Está en la página 1de 81

Marcadores Moleculares

1) Marcadores genéticos
2) Categorías de preguntas
3) Desde aloenzimas a NGS
Marcador genético  Un carácter de un individuo que se
transmite a su descendencia… por lo tanto, permite
diferenciar entre individuos/población/taxa

- Difieren en la cantidad de variabilidad que ilustran


. Ajustar el tipo de marcador a cada problema y su escala
espacial.

- Tipos de marcadores: codominantes (patrones de bandas


distinguibles en homocigotos y en heterocigotos), dominantes.

- Los marcadores difieren en el tipo de herencia:


. ADN nuclear  biparental
. ADN citoplásmico (mtDNA; cpDNA)  uniparental.
Categorías de preguntas

1 Individuos: parentesco, endogamia, consanguinidad

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura,


filogeografía

4 C
A
B
B
A

Entre especies: filogeografía/filogenia


C
D
D
Cromosoma
DNA Individuo

Alelo a un
locus

Población

Especie
Marcadores Bioquímicos

Alozimas: Formas alternativas de una enzima que difieren en la


secuencia de sus aminoácidos, Se reconoce por electroforesis o alguna
propiedad

Marcador Codominante

. Permite indentificar distintos alelos de proteínas (enzimas)


en base a su tasa de migración en un gel de almidón

. Cálculo de frecuencias génicas

. Utilizadas para comparar poblaciones


Preparación y corrida del gel

Inoculación de las muestras


previamente preparadas que
contienen el universo total de
proteínas presentes en un tejido
Corrida electroforética

Las distintas proteínas migran según:


. Su carga neta
. Su peso molecular

Corte y tinción específica del gel

Análisis: Distintos paquetes computacionales


(Biosys, Genepop, Popgene, Arlequin, Genetix, etc)
Locus: ESTERASA

DIVERSIDAD GENÉTICA:

Número de alelos
Frecuencia de cada alelo
Heterocigocidad
Locus: ESTERASA

A1
A2

DIVERSIDAD GENÉTICA:
Número de alelos  2
Frecuencia de cada alelo
A1: 24/50 A2: 26/50

Heterocigocidad 12/25
Proteína dimérica

L1

L2

Proteínas monoméricas conformada


por dos loci
Categorías de preguntas

1 Individuos: parentesco, endogamia, consanguinidad

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura,


filogeografía
¿Una técnica
del pasado?

Ventajas:
• Relativamente sencilla e implementable
¿Una técnica
del pasado?

Desventajas:
• Proteínas fácilmente se denaturan (mantenerlas a –70°C)
• Menor grado de variación que la secuencia de DNA
• A pesar de ser genes funcionales se asume su “Neutralidad”
• Muchas mutaciones pueden pasar inadvertidas (código genético
degenerado o Aa con igual carga y tamaño)
Marcadores Moleculares
Marcadores genéticos basados en la secuencia del
ADN, permiten detectar varición genética.
Marcadores Moleculares
Ventajas:

- Muestras fijadas en alcohol (Nitrógeno liquido, -80°C)

- Distintos tipos de muestras/muestreos


COLECTAS DE ORGANISMOS ACUÁTICOS

BAHAMAS

Antarctica
COLECTAS DE ORGANISMOS NO ACUÁTICOS
TECNICAS DE MUESTREO

• MUY invasivo (= muerto)

• Invasivo (= sangre, biopsias, trocitos de tejidos)

• No invasivo
MUESTREO MUY INVASIVO
MUESTREO NO MUY INVASIVO
MUESTREO CASI NO INVASIVO
* Cotones de algodón comercial, esterilizadas mediante autoclave.
TECNICAS DE MUESTREO NO INVASIVO

• Muestra de museo
• Carcasas
• Pelos
• Plumas
• Cáscara de huevo
• Fecas
¡Confirmar especie!
Contaminación
COLECTAS BOTÁNICAS

Material para Sílica gel


extracción o
de ADN Secar rápido

Material para
extracción Conservar
de ARN- en frío -N2
Proteinas líquido
¡Por fin en el laboratorio!

http://lem.dm.cl
Preparación de DNA

Las metodologías de extracción de DNA buscan:

• Maximizar la recuperación de DNA


• Remover inhibidores
• Remover e inhibir las nucleasas
• Maximizar la calidad del DNA obtenido

Cuanto DNA se puede obtener:

• Célula diploide humana 6pg de DNA


• Espermatozoides contienen 3pg de DNA
Preparación de ADN
Química • SDS, sarcosyl
• CTAB

• Proteinasa K
Lisis celular Enzimática • Lisozimas

• Frío
Mecánica • Sonicación
• Molienda

Solventes • Fenol
• Cloroformo
orgánicos
• Cloruro de sodio
Salt • Acetato de Sodio
Remoción de proteínas
Unión al ADN • Membrana

Precipitación Alcoholes • Ethanol


• Iso-propanol

ADN PCR
Métodos basados en PCR
Polymerase Chain Reaction

Problema:
¿como conseguir suficientes copias de un gen para
poder manipularlo y observarlo?
PCR: Reacción en Cadena de la Polimerasa.
Reacción de extención de partidores
(cebadores, primers) utilizada para amplificar
regiones específicas del ADN.

95ºC 95ºC 72ºC 72ºC


5’ 30’’ 1’ 4’

50-65ºC
45’’
4ºC
x 35 (ciclos)

8
. Polimerasa
5’ .3’Nucleótidos (A, T, C, G)
T G C G C G G C C C AG T C T T G G G C T A G C G C. Primers
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
95ºC 95ºC 72ºC 72ºC
5’ 30’’ 1’ 4’

50-65ºC
45’’
4ºC
x 35 (ciclos)

8
5’ 3’
T G C G C G G C C C AG T C T T G G G C T A G C G C
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
95ºC 95ºC 72ºC 72ºC
5’ 30’’ 1’ 4’

50-65ºC
45’’
4ºC
x 35 (ciclos)

8
Denaturación

5’ 3’
T G C G C G G C C C AG T C T T G G G C T A G C G C

A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
95ºC 95ºC 72ºC 72ºC
5’ 30’’ 1’ 4’

50-65ºC
45’’
4ºC
x 35 (ciclos)

8
Denaturación Anealing
5’ 3’
T G C G C G G C C C AG T C T T G G G C T A G C G C
C G A T C G C
3’ 5’
G Prime
r

Prime
5’ 3’
r
T G C G C G G
A C G C G C C G G G T C A G A A C C C G A T C G
C
3’ 5’
C G
95ºC 95ºC 72ºC 72ºC
5’ 30’’ 1’ 4’

50-65ºC
45’’
4ºC
x 35 (ciclos)

8
Denaturación Anealing Extensión
5’ 3’
T G C G C G G C C C AG T C T T G G G C T A G C G C
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G

5’ 3’
T G C G C G G C C C AG T C T T G G G C T A G C G C
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
PCR: Reacción en Cadena de la Polimerasa
Electroforesis
Microsatelites
Secuencias simples repetidas en tandem a nivel del ADN sin función
conocida extremadamente variables
También conocidos como SSR (Simple Sequence Repeats)

SSR Mononucleotídica (A)11 ctgttgAAAAAAAAAAAtgagag

SSR Dinucleotídica (GT)6 ccaagtGTGTGTGTGTGTtgaat

SSR Trinucleotídica (CTG)4 cagagtCTGCTGCTGCTGgtaat

SSR Tetranucleotídica (ACTC)4 actgtACTCACTCACTCACTCtgaat


Microsatélites (SSR)

Secuencia de microsatélite
(CA)5 Alelo A

Especímen A

Especímen B

Secuencia de
microsatelite
(CA)3 Alelo B
Dirección de la
electroforesis
Homocigotos:
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7

Heterocigotos:
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)9

TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9


TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9 TTCTCTCTCTCTCTCTCTCTAT (CT)9
TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9
TTCTCTCTCTCTCTCTAT (CT)7 TTCTCTCTCTCTCTCTCTCTAT (CT)9 TTCTCTCTCTCTCTCTCTCTAT (CT)9

(CT)7 (CT)9 (CT)9

(CT)7
Ventajas
• Marcador codominante
• Uso relativamente simple
• En general son “neutros” al efecto de la selección natural
• Alta precisión en la determinación de alelos
• Altamente variables  Muchos alelos por locus (polimórficos)

Desventajas
• Requieren diseño de partidores especie-específicos (seq masiva)
• Requieren de un secuenciador para el análisis de fragmentos
• Dinámica evolutiva desconocida
• Bandas stutter y alelos nulos complican su análisis
• Exhiben significativos niveles de Homoplasia
Categorías de preguntas

1 Individuos: parentesco, endogamia, consanguinidad,


análisis forense

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura


RAPD (Random Amplified Polimorphism DNA)

Especímen A Especímen B

Polimorfismo de
secuencia en el
sitio del partidor
. Amplificación al azar de partes del genoma (partidores universales
cortos al azar, 8 a 10 pb)
. Se detecta polimorfismo sólo en donde no amplifica (no hay banda)
 Cambios en las zonas donde se pegan los partidores
. Permite amplificar fragmentos entre 200-2000pb
. Permite amplificar varios loci al mismo tiempo
. Marcador dominante (presencia/ausencia)

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 1 0 1 0 0 0 0 0 0 0 0 0 1 1 0 0
1 0 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
1 0 0 1 1 0 0 0 0 0 0 0 0 1 1 0 0

Matriz de datos es llevada a al


programa TFPGA
Marcador Dominante
Homocigoto Heterocigoto Homocigoto

X X X
Ventajas
• Fácil y barato
• Aproximación multilocus
• No requiere el diseño de partidores específicos
• Permite analizar un gran número de loci a nivel genómico
• Su variabilidad es neutra a los efectos de la selección natural

Desventajas
• Baja diversidad alélica (sólo 2 alelos)
• No se pueden detectar heterocigotos  Dominante
• Alto nivel de Homoplasia:
. Dos bandas de igual tamaño pueden tener distintas
secuencias
. Ausencia de banda puede ser producto de una o varias
mutaciones
• Exhibe graves problemas de reproducibilidad y poco comparables
• En muchos casos son imprecisos
• Técnicas y analíticas
Categorías de preguntas

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura


AFLP (Amplified Fragment Length Polymorphism)
ADN

. Técnica popular que


permite detectar una gran
cantidad de marcadores de
CAAT T C C C G TAAC C
ADN polimórficos G T TAAG G GCATTGG

rápidamente.
. Involucra una digestión con
enzimas de restricción y dos
rondas de PCR
AATTC T TA
. Permite detectar presencia- TTAA G AAT
ausencia de fragmentos de
restricción. Adaptador EcoR I
Adaptador Mse I
Ventajas
• Aproximación multilocus
• No requiere el diseño de partidores específicos
• Permite analizar un gran número de loci a nivel genómico
• Su variabilidad es neutra a los efectos de la selección natural

Desventajas

• Baja diversidad alélica (sólo 2 alelos)


• Marcador dominante  No se pueden detectar heterocigotos
• Alto nivel de Homoplasia
- Dos bandas de igual tamaño pueden tener distintas secuencias
- Ausencia de banda puede ser producto de una o varias
mutaciones en la zona de corte de la enzima de restricción
• Requiere de ADN de alta calidad y pureza
Categorías de preguntas

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura


Marcadores asociados a la
secuenciación del ADN
Reacción de secuenciación de Sanger
Es similar a una PCR:

• Utiliza un sólo primer y a la polimerasa para producir secuencias de


hebra simple de DNA

• Incluye nucleótidos normales (A, C, G, T) para extensión y


dideoxinucleótidos (terminación).

Regular Nucleotides Dideoxy Nucleotides


G A T G A T
C G A G A C
C T C T C
G A T G A T G
A G G A G
T T A T T A
C G
AC C C
A 1. Marcados
T A
C G
2. Terminadores
Sanger Sequencing
Prime
5’
r
T G C G C G G C C C A
A C G C G C C G G G
3’ 5’
T ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?
Sanger Sequencing
Primer
5’
T G C G C G G C C C AG T C T T G G G C T
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
Sanger Sequencing
Prime
5’
r
T G C G C G G C C C AG T C T T G G G C T A G C G C
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
5’
T G C G C G G C C C AG T C T T G G G C T 21 bp
Sanger Sequencing
Prime
5’
r
T G C G C G G C C C AG T C T T G G G C T A
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
5’
T G C G C G G C C C AG T C T T G G G C T 21 bp

5’
T G C G C G G C C C AG T C T T G G G C T A G C G C 26 bp
Sanger Sequencing
Prime
5’
r
T G C G C G G C C C AG
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
5’
T G C G C G G C C C AG T C T T G G G C T 21 bp

5’
T G C G C G G C C C AG T C T T G G G C T A G C G C 26 bp

5’
T G C G C G G C C C AG T C T T G G G C T A 22 bp
Sanger Sequencing
Prime
5’
r
T G C G C G G C C C AG T C T T G G G C
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
5’
T G C G C G G C C C AG T C T T G G G C T 21 bp

5’
T G C G C G G C C C AG T C T T G G G C T A G C G C 26 bp

5’
T G C G C G G C C C AG T C T T G G G C T A 22 bp

5’
T G C G C G G C C C AG 12 bp
Sanger Sequencing

Prime
5’
r
T G C G C G G C C C AG T C T T
A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
5’
T G C G C G G C C C AG T C T T G G G C T 21 bp

5’
T G C G C G G C C C AG T C T T G G G C T A G C G C 26 bp

5’
T G C G C G G C C C AG T C T T G G G C T A 22 bp

5’
T G C G C G G C C C AG 12 bp

5’
T G C G C G G C C C AG T C T T G G G C 20 bp
Sanger Sequencing

A C G C G C C G G G T C A G A A C C C G A T C G
3’ 5’
C G
5’
T G C G C G G C C C AG T C T T G G G C T 21 bp

5’
T G C G C G G C C C AG T C T T G G G C T A G C G C 26 bp

5’
T G C G C G G C C C AG T C T T G G G C T A 22 bp

5’
T G C G C G G C C C AG 12 bp

5’
T G C G C G G C C C AG T C T T G G G C 20 bp

5’
T G C G C G G C C C AG T C T T 16 bp
Sanger Sequencing

A C G C G C C G G G
3’ 5’
T ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?
5’
T G C G C G G C C C A? ? ? ? ? ? ? ? ? T 21 bp

5’
T G C G C G G C C C A? ? ? ? ? ? ? ? ? ? ? ? ? ? C 26 bp

5’
T G C G C G G C C C A? ? ? ? ? ? ? ? ? ? A 22 bp

5’
T G C G C G G C C C AG 12 bp

5’
T G C G C G G C C C A? ? ? ? ? ? ? ? C 20 bp

5’
T G C G C G G C C C A? ? ? ? T 16 bp
Sanger Sequencing
Reader
Reader
Laser
Laser
5’
T G C G C G G C C C AG T C T T G G G C T A 22 bp

5’
T G C G C G G C C C AG T C T T G G G C T 21 bp

5’
T G C G C G G C C C AG T C T T G G G C 20 bp

5’
T G C G C G G C C C AG T C T T G G G 19 bp

5’
T G C G C G G C C C AG T C T T G G 18 bp
5’
T G C G C G G C C C AG T C T T G 17 bp

5’
T G C G C G G C C C AG T C T T 16 bp
5’
T G C G C G G C C C AG T C T 15 bp

5’
T G C G C G G C C C AG T C 14 bp

5’
T G C G C G G C C C AG T 13 bp
5’
T G C G C G G C C C AG 12 bp
GTCTTGGGCTA
Método automático de
secuenciación
Resultado
Cada reacción de secuenciación nos entrega un
cromatograma, ~600-1000 bp:
Variabilidad de la secuencia de ADN

ATTCGCTATCGAACGCTACGCTGCGAACGGG
ATTCGTTATCGAACGCTACGCTGCGAACGGG Sustitución
ATTCGCTATCGAA- - -TACGCTGCGAACGGG Deleción
ATTCGCTATCGAACGCCGCTACGCTGCGAACGGG Repetición
ATTCG- - - -CGAACGCTACGCTGCTATCGAACGGG Transposición

Además:

• Errores de apareamiento de cromosomas


• Ruptura / fusión de cromosomas (o partes)
Dos grandes diferencias entre ADN nuclear
y ADN cytoplasmatico

Mitosis y Meiosis Transmisión bi-parental


(mutaciones (fusion de gametos)
y recombinación)

Solo Mitosis Transmisión mono-parental


(solo mutaciones) (maternal)
DNA Nuclear (nucDNA) vs DNA
Mitocondrial (mtDNA)
nucADN mtADN
Forma Linear Circular
Número de copias 2 por célula Miles por célula
Tamaño Variable (6x109) 16,5Kbp
Tipo de herencia Biparental Uniparental
‘H’ de machos y ‘H’ linajes maternos
hembras. Ventaja en
estudios (filopatria)

Número de alelos Diploide * 1 haplotipo


Más de un locus Ventaja en coalescencia

Recombinación Si No
Varios locus 1 Locus

Estabilidad
Tipo de herencia Baja Alta
Tasa de mutación Menor Mayor
Análisis Complejo Simple
Transformación y
Clonación
Categorías de preguntas

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura,


filogeografía

4 C
A
B
B
A

Entre especies: filogeografía/filogenia


C
D
D
Usos potenciales de los distintos tipos de
marcadores en ecología, filogeografía y filogenia
Nivel Jerárquico Electroforesis Secuencia Secuenciación DNA fingerprint
de proteinas DNA/RNA mtDNA, scnDNA, intrones, RAPD, AFLP

Identidad
genética
Parentesco
Poblaciones
coespecíficas
Especies
relacionadas
Niveles
taxonómicos
intermedios
Separaciones
profundas

Adecuado, altamente informativo

Marginalmente informativo

No apropiado
Tomado de Sunnucks, 2000 TREE
Aproximaciones “OMICAS”

NGS “Next generation sequencing”

Desarrollo de nuevas técnicas en Biología Molecular

• Avances en Bioinformática y de los tiempos requeridos


para el análisis de una enorme cantidad de datos

Se asocia a la identificación-caracterización de genes transcritos


y traducidos que responden a presiones de selección.

Han aumentado la capacidad de comprensión de los mecanismos


de adaptación y especiación.
Genómica: estudio de la función de
los genomas.

Transcriptómica: estudia el conjunto


de moléculas de ARNs (mARN, rARN,
tARN y ARN no codificante), en una
célula o un conjunto celular.
Permite obtener un perfil de la
expresión génica global bajo
condiciones específicas.

Proteómica: se encarga de
caracterizar el conjunto de proteínas,
en especial sus estructuras y
funciones.

Metabolómica: estudio sistemático


de las huellas químicas o metabolitos
que dejan los procesos celulares
específicos.
Ventajas

• Permite la búsqueda y obtención de partidores para:


- Microsatélites
- Genes

• Aumentan la cantidad de loci para trabajar

• Permite ampliar las preguntas y grupos a estudiar

Desventajas
• Precio

• Bioinformatica avanzada

• Capacidad de análisis numérico


Comparación de métodos de secuenciación NGS
Video!
Dos técnicas interesantes

• RAD sequencing

• RNA seq Transcriptoma


RAD sequencing

• Permite analizar genomas en especies no modelo

• Permite detectar loci bajo selección


SNPs = Single Nucleotide Polimorphism

• Un SNP es un cambio en una


base dentro de una secuencia

• Se estima 1 SNP por 1000 bases


en un genoma

• Puede o no alterar la estructura


de la proteina (posición codón)

• Base de datos SNP para


humanos (http://www-
genome.wi.mit.edu/snp/human/)
Categorías de preguntas

1 Individuos: parentesco, endogamia, consanguinidad,


análisis forense

2 Dentro de poblaciones: Tamaño poblacional,


demografía

3 Entre poblaciones: Conectividad, estructura,


filogeografía
RNA seq
RNA seq

Dos aspectos pueden ser estudiados

• Variaciones en genes expresados

• Expresión diferencial entre individuos