Está en la página 1de 34

Gentica de Poblaciones I:

La revolucin Darwiniana

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

Tema 17: Gentica de Poblaciones I: La revolucin


darwiniana, el equilibrio de Hardy-Weinberg y sistemas
de apareamiento
Puntos principales a tratar:
La revolucin darwiniana: el pensamiento
poblacional
La seleccin natural
Principios de la seleccin natural
La variacin gentica y sus estimacin
Poblacin mendeliana
Apareamiento aleatorio y ley de Hardy-Weinberg
Apareamiento no aleatorio
Apareamiento clasificado
Endogamia
2
Tema 17: Gentica Poblaciones I

Dr. Antonio Barbadilla

Nada tiene sentido en biologa


Nothing in Biology makes
si
no
es
a
la
luz
de
la
sense except in the light of
evolucin
evolution
Theodosius
Theodosius Dobzhansky
Dobzhansky

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

EL PARADIGMA
POBLACIONAL:
la variacin en
el seno de las
poblaciones es
la materia
prima de la
evolucin
Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

Lo nico que se trasmite a la descendencia son


genes
Genotipo

Siguiente
generacin

Fenotipo

Expresin gnica, desarrollo

Transmisin

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

Evolucin desde la perspectiva


poblacional:
Es el cambio acumulativo en la
composicin gentica de las
poblaciones

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

Poblacin mendeliana:
Conjunto de individuos intercruzables que
comparten un acervo gentico comn

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

La problemtica de la
gentica de poblaciones es
la descripcin y explicacin
de la variacin gentica
dentro y entre poblaciones
Theodosious Dobzhansky
Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

Variacin gentica o polimorfismo gentico:


gentico

existencia en una poblacin de dos o ms formas


allicas en frecuencias apreciables

Frecuencia gnica o allica (unidad bsica de


evolucin):
f(A) proporcin de un alelo dado en la poblacin
Gen X, alelos A y a

p = f(A)

q = f(a)

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

10

La Gentica de Poblaciones es
una Teora de Fuerzas
Factores que cambian las frecuencias gnicas en las
poblaciones

Deriva gentica

Migracin

p = f(A)
Mutacin
Dr. Antonio Barbadilla

Seleccin natural
Tema 17: Gentica Poblaciones I

11

El problema emprico: la lucha por la


medida de la variacin gentica
Variacin fenotpica cuantitativa: morfolgica,
fisiolgica, conductual
Gentica Cuantitativa
Continua y discreta ->
Experimentos de seleccin, endogamia

Dr. Antonio Barbadilla

Conclusin:
Conclusin
Existe variacin gentica para casi
cualquier
carcter
Tema 17: Gentica Poblaciones I

12

El problema emprico: la lucha por la


medida de la variacin gentica (2)
Variacin cualitativa: polimorfismos
genticos y variantes raras
Polimorfismo morfolgico (color,
tamao, forma)
Polimorfismo inmunolgico (grupos
sanguneos: AB0, Rh, NM,... 40 en
humanos)
Polimorfismo cromosmico (inversiones
paracntricas en Drosophila,
reordenaciones)

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

13

Caracol de huerta europeo Cepaea nemoralis

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

14

Gemetra del abedul Biston betularia

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

15

Cromosomas politnicos de Drosophila

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

16

Teoras de la variacin en los 60


Teora clsica

Teora equilibradora

Ausencia de variacin

Variacin ubicua

Seleccin purificadora

Seleccin equilibradora

Genotipo salvaje es
ptimo

No existe un genotipo
salvaje

Muller (laboratorio)

Dobzhansky (naturalista)

Eugenesia

Dr. Antonio Barbadilla

Viva la diversidad!, no
17
Tema 17: Genticainterferencia
Poblaciones I

El problema emprico: la lucha por la


medida de la variacin gentica (y 3)

Dr. Antonio Barbadilla

Polimorfismo proteico
(alozmico) Electroforesis de
protenas en gel (Lewontin &
Hubby 1966; Harris 1966)
-> era alozmica: la variacin
es ubicua. Consecuencia
terica: teora neutralista.
Nace la evolucin molecular.
Polimorfismos en el nivel del
DNA
RFLPs
Microsatlites
Tema 17: Gentica Poblaciones I
Secuencias de DNA

18

Polimorfismos de DNA

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

19

Polimorfismos de DNA
SNPs
Single Nucleotide Polymorphism

AGAG TTC TG C TC G
AG G G T TAT G C G C G

Secuencia 11
acgtagcatcgtatgcgttagacgggggggtagcaccagtacag

Secuencia 22

acgtagcatcgtatgcgttagacggggtggtagcaccagtacag

Secuencia 33

acgtagcatcgtatgcgttagacggcggggtagcaccagtacag

Secuencia 4
acgtagcatcgtttgcgttagacgggggggtagcaccagtacag

Secuencia 5

Dr. Antonio Barbadilla

acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
Tema 17: Gentica Poblaciones I

20

Medidas de la diversidad gentica


Ejemplo: Estudio electrofortico de la enzima glucosa
fosfato isomerasa en una poblacin de ratones

Frecuencia genotpica
f(FF) = 4 / 16

f(FS) = 7 /16

f(SS) = 5/16

Frecuencia allica o gnica


^ = f(F) =
p
Dr. Antonio Barbadilla

4 + (1/2) 7

= 0,469

^ = 0,531
q^ = 1 - p

16

Heterocigosidad ^ Tema 17: Gentica Poblaciones I


H = 7/16 = 0,4375

21

Frecuencias genotpicas y allicas para el locus del


grupo sanguneo MN en varias poblaciones humanas

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

22

Frecuencia de los alelos IA, IB, e i en el locus del grupo


sanguneo ABO en varias poblaciones humanas

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

23

Patrones de variacin
electrofortica

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

24

Ley del equilibrio de Hardy-Weinberg


Considera como se relacionan las frecuencias allicas y
genotpicas en una poblacin mendeliana bajo una serie de
supuestos ideales
Generaciones discretas y no solapantes
Apareamiento aleatorio
Tamao de poblacin infinito
No mutacin, no migracin entre poblaciones
No diferencias en eficacia biolgica (selectivas) entre
los distintos genotipos

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

25

Los supuestos implican una unin aleatoria


de los alelos para formar genotipos
Esperma

Frecuencias
allicas

A
p

a
q

AA
p2

Aa
pq

Aa
pq

aa
q2

Huevos

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

26

Ley del equilibrio de Hardy-Weinberg


Consecuencias de los supuestos:
Reduccin de la dimensionalidad de una poblacin. Conociendo las
frecuencias allicas podemos predecir las genotpicas
Equilibrio allico y genotpico.
Las frecuencias allicas no cambian de generacin en
generacin (equilibrio allico)
Las frecuencias genotpicas no cambian de generacin en
generacin (equilibrio genotpico). Despus de una generacin
de apareamiento aleatorio, se alcanzan las frecuencias
genotpicas de equilibrio
Sistema conservativo, anlogo al principio de inercia. Solucin al
problema de cmo se conserva la variacin gentica
Modelo nulo por excelencia: Aunque las desviaciones son difciles
de detectar, cualquier desviacin es una indicacin de que algo pasa
en la poblacin
Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

27

Demostracin de la ley de Hardy-Weinberg Frecuencia cigotos (progenie)

Apareamiento

Frecuencia
apareamiento

AA

Aa

aa

P2

AA x Aa

2PQ

AA x aa

2PR

Aa x Aa

Q2

Aa x aa

2QR

aa x aa

R2

P = f(AA)
Q = f(Aa) AA x AA
R = f(aa)

Totales prxima generacin

P = P2 + 2PQ/2 + Q2/4 = (P + Q/2)2 = p2


igualmente se demuestra que Q = 2pq y R = q2

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

28

Grfico de p2, 2pq y q2.

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

29

Prueba de ajuste a Hardy-Weinberg

Frecuencia allica M = 6611/12258 = 0,53932 = p


Frecuencia allica N = 5647/12258 = 0,46068 = q
Frecuencia esperada
Nmero esperada
(Frecuencia X 6129)

p2 = 0,2908 2pq = 0,4969 q2 = 0,2122


1782,7

3045,6

1300,7

1,000
6129

(nmero observado nmero esperado ) 2


X
0,04887
nmero esperado
2

Dr. Antonio Barbadilla

02, 05;1g .l . 3,84

Tema 17: Gentica Poblaciones I

30

Generalizacin del Equilibrio de Hardy-Weinberg


Dominancia

Se puede estimar las frecuencias allicas si suponemos que


la poblacin est en equilibrio Hardy-Weinberg. Ej. Individuos con
fenotipo Rh+ 85%. Si suponemos H-W la frecuencia del alelo Rh+ es
del 85.8%

Mltiples alelos
Ejemplo, 3 alelos con frecuencias p,q y r. Las frecuencias
genotpicas son las que resultan de las expansin (p+q+r) 2 = p2 +
2pq + 2pr + q2 + 2qr + r2

Un gen ligado al X

Dr. Antonio Barbadilla

A1 A1

A 1 A2

P2

2pq

A2A2
2
q
Tema 17: Gentica Poblaciones I

A1

A2

31

Desviaciones del apareamiento aleatorio


Apareamiento clasificado: los distintos fenotipos
no se aparean al azar
positivo: tendencia a aparearse con fenotipos
semejantes (altura, color de piel,...)
negativo: tendencia a aparearse con fenotipos
opuestos
Endogamia: cuando el cruce entre parientes es
ms comn de lo que se espera por azar (exogamia
es el concepto opuesto)
Diferencias entre ambos conceptos: el apareamiento clasificado afecta
a los fenotipos preferidos, mientras que la endogamia afecta a todo el
32
Tema 17: Gentica Poblaciones I
genoma

Dr. Antonio Barbadilla

Consecuencias de las desviaciones del


apareamiento aleatorio
Desviacin de las frecuencias genotpicas de las
esperadas por Hardy-Weinberg
Mayor homozigosidad: apareamiento
clasificado positivo y endogamia
Mayor heterozigosidad: apareamiento
clasificado negativo
No cambio en las frecuencias allicas

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

33

Problemas de exmenes pasados


En una poblaci que est en equilibri de Hardy-Weinberg, la freqncia de lal.lel A s de 0,7 i la de lal.lel a s de 0,3. a)
Quin percentatge de la poblaci ser homozigtica? b) Quines seran les freqncies gniques i genotpiques desprs duna
generaci, si solament sencreuen els heterozigots?
Si el 4% dels individus duna poblaci que es troba en equilibri Hardy-Weinberg manifesta un fenotip recessiu, quina s la
probabilitat de que un descendent de dos individus que no expressin aquest carcter recessiu, si que lexpressi?
En una poblaci animal, el 20% dels individus sn AA, el 60% sn Aa i el 20% sn aa. Quines sn les freqncies al.lliques?
En aquesta poblaci els encreuaments sempre sn entre fenotips semblants, per dins de cada grup fenotpic s a latzar.
Quines freqncies genotpiques i al.leliques hi haur a la segent generaci?
En una poblaci humana constituida per 100.000 individus, el 40% sn del grup sanguini A, el 28% del B, el 25% de l'AB i la
resta del 0. a) Calculeu les freqncies gniques i genotpiques. b) En quin supsits us heu basat per respondre l'apartat
anterior?
Comenteu lefecte que t la deriva gentica en les poblacions naturals. De qu depn la fora de la deriva gentica?
Expliqueu dos casos tpics de deriva gentica, illustrant-los amb exemples reals.
El daltonisme s causat per un al.lel recessiu lligat al sexe. Un de cada deu homes s daltnic. Si suposem que la poblaci
est en equilibri de Hardy-Weinberg, a) Quina s la proporci de dones daltniques? b)
Quants homes daltnics hi ha per
cada dona daltnica? c) En quina proporci de les parelles afectar el daltonisme a la meitat dels fills de cada sexe? d) Quina
s la proporci de parelles en les que tots els fills sn normals?

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

34

Links de inters

Web
Web de
de gentica
gentica de
de poblaciones
poblaciones (A.
(A. Barbadilla)
Barbadilla)

Ensayos
Ensayos de
de evolucin
evolucin (A.
(A. Barbadilla)
Barbadilla)

EvoTutor:
EvoTutor: Learning
Learning through
through interactive
interactive simulation
simulation
(on
(on line
line yy off
off line)
line) Sitio
Sitio excelente
excelente para
para aprender
aprender los
los
procesos
procesos gentico
gentico poblacionales
poblacionales mediante
mediante simulacin
simulacin

Calculadora
Calculadora de
de Hardy-Weinberg
Hardy-Weinberg

Dr. Antonio Barbadilla

Tema 17: Gentica Poblaciones I

35