Está en la página 1de 44

1/2 A 1/2 A 1/2 a AA Aa

1/2 a Aa aa

Principios mendelianos y extensiones


Dr. Antonio Barbadilla

Razn genotpica 1/4 AA 1/2 Aa 1/4 aa

Razn fenotpica 3/4 A1/4 aa


1 Tema 3: Principios mendelianos y extensiones

Objetivos tema Principios mendelianos y extensiones


Debern quedar bien claros los siguientes puntos El mtodo experimental y la terminologa de Mendel Ilustrar los dos principios de la transmisin de los genes (la leyes de Mendel)
Cruce monohbrido y principio de la segregacin 1:1 Cruce dihbrido y principio de la transmisin independiente

La naturaleza probabilstica de los principios mendelianos Relaciones genotipo-fenotipo


La distincin entre dominancia incompleta, parcial y codominancia Alelismo mltiple Gen esencial y letal Pleiotropa Penetrancia y expresividad Interaccin entre genes
Dr. Antonio Barbadilla

Gentica bioqumica: la hiptesis un gen-una enzima


2

Tema 3: Principios mendelianos y extensiones

Los experimentos de Mendel demuestran que:


La herencia se transmite por elementos particulados (no herencia de las mezclas), y sigue normas estadsticas sencillas, resumidas en sus dos principios

Dr. Antonio Barbadilla

Tema 3: Principios mendelianos y extensiones

Monje austriaco Gregor Mendel (1822-1884)


Dr. Antonio Barbadilla

Jardn del monasterio agustino de Santo Toms de Brunn, actual repblica Checa, donde Mendel realiz sus experimentos de cruces con el guisante 4
4

Mendel Web: http://www.mendelweb.org/

Tema 3: Principios mendelianos y extensiones

Caractersticas del experimento de Mendel :


Eleccin de caracteres discretos, cualitativos (alto-bajo, verde-amarillo, rugoso-liso, ...) Cruces genticos de lneas puras (lnea verde x lnea amarilla) Anlisis cuantitativos de los fenotipos de la descendencia (proporcin de cada fenotipo en la descendencia)
Dr. Antonio Barbadilla

Tema 3: Principios mendelianos y extensiones

Flor de la planta del guisante, Pisum sativum estudiada por Mendel

Dr. Antonio Barbadilla

Tema 3: Principios mendelianos y extensiones

Dr. Antonio Barbadilla

Los siete caracteres estudiados por Mendel


7

Tema 3: Principios mendelianos y extensiones

Polinizacin cruzada

Autofecundacin

Dr. Antonio Barbadilla

Mtodo de cruzamiento empleado por Mendel


Tema 3: Principios mendelianos y extensiones

Resultados de todos los cruzamientos monohbridos de Mendel

Fenotipo parental 1. Semilla lisa x rugosa 2. Semilla amarilla x verde 3. Ptalos prpuras x blancos 4. Vaina hinchada x hendida 5. Vaina verde x amarilla 6. Flores axiales x terminales 7. Tallo largo x corto
Dr. Antonio Barbadilla

F1 Todas lisas Todas amarillas Todas prpuras Todas hinchadas Todas verdes Todas axiales Todos largos

F2 5474 lisas; 1850 rugosas 6022 amarillas; 2001 verdes 705 prpuras; 224 blancos 882 hinchadas; 299 hendidas 428 verdes; 152 amarillas 651 axiales; 207 terminales 787 largos; 277 cortos

Relacin F2 2,96:1 3,01:1 3,15:1 2,95:1 2,82:1 3,14:1 2,84 1

Tema 3: Principios mendelianos y extensiones

Interpretacin gentica del cruce monohbrido de Mendel

Dr. Antonio Barbadilla

10

10

Tema 3: Principios mendelianos y extensiones

Primera ley de Mendel:

Segregacin equitativa Los dos miembros de un par de alelos segregan en proporciones 1:1. La mitad de los gametos lleva un alelo y la otra mitad el otro alelo
Razn genotpica
1/2 A 1/2 A 1/2 a
Dr. Antonio Barbadilla

1/2 a Aa aa

AA Aa

1/4 AA 1/2 Aa 1/4 aa Razn fenotpica 3/4 A1/4 aa


Tema 3: Principios mendelianos y extensiones

11

11

Cruce dihbrido

Gen Color Y (amarillo) > y (verde) Gen textura semilla R (liso) > r (rugoso)

Dr. Antonio Barbadilla

12

12

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel: Cruce dihbrido

El cuadrado de Punnett ilustra los genotipos que dan lugar a las proporciones 9:3:3:1

Dr. Antonio Barbadilla

13

13

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel:

Transmisin independiente
Durante la formacin de los gametos la segregacin de alelos de un gen es independiente de la segregacin de los alelos en el otro gen

Dr. Antonio Barbadilla

14

14

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel:


1/4 AB 1/4 Ab 1/4 aB 1/4 ab 1/4 AB 1/4 Ab AABB AAbB AaBB AABb AaBB AAbb AabB AaBb aaBB AaBb Aabb aaBb

Razn genotpica AABB Aabb aaBB 1/16:1/16:1/16: aabb AaBb AABb 1/16:4/16:2/16: aaBb AaBB Aabb 2/16:2/16:2/16

1/4 aB 1/4 ab

AaBb

Aabb

aaBb

aabb

Dr. Antonio Barbadilla

15

Razn fenotpica 9/16 A-B- 3/16 A-bb 3/16 aaB- 1/16 aabb
Tema 3: Principios mendelianos y extensiones

15

Segunda ley de Mendel: Cruce trihbrido


P F1
ABC ABC ABc AbC Abc aBC aBc abC abc AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCc ABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbcc

AABBCC x aabbcc AaBbCc x AaBbCc


AbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCc Abc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc Aabbcc aBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCc aBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbcc abC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCc abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc

Dr. Antonio Barbadilla

16

16

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel: Cruce trihbrido


P F1
ABC ABC ABc AbC Abc aBC aBc abC abc AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCc ABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbcc

AABBCC x aabbcc AaBbCc x AaBbCc


AbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCc Abc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc Aabbcc aBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCc aBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbcc abC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCc abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc

Dr. Antonio Barbadilla

Razn fenotpica 9 9 9 3 3 3
17 1 Tema 3: Principios mendelianos y extensiones

27 17

Naturaleza probabilstica de las leyes Mendel:


Las leyes son probabilsticas deterministas Permiten predecir la probabilidad de los distintos genotipos y fenotipos que resultan de un cruce Permiten inferir el nmero de genes que influyen sobre un carcter
Dr. Antonio Barbadilla

(como si los

alelos de los genes se cogieran al azar de urnas),

no

18

18

Tema 3: Principios mendelianos y extensiones

Caracteres mendelianos en humanos:


Capacidad de sentir el sabor de la feniltiocarbamida Albinismo Tipo sanguneo Braquidactilia (dedos de manos y pies cortos) Hoyuelos de la mejilla Lbulos oreja sueltos o adosados Pecas en la cara Pulgar hiperlaxo Polidactilia OMIM - Online Mendelian Inheritance in Man
Dr. Antonio Barbadilla

http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM
19 Tema 3: Principios mendelianos y extensiones

19

Caracteres mendelianos
Albinismo

Dr. Antonio Barbadilla

20

20

Tema 3: Principios mendelianos y extensiones

Alelismo mltiple
Grupos AB0
A=B>0
Fenotipo ABAB 0 Genotipo AA A0 BB B0 AB 00

Color pelaje conejo C+ > Cch > Ch > c

C+ Salvaje

Cch Chinchilla

Ch Himalaya

c albino

Dr. Antonio Barbadilla

21

21

Tema 3: Principios mendelianos y extensiones

Alelismo mltiple
A nivel de secuencia nucleotdica prcticamente cada copia de un gen es diferente en algn nucletido de su secuencia. El alelismo mltiple es ubicuo.
BRCA2

Individual Individual Individual Individual Individual Individual Individual Individual Individual


Dr. Antonio Barbadilla

1 2 3 4 5 6 7 8 9

acgtagcatcgtatgcgttagacgggggggtagcaccagtacag acgtagcatcgtatgcgttagacggggtggtagcaccagtacag acgtagcatcgtatgcgttagacggcggggtagcaccagtacag acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag


22

22

Tema 3: Principios mendelianos y extensiones

Alelo A
Secuencia 11 Secuencia 22 Secuencia 33

Se usa la notacin AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad stos son internamente heterogneos en el nivel de DNA. Su asignacin como genotipo AA aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de los que pertenecen al genotipo aa y esta diferencia fenotpica se debe posiblemente a un (o a unos pocos) nucletido que sera el verdadero genotipo que causa los diferentes fenotipos

acgtagcatcgtatgcgttagacgggggggtagcaccagtacag acgtagcatcgtatgcgttagacggggtggtagcaccagtacag acgtagcatcgtatgcgttagacggcggggtagcaccagtacag

Alelo a
Secuencia Secuencia Secuencia Secuencia Secuencia Secuencia
23

Dr. Antonio Barbadilla

4 5 6 7 7 88 9

acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag acgtagcatcgtttgcgttagacggcatggcaccggcagtacag


23 Tema 3: Principios mendelianos y extensiones

Gen letal y esencial


Un gen que cuando est alterado es letal, es un gen esencial Gen y del ratn domstico es un ejemplo
Alelo y es dominante para el color amarillo, letal en homocigosis. Alteracin proporciones mendelianas de la F2 es 2:1

Dr. Antonio Barbadilla

24

24

Tema 3: Principios mendelianos y extensiones

Edad de aparicin de un fenotipo


Temprana Tarda

Aparicin tarda de la enfermedad de Huntington

Impronta parental
Ejemplo Factor crecimiento II tipo insulina (Igf2) en ratn. Mutante homocigoto -> enano. El fenotipo del heterocigoto depende del origen del alelo Dr. Antonio Barbadilla Alelo salvaje es paterno -> fenotipo salvaje Alelo salvaje es materno -> fenotipo enano
25
Tema 3: Principios mendelianos y extensiones

25

Relaciones genotipo-fenotipo

Ausencia de dominancia en el Dondiego de noche (Mirabilis jalapa)

P1

F1

F2

Dr. Antonio Barbadilla

26

26

Tema 3: Principios mendelianos y extensiones

Cruce dihbrido con ausencia de dominancia


1/4 A1B1 1/4 A1B2 1/4 A2B1 1/4 A2B2 1/4 A1B1 A1A1B1B1 1/4 A1B2 Razn genotpica ?

1/4 A2B1

1/4 A1B2

Dr. Antonio Barbadilla

Nmero fenotipos distintos? Razn fenotpica ?


27 Tema 3: Principios mendelianos y extensiones

27

Los nmero esperados de cruces mendelianos


Monohbrido Dihbrido Trihbrido Regla general n=1 Tipos de gametos en la F1 Proporcin de homocigotos recesivos en la F2 Nmero de fenotipos distintos de la F2 suponiendo dominancia completa Nmero de genotipos distintos de la F2 (o fenotipos si no hay dominancia) 2 1/4 2 n=2 4 1/16 4 n=3 8 1/64 8 n 2n ()n 2n

27

3n

Dr. Antonio Barbadilla

28

28

Tema 3: Principios mendelianos y extensiones

Relacin genotipo-fenotipo: Variacin en la dominancia

Dr. Antonio Barbadilla

29

29

Tema 3: Principios mendelianos y extensiones

Relacin genotipo-fenotipo: Codominancia


Presencia de ambos fenotipos paternos en el heterocigoto Grupo AB Heterocigoto protena detectada por electroforesis en hemoglobina

Dr. Antonio Barbadilla

30

30

Tema 3: Principios mendelianos y extensiones

Relacin genotipo-fenotipo: Niveles de dominancia

HbAHbA: Normal.

HbSHbS: Anemia grave.

HbAHbS: No anemia

Dr. Antonio Barbadilla

31

31

Tema 3: Principios mendelianos y extensiones

Relacin genotipo-fenotipo: Retinoblastoma hereditario

Dr. Antonio Barbadilla

R > r en el nivel celular pero r > R en el nivel del organismo


Tema 3: Principios mendelianos y extensiones

32

32

Pleiotropa
Ejemplo anemia falciforme
Cambio de un nucletido en el DNA del gen de la hemoglobina Rpida destruccin de los glbulos rojos Produccin de hemoglobina S en lugar de la A Baja concentracin de oxgeno en lo tejidos Agregacin de la hemoglobina S para formar estructuras casi cristalinas en aguja en los glbulos rojos Debilidad fsica Distorsin de los glbulos rojos, adquieren forma de hoz (falciforme) Fallo cardiaco Problemas circulatorios Acumulacin de clulas falciformes en el bazo

Anemia

Dao cerebral

Daos en otros rganos

Dao en el bazo

Parlisis

Funcin mental disminuida

Neumona

Reumatismo

Fallo renal

Dr. Antonio Barbadilla

33

33

Tema 3: Principios mendelianos y extensiones

Penetrancia y expresividad
Ambos conceptos se refieren a la expresin fenotpica variable de ciertos genes Penetrancia: Proporcin de individuos en una poblacin que presentan el fenotipo correspondiente a su genotipo. Si P < 1 se habla de penetrancia incompleta

Expresividad: El grado de expresin individual de un fenotipo para un genotipo dado

Dr. Antonio Barbadilla

34

34

Tema 3: Principios mendelianos y extensiones

Expresividad

Dr. Antonio Barbadilla

La polidactilia se manifiesta en grados distintos


35 Tema 3: Principios mendelianos y extensiones

35

Expresividad

Dr. Antonio Barbadilla

10 grados de expresividad variable en el carcter piel manchada en perros.


36 Tema 3: Principios mendelianos y extensiones

36

Caracteres determinados por ms de un gen

Dr. Antonio Barbadilla

37

37

Tema 3: Principios mendelianos y extensiones

Caracteres determinados por ms de un gen

Dr. Antonio Barbadilla

38

38

Tema 3: Principios mendelianos y extensiones

Interaccin entre genes:


dos o ms genes determinan el fenotipo de un modo que alteran las proporciones mendelianas esperadas

Dr. Antonio Barbadilla

39

39

Tema 3: Principios mendelianos y extensiones

Tipos de interaccin gentica segn la modificacin de las proporciones mendelianas 9 3 3 1 13:3 9:7 9:3:4 12:3:1 15:1 A-BA-bb aaB- aabb

Dr. Antonio Barbadilla

Mutacin supresora 13:3 Duplicacin gnica recesiva 9:7 Epistasia recesiva 9:3:4 Epistasia dominante 12:3:1 Duplicacin gnica dominante 15:1
40 Tema 3: Principios mendelianos y extensiones

40

Gentica bioqumica: estudio de la relacin entre genes y enzimas


Hiptesis un gen - una enzima (Beadle y Tatum 1941) -> Estudio de la ruta biosinttica de la niacina (vitamina B3 en el hongo del pan Neurospora crassa)

Dr. Antonio Barbadilla

41

41

Tema 3: Principios mendelianos y extensiones

Gentica bioqumica: muchos genes


cooperan en el producto final

Dr. Antonio Barbadilla

42

42

Tema 3: Principios mendelianos y extensiones

Explicacin bioqumica de la proporcin 9:7 en el color de la aleurona del maz


Precursor blanco Intermediario blanco Producto final prpura

Enzima A

Enzima B

Gen A

Gen B

Dr. Antonio Barbadilla

Para obtener el producto final prpura necesitamos que tanto el gen A como el B produzcan una enzima funcional. Si uno de los dos genes falla (genotipo aa bb), el producto final ser blanco 43
Tema 3: Principios mendelianos y extensiones

43

Gentica bioqumica:

Relacin concentracin enzima y producto final

Dr. Antonio Barbadilla

44

44

Tema 3: Principios mendelianos y extensiones