Está en la página 1de 46

GENTICA Tema No. 2: El genoma humano y su estudio.

Dr. Wilmer Delgado Luengo


Magster en Gentica Mdica Doctor en Ciencias Mdicas Prof. Titular

El genoma humano y su estudio.


DEFINICIONES

Genoma: Conjunto total del material gentico hereditario presente en una clula, tanto nuclear como extranuclear, codificante o no.
Clase de material gentico: cido Desoxirribonucleico (ADN): la > de los organismos. cido Ribonucleico (ARN): algunos virus. Tipo de material gentico: Codificante: Genes.
Codifica toda la informacin celular (metabolismo, fisiologa, morfologa, comportamiento, embriognesis, crecimiento y desarrollo fsico y mental, reproduccin, entre otras).

No Codificante: intergnico e intragnico. Ubicacin del material gentico (Eucariotas):


Nuclear Mitocondrial 2

El genoma humano y su estudio.


Organismos Procariotas:
Eubacterias y arqueobacterias Clulas pequeas (0,2-5 m) Membrana plasmtica + pared celular. Carecen de compartamentalizacin celular (membrana nuclear, orgnulos). Genoma pequeo y sencillo. Un cromosoma circular de ADN, suspendido en el citoplasma. Plsmidos: material gentico de ADN extra, circular, no esencial.
Resistencia a los antibiticos o materiales txicos. Replicacin autnoma, sin coordinacin con la divisin celular.

El genoma humano y su estudio.


Organismos Eucariotas:
Multicelulares: animales y plantas. Unicelulares y multicelulares simples: Protozoarios, hongos y algas. Membrana celular, pared celular (plantas), citoesqueleto. Compartamentalizacin celular.

El genoma humano y su estudio.


Ncleo:
Doble membrana nuclear. Genoma Nuclear
Ciclo celular:
Interfase: Cromatina.Filamentoso y disperso. Divisin Celular: Cromosoma.

Contiene ~ 90% del ADN. Organizado en cromosoma, en tamao y n variable, segn la especie. Magnitud del genoma:
En n de cromosomas: Haploides: n Diploides: 2n En longitud: pb (pares de bases) nt (nucletidos) 5

LEPTOTENO ZIGOTENO PAQUITENO DIPLOTENO DIACINSIS

El genoma humano y su estudio


COMPARACIN DEL GENOMA NUCLEAR Y MITOCONDRIAL
G Nuclear G Mitocondrial

Tamao
N de Mol Dif. Forma

3000 Mb
24 (X,Y) Lineal

16,6 Kb
1 Molcula Circular

N total de Mol

23 cromosomas (haploides) 46 cromosomas (diploides)


Histonas

Miles

Proteinas asociadas

Ninguna

N de genes

<30000

37

El genoma humano y su estudio


G Nuclear ADN repetitivo Transcripcin Intrones ADN Codificante Recombinacin Abundante Individual Presentes 1,5 % Presente G Mitocondrial Escaso Policistrnica Ausentes 95 % Ausente

Herencia

Mendeliana

Materna

El genoma humano y su estudio


CONSTITUCIN Azcares: 2-Desoxiribosa Ribosa cido Fosfrico: Monofosfato Difosfatos Trifosfatos

10

11

12

El genoma humano y su estudio

13

14

El genoma humano y su estudio

15

El genoma humano y su estudio

16

El genoma humano y su estudio

17

El genoma humano y su estudio


Cdigo Gentico:
Cuatro Nucletidos: A, G, C y T (U). Codn o Triplete: lectura de la secuencia de ADN o ARN de tres en tres nucletidos. Combinaciones posibles de tres nucletidos = 64 codones. 64 Codones: 61 codones: codifican para 20 aminocidos biolgicamente importantes. 3 codones de Terminacin (paro o sin sentido): UAA, UAG y UGA. No codifican para ningn aminocidos. Origina la finalizacin de la sntesis de protenas. Codn de Inicio: AUG: Codifica nicamente para Metionina (Met) La sntesis, de la mayora de las protenas, se inicia con Metionina.

18

19

El genoma humano y su estudio


CDIGO GENTICO: Degenerado: Un aminocido puede ser codificado por mas de un codn (codones sinnimos). Disminuye la posibilidad de que mutaciones puntuales puedan provocar la incorporacin de un aminocido distinto, y por ende, prdida de la funcin proteica. Universalidad: Inicialmente se crea que exista una correspondencia entre codones y aminocidos, independiente del organismo estudiado. Casi universal: Hay excepciones, pocas, a la regla. Los procariotas, eucariotas y mitocondrias de plantas, comparten el mismo cdigo gentico. Un antepasado comn. 20

El genoma humano y su estudio


Niveles de Organizacin (Condensacin, Empaquetamiento) del ADN.

21

El genoma humano y su estudio


Niveles de Organizacin (Condensacin, Empaquetamiento) del ADN.

22

El genoma humano y su estudio


Niveles de Organizacin (Condensacin, Empaquetamiento) del ADN.

23

El genoma humano y su estudio


Heterocromatina:
Aspecto: Se tie intensa/. Condensacin: mxima Clasificacin: Constitutiva: Permanente/ condensada en todo el ciclo celular, a excepcin durante su replicacin. Ej: Centromeros y telomeros. Facultativa: Puede pasar a eucromatina bajo ciertos estmulos. Ej: Cromos. X. Al final de la fase G2 toda la cromatina esta como heterocromatina. Transcripcionalmente inaccesible.

Eucromatina:
Aspecto: Se tie debilmente y de manera difusa. Condensacin: menos condensada. Transcripcionalmente accesible: la molcula de ADN es accesible a protenas (factores de transcripcin, ADN polimerasas, ARN polimerasas, entre otras). Expresin gnica.

24

El genoma humano y su estudio

25

El genoma humano y su estudio

26

El genoma humano y su estudio

27

El genoma humano y su estudio

28

El genoma humano y su estudio


Clasificacin del genoma Humano segn su organizacin:
ADN de copia nica: Secuencias nucleotdicas (exones) presentes una vez o muy pocas veces en el genoma. ADN repetitivo: Secuencias nucleotdicas (intrones) repetidas en nmero variable.

29

El genoma humano y su estudio


ADN repetitivo: repeticiones de cientos a millones de veces en el genoma. Clasificacin:
ADN disperso:
20 % del genoma Repeticin regular: cada 4 Kb. Ejemplos: secuencia Alu (familia Alu), secuencia

Kpn, (familia Kpn),

30

El genoma humano y su estudio


ADN satlite: 10 % del genoma Secuencias repetidas en tandem. Clasificacin: ADN--satlite: unidad de repeticin de 171 pb. Repeticiones en millones de veces en el genoma. ADN minisatlite o VNTR: Unidad de repeticin entre 10 y 70 pb, Repeticiones de miles de veces en el genoma. ADN microsatlite, o STR: unidad de repeticin 2 - 4 nucletidos. Repeticiones: cientos de veces en el genoma.
31

El genoma humano y su estudio

32

El genoma humano y su estudio

33

El genoma humano y su estudio

Homocigoto: ambos alelos de un par de cromosomas homlogos son idnticos. Heterocigoto: ambos alelos de un par de cromosomas homlogos son diferentes.
Heterocigoto simple. Heterocigoto compuesto. Hemicigoto: El hombre por tener un (01) solo cromosoma X y un (01) cromosoma Y es Hemicigoto para casi todos los alelos de los cromosomas X y Y, a excepcin de los alelos localizados en las regiones pseudoautosmicas.

34

El genoma humano y su estudio


Genotipo: la constitucin genmica de un organismo.
Fenotipo: conjunto de rasgos o caracteres INTERNOS O EXTERNOS (morfolgicos, anatmicos, fisiolgicos, bioqumicos y moleculares) resultantes de la expresin del genotipo. El trmino implica la interaccin entre el genotipo y el medio ambiente. Medio Ambiente: conjunto de factores internos y externos al organismos que influyen sobre su genotipo con la consiguiente expresin fenotpica.
35

OMIM ntry Statistics:


Number of Entries in OMIM (Updated 23 July 2012) : Autosomal X Linked Y Linked Mitochondrial

Prefix * Gene description + Gene and phenotype, combined # Phenotype description, molecular basis known % Phenotype description or locus, molecular basis unknown Other, mainly phenotypes with suspected mendelian basis Totals

Totals

13,241 142

643 5

48 0

35 2

13,967 149

3,240

262

28

3,534

1,627

135

1,767

1,779

125

1,906

20,029

1,170

59

65

21,323

36

El genoma humano y su estudio


Mutacin:
Alteracin o cambio en la secuencia del ADN:
Genoma Nuclear o Miticondrial Codificable (gen estructural) o no codificable (regulacin de la expresin gnica) Heredable (clulas germinales) o no (clulas somticas). Principal causa de variabilidad gentica. Importancia:
Evolucin de las especies. Identidad gentica de un individuo.
Heredobiolgicas Identificacin de individuos. Pruebas forenses. Migraciones humanas.

Diagnstico de enfermedades:
Propsito. Dx Prenatal.

Tratamiento de enfermedades:
Cncer. Clulas madres.
37

38

El genoma humano y su estudio

39

El genoma humano y su estudio


La reaccin en cadena de la polimerasa (PCR) Obtencin millones de copias de un fragmento mediante la amplificacin selectiva in vitro de ADN, basada en las propiedades de desnaturalizacin, renaturalizacin e hibridacin del ADN.
Primers Taq polimerasa Desnaturaliz acin 95C
n ciclos

dntp s

Alineacin 45C

Extensin 72C

2 nuevas copias

40

El genoma humano y su estudio


Tecnologa del ADN Recombinante: Enzimas de Restriccin Clonaje Molecular Vectores de Clonacin
Plasmidos Bacterifagos YACs (Plsmido de gran tamao) Cosmidos (Plsmidos + Fago)

ER
AGTTGTACCTCACTTGGAAAAA TCAACATGGAGTGAACCTTTTT AGTTGTA TCAACAT CCTCACTTGGAAAAA GGAGTGAACCTTTTT

41

El genoma humano y su estudio


ANEMIA FALCIFORME

A: S:

CCT pro CCT pro CCT pro

GAG GAG glu glu GTG val AAG lys GAG glu GAG glu
42

C:

El genoma humano y su estudio


Diagnstico Molecular Distrofia Muscular Duchenne/Becker

43

El genoma humano y su estudio


Diagnstico Molecular Fibrosis Qustica: F508
cN cH feto cF508

98 pb 95 pb

Alelo Normal: 98 pb Alelo Mutado: 95 pb

44

El genoma humano y su estudio


CASO DE PATERNIDAD: D1S80

45

GRACIAS

46

También podría gustarte