Está en la página 1de 20

Inhibicin de PCR

Inhibidores son materiales que son coextrados o inhiben la extraccin de ADN Trabajan
Interfiriendo con la ruptura de la clula Degradando enlazando cidos nuclicos Degradando enlazando la polimerasa Interfiriendo con las condiciones de reaccin de PCR

Ejemplos de inhibidores
Fuente Sangre Pelo Heces Tierra Orina Mahones Inhibidor Hematina Melanina Sales biliares, sacridos sustancias hmicas urea tintes textiles

Mecanismos de Inhibicin
Ruptura de clula no exitosa Degradacin caputra de ADN Inhibicin de polimerasa
Inhibidores bloquean el sitio activo de la polimerasa Afecta procesamiento de enzima
http://www.cat.cc.md.us/courses/bio141/lecguide/unit4/genetics/protsyn/regulation/comp.html (accesado Agosto 2004)

Estudio de Inhibidor
Inhibidores de PCR: hematina, indigo, melanina, cido hmico, colgeno, calcio Presente en muestras degradadas Ej. muestras de hueso, muestras expuestas a condiciones ambientales Cal es el efecto del tamao de picos y secuencia en inhibicin de PCR? En qu niveles ocurre inhibicin?

Efecto Cuando se Aumenta la Concentracin de cido Hmico (25 L de volumen de reaccin de PCR)
Big Mini
CSF1PO TH01 TPOX D7S820 vWA D21S11 TH01

CTTv
TPOX CSF1PO

FGA

0 ng

0 ng

5 ng 5 ng
RFU

10 ng 10 ng 15 ng 15 ng

Tamao en pares de bases

Efecto Cuando se Aumenta la Concentracin de ndigo: (25 L de volumen de reaccin de PCR) Big Mini
CTTv
TPOX TH01 CSF1PO

0 M

FGA

D21S11 D7S820

vWA

TPOX TH01

CSF1PO

0 M

200 M

200 M

RFU

280 M

280 M

300 M

300 M

Tamao en pares de bases

Colgeno: Big Mini (500 pg de ADN)


THO1, TPOX, CSF1P0, FGA, D21, D7

Colgeno: CTTv (500 pg de ADN)


vWA, THO1, TPOX,

0 ng

0 ng

CSF1P0

200 ng

200 ng

500 ng

500 ng

600 ng

600 ng

Inhibidores de PCR
En el proceso de PCR, la enzima se mueve a lo largo de la cadena de ADN, aadiendo bases complementarias Si hay inhibidores presente, el proceso no funciona-porqu? En nuestros estudios, la falta parece ser ms una funcin de secuencia que de tamao de pico Mecanismos de inhibicin pueden variar y en muchos casos-tierra y hueso-por ejemplo, ambos degradacin e inhibicin pueden estar presente

Inhibicin puede ser dependiente de secuencia, pero no dependiente en tamao


THO1, TPOX, CSF1P0, FGA, D7, D21

0 ng

Inhibicin por cido Hmico Big Mini 500pg de ADN Genmico Humano

5 ng 10 ng

15 ng

Punto de fusin de 'primer' de PCR puede ser un factor


Locus F R FGA F R CSF1PO F R D21S11 F R TPOX F R D7S820 F R TH01 Secuencias de 'primers' de Big Mini (5'-3') Tm(C) 61.0 62.8 55.9 56.6 52.4 53.6 55.8 56.5 60.0 61.0 58.9 58.6

6FAM-CCTGTTCCTCCCTTATTTCCC GTTTCTT GGGAACACAGACTCCATGGTG 6FAM-AAATAAAATTAGGCATATTTACAAGC GCTGAGTGATTTGTCTGTAATTG VIC-ACAGTAACTGCCTTCATAGATAG GTGTCAGACCCTGTTCTAAGTA VIC-ATTCCCCAAGTGAATTGC GGTAGATAGACTGGATAGATAGACGA NED-CTTAGGGAACCCTCACTGAATG GTTTCTT GTCCTTGTCAGCGTTTATTTGC NED-GAACACTTGTCATAGTTTAGAACGAAC GTTTCTT TCATTGACAGAATTGCACCA

Concentracin Inhibitoria Mnima


INHIBIDOR (ADN inicial) Hematina ndigo Melanina cido Hmico Colgeno Calcio Big Mini (500 pg) 0.76 M 280 M 4 ng 15 ng 800 ng 1000 M Mini 2 & Mini 4 (250 pg) 0.50 M 280 M 4 ng 12.5 ng 600 ng 800 M CTTv (500 pg) 0.50 M 280 M 4 ng 15 ng 200 ng 800 M

Limpieza para Inhibidores de PCR


Albumina de suero bovino (BSA) - Disminuye inhibicin de PCR haciendo a la enzima ms
eficiente y enlazando ciertos compuestos inhibitorios

Agarosa de temperatura de fusin baja/sephadex/filtracin Disminuye inhibicin de PCR capturando polimeros largos
como ADN, y liberando otros compuestos inhibitorios

Adicin de mayores concentraciones de polimerasa


Saturar inhibidores que enlazan la polimerasa

Dilucin de la muestra
ADN an amplifica, inhibidores estn menos concentrados y enlazan la polimerasa/u otros componentes de la reaccin

Destruccin de inhibidores con NaOH

BSA puede disminiur inhibicin por cido hmico


Figura muestra incremento en concentracin de BSA en un coctel de PCR que contiene 30ng de cido hmico

0 g BSA

1.0 g 2.0 g 2.5 g

Big Mini Volumen de reaccin 25 l, 33 ciclos

Conclusiones
Inhibidores actan de muchas maneras Los ms preocupantes son aquellos que se coextraen con el ADN Estos inhibidores producen varios efectos en la data incluyendo - problemas en balance de picos, amplificacin de secuencia especfica y pobre sensitividad Adicin de BSA y extra polimerasa son mtodos comunes para remediar dicho problema QPCR es un mtodo nuevo que ayuda en la deteccin de inhibicin

Temas Forenses/Anlisis de Mezclas

El Problema de las Mezclas


Autor (MASCULINO)

Musestra de la Escena del crimen

Vctima (FMINA)

See Butler, Forensic DNA Typing: Biology and Technology behind STR Markers, Academic Press, 2001

"Artefactos" Biolgicos de Marcadores STR afectan la interpretacin de las mezclas


Productos 'Stutter' Adicin de nucleotidos 'Non-template' Microvariantes Alelos nulos Mutaciones

Producen picos extra, desbalance de picos, alelos fuera del marcador, alelos ausentes

Productos 'Stutter'
Picos que aparecen primordialmente una repeticin menos que el alelo verdadero como resultado de 'strand slippage' durante la sntesis de ADN 'Stutter' es menos pronunciado en unidades de repeticin con tamaos ms grandes (dinucletidos > tri- > tetra- > penta-) Regiones de repeticin ms largas generan ms 'stutter' Cada producto 'stutter' en sucesin, es menos intenso que el anterior (alelo > repeticin-1 > repeticin-2) Picos 'stutter' hacen el anlisis de mezclas ms complicado

Alelos STR con Productos 'Stutter' 15% es el lmite tpico


Tamao de ADN (bp) Unidades de Fluorescencia
D8S1179 D21S11 D18S51 Allele

Stutter Product 6.3% 6.2% 5.4%

Butler, J.M. (2001) Forensic DNA Typing, Figure 6.1, Academic Press

Origen individual tpico Perfil Heterocigoto de STR de Origen Individual 100% Regin de pico heterocigoto REGIN DE REGIN DE MEZCLA MEZCLA Regin Stutter

Ejemplo de Origen Individual vs. Mezcla de Perfiles de ADN


85%

>70% >70%

9%

<15% <15%
100%

Ejemplo de Mezcla de Perfil de STR

60% 25% Producto 'stutter' ms alto que lo normal (>15%)

>70% >70%
rea de pico ms pequea que la vista normalmente con par de alelos heterocigotos (<70%) 10%

<15% <15%

Butler, J.M. (2001) Forensic DNA Typing, Figure 7.1, Academic Press

Lado incorrecto del alelo para ser un producto 'stutter' tpico

Efecto de 'Stutter' en Anlisis de Mezclas


Flechas apuntan a picos realzados por 'stutter'

D3S1358

vWA

suspect Vctima

FGA

Victim Sospechoso

Crime Scene Escena

Altos Niveles de ADN producen Adenilacin Incompleta


Tamao de ADN (bp)

Relative Fluorescence (RFUs)

-A +A 10 ng template (overloaded)

off-scale

D3S1358

VWA 2 ng template (suggested level)

FGA

Baje [ADN] o mantenga a 60C por 20-40 min para correjir


Butler, J.M. (2001) Forensic DNA Typing, Figure 6.4, Academic Press

Adicin Non-template
La polimerasa will often add an extra nucleotide to the end of a PCR product; most often an A Dependent on 5-end of the reverse primer Can be enhanced with extension soak at the end of the PCR cycle (e.g., 15-45 min @ 60 or 72 oC) Can be reduced with new polymerase Best if there is NOT a mixture of +/- A peaks bad quantitation/poor sensitivity A A

Impacto del nucleotido 5' en Adicin 'Non-Template'


+A +A

5-ACAAG
ltima Base de 'Primer' Rotulo de Tinte Opuesto

+A +A -A -A

5-CCAAG

Alelos Microvariantes
No todos los alelos tienen unidades de repeticin completas Alelos con unidades de repeticin parciales estn designados por el nmero de repeticiones completas seguido de un punto decimal y el nmero de bases en la repeticin parcial Ejemplo: Alelo TH01 9.3 (AATG)6(-ATG)(AATG)3

Microvariantes
Definidos como alelos que no son mltiplos exactos de la estructura bsica de repeticin variantes de secuencia de la estructura de repeticin ambos Pueden existir como insercin, delecin cambio de base Variacin en secuencia pued ocurrir dentro de la repeticin, en la regin adyacente, o en un lugar de enlace de 'primers' Puede causar fallo en PCR debido a polimorfismos en el sitio del 'primer' -- alelos nulos

Deteccin de un alelo microvariante en el 'locus' FGA

1 = S25-L25 = 244.34 - 244.46 = -0.12 bp 2 = SOL - L28 = 257.51-256.64 = +0.87 bp c = |1 -2| = |-0.12-0.87| = 0.99 bp

28.1 28.1

Butler, J.M. (2001) Forensic DNA Typing, Figure 6.5, Academic Press

Tres patrones de picos


Pueden resultar de translocaciones cromosomales (2 copias del mismo gene) of same gen), trisomas, mutaciones somticas Resultado puede ser un grupo de 3 alelos balanceados no dependiente en el tipo de mutacin A menudo, estas anomalas pueden fortalecer antes de debilitar una conclusin Ms de 56 patrones triallicos han sido reportados en todos los 13 'loci' de CODIS

Altura de picos Anormal de la lnea de clulas K562


D21S11 FGA D5S818

Cromosoma 21

Cromosoma 4

Cromosoma 5

TPOX

CSF1PO

D16S539

Cromosoma 2

Cromosoma 5

Cromosoma 16

Butler, J.M. (2001) Forensic DNA Typing, Focus Box 7.1, Academic Press

Patrn de Tres picos en D18S51


AMEL D8S1179 D21S11 D18S51

Butler, J.M. (2001) Forensic DNA Typing, Figure 6.6, Academic Press

10

Alelos Nulos
Alelo est presente en la muestra de ADN pero no puede ser amplificado debido a un cambio en nucleotido en el lugar de enlace del 'primer' Decaimiento allico es un problema porque muestras heterocigotas aparecen como un homocigoto falso Dos grupos de 'primers' de PCR pueden proveer diferentes resultados en muestras que se originan de la misma fuente Este fenmeno impacta las bases de datos de ADN Estudios de concordancia son tpicamente llevados a cabo antes de utiizar un estuche de STR nuevo

Impacto de Variacin de Secuencia de AND en el lugar de enlace del 'primer' en PCR


Alelos heterocigotos estn bien balanceados

6 8

Desbalance en altura de picos

6 8

*
8

*
Un aspecto importante es la altura de los picos con mezclas
Alelo 6 ha decado

Butler, J.M. (2001) Forensic DNA Typing, Figure 6.8, Academic Press

El Problema de las Mezclas


Pueden/deben ser interpretadas?
Clculos pueden ser basados en la probabilidad de un sospechoso siendo includo vs. una persona al azar teniendo los alelos encontrados Alternativamente una interpretacin puede ser basada en buscar contribuidores mayores/menores
En este caso la razn de altura de los picos se torna importante Todas las posibilidades deben ser examinadas y aquellas que son ilgicas deben ser rechazadas Para muestras mezcladas, los picos de amelogenina pueden proveer informacin valiosa

11

Primer Paso
Determinar si es una mezcla Busque bandas adicionales Mida razn de bandas 'stutter' (mayor de 15%?) Discuente artefactos tales como gotas de tinte, puntos y eventos de matriz Busque bandas +A (N)

Muestra de Escena del Crimen

Primer Paso (b)


Busque asimetra de picos Familiares cercanos con perfiles parciales pueden ser muy similares ADN con bajo nmero de copias produce asimetra de picos y aumenta el 'stutter' Mutaciones en lugar de enlace de 'primer' tambin puede causar asimetra (lejos del extremo 3) Verifique anormalidades cromosomales con muestras de referencia PHR por debajo de 60% indica mezcla potencial, efecto estocstico inhibicin

Segundo Paso
Identificar el nmero de contribuidores a la mezcla Para dos contribuidores un mximo de 4 alelos deben ser observados 5-6 alelos en un 'locus' indica 3+ contribuidores # de contribuidores debe cuadrar con los hechos del caso

12

Tercer Paso
Determinar la razn aproximada de los componentes en la muestra Generalmente hablando, la proporcin de la muestra en cada 'locus' es preservada despues de coamplificar Una proporcin 2/1 debe aparecer cuando la razn de picos en cada 'locus' es comparada Alelos compartidos y 'stutter' complican el asunto La razn X/y puede ser utilizada para calibrar este efecto Tamao de ADN
X Y A B C A B C D A B CD

RFU s

amelogenin 3 picos en D8S1179 X-Y desbalance de picos

4 picos en D21S11

4 picos en D18S51

Amelogenina Marcador que determina el Sexo


Delecin de 6 bases

X Y

X = 106 bp

X = 212 bp

Y = 112 bp
AmpFlSTR kits

Y = 218 bp
PowerPlex 1.1

1:1 Mezcla: 3X + 1Y

Fmina: X, X

Hombre: X, Y

Butler, J.M. (2001) Forensic DNA Typing, Figure 8.1, Academic Press

Clayton, TM, Whittaker, JP, Sparkes, R. and Gill, P., Forensic Sci Int. 91, (1998) 55-70

13

Cuarto Paso
Cuando 4 picos estn presentes usualmente es trabajo fcil determinar los contribuidores mayores y menores El trabajo es ms dificil si existen alelos compartidos A este punto uno debe resistir la tentacin de mirar los perfiles individuales de la vctima y el sospechoso Esto limita predisposicin en la interpretacin

Cuarto Paso (b)


Haga una lista de todas las posibles combinaciones Examine la proporcin de intensidad de picos
Calcule la intensidad de pico esperada/reas esperadas de acuerdo a sus asunciones Algunas asignaciones en pareja se tornan ilgicas Haga una lista de las posibles asignaciones

Quinto Paso
Compare resultados previos con sospechoso, vctima y muestras de referencia Esto permite una evaluacin imparcial de toda la data

14

Sexto Paso provee alguna evaluacin estadstica


Perfil de ADN Mezclado
Avenida frecuentista
Mtodo 1: Probabilidad de Exclusin
Hombre al azar no excludo

Avenida Bayesian
Data Cuantitativa y cualitativa

Data cualitativa

Mtodo 2: Avenida Cualitativa


Razn de Probabilidad

Mtodo 3: Modelo Binario

Mtodo 4: Modelo Contnuo

Una Comisin de AND de ISFG presidida por Peter Gill comentar en estos cuatro mtodos para interpretacin estadstica de mezclas.
Figure 7.1 from Tim Clayton and John Buckleton, Chapter 7 Mixtures in Forensic DNA Evidence Interpretation (2005) CRC Press

Ejemplo 1

Ejemplo 2

D3

vWA

FGA

Primer paso - es una mezcla? si, hay picos adicionales 'Stutter' por encima del 15% D3 14/15= 18.7 Gotas de tinte/artefactos? cerca de amilogenina Segundo paso max contribuidore consistente con 2/3 Tercer Paso - proporcin X/Y 3448/264 =13/1 o 1/6 M/F Cuarto paso remueve soluciones inverosmiles D3 14,16;15,15 ||| 14,15; 16,16 ||| 14,15;16,16 14,14;15,15;16,16 y despues que con el 17?

AMEL

D8

D21

D18

vWA 15,18; 16,16 ||| 15,16; 16,18 ||| 15,15; 16,18 18,18;15,16 ||| FGA 18,19;22,23 ||| 18,22; 19,23 ||| 18,23;19, 22 D8 13,14;15,15||| 13,14;15,14|||13,14;15,13 13,13; 14, 15||| 14,14;13, 15||| etc.

15

Ejemplo de mezcla Primer paso- es una mezcla? Si, hay picos adicionales 'Stutter' por encima del 15% D3 14/15= 18.7 Gotas de tintes/artefactos? cerca de amelogenina Segundo Paso - max contribuidores consistente con 2/3 Tercer Paso - razn X/Y 3448/264 =13/1 o 1/6 M/F Cuarto Paso- examine posibles combinaciones D3 14,16;15,15 ||| 14,15; 16,16 ||| 14,15;16,16 14,14;15,15;16,16 and then what about 17? AMEL D8 D21 D18 vWA 15,18; 16,16 ||| 15,16; 16,18 ||| 15,15; 16,18 18,18;15,16 ||| 15,18;15,16|||15,18;16,18 FGA 18,19;22,23 ||| 18,22; 19,23 ||| 18,23;19, 22 D8 13,14;15,15||| 13,14;15,14|||13,14;15,13 13,13; 14, 15||| 14,14;13, 15||| etc.

D3

vWA

FGA

Ejemplo de mezcla Paso 4b reste posibilidades inverosmiles D3 14,16;15,15 ||| 14,15; 16,16 ||| 14,15;16,16 14,14;15,15;16,16 and then what about 17? vWA 15,18; 16,16 ||| 15,16; 16,18 ||| 15,15; 16,18 18,18;15,16 ||| 15,18;15,16||| 15,18 16,18 FGA 18,19;22,23 ||| 18,22; 19,23 ||| 18,23;19, 22 D8 13,14;15,15||| 13,14;15,14|||13,14;15,13 13,13; 14, 15||| 14,14;13, 15||| etc.

D3

vWA

FGA

AMEL

D8

D21

D18

ADN con bajo nmero de copias y mezclas


Cuando PCR se lleva a cabo, la meta es 1.0 ng de ADN Componentes menores pueden estar presentes en concentraciones mucho menores Bajo estas condiciones, umbrales estocsticos deben ser seguidos muy de cerca Otro problema es el efecto abrumador del exceso de ADN de la vctima en ciertas situacionesestuches de violacin, raspado de uas

16

Extraccin del Mango y Disparador de una Pistola amplificado utilizando Profiler+ Multiplex
Explorar el problema de mezclas vs amplificacin no especfica de PCR de bajo nmero de copias

Blue

Green

Yellow

Muestra de sangre del sospechoso amplificada utilizando Profiler+ Multiplex Blue

Green

Yellow

Leccin Aprendida del NIST MSS 1,2,&3


Laboratorios tienen instrumentos con diferentes sensibilidades Diferentes niveles de experiencia y entrenamiento juegan una parte en la interpretacin efectiva de muestras Cantidad de ADN inicial hace una diferencia en la habilidad de detectar componentes menores (labs que aaden "demasiado" ADN detectaron componentes menores ms frecuentemente)

17

Estudio Interlab de Interpretacin de Mezclas


(MIX05)
Slo considera interpretacin de data - para remover problemas de variacin en deteccin del instrumento y problemas de cuantificacin 94 labs se matricularon para participar 69 labs han devuelto resultados (17 de fuera de los EU) Cuatro casos ficticios provistos con electroferogramas de "vctima" y "evidencia" (Archivos .fsa de GeneScan que pueden ser convertidos para Mac GeneMapper; archivos de gelatina disponibles a FMBIO labs) Data disponible con estuches Profiler Plus, COfiler, SGM Plus, PowerPlex 16, Identifiler, PowerPlex 16 BIO (FMBIO)

Perfil de sospechoso
Junto con razones para hacer llamados y cualquier estadistica que sea reportada

??

Permite a un gran nmero de practicantes forenses evaluar data de la misma mezcla


Provee mltiples casos representando un amplio rango de escenarios de mezclas

Diseo y propsito de estudio MIX05

Genera data de multiples estuches de STR en la mismas muestras de mezclas para comparar el procedimiento de deteccion de componentes menores La variable primordial debe ser la gua de interpretacin del laboratorio ms que la extraccin del ADN, amplificacin por PCR la sensibilidad de anlisis del instrumento

Existen mejores prcticas que puedan ser inculcadas a otros?

Resultados de MIX05 en Mltiples Estuches


http://www.cstl.nist.gov/biotech/strbase/interlab/MIX05.htm
Evidencia de Primer Caso (mezcla) Profiler Plus

Data Generada por ABI 3100 fue provista


en CD-ROM a laboratorios como archivos .fsa (para Genotyper NT o GeneMapperID) o archivos convertidos a Mac-para Genotyper Mac

COfiler

Identifiler

PowerPlex 16

SGM Plus
Data de FMBIO se hizo disponible cuando requerida

18

Resmen de Respuestas de MIX05


94 labs se matricularon para participar 69 labs devolvieron resultados (17 de fuera
de EU)
Resultado de estuches de STR utilizados
34 ProfilerPlus/COfiler 10 PowerPlex 16 7 PP16 BIO 5 Identifiler 2 SGM Plus 1 All ABI kit data 9 Varias combinaciones

50 labs rotularon alelos 39 labs estimaron promedios 29 labs proporcionaron estadsticas

Resmen de algunos resultados de MIX05 reportados

La mayora de las rotulaciones estuvieron correctas

Algunos promedios de mezclas reportados en MIX05


Muchos labs no reportan la proporcion estimada de componentes de mezclas rutinariamente

19

Algunas estadsticas reportadas para el primer caso de MIX05

Conclusiones
No mezcle la interpretacin a menos que sea necesario (Peter Gill, Forensic Science Service, 1998). No hemos visto lo ltimo en interpretacin de mezclas

The beginnings of a beautiful friendship

Pensamientos adicionales en mezclas


Algunos laboratorios de ADN pueden decidir no pasar el trabajo de decifrar en su totalidad las posibilidades genotpicas y asignarles los contribuidores mayores/menores Una manera ms fcil es simplemente incluir o excluir el perfil de ADN del sospechoso del perfil mezclado encontrado en la escena. Si todos los alelos de un perfil de ADN de un sospechosl son representados en la mezcla obtenida en la escena del crimen, entonces el sospechoso no puede ser excludo como contribuidor a la mancha encontrada en la escena Del mismo modo, los alelos en el perfil de ADN de la vcitma pueden ser restados del perfil de la mezcla para simplificar los alelos que necesitan estar presentes en el perfil de ADN del sospechoso.

20

También podría gustarte