, T6, T7).

Fuente GL SC CM F P
Factor 4 224124.97 6031.24 1024.47 0.000
Error 10 58.87 5.89
Total 14 24183.84
S = 2.426 R-cuad. = 99.76% R-cuad.(ajustado) = 99.66%

En la Tabla 9 se muestran los resultados que se obtuvieron mediante el mtodo


Tukey, donde se demuestra que existen diferencias estadsticamente significativas
entre los tratamientos que se emplearon.

Tabla 9. Comparacin mltiple de medias utilizando el mtodo Tukey para los


tratamientos que contienen extracto etanlico de hierba de Santa Mara

N Media Agrupacin
T6, T7 3 100.00 A
T5 Alternaria 3 84.78 B
T5 Rolfsii 3 77.97 C
T5 Fusarium 3 15.26 D
Testigo 3 0.00 E
Las medias que no comparten una letra son significativamente diferentes.
Las pruebas de inhibicin en el crecimiento micelial realizadas, aplicando
diferentes concentraciones de los extractos etanlicos obtenidos de las cabezas
florales de la hierba de Santa Mara, mostraron diferencias significativas en
comparacin con el crecimiento micelial presentado por los tratamientos testigo
(T1). Aplicando una concentracin de 124.6 mgmL-1 (T6) y 249.3 mgmL-1 (T7), se
obtuvo un 100% en la inhibicin del crecimiento micelial de los tres fitopatgenos
estudiados (Figura 3).
Rodrguez et al. (2012), informa el efecto antifngico de los extractos
hidroalcohlicos y acuosos de la especie vegetal Acacia farnesiana, dando como
resultado un porcentaje de inhibicin en el crecimiento micelial de ms de un 90%
sobre Fusarium sp. Estos resultados son superados con los obtenidos en este
trabajo, ya que el crecimiento micelial de Fusarium ventricosum fue inhibido en un
100% empleando extractos etanlicos a una concentracin a partir de 124.6 mgmL -
1
de la hierba de Santa Mara.

154
El Agro Veracruzano 2015

1. Fusarium
ventricosum
2. Sclerotium
rolfsii
3. Alternaria
sp

-1 -1 -1
A) Testigo B) 55.3 mgmL C) 165.9 mgmL 331.9 9 mgmL
Figura 3. Inhibicin micelial aplicando extractos de hierba de Santa Mara.

Flores et al. (2006) da a conocer que el aceite esencial del rbol de Nim
(Azadirachta indica) no inhibe el crecimiento micelial de Sclerotium rolfsii Sacc, a
diferencia de los resultados positivos obtenidos con los extractos etanlicos de
cempazchil y la hierba de Santa Mara, los cuales presenta una mejor alternativa
para el control de este hongo fitopatgeno.
En la Figura 4, se presenta el anlisis de los resultados obtenidos sobre la
inhibicin en el crecimiento micelial de los hongos fitopatgenos Fusarium
ventricosum, Sclerotium rolfsii Sacc y Alternaria sp.
Se presentaron diferencias estadsticas significativas sobre la inhibicin en el
crecimiento micelial de los tres hongos fitopatgenos utilizando 41.5 mgmL-1 de
concentracin del extracto (T5). As tenemos que Alternaria sp., mostro como
resultado una inhibicin del 84.78%, S. rolfsii presento un porcentaje de inhibicin
del 77.97% y F. ventricosum tuvo un porcentaje de inhibicin del 15.29%.
Polatoglu et al. (2010) reporta actividad bactericida en el aceite esencial de T.
parthenium. El aceite esencial se extrajo de diferentes partes de la planta mediante
hidrodestilacin.

155
El Agro Veracruzano 2015

Concentracin
del extracto
(mgmL-1).
0

41.5

124.6

249.3

F. ventricosum S. rolfsii Alternaria sp.

Figura 4. Efecto de la inhibicin en el crecimiento micelial de los hongos


fitopatgenos, por efecto de la aplicacin del extracto etanlico de la hierba de Santa
Mara. Columnas que no comparten una letra son significativamente diferentes.

El material vegetal utilizado fue recolectado en dos localidades diferentes de


Turqua, las cuales son: Davutpasa, Estambul y Savsb, Ardahan. La actividad
antibacteriana de los aceites se evaluaron en cinco bacterias Gram (+) y cinco
Gram (-), mediante un ensayo de microdilucin en caldo. La actividad ms alta que
observaron fue en el Bacillus subtilis, Staphylococcus aureus y S. aureus resistente
a la meticilina, sin embargo, los aceites esenciales mostraron un valor mayor de
dosis letal media en comparacin con el control positivo. As tenemos que el aceite
extrado de las muestras de Estambul, mostraron la actividad ms alta en B. subtilis
con una dosis de 125 mgmL-1 y S. aureus resistente a la meticilina, con una dosis
de 125 mgmL-1, que es dos veces la concentracin en comparacin con el control
positivo cloranfenicol (62.4 mgmL-1). La muestra perteneciente a la localidad de
Ardahan, mostr mayor actividad en S. aureus (125 mgmL-1) que tambin es dos
veces la concentracin de cloranfenicol (62.5 mgmL-1). As mismo los dos aceites
mostraron efecto txico para Vibrio fischeri.
Shafaghat et al., (2009) obtuvieron actividad antibacteriana utilizando aceites
esenciales de T. parthenium L. Los aceites esenciales se obtuvieron mediante
hidrodestilacin de las hojas, tallos y races. La actividad antibacteriana se evalu
mediante el mtodo de microdilucin en el caldo. Los aceites mostraron efectos
inhibitorios sobre Echerichia coli y Salmonella typhi, pero no presentaron
actividad frente a Staphylococcus aureus.

156
El Agro Veracruzano 2015

Lopez et al., (2008) da a conocer actividad antifngica contra Rhizopus stolonifer


aplicando extractos de T. parthenium obtenidos a partir de acetato de etilo y
diclorometano.
Los anteriores trabajos sealan el efecto inhitorio frente a bacterias de salud
humana y empleando aceites esenciales o extractos orgnicos; a diferencia en este
trabajo se ensay los extractos etanlicos frente a hongos fitopatgenos,
demostrando la capacidad inhibitoria de la hierba de Santa Mara, en
concentraciones inferiores a 50 mgmL-1, demostrndose mayor efectividad que los
extractos de cempazchil en concentraciones semejantes.

Conclusiones
Los extractos etanlicos de las cabezas florales de cempazchil y la hierba de
Santa Mara representan una alternativa en el control de hongos fitopatgenos de
importancia agrcola, ya que desarrollan actividad fungicida in vitro contra los
hongos Fusarium ventricosum, Sclerotium rolfsii Sacc y Alternaria sp.
Aplicando los extractos etanlicos de cempazchil y la hierba de Santa Mara se
inhiben en un 100% el crecimiento micelial de los hongos fitopatgenos Fusarium
ventricosum, Sclerotium rolfsii Sacc y Alternaria sp., a partir de una concentracin
de 165.9 mgmL-1, en el caso de cempazchil, y de 124.6 mgmL-1 para la hierba de
Santa Mara.
El extracto etanlico de cempazchil. mostr tener una mayor actividad fungicida
sobre el hongo Sclerotium rolfsii Sacc. Por otro lado, el extracto etanlico de la
hierba de Santa Mara present una mayor actividad fungicida sobre el hongo
Alternaria sp.
El software de acceso libre ImageJ, versin 1.45, es una herramienta que permite
evaluar en forma rpida y precisa el crecimiento micelial para determinar los
porcentajes de inhibicin.

Literatura Citada

Alcal De Marcano, D., Vargas, N., Pire, A. 2005. Efecto de extractos vegetales y
fungicidas sintticos sobre el crecimiento micelial in vitro de Sclerotium rolfsii y
Thielaviopsis basicola. Rev. Fac. Agron. (LUZ). 22: 315-323.
valos Garca, A., Prez Urria, C. E. 2009. Reduca (Biologa). Serie Fisiologa Vegetal.
2(3): 119-145.
Balbaa, L. K., El Aziz, N. G. A., Youssef, A. A. 2008. Physiological Effects of
Stigmasterol and Nicotinamide on Growth, Flowering, Oil Yield and Some
Chemical Compositions of Tagetes erecta L. Plant. Journal of Applied Sciences
Research, 3(12): 1936-1942

157
El Agro Veracruzano 2015

Barnes, J., Anderson, L.A., Phillipson, J.D. 2002. Herbal Medicines, 2nd ed.
Pharmaceutical Press. London. pp. 212.
Bertoni, O. A. 2013. Insecticida natural para el control de Musca domestica en base a
aceites esenciales y sus componentes. Universidad Catlica de Crdoba.
Argentina. pp. 18, 26.
Cruz-Cruz, C. A., Pea-Rodrguez, L. M. 2011. Phytoprotectants and phytotoxins. The role
of natural products in the Musa spp.- Mycosphaerella fijiensis infectious process.
In: Bananas: Nutrition, Diseases and Trade Issues. Nova Sciencie Publishers, Inc.
pp. 263-278.
Faraz, M., Sayyed Abbas, T., Hasanali, N.B., Bahman, N., Fahima G. 2007. Essential Oil
of the Root of Tanacetum parthenium (L.) Schulz. Bip. (Asteraceae) from Iran.
Iranian Journal of Pharmaceutical Research. 6 (4). pp. 291-293.
Flores, Y., Mujica, Y., Rondn, A. 2006. Evaluacin in vitro de tres controladores del
hongo Sclerotium rolfsii. Memoria de la Fundacin La Salle de Ciencias Naturales
2007, 166: 141-149.
Guarnizo F. A., Martnez Y, P. N. 2009. Qumica orgnica - Con enfoque en ciencias de la
vida. Colombia. pp. 4.
Haziri A., Govori Odai, S., Ismaili, M., Faiku, F., Haziri, I. 2009. Essential Oil of
Tanacetum parthenium (L.) from East Part of Kosova. American Journal of
Biochemistry and Biotechnology. Republic of Kosova. pp. 226-228.
LaGow B. (ed). 2004. PDR for Herbal Medicine. 3rd ed. Thomson. USA. pp. 320.
Lopez, V., Akerreta, S., Casanova, E., Garcia Mina, J. M., Cavero R. Y., Calvo, M. I. 2008.
Screening of Spanish Medicinal Plants for Antioxidant and Antifungal Activities.
Pharmaceutical biology. V. 46, no. 9. pp. 602-609.
Madriz Ordeana, K. 2002. Mecanismos de defensa en las interacciones planta-patgeno.
Manejo integrado de plagas (Costa Rica) No. 63 p. 22-32.
Maity, N., Nema, N. K., Abedy, Md. K., Sarkar, B. K., Mukherjee, P. K. 2011. Exploring
Tagetes erecta Linn flower for the elastase, hyaluronidase and MMP-1 inhibitory
activity. Journal of ethnopharmacology. 11, v. 137, no. 3 Elsevier Ireland Ltd. pp.
1300-1305.
Montes-Belmont, R. 2009. Diversidad de compuestos qumicos producidos por las plantas
contra hongos fitopatgenos. Revista mexicana de micologa 29: 73-82.
Nerio L. S., Olivero Verbel, J., Stashenko E. 2010. Repellent activity of essential oils: A
review. Bioresource Technology 101 (1): 372-378.
Oropeza D. I. 2006. Estudio etnobotnico de plantas medicinales de Tunititlan, Hgo. y
evaluacin antibacteriana de la especie vegetal mas empleada en el tratamiento de
enfermedades de etiologa infecciosa. Universidad Autnoma Metropolitana.
Unidad Iztapalapa. pp. 33.
Osuna-Torres, L., Tapia Prez, M.E., Aguilar Contreras, A. 2005. Plantas medicinales de la
medicina tradicional mexicana para tratar afecciones gastrointestinales: estudio
etnobotnico, fitoqumico y farmacolgico. Universidad de Barcelona. Espaa. pp.
120, 121.
Pavela, R., Sajfrtovb, M., Sovovb, H., Brnetc, M., Karbanb, J. 2010. The insecticidal
activity of Tanacetum parthenium (L.) Schultz Bip. extracts obtained by

158
El Agro Veracruzano 2015

supercritical fluid extraction and hydrodistillation. Industrial Crops and Products.


Volume 31, Issue 3. Pages 449454.
Polatoglu K., Demirci F., Demirci B., Gren N., Can Baser K. H. 2010. Antibacterial
activity and the variation of Tanacetum parthenium (L.) Schultz Bip. Essential oils
from Turkey. Journal of Oleo Science. Japan Oil Chemists Society. 59, (4) 177-
184.
Pupo Blanco, Y. G., Kalombo Bicayi, D., Herrera Isla, L., Malheiros de Mendonca, D. I.,
Vargas Batis, B. 2011. Efecto de extractos vegetales en el crecimiento y
germinacin de esporas de Alternaria solani (E. & M.) J. & G. en condiciones in
vitro. Rev Iberoam Micol. 28(1):60.
Ramrez Guerrero, Kareni. 2009. Actividad antifngica in vitro de extractos vegetales
inhibidores de Fusarium oxysporum f. sp. Gladioli y Curvularia f. sp. Gladioli.
Trabajo recepcional modalidad Tesis. Qumica Industrial. Orizaba, Ver. pp.1.
Roco Chvez, A.; Aquino Jara, A. S. 2012. Control de los hongos del suelo Rhizoctonia
sp., Fusarium sp. y Sclerotium sp. con extractos vegetales. Investig. Agrar.
14(1):17-23.
Rodrguez Pedroso, A. T., Ramrez Arrebato, M. A., Bautista Baos, S., Cruz Triana, A.,
Rivero, D. 2012. Actividad antifngica de extractos de Acacia farnesiana sobre el
crecimiento in vitro de Fusarium oxysporum f. sp. lycopersici. Revista Cientfica
UDO Agrcola 12 (1): 91-96.
Sefidkon, F., Salehyar, S., Mirza, M., Dabiri, M. 2004. The esencial oil of Tagetes erecta
L. occurring in Iran. Flavour and fragrance journal. 19: 579-581.
Seplveda Jimnez, G., Porta Ducoing, H., Rocha Sosa, Mario. 2003. La participacin de
los metabolitos secundarios en la defensa de las plantas. Revista Mexicana de
Fitopatologa. Mxico. Vol. 21, nmero 003. pp. 355-363.
Serrato Cruz. M. A. 2010. Recopilacin y anlisis de la informacin existente de las
especies de las que Mxico es centro de origen y diversidad gentica.
Departamento de fitotecnia. Universidad Autnoma Chapingo. pp. 6, 9-11, 24, 29-
32, 34-36.
Shafaghat A., Sadeghi H., Oji K. 2009. Composition and antibacterial activity of essential
oils from leaf, stem and root of Crysanthemum parthenium (L.) Natural product
communications. Jun; 4 (6): 859-860.
Referencias Electrnicas
1. http://www.medicinatradicionalmexicana.unam.mx/monografia.php?l=3&t=Taget
es%20erecta&id=7343 Consulta: 19/11/13.
2. http://www.medicinatradicionalmexicana.unam.mx/monografia.php?l=3&t=Tanac
etum%20parthenium&id=7488. Consulta: 17/12/13.

159
El Agro Veracruzano 2015

11
EFECTO DE EXTRACTOS ETANLICOS DE Piper auritum KUTH
SOBRE Anastrepha ludens LOEW

Mara Luisa1Vzquez Vzquez1, Marycruz Abato Zrate2, Noel Reyes Prez3,


Francisco Daz Fleischer4, Fernando Rechy Gmez5.
1
Ingeniero Agrnomo. Facultad de Ciencia Agrcolas. Universidad Veracruzana Campus
Xalapa
2
Doctora en Ciencias. Profesor de Tiempo Completo de la Universidad Veracruzana.
Candidata del Sistema Nacional de Investigadores.
3
Doctor en Ciencias. Profesor de Tiempo Completo de la Facultad de Ciencias Agrcolas.
Universidad Veracruzana.
4
Doctor en Ciencias. Investigador de Tiempo Completo. Laboratorio de Biotecnologa y
Ecologa Aplicada de la Universidad Veracruzana. Investigador Nivel 2 en el SNI.
5
Maestro en Ciencias. Profesor de la Facultad de Ciencias Agrcolas. Universidad
Veracruzana.

Resumen

1. Marco terico. En Veracruz existe una enorme diversidad de plantas, algunas de


ellas como Piper auritum (acuyo), presentan actividad insecticida, por lo que son
candidatos a ser usados contra plagas agrcolas y sustituir a los plaguicidas ms
txico como el malatin, el cual es el ms utilizado en el combate de Anastrepha
ludens (mosca mexicana de la fruta), cuya gran importancia no solo es por el dao
que causa mermando la produccin de ctricos y otros cultivos, sino por el cierre
de mercados internacionales debido a que se encuentra cuarentenada para muchos
pases.
2. Objetivo. El presente trabajo se realiz con la finalidad de encontrar alternativas
biorracionales para el control de Anastrepha ludens Loew (mosca mexicana de la
fruta) empleando extractos de P. auritum (acuyo) considerando su capacidad
como biocida.
3. Mtodo. Se colectaron hojas de P. auritum en Vista Hermosa, Municipio de
Jilotepec, Ver. El material fue herborizado e identificado en la Facultad de
Biologa, Xalapa-UV. Las hojas se secaron en una estufa a 40 C, se molieron,
reposaron en etanol (96%) y concentraron con el rotavapor. El experimento se
llev a cabo en el Laboratorio de Parasitologa y Control Biolgico, bajo
condiciones controladas. Los tratamientos fueron: etanol al 96% (T1), testigo

160
El Agro Veracruzano 2015

comercial Malatin (T2) en dosis recomendada por el fabricante y diferentes


diluciones del extracto, 100% concentracin base (T3), 10% (T4), 1% (T5), 0.1%
(T6) y 0.01% (T7). Se evalu el efecto sobre A. ludens, va alimenticia
incorporando los diferentes tratamientos a 1 g de azcar (previas 24 horas de
ayuno), colocando por jaula 25 hembras y 25 machos con cuatro repeticiones. Se
evalu el porcentaje de mortalidad a las 24, 48, 72, 96 y 120 horas.
4. Resultados. La mortalidad fue estadsticamente diferente entre el T2 (76.28%) y
los dems tratamientos (T1 5.19%, T3 7.38%, T4 4.60%, T5 15.72%, T6 5.24% y
T7 11.16%) (=0.05). Es decir, todas las concentraciones de extracto etanlico de
P. auritum tuvieron baja mortalidad, resultando semejantes estadsticamente al
testigo con etanol.
5. Relevancia. Aunque los resultados obtenidos no permiten considerar a los
extractos de P. auritum como un sustituto del malatin como insecticida por va
alimenticia, en resultados preliminares contiguos al presente trabajo ha mostrado
su capacidad de inhibicin de la oviposicin sobre el fruto.

Palabras clave. Principios activos, bioplaguicida, va alimenticia.

Abstract

1. Theoretical Framework. In Veracruz there is a big diversity of plants, some


of them as Piper auritum (acuyo), exhibit insecticidal activity, so they are
candidates to be used against agricultural pests and replace the more toxic
pesticides such as malathion, which is the most used in combating of
Anastrepha ludens (mexican fruit fly), which is important not only for the
damage to production of citrus and other crops, but the closure of
international markets because it is quarantined for many countries.
2. Objetive. This work was performed in order to find alternatives to
biorational control of Anastrepha ludens Loew (mexicana fruit fly) using
extracts of P. auritum (acuyo) considering its capacity as a biocide.
3. Method. P. auritum leaves were collected in Vista Hermosa, Municipality
of Jilotepec, Veracruz, Mxico. The plant material was identified and
herbarium in Faculty of Biology of Universidad Veracruzana campus
Xalapa. The leaves were dried in an oven at 40 C, were ground, ethanol
rested (96%) and were concentrated with a rotary evaporator. The bioassay
was conducted at the Laboratory of Parasitology and Biological Control,
under controlled conditions. Treatments were: ethanol al 96% (T1),
commercial control malathion (T2) at dosages recommended by the
manufacturer and different dilutions of the extract, 100% stock
concentration (T3), 10% (T4), 1% (T5), 0.1% (T6) y al 0.01% (T7). The
effect on A. ludens was assessed via food incorporating of different
treatments in 1 g of sugar (24 hour fasting prior), placing 25 females and
161
El Agro Veracruzano 2015

25 males per cage with four replications. Percent mortality at 24, 48, 72,
96 and 120 hours was evaluated.
4. Results. Mortality was statistically different between T2 (76.28%) and
other treatments (T1 5.19%, T3 7.38%, T4 4.60%, T5 15.72%, T6 5.24% y
T7 11.16%) (=0.05). That is, all concentrations of ethanol extract of P.
auritum had low mortality, resulting statistically similar to the control with
ethanol. Similar results have been obtained with aqueous extracts,
chloroform and dichloromethanic of Melia azaderach fruit 10% on adult
of Ceratitis capitata Wied.
5. Relevance. Although the results do not allow to consider the extracts of P.
auritum as a substitute insecticide malathion via food, contiguous to the
present work preliminary results have demonstrated their ability to inhibit
oviposition on fruit.
Keywords. Active ingredients, biopesticide, via food.

Introduccin

Veracruz, Mxico es considerado uno de los estados con mayor diversidad


biolgica por la cantidad de especies presentes en su territorio, aproximadamente
cuenta con 7,482 especies vegetales, de las cules algunas son utilizadas con fines
medicinales, industriales, alimenticios y farmacolgicos (Bentez-Badillo et al.,
2010). Sin embargo, solo se conoce el potencial de pocas especies y es importante
continuar estudios que contribuyan en la bsqueda de alternativas sustentables para
el control de plagas. Cabe sealar que en Mxico, la citricultura constituye una
actividad socioeconmica relevante por la superficie cosechada (549 mil
hectreas), y es considerado el quinto pas en produccin de ctricos en el mundo,
por su parte Veracruz es el principal estado productor de ctricos del pas (SIAP,
2012). Una plaga muy importante en la fruticultura mexicana es Anastrepha ludens
(mosca mexicana de la fruta), la cual es originaria de Mxico; esta plaga es
polfaga y limita la productividad de los ctricos, tanto por el dao directo que
causa en los frutos como por limitar el acceso a mercados extranjeros debido a que
es una plaga de importancia cuarentenaria a nivel internacional (Aluja, 1993).
Dentro de las tcticas empleadas a nivel nacional e internacional se aplica
principalmente el control qumico donde se recomendaba hasta antes del 2010
principalmente al malatin (insecticida organofosforado) que ha sido sealado por
la EPA (Agencia de Proteccin Ambiental de Estado Unidos) junto con su
metabolito malaoxn como un plaguicida de alto riesgo que causa daos al
aplicador, a los trabajadores de la fabricas del producto, a la fauna benfica como
lo indica Domnguez et al. (2003), para Apis mellifera. Michaud (2003) encontr
162
El Agro Veracruzano 2015

que el malatin es txico para larvas y adultos de coccinlidos depredadores de


plagas, as como de neurpteros; adems el malatin puede quedarse adherido en
la epidermis de los frutos y se han reportado residuos en fruta de mango (Fuentes-
Matus et al., 2010). Esta tctica de control qumico se complementa con la tcnica
del insecto estril. Actualmente se est en la bsqueda de productos tan eficientes
como el malatin pero que sean de bajo impacto al ambiente, nulo para
trabajadores y consumidores. Dentro de las alternativas sustentables para el control
de plagas, los extractos botnicos han constituido en algunos casos una opcin
accesible y econmica para el control de diversas plagas agrcolas (Nava-Prez et
al., 2012 y Pineda et al., 2007). Piper auritum es una especie distribuida
ampliamente en Mxico y con antecedentes como bioplaguicida contra diversas
plagas (Silva et al., 2003; Rodrguez-Hernndez, 2005, Dyeri (et al. 2004)
atribuyen la accin insecticida de este gnero a la presencia de amidas, algunas
especies llegan a tener hasta 31 diferentes tipos de amidas, en el caso de P. auritum
la amida involucrada es la cefaradiona,. Por lo anterior, el objetivo de este estudio
fue evaluar el efecto del extracto etanlico de P. auritum Kuth (acuyo) va
alimenticia sobre la supervivencia de Anastrepha ludens Loew.

Materiales y mtodos

El presente trabajo se realiz en las instalaciones de la Facultad de Ciencias


Agrcolas, de la Universidad Veracruzana, especficamente en el Laboratorio de
Parasitologa y Control Biolgico. Esta Institucin se encuentra ubicada en la zona
centro del estado.
Obtencin del material vegetal. Se colectaron hojas frescas de P. auritum en la
localidad de Vista Hermosa, Municipio de Jilotepec, Ver. Ubicado en las
coordenadas 193630.99 N, 965457.80 O, con una altitud de 1249 m. Parte
del material fue prensado y herborizado para su identificacin en el Herbario de la
Facultad de Biologa, CampusXalapa, contando con el apoyo del M. en C.
Roberto Venustiano Ortega Ortiz, responsable del Herbario, el ejemplar de
referencia se encuentra depositado en el herbario XALU de la Facultad. De
Biologa con nmero de registro 17649.
Obtencin del extracto vegetal. El material colectado para la extraccin de los
principios activos, fue procesado en el Laboratorio de Suelos, se pes, lav con
agua destilada y se puso a deshidratar en una estufa de secado a una temperatura
no mayor a 40 C hasta peso constante. Posteriormente se pulveriz en una
licuadora y se coloc en frascos de color mbar, esterilizados y envueltos con
papel aluminio, se le agreg alcohol etlico al 96% en una proporcin de 500 mL
por cada 100 g de tejido seco, dejndose en refrigeracin a 5 C. El extracto fue
163
El Agro Veracruzano 2015

filtrado (filtro Whatman No.40) con un matraz de Kitasato (de salida) y con ayuda
de una bomba de vaco. Posteriormente el extracto se concentr con un
rotavaporador (BUCHI Mod. R-210), a una temperatura de entre 38 a 40 C a 9
rpm hasta obtener el extracto base equivalente a 100 gramos de tejido vegetal por
cada 10 mL de etanol.
Adquisicin y manejo de la mosca mexicana de la fruta A. ludens. Se
obtuvieron de la planta de cra Moscafrut, del Programa de Mosca de la Fruta,
ubicada en Metapa de Domnguez, Chiapas. Estas moscas son producidas por esta
Centro para posteriormente ser esterilizadas y liberadas dentro de la Campaa de la
mosca de la fruta. Fueron enviadas en estado de pupa; para este experimento se
utilizaron adultos los cuales tenan 5 das de emergidos de la pupa.
Bioensayo. Se colocaron 25 hembras y 25 machos por cada jaula, las cuales fueron
sometidas a ayuno de 24 horas colocndoles nicamente un frasco de 10 mL de
agua para que bebieran. Transcurrido el tiempo de ayuno se aplicaron los
tratamientos correspondientes, los cuales se dejaron por 24 horas y se retiraron
sustituyndose por azcar como alimento. Se contabilizaron los individuos muertos
a las 24, 48, 72, 96 y 120 horas despus de colocados los tratamientos y las jaulas
se reabastecieron con azcar y agua.
Tratamientos. El sustrato alimenticio const de 1 g de azcar estndar para todos
los tratamientos, depositado sobre gasa estril en una caja Petri. En cada
tratamiento se prepar la cantidad requerida para 4 repeticiones. Se colocaron 2
mL de cada tratamiento sobre el sustrato de azcar. Los tratamientos fueron: T1,
testigo (etanol al 96%); T2, testigo comercial (malation a dosis recomendada por el
fabricante); T3, P. auritum al 100%; T4, P. auritum al 10%; T5, P. auritum al 1%,
T6, P. auritum al 0.1% y T7, P. auritum al 0.01%.
Diseo experimental. El ensayo se llev a cabo bajo un diseo completamente al
azar con siete tratamientos y cuatro repeticiones por tratamiento; la unidad
experimental fue cada jaula con 50 adultos (25 hembras y 25 machos), haciendo un
total de 28 unidades experimentales (4 por tratamiento). La variable evaluada fue
mortalidad, que es nmero de individuos muertos convertido a porcentaje del total
de individuos de la jaula. Los datos se analizaron mediante el programa de SAS
versin 9.0 aplicando las pruebas de ANOVA (anlisis de varianza) y comparacin
de medias de Tukey y Duncan para conocer las diferencias estadsticas entre
tratamientos (=0.05).
Condiciones ambientales. El ensayo se llev a cabo a una temperatura entre 16 a
25 C, iluminacin de 14 horas de luz por 10 de oscuridad y humedad relativa de
entre 55 y 65%.

164
El Agro Veracruzano 2015

Resultados y discusin
Los resultados demuestran que la mortalidad causada en A. ludens por malatin va
alimenticia fue estadsticamente diferente a todos los tratamientos, siendo muy
superior a la mortalidad causada por el testigo y por todas las concentraciones de
P. auritum, adems estas ltimas fueron estadsticamente iguales al testigo (C.V.
1.48) (Figura 1). Se han probado otros extractos similares as como acuosos,
clorofrmico y diclorometnico de frutos de Trichilia havanensiscontra otra mosca
de la fruta como lo es Ceratitis capitata Wied. (Guzmn-Pantoja et al., 2012). A
pesar de que el Malatin ha demostrado su eficacia en el control de A. ludens y
estar autorizado su uso en Mxico por la CICOPLAFEST (2004), la Organizacin
Mundial de la Salud (OMS) ha prohibido su empleo desde el ao 2011. Cabe
mencionar que entre los efectos crnicos que causa a la salud humana son riesgo
de cncer y efectos nocivos para la reproduccin Lilian et al., (2006) El malatin
es un insecticida organofosforado con persistencia menor que los organoclorados,
pero con mayor toxicidad en mamferos, adems de que puede tener un efecto
negativo en el control de la mosca de la fruta al ser txico para los depredadores y
parasitoides de plagas (Michaud, 2003), lo que con el tiempo propiciara el
resurgimiento de otras plagas por ausencia de su biocontroladores.

Figura 1. Porcentaje de mortalidad de adultos de A. ludens con malation y diferentes


concentraciones de extracto etanlico de P. auritum.

Al no encontrarse diferencias significativas, entre las concentraciones del extracto


etlico de P. auritum con el testigo absoluto, se considera que no provoca
mortalidad por ingestin en A. ludens. Lo anterior, coincide con lo expresado por
Lugo y Camacaro (2011) quienes no encontraron actividad insecticida como tal en
los 13 extractos vegetales que probaron sobre A. obliqua; sin embargo, observaron
efectos de repelencia en sus pruebas de laboratorio. Los extractos que dieron los
165
El Agro Veracruzano 2015

mejores resultados por su efecto repelente fueron Blumea viscosa y Chenopodium


ambrosioides, registrndose solo 0% y 6% de infestacin en los frutos para cada
uno. Ninguno de los extractos ejerci efecto insecticida.
Por lo cual, es importante evaluar su accin repelente o probar extractos acuosos o
de aceite sobre A. ludens. Adems de considerar el empleo del producto natural del
Spinosad sobre moscas nativas de la fruta, originndose este producto de la
fermentacin aerbica del actinomiceto del suelo Saccharopolyspora spinosa
Mertz y Yao, el cual ya ha sido evaluado sobre Ceratitis capitata (Pineda et al,
2007) por lo que se recomienda como parte de los productos que se pueden aplicar
en la campaa de la mosca de la fruta. Sin embargo, los resultados coinciden con
lo referido por Baltazar y Flandes (2011), que encontraron un total de 16.5 moscas
muertas con extractos etlicos del helecho pesma (Pteridium aquilinum (L.) Kuhn),
aunque no encontraron diferencias entre el efecto de las diferentes concentraciones
del extracto del mencionado helecho.
El mximo efecto de mortalidad en malatin se present a las 48 horas despus de
la ingestin en tanto que P.auritum al 1% (Figura 2), fue incrementando durante el
tiempo. Es decir que el malatin provoco una mortalidad inmediata en
comparacin P. auritum.

Figura 2. Porcentaje total de mortalidad de adultos de A. ludens con malation y


diferentes concentraciones de extracto etanlico de P. auritum.

De acuerdo a Delgado-Barreto et al. (2012) encontraron que P. auritum en


extractos hexanlicos caus efecto antialimentario (inhibicin de la alimentacin)
en el gusano cogollero del maz (Spodoptera frugiperda) lo permite suponer que en
el presente experimento las concentraciones de P. auritum al 100 y al 10%
pudieron causar un efecto similar, es decir no hubo ingestin. Al 1% es probable
166
El Agro Veracruzano 2015

que si haya realizado ingestin por lo que la mortalidad fue mayor que en las dos
concentraciones anteriores aunque estadsticamente fue igual. Las concentraciones
0.1 y 0.01% debieron estar suficientemente diluidas para no causar efecto alguno
por las moscas, ni repelencia ni mortalidad.
Los extractos etanlicos de P. auritum no fueron eficaces para provocar mortalidad
en A. ludens por ingestin y su efecto se considera estadsticamente igual al del
testigo absoluto que fue el etanol al 96%. Por lo anterior no es viable su uso si lo
que se desea es la mortalidad de esta especie de mosca de la fruta. Sin embargo,
debido a los reportes de su empleo contra la actividad insectil podra evaluarse su
efecto anti-oviposicin, o en forma de extractos con otros diluyentes. Es
importante resaltar, que con la aplicacin de insecticidas botnicos no se busca
eliminar las plagas, sino coadyuvar a su regulacin a travs de otros efectos como
pueden ser la inhibicin de alimentacin, crecimiento, desarrollo y oviposicin, tal
como lo seala Rodrguez-Hernndez (2005).

Conclusiones

Los extractos etanlicos de P. auritum en las concentraciones utilizadas en el


presente experimento no fueron eficaces para causar una mortalidad significativa
por ingestin en A. ludens.
Se recomienda realizar estudios de repelencia sobre A. ludens con los extractos
etlicos de P. auritum; as como realizar estudios de mortalidad con los extractos
acuosos y en aceite de esta misma planta. As mismo se sugiere evaluar el efecto
de especies vegetales de la regin sobre A. ludens y otras especies de moscas de la
fruta.

Literatura Citada

Aluja, M. 1993. Manejo integrado en moscas de la fruta (DIPTERA: TEPHRITIDAE).


Editorial Trillas. Mxico, D.F. Mxico 241 p.
Baltazar A. I. M. y Flandes H. C. 2011. Actividad insecticida de extractos de helecho
pesma (Pteridium aquilinum (L.)Kuhn) y el laurel silvestre (Litsea glaucmscens
Kunth) sobre el tefrtido (Anastrepha ludens Loew). Tesis de licenciatura.
Facultad de Ciencias Agrcolas de la Universidad Veracruzana Campus Xalapa.
Bentez-Badillo, G., Hernndez-Huerta, A., Equihua-Zamora, M., Pulido Salas, Ma. T. P.,
Ibez-Bernal, S. y Miranda-Martn del Campo, L. 2010. Biodiversidad.
Gobierno del Estado de Veracruz. En: Atlas del patrimonio natural, histrico y
cultural de Veracruz; Enrique Florescano, Juan Ortz Escamilla, coordinadores.
Mxico: Gobierno del Estado de Veracruz : Comisin del Estado de Veracruz para

167
El Agro Veracruzano 2015

la Conmemoracin de la Independencia Nacional y la Revolucin Mexicana :


Universidad Veracruzana, 2010. v. 1, p. 171-202. ISBN 9786079513160. URL:
http://cdigital.uv.mx/handle/123456789 /9653 (Consultado: 28/10/2014).
CICOPLAFEST. 2004. Catlogo de Plaguicidas. Comisin Intersecretarial para el Control
y Uso de Plaguicidas, Fertilizantes y Sustancias Txicas. Secretara de Salud;
Secretaria de Agricultura, Ganadera, Desarrollo Rural, Pesca y Alimentacin;
Secretara del Medio Ambiente y Recursos Naturales; Secretara de Economa.
Delgado-Barreto E., Garca-Mateos Ma. Del R., Ybarra-Moncada Ma. Del Carmen, Luna-
Morales Csar, Martnez-Damin y Ma. Teresa. 2012. Propiedades entomotxicas
de los extractos vegetales de Azaradichta indica, Piper auritum y Petiveria
alliacea para el control de Spodoptera exigua Hbner. Revista Chapingo. Serie
horticultura, Vol. 18 (1): 55-69.
Domnguez, M.V.M., Leyva, V.J.L., Moreno, D.S., Trujillo, A.F.J., Alatorre, R.R. y
Becerril, R. A.E. 2003. Toxicidad sobre Apis mellifera de cebos empleados en el
combate de moscas de la fruta. Manejo Integrado de Plagas y Agroecologa.
69:66-72.
Dyeri L. A., Richards J. and Dodson C. D. 2004. Isolation, Synthesis, and Evolutionary
Ecology of Piper Amides In: Dyer L y Palmer A. (Eds.). 2004. Piper: A Model
Genus for Studies of Phytochemistry, Ecology, and Evolution. Kluwer
Academy/Plenum Publishers New York. Pp 117-139.
Fuentes-Matus, C., Vega y Len, S., Daz-Gonzlez, G., Noa-Prez, M., Gutirrez-
Tolentino, R. 2010. Determinacin de residuos de malatin y malaoxn en mango
de las variedades Ataulfo y Tommy Atkins producidos en Chahuites, Oaxaca.
Agrociencia 44: 215-223.
Guzmn-Pantoja L. E., Lina-Garca, L. P., Bustos-Zagal G. and Hernndez-Velzquez, V.
M. 2012. Current Status: Mexican Medicinal Plants with Insecticidal Potential. In:
Bioactive Compounds in Phytomedicine, Rasooli, I. (Ed). In Tech. 39-66 pp.
Lilian C. J - Casuso, J.A. Cowper.C., Figueroa. F., Fabiola F. Snchez S. (2006)
.Anlisis preliminares de los efectos genotxicos del malatin. Universidad
Nacional del Oeste, Comunicaciones Cientficas y Tecnolgicas. Resumen: v-016.
Lugo O. X. del C. y Camacaro de P. I. 2011. Evaluacin de extractos de plantas para el
control de Anastrepha obliqua (Macquart) (Diptera: tephritidae) en mango,
Mangifera indica L. Agronoma Mesoamericana 22(1): 181-226.
Michaud, J.P. 2003. Toxicity of fruit fly baits to beneficals insect in citrus. J. Insect Sci.
3:8.9pp.
Nava-Prez, E.; Garca-Gutirrez, C.; Camacho-Bez, J. R. y Vzquez-Montoya, E. L.
2012. Bioplaguicidas: Una Opcin para el Control Biolgico de Plagas. Ra
Ximhai. Vol. 8, Nmero 3, septiembre - diciembre.
Pineda S., Schneider A. I. y Martnez A. I. 2007. Spinosad, una alternativa para el control
de insectos plaga. Ciencia Nicolaita (46): 29-42.
Rodrguez, H. C., 2003. Cuantificacin de la inhibicin de crecimiento en insectos
provocada por sustancias naturales. Agricultura, ambiente y desarrollo sustentable.
Tornero C.M., J.F. Lpez- Olgun y A. Aragn G. (EDS).2003.publicacion

168
El Agro Veracruzano 2015

especial de la Benemrita Universidad Autnoma de Puebla, Mxico. Pp. 223-


242.
Rodrguez-Hernndez, C. 2005. Plantas contra plagas 2. Red de Accin sobre Plaguicidas y
Alternativas en Mxico (RAPAM). Mxico. 209 pp.
SIAP 2012. (Servicio de Informacin Agroalimentaria y Pesquera). Produccin Agrcola,
Cclicos y perenes. En linea: http://www.siap.gob.mx/. (Consultado el 5
noviembre de 2013).
Valencia-Botn Alberto J.; Bautista-Martnez Nstor; Lpez-Buenfil, Jos A. 2004. Uso de
extractos acuosos de nim Azadirachta indica A. Juss, en la oviposicin de la
mosca mexicana de la fruta Anastrepha ludens Loew (diptera: tephritidae) en
naranja valencia. Fitosanidad 8(4): 57-59.

169
BIOTECNOLOGA

170
El Agro Veracruzano 2015

12
EMISIONES VOLTILES DE RIZOBACTERIAS, ESTIMULAN EL
CRECIMIENTO DE Fusarium oxysporum f. sp. vanillae

Jacel Adame Garca1, Mauricio Luna-Rodrguez2, Lourdes Georgina Iglesias Andreu3


1
Instituto Tecnolgico de rsulo Galvn Km. 4.5 Carretera CardelChachalacas, rsulo
Galvn Veracruz. E_mail: jadameg@gmail.com Dra. En Ciencias en Biotecnologa y
Ecologa, Miembro del Sistema Nacional de Investigadores, responsable del Cuerpo de
Acadmico ITURG-CA-1, Perfil Promep 20122015.
2
Mauricio Luna-Rodrguez. Laboratorio de Alta Tecnologa de Xalapa, U V. Mdicos No.
5, Unidad del Bosque, Xalapa C.P. 91010, Veracruz, Mxico. E-mail:
mluna.rodz@gmail.com. Investigador de Tiempo Completo Titular C Dr. en Ciencias en
Biotecnologa de Plantas. Investigador Nivel 1 del SNI, Perfil PROMEP, 3er Especialista
en Diagnstico Fitosanitario de Bacterias y Virus desde 1999 (SAGARPA).
3
Lourdes Georgina Iglesias-Andreu. Instituto de Biotecnologa y Ecologa Aplicada, U.V.
Apdo. Postal 250, Xalapa, Veracruz. Mxico. xliglesias@gmail.com. Investigadora de
Tiempo Completo Titular C. Dra. En Gentica de Plantas, Investigadora Nivel 2 del SNI,
Perfil PROMEP.

Resumen
1. Las bacterias antagonistas afectan negativamente el crecimiento de otros
microorganismos, inhibiendo su crecimiento mediante varios mecanismos, como
secrecin de enzimas hidrolticas, siderforos, antibiticos y compuestos voltiles.
2. Las cepas evaluadas en este trabajo correspondieron a los gneros
Sphingobacterium, Staphylococcus, Serratia, Psychrobacter, Pseudomonas y
Stenotrophomonas. Inicialmente se demostr la actividad antifngica in vitro de
estas cepas empleando tres medios de cultivo: agar papa dextrosa, agar nutritivo y
Czapek, mediante las tcnicas de caja vaciada (antagonismo) y placa sellada
(emisiones voltiles).
3. Los aislados Staphylococcus xylosus BAC-JAG15, Serratia sp. BAC-JAG4 y
Stenotrophomonas sp. BAC-JAG1 presentaron una fuerte inhibicin contra F.
oxysporum f. sp. vanillae en los tres medios probados reduciendo hasta en un 90%
el crecimiento fngico.
4. Sin embargo al evaluar el comportamiento de las emisiones voltiles, el
comportamiento fue contrario a lo obtenido mediante caja vaciada, en los tres
medios se encontr que todas las cepas bacterianas estimularon el crecimiento
micelial hasta un 21%, algunas cepas hasta de un 38% en AN y PDA; en tanto
que, en el medio Czapek solo se observ una ligera estimulacin.

171
El Agro Veracruzano 2015

5. Estos resultados demuestran que la capacidad antagnica de estas cepas


bacterianas, est relacionada con su capacidad para producir compuestos
extracelulares como enzimas lticas, antibiticos y/o y no por compuestos
voltiles.

Palabras clave: antagonismo, vainilla, patgeno, antifngicas

Abstract
1. Antagonistic bacteria negatively affect the growth of other microorganisms
by inhibiting its growth through various mechanisms, such as the secretion
of hydrolytic enzymes, siderophores, antibiotics, and volatile compounds.
2. The evaluated strains in this study corresponded to the genera
Sphingobacterium, Staphylococcus, Serratia, Psychrobacter,
Pseudomonas and Stenotrophomonas.
In vitro antifungal activity of these strains was initially demonstrated using
three growth media: Potato dextrose agar, nutrient agar, and Czapek-Dox
through the employment of poured box (antagonism) and stamping
(volatile emissions) techniques.
3. Isolated Staphylococcus xylosus BAC-JAG15, Serratia sp. BAC-JAG4 y
Stenotrophomonas sp. BAC-JAG1 demonstrated a strong inhibition
against F. oxysporum f. sp. vanillae in the three tested media reducing up
to 90% fungal growth.
4. Nevertheless when evaluating the behavior of volatile emissions, the
displayed behavior was contrary to that obtained by poured box. In the
three media, all bacterial strains showed to stimulate mycelial growth up to
21%, some strains up to 38% in NA and PDA; while in the Czapek
medium only a slight stimulation was observed.
5. These results demonstrate that the antagonistic capacity of these bacterial
strains is related to their ability to produce extracellular compounds such
as lytic enzymes, antibiotics and / or, and not by volatile compounds.

Introduccin

La vainilla (Vanilla planifolia Jacks ex. Andrew) presenta una base gentica
estrecha (Minoo et al., 2008) debido al origen clonal de los cultivos y su
propagacin vegetativa, lo que la hace susceptible a un gran nmero de
enfermedades como la pudricin de tallo y raz causada por Fusarium oxysporum,
marchitamientos por Phytophthora sp., roya por Calospora vanillae Massee,
pudricin por Sclerotium sp., necrosis o antracnosis producida por Colletotrichum
gloeosporioides (Penz.) Sacc. (Bhai and Thomas, 2000; Guzman, 2004; Summerell
et al., 2003; Talubnak and Soytong, 2010).

172
El Agro Veracruzano 2015

Sin embargo, Fusarium es el gnero ms estudiado como causante de la pudricin


de tallo y raz en vainilla. En los primeros reportes de Puerto Rico se report a F.
batatis Wr. var. vanillae como el agente causal de esta enfermedad (Tucker, 1927).
Ms tarde Alconero and Santiago (1969) reportaron que el patgeno corresponde a
F. oxysporum f. sp. vanillae.
Debido a que F. oxysporum es responsable de graves daos en un gran nmero de
especies vegetales de importancia econmica dentro de la cual est la vainilla, el
control de este patgeno es una de las reas de investigacin ms estimulante para
mejorar la productividad de plantas. Lo anterior, permite dirigir investigaciones
relacionadas a la manipulacin de la rizsfera en la cual se presentan
microorganismos benficos con propiedades antagonistas para proteger las races
de efectos deletreos provocados por los patgenos de suelo (Weller, 1988).
Se han descrito los usos potenciales de las bacterias asociadas a las plantas como
agentes de biocontrol de enfermedades vegetales (Hallmann et al., 1997; Rovira,
1965; Sturz and Nowak, 2000; Welbaum et al., 2004). Las rizobacterias
promotoras del crecimiento o PGPR son las ms estudiadas (Kloepper and Schroth,
1978), colonizan las superficies de la raz y/o estn cercanamente adheridas a la
interfase del suelo, la rizsfera (Kloepper et al., 1999; Kloepper and Schroth,
1978).
Las bacterias benefician a la planta mediante la interaccin directa entre los
microorganismos benficos y la planta hospedera, pero tambin lo hacen mediante
mecanismos indirectos, como la actividad antifngica (Berg, 2009). Pueden reducir
la incidencia o severidad de las enfermedades en las plantas (agentes de control
biolgico) o exhibir actividad antagnica hacia el patgeno (antagonistas) (Beattie,
2006).
Las bacterias que proveen proteccin efectiva a las plantas, emplean mltiples
modos de accin como: a) produccin de compuestos antimicrobianos; b)
produccin de enzimas que interfieren con la patognesis fngica; c) competencia
por recursos; d) induccin de la resistencia de la planta y e) las interacciones entre
los miembros de la comunidad microbiana (Beattie, 2006). Por otro lado, se ha
demostrado que las bacterias tambin emplean sus compuestos voltiles durante las
interacciones con otros organismos para influir benfica o patognicamente en las
poblaciones y comunidades (Kai et al., 2007a).
Sin embargo, aunque las bacterias emiten un amplio complejo de mezclas
voltiles, la determinacin de su actividad biolgica inici hace muy poco. Es
importante el estudio de estos compuestos ya que representan una fuente de nuevos
compuestos naturales los cuales pueden ser empleados para incrementar la
productividad de productos agrcolas (Kai et al., 2009a).
Los primeros reportes del efecto de los voltiles bacterianos sobre el desarrollo y
crecimiento de hongos fueron descritos por McCain (1966) quien demostr que los
voltiles producidos por Streptomyces griseus redujeron la esporulacin de
173
El Agro Veracruzano 2015

Gleosporium aridum e indujeron la formacin de esclerocios en Sclerotium


cepivorum y Rhizoctonia solani.
Tambin se han reportado otros efectos producidos por los voltiles bacterianos en
hongos los cuales van desde la estimulacin para la formacin del cuerpo
fructfero, germinacin de esporas, inhibicin y promocin del crecimiento
micelial y la estimulacin o reduccin de la esporulacin (Kai et al., 2009a).
Wheatley (2002) report que cerca de 250 aislamientos bacterianos de suelo
provocan inhibicin o promocin del crecimiento micelial en hongos, por otra
parte Zou et al. (2007a) demostr que de 1,018 bacterias elegidas aleatoriamente el
32% producen voltiles fungistticos. Dentro de las especies bacterianas que
producen voltiles bioactivos se reportan Alcaligenes, Bacillus, Ensifer,
Lysobacter, Planomicrobium, Sporosarcina, Stenotrophomonas, Burkholderia,
Pseudomonas, Serratia, Xanthomonas, Pectobacterium, y Agrobacterium las
cuales pueden ser bacterias potenciales con capacidad antifngica (Kai et al.,
2009a).
Los compuestos voltiles de las cepas bacterianas no causan los mismos efectos o
el mismo grado de inhibicin a todos los hongos; sino que la respuesta va a
depender de la combinacin especfica de hongobacteria. Esto puede deberse a:
(1) los hongos pueden responder a los diferentes componentes de una mezcla de
voltiles, o (2) los sitios de accin pueden ser diferentes, o (3) los hongos poseer
habilidades diferentes para desintoxicarse de los metabolitos voltiles.
Con base en lo anterior en este trabajo se demostr el efecto de los compuestos
voltiles contra Fusarium oxysporum f. sp. vanillae, de un grupo de bacterias
reportadas por su capacidad antagonista in vitro contra este patgeno al crecer
simultneamente en medio de cultivo.

Materiales y mtodos

La cepa de F. oxysporum empleada en este trabajo corresponde a F. oxysporum


f.sp. vanilla, que fue aislada y reportada como altamente patognica para vainilla
por Adame-Garca et al. (2011).
Colecta y aislamiento de rizobacterias. Los aislamientos bacterianos se
obtuvieron a partir de races de plantas de vainilla en Papantla, Veracruz
(202147.57 N y 973039.06 O), municipio mexicano de mayor produccin de
este cultivo. Las muestras con signos de la enfermedad se colocaron en bolsas de
plstico, se etiquetaron y se transportaron al laboratorio. Las races se cortaron en
fragmentos de 5 mm de longitud. Se pesaron 10 g, se colocaron en un matraz
Erlenmeyer de 250 mL estril, y se adicionaron 90 mL de solucin estril de
fosfatos (KH2PO4 0.25 M) (NOM-110-SSA-1994).
La solucin se agit a 120 rpm durante 10 min en un agitador orbital (Lab Line) y
se prepararon cinco diluciones (1:9) adicionales. De las diluciones 10-5 y 10-6 se
174
El Agro Veracruzano 2015

dispersaron 0.1 mL sobre medio de cultivo agar cscara de jaiba (3, 6 y 9%), y se
incubaron a 26 1 C durante 72 h.
Evaluacin de las propiedades antifngicas. Evaluacin in vitro. Para esta
evaluacin se emple la tcnica inhibicin del hongo por compuestos voltiles
producidos durante el crecimiento bacteriano. La evaluacin se llev a cabo
mediante la tcnica de placa sellada de acuerdo a lo reportado por Fernando et al.
(2005). Las bacterias se sembraron en medios AN, PDA y Czapek en la base de
una caja Petri. En una segunda base que contena medio PDA, se inocul en el
centro, un disco de agar de 5 mm de dimetro con micelio de 5 das de
crecimiento. La base de la caja que contena el micelio se invirti tanto en las cajas
que contenan los aislados bacterianos como en los testigos (medio sin bacterias) y
se sellaron con Parafilm.
Las cajas se incubaron en estufa de cultivo (Felisa) a 25 1C guardando la
posicin del hongo en la parte superior. A los 7 das de incubacin se midi el
dimetro de cuerpo micelial y se obtuvo el porcentaje de inhibicin tomando como
referencia el valor del testigo. Para esta prueba, slo se evaluaron los aislamientos
positivos del antagonismo hongo vs bacteria en medio de cultivo. Se estableci en
un diseo completamente al azar con cinco repeticiones.
Los datos obtenidos en las pruebas in vitro se analizaron con el software StatView
5.0 mediante ANOVA y para el contraste de los datos se utiliz la prueba de
Tukey.
Identificacin molecular de los aislados bacterianos. Los aislados bacterianos se
identificaron molecularmente. Para la extraccin del ADN se emple la tcnica de
Cheng and Jiang (2006). Para lo cual se tom 1 mL de suspensin bacteriana y
se centrifug a 8,000 g durante 2 min, una vez removido el sobrenadante, las
clulas se lavaron con 400 L de amortiguador TE (10 mM Tris/HCl, 1 mM
EDTA, pH 8.0) y 200 L de Tris-saturado con fenol (2M, pH 8.0). El
homogenizado se transfiri a tubos de 1.5 mL y fue centrifugado a 8,000 g durante
5 min. Se tomaron 160 L del sobrenadante y se transfirieron a un tubo limpio de
1.5 mL.
A continuacin se adicionaron 40 L de amortiguador TE y 100 L de cloroformo,
se centrifug durante 5 min a 13,000 g. El lisado se purific con cloroformo en dos
ocasiones, hasta que dej de presentarse una interfase blanca. De manera posterior
se tomaron 160 L del sobrenadante, se transfirieron a un tubo de 1.5 mL al cual se
le agreg 40 L de TE y 5 L de RNasa (10 mg mL-1). Este se incub a 37 C
durante 10 min. Finalmente, se adicionaron 100 L de cloroformo, se mezcl por
inversin y se centrifug durante 5 min a 13,000 g. Se transfirieron 150 L del
sobrenadante a un nuevo tubo de 1.5 mL. La fase acuosa contena el ADN
purificado.
Para evaluar el grado de degradacin/integridad del ADN se llev a cabo una
electroforesis en geles de agarosa al 0.8% (TBE 0.5 X) en una cmara horizontal
175
El Agro Veracruzano 2015

(CONSORT) a 100 V. Los geles se tieron en 100 mL de solucin TBE 1X


adicionado con 2 L de bromuro de etidio (10 mg mL-1) durante 20 min y se
visualizaron con un sistema de fotodocumentacin (MicroBis).
El gen ADN ribosomal 16S (16S rADN) se amplific parcialmente con los
oligonucletidos Universal Bact Forward (5GATCCTGGCTCAGGATGAAC3) y
Universal Bact Reverse (5GGACTACCAGGGTATCTAATC3). La amplificacin
se llev a cabo en un volumen de reaccin de 25 L, consistente en 1 X PCR
buffer, 2.0 mM MgCl2, 1 U Taq DNA pol , 0.20 mM dNTPs, 15 pM de cada
iniciador y ~50100 ng de ADN genmico.
La amplificacin se realiz en un termociclador (Mastercycler personal Eppendorf)
bajo el siguiente programa de ciclos trmicos: una desnaturalizacin inicial de 2
min a 94C, 30 ciclos de desnaturalizacin a 94C por 1 min, alineamiento a 55C
por 2 min y extensin a 72C por 2 min; seguido de una extensin final a 72C
durante 5 min.
Para la secuenciacin, se purificaron los productos de PCR con el kit de
purificacin ChargeSwitch - Pro PCR Clean-up Kit (Invitrogen) de acuerdo a las
instrucciones del fabricante. Los fragmentos se secuenciaron en el Instituto de
Biotecnologa de la UNAM en un secuenciador Applied Biosystems (modelo 391)
y se emple el oligonucletido Universal Bact Forward.
Los datos de secuencias para cada aislamiento bacteriano se analizaron en el
GenBank del National Center for Biotechnology Information (NCBI) mediante el
sistema Basic Local Alignment Search Tool (BLAST), de donde se obtuvieron las
especies con mayor similitud y se analizaron con el programa MEGA versin 5.0
(Tamura et al., 2011).

Resultados y discusin

Colecta y aislamiento de rizobacterias


Se aislaron satisfactoriamente poblaciones bacterianas de la raz de vainilla en
medio agar suplementado con cscara de jaiba, las colonias bacterianas fueron
visibles a los 4 das despus de la siembra. Slo siete de los 116 aislamientos
bacterianos presentaron actividad antagnica in vitro al crecerlos de forma
simultnea en medio de cultivo (Adame-Garca, 2012).
El anlisis del gen 16S rADN (Figura 1) permiti identificar a estos aislados como:
Sphingobacterium sp. BAC-JAG26, Staphylococcus xylosus BAC-JAG15, Serratia
sp. BAC-JAG4, Sphingobacterium sp. BAC-JAG89, Psychrobacter sp. BAC-
JAG39, Pseudomonas sp. BAC-JAG101, Stenotrophomonas sp. BAC-JAG1.
Sin embargo, al evaluar si el antagonismo podra ser provocado por compuestos
voltiles, se observaron diferencias significativas en los tres medios de cultivo
probados (gl=7, P<0.0001). Pero caso contrario a lo esperado, en los medios AN y
176
El Agro Veracruzano 2015

PDA todos los aislados bacterianos estimularon el crecimiento de F. oxysporum f.


sp. vanillae hasta en un 21% (Figuras 2a,b).
En tanto que, en el medio Czapek Pseudomonas sp. BAC-JAG101, Psychrobacter
sp. BAC-JAG39 y Serratia sp. BAC-JAG4, lo inhibieron ligeramente (3%) (Figura
2c).

Figura 1. Primer 16S. LD = Lader, B=Bacterias, pb = pares de bases.

177
a)

Inhibicin (%) Inhibicin (%)

b)
-20
-15
-10
0

-22.5
-17.5
-12.5
-7.5
-5
-2.5

-22.5
-17.5
-12.5
-7.5
-2.5

-25
-20
-15
-10
-5
0
a

Control

a
Control
b

cd
Pseudomonas sp. Pseudomonas sp.

Psychrobacter sp.

d
Psychrobacter sp.
b

S. xylosus S. xylosus

178
cd
a

Serratia sp. Serratia sp.

bc
a

Sphingobacteriumsp. BAC-JAG1

b
Sphingobacteriumsp. BAC-JAG1

bc
Sphingobacteriumsp. BAC-JAG4 Sphingobacteriumsp. BAC-JAG4
b

bc

Stenotrophomonas sp. Stenotrophomonas sp.


b
El Agro Veracruzano 2015
El Agro Veracruzano 2015

c)

3.5

3 a

Inhibicin (%)
2.5
ab
2

1.5 ab
b
1 b
b
.5
b b
0 Pseudomonas sp.

Sphingobacteriumsp. BAC-JAG1

Sphingobacteriumsp. BAC-JAG4
Control

Stenotrophomonas sp.
Psychrobacter sp.

Serratia sp.
S. xylosus

Figura 2. Porcentajes de inhibicin de F. oxysporum f. sp. vanillae por los


voltiles producidos por aislamientos bacterianos antagonistas en los tres
medios probados: a) PDA, b) AN y c) Czapek.
Las barras representan el error estndar de cinco repeticiones por muestra. Letras distintas indican
diferencias significativas para la prueba de Tukey a un nivel de significancia p<0.05 .

Discusin

A partir de las races de vainilla se obtuvieron aislamientos bacterianos


pertenecientes a los gneros Sphingobacterium, Psychrobacter, Pseudomonas,
Serratia, Staphylococcus y Stenotrophomonas.
Los aislamientos obtenidos presentaron propiedades antifngicas al inhibir el
crecimiento de F. oxysporum f. sp. vanillae in vitro al probar el antagonismo
hongo vs bacteria en medio de cultivo (Adame-Garca et al., 2013). Estos gneros
ya han sido reportados como rizobacterias con actividad antagonista in vitro contra
hongos fitopatgenos, entre los que se incluye a F. oxysporum.

179
El Agro Veracruzano 2015

Alternativamente a la evaluacin de antagonismo en medio de cultivo se evalu la


inhibicin del crecimiento fngico a consecuencia de compuestos voltiles
producidos durante el crecimiento bacteriano. Lo anterior se evalu para verificar
si la actividad antagnica de los aislamientos bacterianos era a consecuencia de
compuestos voltiles.
Lo anterior se propuso con base en trabajos donde se report que rizobacterias de
los gneros Serratia, Stenotrophomonas y Pseudomonas producen compuestos
voltiles capaces de inhibir el desarrollo fngico (Fernando et al., 2005; Kai et al.,
2007b; Ryu et al., 2003; Zou et al., 2007b). Adems de que en reportes previos se
demostr que los compuestos voltiles bacterianos afectan el desarrollo de F.
oxysporum in vitro (Moore-Landecker and Stotzky, 1972; Moore-Landecker and
Stotzky, 1973; Moore-Landecker and Stotzky, 1974).
En lo que respecta a este estudio se observ que los compuestos voltiles
producidos en PDA y AN, por los aislamientos evaluados, promovieron el
crecimiento de F. oxysporum f. sp. vanillae (21% ). Pero a diferencia de estos
medios, en Czapek se observ que los aislamientos de Pseudomonas sp. BAC-
JAG101, Psychrobacter sp. BAC-JAG39 y Serratia sp. BAC-JAG4, presentaron
una ligera inhibicin (3%) la cual no fue significativa.
Los resultados obtenidos infieren que la produccin de compuestos voltiles
depende del medio de cultivo y de las condiciones de crecimiento. De tal manera
que las diferencias en este trabajo debieron ser provocadas por la composicin de
cada medio de cultivo empleado para el crecimiento bacteriano. Estos medios
difieren en su composicin principalmente en la presencia y tipo de carbohidratos.
La composicin del medio AN radica principalmente en protenas pero carece de
alguna fuente de carbohidratos. Por otra parte, los medios PDA y Czapek si
contienen carbohidratos pero distintos entre ellos, ya que contienen dextrosa y
sacarosa respectivamente. Al respecto Kai et al. (2009b) reportaron que la
produccin de compuestos voltiles de Stenotrophomonas rhizophila P69 diferente
tanto cuantitativa como cualitativamente al adicionar glucosa al caldo nutritivo.
Por ejemplo, la emisin de los compuestos dimetil pirazina y beta fenil etanol por
S. rhizophila P69, no depende de la presencia de glucosa. Mientras que la trimetil
pirazina, la tetrametil pirazina y el beta fenil etil acetato aparecen cuando el medio
de cultivo no contiene glucosa (Kai et al., 2009b).
De tal manera que los aislamientos bacterianos como Pseudomonas monteilii, que
estn reportados por emitir compuestos voltiles con capacidad antifngica en
ciertos medios, al ser desarrollados en medios distintos, pueden llegar a emitir
compuestos voltiles capaces de estimular el crecimiento micelial (Duponnois y
Kisa, 2006).

Resultados similares se reportan en este trabajo, tal es el caso del aislamiento


Pseudomonas sp. BAC-JAG 101 que present antagonismo contra F. oxysporum
180
El Agro Veracruzano 2015

en dos de los tres medios probados (20% PDA y 80% AN), sin embargo los
voltiles emitidos durante su crecimiento en AN y PDA estimularon el crecimiento
micelial de F. oxysporum (20% AN), no as en Czapek donde inhibieron
ligeramente este crecimiento (3%).

Literatura Citada

Adame-Garca, J. 2012. Obtencin de aislamientos bacterianos asociados a Vanilla


planifolia G. Jackson, con propiedades antifngicas. Tesis Doctorado,
Universidad Veracruzana, Xalapa Mxico, 139 pp.
Adame-Garca, J., Iglesias-Andreu, L. G., Trigos, ., Snchez-Coello, N., and Luna-
Rodrguez, M. 2013. Bacterias antagonistas de Fusarium oxysporum f. sp.
vanillae. En "1er Seminario Internacional de Vainilla" UNCR,(ed.), pp. 39,
Heredia, Costa Rica.
Adame-Garca, J., Trigos-Landa, . R., Iglesias-Andreu, L. G., Flores-Estevez, N., and
Luna-Rodrguez, M. 2011. Variaciones isoenzimtica y patognica de Fusarium
spp. Asociadas con la pudricin de tallo y raz de vainilla. Tropical and
Subtropical Agroecosystems, 13, 299-306.
Alconero, R., and Santiago, A. G. 1969. Fusaria pathogenic to vanilla Plant Disease
Reporter, 53, 854-857.
Beattie, G. 2006. Plant-associated bacteria: survey, molecular phylogeny, genomics and
recent advances. S. Gnanamanickam, (ed.), pp. 1-56. Springer Netherlands.
Number of 1-56 pp.
Berg, G. 2009. Plantmicrobe interactions promoting plant growth and health: perspectives
for controlled use of microorganisms in agriculture. Applied Microbiology &
Biotechnology 84, 11-18.
Bhai, R. S., and Thomas, J. 2000. Phytophthora rot - a new disease of vanilla (Vanilla
planifolia Andrews) in India. Journal of Spices and Aromatic Crops, 9, 73-75.
Cheng, H.-R., and Jiang, N. 2006. Extremely rapid extraction of DNA from bacteria and
yeasts. Biotechnology Letters, 28, 55-59.
Duponnois R., and Kisa, M. 2006. The possible role of trehalose in the mycorrhiza helper
bacterium effect. Canadian Journal of Botany, 84, 1005-1008.
Fernando, W. G. D., Ramarathnam, R., Krishnamoorthy, A. S., and Savchuk, S. C. 2005.
Identification and use of potential bacterial organic antifungal volatiles in
biocontrol. Soil Biology and Biochemistry, 37, 955-964.
Guzman, C. C. 2004. Vanilla. En "Handbook of herbs and spices" K. Peter, (ed.), pp. 2-
360. Woodhead Publishing, England. Number of 2-360 pp.
Hallmann, J., Quadt-Hallmann, A., Mahaffee, W. F., and Kloepper, J. W. 1997. Bacterial
endophytes in agricultural crops. Canadian Journal of Microbiology, 43, 895-914.
Kai, M., Effmert, U., Berg, G., and Piechulla, B. 2007a. Volatiles of bacterial antagonists
inhibit mycelial growth of the plant pathogen Rhizoctonia solani. Archives of
Microbiology, 187, 351-360.

181
El Agro Veracruzano 2015

Kai, M., Effmert, U., Berg, G., and Piechulla, B. 2007b. Volatiles of bacterial antagonists
inhibit mycelial growth of the plant pathogen Rhizoctonia solani. Archives of
Microbiology, 187, 351-60.
Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B., and Piechulla, B. 2009a. Bacterial
volatiles and their action potential. Applied Microbiology and Biotechnology, 81,
1001-1012.
Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B., and Piechulla, B. 2009b. Bacterial
volatiles and their action potential. Applied Microbiology and Biotechnology, 81,
1001-12.
Kloepper, J. W., Rodrguez-Ubana, R., Zehnder, G. W., Murphy, J. F., Sikora, E., and
Fernndez, C. 1999. Plant root-bacterial interactions in biological control of
soilborne diseases and potential extension to systemic and foliar diseases.
Australasian Plant Pathology, 28, 21-26.
Kloepper, J. W., and Schroth, M. N. 1978. Plant growth promoting rizobacteria on
radishes. En "Proceedings of the fourth International Conference on Plant
Pathogenic Bacteria", Vol. 2, pp. 879-882, France.
McCain, A. H. 1966. A volatile antibiotic by Streptomyces griseus. Phytopathology, 56,
150.
Minoo, D., Jayakumar, V., Veena, S., Vimala, J., Basha, A., Saji, K., Nirmal Babu, K., and
Peter, K. 2008. Genetic variations and interrelationships in Vanilla planifolia and
few related species as expressed by RAPD polymorphism. Genetic Resources and
Crop Evolution, 55, 459-470.
Moore-Landecker, E., and Stotzky, G. 1972. Inhibition of fungal growth and sporulation by
volatile metabolites from bacteria. Canadian Journal of Microbiology, 18, 957-
962.
Moore-Landecker, E., and Stotzky, G. 1973. Morphological abnormalities of fungi induced
by volatile microbial metabolites. Mycologia, 65, 519-530.
Moore-Landecker, E., and Stotzky, G. 1974. Effects of concentration of volatile
metabolites from bacteria and germinating seeds on fungi in the presence of
selective absorbents. Canadian Journal of Microbiology, 20, 97-103.
NOM-110-SSA-1994 Preparacin y dilucin de muestras de alimentos para su anlisis
microbiolgico.
Rovira, A. D. 1965. Interactions Between Plant Roots and Soil Microorganisms. Annual
Review of Microbiology, 19, 241-266.
Ryu, C.-M., Farag, M. A., Hu, C.-H., Reddy, M. S., Wei, H.-X., Par, P. W., and Kloepper,
J. W. 2003. Bacterial volatiles promote growth in Arabidopsis. Proceedings of the
National Academy of Sciences, 100, 4927-4932.
Sturz, A. V., and Nowak, J. 2000. Endophytic communities of rhizobacteria and the
strategies required to create yield enhancing associations with crops. Applied Soil
Ecology, 15, 183-190.
Summerell, B. A., Salleh, B., and Leslie, J. F. 2003. A utilitarian approach to Fusarium
identification. Plant Disease, 87, 117-128.
Talubnak, C., and Soytong, K. 2010. Biological control of vanilla anthracnose using
Emericella nidulans. Journal of Agricultural Technology 6, 47-55.

182
El Agro Veracruzano 2015

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5:
Molecular Evolutionary Genetics Analysis using Maximum Likelihood,
Evolutionary Distance, and Maximum Parsimony methods. Molecular Biology
and Evolution, 28, 2731-2739.
Tucker, C. M. 1927. Vanilla root rot. Journal of Agricultural Research 35, 1121-1136.
Welbaum, G. E., Sturz, A. V., Dong, Z., and Nowak, J. 2004. Managing Soil
Microorganisms to Improve Productivity of Agro-Ecosystems. Critical Reviews in
Plant Sciences, 23, 175-193.
Weller, D. M. 1988. Biological Control of Soilborne Plant Pathogens in the Rhizosphere
with Bacteria. Annual Review of Phytopathology, 26, 379-407.
Wheatley, R. E. 2002. The consequences of volatile organic compounds mediated bacterial
and fungal interactions. Antonie van Leeuwenhoek, 81, 357-364.
Zou, C.-S., Mo, M.-H., Gu, Y.-Q., Zhou, J.-P., and Zhang, K.-Q. 2007a. Possible
contributions of volatile-producing bacteria to soil fungistasis. Soil Biology &
Biochemistry, 39, 2371-2379.

183
El Agro Veracruzano 2015

13
DIVERSIDAD GENTICA DE Zamia furfuracea L. f: UNA CCADA
ENDMICA DEL ESTADO DE VERACRUZ

Enrique Favin Vega1, Rubn H. Andueza Noh2, Lourdes G. Iglesias Andreu3*,


Andrs Rivera Fernndez4
1
Instituto de Biotecnologa y Ecologa Aplicada (INBIOTECA). Universidad Veracruzana
Avenida de las Culturas Veracruzanas 101, Colonia Emiliano Zapata, C.P. 91090, Xalapa,
Ver., Mxico. Estudiante de doctorado en el Instituto de Biotecnologa y Ecologa Aplicada
E-mail: favian80v@hotmail.com
2
Divisin de Estudios de Posgrado e Investigacin, Instituto Tecnolgico de Conkal,
Yucatn Km. 16.3 Antigua Carretera Mrida-Motul C.P. 97345, Conkal, Yucatn-
Ctedras-Conacyt. Profesor investigador de tiempo completo. Miembro del Sistema
Nacional de Investigadores. Lnea de investigacin: Manejo y conservacin de recursos
fitogenticos bajo enfoques moleculares. E-mail: ruben.andueza@itconkal.edu.mx
3
Miembro del Sistema Nacional de Investigadores (SNI Nivel II), profesor con PERFIL
PROMEP, Instituto de Biotecnologa y Ecologa Aplicada (INBIOTECA), Universidad
Veracruzana. Investigador de Tiempo Completo Titular C. Doctor en Biotecnologa de
Plantas. Lnea de Investigacin Conservacin, Manejo y Mejoramiento gentico de plantas
y del Cuerpo Acadmico Consolidado CA-UVER-234 Biotecnologa Aplicada a la
Ecologa y Sanidad Vegetal. E-mail: liglesias@uv.mx
4
Doctor en Ciencias en Ecologa y Biotecnologa. Profesor de Tiempo Completo Titular C,
Integrante del Cuerpo Acadmico Biotica y Conservacin de los Recursos Naturales
dentro de la Lnea de Generacin y Aplicacin del Conocimiento del mismo nombre, con
perfil PROMEP. Correo electrnico: arivera@uv.mx.

Resumen
1. El conocimiento de la diversidad y estructura gentica de Zamia furfuracea L. es
importante para su manejo, utilizacin de sus recursos genticos y para el
establecimiento de programas eficientes de conservacin.
2. El presente trabajo se desarroll con el objetivo de evaluar la estructura y
diversidad gentica de Zamia furfuracea L. localizada en La Catalana, municipio
de La Antigua, Veracruz, mediante la aplicacin de marcadores moleculares ISSR.
3. Para los anlisis genticos se obtuvieron 68 loci ISSRs y se estimaron los ndices
de diversidad gentica: nmero de alelos por locus (na), nmero de alelos efectivo
(ne), diversidad gentica de Nei (H), ndice de Shannon (I) y porcentaje de loci
polimrfico (%P). La estructura gentica fue evaluada mediante un anlisis de
coordenadas principales (PCoA) y un anlisis UPGMA; tambin se estim el
ndice de estructura gentica (Gst) y el ndice de flujo gnico (Nm).

184
El Agro Veracruzano 2015

4. Los resultados de diversidad gentica a nivel poblacional fueron: na = 1.97, ne =


1.36, H = 0.24, I = 0.38 y %P = 97.06; en cuanto a categoras de vida en la
poblacin las hembras presentaron mayores niveles de diversidad gentica (na =
1.35, ne = 1.26, H = 0.14, I = 0.20 y %P = 35.29) siendo la categora plntulas la
que present los niveles ms bajos de diversidad (na = 1.22, ne = 1.12, H = 0.07, I
= 0.11 y %P = 22.0). El ndice de estructura gentica fue de (Gst = 0.53) y el flujo
gnico (Nm = 0.428), el anlisis de relaciones genticas present un patrn general
de agrupamiento basado en la conformacin de dos grupos principales
denominados 1 y 2.
5. Los resultados muestran que la poblacin no ha sido altamente afectada por la
perturbacin del medio donde se encuentra y su persistencia est ligada al aporte
gentico de los adultos.
Palabras clave: Estructura gentica, marcadores ISSR, recursos genticos.

Abstract
1. The knowledge of the genetic diversity and structure of Zamia furfuracea L. is
important for handling, use of their genetic resources and for the establishment of
efficient conservation programs.
2. This work was developed with the aim of assessing the genetic structure and
diversity of Zamia furfuracea L. located in La Catalana, municipality of La
Antigua, Veracruz, through the application of ISSR molecular markers.
3. Genetic testing 68 loci ISSRs were obtained and indices of genetic diversity were
estimated: number of alleles per locus (na), effective number of alleles (ne), Nei's
genetic diversity (H), Shannon index (I) and percentage of polymorphic loci (%
P). The genetic structure was assessed using a principal coordinates analysis
(PCoA) and a UPGMA analysis; genetic structure index (Gst) gene and the flow
rate (Nm) was also estimated.
4. The results of genetic diversity at the population level were: na = 1.97, ne = 1.36,
H = 0.24, I = 0.38 and %P = 97.06; in terms of categories of life in the population
females had higher levels of genetic diversity (na = 1.35, ne = 1.26, H = 0.14, I =
0.20 and %P = 35.29) being the category seedlings which had the lowest levels
diversity (na = 1.22, ne = 1.12, H = 0.07, I = 0.11 and %P = 22.0. The genetic
structure was (Gst = 0.53) and gene flow (Nm = 0.428), the analysis of genetic
relationships presented a general clustering pattern based on the formation of two
main groups called 1 and 2.
5. These results show that the population has not been highly affected by the
disruption of the environment where it is located and its persistence is linked to
genetic input from adults.
Keywords: Genetic structure, ISSR markers, genetic resources.

185
El Agro Veracruzano 2015

Introduccin

El orden de las Cycadales, representa uno de los grupos de plantas con semillas
(Gimnospermas) ms antiguos que an existen, con una historia fsil cerca de 300
millones de aos (Mamay, 1976; Norstog & Nicholls, 1997).
Durante el perodo jursico las ccadas fueron un componente prominente de la
vegetacin del planeta y jugaron un papel importante como fuente de comida para
los herbvoros de aquel tiempo. Sin embargo, actualmente se encuentran
restringidas nicamente a los ecosistemas tropicales y subtropicales del mundo,
contando con alrededor de 326 especies (Jones, 2002; Hill et al., 2007; Haynes,
2011), que se agrupan en tres familias distribuidas alrededor del mundo:
Cycadaceae, Stangeriaceae y Zamiaceae (Stevenson, 1992).
Mxico es uno de los pases que ms ha contribuido a la diversidad de especies de
las ccadas con ms de 50 de las 326 especies conocidas a nivel mundial, lo que lo
ha situado en el segundo lugar en diversidad de ccadas, solo despus de Australia.
Entre los gneros de ccadas que se encuentran presentes en el pas estn:
Ceratozamia, Dioon y Zamia. De estos, Ceratozamia es el ms importante por el
nmero de especies que posee (26), seguido de Zamia (15) y Dioon (13) (Haynes,
2011).
La conservacin de las ccadas es una prioridad en muchos pases debido a que
estn amenazadas principalmente por el comercio ilegal y el cambio de uso de
suelo (INE-SEMARNAP 2000). Por ello, muchas de estas especies se encuentran
incluidas en la Lista Roja de la Unin Internacional para la Conservacin de la
Naturaleza (UICN) y en la Convencin sobre el Comercio Internacional de
Especies Amenazadas de Fauna y Flora Silvestre (CITES). En Mxico los estudios
encaminados a establecer estrategias para la conservacin del grupo de las ccadas
ha adquirido una gran importancia debido al gran nmero de endemismos
presentes, ya que ha sido reportado que ms del 90% de la riqueza cicadolgica del
pas resulta ser endmica (Vzquez-Torres et al., 2001).
En Mxico, Zamia furfuracea es un recurso gentico valioso, endmico del estado
de Veracruz, que se encuentra en peligro de extincin (NOM-059-ECOL-2010).
Pese a su importancia y estatus no se cuenta con suficiente informacin sobre
gentica poblacional que proporcione informacin bsica que nos permita analizar
los niveles de diversidad gentica de los individuos y as comprender y explicar la
situacin actual de la poblacin natural de Zamia furfuracea en La Catalana,
Municipio de La Antigua, Veracruz; con el fin de proyectar su situacin previsible
en el futuro, para la toma de decisiones en la aplicacin de tcnicas para su uso,
manejo y conservacin.
En los estudios gentico-poblacionales han resultado de particular utilidad el
empleo de los marcadores moleculares basados en la amplificacin del ADN por la
reaccin en cadena de la polimerasa (PCR). Dentro de estos, los marcadores
186
El Agro Veracruzano 2015

denominados Repeticiones de Secuencias Intersimples (ISSRs por sus siglas en


ingls) se han utilizado con xito en ccadas por su sencillez y por su bajo costo,
para realizar el anlisis de la diversidad gentica en diversos estudios (Xiao &
Gong, 2006; Rivera-Fernndez et al., 2012, Martnez-Estrada, 2014).
Tomando en consideracin todo lo anterior, se propuso el desarrollo del presente
trabajo con el objetivo de conocer la diversidad gentica de la poblacin natural de
Zamia furfuracea de La Catalana en el municipio de La Antigua, Veracruz,
Mxico.

Materiales y mtodos

Ubicacin del rea de estudio. El presente estudio se realiz en el Instituto de


Biotecnologa y Ecologa Aplicada de la Universidad Veracruzana durante el
perodo comprendido de septiembre del 2013 a marzo del 2014.
La poblacin natural de Z. furfuracea se encuentra ubicada en la localidad La
Catalana, Municipio de La Antigua, Veracruz, localizada en la zona costera
central del estado entre los 19 18 08.66 latitud N y 96 17 49.30 longitud O
(Figura 1).

Figura 1. Sitio de estudio de la poblacin de Zamia furfuracea La Catalana, municipio


de La Antigua, Veracruz (Fuente: modificado de www.google/images/mapasdeVeracruz,
2010).

La vegetacin que predomina en este sitio es tpica de duna costera y selva baja
con matorrales espinosos que crecen en suelos arenosos. El clima es tropical con

187
El Agro Veracruzano 2015

rgimen trmico-clido regular y lluvias abundantes en el verano (1500 mm) y de


menor intensidad en invierno por la influencia de los vientos del norte.
Obtencin del material biolgico. Para la toma de muestras se traz un transecto
en banda de 30 x 210 m (6300 m2), se registraron y etiquetaron todas las plantas y
se clasificaron de acuerdo a su etapa de crecimiento (Tabla 1).

Tabla 1. Clasificacin de las plantas con base en su etapa de crecimiento (Vzquez-


Torres, et al., 2001).

Etapa de crecimiento Criterio utilizado


Plntulas Se contabilizaron todos los individuos que presentaban
una o dos hojas con no ms de seis fololos (En verticilo
a manera de trbol de la suerte).
Juveniles Todas aquellas plantas con frondas de seis a 15 foliolos
y el tallo y la raz fusionados a la tierra (Semejando una
pequea zanahoria).
Adultos reproductivos Individuos con frondas largas de ms de 15 foliolos y
con estructuras reproductivas o vestigios de las mismas.

Adultos indeterminados. Individuos adultos sin estructuras reproductivas o


vestigios visibles de las mismas.

Se colect tejido foliar de todas las plantas muestreadas, adultas (71) juveniles (30)
y plntulas (40), tomando dos foliolos por individuo (juveniles y adultos). En el
caso de las plntulas se tom un solo foliolo, debido a que la mayora de las
plntulas solo tenan de dos a cuatro foliolos. Las muestras fueron etiquetadas
individualmente, se envolvieron en toallas de papel humedecidas con agua
destilada, se introdujeron en bolsas de plstico y se colocaron en una hielera para
su traslado y anlisis en el INBIOTECA. En el laboratorio las muestras se lavaron
y desinfectaron para su posterior extraccin y anlisis de ADN.
Extraccin y amplificacin de ADN. La extraccin del ADN genmico, se
efectu de acuerdo con el mtodo de Stewart y Va (1993) basado en el empleo de
CTAB 2% (Bromuro de Cetilmetilamonio). Una vez obtenido el ADN, todas las
muestras fueron cuantificadas en un espectrofotmetro UV (Perkin Elmer) a 260 y
280 nm (relacin de absorbancias). Para determinar la calidad de ADN se realiz el
clculo de la relacin de absorbancias para todas las muestras. Una buena calidad
de ADN es aquella cuya relacin de absorbancias es de 1.8 a 2.0 nm. Con base en
la calidad del ADN extrado se seleccionaron las mejores muestras para su
amplificacin; de este modo se analizaron un total de 74 muestras (21 machos, 18
hembras, 19 juveniles y 16 plntulas).

188
El Agro Veracruzano 2015

Tabla 2. Relacin de iniciadores ISSRs evaluados y seleccionados para el estudio de la


diversidad gentica en Z. furfuracea.

No. Iniciad. Secuencia * (5-3) Temp. de No. de bandas


ISSR alineamiento (C) amplificadas
1 809 AGAGAGAGAGAGAGAGG 52 0
2 818 CACACACACACACACAG 52 28
3 827 ACACACACACACACACG 52 0
4 829 TGTGTGTGTGTGTGTGC 52 0
5 848 CACACACACACACACARG 55 0
6 IS-01 GTAGTAGATAGATA 40 0
7 IS-02 GTAGTAGATAGATARG 45 0
8 IS-03 GTAGTAGATAGATARY 45 0
9 IS-04 GACAGACAGACAGACA 48 0
10 IS-05 GACAGACAGACAGACARG 55 0
11 IS-06 GACAGACAGACAGACARY 55 0
12 IS-07 GACACGACACGACACGACAC 55 0
13 IS-08 ACTGACTGACTGACTG 48 24
14 IS-09 ACTGACTGACTGACTGRG 55 0
15 IS-10 ACTGACTGACTGACTGRY 55 0
16 IS-11 GATAGATAGATA 35 0
17 IS-12 GTAGTAGATAGATARG 37 0
18 IS-13 YRGATAGATAGATA 37 0
19 IS-14 GACAGACAGACAGACA 40 0
20 IS-15 GACAGACAGACARG 45 16
21 IS-16 YRGACAGACAGACA 40 0
22 IS-17 GACACGACAC 35 0
23 IS-18 ACTGACTGACTG 40 0
24 S-19 ACTGACTGACTG 45 0
25 IS-20 YR ACTGACTGACTG 40 0
* Y: C/T; R: A/G.

Para la amplificacin de las muestras por PCR, se evaluaron un total de 25


iniciadores ISSRs (UBC, Biotechnology Laboratory, University of British
Columbia). Con base en el nmero, resolucin y repetitibilidad de las bandas
amplificadas en las muestras evaluadas por triplicado, fueron seleccionados tres
189
El Agro Veracruzano 2015

iniciadores. Las caractersticas de cada uno de los iniciadores evaluados se


muestran en la Tabla 2, indicando en color rojo los iniciadores seleccionados para
efectuar el estudio gentico en esta poblacin.
La amplificacin de los iniciadores ISSRs se realiz en un termociclador
(AXIGEN) bajo las siguientes condiciones trmicas: Un paso inicial de
desnaturalizacin a 94 C durante 7min., seguido por 35 ciclos de 30 s. a 94 C, 45
s. a diferentes temperaturas de alineamiento, dependiendo de cada iniciador (45, 48
y 52 C), 90 s. a 72 C y una extensin final a 72 C durante 10 min.
Cada reaccin de PCR fue realizada en un volumen final de: 25 L conteniendo
50ng de ADN genmico, Amortiguador Taq (1X), MgCl2 (2.5 mM), DNTPs (0.4
mM), iniciador o primer (25 pM), Taq DNA polimerasa (1.5 U). El volumen de
reaccin se complet con agua destilada estril. Posteriormente, se tomaron 5 L
de cada uno de los productos de PCR para su separacin por electroforesis en geles
de agarosa al 2 % (p/v) en tampn TAE (1X) a 110 V, durante 75 min. Se utiliz
un marcador de peso molecular de 100 pb (marca Bioline). Finalmente los geles
fueron teidos con bromuro de etidio (10 mgmL-1) y visualizados en un
fotodocumentador (GelDoc-It Imager. UVP).
Anlisis de datos. Para el anlisis de los datos obtenidos se registr el patrn de
bandeo por cada iniciador en las diferentes categoras de vida examinadas. Se
tomaron en cuenta solamente las bandas que mostraron mejor resolucin y
repetitibidad. Se detectaron un total de 68 loci con los tres iniciadores utilizados.
Con base en la variacin molecular detectada se construy una matriz de datos
binarios (1 y 0) en la cual 1 significa presencia y 0 ausencia del loci.
Anlisis de la diversidad gentica en Zamia furfurcea. La diversidad gentica
de la poblacin de Zamia furfuracea fue evaluada de acuerdo con Kimura and
Crow (1964) mediante, el nmero de alelos observado (Na) y el nmero efectivo
de alelos (Ne). Se determin asimismo la diversidad gentica de Nei (1973) (H), el
ndice de informacin de Shannon's (I), segn Lewontin (1972) y el porcentaje de
loci polimrficos (%P).
Los ndices de diversidad gentica fueron determinados en 5 niveles: a) nivel total
considerando a todos los individuos, b) individuos adultos hembras c) individuos
adultos machos, d) individuos juveniles y c) plntulas. Teniendo en cuenta que los
ISSRs constituye un marcador dominante los anlisis se hicieron asumiendo el
principio de equilibrio H-W (Fis = 0). Los anlisis se realizaron con el programa
POPGENE (Population Genetic Analysis) (Yeh et al., 1999).
Anlisis de estructura gentica. Para evaluar la estructura gentica de la
poblacin se realizaron dos anlisis multivariados. Primeramente se realiz con el
programa GenAlex (Peakall y Smouse, 2006) un anlisis de coordenadas
principales (PCoA), con base en la distancia gentica de Nei (1972).
Posteriormente y con el objetivo de corroborar la congruencia de los resultados
obtenidos por el anlisis de coordenadas principales se realiz un anlisis de
190
El Agro Veracruzano 2015

conglomerado con el paquete estadstico PAST (PAlaeontological STatistics,


Hammer et al., 2001). Se utiliz la distancia gentica de Gower (1967) y el mtodo
de UPGMA (Unweighted Pair Group Method with Arithmetic Mean) como
algoritmo de ligamiento (Hammer y Harper, 2001).
Para estimar la estructura gentica de la poblacin se calcul la diferenciacin
gentica poblacional con el ndice de estructura gentica (Gst) y el nmero de
migrantes por generacin o ndice de flujo gentico (McDermott y McDonald,
1993) (Nm), utilizando el programa POPGENE (Population Genetic Analysis)
(Yeh et al., 1999).

Resultados

Los tres iniciadores empleados permitieron obtener un total de 68 loci ISSRs, de


los cuales el 97.06 % fueron polimrficos. El mayor nmero de loci (28) fue
observado con el iniciador IS-818, seguido del iniciador IS-08, con 24 loci,
mientras que solo se detectaron 16 loci en el iniciador IS-15 (Figura 2).
Los resultados del anlisis de diversidad gentica a nivel total y entre categoras
(sexo y edades) de Z. furfuracea, usando los 68 loci ISSRs detectados permitieron
obtener los estimados de diversidad gentica que se indican en la Tabla 3.

Figura 2. Primer IS-818. LD = Lader, M = Individuos machos, C- = Control negativo


y pb = pares de bases.

191
El Agro Veracruzano 2015

Los resultados del anlisis de coordenadas principales (PCoA), permitieron


establecer la conformacin de dos grupos principales dentro de la poblacin. Las
dos primeras coordenadas principales, explicaron el 100% de la varianza total
acumulada (Figura 3).

Tabla 3. Estimadores de diversidad gentica obtenidos con marcadores ISSRs en la


poblacin de Z. furfuracea de La Catalana, Veracruz.

Categoras Na Ne H I (%) P
Poblacin total 1.97 1.36 0.24 0.38 97.06%
Hembras 1.352 1.265 0.145 0.209 35.29 %
Machos 1.264 1.216 0.116 0.166 26.47 %

Juveniles 1.308 1.215 0.121 0.177 30.88 %


Plntulas 1.220 1.126 0.076 0.115 22.06 %
Na: nmero de alelos observado; Ne: nmero de alelos efectivos; H: diversidad gentica de Nei; I:
ndice de Shannon-Weaver; %P: Porcentaje de loci polimrficos.

Figura 3. Anlisis de coordenadas principales (PCoA). Grupo 1 (4 hembras y 3


machos) y grupo 2 (18 machos, 14 hembras, 19 juveniles y 16 plntulas).

El grupo 1, ubicado en la parte inferior izquierda de la Figura 3, se encuentra


separado del grupo 2 por la primera Coordenada Principal, con un porcentaje de
varianza total de 68.70% y por la segunda Coordenada Principal, con el 31.3% de
la varianza total acumulada (Figura 3). El grupo 1 quedo integrado por un total de
192
El Agro Veracruzano 2015

siete individuos adultos, de los cuales cuatro son hembras y tres machos. El grupo
2, ubicado hacia la derecha de la Figura 3, present una mayor dispersin de los
datos y quedo integrado por 18 machos, 14 hembras, 19 juveniles y 16 plntulas.
El anlisis de agrupamiento construido a partir de los valores del ndice de
similitud de Gower (1967) y el mtodo UPGMA, gener un dendrograma, que
arroj resultados similares a los observados en el anlisis PCoA. Se constat a un
nivel de similitud de corte de 0.37, la conformacin de dos grupos principales bien
definidos, con valores bootstrap de 100% y 46%, respectivamente (Figura 4). Estos
resultados sustentan los grupos conformados en el anlisis de PCoA (Figura 3). Se
detect un 100% de congruencia en la conformacin de los dos grupos establecidos
por el PCoA y el anlisis de Conglomerado, en cuanto a su composicin. De esta
manera el grupo 1 quedo integrado por un total de siete individuos adultos de los
cuales cuatro fueron hembras y tres machos, mientras que el grupo 2 quedo de
igual forma conformado por un total de 67 individuos, de los cuales 18 fueron
machos, 14 hembras, 19 juveniles y 16 plntulas.
El anlisis de la estructura gentica de la poblacin total de Z. furfuracea en La
Catalana, en el municipio de La Antigua Veracruz, revel la existencia de un
ndice de estructura gentica alta (Gst = 0.538), en cuanto al ndice de flujo
gentico (Nm) observado en esta poblacin fue de 0.428.

Discusin

Los ndices de diversidad gentica de la poblacin de Zamia furfuracea de La


Catalana muestran que el porcentaje de polimorfismo (%P = 97.06) detectado en
Zamia furfuracea es bastante alto al compararlo con otras especies del genero
Zamia, por ejemplo, (Gonzlez-Astorga et al., 2006) reportaron 66.6 % de
polimorfismo en Zamia loddigesii, (Walters y Decker-Walters 1991) en Zamia
pumila reportaron 16.7 % de polimorfismo; de igual manera, (Gonzlez-Astorga et
al., 2008) reportaron niveles de 81.6, 83.1 y 63.1 de porcentaje de polimorfismo en
tres especies del genero Dioon (sonorensese, tomasellii y holmgregii,
respectivamente), sin embargo, es muy similar a lo reportado por (Limn-Salvador
2009) quien report un porcentaje de polimorfismo de 97.88 en diferentes
poblaciones de Zamia furfuracea. Debemos aclarar que el tipo de marcador
utilizado en los estudios mencionados anteriormente, fueron isoenzimas, cuya
sensibilidad para detectar polimorfismo es menor, comparado con los marcadores
ISSRs, sin embargo, esta diferencia es muy probable que se d por la especie bajo
estudio, ya que los resultados son similares a lo reportado en otros estudios
realizados con diferentes poblaciones de Zamia furfuracea con base en diferentes
tipos de marcadores.

193
El Agro Veracruzano 2015

Figura 4. Dendrograma (UPGMA) de las relaciones genticas detectadas en la


poblacin de Zamia furfuracea. Los valores en los ejes representan el valor bootstrap
para cada nodo. M = macho, H = hembra, J = juvenil, P = plntula.

194
El Agro Veracruzano 2015

En cuanto a la heterocigosis esperada (diversidad gentica de Nei), (Limn-


Salvador 2009) obtuvo un valor de 0.33, con un intervalo entre 0.37 y 0.28 de
diversidad gentica entre las diferentes poblaciones de Zamia furfuracea
examinadas, (Gonzlez-Astorga et al., 2006) registr 0.26 en Zamia loddigesii,
este mismo autor en el 2008, registr ndices de diversidad gentica en Dioon
sonorensese de 0.31, y en D. tomasellii 0.29, lo que concuerda con lo encontrado
en este trabajo ya que se obtuvo un valor de 0.24 de diversidad gentica.
Respecto al nmero promedio de alelos por locus, (Limn-Salvador 2009) report
la existencia de 1.72 0.71 alelos, con un rango de variacin de 1.60 a 1.89 alelos
por locus. Al analizar diferentes poblaciones de Zamia furfuracea, (Gonzlez-
Astorga et al., 2006) registr un promedio de 1.8 alelos en Zamia loddigesii, y un
valor de 2.0 en Dioon sonorensese y 1.96 en D. tomasellii (Gonzlez-Astorga et
al., 2008). Estos resultados son muy similares al obtenido en la poblacin de
Zamia furfuracea de La Catalana ya que de igual forma se observ un elevado
nmero (1.97) de alelos por locus.
Los valores de diversidad gentica ms bajos detectados en la categora de
plntulas pueden deberse al muestreo realizado ya que para ste pudo no ser
representativo del rea de estudio donde se recolect el material biolgico. Cabe
mencionar que solo se observ la presencia de plntulas en una parte del rea
donde se registr el muestreo (equivalente a una tercera parte del rea muestreada).
En el anlisis de estructura gentica utilizando los anlisis multivariados (Figuras 3
y 4) se encontr la existencia de una elevada congruencia en los resultados
obtenidos lo que corrobora la existencia al interior de la poblacin bajo estudio de
dos subgrupos. Cabe significar que estos resultados concuerdan en lo general con
lo obtenido por (Martnez-Estrada 2014) en Zamia inermis dado que en la
poblacin de Zamia furfuracea se present de igual forma un patrn de
agrupamiento general basado en las categoras de edades y sexo (hembras, machos,
juveniles y plntulas). De igual forma los resultados obtenidos en este trabajo
concuerdan con lo obtenido por diversos autores (Rivera-Fernndez, et al., 2012:
Martnez-Estrada, 2014) en relacin a que los marcadores ISSRs son efectivos para
este tipo de estudio ya que permiten determinar la presencia de eventos de
subdivisin en las poblaciones naturales. En este estudio tambin se demuestra que
los marcadores ISSR han sido efectivos para discriminar por categora de edades y
por sexo.
El resultado del ndice de estructura gentica concuerda con los valores elevados
detectados por (Keppel et al., 2002) en Cycas seemannii (0.594) y (Sharma et al.,
2004) en Macrozamia plurinervia (0.588). Al respecto, (Limn-Salvador 2009) al
estudiar la diversidad y estructura gentica de 5 poblaciones de Zamia furfuracea
encontraron un ndice de estructura gentica promedio de 0.16. En otras especies
de ccadas empleando isoenzimas como marcadores se han detectado menores
valores de estructura gentica. Ejemplos de ello son los trabajos realizados en el
195
El Agro Veracruzano 2015

gnero Dioon por (Gonzlez-Astorga et al., 2008) quienes detectaron valores de


estructura gentica de 0.151 en Dioon sonorense, de 0.145 para Dioon tomasellii y
de 0.069 para Dioon holmgrenii.
Los elevados valores de estructura gentica observados en la poblacin de estudio
pueden ser atribuidos al hecho de que solamente se tomaron en cuenta los
individuos provenientes de una sola poblacin, lo cual estara indicando que la
identidad gentica de la poblacin estudiada se ha mantenido a travs del tiempo.
En comparacin con los estudios citados anteriormente, (Gonzlez-Astorga et al.,
2008; Limn-Salvador, 2009) en donde el nmero de poblaciones evaluadas (4, 5,
2 y 5) podra tener un efecto en los valores de estructura gentica reportados.
El ndice de flujo gentico detectado en la poblacin de La Catalana en La
Antigua, Veracruz fue bajo. Es probable que lo anterior se deba a que esta
poblacin se encuentra muy alejada geogrficamente (70 km aproximadamente) de
la poblacin ms cercana de Zamia furfuracea, ubicado en el municipio de
Tlalixcoyan, Veracruz. Es muy posible que el bajo nivel de flujo gentico (Nm =
0.428) detectado en esta poblacin y el alto porcentaje de estructura gentica
(53%) observado le haya permitido evolucionar y subsistir a travs del tiempo
como una poblacin independiente.
Altos ndices de diversidad gentica fueron detectados en la poblacin, mientras
que a nivel de categoras las hembras presentan el resultado ms elevado (35.29%)
seguido de la categora de juveniles (30.88%) y las plntulas registran el valor ms
bajo (22.06%). Estos resultados muestran que la poblacin de La Catalana a
pesar de que ha tenido una importante reduccin en su tamao poblacional, su
diversidad gentica se est manteniendo. Es posible tambin que la prdida de
diversidad ocurrida en la poblacin an no presente un efecto significativo para la
poblacin, debido al aporte gentico de los adultos.
El uso de los marcadores ISSRs en la poblacin de La Catalana revel la
existencia de dos grupos (1 y 2), utilizando la distancia de Gower, (1967) lo que
fue corroborado por los resultados del Anlisis de Componentes Principales. El
grupo uno present una menor cantidad de individuos adultos, pero en
proporciones iguales de sexos (4 hembras y 3 machos). Esto puede contribuir a que
a travs de su descendencia se logre aumentar la diversidad y estructura gentica
de la poblacin. El grupo dos result el ms grande y heterogneo ya que dentro de
este se logr observar la presencia de plntulas, juveniles y adultos sexualmente
reproductivos. Algunos autores sugieren que la historia de vida tiene
consecuencias importantes en la estructura gentica de las poblaciones, atribuidas
principalmente a la forma de crecimiento, distribucin geogrfica, sistemas de
reproduccin y dispersin de polen y semillas (Aguinagalde et al., 2005; Duminil
et al., 2007).

196
El Agro Veracruzano 2015

Conclusiones

La diversidad gentica de la poblacin fue alta, siendo la categora de hembras la


que mantiene la variabilidad gentica dentro de la poblacin. Los resultados
indican que la diversidad gentica de la poblacin no se ve afectada por el bajo
ndice de diversidad observado en plntulas.
Se observ la formacin de dos grupos bien definidos dentro de la poblacin, lo
cual indica una probable subdivisin dentro de la poblacin.
Se consta que la poblacin estudiada no ha sido afectada en gran medida por la
perturbacin del medio donde se encuentra y su persistencia est ligada al aporte
gentico que tienen los individuos adultos.

Literatura Citada

Aguinagalde, I., A. Hampe, A. Mohanty, J.P. Martn, J. Duminil y R.J. Petit, 2005. Effects
of lifehistory traits and species distribution on genetic structure at maternally
inherited markers in European trees and shrubs. Journal of Biogeography,
32(2):329-339.
Duminil, J., S. Fineschi, A. Hampe, P. Jordano, D. Salvini, G.G. Vendramin y R.J. Petit,
(2007). Can population genetic structure be predicted from lifehistory traits. The
American Naturalist, 169(5):662-672.
Gonzlez-Astorga, J., A.P. Vovides, P. Octavio-Aguilar, D. Aguirre-Fey, F. Nicolalde-
Morejn y C. Iglesias, 2006. Genetic diversity and structure of the Cycad Zamia
Loddigesii Miq. (Zamiaceae). Implications for evolution and conservation.
Botanical Journal of the Linnean Society, 152(4):533-544.
Gonzlez-Astorga, J., F. Vergara-Silva, A.P. Vovides, F. Nicolalde-Morejn, D. Cabrera-
Toledo y M.A. Prez-Farrera, 2008. Diversity and genetic structure of three
species of Dioon Lindl. (Zamiaceae, Cycadales) from the Pacific seaboard of
Mxico. Biological Journal of the Linnean Society, 94(4):765776.
Gower, J.C., 1967. A comparison of some methods of cluster analysis. Biometrics,
23(4):623-637.
Hammer, ., D.A.T. Harper y P.D. Ryan, 2001. Paleontological Statistics Software
Package for Education and Data Analysis. Palaeontologia Electronica, 4:918.
Haynes, J.L., 2011. World list of Cycads: a historical review. IUCN/ SSC Cycad Specialist
Group. Botanical Sciences, 90(1):73-87.
Hill, K.D., D.W. Stevenson y R. Osborne, 2007. The world list of cycads. Proceedings of
the Fifth International Conference on Cycad Biology. Botanical Review,
70(2):274-298.
INE-SEMARNAP., 2000. Proteccin, conservacin y recuperacin de la familia
Zamiaceae (Cycadales) de Mxico. Mxico D.F. Instituto Nacional de Ecologia.
63 pp.

197
El Agro Veracruzano 2015

Jones, D.L., 2002. Cycads of the World: Ancient plants in todays landscape. Smithsonian
Institution Press Publ. Washingnton D.C., USA. 456 pp.
Keppel, G., S.W. Lee y P.D. Hodgskiss, 2002. Evidence for long isolation among
populations of a Pacific cycad: Genetic Diversity and Differentiation in Cycas
seemannii A.Br. (Cycadaceae). Journal of Heredity, 93(2):133-139.
Kimura, M. y J.F. Crown, 1964. The number of allele that can be maintained in a finite
population. Genetics, 49:725-738.
Lewontin, R.C., 1972. Testing the theory of natural selection. Nature, 236(5343):181-182.
Limn-Salvador, F., 2009. Gentica de Poblaciones de Zamia furfuracea L. f.
(Zamiaceae): una ccada endmica al estado de Veracruz, Mxico. Tesis de
licenciatura. Facultad de Biologa, U. V., Xalapa, Veracruz. 59 pp.
Mamay, S.H., 1976. Paleozoic origin of the cycads. Geological Survey, Profesional Paper,
934:148.
Martnez-Estrada, E., 2014. Estructura poblacional y diversidad gentica de Zamia inermis
Rees & Vzquez-Torres: una ccada endmica del estado de Veracruz. Tesis de
licenciatura. Facultad de Ciencias Agrcolas. U. V. Xalapa, Veracruz. 58 pp.
McDermott, J.M. y A.B. McDonald, 1993. Gene flow in plant pathosystems. Annual
review of phytopatology, 31(1):353-373.
Nei, M., 1972. Genetic Distance between Populations. The American Naturalist,
106(949):283.
Nei, M., 1973. Analysis of Gene Diversity in Subdivided Populations. Proceedings of the
National Academy of Sciences of the United States of America, 70(12):3321
3323.
Norstog, K.J. y T.J. Nicholls, 1997. The biology of the cycads. Cornell University Press.
Ithaca, New York. 363 pp.
Peakall, R. y P.E. Smouse, 2006. GENALEX 6: genetic analysis in excel. Population
genetic software for teaching and research. Molecular Ecology Notes, 6(1):288
295.
Rivera-Fernndez, A., P. Octavio-Aguilar, N. Snchez-Coello, L. Snchez-Velsquez, S.
Vzquez-Torres, L.G. Iglesias, 2012. Population structure and spatial distribution
of Ceratozamia mexicana Brongn. (Zamiaceae) in preserved and disturbed
environments. Tropical and Subtropical Agroecosystems, 15(S2):110-117.
Secretara de Medio ambiente y Recursos Naturales SEMARNAT. 2010. Norma Oficial
Mexicana. 77 pp.
Sharma, I.K., D.L. Jones y P.I. Foster, 2004. Genetic differentiation and phenetic
relatedness among seven species of the Macrozamia plurinervia Complex
(Zamiaceae). Biochemical Systematics and Ecology, 32(3):313-327.
Stevenson, D.W., 1992. A formal classification of the extant cycads: Brittonia, 44(2):220-
223.
Stewart, C.N. y L.E. Via, 1993. A rapid CTAB DNA isolation technique useful for RAPD
fingerprinting and other PCR applications. Biotechniques, 14(5):748-750.
Vzquez-Torres, M., L. Torres-Hernndez y L.H. Bojrquez-Galvn, 2001. Distribucin,
abundancia, estructura poblacional y potencial reproductor de Zamia furfuracea
L. Universidad Veracruzana. Xalapa, Veracruz. 55 pp.

198
El Agro Veracruzano 2015

Walters, T.W. y D.S. Deckerwalters, 1991. Patterns of allozyme diversity in the west Indies
cycad Zamia pumila (Zamiaceae). American Journal of Botany, 78(3):436445.
Xiao L.Q. y Xun Gong, 2006. Genetic differentiation and relationships of populations in
the Cycas balansae Complex (Cycadaceae) and its conservation implications.
Annals of Botany, 97(5):807-812.
Yeh, F., Y. Rong-cai, T. Boyle y M. W. Freeware, 1999. Popgene version 1.31. for
population analysis. University of Alberta and Centre for International Forestry
Research. Edmonton, 129.

199
El Agro Veracruzano 2015

14
MICROINJERTOS EN Vanilla planifolia
Jos Roberto Bautista Aguilar1, Marco Antonio Ramrez Mosqueda2, Lourdes
Georgina Iglesias Andreu3*, Vernica Borbolla Prez4

1
Ingeniero Agrnomo, Instituto de Biotecnologa y Ecologa Aplicada
(INBIOTECA). Universidad Veracruzana Avenida de las Culturas Veracruzanas 101,
Colonia Emiliano Zapata, C.P. 91090, Xalapa, Ver., Mxico Tel: +52 228 84227-73, Fax:
+52 228 84227-73. E-mail: robert_k64@hotmail.com
2
Licenciado en Biologa (2012, Facultad de Ciencias Biolgicas y Agropecuarias de la
Universidad Veracruzana, Crdoba, Veracruz). Doctorado en Ciencias en Ecologa y
Biotecnologa (Estudiante de tiempo completo 5 semestre), Instituto de Biotecnologa y
Ecologa Aplicada (INBIOTECA) de la Universidad Veracruzana, Xalapa, Veracruz).
3
Miembro del Sistema Nacional de Investigadores (SNI, Nivel II). Investigador de
Tiempo Completo, Titular Cdel Instituto de Biotecnologa y Ecologa Aplicada
(INBIOTECA), de la Universidad Veracruzana. Doctor en Biotecnologa de Plantas. Lnea
de Investigacin Conservacin, Manejo y Mejoramiento gentico de plantas y del Cuerpo
Acadmico Consolidado CA-UVER-234 . Profesor con PERFIL PROMEP. *Autor de
correspondencia E-mail: liglesias@uv.mx.
4
Doctorado en Ciencias en Ecologa y Biotecnologa (Estudiante de tiempo completo 7
semestre), Instituto de Biotecnologa y Ecologa Aplicada (INBIOTECA) de la Universidad
Veracruzana, Xalapa, Veracruz). E- mail: veronicabor1@hotmail.com

Resumen
1. La vainillina es uno de los saborizantes de mayor importancia mundial
proveniente del cultivo de V. planifolia Jacks. Sin embargo su cultivo presenta
una seria problemtica dada por la susceptibilidad al ataque de patgenos
fungosos, como Fusarium oxysporum f. sp. Vanillae que produce serias
afectaciones productivas en sus plantaciones. Este patgeno causa la pudricin de
tallo y raz en vainilla ocasionando serias prdidas productivas. Se ha reportado
que V. insignis presenta resistencia a este patgeno por lo que una estrategia para
el manejo de esta enfermedad pudiera ser a travs de la propagacin de
microinjertos de V. planifolia en patrones de V. insignis.
2. El propsito del presente trabajo fue establecer un protocolo para efectuar
microinjertos en Vanilla spp. Para ello se propuso evaluar primeramente la
compatibilidad entre homomicroinjertos de V. planifolia y luego entre sta especie
con V. insignis como patrn.
3. Utilizando la tcnica de cuas, se realizaron los homomicroinjertos en V.
planifolia . Para ello se evalu el efecto por separado de dos concentraciones de
200
El Agro Veracruzano 2015

medio Murashige y Skoog (MS) (50 y 100 %) y dos concentraciones de cido


giberlico (GA3) (1 y 2 mg L-1). A todos los tratamiento se les adicion 2.15 mg L-
1
de 6-Bencilamonopurina (BAP) igual a la dosis empleada en la fase de
establecimiento in vitro.
4. A las cuatro semanas de cultivo se observ que con el tratamiento MS al 50 %
conteniendo 2.15 mg L-1 de BAP y 2 mg L-1 de GA3 se obtuvieron los mejores
resultados en cuanto a prendimiento (75.0 6.2 % de prendimiento) y
caractersticas del injerto, seguido del medio MS (66.6 6.6 % de prendimiento).
Por ello se seleccion este medio para efectuar los microinjertos de V. planifolia
con V. insignis.
5. Los resultados obtenidos demuestran la existencia de una adecuada compatibilidad
patrn-injerto entre las especies de Vanilla planifolia y Vanilla insignis.
6. Los microinjertos obtenidos sern evaluando en campo, con el fin de establecer un
mtodo alternativo de manejo de reas vainilleras afectadas por F. oxysporum f.
sp. vanillae.
Palabras clave: Vanilla planifolia, Vanilla insignis, Fusarium oxysporum f. sp. vanillae.

Abstract
1. Vanillin flavoring is one of the world's most important coming from the V.
planifolia Jacks. However its cultivation presents a serious problem due to its
susceptibility to the attack of fungal pathogens such as Fusarium oxysporum f. sp.
Vanillae. Stem rot disease is a major constraint to vanilla production and has
caused significant economic losses over the last decade. It has been reported that
V. insignis has some tolerance to this fungal pathogen so a strategy for the
management of this disease may be through the propagation of V. planifolia
micrograft in V. insignis used as rootstocks.
2. The purpose of this study was to establish a protocol for performing micrografts in
Vanilla spp. In order to do this it was first evaluated the micrografts compatibility
between V. planifolia plants and between plants of this species with V. insignis
used as rootstocks.
3. To set the micrografting protocol, the wedges technique was employed. It was
evaluated the effect of two concentrations of Murashige and Skoog (MS) (50 and
100 %), and two concentrations (1 and 2 mg L-1) of gibberellic acid (GA3). It was
also added 2.15 mg L-1 of 6-Bencilamonopurina (BAP), to MS medium of all
treatments.
4. At four weeks of culture it was observed that the treatment with 50 % MS
containing 2.15 mg L-1 of BAP and 2 mg L-1 of GA3 showed the best results as
percentages of viable grafts (75.0 6.2 % engraftment) and characteristics of the
graft followed by MS medium (66.6 6.6 % engraftment). So it was selected this
medium to perform the micrografts of V. planifolia with V. insignis.
5. The results demonstrate the existence of suitable scion-rootstock compatibility
between species of Vanilla planifolia and Vanilla insignis.
6. The obtained micrografts will be evaluated in field, in order to establish an
alternative management method in Vanillas areas affected by F. oxysporum f. sp.
vanillae.
201
El Agro Veracruzano 2015

Keywords: Vanilla planifolia, Vanilla insignis, Fusarium oxysporum f. sp. vanillae.

Introduccin

El gnero Vanilla (Orchidaceae) comprende ms de 100 especies de orqudeas


hemiepfitas (Lubinsky et al., 2008), de las cuales la especie ms importante
econmicamente es Vanilla planifolia Jacks. (Geetha y Sudheer, 2000; Kalimuthu
et al., 2006). De sus frutos beneficiados, se obtiene la vainillina (4-hydroxy 3-
methoxy benzaldehyde), componente qumico responsable del sabor y fragancia
caracterstica de la vainilla; este saborizante se ocupa en una amplia variedad de
platillos y bebidas (Annand y Smith 1986; Kalimuthu et al., 2006).
Un aspecto restrictivo del cultivo de V. planifolia es su elevada susceptibilidad a
enfermedades causadas por hongos, bacterias y virus, que logran causar prdidas
productivas de hasta el 80 % (Bhai y Dhanesh, 2008; Pinaria et al., 2010). Sin
embargo, las fngicas causada principalmente por Fusarium oxysporum f. sp.
vanillae han resultado las ms recurrentes y devastadoras en este cultivo (Naik et
al., 2011; Pinaria et al., 2010). En vainilla este patgeno, ataca los tallos y el
sistema radical de manera que en pocos das ocasiona la pudricin y muerte de la
planta (He, 2007; Bhai y Dhanesh, 2008). Para el control de este patgeno se
emplean tratamientos qumicos los cuales no son del todo efectivos; adems que su
aplicacin prolongada puede resultar nociva para la salud (He, 2007).
Por otro lado, Vanilla insignis, es una especie genticamente relacionada a V.
planifolia que de igual forma posee caractersticas sobresalientes (Bory et al.,
2008) particularmente por su mayor tolerancia al ataque de patgenos y al dficit
hdrico (Soto-Arenas, 1999).
Los injertos consisten en la unin de dos porciones de tejido vegetal viviente, que
crece y se desarrolla como una sola planta (Hartmann y Kester, 2002). El genotipo
comercial (generalmente susceptible, pero de alto rendimiento y buena calidad de
fruto) se injerta sobre un portainjerto resistente, el cual cumple la funcin de
absorber agua, nutrimentos y asla la planta de los patgenos del suelo (Lpez,
2009).
La tcnica de injertacin in vitro microinjertacin se desarroll en la dcada de
1980 (Jonard, 1986). Esta consiste en la insercin, bajo condiciones aspticas, de
un fragmento de tejido injerto proveniente de un brote desarrollado in vitro, en
una vitroplntula enraizada, que se emplea como portainjerto o patrn (Jonard,
1986). El microinjerto obtenido puede ser cultivado in vitro o ser aclimatado
(Onay et al., 2003).
El propsito puede ser la produccin de injertos libres de enfermedades,
rejuvenecimiento y vigorizacin fisiolgica de las plantas (Navarro, 1988; Onay et
al., 2003). Esta tcnica se ha utilizado principalmente para rejuvenecer los tejidos
adultos de especies leosas como: Abies (Ponsonby y Mantell, 1993), Hevea
202
El Agro Veracruzano 2015

brasiliensis (Perrin et al., 1994) y Quercus (Ewald y Naujoks, 1996); para la


produccin de plantas libres de virus (Wu et al., 2007) y para la evaluacin de la
incompatibilidad entre especies del mismo gnero (Navarro, 1988).
A la fecha no se cuenta con estudios sobre microinjertacin en especies del gnero
Vanilla, pese ser una tcnica til para combatir enfermedades fngicas en
diferentes especies vegetales. La microinjertacin de V. planifolia en patrones
tolerantes de V. insignis (especie que presenta cierto grado de resistencia a
Fusarium oxysporum f. sp. vanillae), puede contribuir a controlar los daos que
ocasiona este patgeno en las reas vainilleras. Por tanto, el propsito de este
trabajo fue establecer un protocolo de microinjertacin de V. planifolia en patrones
de V. insignis.

Materiales y mtodos

rea de trabajo.El presente trabajo se realiz en el Laboratorio de Cultivo


Vegetal, del Instituto de Biotecnologa y Ecologa aplicada (INBIOTECA), de la
Universidad Veracruzana, como parte del proyecto de Red Mejoramiento
gentico de V. planifolia Jacks.
Material biolgico. El material vegetal de V. planifolia y V. insignis empleado en
el presente trabajo provino del banco de germoplasma in vitro del gnero Vanilla,
establecido en el INBIOTECA.
Evaluacin de la compatibilidad de homomicroinjertos en V. planifolia. Se
utilizaron brotes enraizados de V. planifolia (10-12 cm) desarrollados bajo
condiciones aspticas. Para la obtencin del portainjerto se elimin la parte apical
de los brotes, a fin de contar con una porcin del tallo enraizado de 5 cm de
longitud. La parte apical removida fue seccionada, en segmentos de 3 cm de
longitud, para su uso en el proceso de microinjertacin.
Se utiliz el mtodo de injertacin por cua. Este consiste en realizar una incisin,
de 1 cm de longitud, en cada patrn, para luego insertar en el mismo, el injerto
previamente cortado en forma de V. El rea de contacto del microinjerto fue
rodeada longitudinalmente con un fragmento (1 x 1 cm) de papel aluminio, para
proporcionar estabilidad y fortalecer, la unin patrn-injerto. Los fragmentos de
papel aluminio empleados fueron previamente esterilizados a 1.5 kg cm-2 de
presin y 121C por 15 min. Los microinjertos fueron establecidos en tubos de
ensaye conteniendo 10 mL de medio liquido (Murashige y Skoog, 1962),
complementado con 3 % (p/v) de sacarosa, 2.1 mg L-1 de 6-bencilaminopurina
(BAP), utilizado para el establecimiento in vitro de V. planifolia (Lee-Espinosa et
al., 2008).
Para sujetar el microinjerto en el medio fue empleado una tira de papel filtro, de 10
cm de largo por 2 cm de ancho, previamente esterilizada. Se evaluaron diferentes
concentraciones del medio basal: MS y MS al 50 %, as como el efecto de
203
El Agro Veracruzano 2015

diferentes concentraciones (0, 1, 2 mg L-1) de cido giberlico (GA3). El pH de los


medios fue ajustado a 5.8 0.2 y los frascos de cultivo se autoclavearon a 1.5 kg
cm-2 de presin y 121C por 15 min. Los cultivos fueron incubados a una
temperatura de 25 2 C, bajo un fotoperiodo de16 horas luz y ocho de oscuridad,
y a una irradiacin de 50 mol m2 s1, proporcionado por lmparas fluorescentes.
A las seis semanas de cultivo, se evalu el porcentaje de prendimiento, longitud y
grosor del injerto, nmero y longitud de races areas presentes en el injerto.
Microinjertacin de V. planifolia y V. insignis. Se utiliz la metodologa de
injertacin anteriormente descrita, solo que en este caso se emplearon los brotes
enraizados de V. insignis, como portainjertos. Se utiliz como medio liquido de
cultivo MS al 50 % complementado con 3 % (p/v) de sacarosa, 2.15 mg L-1 de 6-
bencilaminopurina (BAP) y 2 mg L-1 de GA3. El pH de los medios fue ajustado a
5.8 0.2. Los frascos de cultivo se autoclavearon a 1.5 kg cm-2 de presin y 121C
por 15 min. Los cultivos fueron incubados a una temperatura de 25 2C bajo
fotoperiodo (16 horas luz y ocho de oscuridad) a una irradiacin de 50 mol m2
s1 proporcionada por lmparas fluorescentes. A las ocho semanas de cultivo se
evalu el porcentaje de prendimiento, longitud y grosor del tallo del injerto,
nmero y longitud de races areas presentes en el injerto.
Anlisis estadstico. En ambos experimentos se utiliz un diseo completamente
al azar con 20 microinjertos por tratamiento. Los datos obtenidos se procesaron
estadsticamente mediante el software IBM SPSS (versin 21, para Windows). Se
realiz un anlisis de varianza ANOVA, seguido de una prueba de Tukey
(p<0.05). Los datos de porcentajes fue previamente transformado a arco seno %
antes de su anlisis estadistico.
Aclimatacin. Los microinjertos fueron aclimatados bajo condiciones de
invernadero, a una sombra del 50 %, durante cuatro semanas. Para ello estos se
lavaron previamente con agua corriente y se colocaron cuidadosamente en charolas
de polietileno (50 x 30 x 5cm) conteniendo sustrato estril de musgo turboso y
agrolita (3:1 v/v). Se realizaron tres riegos por semana con agua corriente, con el
fin de mantener una humedad relativa del 80 %. Cuando las plantas alcanzaron
una longitud de 30 cm, se transfirieron a contenedores individuales, conteniendo
una mezcla de musgo turboso, agrolita y composta (1:1:1 v/v), para su posterior
desarrollo. Se realizaron aplicaciones de fungida (Tiabendazol, 1gL-1) y de
fertilizacin foliar, con Nitrofoska N: P: K (25-10-17) una vez por semana.

204
El Agro Veracruzano 2015

Resultados y discusin

Establecimiento de la tcnica para obtener homomicroinjertos en V.


planifolia. A las ocho semanas de cultivo se observ la presencia de un mayor
porcentaje de prendimiento (75 %) en los homomicroinjertos efectuados, aplicando
el tratamiento consistente en medio MS al 50 % suplementado con 2.15 mgL-1
BAP y 2 mgL-1 de GA3 (Figura 1A). Con el tratamiento consistente en medio MS
conteniendo 2.15 mg L-1 GA3, se logr un 66.6 % de prendimiento (Tabla 1).

Figura 1. Establecimiento de la tcnica de microinjertos . A) Preparacin de los


microinjertos y B) Microinjertos de V. planifolia en V. insignis. (bar= 1cm).

Estos resultados evidencian la existencia de una alta compatibilidad entre los


homomicroinjertos efectuados en V. planifolia.
La tcnica de microinjertacin por cua empleada en este estudio, puede ser
utilizada de manera efectiva en especies semiherbceas, al igual que lo reportado
en otras especies leosas como: almendro (Prunus dulcis Mill.) (Channuntapipat et
al., 2003; Yldrm et al., 2010), chirimoya (Annona cherimola Mill.) (Padilla y
Encina, 2011) y anacardo (Anacardium occidentale L.) (Timmanppaih et al.,
2002).
Una ventaja del presente protocolo, en relacin a otros previamente descritos en la
literatura (Yldrm et al., 2010; Padilla y Encina, 2011), que han empleado medio
semislido, se deriva del hecho que al emplearse medio lquido, se logra reducir
sensiblemente los costos de produccin. Se observ que los homomicroinjertos
obtenidos presentaron valores elevados en el porcentaje de prendimiento. Es
posible que esto se deba al factor de compatibilidad que se presenta cuando se
realizan Microinjertos entre individuos de la misma especie.
205
El Agro Veracruzano 2015

Tabla 1. Efecto a las ochos semanas de cultivo de diferentes concentraciones


de sales MS y fitohormonas, en el establecimiento de homomicroinjertos de V.
planifolia

Tratamientos Prendimiento Longitud Grosor Nmero Longitud


(%) del injerto del de races de races
(cm) injerto (cm)
(cm)
MS + 2.15 mg 66.6 6.6ab 8.57 0.08 1.80 1.66
L-1 BAP 0.31a 0.04b 0.20a 0.06a
50% MS +2.15 62.5 8.2ab 8.36 0.12 0.08 1.64 1.62
a
mg L-1 BAP 0.03b 0.33b 0.17a
b
50% MS + 2.15 44.4 7.5 8.20 0.09 0.05 1.66 1.36
a
mg L-1 BAP + 1 0.03b 0.33b 0.23b
mg L-1 GA3
50% MS + 2.15 75.0 6.2a 8.33 0.09 0.30 1.00 1.25
a
mg L-1 BAP + 2 0.09b 0.27b 0.25b
mg L-1 GA3
Los valores representan la media ES (error estndar). Medias con diferente letra fueron
significativamente diferentes (Tukey, p 0.05).

Se ha indicado que cuanto ms alejado sea el parentesco gentico entre patrn e


injerto ms difcil resultar lograr una unin y crecimiento normal del injerto
(Joshi et al., 2003). Se detectaron diferencias significativas en el nmero y
longitud de races de los microinjertos. El medio MS a la mitad de su
concentracin, fue el tratamiento que permiti obtener los mejores resultados al
generar como promedio 1.64 races, con longitudes de 1.66 cm. Estos resultados
concuerdan con los descritos por Timmanppaih et al. (2002) quienes al igual que lo
obtenido en este trabajo, obtuvieron buenos resultados al realizar microinjertos de
Anacardium occidentale, en medio MS a la mitad de su concentracin.
Se detect asimismo la existencia de diferencias significativas en la longitud del
injerto (8.57 cm) al adicionar 2 mg L-1 GA3 al medio de cultivo. Es posible que
esto se deba al efecto del cido giberlico, que ha sido reportado como una
fitohormona til en la elongacin del tallo, en diversas especies vegetales (Lee-
Espinosa et al., 2003).
Establecimiento de la tcnica para obtener microinjertos de V. planifolia en
portainjertos de V. insignis. Los resultados obtenidos mostraron un 75 % de
prendimiento, entre injertos de V. planifolia en portainjertos de V. insignis,
transcurrido ocho semanas de cultivo (Figura 1B). Cabe resaltar que este resultado
fue muy similar a lo obtenido en la tcnica de homomicroinjertos en V. planifolia.
Es posible que esta similitud se deba a la cercana gentica existente entre estas dos
especies (Bory et al., 2008). Al respecto se ha mencionado que V. insignis pudiera
206
El Agro Veracruzano 2015

ser una subespecie de V. planifolia (Lubinsky et al. 2008). En cuanto al nmero y


longitud de races los resultados obtenidos (1.76 races de longitudes de 1.84 cm),
al igual que en la longitud y grosor del injerto (8.66 cm de altura y grosor de 0.30
cm) tambin fueron muy similares a los referidos en los resultados obtenidos en los
homomicroinjertos establecidos en V. planifolia.
Aclimatacin. Se obtuvo un 100 % de supervivencia a las cuatro semanas de
haberse transferido los microinjertos de V. planifolia con V. insignis a condiciones
de invernadero (Figura 2).

Figura 2. Aclimatacin de microinjertos.

Los resultados obtenidos en esta fase concuerdan con los valores de supervivencia
(95-100 %) obtenidos en los trabajos de aclimatacin de microinjertos efectuados
por diversos autores (Channuntapipat et al., 2003; Yldrm et al., 2010; Padilla y
Encina, 2011) en diversas especies vegetales. Mat hur et al. (2008) han
mencionado que en algunas especies vegetales se puede llegar a presentar una
elevada tasa de mortalidad, durante el proceso de aclimatacin, debido a problemas
de disfuncionalidad estomtica, sistemas radiculares dbiles y/o al poco desarrollo
de la cutcula.
El porcentaje de supervivencia (100 %) de los microinjertos establecidos en este
trabajo, es superior a los reportados en plntulas micropropagadas de V, planifolia,
que varan entre un 80-95 % (Tan et al., 2013; Zuraida et al., 2011). El protocolo
establecido garantiz adems un adecuado porcentaje de supervivencia en los

207
El Agro Veracruzano 2015

microinjertos interespecficos obtenidos entre V.planifolia y V.insignis, dos


especies del gnero Vanilla.

Conclusiones

Se obtuvo un 75 % de prendimiento en los microinjertos de V. planifolia en


patrones de V. insignis, lo que evidencia una adecuada compatibilidad entre estas
dos especies. La microinjertacin de V. planifolia en patrones tolerantes de V.
insignis (especie que presentan cierto grado de resistencia a Fusarium oxysporum
f. sp. vanillae), puede resultar un mtodo alternativo de manejo de reas vainilleras
afectadas por F. oxysporum f. sp. vanillae. Adems, esta tcnica puede resultar til
para acelerar la vigorizacin y la madurez fisiolgica del injerto con el fin de
acelerar su entrada en la etapa de produccin.

Agradecimientos

Los autores desean agradecer el financiamiento obtenido para el desarrollo del


trabajo, as como la beca de licenciatura otorgada Mat. S10008134, a partir del
proyecto Red de Conservacin, Manejo y Mejoramiento Gentico de Plantas-
Bases Biotecnolgicas para el Mejoramiento Gentico de Vanilla planifolia Jacks
Ex Andrews. SEP-Promep CA-2012.

Literatura Citada

Annand N, Smith A., 1986. The market for vanilla. Tropical Development and Research
Institute. London. 33 pp.
Bhai S, Dhanesh J., 2008. Occurrence of fungal diseases in vanilla (Vanilla
planifolia Andrews) in Kerala. Journal of Spices and Aromatic Crops, 17:140-148.
Bory S, Lubinsky P, Risterucci A, Noyer J, Grisoni M, Duval M, Besse P., 2008. Patterns
of introduction and diversification of Vanilla planifolia (Orchidaceae) in Reunion
Island (Indian Ocean). American Journal of Botany, 95:805-815.
Channuntapipat C, Sedgley M, Collins G., 2003. Micropropagation of almond cultivars
Nonpareil and Ne Plus Ultra and the hybrid rootstock Titanx Nemaguard. Scientia
Horticulturae, 98, 473484.
Ewald D, Naujoks G., 1996. In: Development of Integrated Systems for Large Scale
Propagation of Elite Plants Using In Vitro Techniques Report of Activities (F.
ORiodain, Ed.), COST 822, European Commission, DirectorateGeneral for
Science, Research and Deelopment, Brussels, 156-160 pp.

208
El Agro Veracruzano 2015

Kalimuthu K, Senthilkumar R, Murugalatha N., 2006. Regeneration and mass


multiplication of Vanilla planifolia Andr. a tropical orchid. Current Science,
91:1401-1403.
Lopez L, Glvez A, Gonzlez A., 2009. Agronomic behaviour of grafted sweet pepper
grown in greenhouse in Mediterranean area. Acta Horticulturae, 807:655- 660.
Lubinsky P, Cameron K, Molina M, Wong M, Lepers-Andrzejewski S, Gmez-Pompa A.
Seung-Chul K., 2008. Neotropical roots of a Polynesian spice: the hybrid origin of
Tahitian vanilla, Vanilla tahitensis (Orchidaceae), American Journal of Botany,
95:1040-1047.
Geetha S, Sudheer A., 2000. In vitro propagation of Vanilla planifolia, a tropical orchid.
Current Science, Vol. 79, No. 6, 886-889 pp.
Hartmann H. Kester D, Davies F, Geneve R., 2002. Plant Propagation, Priciples and
Practices. 7th Edition. New Jersey: Prentice Hall.
He X., 2007. Bio-control of root rot disease in vanilla. PhD. Tesis, Yunnan Agricultural
University.
Joshi I, Bisht P, Sharma V, Uniyal D., 2003. In vitro clonal propagation of mature
Eucalyptus F1 hybrid (Eucalyptus tereticornis Sm. x E. grandis Hill ex. Maiden).
Silvae Genetica, v. 52, n. 3-4, 110-113 p.
Jonard R., 1986. Micropropagation and its applications to tree improvement, p.31-48. In:
Y.P.S. Bajaj (eds). Biotechnology in Agriculture and Forestry. Vol. 1. Trees I.
Springer-Verlag, Berlin.
Lee-Espinosa H, Murgua J, Garca B, Crdoba A, Laguna A, Mijangos J, Barahona L,
Iglesias L, Santana N., 2008. In vitro clonal propagation of Vanilla (Vanilla
planifolia Andrews). Hort Science, 43:454-58.
Mathur A, Mathur A, Verma P., 2008. Biologicalhardening and genetic delity testing of
micro-clonedprogeny of Chlorophytum borivilianu . African Journal of
Biotechnology, 7:10461053.
Murashige T, Skoog F., 1962. A Revised Medium For Rapid Growth And Bioassays Wiht
Tobacco Tissue Culture. Physiologia Plantarum, 15:473-497.
Navarro L., 1988. Application of Shoot-tip Grafting in Vitro to WoodySpecies.
Acta Horticulturae, 227: 43-55.
Onay A, Pirink V, Adiyaman F, Isikalan C, Tilkat E, Basaran D., 2003. In vivo and In
vitro micrografting of pistachio, Pistacia vera. Turkish Journal of Biology, 27: 95-
100.
Padilla I, Encina C., 2011. The use of consecutive micrografting improves
micropropagation of cherimoya (Annona cherimola Mill.) cultivars. Scientia
Horticulturae, Amsterdam, v.129, 167-169 p.
Perrin Y, Lardet L, Enjalric F, Carron M., 1994. Rejuvenation of mature clones of Hevea
brasiliensis (Muell. Arg) by in vitro micrografting. Canadian Journal of Plant
Science, Kluwer Academic Publisher, The Netherlands, 74: 623-630 pp.
Pinaria A., Liew E., Burgess L., 2010. Fusarium species associated with vanilla stem rot in
Indonesia Australasian Plant Pathology, 39 (2):176-183.
Ponsonby D, Mantell S., 1993. In vitro establishment of Picea pungens f glanca and P
sitchensis seedling rootstocks with an assessment of their suitabilities for

209
El Agro Veracruzano 2015

micrografting with scions of various Picea species. The Journal of Horticultural


Science and Biotechnology, 68: 463-475.
Soto-Arenas M., 1999. Filogeografa y recursos genticos de las vainillas de Mxico.
Instituto Chinoin AC. Informe final del proyecto No. J101, SNIB-CONABIO,
Mxico D. F.
Tan B, Chin C, Alderson P., 2011. An Improved Plant Regeneration of Vanilla planifolia
Andrews, Plant Tissue Culture and Biotechnology, Vol. 21, No. 1,, 27-33 pp.
Thimmappaiah G, Anil R., 2002. In vitro grafting of cashew (Anacardium occidentale L.).
Scientia Horticulturae, 92, 177 182.
Yldrma H, Onay A, Szerer V, Tilkat E, Ozden-Tokatli H. A., 2010. Micrografting of
almond (Prunus dulcis Mill.) cultivars Ferragnes and Ferraduel. Horticultural
Science, 125:361367.
Wu H, Toit E, Reinhardt C., 2007. Micrografting of Protea cynaroides. Plant Cell, Tissue
and Organ Culture, 89:2328.
Zuraida A, Nurul A, Harteeni A, Roowi S., 2011 A Novel Approach for Rapid
Micropropagation of Maspine Pineapple (Ananas comosus L.) Shoots Using
Liquid Shake Culture System, African Journal of Biotechnology, Vol. 10, No. 19,
pp. 3859-3866.

210
El Agro Veracruzano 2015

15
USO DE BIORREACTORES DE INMERSIN POR GRAVEDAD (BIG)
PARA LA PROPAGACIN in vitro DE Stanhopea tigrina: UNA ORQUDEA
ENDMICA AMENAZADA

Eduardo Martnez Estrada, Jeric J. Bello Bello, Victorino Morales Ramos*

Colegio de postgraduados Campus Crdoba. Carretera Crdoba Veracruz, km 348. C.P.


94946, Amatln de los Reyes, Veracruz. *Email: vicmor@colpos.mx

Resumen
1. El Cultivo de Tejidos Vegetales (CTV) es una herramienta para la propagacin in
vitro de orqudeas de importancia ecolgica y ornamental; sin embargo, esta
tcnica se ha limitado debido a los altos costos ocasionados por los agentes
gelificantes de los medios de cultivo y la mano de obra.
2. El objetivo de este trabajo fue establecer un sistema para la propagacin y
desarrollo de Stanhophea tigrina utilizando Biorreactores de Inmersin por
Gravedad (BIG).
3. Semillas de capsulas fueron germinadas in vitro en medio MS (Murashige y
Skoog). Despus de 2 meses de desarrollo, se evalu la multiplicacin y
crecimiento de protocormos en sistemas semislido y biorreactores de inmersin
por gravedad. Cuando las vitroplantas alcanzaron los 5-6 cm de longitud fueron
trasferidas a sustrato estril para su aclimatizacin en invernadero.
4. El BIG promovi la multiplicacin y crecimiento in vitro de S. tigrina, logrando
reducir los costos de produccin, mano de obra y tiempo de cultivo in vitro.
5. Utilizar el BIG constituye una opcin viable para la reintroduccin o
aprovechamiento sustentable de esta importante especie.
Palabras clave: Stanhopea tigrina, cultivo in vitro, Sistemas de inmersin temporal.

Abstract
1. Plant tissue culture is a technique tool for in vitro propagation of ornamental and
ecological importance orchids; however this technique has been limited due to
high costs caused by the gelling agents of the culture media and labor.
2. The aim of this study was to establish a Gravity Immersion Bioreactors (GIB)
System for the propagation and development of Stanhophea tigrina L .
3. Capsules seeds were germinated in vitro on MS medium (Murashige and Skoog).
After 2 months of growth, multiplication and protocorm generation were
evaluated in semisolid and GIB. When the plantlets reached 5-6 cm in length were
transferred to sterile substrate in a greenhouse for acclimatization.
211
El Agro Veracruzano 2015

4. GIB promoted multiplication and in vitro growth of S. tigrina, achieving lower


production costs, labor and in vitro culture time.
5. The use of GIB is a viable option for the propagation of this important species.
Keywords: Stanhopea tigrina, in vitro culture, Temporary immersion system.

Introduccin

De las 1,254 especies de orqudeas encontradas en Mxico, al menos 400 son


endmicas (Soto-Arenas et al., 2007). Tan solo en el Estado de Veracruz habitan
alrededor de 500 especies, de las cuales 180 se encuentran amenazadas o en
peligro de extincin. Esto convierte a las orqudeas de Veracruz en un patrimonio
viviente de enorme importancia (Murgua y Lee, 2007). Dentro de las orqudeas
veracruzanas se encuentra Stanhopea tigrina, especie que por sus caractersticas
tan atractivas ha sido objeto de sobreexplotacin para su venta ilegal como plantas
de ornato, actividad que junto con la alteracin y destruccin de su hbitat natural
y su escasa germinacin simbitica, ha puesto a esta especie en la categora de
endmica amenazada por la norma NOM-059-SEMARNAT-2010. Ante esta
situacin, el Cultivo de Tejidos Vegetales (CTV) ha sido una herramienta vital
para la propagacin in vitro de orqudeas de importancia ecolgica y ornamental
(Damon et al., 2004; Kauth et al., 2008; Flores-Escobar et al., 2011, Ng y Saleh,
2011). Sin embargo, aun cuando los protocolos son eficientes y reproducibles, los
altos costos de produccin causados principalmente por la mano de obra y agentes
gelificantes de los medios de cultivo, siguen representando un problema para que
esta tecnologa sea rentable (Caamal y Bello, 2014). Con los avances
biotecnolgicos se han desarrollado nuevas metodologas para la propagacin
masiva de plantas in vitro, una de ellas es el uso de biorreactores. Estos, consisten
en recipientes diseados para la producin a gran escala de clulas, tejidos,
organos plantas completas cultivadas bajo condiciones de laboratorio en un
medio de cultivo lquido. Los biorreactores han demostrado ser una herramienta
eficaz para la micropropagacin de cultivos de importancia econmica y ecolgica
(Hanhineva et al., 2005; Mordocco et al., 2009; Georgiev et al., 2014) y las
orqudeas no han sido excepcin (Young et al., 2000; Tirado et al., 2005; Ramos-
castell et al., 2014). Estos sistemas se han convertido en una herramienta de gran
utilidad para lograr la semiautomatizacin, reduccin de costos y aumento en los
ndices de multiplicacin de los cultivos in vitro (Etienne y Berthouly, 2002). Por
ello, el objetivo de este trabajo fue establecer un sistema para la propagacin y
crecimiento de Stanhophea tigrina utilizando Biorreactores de Inmersin por
Gravedad (BIG).

212
El Agro Veracruzano 2015

Materiales y mtodos

El estudio fue realizado en el Laboratorio de Cultivo de Tejidos del Colegio de


Postgraduados Campus Crdoba, Veracruz.
Instalacin del sistema neumtico para el funcionamiento de los Sistemas de
Inmersin Temporal. En la parte superior de un estante de metal se instalaron
mangueras de silicona con salidas para la conexin de los biorreactores. Las
mangueras se conectaron a vlvulas solenoides y finalmente a un compresor de
aire. El funcionamiento del sistema neumtico fue regulado por medio de un
controlador lgico programable (PLC), el cual, enciende las vlvulas solenoides
para permitir el paso del aire hacia el sistema de inmersin temporal. El
Biorreactor de Inmersin por Gravedad (BIG) consta de dos frascos de vidrio de
capacidad variable que se colocan a diferentes alturas, el recipiente colocado en la
parte superior contiene los explantes y el inferior el medio de cultivo, el frasco
ms elevado est provisto de un orificio en la base. Ambos frascos son conectados
por medio de una manguera de silicona, al accionarse la vlvula solenoide, el flujo
de aire eleva el medio de cultivo haca el frasco superior, pasado el tiempo de
inmersin, el medio regresa al depsito inferior por gravedad.
Desinfeccin y siembra de las semillas. Las capsulas fueron desinfectadas con
hipoclorito de sodio 2% por 10 min para posteriormente ser flameada con etanol
(96). Para la germinacin de las semillas se utiliz medio de cultivo MS
(Murashige y Skoog, 1962) suplementado con 3% de sacarosa (p/v) y 2.5 g L -1 de
Phytagel como agente gelificante. El pH de los medios de cultivo se ajust a 5.8 y
se esteriliz en autoclave a 1.5 Kg cm-2 de presin y 121 C durante 15 min. Una
vez sembradas, las semillas, fueron incubados a 25 2 oC, bajo un fotoperiodo de
16:8 h luz:oscuridad a una irradiancia de 40-50 mol m-2 s-1.
Efecto del sistema de cultivo en la multiplicacin de protocormos. Protocormos
de dos meses de edad fueron utilizados para comparar la multiplicacin en BIG de
capacidad de 1 L y medio semislido. Se utiliz medio MS suplementado con 0.2
mg L-1 de BAP (6-Bencilaminopurina, SIGMA) + 3% de sacarosa (p/v) y 2.5 g L-
1
de Phytagel (SIGMA) como agente gelificante para el medio semislido. Se
utilizaron 10 ml por protocormo y un total de 250 ml por biorreactor. Las
condiciones de esterilizacin e incubacin de los biorreactores fueron similares a la
etapa de germinacin. La frecuencia de inmersin fue cada 12 horas por 2 minutos.
Efecto del sistema de cultivo en el crecimiento de plntulas. Protocormos
fueron transferidos a los BIG de capacidad de 1 L donde se evalu el crecimiento
de las plntulas respecto al medio semislido por 60 das. Se utiliz medio MS
suplementado con 3 % de sacarosa (p/v) y 2.5 g L-1 de Phytagel (SIGMA) como
agente gelificante para el medio semislido. Se utilizaron 10 ml por protocormo y
un total de 250 ml por biorreactor. Las condiciones de esterilizacin, incubacin y
frecuencia de inmersin fueron similares a la etapa anterior.
213
El Agro Veracruzano 2015

Anlisis de datos. Se realiz un diseo experimental completamente al azar y las


medias se compararon con una prueba t-student (P 0.05) utilizando el programa
estadstico SPSS v. 11.5 para Windows.

Resultados

Efecto del sistema de cultivo en la multiplicacin de protocormos. Se


encontraron diferencias significativas entre tratamientos, siendo mayor el nmero
de brotes obtenidos en los BIG que en el medio semislido, con 11.8 1.30 y 7.6
1.67 brotes/ explante, respectivamente (Figura 1).

Figura 1. Efecto del sistema de cultivo en la multiplicacin de Stanhopea tigrina.


Los valores representan la media ES (error estndar). Medias con diferente letra son
significativamente diferentes (t-student, P 0.05) a los 60 das de cultivo.

Efecto del sistema de cultivo en el crecimiento de protocormos. Los resultados


obtenidos mostraron diferencias significativas entre tratamientos. La mayor
longitud se encontr en los BIG (5.15 0.10) siendo inferior en el medio
semislido (3.65 0.08), como lo muestra la Figura 2.

214
El Agro Veracruzano 2015

Figura 2. Efecto del sistema de cultivo en el crecimiento de Stanhopea tigrina. Los


valores representan la media ES (error estndar). Medias con diferente letra son significativamente
diferentes (t-student, P 0.05) a los 60 das de cultivo.

Discusin

Usualmente, los altos costos de produccin ocasionados principalmente por los


agentes gelificantes de los medios de cultivo y mano de obra, limitan la posibilidad
de utilizar el cultivo de tejidos vegetales a especie de alto valor comercial
(Cammal y Bello, 2014). Los avances en la biotecnologa vegetal han permito el
desarrollo de sistemas de micropropagacin ms eficientes como los biorreactores.
En este trabajo, los biorreactores de inmersin por gravedad permitieron obtener
mayor nmero de brotes por explantes y mayor longitud de plntulas respecto al
sistema semislido. Estos resultados concuerdan con los reportados en diversos
cultivos como banano (Aragn et al., 2005), caa (Mordocco et al, 2009) y caf
(Ducos et al., 2007). En orqudeas de importancia ornamental como Phalaenopsis
spp (Young et al., 2000; Tirado et al., 2005), cymbidium (Gao et al., 2014) y
Vanilla planifolia (Ramos Castell et al., 2014) los biorreactores han permitido
facilitar el escalado de los procesos de micropropagacin, aumentando la eficiencia
biolgica y reduciendo los costos de produccin. Sin embargo, los sistemas que
utilizan tienen costos elevados o son poco prcticos a nivel comercial. El sistema
BIG que actualmente se utiliza en el Laboratorio de Cultivo de Tejidos del Colegio
de Postgraduados Campus Crdoba, tiene entre otras ventajas: bajo costo de
215
El Agro Veracruzano 2015

implementacin, capacidad variable y uso de una sola vlvula solenoide,


permitiendo con ello disminuir los gastos de inversin y electricidad del sistema
neumtico. Los brotes obtenidos en ambos tratamientos, produjeron races y
mostraron 95 % de supervivencia durante la etapa de aclimatizacin.

Conclusiones

El uso del BIG promovi la multiplicacin y crecimiento in vitro de S. tigrina,


logrando reducir los costos de produccin, mano de obra y tiempo de cultivo in
vitro, por lo que constituye una opcin viable para la reintroduccin o
aprovechamiento sustentable de esta importante especie veracruzana.

Literatura Citada

Aragn, C. E., M. Escalona, I. Capote, D.Pina, I. Cejas, R. Rodriguez y J. Gonzalez-


Olmedo, 2005. Photosynthesis and carbon metabolism in plantain (Musa AAB)
plantlets growing in temporary immersion bioreactors and during ex vitro
acclimatization. In vitro Cell Dev-Pl.,41(4): 550-554.
Caamal-Velzquez, H. y J. Bello-Bello, 2014. Micropropagacin de caa de azcar
(Saccharum spp.). Colegio de Postgraduados, Estado de Mxico, Mxico, pp 5-7.
Damon A., E. A. Guerrero, L. Rivera y V. Nikolaeva, 2004. Germinacin in vitro de
semillas inmaduras de tres especies de orqudeas de la regin del Soconusco,
Chiapas, Mxico, 10: 195-203.
Ducos, J. P., G. Labbe, C. Lambot y V. Ptiard, 2007. Pilot scale process for the
production of pre germinated somatic embryos of selected robusta (Coffea
canephora) clones. In vitro Cell Dev-Pl.,43(6): 652-659.
Etienne, H. y M. Berthouly, 2002. Temporary immersion systems in plant
micropropagation. Plant Cell, Tissue and Organ Culture, 69(3): 215-231.
Flores-Escobar G., I. Gil-Vsquez, M.T. Colinas-Len y M. Mata-Rosas, 2011.
Propagacin in vitro de la orqudea Brassia verrucosa Bateman ex. Lindl.
Revista Chapingo Serie Horticultura, 17: 5-8.
Gao, R., S.Q. Wu, X.C. Piao, S.Y. Park y M.L. Lian, 2014. Micropropagation of
Cymbidium sinense using continuous and temporary airlift bioreactor
systems. Acta Physiologiae Plantarum, 36(1): 117-124.
Georgiev, V., A. Schumann, A. Pavlov y T. Bley, 2014. Temporary immersion systems in
plant biotechnology. Engineering in Life Sciences, 00: 115.
Hanhineva, K, H. Kokko y S. Krenlampi, 2005. Shoot regeneration from leaf explants of
five strawberry (Fragaria ananassa) cultivars in temporary immersion bioreactor
system. In vitro Cell Dev-Pl., 41(6): 826-831.
Kauth J. P., E. M. Kane, V. A. Wagner y A. C. Reinhardt, 2008. Asymbiotic germination
response to photoperiod and nutritional media in six populations of Calopogon

216
El Agro Veracruzano 2015

tuberosus var. tuberosus (Orchidaceae): evidence for ecotypic differentiation.


Annals of Botany, 102: 783-793.
Mordocco, A. M., J. A. Brumbley y P. Lakshmanan, 2009. Development of a temporary
immersion system (RITA) for mass production of sugarcane (Saccharum spp.
interspecific hybrids). In vitro Cell Dev-Pl., 45(4): 450-457.
Murashige, T. y F. Skoog, 1962. A revised medium for rapid growth and bio assays with
tobacco tissue cultures. Physiologia plantarum, 15(3): 473-497.
Murgua, G.J. y E.H. Lee, 2007. Manual de produccin de Orqudea. Direccin General
Editorial. Universidad Veracruzana. Xalapa, Veracruz, Mxico.
Ng, C. Y. y N.M. Saleh, 2011. In vitro propagation of Paphiopedilum orchid through
formation of protocorm-like bodies. Plant Cell, Tissue and Organ Culture ,
105(2): 193-202.
Ramos-Castell, A., L.G. Iglesias-Andreu, J. Bello-Bello y H. Lee-Espinosa, 2014.
Improved propagation of vanilla (Vanilla planifolia Jacks. ex Andrews) using a
temporary immersion system. In vitro Cell Dev-Pl., 1-6.
Soto-Arenas, M.A., E. Hgsater, R. Jimenez-Chamorro, G. Salazar-Chvez, R. Solano-
Gmez, R. Flores-Gnzalez e I. Ruz-Contreras, 2007. Las Orqudeas de Mxico.
Herbario AMO. Instituto Chincn, A. C., Mxico.
Tirado, J. M., E.J. Naranjo y L. Atehorta, 2005. Propagacin in vitro de phalaenopsis
(orchidaceae) a partir de protocormos, mediante el sistema de inmersin
temporal. Revista Colombiana de Biotecnologa, 7 (1): 25-31.
Young, P. S., H.N. Murthy y P.K. Yoeup, 2000. Mass multiplication of protocorm-like
bodies using bioreactor system and subsequent plant regeneration in
Phalaenopsis. Plant cell, tissue and organ culture, 63(1): 67-72.

217
El Agro Veracruzano 2015

16
ESTABLECIMIENTO DE UN PROTOCOLO DE DESIFECCION PARA
EL CULTIVO IN VITRO DE ESTEVIA (Stevia rebaudiana Bertoni)
MEDIANTE EL USO DE NANOPARTICULAS DE PLATA (NPsAg)

Jeric Jabn Bello Bello y Jos Luis Spinoso Castillo *

Colegio de postgraduados-Campus Crdoba. Carretera Federal Crdoba-Veracruz Km 348,


Congregacin Manuel Len, Municipio Amatlan de los Reyes, C.P. 94946, Veracruz,
Mxico. Email: jericojabin@gmail.com
Resumen
1. El cultivo in vitro de estevia (Stevia rebaudiana B.) es una herramienta importante
aplicada a la micropropagacin, saneamiento, conservacin y mejoramiento
gentico. A pesar de esto, la contaminacin de explantes afecta el establecimiento
in vitro.
2. En este estudio se evalu el efecto microbicida de las NPsAg sobre el porcentaje
de contaminacin y sobrevivencia de explantes. Se seleccionaron nudos como
fuente de explante y fueron tratados con NPsAg a diferentes concentraciones (0,
25, 50 y 100 mgL-1) y tiempos de exposicin (5, 10 y 20 min).
3. El diseo experimental fue completamente al azar con 10 explantes por
tratamiento, con los datos se realiz un ANDEVA con arreglo factorial y una
comparacin de medias con la prueba de Tukey (p0.05).
4. Como resultado se observ que el incremento en las concentraciones de NPsAg
reducen los porcentajes de contaminacin y sobrevivencia. El tiempo de
exposicin no es un factor determinado en la respuesta. La concentracin de 50
mgL-1 de NPsAg fue la ms adecuada para disminuir la contaminacin sin afectar
los porcentajes de sobrevivencia.
5. Lo que sugiere que el uso de NPsAg posee un efecto microbicida sobre explantes
de estevia y puede ser utilizado como una alternativa durante el establecimiento in
vitro de Stevia rebaudiana B.
Palabras clave: Micropropagacin, cultivo in vitro, nanoplata, descontaminacin.

Abstract
1. In vitro culture is an important tool applied to micropropagation, sanitization,
conservation and breeding of estevia (Stevia rebaudiana B.). Despite this,
contamination of the tissue culture media is still common.
2. In this study the microbicide effect of nanosilver (NPsAg) was evaluated on the
percentage of contamination and survival of estevia explants. Different

218
El Agro Veracruzano 2015

concentrations (0, 25, 50 and 100 mg L-1) of NPsAg and exposure times (5, 10 and
20 min) were evaluated on explants from segmental nodes.
3. Completely randomized design with 10 explants per treatment was used, ANOVA
was conducted with factorial arrangement and mean comparisons using Tukey
(p0.05)
4. Increasing concentrations of NPsAg reduce contamination and promote survival
rates. Exposure time has not significant effect. 50 mg L-1 of NPsAg was more
effective diminishing contamination without affecting survival rates.
5. NPsAg have a microbicide effect on estevia explants and they can be used for in
vitro culture of S. rebaudiana B.
Keywords: micropropagation, in vitro culture, nanosilver, decontamination.

Introduccin

El Cultivo de Tejidos Vegetales (CTV) es un conjunto de tcnicas que permiten el


establecimiento, mantenimiento y desarrollo de cualquier parte de una planta,
desde una clula hasta un organismo completo, bajo condiciones artificiales,
aspticas y controladas. A pesar de las ventajas de esta tcnica, la contaminacin
de explantes es un problema que afecta la asepsia del cultivo in vitro (Casells,
1991). De acuerdo a Buckley et al. (1994), el xito del establecimiento de los
cultivos in vitro depende, en gran medida, de la remocin de microorganismos
contaminantes. Los hongos y bacterias son los microorganismos ms comunes
encontrados en CTV. Para eliminarlos se han desarrollado diferentes mtodos,
siendo los antibiticos los mayormente utilizados (Smart et al., 1995). Sin
embargo, stos son frecuentemente fitotoxicos y pueden retardar o inhibir el
desarrollo del tejido vegetal (Teixeira da Silva et al., 2003). Como una alternativa,
las nanopartculas de plata (NPsAg) han sido utilizadas por su efecto microbicida
(Jo et al., 2009). Una de las potenciales aplicaciones de la plata en plantas es el
control de enfermedades en plantas (Park et al., 2006). La estevia (Stevia
rebaudiana: Asteraceae), es originaria de Paraguay, conocida ampliamente por sus
propiedades edulcorantes y medicinales (Arpita et al., 2011). Se propaga
principalmente por medio de semilla, lo que implica recombinacin gentica y por
tanto alta heterogeneidad en el crecimiento y la produccin de estevisidos
(Ferreira y Handro, 1988). Recientemente, el inters por el cultivo in vitro de
estevia ha ido en aumento (Ahmed et al., 2007; Anhbazhagan, et al., 2010; Laribi
et al., 2012). Siendo de gran importancia la eleccin del explante y mtodo de
desinfeccin para lograr su establecimiento in vitro. El objetivo de este estudio fue
establecer un protocolo de desinfeccin para el cultivo in vitro de S. rebaudiana
mediante NPsAg.

219
El Agro Veracruzano 2015

Materiales y mtodos

La investigacin se realiz en el Laboratorio de Cultivo de Tejidos vegetales del


Campus Crdoba del Colegio de Postgraduados, en el Estado de Veracruz,
Mxico. Para evaluar el efecto microbicida de las nanopartculas de plata en el
establecimiento in vitro de S. rebaudiana, explantes nodales de 2 cm de longitud
de la variedad Morita 2, fueron colectados de plantas donantes cultivadas bajo
condiciones de invernadero, se lavaron con agua corriente en circulacin continua
por 30 min y se llevaron a campana de flujo laminar donde se realiz la
desinfeccin de los explantes con etanol al 70% (v/v) por 30 s, cloro comercial
10% (v/v) por 10 min y 5% (v/v) del mismo por 5 min, se enjuagaron en agua
destilada 3 veces y posteriormente, en frascos con 100 mL de agua destilada con
diferentes dosis de NPsAg con tamao de partculas de 2-50 nm a (0, 25, 50 y 100
mg L-1), fueron tratados en diferentes tiempos de exposicin (5, 10 y 20 min).
Finalmente, los explantes fueron sembrados en tubos de ensaye 15x150 con 15 mL
de medio MS (Murashige y Skoog, 1962) adicionado con 2.25 g L-1 de Phytagel
con una temperatura de incubacin de 242C y 16 h de fotoperiodo. Los
porcentajes de contaminacin y sobrevivencia de los explantes fueron registrados
tras 15 das de cultivo.
El diseo experimental fue completamente al azar con diez explantes por
tratamiento y tres repeticiones, con los datos se realizaron un anlisis de varianza
(ANDEVA) con arreglo factorial y una comparacin de medias con la prueba de
Tukey (p0.05) utilizando el programa estadstico SPSS v. 11.5 para Windows.

Resultados

Efecto de las Nanoparticulas de plata en el establecimiento in vitro de S.


rebaudiana. Los resultados indicaron diferencias significativas entre las
concentraciones de NPsAg y tiempos de exposicin. Se observ una interaccin
entre ambas variables evaluadas. Los tratamientos con 100 mg L-1 de NPsAg
mostraron los menores porcentajes de contaminacin (7.661.45%); sin embargo,
la sobrevivencia fue afectada a diferentes tiempos de exposicin, con 50, 50 y 40%
a los 5, 10 y 20 min, respectivamente. La concentracin de 50 mgL -1 de NPsAg,
sin importar el tiempo de exposicin, fue la ms adecuada para disminuir la
contaminacin sin afectar los porcentajes de sobrevivencia. Los explantes con el
mayor porcentaje de contaminacin obtuvieron el 70% de supervivencia a
diferencia de los de mayor concentracin de NPsAg. (Tabla 1).

220
El Agro Veracruzano 2015

Tabla 1. Porcentaje de contaminacin por hongo y bacteria a diferentes tiempos de


exposicin (5, 10 y 20 min) y concentraciones (0, 25, 50 y 100 mg L-1) de NPsAg.

Tiempo Concentracin de NPsAg Sobrevivencia Contaminacin


(min) (mg L-1) (%) (%)*
5 0 70 47.332.33 a
5 25 70 34.331.76 ab
5 50 70 17.661.45 c
5 100 50 7.61.45 d
10 0 70 47.661.45 a
10 25 70 27.661.45 c
10 50 70 17.661.45 c
10 100 50 7.661.45 d
20 0 70 47.661.45 a
20 25 70 37.661.45 ab
20 50 70 17.661.45 c
20 100 40 7.661.45 d

*Los valores representan la media ES (error estndar). Medias con diferente letra son
significativamente diferentes (Tukey, p 0.05).

Discusin

El xito en el proceso de desinfeccin y establecimientos de los cultivos in vitro


depende de varios factores, entre los que se encuentran las condiciones en las que
se mantienen las planta donante, edad, tipo y tamao del explante (Texeira, 2004;
Villegas, 2006). Los resultados obtenidos en este estudio demuestran que las
NPsAg inhiben el crecimiento de microorganismos bajo condiciones in vitro, las
diferencias entre los tratamientos se deben probablemente a la interaccin entre el
tiempo de exposicin y concentracin de las NPsAg. Estos resultados coinciden
con lo reportado por Abdi et al. (2008), quienes al trabajar durante la desinfeccin
de explantes de valeriana (Valeriana officinalis L.) lograron la eliminacin de
contaminantes fngicos y bacterianos, demostrando una reduccin en los
porcentajes de contaminacin a mayor tiempo y concentracin de NPsAg.
Resultados similares fueron obtenidos por Arab et al., (2014) en explantes nodales
de hbridos de durazno y pera (Prunus amygdalus x Prunus persica), donde la
concentracin de 200 mg L-1 de NPsAg durante 7 min caus fitotoxicida de los

221
El Agro Veracruzano 2015

explantes, disminuyendo los porcentajes de sobrevivencia. De acuerdo a Feng et


al. (2000), los iones de plata afectan la replicacin del ADN. Por otro lado,
Yamanaka et al., 2005) menciona que las NPsAg participan en la inactivacin de
las subunidades proteicas del ribosoma, protenas celulares y enzimas esenciales
para la produccin de ATP.

Conclusiones

El uso de NPsAg mostr efecto microbicidas en el establecimiento in vitro de


Stevia rebaudiana; por lo tanto, recomendamos su aplicacin como una alternativa
para el saneamiento in vitro de esta importante especie.

Literatura Citada

Abdi, G., H. Salehi y M. Khosh-Khui, 2008. Nano silver: a novel nanomaterial for removal
of bacterial contaminants in valerian (Valeriana officinalis L.) tissue culture. Acta
Physiol Plant, 30: 709-714.
Ahmed, M. B., M. Salahin, R. Karim, M.A. Razvy, M.M. Hannan, R. Sultana y R. Islam,
2007. An efficient method for in vitro clonal propagation of a newly introduced
sweetener plant (Stevia rebaudiana Bertoni.) in Bangladesh.J. Sci. Res, 2:121-
125.
Anbazhagan, M., M. Kalpana, R. Rajendran, V. Natarajan y D. Dhanave, 2010. In vitro
production of Stevia rebaudiana Bertoni. Emirates Journal of Food and
Agriculture, 22(3): 216-222.
Arab, M., A. Yadollahi, M. Hosseini-Mazinani, y S. Bagheri, 2014. Effects of
antimicrobial activity of silver nanoparticles on in vitro establishment of G x N15
(hybrid of almond x peach) rootstock. Journal of genetic engineering and
biotechnology, 12: 103-110.
Arpita, D, G. Saikat y M. Nirmal, 2011. Micropropagation of an elite medicinal plant:
Stevia rebaudiana Bert. International journal of agricultural research, 6(1): 40-48.
Buckley, P.M. y B.M. Reed, 1994. Antibiotic susceptibility of plant associated bacteria.
HortScience, 29:434.
Cassells, A. C. 1991. Problems in tissue culture: Culture contamination. In:
Micropropagation: technology and application (Eds. Debergh, P.C. y R.H.
Zimmerman), Springer.
Feng, Q.L., J. Wu, C.Q. Chen, F.Z. Cui, T.N. Kim y J.O. Kim, 2000. A mechanistic study
of the antibacterial effect of silver ions on Escherichia coli and Staphylococcus
aureus. J Biomed Mater Res., 52:662-8.
Ferreira, C. y W. Handro, 1988. Micropropagation of Stevia rebaudiana through leaf
explants from adult plants. Plant medic, 54(2): 157-160.
Jo Y.K., B.H. Kim y G. Jung, 2009. Antifungal activity of silver ions and nanoparticles on
phytopathogenic fungi. Plant Dis., 93:1037-43.

222
El Agro Veracruzano 2015

Laribi, B., N. Rouatbi, K. Kouki y T. Bettaieb, 2012. In vitro propagation of Stevia


rebaudiana (Bert.). A non-caloric sweetener and antidiabetic medicinal plant. Int.
J. Med. Arom. Plants, 2(2): 333-339.
Murashige, T. y F. Skoog, 1962. A revised medium for rapid growth and bio assays with
tobacco tissue cultures. Physiologia plantarum, 15(3): 473-497.
Park, H.J., S.H. Kim, H.J. Kim y S.H. Choi, 2006. A new composition of nanosized silica-
silver for control of various plant diseases. Plant Pathol J., 22:295-302.
Smart, D.R., A. Ferro, K. Ritchie y B.G. Bugbee, 1995. On the use of antibiotics to reduce
rhizoplane microbial populations in root physiology and ecology investigations.
Physiol Plant. 95:533540.
Teixeira da Silva, J.A., N.T. Duong, T. Michi, F. Seiichi, 2003. The effect of antibiotic on
the in vitro growth response of chrysanthemum and tobacco stem transverse thin
cell layers (tTcLs). Sci Hortic., 97:397410.
Teixeira, P. D., A. Lima, J.P.H.J Ducroquet y M.P Guerra, 2004. Multiplicacao in vitro do
porta-enxerto de Prunus spp. Carelli. Revista brasileira de fruticultura, 26(2):
377-379.
Villegas, M. A. 2006. Apuntes del curso de propagacin in vitro de frutales, fruticultura.
Recursos genticos y productividad- Montecillo., CP. 30 P.
Yamanaka, M, K. Hara y J. Kudo, 2005. Bactericidal actions of a silver ion solution on
Escherichia coli, studied by energyfiltering transmission electron microscopy and
proteomic analysis. Appl Environ Microbiol, 71:7589-93.

223
El Agro Veracruzano 2015

17
EVALUACIN DEL RENDIMIENTO DE MATERIAL PECTNICO DEL
ALBEDO DE CUATROS ESPECIES DEL GNERO Citrus

Diego Antonio Maruri Mundo1, Jos Luis Cordero Snchez2, Lzaro Gabriel Trujillo
Jurez3
1
Estudiante de Ingeniera en Agronoma en el Instituto Tecnolgico de rsulo Galvn
Extensin Tlapacoyan. E-mail: gpoinvestigacion.citricos@gmail.com
2
Maestro en Ciencias, Profesor Titular C del Instituto Tecnolgico de rsulo Galvn.
Presidente de la Academia de Ciencias Bsicas. Es co-asesor del grupo de investigacin
Aprovechamiento de Residuos Agroindustriales de Origen Vegetal: Estudios Cientficos y
de Ingeniera. E-mail: jolucorsan@yahoo.com.mx
3
Maestro en Ciencias, profesor de Asignatura en el Instituto Tecnolgico de rsulo Galvn
Extensin Tlapacoyan, en Tlapacoyan, Ver. E-mail: ibqgabrieltrujillo@gmail.com

Resumen
1. Los desechos producto de la industrializacin de los ctricos se emplean como
nutrientes en alimentacin animal, pero sus precios no son rentables. Los tres
principales componentes de los ctricos son el albedo, el flavedo y el endocarpio
bagazo. El albedo es alto en pectinas, las cuales son muy importantes en la
industria de los alimentos y tambin se emplean en otras industrias, como la
farmacutica y la industria de los plsticos.
2. El objetivo que persigue este trabajo es evaluar el rendimiento de pectina
empleando la tecnologa de hidrlisis cida y compararlo con los reportados en la
literatura especializada para su escalamiento con fines agroindustriales.
3. El trabajo experimental se llevo a cabo a partir de varias fuentes de informacin
donde se reportaban rendimientos favorables y se fueron adaptando para disminuir
tiempos de proceso y recirculacin, hasta lograr las condiciones favorables para
un mayor rendimiento, a travs de un modelo experimental.
4. Se encontraron las mejores condiciones para un rendimiento aceptable, sin
embargo es necesario afinar an ms la tecnologa para obtener rendimientos mas
favorables, de acuerdo al equipo con que se cuenta.
5. Se trabajo en medio cido, la cul es una tecnologa ya implementada a nivel
industrial, sin embargo los cidos mas usados son inorgnicos, por lo que en este
trabajo se opt por trabajar un cido orgnico, cido ctrico, el cual es considerado
una sustancia alimentaria GRAS.
Palabras clave: Extraccin, pectinas, ctricos.

224
El Agro Veracruzano 2015

Abstract
1. The product of industrialization citrus wastes are used as nutrients in animal feed ,
but their prices are not profitable. The three main components in citrus are albedo,
flavedo and the endocarp or bagasse. The albedo is high in pectins, which are very
important in the food industry and are also used in other industries, such as
pharmaceuticals and plastics industry.
2. The aim of this work is to evaluate the yield of pectin using acid hydrolysis
technology and compared with those reported in the specialist for further scaling
purposes with agribusiness literature.
3. The experimental work was conducted based on several sources of information
where favorable returns were reported and were adapted to reduce processing
times and recycling, to achieve favorable conditions for increased yield through an
experimental model.
4. The best conditions for acceptable yield were found , however you need to further
refine the technology to produce more favorable returns, according to the team
with which account.
5. The extraction used was the hydrolysis in acid medium, which has already been
implemented at industrial level technology, however the most commonly used
acids are inorganic, so in this work we chose to work an organic acid, citric acid,
which is considered a substance GRAS food.
Keywords: Extraction, pectins, citrus.

Introduccin

La zona de Martnez de la Torre-Tlapacoyan, en el estado de Veracruz, se ha


caracterizado por ser una de las principales zonas de produccin de ctricos a nivel
nacional, siendo los principales cultivos: Limn persa (Citrus latifolia Tanaka),
naranja valencia (Citrus sinensis), Toronja (Citrus paradisi) var. Doble roja y
Mandarina (Citrus reticulata) ver. Fremont. Por normatividad, la calidad de los
ctricos esta divida en tres categoras o calidades, que definen el fin comercial que
este enfrenta.
La norma oficial mexicana, NOM-FF-77-1990, clasifica al limn persa en tres
grupos de acuerdo a sus caractersticas morfolgicas, Mxico Extra, Mxico A y
Mxico B. Sin embargo, a nivel comercial se les menciona, como de primera,
segunda y tercera.
El limn de primera se sub-clasifica en otras ms de acuerdo al pas a donde se va
a exportar, pues tienen diferentes demandas en cuanto a su calidad morfolgica
que es directamente proporcional a las caractersticas nutrimentales y qumicas que
tiene el fruto.
Con respecto a la naranja valencia, la norma y a la toronja var. Doble roja, las
normas NMX-FF-027-SCFI-2007 y NMX-FF-039-1995-SCFI son las que regulan
225
El Agro Veracruzano 2015

y clasifican la calidad de ambos ctricos en extra, primera y segunda. Mientras que


para la mandarina no hay normatividad NMX, slo se encuentra en vigor Mxico
Calidad Suprema.
La mayor parte de la produccin no alcanza los estndares de calidad para su
exportacin, por lo que otra alternativa es la comercializacin nacional, en donde
se oferta a menores precios, sin embargo que hace que los productores no
presenten tantas perdidas.
Los precios a nivel nacional llegan a ser tan bajos, que muchos productores
prefieren dejar el ctrico en el rbol, pues el gasto por jornal para el corte es mayor
que el precio que alcanza el limn en el mercado nacional, sin embargo esto hace
que disminuya la produccin del ctrico en los siguientes ciclos agrcolas
La demanda de estos frutos no es tan elevada como la oferta y muchos productores
prefieren dejar la cosecha en sus lugares de origen que transportarla a los centros
de abasto en las zonas urbanas, ya que representa un gasto mayor al beneficio
obtenido por su comercializacin en estos centros.
No es extrao observar cantidades considerables de limn en los basureros de los
centros de abasto, donde se confina el limn que no se pudo comercializar y que al
paso del tiempo, despus del proceso de maduracin, se empieza a descomponer,
por lo que pierde su valor comercial y se desecha.
En temporada alta, cuando el valor comercial disminuye drsticamente, se puede
observar a orilla de carretera, cosechas enteras de ctricos confinadas a espacios
abiertos donde se coloca, ya que no se pudo comercializar, causando
contaminacin ambiental.
Al entrar en la etapa de descomposicin, forma lixiviados con un pH cido que
penetra el suelo y subsuelo, llegando a los mantos acuferos, contaminndolos.
Estos lixiviados tienen una alta demanda bioqumica de oxgeno (DBO) que hace
que cantidades incontables de microorganismos puedan crecer en ellos siendo un
foco de infeccin biolgica considerable, as como la proliferacin de fauna
nociva.
Se han reportado casos, en lotes y parcelas, donde se han confiando estos desechos,
dejando steril el suelo. Al cambiar drsticamente el pH, hace que muchos
microorganismos mesfilos encargados de nitrificar el suelo mueran, as al
cambiar las condiciones de dicho suelo, lo hacen inservible para poder cultivar. La
solucin podra ser la biorremediacin de ste, sin embargo, el proceso es lento y
costoso.
La normatividad que regula las caractersticas fitosanitarias de estos cuatro ctricos
es la NOM-EM-004-FITO-1994, esta norma dicta las recomendaciones de sanidad
para la exportacin, comercializacin nacional, regional y local de los cuatro
ctricos. En los centros de abasto, los ctricos tienen mucha aceptacin, sobre todo
la naranja que es uno de los ctricos de mayor consumo en Mxico, sin embargo, se
generan una gran cantidad de residuos, pues slo se ocupa el jugo en ambos
226
El Agro Veracruzano 2015

ctricos, por lo que dichos residuos se han convertido en una seria amenaza de
contaminacin (Figura 1).
Existen datos estadsticos que mencionan la exportacin de ctricos al extranjero al
menos desde el 2003. Las fracciones arancelarias correspondientes son: Limn
persa (0805.50.02), naranja valencia (0805.10.01), mandarina (0805.20.01) y
toronja (0805.40.01) (Secretaria de agricultura, ganadera, desarrollo rural, pesca y
alimentacin, 2014).

Figura 1. Canales de distribucin de los ctricos (Merchand, 2005).

Con mucho, el gnero principal dentro de la Aurantioideae es el Citrus, en el que


prcticamente todos los rboles de ctricos cultivados en todo el mundo estn
incluidos. La frecuencia de mutaciones espontneas, as como la alta incidencia de
hbridos naturales juntos para el elevado nmero de hbridos interespecficos
obtenidos artificialmente se ha originado la existencia de un gran nmero de
variedades, con inters ms o menos comercial, recibiendo nombres locales y
complicando la identificacin taxonmica de cada uno de ellos (Dugo, 2002).
El gnero Citrus, cuyo trmino comn es ctrico, designa las especies de grandes
arbustos o arbolillos perennes (entre 5 y 15 m), cuyos frutos o frutas de la familia
Rutaceae poseen un alto contenido en vitamina C y cido ctrico, el cual les
proporciona ese sabor cido tan caracterstico.
Este gnero oriundo del Asia tropical y subtropical est conformado por tres
especies y numerosos hbridos cultivados, incluyendo las frutas ms ampliamente
comercializadas, como el limn, la naranja, la lima, la toronja o pomelo y la
227
El Agro Veracruzano 2015

mandarina, con diversas variedades que dependen de la regin en la que se cultive


cada una de ellas (Goycoolea, 2012).
El papel de los ctricos en el suministro de nutrientes y valor medicinal ha sido
reconocido desde la antigedad. Las frutas ctricas, que pertenece al gnero Citrus
de la familia Rutaceae, son bien conocidos por su refrescante fragancia, la
capacidad de la vitamina C de calmar la sed. Adems del cido ascrbico, estas
frutas contienen varios fitoqumicos, que desempean el papel de los nutracuticos,
como los carotenoides (licopeno y -caroteno), limonoides , flavanonas (naringinas
y rutinsidos), y vitaminas del complejo B y nutrientes relacionados (tiamina,
riboflavina, cido nicotnico/niacina, cido pantotnico, piridoxina, cido flico,
biotina, colina e inositol).
El fruto de los ctricos es un hesperidio que surge a travs del crecimiento y el
desarrollo del ovario, consiste en un nmero variable de carpelos (generalmente
nueve a diez en los cultivos comerciales ms importantes, como las naranjas y
mandarinas) cubiertas por una cscara coricea y la parte comestible, el endocarpio
. Estos carpelos contienen semillas y pulpa (El-Otmani, 2011).
Mxico es lder en produccin de ctricos, al ubicarse como el quinto productor a
nivel mundial (4.6% del total) detrs de China (21%), Brasil (18%), Estados
Unidos (8%) y la India (6%).
La citricultura en Mxico es una actividad de gran importancia econmica y social:
Se realiza en poco ms de medio milln de hectreas en regiones con clima
tropical y sub-tropical en 23 entidades federativas. De esa superficie,
aproximadamente 80% se destina a los denominados ctricos dulces, cuya
produccin es del orden de 4.9 millones de toneladas por cosecha, principalmente
de naranja (83% del total), toronja (8%), mandarina (5%) y tangerina (4%) (Figura
2).
La produccin de ctricos en Mxico, se desarrolla en 28 estados con climas
tropicales y subtropicales, con un volumen de produccin de 7,119,349.66
toneladas. El cultivo de ctricos dulces representa una fuente importante de
ingresos en las zonas rurales productoras de estos frutos. Se estima que cerca de 69
mil familias dependen de esta actividad, con un valor superior a siete mil 100
millones de pesos.
Los estados de mayor importancia en la produccin son Veracruz (55% del total
nacional), San Luis Potos y Tamaulipas, que en conjunto representan 22% de la
superficie sembrada y cosechada, as como Puebla y Nuevo Len (SAGARPA,
2014).

228
El Agro Veracruzano 2015

Figura 2. Principales Estados productores de ctricos (SIAP-SAGARPA, 2012).

Para Mxico la citricultura representa una actividad de gran importancia dentro de


la fruticultura nacional: Una de cada veinte toneladas de ctricos que se consumen
en el mundo proviene de nuestro pas.
La superficie sembrada en 2011, fue de 560,143.63 hectreas, que produjeron un
promedio anual de 7,119, 349.66 toneladas de fruta. Lo que sita a nuestro pas en
el quinto lugar mundial en produccin de ctricos.El producto ms cultivado en
Mxico es la naranja, seguido del limn, la toronja y la mandarina.
Los frutos ctricos se destinan primordialmente al mercado domstico. Del total de
la produccin nacional, el 88% se dirige al consumo interno y para la exportacin
el 12%, de los cuales se conforma como jugos el 1.4% y como fruta fresca el
0.44% (Inforural, 2012).
Cuando se observa la seccin transversal de una fruta ctrica, desde el exterior
hacia el interior, presenta las siguientes capas (Figura 3).
Una cutcula gruesa que pertenece a las clulas de la epidermis, que contiene los
estomas;
El epicarpio o flavedo, formado por tejido parenquimtico que es rica en
pigmentos (cloroplastos y cromoplastos).
El albedo, tejido parenquimatoso compuesto de clulas esponjosas de forma
irregular que son de color blanco y separados por grandes bolsas de aire. En el

229
El Agro Veracruzano 2015

albedo, las zonas ms ricas en pectina corresponden a la pared primaria de las


clulas y a la lmina media que las separa, donde suponen aproximadamente el 22-
35% de su peso seco.
El endocarpio, es la parte comestible de la fruta, formado por segmentos que
contienen las vesculas de jugo que tienen paredes ultrafinas. Los segmentos estn
cubiertos por una membrana carpelar delgada y se distribuyen alrededor de un eje
central que tiene la misma composicin que el albedo.
Las semillas, se encuentran alrededor del eje central incrustadas en el endocarpio.
(Dugo, 2002; Navarro, 2014)

Figura 3. Corte transversal de una fruta ctrica, mostrando: (a) Flavedo con glndulas
de aceite; (b) las semillas; (c) Pulpa; (d) El eje central; (e) albedo; (f) segmento; (g) de
la segmento intermembranal (Dugo, 2002).

Los productos resultantes de la industrializacin de los ctricos son los jugos, los
aceites esenciales y la cscara. Esta ltimo, junto con la pulpa y las semillas, son
el residuo industrial y representan el 40-60% del peso de la materia prima. La
utilizacin de este residuo es un requisito fundamental de la industria de
procesamiento de frutas, no slo por razones econmicas, sino tambin para
reducir el impacto ambiental grave que esto podra producir, sin embargo no
siempre se lleva a cabo.
Los subproductos principales producidos a partir de la extraccin del jugo son:
Cscara seca, melazas de ctricos, d-limoneno, pectinas, extractos opacos, slidos
solubles, flavonoides, limonoides, fibra, aceites de semillas, alcohol etlico,
230
El Agro Veracruzano 2015

cscaras en salmuera, cscara cristalizada, productos de fermentacin, entre otros.


Otros productos que pueden ser producidos a partir de la pulpa separada del jugo
son: Pulpa lavada, pulpa de jugo, jugo con clulas enteras y extractos de carotenos
(Dugo, 2002).
La cscara que se utiliza para la extraccin de pectina, tiene que ser calentada
durante 10 min a 95 - 98 C para inactivar las enzimas pcticas. Las condiciones de
extraccin tales como el pH, el tiempo y la temperatura tienen que ser
cuidadosamente controladas para conseguir la mxima extraccin de pectina.
Ambos, cidos orgnicos e inorgnicos se pueden utilizar para hidrolizar el
protopectina en pectina soluble. Los cidos minerales ms baratos como los cidos
clorhdrico y sulfrico son preferidos para la extraccin (May, 2000).
Su componente principal es el cido poligalacturnico, que existe parcialmente
esterificado con metanol. Se encuentran principalmente en las frutas y vegetales,
para aprovechar su capacidad para balancear el equilibrio del agua dentro del
sistema. Esta sustancia se asocia con la celulosa y le otorga a la pared celular la
habilidad de absorber grandes cantidades de agua (Figura 4).

Figura -D-galacturnico (A) y poligalacturnico (B)


(Navarro, 2014).

Las sustancias pcticas son macromolculas de origen vegetal, compuestas por


cadenas de cido poligalacturnico, ms o menos metilado. Su estructura est
compuesta por dos tipos de polmeros: Ramnogalacturonana (polmero cido
conteniendo unidades de ramnosa) y arabinogalactana (polmero neutro compuesto
por polmeros de arabinosa y galactosa. Localizadas en la lmina media y la pared
celular, las pectinas juegan un papel importante en el mantenimiento de la textura
de los tejidos vegetales.
Segn su estructura se clasifican en los siguientes grupos:
231
El Agro Veracruzano 2015

Protopectina: Trmino aplicado a las sustancias pcticas insolubles en agua, y que


bajo condiciones controladas de hidrlisis originan cidos pectnicos.
cidos pectnicos: Son los cidos poligalacturnicos coloidales que contienen una
apreciable proporcin de grupos metil-ster. Estos cidos bajo condiciones
adecuadas, son capaces de formar geles con azcar y cido o, si presentan un bajo
contenido en metoxilo, con determinados iones metlicos. Las sales de los cidos
pectnicos se denominan pectinatos.
Pectinas: Son aquellos cidos pectnicos solubles en agua, de elevado contenido en
steres metlicos y grado de neutralizacin, capaces de formar geles con azcar y
cido bajo condiciones adecuadas.
Acidos pcticos: Son aquellas sustancias pcticas constituidas principalmente por
cidos poligalacturnicos prcticamente libres de grupos metoxilo. Las sales de
estos cidos se denominan pectatos.
Las pectinas y las gomas son polisacridos importantes en los alimentos por sus
propiedades funcionales. Se usan mucho como agentes gelificantes, espesantes y
estabilizantes. Las pectinas son cidos pectnicos de elevado peso molecular y se
dispersan en agua. Como se mencion anteriormente, algunos de los grupos
carboxilo a lo largo de la cadena de cido galacturnico estn esterificados con
metanol.
El grado de esterificacin en pectinas no modificadas vara desde
aproximadamente 60% en pulpa de manzana hasta aproximadamente 10% en
fresas. (Las pectinas pueden ser desesterificadas deliberadamente durante la
extraccin o el procesado). Segn el grado de esterificacin, las pectinas se
clasifican como pectinas de alto metoxilo o de bajo metoxilo. Los dos grupos
tienen diferentes propiedades y gelifican bajo condiciones diferentes (Figura 5)
(Navarro, 2014).
Pectinas de bajo metoxilo. Las pectinas de bajo metoxilo tienen la mayora de los
grupos carboxilos libres. En realidad, solo 20-40% de los grupos carboxilo estn
esterificados. Por lo tanto, la mayora estn disponibles para formar enlaces
cruzados con iones divalentes como calcio.
Si se forman suficientes enlaces cruzados, se puede obtener una red tridimensional
que atrapa lquido, formando un gel. Las pectinas de bajo metoxilo, pueden, por
tanto, formar geles en presencia de iones divalente sin necesitar azcar o cido.
Pectinas de alto metoxilo. Las pectinas de alto metoxilo tienen una elevada
proporcin (normalmente 50-58%) de grupos carboxilo esterificados. La mayora
de los grupos cidos, por tanto, no estn disponibles para formar enlaces cruzados
con iones divalentes, as estas pectinas no forman geles de esta manera. Sin
embargo, se pueden hacer gelificar con la adicin de azcar y cido. Comnmente,
son las pectinas de alto metoxilo las que se usan para formar geles de pectina
(Vaclavik, 2002).

232
El Agro Veracruzano 2015

Figura 5. Relacin entre el contenido en metoxilo, el grado de esterificacin y la


estructura de las sustancias pcticas (Navarro, 2014).

Las sustancias pcticas de los tejidos vegetales y los enzimas que las degradan
tienen una enorme importancia para la industria agroalimentaria. Por una parte,
desempean papeles esenciales en las estructuras celulares de los rganos
vegetales durante la maduracin, almacenamiento, etc. Por otra, en las tcnicas de
transformacin industrial, tales como extraccin, clarificacin, etc., de jugos de
frutos; una vez extradas de los rganos que las contienen, utilizadas como aditivos
alimenticios aprovechando sus propiedades gelificantes, espesantes, entre otras
(Navarro, 2014).
Las pectinas se obtienen de materiales vegetales que tienen un alto contenido de
stas, tales como manzanas, frutas ctricas, pia, guayaba, tomate, maracuy y
betabel. Estas pectinas son, en la actualidad, ingredientes muy importantes en la
industria de los alimentos, paras hacer gelatinas, helados, salsas y quesos. Tambin
se emplean en otras industrias, como la farmacutica, que requieren modificar la
viscosidad de sus productos, y en la industria de los plsticos as como en la
fabricacin de productos espumantes, como agente de clarificacin y aglutinantes
(Devia, 2003).
Prcticamente toda la pectina que se consume en el pas es de importacin, debido
a que dos grandes empresas tienen el monopolio y exportan casi toda la produccin
nacional: Hrcules de Mxico y Danisco, la primera es una empresa
Norteamericana y la segunda Danesa (Merchand, 2005).
Un gel de pectina est constituido principalmente por agua retenida en una red
tridimensional de molculas de pectina. La pectina es dispersable en agua y forma

233
El Agro Veracruzano 2015

un sol (slido disperso en una fase continua lquida), pero bajo las condiciones
adecuadas, se puede convertir en un gel (lquido disperso en una fase continua
slida). Esto ocurre cuando las molculas de pectina interactan entre s en puntos
especficos. No es fcil formar geles de pectina, se requiere un delicado equilibrio
de pectina, agua, azcar y cido.
La pectina es hidroflica (amante del agua) debido al gran nmero de grupos
hidroxilo polares y grupos carboxilo cargados en la molcula. Cuando la pectina se
dispersa en agua, algunos de los grupo cidos se ionizan y el agua se une tanto a
los grupos cargados como a los polares de las molculas. La carga negativa de la
molcula de pectina, unido a su atraccin por el agua, las mantiene separadas
pudiendo as formar un gel estable.
Para formar un gel, las fuerzas que mantienen las molculas de pectina separadas
se deben reducir de manera que puedan interactuar entre s en puntos especficos,
atrapando agua dentro de la red tridimensional resultante. En otras palabras, se
debe reducir la atraccin de las molculas de pectina por el agua y se debe
aumentar la atraccin de las molculas de pectina entre s. Esto se puede conseguir
por la adicin de azcar y cido.
Los azcares compiten por el agua, haciendo que est menos disponible para
asociarse con las molculas de pectina. Esto reduce las fuerzas atractivas entre la
pectina y las molculas de agua.
El cido aade iones hidrgeno, reduciendo el pH. (El pH debe ser inferior a 3.5
para formar un gel). Los cidos carboxlicos que tienen un grupo carboxilo, son
cidos dbiles y no estn completamente ionizados en solucin, la forma no
ionizada del cido se encuentra en equilibro con la forma ionizada (Vaclavik,
2002).
Despus de la extraccin de zumo de naranja, alrededor del 50 % de la fruta
termina como cscara y bagazo. La cscara es la principal materia prima para la
produccin de pectina, la cual se lleva a cabo despus de la extraccin de aceite.
Las enzimas pcticas presentes en la cscara tienen que ser inactivadas para evitar
la descomposicin de la pectina durante el procesamiento y almacenamiento. Para
la produccin comercial de la pectina, la cscara pasa por varias etapas que
incluyen la eliminacin de aceite de cscara, trituracin de la cscara para facilitar
el lavado y extraccin, el cribado de la cscara en jaulas de rotacin para quitar las
semillas, y la lixiviacin de la cscara con agua para eliminar los azcares solubles
y otros materiales indeseables (Sandhu, 2012).
En las ltimas dcadas, las sustancias pcticas han adquirido una gran importancia,
sobre todo en las industrias alimentarias. Las pectinas son principalmente agentes
gelificantes, y la industria utiliza esta propiedad bien para restituir a ciertos
alimentos una textura degradada por los tratamientos de conservacin, bien para
permitir su presentacin bajo una forma apropiada a su buen mantenimiento y a su
buen uso (Navarro, 2014).
234
El Agro Veracruzano 2015

Debido a que las pectinas son compuestos que generalmente se emplean en


alimentos, es necesario extraerlas del tejido vegetal mediante el uso de reactivos,
disolventes y equipos que no dejen residuos txicos en el producto final. Por ello,
el proceso de extraccin debe cumplir con estas necesidades; adems, las
propiedades fisicoqumicas de la pectina extrada, tales como pH, porcentaje de
cenizas, grado de gelificacin y grado de esterificacin entre otros, deben estar
dentro del rango apropiado para que las cualidades de la pectina puedan
aprovecharse.
Existen diferentes tcnicas para la extraccin de pectina a partir de tejidos
vegetales, en las cuales pueden utilizarse procedimientos fsico-qumicos, o
enzimticos. Con la finalidad de obtener un mayor rendimiento durante la
extraccin de sustancias pcticas, comnmente se realizan pre-tratamientos al
material vegetal para facilitar la extraccin. Es imposible extraer pectina libre del
tejido vegetal, porque existe en una forma insoluble conocida como protopectina.
Tambin se han empleado otros mtodos fsico-qumicos para la extraccin de
pectinas. Se ha usado la tcnica de extrusin como pre-tratamiento para la
extraccin de pectinas ctricas. La cantidad de pectinas solubles en agua se
increment despus del pre-tratamiento de extrusin. Tambin se ha usado un
lavado con agua caliente antes del proceso de extraccin de pectina de semilla de
girasol para mejorar la calidad y cantidad de pectina; sin embargo, el pre-
tratamiento increment la prdida de pectina.
Se obtuvo un alto rendimiento de pectina en seis minutos, utilizando un pre-
tratamiento termo-mecnico en el que se someti cscara de naranja a una presin
de vapor de 100-700 kPa, seguido de una descompresin instantnea a vaco a 5
kPa.
Existen pocos trabajos sobre extraccin enzimtica de pectinas. El mtodo
enzimtico emplea pectinesterasa o pectinmetilesterasa, la cual convierte a las
pectinas de alto metoxilo en pectinas de bajo metoxilo sin la despolimerizacin de
la molcula de pectina. Se han obtenido pectinas de bajo metoxilo va enzimtica
(pectinesterasa de origen vegetal) con capacidad para formar geles de alta
resistencia, y las compararon con geles obtenidos por va qumica, encontraron que
los geles obtenidos por va enzimtica eran ms resistentes.
Otros investigadores extrajeron pectina de bagazo de limn utilizando endo-
poligalacturonasa de Aspergillus niger con objeto de comparar dicho proceso con
la extraccin convencional, encontrando un rendimiento menor en el mtodo
enzimtico que en el mtodo convencional. Se han utilizado enzimas de
Aspergillus awamori con la finalidad de degradar la celulosa y las sustancias
insolubles de la pared vegetal de calabazas, y obtuvieron pectinas con un grado de
esterificacin del 53% en tres horas de procesamiento (Aldana-Villaruel, 2011).
La extraccin asistida con microondas no toma ms de quince minutos para extraer
una cantidad satisfactoria de la pectina. Los mtodos que emplean calentamiento
235
El Agro Veracruzano 2015

por microondas son generalmente ms eficaces en trminos de rendimiento de


pectina y dan mejores productos de calidad tambin. El rendimiento de la pectina
tambin depende de los tipos de disolventes de extraccin utilizados y el uso de
agentes quelantes adicionales, tales como cido etildiaminotetraactico (EDTA) y
cido ciclohexanediaminotetraactico (CDTA), que ayudan en la liberacin de la
pectina de la pared celular.
Se ha reportado el uso de un procedimiento de extraccin a base de agua para
adquirir sustancias pcticas a escala industrial. La extraccin de pectina a partir de
la calabaza con la ayuda de enzimas microbianas ha sido un terrapln notable para
experiencias futuras y estudios ms amplio en el campo de las pectinas. La
extraccin y caracterizacin de pectinas a partir de cscaras de cacao demostr ser
una tecnologa emergente para buscar otras fuentes de pectina a escala industrial
(Srivastava, 2011).
En los ltimos aos la tcnica de extraccin con fluidos supercrticos, para la
extraccin de polmeros naturales ha sido una tecnologa en desarrollo viable para
la extraccin de pectinas. Se ha reportado la extraccin de estos polisacridos de
un fruto ctrico japons (yuzu) usando agua supercrtica a 160 C de temperatura y
20 MPa de presin, obteniendo de esta manera un rendimiento de pectina del 80%.
La relevancia de la utilizacin de la tcnica anterior para la extraccin de la pectina
an no se ha demostrado sobre las otras tcnicas disponibles. Otras tecnologas han
sido reportadas y se muestran en la Tabla 1.

Tabla 1. Diferentes metodologas reportadas para la extraccin de pectina.

Tecnologa Ventajas Desventajas Referen-


cia
Hidrlisis Un mayor rendimiento en la Las cantidades de cidos Devia,
cida extraccin. No se requiere equipo inorgnicos hacen que no se apto 2003
especializado. Las condiciones para consumo humano. Se
no son tan severas, por lo que el producen desechos,
gasto energtico es mnimo. principalmente agua acidulada,
la cual se debe de neutralizar
antes de verterla al drenaje
municipal.
Hidrlisis Se utilizan medios mas Los rendimiento en la extraccin Matsuhiro,
bsica amigables con el ambiente y una son bajos. Se producen 2001
mejor calidad de cido desechos, principalmente agua
galacturnico. basificada, la cual se debe de
neutralizar antes de verterla al
drenaje municipal.

236
El Agro Veracruzano 2015

Asistida por Es una tcnica rpida, tiempos Necesidad de un proceso de Fishman,


microondas cortos de operacin, utiliza filtracin despus de la 2000
volmenes pequeos de extraccin para separar el
disolvente, permite el control del extracto de la materia prima,
proceso y bajo consumo de existencia de puntos fros y
energa. puntos calientes y
sobrecalentamiento de la
muestra.
Extraccin El equipo empelado es de poca Los tiempos de proceso son Angurell,
Soxhlet complejidad, alta eficiencia y largos ya que se requiere 2007
control. La tasa de saturacin del recirculacin.
disolvente es bajo y el
rendimiento es alto.
Hidrodestila Los componentes del material Si el caudal o la temperatura del Ortuo,
cin vegetal no se degradan por el condensador no es el adecuado 2006
efecto de la temperatura. se pueden causar prdidas en el
rendimiento del extracto.

Materiales y mtodos

El trabajo experimental se llevo a cabo en un espacio fsico externo a la Extensin


Tlapacoyan del Instituto Tecnolgico de rsulo Galvn, denominado Centro de
Investigacin en Ingeniera de Agroprocesos (CIIAP-ITUG): La renta del espacio
fsico, parte del material experimental e insumos estn financiados con recursos
propios de los asesores de ste grupo de investigacin. A continuacin se describen
los pasos para la extraccin de pectina por hidrlisis cida, el cul fue el mtodo
elegido (Figura 6), ya que requiere menos equipo especializado y al ser un
proyecto sin financiamiento institucional o externo, slo se poda trabajar con el
poco material que se tiene, sin embargo se consideraron algunas variantes.
Se sustituy un cido inorgnico como cido sulfrico, cido ntrico o cido
clorhdrico, que son cidos fuertes por cido ctrico que es un cido dbil, sin
embargo llega al pH requerido (pH2), el cido ctrico al ser de naturaleza
orgnica al encontrarse en varias fuentes vegetales, es considerado un ingrediente
alimentario GRAS, es decir, seguro para consumo humano.

237
El Agro Veracruzano 2015

Figura 6. Proceso inicial para la obtencin de pectinas ctricas (Adaptado de Devia,


2002).

Cabe sealar que al principio de la experiencia, si se us cido clorhdrico al ser el


cido que mas se utiliza segn la literatura especializada, sin embargo, al recolectar
la pectina ya seca y molida, se observaban trazas de dicho cido, pues disolva el
papel aluminio, por lo que ese fue otro factor a considerar para cambiar al cido
ctrico.
Separacin del flavedo. Por rayado se separa el flavedo, esto con el objetivo de
evitar extraer los carotenoides presentes en esta parte del ctrico.
238
El Agro Veracruzano 2015

Pelado (obtencin del albedo). Con un cter se separa el albedo del endocarpio
teniendo cuidado de no romper la delgada membrana que cubre las vesculas
jugosas.
Inactivacin de enzimas pcticas. Con el propsito de hacer ms eficiente el
proceso de extraccin es necesario inactivar las enzimas pcticas, manteniendo la
materia prima en agua, con concentraciones cercanas a 300 gramos por litro y
calentando hasta ebullicin, lo cual contribuye a eliminar suciedades o micro-
organismos presentes en la cscara. Se decanta el agua y la materia prima queda
lista para la hidrlisis.
Hidrlisis cida. Al material slido se le agrega la misma cantidad de agua usada
inicialmente y a esta solucin se le agrega cido sulfrico, cido ntrico o,
preferiblemente, cido clorhdrico hasta obtener un pH entre 1.5 y 3. Cuando se
usa cido clorhdrico del 37%, se calcula que se deben usar de 6 a 8 ml de cido
por cada litro de la solucin, para alcanzar el pH indicado. El tiempo de
calentamiento de la solucin es de 40 a 60 minutos manteniendo la temperatura en
el valor deseado (60C 80C); la agitacin permanente debe mantenerse para
evitar que el material slido se deposite en el fondo del tanque de hidrlisis.
Precipitacin. En la etapa de precipitacin de las pectinas se pueden emplear sales
o alcoholes. Se prefieren estos ltimos porque al usar las pectinas en la industria de
alimentos se evitan residuos, mientras que con las sales es necesario un lavado
muy cuidadoso para retirar todo residuo. En la precipitacin de las pectinas se
recomienda un volumen de alcohol equivalente al 80% de la solucin que se va a
precipitar. Sin embargo, en ensayos de laboratorio se ha encontrado que
disminuyendo el volumen de alcohol a un equivalente el 60% del volumen de la
solucin no se disminuye el rendimiento de una manera notable y si disminuyen
los costos sustancialmente.
Secado. Posteriormente la torta se pone a secar a 40 C en un secador de tnel o de
bandejas hasta que pierde casi toda el agua con el propsito de disminuir el agua
libre.
Molienda. Una vez que el material sea secado, se somete a una reduccin de
tamao para obtener un polvo fino, empleando un molino de cuchillas o un molino
de bolas.
Tamizado. Se homogeniza el tamao utilizando un tamiz de agregado fino y aquel
material que haya quedado con un tamao de partcula no deseado se vuelve a
pasar por el molino y posteriormente se tamiza hasta llegar al tamao deseado.
Sin embargo el mtodo era muy largo puesto que cada hidrlisis cida dura
aproximadamente una hora, por lo que se opto por eliminar la recirculacin y el
lavado en fro, as como la recirculacin despus del tamizado, al utilizar un
molino de ultrafinos, como es el molino de bolas y con eso disminuir el tiempo de
proceso considerablemente, as tambin se cambio el cido clorhdrico que es un
cido inorgnico fuerte por cido ctrico que es un cido inorgnico dbil, pero que
239
El Agro Veracruzano 2015

alcanza pH favorables para la hidrlisis sin disminuir la extraccin de manera


considerable (Figura 7).

Figura 7. Proceso final para la obtencin de pectinas ctricas.

Resultados

Se tomaron diferentes muestras de las cuatro diferentes especies de ctricos


provenientes de las huertas de la zona de Martnez de la Torre, Atzaln y
Tlapacoyan, Ver., donde fueron recolectados de manera aleatoria. Los frutos se
lavaron, se midieron axial y ecuatorialmente y se midi el espesor del albedo.
Posteriormente se midio el contenido de agua en el albedo de cada ctrico. Los
datos obtenidos a partir de los 3000 g de flavedo se hicieron por triplicado para
cada uno de los ctricos (limn persa, naranja valencia, mandarina Fremont y
240
El Agro Veracruzano 2015

toronja var. doble roja) sacando una media para obtener resultados y los
rendimientos de pectina de cada ctrico, los cules se muestran en la Tabla 2.

Tabla 2. Resultados obtenidos con el arreglo del proceso final.

Ctrico
Parmetro Limn Naranja Toronja Mandarina
Longitud axial (cm) 7.03 7.53 7.96 6.15
Longitud ecuatorial (cm) 5.70 7.42 8.80 7.20
Espesor del albedo (cm) 0.30 0.40 0.90 0.15
Peso de la fruta (g) 3,004.00 3,022.37 3,097.40 3,000.00
Humedad del albedo (%) 70 63.7 75 73.6
Albedo fresco (g) 558.67 462.60 696.91 180.16
Albedo deshidratado (g) 167.60 167.92 174.23 47.53
Pectina ctrica (g) 33.14 38.39 58.69 4.42
Rendimiento (%/g de albedo 2.35 8.29 8.42 2.45
fresco)
Rendimiento en base seca (%/g de 8.35 13.02 10.61 9.30
albedo seco)

Discusin

La naranja valencia mostr un mayor rendimiento, esto de puede deber a que


contiene una mayor humedad en el albedo con respecto a los otros tres ctricos, lo
que confirma la relacin de la pectina con el contenido de agua en el fruto.
Mientras que la toronja fue la que mayor cantidad de pectina present, esto es
debido a que este fruto presenta un mayor cantidad de albedo como se puede
apreciar en el tamao promedio (longitud axial, ecuatorial y espesor del albedo),
sin embargo el exceso de agua (agua libre) tambin perjudica la cantidad de
pectina extrada.
Cabe sealar que el ndice de maduracin es importante, ya que a medida que el
fruto se madura tiende a perder humedad, por lo que las pectinas dejan de ser
estables, por lo que se disminuye la concentracin de stas en el albedo.
A pesar de que la toronja var. Doble roja presenta una mayor humedad relativa del
albedo que la naranja el contenido de pectina y el rendimiento, estn por debajo de
los otros ctricos debido al tamao que presenta, lo cual hace que haya una menor
cantidad de albedo, con lo cual se corrobora la relacin cantidad de albedo-
cantidad de pectina.

241
El Agro Veracruzano 2015

Por otra parte, la mandarina es el ctrico que menos pectina presenta, sin embargo
debido a la humedad del albedo de este ctrico y a la cantidad de albedo que
presenta, supera en rendimiento (base seca) al limn persa, que es el que menos
humedad presenta en el albedo.
Para estar seguro que los resultados que se obtuvieron en el laboratorio eran
coherentes, se compar con los resultados reportados en la literatura especializada
utilizando la misma tecnologa, pero condiciones y cidos diferentes Tabla 3).

Tabla 3. Comparativo de los rendimientos de pectina obtenidos en el laboratorio con


respecto a los reportados en la literatura especializada.

Ctrico

Parmetro Limn Naranja Toronja Mandarina

Rendimiento obtenido, en 8.35 13.02 10.61 9.30


base seca (%/g de albedo
seco)
Rendimiento reportado en la 10.33 17.42 9.24 10.50
literatura, base seca (%)
Tecnologa empleada Hidrlisis Hidrlisis Hidrlisis Hidrlisis
cida cida cida cida
Referencia Azad, 2014 Cabarcas, Bagherian, Cho, 2003
2012 2004

Los rendimientos reportados son ms altos que los obtenidos para este trabajo con
excepcin de la toronja, sin embargo los datos no son tan diferentes y slo son
variaciones menores en el mismo orden de magnitud, por lo que se considera que
se puede deber al uso del cido ctrico en sustitucin del cido clorhdrico que es el
ms empleado en las referencias consultadas.
Sin embargo, si se utilizara cido clorhdrico, los efluentes tendran que tener un
tratamiento especial antes de ser vertidos en el drenaje municipal, mientras que con
el Ac. Ctrico no.

Conclusiones

El contenido de pectina en ctricos son depende fundamentalmente de la cantidad


de agua, el contenido de albedo presentes en el fruto y el ndice de maduracin en
el fruto, los cuales influyen directamente en el rendimiento del cido
poligaracturnico.

242
El Agro Veracruzano 2015

Se puede concluir, que estos ctricos analizados en este trabajo son materias primas
factibles tcnica y econmicamente para extraer pectina, el cual es un producto de
alto valor comercial y que, actualmente no es aprovechado por la industria
citrcola.
Los cuatro ctricos tienen temporadas bajas, donde el precio medio rural ($/Ton) es
alto, sin embargo, cuando es temporada alta, dicho precio medio rural ($/Ton) es
bajo, por lo que en dicha temporada se pueden aprovechar los ctricos para obtener
sub-productos de alto valor comercial, tales como las pectinas.
Por lo tanto, el uso de esta tecnologa es una opcin tcnica y econmicamente
viable para que los productores no vean prdida su inversin y por el contrario si
se logran asociar en Cooperativas Agroindustriales podrn obtener un mayor
producto-beneficio de sus cosechas en cada ciclo agrcola, pues los cuatro ctricos
tienen produccin a lo largo de todo el ao.

Literatura Citada

Aldana-Villaruel D.S., C.N. Aguilar-Gonzlez, J.C. Contreras-Esquivel, G.V. Nevrez-


Moorilln, 2011. Molculas pcticas: Extraccin y su potencial aplicacin como
empaque. Tecnociencia Chihuahua, 5(2):76-82.
Angurell, I., N. Casamitjana, A.Caubet, I. Dinars, N. Llor, D. Muoz-Torrero, E. Nicols,
M. Prez-Garca, M. Pujol, G. Rosell, M. Seco y D. Velasco, 2014. Operaciones
Bsicas en el Laboratorio de Qumica. Departamento de Qumica Inorgnica.
Universidad de Barcelona. Espaa. 300 pp.
Azad A.K.M., M. Ali, S. Akter, J. Rahman y M. Ahmed, 2014. Isolation and
characterization of pectin extracted from lemon pomace during ripening. Journal
of food and Nutrition Sciences, 2(2):30-35.
Cabarcas E., A. Guerra, C. Henao y M.T.A. Acevedo-Morantes, 2012. Extraccin y
caracterizacin de pectina a partir de cscaras de pltano para desarrollar un
diseo general del proceso de produccin. Tesis Licenciatura. Facultad de
Ingeniera. Universidad de Cartagena. Cartagena de Indias, Colombia. 50 pp.
Chon C.W., D.Y. Lee y C.W. Kim, 2003. Concentration and purification of soluble pectin
from mandarin peles using crossflow microfiltration system. Carbohydrate
polymers, 54(1):21-26.
Devia J., 2003. Proceso para producir pectinas ctricas. Revista Universitaria EAFIT,
129(1): 21-29.
Dugo G., Di Giacomo A., 2002. Citrus. The Genus Citrus, Taylor & Francis. USA. 630 pp.
El-Otmani M. Y A. Ait-Oubahou. 2011. Citrus spp.: orange, mandarin, tangerine,
clementine, grapefruit, pomelo, lemon and lime. pp. 437-514. En: Yahia E. M.
(ed.) Postharvest biology and technology of tropical and subtropical fruits.
Volume 2: Aai to citrus. Woodhead Publising. 515 pp.

243
El Agro Veracruzano 2015

Fishman M.L., H.K. Chau, P. Hoagland y K. Ayyad, 2000. Characterization of pectin,


flash-extracted from orange albedo by microwave heating, under pressure.
Carbohydrate Research, 323(1):126-138.
Bagherian H., F.Z. Ashtiani, A. Fouladitajar y M. Mohtashamy, 2011. Comparisons
between conventional, microwave -and ultrasound- assisted methods for
extraction of pectin from grapefruit. Chemical engineering and processing:
Process intensification, 50(12):1237-1243.
Goycoolea N. E. 2012. Ctricos. Produccin Nacional. Inforural. Mxico. 100 pp.
Matsuhiro B., Rubia M.J. 2001. Modificacin qumica de pectina de limn. Boletn de la
Sociedad Chilena de Qumica, 46(1): 34-39.
May C.D., 2000. Pectins. pp. 169-188. En: Phillips G.O. y P.A. Williams. (eds.) Handbook
ok Hydrocolloids. CRC Press. 450 pp.
Merchand R.M.A., 2005. La dinmica transnacional de la agroindustria del limn y su
hinterland agrcola en el valle de Tecomn. Anlisis econmico,44(20):215-248.
Navarro G. G., 2014. Sustancias pectinas y enzimas pecticos. Qumica y aplicaciones.
Universidad de Murcia. Espaa. 66 pp.
Ortuo M.F., 2006. Manual Prctico de Aceites Esenciales, aromas y perfumes. Aiyana.
Espaa. 274 pp.
Sandhu K.S., Minhas K.S. y J.S. Sidhu, 2012. Oranges and Citrus Juices. pp. 309-346. En:
Sinha N., J. Sidhu, J. Barta, J. Wu y Cano M.P.(eds.) Handbook of fruits and
fruits processing. Wiley-Blackwell Publishing. 748 pp.
Secretaria de agricultura, ganadera, desarrollo rural, pesca y alimentacin (2014). Servicio
de Informacin agroalimentaria y pesquera: Sistema de informacin arancelaria
va Internet. Secretaria de economa. 150 pp.
Srivastava P. Y R. Malviya, 2011. Sources of pectin, extraction and this applications in
pharmaceutical industry An overview. Indian Journal of Naural Products and
Resources, 2(1):10-18.
Vaclavik V.A. y E.W. Christian, 2002. Pectinas y otros carbohidratos. pp. 63-74. En:
Fundamentos de Ciencia de los alimentos. Acribia. 483 pp.

244
El Agro Veracruzano 2015

18
PROLIFERACIN DE CLULAS MADRE HEMATOPOYETICAS DE
CORDN UMBILICAL DE ORIGEN BOVINO TRATADAS CON
GHRELINA

Arabia Denisse Zamora Pardo *, Belisario Domnguez Mancera, Manuel Barrientos


Morales, Patricia Cervantes Acosta, Antonio Hernndez Beltrn

Laboratorio de Biologia Celular, Unidad de Diagnostico; Facultad de Medicina Veterinaria y


Zootecnia de la Universidad Veracruzana, CampusVeracruz. Miguel ngel de Quevedo esquina
Yez s/n Colonia Unidad Veracruzana. CP. 91710, Veracruz, Mxico. *beldominguez@uv.mx

Resumen
1. La posibilidad de cultivar clulas madre hematopoyticas (CMH) con xito, se basa
en la capacidad de poder obtener una mayor cantidad de estas clulas con el uso de
promotores del crecimiento celular, Una de las hormonas recientemente estudiadas en
la proliferacin celular es la Ghrelina,estimulante de la secrecin de hormona de
crecimiento, adems de un efecto orexignico; dilucidar los efectos de proliferacin
celular en CMHs tratadas con Ghrelina puede apoyar en la bsqueda de informacin
as como de alternativas teraputicas para el tratamiento de enfermedades de la
sangre. Para analizar el efecto de la Ghrelina sobre la proliferacin celular de las
CMH y las posibles vas de sealizacin involucradas se obtuvieron muestras de
sangre de cordn umbilical de becerros recin nacidos de doble propsito de la
PZTM-UV.
2. Las muestras de sangre fueron lavadas PBS y sembradas en placas multipozos con
medio Dubelccos Modified Eagles Medium suplementado con 10% de suero fetal
bovino y 1% de una mezcla de antibitico-antimictico. 24 horas posteriores a la
siembra, de manera lenta y suave se agitaron las placas multipozos para promover el
desprendimiento de clulas que no producen matriz extracelular y que no se
adhirieron a la placa, se aspir el medio con clulas no adheridas, se aadi medio
fresco y observo al microscopio (40X) para revisar integridad y viabilidad.
3. Posterior a ello se aaden activadores y bloqueadores de las vas de sealizacin
PKA, PKC, Camkinasa tipo II y Canales de calcio dependientes de Voltaje por un
periodo de 48hrs. Las clulas fueron cosechadas con una solucin de tripsina 0.05% y
EDTA 453 mM. La proliferacin se determin por conteo en cmara de Neubauer y
cuantificacin de protena por el mtodo de Bradford. La viabilidad celular se midi
con Azul de Tripano, la cual fue >95%.
4. La Ghrelina (100nM) incrementa el nmero de clulas nucleadas y la cantidad de
protena (p< 0.05). El activador de la va PKA, el Dibutiril AMPc (5mM) solo o en
245
El Agro Veracruzano 2015

combinacin con Ghrelina (100nM), increment la proliferacin y la cantidad de


protena; su bloqueador, el KT5720 (500nM) no mostr efecto sobre la proliferacin
o la cantidad de protena (P> 0.05). La Cheleritrina (bloqueador de PKC, 0.5nM),
inhibe el efecto estimulador de Ghrelina sobre la proliferacin, el activador
Phorbol12-Myristate13-acetate (PMA; 100nM) en combinacin con Ghrelina
muestra un incremento en proliferacin y cantidad de protena (p< 0.05). El
bloqueador de la va de sealizacin de la Calcio Calmodulina cinasa tipo II (CaMK-
II; KN-62 10nM) en conjunto con Ghrelina, bloqueo el efecto sobre proliferacin y
cantidad de protena. El bloqueador de canales de calcio, (Nifedipina 0.5 nM)
bloque el efecto que ejerce la Ghrelina sobre la proliferacin celular y su agonista el
BayK 8644 (0.5 nM), solo o en combinacin con Ghrelina increment la
proliferacin.
5. Se concluye que la Ghrelina promueve la proliferacin celular a travs de la
activacin de la va de la PKC y utiliza el influjo de calcio del medio extracelular
para activar la va CaMK-II.
Palabras clave: clulas hematopoyticas, Ghrelina, vas de sealizacin

Abstract

1. The ability to grow hematopoietic stem (HSC) cells successfully, based on the ability
to obtain a greater amount of these cells using cell growth promoters, One hormones
recently studied in cell proliferation is Ghrelin, stimulating hormone of growth
hormone secretion, and a orexigenic effect; elucidate the effects of cell proliferation
in HSCs treated with ghrelin can support the search for information as well as
therapeutic for the treatment of blood diseases alternatives. To analyze the effect of
Ghrelin on cell proliferation of HSCs and possible signaling pathways involved blood
samples from the umbilical cord of newborn calves of dual-purpose were obtained
from PZTM-UV.
2. Blood samples were washed in PBS and seeded in multiwell plates with Dubelccos
Modified Eagles Medium supplemented with 10% fetal bovine serum and 1% of
antibiotic-antimycotic mixture. 24 hours after seeding, slowly and smoothly the
multiwell plates were shaken to promote detachment of cells that did not produce
extracellular matrix and that did not adhere to the plate, the medium was aspirated
with non-adherent cells, fresh medium was added and were observed in a microscope
(40X) to check integrity and viability.
3. Following this, activators and blockers of PKA signaling pathways, PKC, CamKinasa
type II and Voltage Gated Calcium Channels were added for a period of 48hrs. The
cells were harvested with 0.05% trypsin solution and 453 mM EDTA. Proliferation
was determined by counting in a Neubauer chamber and quantification of protein by
the Bradford method. Cell viability was measured by Trypan blue stain, which was
>95%.
4. Ghrelin (100 nM) increased the number of nucleated cells and the amount of protein
(p<0.05). The PKA pathway activator, dibutyryl cAMP (5mM) alone or in
combination with Ghrelin (100 nM), increased proliferation and the amount of
protein; its blocker, the KT5720 (500 nm) showed no effect on proliferation or the
246
El Agro Veracruzano 2015

amount of protein (P>0.05). Cheleritrina (PKC blocker, 0.5nM) inhibits the


stimulatory effect of Ghrelin on proliferation, its activator Phorbol12-Myristate13-
acetate (PMA, 100 nM) in combination with Ghrelin showed an increase in
proliferation and amount of protein (P<0.05). The blocking of the signaling pathway
of Calcium Calmodulin kinase type II (CaMK-II, KN-62 10nM) together with
Ghrelin, blocking the effect on proliferation and amount of protein. The calcium
channel blocker (nifedipine 0.5 nM) blocked the effect exerted Ghrelin on cell
proliferation and the agonist BayK 8644 (0.5 nM), alone or in combination with
increased proliferation Ghrelin.
5. In conclusion, Ghrelin promotes cell proliferation via activation of the PKC pathway
and uses calcium influx from the extracellular medium to activate the CaMK-II
pathway.

Introduccin

El sistema hematopoytico tiene como funcin retirar de la circulacin las clulas


viejas o defectuosas eliminarlas y reemplazarlas, este sistema est constituido por
un conjunto de clulas de la mdula sea, de la sangre y del sistema linfoide que
dan origen a todos los tipos de clulas sanguneas a partir de una clula madre
hematopoytica (CMH). Las CMHs poseen tres caractersticas bsicas: (i) son
multipotentes, es decir, tienen el potencial de generar los linajes sanguneos: la
lnea roja que produce los eritrocitos, la lnea blanca que produce clulas de
diferentes tipos como el de tipo linfoide: linfocitos B y T, y el tipo mieloide:
basfilos/mastocitos, eosinfilos, neutrfilos/granulocitos, y
monocitos/macrfagos, tambin generan la lnea tromboctica que da origen a
megacariocitos/plaquetas. (ii) tienen un alto potencial proliferativo son capaces de
dividirse y producir un gran nmero de clulas maduras durante la vida del
individuo. (iii) cuentan con alta capacidad de generacin de nuevas clulas madre
idnticas manteniendo una divisin de tipo simtrico, capacidad conocida como
auto-renovacin esta propiedad es importante ya que mltiples procesos producen
estrs fisiolgico en el organismo con un consumo exagerado de determinadas
poblaciones celulares sanguneas (Figura 1), que de no ser por la capacidad de
auto-renovacin y su posterior compromiso hacia precursores maduros se veran ,
reducidas (Hoffman, 2000; Ivanova et al ., 2002). En el sistema hematopoytico,
las clulas madre son heterogneas con respecto a su habilidad de auto-renovarse,
para distinguirlas se clasifican en clulas madre hematopoyticas a largo plazo
(CMH-LP) y clulas madre hematopoyticas a corto plazo (CMH-CP). Las CMH-
LP son capaces de producir todos los tipos de clulas maduras de la sangre durante
la vida de un individuo y de generar progenitores que al ser trasplantados pueden
reconstituir el sistema hematopoytico, constituyen menos del 0.1% de CMHs
contenidas en la mdula sea en un individuo adulto. Las CMH-CP son las
247
El Agro Veracruzano 2015

encargadas de generar clulas progenitoras comprometidas con el linaje linfoide o


mieloide (Ivanova et al ., 2002; Mayani et al., 2003). Parece ser que hay un
compromiso progresivo de las CMH-LP en la generacin de CMH-CP y de stas a
su vez en la generacin de progenitores multipotentes (PMP) pasando por varios
estadios de diferenciacin que implican cambios funcionales irreversibles y que
caracterizan el proceso de maduracin celular (Morrison et al., 1997; Weissman,
2000).

Figura 1. Linaje celular derivado de clulas madre hematopoyticas (tomado de: Luis
T. Merc; Clulas Madre 2009).

A medida que las CMHs maduran van perdiendo su potencial de auto-renovarse


pero se vuelven mitticamente ms activas es decir que en los compartimentos de
clulas progenitoras hay muy poca capacidad de auto-renovacin y una alta
actividad mittica (Hoffman, 2000; Reya et al ., 2001). Una caracterstica que
comparten las clulas madre adultas con varios tejidos es su relativa quiescencia,
las clulas madre tienen una baja tasa de recambio en tanto que su descendencia
denotada como clulas progenitoras en el sistema hematopoytico proliferan a
gran escala, estas clulas progenitoras proveen billones de clulas sanguneas por
da que son necesarias para mantener la homeostasis en el individuo (Attar et al.,
2004). Se ha comprobado que aunque la mayora de CMHs permanecen
quiescentes en fase G0 en algn momento pueden entrar al ciclo celular para
dividirse (Ezoe et al., 2004). La baja tasa de proliferacin caracterstica de las
CMHs, es esencial para el mantenimiento de la poblacin de clulas madre durante
la vida de un individuo la dinmica que regula cules clulas se auto-renuevan para
248
El Agro Veracruzano 2015

mantener la poblacin y cules proliferan y llegan a comprometerse para producir


clulas diferenciadas an no es clara, aunque se cree que unas sustancias llamadas
citosinas producidas por las clulas pueden tener un papel decisivo en la
regulacin de la activacin de las CMHs. Esta activacin, conlleva a una serie de
cambios celulares que inducen el paso de fase G0 a fase G1 indicando el inicio de
la divisin celular conduciendo la expresin de un marcador de superficie de
membrana denominado CD34 y a una prdida gradual de la multipotencialidad con
las sucesivas divisiones celulares. Las clulas activadas retienen su
multipotencialidad durante un nmero definido de ciclos y cuando llegan a un
estado de mayor compromiso en la diferenciacin, proliferan a una mayor
velocidad (Marone, 2002). Por el contrario las clulas destinadas a la auto-
renovacin son capaces de retornar a un estado prolongado de quiescencia o G0
despus de cada ciclo celular y entrar nuevamente al ciclo cuando son estimuladas
adecuadamente an despus de un largo perodo de tiempo de quiescencia.
Cualquier clula puede tener diferentes opciones durante su existencia si se trata de
una clula eucariota elegir aquella que sea ms conveniente para el individuo del
cual forma parte o si se trata de una clula procariota tomar la opcin que le
permitir sobrevivir bajo las condiciones ambientales en que se encuentre. En
ambos casos la eleccin se hace en respuesta a las diferentes seales que se
encuentran en el entorno celular. Estas opciones son proliferar, diferenciarse,
permanecer en quiescencia o morir (Marone, 2002). En el caso de las CMHs la
proliferacin est relacionada con la capacidad de auto-renovarse y de generar un
linaje celular por divisin clonal .En el caso del tejido sanguneo el proceso de
auto-renovacin es crucial para que se mantenga el nmero de clulas sanguneas
requeridas para el correcto funcionamiento del organismo. Estos dos procesos
deben estar equilibrados de lo contrario pueden surgir enfermedades que ponen en
peligro la vida incluyendo cnceres, desordenes sanguneos, deficiencias del
sistema inmune, desordenes metablicos y sndromes de deficiencia de mdula
sea (Marone, 2000).
La prdida de las clulas sanguineas es compensada gracias a la actividad del
sistema hematopoytico y la presencia de una poblacin de clulas primitivas
inmaduras conocidas como Clulas Madre Hematopoyticas (CMHs) encargadas
del proceso de hematopoyesis activo desde el inicio de la vida fetal y que genera
cerca de 2 x 1011 eritrocitos y 1010 clulas blancas por da (Bellantuono, 2004). Se
ha encontrado que hay mecanismos moleculares de sealizacin que participan
como reguladores de la auto-renovacin, proliferacin y diferenciacin de las
CMHs se conocen como vas de sealizacin que se han asociado con la actividad
de las CMHs, la va Hedgehog (Hh); se relaciona con la activacin de la
proliferacin de las CMHs y con la induccin de patrones morfo genticos claves
para el desarrollo embrionario, otra va involucrada en la proliferacin de las
clulas CMHs es la Notch, la cual se ha asociado con los procesos de proliferacin,
249
El Agro Veracruzano 2015

diferenciacin y muerte celular en casi todos los estadios del desarrollo adems de
ser un importante regulador de la auto-renovacin de las CMHs por inhibicin de
la diferenciacin y por ltimo, la va Wingless (Wnt) que proporciona seales de
mantenimiento y proliferacin para las poblaciones de clulas madre y clulas
progenitoras, adems de las protenas morfognicas de hueso o BMPs y otros
factores que regulan la expresin de los genes activndolos o reprimindolos
(Mera et al., 2007). Estudios sugieren que las clulas madre de la sangre del
cordn umbilical ofrecen algunas ventajas primordiales frente a las de la mdula
sea o a las de un embrin porque son muy vitales y pueden convertirse en muchos
tipos diferentes de clulas, ni su obtencin ni su uso en medicina suscitan
problemas ticos y son la base ideal para el uso futuro en medicina regenerativa
(Lovell et al., 2001). Durante el desarrollo del feto las CMHs migran desde el
hgado y bazo hasta la mdula sea que asume gradualmente la funcin de
producir las distintas clulas sanguneas (Pipes et al., 2006). Cuando nace el feto,
la placenta y el cordn umbilical an contienen clulas madre como consecuencia
de ese proceso de migracin, esa circunstancia es aprovechada para introducir la
aguja en la vena umbilical y extraer las clulas que an estn circulando. El
procedimiento de recoleccin de la sangre es indoloro tanto para la madre como
para el feto y no conlleva ningn riesgo para ambos se realiza de una forma rpida
y eficaz mediante el drenaje por gravedad introduciendo la aguja en la vena
umbilical y llenando la bolsa de sangre (Pipes et al., 2006). Una vez colectada la
sangre del cordn umbilical, se pueden obtener cultivos ricos en clulas
progenitoras hematopoyticas con la capacidad de diferenciarse a clulas mieloides
y linfoides. Para inducir la diferenciacin dirigida hacia otros tipos celulares, las
clulas de cordn umbilical se exponen en presencia diferencial de un cctel de
factores de crecimiento, como hormonas y citocinas acompaadas de clulas
nodriza para generar el microambiente acorde al tipo celular deseado (Ulloa-
Montoya et al., 2005).
Una de las seales endocrinas del organismo que se ha estado estudiando y que se
encuentran involucradas en estimular o inhibir el crecimiento y diferenciacin
celular en el organismo es la Ghrelina (Nanzer et al., 2004; Mohamed et al., 2010;
Xu et al., 2013; Chung et al., 2013). El principal tejido productor de Ghrelina es el
estmago (Kojima et al., 1999, 2001; Dornonville et al., 2001). Se ha revelado su
presencia en una amplia diversidad de tejidos y rganos del organismo entre los
que se incluye est el intestino (Kagotani et al., 2001), la hipfisis (Korbonits et
al., 2001), el rin (Mori et al., 2000), la placenta (Gualillo et al., 2001) y el
hipotlamo (Kojima et al., 1999; Dornonville et al., 2001). La Ghrelina al unirse a
su receptor especfico a secretagogo de GH (GHS-R), induce un aumento en la
concentracin de calcio libre intracelular a travs de la produccin de inositol
trifosfato (IP3), para estimular la secrecin de GH, principal funcin de la Ghrelina
en somatotropos (Arvat et al., 2000; Kojima et al., 1999). Adems de este efecto,
250
El Agro Veracruzano 2015

se ha visto que la Ghrelina est involucrada en el control de la ingesta de alimento


y en el peso corporal (Asakawa et al., 2001; Tschop et al., 2000). Se ha reportado
que en estudios realizados en lneas celulares tumorales como los osteoblastos
MC3T3-E1, induce la proliferacin, diferenciacin y la inhibicin de la apoptosis
(Kim et al., 2005), estudios realizados sobre que vas de sealizacin son activadas
por Ghrelina, se ha reportado que activa la va de las ERK1/2 MAPK y el pre
tratamiento con un inhibidor de la MAPK kinasa el PD98059 se atena la
proliferacin celular inducida por Ghrelina (Kim et al., 2005); dilucidar los efectos
de proliferacin y diferenciacin celular en clulas CMHs tratadas con Ghrelina
puede apoyar en la bsqueda de informacin as como de alternativas teraputicas
para el tratamiento de enfermedades de la sangre.

Materiales y mtodos

Localizacin. El presente proyecto se realiz del 15 de agosto del 2013 al 15 de


enero del 2014 en el Laboratorio de Biologa Celular, ubicado en la Unidad de
Diagnstico Augusto R. Mancisidor Ahuja en la Posta Zootcnica Torren del
Molino de la Facultad de Medicina Veterinaria y Zootecnia, Universidad
Veracruzana, ubicado en el kilmetro 14.5 de la carretera libre Veracruz-Xalapa,
en la congregacin de Tejera, municipio de Veracruz.
Obtencin de muestras. Las muestras fueron colectadas de cordones umbilicales
de becerros recin nacidos de sexo indistinto y de las cruzas de suizo/ceb as
como de Holstein/Ceb en diferentes proporciones pertenecietes a la Posta
Zootcnica Torren del Molino (PZTM) de la Facultad de Medicina Veterinaria y
Zootecnia de la Universidad Veracruzana; las muestras se tomaron directamente de
los becerros (n = 5) sin realizar seccin del cordn umbilical, con una jeringa de
plstico estril de 5 ml con aguja de 22G x 32 mm, aproximadamente 2-3 ml de
sangre.
Metodologa para la toma de muestra. A las jeringas (con capacidad de 5 ml) se
les agrego 0.5ml de anticoagulante (citrato trisdico IPM BLORECEP 500 ACD).
Las muestras fueron transportadas en un periodo no mayor a 1hr al Laboratorio de
Biologia Celular, se metieron en una hielera con bolsas de agua caliente para
mantener la temperatura de 38 - 39 C, en cada muestreo se utilizaron alrededor de
3 a 5 jeringas, se realizaron cinco muestreo por conveniencia ya que se tomaron
las muestras del becerro que se encontraba recin nacido o que haba sido parido
en un lapso no mayor a 1 hora.
Dentro de la primera fase del trabajo de campo se incluyen los procedimientos de
colecta, transporte y siembra. En el inciso a) de la Figura 2 se observa el momento
del parto al becerro, el cual debe ser levantado para disminuir el riesgo de
contaminacin del cordn umbilical, adems de realizar la antisepsia con torundas
251
El Agro Veracruzano 2015

impregnadas en alcohol etlico al 70%; en el inciso b) se sostiene el becerro para la


extraccin sangunea ya sea de vena o arteria indistintamente, se realiza una
puncin sin seccionar el paquete vascular, con ayuda de una jeringa de plstico
desechable y estril; en el inciso c) las muestras de sangre (3-5 ml) se colocaron
en tubos cnicos de 15ml estriles, se aadi solucin buferada de fosfatos (PBS)
estril hasta completar 12 ml y se dio inicio al lavado de las clulas; las muestras
se colocaron en la centrifuga (Hettich) a 1500 rpm por 10 minutos, al trmino, se
retir el sobrenadante;el procedimiento fue repetido por duplicado bajo las mismas
condiciones; el sobrenadante se retir en condiciones de esterilidad en una
campana de flujo laminar (Nuaire). Al finalizar el segundo lavado; d) Al paquete
celular se le aadi DMEM (Dubelccos Modified Eagles Medium) hasta aforar
12 ml de medio de cultivo suplementado con 10% de suero fetal bovino y 1% de
una mezcla de penicilinas + anfotericina B (BIOWEST). El paquete celular fue
resuspendido y se sembr en placas multipozos de 12 con 1 ml de esta suspensin
celular para la separacin de las CMHs con las otras clulas que no producen
matriz extracelular (eritrocitos y clulas de la lnea blanca).

Figura 2. Manipulacin de tejido sanguneo proveniente de cordn umbilical de


becerro. a) parto bovino. b) obtencin de muestra de sangre de cordn umbilical. c)
Lavado de clulas. d) Siembra en medio DMEM en placas multipozos tratadas con
Ghrelina+activadores de las diferentes vas de sealizacin celular (Foto: Zamora-Pardo,
2013).

252
El Agro Veracruzano 2015

Medidas de bioseguridad. Todos los procedimientos experimentales se llevaron a


cabo en condiciones controladas de esterilidad, en una campana de flujo laminar
(Nuaire), mechero de gas butano, material de vidriera (Pyrex) y plstico
esterilizado por calor hmedo (115 Atm/132C) adems de consumibles estriles
desechables.
Separacin de CMHs. Veinticuatro horas despus de haber sido sembrada la
sangre del cordn umbilical, de manera lenta y suave se agitan las placas
multipozos para promover el desprendimiento de las clulas que no producen
matriz extracelular (eritrocitos y clulas de la lnea blanca) y que no estn
adheridas al suelo de la placa que est recubierto con poly-L-lisina, se extrae el
medio de cultivo aspirando con una pipeta el medio que contiene las citadas
clulas, posterior a ello, se colocaron de 2 ml de medio DMEM fresco y se
observ al microscopio con la finalidad de revisar integridad y viabilidad celular.
Diseo de experimento. En placas de cultivo de 12 pozos donde fueron sembradas
las clulas de la sangre; son aadidos activadores y bloqueadores de las diferentes
vas de sealizacin intracelular por un periodo de 48 horas.
1.- Va AMPc-PKA, para la va de la cinasa tipo A dependiente de AMP cclico, se
utiliz el Dibutiril AMP cclico (5 mM) (Cay et al., 2011) como activador y el
KT5720 (500 nM) (Fujiwara et al., 1995) como bloqueador.
2.- Va DAG-PKC, para evaluar la va de la protena kinasa C se utiliz el
activador ster de Forbol (Phorbol12-Myristate13-Acetate, PMA) (Wang et al.,
2010) anlogo sinttico del Diacil Glicerol, (100 nM) y para el bloqueo se utiliz
Chelerythrine (5 M). (Zhang et al., 2006)
3.- Va Cam Kinase tipo II, Calcio calmodulina Cinasa tipo II, para evaluar la va
de la protena modulada por el calcio intracelular, se utiliz el bloqueador KN62
(10M) (Wei et al., 1996).
4.- Calcio extracelular, para analizar el efecto del incremento de la concentracin
de calcio libre intracelular que provenga del medio extracelular el cual pasa a
travs de canales de calcio de alto umbral de activacin HVA tipo L, se utiliz un
agonista de canales de calcio HVA (Bayk 8644) (0.5 M) (Triggle et al., 1987), y
su antagonista o bloqueador de canales de calcio (Nifedipina) (0.5 M) (Miller,
1987).
Para determinar el efecto de la Ghrelina sobre la proliferacin celular, se analiz a
travs de la cuantificacin de clulas post tratamiento, con el uso del
procedimiento descrito por Freshney 2010.
Obtencin de clulas (cosecha para conteo celular y cuantificacin de
protena). Despus de 48 horas de cultivo y tratamiento de las clulas que
permanecieron adheridas a la placa, se procedi a su conteo, se extrajeron las
placas de la estufa de cultivo y con una pipeta se aspir el medio del pozo, las
clulas fueron despegadas con una solucin (100l) que contiene 0.05% de tripsina

253
El Agro Veracruzano 2015

y 453 mM de EDTA, a la suspensin celular resultante se le adicion 1 ml de


medio de cultivo fresco, esta suspensin fue transferida a microtubos eppendorf y
congelada a -20C hasta su anlisis para su conteo y cuantificacin de protenas.
Determinacin de la viabilidad y cuantificacin celular. Para realizar el conteo
celular se utiliz un hematocitmetro (cmara de Neubauer; Improved y Propper),
la cual contiene dos cmaras grabadas y graduadas con diferentes tamaos de
cuadrculas. El grabado corresponde a una cuadrcula de 3x3 mm y esta a su vez
est distribuida en cuadrantes de 1 mm2, por lo que la cantidad de clulas contadas
en cada uno es la cantidad por mm2. La profundidad de la cmara es de 0.1mm,
con un volumen concentrado en un cuadrante de 0.1mm3 o su equivalente a 1 x 10-
4
ml (0.0001 ml). Se aadieron 25 l de la suspensin celular en microtubos
cnicos para centrifuga (Eppendorf) y se les adicion 75 l de azul de tripano al
1%, dejando incubar por 3 minutos; en el hematocitmetro, se agreg la solucin
en cada una de las cmaras, se observaron al microscopio (Leyca) en seco dbil
(40x) y se realiz el conteo celular. Para realizar el recuento celular, se coloc el
cubreobjetos sobre la cmara, la velocidad de llenado de la cmara fue homogneo,
evitando as una mala distribucin de las clulas en el preparado para evitar errores
en el recuento.
Preparacin del Reactivo de Bradfortd. Se pesaron 5mg de Azul de coomassie
G-250 (Sigma) se vierte a un tubo cnico de 50ml, se le adiciona 2.5ml de
etanol, 5ml de cido fosfrico y cuanto baste para 50ml de agua desionizada
(Bradfortd, 1976).
Cuantificacin de protenas. Despus de recuperar el medio de cultivo, las
clulas son despegadas con una solucin que contiene tripsina 1X y 453 mM de
EDTA, la suspensin celular resultante se le adiciono 1 ml de medio de cultivo
fresco. Esta suspensin celular se transfiri a microtubos y centrifug por 10 min a
2,000 rpm. Se retir el sobrenadante y se aadi 1 ml de buffer de lisis (Promega
Corporation) con la finalidad de liberar el contenido celular. La mezcla es
incubada a temperatura ambiente (24 C) por 5 min, el homogenado celular se
resuspende y se centrifuga a 13,500 rpm por 7 min, se construy una curva de
calibracin con BSA (albmina srica bovina) como protena de referencia. La
determinacin de la concentracin de protenas se realiz con el uso de cubetas de
1 ml; se adicion a cada cubeta 2 l de muestra (estndar y problema), 98 l de
agua desionizada y 100 l del reactivo de Bradfortd y se incub en bao mara a 37
C por 5 min. La lectura de la absorbancia se realiz a una longitud de onda de 620
nm en un espectrofotmetro (Helios).
Preparacin de la curva estndar de albumina. Fueron presados 50mg de
albumina y se diluyeron en 50 ml de agua desionizada; en el Cuadro 1 se muestra
el protocolo de curva estndar para albumina srica bovina.

254
El Agro Veracruzano 2015

Cuadro 1. Protocolo de cuantificacin de protenas con el empleo de albumina srica


bovina (BSA)

g/ml Solucin de BSA Agua desionizada Reactivo de


Bradford Azul de
Coomassie
0 0 l 500 l 0 l
1 1 l 499 l 500 l
3 3 l 497 l 500 l
10 10 l 490 l 500 l
30 30 l 470 l 500 l
Blanco 500 l de agua desionizada. Leer : 620; Longitud de onda: 620 nm

La curva estndar elaborada con las citadas concentraciones fue la siguiente.

500 f1 = min + (max-min)/(1 + (x/EC50)^(-Hillslope))

450
Adsorbancia (620 nm)

400

350
min = 199.5
300 max = 693.4
EC50 = 25.25
Hillslope = 0.50
250

200

0 10 20 30

[Albumina]-3

Figura 3. Curva de calibracin estndar de BSA 620nm.

Anlisis estadstico. Para el anlisis estadstico, se us el software STATISTICA


v.10 (Stat Soft for Windows, 2010). Con ANDEVA de una va dentro del mdulo
GLM (modelo lineal general) para analizar la cantidad de protena as como el
nmero de clulas por tratamiento y diferencias de medias por la metodologa de
Tukey con una significancia de 0.05. Las Variables independientes fueron:
Tratamientos en las diferentes vas de sealizacin y las Variables dependientes
fueron: Nmero de clulas en los diferentes tratamientos as como Concentracin
de protena en los diferentes tratamientos.

255
El Agro Veracruzano 2015

Resultados

El cultivo de clulas madre CMH de cordn umbilical de bovino, pudo ser


realizado en condiciones de laboratorio por al menos 2 semanas, las CMH fueron
cultivadas en DMEM suplementado con SFB y la mezcla de antibiticos y
antimicticos, al cosechar las clulas y revisar su viabilidad mediante la tcnica de
exclusin de azul de tripano para constatar que se encontraban en divisin celular,
los cultivos mostraron una viabilidad superior al 95%. En los casos en que las
clulas fueron expuestas al secretagogo de GH y promotor de la proliferacin
celular Ghrelina, se observaron incrementos en la cantidad de clulas presentes en
el fondo de la caja de cultivo (Figura 4, B) que posterior a la cosecha, fueron
contabilizadas en la cmara de Neubauer en objetivo de 40X (Figura 4 C y D)
descartadas de otros tipos celulares presentes en la cmara.
Cuando se realiz la cosecha de las clulas de cordn umbilical presentes en el
fondo de la placa, se observaron clulas de la lnea blanca, las cuales no fueron
incluidas en el conteo ya que solo se cuantificaron aquellas clulas que presentaban
ncleo concntrico y no polimorfonucleares; en la Figura 5 se muestra las clulas
de sangre de cordn umbilical con magnificacin 100X en las que se aprecia las
clulas polimorfonucleares (lnea blanca) que se encontraron al realizar el conteo
fueron tenidas con hematoxilina y eosina, adems de eritrocitos que permanecieron
en el cultivo.
En la Figura 6A, se puede apreciar el conteo celular realizado en los cultivos bajo
condiciones control, sin exposicin a Ghrelina o a algunos de los activadores o
bloqueadores de vas de sealizacin; se reporta la existencia de diferentes
morfologas en las clulas cultivadas que provienen de la sangre de cordn
umbilical; las clulas que muestran ncleo concntrico, que no son
polimorfonucleares (clulas de la lnea blanca) son alrededor del 35% de la
poblacin celular, estas clulas son al parecer, las CMHs, para su confirmacin es
necesario el uso de marcadores como anticuerpos para protenas de superficie
como el CD34.

256
El Agro Veracruzano 2015

Figura 4. Cultivo de clulas madre hemocitopoyticas. A. microfotografa 20X se


muestran clulas bajo condiciones control y tratadas con Ghrelina (B) provenientes de
sangre cordn umbilical de bovino en crculos se muestran algunas clulas con ncleo,
rodeadas de eritrocitos. (C y D). microfotografa de la cuadricula de la cmara de
Neubauer 40X, se muestra como se realiza el conteo de las clulas. clulas madre
hemocitopoyticas.

A B

C D

Figura 5. Clulas de sangre de cordn umbilical con magnificacin de 100X. A. clulas


de sangre de cordn umbilical en las que se muestra un eosinfilo. B. clulas de sangre de
cordn umbilical en las que se muestra un basfilo. C. clulas de sangre de cordn
umbilical en las que se muestra un macrfago. D. clulas de sangre de cordn umbilical en
las que se muestra un neutrfilo.

257
El Agro Veracruzano 2015

El tratamiento con Ghrelina a una concentracin de 100 y 1000 nM (1mM) por 48


horas incrementa de manera significativa, el nmero de clulas nucleadas en el
cultivo (Figura 6B), probando as que la Ghrelina promueve proliferacin celular.

A B
24
Nucleadas (CMHs)

Celulas nucleadas 105


*
20
Tipos celulares

Ovaladas (polimorfo nucleares)


16

Irregulares (plaquetas) 12

8
Circulares (Eritrocitos)

4
0 10 20 30 40 50 0.1 1 10 100 1000
0

Celulas (%) [Ghrelina] nM

Figura 6. Proporcin de las morfologas encontradas en el cultivo de clulas de cordn


umbilical. A. Las clulas de la sangre de cordn umbilical fueron sembradas en
condiciones control de cultivo estndar, sin la adicin de frmacos que pudieran interferir
con la proliferacin celular en un periodo de tiempo de 48 horas. B. Curva dosis respuesta
del tratamiento de Ghrelina sobre las clulas nucleadas en cultivo. Las clulas de la sangre
de cordn umbilical fueron tratadas con diferentes concentraciones de Ghrelina por 48
horas*(p< 0.05).

Para mostrar el efecto de la Ghrelina sobre la proliferacin celular en CMHs y que


no presentara efecto de error de la observacin adems de la cuantificacin con la
que se hace en la cmara de Neubauer, se realiz la lisis celular y se cuantific la
protena con diferentes concentraciones del frmaco (Figura 7). La Ghrelina
incrementa la cantidad de protena presente en medio, lo que demuestra que hay un
mayor nmero de clulas presentes en el fondo del pozo de cultivo a medida que la
concentracin de Ghrelina incrementa con respecto al valor control.
Un aspecto que resulta interesante investigar es acerca de la va de sealizacin
intracelular involucrada en el efecto estimulatorio que ejerce la Ghrelina sobre la
proliferacin celular en este tejido; para tal fin se propuso realizar el anlisis de
tres cascadas de sealizacin: una mediada por el AMPc-PKA, otra mediada por
DAG-PKC y la otra mediada por la CamK-II. Se analiz inicialmente la
participacin de la va AMPc-PKA, para ello se emple un inhibidor permeable de

258
El Agro Veracruzano 2015

la PKA (KT-5720), el cual es considerado una herramienta farmacolgica para el


estudio de la va de sealizacin dependiente de AMPc, se cultivaron clulas de la
sangre de cordn umbilical por 48 horas en presencia de Ghrelina (100mM), KT-
5720 (500nM) y con los dos compuestos simultneamente.

A B
6 500

5
400

Protena (% del control)


4
Protena (mg)

300

200
2

100
1

0 0
1 10 100 1000 1 10 100 1000

-9 -9
[Ghrelina] [Ghrelina]

Figura 7. Curva dosis respuesta de protena del efecto de la Ghrelina sobre la


proliferacin celular. A. cantidad de protena presente en el medio. B. protena porcentaje
del control respecto a la concentracin de Ghrelina.

En la Figura 8A se muestra el anlisis del conteo celular de clulas nucleadas con


el bloqueador y activador de la va de la PKA en la cual, no se observan cambios
significativos con el tratamiento con Ghrelina en combinacin con el bloqueador
de la va, el KT 5720; en el mismo sentido, el uso de un AMPc no hidrolizable, no
increment de manera significativa el nmero de clulas nucleadas presentes en el
medio de cultivo, con respecto al valor control. De igual forma; en la Figura 8B, al
hacer el anlisis de la cantidad de protena se muestra que las clulas tratadas con
Ghrelina presentan un incremento significativo respecto al valor control, las
clulas que fueron tratadas con el bloqueador en combinacin con Ghrelina
presentan un incremento deduciendo que la Ghrelina sigui su efecto de
proliferacin sin la utilizacin de esta va.
En otra serie de experimentos, se decidi probar la participacin de la va DGA-
PKC, la cual ha sido una de las principales vas que se ha reportado que la
Ghrelina ocupa en otras clulas somticas, como pituitaria, cerebro, rin, placenta
entre otros; para lo cual se utiliz Cheleritrina, un potente inhibidor permeable de

259
El Agro Veracruzano 2015

la actividad de la PKC, se cultivaron clulas de cordn umbilical por 48 horas en


presencia de Ghrelina (1mM), Cheleritrina (5 M) y con los dos compuestos
simultneamente.

A B
350
30
Celulas nucleadas 105

300

Protena (% del control)


*
25
250
20
200 *
*
15 *
150
10
100

5 50

0 0

a
a

l
l

KT

iri
tro

KT
iri
ro

in

in

in
in

in

ut
ut
nt

el

el

el
on
el

el

ib
ib
co

hr

hr

hr
hr

hr

D
D

G
+G

G
l+

+
KT

iri

l
KT

iri
ut

ut
ib

ib
D

D
Figura 8. Efecto de la participacin de la va de sealizacin PKA sobre las clulas
nucleadas (A) y protena (B) tratadas con Ghrelina. Las clulas de la sangre de cordn
umbilical fueron tratadas por 48hrs en ausencia (control) y presencia de Ghrelina (100mM)
en conjunto con el bloqueador de la PKA (KT5720, 500nM) o un AMPC no hidrolizable,
el Dibutiril AMPc (5mM).

Los resultados encontrados se muestran en la Figura 9A, se observan diferencias


significativas (p< 0.05) del efecto de la Ghrelina sobre las clulas ya que al
bloquear la va con Cheleritrina, el efecto estimulador de la Ghrelina sobre la
proliferacin no se presenta. Un anlogo sinttico del Diacil Glicerol (DAG), el
ster de Forbol (phorbol myristate acetate, PMA) a una concentracin de 100nM;
por s solo, muestra un incremento en el nmero de clulas nucleadas presentes en
el medio de cultivo (p< 0.05), lo que prueba que la Ghrelina ocupa la va de la
PKC en clulas de cordn umbilical. Al analizar el porcentaje de protena presente
en clulas de sangre de cordn umbilical, el bloqueador (cheleritrina) de la va
PKC no mostro incremento con respecto al valor control; sin embargo, cuando
fueron tratadas con el activador de la va de la PKC el ster de Forbol (phorbol
myristate acetate, PMA) solo y en conjunto con la Ghrelina se presenta un
incremento significativo de protena, lo que prueba que la Ghrelina puede ocupar
la va de la PKC en clulas de cordn umbilical (Figura 9B).

260
El Agro Veracruzano 2015

A B
350
30
300

Celulas nucleadas 105

Proteina (% del control)


25 *
*

250
20 *

*
200
15
150 *

10
100
5
50

0 0
l

a
ro

a
ro
in

lin

lin
PM

lin

in

in

lin
PM
nt

itr

nt
e

el
itr
e

e
co

hr

hr
er

Co

hr

hr

hr
er
G

G
el

G
el
Ch

Ch

+
a

a
itin

PM

itin
PM
er

er
el

el
Ch

Ch
Figura 9. Efecto de la participacin de la va de sealizacin PKC sobre las clulas
nucleadas (izquierda) y protena (derecha) tratadas con Ghrelina. Las clulas de la
sangre de cordn umbilical fueron tratadas por 48hrs en ausencia (control) y presencia de
Ghrelina (1mM) en conjunto con el bloqueador de la PKC (Cheleritrina, 0.5 M) o un el
ster de Forbol (phorbol myristate acetate, PMA) a una concentracin de 100nM , *(p<
0.05).

En una serie de trabajos realizados en neuronas, clulas de pituitaria, clulas


mesenquimales, en los cuales ha reportado que al aumentar la actividad de los
canales de calcio tipo L por despolarizacin de la membrana plasmtica, se activan
diferentes vas de sealizacin intracelular que inducen la expresin de genes
especficos, involucrados en el desarrollo, supervivencia y proliferacin celular, as
como inhibicin de estos aspectos; estos efectos son mediados al menos en parte
por la protena cinasa dependiente de calcio-calmodulina tipo II, CamK-II (Len-
Iza y Zarain-Herzberg, 2011). Al considerar esta informacin, se propuso explorar
si la Ghrelina pudiera requerir de la actividad de la CaMK-II en el efecto que
ejerce esta hormona sobre la proliferacin celular. Para lo cual, el procedimiento
que se emple para poner a prueba esta hiptesis fue el siguiente: se cultivaron
clulas de cordn umbilical por 48 horas en presencia de Ghrelina (100mM) y de
un potente inhibidor de la CaMK-II, el KN-62 (10 M). El bloqueador de la va de
sealizacin protena cinasa dependiente de calcio-calmodulina tipo II en conjunto
con Ghrelina, bloquea el efecto de esta hormona sobre la proliferacin de las
clulas de cordn umbilical, lo que prueba que la Ghrelina puede ocupar una va de
sealizacin que depende de un aumento en el calcio intracelular, el cual puede
activar la CaMK-II (Figura 10). Al medir la cantidad de protena en los cultivos de
261
El Agro Veracruzano 2015

clulas de cordn umbilical, se observa que al combinarse la Ghrelina y el KN62


no existe incremento alguno de protena bloqueando as el efecto de esta hormona.

A B
350
30
300

Proteina (% del control)


Celulas nucleadas 105

25
250
20 *
200

15 150

10 100

5 50

0 0

control KN62 KN62 + Ghrelina Control Ghrelina KN62 KN62 + Ghrelina

Figura 10. Participacin de la va de sealizacin de la protena cinasa dependiente de


calcio-calmodulina tipo II (CaMK-II), sobre las clulas nucleadas (A) y protena (B)
tratadas con Ghrelina.

Las clulas de la sangre de cordn umbilical fueron tratadas por 48hrs en ausencia (control)
y presencia de Ghrelina (100mM) en conjunto con el bloqueador de la CaMK-II (KN62) en
una concentracin de 10 M.
Por ltimo, para analizar si el efecto de la Ghrelina sobre la proliferacin de las
clulas de la sangre de cordn umbilical dependa de un aumento en el calcio
intracelular que pasa a travs de la activacin de canales de calcio de alto umbral
de activacin tipo L (HVA-Tipo L), sensibles a dihidropiridinas, se manipulo
farmacolgicamente la actividad de los canales de calcio HVA. Con agonistas y
antagonistas a una concentracin constante de 0.5 M. Las clulas de cordn
umbilical se cultivaron por 48 horas en presencia de Bay K 8644, de Nifedipina y
de Ghrelina (10mM). La Nifedipina aumenta el tiempo que permanece el canal de
calcio tipo L cerrado, disminuyendo el influjo de calcio, mientras que el Bay K
aumenta el tiempo de apertura, lo cual ocasiona un aumento en la entrada de
calcio, los resultados se muestran en la Figura 11. La Nifedipina bloquea el efecto
que ejerce la Ghrelina sobre la proliferacin celular, probando as que la Ghrelina
incrementa el influjo de calcio del medio extracelular al medio intracelular y este
aumento en la concentracin intracelular de calcio puede activar protenas que
promueven la proliferacin celular, el tratamiento con BayK, solo o en
combinacin con Ghrelina incrementa el nmero de clulas nucleadas presentes en
el medio de cultivo, lo que se traduce en un aumento en la proliferacin celular.

262
El Agro Veracruzano 2015

A B
350 *
30 * *
*

Celulas nucleadas 105


300

Protena (% del control)


25
250
20
200 *
15
150
10
100
5
50
0
0

K
l

na

hr

hr
ro

K
l

na

a
BY

ro
G

G
pi

in

in
nt

in
BY

pi
nt

el

el
di

el
co

di
Co
fe

hr

hr

hr
na

fe
BY
Ni

G
pi

Ni

+
di

na
fe

BY
Ni

pi
di
fe
Ni
Figura 11. Efecto de la participacin de los canales inicos de alto umbral de activacin
tipo L (HVA tipo-L), sensibles a dihidropiridinas sobre la proliferacin (izquierda) y la
cantidad de protena (derecha) en las clulas de cordn umbilical.

Las clulas de la sangre de cordn umbilical fueron tratadas por 48hrs en ausencia (control) y
presencia de Ghrelina (100mM) en conjunto con el antagonista (Nifedipina) o agonista (BayK
8644) de canales de calcio de alto umbral de activacin tipo L a una concentracin de 0.5 M
*(p< 0.05).
El anlisis realizado al cuantificar la cantidad de protena presente en el medio de
cultivo de sangre de cordn umbilical tratadas con Ghrelina muestra un incremento
significativo; cuando la Ghrelina se combina con el agonista (Bayk) de los canales
inicos de alto umbral de activacin tipo L (HVA tipo-L tambin se aprecia
incremento significativo en la cantidad de protena con respeto al control; por otro
lado, cuando se analiza el efecto que ejerce la Nifedipina se observa que esta
bloquea la accin de proliferacin que tiene la Ghrelina al no mostrar incremento
en la protena con respecto al valor control.

Discusin

El estudio de las clulas madre inici a mediados de los aos 60s y se expandi
durante la dcada de los 70s con los trabajos realizados por Friedstein (Beyer et
al., 2006), quien describi por primera vez una poblacin de clulas adherentes de
medula sea que formaban parte del estroma medular, con caractersticas
fibroblastoides denominadas unidades formadoras de colonias de fibroblastos
(UFC-F) (Gregory et al., 2005). En la ltima dcada varios estudios caracterizaron
este grupo de clulas, mostrando que medula sea (MO), Sangre de cordn

263
El Agro Veracruzano 2015

umbil