Está en la página 1de 62

APLICACIN DE LA GENETICA A LA MEJORA DE CEPAS

Mutaciones: algunas definiciones


Cualquier cambio heredable en la secuencia del material gentico se denomina mutacin Las mutaciones son el origen de todos los polimorfismos heredables(presencia de dos o ms variantes heredables para una misma caracterstica que coexisten dentro de una poblacin). Las mutaciones en un gen determinado crean variantes de este gen, denominadas alelos La constitucin gentica de los individuos se denomina genotipo Los rasgos observables o medibles de un individuo se denominan fenotipo El fenotipo es consecuencia del genotipo

TIPOS DE MUTACIN SEGN EL MECANISMO CAUSAL

Por sustitucin de bases molecular

Por inserciones o deleciones de bases

Inversiones Deleciones o duplicaciones Translocaciones

Por Mutacin

cromosmica

Poliploida genmica Aneuploida

Las alteraciones de la dotacin diploide de cromosomas se denominan aberraciones cromosmicas o mutaciones cromosmicas.
Hay 3 tipos de mutaciones cromosmicas: 1. Reordenamientos cromosmicos: implican cambios en la estructura de los cromosomas (duplicacin, deleccin, inversin y traslocacin). 2. Aneuploidas:supone un aumento o disminucin en el nmero de cromosomas. 3. Poliploidia: presencia de conjuntos adicionales de cromosomas. La aneuploidia: da lugar a monosomas, trisomas, tetrasomas, etc. La poliploidia: dotaciones de cromosomas pueden tener orgenes idnticos o distintos, dando lugar a autopoliploides y alopoloploides respectivamente. Las deleciones y duplicaciones pueden modificar grandes segmentos del cromosoma. Las inversiones y translocaciones dan lugar a una pequea o ninguna prdida de informacin gentica.

Los lugares frgiles son constricciones o brechas que aparecen en regiones particulares de los cromosomas con una predisposicin a romperse en determinadas condiciones. El estudio de las series normales y anormales de cromosomas se conoce como citogentica-

El origen de las mutaciones


Espontneas
Debidas a procesos celulares normales Dependen de la tasa de error de la DNA polimerasa y de la eficiencia de los sistemas de reparacin Suceden con baja frecuencia

Inducidas
Debidas a agentes fsicos o qumicos (mutgenos) que daan las molculas de DNA El tipo de dao es especfico del mutgeno La frecuencia de mutacin es funcin de la dosis de mutgeno

A modo de resumen
Los informacin gentica, responsable de la herencia, se encuentra almacenada, salvo raras excepciones, en el DNA Esta informacin se encuentra en unidades funcionales, llamadas genes, que se agrupan en molculas de DNA de gran tamao para formar cromosomas El genoma de un organismo es el conjunto de cromosomas que contiene La informacin gentica adquiere funcionalidad mediante su expresin para fabricar protenas La replicacin del DNA garantiza la transmisin de la informacin gentica a sucesivas generaciones Sin embargo, los genomas son plsticos, y estn sometidos a alteraciones a lo largo del tiempo que aumentan la diversidad

Ideas emergentes
Algunas propiedades del DNA (p. ej., su disociacin y reasociacin) sirven de base para el desarrollo de tcnicas encaminadas a la manipulacin del DNA El mecanismo general de replicacin del DNA es universal e independiente de la secuencia de ste. Es posible replicar cualquier molcula de DNA en cualquier organismo, siempre que incluya las seales necesarias para la replicacin de dicho organismo Los procesos naturales relacionados con la replicacin, reparacin y expresin del DNA proporcionan una batera de enzimas de inters potencial para la manipulacin del DNA in vitro Los procesos de expresin gnica (transcripcin y traduccin) estn universalmente conservados, por lo que un gen codifica el mismo producto gnico en todos los organismos. La posibilidad de mutar los genes a voluntad para obtener fenotipos especficos (mutagnesis dirigida) es una potente herramienta para estudiar la funcin de los productos gnicos.

RECOMBINACIN

INTRODUCCIN Recombinacin gentica: reordenaciones del DNA 1-Recombinacin gentica homloga: intercambio gentico de 2 molculas de DNA de secuencia homloga (2 copias del mismo cromosoma). 2-Recombinacin especfica de sitio: intercambio en secuencia de DNA particular. 3-Transposicin del DNA: Traslado de un segmento corto DNA a otro lugar del cromosoma.

FUNCIONES DE LA RECOMBINACIN:
1-Reparacin 2-Regulacin de la expresin de genes 3-Segregacin ordenada de los cromosomas durante la divisin cell 4-Mantenimiento de la diversidad gentica

2-RECOMBINACIN GENTICA HOMLOGA

Asociada a la divisin cell


Segregacin ordenada de los cromosomas y reparacin

Ocurre en la meiosis: cell germinal diploide se divide para producir gametos haploides

Obtencin de organismos genticamente idnticos

En el campo de la Ingeniera gentica consiste en aislar y multiplicar un gen, o en general, un trozo de ADN

En Animales superiores consiste en obtener un individuo a partir de una clula o de un ncleo de otro individuo

La ingeniera gentica, conocida tambin como manipulacin gentica, surge en los aos 70 (siglo XX) cuando se consigue introducir material gentico de una especie en clulas de otra especie muy distinta.

La biotecnologa manipula y modifica microorganismos o clulas obtenidas de animales y plantas en el mbito industrial (medicina, farmacia). No se incluyen actividades que manipulen animales o plantas enteras, aunque stas son necesarias posteriormente.

En la naturaleza se produce una transferencia de material gentico entre bacterias, fenmeno llamado transformacin. La transferencia de forma artificial se realiza mediante la tcnica del ADN recombinante. A sta se han ido sumando otras tcnicas de ingeniera gentica que se analizan seguidamente.

Ingeniera gentica
Conjunto de tcnicas nacidas de la Biologa molecular que permiten manipular el genoma de un ser vivo
cromosoma

Homo sapiens

gen

Mediante la ingeniera gentica se pueden introducir genes Escherichia coli en el genoma de un individuo que carece de ellos

Se basa en la capacidad de ciertas bacterias que contienen enzimas llamadas restrictasas o endonucleasas de restriccin (actualmente se comercializan ms de cien enzimas diferentes) que cortan el ADN por sitios especficos que reconocen, obtenindose fragmentos de restriccin. Para que se puedan unir despus los fragmentos de ADN extrao y el ADN que se utilizar como vector, se han de cortar ambos con la misma restrictasa. Comparando dichos fragmentos, se construyen los mapas de restriccin, los cuales se usan para comparar genomas de especies diferentes y establecer cambios evolutivos as como para detectar mutaciones cromosmicas como delecciones e inserciones.
Restrictasa (Bacteria origen) EcoR1 (Escherichia coli) Secuencia reconocida ...G-A-A-T-T-C... ...G-T-T-A-A-G... Fragmentos de restriccin A-A-T-T- C... G... G... ...C-T-T-A-A

Cuadro I: Fragmentos de restriccin originados por la enzima EcoRl

La transformacin de bacterias con ADN extrao se produce en muy pocas clulas (baja eficacia) en condiciones de laboratorio. Por ello, se emplean vectores genticos que funcionan como taxistas que transportan a un cliente el ADN recombinante. Los vectores ms usados son:

a) un plsmido (fragmento extra de ADN bicatenario circular de unos 4,3 kb, que existe en algunas especies de bacterias).
b) un csmido (similar al plsmido pero de mayor longitud, unos 40 kb). c) un virus vector ( en este caso el ADN extrao que se quiere transferir se incorpora al ADN vrico y funciona como ADN recombinante). Si la introduccin de ADN extrao se realiza en clulas eucariotas no reproductoras se denomina al proceso transfeccin. Si la introduccin se realiza en clulas reproductoras de plantas y animales, la alteracin gnica va a estar presente en todas clulas del cuerpo, en este caso se habla de transgnesis

La multiplicacin de las clulas que contienen el ADN recombinante (ADNr), ya sea en un plsmido o en un csmido, o en su propio ADN (si se us un virus vector), produce una clonacin de ste, es decir, la produccin de mltiples copias idnticas de ADNr que lleva el gen extrao, una copia en cada clula.
Pero cada clon de clulas tendr un fragmento de ADN extrao distinto. Al conjunto de estas copias de ADNr diferentes se denomina biblioteca genmica. Lo que se tiene que hacer ahora es seleccionar el clon de clulas (colonia crecida en agar) en cuyo interior est contenido el fragmento de ADN con el gen que interesa. Esto se consigue mediante la obtencin de una molcula de ADN complementario (ADNc) a partir de su propio ARNm procedente del gen extrao que se ha expresado.

El siguiente paso es localizar la posicin del gen (regin codificante de protena) que interesa en el fragmento que est clonado en la colonia de clulas seleccionada. Se emplea la tcnica de transferencia de Southern (su inventor fue E.M. Southern). Esta tcnica se basa en la obtencin de fragmentos de restriccin del clon seleccionado y el tratamiento con ADNc radiactivo que hibridar con la regin transcrita del gen porque el ADNc se ha obtenido a partir del ARNm producido en la transcripcin de las clulas del clon seleccionado. Como el ADNc se ha construido con istopos radiactivos funciona como una sonda y marcar en una autorradiografa la posicin de los fragmentos que hayan hibridado (unin segn bases complementarias de los nucletidos) con el ADNc radiactivo. En esta tcnica se basa el procedimiento para la obtencin de "huellas genticas".

Tecnologa del ADN recombinante


Aislamiento y manipulacin de fragmentos de ADN de un organismo para introducirlo en otro (ADN recombinante)

Nathans D., Arber W., y Smith H. (premio Nobel de Fisiologa y Medicina en 1978 por el descubrimiento de las enzimas de restriccin y su aplicacin en Gentica Molecular)

Tecnologa del ADN recombinante


Molcula A Molcula B

Digestin de ambas molculas con la misma enzima de restriccin, BamHI Extremos cohesivos Mezclar

Tratar con ADN-ligasa

ADN recombinante

Reaccin en cadena de la polimerasa (PCR)


En 1983 Kary Mullis da a conocer esta tcnica y en 1993 recibi el Premio Nobel de Qumica por este descubrimiento

Es un proceso cclico (cada ciclo consta de 3 pasos)


94C desnaturalizacin (separacin de las dos hebras de ADN) 50C Anillamiento de "cebadores"

72C copia de cada una de las hebras de ADN por la ADN polimerasa

35 ciclos

236= 68 billones de copias

Mediante la tcnica de la reaccin en cadena de la polimerasa (PCR en ingls) se pueden obtener grandes cantidades de ADN que permiten diferentes anlisis, a partir de cantidades mnimas. Se basa en el proceso de replicacin del ADN, para ello se utilizan unos oligonucletidos que se han de disear como cebadores que inician la replicacin "in vitro". La replicacin se repite multitud de veces duplicando en cada ciclo la cantidad de ADN obtenido. Esta sntesis artificial de ADN se ha de realizar a altas temperaturas para que las dos cadenas de ADN no se enrollen entre s, lo cual puede realizarse gracias a una enzima ADN polimerasa obtenida de una bacteria termfila. Esta tcnica tiene mltiples utilidades: realizar pruebas de paternidad o averiguar la autora de un delito; diagnosticar enfermedades hereditarias antes del nacimiento, analizar restos de tejidos en huesos para hacer estudios filogenticos; realizar secuenciaciones de genomas (mucho ms rpido que a partir de la clonacin en clulas), etc.
Figura 1: Clonacin de ADN por la reaccin en cadena de la polimerasa

Plsmido

Plsmidos
gen de resistencia a la ampicilina

2
Extremos cohesivos

Molcula de ADN recombinante

Plsmido

Virus

Ciclo lisognico

Ciclo ltico

(f)

(g)

(h)

Genoma de hongos: 44 millones de pares de bases Huesped: Escherichia coli Vector: Bacterifagos capacidad: 20 mil pares de bases

Genoma humano: 3000 millones de pares de bases Huesped: Saccharomyces cerevisiae Vector: YAC (cromosoma artificial de levadura) MegaYAC (capacidad: 1 milln de pares de bases)

La tcnica de la clonacin de ADN ha permitido obtener gran cantidad de este cido nucleido para que pueda realizarse su secuenciacin y conocer la composicin qumica de cada gen, conocimiento que se considera de incalculable valor. Esto ha posibilitado la obtencin de secuencias de genomas completos (son cada vez ms los organismos y virus que son secuenciados, incluida la especie humana). La tcnica de Sanger (o del didesoxi), que es como se llama, se basa en la sntesis de ADN, usando como molde una versin monocatenaria del ADN que va a ser secuenciado. La tcnica utiliza cuatro nucletidos especiales, los didesoxinucletidos (de aqu el nombre de la tcnica) que provocan la terminacin de la sntesis de fragmentos de ADN, los cuales segn su longitud se situarn en distintos sitios en una placa de gel y de ah se deduce la secuencia de nucletidos.

Secuenciacin de genomas

ACTTTGTCCACGGCCTAAGCGTTTTTTGCCC AGTGACTTTGTCCAAC GTCCAACAGTTACCAAGTGACTTTGTCCAC TTTTGCCC AGTGACTTTGTCCA ACGGCCTAAGCGTTTTTTTT


ALINEAMIENTO DE TODAS LAS SECUENCIAS Y RECONSTRUCCIN DEL CROMOSOMA

Deteccin de mutaciones

Mtodo de diagnstico rutinario (relacin entre enfermedad y mutacin puntual)

Secuenciacin de ADNs fsiles

Posibilidad de aislar secuencias de ADN a partir de unas pocas copias (la mayora estn daadas o degradadas)

Diagnstico de enfermedades genticas

Diagnstico prenatal / Diagnstico preimplantacin de enfermedades hereditarias o determinacin del sexo del feto previamente a su implantacin en procesos de fecundacin in vitro

Identificacin de especies y control de cruces entre animales


Para descubrir fraudes comerciales, tales como vender carne de una especie ms barata a los precios de otra ms cara, o el comercio ilegal de especies en peligro

Secuenciacin de genomas

Conocimiento bsico y aplicado de diferentes organismos (incluido el genoma humano)

Obtencin de protenas de inters mdico, comercial, etc...

(insulina, hormona del crecimiento, factores de coagulacin antes se obtenan a partir de los tejidos que las producen o fluidos corporales)

Obtencin de vacunas recombinantes


Extraccin del ADN del virus

(aternativa al uso de organismos patgenos inactivos)

ADN plsmido bacteriano

Integracin del plsmido hbrido en el ncleo de una clula de levadura

La levadura fabrica las protenas vricas con poder inmunolgico

Inyeccin de protenas vricas en un chimpanc

Diagnstico de enfermedades de origen gentico


ADN sano ADN enfermo Conocimiento previo de la secuencia de ADN enfermo

Mediante ingeniera gentica se construye una sonda de ADN, marcada (marcaje fluorescente), con la secuencia complementaria del ADN enfermo

ADN complementario del ADN enfermo


DIAGNSTICO

Biochip Microarray DNAchip

Si aparecen bandas fluorescentes demuestra que la persona presenta la anomala Hibridacin? Renaturalizacin No hibridacin? del ADN con la sonda fluorescente Desnatura lizacin del ADN ADN de la persona que se quiere diagnosticar

Plantas transgnicas

Agrobacterium tumefaciens es patgena de plantas.Produce tumores


Agrobacterium Plsmido Ti

ncleo cromosoma

Transgnesis= introduccin de ADN extrao en un genoma, de modo que se mantenga estable de forma hereditaria y afecte a todas las clulas en los organismos multicelulares.
Ingeniero gentico natural tras sutitucin de genes onc por genes de inters

inductor de tumores contiene oncogenes (genes onc)

cromosoma clula vegetal tumores Proliferacin de hormonas crecimiento. Se forman tumores en las zonas de la lesin

Resistencia a herbicidas, insectos y enfermedades microbianas


El maz transgnico de Novartis es resistente al herbicida Basta y tambin es resistente al gusano barrenador europeo (contiene el Gen de resistencia a la toxina Bt de Bacillus thuringiensis) produce su propio insecticida Problemas:La toxina Bt en las plantas transgnicas tiene propiedades sustancialmente diferentes a la toxina Bt en su forma natural. La toxina puede ser transmitida a travs de la cadena alimenticia, un efecto que nunca ha sido observado en la toxina Bt en su forma natural. Larvas de especies de insectos predadores benficos (larvas verdes de crisopa) murieron cuando fueron alimentadas con el gusano barrenador europeo Gold rice de Monsanto con color amarillo por los altos niveles de vitamina A

Mejora de la calidad de los productos agrcolas


Produccin de aceites modificados

Sntesis de productos de inters comercial

Anticuerpos animales, interfern, e incluso elementos de un polister destinado a la fabricacin de plsticos biodegradables

Transgnesis en animales

(por microinyeccin de zigotos)

Gen humano

Secuencia promotora para la sntesis de una protena de la leche

Gen hbrido

humano Ovulos de cerda fecundados

rata

Desarrollo de una cerda transgnica

Clonacin de animales

(TRANSFERENCIA NUCLEAR DE CLULAS EMBRIONARIAS)

Clonacin de animales

(TRANSFERENCIA DEL NCLEO DE UNA CELULA SOMATICA: CLULA DIFERENCIADA)

Clonan terneros en EE UU para producir anticuerpos humanos

efe- Washington - agosto 2002

Terneros clonados y manipulados genticamente (fbrica de anticuerpos humanos) genes para anticuerpos humanos recombinantes clulas drmicas clonacin

Objetivo: Tratamiento de enfermedades inmunolgicas Futuro: Tratamiento de una amplia gama de enfermedades ocasionadas por bacterias y virus, como hepatitis, ntrax (utilizada como arma biolgica)

Clonan cerdos destinados a trasplantar sus rganos a humanos

La empresa escocesa PPL Therapeutics logra retirar de los cerditos el gen que provoca el rechazo en transplantes a humanos "alfa 1,3
galactosil transferasa"

Enero 2002. AP Photo/Roanoke Times, Gene Dalton (IDEAL-EFE)

Paso importante en favor del xenotrasplante (transferencia de clulas u rganos de una especie a otra)
Ayudar a superar la escasez de rganos humanos para hacer trasplantes de todo tipo

Un laboratorio de Texas clona al primer animal domstico


"Copycat" es el primer gatito nacido mediante clonacin" El experimento abre las puertas de la clonacin masiva de animales domsticos, un fin sin explorar cuya sola posibilidad haba desencadenado ya el almacenamiento de clulas de mascotas por parte de sus ricos propietarios

febrero 2002 Universidad College Station (Texas)

El sexto da El ataque de los clones

La clonacin humana ya se est intentando de forma clandestina por varios laboratorios en el mundo La clonacin reproductiva no arroja los resultados suficientes, no existen garantas como para decir 'Vamos a clonar un ser humano' Por cada intento de clonacin hay detrs miles de fallos, abortos y malformaciones genticas Para obtener a Dolly: 277 fusiones de ovocitos con clulas mamarias, solo 29 embriones fueron aptos. De estos solo uno result un xito

CREACIN DE UN EMBRIN ARTIFICIAL (con clulas adultas) -embrin somticoOBJETIVO LTIMO: TRATAMIENTO de ENFERMEDADES 1 Cultivo de blastocisto OBJETIVO LTIMO: AUTOTRASPLANTES (no hay rechazo) Fecundacin

2 Eliminacin de la capa externa Embrin temprano

3 Adicin de sustancias que disgregan la masa celular interna

Fusin de clula somtica y ovulo enucleado En caso de existir deficiencias a nivel gentico se puede hacer terpia gnica a nivel de clulas madre

4 Transferencia de los agregados celulares a un nuevo pozo

6 Adicin de factores de diferenciacin seleccionados

7 Administracin de clulas diferenciadas a tejidos daados 5 Formacin de clulas diferenciadas a tejidos daados

Las clulas madre abren la posibilidad a un nuevo mundo en las terapias de los trasplantes
Calificada como una tcnica "ineficaz e imperfecta" por cientficos como Iam Wilmut, "padre" de la oveja Dolly, la clonacin ha encontrado en las clulas "madre" su primera razn de ser. Retos tcnicos 1. Las clulas embrionarias de ratn originan teratomas y teratocarcinomas en animales adultos

2.
3.

Conocimiento de las seales implicadas en el desarrollo y diferenciacin


Asegurar la salud a largo plazo de las clulas a transplantar (edad biolgica de las clulas)

Declaracin Universal de Derecho Humanos y Genoma Humano de la UNESCO (1997), adoptada en 1998 por la Asamblea General de ONU (busca un balance entre una
continuacin en las investigaciones y la salvaguarda de los derechos humanos)

Frente a los mltiples beneficios de la ingeniera gentica pueden surgir algunos problemas

Problemas sanitarios nuevos microorganismos patgenos,


efectos secundarios de nuevos frmacos de diseo, etc...

Problemas ecolgicos

desaparicin de especies con consecuencias desconocidas, nuevas contaminaciones debidas a un metabolismo incontrolado, etc...

Problemas sociales y polticos en el campo de la produccin industrial, agrcola y ganadera,


pueden crear diferencias an ms grandes entre pases ricos y pobres. El sondeo gnico en personas puede llevar a consecuencias nefastas en la contratacin laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona (empleo, agencias de seguros, discriminacin..).

Problemas ticos y morales

Poder conocer y modificar el patrimonio gentico humano puede ser una puerta abierta al eugenismo "Eugenesia: la ciencia del incremento de la felicidad humana a travs del perfeccionamiento de las caractersticas hereditarias".

BIOTECNOLOGIA Aplicaciones industriales Aplicaciones medioambientales Aplicaciones agrcolas, ganaderas pisccolas Aplicaciones mdicas Aplicaciones jurdicas

Existen en la naturaleza unos centenares de especies de microorganismos (bacterias, levaduras, mohos, algas unicelulares) que producen sustancias que presentan algn inters para la especie humana.

Cuadro II: Algunos de los principales productos industriales obtenidos con la ayuda de los microorganismos

Los productos que tienen un inters comercial se pueden agrupar en cuatro clases: a) a) a) a) productos del metabolismo primario( dixido de carbono, etanol, cido actico, aminocidos, etc.). productos del metabolismo secundario (antibiticos, toxinas). macromolculas (polisacridos, enzimas); y clulas microbianas (pienso animal llamado protenas microbianas).

La industria farmacutica produce actualmente toda una gama de sustancias que obtiene de microorganismos como son: sustancias antimicrobianas (sobre todo antibiticos de diversos tipos), vacunas, vitaminas, hormonas peptdicas (como la insulina, la hormona del crecimiento o somatotropina), factores hipotalmicos (como la somatostatina, ver figura) y enzimas.

Figura 2: Sntesis de la somatostatina en

Escherichia coli

El proceso de fermentacin ha sido manipulado por el hombre de diversas formas para obtener toda una serie de alimentos y bebidas. As, por fermentacin lctica se produce queso y yogur; la fermentacin alcohlica se emplea para la elaboracin de pan fermentado (en este caso se aprovechan las burbujas de dixido de carbono para esponjar el pan) y bebidas alcohlicas como el vino, la cerveza (ver figura 3), sidra, etc. En la fermentacin alcohlica se emplean diferentes especies de levaduras (hongos unicelulares) del gnero

Saccharomyces

Figura 3: Produccin de la cerveza

Diversos tipos de industrias utilizan microorganismos para la obtencin de sustancias de inters como aminocidos (cido glutmico en forma de glutamato monosdico usado como potenciador de sabores y aromas); cidos orgnicos como ctrico, actico (utilizado en la fabricacin de acetatos, pelculas fotogrficas, etc.); butanol (empleado en la fabricacin de plastificantes), etanol (como combustible), enzimas como proteasas (usadas en detergentes), etc.

En las industrias mineras se utilizan micoorganismos para extraer por biolixiviacin metales preciosos, metales pesados, uranio y petrleo.

Para la proteccin del medio ambiente se utilizan tcnicas de biorremediacin empleando microbios que son capaces de metabolizar el petrleo en casos de mareas negra y en el lavado de tanques de petroleros; as como para descontaminar aguas residuales de diferente industrias que contengan metales pesados, uranio, hidrocarburos, etc.

Las tcnicas biotecnolgicas se aplican a la agricultura y a la ganadera para obtener mayores cosechas y mejores alimentos con plantas y mayor cantidad y calidad en la cra de ganado, as como evitar el fraude en el consumo de alimentos (comercializar unas especies pisccolas por otras, alimentos transgnicos, etc.). Se trabaja en tres lneas biotecnolgicas: a) para obtener mltiples individuos iguales con una caracterstica que interese. b) Modificacin gentica de especies con caractersticas nuevas (transgnesis) c) Desarrollo de huellas genticas para identificar especies o bsqueda de genes concretos.

La clonacin en plantas se consigue sobre todo mediante la manipulacin de cultivos celulares. La principal tcnica empleada es la micropropagacinn o propagacin vegetativa in vitro, la cual permite clonar en corto tiempo un gran nmero de especies. Este procedimiento se utiliza para la seleccin y produccin de plantas en grandes cantidades, as como para la investigacin en biologa vegetal. Se consigue mediante la obtencin de unos fragmentos o explantes de la planta madre. Los explantes se colocan en un medio de cultivo adecuado y produce un callo (masa de clulas sin diferenciar); los callos pueden dividirse en multitud de fragmentos o incluso hacerse una suspensin de clulas. En el momento que se desee, se cambian las concentraciones de hormonas auxina y citoquinina, esto hace que se diferencien las clulas de los callos con lo que originarn plantas enteras. Esta tcnica puede ser muy til para la conservacin de especies y variedades en peligro de extincin, as como para hacer ms rentables la produccin de flores o de metabolitos secundarios (perfumes, pigmentos, etc.)

Figura 4: Mtodo de obtencin de callos caulinares

Para obtener plantas trsgnicas con genes de otras especies ( sean plantas, microbios o animales) se pueden utilizar dos grupos de tcnicas: las indirectas y las directas.

La ms usada es la transformacin de clulas mediante la bacteria Agrobacterium tumefaciens. Esta bacteria vive en el suelo y produce en las plantas dicotiledneas una enfermedad tumoral llamada "agalla de cuello". Cuando contacta con las clulas de la planta les transfiere un segmento de ADN del plsmido Ti (inductor de tumores) que contiene la bacteria. Este plsmido puede integrarse en uno o ms cromosomas de las clulas vegetales, por lo que puede utilizarse como vector de genes que se deseen introducir en plantas de especies dicotiledneas. La clula que recibe genes extraos puede regenerar una planta entera mediante la tcnica de la micropropagacin y obtener as una planta transgnica. Figura 5: Transferencia de ADN extrao a una clula vegetal mediante el
vector bacteriano Agrobacterium tumefaciens

Entre las diversas tcnicas de transferencia directa de material gentico una de las ms empleadas es la "de la perdigonada" o transformacin biolstica. Se trata de disparar bolitas de oro que llevan fragmentos de ADN adheridos, con una especie de pistola, sobre una poblacin de clulas. Las bolitas que queden en el citoplasma pueden transferir el ADN que transportan a algn cromosoma de la clula bombardeada. Las aplicaciones agrcolas van desde el mejoramiento de procesos bsicos como la fotosntesis y la fijacin de nitrgeno atmosfrico por parte de las plantas, hasta la resistencia a herbicidas, agentes patgenos y factores de estrs (salinidad del suelo, sequa, etc.), as como la obtencin de productos agrcolas de mejor calidad y caractersticas nuevas.
Figura 6: Obtencin de una planta transgnica por transformacin biolstica

La obtencin de un gran numero de animales con alguna caracterstica comn (producir mucha leche, engordar rpidamente, producir lana azul, etc.) es una aspiracin de muchos ganaderos. La forma de conseguirlo es mediante la clonacin con la que se consiguen animales genticamente idnticos. Se usan para ello dos tcnicas:

a) la disgregacin de clulas embrionarias a partir de un embrin, de modo que cada clula separada funciona como un zigoto y originar un animal. b) la transferencia nuclear; sta consiste en obtener vulos enucleados (se les ha extrado el ncleo por microsuccin) y conseguir introducir un ncleo de una clula embrionaria o de una diferenciada (especializada), con esta ltima modalidad se obtuvo la famosa oveja Dolly. Cuanto ms diferenciada est una clula ms difcil es conseguir su reprogramacin para que funcione como un zigoto y origine un nuevo animal.

Obtencin de reses clnicas mediante la transferencia de ncleos de clulas embrionarias de mrula

En los animales el ADN extrao o transgn se introduce en zigotos de modo que el embrin que resulte haya integrado el transgn en todas las clulas y origine un organismo transgnico. Una forma de conseguir la transgnesis es mediante la tcnica de la microinyeccin de zigotos, en la que se inyecta con una micropipeta el material gentico que se desee. Otra posibilidad es utilizar clulas embrionarias en las que se inocula el transgn mediante diversas tcnicas (electroporacin, transfeccin con virus o por microinyeccin).

Aparato de microinyeccin

Las aplicaciones son mltiples, como con las plantas, desde el uso de animales como biorreactores para la produccin de protenas de inters (humanas o de otro tipo), hasta el estudio de genes especficos y la posibilidad de la terapia gnica en humanos.
Cuando el ADN extrao que se introduce no afecta a clulas germinales, sino a las clulas somticas, se denomina al proceso tranfeccin y para conseguirla se usan distintas tcnicas. Las clulas transfectadas tienen gran inters en la obtencin de lneas celulares alteradas capaces de producir compuestos comerciales.
Fases en la transfeccin de ADN segn diversas tcnicas

Este proyecto de investigacin tiene como objetivo averiguar la secuenciacin completa de nucletidos de los 23 pares de cromosomas humanos, para conocer la composicin qumica exacta de todos los genes (genoma) y su ubicacin en cada uno de los cromosomas, as como toda la informacin adicional extra no codificante (el llamado ADN basura) y estudiar su funcin.

En 1997, el Genoma humano fue declarado patrimonio de la Humanidad por la UNESCO, para evitar que se comercialice con l. En junio del ao 2001 se presenta una primera aproximacin de la secuencia completa, descubrindose que tenemos muchos menos genes (unos 30.000) de los inicialmente previstos (100.000).

Ubicacin de algunas enfermedades genticas conocidas en el mapa gentico humano

Las enfermedades genticas debidas a un solo gen defectuoso ascienden a ms de 4000, de las cuales 345 afectan al cromosoma X, por lo que sern transmitidas a los nios varones, si su madre posee uno de esos defectos genticos. La terapia gnica est siendo considerada la cuarta revolucin de la medicina (despus de las medidas de salud pblica, la anestesia, y las vacunas y antibiticos). Para su aplicacin se siguen dos estrategias: a) Insertar una copia sana de un gen en las clulas del paciente con una enfermedad gentica, para compensar el efecto del gen defectuoso ( esto se consigui con una nia que tena una inmunodeficiencia grave). b) Introducir un gen especialmente diseado para que proporcione una nueva caracterstica a las clulas (por ejemplo, introducir en linfocitos un gen que produzca un inhibidor del virus del sida en pacientes afectados por el VIH).

Las vacunas contienen un agente patgeno causante de una enfermedad infecciosa, pero o est muerto o est atenuado (son cepas muy poco virulentas). Tambin se puede vacunar con subunidades del patgeno, stas pueden hoy da fabricarse mediante ingeniera gentica en gran cantidad. Las subunidades son protenas con poder antignico. As, se ha conseguido obtener la vacuna de la hepatitis B mediante la tecnologa del ADN recombinante. El gen de la subunidad proteica del virus de la hepatitis fue introducido en la bacteria Escherichia coli y en la levadura Saccharomyces cerevisiae, las cuales produjeron en cultivo la protena del virus.

Los anticuerpos sirven como defensa frente a enfermedades infecciosas y sustancias extraas, pero adems son un medio de curacin para aquellos enfermos que no son capaces de producirlos. La tcnica de los anticuerpos monoclonales permite obtener gran cantidad de ellos y sin impurezas; consiste en inmortalizar las clulas responsables de su fabricacin, las clulas plasmticas que se forman por activacin de los linfocitos B. La forma de conseguirlo es hibridando clulas plasmticas y clulas tumorales con capacidad para multiplicarse indefinidamente (clulas de mielomas), el resultado son clulas hbridas llamadas hibridomas que se pueden clonar. Cada clon (procedente de un solo hibridoma) producir un anticuerpo monoclonal.

La biotecnologa se puede aplicar a otras facetas de la vida social adems de las mencionadas. De entre todas ellas es de destacar su utilizacin en relacin con el derecho y la ciencia forense.

En el esclarecimiento de un crimen puede ser crucial la prueba que aporte el bilogo forense al determinar la huella gentica del criminal a partir de un resto de saliva en un cigarrillo (contiene clulas de la mucosa bucal), una mancha de sangre (leucocitos), restos de semen (espermatozoides) o un simple pelo (clulas del folculo piloso). La tcnica que se aplica es la del perfilado del ADN o prueba del ADN . Se basa en la presencia de regiones en el material gentico no codificante que se denominan minisatlites , y que contienen muchas repeticiones en tndem de una pequea secuencia de nucletidos. Para su deteccin se utilizan sondas gnicas (oligonucletidos marcados con tomos radiactivos), de modo que cada sonda detecta un minisatlite. Estos minisatlites son de diferente longitud en cada persona puesto que el nmero de repeticiones en tndem es variable. La huella gentica tambin puede utilizarse para realizar pruebas de paternidad y para identificar a personas desaparecidas de las que se tengan sus huesos; esto ocurri con los restos seos de los miembros de la familia del ltimo zar de Rusia asesinados por los bolcheviques.
Tcnica utilizada en la prueba del ADN

La posibilidad de clonar animales mamferos, tanto a partir de clulas embrionarias como de clulas diferenciadas (caso de la oveja Dolly), abre la puerta para la clonacin de humanos. Para mayor polmica se publica en 1993 un experimento de clonacin humana hecho con embriones humanos que no podran haber sobrevivido, pero que mediante la disgregacin de sus clulas se obtuvieron 48 embriones clnicos (idnticos genticamente) que fueron posteriormente destruidos. Clonar personas enteras est prohibido en muchos pases y condenado por muchas instituciones, pero clonar tejidos humanos con fines teraputicos es pedido por multitud de cientficos, sobre todo desde que se puede dirigir la diferenciacin de clulas madre hacia la obtencin de tejidos concretos.

Tcnica de clonacin