Está en la página 1de 10

ABP-2 enzimologa y gentica.

Qu le ocurre a Mei

Ling?

Resumen: este caso se ha diseado para su utilizacin en la asignatura


Bioqumica I de

primer curso del Grado Farmacia y Bioquimca en la FF y B de la


UNMSM. Mei Ling, estudiante chino natural de Shangai, realiza un
curso de Toxicologia en la UNMSM en el seno de un programa de
intercambio. En una salida nocturna con sus compaeros, toma un par
de cervezas y empieza a notar un malestar tan alarmante que ha de
ser ingresado en el Servicio de Urgencias del Hospital Casimiro Ulloa.
Los estudiantes deben averiguar cul es el problema de Mei. El
estudio de las bases moleculares del sndrome de intolerancia al
alcohol permite a los alumnos comprender los fundamentos de la
OBJETIVOS
cintica enzimtica,
la importancia de la relacin estructura-funcin
en protenas y conceptos esenciales de Gentica.
EDUCATIVOS

Objetivos
generales

Conseguir
entre

que

los

estudiantes

reflexionen

sobre

la

relacin

los

conocimientos bioqumicos y las situaciones cotidianas (como


la ingestin de alcohol).
Comprensin de la relacin estructura-funcin de las protenas.
Comprensin de la relacin gen-protena y las posibles
consecuencias de las alteraciones en la secuencia del DNA.

24

Objetivos
especfcos
Despus de realizar el problema ABP, los estudiantes sern

capaces de:
Manejar y transformar correctamente unidades de medida bioqumicas.

Comprender cmo los cambios de aminocidos en posiciones


crticas de las cadenas polipeptdicas pueden afectar a la

funcin de las protenas.


Calcular los parmetros cinticos de una enzima y comprender

su significado bioqumico.

Entender los conceptos de gen, alelo, polimorfismo y mutacin.


Discutir los procesos a travs de los cuales la informacin
almacenada en el
DNA se expresa en las protenas.
Explicar el metabolismo del etanol y comprender los riesgos
que conlleva el consumo excesivo.
METODOLOG
A

Actividad de aprendizaje cooperativo: equipos formados por 8 alumnos.

Presentacin del problema en clase


Requisitos: con alumnos de primer curso son recomendables

clases previas convencionales para explicar las propiedades de


los aminocidos, estructura de las protenas, y conceptos
bsicos de cintica enzimtica .

Tiempo disponible para la resolucin del problema: 2 semanas.

Tutoras: 2 horas en el aula. Se puede optar por la


realizacin de tutoras externas formalizadas en grupos poco
numerosos.
Discusin del problema y evaluacin del aprendizaje: sesin
nica en el aula de
PROBLEMA
1 hora de duracin utilizando una presentacin de Power Point
ABP

QU LE OCURRE A MEI
LING?1
Mei

Ling, estudiante chino de 23 aos, participa en un programa de

intercambio

suscrito entre la Tongji University de Shangai y la Universidad Nacional


Mayor de San Marcos. En Agosto

Los personajes y documentos presentados en este ABP son


totalmente ficticios.

25

del ao pasado viaj a Lima para realizar el ltimo curso de Toxicologia en

la Facultad de Farmacia y Bioqumica de la UNMSM. Mei se ha


incorporado perfectamente al nuevo ambiente, ha hecho amigos entre
sus compaeros de clase y disfruta de los encantos de la ciudad. El
24 de Octubre pasado, Mei y sus compaeros de clase Pedro, David,
Noa y Mara fueron a celebrar el comienzo de la semana de Farmacia.
Pedro: propongo ir a tomar unos vinos por el barrio Miraflores en

de las pizzas

la calle

para que Mei vea el ambiente y luego acabamos la

noche en Discoteca Black & White en Lince.


Noa: estupendo porque Mei parece un ratn de biblioteca de tanto
estudiar. Le vendr bien divertirse.
Pedro: no exageres. Todos estudiamos mucho.

David: bueno Mei T qu opinas?


Comienzan
Antica, local tpico que est a esas horas completamente
Yuga:
bien. en
Interesante.
abarrotado.
Noa: , fjate que ambiente. Vamos a pasar una noche
estupenda.

Pedro: empezamos con unos vinos y unas pizzas Qu


les parece?
Mei: mejor cerveza negra para mi. Dicen que es buena.
Les sirven las pizzas y las bebidas, y empiezan a comentar sus
David: yo tambin prefiero cerveza.
planes para las

vacaciones. A los 15 minutos, los vasos estn vacos y piden otra


Mara: Mei tienes calor? Te ests poniendo rojo como un
ronda.
tomate.

Mei: no muy bien. Dolor de cabeza. No bebo ms.


Noa: si es que tanto estudiar, te va a fundir los
Diez minutos despus, Mei se encuentra francamente mal: tiene
circuitos
taquicardia, su

dolor de cabeza es insoportable y tiene nauseas.


Pedro: pero, qu te

pasa?
Mai no puede contestar. Intenta levantarse y se tambalea. Est a punto
de

desmayarse.

Mara: esto no es normal. Parece que se ha bebido un barril entero.


Qu

hacemos? Llamamos a una ambulancia?


Noa: no. Es mejor que le llevemos nosotros a urgencias. Ser
ms rpido. David, trae el coche del estacionamiento deprisa que
Veinte minutos ms tarde, David, Pedro, Mara, Noa y Mei entran en
esto tiene muy mal aspecto.
Urgencias

del Hospital Casimiro Ulloa. Les atiende el Dr. Canal, Max de sexto
ao, al que cuentan lo ocurrido.
26

Dr. Canal: dices que slo tom una cerveza, seguro? Porque los
sntomas

podran indicar una fuerte intoxicacin etlica.


Noa: seguro. Hemos estado juntos desde esta maana y no ha
bebido nada ms.
Dr. Canal: Alguno ha tomado cerveza como l?
David: yo tambin he tomado dos cervezas y estoy
perfectamente.
Dr. Canal: bien, pedir una analtica urgente. David, tienes
Mei es trasladado a una camilla . Mientras le exploran y le hacen los
inconveniente en que te hagamos tambin a ti una analtica?
anlisis pedidos por el Dr. Canal, sus amigos esperan muy
David: si puede servir para algo, encantado.
preocupados. Dos horas despus, el Dr. Canal tiene los
resultados. Esta es la ficha correspondiente (Fig. 1).

Figura 1. Ficha del paciente que recoge los datos personales, los sntomas y aspecto
en el momento

del ingreso y los resultados de la gasometra arterial y de la analtica


sangunea que le realizaron.
El Dr. Canal informa a los amigos de Mei y les dice que la intolerancia al

alcohol

por deficiencia de la enzima ALDH-2 es relativamente frecuente en los


orientales. No debe ingerir nunca bebidas que contengan alcohol. Al
da siguiente Mei se encuentra mejor y sus amigos le llevan a la
27se aloja.
residencia de estudiantes en la que

Noa: que susto nos has dado Mei. Me alegro de que te encuentres mejor.

Pedro: Qu dijo el mdico que tena? Yo no he entendido nada.


Slo s que no puedes tomar alcohol. No lo sabas?
Yuga: en Shangai slo tomaba zumos.
David: quiz debamos consultarlo con Elena y Juan. Ellos
estudian Bioqumica y seguro que nos lo pueden explicar.
As lo hacen. Por supuesto, Elena y Juan saben cmo se metaboliza el
etanol y

cmo funciona una enzima pero no tienen claro qu es la ALDH-2 y


qu relacin puede tener con los orientales. Muy voluntariosos, se
dedican a buscar bibliografa sobre el tema y encuentran informacin
Aldehdo
muy interesante (Tabla 1 y Figs. 2, 3 y 4).
deshidrogenasa

Parmetros
cinticos

KM CH3-CHO
M)

Vmax (U/mg)

ALDH1A1
Aldehdo
deshidrogenasa
33
citoslica

0.6
3

ALDH2
Aldehdo
deshidrogenasa
0.2
mitocondrial

0
0.6
0

Tabla 1. Parmetros cinticos de la aldehdo deshidrogenasa citoslica y


mitocondrial. Actividad

enzimtica determinada a 25C, en tampn fosfato sdico 0.1 M, pH 7.5,


con una concentracin 1 mM
de NAD+ y la misma concentracin de ALDH-1A1 y ALDH-2.
Aldehdo deshidrogenasa

mitocondrial
La ALDH-2 humana est codificada por el gen ALDH2 que se
localiza en el

cromosoma 12. Dicho gen presenta un polimorfismo debido a la


sustitucin de un nico nucletido, lo que conduce al cambio del
residuo que ocupa la posicin 487 de la cadena polipeptdica (Fig. 2).
Los productos de ALDH2*1 y ALDH2*2 son dos variantes de la
enzima aldehdo deshidrogenasa mitocondrial. La variante
codificada por ALDH2*2 no presenta actividad in vivo. El estudio
Se ha analizado la distribucin de ALDH2*1 y ALDH2*2 en distintos
cintico de ambas variantes arroja los resultados que se muestran en
grupos
la figura
3.
tnicos, comprobndose que la frecuencia de ALDH2*2 es mnima en
poblaciones de origen caucsico y alta en ciertas poblaciones
orientales (Fig. 4).

28

Gen ALDH2

3
ALDH2*1
5
Secuencia del DNA GGGCTGCAGGCATACACTGAAGTGAAAACT
3
5
ALDH2*1
Secuencia
GGGCUGCAGGCAUACACUGAAGUGAAAACU
Secuenciadel
delmRNA
DNA GGGCTGCAGGCATACACTGAAGTGAAAACT
3
5
ALDH2*2
Secuencia del DNA GGGCTGCAGGCATACACTAAAGTGAAAACT
5
3
Secuencia del mRNA GGGCUGCAGGCAUACACUAAAGUGAAAACU

Figura 2. Aldehdo deshidrogenasa mitocondrial. Secuencia parcial de las variantes


polimrficas del

gen codificante de la ALDH2 y de los correspondientes mRNAs.

Figura 3. Estudio cintico de las variantes de la enzima ALDH-2. Actividad aldehdo


deshidrogenasa

determinada a 25C, en tampn fosfato sdico, pH 7.4, en presencia de


100M de acetaldehdo. La concentracin de enzima es la misma en ambos
casos.
Con sus conocimientos de Bioqumica, Elena y Juan han sido

capaces de

interpretar estos resultados, entender qu le pasa a Mei Ling y


contestar las preguntas de sus amigos.

29

Figura 4. Distribucin de ALDH2*1 y ALDH2*2 en distintos grupos tnicos. En


ordenadas se indica el

porcentaje de individuos con las distintas variantes allicas.

CUESTION
ES
1.

David tom dos cervezas de 350 ml y una graduacin de 4.5%.

Como est
2.

preocupado por lo ocurrido, quiere saber cuntos gramos de


etanol ingiri. (Densidad del etanol: 0.8 g/ml).

Llev a Yuga al hospital conduciendo su propio coche. Si la Polica le hubiera hecho

la prueba de alcoholemia, habra superado el lmite permitido actualmente?


Elena consult esta pgina web: http://www.msps.es/ciudadanos/proteccion
Salud/adolescencia/alcohol/home.ht m.
http://www2.congreso.gob.pe/Sicr/TraDocEstProc/Contdoc03_2011.nsf/0/58a
2e63e7d509ab605257e52007a87c4/$FILE/PL0454020150527.pdf
Qu opinis de la conducta de
David?
30

3. Puedes

explicar a Mei y sus amigos el significado de los parmetros

determinados

en la gasometra arterial y en la analtica sangunea? A una pO2


de 23 torr, cul
sera el porcentaje de saturacin de la hemoglobina? Cul es la
concentracin plasmtica de glucosa de Mei expresada en mM?
4. Tambin les interes mucho saber cmo se metaboliza el etanol. Cul es
Por qu no hay valores de referencia en los parmetros etanol y
la
va
acetaldehdo?
Qu significa U/L?
ms importante cuantitativamente? Qu enzimas intervienen en
esta va? Por cierto, a qu categora pertenecen segn la
5. Las aldehdo deshidrogenasas citoslica y mitocondrial, qu son entre s? A
nomenclatura EC?
la vista

de los parmetros cinticos, cul de ellas ser la principal


responsable de la formacin de acetato in vivo? En la primera
etapa de la reaccin catalizada por las aldehdo deshidrogenasas,
la cadena lateral de un residuo de cistena del centro activo ataca
al sustrato formndose un intermediario covalente enzima6. Podran explicar de forma sencilla a Mei y sus amigos el
sustrato.
significado
Qu tipo de
de enlace se forma y cmo se denomina a este
mecanismo cataltico?
polimorfismo?
Conocn
otros
genes
que
presenten
polimorfismos? ALDH2*1 y ALDH2*2 son dos genes distintos? De
acuerdo con las secuencias de DNA que se muestran, cul sera
la correspondiente secuencia de aminocidos en la cadena
polipeptdica? La sustitucin G-A, qu cambio supone en el
7. Respecto al gen que codifica la aldehdo deshidrogenasa
aminocido que ocupa la posicin 487?
mitocondrial,qu

genotipo cree que tendr David? Y Mei? Cmo podran estar


seguros?

8. A la vista de los parmetros cinticos determinados para las enzimas


productos de

ALDH2*1 y ALDH2*2, podis explicar por qu la variante


codificada por ALDH2*2 no presenta actividad in vivo? Qu
Dato
importantetiene?
que encontr
concentracin
consecuencias
Creis Juan:
que la
puede
ser un factor de
+
intracelular
de NAD
es aproximadamente 0.4 mM.
proteccin frente
al alcoholismo?
9. Mei no puede creer que por cambiar un nico aminocido, la enzima

deje de

funcionar y le cree tantos problemas (recuerde que estudia


10. Toxicologia).
Para el tratamiento del alcoholismo crnico se utiliza disulfiram, un
Por qu este cambio puede ser tan importante? Propongan alguna
frmaco
que
explicacin
.
produce una reaccin aguda al consumo de etanol. Consideren la
informacin que se presenta en la figura 5 y propongan una
hiptesis para explicar cmo puede actuar el disulfiram a nivel
molecular.
31

Disulfiram

Figura 5. Representacin de Lineweaver-Burk que muestra el efecto del


disulfiram sobre la aldehdo
deshidrogenasa.
La actividad )de
la enzima se midi in vitro a distintas
de disulfiram 0.3M. El efecto del disulfiram
presencia ) y en ausencia +(
concentraciones
de
NAD
en
elimina en presencia de 2-mercaptoetanol
(
0.4 M.

sobre la enzima se

MATERIAL DE
CONSULTA
Devlin T. 2004. Bioqumica. Libro de texto con aplicaciones clnicas. Ed.
Revert.
Larson, H.N., Weiner H., Hurley T.D. (2005). J. Biol. Chem., 280: 3055030556.
http://www.adicciones.es/files/aragon.3.p
df
http://www4.ujaen.es/~descara/psicofarmacologia/genetica.
pdf
http://www.adicciones.es/files/izquierdo.13.
pdf
BIBLIOGRAF

Bibliografa

bsica
Berg,
y Stryer, L. 2008. Bioqumica. 6 edicin. Ed.
IA J. M.; Tymoczko, J. L.
Revert.
Nelson, D. L. y Cox, M.M. 2009. Lehninger. Principios de Bioqumica. 5
edicin. Ed.

Omega.

Devlin, T. 2004. Bioqumica. Libro de texto con aplicaciones clnicas. 4


edicin. Ed.

Revert.

32

Voet, D.; Voet, J. G. y Pratt C. W. 2007. Fundamentos de Bioqumica. 2


edicin. Ed.

Panamericana.

Bibliografa

especfica
Aragn, C.; Miquel, M.; Correa, M. y Sanchs-Segura, C. 2002. Alcohol y
metabolismo

humano. Adicciones, 14: 23-42. Disponible en:


http://www.adicciones.es/files/aragon.3.pdf

Berlin, D. S.; Person, M. G.; Mittal, A.; Oppezzo, M. A.; Chin, D. B.; Starr, B.;
Klein, T.E.;

Schwartz, D. L. y, Altman, R. B. 2010. DNA Twist: A Web-based


tool for teaching middle and high school students about
pharmacogenomics. Clin. Pharmacol. Ther., 87: 393-395.

Chen, Y. C.; Peng, G. S.; Wang, M. F.; Tsao, T. P. y Yin, S. J. 2009.


Polymorphism of

ethanol-metabolism genes and alcoholism. Correlation of allelic


variations with the pharmacokinetic and pharmacodynamic
consequences. Chem. Biol. Interact,
Escarabajal, M. D. 2003. Alteraciones genticas relacionadas con el
178 : 2-7.
alcoholismo. Rev.

Neurol., 37: 471-480. Disponible en:


http://www4.ujaen.es/~descara/psicofarmacologia/genetica.pdf

Farrs, J.; Wang, X.; Takahashi, K.; Cunningham, S. J., Wang, T. T. y Weiner, H.
1994.

Efects of changing glutamate 487 to lysine in rat and human


liver mitochondrial aldehyde dehydrogenase. A model to study
human (oriental type) class 2 aldehyde dehydrogenase. J. Biol.
Izquierdo, M. 2002. Intoxicacin etlica aguda. Adicciones, 14: 175-193.
Chem., 269: 13854-13860.
Disponible en:

http://www.adicciones.es/files/izquierdo.13.pdf

Larson, H. N.; Weiner, H. y Hurley, T. D. 2005. Disruption of the coenzyme


binding site

and dimer interface revealed in the crystal structure of


mitochondrial aldehyde
Larson, H. N.; Zhou, J.; Chen, Z.; Stamler, J. S.; Weiner, H. y Hurley, T.D. 2007.
dehydrogenase Asian variant. J. Biol. Chem., 280: 30550-30556.
Structural

and functional consequences of coenzyme binding to the


Database
inactive Asian variant of Biological
mitochondrial
aldehyde dehydrogenase.
Roles of residues 475 and 487.
http://www.dnatwist.org/BDE/ind
J. Biol. Chem., 282: 12940-12950.
RECURSOS
ex.html
ELECTRNICOS:
Ministerio de Sanidad, Poltica Social e Igualdad. Consumo juvenil de alcohol.

http://www.msps.es/ciudadanos/proteccionSalud/adolescencia/
alcohol/home.h tm

34