P. 1
Protocolo de PCR para Malaria

Protocolo de PCR para Malaria

|Views: 793|Likes:
Publicado porJuan Carlos

More info:

Published by: Juan Carlos on Aug 01, 2011
Copyright:Attribution Non-commercial

Availability:

Read on Scribd mobile: iPhone, iPad and Android.
download as PDF, TXT or read online from Scribd
See more
See less

12/23/2012

pdf

text

original

Protocolo de Diagnóstico de Malaria por Método de Reacción en Cadena de la Polimerasa (PCR).

PRODUCTO 6 Metodología utilizada para el diagnóstico y diferenciación de Plasmodium spp. en pacientes positivos por Malaria. Lic. Juan C. Domínguez 30 de junio de 2011

INDICE

INTRODUCCION PALUDISMO O MALARIA LA TÉCNICA DE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) REACTIVOS Y EQUIPOS o Extracción de DNA o Diagnóstico mediante PCR o Electroforesis PROCEDIMIENTOS PARA LAS PRUEBAS MOLECULARES o Extracción de DNA o PCR diagnóstico (Nested-PCR) a. Primer PCR b. Segundo PCR o Preparación de Geles de Agarosa BIBLIOGRAFIA

2

INTRODUCCIÓN

La malaria es una parasitemia de preocupación mundial. Las estimaciones de la Organización Mundial de la Salud, 300 hasta 500 millones de casos de infecciones de malaria que resulta en más de un millón de muertes que ocurren a nivel mundial cada año. Aunque, la gran mayoría de estos casos se encuentran en los países de las regiones tropicales de África, Asia, América Central y América del Sur, donde la enfermedad es endémica. Los Centros para el Control y Prevención recomienda que la malaria se debe considerar un diagnóstico diferencial en pacientes febriles que hayan viajado a una región donde la malaria es endémica y en todo los pacientes que presenten fiebre de origen desconocido, independientemente de su historial de viajes.

La diferenciación de las especies de Plasmodium es esencial para seleccionar el tratamiento adecuado, especialmente la diferenciación de P. falciparum de los demás, ya que esta especie es responsable de casi 95% de las muertes por malaria.

La técnica de la reacción en cadena de la polimerasa (PCR) se ha sumado a la lista de desarrollos tecnológicos originados en el ámbito industrial que provocaron cambios cualitativos en las ciencias básicas. Uno de los proyectos más ambiciosos de la biología moderna es la determinación de la secuencia completa del genoma humano, y sumándose a eso, el diagnostico de nuevas enfermedades trasmitidas por diferentes patógenos: virus, bacterias, parásitos y otros; y de otra índole.

3

PALUDISMO O MALARIA El paludismo o malaria es una enfermedad muy extendida en el trópico. Es una de las principales causas de mortalidad en el mundo. Está causada por un protozoo (Plasmodium) que es transmitido al hombre a través de la picadura de la hembra del mosquito Anopheles. Existen cuatro especies de Plasmodium que causan la enfermedad en el hombre (P. vivax, P. ovale, P. malariae y P. falciparum). Las tres primeras producen un paludismo relativamente benigno, pero la cuarta produce un paludismo grave que amenaza la vida del enfermo. Además, con el paso del tiempo, Plasmodium falciparum ha desarrollado resistencia a algunos de los medicamentos utilizados por el ser humano para combatirlo. Figura 1. Ciclo de trasmisión del Paludismo

Las tasas de transmisión del paludismo pueden variar en función de factores locales como las precipitaciones (los mosquitos se crían en condiciones húmedas), la proximidad de los lugares de cría a las personas y las especies de mosquitos presentes en la zona. Algunas regiones, denominadas "endémicas", tienen un número bastante constante de casos a lo largo de todo el año. En otras hay "estaciones palúdicas", generalmente coincidentes con la estación lluviosa. Pueden producirse grandes y devastadoras epidemias cuando el parásito se introduce en una zona donde la población ha tenido poco contacto con él y posee escasa o nula inmunidad al paludismo o cuando personas con baja
4

inmunidad se desplazan a zonas donde los casos de paludismo son constantes. Estas epidemias pueden ser desencadenadas por condiciones climáticas húmedas y agravadas aún más por inundaciones o movimientos masivos de población originados por conflictos.

Los primeros síntomas comunes (fiebre, dolor de cabeza, escalofríos y vómitos) suelen aparecer 10 a 15 días después de que se haya producido la infección. Si no se trata rápidamente con medicamentos eficaces, el paludismo puede ser grave, y a menudo mortal.

Grupos especiales de riesgo: • Son muy vulnerables los viajeros procedentes de regiones libres de paludismo, con escasa o nula inmunidad, que se desplazan a zonas donde la enfermedad es frecuente. • Las embarazadas no inmunes corren un alto riesgo de sufrir el paludismo. La enfermedad puede producir tasas de aborto elevadas y causar una mortalidad materna anual de más del 10% (cifra que puede llegar al 50% en casos de enfermedad grave). • Las embarazadas semi-inmunes corren el riesgo de sufrir anemia intensa y retraso del crecimiento fetal, aunque no presenten signos de enfermedad aguda. Se calcula que anualmente mueren 200 000 lactantes a consecuencia del paludismo adquirido durante el embarazo. • Las embarazadas infectadas por el VIH también corren mayor riesgo.

El tratamiento temprano del paludismo reduce su duración, previene las complicaciones y evita la mayoría de las muertes. Debido a sus considerables repercusiones sanitarias en los países de bajos ingresos, el tratamiento del paludismo es parte esencial del desarrollo sanitario mundial. El objetivo del tratamiento consiste en curar al paciente, más que en reducir su número de parásitos.

La OMS recomienda: • Un tratamiento rápido de todos los episodios de la enfermedad (a ser posible, en las 24 horas siguientes al inicio de los síntomas);
5

• •

El uso de mosquiteros tratados con insecticida para evitar las picaduras de los mosquitos por la noche; En las embarazadas de zonas muy endémicas, dosis profilácticas de sulfadoxina pirimetamina para eliminar periódicamente los parásitos que pueda haber en la placenta;

La fumigación de interiores con insecticidas de acción residual para matar los mosquitos que haya en las paredes y techos de las casas.

Figura 2. La fumigación con insecticidas como medidas preventivas.

6

LA TECNICA DE REACCIÓN EN CADENA DE LA POLIMERASA (PCR) Esta técnica permite amplificar pequeñas cantidades de ADN entre cientos de miles y millones de veces. El tramo destinado a reproducirse puede tener desde cincuenta hasta más de dos mil nucleótidos de longitud. El segmento de ADN que sirve de molde no requiere estar necesariamente en estado puro, sino que puede ser parte de mezclas complejas. El método se basa en la realización de tres reacciones sucesivas llevadas a cabo a distintas temperaturas. Estas reacciones se repiten cíclicamente entre veinte y cuarenta veces. • • La muestra se calienta, en el primer paso, hasta lograr la separación de las dos cadenas que constituyen el ADN, hecho que se conoce como "desnaturalización". En el segundo paso, la temperatura se reduce para permitir el "apareamiento" de cada una de dos cadenas cortas de nucleótidos (oligonucleóridos) con cada una de las hebras separadas del ADN molde. Se trata de segmentos de ADN de cadena simple, sintetizados en el laboratorio y diseñados de manera tal que permiten definir los límites del tramo de ADN que se desea replicar. Para que se pueda producir el apareamiento, cada uno de estos oligonucleótidos, a los que se denomina "iniciadores" o primers, debe ser complementario del tramo al que tienen que unirse en las cadenas separadas del ADN molde. • En tercer lugar, una enzima ADN polimerasa extiende los primers, en el espacio comprendido entre ambos, sintetizando las secuencias complementarias de las hebras del ADN molde. Para ello, la ADN polimerasa usa desoxidonucleósidos trifosfato (dNTPs) agregados a la mezcla de reacción. La temperatura a la que se realiza el tercer paso está condicionada por aquélla a la cual "trabaja" la enzima ADN polimerasa. Al cabo del primer ciclo de tres reacciones (desnaturalización, apareamiento, extensión) el tramo de ADN elegido se ha duplicado y el doble de su cantidad original se encuentra disponible para ser nuevamente replicado en un segundo ciclo. El resultado de la

7

aplicación de numerosos ciclos "en cadena" da lugar a la amplificación geométrica del segmento de ADN delimitado por los primers. Figura 3. Ciclo de la Técnica PCR

El hecho de que las moléculas de ADN obtenidas al finalizar la reacción en cadena correspondan efectivamente al fragmento de interés queda asegurado por la intervención de los primers que definen los extremos "derecho" e "izquierdo" de ese fragmento. Así, una vez que la reacción a finalizado, el tamaño del fragmento multiplicado puede determinarse sometiendo los productos de la reacción a una electroforesis en gel de agaroza o poliacrilamida, es decir, a un proceso de separación por difusión bajo la acción de un campo eléctrico. Una estrategia distinta para confirmar la identidad del fragmento replicado consiste en realizar dos reacciones de PCR consecutivas. Al finalizar la primera, una alícuota de la misma es sometida nuevamente al proceso de multiplicación tras haber colocado dos primers internos. Mediante el empleo de esta metodología, conocida como nested PCR (PCR anidada), la filiación de los fragmentos obtenidos queda confirmada por el hecho de que poseen tamaños previsibles.

8

En algunos casos, los productos amplificados poseen secuencias que son reconocidas y clivadas por ciertas enzimas llamadas en donucleasas de restricción. La determinación del tamaño al que quedan reducidos los fragmentos al ser puestos en contacto con la enzima de restricción adecuada indica que nos encontramos ante los segmentos de interés. Se han desarrollado varias pruebas diagnosticas basadas en la amplificación del ADN de Plasmodium spp mediante PCR. Estas pruebas han demostrado a nivel experimental tener una mayor sensibilidad y especificidad para detectar el parasito al compararlas con otras pruebas diagnosticas convencionales. Se han diseñados varias técnicas de PCR empleando oligonucleótidos que amplifican regiones del ADN especificas para cada una de las especies de Plasmodium que infectan al humano. Para el diagnostico de P. falciparum se ha descrito un PCR que amplifica una región altamente repetitiva del genoma del parásito. Esta misma prueba también se ha descrito en formato multiplex para detectar simultáneamente P. falciparum y P. vivax, empleando otro par de oligonucleótidos dirigidos a una secuencia repetitiva de P. vivax. Además de la utilidad diagnostica, la técnica de PCR puede emplearse para detectar mutaciones en el parásito asociadas con resistencia a medicamentos y para conducir estudios de epidemiologia molecular durante brotes de malaria.

9

Reactivos y Equipos Extracción de ADN • • • • • • • • • • • • • • • • Micropipetas de 40-200 µl y 200-1000 µl Pinzas Puntas de 1-100 µl y 200-1000 µl Sacabocados Tubos eppendorf Agua destilada esteril Buffer 0.5 % saponina de 1 x PBS Chelex- 100 HCl NaOH PBS (Phosphate Buffer Saline) Autoclave Baño seco Microcentrifuga Refrigerador Vortex

Diagnóstico mediante PCR • • • • • • • • • Micropipetas 1-10 µl, 5-40 µl, 20-200 µl, 200-1000 µl Puntas con filtro 1-10 µl, 10-200 µl, 200-1000 µl Tubos eppendorf Tubos de PCR Agua destilada esteril Cloruro de magnesio Hielo PCR Master Mix Cámara de flujo laminal

10

• • •

Cubetas Gradillas Vortex

Electroforesis Equipo • • • • Balanza analítica Sistema de mini gel horizontal Fuente de corriente Transiluminador

Materiales y Reactivos • • • • • • • • • • • Erlenmeyer Micropipeta de 1-10 µl, 10-200 µl Papel parafina Probeta de 100 ml Puntas con filtro de 1-10 µl, 1-200 µl Acrilamida-Bisacrilamida Agarosa de lata resolución Agarosa Low meeting Agua destilada Loading buffer Marcador molecular 50-2000 bp

11

Procedimientos para las Pruebas Moleculares Pasos para la recolección de las muestra en papel filtro Whatman 3MM • • • • • • • Rotular el papel filtro Limpiar la piel con alcohol y dejar secar Puncionar con la lanceta la yema del dedo hacia el borde lateral, mas debajo de la uña Limpiar la primera gota de sangre con algodón seco Presionar el dedo para obtener una gota pequeña Colocar 3 gotas sobre el papel sin firmar el dedo en el papel y dejar que se forme un botón del tamaño de una moneda de 10 centavos Dejar secar por lo menos dos horas a temperatura ambiente y almacenar en bolsas plásticas transparentes hasta su procesamiento. Extracción de ADN 1. Se toma con un sacabocados círculos de muestras en papel filtro y se coloca en un microtubo tipo eppendorf de 1.5 ml, debidamente rotulado con el nombre del paciente y la fecha 2. Se añade un 1 ml de buffer 0.5 % saponina en 1X PBS a cada tubo con su respectiva muestra. Se mezcla bien y se incuba a 4° C durante toda la noche 3. Se descarta la solución de glóbulos rojos lisados y se remplaza con 1 ml de 1X PBS por 30 min. 4. Por cada muestra analizada se calienta 200 µl de Chelex-100 a 100 ° hasta que se C disuelvan las perlitas 5. Se retira el lisado de glóbulos rojos y a continuación se transfieren los círculos de papel filtro a los tubos con Chelex-100 disuelto, mezclando vigorosamente por 30 segundos 6. Posteriormente las muestras se incuban en le baño seco durante 100 ° y se mezclan C en le vortex durante 30 segundos 7. Las muestras se centrifugan a 10 000 rpm durante 2 min. El sobrenadante donde se encuentra el ADN es retirado con cuidado y transferido a otro tubo debidamente rotulado. La centrifugación se repite y el sobrenadante es extraido nuevamente. 8. Todas las muestras son almacenadas a -20 °C

12

PCR diagnóstico (Nested-PCR) La extracción del DNA de malaria a partir de sangre recolectada en papel filtro Whatman 3MM se realiza empleando la metodología estándar de Chelex, descrita anteriormente, o empleando el Kit de QUIAGEN, de acuerdo a las instrucciones de la casa comercial. Inicialmente, el ADN extraído será empleado para confirmar el diagnóstico de Plasmodiun vivax empleando un PCR anidado. El procedimiento consiste en realizar una primera amplificación por PCR para la identificación de un fragmento de género-especifico seguido de una amplificación especie-especifico que permite distinguir entre Plasmodium vivax y Plasmodium falciparum, inclusive permite detectar infecciones mixtas. a. Primer PCR (género-especifico) rPLU5: CTTGTTGTTTGCCTTAAACTTC rPLU6: TTAAAATTGTTGCAGTTAAAACG • • • • • • Rotular los tubos para cada una de las muestras de ADN Añadir 25 µl de PCR mix, 1 µl de MgCl2 Agregar 2 µl de rPLU5 y 2 µl de rPLU6 15 µl de agua libre de DNAasas y RNAasas 5 µl de DNA Colocar esta mezcla en el termociclador con las siguientes condiciones: PROGRAMA N° DE CICLOS Desnaturalización inicial Desnaturalización Alineamiento Extensión Extensión final 94 ° x 2 minutos C 94 ° x 1 minuto C 58 ° x 2 minutos C 72 ° x 2 minutos C 72 ° x 2 minutos C 1 ciclo
13

1 cicl o

25 ciclos

b. Segundo PCR (especie-especifico) Cebadores de PCR especie específico: P. falciparum rFAL1: 5´-TTAAACTGGTTTGGGAAAACCAAATATATT-3´ rFAL2: 5´-ACACAATGAACTCAATCATGACTACCCGTC-3´ P. vivax rVIV1: 5´-CGCTTCTAGCTTAATCCACATAACTGATAC-3´ rVIV2: 5´-ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA-3´ • • • • • • • • Añadir PCR mix agregar 25 µl Agregar 1 µl de MgCl Agregar 2 µl de rV1V1 Agregar 2 µl de rV1V2 Agregar 2 µl de rFAL1 Agregar 2 µl de rFAL2 Añadir 14 µl de H2O Añadir 2 µl de DNA amplificado en el primer PCR PROGRAMA N° de Ciclos Desnaturalización inicial Desnaturalización Alineamiento Extensión Extensión final 94 ° x 2 minutos C 94 ° x 30 segundos C 65 ° x 1 minutos C 72 ° x 1 minutos C 72 ° x 4 minutos C Final 1 ciclo 35 ciclos 1 cicl o

14

Los productos esperados son: • • Plasmodium falciparum: 205 pb Plasmodium vivax: 120 pb

15

Preparación de geles de Agarosa La electroforesis en geles de agarosa se realiza generalmente en cubetas horizontales, requiriendo de una fase móvil y la fase estacionaria. El polímero utilizado para el análisis electroforético de ácidos nucleícos de gran tamaño es la agarosa. La migración del ADN o ARN en un gel de agarosa sometido a un campo eléctrico depende del voltaje del campo, como del tamaño del poro del gel de agarosa. La separación efectiva de los fragmentos de ADN o ARN depende de la masa como de la carga de los distintos fragmentos, es decir, la relación carga/masa •

Gel de Agarosa al 2%

Pesar 1 g de agarosa en un papel de pesa, añadir 50 ml de TBE (1X) llevar a ebullición. Dejar enfriar la disolución en un baño de agua fría. Agregar 2.5 µl de bromuro de etidio (10ml/1 ml) y agitar. Verter la solución de agarosa en la cámara de electroforesis apropiada, sellando los extremos y colocar los peines. Dejar polimerizar, 20 minutos aproximadamente. Una vez polimerizado el gel, llenar la cámara electroforética con tampón 1X y quitar el peine con cuidado de no romper los pocillos. Llenar cada pocillo con 5 µl de muestra y 1 µl de buffer de corrida. Aplicar la fuente de corriente 75-85 V durante 30 min.

16

BIBLIOGRAFIA • A. Santamaria Salazar. Diagnóstico y caracterización molecular de las

infecciones por Plasmodium falciparum en la Comarca Kuna Yala. Panamá 20032004. • • • J. Botella, A. Espacio, L. Aguilella. Medicina para Montañeros. 2006

www.ctv.es/USERS/borobar/paludismo.htm PALUDISMO. ORGANIZACIÓN MUNDIAL DE LA SALUD. PCR en tiempo real para la detección e identificación de Plasmodium spp. Journal Clinical Microbiology. Volumen 43 (5), Mayo 2005.

17

You're Reading a Free Preview

Descarga
scribd
/*********** DO NOT ALTER ANYTHING BELOW THIS LINE ! ************/ var s_code=s.t();if(s_code)document.write(s_code)//-->