Está en la página 1de 145

Microbiota y

bioinformatica
M en C. Sánchez Tapia
Mónica Todd Curie
Microbiota
 Es un ecosistema abierto que comprende una amplia variedad de
poblaciones microbianas metabólicamente activas que coexisten en
una región espacio temporal definida y que juegan un papel en la
salud del huésped

 Es considerada como un órgano metabólico que, además es adaptable,


plástico y renovable

 Ecosistema complejo: > 1000 especies distintas. (1014 HMP)


 Incluye virus, bacterias, archeas, protozoarios y levaduras
Mricrobioma y metagenoma
 Microbioma:

Set de genes presentes por la


microbiota. Solo un grupo
en particular

 Metagenoma: Secuenciar el
ADN experimentalmente de
toda la comunidad
bacteriana
Localización
 Microbiota del:
 Intestino
 Piel
 Tracto urogenital
 Cavidad oral

The Human Microbiome Project Consortium


Nature vol 486,2012
Clasificación

• Determinada región y edad


• Microorganismos “constantes”
Residente

• Apatógenos o potencialmente patógenos


• Por horas, días o semanas (piel o mucosas)
Transitoria

• Probióticos
Turista
CUANTAS BACTERIAS Y GENES TIENE LA
MICROBIOTA
 10 Trillones de
microorganismos
 1000 especies bacterianas
 100 veces mas genes que el
genoma humano
 Se le considera como otro
organo debido a su impacto
sobre la salud.
 La microbiota pesa aprox 2 Kg
 Se le considera como una
tarjeta de identidad individual. 20-25000 genes humanos
vs 3.3 millones genes bacterianos
Microbiota Intestinal
Microbiota Intestinal

 La mayoría de la microbiota  Los Firmicutes y


del intestino pertenece a Bacteroidetes
uno de los siete principales constitutyen el 90% de
tipos reinos (phylas) de la microbiota intestinal
microorganismos, que son:
humana.
 Firmicutes
 Bacteroidetes
 Proteobacteria
 Fusobacteria
 Verrucomicrobia
 Cyanobacteria
 Actinobacteria
Microbiota Intestinal
Taxonomía y filogenia

Taxonomía Filogenia

Identificación Historia evolutiva de


Clasificación los microorganismos
Nomenclatura

Clasificación que refleja la


Clasificación
historia evolutiva de los
filogenética
microorganismos

Basada en
comparación de
secuencias de
RNA 16s Genomas

Grupos de
genes
Taxonomía y filogenia
Categorías taxonómicas
Categorías taxonómicas
Clasificación
C. filogenética
Bacteroidetes
 Alrededor de 20 géneros bacterianos

Phylum Class Order Genus

Bacteroidetes Bacteroidales Bacteroides

Bacteroidetes Flavobacteria

Sphingobacteria
Firmicutes
 Agrupa mas de 250 géneros
 Gram positivos
 Bajo contenido G + C
 Bacilos y cocos

Bacillales

Bacillus

Lactobacillales

Firmicutes
Clostridium Clostridiales

Erysipelotrichi

Phylum Class Order


Firmicutes

Class Order Genus Species


Tenericutes
 Gram negativas
 Células delimitadas por una membrana plasmática
 Carecen de pared celular
Phylum Class Genus

Mycloplasma

Spiroplasma

Tenericutes Mollicutes

Ureaplasma

Phytoplasma
Actinobacteria
 Gram positivas
 Alto contenido en G+C
 Muchas se han aislado del suelo
 Aumentan con el consumo de fibra

Actinomycea Micrococcus Arthobacter Corynebacterium

Mycobacterium Nocardia Propionibacterium Streptomyces

Frankia Actinoplanes Thermomonospora Bifidobacterium


Proteobacteria
 Amplia variedad de patogenos
 Gram negativas
 Poseen membrana externa y LPS
 Existen 6 clases: α, β, γ, δ, ε y ζ
Proteobacteria
Verrucomicrobia
 Son un Phylum reciente
 Gram negativas (mayoritariamente)
 Cococidales o en forma de barra con protuberancias
(“verrugas”)
 Aerobios estrictos o facultativos
 Termolifos-psicrofilos
 Acidofilos

Akkermancia muciniphila

Spartobacteria

Verrucomicrobia Opuntutae

Verrucomicrobiae

Phylum Class
Funciones
Funciones de la microbiota
• Síntesis de vitaminas

Metabólicas Producción de energía



• Fermentación de CHOS complejos
• Absorción de SCFAs

Tróficas • Diferenciación de las células epiteliales

• Barrera física para patógenos


Protección • Efectos antimicrobiales
• Estimulación del sistema inmune
Metabólicas
Metabolitos

Primarios Secundarios
• Lípidos • Carotenos
• Carbohidratos • Fenoles
• Aminoácidos • Organosulforados

Microbioma

Biotransformación C. bioactivos

• Síntesis de vitaminas
• Producción de energía
• Fermentación de CHOS complejos
• Absorción de SCFAs
Tróficas
Tróficas
Protección
Protección
Protección
 Teoría de la higiene
 Inmunidad innata
Microbiota y enfermedad

De Vos & De Vos, 2012. nutrition Reviewa 70 (S.):S45-S56


Microbiota y obesidad

Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Obesity alters gut
microbial ecology. Proc Natl Acad Sci USA 2005; 102: 11070-5.
Microbiota y obesidad

Ley RE, Turnbaugh PJ, Klein K, Gordon JI. Human gut microbes associated
with obesity. Nature 2006; 444: 21- 8.
Germ-free animals

 Función digestiva
 Inmunidad (mucosa/sistemica)
 Motilidad
 Respuesta al stress

 Ingesta calórica

GF
Mecanismos
Microbiota y obesidad
 Obtención de energía

 Regulación de niveles y tipo de ácidos biliares

 Participaciónen el sistema endocabinoide


produciendo adipogénesis

 Producción de acetato afecta la saciedad y los niveles


de glucosa estimulando la secreción de insulina
Mecanismos
Obtención de energía
 Ratones obesos: bajos
bacteriodetes y altos firmicutes

 Ratones obesos mostraban


incrementado el metabolismo de
almidón, galactosa y butanoato

 Se adquiere el fenotipo de la
microbiota transplantada

 Perdida de peso en humanos


demostró incrementar el radio
Bacteroides/Firmicutes
Mecanismos
Regulación de niveles y tipo de ácidos
biliares

Cell metabolism 17, 225-235, February 5, 2013


Mecanismos

Sistema eCB y adipogenesis


Mecanismos

Saciedad y secreción de insulina


 Microbiota genera acetato
 Acetato incrementa la estimulación parasimpática en el
cerebro
 Señales viajan por el vago estimulando la secreción de
grelina y potencia la secreción de insulina
Mecanismos
Microbiota y obesidad

Dieta alta en grasa


y azúcar

Firmicutes

Bacteroidetes
Secreción de
insulina Disbiosis Ácidos biliares

SCFA CHO´S
Adipogenesis

Ingesta Energía Acumulación de


mayor Obesidad
adicional grasa
SCFA
 Fuente de energía
 Mucosa: Estimula la proliferación y promueve la
absorción de sodio y agua
 Musculo, corazón y cerebro: Acetato
 Propianato: Gluconogenesis

 Regula la expresión de genes via ICAM-1 en


células endoteliales
 Baja la expresión de COX-2 (butirato y acetato)
 Promueve la secreción de leptina
Obesidad y microbiota
Permeabilidad intestinal

Estado crónico de inflamación

Riesgo Desordenes
cardiovascular Metabólicos
Enfermedades
Desordenes - Obesidad
gastroitestinales
neurológicos - Diabetes
- SM

- Parkinson
- Alzheimer
Microbiota y fisiología
Factores que afectan la microbiota
intestinal
Huésped

Factores
Fármacos microbianos

Interacciones
Dieta microbianas
Estudio de la microbiota

Secuenciación
masiva
Microarreglos

qPCR

Cultivos
microbianos
Estudio de la microbiota

Karlsson F et al. Diabetes 2013;62:3341-3349


Que información nos dan los microbios en
el intestino
Cultivo de microorganismos
• Fenotipo
• Secuenciamiento del DNA
• Solamente el 30% de las Microbiota
bacterias son cultivables • Comunidad microbiana
que habita un medio
ambiente específico
Metatranscriptoma
• Analisis de la act. Microbiona heces
• Por medio del analisis de la
• Expresión de genes

Microbioma
Metagenoma • Contenido de todos
• Combinación de genomas de los genes
• Los trillones de (genoma)de una
• Microbios y genes del huesped microbiota
“Omicas” estudio del intestino
Metagenómica y microbiota
 Composición: 16S rRNA gen. Identificar especies
 Función: Shotgun. Expresión de genes
Gen 16S
o Regiones altamente conservadas en las especies bacterianas

o Regiones variables para la filogenia y taxonomía bacteriana


(Para microbiota intestinal se reportan de V1 a V5)

Aproximadamente
550 pb

Tomado y modificado de Karlsson F et al. Diabetes 2013;62:3341-3349


Secuenciación masiva (Plataformas
y estrategias)

Pirosecuenciación Por sintesis


Usa nucleótidos terminadores marcados
Se va adicionando base por base en
cada pocito y al acoplarse una base se con fluoroforos. Paralelizacion masiva
600 pb
emite luz.
400 pb

Primers
Shotgun Microbioma
degenerados
Estrategias

Amplicones Gen 16S Bacterioma


Pirosecuenciación
Secuenciación por síntesis
Pasos para hacer secuenciación en por
sintesis (MiSeq)
 Obtención de DNA de heces de buena calidad

 Generación de amplicon adicionando adaptadores A y B

 Purificación y verificación del producto de PCR

 Indexado de las muestras (etiquetas moleculares)y adición de adaptadores

 Purificación y verificación del producto de PCR

 Cuantificación de DNA de doble cadena

 Pool equimolar de la libreria

 Colocar la librería flow cell


Extracción DNA
Obtención de DNA de heces de
buena calidad
 Qiamp Mini Stool (Qiagen)
 Verificar que las relaciones 260/280 y 260/2 30
estén alrededor de 2
 Gel de integridad
Librerías
Generación del amplicon (v3 a v4)
Reactivo V (µL)
DNA genómico (5 ng/µL en 2.5
10mM Tris pH=8.5)
Primer Forward (1µM) 5
Primer Reverse (1µM) 5
Kapa HiFi HotStart Ready 12.5
˜550pb Mix
Volumen total 25
Librerías

Purificación y verificación del producto de PCR


 Uso de perlas magnéticas (Ampure)

 Electroforesis capilar (Bioanalizador)


Librerías

Indexado de las muestras (Nextera XT) y


adición de adaptadores (2° PCR)

609 pb

Reactivo V (µL) por muestra


Amplicon purificado 5
Nextera XT Index Primer 1 (N7xx) 5
Nextera XT Index Primer 2 (S5xx) 5
Kapa HiFi HotStart Ready Mix 25
H2O Grado PCR 10
Volumen total 50
Normalización
Cuantificación de DNA de doble
cadena
 Quibit 3.0 (fluorometro). Kit dsDNA High
Sensitivity
 Dilución amplicon 1:10
Pool equimolar

Pool equimolar
 Calcular molaridad en base a Qiubit
  𝑛𝑔
𝑛𝑀 = [ 𝐶( )
]
𝜇 𝐿 𝑄𝑖𝑢𝑏𝑖𝑡
𝑝𝑏 ∗ 660
∗10
6

 Diluir a 10nM cada muestra y recuantificar


 Hacer pool (3µL por muestra) considerando la
recuantificación. Verificar molaridad
 Diluir a 4nM y recuantificar

Nota: Cuando no todas las muestras quedan a 10nM se


considera la C para adicionar la misma cantidad de moléculas
de DNA
Secuenciación
Cada punto es la imagen producida por
uno de los clusters
Secuenciación

Base space
 Nube electrónica que te
permite ver en tiempo real
el progreso de la corrida

 Almacena los datos


generados (fastq)

 Herramnientas de análisis
preliminar
(16sMetagenomics)
Secuenciación

Pool equimolar de Análisis de la diversidad


todas las muestras (Bioinformatica)
con sus respectivos Mezcla de amplicones y
Index secuenciación
Identificar índices (index) Agrupar secuencias base de datos para
para ubicar muestras similares en OTUS identificar OTUS
>GCACCTGAGGACAGGCATGAGGAA… >GCACCTGAGGACAGGCATGAGGAA…
>GCACCTGAGGACAGGGGAGGAGGA… >GCACCTGAGGACAGGGGAGGAGGA…
>TCACATGAACCTAGGCAGGACGAA… >TCACATGAACCTAGGCAGGACGAA…
>CTACCGGAGGACAGGCATGAGGAT…
>TCACATGAACCTAGGCAGGAGGAA… >CTACCGGAGGACAGGCATGAGGAT…
>GCACCTGAGGACACGCAGGACGAC… >TCACATGAACCTAGGCAGGAGGAA…
>CTACCGGAGGACAGGCAGGAGGAA… >GCACCTGAGGACACGCAGGACGAC…
>CTACCGGAGGACAGGCAGGAGGAA… Abundancia
>CTACCGGAGGACACACAGGAGGAA… Filogenia
>GAACCTTCACATAGGCAGGAGGAT… relativa de
>CTACCGGAGGACACACAGGAGGAA… de OTUS
>TCACATGAACCTAGGGGCAAGGAA…
>GAACCTTCACATAGGCAGGAGGAT…
OTUS dentro
>GCACCTGAGGACAGGCAGGAGGAA…
de la
>TCACATGAACCTAGGGGCAAGGAA… comunidad
>GCACCTGAGGACAGGCAGGAGGAA…
Bioinformatica

Comienza en los años 50’s sin embargo con el aumento


de datos obtenidos en el campo biológico se volvió
indispensable el uso de la informática

BIOLOGÍA + COMPUTACIÓN = BIOINFORMÁTICA

Jonathan D. Wren. Bioinformatics programs are 31-fold over-represented among the highest impact
scientific papers of the past to decades, 2016
Aplicaciòn
Para el análisis de las secuencias obtenidas se utilizan
diferentes “pipelines”

Programas que unen a otros programas y algoritmos para que el


usuario no tenga que descargar e instalar cada uno por separado
Pipelines

• mothur*  www.mothur.org/
• QIIME*  www.qiime.org/
• WATERS  https://code.google.com/p/waters16s/
• RDPipeline  https://rdp.cme.msu.edu
• VAMPS  https://vamps.mbl.edu
• Genboree  http://www.genboree.org/site/
• SnoWMan  https://snowman.genome.tugraz.at/snowman/
Pipelines

• Universidad de Michigan
• Los autores reescribieron herramientas y
algorítmos específicos de programas para
optimizar el software que se incluye en el
paquete
• Funciona con diferentes sistemas operativos:
Mac OSX, Windows o LInux
• Se descarga un solo archivo para su instalación
Pipelines

• Sus creadores combinaron herramientas y


algoritmos originales directamente en la
“pipeline”
• Funciona con diferentes sistemas operativos:
Mac OSX, Windows o Linux
• Se descarga un solo archivo para su instalación
Pipelines

• Universidad de California, Davis


• Fue desarrollado con el principal objetivo de
expandir el análisis de la secuenciación masiva
para aquellos que no son informáticos
• Funciona con Mac OS X 10.5 y 10.6 únicamente
Pipelines

• Universidad del Estado de Michigan


• Fue creado para datos de secuenciaciones que son
muy grandes
• Dos versiones: una que puedes utilizar a través de
internet y otra que se descarga
• Fungioma
Pipelines

• Woods Hole, Massachusetts


• Fue diseñado para permitir a los ecologistas y
clínicos pudieran analizar de manera fácil los
datos obtenidos de la secuenciación. Utilizando
una interface sencilla “point and click”
• Basada en internet
Pipelines

• Houston, TX
• Creado para aquellos que tienen un
antecedente bioinformático
• Basado en internet
Pipelines

• Universidad de Graz, Austria


• Análisis básico y sencillo, utilizando una
interface sencilla
• Basada en internet
Pipelines

Plataforma MiSeq + QIIME  combinación de


ambos es un método que ha ganado popularidad
para el análisis de comunidades microbionas
QIIME

• Quantitative Insights Into Microbial Ecology


QIIME
• Greg Caporaso
• Northern Arizona University
• “Pipeline” gratis
• Tiene varios análisis de diversidad, métodos
estadísticos, herramientas para la visualización y
presentación de los datos obtenidos
• Línea de comandos
• Lenguaje de programación “Python”
QIIME
Se basa y utiliza muchos otros programas y algoritmos

• Ventaja: se preserva la integridad de estos, no hay duda


que la herramienta que se está utilizando es la diseñada,
creada y probada por los autores originales

Los usuarios de QIIME pueden estar seguros que están


utilizando las herramientas más actualizadas
Es importante citar cada uno de los algoritmos y base
de datos que se estén utilizando
Instalacion
• Terminal

Requerimientos no instalados en QIIME


– XQuartz
– R
– BLAST (Basic Local Alignment Search Tool)
– USEARCH
– AmpliconNoise
– Topiary Explorer
– Cytoscape
Analisis
UPSTREAM DOWNSTREAM
 Unir 2 lecturas  FiltrarOTUs (singletons)
 Control de calidad  Alpha diversidad
 Beta diversidad
(Phred)
 Chimera check  Resumen taxonomía
 Boxplots de distancias
 Escoger OTUs
 Comparación alpha
 Secuencia
diversidad
representativa  Jackknifed beta diversidad
 Asignar taxonomía
 Árbol (boostrapped)
 Hacer tabla OTU  Comparación categorías
 Alinear secuencias  OTU Network
 Árbol filogenético  OTU Heatmap
UPSTREAM
Upstream
Archivos .fastq
Archivo txt donde se encuentran
la secuencias (nucleótidos) y su
respectivo score de calidad
Desarrollado por Wellcome
Trust Sanger Institute
Upstream
Archivos .fastq

• @ Identificador del instrumento


• Identificación de la muestra American Standard Code for
• Secuencia de letras Information Interchange

• Valores de calidad (Phred Quality Score) ! Más bajo ~ Más alto


Upstream
Join paired ends

Método
fastq-join Archivo con ambas
SeqPrep lecturas unidas
Secuencia
nucleóticos + score
R1
de calidad

R2
Upstream
Split libraries fastq (multiple)
Un solo archivo (sólo las
-i lecturas unidas
-p parameter file (requisitos script original) secuencias)
-q Phred quality score Seqs.fna
--demultiplexing methdod
Upstream
OTU picking
OPERATIONAL TAXONOMIC UNIT
Distinción microbiológica de especies. Se utiliza un
porcentaje de similitud para clasificar a las bacterias en
“iguales” o “diferentes” OTUs. Son clusters de lecturas que
son similares en un 97%
Upstream
Chimera Check
• Durante el proceso de PCR se pueden generar
secuencias que son artefactos y no son parte de
nuestra secuencia de interés.
• QIIME, tres métodos para detectar chimeras
• Blast fragments (BLAST)
• ChimeraSlayer (BLAST)
• Usearch (uchime)
Upstream
OTU picking
-i secuencias
-m: sortmerna, mothur, trie, uclust_ref. 11 procedimientos
usearch, usearch_ref, blast, usearch61, 27 outputs
usearch61_ref, sumaclust, swarm, prefix:_suffix, * seqs_otus.txt
sdhit, uclust
-b –f base de datos de referencia (chimeras)

OTUs
Upstream
Escoger secuencia representativa
-i seqs_otus.txt
-f seqs.fna
-m random, longest, most_abundant, first rep_set.fna
Asignar Taxonomía
-i rep_set.fna
-m: rdp, blast, rtax, mothur, uclust, 2 archivos
sortmerna * rep_set_tax_assignments.txt
-c 0.80 (recomendado)
Base: Green Genes

OTUs Taxonomía
Upstream
Hacer OTU table*
-i seqs_otus.txt
otu_table.biom
-t rep_set_tax_assingments.txt
Facilita el manejo
de grandes bases
Biological de datos
Observation
Matrix

biom convert otu_table.txt


Upstream
Alinear secuencias
-i rep_set.fna
-m, Infernal, clustalw, muscle, mafft aligned_seqs.fna
Base: Green Genes
Upstream
Árbol filogenético*
-i filtered_seqs.fasta
-m FastTree, clearcut, clustalw, raxml, muscle rep_se.tre (FigTree)
DOWNSTREAM
Downstream
Tabla OTU
Sin filtro de calidad Filtro de calidad

OTU table
Filtered OTU table

Samples: 16 Samples: 16
OTUs: 2096 OTUs: 849
Total count: 472480 Total count: 459616
Counts Counts
Rarefaction Level
Min: 4038 Min: 3778* Depth
Max: 58702 Max: 57392
Med: 26384 Med: 25565
Mean: 29530 Mean: 28726
SD: 19125 SD: 18695
Downstream
Mapping File (.txt)
Downstream
Scripts QIIME

• Comandos
• Logaritmos
• Varias opciones
• Llegar al mismo
resultado
Downstream
Análisis de Diversidad

• alpha_rarefaction.py
• beta_diversity_through_plots.py
• summarize_taxa_through_plots.py
• make_distance_boxplots.py
• compare_alpha_diversity.py
• group_significance.py
Downstream
Biodiversidad
 Alfa diversidad
 Beta diversidad
 Gama diversidad
Downstream

Alfa diversidad

Especies
observadas

Índice Shannon

Diversidad
filogenética
Downstream
Alfa diversidad
Especies observadas

Número de especies = Números de OTUs

Especies observadas Especies observadas


N= 100 N= 100

OTU  Operational Taxonomic Unit


 97% de similitud
Downstream
Alfa diversidad
Índice Shannon
Número de especies + Abundancia de cada especie

Especies observadas Especies observadas


N= 100 N= 100

99 de ellas prop. = 0.005


100 de ellas prop. = 0.01
1 de ellas prop. = 0.505
H = 4.60517
H = 2.967682
Downstream
Alfa diversidad
Diversidad Filogenética
Método para cuantificar la diversidad entre especie tomando en cuenta
la relación evolutiva entre ellas

Vellend M, et al. Measuring phylogenetic biodiversity,


Downstream
Alpha diversidad
• Requerido: árbol filogenético

• Estimadores: num de OTUs,


Chao1, Shannon, PD distance
Downstream
Alpha rarefaction diversity

• Genera OTU tables (rarefaction)


• Calcula alpha diversidad de cada tabla deOTU
• Genera gráficas de rarefacción
Downstream
compare_alpha_diversity.py
Downstream
Beta diversidad
Distancias UniFrac

Distancias UniFrac  Unique Fraction Metric

N= 10 OTUs

Todos OTUs
compartidos entre
muestras
Unifrac distance
=O
Downstream
Beta diversidad
Distancias UniFrac

Distancias UniFrac  Unique Fraction Metric

N= 10 OTUs

5 OTUs en una
muestra
5 OTUs en una
muestra
Unifrac distance = 1
Downstream
Beta diversidad
Distancias UniFrac
Distancias UniFrac  Unique Fraction Metric

N= 10 OTUs

Mitad de los OTUs


compartidos
Unifrac distance =
0.05
Downstream
Beta diversiad
Distancias UniFrac

Similitud entre cada grupo

Diferencia entre grupos

Ziętak M, et al. Altered microbiota contributes to reduced diet-induced obesity upon cold exposure. 2016
Downstream
Beta diversidad
Unweighted Weighted
Presencia - ausencia Presencia – ausencia
+
abundancia
Downstream
Unweighted

Weighted
Downstream

Comparar categorías (beta diversidad)


• Significacia estadística: utilizando las matrices
de distancias

• adonis*
• ANOSIM*
• BIOS-ENV
• Moran’s I
• MRPP
• PERMANOVA*
• PERNDISP
• db-RDA
Downstream
Adonis
Método no paramétrico, es muy similar a PERMANOVA.
Más robusto, acepta variables categóricas o continuas
* Tratamiento
Downstream
ANOSIM
Método no paramétrico
Signifiancia determinada por permutaciones
Comparación de variables categóricas
Downstream
PERMANOVA

Método no parámetrico, basado en permutaciones


Muy similar a adonis
Sólo acepta variables categóricas
Basado en ANOVA
Downstream
Remuestreo “Jacknifed”
• Estimar la precisión de las muestras mediante el uso
de subconjuntos de datos disponibles

• Asegurar que nuestras muestras se siguen comportando


de la misma manera
Unweighted
Downstream

Weighted
Downstream
Downstream
Taxonomía
Reino Bacteria

Filo Firmicutes

Clase Bacilli

Orden Lactobacillales

Familia Lactobacillaceae

Género Lactobacillus

Especie casei
Ejemplos

atcheva-Datchary P, et al. Dietary fiber-induced improvement in glucose metabolism is associated with increased abundance of Prevotella. 2015
ng-Ah K, et al. Gut microbiota lipopolysaccharide accelerates inflamm-aging in mice. 2016
Downstream
Árbol filogenético

Rojo: 75-100%
Amarillo: 50-75%
Verde: 25-50%
Azul: <25%
Downstream
OTU Network

• Hace un OTU network


• Visualización de las muestras y OTUs
• Archivos necesarios
• Cytoscape
Downstream
Downstream
Ros eburia faecis

Prev otella copri

Fae callibacterium praus nitz ii

Bac teroides plebeius

Ruminococcus gnavus

Bac teroides ac idifac iens

Mucis pirillum s chaedleri

Ruminococcus bromii

Bac teroides uniformis

Akkermans ia muc iniphila

Control HF HFAC HFL HFH


Shotgun metagenomic sequencing

• Es un método de secuenciación
relativamente nuevo y poderoso:
biodiversidad y función
• ¿Quién está ahí?
• ¿Qué es lo que realizan?
QIIME en el análisis shotgun
sequencing
• Aún está en fase de experimentación
• Utilizarse con precuación
• Recomienda el método “blast” (BLAST-like
alignment tool)
• También es soportado en “usearch”
• Bases de datos:
• IMG: Integrated Microbial Genomes
• KEGG: Kyoto Encyclppedia of Genes and Genomes
• M5nr: M5 non-redundant protein database
Perspectivas en salud de la microbiota
 Diagnostico: predicción del riesgo de enfermedad
 Terapéutica: Tratamuientos a base de alimentos funcionales,
probioticos y prebioticos
 Tratamiento basado en productos microbianos
Factores asociados a la obesidad y
sus consecuencias
Daño
Estrés oxidativo Cognocitivo
Alzheimer
inflamación

Inflexibilidad
metabólica
Intolerancia a la glucosa
obesidad Resistencia a la insulina
Cambios en la
Expresión de genes
Esteatosis hepática
UNO DE CADA DOS MEXICANOS >20 AÑOS
PRESENTA SINDROME METABOLICO
GENOTIPO SENSIBLE
DIETA ALTA EN
INACTIVIDAD
HIDRATOS DE OBESIDAD
CARBONO Y GRASA DIABETES
IMC>30
TIPO 2
TRIGLICERIDO GLUCOSA
S
>100 mg/dl
> 150 mg/dl

SINDROME
METABOLIC
O
COLESTERO ENFERMEDAD
L HDL
<40 mg/dl H HIPERTENSION
CARDIO
<50 mg/dl M 130/85 mmHg
VASCULAR

RESISTENCI
A A LA
INSULINA
Estrategias dietarias para el control
de la obesidad
Consumo de antioxidantes
polifenoles flavonoides licopeno antocianinas

Consumo de prebioticos

Dietasbasadas en
alimentos de origen vegetal

Fibra soluble

Alimentos funcionales

Alimentos con indice glucémico bajo


ALIMENTOS FUNCIONALES,
SINDROME METABOLICO Y
MICROBIOTA
 ¿Sepuede desarrollar una PREBIOTICOS
estrategia dietaria con CHIA SOYA NOPAL AVENA INULINA

alimentos funcionales y
prebioticos para combatir
HO
O HO O
OH OH beta glucanos fructanos
OH O

o controlar el grave
OH OH
ac grasos w 3 isoflavonas
+ polifenoles
+
aminoácidos pectina

problema de obesidad en
+
mucilago

la población mexicana? insulina

SREBP-1
PPARa SREBP-1 LXR
citoplasma FACTORES DE TRANSCRIPCION
núcleo
DNA
gen

ADN
LIPOGENESIS, STRESS OXIDATIVO
OXIDACION DE ACIDOS GRASOS

DRA NIMBE TORRES YTORRES


Alimento Funcional
 Son aquellos que en forma natural o procesada además de sus
componentes nutritivos contienen compuestos bioactivos, los cuales se
encuentran en pequeñas cantidades y tienen una función benéfica dentro
del organismo

 Se consume como parte de un patrón de alimentación normal.

 Vit C (nutrimento esencial) vs


Soya (alimento funcional)
Algunos alimentos funcionales

Avena Semilla de Chia Soya

Inulina Nopal
Beneficios de los alimentos funcionales
BENEFICIOS DESAFIO

• Mantenimiento de la salud Ciencias de la Tecnología de


nutrición alimentos
• Función inmune
• Salud gastrointestinal
(microbiota)
Ciencias de la
• Salud mental salud
• Salud en el envejecimiento
• Rendimiento físico
Desarrollo de
• Reducción de obesidad productos
alimenticios
• Reducción de enfermedades
relacionadas con la Beneficio para el
alimentación consumidor
Probioticos
 Sonbacterias vivas y levaduras que son buenos
para su salud, especialmente su sistema digestivo.
Solemos pensar de bacterias como algo que causa
enfermedades
Prebioticos
 Un prebiótico se define como un carbohidrato
fermentado selectivamente que permite cambios
específicos, tanto en la composición y / o actividad en la
microbiota gastrointestinal y que confieren beneficios
salud
LA DIETA MODULA LA MICROBIOTA

CONTROL HFD
MICROBIOTA Y DIABETES

DT 2 SANOS

A dietary intervention with functional foods reduces metabolic endotoxaemia and attenuates biochemical abnormalities by modifying faecal
microbiota in people with type 2 diabetes. Medina-Vera I, Sanchez-Tapia M, Noriega-López L, Granados-Portillo O, Guevara-Cruz M, Flores-
López A, Avila-Nava A, Fernández ML, TovarAR, Torres N. Diabetes Metab. 2018 Sep 25.
“Todas las enfermedades tienen
su origen en el intestino"

"Que tu alimento sea tu


medicina, y que tu medicina
sea tu alimento"

También podría gustarte