Está en la página 1de 44

1/2 A 1/2 a

1/2 A AA Aa

Principios 1/2 a Aa aa

mendelianos y Razn genotpica

extensiones 1/4 AA
1/2 Aa
1/4 aa
Razn fenotpica
3/4 A-
Dr. Antonio Barbadilla
1/4 aa
1
1 Tema 3: Principios mendelianos y extensiones
Objetivos tema
Principios mendelianos y extensiones

Debern quedar bien claros los siguientes puntos


El mtodo experimental y la terminologa de Mendel
Ilustrar los dos principios de la transmisin de los genes (la
leyes de Mendel)
Cruce monohbrido y principio de la segregacin 1:1
Cruce dihbrido y principio de la transmisin independiente
La naturaleza probabilstica de los principios mendelianos
Relaciones genotipo-fenotipo
La distincin entre dominancia incompleta, parcial y codominancia
Alelismo mltiple
Gen esencial y letal
Pleiotropa
Penetrancia y expresividad
Interaccin entre genes
Gentica bioqumica: la hiptesis un gen-una enzima
Dr. Antonio Barbadilla

2
2 Tema 3: Principios mendelianos y extensiones
Los experimentos de Mendel
demuestran que:

La herencia se transmite por elementos


particulados (no herencia de las mezclas),
y

sigue normas estadsticas sencillas,


resumidas en sus dos principios

Dr. Antonio Barbadilla

3
3 Tema 3: Principios mendelianos y extensiones
Monje austriaco
Gregor Mendel (1822-
1884)
Jardn del monasterio agustino de Santo Toms de Brunn, actual
repblica Checa, donde Mendel realiz sus experimentos de cruces con
Dr. Antonio Barbadilla

el guisante
Mendel Web: http://www.mendelweb.org/ 4
4 Tema 3: Principios mendelianos y extensiones
Caractersticas del
experimento de Mendel :
Eleccin de caracteres cualitativos
(alto-bajo, verde-amarillo, rugoso-liso, ...)

Cruces genticos de lneas puras (lnea


verde x lnea amarilla)

Anlisis cuantitativos de los fenotipos de


la descendencia (proporcin de cada
fenotipo en la descendencia)
Dr. Antonio Barbadilla

5
5 Tema 3: Principios mendelianos y extensiones
Flor de la planta
del guisante, Pisum sativum
estudiada por Mendel

Dr. Antonio Barbadilla

6
6 Tema 3: Principios mendelianos y extensiones
Los siete caracteres estudiados
Dr. Antonio Barbadilla
por Mendel
7
7 Tema 3: Principios mendelianos y extensiones
Polinizacin cruzada Autofecundacin

Dr. Antonio Barbadilla

Mtodo de cruzamiento empleado por Mendel 8


8 Tema 3: Principios mendelianos y extensiones
Resultados de todos los cruzamientos
monohbridos de Mendel

Dr. Antonio Barbadilla

9
9 Tema 3: Principios mendelianos y extensiones
Interpretacin gentica del cruce monohbrido de Mendel

Dr. Antonio Barbadilla

10
10 Tema 3: Principios mendelianos y extensiones
Primera ley de Mendel:
Segregacin equitativa
Los dos miembros de un par de
alelos segregan en proporciones 1:1.
La mitad de los gametos lleva un
alelo y la otra mitad el otro alelo
Razn genotpica

1/2 A 1/2 a 1/4 AA


1/2 Aa
1/2 A AA Aa 1/4 aa

1/2 a Aa aa Razn fenotpica


3/4 A-
1/4 aa
Dr. Antonio Barbadilla

11
11 Tema 3: Principios mendelianos y extensiones
Cruce dihbrido

Gen Color
Y (amarillo) > y (verde)

Gen textura semilla


R (liso) > r (rugoso)

Dr. Antonio Barbadilla

12
12 Tema 3: Principios mendelianos y extensiones
Segunda ley de
Mendel: Cruce
dihbrido

El cuadrado de
Punnett ilustra
los genotipos que
dan lugar a las
proporciones
9:3:3:1

Dr. Antonio Barbadilla

13
13 Tema 3: Principios mendelianos y extensiones
Segunda ley de Mendel:
Transmisin independiente

Durante la formacin de los gametos


la segregacin de alelos de un gen es
independiente de la segregacin de
los alelos en el otro gen

Dr. Antonio Barbadilla

14
14 Tema 3: Principios mendelianos y extensiones
Segunda ley de Mendel:
1/4 AB 1/4 Ab 1/4 aB 1/4 ab
Razn genotpica

AABB Aabb aaBB


1/4 AB AABB AAbB AaBB AaBb 1/16:1/16:1/16:
aabb AaBb AABb
1/4 Ab AABb AAbb AabB Aabb 1/16:4/16:2/16:
aaBb AaBB Aabb
2/16:2/16:2/16
1/4 aB AaBB AaBb aaBB aaBb

1/4 ab AaBb Aabb aaBb aabb

Dr. Antonio Barbadilla Razn fenotpica


9/16 A-B- 3/16 A-bb 3/16 aaB- 1/16 aabb 15
15 Tema 3: Principios mendelianos y extensiones
Segunda ley de Mendel: Cruce trihbrido
P AABBCC x aabbcc

F1 AaBbCc x AaBbCc
ABC ABc AbC Abc aBC aBc abC abc

ABC AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCc

ABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbcc

AbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCc

Abc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc Aabbcc

aBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCc

aBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbcc

abC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCc

abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc

Dr. Antonio Barbadilla

16
16 Tema 3: Principios mendelianos y extensiones
Segunda ley de Mendel: Cruce trihbrido
P AABBCC x aabbcc

F1 AaBbCc x AaBbCc
ABC ABc AbC Abc aBC aBc abC abc

ABC AABBCC AABBCc AABbCC AABbCc AaBBCC AaBBCc AaBbCC AaBbCc

ABc AABBCc AABBcc AABbCc AABbcc AaBBCc AaBBcc AaBbCc AaBbcc

AbC AABbCC AABbCc AAbbCC AAbbCc AaBbCC AaBbCc AabbCC AabbCc

Abc AABbCc AABbcc AAbbCc AAbbcc AaBbCc AaBbcc AabbCc Aabbcc

aBC AaBBCC AaBBCc AaBbCC AaBbCc aaBBCC aaBBCc aaBbCC aaBbCc

aBc AaBBCc AaBBcc AaBbCc AaBbcc aaBBCc aaBBcc aaBbCc aaBbcc

abC AaBbCC AaBbCc AabbCC AabbCc aaBbCC aaBbCc aabbCC aabbCc

abc AaBbCc AaBbcc AabbCc Aabbcc aaBbCc aaBbcc aabbCc aabbcc

Dr. Antonio Barbadilla Razn fenotpica


27 9 9 9 3 3 3 17 1
17 Tema 3: Principios mendelianos y extensiones
Naturaleza probabilstica de
las leyes Mendel:
Las leyes son probabilsticas (como si los
alelos de los genes se cogieran al azar de urnas), no
deterministas

Permiten predecir la probabilidad de


los distintos genotipos y fenotipos
que resultan de un cruce

Permiten inferir el nmero de genes


que influyen sobre un carcter
Dr. Antonio Barbadilla

18
18 Tema 3: Principios mendelianos y extensiones
Caracteres mendelianos en
humanos:
Capacidad de sentir el sabor de la
feniltiocarbamida
Albinismo
Tipo sanguneo
Braquidactilia (dedos de manos y pies cortos)
Hoyuelos de la mejilla
Lbulos oreja sueltos o adosados
Pecas en la cara
Pulgar hiperlaxo
Polidactilia
OMIM - Online Mendelian Inheritance in Man
Dr. Antonio Barbadilla http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM
19
19 Tema 3: Principios mendelianos y extensiones
Caracteres mendelianos

Albinismo

Dr. Antonio Barbadilla

20
20 Tema 3: Principios mendelianos y extensiones
Alelismo mltiple
Grupos AB0

A=B>0

Fenotipo Genotipo
A- AA A0
B- BB B0
AB AB
0 00

Color pelaje conejo C+ Cch Ch c

C+ > Cch > Ch > c Salvaje Chinchilla Himalaya albino

Dr. Antonio Barbadilla

21
21 Tema 3: Principios mendelianos y extensiones
Alelismo mltiple
A nivel de secuencia nucleotdica prcticamente cada copia
de un gen es diferente en algn nucletido de su secuencia.
El alelismo mltiple es ubicuo.
BRCA2

Individual 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
Individual 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag
Individual 3 acgtagcatcgtatgcgttagacggcggggtagcaccagtacag
Individual 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
Individual 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
Individual 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Individual 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Individual 8 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Individual 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Dr. Antonio Barbadilla

22
22 Tema 3: Principios mendelianos y extensiones
Se usa la notacin AA, Aa y aa para denominar a los genotipos
Cmo explicamos los mendelianos que determinan un fenotipo, pero en realidad stos son
genotipos mendelianos si en internamente heterogneos en el nivel de DNA. Su asignacin como
genotipo AA aa se debe generalmente a que todas las secuencias
el nivel del DNA cada alelo que pertenecen al genotipo AA comparten un fenotipo distinto de
suele ser distinto? las que pertenecen al genotipo aa y esta diferencia fenotpica se
debe posiblemente a un nucletido (o a unos pocos) que sera el
verdadero genotipo que causa los diferentes fenotipos

Secuencia nucleotdica de una regin del gen A en


distintos individuos
Indiv1Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
Indiv1Secuencia 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag
Alelo A = a Genotipo AA = aa -> Fenotipo A
Alelo a = t
Indiv2Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
Indiv2Secuencia 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
Genotipo Aa = at -> Fenotipo A

Indiv3 Secuencia 1acgtagcatcgtttgcgttagacggcatggcaccggcagtacag


Indiv3 Secuencia 2acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Genotipo aa = at -> Fenotipo a

Dr. Antonio Barbadilla

24
24 Tema 8: Extensiones del anlisis mendeliano
Gen letal y esencial
Un gen que cuando est alterado es letal, es un gen esencial

Gen y del ratn domstico es un ejemplo

Alelo y es dominante para el color amarillo, letal en homocigosis. Alteracin


proporciones mendelianas de la F2 es 2:1

Dr. Antonio Barbadilla

25
25 Tema 3: Principios mendelianos y extensiones
Edad de aparicin de un
Aparicin tarda de la
fenotipo enfermedad de Huntington

Temprana
Tarda

Impronta parental
Ejemplo
Factor crecimiento II tipo insulina (Igf2) en ratn.
Mutante homocigoto -> enano.
El fenotipo del heterocigoto depende del origen del alelo
Dr. Antonio Barbadilla Alelo salvaje es paterno -> fenotipo salvaje
Alelo salvaje es materno -> fenotipo enano 26
26 Tema 3: Principios mendelianos y extensiones
Relaciones genotipo-fenotipo
P1
Ausencia de
dominancia
en el Dondiego
de noche F1

(Mirabilis jalapa)

F2

Dr. Antonio Barbadilla

27
27 Tema 3: Principios mendelianos y extensiones
Cruce dihbrido con ausencia de
dominancia
Razn genotpica ?
1/4 A1B1 1/4 A1B2 1/4 A2B1 1/4 A2B2

1/4 A1B1 A1A1B1B1

1/4 A1B2

1/4 A2B1

1/4 A1B2

Nmero fenotipos distintos? Razn fenotpica ?


Dr. Antonio Barbadilla

28
28 Tema 3: Principios mendelianos y extensiones
Los nmero esperados de cruces
mendelianos
Monohbrido Dihbrido Trihbrido Regla general

n=1 n=2 n=3 n

Tipos de gametos en la F1 2 4 8 2n

Proporcin de homocigotos 1/4 1/16 1/64 () n


recesivos en la F2

Nmero de fenotipos distintos de 2 4 8 2n


la F2 suponiendo dominancia
completa

Nmero de genotipos distintos de


la F2 (o fenotipos si no hay 3 9 27 3n
dominancia)

Dr. Antonio Barbadilla

29
29 Tema 3: Principios mendelianos y extensiones
Relacin genotipo-fenotipo:
Variacin en la dominancia

Dr. Antonio Barbadilla

30
30 Tema 3: Principios mendelianos y extensiones
Relacin genotipo-fenotipo:
Codominancia
Presencia de ambos fenotipos paternos en el
heterocigoto

Grupo AB

Heterocigoto protena detectada por


electroforesis en hemoglobina

Dr. Antonio Barbadilla

31
31 Tema 3: Principios mendelianos y extensiones
Relacin genotipo-fenotipo:
Niveles de dominancia

HbAHbA: Normal. HbSHbS: Anemia grave. HbAHbS: No anemia

Dr. Antonio Barbadilla

32
32 Tema 3: Principios mendelianos y extensiones
Relacin genotipo-fenotipo:
Retinoblastoma hereditario

R > r en el nivel celular


Dr. Antonio Barbadilla pero
r > R en el nivel del organismo 33
33 Tema 3: Principios mendelianos y extensiones
Pleiotropa
Ejemplo anemia falciforme

Cambio de un nucletido
en el DNA del gen de
la hemoglobina

Rpida destruccin de Problemas Acumulacin de clulas


los glbulos rojos circulatorios falciformes en el bazo
Produccin de hemoglobina S
en lugar de la A

Baja concentracin de
oxgeno en lo tejidos Dao Daos en Dao en
Anemia cerebral otros rganos el bazo
Agregacin de la hemoglobina S para
formar estructuras casi cristalinas en
aguja en los glbulos rojos

Debilidad
Fallo
fsica
cardiaco Parlisis
Distorsin de los glbulos rojos,
adquieren forma de hoz (falciforme)

Funcin mental
Fallo renal
disminuida Neumona Reumatismo

Dr. Antonio Barbadilla

34
34 Tema 3: Principios mendelianos y extensiones
Penetrancia y expresividad
Ambos conceptos se refieren a la expresin
fenotpica variable de ciertos genes

Penetrancia: Proporcin de individuos en una


poblacin que presentan el fenotipo
correspondiente a su genotipo. Si P < 1 se habla
de penetrancia incompleta

Expresividad: El grado de expresin individual


de un fenotipo para un genotipo dado

Dr. Antonio Barbadilla

35
35 Tema 3: Principios mendelianos y extensiones
Expresividad

La polidactilia se manifiesta en grados distintos


Dr. Antonio Barbadilla

36
36 Tema 3: Principios mendelianos y extensiones
Expresividad

10 grados de expresividad variable en el


Dr. Antonio Barbadilla carcter piel manchada en perros.
37
37 Tema 3: Principios mendelianos y extensiones
Caracteres determinados por
ms de un gen

Dr. Antonio Barbadilla

38
38 Tema 3: Principios mendelianos y extensiones
Caracteres determinados por
ms de un gen

Dr. Antonio Barbadilla

39
39 Tema 3: Principios mendelianos y extensiones
Interaccin entre genes:
dos o ms genes determinan el fenotipo de un
modo que alteran las proporciones mendelianas
esperadas

Dr. Antonio Barbadilla

40
40 Tema 3: Principios mendelianos y extensiones
Tipos de interaccin gentica segn la
modificacin de las proporciones mendelianas
9 3 3 1
13:3
9:7
9:3:4
12:3:1
15:1

A-B- A-bb aaB- aabb


Mutacin supresora 13:3
Duplicacin gnica recesiva 9:7
Epistasia recesiva 9:3:4
Epistasia dominante 12:3:1
Dr. Antonio Barbadilla Duplicacin gnica dominante 15:1
41
41 Tema 3: Principios mendelianos y extensiones
Gentica bioqumica: estudio de
la relacin entre genes y
enzimas
Hiptesis un gen - una enzima (Beadle y
Tatum 1941) -> Estudio de la ruta
biosinttica de la niacina (vitamina B3 en
el hongo del pan Neurospora crassa)

Dr. Antonio Barbadilla

42
42 Tema 3: Principios mendelianos y extensiones
Gentica bioqumica: muchos genes
cooperan en el producto final

Dr. Antonio Barbadilla

43
43 Tema 3: Principios mendelianos y extensiones
Explicacin bioqumica de la proporcin 9:7
en el color de la aleurona del maz
Precursor Intermediario Producto final
blanco blanco prpura

Enzima A Enzima B

Gen A Gen B

Para obtener el producto final prpura necesitamos


que tanto el gen A como el B produzcan una enzima
funcional. Si uno de los dos genes falla (genotipo aa
bb), el producto final ser blanco
Dr. Antonio Barbadilla

44
44 Tema 3: Principios mendelianos y extensiones
Gentica bioqumica: Relacin
concentracin enzima y producto final

Dr. Antonio Barbadilla

45
45 Tema 3: Principios mendelianos y extensiones