Está en la página 1de 329

GUA METODOLGICA DE BIOLOGA

BENEMRITA UNIVERSIDAD AUTNOMA DE PUEBLA

Benemrita Universidad Autnoma de Puebla


VICERRECTORA DE DOCENCIA
DIRECCIN GENERAL DE EDUCACIN MEDIA SUPERIOR

GUA METODOLGICA DE BIOLOGA


PLAN 06

AUTORES

PASCUAL VICENTE MUOZ MA. DOLORES RAMOS VERA JORGE ANTONIO VIDAL ARGELLO MIRIAM ROMERO TORRES

AGOSTO 2011

GUA METODOLGICA DE BIOLOGA

GUA METODOLGICA DE BIOLOGA, PLAN 06

Dr. Roberto Enrique Agera Ibaez


RECTOR

Dr. Jos Ramn Eguibar Cuenca


SECRETARIO GENERAL

Ma. Esther Gmez Rodrguez


ABOGADA GENERAL

Mtro. Jos Jaime Vzquez Lpez


VICERRECTOR DE DOCENCIA

Lic. Jorge Luis Lima Villegas


DIRECTOR GENERAL DE EDUCACIN MEDIA SUPERIOR

Lilin Ruiz Crdoba


SECRETARIA ACADMICA DE LA DGEMS

Esta gua metodolgica se elabor en la Direccin General de Educacin Media Superior de la Benemrita Universidad Autnoma de Puebla

D.R. BENEMRITA UNIVERSIDAD AUTNOMA DE PUEBLA CALLE 4 SUR 104, COL CENTRO C.P. 72000. PUEBLA, PUE. MXICO AGOSTO DE 2011

GUA METODOLGICA DE BIOLOGA

PRESENTACIN
El trabajo que a continuacin se presenta es producto de la conjuncin entre los objetivos trabajados en ciclos anteriores con el modelo constructivista del conocimiento dentro del Modelo Universitario Minerva de la Benemrita Universidad Autnoma de Puebla y el enfoque en el desarrollo de competencias de acuerdo a la Reforma Integral de la Educacin Media Superior (RIEMS), integrando la Asignatura de Biologa al Marco Curricular Comn (MCC) que permitir dar en un futuro la flexibilidad y el enriquecimiento del currculo del bachillerato. Los bloques que se presentan son los siguientes: BLOQUE 1. LA BIOLOGA COMO CIENCIA BLOQUE 2. CLULA, ESTRUCTURA Y FUNCIN BLOQUE 3. HERENCIA Y VARIACIN BLOQUE 4. LA EVOLUCIN DE LOS SERES VIVOS BLOQUE 5. BIODIVERSIDAD Y MEDIO AMBIENTE BLOQUE 6. INTRODUCCIN A LA ANATOMA Y FISIOLOGA HUMANA En cada bloque se especifican las competencias genricas y sus atributos, posteriormente se presentan las tablas de objetivos especficos; conocimientos previos, declarativos, procedimentales y actitudinales/valorales, as como los contenidos especficos, mapas conceptuales, los criterios de evaluacin de acuerdo al Programa de Estudios de la Asignatura, orientaciones didctico-pedaggicas y la bibliografa, vnculos a sitios web de inters (TICs y TACs) y material audiovisual para desarrollar las actividades. Bloque 1. La Biologa como Ciencia. Analiza a la Biologa como una ciencia construida desde lo social y fundamentada en paradigmas, para reconocerse como un ser biolgico y social, contrastando el carcter intra e interdisciplinario de esta ciencia con otras.

GUA METODOLGICA DE BIOLOGA

Bloque 2. Clula, Estructura y Funcin. Relaciona la composicin qumica con la estructura y fisiologa celular, para valorar la importancia de la clula como unidad estructural y funcional de los seres vivos a travs del anlisis de los procesos celulares. Bloque 3. Herencia y Variacin. Investiga los fundamentos que permiten delinear las bases genticas de la herencia para argumentar su desarrollo histrico, as como su impacto en la vida actual, valorando la trascendencia del proyecto genoma humano y su alcance en las aplicaciones de la biotecnologa a travs de la resolucin de problemas, elaboracin de cariotipos y la realizacin de un ensayo. Bloque 4. Evolucin de los Seres Vivos. Investiga las principales teoras sobre el origen y evolucin de los seres vivos para explicar la diversidad, a travs de la comparacin de los cambios genticos, que han manifestado a travs del tiempo. Bloque 5. Biodiversidad y Medio Ambiente. Interrelaciona el medio ambiente y su biodiversidad con el flujo de materia y energa de cada ecosistema para ubicarlos y valorar el equilibrio de la biosfera a travs de una visita guiada a reas naturales y la elaboracin de un mapa mental integrador. Bloque 6. Introduccin a la Anatoma y Fisiologa Humana. Identifica la organizacin del cuerpo humano y la funcin que desempean los sistemas en el mantenimiento de la homeostasis del mismo, para tomar decisiones en el cuidado de su cuerpo a travs del uso de modelos anatmicos.

GUA METODOLGICA DE BIOLOGA

JUSTIFICACIN

El nivel educativo medio superior en Mxico emprende una transformacin de fondo a travs de la Reforma Integral de la Educacin Media Superior (RIEMS) acordada en 2008 entre la Asociacin Nacional de Universidades e Instituciones de Educacin Superior (ANUIES) y la Secretara de Educacin Media Superior de la Secretara de Educacin Pblica (SEP SSEMS), en dicha reforma, la vertiente ms relevante lo es la orientacin pedaggica educativa basada en el desarrollo de competencias; enfoque cuyas intenciones es demasiado pertinente en un pas como Mxico, en donde se requiere de la formacin de personas capaces de dirigir una nacin hacia la bsqueda de verdaderos cambios que se reflejen primeramente en el individuo y posteriormente en la sociedad de la que forma parte. Por consiguiente, se requiere de la formacin integral, partiendo necesariamente desde la convivencia con prcticas o actividades de aprendizaje implementadas en primer lugar para el crecimiento en el factor desarrollo humano, en este caso especfico del estudiante, a quien se le prepara a ser una persona diferente, con actitud propositiva, en la mirada de mejorar su realidad, en diversos casos, de los cuales pueden mencionarse: el contribuir al desarrollo sustentable, a propiciar una sociedad democrtica, utilizar de forma responsable la tecnologa, y conformar un proyecto de vida que implique dar respuesta a los retos que le corresponde vivir. Ante este compromiso, la asignatura de Biologa que se imparte en el segundo ao del Plan de estudios 06 del nivel medio superior de la Benemrita Universidad Autnoma de Puebla (BUAP), busca al igual que las otras asignaturas del plan curricular de contribuir en la preparacin de ciudadanos que necesita la sociedad, la cual es cada vez ms compleja y demandante. En este tenor, la asignatura se ubica dentro de tres marcos que son:
5

GUA METODOLGICA DE BIOLOGA

Marco mundial, en donde el fenmeno de la globalizacin permea el ambiente educativo a travs de la incorporacin de una cultura cientfica nacional, que rescata como eje de apoyo los mejores conocimientos elaborados en el mundo, encaminando su aplicacin a formar personas crticas, creativas, competentes, capaces de incidir en aquellos mbitos en los que se desenvuelve para mejorar su entorno nacional. Marco nacional, que se caracteriza por la RIEMS que establece Competencias a desarrollar en el estudiante y docente; constituyendo as el marco curricular comn del Sistema Nacional de Bachillerato. Esta educacin en competencias enfatiza el acento en el Saber Hacer, es decir, visualizar la movilizacin prctica y no ociosa de los conocimientos, habilidades, aptitudes y actitudes que el estudiante aprende a travs de su formacin escolar, en donde ste sea capaz de aplicarlos en la solucin de problemas y/o retos que se le presentan en la vida acadmica, cotidiana y ms all de su trayectoria escolar. Marco institucional, constituyndose en el Modelo Universitario Minerva (MUM), cuyo sustento base lo es el enfoque metodolgico constructivista sociocultural, orientacin que el nivel medio superior universitario manifiesta en el desglose de su mapa curricular, a la vez derivndose en un equilibrio entre las areas de Ciencias Naturales y Exactas, Ciencias Sociales, Lenguaje y Humanidades. Asimismo se establece un tronco comn, que incluye la readecuacin y adaptacin de los programas de diversas asignaturas con la finalidad de brindar a los estudiantes una educacin que les permita una vez que egrese del nivel medio superior, acceder de forma crtica y tica al nivel superior y/o incorporarse al campo laboral. Bajo este contexto, la asignatura de Biologa ofrece junto con las dems asignaturas en su relacin interdisciplinar, transdisciplinar y transversalidad saberes que contribuyen al crecimiento cognitivo y cognoscitivo del estudiante

GUA METODOLGICA DE BIOLOGA

hacia su aprendizaje y autoaprendizaje y a la generacin de conocimientos que va a favorecer al avance de la cultura, la ciencia y la tecnologa, a travs de una serie de actividades que le permitan el desarrollo y adquisicin de competencias indispensables para la vida, como son las de tipo: Genrico que describen fundamentalmente conocimientos, habilidades, actitudes y valores integrados que permiten la realizacin de diversos desempeos o tareas. Y las Disciplinares que capacitan al estudiante para procesar, aplicar y transformar en contextos especficos, el conocimiento organizado en las disciplinas; implica el dominio de las principales metodologas y enfoques propios de distintas reas de conocimiento. Especficamente la Biologa pertenece al rea de las ciencias experimentales, que estn orientadas hacia la aplicacin de mtodos y procedimientos de las ciencias, resolucin de problemas cotidianos y la comprensin racional de su entorno, adems tienen un enfoque prctico en distintos contextos, tiles a lo largo de la vida, sin omitir el rigor de las disciplinas y favorece acciones

responsables hacia el medio ambiente y a s mismo. Por su carcter experimental, no puede ser concebida sin la aplicacin de actividades experimentales de sus contenidos, a fin de propiciar la formacin integral del estudiante. Por lo que implica generar ambientes de aprendizaje en donde se pretende desarrollar un conjunto de competencias que integran conocimientos, habilidades y actitudes. Dicho de otra manera, contribuir y desarrollar la formacin por competencias es tarea compleja, pero no imposible. La idea principal es avanzar hacia la preparacin de individuos con cualidades individuales, de carcter tico, acadmico, y social.

GUA METODOLGICA DE BIOLOGA PROGRAMA EDUCATIVO (PE): NIVEL MEDIO SUPERIOR

ASIGNATURA: BIOLOGA CDIGO: PROG 0015 NIVEL: MEDIO SUPERIOR CRDITOS: 10

UNIDAD ACADMICA: PROGRAMA EDUCATIVO: MODALIDAD EDUCATIVA: NIVEL EDUCATIVO: CDIGO: NOMBRE DE LA ASIGNATURA: UBICACIN EN EL MAPA CURRICULAR:

NIVEL MEDIO SUPERIOR PLAN 06 ESCOLARIZADA BACHILLERATO 0015 BIOLOGA SEGUNDO AO

CORRELACIN: La relacin vertical que tiene este programa con respecto a su ubicacin en el mapa curricular es con Qumica, Psicologa y Desarrollo Humano en primer ao; Fsica y materias propeduticas como Educacin Ambiental y para la Salud, Temas Selectos de Biologa y Bioqumica en tercer ao; y una relacin horizontal con Matemticas, Cultura Fsica e Informtica en segundo ao ASIGNATURAS PRECEDENTES: Qumica, Psicologa y Desarrollo Humano ASIGNATURAS CONSECUENTES: Fsica, Educacin Ambiental y Salud, Temas Selectos de Biologa y Bioqumica. CARGA HORARIA DEL ESTUDIANTE TEORA
HORAS CRDITOS

PRCTICA
HORAS CRDITOS

ESTUDIO INDEPENDIENTE
HORAS CRDITOS

TOTAL
HORAS CRDITOS

10

GUA METODOLGICA DE BIOLOGA

NDICE
Presentacin Justificacin ndice Propsitos BLOQUE 1 LA BIOLOGA COMO CIENCIA 1.1 Qu relacin tiene la Biologa con el desarrollo social 1.2 Cules son los paradigmas en los que se basa de la Biologa? 1.3 Cul es el objeto de estudio de la Biologa? 1.4 Cul es la importancia de la Biologa en la solucin de problemas del entorno social? 1.5 Cules son las caractersticas de los niveles de organizacin de la materia? 3 5 9 11 12 16 17 25 30 35

BLOQUE 2 CLULA, ESTRUCTURA Y FUNCIN 2.1 Cules hechos histricos condujeron al planteamiento de la Teora Celular? 2.2 Qu diferencia hay entre clula procarionte y eucarionte? 2.3 Cmo est estructurada y cmo funciona una clula? 2.4 Cmo se reproducen las clulas? 2.5 Cmo se pasa de una clula a la pluricelularidad? 2.6 Cul es la relacin tejido-rgano-sistema?

40 45 48 50 80 86 88

BLOQUE 3 - HERENCIA Y VARIACIN 3.1 Cules hechos histricos condujeron al desarrollo de la Gentica? 3.2 Qu diferencias y similitudes encontramos en los conceptos de Gentica? 3.3 En qu consisten las leyes establecidas por Mendel sobre la herencia? 3.4 Qu diferencia hay entre los patrones hereditarios mendelianos y los no mendelianos? 3.5 Qu es una mutacin? 3.6 Cules son las aplicaciones ms importantes de la Gentica?
9

92 97 100 101 102 113 119

GUA METODOLGICA DE BIOLOGA

BLOQUE 4 EVOLUCIN DE LOS SERES VIVOS 4.1 Qu es la evolucin biolgica? 4.2 Cmo se origin la vida? 4.3 Cmo se originaron las clulas eucariontes? 4.4 Cmo explica la evolucin la diversidad de los seres vivos? 4.5 Cules son las evidencias de la evolucin?

135 139 139 144 148 156

BLOQUE 5 BIODIVERSIDAD Y MEDIO AMBIENTE 5.1 Cmo se clasifican a los seres vivos? 5.2 Los virus vivo o no vivo? 5.3 Cul es el sistema actual de clasificacin de los seres vivos? 5.4 Cmo se relaciona la biodiversidad con el medio ambiente? 5.5 Cul es la dinmica de los ecosistemas? 5.6 Cmo se equilibran los ciclos biogeoqumicos? 5.7 Cules son las grandes divisiones de la bisfera?

180 185 191 195 232 248 257 265

BLOQUE 6 INTRODUCCIN A LA NATOMA Y FISIOLOGA HUMANA 6.1 Cmo funciona el sistema tegumentario? 6.2 Cmo funciona el sistema muscular? 6.3 Cmo funciona el sistema seo? 6.4 Cmo funciona el sistema digestivo? 6.5 Cmo funciona el sistema respiratorio? 6.6 Cmo funciona el sistema circulatorio? 6.7 Cmo funciona el sistema linftico? 6.8 Cmo funciona el sistema excretor? 6.9 Cmo funciona el sistema nervioso? 6.10 Cmo funciona el sistema endcrino? 6.11 Cmo funciona el sistema reproductor?

281 286 288 291 294 298 300 304 305 307 315 320

10

GUA METODOLGICA DE BIOLOGA

PROPSITOS DE LA ASIGNATURA: Analizar los conceptos y procesos biolgicos sustentados en el respeto hacia la vida y su entorno, a travs de la movilizacin de conocimientos, habilidades, actitudes y valores, para generar mejores explicaciones de los fenmenos que se llevan a cabo en los seres vivos de manera crtica, reflexiva y creativa aplicndolas en la resolucin de problemas en diversos contextos. Competencias a desarrollar en la Asignatura:
Genricas
3. Elige y practica estilos de vida saludables. Atributos: 3.2 Toma decisiones a partir de la valoracin de las consecuencias de distintos hbitos de consumo y conductas de riesgo. 5. Desarrolla innovaciones y propone soluciones a problemas a partir de mtodos establecidos. Atributos: 5.2 Ordena informacin de acuerdo a categoras, jerarquas y relaciones. 5.5 Sintetiza evidencias obtenidas mediante la experimentacin para producir conclusiones y formular nuevas preguntas. 5.6 Utiliza las tecnologas de la informacin y comunicacin para procesar e interpretar informacin. 6. Sustenta una postura personal sobre temas de inters y relevancia general, considerando otros puntos de vista de manera crtica y reflexiva. Atributos: 6.1 Elige las fuentes de informacin ms relevantes para un propsito especfico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. 6.2 Evala argumentos y opiniones e identifica prejuicios y falacias. 6.4 Estructura ideas y argumentos de manera clara, coherente y sinttica. 8. Participa y colabora de manera efectiva en equipos diversos. Atributos: 8.1 Propone maneras de solucionar un problema o desarrollar un proyecto en equipo, definiendo un curso de accin con pasos especficos. 8.3 Asume una actitud constructiva, congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo.

Disciplinares Bsicas
1. Emite juicios de valor sobre la contribucin y alcances de la ciencia como proceso colaborativo e interdisciplinario en la construccin social del conocimiento. 2. Fundamenta opiniones sobre los impactos de la ciencia y la tecnologa en su vida cotidiana, asumiendo consideraciones ticas. 4. Identifica problemas, formula preguntas de carcter cientfico y plantea las hiptesis necesarias para responderlas. 5. Obtiene, registra y sistematiza la informacin para responder a la pregunta de carcter cientfico, consultando fuentes relevantes y realizando experimentos pertinentes. 7. Rectifica preconcepciones personales o comunes sobre diversos fenmenos naturales a partir de evidencias cientficas. 9. Disea modelos o prototipos para resolver problemas, satisfacer necesidades o demostrar principios cientficos. 11. Analiza las leyes generales que rigen el funcionamiento del medio fsico y valora las acciones humanas de impacto ambiental. 12. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo, sus procesos vitales y el entorno al que pertenece. 13. Relaciona los niveles de organizacin qumica, biolgica, fsica y ecolgica de los sistemas vivos. 14. Aplica normas de seguridad en el manejo de sustancias, instrumentos y equipo en la realizacin de actividades de su vida cotidiana.

11

GUA METODOLGICA DE BIOLOGA

BLOQUE 1
La Biologa como ciencia

12

GUA METODOLGICA DE BIOLOGA

13

GUA METODOLGICA DE BIOLOGA

BLOQUE DE APRENDIZAJE 1: LA BIOLOGA COMO CIENCIA


TIEMPO: 18 horas UNIDAD DE COMPETENCIA: Analiza a la Biologa como una ciencia construida desde lo social y fundamentada en paradigmas, para reconocerse como un ser biolgico y social, contrastando el carcter intra e interdisciplinario de esta ciencia con otras. SABERES Procedimentales Investiga las aportaciones y aplicaciones de la Biologa y sus ramas por medio de un glosario. Contrasta los paradigmas de la Biologa a travs de un debate en plenaria Emplea el mtodo cientfico para desarrollar un proyecto de investigacin. Construye un mapa mental de la interrelacin de la Biologa, sus ramas y ciencias auxiliares. COMPETENCIAS Genricas/Atributos Disciplinares 5.2 Ordena informacin de acuerdo a categoras, jerarquas y relaciones. 5.6 Utiliza las tecnologas de la informacin y comunicacin para procesar e interpretar informacin. 8.1 Propone maneras de solucionar un problema o desarrollar un proyecto en equipo, definiendo un curso de accin con pasos especficos. 1. Emite juicios de valor sobre la contribucin y alcances de la ciencia como proceso colaborativo e interdisciplinario en la construccin social del conocimiento. 4. Identifica problemas, formula preguntas de carcter cientfico y plantea las hiptesis necesarias para responderlas.

Declarativos Concepta a la Biologa como una ciencia. Analiza los cuatro paradigmas que dan el carcter de cientificidad a la Biologa. Fundamenta el campo de accin de la Biologa y sus principales ramas. Jerarquiza los niveles de organizacin de la materia viva Explica las caractersticas distintivas de los seres vivos y las ejemplifica. Argumenta la relacin que existe entre la Biologa con la Tecnologa y la Sociedad.

Actitudinales/ Valorales Valora el impacto de los avances de la Biologa en la sociedad actual. Fomenta la tolerancia y disponibilidad en el trabajo colaborativo durante la realizacin de proyectos. Reflexiona de manera informada y crtica sobre las implicaciones de la investigacin cientfica en los diferentes mbitos social, familiar y personal.

5. Obtiene, registra y sistematiza la informacin para responder a la pregunta de carcter cientfico, consultando fuentes relevantes y realizando experimentos pertinentes. CRITERIOS DE DESEMPEO Contrasta los paradigmas de la Biologa a travs de un debate en plenaria Emplea el mtodo cientfico para desarrollar un proyecto de investigacin. Interrelaciona la Biologa, sus ramas y ciencias auxiliares a travs de la elaboracin de un mapa mental.

14

GUA METODOLGICA DE BIOLOGA

ESTRATEGIAS DE ENSEANZA
Clase Magistral
Base orientadora de la

ESTRATEGIAS DE APRENDIZAJE
Glosario Mapa mental Debate

RECURSOS DIDCTICOS
Gua metodolgica Internet

EVIDENCIAS Y/O PRODUCTOS


Actividades de la gua metodolgica del alumno.
Mapa mental

accin (BOA)
Libros y Revistas Asesora metodolgica y Proyecto de

electrnicas.
Artculos de divulgacin

Debate Proyecto de investigacin

temtica
Curso extracurricular

investigacin en revistas cientficas


Pintarrn

sobre metodologa de la investigacin

EXPLORANDO TUS CONOCIMIENTOS


1. Qu estudia la Biologa? _______________________________________________________________________ 2. Escribe el nombre de tres cientficos que hayan contribuido al estudio de la Biologa _______________________________________________________________________ 3. Con qu ciencias se relaciona la Biologa? _______________________________________________________________________ 4. Escribe una aplicacin de algn conocimiento o descubrimiento biolgico que conozcas _______________________________________________________________________ _______________________________________________________________________ 5. Escribe cules son los pasos del mtodo cientfico _______________________________________________________________________ _______________________________________________________________________

15

GUA METODOLGICA DE BIOLOGA

1.1 QU RELACIN TIENE LA BIOLOGA CON EL DESARROLLO SOCIAL?


La Biologa es la ciencia que estudia a los seres vivos. Surge de manera formal en el siglo XIX y ha definido su objeto de estudio a lo largo de la historia; ha establecido conceptos, teoras y principios y varios enfoques metodolgicos para abordar el estudio de la vida. Este campo de conocimiento que inici como la descripcin y la clasificacin del mundo viviente, se ha transformado en una ciencia que busca comprender las funciones y las estructuras de los seres vivos; integra temas fundamentales en el estudio de los organismos, como son: el desarrollo, la herencia, la evolucin, la interaccin con el medio y con otros organismos. Tiene tambin una amplia gama de aplicaciones prcticas y ha contribuido al desarrollo de una gran cantidad de campos aplicados, como la medicina, la ingeniera gentica, la biotecnologa, la agricultura y la cra y mejora de animales, entre otras. La Biologa en la actualidad ha conformado una gran trama conceptual y metodolgica que ha logrado comprender y explicar la enorme complejidad de los seres vivos. Adems, sus conocimientos tienen importantes consecuencias en la sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el uso de los recursos naturales, donde el conocimiento biolgico es fundamental.

LA BIOLOGA DENTRO DEL CONTEXTO DE OTRAS CIENCIAS La Biologa es una ciencia tan compleja que para alcanzar sus objeticos, se apoya en otras disciplinas cientficas. Las ciencias que auxilian a la Biologa para lograr investigaciones completas se denominan ciencias auxiliares. Las principales se enuncian a continuacin: Qumica, Matemticas, Fsica, Geografa, Historia. Ya vimos que la Biologa es una ciencia muy extensa, con ramas muy variadas que se dividen a su vez en otras disciplinas.

16

GUA METODOLGICA DE BIOLOGA

RAMA Anatoma Bacteriologa Bioqumica Botnica Citologa Ecologa Embriologa Etologa Evolucin Filogenia Fisiologa Gentica Histologa Morfologa Paleontologa Taxonoma Virologa Zoologa

OBJETO DE ESTUDIO Estructura de los organismos Bacterias Composicin qumica de la materia viva Plantas Estructura y funciones de las clulas Ecosistemas. Desarrollo de los vulos fecundados Comportamiento animal Variacin de las especies a lo largo del tiempo. Relaciones evolutivas entre los seres vivos Funciones orgnicas de los seres vivos Herencia de los caracteres biolgicos Estructura y funciones de los tejidos Estructura de los seres vivos. Vida en el pasado Clasificacin y nomenclatura de los seres vivos Virus Animales

1.2 CULES SON LOS PARADIGMAS EN LOS QUE SE BASA LA BIOLOGA?


Han existido una gran cantidad de investigaciones en los diferentes campos de estudio de la Biologa, sin embargo las que se retoman por su gran contribucin al campo de estudio de la Biologa ya que se definieron nuevos conceptos, mtodos y objetos de estudio; es decir, grandes programas de investigacin que se encuentran en el origen de la Biologa moderna son los siguientes:

17

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Haz una investigacin documental de otras ramas de la Biologa que no estn en el cuadro anterior y llnalo en la siguiente tabla Rama Objeto de estudio

18

GUA METODOLGICA DE BIOLOGA

Responde las siguientes preguntas 1. Cmo puede contribuir la entomologa a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 2. Cmo puede contribuir la bioqumica a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________

3. Cmo puede contribuir la Gentica a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________

19

GUA METODOLGICA DE BIOLOGA

Teora Celular Teora de la evolucin Teora del gen Teora de la homeostasis

El paradigma constituye un cuerpo de conocimientos tericos y metodolgicos que son reconocidos durante cierto tiempo, como modelo de problemas y soluciones de una sociedad cientfica determinada. El paradigma incluye los problemas relevantes a resolver, las formas reconocidas como vlidas para solucionarlos, los procedimientos experimentales, los conceptos y las teoras, los datos empricos, los criterios y juicios de valor compartidos por la comunidad, etc. De esta manera, lo que se considera cientfico o ms en particular, lo objetivo queda determinado por las convenciones de los miembros de la comunidad y as resulta imposible decidir la superioridad cientfica de un paradigma sobre otro. La Biologa se constituy como ciencia hasta el siglo XIX en un proceso que inici en 1838 con la formulacin de la teora celular y que culmin en 1900 con el descubrimiento de las leyes de la herencia. Es en esta etapa cuando se formulan paradigmas de orden superior; esto es, que abordan problemas de carcter general y que por ello se denominan como paradigmas globales de la Biologa, siendo en este periodo cuando por vez primera contamos con conceptos unificadores de orden general y con una posible aceptacin universal. En este orden de ideas, el primer paradigma global es la teora celular formulada por Teodoro Schwann y Matias J Schleiden, quienes escriben la versin definitiva de su enunciado en 1839 (fig. 3.3) El segundo paradigma es la teora de la evolucin formulada por Charles Darwin en su obra El origen de las especies (1859), la cual, aunque es rechazada por ciertos sectores, genera una polmica que ya se da en el seno de una comunidad cientfica constituida. A esta teora hay que aadir a Alfred Rusell Wallace, coautor quien lleg a las mismas conclusiones de manera independiente a Darwin. El tercer paradigma es la teora de la homeostasis, esto es, de la regulacin del medio interno de los organismos, enunciado por Claude Bernard y contenido en la
20

GUA METODOLGICA DE BIOLOGA

obra Lecciones sobre los Fenmenos de la Vida Comunes a los Animales y los Vegetales, publicado en 1878. El cuarto paradigma son las leyes de la herencia formuladas por el monje agustino Gregorio Mendel en 1865, en el texto Experimentos sobre Hibridacin de las Plantas, pero que carece de impacto cientfico hasta su redescubrimiento en 1900 al haber llegado a esas mismas conclusiones Carl Correns, Erich Tschermak y Hugo De Vries.

ACTIVIDAD Completa la siguiente tabla con la informacin que se te solicita. Investiga y aade 10 prefijos y sufijos distintos a los mostrados. Dicha informacin debe estar relacionada con la asignatura de Biologa.

Prefijo

significado

ejemplo

significado

a anti auto bio cito cloro di, bi eu fito foto hemo herb hetero hidro

sin contra, opuesto por si mismo vida clula verde dos verdadero vegetal luz sangre relativo a plantas diferente agua

21

GUA METODOLGICA DE BIOLOGA


hiper hipo por encima de por debajo de

homeo igual homo iso macro micro poli proto igual igual grande pequeo muchos primero

pseudo "falso vita zoo vida animal

Sufijo dermis piel fago fase

significado

ejemplo

significado

comida estado

22

GUA METODOLGICA DE BIOLOGA


filo gen itis lisis loga metro osis podo trofos que lo atrae, afn a origen, produccin inflamacin rompimiento estudio de medicin condicin, enfermedad pie alimento

ACTIVIDAD En cada espacio escribe el nombre de cada uno de los paradigmas de la biologa, su autor(es) y el ao de su creacin. Escribe en cada inciso la relacin existente entre los dos paradigmas interrelacionados segn indican las flechas.

23

GUA METODOLGICA DE BIOLOGA

a) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ b) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ c) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ d) ___________________________________________________________________________________
24

GUA METODOLGICA DE BIOLOGA

___________________________________________________________________________________ ________________________________________________________________________________ e) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ f) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ Finalmente, qu puedes concluir al trmino de est actividad con respecto a los paradigmas de la Biologa ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________

1.3 CUL ES EL OBJETO DE ESTUDIO DE LA BIOLOGA?


Cualquier persona puede reconocer que una hormiga, un rosal o una gallina son seres vivos; en tanto que una piedra o el agua de lluvia no lo son. A pesar de su enorme diversidad, los seres vivos de nuestro planeta comparten una lista de caractersticas que los distinguen como tales. stas son las siguientes: Organizacin. Los seres vivos tienen una estructura organizada. Su unidad primordial es la clula; a partir de ella, la organizacin se hace ms compleja, pues sta permite
25

GUA METODOLGICA DE BIOLOGA

generar tejidos, rganos y sistemas. Tu cuerpo est formado por clulas que a su vez constituyen tejidos (como la piel) rganos como el corazn). Irritabilidad. Responden a estmulos del medio ambiente. Por ejemplo, las plantas crecen en direccin a la luz y las personas nos rascamos cuando nos pica un mosquito. Reproduccin. Los seres vivos producen descendencia similar a ellos. Has observado cachorros de algunas mascotas? Crecimiento. Multiplican su nmero de clulas a partir de una sola, lo que los hace crecer. T crecers varios centmetros ms y al llegar a cierta edad, tu crecimiento se detendr. Metabolismo. Tu cuerpo est formado por sustancias en constante transformacin, las cuales obtienes mediante la alimentacin y la respiracin. En tu interior stas se combinan y se descomponen, es decir, participan en reacciones qumicas. El conjunto de reacciones qumicas ocurridas en un ser vivo se lama metabolismo. Adaptacin. Los seres vivos tienen capacidad para adaptarse y sobrevivir en un ambiente determinado. Por ejemplo, los osos polares tienen una gruesa capa de grasa bajo la piel que los ayuda a sobrevivir en temperaturas por debajo de los cero grados centgrados. Movimiento. Es la facultad de desplazar el cuerpo de un punto a otro, o al menos una parte de l, como las plantas, que orientan sus hojas hacia la luz. Generalmente el movimiento ocurre para conseguir alimento, protegerse para huir de algn depredador. A pesar de que algunos objetos no vivos pueden tener una o ms de estas caractersticas (algunos cristales de roca pueden crecer, nicamente los seres vivos las renen todas. Esto hace suponer que todos los seres vivos tienen un mismo origen: una especie que evolucion de maneras distintas para dar lugar a la enorme cantidad de especies. A esa primera especie se le llama ancestro comn y una prueba irrefutable de su existencia es que todos los seres vivos del planeta usan la misma sustancia qumica para heredar sus caractersticas: el cido desoxirribonucleico (ADN) (fig. 1.1)

26

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD 1. Organizados en equipos, observen con una lupa las caractersticas de 1 roca, 1 planta, 1 lombriz de tierra.. 2. En el siguiente cuadro comparativo de los tres objetos de estudio marquen el recuadro que seale la caracterstica correspondiente que posea.

a) La roca posee alguna caracterstica por la que pudiera ser considerada ser vivo?, por qu?
__________________________________________________________________________ __________________________________________________________________________

b) Para que se considere que un ser est vivo, puede tener una sola de las caractersticas analizadas o debe tenerlas todas? Explcalo.
__________________________________________________________________________ __________________________________________________________________________

c) Cul es la unidad fundamental de la que estamos constituidos todos los seres vivos? ____________ .

ACTIVIDAD ESPECFICA - PROYECTO EN MI CONTEXTO Por equipo, escojan un tema sobre Biologa que les guste para trabajar un proyecto que desarrollarn durante esta unidad. Considera los siguientes aspectos para desarrollarlo

27

GUA METODOLGICA DE BIOLOGA


RBRICA PARA EVALUAR UN PROYECTO DE INVESTIGACIN Institucin educativa: Nombre del docente: Nombre del alumno: Ao/grupo: Fecha: Nombre de quien evala: Bloque/tema: Autoevaluacin: Coevaluacin: Evala el profesor: Asignatura:

PONDERACIN CRITERIOS EXCELENTE (4) MUY BIEN (3) La pregunta o problema es relevante y aunque motiva la investigacin, su contribucin al conocimiento es limitado. BIEN (2) La pregunta o problema es relevante, pero su solucin es predecible y su contribucin al conocimiento es limitado. DEFICIENTE (1) La pregunta o problema tiene muy poca o ninguna relevancia y posibilidad de solucin. No motiva la investigacin. TOTAL

El Problema o la pregunta

La pregunta y el problema son relevantes, motiva la investigacin y contribuye de manera satisfactoria al conocimiento.

Establece el Establece el propsito de la propsito de la investigacin, la investigacin, la metodologa, pero metodologa y tiene dificultad para criterios a ser establecer los utilizados. La criterios a ser metodologa utilizados. La utilizada es metodologa utilizada adecuada para es adecuada para resolver el problema. resolver el problema.

El propsito de la investigacin no es Establece el propsito claro o no se de la investigacin, la establece. No metodologa, pero establece la tiene dificultad para metodologa a establecer los utilizar o sta no es criterios. Tiene adecuada para dificultad resolver el problema. seleccionando la No establece los metodologa para criterios o stos no resolver el problema. son apropiados para el problema. Las fuentes de informacin son limitadas o poco variadas. La informacin recopilada tiene relacin con el tema pero algunas no estn al da o no son relevantes. Algunas fuentes no son confiables por lo que no contribuyen al desarrollo del tema.

Metodologa de investigacin

Las fuentes de informacin son variadas y mltiples. La informacin recopilada tiene relacin con el tema, es relevante y actualizada. Las fuentes son confiables (aceptadas dentro de la especialidad) y contribuyen al desarrollo del tema.

Las fuentes de informacin son variadas y mltiples. La informacin recopilada es actualizada pero incluye algunos datos que no son relevantes o no tienen relacin con el tema. Las fuentes son confiables y contribuyen al desarrollo del tema.

Fuentes de informacin

Las fuentes de informacin son muy pocas o ninguna. Si utiliza fuentes, stas no son confiables ni contribuyen al tema. La informacin tiene poca o ninguna relacin con el tema principal.

28

GUA METODOLGICA DE BIOLOGA

Recopila y organiza los datos de acuerdo al rea de estudio. Corrobora los datos. Mantiene integridad en la recopilacin de los datos, no los altera para su beneficio.

Recopila y organiza los datos de acuerdo al rea de estudio. Corrobora los datos. Tiene dificultad manteniendo la integridad en la recopilacin de los datos.

Recopila y organiza los datos de acuerdo al rea de estudio. Tiene dificultad corroborando los datos y manteniendo la integridad en la recopilacin de los mismos. Mantiene objetividad en el anlisis de los datos.Tiene dificultad estableciendo relaciones entre los datos (diferencias y similitudes) y haciendo inferencias. Tambin tiene dificultad relacionando los datos con el conocimiento previo

Recopila muy pocos datos o ninguno. stos tienen poca o ninguna credibilidad. No corrobora los datos y tampoco mantiene la integridad de los mismos. Mantiene poca o ninguna objetividad en el anlisis de los datos. Tiene dificultad estableciendo relaciones entre los datos (diferencias y similitudes). No puede hacer inferencias o relacionar los datos con el conocimiento previo. Responde parcialmente a los objetivos o no responde. Mantiene muy poca o ninguna objetividad al expresar las ideas. No sustenta la conclusin con los datos. Tiene dificultad documentando las fuentes de informacin o no las documenta. No utiliza los formatos establecidos. Incluye fuentes de informacin que no estn citadas en la investigacin. Total:

Documentacin

Mantiene objetividad en el anlisis de los datos. Establece relaciones entre los datos (diferencias y similitudes). Puede hacer inferencias de los datos. Los relaciona con el conocimiento previo.

Mantiene objetividad en el anlisis de los datos. Establece relaciones entre los datos (diferencias y similitudes). Tiene dificultad haciendo inferencias de los datos y relacionndolo con el conocimiento previo.

Anlisis

Responde a los objetivos. Mantiene objetividad al expresar las ideas. Se sustenta con los datos.

Responde a los objetivos. Mantiene objetividad al expresar las ideas. Tiene dificultad sustentando la conclusin con los datos.

Responde a los objetivos. Tiene dificultad manteniendo objetividad al expresar las ideas y sustentando la conclusin con los datos.

Conclusin

Las fuentes de informacin estn documentadas y propiamente citadas.

Las fuentes de informacin presentan algunos errores.

Las fuentes de informacin estn documentadas. Tiene dificultad utilizando los formatos del rea de estudio en la citacin de las fuentes.

Comentarios:

REFERENCIAS: (Pimienta, Constructivismo: Estrategias para aprender a aprender., 2005) (Pimienta, Metodologa Constructivista. Gua para la planeacin docente., 2005)

Referencias

29

GUA METODOLGICA DE BIOLOGA

1.5 CUL ES LA IMPORTANCIA DE LA BIOLOGA EN LA SOLUCIN DE PROBLEMAS DEL ENTORNO SOCIAL?


BIOLOGA, TECNOLOGA Y SOCIEDAD La Biologa es la ciencia que se encarga del estudio de los seres vivos y de los fenmenos y procesos que ocurren en los seres vivos. Su definicin deriva etimolgicamente del griego bios, vida, y de logos, tratado o estudio. Aunque el trmino se utiliz por primera vez hasta el siglo XIX, la disciplina se ejerca desde muchos aos atrs con otros nombres. La Biologa se cuestiona exclusivamente sobre el mundo natural y se caracteriza, al igual que las otras ciencias, por seguir un mtodo que surge de la observacin, de la comparacin de hechos y de la aceptacin o rechazo de argumentos para aceptar una idea como vlida. La Biologa en la actualidad ha conformado una gran trama conceptual y metodolgica que ha logrado comprender y explicar la enorme complejidad de los seres vivos. Adems, sus conocimientos tienen importantes consecuencias en la sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el uso de los recursos naturales, donde el conocimiento biolgico es fundamental. A lo largo de la historia la bsqueda de conocimiento sobre la naturaleza ha sido abordada de muy diferentes formas y ha perseguido fines diversos. Las primeras explicaciones sobre el mundo natural recurrieron a la intervencin de factores sobrenaturales. En la actualidad la ciencia ha eliminado estos elementos metafsicos y basa sus explicaciones en causas naturales. Para ello las comunidades de cientficos han establecido normas y criterios que hacen que sus explicaciones tengan un considerable grado de certeza. Sin embargo, estos criterios no han sido siempre los mismos; han cambiado en diferentes pocas, en funcin de factores cientficos, filosficos, sociales e histricos. Al iniciar el camino de la racionalidad, la ciencia se convirti en una actividad fundamental ya que plante una alternativa a las posturas metafsicas para comprender el mundo que nos rodea. Desde el ao 580 a.C. hasta nuestros das, la bsqueda de explicaciones sobre la naturaleza transit por diferentes rutas hasta llegar a nuestra poca en que la ciencia en general (y la biologa en particular) se ha convertido en una actividad social fundamental.

30

GUA METODOLGICA DE BIOLOGA

La Biologa como ciencia surge de manera formal en el siglo XIX, cuando se define con precisin su objeto de estudio y se establecen referentes tericos y metodolgicos que unifican el estudio de los seres vivos. Pero, por qu se dice que la biologa es una ciencia? Qu es lo que caracteriza al conocimiento cientfico que lo hace distinto a otro tipo de conocimiento? Cmo se construyen las teoras cientficas? En el siglo XIX, la revolucin industrial y la burguesa impulsaron de manera importante el desarrollo de las ciencias naturales. La fsica, la qumica y la biologa servan para desarrollar la industria y, por lo tanto, se otorgaron grandes presupuestos para impulsarlas. El mtodo experimental cobr gran importancia y, a travs de los aos, se convirti en el mtodo de demostracin que estableca la diferencia entre la metafsica y la ciencia; las ciencias que utilizaban el experimento comenzaron a destacar y a ofrecer resultados aceptables. Debido a esta situacin se construyeron enfoques filosficos que se propusieron explicar la actividad de los cientficos; uno de ellos fue el positivismo de Augusto Comte (1798-1857), que trascendi hasta nuestros das, y en algunos aspectos es una concepcin que se mantiene en la enseanza de la ciencia. El positivismo afirma que: Las teoras se construyen a travs del mtodo experimental. La ciencia est formada por conocimientos verdaderos. Existe un nico mtodo para estudiar la realidad. La actividad cientfica es socialmente neutra. La ciencia busca la organizacin sistemtica del conocimiento acerca del mundo, pretende formular teoras que expliquen las relaciones que existen entre diferentes clases de fenmenos y procura explicar por qu los hechos ocurren de cierta manera y bajo ciertas condiciones. Puede reelaborar problemas antiguos, pero una de sus intenciones es generar conocimiento nuevo acerca del universo. La ciencia no es slo un conjunto de diferentes formas de conocimiento, sino que es tambin el producto de una actividad humana que tiene una naturaleza especfica. La ciencia es el resultado del esfuerzo de generaciones anteriores y la cooperacin de las contemporneas y stas son fundamentales para su desarrollo futuro, su naturaleza es claramente social. La Biologa adems ha promovido el desarrollo del quehacer humano con la generacin de frmacos y vacunas para evitar enfermedades, con la creacin y
31

GUA METODOLGICA DE BIOLOGA

mejoramiento de nuevas cepas de organismos vivos de uso agrcola, ganadero y forestal o incluso en campos como la Genmica, donde el desarrollo de Terapia Gnica o estudiando el genoma humano por completo ha abierto las posibilidades de evitar patologas asociadas a factores genticos. El Proyecto Genoma Humano ha generado la participacin de pases de todo el mundo que colaboran de manera coordinada, para cumplir los objetivos planteados inicialmente: crear un mapa gentico de los lugares relativos de los genes, un mapa fsico de las posiciones reales, y la determinacin de la secuencia de bases del ADN Novedades en la ciencia El Proyecto Genoma Humano se propuso en 1990 como un estudio a 15 aos, en el que se secuenciara el genoma humano completo, de ms de 3,000 millones de pares de bases. En un principio no quedaba claro si toda la informacin que se obtuviera sera del dominio pblico o solo propiedad de empresas privadas. Sin embargo, en febrero de 1996 establecieron varios acuerdos los participantes (ms de 2000 cientficos de ms de 20 institutos en 6 pases). El ms importante acuerdo fue que se proveera de una serie de datos para toda la comunidad cientfica, ya que la informacin gentica se considera como la "verdadera herencia" humana. El primer cromosoma completo (el cromosoma humano 22) se public en diciembre de 1999. En el verano del ao 2000 se public el genoma "en bruto"; para abril de 2003 se termin la secuencia completa y se public en agosto de 2004. Desde entonces se abrieron varios caminos a seguir. Aunque en un principio se pens que las aplicaciones y los beneficios seran inmediatos, fcilmente se dieron cuenta de que hay mucho trabajo por delante. En el caso de las leguminosas, como el frjol, se encuentran bacterias del genero Rhizobium, que tienen la capacidad de transformar el nitrgeno disuelto en el suelo en compuestos que las plantas pueden aprovechar (sales de amonio) y con ellos fabricar cidos nuclicos (ADN y ARM) y protenas (fijacin del nitrgeno). Se ha calculado que ms de 70 millones de toneladas de nitrgeno se incorporan anualmente a la biosfera mediante este proceso. Mediante una asociacin simbitica entre la bacteria y la raz se forma una protuberancia, donde habita la bacteria y pasa sales de amonio a la raz. Este tipo particular de bacterias que "infectan" al frjol son de la especie Rhizobium etli.
32

GUA METODOLGICA DE BIOLOGA

Esta asociacin y formacin del ndulo est determinada por un "dialogo" molecular entre ambas partes, por lo que resulta muy importante identificar los "sucesos" moleculares que intervienen en este proceso. En el Centro de Ciencias Genmicas (CCG) de la UNAM, en Cuernavaca, Morelos, un grupo de investigadores mexicanos se ha dedicado a analizar la secuencia completa del genoma de Rhizobium etli. De manera que se ha encontrado que una seccin llamada "plsmido simbitico" en las molculas de ADN que porta la mayor parte de los genes involucrados en la capacidad de nodular al frjol y fijar nitrgeno. Otro descubrimiento aun ms interesante es que este plsmido tiene genes que se parecen a otros presentes en bacterias patgenas (dainas) de plantas, como Agrobacterium que provoca tumores, y en bacterias patgenas del ser humano, como Brucella, que provoca una infeccin grave llamada brucelosis. Esto sugiere que, aunque no son bacterias iguales, podran utilizar formas comunes para interactuar con diferentes tipos de clulas. En Amrica Latina, el desarrollo de la innovacin cientfico/tecnolgica se ha estancado, colocndonos en desventaja con los dems pases del llamado "primer mundo". En pases como Japn o China se ha comprendido que el desarrollo cientfico es la base del crecimiento, por lo que invierten gran parte de su producto interno bruto en la generacin de nuevas patentes de las tecnologas creadas por sus cientficos. Aunque en Mxico se cuenta con un buen nivel de desarrollo cientfico y con la capacidad de vincularlo a la generacin de nuevas tecnologas, hace falta la participacin de la sociedad civil y del Estado para aumentar la inversin en estos rubros y para forjar una cultura cientfica ms slida.

LAS CARACTERSTICAS DE LA CIENCIA: EL MTODO CIENTFICO La ciencia (del latn scientia, conocimiento) es un proceso dinmico de adquisicin, organizacin y acervo de conocimientos que son el resultado de aplicar el mtodo cientfico. La ciencia se basa exclusivamente en los hechos del mundo natural y no en las creencias, lo cual permite que sea, hasta cierto punto, objetiva. Por ejemplo, en un estudio cientfico de los sismos que ocurren frecuentemente en Mxico, se buscan las causas y las consecuencias del fenmeno y se trata de explicarlo sin que en ningn momento las creencias religiosas o de cualquier otra ndole afecten el estudio. As nos damos cuenta de que la ciencia es sistemtica, analtica y comunicable porque sigue un mtodo para sus estudios y los analiza antes de tomar cualquier resolucin. Adems, siempre trata que los otros especialistas estn enterados de los resultados
33

GUA METODOLGICA DE BIOLOGA

para escuchar sugerencias y crticas. Siguiendo en el ejemplo de los sismos, se informa a la poblacin para que tome las medidas pertinentes y se minimicen los daos. La ciencia es explicativa por su naturaleza clara e informativa, pero sobre todo es verificable porque los resultados pueden reproducirse para confirmar los conocimientos; es predictiva porque genera modelos que se adelantan a los hechos. De esta forma se pueden evitar algunas catstrofes, como en el caso de los modelos preventivos para el desalojo de edificios durante un sismo.
ACTIVIDAD Identifica y subraya de distinto color cada uno de los pasos del mtodo experimental que sigui Louis Pasteur: observacin y planteamiento del problema (amarillo), hiptesis (verde), experimentacin (rojo), resultados y conclusin (azul). A mediados del siglo XIX, Pasteur se dedic a estudiar una enfermedad llamada clera de las gallinas, que causaba gran mortandad entre las aves. Pasteur haba observado a travs de microscopios, a muchos microorganismos, supona que algunas enfermedades, si no es que todas, bien podan ser causadas por ellos. As, Pasteur se dedic a estudiar diferentes tejidos de las gallinas enfermas, con la finalidad de encontrar y obtener microorganismos. Por fin, obtuvo algunos que l consider podan ser los causantes de la enfermedad, y los cultiv en caldos especiales, donde se mantenan vivos por varias semanas Posteriormente, inyect algunos de estos microorganismos en gallinas sanas: todas enfermaron de clera y murieron.

El mtodo cientfico plantea los siguientes pasos: planteamiento del problema, composicin del marco terico, formulacin de hiptesis, experimentacin confirmacin o rechazo de la hiptesis. El planteamiento del problema, consiste en hacer una pregunta que gue todo el proceso de la investigacin. Es lo que se va a explicar cientficamente en algn grado. La composicin del marco terico implica: la revisin de la literatura sobre el tema, la seleccin de planteamientos de diversas ideas y hasta contrapuestas corrientes tericas y la elaboracin propia del texto. La formulacin de la hiptesis consiste en simples afirmaciones sujetas a comprobacin que lleguen a explicar los fenmenos.

34

GUA METODOLGICA DE BIOLOGA

A travs de la experimentacin la hiptesis puede ser comprobada una y otra vez, estableciendo con el tiempo una teora o ley. Si no es as, entonces hay que replantear la hiptesis original para volver a comenzar. Finalmente, se alcanza una conclusin que recopila los resultados y la comprobacin o no de la hiptesis.

1.5 CULES SON LAS CARACTERSTICAS DE LOS NIVELES DE ORGANIZACIN DE LA MATERIA? Por sorprendente que parezca, las interacciones entre las distintas molculas que ocurren a nivel microscpico, pueden producir a nivel macroscpico una clula viva. A qu se llama materia? Todo lo que podemos ver y tocar es materia. Pero tambin son materia algunas cosas que no podemos ver, como el aire, por ejemplo. La materia ocupa una cierta porcin de espacio que se denomina volumen. En el caso especfico del aire esto no es tan evidente. Qu es la materia viva? Dentro de los niveles de organizacin, la materia viva ocupa los cuatro ltimos lugares. La materia viva llamada tambin materia orgnica, esta formada principalmente por carbono, hidrgeno, oxigeno y nitrgeno. Estos elementos, al combinarse, forman biomolculas que interactan entre si dentro de la forma viva mas simple que es la clula. La clula es la unidad fundamental por la cual estn constituidos todos los seres vivos y en general se acepta que, ningn organismo es un ser vivo si no consta al menos de una clula

LOS NIVELES DE ORGANIZACIN DE LA MATERIA La materia en el universo est organizada. Los seres vivos estn formados por materia que a su vez est formada por elementos qumicos (como el nitrgeno, calcio, carbono) que estn formados por tomos. Los fsicos han descubierto un variado nmero de partculas subatmicas como protones, neutrones y electrones. Si combinamos tomos de hidrgeno entre s obtenemos hidrgeno molecular (H2), que es un gas incoloro; si, en cambio, combinamos el H2 con oxgeno, otro gas, obtenemos agua, una molcula.

35

GUA METODOLGICA DE BIOLOGA

La vida surgi a partir de tomos y molculas. Si combinamos molculas entre s, formamos grandes y complejas molculas: las macromolculas, como protenas y cidos nuclecos. Estas constituyen la materia prima que forman los virus y las clulas. En el nivel subcelular mltiples molculas se ensamblan y dan lugar a estructuras especializadas como los organelos celulares (mitocondrias, cloroplastos, entre otros). Se puede decir que la vida aparece como propiedad definitoria en el nivel celular, es decir, la clula es la porcin ms sencilla de la materia viva que es capaz de realizar todas las funciones vitales. En la mayor parte de los individuos pluricelulares, las clulas se organizan de acuerdo a sus caractersticas y funciones conformando tejidos como el conectivo, muscular, epitelial, nervioso. Los tejidos estn ordenados en estructuras funcionales, denominadas rganos como el corazn y los pulmones en los animales, o las hojas y las races en las plantas. Las funciones biolgicas bsicas se llevan a cabo por un sistema o aparato, que es una asociacin coordinada de tejidos y rganos. Los organismos pluricelulares estn formados por sistemas que actan en forma coordinada y precisa. Un individuo es un solo organismo de una especie determinada, por ejemplo el hombre. Cuando se renen a todos los individuos de una misma especie que viven en un mismo lugar, en el mismo tiempo, y que comparten el mismo hbitat forman una poblacin. Estas poblaciones interactan de distinta manera con otras poblaciones del lugar constituyendo una comunidad, por ejemplo la poblacin de elefantes de la sabana africana. Esta comunidad comparte el mismo lugar fsico que presenta caractersticas particulares y cuando se relacionan con el medio fsico constituye a un ecosistema, y el conjunto de ecosistemas forman un bioma caracterizado por las condiciones climticas que determinan un gran biosistema regional. Por ejemplo, cuando se habla de la selva, no nos referimos a la selva amaznica o a la africana sino a todas las selvas del orbe. El conjunto de todos los biomas integran a la biosfera, que es la capa de la Tierra donde existe vida. Desde aqu, surgen otros niveles superiores de organizacin que estudian los astrnomos como que nuestro planeta Tierra es parte de un Sistema Solar que a su vez pertenece a una galaxia, la Va Lctea, que es una de las miles de millones de galaxias que conforman el Universo.

36

GUA METODOLGICA DE BIOLOGA

NIVELES DE ORGANIZACIN DE LA MATERIA Subatmico Atmico Molecular Macromolecular Subcelular Celular Tisular rganos Sistmico Organismos Poblacional Comunitario Ecosistema Biosfera Cosmolgico Protones, neutrones y electrones Carbono, Hidrgeno, Oxgeno Monosacridos, aminocidos, nucletidos. Polisacridos, protenas, cidos nuclicos, lpidos complejos, virus Organelos celulares: mitocondrias, cloroplastos, ribosomas, Clula procarionte y eucarionte Organismos unicelulares: bacterias, algas, levaduras, protozoarios Tejidos conectivo, epitelial, muscular, nervioso Corazn, pulmones, estmago Sistema circulatorio, digestivo, respiratorio Organismos pluricelulares, animales y vegetales superiores Parvada de aves, banco de atunes Bosque Ecosistemas y biomas terrestres y acuticos: Bosque tropical, arrecifes de coral Todos los biomas del planeta Planetas, estrellas, galaxias y universo

ACTIVIDAD Escribe en una hoja de tu libreta y en forma de lista, los niveles de organizacin de la materia de forma descendente. Con el trabajo documental de las ramas de la Biologa investigadas, ubica cada ciencia utilizando llaves o corchetes de acuerdo al nivel o los niveles correspondientes a su campo de estudio. Primero delimita el campo de accin de la Biologa. En forma grupal, el profesor o algn alumno voluntario har lo mismo tratando de incluir todas las ciencias investigadas por todos los alumnos.

37

GUA METODOLGICA DE BIOLOGA

MATRIZ DE VALORACIN DE COMPETENCIAS Criterios


Emplea el mtodo cientfico para desarrollar un proyecto de investigacin

Pre-formal
Realiza un proyecto de investigacin sin aplicar los pasos del mtodo cientfico

Receptivo
Realiza un proyecto de investigacin aplicando los pasos del mtodo cientfico con orientacin del docente

Resolutivo
Realiza un proyecto de investigacin aplicando los pasos del mtodo cientfico de forma clara y precisa

Autnomo
Realiza un proyecto de investigacin aplicando los pasos del mtodo cientfico de forma crtica y reflexiva.

Estratgico
Realiza un proyecto de investigacin aplicando los pasos del mtodo cientfico de forma crtica, reflexiva y propositiva

Ponderacin Logros:

Puntos

30

Puntos

60

Puntos 80 Puntos Aspectos a mejorar :

100

Puntos 100

EVALUACIN
DIAGNSTICA Aplicacin de un examen diagnstico y la retroalimentacin por medio de una lluvia de ideas.
ACTIVIDADES DE APRENDIZAJE: Glosario Mapa mental Debate ACTIVIDAD ESPECFICA: Proyecto de investigacin

FORMATIVA

SUMATIVA

Examen departamental tipo CENEVAL o PISA Laboratorio (evaluacin V-Gowin) Actividades de aprendizaje Actividad especfica por unidad

30% 20% 20% 30%

BIBLIOGRAFA BSICA Bernal, J.D. (1994). La Ciencia en la Historia. Nueva Imagen UNAM. Mxico. pp 1226 Cervantes, M. y Hernndez, M. (2004) Biologa General. Publicaciones Cultural. Mxico. pp 1242 Gonzlez, Vector. (1998) Genmica en Mxico, Como ves? Ao I, Nm. 1. Mxico. p 26. Prez Granados, P.A. y Molina Cern, M.L. (2007). Biologa Ed. Santillana, Primera edicin Mxico. Vzquez, C.R. (2006). Biologa I. Publicaciones Cultural. Mxico. pp 48
38

GUA METODOLGICA DE BIOLOGA

BIBLIOGRAFA COMPLEMENTARIA Biggs, Kapicka y Lundgren. (1999). Biologa, la Dinmica de la Vida. Mc Graw Hill. Mxico. 737 pp. Buican, D; (1996). Historia de la Biologa. Segunda edicin. Acento editorial, serie Flash. Espaa. 91 pp. Consejo Nacional para la Enseanza de las Biologa. (1975). Biologa. CECSA, Mxico. 960 pp. Garca, H. (1997). La Vuelta al Mundo del Doctor Balmis o los Desconocidos Nios Hroes en Gentica para el Futuro. Coleccin Esto es Qumica y qu? Facultad de Qumica, UNAM. Mxico. pp. 60-74 Gmez Caballero, J. A. y Pantoja Alor, J. (2003.) El Origen de la Vida desde un Punto de Vista Geolgico. Boletn de la Sociedad Geolgica Mexicana. Tomo LVI, Nm. 1. Mxico. pp. 56-86.
http://www.geociencias.unam.mx/~alaniz/SGM/200356Gomez.pdf

Lazcano Araujo, A. (1996) El Origen de la Vida. Quinta reimpresin. Trillas; Mxico. 107 pp. Ledesma M., I. (1993). Biologa: "Ciencia o Naturalismo, en Ciencia y Desarrollo, CONACYT, mayo junio. Mxico. pp. 7077. Llera Domnguez. (1984); Temas para un Futuro Bilogo. Segunda Edicin, UNAM. Mxico. 569 pp. Rodrguez, L.F.; (1986). Un Universo en Expansin. Fondo de Cultura Econmica. Mxico 111 pp. Rojas Pea, I. (2004) El Origen de la Vida sobre la Tierra. Universit`a degli studi di Genova. Italia. 36 pp. http://www.lunanueva.cl/files/articulos/El_Origen_de_la_Vida_en_la_Ti erra_v3.pdf

VIDEOS RECOMENDADOS Cosmos de Carl Sagan Paradigmas de Joe Baker TIC Proyecto Bisfera. http://recursos.cnice.mec.es/biosfera/
39

GUA METODOLGICA DE BIOLOGA

BLOQUE 2
Clula, estructura y funcin

40

GUA METODOLGICA DE BIOLOGA

BLOQUE DE APRENDIZAJE: LA CLULA: ESTRUCTURA Y FUNCIN


TIEMPO: 45 horas UNIDAD DE COMPETENCIA: Relaciona la composicin qumica con la estructura y fisiologa celular, para valorar la importancia de la clula como unidad estructural y funcional de los seres vivos a travs del anlisis de los procesos celulares. SABERES Procedimentales Elabora una lnea del tiempo del descubrimiento de la clula, el desarrollo de la teora celular hasta la poca actual Construye un cuadro de doble entrada de los componentes celulares. Utiliza el microscopio como instrumento para el estudio de la clula Desarrolla un mapa conceptual integrador de la estructura y los procesos celulares. Desarrolla modelos experimentales que demuestren los procesos celulares. COMPETENCIAS Genricas/Atributos Disciplinares 5.2 Ordena informacin de acuerdo a categoras, jerarquas y relaciones. 5.5 Sintetiza evidencias obtenidas mediante la experimentacin para producir conclusiones y formular nuevas preguntas. 6.1 Elige las fuentes de informacin ms relevantes para un propsito especfico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. 1. Establece la interrelacin entre la ciencia, la tecnologa, la sociedad y el ambiente en contextos histricos y sociales especficos. 4. Obtiene, registra y sistematiza la informacin para responder a preguntas de carcter cientfico, consultando fuentes relevantes y realizando experimentos pertinentes. 12. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo, sus procesos vitales y el entorno al que pertenece. 13. Relaciona los niveles de organizacin qumica, biolgica, fsica y ecolgica de los sistemas vivos. 14. Aplica normas de seguridad en el manejo de sustancias, instrumentos y equipo en la realizacin de actividades de su vida cotidiana.

Declarativos Explica la teora celular

Actitudinales/Valorales Valora la importancia del trabajo colaborativo. Valora la importancia de los procesos celulares para la conservacin de la vida. Usa responsablemente el material de laboratorio en el trabajo experimental

Relaciona la composicin qumica con la estructura y funcin celular

Identifica los procesos celulares

41

GUA METODOLGICA DE BIOLOGA


CRITERIOS DE DESEMPEO Explica el descubrimiento de la clula, el desarrollo de la teora celular hasta la poca actual a travs de una lnea del tiempo. Relaciona la composicin qumica, la estructura y funcin celular a travs de un cuadro de doble entrada. Describe los tipos de clula mediante el uso del microscopio compuesto y reporta los resultados en una V de Gowin. Analiza la estructura y los procesos celulares mediante un mapa conceptual integrador.

ESTRATEGIAS DE ENSEANZA Aplicacin de preguntas generadoras


Dinmicas

ESTRATEGIAS DE APRENDIZAJE Elaboracin de una lnea del tiempo


Elaboracin

RECURSOS DIDCTICOS
Aula Microscopio Laboratorio virtual Videos Software Revistas Pizarrn Plumones Can DVD Gua metodolgica Manual de Masking

EVIDENCIAS Y/O PRODUCTOS Lnea del tiempo


Reporte

grupales
Presentaciones

de un cuadro de doble entrada y manejo del microscopio conceptual integrador de laboratorio a travs de una V de Gowin de actividades de la gua metodolgica

de la prctica V de Gowin conceptual integrador de doble entrada

Mapa

de power point sobre los niveles de organizacin celular experimentales.

Conocimiento

educativo

Cuadro

de divulgacin

Mapa

Actividades

Reporte

Resolucin

prcticas

tape reactivos de

Materiales y

laboratorio
Bata

blanca

42

GUA METODOLGICA DE BIOLOGA

43

GUA METODOLGICA DE BIOLOGA

EXPLORANDO TUS CONOCIMIENTOS


1. Existen organismos macroscpicos y microscpicos Menciona algunos ejemplos de los ltimos? ______________________________________________________________________ __________________________________________________________________ 2. En el siguiente recuadro dibuja una clula

3. Cul consideras que es el instrumento ms importante para el estudio de la clula? _________________________________________________________________ 4. Quin descubri la primera clula? _________________________________________________________________ 5. Escribe las funciones que realiza una clula ______________________________________________________________________ ____________________________________________________________

44

GUA METODOLGICA DE BIOLOGA

La clula es la unidad estructural y funcional de todos los seres vivos. Por lo tanto, en el ambiente se localizan organismos unicelulares, como las bacterias y los protozoarios entre los que se encuentran las amibas y el Paramecium. Pero tambin existen organismos pluricelulares como los hongos, plantas y animales los cuales se diferencian de los unicelulares por que estn formados por rganos, tejidos y algunos presentan sistemas. Toda clula est delimitada por una membrana celular lo cual le permite funcionar como una fbrica porque en ellas se requiere de materia prima para la produccin de sustancias tiles, en donde los obreros son las enzimas. Algunas molculas reguladoras hacen las veces de capataces, ya que vigilan que las actividades se realicen de acuerdo con las indicaciones contenidas en la molcula de ADN, la cual se localiza en el ncleo o centro de control.

ACTIVIDAD 1. Realiza una investigacin documental a cerca de la Teora Celular 2. Con esa informacin elabora una lnea del tiempo donde se pueda evidenciar los antecedentes de la teora celular, los personajes y sus postulados. Anota en ella el ao, nombre del cientfico y una breve oracin de la aportacin que hizo. Acurdate de llevar una secuencia cronolgica de los acontecimientos. 3. Posteriormente en plenaria expondrn la lnea del tiempo

2.1 CULES HECHOS HISTRICOS CONDUJERON AL PLANTEAMIENTO DE LA TEORA CELULAR?


Descubrimiento de la clula En 1665 el cientfico ingls Robert Hooke (fig.2.1) al observar un corte fino de corcho, identific una serie de estructuras parecidas a un panal de abejas. A estos espacios los llam celdillas debido a que se parecan mucho a las celdas que ocupaban los monjes en el monasterio, de ah deriv el trmino de clula. Sin embargo, a pesar de que es a Hooke a quien se le da el crdito de descubrir las clulas, no fue el primero en observarlas; El primero en observar bacterias, glbulos rojos, protozoarios y espermatozoides fue el holands llamado Anton van Leeuwenhoek, en el siglo XVII (fig. 2.2).

45

GUA METODOLGICA DE BIOLOGA

En el siglo XVII, el desarrollo tecnolgico, particularmente la invencin del microscopio, permiti la exploracin de un mundo que antes era inaccesible para el ojo humano; esto abri un sinfn de posibilidades y formas de aproximacin al estudio del mundo microscpico. Sin embargo, no fue suficiente con tener instrumentos o tcnicas que permitieran observar las estructuras o fenmenos vivos para poder entenderlos y explicarlos, fue necesario tambin contar con marcos conceptuales que permitieran interpretarlos. Un ejemplo de ello lo constituye el planteamiento de la teora celular.

Fig. 2.1 Robert Hooke

Fig. 2.2 A. Leeuwenhoek

A partir del descubrimiento de Hooke, una serie de naturalistas y cientficos iniciaron la bsqueda de clulas en tejidos animales y vegetales, entre ellos se encuentran los alemanes Friedrich Theodor Schwann y Matthias Jakob Schleiden, zologo y botnico, respectivamente, quienes en 1838 y 1839 descubrieron que todos los animales y vegetales estn formados de clulas (fig. 3.3). Con ello se formulan los dos primeros principios de la teora celular: 1. Todos los seres vivos estn compuestos de una o ms clulas. 2. La clula es la unidad estructural de la vida. Fue en 1855 que el patlogo alemn Rudolf Virchow (fig.2.3) concluy que las clulas proceden de otras clulas semejantes, su hiptesis dio lugar al tercer postulado de la teora celular: 3. Las clulas slo pueden originarse por divisin de una clula preexistente.

46

GUA METODOLGICA DE BIOLOGA

Fig. 2.3 M. Schleiden, T. Schwann y R. Virchow

De aqu se concluye que la clula es la unidad: Anatmica. Los seres vivos estn formados por una o ms clulas. Fisiolgica. Cada clula lleva a cabo todas las funciones vitales. De origen. La clula se origina a partir de clulas preexistentes.
ACTIVIDAD Contesta las preguntas siguientes con respecto a la Teora Celular 1. Las clulas de tu piel respiran, se nutren, excretan; si no efectuaran estas funciones, moriran. Con cul de los postulados de la teora celular se relaciona el hecho de que las clulas de tu piel se mantengan vivas? Por qu? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________

47

GUA METODOLGICA DE BIOLOGA

2. Despus de haber tenido un raspn, se forma una costra con sangre coagulada y los restos muertos de clulas, y bajo la costra tu piel se regenera Con cul de los postulados de la teora celular se relaciona la regeneracin de tu piel? Por qu? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 3. Tu cuerpo est formado por piel, msculos, huesos, etc. Estas partes, a su vez, estn constituidas por clulas. Este hecho, Con cul de los postulados de la teora celular se relaciona? Por qu? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________

2.2 QU DIFERENCIAS HAY ENTRE CLULAS PROCARIONTES Y EUCARIONTES?


Existen dos tipos celulares bsicos clasificados con base en su organizacin y complejidad estructural: procarionte y eucarionte. Las clulas procariontes (pro, antes y Karion, ncleo) no tienen ncleo verdadero, el ADN se encuentra disperso en el citoplasma constituyendo un solo cromosoma o unido a la membrana citoplsmica (fig.2.4); el ejemplo caracterstico son las bacterias.

48

GUA METODOLGICA DE BIOLOGA

Las clulas procariontes son de menor tamao que las eucariontes. Presentan una pared celular que rodea completamente a la membrana celular, protegindola de las agresiones del medio externo y da forma a la clula. Los dos tipos celulares poseen ribosomas encargados de la sntesis de protenas, sin embargo, presentan una diferencia sustancial en cuanto al tipo de ARN ribosomal que lo forman. De aqu que los ribosomas procariontes se denominen 70s y los eucariontes 80s por su coeficiente de sedimentacin. La divisin celular de las clulas procariontes se da por divisin binaria o biparticin, el ADN se duplica y las dos copias se separan y se forman dos clulas hijas idnticas, por esta razn la reproduccin es ms rpida que en las eucariontes; por ejemplo, una nueva generacin de bacterias puede aparecer cada 20 o 40 minutos. Las clulas procariontes son microorganismos asexuados (sin sexo). En algunas bacterias se ha observado in vitro (en laboratorio) que bajo ciertas circunstancias realizan un proceso llamado conjugacin, en el que un fragmento de ADN denominado plsmido puede pasar de una bacteria a otra. Por otro lado, las clulas eucariontes (eu, verdadero y Karion, ncleo) son mucho ms complejas, tanto estructural como funcionalmente. El ADN se localiza dentro de una doble membrana llamada envoltura nuclear que lo separa del resto del citoplasma y conforma un ncleo verdadero. La complejidad de las clulas eucariontes se basa en el desarrollo de compartimentos internos que originan diversas estructuras subcelulares denominadas componentes celulares como: mitocondrias, cloroplastos, ribosomas, lisosomas, complejo de Golgi, centriolos, vacuolas, retculo endoplsmico, peroxisomas y citoesqueleto; cada componente tiene una funcin especializada (fig. 2.5). Por lo general, las clulas eucariontes se dividen por mitosis, donde el material gentico (ADN) duplicado se condensa en estructuras llamadas cromosomas y se divide en dos clulas hijas. Las clulas germinales sufren meiosis, a partir de la cual se producen clulas hijas con la mitad del nmero de cromosomas de la clula madre, siendo la base de la reproduccin sexual. De acuerdo con la clasificacin de seis reinos, las clulas procariontes slo estn presentes en los reinos Arqueobacteria y Eubacteria. De ellas derivaron las clulas eucariontes actuales presentes en los cuatro reinos restantes: Protista, Fungi, Plantae y Animalia.
49

GUA METODOLGICA DE BIOLOGA

Fig. 2.4. Morfologa de una clula procarionte

Fig. 2.5. Morfologa de una clula eucarionte

2.3. CMO EST ESTRUCTURADA Y CMO FUNCIONA UNA CLULA?


Entre las propiedades que comparten las clulas y que a la vez pueden considerarse como caractersticas de los seres vivos, se encuentra su complejidad, el intercambio de materia y energa con el medio, el mantenimiento de su medio interno, la capacidad de autorregularse, el que tienen ADN necesario para la reproduccin, el crecimiento y el desarrollo, as como la especializacin celular y la capacidad de responder a estmulos. Las clulas son entidades complejas y organizadas en trminos de orden y regularidad. Esta estructura est basada en molculas orgnicas e inorgnicas. La complejidad de la vida va desde las partculas subatmicas y los tomos; la organizacin de estos tomos en molculas de pequeo y gran tamao como agua, protenas y cidos nucleicos a su vez se organizan en estructuras subcelulares que constituyen a las clulas. Las clulas intercambian materia y energa con el medio, esto se refiere a que las clulas incorporan nutrientes para transformarlos a partir de una serie de reacciones qumicas que realizan y con ello obtienen la energa til a la clula para realizar todas sus actividades, como el movimiento, la reproduccin, el crecimiento, etc. Esta energa se encuentra almacenada en una molcula altamente energtica denominada ATP (adenosntrifosfato), la cual pertenece al grupo bioqumico de los nucletidos. Todos los seres vivos se alimentan, esto es, toman del medio las sustancias necesarias para obtener energa. Los auttrofos transforman la energa solar en
50

GUA METODOLGICA DE BIOLOGA

energa qumica a travs de la fotosntesis; en cambio, los hetertrofos tienen que transformar los alimentos en otros ms sencillos y a partir de stos sus clulas se encargan de sintetizar otros compuestos ms complejos que utilizan para reparar tejidos y llevar a cabo todas sus actividades. Toda esta serie de reacciones que se llevan a cabo en el interior de la clula gracias a la presencia de las enzimas o biocatalizadores en conjunto se llama metabolismo. ste consta de dos fases: una fase de degradacin donde molculas grandes se transforman en molculas pequeas llamada catabolismo y una fase de sntesis donde se forman molculas grandes a partir de molculas pequeas llamada anabolismo.
ACTIVIDAD Realiza una investigacin documental para completar el siguiente cuadro comparativo entre clula procarionte y eucarionte, escribiendo las caractersticas que las hacen distintas.

51

GUA METODOLGICA DE BIOLOGA

Las clulas mantienen constante su medio interno a travs de un proceso de equilibrio fisiolgico denominado homestasis, propiedad importante para el funcionamiento celular, ya que si falla se presentan alteraciones que pueden ser determinantes y causar la muerte celular. La clula, por tanto, posee mecanismos reguladores de todo su funcionamiento, como la reproduccin, la sntesis de protenas, la cantidad de electrlitos, la cantidad de agua, etctera. Las clulas tienen ADN, molcula que identifica a cada ser vivo y que contiene las instrucciones para todo el funcionamiento celular: la reproduccin, el desarrollo, crecimiento y funcionamiento de la clula, dichas informacin se encuentra contenida en la secuencia de nucletidos del ADN. Los mecanismos reguladores de la clula son tan importantes que un cambio en la secuencia del ADN debe ser identificado y corregido por la clula, de no ser as, se presentar una mutacin. Algunas mutaciones son tan severas que causan la muerte del organismo. Sin embargo, las mutaciones no letales y no dainas producen la variabilidad gentica que permite que los seres vivos evolucionen. Las clulas responden a los estmulos del medio como el alimento, la luz, las hormonas, los factores de crecimiento, las sustancias qumicas, la presin o la cantidad de agua. Todas las clulas responden de manera especfica para cada sustancia o agente externo o interno. Esto permite a las clulas sobrevivir, moverse, iniciar la divisin celular, modificar su actividad metablica, etc. A esta capacidad de respuesta celular se le denomina irritabilidad. Cuando las clulas con una funcin especfica se unen entre s, dan origen a los tejidos y estos, a su vez, forman rganos, y el conjunto de rganos forman sistemas, de la misma manera las biomolculas como: aminocidos, protenas carbohidratos, lpidos y cidos nuclicos constituyen los componentes de la clula. Dichos componentes de acuerdo a su composicin qumica y la funcin que desempean se clasifican en:
SISTEMAS MEMBRANOSOS SISTEMAS NO MEMBRANOSO Citosol o hialoplasma Membrana celular Inclusiones citoplasmticas Retculo endoplsmico: liso y Citoesqueleto rugoso Microtbulos (Centriolos, Cilios Complejo de Golgi y flagelos) Lisosomas Microfilamentos Filamentos intermedios 52 Ribosomas ORGANELOS Mitocondria Cloroplasto Ncleo Vacuolas Microcuerpos Vesculas

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD
A travs de un diagrama de Venn establece las diferencias y similitudes entre una clula animal y una vegetal.

MEMBRANA CELULAR
La membrana celular es la que limita y da forma a la clula, su composicin qumica es lipoproteca, es decir, est constituida por una doble capa de fosfolpidos, protenas perifricas e integrales, carbohidratos y colesterol, si se trata de una clula animal, pero si es de origen vegetal presenta ergosterol.

53

GUA METODOLGICA DE BIOLOGA

Las protenas: son compuestos orgnicos formados por aminocidos (fig. 2.6), los cuales se caracterizan por tener un grupo amino, un carboxilo y un radical como se puede observar en la siguiente frmula general.

Fig. 2.6. Frmula general de un aminocido

ACTIVIDAD 1. Realiza una investigacin documental a cerca de las protenas, en la que se enfatice su definicin, clasificacin y funcin. 2. Posteriormente integra equipos de tres compaeros y compartan su informacin obtenida a travs de sus respectivas investigaciones. 3. A continuacin elaboren un cuadro sinptico donde se pueda evidenciar la clasificacin de las protenas por su: composicin qumica, forma, estructura y funcin. 4. En plenaria, expongan su cuadro sinptico para hacer una retroalimentacin.

Los carbohidratos: son miembros de una familia de compuestos orgnicos que se caracterizan por tener varios grupos hidroxilos y por lo menos potencialmente un grupo aldehdico o cetnico. Un alcohol polivalente es una molcula orgnica que tiene ms de un radical alcohlico (C OH), por ejemplo el glicerol. La palabra carbohidrato literalmente significa carbn con agua (carbn hidratado) o hidrato de carbono, y se les conoce as por tener carbn, hidrgeno y oxgeno, stos dos ltimos en la misma proporcin que en el agua (2:1); sin embargo, en la frmula emprica se observa que eso no es cierto.

CnH2nOn
54

GUA METODOLGICA DE BIOLOGA

Tambin se les conoce como sacridos (sacar en latn significa azcar), glcidos (glucos en griego significa dulce) o azcares; desempean su principal funcin biolgica como energticos, o sea, que de ellos se obtiene energa para procesos vitales. Un gramo de carbohidratos proporciona 4 caloras. Adems, desempean funciones estructurales y de reserva. Los fosfolpidos son ejemplos de lpidos compuestos formados por la unin de cidos graso, un alcohol denominado glicerol y cido fosfrico. El colesterol y el ergosterol son esteroles, el primero participa en la fluidez y estabilidad de las membranas biolgicas, y el segundo se transforma en vitamina D debido a la radiacin ultravioleta En la dcada de 1950 se observaron por primera vez al microscopio electrnico las membranas celulares. Qumicamente estn constituidas por una doble capa de lpidos, carbohidratos y protenas. Para explicar su estructura, los bilogos S.J. Singer y G.L. Nicholson, en 1972, elaboraron un modelo llamado mosaico fluido (fig. 2.7). Lo importante de este modelo es que denota la calidad dinmica de la membrana celular. Existen varios mecanismos por medio de los cuales la membrana es selectivamente permeable: a) el tamao del poro, b) la solubilidad en lpidos y c) el potencial elctrico de la membrana. Las molculas cuyo tamao coincida con el tamao del poro o sean ms pequeas que ste podrn atravesar la membrana fcilmente. Algunas molculas como los gases pueden atravesar la membrana debido a que son solubles en los lpidos de sta y finalmente, la carga elctrica de los iones determina en un momento dado qu tipo de molculas la atraviesan.

ACTIVIDAD 1. Realiza una investigacin documental sobre los carbohidratos y lpidos, en la que se enfatice su definicin, clasificacin y funcin. 2. Integra equipos de tres compaeros y compartan su informacin obtenida a travs de sus respectivas investigaciones. 3. Posteriormente consensada la informacin elaboren un mapa conceptual integrador donde se pueda evidenciar la funcin, clasificacin y funcin de los carbohidratos y los lpidos. 4. A continuacin en plenaria, expongan su mapa conceptual para hacer una recapitulacin y retroalimentacin.

55

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD. Explica la importancia del colesterol en tu organismo y argumenta los daos que puede ocasionar el exceso. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ Argumenta cul es la relacin que existe entre el colesterol y el estrgeno ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ _______________________________________________________________________________

Los lpidos ms abundantes en la membrana son los fosfolpidos. En ciertas membranas tambin existe colesterol, sustancia que en ciertas clulas animales puede constituir hasta 50%. Las membranas de la mayor parte de los vegetales y de las bacterias no contienen colesterol. Los grupos polares de cada capa de fosfolpidos se orientan hacia el exterior de la bicapa y pueden interactuar con las molculas de agua que los rodean, las cadenas hidrofbicas del fosfolpido se encuentran orientadas hacia el interior de la bicapa. Esta bicapa de lpidos tiene consecuencias en la estructura y funcionamiento de las clulas. Debido a la cohesin y formacin
56

GUA METODOLGICA DE BIOLOGA

espontnea de las bicapas nunca se observan membranas con bordes libres; siempre son estructuras ntegras continuas. Gracias a la flexibilidad de la bicapa de lpidos, las membranas son deformables y pueden cambiar toda su forma como ocurre durante la locomocin o la divisin celular. La composicin de carbohidratos de la membrana depende del tipo de clula, y la cantidad de stos vara entre 2 y 10% del peso total. Se encuentran unidos a los lpidos y las protenas en forma de glucolpidos y glucoprotenas, respectivamente.

Fig. 2.7. Modelo de mosaico fluido de la membrana celular

Las protenas de la membrana varan desde una docena hasta 50 tipos diferentes. Cada una se encuentra localizada y dirigida en una posicin particular de la bicapa lipdica. Pueden ser protenas integrales, que penetran en la bicapa de lpidos; la mayora atraviesan completamente la bicapa y tienen regiones que sobresalen en ambos lados de la membrana hacia el espacio extracelular y el citoplsmico. Otro tipo de protenas son las perifricas, que se localizan por completo fuera de la bicapa de lpidos, pero ancladas por grupos de cidos grasos o por otras protenas a la superficie extracelular o citoplsmica.
57

GUA METODOLGICA DE BIOLOGA

La membrana celular cumple varias funciones: a. Delimita y protege la clula. b. Es una barrera selectivamente permeable, ya que impide el libre intercambio de materiales de un lado a otro, pero al mismo tiempo proporcionan el medio para comunicar un espacio con otro. c. Permite el paso o transporte de solutos y de agua de un lado a otro de la clula, pues regula el intercambio de sustancias entre el interior y el exterior de la clula siguiendo un gradiente de concentracin; d. Poseen receptores qumicos que se combinan con molculas especficas que permiten a la membrana recibir seales y responder de manera especfica, por ejemplo, inhibiendo o estimulando actividades internas como el inicio de la divisin celular, la elaboracin de ms glucgeno, movimiento celular, liberacin de calcio de las reservas internas, etc. CITOPLASMA El citoplasma es la masa coloidal qumica y morfolgicamente compleja, comprendida entre la membrana celular y la membrana nuclear. Es un lquido viscoso de consisten cia gelatinosa y su estructura corresponde a la de un coloide (sistema constituido por agua y diferentes molculas de elevado peso molecular); en el que estn suspendidos los organelos y las microestructuras celulares. La parte del citoplasma que est atravesado por una red de fibras y filamentos denominada citoesqueleto, recibe el nombre de morfoplasma (parte coloidal); a toda la porcin citoplasmtica que carece de esta estructura se le da el nombre de citosol o hialoplasma (parte lquida del citoplasma), por tanto, el citoplasma presenta un estado fluido (sol) y otro viscoso (gel), lo cual permite que se encuentre en movimiento continuo (ciclosis) favoreciendo el intercambio de sustancias con el medio exterior.

RETCULO ENDOPLSMICO
El retculo endoplsmico es un sistema membranoso que se distribuye a travs del citoplasma, desde la membrana nuclear hasta la membrana plasmtica. Se observan dos tipos de retculos endoplsmicos; el rugoso (RER) y el liso (REL) (fig. 2.8), que se diferencian entre s por los siguientes aspectos:
58

GUA METODOLGICA DE BIOLOGA

a. El RER presenta ribosomas adheridos a sus membranas y el REL recibe este nombre porque no las tiene. b. El RER es un conjunto de canales con forma de cisternas en cuyas paredes membranosas se realiza la sntesis de protenas con la intervencin de los ribosomas (ARNr), el ARN mensajero y el ARN de transferencia. c. A medida que el RER se aleja de la membrana nuclear externa y se distribuye en el citoplasma, hay una zona de transicin donde cambia de forma (canales y cisterna) y se observan los retculos con tubos anastomosados entre s y cuyas paredes membranosas carecen de ribosomas. d. Como consecuencia desarrollan funciones diferentes. En el retculo endoplsmico liso se sintetizan algunos fosfolpidos, hormonas esteroides y cidos grasos. Mientras que en el retculo endoplsmico rugoso se realiza la sntesis proteica y la maduracin de las protenas de exportacin y las que se transportan a otros componentes celulares.

Fig. 2.8. Retculo endoplsmico rugoso

Las clulas tienen cantidades distintas de REL o RER, segn sus actividades. Por ejemplo, las clulas que secretan gran cantidad de protenas tienen una gran actividad de RER.
59

GUA METODOLGICA DE BIOLOGA

COMPLEJO DE GOLGI
El complejo de Golgi, (fig. 2.9 y 2.10), consiste en cisternas aplanadas, discordes con rebordes amplios relacionados con vesculas emergentes. Realiza funciones especficas, tales como: Formar vesculas como los lisosomas, la distribucin de protenas y lpidos que reciben del retculo endoplsmico, algunas de estas protenas son enzimas que se envan a los lisosomas. Transforma las protenas y los residuos de carbohidratos para formar glucoprotenas presentes en la superficie externa de la membrana celular. Almacena las glucoprotenas en vesculas para ser enviadas a otras partes de la clula; asimismo, ensambla glucolpidos y glucoesfingolpidos.

Fig. 2.9. Complejo de Golgi

Fig. 2.10. Relacin entre RER y complejo de Golgi

ACTIVIDAD Para determinar el lugar de sntesis y el camino que siguen las protenas segregadas por las clulas del pncreas antes de salir de la clula, se realiza la siguiente experiencia: se toma el pncreas de una rata y se corta en fragmentos. Estos fragmentos se mantienen en un medio fisiolgico que contiene un aminocido marcado, por ejemplo, leucina tritiada. Despus de un tiempo (de tres a cinco minutos), los fragmentos de pncreas se transfieren a un medio que contiene el mismo aminocido pero sin marcar (no radiactivo). Se toman muestras a lo largo del tiempo despus de aplicar el marcador radiactivo.

60

GUA METODOLGICA DE BIOLOGA

Inmediatamente despus de tomarlas, las muestras son fijadas y preparadas para su examen histoautoradiogrfico. a) Muestra A: se constata que tras 5 minutos se puede observar radiactividad en la regin basal de la clula, a nivel del retculo endoplsmico rugoso. b) Muestra B: 15 minutos despus del marcado con leucina tritiada, se constata que la radiactividad est localizada en la regin del retculo endoplsmico rugoso situada en la proximidad de los dictiosomas del Complejo de Golgi. c) Muestra C: cuando se examina una muestra tomada 20 minutos despus del marcado, se observan protenas radiactivas en los dictiosomas

61

GUA METODOLGICA DE BIOLOGA

d) Muestra D: en las muestras tomadas 60 minutos despus de la experiencia, slo se observa radiactividad en las vesculas que rodean las cisternas del complejo de Golgi, en la cara de maduracin de los dictiosomas. e) Muestra E: 4 horas despus, la radiactividad slo se detecta en el exterior de la clula. Analizando esta experiencia, explica dnde se sintetizan las protenas segregadas por las clulas pancreticas y cul es el camino que siguen hasta que salen de la clula. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ Qu relacin hay entre el retculo endoplsmico y el complejo de Golgi? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________

LISOSOMAS
Los lisosomas son vesculas con una estructura muy sencilla y estn rodeados solamente por una membrana. Contienen gran cantidad de enzimas hidrolticas (digestivas) que degradan todas las molculas inservibles para la clula. Funcionan como estmagos de la clula y adems de digerir cualquier sustancia que ingrese del exterior (lisosomas secundarios o vacuolas digestivas), ingieren restos celulares viejos para digerirlos, por tanto son llamados autofagosomas o vacuolas autofgicas o digestivas (fig. 2.11). Cuando las clulas enferman, los lisosomas rompen su membrana y las enzimas encerradas en su interior destruyen toda la clula en un proceso denominado autolisis.

62

GUA METODOLGICA DE BIOLOGA

Actualmente se conocen unas 40 enzimas lisosmicas, todas ellas son hidrolasas cidas del tipo de las proteasas, nucleasas, lipasas, fosfolipasas, fosfatasas, glucosidasas y sulfatasas. Las enzimas hidrolticas de los lisosomas se forman a partir del retculo endoplsmico rugoso y posteriormente son empaquetadas por el complejo de Golgi, originndose as los lisosomas.

Fig. 2.11. Formacin de lisosomas a partir del complejo de Golgi

VACUOLAS
Son sacos rodeados tambin por una sola membrana. Hay diferentes tipos de vacuolas, unas son temporales y otras permanentes. Algunas de soporte, otras de almacenamiento de agua, desechos metablicos o alimentos y otras ayudan a la clula a eliminar el exceso de agua del interior.

RIBOSOMAS
Los ribosomas se encuentran libres en el citoplasma, aislados en grupos llamados polirribosomas o en la parte externa del retculo endoplsmico rugoso. stos realizan la sntesis de protenas de membrana y de protenas que algunas clulas secretoras exportan hacia sus alrededores, como las enzimas digestivas y las hormonas proteicas; por ejemplo: insulina. Las protenas que son transportadas dentro de los canales, se mueven por los extremos cercanos al complejo de Golgi.
63

GUA METODOLGICA DE BIOLOGA

Los ribosomas completos estn formados por dos subunidades de diferente tamao. La subunidad pequea se ajusta a la ms grande como un engrane solamente si hay ARNm que deba ser traducido. La subunidad ms pequea contiene ms o menos 30 protenas diferentes y las ms grandes de 45 a 50, todas estrechamente unidas con los ARN ribosomales (fig. 2.12). Durante la sntesis de protenas se establece un contacto entre los ARNm, ARNt y ARNr. La superficie del ribosoma tiene cuatro sitios de unin, uno para secuencia corta de tres nucletidos del ARNm, otro para el ARNt nuevo que lleva el aminocido especfico para que se ensamble a la cadena polipptidica nueva, otro para el ARNt que ha descargado el aminocido y un sitio donde la enzima peptidil transferasa trabaja formando enlaces peptdicos entre los aminocidos adyacentes.

CITOESQUELETO
La gran variedad de filamentos protenicos del interior de las clulas le confieren cierta consistencia a stas, que en conjunto se llaman citoesqueleto. Entre estas estructuras se encuentran las siguientes:

Microtbulos
Estas estructuras, estn en el citoplasma, son cilindros huecos de 25 nm de grosor. Dan soporte a las clulas, forman el huso acromtico durante la mitosis, permiten el desplazamiento de los cromosomas a travs del huso mittico o acromtico y participan activamente en transportar organelos o nutrientes dentro de la clula. Los microtbulos estn formados por una glucoprotena que se conoce con el nombre de tubulina (figuras. 2.13 y 2.14). En los axones nerviosos de las neuronas, los microtbulos participan en el transporte de las protenas y otros compuestos, como las hormonas de la hipfisis y del hipotlamo. Los cilios y flagelos de algunos organismos unicelulares estn formados por microtbulos y participan en la locomocin y desplazamiento de estos. Los cilios, que son estructuras en forma de pelos microscpicos, existen en cantidad abundante alrededor de la clula para que al agitarse les permitan desplazarse en el medio que generalmente es lquido (fig. 2.15).
64

GUA METODOLGICA DE BIOLOGA

Filamentos de actina o microfilamentos


Existen otras estructuras que forman el citoesqueleto compuestas de protenas contrctiles y presentes en gran cantidad en las clulas de msculo esqueltico. A estos filamentos se les denomina de actina porque estn formados por la protena o microfilamentos, ya que su grosor es de 6 a 8 nm (fig. 2.13). Se pueden asociar con otras protenas, tales como la miosina o participan en la formacin de las uniones intercelulares.

Filamentos intermedios
Los filamentos intermedios tienen un dimetro de 10 nm, estn formados por una gran variedad de protenas y participan directamente en mantener la forma de la clula y darle fuerza tnsil a sta (figs. 2.13, 2.14, y 2.15).

CENTROLO Y HUSO
Cerca del ncleo hay una pequea estructura que se llama centriolo o centro organizador de microtbulos. Cuando inicia la divisin celular, se replica y da lugar a dos estructuras iguales. Los centriolos son estructuras cilndricas de las clulas animales y de las clulas de algunos vegetales inferiores (fig. 2.16). Los pares de cilindros se separan lentamente, emigrando cada par a los polos opuestos de la clula. Durante su trayectoria organizan poco a poco entre ellos el huso acromtico. Los centriolos vistos al microscopio electrnico se aprecian como cilindros huecos formados por nueve tripletes de microtbulos (fig. 2.16). Al inicio de la divisin celular, como ya se mencion anteriormente, los centriolos emigran a polos opuestos. De cada centriolo se proyecta un racimo de filamentos de protena contrctil formando figuras llamadas ster. Cuando los filamentos han llegado a polos opuestos se obtiene una figura semejante a dos conos unidos por su base, es decir, ensanchadas en el ecuador, estrechas en los extremos y a la que llamamos huso acromtico.

65

GUA METODOLGICA DE BIOLOGA

Figura 2.13. Fibras del Citoesqueleto Fig. 2.12. Estructura de un ribosoma

Fig. 2.14. Disposicin del citoesqueleto en la clula

Fig. 2.16. Estructura de un centriolo

Fig. 2.15. Estructura de un cilio

66

GUA METODOLGICA DE BIOLOGA

CLOROPLASTOS
Los cloroplastos son organelos de doble membrana, presentes nicamente en las clulas vegetales y en protistas fotosintticos, los cuales almacenan el pigmento verde llamado clorofila que capta la luz solar. Los cloroplastos estn constituidos de una membrana externa que delimita al organelo del citoplasma y rodea al estroma dentro del cual se encuentran sacos membranosos llamados tilacoides, que forman la membrana interna; stos se apilan formando estructuras llamadas granas (fig. 2.17).

Fig. 2.18. Esquema general de la fotosntesis

La fotosntesis es un proceso que utilizan las plantas, algas y algunas bacterias para sintetizar su alimento, usando como fuente de energa la luz solar que transforma en energa de enlaces qumicos. En los organismos eucariontes, la fotosntesis se lleva a cabo en los cloroplastos. La luz solar contiene energa que ingresa a la atmsfera terrestre, slo una pequea fraccin de sta es interceptada por los organismos fotosintticos. En el interior de las clulas vegetales se encuentran los cloroplastos, que contienen un pigmento de color verde llamado clorofila. Este pigmento absorbe la energa de la luz solar y la cede para la elaboracin (sntesis) de carbohidratos como la glucosa, a partir de dos compuestos disponibles en el medio ambiente: el agua y el dixido de carbono del aire. El oxgeno que se libera en la atmsfera sirve para efectuar el proceso respiratorio. La fotosntesis se resume en la siguiente ecuacin qumica:
67

GUA METODOLGICA DE BIOLOGA

Fig. 2.17. Estructura de un cloroplasto

La fotosntesis (fig. 2.18) tiene dos etapas: la fase luminosa que incluye una serie de reacciones que dependen de la luz, y la fase oscura, que no requiere la luz. Se le conoce como oscura porque no importa que la luz del Sol est o no presente irradiando luz, se efecta de cualquier forma. Cada ao la fotosntesis de todos los vegetales del planeta fija unos 100 millones de toneladas de carbono, desde el CO2 hasta los compuestos orgnicos. Se ha calculado que si el CO2 consumido en la fotosntesis no fuera repuesto por los procesos de respiracin celular, cuantos meses. Por el contrario, lento que todo el O2 en unos 2,000 aos.

MITOCONDRIA
Con el microscopio ptico las mitocondrias aparecen como bastones o raquetas. Fueron descritas por primera vez por Altman en 1884. Fue Benda, en 1897, quien las denomin mitocondrias (mito = hilo, chondrios = grnulo).
68

GUA METODOLGICA DE BIOLOGA

Su tamao, nmero y forma son muy variables. En el hgado se calcula que hay unas 1000 mitocondrias por clula; sin embargo, en las clulas del corazn, los tbulos distales del rin y otras clulas que necesitan una gran fuente de energa son mucho ms abundantes. Se distribuyen dentro de la clula en relacin con los lugares donde la aplicacin de esa fuente de energa es ms intensa. Las dimensiones de la mitocondria pueden ser desde 0.5 m hasta 5 o 7 m de longitud.

Fig. 2.19. Estructura de una mitocondria

Por regla general, todas las clulas de los organismos eucariontes tienen mitocondrias, pero hay excepciones. Nuestros glbulos rojos y las amibas carecen de mitocondrias, y en un estadio del ciclo de vida del microorganismo protista denominado Tripanosoma brucei sus mitocondrias prcticamente desaparecen. Estos organelos presentan una doble membrana (externa e interna). Cada una de unos 7 m de espesor y entre ambas membranas hay un espacio de unos 8 m (espacio perimitocondrial o intermembranal). La membrana interna presenta invaginaciones hacia el interior, que constituyen tabiques denominados crestas. stas no llegan de un lado a otro de la mitocondria, por lo que la compartimentacin que introducen es abierta. Tridimensionalmente, la forma de la mitocondria podra compararse muy bien a la de un cacahuate. El interior de la mitocondria est constituido por un contenido ms o menos lquido denominado matriz mitocondrial (fig. 2.19).
69

GUA METODOLGICA DE BIOLOGA

El oxgeno del aire que respiramos llega a cada una de nuestras clulas a travs de los glbulos rojos que lo acarrean, pero, qu pasa dentro de stas? Es aqu donde comienza la respiracin celular, proceso que en las clulas eucariontes se lleva a cabo en un organelo especializado que es la mitocondria. Durante este proceso, parte de la energa desprendida de la glucosa, con ayuda del oxgeno, se incorpora a una molcula de ATP (adenosn trifosfato).

Fig. 2.20 Esquema general de la respiracin celular

La ecuacin general de la respiracin celular es:

Una vez sintetizadas, las molculas de ATP salen de las mitocondrias y viajan a todas las clulas del cuerpo. Ah son utilizadas en las funciones celulares de los rganos y tambin ayudan para todas las actividades diarias del cuerpo (fig. 2.20).

NCLEO Es el organelo ms prominente de la clula y se localiza en cualquier sitio del citoplasma. Est rodeado por un par de membranas concntricas denominadas en conjunto envoltura nuclear o membrana nuclear. No es continua, sino que posee
70

GUA METODOLGICA DE BIOLOGA

poros que permiten el paso de las cadenas de ARNm, sintetizadas del ncleo al citoplasma para que realicen su funcin. El poro es un complejo protenico que controla el paso de sustancias a travs de la envoltura nuclear. Adems de que esta envoltura separa el contenido nuclear o nucleoplasma del citoplasma. El nucleoplasma es un medio acuoso de solucin coloidal en estado semigel, rica en protenas y es donde estn suspendidos los cromosomas.

ACTIVIDAD Realiza un esquema global ilustrado que muestre la interrelacin entre los reactivos y productos de las reacciones de la fotosntesis y de la respiracin celular.

71

GUA METODOLGICA DE BIOLOGA

Se considera que esta membrana y el ncleo tienen la misma relacin que la membrana plasmtica y el citoplasma, o sea, que regulan de la misma manera los materiales que pasan hacia dentro y fuera del ncleo. Dentro del ncleo se encuentra uno o ms nuclolos que son pequeos cuerpos amorfos, los cuales a menudo cambian de forma y tamao. Cuando una clula inicia su divisin stos desaparecen y cuando termina la divisin celular aparecen nuevamente (fig. 2.21).

Fig. 2.21. Estructura del ncleo

Los cromosomas son estructuras que se forman de ADN altamente compactado. Cuando se encuentran en este estado, se utiliza el trmino cromatina. La cromatina se encuentra formada por una nucleoprotena. Las nucleoprotenas son estructuras complejas formadas por cidos nucleicos y protenas del tipo de las histonas que en conjunto se denominan nucleosomas. Las histonas son protenas bsicas, pues son ricas en aminocidos, tales como la lisina y la arginina; stos contienen un grupo amino libre capaz de adquirir un protn por poseer un par de electrones no compartido, por lo tanto tienen carga positiva (fig. 2.22).
72

GUA METODOLGICA DE BIOLOGA

El ADN lleva carga negativa debido a la presencia de numerosos grupos fosfatos, por lo cual las histonas se enlazan fuertemente con el ADN. La clula inicia la divisin y la cromatina se organiza en los cromosomas, trmino que quiere decir cuerpos coloreados. El ncleo es el centro de regulacin de la clula, cuyas principales funciones son: 1. La continuidad celular: Es necesario para la reproduccin y regeneracin de las partes perdidas. En general, es el centro de control. 2. Contiene los factores hereditarios de la clula, permitiendo as que sus caractersticas pasen a sus descendientes.

2.22. Estructura de la cromatina

Para poder comprender la funcin del ncleo tenemos que adentrarnos al estudio de otras biomolculas, los cidos nuclicos, esenciales en el avance del conocimiento del desarrollo de la estructura y funcin los seres vivos, sobre todo en los aspectos de la reproduccin celular, de la conservacin de la informacin y herencia gentica, y del control de las funciones celulares. En general se les considera como macromolculas naturales, polmeros de nucletidos de una cadena (ARN) o dos cadenas (ADN), cuya funcin principal es la de contener y permitir la transcripcin y traduccin de la informacin gentica (cdigo gentico), para la elaboracin de protenas, sustancias importantes para la estructura y funcionamiento de las clulas, informacin que se centra en el Dogma Central de la Biologa.
73

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental sobre los cidos nuclicos: unidades que los conforman (niucletidos), estructura tridimensional, tipos, funciones, etc., para que a partir de la informacin colectada se elabore un diagrama de Venn de diferencias y similitudes de los cidos nuclicos

ADN

ARN

ACTIVIDAD Realiza una investigacin documental y completa el siguiente cuadro de los tipos de ARN

74

GUA METODOLGICA DE BIOLOGA

tipo de ARN

forma

localizacin

funcin

EL DOGMA CENTRAL DE LA BIOLOGA ES UNIVERSAL?

Watson y Crick sospecharon que una vez esclarecida la estructura del ADN, sera ms fcil entender su funcin. Razonaron, entonces, que si el ADN era la molcula que transmita la informacin gentica a las clulas hijas, esta deba funcionar como un cdigo. Para mitad de los 50s se saba que la secuencia de nucletidos en el ADN daba origen a una secuencia de polipptidos. Es decir, la molcula de ADN deba dirigir la sntesis de protenas.

ADN Protenas
Pero si esto era cierto, faltaba dilucidar una pieza del rompecabezas ya que se saba que las protenas se sintetizaban fuera del ncleo. Cmo poda el ADN, que estaba dentro del ncleo, dirigir la sntesis de protenas fuera del mismo? A Crick se le ocurri la idea de que deba existir un intermediario.

ADN ? Protenas
Un posible candidato para intermediario era el ARN, que se encuentra en el citoplasma. El ARN tena varias caractersticas que lo hacan un firme candidato: Un esqueleto de azcares y fosfatos (a pesar de que tiene un azcar distinto, ya que el ARN tiene ribosa en vez de desoxirribosa),

75

GUA METODOLGICA DE BIOLOGA

Tanto el ADN como el ARN usan las mismas bases nitrogenadas, pero el ARN tiene uracilo en vez de timina, El uracilo se puede unir a la adenina como lo hace la timina, El ARN es una cadena sencilla. Crick sintetiz esta idea a lo que llam el Dogma Central de la Biologa, que especifica que el ADN se traduce en ARN y este, a su vez, dirige la produccin de protenas.

Segn este postulado, la informacin fluye de manera unidireccional: no puede moverse de las protenas al ADN. Es decir, una vez que la informacin llega a las protenas, estas no pueden ser cambiadas o, lo que es lo mismo, las protenas no pueden influir en los genes. Si bien Crick us el trmino dogma en un sentido figurado y quiz con humor, ya que las ideas cientficas slo son aceptadas hasta que aparezca evidencia experimental que las desmienta, durante algn tiempo esta idea adquiri cierta dimensin de verdad absoluta en la mayora de los libros de texto. No obstante, la ciencia es un ente dinmico, que no se asienta en dogmas, salvo notables excepciones. Actualmente el dogma ha sufrido cierta fisura, pues han surgido una serie de elementos que implican la ampliacin de este dogma tan categrico. Estas excepciones ataen, entre otras situaciones o elementos, a los priones, ribozimas y la enzima transcriptasa inversa. En 1971 se descubri que algunos virus, como el VIH, llevan su informacin en forma de ARN, y que esta puede pasar al ADN de sus huspedes. Ese proceso ocurre en sentido contrario al esquema de Crick, ya que la informacin pasa del ARN al ADN. Adems, actualmente se sabe que tanto el ARN como las protenas pueden influir en la expresin del cdigo gentico.

76

GUA METODOLGICA DE BIOLOGA

Podemos resumir el Dogma Central de la Biologa como sigue (fig. 2.21): 1. La informacin contenida en el ADN se transcribe a una molcula de ARN (proceso llamado transcripcin) que recibe el nombre de ARN mensajero o ARNm. 2. La informacin contenida en el ARNm es "leda" por estructuras llamadas ribosomas, traduciendo el lenguaje nuclico al lenguaje proteco. La relacin que hay entre ambos lenguajes recibe el nombre de Cdigo Gentico (fig. 2.24). As, la palabra GTG en cidos nuclicos en protena se traduce por Histidina; TTT por Lisina, y as sucesivamente. Este proceso se denomina traduccin. El flujo de informacin para la expresin de los genes, es por lo tanto:

ADN ARN Protenas

Fig. 2.23. Dogma Central de la Biologa

77

GUA METODOLGICA DE BIOLOGA

Pero la otra funcin del ADN es la de transmitirse a su descendencia. Esto lo hace el ADN duplicndose a s mismo en el proceso conocido como replicacin. Ahora bien: en la reproduccin sexual, el nuevo individuo recibe la mitad del ADN de cada uno de sus padres. As, este individuo es genticamente distinto de ambos: as es como la reproduccin sexual genera variabilidad. Si el ADN se transmitiera a la clula o al individuo hijo sin variacin, como copia exacta del ADN parental, estaramos ante la reproduccin clnica (fig. 2.23).

ACTIVIDAD

Haz una investigacin documental acerca de los procesos involucrados en el Dogma Central (duplicacin, transcripcin y traduccin). Por equipo, idea y construye un modelo para representar cada proceso. Considerando tu modelo responde las siguientes preguntas. 1. Cmo es la secuencia de las molculas hijas de ADN con respecto a la original? 2. En qu momento del ciclo celular ocurre la replicacin del ADN? 3. Qu pasara si el ADN no se duplicara antes de la divisin celular? 4. Qu sucede para separar las dos hebras de ADN? 5. En el modelo que construiste qu sera la polimerasa? 6. Cul es la finalidad de construir una secuencia de bases de ADN? 7. Qu paso de este modelo representa la transcripcin? 8. Qu pasos del modelo representan la traduccin? 9. Cmo est relacionada la secuencia de bases en los cidos nuclicos con la secuencia de aminocidos en las protenas?

78

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Utilizando el cdigo gentico deduce, Cul sera el ARNm y el polipptido resultantes de la siguiente secuencia de ADN?

CCGCGGCATATTTATGGCAAAAGC
ARNm

Polipptido

Cuntos codones posee el ARNm? De cuntos aminocidos formaran el polipptido?

__________________ __________________

79

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Si hiciramos la analoga de la sntesis proteica con la construccin de un edificio, cules seran los protagonistas de dicha obra y por qu? Escribe la letra dentro del parntesis que corresponda

Explica en cada caso el porqu asignaron esa respuesta. Por ejemplo, el ncleo sera el ingeniero porque es quin ordena y dirige la construccin del edificio (protena)

Nuclolo Aqu se sintetizan los tipos de molculas de ARNr que se usan en la formacin de los ribosomas. Los nuclolos son esenciales para la sntesis de protenas y de cidos ribonucleicos.

2.4 CMO SE REPRODUCEN LAS CELULAS? CICLO CELULAR


La reproduccin es una funcin bsica de los seres vivos, es un proceso que les permite a las especies la continuidad de la vida tanto en el tiempo porque las perpetua, como en el espacio porque sustituye a los organismos que mueren y se mantiene el nmero de individuos. La reproduccin tiene una ntima relacin con la transmisin de caracteres hereditarios y la evolucin de las especies.
80

GUA METODOLGICA DE BIOLOGA

El proceso de divisin celular por el cual una clula da origen a dos clulas idnticas con igual dotacin de cromosomas, se denomina mitosis. En el caso de las clulas somticas humanas cada clula que se divide da lugar a dos clulas hijas con 46 cromosomas. Cuando no se manifiestan los fenmenos de la divisin, se dice que la clula est en el periodo de interfase, en el cual el ADN no est compactado y forma una fina red dentro del ncleo.

2.24. Ciclo celular

La mayora de las clulas del organismo se divide peridicamente, siendo notables excepciones las neuronas y los miocitos. Para lograr esta divisin, ocurren transformaciones y fenmenos que se suceden de manera cclica, constituyendo lo que se denomina el ciclo celular. Para dividirse, la clula ha tenido que duplicar previamente su material gentico, lo cual ocurre durante el periodo S o fase de sntesis (de ADN), por lo que en el periodo G1, previo a la fase S, cada cromosoma estar constituido por una simple cromtida, mientras que, despus del periodo S, en el periodo G2 los cromosomas ya aparecern formados por dos cromtidas unidas por el centrmero. Al final del periodo G2 ocurren las fases de la mitosis, las cuales se suceden en un tiempo de una a dos horas.
81

GUA METODOLGICA DE BIOLOGA

DIVISIN CELULAR
Mitosis Es un proceso continuo con fases consecutivas que se definen segn las caractersticas morfolgicas que presentan los cromosomas (fig. 2.24). En la profase, los cromosomas que ya se haban duplicado en el periodo de sntesis de la interfase, se acortan y aparecen como bastones compactos. La membrana nuclear deja de hacerse visible y se observan los centrolos, que tambin se han duplicado, migrando uno de ellos por la periferia del ncleo hacia el otro polo de la clula; los centrolos son los sitios donde se ensambla la tubulina, la cual es la subunidad proteica de los microtbulos, que forma el huso mittico. En la metafase, los cromosomas se colocan en el plano ecuatorial de la clula y aparecen unidos por el centrmero con el huso acromtico. En la anafase ocurre la divisin longitudinal del centrmero, lo que permite que cada cromtida se separe y, unida por su centrmero al huso acromtico, migre hacia el polo respectivo de la clula. En la telofase se forman dos ncleos hijos (cariocinesis) y el citoplasma tambin completa su divisin (citocinesis) mediante un plegamiento de la membrana que comienza desde la periferia en la parte media y progresa hacia el centro de la clula, de tal manera que finalmente se obtienen dos clulas hijas con igual dotacin de cromosomas y citoplasma (divisin ecuatorial). La mitosis asegura la distribucin exacta y equitativa de los cromosomas en cada una de las clulas hijas, de modo que cada clula tenga exactamente el mismo nmero y tipo de cromosomas que las dems clulas de la misma especie. Esto garantiza que la informacin gentica (juego de cromosomas) se distribuya exactamente en cada uno de los ncleos hijos, en donde cada clula tendr toda la informacin gentica para la totalidad de las caractersticas del organismo. En los organismos pluricelulares, la divisin mittica no solamente puede dar origen a nuevos individuos por reproduccin vegetativa en plantas o por fragmentacin en animales, sino que adems, restituye las clulas muertas, sana
82

GUA METODOLGICA DE BIOLOGA

heridas y en algunos casos, regenera tejidos daados o perdidos del cuerpo. En organismos unicelulares, la mitosis es una forma de producir mucha progenie idntica. Esto conlleva una variabilidad mnima, formando, por su capacidad de adaptabilidad, una ventaja en condiciones ambientales estables y una desventaja cuando estas condiciones cambian. Los organismos unicelulares se reproducen habitualmente mediante mitosis, as que las clulas hijas son exactamente iguales a la progenitora. En este mecanismo de reproduccin no interviene el sexo, por lo que se denomina reproduccin asexual. Otros tipos de reproduccin asexual ocurren tambin en organismos unicelulares e incluso pueden darse en organismo superiores, como muchas plantas, en los que es un medio auxiliar de reproduccin. Con una rama de un rbol se puede obtener un rbol entero idntico genticamente al original.

2.25. Fases de la mitosis

83

GUA METODOLGICA DE BIOLOGA

Meiosis Un mecanismo ms complejo y perfecto de reproduccin es la reproduccin sexual que acontece en los organismos con diferenciacin sexual y est mediada por clulas gamticas haploides que se fusionan para formar un cigoto diploide. Como compensacin, este mecanismo exige que clulas diploides que originan gametos, directamente o indirectamente despus de una serie de divisiones mitticas, lleven a cabo un tipo de divisin especial denominado meiosis (fig. 2.26).

2.26. Fases de la meiosis

La meiosis permite la reduccin del nmero de cromosomas por medio de dos sucesivas divisiones celulares, denominadas primera y segunda divisiones meiticas; slo una de ellas, la primera, es precedida de la duplicacin de los cromosomas. Los cromosomas homlogos se aparean en la primera divisin de la meiosis y realizan un proceso de intercambio de material gentico, denominado entrecruzamiento (crossingover), que tiene notable importancia en la evolucin y variacin gentica de las especies que se reproducen sexualmente.
84

GUA METODOLGICA DE BIOLOGA

En la profase I, los cromosomas homlogos se aparean o sinapsan en toda su longitud, formando los llamados cromosomas bivalentes y luego intercambian porciones de su material en lo que constituye el punto de entrecruzamiento, el cual se manifiesta citolgicamente por los llamados quiasmas. En la metafase I, los cromosomas bivalentes, despus de haber llevado a cabo el entrecruzamiento, se colocan en el plano ecuatorial de la clula, orientando sus centrmeros hacia cada uno de los polos, Durante la anafase I, los dos cromosomas de cada par se separan, dirigindose cada uno al polo celular correspondiente. Esta separacin de los homlogos constituye la base fsica de la segregacin de los alelos. En la telofase I se completa la primera divisin de meiosis, la cual es seguida por la meiosis II. En la metafase II, los cromosomas se colocan en el plano ecuatorial de la clula y en la anafase II ocurre la divisin longitudinal del centrmero, completndose la migracin hacia los polos en la telofase II. Por consiguiente, cada una de las dos clulas obtenidas en la meiosis I originar a su vez otras dos, o sea, cuatro en total, cada una de ellas con un nmero simple o haploide de cromosomas en condiciones normales.

ACTIVIDAD Completa la siguiente tabla de diferencias entre mitosis y meiosis escribiendo en el espacio el enunciado correspondiente a la descripcin

85

GUA METODOLGICA DE BIOLOGA

2.5 CMO SE PASA DE UNA CLULA A LA PLURICELULARIDAD?


Tamao, forma y funcin de las clulas Casi todas las clulas son microscpicas. Las clulas se miden en micras (m), es decir, la milsima parte de un milmetro, por tanto las clulas procariontes miden entre 1-5 m y las eucariontes de 10 a 30 m en animales y hasta 100 m en vegetales. Se considera a los protozoarios como los paramecios y las amibas organismos unicelulares complejos, ya que todas las actividades celulares que realizan, como responder ante estmulos del ambiente, procurarse alimento, excretar el exceso de lquido y evadir a los depredadores, las lleva a cabo cada clula. Las clulas presentan formas diversas que en general se relacionan con su funcin. Por ejemplo, los espermatozoides poseen un flagelo que les da una gran movilidad, pues su funcin reproductora as lo requiere; las clulas del msculo esqueltico contienen una red de filamentos alineados con precisin y compuestos de protenas contrctiles; las clulas del cartlago se rodean de una matriz caracterstica que contiene polisacridos y la protena colgeno, que juntos suministran apoyo mecnico; los eritrocitos se convierten en sacos de forma discoidal llenos de hemoglobina, que transporta oxgeno.

ACTIVIDAD Elabora en tu libreta un cuadro de doble entrada con las siguientes caractersticas
SISTEMAS MEMBRANOSOS LOCALIZACIN COMPOSICIN QUMICA MORFOLOGA FISIOLOGA

SISTEMAS NO MEMBRANOSOS

ORGANELOS

86

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Investiga y dibuja tres o mas tipos diferentes de clulas humanas; compralas entre s de acuerdo a su funcin y explica porqu tienen esa estructura.

87

GUA METODOLGICA DE BIOLOGA

2.6. CUL ES LA RELACIN TEJIDO-RGANO-SISTEMA? El cuerpo animal est compuesto de sistemas los cuales a su vez estn formados por dos o ms rganos. Los rganos estn compuestos de tejidos los cuales se componen de clulas. Un tejido es un grupo de clulas y de material extracelular que forman una unidad estructural y funcional, especializada para una tarea especfica. Los tejidos animales incluyen el tejido epitelial, conectivo, muscular y nervioso. El tejido epitelial forma membranas que cubren las superficies corporales interna y externa y tambin origina las glndulas El tejido conectivo generalmente contiene una cantidad considerable de material extracelular e incluye a la dermis, hueso, cartlago tendones, ligamentos, el tejido adiposo y la sangre El tejido muscular est especializado en el movimiento y utiliza filamentos proteicos que se deslizan, la actina y la miosina. Existen tres tipos de tejido muscular: el esqueltico, liso y cardiaco. El tejido nervioso est especializado en la generacin y conduccin de seales elctricas.

ACTIVIDAD ESPECFICA Por equipo, elabora un mapa conceptual de una clula eucarionte hipottica donde interrelaciones a todos los componentes celulares con sus funciones. Debido a la complejidad del mismo, se recomienda que se construya en varios pliegos de papel bond para poder extenderse. Este mapa conceptual se expondr al grupo para su evaluacin.

RUBRICA PARA EVALUAR UN MAPA CONCEPTUAL Institucin educativa: Nombre del docente: Nombre del alumno: Ao/grupo: Fecha: Nombre de quien evala: Bloque/tema: Autoevaluacin: Coevaluacin: Evala el profesor: Asignatura:

88

GUA METODOLGICA DE BIOLOGA

PONDERACIN CRITERIOS EXCELENTE (4) Identifica los Identificacin de conceptos y tiene conceptos del varias ramas que se tema derivan del concepto principal Ordena los conceptos del ms general al ms especfico. Y al leer los conceptos con sus relaciones, tienen sentido por s mismo. MUY BIEN (3) Identifica los conceptos y tiene algunas ramas que se derivan del concepto principal Ordena los conceptos del ms general al ms especfico. Y al leer los conceptos con sus relaciones, tienen poco sentido por s mismo. Muestra cada concepto una sola vez, aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja, pero slo se pueden apreciar algunas relaciones entre conceptos de manera clara y correcta Utiliza lneas para unir los conceptos, y sobre la lnea escribe frases o palabras claves que indican la relacin existente entre dichos conceptos, pero no lo hace en todas las lneas BIEN (2) Identifica los conceptos y solo muestra dos ramas que se derivan del concepto principal Ordena los conceptos del ms general al ms especfico. Y al leer los conceptos con sus relaciones, no tienen sentido por s mismo. Muestra cada concepto una sola vez, aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja, pero no se pueden apreciar relaciones entre conceptos de manera clara y correcta DEFICIENTE (1) Identifica solo los conceptos, pero no muestra ramas que se derivan del concepto principal No ordena los conceptos del ms general al ms especfico. Y al leer los conceptos con sus relaciones, no tienen sentido por s mismo. PUNTAJE

Jerarquizacin de los conceptos de mayor a menor inclusividad

Muestra cada concepto una sola Organizacin de vez, aunque haya los conceptos relaciones que tengan relacionndolos que marcarse de un vertical y extremo a otro de la horizontalmente hoja y se pueden segn el grado apreciar varias de inclusividad relaciones entre conceptos de manera clara y correcta

Muestra cada concepto varias veces, aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja y no muestra relaciones entre conceptos de manera clara y correcta

Utiliza lneas para unir los conceptos, y sobre Especificacin la lnea escribe frases de conectores y o palabras claves que nexos entre los indican la relacin conceptos. existente entre dichos conceptos, hacindolo en todas las lneas

Utiliza lneas para unir los conceptos, pero no escribe frases o palabras claves que indiquen la relacin existente entre dichos conceptos,

Solo utiliza algunas lneas para unir los conceptos, y no escribe sobre la lneas frases o palabras claves que indiquen la relacin existente entre dichos conceptos, TOTAL:

COMENTARIOS:

REFERENCIAS:(Garza, 2000) (Nez Chan, 2002) (Pimienta, Metodologa Constructivista. Gua para la planeacin docente., 2005)

89

GUA METODOLGICA DE BIOLOGA

MATRIZ DE VALORACIN DE COMPETENCIAS Criterios Analiza la estructura y los procesos celulares mediante un mapa conceptual integrador. Pre-formal Investiga la estructura y los procesos celulares mediante un mapa conceptual Receptivo Identifica la estructura y los procesos celulares mediante un mapa conceptual integrador. Resolutivo Establece diferencias y semejanzas entre la estructura y los procesos celulares mediante un mapa conceptual integrador. Puntos 80 Aspectos a mejorar : Autnomo Argumenta diferencias y semejanzas de los procesos celulares mediante un mapa conceptual integrador. Puntos 100 Estratgico Fundamenta los procesos celulares a travs de un mapa conceptual integrador.

Ponderacin Logros:

Puntos

30

Puntos

60

Puntos 100

EVALUACIN
DIAGNSTICA Aplicacin de un examen diagnstico y la retroalimentacin por medio de una lluvia de ideas. ACTIVIDADES DE APRENDIZAJE: Lnea del tiempo Cuadro de doble entrada Reporte de laboratorio en V-Gowin ACTIVIDAD ESPECFICA: Mapa conceptual integrador Examen departamental tipo CENEVAL o PISA Laboratorio (evaluacin V-Gowin) Actividades de aprendizaje Actividad especfica por unidad

FORMATIVA

SUMATIVA

30% 20% 20% 30%

BIBLIOGRAFA BSICA Atlas de Biologa. Los Mecanismos de la Vida. Ediciones Cultural. Madrid Espaa pp.50, 52, 53 y 62-64. Cervantes M. y Hernndez M. (2005) Biologa General. Publicaciones Cultural 2 reimpresin. Mxico pp. 126-141 Lodish, Harvey (2005). Biologa Celular y Molecular. Editorial Mdica Panamericana 5 edicin.
90

GUA METODOLGICA DE BIOLOGA

Overmire. (2003). Biologa. Ed. Limusa Mxico. 611pginas. Salomn B Martn. (2001) Biologa. Ed Mc Graw-Hill 3 edicin. pp. 75-95 Valdivia, B. Granillo y P, Villarreal, M.S. (2006) Biologa, La Vida y sus Procesos. Ed. Publicaciones Cultural. Mxico. pp. 70-100 Vzquez C. R. (2004). Biologa. Bachillerato General Publicaciones Cultural Primera Edicin. Mxico. pp. 72-125

BIBLIOGRAFA COMPLEMENTARIA Bojorquez Castro, Luis (2000). La Vida Celular. Programa Nacional de Formacin de Profesores. Asociacin Nacional de Universidades e Institutos de Enseanza Superior George Dreyfus (2002). La Clula. SEP/Santillana. Coleccin Espejo de Urania. Mxico Pea, Antonio (1986). Las Membranas de las Clulas. La Ciencia desde Mxico 18. Fondo de Cultura Econmica, Consejo Nacional de Ciencia y Tecnologa Tapia, Ricardo. (1987) Las Clulas de la Mente. La Ciencia desde Mxico 30. Fondo de Cultura Econmica, Consejo Nacional de Ciencia y Tecnologa

VIDEOS RECOMENDADOS Gran Planeta Celular Cosmos de Carl Sagan

TICs Bioxeo Recursos Biologa http://www.bioxeo.com/plabioca.htm Cells alive http://www.cellsalive.com Proyecto Bisfera. http://recursos.cnice.mec.es/biosfera/
91

GUA METODOLGICA DE BIOLOGA

BLOQUE 3
Herencia y variacin

MI

FAMILIA

92

GUA METODOLGICA DE BIOLOGA

93

GUA METODOLGICA DE BIOLOGA

BLOQUE DE APRENDIZAJE: HERENCIA Y VARIACIN


TIEMPO: 29 horas UNIDAD DE COMPETENCIA: Investiga los fundamentos que permiten delinear las bases genticas de la herencia para argumentar su desarrollo histrico, as como su impacto en la vida actual, valorando la trascendencia del proyecto genoma humano y su alcance en las aplicaciones de la biotecnologa a travs de la resolucin de problemas, elaboracin de cariotipos y la realizacin de un ensayo. SABERES Procedimentales Realiza una lnea del tiempo del desarrollo histrico del campo de la Gentica Aplica los conceptos de la gentica en las leyes de la herencia para la resolucin de problemas de gentica. Realiza una prctica de rasgos hereditarios para identificar el fenotipo de sus compaeros y predecir su posible genotipo. Categoriza las mutaciones como mecanismos que producen enfermedades hereditarias y las detecta mediante la elaboracin de cariotipos. Desarrolla un ensayo sobre el impacto de las aplicaciones de la Gentica sobre algunas actividades humanas. COMPETENCIAS Genricas/Atributos Disciplinares 6.1 Elige las fuentes de informacin ms relevantes para un propsito especfico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. 2. Fundamenta opiniones sobre los impactos de la ciencia y la tecnologa en su vida cotidiana, asumiendo consideraciones ticas. 4. Obtiene, registra y sistematiza la informacin para responder a preguntas de carcter cientfico, consultando fuentes relevantes y realizando experimentos pertinentes. CRITERIOS DE DESEMPEO Investiga los hechos histricos premendelianos mediante una lnea del tiempo. Aplica las Leyes de Mendel a travs de la prctica de su mtodo experimental y los diferencia de patrones hereditarios no mendelianos Categoriza e identifica a las mutaciones como mecanismos generadores de enfermedades hereditarias, por medio de la construccin y el diagnstico de un cariotipo. Analiza las aplicaciones actuales de la gentica mediante la investigacin y elaboracin de un ensayo.

Declarativos Analiza los hechos histricos que condujeron al estudio de la Gentica Analiza las leyes de la gentica mendeliana para comprender el mecanismo de la herencia. Explica los patrones hereditarios mendelianos y no mendelianos Describe las mutaciones como mecanismos de variabilidad gentica. Ejemplifica las aplicaciones ms importantes de la Gentica.

Actitudinales/Valorales Fomenta el respeto y tolerancia hacia personas con enfermedades hereditarias y/o con rasgos fsicos diferentes. Valora el respeto a la decisin de los padres a tener o no un hijo con alguna enfermedad hereditaria. Critica de forma informada las aplicaciones actuales de la Gentica que permita la toma de decisiones apegadas a la Biotica.

94

GUA METODOLGICA DE BIOLOGA ESTRATEGIAS DE ENSEANZA


Aplicacin de

ESTRATEGIAS DE APRENDIZAJE
Elaboracin de un collage Elaboracin de un cuadro

RECURSOS DIDCTICOS
Gua metodolgica.
Manual de prcticas. Revista electrnicas. Can. Computadora. Laboratorio virtual. Pizarrn. Plumones. Artculos de

EVIDENCIAS Y/O PRODUCTOS


Lnea del tiempo Reporte de la prctica V

preguntas generadoras
Dinmicas grupales Presentaciones de

comparativo
Elaboracin de un cuadro

de Gowin
Entrega de un Ensayo rbol genealgico Problemario resuelto

cariotipo

sinptico
Resolucin de problemas Construccin de rbol

power point sobre mutaciones y enfermedades hereditarias.


Problemario. Actividades

genealgico
Investigacin Cuestionarios. Resolucin de

experimentales.

problemario.
Resolucin de

divulgacin cientfica.
Videos Ilustraciones y

actividades de la gua.
Ensayo. Reporte de actividades

animaciones sobre temas de gentica


Software educativo. DVD

experimentales a travs de una V de Gowin.

EXPLORANDO TUS CONOCIMIENTOS 1. Por qu te pareces a tus padres?__________________________________________________________________ 2. De qu estn compuestos los genes? ______________________________________________________________________ 3. Escribe 5 rasgos que se hereden ______________________________________________________________________ 4. Escribe 2 enfermedades hereditarias ______________________________________________________________________
95

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD: GLOSARIO Para analizar mejor este bloque es importante y necesario que antes te familiarices con la terminologa de gentica. Elabora un glosario con un mnimo de 20 trminos.

96

GUA METODOLGICA DE BIOLOGA

3.1 CULES HECHOS HISTRICOS CONDUJERON AL ESTUDIO DE LA GENTICA? - LAS IDEAS PREMENDELIANAS
Muchas veces hemos odo expresiones como este nio es idntico a su pap o bien tiene los ojos de la abuela, es decir, sabemos que algunas caractersticas de los individuos han sido heredadas de sus progenitores Cmo sucede esto? A lo largo de la historia de la humanidad se desconocan los detalles cientficos de cmo funcionaba la herencia. Se procreaba y se observaban ciertos rasgos fsicos semejantes entre padres e hijos, pero los mecanismos no eran conocidos. Muchas leyendas se basaron en extravagantes posibilidades de apareamiento entre individuos de diferentes especies. La esposa de Minos, segn la mitologa griega, se apare con un toro y produjo el Minotauro. Los hroes folclricos de Rusia y Escandinavia, eran tradicionalmente los hijos de mujeres que haban sido capturadas por osos, de los que estos hombres derivaban su gran fuerza, enriqueciendo as el linaje nacional. El camello y el leopardo tambin se apareaban de vez en cuando, segn los primeros naturalistas, que eran incapaces de explicar de otro modo, a un animal tan poco probable como la jirafa. As, el folklore reflej las nociones tempranas e imperfectas acerca de la naturaleza de las relaciones hereditarias. Los filsofos griegos sostenan varias ideas: Hipcrates (460-377 a.C.) enunci la teora de la pangnesis, segn la cual cada parte del organismo enviaba su informacin hereditaria a los rganos reproductores, y posteriormente la informacin de ambos padres se mezclaba como un fluido. Aristteles (384-322 a.C.) pensaba que el semen masculino y el flujo menstrual se mezclaban en la concepcin, mientras que otros ni siquiera consideraban que este tipo de mezclas eran necesarias, las formas "simples" (gusanos, moscas, etc.) nacan por generacin espontnea. Durante el siglo XVIII, el holands Anton van Leeuwenhoek descubre "animculos" en el esperma humano y de otros animales. Algunos otros, como los espermistas, imaginaron ver a un "pequeo hombrecito" al que llamaron homnculo, dentro de cada espermatozoide (Fig. 3.1) y afirmaban que la hembra slo provea el ambiente para el desarrollo de la futura generacin. Por el contrario, la escuela ovista pensaba que el futuro ser se encontraba dentro del vulo, y que el esperma solo lo estimulaba.
97

GUA METODOLGICA DE BIOLOGA

En el siglo XIX, la teora de la mezcla explicaba que la unin de vulos y espermatozoides produca una descendencia que era una "mezcla" de los rasgos de los padres. A base de esta hiptesis podra predecirse que la progenie de un animal negro y de uno blanco sera gris y que su progenie tambin lo sera, pues el material hereditario blanco y negro, una vez mezclado, nunca podra separarse de nuevo.

ACTIVIDAD: Realiza una investigacin documental y en tu libreta contesta las siguientes preguntas: 1. Saba Mendel qu era un gen? Por qu? _____________________________________________________________________________________ _____________________________________________________________________________________ 2. Por qu utiliz Mendel en sus experimentos chcharos y no otra planta? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 3. Por qu Mendel llam a la 1. Ley de la Uniformidad? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 4. Por qu le llam Ley de la Segregacin a su segunda Ley? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________

98

GUA METODOLGICA DE BIOLOGA

EL EXPERIMENTO DE MENDEL Se podra decir que el nacimiento de la Gentica ocurri cuando el fraile agustino Gregor Mendel (1822-1884) realiz experimentos acerca de la herencia en chcharos (Fig. 3.2) y en 1865 present su investigacin a la Sociedad de Historia Natural de Brnn (actual Repblica Checa), con el ttulo Experimentos en Hibridaciones de Plantas. Mendel ciment las bases de la Gentica actual explicando que los rasgos heredables son contenidos en unidades discretas, llamadas genes, que se heredan por separado en cada generacin. No fue hasta 1930 cuando se comprendi completamente el alcance de su obra, especficamente en relacin con la teora de la evolucin de Darwin. Mendel seleccion para su investigacin siete rasgos del chcharo: textura y color de la semilla, posicin y color de la flor, forma y color de la vaina y longitud del tallo (tabla 3.1)

Tabla 3.1. Los siete rasgos del chcharo que estudi Mendel

99

GUA METODOLGICA DE BIOLOGA

Mendel ide un mecanismo para simbolizar y comprender la transmisin de los rasgos hereditarios. Emple un par de letras que representan los genes que intervienen en cada rasgo estudiado. Por ejemplo, en el tamao de la planta, la letra A mayscula representa al gen para tallo alto, que es un rasgo dominante, mientras que la letra a minscula refiere al gen para el tallo bajo que corresponde a un rasgo recesivo.

Fig. 3.1 El homnculo

Fig. 3.2 Gregor Mendel

ACTIVIDAD Retomando la lnea del tiempo de clula, agrgale los hechos ms relevantes que marcaron el curso de la gentica.

3.2 QU DIFERENCIAS Y SIMILITUDES ENCONTRAMOS EN LOS CONCEPTOS DE LA GENTICA?


La gentica actual, a partir del trabajo de Mendel, expone varios conceptos bsicos para la comprensin de los mecanismos de la herencia: El fenotipo es la apariencia de un organismo, todo lo que podemos observar como resultado de la expresin de la informacin gentica. Por ejemplo, el color de cabello, color de piel, altura, color de ojos, posicin de las flores, forma de la hoja, etc. Por otro lado, el genotipo es la constitucin gentica de un organismo que determina

100

GUA METODOLGICA DE BIOLOGA

al fenotipo y que no es observable directamente, aunque se puede inferir al analizar las proporciones fenotpicas. Los genes alelos son determinados segmentos de ADN que determinan un rasgo hereditario. Cada gen se ubica en uno de los cromosomas homlogos, lo que permite su segregacin en distintos gametos durante la meiosis. En el ejemplo anterior, los genes A y a son alelos porque ambos codifican para la misma caracterstica (tamao de la planta), aunque con expresiones distintas: alta y baja, respectivamente. Adems, cada gen se ubica en un cromosoma del par homlogo, en un lugar fsico especfico, conocido como locus. Los cromosomas homlogos tienen los mismos genes, ubicados en los mismos loci (plural de locus). Cuando un organismo tiene alelos iguales, se dice que el genotipo es homocigoto (raza pura), dominante y recesivo, el primero tiene slo alelos dominantes (AA) y el segundo lleva slo alelos recesivos (aa). Cuando el individuo porta alelos distintos (Aa), su genotipo es heterocigoto (hbrido). Para facilitar la notacin, el cruzamiento inicial entre dos variedades se llama generacin paterna, o P1, y su descendencia, ya fuese para la forma de las semillas o para las plantas, se llama primera generacin filial, o F1. Las generaciones sucesivas a partir de este cruzamiento se denominan F2 y as sucesivamente.

3.3 EN QU CONSISTEN LAS LEYES, ESTABLECIDAS POR MENDEL, SOBRE LA HERENCIA?


Primera ley - Ley de la uniformidad de la primera generacin Al cruzar entre s individuos de razas puras distintas para un determinado carcter, se obtiene una generacin de individuos hbridos, genticamente iguales para ese carcter y cuyo fenotipo es producto del carcter dominante. Segunda ley - Ley de la segregacin de los caracteres Los alelos de un carcter en los hbridos de la primera generacin se segregan durante la formacin de los gametos sin mezclarse y se renen de nuevo de todas las formas posibles en la fecundacin para originar a los individuos de la segunda generacin (fig. 3.3).
101

GUA METODOLGICA DE BIOLOGA

Tercera ley - Ley de la herencia independiente de los caracteres Cada uno de los caracteres hereditarios se transmite a los descendientes con absoluta independencia de los dems (fig. 3.4)

Cruzamiento de prueba Al cruzar un fenotipo con el padre homocigoto recesivo se puede determinar el genotipo desconocido. Si se producen dos fenotipos distintos quiere decir que el progenitor desconocido era heterocigoto para ese carcter. Si por el contrario aparece un solo fenotipo entonces es homocigoto (fig. 3.5).

3.4 QU DIFERENCIA HAY ENTRE LOS PATRONES HEREDITARIOS MENDELIANOS Y LOS NO MENDELIANOS?
Los principios establecidos por Mendel se agrupan en un modelo gentico denominado herencia mendeliana. Esto implica que los patrones hereditarios, tanto rasgos normales como alteraciones hereditarias, se rigen por las leyes de Mendel. Por ejemplo, herencia autosmica dominante y recesiva, determinacin del sexo. Por otro lado, aquellos rasgos que no cumplen dichas leyes quedan incluidos en la herencia no mendeliana. Por ejemplo, herencia intermedia, genes ligados, herencia ligada al sexo, alelos mltiples, codominancia, poligenia y herencia multifactorial.

HERENCIA MENDELIANA Herencia autosmica dominante En este tipo de herencia slo se necesita uno de los genes para que se exprese una caracterstica o una mutacin (Fig. 3.7). Si una persona tiene un alelo dominante defectuoso desarrollar la enfermedad. Se conoce como autosmica porque el gen se encuentra en un cromosoma somtico o autosoma. La caracterstica o anomala ser ms extrema o severa en los individuos homocigotos que en los heterocigotos. Se heredan de esta forma: braquidactilia, acondroplasia, enfermedad de Huntington, polidactilia y aniridia.

102

GUA METODOLGICA DE BIOLOGA

Herencia autosmica recesiva Se expresa nicamente cuando en el genotipo de un individuo estn los dos alelos recesivos que pueden ser normales o mutados (Fig. 3.8). Casi todas las enfermedades causadas por la falta de una enzima esencial, se heredan de esta forma. Los portadores son heterocigotos para el gen, puesto que llevan un alelo normal y otro alterado. Son personas fenotpicamente normales, pero que pueden transmitir su alelo defectuoso a sus hijos. Se heredan de forma autosmica recesiva la anemia drepanoctica (o falciforme), albinismo, fenilcetonuria y fibrosis qustica, entre otras. Determinacin del sexo Existen dos tipos de cromosomas: autosomas que contienen genes que determinan las caractersticas somticas, y cromosomas sexuales o gonosomas, que definen los caracteres sexuales. En el humano, cuya dotacin cromosmica es de 46, cada clula somtica contiene 22 pares de autosomas ms un par sexual XX si se trata de una mujer (homogamticas) y 22 pares de autosomas y un par XY si se trata de un varn (heterogamticos).

Fig. 3.7 Herencia autosmica dominante

Fig. 3.8 Herencia autosmica recesiva

En la mujer ocurre la inactivacin de uno de los cromosomas X (que resulta en la formacin del corpsculo de Barr observado en los ncleos interfsicos), proceso que mantiene el equilibrio gnico en ambos sexos al igualar el contenido de ADN cromosmico activo.
103

GUA METODOLGICA DE BIOLOGA

Fig. 3.3 Primera y segunda leyes de Mendel

Fig. 3.4 Tercera ley de Mendel

Fig. 3.5 Cruzamiento de prueba

Fig. 3.6 Determinacin del sexo

La determinacin del sexo ocurre en la fecundacin y depende de los gametos. Al ser aleatoria, un vulo puede ser fecundado por cualquiera de los dos tipos de espermatozoides que se han producido, por lo que en el 50% de los casos se formarn mujeres y en el otro 50% se formarn hombres (fig. 3.6).
104

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD - A QUIN ME PAREZCO MS Y POR QU? Construye tu rbol genealgico. Un rbol genealgico o genograma es un grfico que muestra las relaciones de parentesco y la transferencia de los rasgos hereditarios a travs de varias generaciones en una familia. Se elabora con el fin de detectar algunas anomalas genticas y para establecer las probabilidades que tiene un padre de procrear un hijo con un rasgo determinado. El anlisis genealgico puede detectar la herencia autosmica dominante y recesiva, y la herencia ligada al sexo as como pueden observarse las relaciones de consanguinidad y la unin entre personas estrechamente relacionadas. Los consejeros genticos emplean la genealoga para determinar en las parejas si sern capaces de producir hijos sanos. Analiza en tres generaciones de tu familia dos caractersticas normales que se presenten por herencia autosmica dominante y/o recesiva, as como cualquier patologa o enfermedad presente en tus familiares y elabora tu rbol genealgico. Expn tu rbol genealgico explicando el fenotipo entre los familiares presentados y el origen posible de las caractersticas y enfermedades, con base en las leyes de Mendel y, especficamente, la transmisin de caracteres hereditarios (genotipo).

105

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD - PROBLEMARIO DE HERENCIA MENDELIANA Con base en las Leyes de Mendel. Resuelve el siguiente problemario en tu libreta. 1. Mendel, en uno de sus experimentos, cruz dos plantas de chcharo de lneas puras, una de tallo largo y otra de tallo corto. Utilizando la cuadricula de Punnett, muestra el genotipo y fenotipo que obtuvo en la F1 y F2. 2. Se cruzan dos plantas de chcharos, una de vainas verdes y flores axilares (VVAA) con otra de vainas amarillas y flores terminales (vvaa). Obtn genotipos y fenotipos de F1 y F2, utiliza el cuadro de Punnett. 3. Se cruzan tomates rojos hbridos y de tamao normal homocigotos con la variedad amarilla enana. Qu proporcin de tomates rojos que salen en la F1 sern enanos? (Los alelos dominantes son el tamao normal y el color rojo). 4. El color rojo de la pulpa del tomate depende de la presencia de un factor R dominante sobre su alelo r para el amarillo. El tamao normal de la planta se debe a un gen N dominante sobre el tamao enano n. Se cruza una planta de pulpa roja y tamao normal, con otra amarilla y normal y se obtienen: 30 plantas rojas normales, 31 amarillas normales, 9 rojas enanas y 10 amarillas enanas. Cules son los genotipos de las plantas que se cruzan?. Comprobar el resultado realizando un cuadro de Punnett.

HERENCIA NO MENDELIANA Herencia intermedia o Dominancia incompleta Al cruzar distintas lneas puras entre s (dominantes y recesivas), se obtiene en la primera generacin individuos con un rasgo intermedio al de los dos progenitores puros. Por ejemplo, en humanos la textura del cabello est influida por un gen con dos alelos dominantes incompletos, que llamaremos C1 (cabello rizado) y C2 (cabello lacio). Los heterocigotos con el genotipo C1C2 tienen cabello ondulado. Si una persona con cabello rizado tiene un hijo con una persona de cabello lacio, todos sus hijos saldrn con cabello ondulado (F1). Si dos personas con cabello ondulado se casan (F2), tendrn hijos con cualquiera de los tres tipos de cabello, con las siguientes probabilidades: 25% cabello rizado (C1C1), 50% cabello ondulado (C1C2) y 25% cabello lacio (C2C2), con lo que se obtiene una proporcin fenotpica de 1:2:1 (Fig. 3.9). Esto ocurre porque uno de los alelos para la textura del cabello ejerce una dominancia incompleta sobre el otro alelo. Otros rasgos con herencia intermedia son la braquidactilia y anemia falciforme.
106

GUA METODOLGICA DE BIOLOGA

Genes ligados Los genes se separan independientemente durante la meiosis; sin embargo, existen grupos de genes en un mismo cromosoma. Un ejemplo de ligamiento lo constituyen los genes del grupo sanguneo Rh y los genes HLA (complejo de histocompatibilidad)

Fig. 3.9 Herencia intermedia

Fig. 3.10 Genes ligados

Por ejemplo, en el chcharo dulce (Fig. 3.10), el color de flor prpura (P) domina sobre el rojo (p), y la forma larga de polen (L) domina sobre la redonda (l). Cuando un chcharo homocigoto de polen largo y de flor prpura se cruza con uno de polen redondo y de flor roja, toda la F1 tiene flores prpuras y polen largo. As los fenotipos de la F2 no se presentan como 9:3:3:1, sino que tienen 75% de plantas de polen largo y flor prpura y 25% de polen redondo y flor roja. Sin embargo, los genes para el color de la flor y la forma del polen estn en el mismo cromosoma de tal manera que los genes se distribuyen juntos durante la meiosis y se heredan juntos.
107

GUA METODOLGICA DE BIOLOGA

Herencia ligada al sexo Existen rasgos determinados por genes que se encuentran en cualquiera de los dos cromosomas sexuales: X o Y. Por esta razn, las proporciones que se obtienen en la descendencia, as como los mecanismos por los cuales se heredan, cambian respecto a los genes que se encuentran en los cromosomas somticos. En los humanos, el cromosoma Y contiene unas cuantas docenas de genes, muchos de los cuales desempean un papel en la masculinidad. En cambio, el cromosoma X contiene ms de 1000 genes, pocos de los cuales tienen un papel especfico en la reproduccin de rasgos femeninos y la mayora no tienen su equivalente en el cromosoma Y, codificando rasgos que son importantes en ambos sexos como la visin del color, la coagulacin de la sangre y ciertas protenas estructurales de los msculos.

Fig. 3.11 Herencia ligada al cromosoma X: daltonismo

Fig. 3.12 Experimento de Morgan

As se tiene que, la mayora de este tipo de herencia los genes anmalos se encuentran en el cromosoma X y son recesivos, por lo que se debe tener el gen daado en dosis doble (homocigosis) para que se produzca la enfermedad en la mujer
108

GUA METODOLGICA DE BIOLOGA

y en el varn solo se necesita uno (Fig. 3.11). Las mujeres con fenotipo normal pueden no llevar el gen (homocigotas dominantes), o llevar uno normal y uno daado (heterocigota o portadora). Si una mujer portadora se une a un hombre sano, en cada fecundacin tendr una probabilidad del 25% de hijas sanas (que no lleven el gen), 25% de hijas portadoras (heterocigotas), 25% de hijos sanos (su cromosoma X lleva el gen dominante) y 25% de hijos enfermos (su cromosoma X lleva el alelo daado). El descubrimiento de los genes ligados al sexo fue hecho en 1910 por Thomas H. Morgan en la mosca de la fruta, Drosophila melanogaster (Fig. 3.12). Esta mosca posee caractersticas externas claramente observables. Una de ellas es el color de ojos. El color natural o silvestre es rojo, pero hay una serie de variantes en este rasgo hereditario. Morgan estudi esta caracterstica y observ que algunas moscas tenan ojos de color blanco. A travs de sus investigaciones logr determinar qu ese rasgo estaba ligado al cromosoma X. En sus trabajos, Morgan cruz machos de ojos blancos con hembras de ojos rojos. En la F1, todos los individuos de ambos sexos tenan ojos rojos Cuando las moscas de la F1 se cruzaron entre s, el 25% de los descendientes de la F2 presentaron ojos blancos y el 75% restante ojos rojos. Estos resultados permiten inferir que el rasgo de color de ojos est controlado por dos alelos, en donde el gen que determina el color rojo es dominante sobre el gen para el color blanco. Si se analiza el sexo y color de ojos de los individuos de la F2, se puede comprobar que todas las hembras son de ojos rojos, en tanto que los machos, slo la mitad es de ojos de color rojo y la otra mitad, de color blanco. Las moscas de ojos blancos tienen alelos puros para ese rasgo, ya que originan solo progenie con ojos blancos. En cambio, las moscas hembras de ojos rojos pueden tener genes para ojos de color rojo o blanco, ya que la descendencia obtenida de ellas presenta las dos caractersticas. Con base en lo anterior, surge la teora cromosmica de la herencia, la cual ha tenido aportaciones posteriores, y en la actualidad puede resumirse en los siguientes postulados: Los genes que determinan los factores hereditarios del fenotipo se localizan en los cromosomas.

109

GUA METODOLGICA DE BIOLOGA

Cada gen ocupa un lugar especfico o locus (en plural es loci) dentro de un cromosoma concreto. Los genes se encuentran dispuestos linealmente a lo largo de cada cromosoma. Los genes alelos se encuentran en el mismo locus de la pareja de cromosomas homlogos, por lo que en los organismos diploides cada carcter est regido por una par de genes alelos. Codominancia y alelos mltiples Los alelos mltiples son una condicin en la que hay ms de dos alelos alternativos probables que definen ciertos rasgos. Un ejemplo clsico son los alelos del sistema de grupos sanguneos ABO (Tabla 3.2 y Fig. 3.13) y los del complejo de histocompatibilidad (HLA). Los alelos mltiples se originan por diferentes mutaciones en un mismo gen. Los 4 grupos sanguneos, A, B, AB u O, son consecuencia de tres distintos alelos de un slo gen (IA, IB e iO) presente en el cromosoma 9. Este gen codifica una glucoprotena especfica que se localiza en la superficie de los glbulos rojos o eritrocitos. A su vez, los alelos IA e IB son codominantes sobre iO que es recesivo, es decir, ambos son fenotpicamente detectables en heterocigosis, por lo que tienen sangre tipo AB.

Tabla 3.2 Grupos sanguneos

Fig. 3.13 Codominancia y alelos mltiples

110

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD - CMO SE TRANSMITE LA HEMOFILIA? En las familias reales puede observarse en sus genogramas un alto grado de consanguinidad, ya que era tradicional y beneficioso casarse entre los miembros de la realeza, un ejemplo de ello es la reina Victoria de Inglaterra. Analiza el siguiente genograma y determina cul es el patrn gentico que sigue la hemofilia apoyndote en la teora cromosmica. Especificando por qu se presentan personas sanas, portadoras y enfermo/a.

Adems, el ambiente influye sobre muchos rasgos polignicos. A la suma de los factores herencia-ambiente se le conoce como herencia multifactorial. Entre los padecimientos que se heredan en forma multifactorial se encuentran la mayora de los defectos del nacimiento: labio y paladar hendido, defectos del tubo neural, luxacin congnita de cadera, estenosis pilrica, cardiopatas, etc y muchos padecimientos sistmicos: lupus eritromatoso, diabetes mellitus, esquizofrenia, epilepsia, hipertensin arterial, psicosis maniacodepresiva.

ACTIVIDAD En tu libreta elabora un cuadro comparativo sobre los tipos de herencia mendeliana y no mendeliana.

111

GUA METODOLGICA DE BIOLOGA

PROBLEMARIO DE HERENCIA NO MENDELIANA Resuelve en tu libreta los siguientes problemas de gentica. Lelos con detenimiento y razona el patrn hereditario. 1. Un varn de ojos azules se casa con una mujer de ojos pardos. La madre de la mujer era de ojos azules, el padre de ojos pardos y tena un hermano de ojos azules. Del matrimonio naci un hijo con ojos pardos. Razonar cmo ser el genotipo de todos ellos, sabiendo que el color pardo domina sobre el color azul. Elabora un rbol genealgico para explicarlo. 2. En la especie vacuna, la falta de cuernos F, es dominante sobre la presencia f. Un toro sin cuernos se cruza con tres vacas: a) Con la vaca A que tiene cuernos se obtiene un ternero sin cuernos. b) Con la vaca B tambin con cuernos se produce un ternero con cuernos. c) Con la vaca C que no tiene cuernos se produce un ternero con cuernos. Cules son los genotipos del toro y de las tres vacas? 3. Un ratn A de pelo blanco se cruza con uno de pelo negro y toda la descendencia obtenida es de pelo blanco. Otro ratn B tambin de pelo blanco se cruza tambin con uno de pelo negro y se obtiene una descendencia formada por 5 ratones de pelo blanco y 5 de pelo negro. Cul de los ratones A y B ser homocigoto y cul heterocigoto? Razona la respuesta. 4. En la especie humana la Miopa es un rasgo dominante (M). Al unirse una mujer de visin normal a un hombre con miopa, tienen un hijo con visin normal. Determina el genotipo de: a) La madre. b) El padre. c) El hijo. d) Explica cmo se pudo presentar este suceso. e) Determina qu posibilidad tiene la pareja de que su siguiente hijo tenga visin normal, y que probabilidad de que su siguiente hijo sea miope. 5. Qu proporcin genotpica y fenotpica cabe esperar en un matrimonio entre un hombre daltnico y una mujer portadora?

6. La aniridia (dificultades en la visin) en el hombre se debe a un factor dominante (A). La jaqueca es debida a otro gen tambin dominante (J). Un hombre que padeca de aniridia y cuya madre no, se cas con una mujer que sufra jaqueca, pero cuyo padre no la sufra. Qu proporcin de sus hijos sufrirn ambos males?

112

GUA METODOLGICA DE BIOLOGA

7. Si ambos padres tiene sangre tipo A Qu posibilidades hay de que tengan un hijo con tipo sanguneo O? Fundamenta tu respuesta. 8. Investiga en tus familiares, el fenotipo de plegar su lengua en U. Con base a la informacin obtenida realiza un rbol genealgico expresando el genotipo de cada integrante. La capacidad de plegar la lengua exprsala como uncaracterstica dominante y la incapacidad de plegar la lengua como una caracterstica recesiva. 9. El Defecto de Albinismo es una caracterstica recesiva. Si una mujer albina se une a un hombre de color normal cuyo padre es albino, si tienen 8 hijos Cmo sern fenotpicamente sus hijos? 10. En los rbanos, el cruce entre plantas que producen rbanos redondos (RRRR) y las que producen rbanos alargados (RARA) producen rbanos ovalados (RRRA). En un cuadro de Punnett representa la posible descendencia del cruce de dos plantas, una de rbanos redondos con una de rbanos ovalados.

3.5 QU ES UNA MUTACIN?


El botnico Hugo de Vries en el ao de 1901, en sus estudios sobre herencia mendeliana en plantas, encontr que la herencia en la mayora de las especies generalmente era ordenada y predecible. Sin embargo, pudo observar que cada cierto tiempo apareca alguna variante que no estaba presente ni en los progenitores ni en ningn antecesor de estas mismas plantas. A partir de lo ocurrido de Vries planteo una hiptesis, donde determin que estas variantes surgan como resultado de cambios sbitos en los genes y que la variante producida por un gen cambiado se transmita luego a la progenie, como lo hace cualquier otra caracterstica hereditaria. De Vries denomin mutaciones a estos cambios hereditarios repentinos, y mutantesa los organismos que exhiban estos cambios. Los conceptos propuestos por de Vries no resultaron tan errneos, el concepto de mutacin como fuente de la variacin gentica demostr ser de suma importancia, aunque la mayora de sus ejemplos no eran muy vlidos. Las mutaciones junto con la recombinacin gentica aumentan la variabilidad gentica de las especies, lo que contribuye a su adaptacin al medio ambiente y, en
113

GUA METODOLGICA DE BIOLOGA

definitiva, a la evolucin de las mismas. Si no existieran las mutaciones no existira la gran biodiversidad planetaria. En un ambiente heterogneo o cambiante, una variacin determinada puede darle a un individuo o a su progenie una ligera ventaja, como as tambin un efecto negativo provocando la extincin de una especie. Para resumir entonces:"Una mutacin es un cambio heredable en el material gentico de una clula". De acuerdo al dogma central de la biologa, el ADN es una molcula estable que contiene la informacin gentica, sin embargo al cambiar dicha informacin, tambin lo har la secuencia de aminocidos en las protenas formadas, provocando alteraciones que generalmente son corregidas a travs de diferentes mecanismos de reparacin; no obstante, pueden generarse cambios en la secuencia de bases. En la naturaleza las mutaciones ocurren al azar y espontneamente, pero se conocen varios agentes externos, los mutgenos, que inducen varias clases de cambios heredables perjudiciales o benficos y pueden ser: fsicos (rayos ultravioleta, X, gamma), qumicos (agentes alquilantes, oxidantes) y biolgicos (virus y transposones). Podemos establecer dos grandes grupos de mutaciones en relacin con el tipo de clulas en las que se producen: somticas y germinales. Una mutacin en una clula somtica, puede provocar alteraciones en el organismo en el que se presente; pero desaparece en el momento en que muere el individuo en que se origin. Sin embargo, las mutaciones en las clulas germinales, vulos y espermatozoides, pueden transmitirse como rasgos hereditarios diferenciadores a los descendientes del organismo en los que tuvo lugar la mutacin.

TIPOS DE MUTACIONES
Las mutaciones pueden darse en tres niveles diferentes: molecular (gnicas o puntuales), cromosmico y genmico MUTACIONES GNICAS O PUNTUALES Las mutaciones a nivel molecular son llamadas gnicas o puntuales y afectan la constitucin qumica de los genes cambiando la secuencia de nucletidos (Tabla 3.3). Se originan por:
114

GUA METODOLGICA DE BIOLOGA

Sustitucin. Donde debera haber un nucletido se inserta otro. Por ejemplo, en lugar de la citosina (C) se instala una timina (T). Inversin. Mediante dos giros de 180 dos segmentos de nucletidos de hebras complementarias se invierten y se intercambian. Translocacin. Ocurre un traslape de pares de nucletidos complementarios de una zona del ADN a otra Delecin. Se pierde o elimina uno o ms nucletidos produciendo un error de lectura durante la traduccin que conlleva a la formacin de protenas no funcionales. Insercin. Ocurre cuando se aade o agrega uno o ms nucletidos.

Tabla 3.3 Mutaciones puntuales o gnicas

MUTACIONES CROMOSMICAS El cambio afecta a un segmento de cromosoma (mayor de un gen), por tanto a su estructura. Estas mutaciones pueden ocurrir por: Delecin. Es la prdida de un segmento cromosmico, que puede ser terminal o intercalar (Fig. 3.14). Cuando ocurre en los dos extremos, la porcin que porta el centrmero une sus extremos rotos y forma un cromosoma anular(Fig. 3.15).

115

GUA METODOLGICA DE BIOLOGA

Inversin. Cuando un segmento cromosmico rota 180 sobre s mismo y se coloca en forma invertida, por lo que se altera el orden de los genes en el cromosoma (Fig. 3.16).

Fig. 3.14 Delecin

Fig. 3.15 Cromosoma anular

Fig. 3.16 Inversin

Fig. 3.17 Translocacin

Translocacin. Intercambio de segmentos entre cromosomas no homlogos, que puede ser o no recproca (Fig. 3.17). Algunos tipos de translocaciones producen abortos tempranos. Tambin se pueden formar portadores de trisomas como la del 21 (sndrome de Down); al translocarse todo el cromosoma 21 a otro cromosoma como el 14 (14/21), los gametos de esa persona llevarn el cromosoma translocado ms uno normal, por lo que al fecundarse con el gameto contrario, el producto resultante tendr tres cromosomas 21. Isocromosomas: Se origina durante la meiosis o mitosis, cuando la divisin del centrmero se produce segn el plano transversal en vez de vertical. Como consecuencia, uno de los brazos del cromosoma original se pierde y los brazos del isocromosoma resultante son genticamente idnticos entre s pero en sentido inverso (Fig. 3.18).
116

GUA METODOLGICA DE BIOLOGA

Fig. 3.18 Isocromosomas

MUTACIONES GENMICAS Son alteraciones en el nmero de los cromosomas propios de la especie. Este tipo de mutaciones tambin recibe el nombre de aberraciones o variaciones cromosmicas. Pueden ser: Euploida Se da cuando la mutacin afecta al nmero de juegos completos de cromosomas, es decir, afecta a todo el genoma. Se pueden clasificar por el nmero de cromosomas que se tengan en: monoploida o haploida: si las clulas presentan un solo juego de cromosomas; y poliploida: si presentan ms de dos juegos cromosmicos. Son causadas por errores en la separacin (disyuncin) de los pares de cromosomas homlogos durante la meiosis, no separndose ninguno de estos. Los organismos poliploides generalmente son ms grandes y vigorosos presentando habitualmente gigantismo. Esto ha sido empleado en numerosas plantas cultivadas donde el tamao de hojas, semilla, fruto o flor es econmicamente importante, por ejemplo en alfalfa, tabaco, caf, pltano, manzana, pera, lila y crisantemo. Aneuploida Afecta al nmero de cromosomas individualmente y se debe al fenmeno de no disyuncin ocurrido durante la meiosis cuando los cromosomas homlogos no se separan y ambos se incorporan a un mismo gameto (Fig. 3.19).
117

GUA METODOLGICA DE BIOLOGA

Si este gameto fecunda a otro se originar un cromosoma triplicado (trisoma); de igual forma tambin habr gametos que tendrn un cromosoma menos (Fig. 3.20) y, por ello, cuando fecunden a otro normal, el individuo tendr un cromosoma menos (monosoma).

Fig. 3.19 La no disyuncin produce monosomas y trisomas g. 3.20 Trisomas y monosomas en cromosomas sexuales

Fi

Trisomas En el humano, se pueden presentar a nivel de cromosomas somticos (autosomas), como la trisoma del cromosoma 21 que produce el sndrome de Down (47, XX + 21 47, XY + 21).Asimismo, los cromosomas sexuales (gonosomas) pueden afectarse, como el caso delsndrome de Klinefelter (47, XXY), donde sus clulas tienen un nmero anormal de cuerpos de Barr. Otros sndromes son el triequis o metahembras (47, XXX) y la polisoma XYY (47, XYY).

Monosomas La falta de un cromosoma produce una monosoma. En el humano, se presenta el sndrome de Turner (45, X). No presentan cuerpo de Barr como las mujeres normales, pues el nico cromosoma X que tienen est activado.
118

GUA METODOLGICA DE BIOLOGA

A continuacin, se detallan las caractersticas de algunas mutaciones que se pueden dar en la especie humana.

ALTERACIONES EN LOS AUTOSOMAS SNDROME TIPO DE MUTACIN CARACTERSTICAS Y SNTOMAS DE LA MUTACIN Los afectados tienen retardo mental en diferente grado, corazn defectuoso, baja estatura, prpados rasgados, boca pequea, lengua salida, crneo ancho y marcha lenta. Las mujeres son frtiles y los transmiten al 50% de su progenie; los hombres son estriles. Anomalas en la forma de la cabeza, boca pequea, mentn huido, lesiones cardiacas. Labio leporino, lesiones cardiacas, polidactilia.

Sndrome de Down Sndrome de Edwars Sndrome de Patau

Trisoma 21

Trisoma 18 Trisoma 13 15

ALTERACIONES EN LOS CROMOSOMAS SEXUALES Sndrome de Klinefelter 44 autosomas + XXY Son varones estriles con rasgos femeninos, escaso desarrollo de las gnadas y retraso mental. Son frtiles, altos y de conducta controversial. Los afectados presentan estatura elevada, personalidad infantil, bajo coeficiente intelectual, acn, un tamao mayor de dientes, conducta agresiva, comportamiento antisocial y la espermatognesis puede o no estar alterada.

Sndrome del duplo Y

44 autosomas + XYY

Sndrome de Turner Sndrome de Triple X

44 autosomas + X 44 autosomas + XXX

Mujeres con baja estatura, aspecto hombruno, atrofia de ovarios, dobleces caractersticos en el cuello y retardo mental moderado. En la pubertad no menstran ni desarrollan caracteres sexuales secundarios. Son mujeres frtiles de apariencia normal pero con tendencia al retardo mental, Infantilismo y escaso desarrollo de las mamas y los genitales externos.

3.6 CULES SON LAS APLICACIONES MS IMPORTANTES DE LA GENTICA? Andrea es una chica de 40 aos muy agraciada vive con su pareja que es Ricardo y planean tener un hijo, solo que no se atreven debido a que en las familias de ambos hay antecedentes de Sndrome de Down. Si ellos fueran tus amigos, cmo podras ayudarlos?
119

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD La anemia falciforme es una enfermedad que se debe a una mutacin en un nucletido del gen que tiene informacin para la fabricacin de la hemoglobina. A partir del alelo mutado se generan molculas de hemoglobina anormales. La secuencia de ADN que se muestra a continuacin pertenece al gen que tiene la informacin para fabricar un fragmento de la hemoglobina normal:

GTGCACCTGACTCCTGAGGAG CACGTGGACTGAGGACTCCTC
a. Utilizando la tabla del cdigo gentico escribe la secuencia de aminocidos que se sintetiza a partir de la hebra inferior del ADN. Secuencia de ARNm: Secuencia proteica:

120

GUA METODOLGICA DE BIOLOGA

Acurdate que la hebra de ARNm obtenido a partir de leer la hebra inferior del ADN es de secuencia igual a la hebra superior, slo que en vez de T tiene U. b. El fragmento de protena que figura a continuacin pertenece a la hemoglobina falciforme. Val-His-Leu-Trip-Pro-Val-Glu Compara esta secuencia con la anterior y determina cul es el nucletido que sufri la mutacin responsable de la anemia falciforme De los tres tipos principales de mutacin que existen sta es de tipo? _______________________ Y a la vez a cual subtipo pertenece? ____________________________ Qu sucedi? _____________________________________________________

CONSEJO GENTICO El Consejo Gentico es el estudio que se realiza a travs de la valoracin clnica y estudios especializados para saber si existe riesgo de que en una familia se pueda repetir, o bien presentarse por primera vez, alguna malformacin congnita (alteracin del desarrollo anatmico que se presenta durante la vida intrauterina y se manifiesta al nacimiento) o cualquier enfermedad, independientemente de que la causa sea o no gentica (hereditaria). Por lo que, la prctica del asesoramiento o consejo gentico es muy importante en la prevencin de enfermedades hereditarias y sndromes con malformaciones congnitas (que se presentan al nacimiento). Este Consejo Gentico puede ser previo a/o despus de. El primero es aquel que se imparte antes del nacimiento de un nio afectado y el segundo es el que se da cuando, dentro de una familia, existe el antecedente de uno o ms casos con alguna alteracin que puede ser hereditaria y en relacin con la cual se consulta. El equipo que lo imparte est conformado por varios especialistas (ginecoobstetras, psiclogos, endocrinlogos, cirujanos, trabajadores sociales, etc), coordinados por un genetista. Para impartir consejo gentico se deben tener en cuenta los aspectos mdicos y psicolgicos tanto del paciente como de su familia. El estudio deber explicar cul ser la evolucin del defecto de nacimiento o enfermedad por la que se consulta, sobre el manejo teraputico, diettico o de rehabilitacin y, sobre todo, informar sobre las medidas preventivas que pueden tomarse.
121

GUA METODOLGICA DE BIOLOGA

Las causas ms frecuentes para solicitar asesoramiento gentico son: personas que sufren un padecimiento gentico, parejas con un hijo afectado, familias con parientes afectados, aborto de repeticin, consanguinidad y mismo grupo tnico. Algunos trastornos genticos se pueden descubrir antes del nacimiento por medio de una serie de pruebas que constituyen el diagnstico prenatal. Entre estos procedimientos est la amniocentesis, que consiste en tomar una muestra de lquido amnitico que se analiza por medio de un cariotipo, detectndose cualquier anomala cromosmica numrica o estructural. La fetoscopa, que permite ver al feto por medio del endoscopio, y la ultrasonografa, que utiliza ondas de sonido de alta frecuencia para producir una imagen del feto en una pantalla, es de gran valor para el diagnstico de algunas malformaciones fetales. Al confirmar el diagnstico se toman las medidas teraputicas y preventivas requeridas, tales como restricciones dietticas, administracin de enzimas, trasplantes de clulas, manipulacin gentica y tratamiento quirrgico prenatal, entre otras.

PROYECTO GENOMA HUMANO El Proyecto Genoma Humano (PGH) se inici en 1988 y se concluy en el 2004. Consisti en obtener la secuencia completa de ms de 3,000 millones de pares de bases del ADN del genoma humano, codificada en 23 pares de cromosomas contenidos en cada una de las clulas del cuerpo. Se estima que, en total, deben ser unos treinta mil genes. En los ltimos aos la localizacin de genes ha tenido un notable avance, pues en 1990 ya se haban localizado ms de 600. Es importante hacer notar que para algunos cromosomas las investigaciones han resultado muy fructferas, como es el caso del cromosoma X.

ACTIVIDAD Realiza la lectura del artculo que se encuentra en el siguiente link http://www.alumno.unam.mx/algo_leer/Genoma.pdf; posteriormente realiza un mapa conceptual sobre el proyecto del genoma humano.

122

GUA METODOLGICA DE BIOLOGA

INGENIERA GENTICA Es un conjunto de tcnicas cuyo objetivo principal es la creacin de nuevas combinaciones genticas basndose en la manipulacin directa del ADN.

ACTIVIDAD ESPECFICA: TRANSGNICOS Analiza el siguiente artculo cuestionando para qu y cmo puedes utilizar los organismos transgnicos y qu repercusiones pueden tener en ti el consumirlos. Realiza un ensayo al respecto, considerando los aspectos bioticos.
Prof. Daniel Ramn. Director del Instituto Agroqumica y Tecnologa de Alimentos IATA-CSIF.

Valencia. Fecha de Publicacin: Abril de 1999

Alimentos transgnicos: objetivos y valores


Alimento transgnico es aquel en cuyo diseo se han utilizado tcnicas de ingeniera gentica. Con ello se pretende obtener productos cuyas caractersticas respondan ms adecuadamente a las exigencias del productor o del consumidor. Esta denominacin se utiliza slo en Espaa, ya que en el resto de pases de nuestro entorno se les incluye dentro del trmino ms amplio de "nuevos alimentos" (en ingls "novel foods"). Los alimentos transgnicos no representan algo nuevo, ya que desde la antigedad el hombre viene modificando el patrimonio gentico de animales o plantas para crear nuevas razas de animales o variedades vegetales cuyo rendimiento industrial sea ms adecuado. Mediante el cruce sexual, los ganaderos han obtenido durante siglos nuevas razas de vacuno que produjeran ms leche y los agricultores han conseguido variedades vegetales de mayor inters agronmico. Al llevar a cabo estos cruces, los mejoradores combinan de forma aleatoria los miles de genes de los genomas de dos cepas parentales intentando encontrar un genoma resultante que rena los genes beneficiosos de ambos progenitores. Se trata por lo tanto de una tcnica basada en el azar en la que la probabilidad de encontrar la combinacin gentica adecuada es muy baja. Pero conviene recordar que ha funcionado, y que la inmensa mayora de alimentos animales o vegetales de nuestra dieta estn constituidos por especies obtenidas mediante esta estrategia. Por contra, y como comentamos al principio, en el diseo de los alimentos transgnicos se utilizan tcnicas de ingeniera gentica. En estas, a partir del genoma de un individuo
123

GUA METODOLGICA DE BIOLOGA

donador se asla el gen que interesa expresar, se modifica in vitro y se introduce, ya sea en el genoma del propio individuo, ya sea en el genoma de un organismo receptor que puede ser un animal, un vegetal, o un microorganismo. Recordemos que el trmino transgnico hace referencia a la expresin de un gen proveniente de una especie de forma distinta. As, slo aquellos alimentos transgnicos en los que se hayan expresado genes de otras especies tendran una denominacin correcta. Las diferencias entre los alimentos de la biotecnologa tradicional y los alimentos transgnicos son slo tcnicas. Por un lado, las tcnicas de ingeniera gentica son mucho ms precisas que el cruce sexual, por lo tanto se pueden obtener resultados mucho ms adecuados en un menor tiempo. Adems, la ingeniera gentica implica direccionalidad, o lo que es lo mismo, mayor control sobre el producto final frente al azar del cruce sexual. Finalmente, son mucho ms potentes al permitir transferir genes de una especie a otra, o incluso de un reino a otro. Sin duda, esta ltima caracterstica tiene repercusiones de ndice tico o social. Se han comercializado unos pocos alimentos transgnicos, aunque muchos otros estn en fase de experimentacin o comercializacin. Pueden ser transgnicos que portan mltiples copias del gen de la hormona de crecimiento de la trucha y ganan tamao mucho ms rpido con el consiguiente beneficio para el productor. La ingeniera gentica permite expresar determinados genes en determinados tejidos. As, se han expresado genes que codifican protenas de alto valor aadido en la glndula mamaria de diferentes mamferos. Son frmacos de alto valor aadido como el activador del plasmingeno o el factor antihemoflico, con lo que un rebao de tamao medio podra producir la suficiente cantidad de estos productos para poder atender la demanda de todos los enfermos actuales durante un ao. Un beneficio espectacular para el consumidor. Tambin se han aplicado tcnicas de ingeniera gentica en el caso de los alimentos fermentados. Se han construido bacterias lcticas o levaduras transgnicas que portan genes de otros organismos. Los resultados son quesos en los que es posible controlar, e incluso acortar, los tiempos de maduracin sin prdida de calidad, o vinos con un incremento de aroma afrutado, una caracterstica organolptica muy apreciada por el consumidor centroeuropeo. Basta echar un vistazo a los peridicos nacionales durante los ltimos tres meses para comprender que, a pesar de sus enormes posibilidades, existe un debate social en torno a la comercializacin de los alimentos transgnicos. Los miedos asociados a su ingesta son mucho mayores que los asociados al uso de cualquier otro producto de la ingeniera gentica. Por qu? Podemos encontrar varias razones pero la ms importante es que con los alimentos transgnicos el consumidor siempre tiene la opcin de escoger. Podemos decidir entre
124

GUA METODOLGICA DE BIOLOGA

consumir tomate transgnico o uno convencional, pero no sobre inyectarnos insulina transgnica, ya que no existe la alternativa contraria. A este hecho sumemos que alimentacin es algo ms que la necesidad fisiolgica de obtener energa: alimentacin es cultura. En este contexto deben entenderse todos los recelos en torno a la ingesta de estos productos. Cual es la situacin actual? Hay una disputa entre dos polos: las compaas multinacionales productoras y los grupos de presin (fundamentalmente organizaciones ecologistas) con sus mensajes contrarios. Esta controversia unida a la falta de divulgacin cientfica adecuada confunden al consumidor que se pregunta: son seguros los alimentos transgnicos? Desde un punto de vista cientfico la respuesta es clara: son al menos tan seguros como aquellos convencionales de los que proceden. Partamos de la base en que en alimentacin, como en cualquier otra faceta de la vida, es imposible hablar de riesgo cero. Por eso los riesgos deben definirse por comparacin con situaciones conocidas. Todos los alimentos transgnicos han tenido que pasar una serie de pruebas de laboratorio encaminadas a demostrar su inocuidad sanitaria. Como ejemplo baste decir que la compaa productora del tomate FlavrSavt TM, el primer alimento transgnico comercializado, tard cuatro aos en realizar todas las pruebas exigidas por la agencia estatal FDA (Food and DrugAdministration) hasta obtener el permiso de comercializacin. As ha sido con todos los alimentos que se han comercializado hasta la fecha, y as seguir siendo, ya que la legislacin americana y europea lo contempla. Las pruebas requeridas se basan en determinar la composicin nutricional del alimento transgnico y detectar su posible alergenicidad o toxicidad. Todas estas pruebas no se exigen al resto de alimentos, aunque as debiera ser. Desde distintos frentes se ha postulado el riesgo que para el medio ambiente supone la construccin de estos alimentos, sobre todo la de los vegetales transgnicos. A menudo se habla de la posible transferencia de los genes exgenos desde la variedad transgnica a variedades silvestres. Esta transferencia se produce frecuentemente en la Naturaleza, en algunas especies convencionales ms que en otras. Por eso podemos afirmar que, por ejemplo en Europa, la transferencia de genes es imposible si utilizamos maz transgnico y probable si utilizamos soja transgnica. Resulta por lo tanto evidente que el control sobre este tipo de experimentos debe ser riguroso. Y de hecho as lo es al deberse aplicar las distintas reglamentaciones que legislan al respecto. En 1992, el Gobierno estadounidense declar a travs de la FDA que no necesitaba desarrollar una legislacin especial para los alimentos transgnicos, al considerar que la existente para la comercializacin de variedades obtenidas por mtodos genticos convencionales cubra todos los aspectos necesarios. Conviene destacar que con ello el legislador americano decidi

125

GUA METODOLGICA DE BIOLOGA

evaluar slo el producto final en cuanto a su inocuidad sanitaria, obviando la tcnica usada (cruce sexual vs ingeniera gentica) para su diseo. La Comunidad Europea sin embargo decidi desarrollar una legislacin especfica para estos productos que considera tanto el alimento final como las tcnicas utilizadas. El pasado mes de Julio se aprob el Reglamento para la comercializacin de los nuevos alimentos, que entre otros, incluye los alimentos transgnicos. En esta normativa se disea un entramado burocrtico por el que cada alimento transgnico deber superar antes de su comercializacin la aprobacin por parte de un comit de expertos cientficos nombrado por la Comisin Europea, as como el visto bueno de comits de cada uno de los pases miembros. En Japn o Canad tambin disponen de legislacin para la comercializacin de los alimentos transgnicos bastante similar, en cuanto a la aprobacin por parte de comits, a la europea. Una de las cuestiones ms consideradas en la reglamentacin europea es la del etiquetado. Deben ser etiquetados los alimentos transgnicos? Esta cuestin implica una pelea por intereses. Las compaas productoras son, en general contrarias a dicho etiquetado ya que temen una bajada en las ventas. Pero el consumidor tiene todo el derecho a estar informado. Las autoridades americanas han decidido etiquetar slo aquellos alimentos transgnicos cuya composicin vare con respecto al convencional equivalente, o aquellos que contengan genes de reserva tica (un gen de animal expresado en un vegetal con el consiguiente problema para los vegetarianos), organismos modificados genticamente vivos (un yogurt producido con una bacteria lctica transgnica), o la aparicin en su composicin de un producto con un efecto txico probable en una subpoblacin (aparicin de fenilalanina y riesgo para la fenilcetonricos). La legislacin europea es muy similar, pero ha sido objeto de un amplio debate, de forma que en estos momentos se prev la modificacin de dicho reglamento en lo concerniente al etiquetado y se prev la obligatoriedad del etiquetado para todos los alimentos transgnicos. Curiosamente algunas compaas han decidido asumir, sin necesitarlo, el riesgo del etiquetado. Por ejemplo, Zeneca en Inglaterra decidi etiquetar una sopa obtenida a partir de tomates transgnicos, a pesar de la decisin del gobierno britnico que le exima del mismo. Acompaaron esta decisin con una campaa publicitaria explicando al consumidor la modificacin gentica introducida en el tomate transgnico, y el producto se ha vendido sin problemas. En este mismo pas algunas cadenas de supermercados han anunciado pblicamente que etiquetarn todos los alimentos transgnicos que se vendan en sus estanteras, independientemente de que as lo determinen los comits pertinentes. En resumen, el etiquetado es una cuestin de defensa e informacin del consumidor. La etiqueta es exigible, pero la etiqueta debe ser informativa. Y para ser informativa hace falta introducir al consumidor en trminos como biotecnologa, ingeniera gentica y nutricin.
126

GUA METODOLGICA DE BIOLOGA

Se han realizado encuestas en varios pases como Estados Unidos y Japn, as como en varios estados miembros de la Comunidad Europea. En general, los europeos somos los menos proclives a la comercializacin de los alimentos transgnicos, aunque existen distintos criterios. Los pases nrdicos, Austria y Luxemburgo, mantienen las posturas ms contrarias. Existen una serie de criterios comunes entre todos los encuestados que se pueden resumir en: a) el consumidor acepta en mayor grado los alimentos transgnicos de origen vegetal y fermentado, y en mucha menor medida los de origen animal; b) se muestran ms proclives a aceptar los alimentos transgnicos cuyo diseo favorece al consumidor, y menos los que favorecen al productor, y c) hay una exigencia mayoritaria del etiquetado. Los alimentos transgnicos son una realidad incuestionable. Los cientficos que trabajamos en estos temas no podemos obviar sus claras repercusiones sociales y debemos hacer frente a nuestra obligacin de informar a la sociedad sobre sus presuntos riesgos y sus enormes posibilidades.

RUBRICA PARA EVALUAR PORTAFOLIO DE EVIDENCIAS Institucin educativa: Nombre del docente: Nombre del alumno: Ao/grupo: Fecha: Nombre de quien evala: Bloque/tema: Autoevaluacin: Coevaluacin: Evala el profesor: Asignatura:

PONDERACIN CRITERIOS EXCELENTE (4) MUY BIEN (3) BIEN (2) DEFICIENTE (1) PUNTAJE

Presentacin del portafolio

Identifica y selecciona de una forma clara y detalla las actividades realizadas.

Identifica y selecciona parcialmente de una forma clara y detallada las actividades realizadas. El nivel de expresin escrita es clara pero no fundamental para su comprensin Utiliza informacin fundamental en ideas y argumentos sin un criterio

Identifica pero no selecciona de una forma clara y detalla las actividades realizadas. El nivel de expresin escrita es poco clara y no fundamental para su comprensin Utiliza informacin fundamental en ideas sin argumentos sin un

No identifica ni selecciona de una forma clara y detallada las actividades realizadas. El nivel de expresin escrita no es clara ni fundamental para su comprensin. Utiliza informacin sin ningn fund, ideas ni argumentos y sin un criterio

El nivel de expresin escrita es Redaccin clara y clara y fundamental comprensiva para su comprensin. Inclusin de informacin diversa seleccionada Utiliza informacin fundamental en ideas y argumentos con un criterio

127

GUA METODOLGICA DE BIOLOGA


actual, y con criterio Equilibrio entre la informacin aportada procedente de fuentes externas, del profesor y la propia adecuado a su nivel adecuado a su nivel. Informa y aporta ideas propias relacionndolas con fuentes externas y las del profesor. Integra y relaciona todas las actividades y acta con coherencia a la hora de organizar el portafolios Informa y aporta ideas propias sin relacionarlas con fuentes externas y con las del profesor. Integra y relaciona todas las actividades pero no acta con coherencia a la hora de organizar el portafolios Selecciona actividades complementarias y optativas sin capacidad para decidir lo que se va a evaluar. Aporta contenidos, e ideas, sin sugerencias propias que lo hagan distinto del resto de sus compaeros. Asiste y participa en clase, realiza tareas complementarias sin adquirir un compromiso personal con la asignatura para lograr una buena evaluacin. criterio adecuado a adecuado a su su nivel. nivel. .informa pero no aporta ideas ni las relaciona con fuentes externas ni con las del profesor No informa ni aporta ideas relacionadas con fuentes externas y con las del profesor No integra ni relaciona las actividades ni acta con coherencia a la hora de organizar el portafolios No selecciona actividades complementarias ni optativas con capacidad para decidir lo que se va a evaluar. No aporta contenidos ideas ni sugerencias propias que lo hagan distinto del resto de sus compaeros Asiste pero no participa en clase ni realiza tareas complementarias, ni adquiere un compromiso personal con la asignatura para lograr una buena evaluacin.

Organizacin e integracin del portafolios

Integra pero no relaciona todas las actividades ni acta con coherencia a la hora de organizar el portafolios Selecciona pocas actividades complementarias y optativas sin capacidad para decidir lo que se va a evaluar Aporta pocos contenidos ideas y sugerencias propias que lo hagan distinto del resto de sus compaeros Asiste y participa en clase, sin realizar tareas complementarias ni adquiriendo un compromiso personal con la asignatura para lograr una buena evaluacin.

Selecciona actividades Seleccin de complementarias y actividades optativas con complementarias y capacidad para optativas decidir lo que se va a evaluar. Aportacin de contenidos, ideas y sugerencias propias en las actividades Aporta contenidos, ideas, y sugerencias propias que lo hacen distinto del resto de sus compaeros. Asiste y participa en clase, realiza tareas complementarias adquiriendo un compromiso personal con la asignatura logrando una buena evaluacin

Implicacin, participacin y compromiso

Total
REFERENCIAS: (Nez Chan, 2002)

CLONACIN La clonacin es la accin de reproducir a un ser de manera perfecta en el aspecto fisiolgico y bioqumico de una clula originaria, es decir que, a partir de una clula de un individuo se crea otro exactamente igual al anterior. Un clon es el conjunto de individuos que desciende de otro por va vegetativa o asexual. La clonacin existe en la naturaleza paralelamente a la reproduccin sexual. Los descendientes de los microorganismos que iniciaron la vida, eran idnticos a sus padres.

128

GUA METODOLGICA DE BIOLOGA

En 1997, IanWilmut, anunci que haba clonado una oveja llamada Dolly. Esta oveja se convirti en el primer mamfero clonado. En la clonacin de Dolly se obtuvo un vulo de oveja, se elimina su ncleo, se sustituye por un ncleo de clula de oveja adulta procedente del tejido mamario y se implanta en una tercera oveja que sirve como mam de "alquiler" puesto que ser la que lleve el embarazo (Fig. 3.20).

TERAPIA GNICA Es un tratamiento que reemplaza genes defectuosos por otros sanos. En el futuro, las enfermedades hereditarias podrn detectarse y curarse a tiempo gracias a este procedimiento. En 1990, se inici el primer estudio clnico de terapia gnica humana, con una nia que recibi una transfusin de leucocitos procesados mediante ingeniera gentica, para contener el alelo normal; en la actualidad la nia tiene un sistema inmune funcional En 1994 se iniciaron estudios experimentales para combatir la fibrosis qustica, una enfermedad pulmonar hereditaria. Con tcnicas de ingeniera gentica se incluy en un virus el gen normal. El virus se introdujo en los pulmones por medio de un aerosol bucal para que penetrara a las clulas que con esta informacin pudieran sintetizar la protena que al faltar produce la enfermedad.

Fig. 3.20 Clonacin de la oveja Dolly

129

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD: LECHE CURATIVA El propsito de esta actividad es identificar los avances de la manipulacin gentica. 1. Lee con atencin la siguiente noticia Cientficos argentinos han creado una vaca transgnica que produce insulina en su leche. El ADN de las vacas se ha modificado para que generen leche con el precursor de la insulina. De l se extrae una molcula idntica a la del ser humano; mediante un proceso qumico, se purifica y se transforma en un medicamento inyectable. As, se ha conseguido que el frmaco final sea igual a la hormona que los humanos sanos producen naturalmente. Y adems, es muy rentable: con ella, slo en Argentina los precios de la insulina bajaran 30%.
Fuente: Vacas clonadas para producir insulina. Consultado el 6 de julio de 2010. Disponible en http:///www.biotecnologica.com/vacas-clonadas-para-producir-insulina/(Adaptacin)

2. Investiga cmo se obtena anteriormente la insulina y responde las siguientes preguntas en tu cuaderno. 3. Crees que esta tcnica sea mejor que las anteriores?, Por qu? 4. Si fueras diabtico usaras insulina con este origen? 5. Elabora una conclusin con base en la lectura y en tus respuestas.

CLULAS MADRE Clula madre o stemcell se define como una clula progenitora, autorenovable, capaz de regenerar uno o ms tipos celulares diferenciados. En animales superiores, se clasifican en dos grupos: Clulas madre embrionarias pluripotenciales que derivan de la masa celular interna del blastocisto del embrin (7-14 das), y son capaces de generar todos los diferentes tipos celulares del cuerpo. Clulas madre rgano-especficas multipotenciales, es decir, capaces de originar las clulas de un rgano concreto en el embrin, y tambin en el adulto. Un ejemplo de clulas madre rgano-especficas, es el de las clulas de la mdula sea, que pueden generar todos los tipos celulares de la sangre y del sistema inmune. Tambin existen en ms rganos como piel, grasa subcutnea, msculo cardaco y esqueltico, cerebro, retina, pncreas, etc. Se cultivan tanto en in vitro (en el
130

GUA METODOLGICA DE BIOLOGA

laboratorio), como in vivo (en un modelo animal) utilizndolas en la reparacin de tejidos daados. A pesar de todo, la aplicacin de estas tcnicas de trasferencia de clulas madre de adulto para el recambio y reparacin de tejidos enfermos est todava en sus comienzos. Se ha comprobado que clulas madre de adulto pueden reprogramarse (transdiferenciarse), y dar lugar a otros tipos celulares que hasta ahora se pensaba que eran incapaces de generar. Es decir, ya no seran multipotenciales, si no pluripotenciales. En la lnea germinal se pide su prohibicin en todo aquello que sea recomponer un programa gentico humano. Los trabajos con embriones humanos con fines puramente experimentales se consideran un atentado a la dignidad de la especie humana. Por todo ello, es preciso que los conocimientos y avances en Ingeniera Gentica se consideren patrimonio de la humanidad, y que los organismos internacionales creados para ello sean capaces de vencer las reticencias que crean los intereses polticos y econmicos, logrando una legislacin adecuada y justa, que recoja las voces razonables de todos los sectores sociales.

IMPLICACIONES BIOTICAS EN LA GENTICA Los avances vertiginosos de la gentica y otras ciencias nos hacen preguntarnos si el ser humano est listo para manejarlos correctamente. La tica y las leyes no han avanzado al mismo ritmo que la ciencia, por lo que es imperioso el desarrollo de la Biotica y de una legislacin adecuada para que estos nuevos conocimientos generen un desarrollo positivo y no se conviertan en una forma de control y exterminio. Frente a los mltiples beneficios que ofrece este campo, se encuentran algunos problemas que causa la aplicacin de la Ingeniera Gentica: Sanitarios. Pueden aparecer nuevos microorganismos patgenos que causen enfermedades desconocidas, o que el uso de frmacos de diseo provoque efectos secundarios no deseados. Ecolgicos. Al liberar nuevos organismos en el ambiente puede provocarse la desaparicin de especies contra las que se lucha, con consecuencias an
131

GUA METODOLGICA DE BIOLOGA

desconocidas, ya que cumplen una funcin en la cadena trfica de la naturaleza. Se puede pensar en posibles nuevas contaminaciones debidas a un metabolismo incontrolado. Sociales y polticos. Las aplicaciones de la biotecnologa en el campo de la produccin industrial, agrcola y ganadera, pueden crear diferencias an ms grandes entre pases ricos y pobres. El sondeo gnico en personas puede llevar a consecuencias nefastas en la contratacin laboral, por ejemplo, y atenta contra la intimidad a que tiene derecho toda persona. ticos y morales. La experimentacin en la especie humana puede atentar contra su misma dignidad. En el campo de la Terapia Gnica es defendible este procedimiento cuando se utilice en clulas somticas para corregir enfermedades.

Criterios Analiza las aplicaciones actuales de la gentica mediante la investigacin y elaboracin de un ensayo. Ponderacin Logros:

MATRIZ DE VALORACIN DE COMPETENCIAS Pre-formal Receptivo Resolutivo Autnomo Analiza las Analiza las Investiga las aplicaciones Analiza las aplicaciones aplicaciones actuales de la aplicaciones actuales de la actuales de la gentica actuales de la gentica gentica sin mediante la gentica mediante una la investigacin mediante la investigacin elaboracin y la investigacin muy de un elaboracin y elaboracin completa y ensayo. de un de un ensayo. elaboracin resumen. de un ensayo. Puntos 20 Puntos 40 Puntos 80 Puntos 100 Aspectos a mejorar :

Estratgico Analiza las aplicaciones actuales de la gentica mediante la investigacin y elaboracin de un ensayo crtico y reflexivo. Puntos 100

EVALUACIN
132

GUA METODOLGICA DE BIOLOGA DIAGNSTICA Examen diagnstico Lluvia de ideas ACTIVIDADES DE APRENDIZAJE: Problemario Actividades de la Gua metodolgica Lnea de Tiempo Cariotipo y diagnstico Investigacin documental Ensayo V de Gowin de actividades experimentales ACTIVIDAD ESPECFICA: Portafolio de evidencias Examen departamental tipo CENEVAL o PISA Laboratorio (evaluacin V-Gowin) Actividades de aprendizaje Actividad especfica por unidad

FORMATIVA

SUMATIVA

30% 20% 20% 30%

BIBLIOGRAFA BSICA De Erice E. y Gonzlez A. (2009). Biologa, La ciencia de la vida. Editorial McGraw Hill, 1.Edicin, pp. 399. Audesirk, T, Audesirk, G y Byers, B.E. (2008). Biologa, Ciencia y Naturaleza. Editorial Prentice Hall, 2. Edicin, Mxico, pp. 704. Valdivia. B, Granillo. P, Villarreal M. S. (2006). Biologa, La Vida y sus Procesos. Editorial Publicaciones Culturales, Mxico, pp. 407. Nelson, Gideon E. (2002). Principios de Biologa. Editorial Limusa Willey. 3ra. Reimpresin de la Segunda Edicin, Mxico.

BIBLIOGRAFA COMPLEMENTARIA Claybourne, Ana. (2006). El Gran Libro de los Genes y el ADN. SEP/Usborne. Coleccin Astrolabio. Mxico. Gmez Roig, E. (2004). Los Transgnicos. SEP/Libros del Escarabajo. Coleccin Espejo de Urania. Mxico. Walter, R. (2004). Genes y ADN. SEP/Altea. Coleccin Espejo de Urania. Mxico.
133

GUA METODOLGICA DE BIOLOGA

Cherfas, Jeremy (2003). El Genoma Humano. SEP/Planeta. Coleccin Espejo de Urania. Mxico. Gmez Roig, E. (2003). La Clonacin 1. SEP/Libros del Escarabajo. Coleccin Astrolabio. Mxico. Noguera Solano, R. y Ruiz Gutirrez, R. (2000). Laboratorio de Historia de la Biologa y Evolucin, Facultad de Ciencias, Universidad Nacional Autnoma de Mxico. Garca, H. (1997). Gentica para el Futuro. Coleccin Esto es Qumica y qu?, Facultad de Qumica, UNAM. Mxico.

VIDEOS RECOMENDADOS Pelcula GATACA Pelcula La Isla TICs Action Bioscience http://actionbioscience.org/esp/genomica/index.html Proyecto Bisfera. http://recursos.cnice.mec.es/biosfera/ Embryos http://www.embryos.org My Heritage http://www.myheritage.es/genealogia Genograma http://chato.cl/blog/2001/01/genograma_arbol_genealogico.html Mutaciones http://www.botanica.cnba.uba.ar/Pakete/Dibulgeneral/LasMutaciones/Mutaciones.h tm

134

GUA METODOLGICA DE BIOLOGA

BLOQUE 4 Evolucin de los Seres Vivos

135

GUA METODOLGICA DE BIOLOGA

BLOQUE DE APRENDIZAJE: EVOLUCIN DE LOS SERES VIVOS


TIEMPO: 18 hrs UNIDAD DE COMPETENCIA: Investiga las principales teoras sobre el origen y evolucin de los seres vivos para explicar la diversidad, a travs de la comparacin de los cambios genticos, que han manifestado a travs del tiempo. SABERES Procedimentales Redacta una resea sobre el video proyectado. Debate en forma grupal el tema expuesto en equipo sobre las teoras del origen de la vida. Ilustra las ideas de Lamarck, Darwin-Wallace y Neodarwinismo en equipo mediante un cartel. Debate en forma grupal el tema expuesto en equipo sobre las teoras evolutivas. Interpreta un mapa mental de las evidencias de la evolucin. Disea una lnea de tiempo sobre la evolucin de una especie. COMPETENCIAS Genricas/Atributos Disciplinares 5.6 Utiliza las tecnologas de la informacin y comunicacin para procesar e interpretar informacin. 6.2. Evala argumentos y opiniones e identifica prejuicios y falacias. 6.4. Estructura ideas y argumentos de manera clara, coherente y sinttica. 8.3 Asume una actitud constructiva, congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo.

Declarativos Analiza el concepto de evolucin de los seres vivos mediante el video Darwin y el rbol de la vida. Explica las distintas teoras sobre el origen de la vida. Argumenta las distintas teoras evolutivas.

Actitudinales/V alorales Participa de forma colaborativa en equipos diversos. Asume una postura de respeto hacia los diferentes puntos de vista, interculturalidad y creencias. Reflexiona las implicaciones de la actividad humana como un aspecto modificante en la evolucin de los seres vivos.

5. Obtiene, registra y
sistematiza la informacin para responder a la pregunta de carcter cientfico, consultando fuentes relevantes y realizando experimentos pertinentes. 7. Rectifica preconcepciones personales o comunes sobre diversos fenmenos naturales a partir de evidencias cientficas.

CRITERIOS DE DESEMPEO Argumenta las diferentes teoras acerca del origen de la vida mediante una investigacin documental. Argumenta las caractersticas de las diferentes teoras evolutivas para determinar los factores que influyen en los cambios genticos con base en la adaptacin de las especies mediante la elaboracin de carteles. Analiza, reflexiona y compara los cambios genticos que se han manifestado en los seres vivos como origen de la biodiversidad a travs de una lnea del tiempo.

136

GUA METODOLGICA DE BIOLOGA

ESTRATEGIAS DE ENSEANZA
Lluvia de ideas Anlisis de medios Clase Magistral Debate Base orientadora de la accin (BOA) Asesora metodolgica y temtica del bloque.

ESTRATEGIAS DE APRENDIZAJE
Exposicin Debate Mapa mental Cartel Ejercicios de Gua metodolgica Lnea de tiempo

RECURSOS DIDCTICOS
Gua metodolgica Video Darwin y el rbol de la vida. Libros y Revistas electrnicas. Artculos de divulgacin en revistas cientficas. Presentaciones en Power Point. Ilustraciones y animaciones. Pintarron. Plumones. Equipo multimedia

EVIDENCIAS Y/O PRODUCTOS


Actividades de la gua didctica del alumno Cartel sobre las ideas de Lamarck, Darwin-Wallace y Neodarwinismo en equipo Mapa mental de las evidencias de la evolucin Lnea de tiempo sobre la evolucin de una especie

EXPLORANDO TUS CONOCIMIENTOS 1. Escribe 5 palabras que se te vienen en mente al leer la palabra Evolucin ________________________________________________________________ ________________________________________________________________ 2. Evolucionan todas las cosas? ________________________________________________________________ 3. Escribe 3 personajes relacionados con la evolucin ________________________________________________________________ ________________________________________________________________ 4. Existen pruebas de que la evolucin existe? cules? ________________________________________________________________ ________________________________________________________________
137

GUA METODOLGICA DE BIOLOGA

138

GUA METODOLGICA DE BIOLOGA

4.1 QU ES LA EVOLUCIN BIOLGICA? En el sentido ms amplio, la evolucin consiste en una serie de cambios que se presentan a lo largo del tiempo involucrando a todo cuanto existe y es objeto de estudio por parte de la ciencia. Desde esta perspectiva, todo lo que existe en el universo es objeto de su propio proceso evolutivo. As entonces, la evolucin biolgica es un cambio en las propiedades de las poblaciones de organismos que va ms all de su vida individual. Los cambios evolutivos son aquellos que se heredan a travs del material gentico, de una generacin a otra. La evolucin biolgica puede ser imperceptible o trascendente; desde cambios sutiles en la proporcin de diferentes alelos dentro de una poblacin (tal como los que determina el grupo sanguneo) hasta las alteraciones sucesivas que marcan el desarrollo desde el organismo ms primitivo hasta los seres vivos ms complejos. La evolucin es el gran principio unificador de la Biologa, sin ella no es posible entender las propiedades distintivas de los organismos, sus adaptaciones al medio ambiente; ni las relaciones de mayor o menor proximidad que existen entre las distintas especies. La historia de la vida es una historia de extincin y muerte, con unos pocos supervivientes. El 99.9% de las especies que han existido alguna vez sobre la Tierra estn actualmente extintas. La evolucin es un concepto asombroso y convincente, ms crucial actualmente para el bienestar humano, la ciencia y para nuestra comprensin del mundo. Las pruebas que la sustentan son abundantes, crecientes, slidamente conectadas y fcilmente disponibles en museos, libros y revistas, y en un cmulo de estudios cientficos evaluados por expertos de todo el mundo.

4.2. CMO SE ORIGIN LA VIDA? La cuestin sobre el origen de la vida y por ende de los seres vivos es, de hecho, una de las ms antiguas en filosofa. A travs de los aos han surgido diversas teoras que tratan de explicar cmo surgi la vida en nuestro planeta y cmo sta ha cambiado a travs del tiempo.

139

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD EL PENSAMIENTO DEL ORIGEN DE LA VIDA A TRAVS DEL TIEMPO Realiza una investigacin documental acerca de las 4 teoras ms relevantes acerca del origen de la vida y a partir de sta, en trabajo por equipo, completa la siguiente lnea del tiempo anotando el ao, autor, teora (experimento) y fundamento en la fecha correspondiente en el lado que corresponda a la corriente ideolgica de la teora.
Abiogenistas Biogenistas

Siglo II

Siglo XVII

Siglo XVIII

Siglo XIX

Siglo XX

140

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD TEORAS SOBRE EL ORIGEN DE LA VIDA A partir de la investigacin documental elabora por equipo un mapa mental de los experimentos de las teoras que explicaron el origen de la vida. Posteriormente presntalo en plenaria grupal.

141

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD LA EVOLUCIN QUMICA 1. Convierte el siguiente esquema en frmulas qumicas correspondientes a cada tomo o molcula que se describe.

Lpidos

Protenas

Carbohidratos

cidos nuclecos

Alcoholes cidos grasos

Aminocidos

Monosacridos Bases nitrogenadas

cido fosfrico

Hidrocarburos

Formaldehido

cido cianhdrico

Metano

Agua

Amonaco

Carbono

Hidrgeno

Oxgeno

Nitrgeno

2. Escribe los smbolos y frmulas correspondientes en orden de evolucin. En las biomolculas (lpidos, protenas, carbohidratos y cidos nuclicos) escribe una frmula condensada.

142

GUA METODOLGICA DE BIOLOGA

143

GUA METODOLGICA DE BIOLOGA

5. Responde las siguientes preguntas Qu relacin existe? ___________________________________________________________________________________ ___________________________________________________________________________________ __________________________________________________________________________ Cul fue la tendencia de esta evolucin molecular? ___________________________________________________________________________________ _____________________________________________________________________________

4.3 CMO SE ORIGINARON LAS CLULAS EUCARIONTES?


Carl Woese en 1980 denomin protobionte o progenote al antepasado comn de todos los organismos actuales (eubiontes) y representara la unidad viviente ms primitiva, pero dotada ya de la maquinaria necesaria para realizar la transcripcin y la traduccin gentica. De este tronco comn surgiran en la evolucin tres modelos de clulas procariontes: arqueas, urcariotas y bacterias Durante un perodo de ms de 2,000 millones de aos, solamente existieron estas formas celulares, por lo que se puede pensar que se adaptaron a vivir en todos los ambientes posibles y "ensayaran" todos los posibles mecanismos para realizar su metabolismo. La evolucin celular se produjo en estrecha relacin con la evolucin primitiva de la atmsfera y de los ocanos terrestres. As, la teora ms aceptada en la actualidad es que:

144

GUA METODOLGICA DE BIOLOGA

Las primeras clulas seran hetertrofas anaerobias, utilizaran como alimento las molculas orgnicas presentes en el medio (sopa primigenia). Como estas molculas terminaran por agotarse, podra haber ocurrido una especie de primera crisis ecolgica a nivel molecular, si no hubiera sido porque en algn momento de la evolucin celular... Algunas clulas aprendieron a fabricar las molculas orgnicas mediante la fijacin y reduccin del CO2. Se iniciaba as la fotosntesis, como un proceso de nutricin auttrofa. El empleo del agua en la fotosntesis como donante de electrones, tuvo como origen la liberacin de O2 y por tanto la transformacin de la atmsfera reductora en la atmsfera oxidante que hoy conocemos. Empez una revolucin del oxgeno que causara la muerte de muchas formas celulares para las que fue un veneno, otras se adaptaran a su presencia y algunas otras aprendieron a utilizarlo para sus reacciones metablicas, lo que dio lugar a la respiracin aerobia, realizando una nutricin hetertrofa aerobia. Estas formas celulares tienen organizacin procarionte y son de pequeo tamao. A partir de ellas, se piensa que evolucionaron las clulas eucariontes.

TEORA ENDOSIMBITICA El siguiente paso en la evolucin celular fue la aparicin de las eucariontes hace unos 1,500 millones de aos. Lynn Margulis, en su teora endosimbitica (fig. 4.1 y 4.2), propone que se originaron a partir de una primitiva clula procarionte, que perdi su pared celular, lo que le permiti aumentar de tamao, esta primitiva clula en un momento dado, englobara (fagocitosis) a otras clulas procariticas ms pequeas que tuvieran estructuras primitivas para metabolizar el CO2 atmosfrico; y otras capaces de absorber la luz solar e iniciar el proceso fotosinttico establecindose de esta manera una relacin endosimbitica conocida con el nombre de urcariota. La incorporacin intracelular de estos primitivos procariontes a la primitiva clula urcariota, le proporcionara dos caractersticas fundamentales de las que careca: La capacidad de un metabolismo oxidativo, con lo cual la clula anaerobia pudo convertirse en aerobia.

145

GUA METODOLGICA DE BIOLOGA

La posibilidad de realizar la fotosntesis y por tanto ser un organismo auttrofo capaz de utilizar como fuente de carbono el CO2 para producir molculas orgnicas.

Para comprender mejor esta teora es pertinente definir el trmino simbiosis. Se trata de una asociacin prolongada de individuos (coexistencia) de diferente clase en una unidad morfolgica con ventajas mutuas y significativas. Por tanto, el trmino endosimbiosis se refiere a una relacin simbitica al interior de la clula, con algunas particularidades metablicas que no se encontraban en los individuos separados y esta asociacin se transmite de generacin en generacin.

Fig. 4.1. Esquema de la posible secuencia de eventos que originaron a las diversas clulas eucariontes

Fig. 4.2 Proceso de Endosimbiosis

146

GUA METODOLGICA DE BIOLOGA

Los fundamentos de la teora endosimbitica son: Las mitocondrias y cloroplastos, organelos presentes en las clulas eucariontes, tienen dimensiones y morfologa parecidas a la de las bacterias. Estos organelos poseen ADN, ARNm, ribosomas, ARNt, componentes esenciales para su duplicacin independiente del ncleo celular. La importancia de estas observaciones radica en sugerir que estos organelos fueron organismos unicelulares capaces de autoreplicarse y sintetizar la totalidad de sus protenas por si mismos. Poseen ADN circular al igual que las bacterias actuales.

Fig. 4.3. Representacin del tiempo biolgico en horas.

147

GUA METODOLGICA DE BIOLOGA

4.4. CMO EXPLICA LA EVOLUCIN LA DIVERSIDAD DE LOS SERES VIVOS? Aristteles desarroll su Scala Naturae, o Escala de la Naturaleza, para explicar su concepto del avance de las cosas vivientes desde lo inanimado a las plantas, luego a los animales y finalmente pone al hombre en la "cumbre de la creacin". En la Edad Media se aceptaba la tradicin judeocristiana, es decir lo que deca el Gnesis del Antiguo Testamento, con su especial creacin del mundo construido literalmente en seis das. A travs de la historia se postularon dos lneas del pensamiento acerca de la evolucin biolgica. stas comprenden las teoras fijistas apoyadas hasta el siglo XVIII, que pretendan darle forma cientfica a la explicacin bblica sobre la crea-cin (tambin llamadas creacionistas). Afirmaban que no hay procesos de cambio, que las caractersticas de los seres vivos permanecieron invariables y que el nmero de especies en la Tierra siempre fue igual, desde que stas fueron creadas. George de Cuvier (1769-1832) postul la teora del catastrofismo, que dice que los seres vivos fueron creados por Dios, pero algunos desaparecieron como consecuencia de diferentes cataclismos (el ms reciente, el diluvio universal), acaecidos en pocas remotas que acabaron con la fauna y flora existentes. Las que sobrevivan permanecan invariables y tras cada catstrofe se produca una nueva creacin divina. De esta manera explicaba la existencia de organismos extintos que se conocan slo por sus restos fsiles. La otra lnea de pensamiento se basa en las teoras transformistas que establecen que las especies derivan unas de otras por una transformacin a travs del tiempo, que las especies no han aparecido de la noche a la maana y que deben tener antecesores. George de Buffon (1707-1788) propuso que las especies (pero solo las no creadas por accin divina...) pueden cambiar. Esto fue una gran contribucin al primitivo concepto de que todas las especies se originaban de un creador perfecto y por tanto no podan cambiar debido a su origen. En 1795, James Hutton, expuso la teora del uniformismo, que planteaba que ciertos procesos geolgicos operaron en el pasado de la misma forma que lo hace hoy en da llegando a establecer la edad de la Tierra en 4,500 millones de aos.
148

GUA METODOLGICA DE BIOLOGA

Durante el siglo XIX El britnico Charles Lyell refin las ideas de Hutton, y concluy que el efecto lento, constante y acumulativo de las fuerzas naturales haba producido un cambio continuo en la Tierra, su libro Los Principios de la Geologa tuvo un profundo efecto en Charles Darwin y Alfred Wallace. Robert Thomas Malthus (1766-1834) escribi el libro Ensayo sobre el Principio de Poblacin, donde menciona que mientras las poblaciones humanas crecen en una proporcin geomtrica (por ejemplo, 4, 8, 16, 32, etc.), los alimentos crecen en una progresin aritmtica (por ejemplo, 2, 4, 6, 8, etc.) lo que trae como consecuencia las guerras y la muerte por hambruna. Darwin pens que en el reino animal pasaba lo mismo, que los animales tenan que competir entre los de su misma especie y con los de distintas especies para sobrevivir, deduciendo la lucha por la existencia (principio del pensamiento maltusiano). Dentro de las teoras ms relevantes para explicar el proceso evolutivo estn: Teora de los caracteres adquiridos - Jean Baptiste Lamarck Teora de la seleccin natural - Charles Darwin y Alfred Rusell Wallace Teora neodarwinista Theodore Dobzhansky

Fig, 4.4. Louis Pasteur

Fig. 4.5. A. I. Oparin

149

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD - EL EFECTO, LA CAUSA Y EL CUELLO DE LAS JIRAFAS 1. Lee detenidamente los siguientes textos. Haz un mapa mental de cada uno.

A. - "En relacin a las costumbres, es curioso observar el resultado en la forma particular y la talla de la jirafa (Camelo pardalis): sabemos que este animal, el ms grande de todos los mamferos, vive en lugares en los que la tierra , casi siempre rida y sin hierba, le obligan a comer hojas de los rboles ya esforzarse continuamente por llegar. De esta costumbre (de esforzarse por llegar) resulta, despus de un largo tiempo, en todos los individuos de su raza, que sus patas delanteras se han vuelto ms largas que las traseras y que su cuello se ha alargado de tal manera que la jirafa, sin levantarse sobre las patas traseras, eleva su cabeza y alcanza seis metros de altura " Autor_____________________________

B. - "La jirafa, por su elevada estatura y por su cuello, patas delanteras, cabeza y lengua muchos alargados, tiene toda una estructura admirablemente adaptada para comer en las ramas ms altas de los rboles. La jirafa puede as obtener comida al que no llegan otros ungulados que viven en el mismo lugar, y esto debe ser un ventaja en tiempos de escasez. ... Al originarse la jirafa, los individuos que llegaran ms alto y que en tiempos de escasez fuesen capaces de llegar aunque fuera un poco ms arriba que los dems, se salvaran con ms frecuencia. Estos se reproduciran entre s y dejaran descendencia que habra heredado las mismas caractersticas corporales, mientras que los individuos menos favorecidos por los mismos conceptos, tendran tendencia a desaparecer" Autor_______________________________

150

GUA METODOLGICA DE BIOLOGA

2. Interpreta las relaciones lgicas de ambos texto argumentativos y distingue el modelo explicativo de Darwin del de Lamarck.
TEXTO A HECHO que se expone TEXTO B

RAZONES que se dan para explicar el hecho

151

GUA METODOLGICA DE BIOLOGA

AUTOR del texto

RELACIONES LGICAS: Cul es la causa? Cul es la consecuencia?

Un punto crucial de las teoras darwiniana y lamarkista es que no explican adecuadamente las variaciones que presentan los individuos y que tienen que ser forzosamente heredadas; en caso contrario, nicamente afectara a un grupo numeroso de organismos, pero no al total de la especie. Mendel, public en 1866 sus descubrimientos sobre las leyes de la herencia, sin embargo, Darwin nunca tuvo conocimiento de tales investigaciones lo que le impidi comprender la relacin existente entre la seleccin natural y los efectos del uso y del desuso. En resumen, podemos considerar las ideas de Darwin en cuatro puntos: Las especies se originan unas de otras por una serie de variaciones y mutaciones aleatorias, las cuales han ocurrido a lo largo del tiempo. El proceso evolutivo es continuo y gradual en todos los individuos, esto es, no ocurren saltos ni interrupciones, en donde una forma pase a otra muy distinta. Todos los organismos semejantes estn relacionados por medio de su historia evolutiva, donde se observan antepasados comunes. La seleccin natural condiciona el curso del proceso evolutivo, es decir, la evolucin de las especies no est forzada ni dirigida por una presin ajena a dicho proceso, sino que es un resultado aleatorio.

152

GUA METODOLGICA DE BIOLOGA

MECANISMOS DE LA VARIABILIDAD
Despus de varias discusiones entre los cientficos sobre la evolucin, pareca que se haba comprendido como se haba generado el proceso evolutivo en el mbito de la seleccin natural, pero surga una pregunta Cmo se produca la variedad en la descendencia? Esto se deba a la presencia de flora y fauna muy parecida, que exista en diferentes partes del mundo; un ejemplo se dio en la variedad de tortugas y pinzones existentes en las islas Galpagos observadas por Darwin. Apoyndose en los experimentos de Mendel sobre gentica, se vio que las caractersticas de los padres son transmitidas a los hijos, pero que estos adquieren caractersticas diferentes, esto se debe a los mecanismos generadores de variabilidad. Los mecanismos ms importantes son: Reproduccin sexual. Esta se da con la unin de los gametos masculino y femenino que origina a un individuo con caractersticas semejantes, pero diferentes a sus padres, es decir, se combinan, no se mezclan los caracteres paternos y maternos, a travs de los genes. Mutaciones. Son cambios que son producidos en el material gentico de los padres, y los hijos reciben dicha informacin ya alterada con lo cual se favorece al nuevo individuo ofrecindole ventajas. Las mutaciones slo son heredables cuando afectan a clulas reproductoras Microevolucin. Es el proceso por el cual, a partir de una especie ya existente, se origina otra, y puede ocurrir por: Aislamiento geogrfico: Esto se da cuando dos poblaciones de organismos similares quedan aisladas por barreras geogrficas, evolucionan de forma distinta. Por ejemplo, las poblaciones de mamferos de Australia al quedar aisladas evolucionaron de modo distinto a las del resto del mundo. Tendencias evolutivas diferentes: Es cuando en algunos individuos de una poblacin se producen variaciones genticas, que pueden dar origen a otra lnea evolutiva. No interviene, pues, la seleccin natural. Por ejemplo, el elefante africano tiene orejas ms grandes que el asitico, porque vive en regiones ms clidas y las orejas le permiten eliminar mayor cantidad de calor.
153

GUA METODOLGICA DE BIOLOGA

Fig. 4.6. Sinopsis del proceso evolutivo

ACTIVIDAD FSIL VIVIENTE Se ha descubierto que existen una cuantas especies que son iguales a como eran hace millones de aos. Dentro del campo de la biologa se les denomina pancrnicas; aunque comnmente son llamadas fsiles vivientes. Una especie de este tipo es el celacanto, un pez que tiene fsiles de una antigedad de 80 m.a., pero que actualmente se le encuentra en aguas profundas cercanas a Madagascar. En el pasado habitaron prcticamente todos los ocanos. Tomando en cuenta la teora de la evolucin por seleccin natural, encuentra las razones que expliquen por qu el celacanto no ha cambiado en 80 m.a.
154

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD LA SELECCIN NATURAL DE DARWIN Y WALLACE Elabora un mapa conceptual de la Teora de la Seleccin Natural de Darwin que incluya por lo menos los siguientes conceptos: sobrepoblacin, lucha por la existencia, variaciones, cambio gradual, poblaciones, adaptaciones, sobrevivencia del ms apto, seleccin natural, medio ambiente, transmisin de rasgos heredables, especiacin, extincin.

155

GUA METODOLGICA DE BIOLOGA

TEORA NEODARWINISTA En 1937, Theodore Dobzhansky publica su libro "Gentica y el Origen de las Especies" donde incorpor a la teora de Darwin, los postulados de las leyes de Mendel adems de los conocimientos que ya se tenan sobre gentica, bioqumica y paleontologa, haciendo una sntesis y resultando en la Teora Sinttica de la Evolucin o Neodarwinista. sta se basa en los cambios evolutivos que se llevan a cabo en las poblaciones, y no en los individuos (hay que recordar que Darwin nicamente observ las variaciones en los organismos). Un organismo nace, crece y con el tiempo muere, a travs de su vida los individuos pueden sufrir cambios, pero su constitucin gentica permanece constante. Por otro lado, la constitucin gentica de una poblacin puede variar de una generacin a otra mediante procesos internos (mutaciones y recombinacin gnica) y procesos externos (seleccin natural y aislamiento reproductivo). Sus afirmaciones bsicas son: Tal y como sostuvo Darwin, la evolucin ocurre por seleccin natural. La variabilidad gentica en una poblacin se debe a la existencia de mutaciones. La seleccin natural acta sobre las poblaciones y no sobre individuos aislados. La evolucin ocurre a lo largo de miles y millones de aos. Los cambios que se producen en las especies son pequeos y graduales.

4.5 CULES SON LAS EVIDENCIAS DE LA EVOLUCIN? La teora de la evolucin se basa en una serie de pruebas aportadas por diferentes disciplinas cientficas y que infieren que todos los seres vivos actuales son el resultado de la evolucin. Actualmente la comunidad cientfica no duda del hecho de la evolucin, aunque hay diferentes hiptesis sobre cmo ha tenido lugar. Se puede poner un smil histrico para entender esta idea: ningn historiador pone en duda que el imperio romano cay (esto es un hecho aceptado), pero, cules fueron las causas de la cada del imperio romano? Para responder esta pregunta hay diferentes ideas, diferentes hiptesis alternativas, que se ponen a discusin entre los historiadores.

156

GUA METODOLGICA DE BIOLOGA

Aunque hoy en da no hay que "demostrar" la evolucin, en otras pocas s que se pona en duda y datos paleontolgicos, anatmicos y embriolgicos han sido utilizados como pruebas del hecho evolutivo. Son pruebas que permiten estable-cer relaciones de parentesco entre diferentes seres vivos. Tambin los estudios de comparacin de protenas y cidos nuclicos que aportan nueva luz sobre las relaciones entre los organismos.

ACTIVIDAD LA PRUEBAS DE LA EVOLUCIN I. Evidencias embriolgicas

Distintas etapas embrionarias de algunos vertebrados

La comparacin de embriones de diferentes grupos de vertebrados ha sido considerada una prueba ms de la evolucin. 1. Escribe los argumentos que crees que usan los evolucionistas para apoyar sus ideas. _______________________________________________________________________________________ _______________________________________________________________________________________

157

GUA METODOLGICA DE BIOLOGA

_______________________________________________________________________________________ _______________________________________________________________________________________ 2. Crees que la embriologa comparada puede servir para establecer la nocin de antepasado comn? Por qu? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ II. Evidencias anatmicas: rganos homlogos, las extremidades de los vertebrados Investiga el nombre de cada uno de los huesos que constituyen las extremidades delanteras de los vertebrados mostrados en la siguiente imagen. Ilumina de diferente color cada hueso y escribe su nombre. Observa y responde: 1. Por qu se puede decir que las extremidades de los vertebrados tienen la misma organizacin? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 2. Describe, a partir del modelo de organizacin general, las transformaciones que resultan de la adaptacin al vuelo de los vertebrados.

_______________________________________________________________________________________ _______________________________________________________________________________________ 3. Formula una hiptesis que explique las semejanzas que has constatado en la organizacin de las extremidades de los vertebrados

158

GUA METODOLGICA DE BIOLOGA

159

GUA METODOLGICA DE BIOLOGA

III. Evidencias anatmicas: rganos anlogos Observa detenidamente los animales de la siguiente imagen.

1. Qu tienen en comn ambos animales? _______________________________________________________________________________________ _______________________________________________________________________________________ 2. Si comparas las extremidades traseras de la rana y el saltamontes, podras decir que tienen la misma funcin? y tienen el mismo origen? por qu?

_______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 3. Haz una investigacin documental en tu libreta sobre otros tres rganos anlogos e ilustrala con dibujos

160

GUA METODOLGICA DE BIOLOGA

IV. Evidencias anatmicas: rganos vestigiales. 1. Qu semejanzas encuentras entre los vestigios de las extremidades posteriores de la ballena y del pitn? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________

161

GUA METODOLGICA DE BIOLOGA

2. Formula una hiptesis para explicar las coincidencias observadas entre estos dos organismos (cuidado de no utilizar argumentos "lamarkistas" en su explicacin) _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 3. Crees que se pueda encontrar una explicacin que no implique evolucin a la existencia de rganos vestigiales como estos? Razona tu respuesta. _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________

Haz una investigacin documental extensa en tu libreta de cules son los rganos vestigiales que presenta el ser humano

V. Evidencias paleontolgicas Razona qu esperaramos encontrar en el registro fsil si no hubiera cambio, si no hubiera evolucin y compara tus reflexiones con el registro fsil que muestran las figuras. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________

162

GUA METODOLGICA DE BIOLOGA

Diferentes gneros de animales parecidos a los caballos actuales

163

GUA METODOLGICA DE BIOLOGA

VI. Evidencias bioqumicas. El citocromo C es una pequea protena (aproximadamente de unos 110 aminocidos) que interviene en el transporte de electrones de la cadena respiratoria de los vegetales y animales. Esta molcula est presente en la mayora de los organismos. Se pueden establecer ciertas comparaciones entre la secuencia de aminocidos correspondientes a especies muy diferentes. En el siguiente cuadro se presentan las diferencias entre las secuencias de aminocidos del citrocromo C obtenidas de diferentes animales, plantas y microorganismos. Los nmeros se refieren al nmero de aminocidos diferentes en el citrocromo C de la especie comparada.

1. De acuerdo con el cuadro, el organismo que est evolutivamente ms cercano al hombre es _____________________, con una diferencia de ______________________ y el ms lejano es ________________________, con una diferencia de 51 aminocidos en la cadena del citocromo C. 2. Cul par de especies est mas estrechamente relacionada entre s? Por qu? A. Humano Carpa B. Cascabel Polilla C. Levadura - Coliflor D. Oveja Chimpanc E. Caracol Chiriva _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________
164

GUA METODOLGICA DE BIOLOGA

VII. Evidencias biogeogrficas Segn la Biogeografa existen siete grandes regiones en las que se presenta homogeneidad adaptativa florstica, faunstica y obviamente climatolgica: a) Regin Palertica: Europa y zonas nrdicas de Asia. b) Regin Nertica: Norteamrica. c) Regin Neotropical: Sudamrica. d) Regin Etipica: frica. e) Regin Oriental: Asia tropical. f) Regin Austral: Australia, Nueva Zelanda y Nueva Guinea. g) Regin Ocenica: Islas ocenicas.

Puede decirse que la Biogeografa es la ciencia que conjunta muchas evidencias e igualmente aporta pruebas propias y muy actuales, lo que le da un gran peso en el proceso de comprobacin de la Evolucin. En la figura puedes observar seis regiones biogeogrficas y algunos animales caractersticos, con base en l completa el siguiente cuadro con la informacin que se te pide:
165

GUA METODOLGICA DE BIOLOGA

166

GUA METODOLGICA DE BIOLOGA

ESPECIACIN La especiacin es el proceso de generacin de nuevas especies a partir de una y es el resultado de la adaptacin. Esto requiere que se produzcan barreras reproductoras entre las especies incipientes. Cuando una poblacin queda separada por barreras geogrficas (como el mar, el desierto, un ro o una cordillera), sta se adapta progresivamente a las nuevas condiciones ambientales por medio de la seleccin natural, modificando algunas de sus caractersticas. Si las condiciones ambientales perduan por muchas generaciones, se habr generado en la poblacin una serie de cambios que la harn diferente de la poblacin original. Se desarrollar una raza, una subespecie o una variedad y si la duracin del aislamiento geogrfico es mayor; cuando las dos poblaciones vuelven a estar en contacto, la ausencia de fertilizacin indica que cada una es una especie diferente. Se considera que una nueva especie puede originarse por este mecanismo cada milln de aos. Tambin pueden producirse nuevas especies por poliploida y es una especiacin extraordinariamente rpida ya que la produccin de cromosomas se produce durante una generacin. Este fenmeno es poco comn en animales pero muy frecuente en vegetales. De hecho, muchas de las plantas domsticas (trigo, algodn, tabaco, manzano, lamo) se obtuvieron del cruzamiento de diversas variedades que, por lo general, producen hbridos poliplodes. FSILES Los fsiles constituyen una prueba para el estudio de la evolucin de la vida. Un fsil no slo se refiere a huesos, dientes, tejido o conchas conservadas en forma de roca sino que tambin se usa para designar toda huella o prueba dejada por algn ser vivo en el pasado. Permiten interpretar el ambiente que habitaron, sus caractersticas fisiolgicas y su relacin evolutiva con otras especies, sus depredadores y la probable causa de su muerte. Los fsiles ndice slo se encuentran en rocas de una poca especifica por lo tanto pueden determinar de manera indirecta la edad geolgica de las rocas de un estrato dado. Tcnicas de fechacin en fsiles. Bsicamente son dos los mtodos usados para calcular la edad de los fsiles: la datacin relativa y la datacin radiomtrica.

167

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD CMO SE ORIGINARON LAS BALLENAS Describe las transformaciones que resultan de la adaptacin a la vida acutica de los vertebrados como la ballena. Esta es la lnea evolutiva de la ballena azul. Explica cmo evolucion y las adaptaciones que tuvieron que llevarse a cabo para llegar a la especie actual. Describe lo que sucedi en cada especie

168

GUA METODOLGICA DE BIOLOGA __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ _________________________________________________________________________

Datacin relativa. La corteza terrestre se forma por capas de rocas super-puestas. Las capas ms profundas son las ms antiguas, y las ms superficiales las ms recientes. As, los fsiles encontrados en capas profundas son ms antiguos que los hallados en capas superficiales. Esto permite calcular relativamente, por simple comparacin, la edad aproximada de los fsiles, siempre y cuando sea posible calcular la edad de un estrato. Este mtodo es muy impreciso, aunque se usa en combinacin con la datacin radiomtrica (fig. 4.7). Datacin radiactiva. Permite medir tiempos geolgicos que se asignan en base a la velocidad de desintegracin de los istopos radioactivos. Cada istopo se transforma en otro en un tiempo determinado llamado vida media que es el lapso en que la mitad de los istopos de una muestra se transforman en istopos de otro elemento (Tabla 4.1 y fig. 4.8).
169

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD TIPOS DE FOSILES Realiza un mapa conceptual a partir de una investigacin documental sobre los tipos de fosilizacin que existe. Ejemplifica e ilustra tu mapa.

Fig. 4.7. Datacin relativa

Fig. 4.8 Datacin radiactiva del C14

170

GUA METODOLGICA DE BIOLOGA

Fig. 4.6 Diferentes tipos de Fsiles

Tabla 4.1 Vida media de algunos elementos

171

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD UN CRONMETRO PARA EL PASADO

En esta actividad se explicar cmo se obtienen las cantidades restantes de elementos radiactivos a travs del tiempo para el fechamiento de fsiles. Tomemos como ejemplo el carbono 14, el cual se desintegra aproximadamente 10% cada 1 000 aos. Para realizar algunos clculos, comencemos con una cantidad de 100 unidades de este istopo radiactivo. De acuerdo con lo anterior, en los primeros 1 000 aos se habr desintegrado 10% de las 100 unidades, es decir, 10 unidades. As, quedarn 100 - 10 = 90 unidades de este elemento 1 000 aos despus. Las cantidades para el siguiente periodo de 1 000 aos (del ao 1 000 al 2 000) se calculan como sigue: Cantidad desintegrada = 10% de 90 unidades = _____________ unidades

Cantidad sobrante despus de 2 000 aos = 90 - 9 = ___________ unidades

En la siguiente tabla se han organizado los resultados anteriores junto con los clculos de otros dos periodos de 1 000 aos. Comprueba los valores dados y calcula, usando el mismo procedimiento, las cantidades faltantes en la tabla. 1. Qu porcentaje de carbono 14 se encontrar despus de 10 000 aos? _____

2. Si en un fsil se observa que su cantidad de carbono 14 se ha reducido 35%, qu edad aproximada tendr este fsil? ______________________________

3. Si en un fsil se observa que su cantidad de carbono 14 se ha reducido 20%, qu edad aproximada tendr este fsil? (Sugerencia: contina los clculos de la tabla anterior hasta llegar a este porcentaje.) ____________________________

172

GUA METODOLGICA DE BIOLOGA

ACTIVIDADES DE CIERRE DE BLOQUE

1. Qu hubiera sucedido si la atmsfera primitiva hubiera contenido oxgeno? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 2. Por qu evolucionaron las clulas de consumidoras a productoras?

173

GUA METODOLGICA DE BIOLOGA

_______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 3. Cul es el efecto de la fotosntesis sobre la atmsfera primitiva? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 4. A qu se debe la aparicin de los organismos multicelulares? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 5. Por qu es importante el estudio de la Qumica para el conocimiento de los seres vivos? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 6. Sugiere pruebas especficas que apoyen la idea de que las modificaciones provocadas por la accin directa del medio no se heredan _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________

174

GUA METODOLGICA DE BIOLOGA

7. En qu se diferencian y en qu se asemejan la seleccin artificial y la seleccin natural? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ ______________________________ 8. Cmo puede explicarse la extincin, o la desaparicin en un lugar, de una especie animal o vegetal por accin de la seleccin natural? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________

9. Cmo explica la seleccin natural las diferencias en coloracin o forma entre especies prximas que ocupan medios distintos, o entre razas de una misma especie que se encuentran en medios diferentes? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 10. En qu punto la teora larmarkiana de la adaptacin no est de acuerdo con las pruebas de que hoy disponemos?

175

GUA METODOLGICA DE BIOLOGA

_______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 11. Una vez ocurrida una mutacin, qu debe ocurrir al gen para que el carcter quede permanente en el grupo? ________________________________________________________________________________ 12. Explica el papel del aislamiento geogrfico en el origen de las especies. _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________ 13. Identifica a qu evidencias corresponden los siguientes ejemplos: La familia de las cactceas en los desiertos de Amrica y la familia de las Euforbiceas en los desiertos asiticos y africanos desarrollan tallos carnosos con tejidos almacenadores de agua y espinas protectoras contra la prdida de la misma, y a pesar de no tener ningn parentesco, se asemejan estructuralmente. ____________________________________________________________ Los osos pardos (Ursus arctos), desde hace 1.5 millones de aos estuvieron ampliamente distribuidos en el hemisferio norte, desde los bosques caducifolios hasta la tundra, siendo su dieta bsicamente vegetariana y ocasionalmente carnvora. Se dice que de esta especie tan difundida, se separ un grupo, el cual estuvo sometido a la presin selectiva de un ambiente adverso en las zonas ms al norte, lo que produjo una nueva especie: el oso polar (Ursus maritimus), el que difiere del Ursus arctos, en el color de su pelaje, dentadura tipo netamente carnvora, cabeza y hombros aerodinmicos y cerdas rgidas en las plantas de los pies, que lo aslan del fro y le dan traccin en el suelo helado. _________________________________________________________________________________

176

GUA METODOLGICA DE BIOLOGA

La familia de los cetceos, incluye a ballenas, delfines y marsopas y sus rasgos externos son semejantes a los de los tiburones y a otros peces grandes, pero los cetceos son animales de sangre caliente, pulmonados y en el interior de sus aletas hay huesos que indican una mano tetrpoda. _________________________________________________________________________________ 14. Por qu los marsupiales estn diseminados por Australia y apenas viven en otras partes? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________

ACTIVIDAD ESPECFICA Elabora un mapa conceptual integrador que resuma los eventos del origen de la vida, origen de las clulas eucariontes, de la evolucin a la pluricelularidad y de la evolucin por seleccin natural. La rbrica para su evaluacin es la misma que para el bloque de Clula (pgina 91)

EVALUACIN
DIAGNSTICA Aplicacin de examen diagnostico y lluvia de ideas. ACTIVIDADES DE APRENDIZAJE: Exposicin por equipo. Participacin en el debate sobre las teoras del origen de la vida y evolutivas. Cartel sobre las ideas de Lamarck, Darwin-Wallace y Neodarwinismo en equipo. Mapa mental de las evidencias de la evolucin. Ejercicios de la gua didctica. ACTIVIDAD ESPECFICA: Lnea de tiempo sobre la evolucin de una especie. Examen departamental tipo CENEVAL o PISA 30% Laboratorio (evaluacin V-Gowin) 20% Actividades de aprendizaje 20% Actividad especfica por unidad 30%

FORMATIVA

SUMATIVA

177

GUA METODOLGICA DE BIOLOGA MATRIZ DE VALORACIN DE COMPETENCIAS Criterios:


Analiza, reflexiona y compara los cambios genticos que se han manifestado en los seres vivos como origen de la biodiversidad a travs de una lnea del tiempo

Pre-formal:

Receptivo:

Resolutivo:

Autnomo:

Estratgico: Propone cambios evolutivos en los seres vivos con base en las condiciones medio ambientales actuales. Puntos: 100

Busca informacin sobre los cambios que han manifestado los seres vivos. Puntos: 30

Compara los cambios manifestados en los seres vivos.

Argumenta Registra los los diferentes factores factores que evolutivos influyen en determinantes los cambios en los seres que sufren vivos. los seres vivos Puntos: 80 Puntos: 100 Aspectos a mejorar :

Ponderacin: Logros:

Puntos: 60

BIBLIOGRAFA BSICA Audesirk , T. y Byers, B. (2008). Biologa. Ciencia y Naturaleza. Segunda Edicin. Pearson- Prentice Hall. Chamizo, J. A. (2006). La ciencia. Revista Cmo ves? Direccin general de Divulgacin de la Ciencia. Universidad Nacional Autnoma de Mxico. Ao 12. No. 128-135. Oram, R.F. (1987). Biologa. Sistemas Vivientes. CECSA Mxico. pp. 285-315. Tellera J. J.L.; (1991); Zoologa evolutiva de los vertebrados; Editorial Sntesis, Espaa; 168 pginas.

BIBLIOGRAFA COMPLEMENTARIA ActionBioscience.org. (2004) La Seleccin Natural: Cmo Funciona la Evolucin. Una entrevista con Douglas Futuyma en ActionBioscience.org. http://www.actionbioscience.org/esp/evolution/futuyma.html Bada, J.L. y Lazcano, A. (2003) Sopa Prebitica, Nueva visita al Experimento de Miller en Astroseti.org (reproducido con permiso de Science Magazine). http://www.astroseti.org/sopa.php

178

GUA METODOLGICA DE BIOLOGA

Eldredge, N. (2000) Las Especies, la Especiacin y el Medio Ambiente en ActionBioscience.org http://www.actionbioscience.org/esp/evolution/eldredge.html Evolutionibus (2004) El neodarwinismo y la Teora Sinttica http://www.terra.es/personal/cxc_9747/neodarwinismo.html Major, T. (2005) Creacin vs Evolucin: Darwin y la Evolucin en ApologeticsPress.org http://www.apologeticspress.org/espanol/articulos/405 Ingman, M. (2001) El ADN Mitocondrial Esclarece la Evolucin Humana en ActionBioscience.org http://www.actionbioscience.org/esp/evolution/ingman.html

TICs Proyecto Bisfera. http://recursos.cnice.mec.es/biosfera/ RECURSOS DIDCTICOS Video Cosmos de Carl Sagan Video La Eva Gentica Discovery Channel Video Las Galpagos Video Darwin y el rbol de la vida BBC de Londres

179

GUA METODOLGICA DE BIOLOGA

BLOQUE 5
Biodiversidad y Medio Ambiente

180

GUA METODOLGICA DE BIOLOGA

BLOQUE DE APRENDIZAJE V: BIODIVERSIDAD Y MEDIO AMBIENTE


TIEMPO: 45 hrs. UNIDAD DE COMPETENCIA: Interrelaciona el medio ambiente y su biodiversidad con el flujo de materia y energa de cada ecosistema para ubicarlos y valorar el equilibrio de la biosfera a travs de una visita guiada a reas naturales y la elaboracin de un mapa mental integrador. SABERES Procedimentales Identifica a los seres vivos utilizando las reglas de la nomenclatura taxonmica binomial de Linneo a travs de claves dicotmicas. Clasifica a los seres vivos de acuerdo a Carl Woese en tres dominios y seis reinos, sealando su importancia ecolgica, mdica y econmica. Elabora una presentacin en power point de cada reino con caractersticas, imgenes e importancia. Realiza actividades experimentales para identificar caractersticas generales de los seres vivos reportando los resultados en una V de Gowin. Distingue los factores biticos y abiticos de un ecosistema, a travs de visitas guiadas a reas naturales de su comunidad. COMPETENCIAS Genricas Disciplinares 3.2 Toma decisiones a partir de la valoracin de las consecuencias de distintos hbitos de consumo y conductas de riesgo. 6.1 Elige las fuentes de informacin ms relevantes para un propsito especfico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. 8.3 Asume una actitud constructiva, congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. 2. Fundamenta opiniones sobre los impactos de la ciencia y la tecnologa en su vida cotidiana, asumiendo consideraciones ticas. 4. Obtiene, registra y sistematiza la informacin para responder a preguntas de carcter cientfico, consultando fuentes relevantes y realizando experimentos pertinentes 11. Analiza las leyes generales que rigen el funcionamiento del medio fsico y valora las acciones humanas de impacto ambiental. 13. Relaciona los niveles de organizacin qumica, biolgica, fsica y ecolgica de los sistemas vivos.

Declarativos Explica la clasificacin taxonmica de los organismos de acuerdo a las reglas de Linneo. Describe los niveles taxonmicos propuestos por Woese: Tres dominios y seis reinos. Fundamenta que la ecologa es el estudio de las relaciones de la biodiversidad con su medio ambiente. Explica la estructura y funcin de los ecosistemas haciendo nfasis en el flujo de la materia y la energa. Distingue los diferentes tipos de ecosistemas, sus recursos naturales y considera la importancia de los ecosistemas locales. Identifica las causas y efectos de los problemas ambientales en los ecosistemas

Actitudinales/Valorale s Valora la importancia mdica, econmica y social de los seres vivos para su aprovechamiento racional. Organiza grupos y mesas de debate sobre las causas y consecuencias del deterioro ambiental y las alternativas para el manejo responsable de la biosfera Fomenta la conservacin de la flora y fauna de su regin/comunidad.

CRITERIOS DE DESEMPEO

181

GUA METODOLGICA DE BIOLOGA

Elabora un mapa mental integrador de los ciclos biogeoqumicos y la relacin con el equilibrio ecosistmico

Analiza la estructura y las relaciones entre los componentes de los ecosistemas en un mapa mental integrador. Realiza actividades experimentales sobre biodiversidad y medio ambiente, aplicando la V de Gowin. Valora la importancia de la interrelacin de los seres vivos con su medio ambiente a travs de visitas guiadas a reas naturales.

ESTRATEGIAS DE ENSEANZA Aplicacin de preguntas generadoras


Presentaciones

ESTRATEGIAS DE APRENDIZAJE Elaboracin de presentaciones en power point.

RECURSOS DIDCTICOS
Gua

metodolgica de practicas educativo

Manual

EVIDENCIAS Y/O PRODUCTOS Portafolio electrnico con las presentaciones de power point.
Reporte

de power point de los diferentes reinos dicotmica

Investigacin documental de actividades de gua metodolgica. escrito de visita guiada.

Software Pizarrn

escrito de problema ambiental. de visita guiada

Resolucin

Plumones Papel

Reporte Mapa

Clave

Bond

mental integrador.

Visita guiada. Actividades

Reporte

Can DVD Laboratorio Artculos

Reportes

experimentales.
Debate

en plenaria.

Mapa

mental integrador

de actividades experimentales utilizando la V de Gowin.

Reportes

de actividades experimentales utilizando la metodologa de la V de Gowin.

de divulgacin cientfica

Videos Libreta

de apuntes, lpices, plumas.

182

GUA METODOLGICA DE BIOLOGA

EXPLORANDO TUS CONOCIMIENTOS 1. Cuntos y cules son los reinos de los seres vivos? ___________________________________________________________________ ___________________________________________________________________ 2. Escribe el nombre cientfico de un organismo (que no sea el hombre, Homo sapiens) ______________________________________________________________________ ______________________________________________________________________ 3. Qu es la Biodiversidad? ______________________________________________________________________ ______________________________________________________________________ 4. Sabias que Mxico es un pas megadiverso por qu? ______________________________________________________________________ ______________________________________________________________________ 5. Dibuja una cadena alimenticia

183

GUA METODOLGICA DE BIOLOGA

184

GUA METODOLGICA DE BIOLOGA

5.1 CMO SE CLASIFICAN A LOS SERES VIVOS? La diversidad biolgica o biodiversidad se refiere a la enorme variedad de organismos vivos que existen en nuestro planeta, se cree que existen alrededor de diez millones de organismos diferentes de los cuales solo se conocen cientficamente 15 % (1.5 millones). Existe la necesidad de ordenar y organizar el elevado nmero de seres vivos para facilitar su conocimiento y anlisis. La Sistemtica se encarga de estudiar las semejanzas o diferencias entre los organismos, ubicndolos en diferentes categoras. Asimismo utiliza datos comparativos para responder preguntas en relacin con el nivel taxonmico, el proceso evolutivo y la filogenia (origen de los organismos). La Taxonoma se encarga de clasificar a los seres vivos y ubicarlos en grupos especficos llamados taxones, as como tambin les asigna la nomenclatura adecuada. Por lo tanto la Taxonoma biolgica se encarga de elaborar inventarios de la biodiversidad a nivel mundial o regional, proporciona mtodos que facilitan la identificacin de los organismos, elabora un sistema de clasificacin que sea aceptado mundialmente, estudia las implicaciones evolutivas y por ltimo proporciona un nombre exclusivo para cada grupo de seres vivos o fsiles. Existen varios tipos de clasificacin: Sistema artificial. Un sistema estrictamente utilitario, considera el beneficio, dao, hbito, color, forma u otros caracteres de los seres vivos. Se basa exclusivamente en caracteres externos de los organismos. Sistema natural. Esta clasificacin considera caractersticas morfolgicas similares entre los organismos (homologas), tambin utiliza otros estudios como los citolgicos, embriolgicos, ecolgicos y paleontolgicos. Sistema filogentico. Seala que la variedad de formas de vida del planeta se relaciona con los procesos evolutivos de los seres vivos y por compartir ancestros comunes. NOMENCLATURA BINOMIAL DE LINNEO. El botnico sueco Carlos Linneo (1707-1778) (fig. 5.1) desarroll un mtodo de clasificacin que an se utiliza en la actualidad. Este naturalista seleccion rasgos fsicos como tamao y forma, que permitan una clasificacin con base en las
185

GUA METODOLGICA DE BIOLOGA

relaciones estrechas de los organismos; por ejemplo l clasific a las plantas con flores, considerando el nmero de similitudes y el tipo de estructura de sus sistemas reproductores. A Linneo se deben las agrupaciones de los organismos por sus semejanzas en categoras taxonmicas; por ejemplo, todas las especies con caracteres semejantes las agrup en la categora superior llamada gnero y todos los gneros similares en familia, y as sucesivamente. Linneo tambin estableci la nomenclatura binomial para designar a las especies, regla que hasta la actualidad es universalmente aceptada. En este sistema el nombre cientfico de los organismos est escrito en latn, la primera palabra identifica el gnero en el que se clasifica el organismo, la segunda representa a la especie y por lo general es un nombre que describe al organismo; por ejemplo: El perro domstico lleva por nombre Canis familiaris; donde Canis refiere a que el organismo pertenece al grupo de los carnvoros y familiaris indica que es un animal domesticado que sirve de compaa a la familia.

NIVELES TAXONMICOS. La unidad de clasificacin de los seres vivos es la especie, que puede definirse como el conjunto de individuos similares estructural y funcionalmente, que slo pueden cruzarse entre s y tienen un antecesor comn. Las categoras taxonmicas forman un orden jerrquico o posicin taxonmica, es decir, una serie de niveles en los que la categora mayor abarca a todas las dems. Hay ocho categoras principales: especie, gnero, familia, orden, clase, divisin o Filo, reino y dominio (Tabla 5.1). Cada categora, desde especie hasta dominio, es cada vez ms general e incluye organismos cuyo antepasado comn era cada vez ms remoto en su relacin evolutiva. Actualmente existe la tendencia de integrar una categora nueva: el dominio, que se ubicara por encima del reino. El nombre cientfico de un organismo se forma de hecho de las dos categoras ms pequeas: el gnero y la especie.

REGLAS DE LA NOMENCLATURA BINOMIAL. Los primeros nombres que tuvieron las plantas y animales eran nombres vernculos o nombres comunes, pero estos tienen los siguientes inconvenientes: No son universales, slo son aplicables a una lengua, a menudo dos o ms organismos no
186

GUA METODOLGICA DE BIOLOGA

relacionados tienen el mismo nombre comn. El gorrin es un ejemplo de la confusin originada cuando se usan nombres comunes siendo su nombre cientfico en todos los pases Paisser domesticus (Tabla 5.2).

Avena Dominio Reino Eukaria Plantae

Roble blanco Eukaria Plantae Anthophyta Dicotyledoneae Fagales Fagaceae Quercus Quercus alba

Elefante Eukaria Animalia Chordata Mammalia Proboscidea Elephantidae Elephas Elephas maximus

guila calva
Eukaria

Mosca de la fruta
Eukaria

Animalia Chordata Aves Falconiformes Falconidae Haliacetus Haliacetus leucocephalus

Animalia Arthropoda Insecta Diptera Drosophilidae Drosophila Drosophila melanogaster

Divisin o Magnoliophyta Filo Clase Orden Familia Gnero Especie Liliopsida Poales Poaceae Avena Avena sativa

Tabla 5.1 Posicin taxonmica de algunas especies de plantas y animales

pas Estados Unidos Alemania Holanda Dinamarca Suecia Portugal Francia Espaa Italia Noruega

nombre comn Sparrow english Haussperling Musch Grasspurv Hussparv Pardal Moineau domestique Gorrin Passera oltramontana Grasspurv

Fig. 6. 1. Carlos Linneo

Tabla 5.2. Nombres vulgares del gorrin

187

GUA METODOLGICA DE BIOLOGA

El nombre cientfico de una especie es una combinacin de dos palabras en latn: El nombre genrico. Es un sustantivo en singular o una palabra tratada como tal (nombre uninominal). Puede ser el nombre de una persona latinizado en conmemoracin. El nombre especfico. Por lo general es: un adjetivo, por ejemplo, Quercus rotundifolia, hojas redondeadas; un sustantivo en aposicin (o yuxtaposicin) con el gnero, por ejemplo, Pyrus malus L., malus = manzana en latn; un nombre en conmemoracin a una persona, por ejemplo, Centurea boissieri, proviene de Boissier. Las normas bsicas para la escritura de los nombres cientficos son: Se usa el latn o palabras latinizadas. La primera letra del gnero va en mayscula; el resto del nombre va en minscula. Cuando se imprime, el nombre cientfico se escribe con letra cursiva (o itlica). Cuando se escribe a mano o a mquina, se subraya. Al final del nombre cientfico se acompaa el apellido abreviado del autor que lo describi. Lam es abreviacin de Lamarck y L de Linneo. As, por ejemplo, el encino es Quercus rotundifolia Lam, el pino pionero es Pinus pinea L.

ACTIVIDAD Investiga dos ejemplos donde el uso de nombres comunes conlleve a confusin. Argumenta qu se tendra que hacer e ilstralo con imgenes de las especies involucradas.

188

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Investiga la posicin taxonmica de tres especies e ilstralas con una imagen. No se te olvide utilizar las reglas de nomenclatura cientfica Dominio: Reino: Phylum: Clase: Orden: Familia: Gnero: Especie: Nombre comn: ___________________________________________________________________________________ Dominio: Reino: Phylum: Clase: Orden: Familia: Gnero: Especie: Nombre comn:
189

GUA METODOLGICA DE BIOLOGA

Dominio: Reino: Phylum: Clase: Orden: Familia: Gnero: Especie: Nombre comn:

Cul de las tres especies investigadas est menos estrechamente relacionadas con las otras dos? Por qu?
__________________________________________________________________________________________ __________________________________________________________________________________________ ________________________________________________________________________________________

ACTIVIDAD Consulta la pgina electrnica: http://www.biodiversidad.gob.mx/pdf/NOM-059-ECOL-2001.pdf, Busca y enlista 15 especies con su nombre comn y cientfico. No olvides respetar las reglas de nomenclatura binomial.
1. ________________________ 2. ________________________

190

GUA METODOLGICA DE BIOLOGA

3. ________________________ 4. ________________________ 5. ________________________ 6. ________________________ 7. ________________________ 8. ________________________ 9. ________________________ 10. ________________________ 11. ________________________ 12. ________________________ 13.________________________ 14.________________________ 15.________________________

5.2 LOS VIRUS, VIVO O NO VIVO?


Los virus son parsitos intracelulares que no poseen metabolismo ni organizacin celular por lo que se les sita en el lmite entre lo vivo y lo inerte. Son tan pequeos (entre 20 y 300 milimicras: m) que slo se pueden ver a travs de un microscopio electrnico. Algunos tienen formas gemetricas regulares (icosaedro, helicoidal, etc.) algunos parecen bastones, cristales, filamentos, esferas y otros poseen una cabeza redonda, provista de una pequea cola (Fig. 5.2).

191

GUA METODOLGICA DE BIOLOGA

Un virus es bsicamente un agregado de material gentico ya sea ADN o ARN dentro de una cubierta proteica llamada cpside, la cual, a su vez, est conformada de fragmentos denominados capsmeros. Algunos tienen una capa lipoproteica denominada envoltura viral (Fig. 5.3).

Fig. 5.2 Comparativo de tamao y forma de varios grupos de virus

Los virus no se consideran dentro de los seis reinos de la vida, ya que carecen de muchas caractersticas propias de los seres vivientes. Los virus tienen diferentes
192

GUA METODOLGICA DE BIOLOGA

clulas hospederas ya que infectan a los animales incluido el hombre; a las plantas y los bacterifagos que afectan a las bacterias. Cada tipo es independiente del resto, es decir, que los virus de plantas no pueden infectar animales ni bacterias y viceversa. Los virus son especficos de un cierto tipo celular siendo muy selectivos con sus hospederos y con las vas de entrada para infectarlos. Los mtodos de entrada son muy especializados, y es una de las formas en las que los virus detectan a sus vctimas.

ACTIVIDAD Realiza una investigacin documental sobre los virus y destaca su importancia econmica, cientfica y mdica a travs de un mapa conceptual.

193

GUA METODOLGICA DE BIOLOGA

Fig. 5.3. Estructura del bacterifago T4 y del virus VIH

ACTIVIDAD Consulta algunas referencias electrnicas y de tu biblioteca, contesta las siguientes preguntas: Qu es un Prin? __________________________________________________________________________________________ ____________________________________________________________________ Qu es un Viroide? __________________________________________________________________________________________ _____________________________________________________________________ Menciona algunas vacunas que previenen contra enfermedades de tipo viral. __________________________________________________________________________________________ ________________________________________________________________________________________

194

GUA METODOLGICA DE BIOLOGA

Comenta brevemente sobre el virus del papiloma humano y cules son sus consecuencias. __________________________________________________________________________________________ __________________________________________________________________________________________ __________________________________________________________________________________________ __________________________________________________________________________________________

REPLICACIN DE LOS VIRUS. Los virus tienen un solo propsito: reproducirse. Para llevarlo a cabo, tienen que apoderarse de la materia, la energa y la maquinaria de la clula hospedera adecuada introduciendo su material gentico en la misma, fusionando la cubierta viral con la pared o la membrana de la clula y liberando sus genes dentro de ella. Si es un virus ADN, su material gentico se inserta en el ADN de la clula hospedera. Si es un virus ARN (retrovirus), debe primero cambiar su ARN en ADN, poder insertarse. Despus, los genes virales se copian muchsimas veces, los virus emplean las enzimas del hospedero para producir cpsides y otras protenas virales. Los nuevos genes virales y las protenas se ensamblan en partculas virales. Los nuevos virus se liberan de la clula hospedera sin destruirla o, eventualmente, el nmero de virus es tan grande que rompen la pared celular del hospedero para salir e infectar a otras clulas.

5.3 CUAL ES EL SISTEMA ACTUAL DE CLASIFICACIN DE LOS SERES VIVOS?


PROPUESTA DE 3 DOMINIOS 6 REINOS. Desde Aristteles hasta Linneo, los bilogos dividan el mundo de los seres vivos en dos reinos: vegetal (Plantae), individuos inmviles, auttrofos y fotosintticos, y animal (Animalia), organismos mviles y hetertrofos. En 1866, el alemn Ernst Haeckel sugiri la conveniencia de constituir un tercer reino: el Protista, que comprendiera a los organismos unicelulares (bacterias, algas, hongos y protozoarios). En 1937, Chatton estableci un cuarto reino, el Monera, para abarcar a todos los organismos procariontes (bacterias y cianofitas), diferencindolos de los eucariontes (plantas, animales y protistas). En 1969, el bilogo R. H. Whittaker, establece un
195

GUA METODOLGICA DE BIOLOGA

esquema de clasificacin que rene los organismos en cinco reinos. l distingui el reino Fungi (hongos y levaduras) como un reino separado de las otras formas de origen vegetal. Los hongos carecen de pigmentos fotosintticos pero tienen ncleos y paredes celulares. En 1990, Carl Woese comprob que por la secuenciacin del ARNr, los procariontes se dividan en dos grupos: eubacterias y arqueobacterias. Propuso un nuevo taxn superior al reino que llam dominio. Todos los seres vivos se agruparan en 3 dominios: Archaea (arqueobacterias), Bacteria (eubacterias) y Eukarya (protistas, hongos, animales y plantas) (fig. 5.4)
ACTIVIDAD Investiga e indica en la figura de abajo, el nombre de cada paso del proceso de replicacin de un bacterifago:

1. _____________

2. ________________ 6. ______________

3. _____________ 5. ______________

4. _________________

196

GUA METODOLGICA DE BIOLOGA

Fig. 5.4. rbol evolutivo de los seis reinos de seres vivos

DOMINIO ARCHAEA
REINO ARQUEOBACTERIA Las arqueobacterias (del gr., arkhaios = antiguo; bakterion = bastn) se encuentran actualmente restringidas a hbitats marginales por lo que son extremfilas, o sea que viven en condiciones extremas, aunque no todas lo son. Presentan formas unicelulares procariontes. Sus paredes celulares carecen del peptidoglucano presente en todas las eubacterias. Las arqueas se nutren de varias sustancias para obtener energa, incluido hidrgeno, dixido de carbono y azufre. Algunos tipos importantes de arqueas son: Metangenas. Habitan en cinegas y pantanos, plantas de tratamiento de aguas negras, manantiales calientes, respiraderos de las profundidades marinas y en los estmagos de rumiantes. Halfilas. Viven en regiones con altas concentraciones de sal como el Mar Muerto (con siete veces la concentracin del agua de mar). Termoacidfilas. Se desarrollan en manantiales azufrosos y respiraderos volcnicos en condiciones de alta temperatura y pH bajo. Sicrfilas. Viven a temperaturas muy bajas. Se han encontrado en lagos congelados en la Antrtida (hasta -7C).
197

GUA METODOLGICA DE BIOLOGA

DOMINIO BACTERIA
REINO EUBACTERIA Organismos procariontes, tienen pared celular compuesta de peptidoglicano y no poseen organelos membranosos ni formas multicelulares. Se clasifican en dos divisiones: Cyanobacteria o Cyanophyta (auttrofas) y Schizophyta o Eubacteria (hetertrofas). Las cianobacterias o cianofitas (algas azul-verdes) de hbitat acutico. Contienen clorofila adems de otros pigmentos como xantofila, caroteno y ficocianina, esta ltima les proporciona el color azul. Los pigmentos no estn contenidos en cloroplastos como en las clulas eucariticas sino que forman parte de un sistema de membranas localizadas hacia el borde de la clula (fig. 5.5) Las cianobacterias se reproducen por fisin binaria o por fragmentacin. Entre los gneros ms representativos de estas algas estn: Oscillatoria, Anabaena, Nostoc, Spirulina y Lyngbya.

Fig. 5.5. Morfologa de una cianobacteria

Las eubacterias son organismos unicelulares aparentemente simples. No poseen ncleo verdadero sino un cromosoma circular. El citoplasma tiene un aspecto granular fino debido a la presencia de una gran cantidad de ribosomas y algunas bacterias tienen ADN menores extracromosmicos autnomos llamados plsmidos. La membrana celular es una bicapa lipdica como la de eucariontes rodeada por una
198

GUA METODOLGICA DE BIOLOGA

pared celular de pptidoglicano. Algunas bacterias infecciosas tienen una capa viscosa que rodea a la pared celular llamada cpsula, que la protege del ataque de linfocitos del sistema inmune del hospedero, y, adems, les sirve para deslizarse (fig 5.6). Existen cientos de especies de bacterias, pero todas ellas tienen una de las cuatro formas existentes: cocos, bacilos, vibrios y espirilos (fig. 5.7). Pueden presentar nutricin auttrofa (fotosinttica y quimiosinttica) o hetertrofa (saprofita y parasitaria). De acuerdo a su respiracin, las bacterias pueden ser: aerobias y anaerobias (facultativas, obligadas y estrictas).

Fig. 5.6. Morfologa de una eubacteria

Fig. 5.7. Formas de las bacterias

La mayora de las bacterias se reproducen asexualmente por fisin binaria. Muchas bacterias, en especial los bacilos, se reproducen por esporulacin que consiste en formar endosporas cuando las condiciones no son favorables permaneciendo latentes por mucho tiempo. Una forma de reproduccin sexual es la conjugacin en la que se transfieren plsmidos a travs de un pelo sexual (pilli), hueco, especial y largo resultando en nuevas combinaciones genticas.

199

GUA METODOLGICA DE BIOLOGA

Importancia evolutiva. Hace unos 2 mil millones de aos, las cianobacterias ayudaron a formar y cambiar el medio ambiente inicial de la Tierra, creando el oxgeno atmosfrico lo que permiti el desarrollo de formas de vida ms complejas.

DOMINIO EUKARYA A este dominio pertenecen los reinos protista, fungi, plantae y animalia cuya principal caracterstica es estar constituidos por clulas eucariontes.

REINO PROTISTA Los protistas se dividen en tres grandes grupos: las algas protistas (euglenofitas, crisofitas y pirrofitas), protistas fungales (mixomicetos, acrasiomicetos y oomicetos) y protozoarios (sarcodinos, mastigforos, ciliforos y esporozoarios) (fig. 6.9). Incluye una variedad de tipos de eucariontes (unicelulares, coloniales, multicelulares) y variedades nutricionales (hetertrofos, auttrofos o una combinacin de ambos). Tienen un ncleo formado por varios cromosomas y limitado por una envoltura nuclear. Poseen organelos como mitocondrias, cloroplastos y corpsculos basales (fig. 5.9). Casi todos los protistas se reproducen asexualmente por fisin binaria, pero algunos lo pueden hacer sexualmente por medio de la conjugacin.

Fig. 5.9. Morfologa de la Euglena Fig. 5.8. Ejemplos de protozoarios

200

GUA METODOLGICA DE BIOLOGA

REINO FUNGI Un hongo es un organismo constituido por clulas eucariontes con paredes celulares de quitina. Vara en tamao, desde unicelular (levadura) hasta pluricelulares (grandes setas). El reino Fungi se clasifica en cuatro divisiones: zigomicetos, ascomicetos, basidiomicetos (fig. 5.10) y deuteromicetos (fig. 5.11).

Fig. 5.10. Morfologa de Agaricus (basidiomiceto)

Fig. 5.11. Ejemplos de deuteromicetos

Los hongos son hetertrofos, secretan enzimas digestivas a su alrededor que degradan la materia orgnica que despus absorben. Los hongos necesitan humedad, poca luz. La mayora son saprofitos, consumen los restos y los desperdicios de otros organismos y otros son parsitos. La mayora de los hongos estn constituidos de filamentos ramificados, o tubos, llamados hifas. stas crecen y se ramifican formando redes complejas llamadas micelios. La reproduccin asexual puede ocurrir por fragmentacin de las hifas, tambin pueden producir esporas sexuales y asexuales. Las estructuras reproductoras son caractersticas que se usan para clasificar los hongos.
201

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Con apoyo de la bibliografa recomendada, investiga cmo se conforma un liquen (dibuja un esquema) y que tipo de asociacin ecolgica representa. Tambin esquematiza el ciclo de vida de un champin.

202

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD

Realiza una investigacin documental acerca de la importancia de los organismos pertenecientes


REINO IMPORTANCIA ECONMICA IMPORTANCIA ECOLGICA IMPORTANCIA MDICA

Eubacteria

Protista

Fungi

Comentario final
___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 203

GUA METODOLGICA DE BIOLOGA

REINO PLANTAE Las plantas son organismos eucariontes que van desde unicelulares hasta rboles enormes. Sus clulas poseen pared celular compuesta de celulosa. Obtienen sus nutrientes por medio de la fotosntesis y absorcin. El reino Plantae incluye a las plantas no vasculares y a las plantas vasculares o traqueofitas.

PLANTAS NO VASCULARES Estas plantas no poseen tejido vascular y son las ms sencillas y antiguas. No tienen races, tallos, ni hojas verdaderas. La mayora son acuticas. Incluyen a las algas eucariontes (rodfitas, feofitas, clorfitas) y briofitas

DIVISIN FEOFITAS (ALGAS PARDAS) Es un grupo de especies bentnicas marinas de las costas rocosas fras. Tambin se encuentran en aguas tropicales, como las grandes masas de algas flotantes del gnero Sargassum. Contienen, adems de clorofila a y c, fcoxantina, que da el color pardo u olivo. Tienen aspecto filamentoso y ramificado, algunas desarrollan rizoides para adherirse al sustrato. Las feofitas ms abundantes son los Macrocystis, generalmente llamados kelps. Su crecimiento es grande y rpido. Pueden crecer de 30 a 65 cm en un da. En 6 meses alcanza su largo mximo de entre 50 y 100 m. (fig. 5.13).

DIVISIN RODOFITAS (ALGAS ROJAS) Son mayormente marinas tropicales. Pueden llevar a cabo la fotosntesis a grandes profundidades (hasta a 175 m) debido a la ficoeritrina y a otros pigmentos que son azules (fcobilinas). La mayora son multicelulares, filamentosas o membranosas. La pared celular est formada de celulosa, u otro polisacrido, embebidos en una matriz de galactosa. Algunas depositan carbonato de calcio en la superficie de sus clulas que les dan consistencia dura y quebradiza (conocidas como algas coralinas) (fig. 5.12).

204

GUA METODOLGICA DE BIOLOGA

La mayora de las algas rojas producen vulos y espermatozoides en estructuras especializadas de sus ramas. Ninguno de ellos se mueve, pero las corrientes de agua llevan los espermatozoides hasta los vulos.

Fig. 5.12. Ejemplos de rodfitas Fig. 5.11. Ejemplos de feofitas

DIVISIN CLOROFITAS (ALGAS VERDES) Grupo diverso que coloniza todo tipo de hbitats: agua dulce y salada, nieve, tierra y en los rboles. Desarrollan estructuras corporales que van desde unicelulares hasta formas masivas, de varios metros de tamao. Los pigmentos (clorofilas a y b) y las sustancias qumicas en las paredes celulares de las algas verdes son muy parecidos a los de las plantas vasculares. Generalmente, almacenan su alimento como almidn.

ACTIVIDAD Realiza una investigacin documental a cerca de las diferencias qumicas entre los distintos grupos de algas y completa el siguiente cuadro de doble entrada. Una vez concluido el cuadro realiza una reflexin del porqu si todas son algas no se encuentran en el mismo reino? Argumenta tu respuesta. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________

205

GUA METODOLGICA DE BIOLOGA

___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________


TIPO DE ALGA PHYLUM/REINO TIPO DE CLOROFILA OTROS PIGMENTOS RESERVAS PARED CELULAR

AZUL VERDE

Cianofita Reino Eubacteria

VERDE

Carotenos (rojo) Xantofilas (amarillo)

Slice
CAF

Pirrfita Reino Protista

Almidn Grasas

ROJA

ayd

Celulosa

DIVISIN BRIOFITAS (MUSGOS Y HEPTICAS) Las briofitas son las nicas plantas terrestres no vasculares. Este grupo incluye las hepticas y los musgos. Todas son plantas pequeas con pocos centmetros de largo.
206

GUA METODOLGICA DE BIOLOGA

Viven en ambientes hmedos, casi todas viven agrupadas lo que les permite retener humedad. No tienen races, tallos, ni hojas verdaderas. Las estructuras parecidas a races llamadas rizoides anclan a la planta a la tierra. Las briofitas favorecen la fertilidad de los suelos, donde pueden crecer otras especies de plantas.

ACTIVIDAD Busca en un libro de biologa de tu biblioteca, esquematiza la estructura y el ciclo de vida de un musgo.

207

GUA METODOLGICA DE BIOLOGA

DIVISIN TRAQUEOFITAS: PLANTAS VASCULARES Grupos de plantas ms complejos; el agua y los minerales van desde la tierra a todas las partes de la planta a travs de un tejido conductor especializado: el xilema. Los alimentos y otras sustancias elaboradas se transportan por el floema. Ambos tejidos estn formados por clulas rgidas, que como resultado, tambin sirven de sostn estructural a la planta. Tienen hojas duras cubiertas por materiales cerosos como la cutina y adaptadas para retener agua. La mayor parte de las plantas vasculares estn adaptadas a una vida terrestre. Este grupo se divide en dos grandes categoras: plantas sin semilla que incluyen a las pteridofitas (helechos) y por el otro las plantas con semilla que comprenden a las coniferofitas (conferas) y a las antofitas (plantas con flores).

PLANTAS SIN SEMILLA (CRIPTGAMAS) DIVISIN PTERIDOFITAS (HELECHOS) Los helechos crecen en tierras hmedas, en bosques, en campos abiertos, en rboles y en riscos. La mayora crece en bosques pluviales tropicales, donde algunas especies de helechos arborescentes alcanzan hasta 25 m de alto. Presentan un tallo ms o menos desarrollado pero generalmente reducido a un rizoma subterrneo, y unas hojas o frondas de diferentes tamaos con venas ramificadas llamadas pnnulas. En el envs de las frondas se disponen los esporangios agrupados en soros. En el interior de los esporangios estn las esporas que son liberadas al exterior para su germinacin.

PLANTAS CON SEMILLA (FANERGAMAS) Estas plantas se reproducen al formar semillas y son las ms abundantes con ms de 200,000 especies. Se encuentran en la mayora de los ambientes terrestres y en muchos ambientes acuticos. Una semilla es una estructura que se compone de un embrin vegetal, de alimento para el embrin y de una cubierta externa. La mayora de las plantas de semilla estn adaptadas para la vida en tierra. El alimento almacenado en las semillas le suple la energa para las etapas tempranas de crecimiento. Se dividen en dos grupos: coniferofitas (gimnospermas) y antofitas (angiospermas).
208

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Materiales por equipo: libro de biologa, un helecho en maceta, lupa, hojas recicladas. Investiga sobre las plantas pteridofitas, con apoyo de tu profesor identifica y realiza un dibujo indicando las siguientes partes del helecho: fronda, pinnula, fronda en crecimiento, soros, esporangios, rizomas.

209

GUA METODOLGICA DE BIOLOGA

GIMNOSPERMAS (PLANTAS SIN FLORES) Las gimnospermas tienen semillas desnudas, las cuales no estn rodeadas de un fruto. En este grupo se encuentran las cicadofitas (ccadas), ginkgofitas (ginkgos) y principalmente las coniferofitas (conferas).

DIVISIN CONIFEROFITAS (CONFERAS) Las conferas viven en latitudes fras y a grandes alturas, adaptadas a condiciones secas y fras: son perennifolias (hojas verdes todo el ao), lo cual les permite seguir realizando la fotosntesis y crecer lentamente en pocas difciles; hojas aciculadas (forma de aguja) y escamosas cubiertas de una cutcula gruesa que impide la evaporacin. Producen una resina en su savia que es "anticongelante", lo que les permite seguir transportando nutrientes a temperaturas por debajo del punto de congelacin. Las conferas son plantas que producen conos: la estructura que contienen las semillas de la planta. Crecen como rboles o arbustos, en grupos grandes y densos que forman extensos bosques. Entre las conferas ms conocidas se encuentran los gneros: Pinus (pinos), Abies (oyamel), Taxodium (ahuehuete), Cupressus (cedro), y Juniperus (tscate)

DIVISIN ANGIOSPERMAS (PLANTAS CON FLORES) Son ms diversas que las gimnospermas. Existen 215,000 especies aproximadamente. La flor, que es una caracterstica de este grupo, aumenta las posibilidades de la planta de tener una reproduccin exitosa. Una parte de la flor es el ovario que contiene los vulos. Despus de ser fecundado, el vulo se transforma en semilla y el ovario que lo rodea madura hasta convertirse en una estructura llamada fruto. Las angiospermas incluyen diversas formas biolgicas. Se encuentra en gran diversidad de hbitats. Se dividen en dos clases: monocotiledneas y dicotiledneas.

210

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Consulta pginas de internet y esquematiza el ciclo de vida del pino, y menciona la importancia econmica de las conferas.

211

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD. Materiales en equipo: semillas diversas, 10 plantas con flor, lupa, papel bond. Con el siguiente esquema, observa tus plantas e identifica sus estructuras, dibjalas en el papel bond y seala a que clase pertenece. Haz lo mismo con las semillas. Expongan en plenaria de grupo

212

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD

Elabora un cuadro sinptico de la clasificacin del reino Plantae donde incluyas a todas la divisiones o phyla

. ACTIVIDAD Trabaja en pareja. En un papel bond, realiza un mapa mental, con imgenes, recortes o dibujos, indicando la importancia econmica, mdica, e industrial de las plantas angiospermas, puedes citar ejemplos que utilices en tu vida cotidiana, apyate de libros de biologa y utilizando las TIC. Comparen los mapas de todo el grupo

213

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD. Material en equipos: cinco flores diferentes, lupa, hojas recicladas. Observa e identifica las estructuras de las flores que llevaste a clase, dibuja y seala cada parte, guindote del siguiente esquema.

214

GUA METODOLGICA DE BIOLOGA

REINO ANIMALIA Los animales son organismos eucariontes, pluricelulares y hetertrofos. Sus clulas carecen de pared celular y se organizan en tejidos. Obtienen sus nutrientes principalmente mediante la ingestin. Son mviles en muchos estadios de su vida. Presentan funciones desarrolladas de coordinacin y movimiento, debido a que la mayora posee un sistema nervioso. Existen unos 30 phyla de animales pero slo 9 son importantes por el nmero de especies que los integran: porferos, cnidarios, platelmintos, nematodos, anlidos, moluscos, artrpodos, equinodermos y cordados.

CARACTERSTICAS TAXONMICAS DE LOS ANIMALES

La diversidad de este reino es enorme, y su clasificacin se basa en las siguientes caractersticas que comparten: Nmero de capas germinales. Durante el desarrollo embrionario el embrin adquiere capas celulares a partir de las cuales se originan todos los tejidos, rganos y sistemas. El ectodermo es la capa externa que da origen a epidermis y sus derivados, sistema nervioso, recubrimiento de la boca y nariz. El mesodermo es la capa intermedia que origina la pared interna del tubo digestivo, uretra, conductos respiratorios y pulmones, hgado, pncreas, y vejiga urinaria. El endodermo es la capa interna que da origen al esqueleto, msculos, dermis, tejidos conectivos, sangre, vasos sanguneos, mesenterio, pared de la cavidad celmica, sistema excretor y reproductor (fig. 5.13). Simetra. Simetra es la posibilidad de dividir al individuo en partes iguales a partir de un eje que pase por su centro. Un organismo es asimtrico cuando no se pueden obtener partes iguales debido a que su forma es completamente irregular. Entre ellos tenemos a la amiba, algunas esponjas, etc. (Fig. 5.14). La simetra radial es aquella en la que el organismo puede ser dividido por cualquier plano que pase a partir de la boca a lo largo del cuerpo en partes iguales. Por ejemplo las medusas y las estrellas de mar. La simetra bilateral es aquella en la cual un solo plano pasa a lo largo del animal dividindolo en dos partes, izquierda y derecha, a manera de imgenes especulares. Por ejemplo la mosca y el hombre.

215

GUA METODOLGICA DE BIOLOGA

Fig. 5.13. Capas embrionarias y presencia de celoma

Celoma. El celoma es la cavidad general del cuerpo, delimitado por mesodermo, y que contiene las vsceras. Los animales se clasifican en acelomados si su cuerpo es slido sin otra cavidad que la del tubo digestivo, como es el caso de las esponjas y los gusanos planos. Los organismos pseudocelomados (falso celoma) s tienen rganos internos dentro de un espacio corporal no delimitado pero ste no es de origen mesodrmico, como en el caso de la lombriz intestinal. Los animales eucelomados presentan rganos internos en una cavidad corporal limitada por peritoneo (mesodermo) como es el caso de la lombriz de tierra y el ser humano (Fig. 5.13). Metamerismo. El metamerismo es una repeticin seriada de segmentos semejantes a lo largo del eje longitudinal del cuerpo, cada segmento se llama metmero y est representado por un nmero de estructuras variable dependiendo del grupo animal del que se trate. Los animales metamricos son: anlidos, artrpodos y cordados (fig. 5.15). Cefalizacin. La cefalizacin es la diferenciacin de un extremo ceflico o cabeza (centro del sistema nervioso y los rganos de los sentidos) y uno posterior o caudal. (fig. 5.16) Esqueleto. El esqueleto est conformado por las estructuras que dan sostn al cuerpo. Puede ser externo o exoesqueleto como en el calamar o erizo de mar o puede ser interno o endoesqueleto como en el humano (fig. 5.17). Cordn Nervioso Central. Son importantes para la clasificacin, su desarrollo y posicin en relacin al tubo digestivo (dorsal, como en los cordados, o ventral, como en los artrpodos). Algunos animales, en su lugar, presentan una red nerviosa, como en los cnidarios.
216

GUA METODOLGICA DE BIOLOGA

Caractersticas nicas. Son las caractersticas nicas exclusivas de un phylum que no comparte con ningn otro y le otorga singularidad.

Fig. 5.14. Tipos de simetra

Fig. 5.15. Ejemplos de metamerismo

Fig. 5.16. Cefalizacin

Fig. 5.17. Esqueleto

PHYLUM PORIFEROS (ESPONJAS) Las esponjas viven adheridas a rocas o en el fondo marino. Varan en tamao desde 1 cm hasta ms de 2m de dimetro. Presentan una gran variedad de formas: redonda, oblonga, de vaso, otras forman crecimientos costrosos, aplastados adheridos a rocas. Su color vara, no tienen poder de locomocin, no reaccionan a los estmulos y no tienen un medio aparente para capturar alimento. Sus cuerpos estn llenos de poros que utilizan para la circulacin del agua. Presentan una abertura principal (sculo) que utilizan para la excrecin. Tienen una cavidad interna llamada espongiocele (fig. 5.18). Sus esqueletos estn formados por espculas (de calcio o slice) o de fibras proteicas de espongina. Son diblsticos, pero el ectodermo es interno y el endodermo es externo. Su alimento consiste en organismos microscpicos, desechos orgnicos y detritos (desechos orgnicos muy finos).
217

GUA METODOLGICA DE BIOLOGA

Su reproduccin es asexual y consiste en la gemacin en la cual la esponja origina yemas sobre alguna parte de su cuerpo que eventualmente forman adultos maduros. Tambin presentan reproduccin sexual.

PHYLUM CNIDARIOS O CELENTERADOS La mayora son marinos y su distribucin es cosmopolita. Son los ms simples de todos los metazoarios. Poseen simetra radial. Tienen los cinco tejidos bsicos: epitelial, muscular, nervioso, conectivo y reproductor. Son diblsticos, poseen una capa no germinal de material gelatinoso entre el endodermo y el ectodermo de nominada mesoglea. Poseen nematocistos (estructuras urticantes,) que les sirven de ataque y defensa. Poseen una red nerviosa a travs de su cuerpo que los hace sensibles a los estmulos. Presentan una cavidad con funciones digestivas conocida como celentern con una boca por la cual ingresan los alimentos y se excretan los desechos y materiales digeribles (Fig. 5.19). Clasificacin. Los celenterados se clasifican en tres grupos distintos: hidrozoarios (hidras, Obelia y Physalia), escifozoarios (medusas) y antozoarios (anmonas y corales).

Fig. 5.19. Tipos biolgicos de cnidarios

Fig. 5.18. Anatoma de una esponja

218

GUA METODOLGICA DE BIOLOGA

PHYLUM PLATELMINTOS (GUSANOS PLANOS) Todos son tribsticos, acelomados y con simetra bilateral. Existen parsitos y los hay de vida libre. Todas las formas tienen sistema nervioso, excretor y reproductor, sin embargo, no tienen sistema digestivo. Se dividen en tres clases turbelarios (planarias y nudibranquios), trematodos (fasciola) y cestodos (solitaria, equinococo) (Fig. 5.20).

PHYLUM NEMATODOS (GUSANOS REDONDOS) Son vermes cilndricos y delgados con los extremos puntiagudos. Presentan sexos separados y dimorfismo sexual. Carecen de aparato respiratorio y circulatorio, aparato excretor poco desarrollado; el sistema nervioso consta de un anillo periesofgico de que parten nervios longitudinales en direccin anterior y posterior. Tienen boca y ano. Los hay parsitos y de vida libre, estos ltimos, son comunes en la tierra, en el fango y en los organismos descompuestos (Fig. 5.21).

Fig. 5.20. Ejemplos de platelmintos

Fig. 5.21. Anatoma de un nematodo

219

GUA METODOLGICA DE BIOLOGA

PHYLUM ANLIDOS (GUSANOS ANILLADOS) El cuerpo de los anlidos se compone de secciones llamadas segmentos. Viven en el suelo, en riachuelos de agua dulce, en charcas y en los ocanos. El plano corporal es un tubo dentro de un tubo, siendo el tubo interno el tracto digestivo. El tracto digestivo es completo y tiene dos aberturas: la boca y el ano. Tienen un sistema circulatorio cerrado donde la sangre siempre est dentro de los vasos. Tienen un par de nefridios para la excrecin en cada segmento del cuerpo. Poseen pequeas cerdas o quetas que utilizan para la locomocin. Han desarrollado el primer celoma (cavidad interna) verdadero. Poseen simetra bilateral. Los anlidos se dividen en tres clases: poliquetos (gusanos marinos), oligoquetos (lombriz de tierra) e hirudneos (sanguijuelas) (Fig. 5.22). PHYLUM MOLUSCOS Es un grupo de invertebrados de cuerpo blando que poseen un manto que, a menudo, secreta una concha dura de calcio. Presentan un pie ventral musculoso que utilizan para moverse. El tracto digestivo est completo. Dentro de la boca de muchos moluscos hay una estructura llamada rdula, que se usa para raspar el alimento. Los moluscos son un grupo numeroso de organismos que se encuentran en hbitats que van desde los mares hasta los desiertos. Se clasifican en cinco clases distintas: anfineuros (quitn), escafpodos (colmillo de elefante), pelecpodos o bivalvos (almeja, ostra, ostin), gasterpodos (caracol de jardn) y cefalpodos (pulpo, calamar y nautilo) (fig. 5.23).

PHYLUM ARTROPODOS. Los artrpodos incluyen alrededor de 1 milln de especies que ocupan prcticamente todo tipo de hbitat, desde el fondo de los mares hasta las cumbres ms altas de las montaas. Poseen un exoesqueleto segmentado formado de quitina. El cuerpo est dividido en tres partes: cabeza, trax y abdomen. Presentan apndices articulados pares para la locomocin o natacin, que pueden sufrir modificaciones para convertirse en rganos masticadores o copuladores.

220

GUA METODOLGICA DE BIOLOGA

Han desarrollado el ms alto grado de cefalizacin de todos los invertebrados, a excepcin de los cefalpodos. El cordn nervioso es ventral al tubo digestivo. Presentan ojos compuestos con una visin tipo mosaico. Han dado origen a los nicos invertebrados voladores. Adems, presentan simetra bilateral, son celomados (poseen un celoma reducido), un sistema circulatorio abierto y sexos separados. Clasificacin. Basndose en la especializacin de los segmentos, los artrpodos se dividen en 4 subphyla: quelicerados (araas, escorpiones, garrapatas), crustceos (cangrejo, cochinilla), unirramios, (milpis) y Hexpodos (insectos).

Fig. 5.22. Ejemplos de anlidos

Figura 5.23. Ejemplos de moluscos

SUBPHYLUM QUELICERADOS El cuerpo se compone de dos partes: cefalotrax y abdomen. Los quelicerados tienen seis pares de apndices en el cefalotrax. El primer par son quelceros, modificados como pinzas o colmillos; el segundo par, los pedipalpos, funcionan como rganos de alimentacin, los cuatros pares restantes son patas ambulatorias. Presentan ojos simples llamados ocelos. La clase arcnida incluye araas, escorpiones, caros y garrapatas. Son principalmente terrestres. Casi todos son carnvoros. (Fig. 5.24)

221

GUA METODOLGICA DE BIOLOGA

Fig. 5.24. Ejemplos de quelicerados

SUBPHYLUM CRUSTCEOS La mayora de los crustceos son marinos, aunque hay algunos dulceacucolas, mientras que otros, como las cochinillas, viven en lugares hmedos de la tierra. El cuerpo de la mayora de los crustceos es segmentado compuesto de dos partes: cefalotrax y abdomen. En la mayora el exoesqueleto se endurece con compuestos de calcio, adems de la quitina. Presentan dos pares de antenas. Las langostas, los camarones, los cangrejos, las pulgas de agua y las cochinillas son ejemplos de crustceos (Fig. 5.25)

SUBPHYLUM UNIRRAMIOS El subphylum Uniramia contiene la mayor cantidad de especies y el mayor nmero de organismos. Reciben este nombre debido a que sus apndices no estn ramificados. Son de hbitat terrestre. Tienen un par de antenas, que son apndices sensoriales, y mandbulas, que son partes bucales para masticar y romper el alimento.
222

GUA METODOLGICA DE BIOLOGA

Fig. 5.25. Ejemplos de crustceos

Los quilpodos presentan un cuerpo alargado formado por mltiples segmentos. Incluye a los ciempis que poseen un par de patas en cada segmento y a los milpis con dos pares de partas por segmento (Fig. 5.26)

SUBPHYLUM HEXAPODOS O INSECTOS Los insectos se encuentran en casi todos los ambientes habitables de la Tierra. Es el grupo ms grande de artrpodos terrestres. Su cuerpo se divide en tres: cabeza, trax y abdomen. La cabeza tiene dos ojos compuestos y ojos simples, incluyen un par de antenas y varios pares de piezas bucales (5.27). Presentan tres pares de patas. En ocasiones tienen uno o dos pares de alas articuladas en el trax, por lo que son los nicos invertebrados que pueden volar. Presentan metamorfosis, proceso por el cual el animal pasa de etapa de larva a adulto (5.28).

223

GUA METODOLGICA DE BIOLOGA

Fig. 5.26. Ejemplos de quilpodos

Fig. 5.27. Anatoma del saltamontes

Fig. 5.28. Metamorfosis incompleta y completa

PHYLUM EQUINODERMOS Son los nicos que poseen un pie ambulacral en forma de tubo que usan para la locomocin, aprensin y para abrir las conchas de moluscos con los que se alimentan. Son los nicos que poseen un exoesqueleto de espinas calcreas y un endoesqueleto de placas drmicas. Tienen branquias drmicas y pedicelarios que las protegen. Poseen un sistema nervioso radial sin cerebro. Presentan ano en posicin dorsal y una boca ventral. Brazos generalmente mltiplos de cinco y poseen glndulas digestivas denominadas ciegos hepticos. Las larvas tienen simetra bilateral y son parecidas a las de los cordados ms primitivos. Tienen la simetra radial ms avanzada. Son triblsticos. Carecen de cabeza y segmentacin (Fig. 5.29). Los equinodermos se clasifican en cinco clases: asteroideos (estrella de mar), ofiuroideos (estrella serpiente), equinoideos (erizo de mar), crinoideos (lirio de mar) y holoturoideos (pepino de mar).

224

GUA METODOLGICA DE BIOLOGA

Fig. 5.29. Anatoma de una estrella de mar

PHYLUM CORDADOS Los cordados evolucionaron a lo largo de unos 500 millones de aos.; presentan una gran variedad de formas, evidencia de su gran capacidad de adaptacin. Presentan un endoesqueleto de tejido vivo en el cul se insertan los msculos y tambin proporciona proteccin a rganos internos vitales. Poseen un sistema nervioso dorsal tubular. Tienen hendiduras branquiales farngeas, o vestigios de ellas. Un corazn situado en la parte ventral y un sistema circulatorio cerrado. Son eucelomados (con celoma verdadero) con simetra bilateral, cefalizacin y metamerismo (segmentacin del cuerpo). Tienen notocorda que es una varilla delgada y flexible que da sostn al cuerpo y un cordn nervioso dorsal que corre a lo largo de la superficie superior del cuerpo Los cordados inferiores estn formados por organismos menos evolucionados, que muestran algunos de los rasgos caractersticos de los cordados, y que son ejemplos de posibles eslabones que vincularan a vertebrados e invertebrados. Estos estn clasificados en tres subphyla: hemicordados (gusano bellota) (Fig. 5.30), urocordados (ascidias) y cefalocordados (anfioxo) (Fig. 5.31). Los cordados superiores constituyen el subphylum vertebrados constituido por animales con espina dorsal.

225

GUA METODOLGICA DE BIOLOGA

SUBPHYLUM VERTEBRADOS Estos animales presentan una columna vertebral. Tienen un endoesqueleto que provee proteccin a los rganos internos. Este subfilo se divide en siete clases: peces sin mandbula, peces cartilaginosos, peces seos, anfibios, reptiles, aves y mamferos.

Fig. 5.31. Ejemplo de cefalocordado, Branchiostoma

CLASE AGNATOS (PECES SIN MANDBULA) No tienen aletas pareadas, ni escamas ni dientes verdaderos. En medio del hocico hay una sola abertura nasal; tienen un corazn de dos cmaras. La reproduccin es sexual. Las hembras liberan sus huevos al agua, donde son fecundados por los espermatozoides.

Fig. 5.30. Ejemplos de hemicordados

CLASE CONDROICTIOS (PECES CARTILAGINOSOS) Los tiburones y las mantas (rayas) constituyen esta clase ya que tienen esqueletos de cartlago y no de hueso. La mayora de los tiburones son largos y delgados y pueden nadar rpidamente. En general, son predadores y se alimentan de peces y otros animales marinos. Las rayas tienen cuerpo aplanado y aletas pectorales anchas en forma de alas. En los tiburones y las rayas, los sexos estn separados y presentan fecundacin interna. Algunas especies son ovparas, otras son ovovivparas.

CLASE OSTEOICTIOS (PECES SEOS) En los peces seos, el esqueleto se compone principalmente de hueso. Respiran por branquias. Casi todos tienen escamas y aletas, aunque las aletas estn modificadas en las diferentes especies. La mayora poseen tambin una vejiga natatoria, que es una estructura llena de gases que ayuda a mantener al pez a flote en el agua.
226

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental y completa el siguiente cuadro de doble entrada. Posteriormente en plenaria se presenta para su retroalimentacin.
CARACTERISTIC AS UNICAS METAMERISMO CEFALIZACION CAPAS GERMINALES ESQUELETO

PHYLUM

Poriferos

Cnidarios

Platelmintos

Nematodos

Anlidos

Moluscos

Artrpodos

Equinodermos

Cordados

227

CORDON NERVIOSO CENTRAL

SIMETRIA

CELOMA

CLASES

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD

Realiza una investigacin documental acerca de la importancia de los organismos del reino Animalia
PHYLUM Poriferos IMPORTANCIA ECONMICA IMPORTANCIA ECOLGICA IMPORTANCIA MDICA

Cnidarios

Platelmintos

Nematodos

Anlidos

Moluscos

Artrpodos

Equinodermos

Cordados

Comentario final
___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 228

GUA METODOLGICA DE BIOLOGA

CLASE ANFIBIOS Los anfibios son vertebrados que tienen branquias cuando son larvas y pulmones cuando son adultos. Los anfibios fueron los primeros vertebrados en adaptarse a la vida terrestre. Despus que salen de los huevos, la mayor parte de los anfibios jvenes son acuticos y respiran por medio de las branquias. Como adultos, los anfibios viven en tierra, al menos parte del tiempo y respiran por pulmones. Los anfibios son poiquilotermos y permanecen inactivos durante el tiempo fro. Este perodo de inactividad se conoce como hibernacin. Los anfibios se dividen en tres ordenes: anuros (ranas y sapos), caudados (salamandras) y apodos (cecilias).

CLASE REPTILES Estos animales son poiquilotermos, cubiertos con una piel seca y escamosa. Estn adaptados para la reproduccin en tierra, pero algunas especies pasan mucho tiempo en el agua. La piel de los reptiles es seca, gruesa e impermeable y protege al cuerpo de la desecacin en climas muy clidos y secos. Poseen rganos reproductores adaptados a la fecundacin interna. Los huevos se fecundan dentro del cuerpo de la hembra. El huevo de los reptiles tiene un cascarn que evita que se seque en la tierra. Los reptiles se clasifican en cuatro ordenes: rincocfalos (tatuara), cocodrilos (lagartos), quelonios (tortugas) y escamosos (lagartos y serpientes).

CLASE AVES Las aves presentan bocas modificadas en picos. Sus cuerpos estn cubiertos con plumas y pueden mantener constante la temperatura de su cuerpo (son homeotermos). Sus patas delanteras se han modificado y se han convertido en alas. Sus patas traseras sirven de sostn al cuerpo. Tienen un corazn de 4 cmaras, pulmones bien desarrollados, huesos finos y huecos. El vuelo es una de las caractersticas ms importantes en las aves. Sus cuerpos estn adaptados para satisfacer los requisitos del vuelo: tener poco peso y mucha potencia.

CLASE MAMFEROS Un mamfero es un vertebrado que tiene pelo, y son homeotermos. El corazn de cuatro cmaras de un mamfero es una doble bomba que mantiene la sangre desoxi229

GUA METODOLGICA DE BIOLOGA

genada separada de la oxigenada. Las glndulas mamarias, que se encuentran en las hembras, secretan leche que sirve como alimento para las cras durante las etapas del crecimiento inicial. En el mamfero, el cerebro, la parte que es el centro de interpretacin sensorial y que controla las respuestas musculares, es muy grande. En general los mamferos son ms inteligentes que otros vertebrados. La mayora de los mamferos paren sus cras vivas. El embrin se desarrolla en el cuerpo de la madre dentro de un rgano muscular llamado tero. Cada mamfero tiene dientes de diferentes tipos para diferentes funciones. Los mamferos se clasifican en varios ordenes: monotremas (ornitorrinco, equidna), marsupiales (canguro, tlacuache), insectvoros (topo, musaraa), quirpteros murcilagos), desdentados (oso hormiguero, perezoso), roedores (ratn, ardilla), cetceos (ballena, delfn), sirenios (manat), pinnpedos (foca, morsa), carnvoros (lobo, tigre, oso), perisodctilos (caballo, rinoceronte), artiodctilos (alce, venado, cabra), proboscdeos (elefante) y primates (lmures, chimpanc, gorila).
ACTIVIDAD Elabora un lbum de los rdenes de la clase Mammalia donde incluyas las caractersticas de cada uno con ejemplos e ilustraciones de los miembros que componen cada uno. Anota el nombre comn con su nombre cientfico.

ACTIVIDAD Trabaja en pareja. Realicen el siguiente cuadro de doble entrada que resume las caractersticas principales de los seis reinos de seres vivos. Una vez concluido, expnganlo en plenaria para compartirlo con todo el grupo.

230

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental acerca de la importancia de los organismos del phylum Cordados
CLASE Agnatos IMPORTANCIA ECONMICA IMPORTANCIA ECOLGICA IMPORTANCIA MDICA

Condroictios

Osteoictios

Anfibios

Reptiles

Aves

Mamferos

Comentario final
___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________

231

GUA METODOLGICA DE BIOLOGA

5.4. CMO SE RELACIONA LA BIODIVERSIDAD CON EL MEDIO AMBIENTE?


La Ecologa es una ciencia del siglo XX que naci como una respuesta al progresivo y acelerado proceso de deterioro y desequilibrio medio ambiental que padece la biosfera de nuestro planeta. El trmino Ecologa fue propuesto por el bilogo alemn Ernst Haeckel en 1869, proveniente del griego oikos (casa) y logos (tratado); es la parte de la Biologa que estudia las interrelaciones de los organismos entre s y con su medio. Si bien la Ecologa, como ciencia tiene apenas poco ms de un siglo de vida, los fenmenos y procesos estudiados por los eclogos han sido observados y estudiados desde hace varios siglos. pero muchos de los conceptos de Ecologa son anteriores al trmino en un siglo o ms. Al estudiar las relaciones entre los organismos y el ambiente en que viven, la Ecologa sistematiza el conocimiento que genera, utilizando diferentes niveles de organizacin o integracin. Cada nivel tiene conceptos y atributos particulares, y el nivel mnimo que compete a la ecologa es el de organismo. Un individuo es un solo organismo de una especie determinada. Por ejemplo: un tiburn, un alga, una hormiga, un junco. Los organismos no viven aislados, cuando habitan al mismo tiempo en un mismo lugar forman una poblacin. As, un cardumen de atunes es un ejemplo de poblacin. La comunidad es el conjunto de poblaciones vegetales y animales de diferentes especies que interactan en un hbitat al mismo tiempo. El ecosistema, constituye la unidad bsica de la ecologa y es un complejo formado por una serie de factores fisicoqumicos y los seres vivos que interactan constantemente ocupando un rea determinada; un conjunto de ecosistemas forma un bioma caracterizado por un tipo vegetal determinado o cualquier otro aspecto del paisaje. Por ltimo, el trmino biosfera o ecsfera se aplica al sistema biolgico amplio, prcticamente autosuficiente, que abarca a todos los organismos vivos del planeta y sus interacciones con el medio fsico.

ACTIVIDAD Dibuja un diagrama en que se ilustre la relacin que hay entre la Ecologa y las materias que integran tu plan de estudios.

232

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Elabora un collage con distintos recortes donde seales los niveles de organizacin de la naturaleza que estudia la Ecologa (organismo, poblacin, comunidad, ecosistema, bioma, biosfera)

ACTIVIDAD Investiga junto con otro compaero el desarrollo histrico de la Ecologa y presntenlo en la lnea de tiempo trabajada anteriormente, donde sealen nombre del cientfico, ao y su aportacin.

CULES SON LOS FACTORES DE LOS ECOSISTEMAS? En forma aislada, el individuo es afectado por componentes que no tienen origen vital, es decir, los factores abiticos de su ambiente. Sin embargo, si se le considera en relacin con otros individuos de igual o diferente especie, se observa que es afectado por diferentes factores biticos.

ADAPTACIONES AL AMBIENTE Para entender qu es una adaptacin biolgica, debe tenerse claro, que solo los seres vivos pueden desarrollarla a travs de procesos evolutivos de seleccin natural, que van heredndose de una generacin a otra para incrementar sus expectativas de sobrevivencia al medio fsico, qumico y biolgico que le rodea. Hay tres tipos de adaptaciones al ambiente: Morfolgicas o estructurales. Cambios externos que permiten que un organismo se confunda con el medio o imite formas, sonidos o colores de animales ms peligrosos. Por ejemplo, camuflaje, mimetismo, adaptaciones anatmicas, agresivas.

233

GUA METODOLGICA DE BIOLOGA

Fisiolgicas o funcionales son aquellas que guardan relacin con el metabolismo y funcionamiento interno de diferentes rganos o partes del individuo. Por ejemplo, hibernacin, invernacin, diapausa, estivacin, poiquilotermia y homeotermia. Conductuales. Son cambios de conducta de los organismos que permiten ajustarse a su ambiente o trasladarse peridicamente a otro, cuando las condiciones ambientales son desfavorables. Por ejemplo, migracin, conductas.

ACTIVIDAD Realiza una investigacin documental de los factores abiticos y biticos y a partir de lo investigado elabora en tu libreta un mapa conceptual de los factores que constituyen a los ecosistemas. 1. Cmo se relacionan los factores biticos y abiticos? _______________________________________________________________________________ _______________________________________________________________________________ 2. Qu impacto ocasiona el desequilibrio de alguno de los factores en el ambiente? Plantea un ejemplo. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ ______________________________________________________________________________

POBLACIN La poblacin es el conjunto de individuos de la misma especie que habitan en un rea determinada, que comparten cierto tipo de alimentos y que, al reproducirse, intercambian informacin gentica.

234

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD

Realiza una investigacin documental sobre los tipos de adaptaciones al ambiente (morfolgicas, fisiolgicas y conductuales) y escribe dos ejemplos de cada una

Por qu la ballena, puede estar expuesta a grandes diferencias de presin, hasta de 800 metros, al parecer sin inconveniente? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ Qu tipo de adaptacin han desarrollado los osos polares, y por qu? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ Por qu muchas aves nidifican entre las rocas, y a qu tipo de adaptacin corresponde? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________

ACTIVIDAD Haz una investigacin sobre las caractersticas dinmicas de la poblacin: densidad, distribucin de edades, distribucin espacial, proporcin de sexos, tasa de natalidad, tasa de mortalidad, curva de sobrevivencia, tasa de crecimiento, potencial bitico, migracin

235

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD La grfica siguiente representa las curvas de crecimiento de dos poblaciones: A y B.

En cul de las poblaciones de la grfica se evidencia el potencial bitico? Por qu? _______________________________________________________________________________ Menciona dos causas que determinaron en ambas poblaciones la reduccin del nmero de organismos. _______________________________________________________________________________ _______________________________________________________________________________ Qu le podra ocurrir a la poblacin B en el transcurso de los prximos aos? _______________________________________________________________________________ _______________________________________________________________________________ Explica en la poblacin A, las relaciones que se establecen entre la natalidad, la mortalidad y las migraciones a partir del ao 2002. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________
236

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Explica y ejemplifica el siguiente planteamiento. La incidencia de los factores limitantes del medio ambiente sobre la poblacin, incrementa la accin de la resistencia ambiental. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _____________________________

ACTIVIDAD CURVA DE SOBREVIVENCIA La siguiente grfica representa la curva de sobrevivencia de las poblaciones. Describe la grfica y especfica en qu casos ocurre una curva convexa, una curva cncava y una lnea recta.

237

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD La siguiente grfica representa el comportamiento de una poblacin de gaviotas en una zona costera de Cuba.

Sita en la grfica el lmite mximo ambiental. 1. Explica el comportamiento de esta poblacin de gaviotas del ao 2000 al 2005. ___________________________________________________________________________________ ___________________________________________________________________________________ __________________________________________________________________________ 2. Explica que le suceder a los ecosistemas de las zonas costeras de Cuba, si se vierten en los mismos desechos txicos industriales. ___________________________________________________________________________________ ___________________________________________________________________________________ _____________________________________________________________________________ 3. Argumenta 3 medidas que pueda aplicar el hombre para proteger el equilibrio de los ecosistemas costeros. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________
238

GUA METODOLGICA DE BIOLOGA

HBITAT Y NICHO ECOLGICO El hbitat de un organismo es el lugar donde vive, su rea fsica, alguna parte especfica de la superficie de la tierra, aire, suelo y agua. Puede ser vastsimo, como el ocano, o las grandes zonas continentales, o muy pequeo, y limitado por ejemplo la parte inferior de un leo podrido, pero siempre es una regin bien delimitada fsicamente. En un hbitat particular pueden vivir varios animales o plantas. En cambio, el nicho ecolgico es el estado o el papel de un organismo en el ecosistema. Depende de las adaptaciones estructurales del organismo, de sus respuestas fisiolgicas y su conducta. Puede ser til considerar al hbitat como la direccin de un organismo (donde vive) y al nicho ecolgico como su profesin (lo que hace biolgicamente). El nicho ecolgico no es un espacio demarcado fsicamente, sino una abstraccin que comprende todos los factores fsicos, qumicos, fisiolgicos y biticos que necesita un organismo para vivir. Para describir el nicho ecolgico de un organismo es preciso saber qu come y qu lo come a l, cules son sus lmites de movimiento y sus efectos sobre otros organismos y sobre partes no vivientes del ambiente. Una de las generalizaciones importantes de la ecologa es que dos especies no pueden ocupar el mismo nicho ecolgico. Una sola especie puede ocupar diferentes nichos en distintas regiones, en funcin de factores como el alimento disponible y el nmero de competidores. Algunos organismos, por ejemplo, los animales con distintas fases en su ciclo vital, ocupan sucesivamente nichos diferentes. Un renacuajo es un consumidor primario, que se alimenta de plantas, pero la rana adulta es un consumidor secundario y digiere insectos y otros animales. En contraste, tortugas jvenes de ro son consumidores secundarios, comen caracoles, gusanos e insectos, mientras que las tortugas adultas son consumidores primarios y se alimentan de plantas verdes como apio acutico.

ACTIVIDAD Busca tres ejemplos de especies donde describas su hbitat y nicho ecolgico. Ilstralo con imgenes.

239

GUA METODOLGICA DE BIOLOGA

POTENCIAL BITICO Y RESISTENCIA AMBIENTAL Cuando el ndice de crecimiento en condiciones favorables es mximo (potencial bitico) las poblaciones tienen la capacidad mxima de aumentar el nmero de individuos. En cambio, la resistencia ambiental es la suma de factores denso-dependientes y denso-independientes que contribuyen a disminuir el nacimiento y sobrevivencia de los organismos de una poblacin (Fig. 5.32).

Fig. 5.32 Potencial bitico y resistencia ambiental

Los factores denso-dependientes o intrnsecos son los que afectan y surgen dentro de la mima poblacin. Por ejemplo: alimento, enfermedades, competencia intraespecfica, rapacidad, lucha por recursos limitados, etc. Los factores denso-independientes o extrnsecos son los que afectan a la poblacin y provienen del exterior. Por ejemplo: factores climticos, competencia interespecfica, el fuego, terremotos y la depredacin. El balance de los ecosistemas surge del balance interno que existe entre el potencial bitico de cada especie con la resistencia ambiental del hbitat.

240

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Grafica cmo sera la resistencia ambiental de la cucaracha y del oso panda. Explica el por qu de cada caso
Cucaracha

Oso panda

Expn la importancia de la curva de sobrevivencia para una compaa de seguros de vida

241

GUA METODOLGICA DE BIOLOGA

RELACIONES ENTRE POBLACIONES Entre los individuos de una comunidad se establecen mltiples y diversas interacciones. La relacin que se establece entre los individuos de una misma especie y una misma poblacin, se denomina intraespecfica. A su vez, la relacin entre organismos de diferentes especies dentro de la comunidad se denomina interespecfica

ACTIVIDAD - RELACIONES INTRAESPECFICAS Investiga en que consiste cada una de las relaciones intraespecficas, describe un ejemplo e ilstralo en cada caso. Asociacin familiar:

Asociacin gregaria:

Asociacin colonial:

Asociacin estatal:

242

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD - RELACIONES INTERESPECFICAS Considerando la tabla de abajo rellena los espacios vacios con los simbolos +, - 0 de las especies A y B de acuerdo a la descripcin de la interaccin. Realiza una investigacin donde documentes un ejemplo de cada una de las relaciones interespecficas.

CONCEPTO DE COMUNIDAD Comunidad es el conjunto de poblaciones de animales y plantas que ocupan un rea determinada con interdependencia mutua entre los individuos que la constituyen, manteniendo un cierto equilibrio dinmico. La variedad de poblaciones que conforman una comunidad determina su diversidad, as como las relaciones de dominancia y cobertura. Las comunidades pueden clasificarse por el tamao y forma de vida de los organismos en:

243

GUA METODOLGICA DE BIOLOGA

Comunidad mayor. Biomas o grandes conjuntos de organismos que habitan una amplia zona geogrfica (tundra, taiga, selva, desierto, etc.). Comunidad menor. Se determinan en relacin con su extensin, por lo que depende de las comunidades contiguas. Por ejemplo, el acahual (zonas de crecimiento secundario en las selvas) y malpas (zona de crecimiento sobre suelos volcnicos). Comunidad dominante. Cuando una especie destaca por su biomasa y abundancia y es la que controla el flujo de energa dentro de la comunidad. Por ejemplo, el pino (Pinus sp) es la especie dominante del bosque de conferas.

Estratificacin de las comunidades Con objeto de facilitar el estudio de la distribucin de los organismos, se han hecho una serie de divisiones en capas de las comunidades que integran al ecosistema, denominadas estratos. En ecologa vegetal es el conjunto de plantas pertenecientes a un lmite de altura dado, distinguindose cuatro estratos: arbreo, arbustivo, subarbustivo y rasante o mucinal (Fig. 5.34)

Fig.5.34. Ecotono entre un bosque caducifolio y un bosque de conferas Fig. 5.33. Estratificacin en un bosque

244

GUA METODOLGICA DE BIOLOGA

La composicin de una comunidad se refiere a la enumeracin de elementos que la conforman, es decir, hacer una lista de las especies que integran la comunidad. La estructura se relaciona adems con el comportamiento de algunos de estos elementos, es decir, la forma en que se reparten los recursos. No slo es la descripcin del arreglo espacial en el plano vertical y horizontal de la comunidad sino tambin conocer las relaciones numricas entre los organismos. Distribucin de las comunidades. Las comunidades vegetales dominantes en su estado de clmax tienen una fisonoma distinta a la de otras comunidades de plantas, las cuales a su vez determinan el tipo de comunidades de animales. Los factores externos que limitan la distribucin de las comunidades se denominan barreras. Entre stas se hallan: Barreras fsicas, como la tierra para los animales acuticos y el agua para muchos de los animales terrestres o la variacin de las caractersticas del suelo y del agua. Barreras climticas, como la temperatura (media, estacional o extrema), la humedad (relativa, media, anual o mensual), etc. Barreras biolgicas, como la ausencia de alimento apropiado o la presencia de competidores eficaces, enemigos, enfermedades, etc.

Estas barreras de transicin entre dos o ms comunidades diversas se denominan ecotonos (5.34), que es una zona de unin que puede ser escasa o de una extensin lineal considerable, pero en todo caso es ms angosta que las reas de las comunidades adyacentes. Un ecotono suele contener a organismos de cada una de las comunidades y adems organismos caractersticos de la comunidad ecotonal, por lo que es muy rico en diversidad y que caracterizan a un lugar determinado. La tendencia hacia una diversidad y densidad aumentada en las uniones de las comunidades se denomina efecto de borde. Densidad y diversidad en las comunidades Se entiende por densidad al nmero de individuos de una misma especie que conforman una poblacin en un rea determinada, a ms individuos ms densidad. El trmino densidad no debe confundirse con diversidad que es el nmero de poblaciones de especies distintas que conforman una comunidad.

245

GUA METODOLGICA DE BIOLOGA

Las poblaciones en las comunidades son poco diversas cuando estn sujetas a factores fisicoqumicos fuertemente limitativos pero la densidad aumenta si una poblacin se ha adaptado a estos factores y las otras no como en el caso de la Artemia sp que es abundante en las salinas; pero no siempre ocurren estos casos.

SUCESIN ECOLGICA La sucesin ecolgica es el proceso gradual que implica un reemplazamiento de individuos o de comunidades enteras, por el cual la composicin de especies de una comunidad se modifica como consecuencia de perturbaciones o cambios drsticos. Se reconocen dos tipos de sucesin, dependiendo de la magnitud de la perturbacin que da inicio: primaria y secundaria. Se denomina sucesin primaria a aquella que ocurre cuando la colonizacin empieza sin influencia de la comunidad anterior. Por ejemplo, cuando un volcn hace erupcin y no quedan elementos de la comunidad previa. A las especies que ocupan las primeras etapas de la sucesin se les denomina pioneras, por ejemplo, los lquenes y musgos, se adhieren a la roca volcnica y obtienen sus nutrientes disueltos en el agua de lluvia que retienen mediante estructuras de absorcin. Posteriormente, cuando especies mueren, su biomasa servir de sustrato a otras que sobrevivirn en el espacio que las pioneras dejaron. Las caractersticas de este espacio ya son distintas de las que prevalecan al comienzo de la colonizacin, cuando los lquenes o musgos se establecieron (Fig. 5.35). Si la perturbacin no es tan drstica, algunos organismos o sus propgulos seguirn en el sitio y tendrn influencia durante la colonizacin, a este proceso se le denomina sucesin secundaria y es el que constantemente se desarrolla en todas las comunidades naturales, como producto de la muerte de los organismos (Fig. 5.36). En la sucesin de comunidades primero se dan pequeos cambios llamados microsucesiones que progresivamente conforman la sucesin principal. Las sucesiones se dan por cambios en los factores abiticos (humedad, temperatura, movimientos orognicos, deshielos, etc.) o por la llegada o introduccin de organismos forneos u oportunistas que originan una serie de competencias con las especies autctonas y en la que se impone la ms adaptada, por esto las sucesiones estn relacionadas con la evolucin de las especies.
246

GUA METODOLGICA DE BIOLOGA

A la etapa terminal de la sucesin se le denomina clmax. En trminos prcticos, podemos referirnos a esta etapa como aquella en que la comunidad se reemplaza con las mismas especies y, por tanto, la composicin permanece tambin estable. Sin embargo, en todas las comunidades, en pequea o mediana escala, suceden muertes y reemplazamientos de especies, que desencadenan procesos sucesionales, aun en aquellas comunidades aparentemente estables. El metabolismo o funcionamiento de las comunidades cambia a lo largo de la sucesin. A medida que la sucesin avanza, las relaciones trficas se vuelven ms complicadas. La diversidad de especies tambin aumenta durante las primeras etapas sucesionales, para alcanzar un mximo en una etapa intermedia, cercana al clmax.

Fig.5.35. La colmatacin de lagos es un ejemplo de sucesin ecolgica primaria

ACTIVIDAD Investiga un ejemplo de sucesin ecolgica primaria y otro de sucesin secundaria, ilstralo. Qu tipo de sucesin ocurrira en una franja vaca en un bosque nacional y por qu?

Fig. 5.36. Sucesin ecolgica secundaria

247

GUA METODOLGICA DE BIOLOGA

5.5 CUL ES LA DINMICA DE LOS ECOSISTEMAS?


Los ecosistemas se autoconservan y se autorregulan. Los mecanismos de control, por un lado, son los que regulan el almacenamiento y la liberacin de elementos nutritivos, y por el otro, la produccin y descomposicin de sustancias orgnicas, desarrollndose diferentes ciclos de materiales y mltiples transferencias de energa.
ACTIVIDAD PARQUE NACIONAL TORTUGUERO Lee detendamente la siguiente lectura El Parque Nacional Tortuguero est situado en la regin noreste de Costa Rica, en pleno mar de las Antillas, en la desembocadura del ro Tortuguero, una de las zonas ms lluviosas del pas, donde las preci-pitaciones pluviales oscilan entre los 3,000 y los 5,000 mm anuales. Su extensin abarca 21,000 hectreas de tierra firme, as como las aguas territoriales costarricenses frente a ellas. Ya una crnica holandesa del ao 1592 citaba la regin de Tortuguero como zona tradicional de desove de las tortugas marinas. Durante siglos enteros esa zona, debido a su aislamiento, conserv prcticamente inalterados todos sus valores naturales. En los aos cincuenta de este siglo fue cuando se dej sentir la presin humana con ms fuerza, pues se recolectaban miles de huevos semanalmente para venderlos. La creacin del rea como parque nacional puso fin a todos los desmanes, y ya, en los ltimos aos, los hombres de ciencia han comprobado que es notable el incremento de la poblacin de tortugas de diferentes especies que van a desovar en esas playas. Tortuguero constituye una inmensa llanura empantanada. Slo en su parte occidental estn los cerros de Sierpe, que alcanzan 300 metros de altitud. Para poder visitar el parque hay que hacerlo navegando en barca por los cientos de canales y lagunas pantanosas que lo forman. Slo desde el aire se puede uno dar idea del conjunto de esta inmensa selva lluviosa tropical. En Tortuguero se localizan diferentes tipos de vegetacin. Por ejemplo, en las playas hay numerosos cocoteros y palmeras que crecen prcticamente al borde del mar. En los suelos pantanosos se encuentra el cativo, especie de acacia, que llega a alcanzar 60 metros de alto. A su lado proliferan nsperos, gavilanes y cedros machos. Bosques de menor altura se localizan en el borde de las reas pantanosas y en las mrgenes de los cursos de agua. En ellos crecen rboles como el sangrillo, el pumpunjoche y el gucimo blanco.

248

GUA METODOLGICA DE BIOLOGA

Los bosques de palmas o yolillales ocupan grandes extensiones y se dan en suelos que estn inundados la mayor parte del ao. En la parte occidental de Tortuguero, en zonas no pantanosas, se localizan los bosques de cedro macho y de gaviln, acompaados de guacimos y tabacones. Entre los tesoros zoolgicos que albergan estas veintin mil hectreas protegidas destaca el manat, uno de los mamferos ms amenazados de extincin. Este inofensivo animal, de movimientos lentos, se alimenta fundamentalmente de grandes cantidades de plantas acuticas flotantes. Otra especie muy interesante es el gaspar, un pez de agua dulce, de unos dos metros de longitud, considerado autntico fsil viviente, cuyos antepasados vivieron hace ms de 90 millones de aos. Los bosques de Tortuguero estn recorridos por el aguar, mximo depredador del parque, la danta o tapir, el oso hormiguero gigante y el manigordo, as como monos de diversas especies. Numerosos caimanes viven en la orilla de los canales y aves de los ms vistosos colores y variados tamaos anidan en ese esplndido lugar. Actualmente se han identificado unas 350 especies, entre las que destacan tucanes, zopilotes, pjaros fragata, pelcanos, garcillas, gavilanes, halcones, guacamayos, oropndolas y colibres. Aunque toda esta rica y variada fauna es importante, lo que destaca en Tortuguero es la zona de de-sove de las tortugas marinas. Tres especies abandonan el mar para desovar en sus playas: la tortuga verde, la de carey y la caguama o caballera. La ms abundante de todas es la verde, que adems se unta en grandes grupos para reproducirse. Cada ao, de agosto a noviembre, miles de tortugas se concentran para desovar en una seccin comprendida entre la boca del ro Tortuguero y la desembocadura del Parismina. La tortuga verde realiza la puesta cada dos o tres aos y en cada ocasin desova cuatro o cinco veces. Se han realizado estudios sobre la migracin de las especies que visitan Tortuguero y se ha comprobado que se distribuyen por todo el Caribe Occidental, desde la parte oriental de Venezuela hasta Yucatn, Jamaica, Cuba y Florida. Esta migracin de la tortuga verde se debe a que Costa Rica no tiene praderas submarinas donde las tortugas encuentran la base de su alimentacin. La tortuga de carey es una de las ms pequeas de la especie marina. Se le persigue para obtener de ella el carey, sustancia traslcida, de bellsimo color pardo oscuro, utilizado en joyera, que cubre el caparazn del animal. A diferencia de la tortuga verde, la de carey no anida en forma masiva en Tortuguero. La especie se aparea en julio y agosto en dos bancos de fondo rocoso, frente a la desembocadura de Tortuguero.

249

GUA METODOLGICA DE BIOLOGA

La tortuga caballera se caracteriza por el tamao grande de su cabeza y porque se alimenta principalmente de erizos, cangrejos y estrellas de mar. Su presencia en las playas de Tortuguero es espordica y no se puede considerar como habitual. El desove de las tortugas constituye uno de los fenmenos biolgicos ms interesantes que se pueden observar en Tortuguero. Una vez ledo el texto, contesta las siguientes preguntas: 1. Cul es el rea que ocupa la comunidad de los individuos referidos en el texto?

2. Transcribe el nombre de una barrera geogrfica que se cita en el texto.

3. Cul es el mamfero amenazado en Tortuguero?

4. Transcribe el nombre de cinco especies de la comunidad que se alberga en los bosques de Tortuguero.

5. Cul es el mayor depredador de tortugas? 6. Transcribe el nombre de una poblacin en Tortuguero. 7. Qu fenmeno biolgico destaca en Tortuguero? 8. Cul es la especie dominante de tortugas en la regin citada en el texto? 9. Para qu se persigue a la tortuga de carey? 10. Cules seran los integrantes de una comunidad mayor en Tortuguero, y cules los de una menor?

250

GUA METODOLGICA DE BIOLOGA

CADENA ALIMENTICIA La cadena alimenticia es la serie de transformaciones que sufren la energa y la materia al pasar a travs de los organismos que integran una comunidad; en ella se indica quin se come a quin (Fig. 5.37). As, cada eslabn de una cadena alimenticia representa un nivel diferente de alimentacin, el cual se denomina nivel trfico. Cuando los organismos comparten la misma fuente de energa, se dice que se localizan en el mismo nivel trfico. Por ejemplo, los vegetales ocupan el primer nivel trfico, mientras que una oveja ocupara el segundo nivel trfico, considerando que se tarta de un herbvoro; un jaguar por el contrario, ocupara un tercer nivel, puesto que se alimenta de carne; los organismos que se alimentan de carnvoros, como los buitres, ocuparan un cuarto nivel, hasta llegar a los desintegradores que cerrarn el ciclo. En una cadena alimenticia (Fig. 5.39), durante la transferencia de masa y energa hay una enorme prdida de energa que se libera en forma de calor, que es menor si la cadena es ms corta, por lo que se dispone de mayor cantidad de energa en cada paso. En este flujo de energa, los organismos pueden ser productores o consumidores.

Fig.5.37. Flujo de materia y energa en el ecosistema

251

GUA METODOLGICA DE BIOLOGA

Los productores o auttrofos convierten la energa ambiental en enlaces de carbono, como en la glucosa. Los ejemplos ms destacados son las plantas; que usan, por medio de la fotosntesis, la energa solar para convertir el CO2 en glucosa (u otro azcar). Las algas y las cianobacterias tambin son productores fotosintetizadores, como las plantas. Otros productores son las bacterias quimiosintticas que viven en las profundidades ocenicas. Estas bacterias toman la energa de productos qumicos provenientes del interior de la Tierra y con ella producen azcares. Los consumidores o hetertrofos obtienen su energa de los enlaces de carbono originados por los productores. Es posible distinguir cuatro tipos de hetertrofos basndose en lo que comen:

CONSUMIDOR herbvoros carnvoros omnvoros detritvoros

NIVEL TRFICO primario secundario o superio todos los niveles ---------------

FUENTE ALIMENTICIA plantas animales plantas y animales detrito

Tabla 5.2. Tipos de consumidores

Fig. 5.38. Niveles trficos

252

GUA METODOLGICA DE BIOLOGA

Es importante observar que muchos animales no tienen dietas especializa das. Los omnvoros comen tanto animales como plantas. Igualmente, los carnvoros (excepto algunos muy especializados) no limitan su dieta slo a organismos de un nivel trfico. Las ranas y sapos, por ejemplo, no discriminan entre insectos herbvoros y carnvoros; si es del tamao adecuado y se encuentra a una distancia apropiada, la rana lo capturar para comrselo sin que importe el nivel trfico (Fig. 5.38).

Fig. 5.39. Cadena alimenticia

REDES ALIMENTICIAS El mundo real es mucho ms complicado que una simple cadena alimenticia. An cuando muchos organismos tienen dietas muy especializadas (como es el caso de los osos hormigueros), en la mayora no sucede as. Los gavilanes no limitan sus dietas a lagartijas, las lagartijas comen otras cosas aparte de saltamontes, los saltamontes comen hierbas, etc. Una representacin ms realista de quien come a quien se llama red alimenticia, como se muestra en la Figura 5.40. Podemos ver que una red alimenticia consiste de cadenas alimenticias interrelacionadas, y la nica manera de desenredar las cadenas es seguir el curso de una cadena hacia atrs hasta llegar a la fuente.

PIRMIDES ALIMENTICIAS Mediante las cadenas alimenticias se va constituyendo la biomasa que es la estructura viva de un ecosistema y que se expresa en peso y caloras. Un concepto muy importante es el de biomasa. Un principio general es que, mientras ms alejado est un nivel trfico de su fuente (detrito o productor), menos biomasa contendr.
253

GUA METODOLGICA DE BIOLOGA

Fig. 5.40 Red alimenticia

La estructura trfica de un ecosistema se representa grficamente mediante una pirmide, debido a que el nmero de auttrofos es mayor al de consumidores (Fig. 5.44). La biomasa tiende a disminuir conforme se avanza en la cadena alimenticia. Esta reduccin en la biomasa se debe a varias razones: No todos los organismos en los niveles inferiores son comidos No todo lo que es comido es digerido Siempre se pierde energa en forma de calor Es importante recordar que es ms fcil detectar la disminucin en el nmero si lo vemos en trminos de biomasa. No es confiable el nmero de organismos en este caso debido a la gran variacin en la biomasa de organismos individuales. Por ejemplo, algunos animales pequeos se alimentan de los frutos de rboles. En trminos de peso combinado, los rboles de un bosque superan a los animales pero, de hecho, hay ms individuos de animales que de rboles; ahora bien, un rbol individual puede ser muy grande, con un peso de cientos de kilos, mientras que un animal individual (en el caso que estamos analizando) puede pesar, quizs, un kilo.
254

GUA METODOLGICA DE BIOLOGA

Hay tres tipos de pirmides alimenticias: por nmero de individuos (Fig. 5.42), de biomasa (Fig. 5.41) y de energa (Fig. 5.43)

Fig. 5.41. Pirmide de biomasa

Fig.5.42. Pirmide de nmero de individuos

Fig.5.43. Pirmide de energa

Fig.5.44. Pirmide trfica

FLUJO DE ENERGA A TRAVS DEL ECOSISTEMA La energa "fluye" a travs del ecosistema como enlaces carbono-carbono. Cuando ocurre la respiracin, estos enlaces se rompen y el carbono se combina con el oxgeno para formar CO2 y se libera energa, que es usada por el organismo o perdida en forma de calor
255

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Elabora una red alimenticia utilizando dibujos, recortes o estampas de 12 organismos. Recuerda la posicin de cada uno de acuerdo al nivel trfico al que pertenece y traza la direccin de la flecha hacia quin es comido.

1. Quines estn en la base de la red alimenticia?_________________________________ 2. Si en un ecosistema, todos los herbvoros murieran por una epidemia Qu pasar con los vegetales? ____________________________________________________________________________ 3. Qu pasar con los animales carnvoros? __________________________________________________________________________ 4. Qu pasara en la atmsfera si no existieran organismos productores? ___________________________________________________________________________

256

GUA METODOLGICA DE BIOLOGA

Toda la energa proviene del sol, y su destino final es perderse en forma de calor. La energa no se recicla en los ecosistemas. Los nutrientes inorgnicos no contienen uniones carbono-carbono. Algunos de estos nutrientes inorgnicos son el fsforo de dientes, huesos y membranas celulares; el nitrgeno de los aminocidos (las unidades de las protenas); y el hierro en la sangre. Los auttrofos obtienen estos nutrientes inorgnicos del suelo o el agua que rodea la planta. Estos son pasados de organismo a organismo cuando uno es consumido por otro. Al final, todos los organismos mueren y se convierten en detrito, alimento para los descomponedores. En esta etapa, la energa restante es extrada (y perdida como calor) y los nutrientes inorgnicos son devueltos al suelo o agua para ser utilizados de nuevo. Los nutrientes inorgnicos son reciclados, la energa no. En resumen, en el flujo de materia y energa se puede generalizar que: La fuente primaria de energa (en la mayora de los ecosistemas) es el sol. El destino final de la energa en los ecosistemas es perderse como calor. La energa y nutrientes pasan de un organismo a otro a travs de la cadena alimenticia a medida que un organismo se come a otro. Los descomponedores extraen la energa mantenida en los restos de los organismos. Los nutrientes inorgnicos son reciclados pero la energa no

5.6 CMO SE EQUILIBRAN CICLOS BIOGEOQUMICOS?


La materia se compone de distintos elementos qumicos, algunos de ellos indispensables para los seres vivos porque constituyen parte del citoplasma. En la biosfera esos elementos circulan a lo largo de trayectorias mayores y menores, conocidas como ciclos biogeoqumicos. Los componentes de cada ciclo se conocen como pozos, uno mayor y el otro menor; el primero est compuesto por materiales abundantes de escaso dinamismo y de orden inerte (sin vida), mientras que el segundo se compone por una menor cantidad de materiales, el cual es mucho ms activo y se desplaza, por tanto, ms velozmente entre los seres vivos y su medio; esta fraccin se llama pozo de intercambio.
257

GUA METODOLGICA DE BIOLOGA

Los ciclos se clasifican bajo diferentes puntos de vista: por su funcin, por el estado fsico de los materiales, por su localizacin, etc. Desde el punto de vista ecolgico, los ciclos biogeoqumicos se clasifican en gaseosos (ciclos del agua, nitrgeno y carbono) y sedimentarios (ciclos del azufre y fsforo)

CICLO DEL NITRGENO El nitrgeno constituye el 78% del aire; a pesar de esta gran abundancia, los seres vivos no usan el nitrgeno en forma gaseosa, porque antes de aprovecharlo es necesario transformarlo en nitratos solubles. Esta transformacin la realizan bacterias fijadoras de nitrgeno en las races de leguminosas. De esta manera, los nitratos pasan al suelo y estn disponibles para que los absorban las plantas a travs de su raz. Las plantas convierten los nitratos en aminocidos, que son la estructura primaria de las protenas (Fig. 5.45). Las protenas vegetales pueden seguir uno de dos caminos: Transformarse en protenas animales que se convierten en urea, amoniaco o cido rico, sobre los cuales actan las nitritobacterias o bacterias putrificantes para producir nitratos o nitrgeno molecular con los que, finalmente, se reinicia el ciclo. Al morir el animal, actan las bacterias putrificantes que producen amoniaco. Cuando muere la planta, se descompone en compuestos de amonio que son atacados por otras bacterias que producen nitrgeno atmosfrico (N2), si son del tipo desnitrificante, o nitratos si actan las nitritobacterias.

CICLO DEL AGUA El agua es un compuesto esencial para la vida en nuestro planeta; una buena proporcin de los cuerpos de los seres vivos est constituida por agua (70% en humanos) y dos terceras partes de la superficie terrestre estn cubiertas por este lquido. Gracias a sus caractersticas fisicoqumicas, el agua es una molcula de gran estabilidad que permite que muchas sustancias qumicas se disuelvan en ella y se vuelvan accesibles para los seres vivos (Fig. 5.46).

258

GUA METODOLGICA DE BIOLOGA

Fig. 5.45. Ciclo del nitrgeno

Las plantas toman a travs de sus races los nutrientes del suelo disueltos en agua. Los animales dependen del agua presente en los tejidos pulmonares para realizar el intercambio gaseoso y tomar el vital oxgeno del aire. El agua se encuentra almacenada en forma slida en las enormes masas de hielo polar; en su forma lquida, en todos los cuerpos de agua, como mares, ros y lagunas, o bien en mantos acuferos subterrneos. En forma gaseosa se encuentra en la atmsfera, ya sea como vapor de agua disperso o en forma de nubes. El movimiento del agua descrito por el ciclo hidrolgico se realiza mediante procesos fsicos. El agua se evapora de todas las superficies donde se encuentra, pasando del estado lquido al de vapor, movindose por la atmsfera. Ah se condensa y regresa a la superficie en forma de lluvia, nieve o granizo y se vuelve a almacenar en los cuerpos de agua, incluidos los glaciares. Buena parte del agua de lluvia se permea a travs del suelo hasta llegar a los mantos freticos, donde se almacena. Parte de los acuferos corren como ros subterrneos, desembocando nuevamente en cuerpos de agua exteriores. Las plantas extraen el agua del subsuelo, la utilizan y la regresan a la atmsfera en forma de vapor de agua por medio de la transpiracin de sus hojas.

259

GUA METODOLGICA DE BIOLOGA

Fig. 5.46. Ciclo del agua

Se estima que el 20% de la lluvia anual se deposita en los ocanos; el 80% restante recarga el suelo y los mantos freticos. Pero estas proporciones se han visto seriamente alteradas por la actividad humana, ya que la creacin de presas, la pavimentacin, la compactacin del suelo y la tala de los bosques han disminuido la cantidad de agua que se infiltra en el subsuelo y aumentado la que regresa a los ocanos. Por otro lado, la extraccin del agua subterrnea por medio de pozos para la irrigacin ha alterado tambin estas proporciones.

CICLO DEL AZUFRE El ciclo del azufre es de particular inters, porque a pesar de ser un elemento menor sus estados de oxidacin le permiten combinarse con muy variados cationes bajo condiciones fisicoqumicas contrastantes (Fig. 5.47). Adems, este elemento desempea un importante papel en el metabolismo de plantas y animales; forma parte de los aminocidos, cistina y cistena.

260

GUA METODOLGICA DE BIOLOGA

En la corteza terrestre, el azufre se puede encontrar en distintas combinaciones: Sulfuros. Presentes en las rocas gneas. Sulfatos (combinado con mltiples cationes) comunes en depsitos sedimentarios en fondos lacustres y marinos por descomposicin incompleta de la materia orgnica. Estado nativo: se presenta en forma de molculas unidas; est relacionado con emanaciones de carcter volcnico y es producido por la oxidacin incompleta del in sulfuro. Tambin participa en la reduccin bacteriana de los sulfatos.

Fig. 5.47. Ciclo del azufre

Este ciclo y el del nitrgeno se afectan cada vez ms debido a la contaminacin atmosfrica porque los xidos de nitrgeno y de azufre circulan rpidamente y en poca concentracin, pero la combustin de petrleo (o sus derivados) y del carbn incrementan su concentracin. Este elemento se caracteriza porque implica las fases lquida, gaseosa y slida de la superficie terrestre. Algunas bacterias transforman: H2S S SO4 y otras, denominadas "desulfovibriones", reducen los sulfatos (SO4 H2S) y otras ms oxidan los sulfuros (tiobacilos). En el proceso de la produccin primaria se incorpora el azufre en forman sulfatos y, en contraste, la excrecin de los animales aporta sulfatos al ciclo.
261

GUA METODOLGICA DE BIOLOGA

Fig. 5.48. Ciclo del carbono (dixido de carbono)

CICLO DEL CARBONO (DEL DIXIDO DE CARBONO) El metabolismo de los seres vivos requiere de muchos compuestos para su desarrollo y contienen un importante elemento: el carbono. En la atmsfera se encuentra el dixido de carbono (CO2) y la proporcin que representa es sostenida por plantas y animales porque es un producto final de la respiracin. Otro aspecto importante, es que este gas es usado por los vegetales en la produccin de carbohidratos (Fig. 5.48). Los carbohidratos siguen distintos trayectos: Un animal los consume al alimentarse de plantas para obtener energa liberando CO2; que pasa de nueva cuenta a la atmsfera. Al morir plantas y animales se descomponen las sustancias orgnicas de que estn formados, como carbohidratos, grasas y protenas.

262

GUA METODOLGICA DE BIOLOGA

Las plantas, al quedar sepultadas y al someterse a grandes presiones forman carbn, el cual originar turba, hulla, lignito o petrleo, que al ser empleados como combustibles o por influencias climticas, regresa a la atmsfera como CO2.

CICLO DEL FSFORO El ciclo de este elemento tiene como pozo depsito las rocas de la corteza, del cual es liberado para incorporarse en los ecosistemas, aunque una buena parte se aloja en los sedimentos de aguas profundas y poco profundas. El fsforo biolgico forma parte del esqueleto de los vertebrados (como fosfatos de calcio) y slo una pequea cantidad participa en el citoplasma celular; las plantas superiores contienen tres dcimas del 1% de su materia seca en fsforo, proporcin similar al contenido de las rocas gneas. Los herbvoros tienen un porcentaje mucho ms alto de fsforo en su esqueleto y tambin lo eliminan a gran velocidad mediante las heces fecales; as, ste retoma al suelo para despus sedimentarse en los lagos y en los mares; en estos ltimos se forman ndulos con una alta proporcin de P2O5 (30%) (Fig. 5.49). Un epiciclo de este elemento est vinculado con las aves marinas que depositan gradualmente guano en los litorales, en los cuales se alimentan bsicamente de peces. Desafortunadamente, la participacin del hombre ha provocado alteraciones al acelerar las prdidas de fsforo por la excesiva extraccin de roca fosfatada de origen geolgico antiguo; tambin las corrientes marinas ascendentes han hecho aflorar sedimentos ricos en fsforo orgnico. El fsforo es un elemento que forma parte del citoplasma celular, tambin es un componente de los cidos nuclicos, de molculas almacenadoras de energa (ATP), y se encuentra tambin en los huesos y dientes de animales. La mayor reserva de fsforo est en la corteza terrestre y en los depsitos de rocas marinas. Durante este ciclo: Se libera fsforo de las rocas y el suelo hacia los ecosistemas, donde se disuelve en el agua del terreno para ser utilizado por los vegetales.

263

GUA METODOLGICA DE BIOLOGA

Los animales obtienen fsforo al alimentarse de las plantas o de otros animales que las hayan ingerido. Al morir las plantas o animales liberan fsforo que se reintegra al suelo. Dicho elemento puede disolverse o ser acarreado por las lluvias a los mantos acuferos o al ocano. El guano, como se denomina al excremento de muchas aves, tambin deposita pequeas cantidades de fosfatos en la tierra o en el agua.

Fig. 5.49. Ciclo del fsforo

La conclusin fundamental del estudio de los ciclos biogeoqumicos, es que forman el gran ciclo geoqumico realizado entre los ocanos y las masas continentales. Este gran proceso cclico permite mantener la salinidad marina y un intercambio de elementos entre mar y tierra con la participacin innegable de la atmsfera; por ejemplo, los vientos de procedencia marina transportan una parte significativa del sodio que las corrientes fluviales proporcionan a las aguas ocenicas. As, la integracin de las interfases agua, tierra y aire de la superficie terrestre funcionan como un solo y gran ecosistema denominado biosfera
264

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Utiliza los esquemas de los diferentes ciclos biogeoqumicos para responder a las siguientes preguntas 1. De donde proviene el CO2 que utilizan las plantas en la fotosntesis? __________________________________________________________________________________ 2. Cmo han alterado las actividades humanas el ciclo del carbono y cules son las consecuencias para el clima futuro?
__________________________________________________________________________________________ __________________________________________________________________________________________ _________________________________________________________________________________________

3. Explica cmo llega el gas nitrgeno del aire a la plantas


__________________________________________________________________________________________ __________________________________________________________________________________________

4. Rastrea una molcula de fsforo de una roca rica en fosfato al ADN de un carnvoro- Qu hace que el ciclo del fsforo sea fundamentalmente diferente de los ciclos del carbono y del nitrgeno?
__________________________________________________________________________________________ __________________________________________________________________________________________ _________________________________________________________________________________________

5.7 CULES SON LAS GRANDES DIVISIONES DE LA BIOSFERA?


La cualidad ms relevante del ecosistema estriba en su independencia energtica, su autarqua, ya que se conjugan todos los eslabones necesarios para constituir un ciclo energtico completo. El ecosistema ocupa entre todas las categoras de organismos ecolgicos un lugar principal porque representa la unidad de convivencia energticamente autrquica ms pequea. Sin embargo es posible construir, en un plano abstracto, unidades ecolgicas superiores de mayor cuanta. Es as como todos los ecosistemas de estructura y organizacin semejante se agrupan bajo el concepto de bioma.
265

GUA METODOLGICA DE BIOLOGA

Los biomas son las comunidades tpicas de las grandes regiones climticas. Un bioma no es un lugar, es una categora. Cuando hablamos de la selva, no nos referimos a la selva amaznica o a la selva africana sino a todas las selvas del orbe. Un bioma es una comunidad de plantas y animales con formas de vida y condiciones ambientales similares e incluye varias comunidades y estados de desarrollo. Se nombra por el tipo dominante de vegetacin. El conjunto de todos los biomas viene a integrar por ltimo la biosfera. No suele haber lnea de demarcacin precisa entre biomas adyacentes, sino que, por el contrario, cada uno se superpone en una vasta zona de transicin llamada ecotona. Los biomas no se distribuyen en forma aleatoria sino, por el contrario, con una cierta regularidad tanto en el plano horizontal (latitud) como en el vertical (altitud).

BIOMAS TERRESTRES Son extensas regiones geogrficas, formadas por los diversos ecosistemas terrestres donde viven comunidades de plantas y animales (biticos), que poseen caractersticas y adaptaciones apropiadas para el ambiente en que se desenvuelven, y cuya distribucin est determinada por el clima, suelo, altitud, presin atmosfrica, es decir por factores fisicoqumicos llamados abiticos. En el siguiente cuadro comparativo se dan a conocer algunas caractersticas abiticas y biticas de los Biomas Terrestres (Tabla 5.3)

ACTIVIDAD Contesta en tu libreta las siguientes preguntas respecto a los biomas 1. Qu diferencia existe entre el bioma desierto y el ecosistema desierto? Escribe un ejemplo 2. Por qu se encuentran biomas similares en grandes latitudes y en grandes altitudes? 3. Esperaras encontrar exactamente las mismas especies de animales y plantas en la regin de la tundra de Alaska y en la regin de la tundra de los Andes? Por qu? 4. Haz escuchado el comercial que dice Apaga la luz porque se inunda Tabasco. Explica el porqu de esta afirmacin

266

GUA METODOLGICA DE BIOLOGA

Bioma

Localizacin
Regiones cercanas a casquetes polares: Alaska, Norte de Canad, Norte de Groenlandia y Siberia

Al sur de la tundra; en zonas de las altas montaas: Siberia, Canad, centro de EUA, en Mxico Chihuahua, Durango, Michoacn (Sierra Madre Occidental)

Pases centrales de Europa, centro de Canad, EUA y en Mxico en laderas de la Sierra Madres y el eje volcnico transversal

Clima Polar fro todo el ao, nevadas intensas y cortos periodos de verano. Las temperaturas medias oscilan entre - 15C y 5C 300 mm. de lluvia anual Fro o templado y hmedo, con inviernos largos, alcanzan temperaturas 10 a 20C en verano y -15C y +5C en invierno. De 250 a 500 mm. de lluvia anual Templado con las cuatro estaciones del ao bien marcadas y alternancia de lluvias, periodos secos, tormentas, etc. La temperatura media anual es de 23'C, Entre 500 y 1000 mm. de lluvia anual
Todas las regiones cercanas al ecuador tienen en comn el ser calurosas, tienen una temperatura que oscila entre los 20-25C. De los 2000-10000 mm. de lluvia anual

Tabla 5.3. Biomas Terrestres Suelo


Permanentemente helado, solo unos centmetros se deshiela en verano, la capa ms profunda siempre es helada llamada Permafrost

Flora

Fauna
Tundra Sur Carib, y en la norte Reno, en ambas, foca, osos polar, lobo blanco, pingino y aves

Tundra

Lquenes, musgos, y algunas conferas enanas

Relieve accidentado, el suelo es de color grisceo y muy cido, debido a la lenta descomposicin del material vegetal de la superficie.

rboles de confera como el Pino y el Abeto, cuyas hojas en forma de aguja son perennes (siempre verdes) lo que les permiten soportar bien las heladas y perder poca agua.

Roedores. herbvoros: venados, alces, jabales, zorro plateado, marta y visn

Bosque Caducifolio

Bosque de Conferas

Los suelos son ricos porque la meteorizacin es alta y la actividad biolgica tambin, su color es caf forestal.

Las especies de rboles que forman el bosque son muy numerosas: Hayas, Robles, Castaos, Avellanos, Nogal, Olmos, etc.

Castores, Ardillas, Puerco Espn, Lobos, Alces, Ciervo, Gato monts. Musaraa y Linces.

Se encuentra en las regiones ecuatoriales o cercanas a l, en la cuenca del Amazonas de Amrica del Sur, Congo, y en Mxico; Sur de Veracruz, parte de Chiapas y Tabasco.

El suelo es de tipo pantanoso dbil y pobre, debido a que la mayor parte de los nutrientes se encuentran en los seres vivos y no en el suelo. Si este ecosistema es destruido, su recuperacin es casi imposible de lograr, ya que el suelo desnudo se hace costroso. No es apto para la agricultura (en tres o cuatro cosechas pierde sus nutrientes).

rboles de 10-20 mts. Caoba, Cedro. bano, Teca, etctera con mucha humedad y escasa luminosidad. Arbustos, plantas herbceas, epfitas (p/e. orqudea), hojas que chorrean para evitar el exceso de agua y el lavado de nutrientes. Helechos, lianas y enredadera.

Del nivel o estrato superior: monos, aves canoras, serpientes e insectos, en los estratos ms bajos: batracios, y reptiles, en las aguas superficiales gran diversidad de peces.

Bosque Tropical

267

GUA METODOLGICA DE BIOLOGA

Ucrania hasta Mongolia, Amrica del Norte (pradera) y en la del Sur (pampa)

Es semidesrtico con largos periodos de sequa. Su temperatura oscila entre 20 a 29 C. Entre los 250 y 600 mm. de lluvia anual

Se ubica en regiones tropicales, en zonas centrales de frica, Amrica y Australia.

Es clido con largos periodos de sequa. temperaturas medias de 23 C 600 mm. de lluvia anual

Se localiza en frica, Asia, Australia, Chile, Per, Suroeste de EUA y en el noroeste de la Repblica Mexicana en Sonora

Desrtico puede alcanzar una temperatura hasta de 58 C por la maana y por la noche en algunas zonas han llegado hasta -5C o 6C. Un promedio de 200 mm. de lluvia anual

Acumula mucho humus formado por la gran cantidad de materia orgnica que aportan las hierbas al suelo, (se descomponen rpidamente). El suelo negro de la pradera (chernoziem) est entre los mejores para cultivar maz y trigo. Arcilloso e impermeable. Presenta alternancia de una estacin hmeda y otra seca y rida, lo que facilita la propagacin de incendios. El fuego agiliza el crecimiento de las hierbas y frena el desarrollo de los rboles, acelerando la mineralizacin del suelo y plantas que se adaptan a esas condiciones. Los suelos pueden ser de color: marrn claro, gris o amarillentos. Son de tipo calcreo y altamente salino, siendo poco productivos. La arena es un sustrato comn, contribuyendo a la sequedad ya que drena rpidamente la escasa precipitacin.

Praderas, Estepa y Pampas

Su vegetacin es predominan los pastizales, plantas herbceas y matorrales

Gacela, Coyote, Lobo, Antlope, Linces y algunos roedores

Los rboles estn dispersos los ms frecuentes son Acacias y Baobabes; plantas herbceas hierbas, pastos y gramneas

Representados por: Antlopes, Cebras, Jirafas, Rinocerontes, Elefantes, Bfalos y grandes mamferos carniceros, avestruz.

Sabana

Desierto

Se desarrollan cactus, nogales, yucas, etc.

Mamferos: zorra, coyote, lobo, algunos reptiles, roedores y aves de rapia.

268

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Investiga y colorea en el planisferio los Biomas terrestres del mundo. Utiliza un cdigo de colores para identificarlos.

269

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Investiga y colorea en el mapa los Biomas que existen en Mxico. Utiliza un cdigo de colores para identificarlos.

270

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Retoma la actividad del mapa conceptual de causas y consecuencias de la crisis ambiental y los esquemas de los ciclos biogeoqumicos e indica con un asterisco qu parte del ciclo es afectada y cul es el problema que lo ocasiona

ACTIVIDAD ESPECFICA Haz una investigacin documental sobre los siguientes problemas ambientales documentando su definicin as como sus causas y consecuencias: contaminacin del aire, suelo y agua, efecto invernadero, extincin de especies, deterioro de la capa de ozono, sobrepastoreo, deforestacin, calentamiento global, introduccin de especie exticas, trfico de especies, caza, prdida de biodiversidad, lluvia cida, incendios forestales. A partir de lo investigado, por equipo, construir un mapa mental de la crisis ambiental interrelacionando las causas y consecuencias de estos problemas. Usa slo los nombres de los problemas Elabralo en un pliego de papel y exponlo al grupo.

271

GUA METODOLGICA DE BIOLOGA

RUBRICA PARA EVALUAR MAPAS MENTALES Institucin educativa: Nombre del docente: Nombre del alumno: Ao/grupo: Fecha: Nombre de quien evala:
PONDERACIN CRITERIOS EXCELENTE (4) Identifican fcilmente la idea principal e incluyen todas las palabras y/o ideas subordinadas, para desarrollar adecuadamente el tema. MUY BIEN (3) Seleccionan la idea principal e incluyen casi todas las palabras e ideas subordinadas para desarrollar el tema BIEN (2) Tienen cierta dificultad para seleccionar la idea principal e incluyen algunas de las palabras e ideas subordinadas para desarrollar el tema. Ubican la idea principal al centro pero presentan de 3 a 4 errores al agrupar las palabras e ideas subordinas de acuerdo a su naturaleza y/o jerarqua. Varias de las palabras e ideas estn conectadas incorrectamente. Solo hace uso de flechas o de cdigo de smbolos. Agrupacin, jerarqua y ramas solo algunas se presentan por cdigo de colores distintos. DEFICIENTE (1) Seleccionan con mucha dificultad la idea principal y palabras e ideas subordinadas son incorrectas. No ubican la idea principal al centro y/o presentan 5 o ms errores al agrupar las palabras e ideas subordinadas de acuerdo a su naturaleza y/o jerarqua. La mayora de las palabras e ideas estn mal conectadas. Solo hace uso de flechas o de cdigo de smbolos. Agrupacin, jerarqua y ramas se presentan por cdigo de 2 o menos colores. PUNTAJE

Asignatura:

Bloque/tema: Autoevaluacin: Coevaluacin: Evala el profesor:

Contenidos

Ubican la idea principal en el centro. Las palabras e ideas Ubicacin y subordinadas se agrupacin presentan en forma radial y se agrupan de acuerdo a su naturaleza y jerarqua. Logra establecer conexiones Conexiones adecuadas entre las e palabras e ideas intergrupos claves, a travs de flechas o usando un cdigo de smbolos. Agrupacin, jerarqua Agrupacin, y ramas se presentan jerarqua y por cdigo de colores ramas distintos. por colores

Ubican la idea principal en el centro. Presentan pequeos errores (1 o 2) al agrupar las palabras e ideas subordinadas de acuerdo a su naturaleza y jerarqua. Algunas de las palabras e ideas (1 o 2) no estn conectadas correctamente. Utiliza flechas y/o cdigo de smbolos. Agrupacin, jerarqua y ramas la mayora se presentan por cdigo de colores distintos.

Imgenes del mapa TOTAL:

Utiliza ms del 90% Utiliza ms del 70% de imgenes que son de imgenes, y la de gran colorido. mayora son de gran colorido en el mapa.

Utiliza menos del Utiliza ms del 50% 50% de imgenes de imgenes, en el en el mapa. Con mapa y estas son de muy poco color o poco colorido. sin l.

COMENTARIOS:

REFERENCIAS: (Landsberger, 2005)

272

GUA METODOLGICA DE BIOLOGA

ECOSISTEMAS ACUTICOS

ECOSISTEMAS OCENICOS stos cubren entre el 70 y 71% de la superficie terrestre formada por el agua marina. El ocano est dividido por los continentes y grandes archipilagos en cinco partes que son los Ocanos: Pacfico, Atlntico, ndico, rtico y Antrtico. El agua del mar, contiene sustancias slidas en disolucin, como el sodio y el cloro cloruro de sodio, magnesio, calcio y potasio, que constituyen cerca del 90 % de los elementos disueltos en el agua de mar. En la tabla 5.4 se presentan algunos factores biticos y abiticos de los ocanos.

ECOSISTEMAS DULCEACUCOLAS La ciencia que estudia los ecosistemas de agua dulce se llama Limnologa, y la que estudia los ecosistemas de agua salada se llama oceanografa. Los ecosistemas dulceacucolas, constituyen el 1% de agua dulce, es el punto clave entre los ocanos y la atmsfera en el ciclo hidrolgico de la naturaleza, por lo que est integrado por dos grandes tipos de ecosistemas: los de aguas quietas, como los lagos, charcas, pantanos y las turberas llamados bioma lntico; y los de aguas de movimiento como: fuentes, arroyos, y ros llamados bioma ltico.

BIOMAS LNTICOS Se distinguen 3 zonas: el litoral, la zona limntica (las aguas alejadas de la orilla) y la zona profunda ubicada debajo de la anterior. Litoral lacustre (lagos y lagunas), aqu es ms abundante la vida, pues la luz penetra hasta el fondo. Zona limntica, constituye el agua libre hasta la profundidad mxima que alcanza a penetrar la luz, aqu se produce el mximo desarrollo de fitoplancton, y donde el zooplancton constituye el principal componente de la comunidad de consumidores de primer orden.

273

GUA METODOLGICA DE BIOLOGA

CARACTERSTICAS TEMPERATURA

DESCRIPCIN

La media oscila entre 2 30oC, sta aumenta 1 atmsfera por cada 10 m de profundidad, por ejemplo, los organismos que se encuentran en las profundidades marinas pueden llegar a soportar presiones de unas 1000 atmsferas. Ftica: es la zona hasta donde penetra la luz llegando esta hasta los 200 m de profundidad. Aftica: a partir de 200 m., donde no hay luz.

PRESIN ATMOSFRICA

ZONAS DE LUZ

SALINIDAD

Aproximadamente del 3.5% Organismos pelgicos. Se localizan en las aguas libres, sin relacin con el fondo ocenico. Por ejemplo: cardmenes de peces, ballenas, calamares, etc Organismos bentnicos. Se localizan en el fondo ocenico. Son numerosos entre ellos estn las algas, anlidos, moluscos, corales, estrellas, crustceos, peces de fondo, etc. Organismos planctnicos. Viven flotando en las aguas y se mueven principalmente arrastrados por las corrientes. Por ejemplo: algas microscpicas (fitoplancton), protozoos, pequeos crustceos, huevos, larvas, medusas, etc.) Plataforma litoral o costera: es la zona ms cercana a la tierra. Plataforma Continental: parte del Continente pero sumergida, con una profundidad media de 200 m y pendientes generalmente suaves; su anchura es muy variable de una zona a otra. Suele contener vida marina en abundancia y la mayor parte de la pesca se realiza en esta zona. Aqu se encuentra la cuarta parte de la produccin mundial de petrleo y gas procedente de las rocas que se encuentran debajo de estas plataformas. Talud Continental: continuacin de la Plataforma que se puede considerar ya como verdadera zona Ocenica; presenta pendientes muy acusadas y va desde 200 m hasta 4.000 m. Fosas abisales: Son las partes ms profundas de los ocanos, con una media de 7000 a 8000 m de profundidad, que pueden llegar a medir miles de kilmetros de largo.
Tabla 5.4. Algunas caractersticas de Ecosistemas Marinos

FORMAS DE VIDA

TOPOGRAFA

274

GUA METODOLGICA DE BIOLOGA

Zona profunda, se encuentra por debajo de la zona limntica, y sus habitantes ms caractersticos son: las bacterias, los hongos descomponedores, algunos gusanos, moluscos etc., capaces de sobrevivir con poca luz y baja concentracin de oxgeno. De acuerdo a su tipologa ecolgica se clasifican en: Lagos oligotrficos con nutrientes escasos, una zona de agua fra profunda, el hipolimnion, rica en oxgenos y con una baja densidad, de plancton. Lagos eutrficos ricos en nutrientes y con una elevada productividad primaria debido al denso fitoplancton y a la vegetacin de los mrgenes, que sufren escasez de oxgeno en el hipolimnion durante el verano

BIOMAS LTICOS Conforme a su curso se clasifican en: Curso Superior. Generalmente, coincide con las reas montaosas de una cuenca determinada. La erosin es mayor y los ros suelen formar valles en forma de V al encajarse en el relieve aunque hay excepciones. Curso medio. Aqu se alternan las reas o zonas donde el ro erosiona y donde deposita parte de sus sedimentos, lo cual se debe, principalmente, a las fluctuaciones de la pendiente y a la influencia que reciben con respecto al caudal y sedimentos de sus afluentes. Curso inferior. Fluye en reas relativamente planas, donde suele formar meandros: establece curvas regulares, que pueden llegar a formar lagos en herradura. Al fluir el ro, acarrea grandes cantidades de sedimentos, los que pueden dar origen a islas, llamadas deltas. Un ro que termina en una boca muy ancha y profunda se llama estuario, el cual contiene tanto agua dulce como salada pues es el punto donde se unen ambas.

275

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Investiga e ilustra las caractersticas de un manglar, un estuario y un arrecife de coral.

ESTUARIO

MANGLAR

ARRECIFE DE CORAL

276

GUA METODOLGICA DE BIOLOGA

EVALUACIN
DIAGNSTICA Se toma en cuenta los conocimientos previos a partir de la tcnica lluvia de ideas y de la aplicacin del examen diagnstico. ACTIVIDADES DE APRENDIZAJE: FORMATIVA Ejercicios de la gua metodolgica Debate grupal V de Gowin Presentacin de exposiciones en power point ACTIVIDAD ESPECFICA: Mapa mental integrador Reporte de visita guiada a reas naturales Portafolio Rbrica Examen departamental tipo CENEVAL o PISA 30% Laboratorio (evaluacin V-Gowin) 20% Actividades de aprendizaje 20% Actividad especfica por unidad 30%

SUMATIVA

Criterios Analiza la estructura y las relaciones entre los componentes de los ecosistemas en un mapa mental integrador.

MATRIZ DE VALORACIN DE COMPETENCIAS Pre-formal Receptivo Resolutivo Autnomo Identifica los Describe Analiza la Analiza la componentes algunos estructura y estructura y de los componentes las relaciones las relaciones de los entre los entre los ecosistemas. ecosistemas y componentes componentes sus relaciones de los de los en un mapa ecosistemas ecosistemas mental en un mapa de una forma mental crtica y integrador. reflexiva, en integrador. un mapa mental integrador.

Estratgico Analiza la estructura y las relaciones entre los componentes de los diferentes ecosistemas en un mapa mental integrador, sugiriendo propuestas para la conservacin de los ecosistemas Puntos: 100

Ponderacin Logros:

Puntos: 30

Puntos: 60

Puntos: 80 Puntos: 100 Aspectos a mejorar :

277

GUA METODOLGICA DE BIOLOGA

BIBLIOGRAFA BSICA
Banchs, J, Biosca, A. et al. (2003). El Mundo de la Ecologa. Ed. Ocano Pas Espaa Barnes, H. (1989). Zoologa de los Invertebrados. Ed. Interamericana. Mxico. Bernal, J.D. (1994). La Ciencia en la Historia. Nueva Imagen UNAM. Mxico. pp 12-26 Biagi. (1980). Enfermedades Parasitarias. Quinta reimpresin, La Prensa Mdica Mexicana, Mxico, 376 pp. Cervantes M. y Hernndez M. (2005). Biologa General. Publicaciones Cultural. Mxico. pp. 427477. Coello, Joseph y Tola Jos. (1998). Atlas Mundial del Medio Ambiente. Preservacin de la Naturaleza. Ed. Cultural S. A. Pas Espaa. Cronquist, A. (1986). Botnica Bsica; CECSA, Mxico; 655 pp. Curtis H. y Barnes N.S. (2000) Biologa. Editorial Mdica Panamericana. Colombia. pp. 715-736. Libro electrnico Ciencias de la Tierra y del Medio Ambiente: Tema 5: Principales ecosistemas >> Biomas terrestres. www.tecnun.es/asignaturas/ecologia/hipertexto/05PrinEcos/120BiomTer.htm Marten, G. (1992). Ecologa Humana. Conceptos Bsicos del Desarrollo Sustentable. Valdivia, B., Granillo, P. y Villareal, S. (2003). Biologa. La Vida y sus Procesos. Publicaciones cultural. Mxico, D. F. pp. 249-300. Vzquez Conde, R. (2004) Biologa Experimental. Publicaciones Cultural. Mxico. Vzquez, C.R. (2006). Biologa I. Publicaciones Cultural. Mxico. pp 4-8

BIBLIOGRAFA COMPLEMENTARIA
Cervantes, A. (2006).Tesoros de la Biodiversidad. SEP/Santillana. Coleccin Espejo de Urania. Mxico. Nesman, P. (2005) Las Plantas. Correo del Maestro. Mxico. 278

GUA METODOLGICA DE BIOLOGA

Piero Daniel. (1987) De las bacterias al hombre: la Evolucin. Consejo Nacional de Ciencia y Tecnologa Fondo de Cultura Econmica, La ciencia/ 25 desde Mxico, Bada, J.L. y Lazcano, A. (2003) Sopa Prebitica, Nueva visita al Experimento de Miller en Astroseti.org (reproducido con permiso de Science Magazine). http://www.astroseti.org/sopa.php Biggs, Kapicka y Lundgren; (1999); Biologa, la dinmica de la vida; Mc Graw Hill, Mxico; 737 pginas. Buican, D; (1996); Historia de la Biologa; segunda edicin; Acento editorial, serie Flash; Espaa; 91pginas. Consejo Nacional para la enseanza de la Biologa; (1975); Biologa; CECSA, Mxico. 960 paginas.

VIDEOS RECOMENDADOS El Mundo de los Insectos Biodiversidad Sexo en el arrecife Planeta Tierra Video La Marcha de los Pinginos Huella ecolgica en la web Videojuego en lnea Honoloko Literatura del tema

TICs Action Bioscience


http://actionbioscience.org/esp/biodiversidad/index.html

Revista electrnica Biodiversitas http://www.biodiversidad.gob.mx/Biodiversitas/resultados.php


279

GUA METODOLGICA DE BIOLOGA

Comisin Nacional para el Conocimiento y Uso de la Biodiversidad


http://www.conabio.gob.mx

2010 Ao internacional de la Biodiversidad http://www.cbd.int/2010/welcome/ La Vida entre Reinos http://redescolar.ilce.edu.mx/redescolar/proyectos/reinos_pri2006/index.htm LibroBOTNICAOnLine http://www.forest.ula.ve/~rubenhg/ Naturaleza Mexicana http://www.wwf.org.mx/wwfmex/ecosistemas.php Proyecto Biosfera - Ministerios de Educacin y Ciencia http://recursos.cnice.mec.es/biosfera/ Secretaria del Medio Ambiente http://www.sma.df.gob.mx Consejo Nacional de Ciencia y Tecnologa: Revista Ciencia y Desarrollo http://www.conacyt.mx/comunicacion/revista

280

GUA METODOLGICA DE BIOLOGA

BLOQUE 6 Introduccin a la Anatoma y Fisiologa Humana

281

GUA METODOLGICA DE BIOLOGA

BLOQUE DE APRENDIZAJE VI: INTRODUCCIN A LA ANATOMA Y FISIOLOGA HUMANA


TIEMPO: 25 horas UNIDAD DE COMPETENCIA: Identifica la organizacin del cuerpo humano y la funcin que desempean los sistemas en el mantenimiento de la homeostasis del mismo, para tomar decisiones en el cuidado de su cuerpo a travs del uso de modelos anatmicos. SABERES Procedimentales Describe la estructura y funcin de los tejidos del cuerpo humano a travs de modelos y observacin al microscopio de muestras histolgicas. Elabora reportes de laboratorio a travs de una V de Gowin. Identifica rganos y sistemas en un pollo. Construye modelos anatmicos para identificar los rganos de los respectivos sistemas Relaciona la estructura y funcin de los diferentes rganos y sistemas a travs de mapas mentales Aplica y difunde medidas de higiene y salud para prevenir enfermedades a travs del uso de medios de comunicacin. COMPETENCIAS Genricas/Atributos Disciplinares 3.2 Toma decisiones a partir de la valoracin de las consecuencias de distintos hbitos de consumo y conductas de riesgo. 5.2 Ordena informacin de acuerdo a categoras jerarquas y relaciones. 5.6 Utiliza las tecnologas de la informacin y comunicacin para procesar e interpretar informacin. 8.3 Asume una actitud constructiva, congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. 9. Disea modelos o prototipos para resolver problemas, satisfacer necesidades o demostrar principios cientficos. 12. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo, sus procesos vitales y el entorno al que pertenece.

Declarativos Identifica la estructura y funcin de los tejidos del cuerpo humano. Identifica la estructura y funcin de los rganos y sistemas del cuerpo humano. Explica las medidas de higiene y prevencin de la salud

Actitudinales/ Valorales Se desempea activa y responsablemente en trabajos individuales y por equipo. Muestra actitudes de respeto al trabajo y opiniones de sus compaeros. Reflexiona de manera crtica e informada sobre las medidas de higiene y salud para tener una buena calidad de vida. Promueve y difunde a travs de peridicos murales, conferencias y trpticos la importancia de tomar medidas para prevenir enfermedades.

CRITERIOS DE DESEMPEO Identifica la estructura de los rganos y sistemas del cuerpo humano a travs de modelos anatmicos. Relaciona la estructura y funcin de los diferentes rganos y sistemas a travs de mapas mentales.

282

GUA METODOLGICA DE BIOLOGA

ESTRATEGIAS DE ENSEANZA Clase magistral.


Actividades

ESTRATEGIAS DE APRENDIZAJE Elaboracin de mapa mental


Construccin

RECURSOS DIDCTICOS
Gua metodolgica Videos Lminas Rotafolio Modelo

experimentales
Ilustraciones Mapas

de

EVIDENCIAS Y/O PRODUCTOS Actividades de la gua metodolgica de biologa.


Investigaciones

modelos
Investigacin

documentales
Reporte

mentales

documental.
Elaboracin

de

anatmico humano power point

de laboratorio (V de Gowin) sistemas del cuerpo humano.

material de difusin
Reporte

Presentaciones en

Modelos de los

de laboratorio en V de Gowin de actividades de la gua metodolgica

Computadora Can Apoyo

Mapa mental Material

de difusin

Resolucin

bibliogrfico

Laboratorio

experimental
Muestras

biolgicas e histolgicas de diseccin

Estuche

EXPLORANDO TUS CONOCIMIENTOS 1. Escribe el nombre de tres glndulas del cuerpo _________________________________________________________________________ 2. En dnde se lleva a cabo el intercambio gaseoso en la respiracin pulmonar? _________________________________________________________________________ 3. Qu diferencias hay entre venas y arterias? _________________________________________________________________________ 4. Escribe el nombre de cinco huesos del cuerpo _________________________________________________________________________
283

GUA METODOLGICA DE BIOLOGA

284

GUA METODOLGICA DE BIOLOGA

6.1. INTRODUCCIN
La anatoma es la rama de la medicina que estudia la forma y estructura del cuerpo as como sus partes constitutivas, mientras que la fisiologa estudia la funcin de las diferentes estructuras corporales. El cuerpo humano no es simplemente un agregado de rganos, sino una unidad organizada y bien coordinada que funciona como un todo integrado. Esta unidad morfolgica y fisiolgica se logra por medio de un elevado nivel de organizacin estructural y numerosos mecanismos de control relacionados entre s. Las influencias personales, sociales y culturales en la vida de un individuo no son ajenas al funcionamiento fisiolgico del cuerpo, los mdicos estiman que entre el 40% y 70% de todas las alteraciones funcionales (enfermedades) tienen origen psicosomtico atribuible a la vida personal y social de cada individuo. El cuerpo humano esta integrado por diferentes sistemas, estos sistemas estn formados a su vez por rganos, que son agrupaciones de diferentes tejidos especializados con una funcin establecida. Se reconocen cuatro tipos fundamentales de tejidos: el epitelial, el conjuntivo, el muscular y el tejido nervioso (Tabla 6.1).

TEJIDO Epitelial

FUNCIONES Proteccin y produccin de hormonas, enzimas y sudor Unin y sostn de otros tejidos

IMPORTANCIA Forma membranas que cubren el cuerpo y revisten cavidades Forma glndulas endocrinas (hormonas) y glndulas exocrinas (sudor) Forma tendones (unin), cartlago, hueso (soporte), sangre y linfa (transporte) y el estroma de los ovarios (sostn) Est dividido en tres grupos:

Conectivo

Muscular

Contraccin por la presencia de actina y miosina

Msculo estriado, que forma la musculatura corporal Msculo cardiaco, que forma el corazn Msculo liso, que forma rganos internos como el tubo digestivo, vasos sanguneos Forma el sistema nervioso. La neurona es la unidad estructural y funcional, forma encfalo y mdula espinal (sistema nervioso Central) y tejido nervioso (Sistema nervioso perifrico) Tabla 6.1

Nervioso

Conduccin de impulsos nerviosos

285

GUA METODOLGICA DE BIOLOGA

6.1. CMO FUNCIONA EL SISTEMA TEGUMENTARIO?


El rgano ms grande del cuerpo es la piel, en un adulto cubre un rea total de ms de 1.5 metros cuadrados. La piel se conoce como tegumento y se compone de uno o ms tejidos que protegen al cuerpo del ambiente.
ACTIVIDAD Realiza una Investigacin documental de las funciones que tiene la piel. A partir de esta informacin realiza un mapa conceptual de las funciones de la piel.

286

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Escribe los nombres correspondientes a cada estructura que sealan las lneas de la siguiente figura esquemtica. Haz una investigacin experimental y escribe la funcin de cada parte.

287

GUA METODOLGICA DE BIOLOGA

6.2. CMO FUNCIONA EL SISTEMA MUSCULAR?


El sistema muscular est constituido por clulas que reciben el nombre de miocitos, la unin de un gran nmero de miocitos forman las fibras musculares que al unirse a su vez forman rganos llamados msculos. En el humano se han clasificado en tres tipos: esqueltico o estriado, liso y cardiaco. El msculo esqueltico se le denomina as porque se encuentra adherido al esqueleto y estriado porque al microscopio se observan bandas o estras, unas anchas constituidas por protenas contrctiles de miosina y otras bandas o estras delgadas constituidas por protenas contrctiles de actina (fig. 6.1). El msculo cardiaco se localiza en el espesor de las cavidades del corazn, su estructura es similar a la del msculo esqueltico o estriado. El msculo liso se le llama as porque no presenta bandas o estras y se localiza en las paredes de las vsceras huecas (estmago, intestinos, vasos sanguneos, etc.).

Fig. 6.1. Contraccin muscular

La diferencia es que el msculo esqueltico funciona en forma voluntaria median-te estmulos nerviosos, fsicos y qumicos, a diferencia de los msculos cardiaco y liso que presentan automatismo, regulados por centros nerviosos especializados y por hormonas. Las clulas del msculo esqueltico o estriado y del cardiaco, son clulas alargadas con muchos ncleos, las del msculo liso cuentan con un solo ncleo oval casi central.

288

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Investiga en qu consisten los siguientes movimientos voluntarios de los msculos: flexin, extensin, aduccin, abduccin, pronacin, supinacin, elevacin, depresin, oclusin, dilatacin y oposicin. En la imagen coloca el tipo de movimiento de que se trate en la letra correspondiente.

289

GUA METODOLGICA DE BIOLOGA

La contraccin de un msculo se debe a la atraccin de sus fibras por estmulos que cambian sus cargas de tipo elctrico que al encontrarse de diferente carga se atraen dando como resultado el acortamiento del conjunto, los msculos jalan no empujan, por lo tanto para que exista un movimiento completo es necesario que existan msculos antagnicos; por ejemplo para doblar el brazo, es necesario que existan msculos en su regin anterior, para volver a extenderse se necesita que se contraigan msculos localizados en su regin posterior (fig. 6.1). La diversidad de movimientos que se efectan se debe a la combinacin de contraccin y relajacin de los msculos esquelticos, cuya finalidad es la locomocin), funcin presente casi en la totalidad de los organismos hetertrofos para poder buscar su alimento.
Figura 6.2. Msculos importantes en el ser humano

Los msculos cardiaco y liso que presentan automatismo y regidos por centros nerviosos especializados, tenemos como ejemplo de sus movimientos; las contracciones involuntarias del corazn (sstole y distole), los movimientos del tubo digestivo a los cuales se les denomina perstalsis.

290

GUA METODOLGICA DE BIOLOGA

6.3. CMO FUNCIONA EL SISTEMA SEO?


El sistema seo est constituido por clulas que reciben el nombre de osteocitos, constituidos de calcio y fsforo que forman a los huesos (fig. 6.2). Las funciones del esqueleto son: Servir como una estructura slida que constituye un armazn que da soporte y forma. Proteger a rganos muy delicados, formando cavidades como las del crneo y cavidad torcica. Producir elementos formes de la sangre como son los glbulos rojos y blancos, en el interior de la mdula sea. Almacn de calcio y fsforo. Participar en la conduccin sensorial, como las vibraciones sonoras en el odo. La unin de los diversos huesos van a formar una estructura que sirve de armazn, de soporte a la cul se le denomina esqueleto; el humano esta constituido por la unin de diversos huesos en numero promedio de 204, al esqueleto se le van a unir una gran cantidad de diversos msculos que le van a dar movimiento.

6.2. Estructura de un hueso largo

291

GUA METODOLGICA DE BIOLOGA

Fig. 6.3. Huesos del crneo

A los huesos localizados sobre la lnea media del cuerpo se les denomina esqueleto axial (huesos del crneo, columna vertebral, hueso del pecho y sacro) (fig. 6.3) a los huesos localizados a los lados de la lnea media del cuerpo se les denomina esqueleto apendicular (huesos de los brazos y piernas, huesos de la cadera. Los huesos se clasifican en: Huesos largos (hmero, cubito, radio, fmur, tibia, peron) Huesos cortos (falanges) Huesos planos (huesos del crneo, omoplatos, huesos de la cadera) Huesos irregulares (vrtebras, huesos del carpo y metacarpo)

A los extremos de los huesos largos se les denomina epfisis y a su cuerpo difisis. A los huesos planos se les consideran las siguientes regiones; caras, bordes y ngulos (fig. 6.2).

292

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Ilumina el esqueleto axial y de un color. Utiliza un segundo color para iluminar el esqueleto apendicular. En ambos casos escribe el nombre de los huesos principales que reconozcas.

La unin de los diversos huesos se les llama articulacin, son varios los elementos que participan los cuales son: ligamentos y tendones, cpsula articular, meniscos y lquido sinovial.
293

GUA METODOLGICA DE BIOLOGA

6.4. CMO FUNCIONA EL SISTEMA DIGESTIVO?


La digestin es el proceso mediante el cual el alimento que ingiere un organismo es descompuesto en molculas lo suficientemente pequeas como para que entren las clulas. Entre estas molculas se encuentran los monosacridos, los aminocidos, cidos grasos, hierro y otros minerales. Por esta razn el alimento debe ser ingerido, digerido y absorbido. En los animales superiores la digestin tiene lugar en un largo tubo que va desde la boca al ano y que tiene diferentes zonas especializadas para cada proceso de la digestin.

Figura 6.4. Sistema digestivo

294

GUA METODOLGICA DE BIOLOGA

Las funciones de la digestin son: Ingestin. Los alimentos son introducidos al tracto digestivo por un orificio generalmente llamado boca. Destruccin mecnica. Los alimentos se rompen en partes ms pequeas la intervencin de los colmillos y otras piezas dentales y el mezclado de la cavidad digestiva. Destruccin qumica. Las partculas de los alimentos se exponen a enzimas y lquidos digestivos a fin de que las molculas grandes se desdoblen en unidades ms pequeas. Absorcin. Las molculas pequeas deben pasar a las clulas (Fig. 6.5). Eliminacin. Los materiales no digeribles deben ser expulsados del cuerpo.

Fig. 6.5. Estructura interna del intestino delgado

295

GUA METODOLGICA DE BIOLOGA

ESTRUCTURA Cavidad bucal

FUNCIN Es el lugar de entrada de los alimentos al organismo. Est provisto de 32 dientes encargados de triturar el alimento. Conduce el bolo alimenticio hacia el esfago, donde la epiglotis evita que el alimento pase al tracto respiratorio.. Conduce los alimentos hacia el estmago. Es una bolsa musculosa en forma de J en donde los alimentos son transformados por accin de los jugos gstricos. Es un tubo de 7 m de largo que tiene en su interior una serie de microvellosidades encargadas de absorber a la sangre los alimentos. Es un tubo grueso y corto.. Por l se expulsa la sustancias no absorbidas por las vellosidades intestinales y se absorbe el agua. Almacena los residuos Expulsa las heces fecales
Tabla 6.2. rganos principales del sistema digestivo

Faringe Esfago Estmago

Intestino delgado

Intestino grueso Recto Ano

ESTRUCTURA Pncreas (jugo pancretico) Hgado (bilis) Glndulas partidas Glndulas del intestino delgado

FUNCIN Desdobla las protenas intactas, convierte las dextrinas en maltosa y desdobla las grasas neutras. Emulsifica las grasas neutras y participa en la absorcin de los productos de la descomposicin de las grasas neutras. Producen y secretan amilasa salival (ptialina) Gluclisis y protelisis
Tabla 6.3. Glndulas anexas del sistema digestivo

296

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD A partir de las Tablas 6.2 y 6.3 y con la informacin proporcionada en esta gua, construye un mapa conceptual integrador que involucre la ruta del alimento, los rganos por donde pasa, las glndulas anexas, las funciones de la digestin.

297

GUA METODOLGICA DE BIOLOGA

6.5. CMO FUNCIONA EL SISTEMA RESPIRATORIO?


Se llama sistema respiratorio al conjunto de estructuras del organismo que permite la captacin del oxgeno del aire y la eliminacin del dixido de carbono producido en su interior. Este proceso se conoce como respiracin. El sistema respiratorio transporta el aire hacia los pulmones y realiza el intercam-bio gaseoso (Fig. 6.6) que se lleva a cabo en ellos. Esta constituido por rganos de transporte y rganos de intercambio gaseoso, que permiten la llegada de oxgeno a la sangre y la eliminacin del bixido de carbono. Los pulmones son los rganos ms importantes de este sistema y se encuentran protegidos por una membrana de doble capa llamada pleura. Se encuentran alojados en las partes laterales de la cavidad torcica, cubiertos principalmente por las costillas. El pulmn derecho es mayor que el izquierdo consta de tres lbulos, mientras que el otro solo tiene dos. Durante la inhalacin la cavidad torcica se expande, esto sucede cuando el diafragma y los msculos intercostales se contraen levantando las costillas hacia arriba y hacia fuera. La exhalacin se produce cuando los msculos se relajan, la relajacin hace que las costillas se muevan hacia abajo y hacia adentro disminuyendo el tamao de la cavidad torcica y obligando al aire a salir de los pulmones.

RGANO
Nariz Faringe

ESTRUCTURA
Fosas nasales Cmara comn al aparato digestivo y respiratorio Formada por secciones de cartlago y cuerdas vocales Tubo flexible con paredes de cartlago cubiertos con membranas mucosas Tubos flexibles cartilaginosos Tubos flexibles cartilaginosos

FUNCIN
Humedece calienta y purifica el aire Conduce el aire hacia la laringe y expulsa moco y partculas Produce tonos de voz e interviene en el proceso de la tos. Conducto de paso que da origen a los bronquios Conducen el aire hacia los pulmones Conducen el aire hacia los alvolos

Laringe Trquea

Bronquios Bronquolos

Tabla 6.4. rganos conductores del sistema respiratorio

298

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Escribe el nombre del rgano que corresponda e ilumnalo de diferente color

El aire que queda en los pulmones despus de la exhalacin impide que los alvolos se colapsen. Durante la respiracin normal se introducen 500 ml de aire, de los cuales 350 ml llegan a los alvolos. La frecuencia respiratoria se controla por el centro respiratorio del encfalo, cada contraccin es estimulada por impulsos que provienen de clulas nerviosas. El centro respiratorio ajusta la frecuencia respiratoria y el volumen para cumplir con las necesidades del cuerpo.
299

GUA METODOLGICA DE BIOLOGA

Fig. 6.6. Alvolos pulmonares

Fig. 6.7. Intercambio gaseoso

6.6. CMO FUNCIONA EL SISTEMA CIRCULATORIO?


El sistema circulatorio sirve para llevar los alimentos y el oxgeno a las clulas, y para recoger los desechos metablicos que se eliminarn por los riones, en la orina, y por el aire exhalado en los pulmones, rico en dixido de carbono (CO2). De toda esta labor se encarga la sangre, que est circulando constantemente. Las funciones bsicas del sistema circulatorio son la oxigenacin celular (parte de la respiracin celular), nutricin, regulacin de la temperatura corporal, transporte de hormonas, interviene en la regulacin cido-base y en la concentracin de agua celular El corazn, es un rgano situado en el interior del trax entre ambos pulmones est integrado por msculo estriado cardiaco. Este rgano funciona como bomba y presenta dos cavidades superiores llamadas aurculas y otras dos inferiores, los ventrculos. Entre la aurcula y el ventrculo derecho hay una vlvula llamada tricspide; entre la aurcula y ventrculo izquierdo esta la vlvula mitral. (Fig. 6.8) Las gruesas paredes del corazn forman el miocardio. La contraccin del corazn est determinada por impulsos elctricos, que provienen de un tejido especializado a manera de marcapasos natural situado en la aurcula derecha, llamado nodo sinusal, estos impulsos elctricos producen el latido del corazn. Los vasos sanguneos, estn constituidos por las arterias, venas y capilares. Las arterias salen del corazn. Son gruesas y elsticas y nacen en los ventrculos aportan sangre a los rganos del cuerpo, por ellas fluye rpidamente la sangre a presin debido a la elasticidad y resistencia de sus paredes. Las arteriolas son las ltimas ramas del sistema arterial. Actan como vlvulas de control a travs de las cules se manda sangre hacia los capilares. Son pequeas y con una poderosa pared muscular. Las venas transportan sangre de los tejidos hacia las aurculas del corazn. La presin del sistema venoso es muy baja,
300

GUA METODOLGICA DE BIOLOGA

sus paredes son delgadas y poco elsticas. Las vnulas reciben la sangre de los capilares antes de llamarles venas. En los capilares se realiza el intercambio gaseoso entre la sangre y las clulas. Son sumamente delgados que penetran por todos los rganos del cuerpo, Intercambian lquidos, nutrientes, electrolitos, hormonas y otras sustancias entre la sangre y los espacios intersticiales. La sangre est contenida en el cuerpo en cantidad de unos 4 a 6 litros. En ella se distingue una parte lquida, el plasma, y una parte slida; las clulas sanguneas o elementos formes (eritrocitos, leucocitos y plaquetas). Para movilizar la sangre, el corazn presenta dos movimientos o latidos, uno de contraccin o sstole, y otro de dilatacin o distole. Esto genera la presin arterial que es ms alta durante la sstole y disminuye durante la distole.

ACTIVIDAD Identifica y escribe el nombre de cada estructura que sealan los nmeros y lneas sobre el esquema del corazn. 3.______________________________________ 4.______________________________________ 5.______________________________________ 6.______________________________________ 7.______________________________________ 8.______________________________________ 9.______________________________________ 10.______________________________________ 11.______________________________________ 1.___________________________________ 2.___________________________________ 12.______________________________________ 13.______________________________________

301

GUA METODOLGICA DE BIOLOGA

Circulacin sangunea La sangre procedente del organismo (circulacin sistmica) llega a la aurcula derecha a travs de dos venas principales: la vena cava superior y la vena cava inferior. Cuando la aurcula derecha se contrae, impulsa la sangre a travs de un orificio, la vlvula auriculoventricular, hacia el ventrculo derecho. La contraccin de este ventrculo conduce la sangre hacia los pulmones. La vlvula tricspide evita el reflujo de sangre hacia la aurcula, ya que se cierra por completo durante la contraccin del ventrculo derecho. En su recorrido a travs de los pulmones (circulacin pulmonar), la sangre se oxigena, regresando al corazn por medio de las cuatro venas pulmonares que desembocan en la aurcula izquierda. Cuando esta cavidad se contrae, la sangre pasa al ventrculo izquierdo y desde all a la aorta gracias a la contraccin ventricular. La vlvula bicspide o mitral evita el reflujo de sangre del ventrculo hacia la aurcula izquierda (fig. 6.9).

Fig. 6.9. Circulacin sangunea

302

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental sobre los componentes de la sangre. A partir de sta elabora un mapa conceptual

303

GUA METODOLGICA DE BIOLOGA

6.7 CMO FUNCIONA EL SISTEMA LINFTICO?


En el organismo humano existen dos tipos de sistemas de transporte: el sistema circulatorio y el sistema linftico. El sistema linftico consta de: una red de capilares linfticos que conducen linfa y de tejido linftico formado por nodos linfticos, los rganos linfticos como el timo, bazo y tonsilas (amgdalas). Las funciones principales de ste sistema son: A. Limpiar y regresar los desechos celulares a la sangre. Como resultado del metabolismo celular, se difunden sustancias de desecho hacia el lquido extracelular, al que se integran. Una parte de estos desechos se dirige al extremo venoso del capilar, el resto hacia los extremos venoso del capilar, el resto hacia los extremos cerrados de los vasos linfticos, que forman una red distribuida por todo el cuerpo. B. Transportar grasas del intestino al torrente sanguneo. El intestino delgado tiene muchos capilares linfticos. Despus de absorber las grasas digeridas en el interior de los vasos quilferos o linfticos, estas se recombinan viajando por estos vasos quilferos. Estas partculas son muy grandes para que puedan difundir al interior de los capilares sanguneos, pero pueden moverse fcilmente a travs de las aberturas de la clulas capilares linfticas. Una vez en la linfa, son bombeadas hacia una gran vena que llega al corazn. Despus de una comida rica en grasa, estas partculas de grasa representan el 1% del fluido linftico. C. Dar la respuesta inmunolgica. El sistema linftico produce linfocitos, un tipo de glbulos blancos, para defender el cuerpo al exponer bacterias y virus a los leucocitos. La respuesta inmunolgica se efecta en dos partes, primero el cuerpo debe reconocer el antgeno y segundo debe buscar la manera de deshacerse de l. Para esto es necesaria la accin de los leucocitos que tienen como funcin reconocer a los antgenos. Estas clulas se reproducen en la mdula sea y de aqu pasan a la sangre, a los nodos linfticos y al bazo. Algunos linfocitos primero pasan por el timo, por esto se denominan clulas T, en tanto que los otros se llaman clulas B. El timo, el bazo, los nodos linfticos y algunas clulas como los linfocitos T y los linfocitos B forman el sistema inmunolgico del cuerpo.
304

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental sobre la respuesta inmune humoral y celular y dibuja un esquema de las mismas

305

GUA METODOLGICA DE BIOLOGA

6.8. CMO FUNCIONA EL SISTEMA EXCRETOR?


Cuando hablamos de excrecin, siempre pensamos en la eliminacin de produc-tos de desecho. Esta sin embargo, es slo una de sus funciones. La excrecin es adems, un sistema regulador del medio interno, es decir, determina la cantidad de agua y de sales que hay en el organismo en cada momento, y expulsa el exceso de ellas de modo que se mantenga constante la composicin qumica y el volumen del medio interno (homeostasis). El sistema urinario elimina los productos nitrogenados, principalmente la urea, y regula el equilibrio hdrico y salino (electrolitos). La orina que se produce en el rin pasa a los clices menores y de stos a los clices mayores, la vejiga urinaria por medio del urter. La eliminacin final de la orina se realiza a travs de la uretra. La sangre llega al rin (fig. 6.10) por medio de la arteria renal, a travs de pequeas redes de capilares que se conocen como glomrulos, cada uno de los cuales est asociado a una cpsula renal (cpsula de Bowman), constituyndose as la primera parte de una nefrona (fig. 6.11). En conjunto, un glomrulo y una cpsula renal forman un corpsculo renal. A travs de las redes de los capilares se produce un ultrafiltrado, carente de clulas sanguneas y de protenas que se van acumulando en la cpsula renal antes de pasar, sucesivamente por el tbulo contorneado proximal, el asa de Henle y tbulo contorneado distal; finalmente el ultrafiltrado llega al tbulo colector. Durante este recorrido la composicin del lquido va variando y el agua es recuperada.

6.10. Estructura del rin

6.11. Estructura de una nefrona

306

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD. Completa el siguiente cuadro con los datos faltantes en cada recuadro.

6.9. CMO FUNCIONA EL SISTEMA NERVIOSO?


El cuerpo humano es una maravilla en complejidad y coordinacin; si se piensa un poco en l se advertir que lleva acabo muchas actividades, a veces simultneamente, algunas voluntarias y otras no. Por ejemplo, al estar leyendo esta pgina se realizan procesos muy complejos en el cerebro. Asimismo se pueden percibir sonidos que se producen alrededor o sentir fro o calor al palpar un libro con los dedos. En el interior del cuerpo el corazn late, la sangre circula, el estmago realiza la digestin y los pul-mones transportan aire. Todas estas actividades se realizan simultnea y requieren de un centro de control que las coordina: el sistema nervioso.

307

GUA METODOLGICA DE BIOLOGA

El sistema nervioso cumple con dos funciones bsicas que son la coordinacin de las diferentes acciones del cuerpo y la coordinacin de las respuestas del cuerpo al mundo externo. Hay, en el sistema que nos ocupa, estructuras que reciben informacin proveniente del medio tanto interno como externo (receptores). As como tambin estructuras que envan mensajes apartes del cuerpo que producen una respuesta especfica (efectores). Esta informacin y mensajes van en forma de seales elctricas (impulso nervioso).

LAS NEURONAS El sistema nervioso est compuesto por clulas, llamadas neuronas, muy especializa-das e incapaces de reproducirse. La neurona es la unidad fundamental del sistema nervioso y bsicamente cumple las siguientes funciones: Recibe la informacin del medio interno o externo y de otras neuronas. Integra la informacin que recibe y producir una seal de respuesta adecuada. Conducir la seal a la terminacin nerviosa correspondiente, la cual puede estar localizada a cierta distancia. Transmitir la seal a otras clulas nerviosas, glndulas o msculos. Coordinar las actividades metablicas que mantienen la integridad de la clula.

Cada neurona (fig, 6.12) est constituida por cuatro regiones distintas: las dendritas, el cuerpo celular o soma, el axn y las terminales sinpticas.
Fig. 6.12 neurona

El sistema nervioso se divide para su estudio en sistema nervioso central y sistema nervioso perifrico.

308

GUA METODOLGICA DE BIOLOGA

SISTEMA NERVIOSO CENTRAL Consta de encfalo y mdula espinal. Es la parte del sistema nervioso que recibe y procesa la informacin de los receptores. Inicia respuesta, almacena recuerdos, genera pensamientos y emociones. El sistema nervioso central consiste principalmen-te en neuronas de asociacin. Los rganos que protegen al sistema nervioso central son el crneo, que protege al encfalo, y la columna vertebral, que protege a la mdula espinal; las meninges (duramadre, aracnoides y piamadre), que son membranas de tejido conectivo; y el lquido cefalorraqudeo, que es un lquido claro parecido a la linfa que acta fundamentalmente como amortiguador. La mdula espinal (fig. 6.13) es un cable neural que se extiende dentro del canal de la columna vertebral, desde la base del encfalo hasta la cadera. En el centro de la mdula espinal se localizan cuerpos de neuronas formando un rea en forma de mariposa que es llamada la sustancia gris. Est rodeada por haces de axones llamados sustancia blanca. La mdula espinal tiene como funciones conducir seales desde y hacia el encfalo y controlar las actividades reflejas.

Fig. 6.13. Mdula espinal

El encfalo se localiza dentro de la cavidad craneana y tiene un peso aproximado de 1500g. Consta de 3 partes: rombencfalo, mesencfalo y procencfalo (fig. 6.14). El rombencfalo est formado por la mdula oblonga , el puente y el cerebelo. La mdula oblonga controla diversas funciones autnomas como respirar, la frecuencia cardiaca, la presin sangunea y la deglucin. El puente interviene en la transicin entre el dormir y el despertar y entre los diversos estadios del sueo. El cerebelo coordina las actividades musculares(como caminar).
309

GUA METODOLGICA DE BIOLOGA

El mesencfalo contiene la formacin reticular, cumple una funcin importante en el sueo, en aspectos emotivos, en el tono muscular y en ciertos movimientos y reflejos. Filtra la entrada de informacin sensorial antes de que llegue a las regiones conscientes del encfalo. El procencfalo, llamado tambin cerebro, comprende las siguientes partes: El tlamo, el sistema lmbico y la corteza cerebral. El tlamo lleva informacin sensorial al sistema lmbico y al cerebro, como la proveniente de las vas auditiva y visual, de la piel y del interior del cuerpo. El sistema lmbico es un grupo de estructuras localizado en un arco que se encuentra entre le tlamo y el cerebro. Estas estructuras trabajan juntas para producir las emociones ms bsicas, impulsos y conductas, incluyendo miedo, rabia, tranquilidad, sed y placer y las respuestas sexuales. El sistema lmbico comprende al hipotlamo, porciones del tlamo, la amgdala y el hipocampo. En los humanos la corteza cerebral constituye la mayor parte del encfalo; es la capa ms externa del procencfalo. La corteza cerebral se divide en dos partes llamadas hemisferios cerebrales, que se comunican mediante una gran haz de axones, el cuerpo calloso. La corteza cerebral es el centro del procesamiento de informacin, la memoria y la iniciacin de acciones voluntarias. Incluye principalmen-te a las reas motora y sensitiva y reas de asociacin que analizan la informacin sensorial y planean los movimientos.

Fig. 6.14. Encfalo

310

GUA METODOLGICA DE BIOLOGA

SISTEMA NERVIOSO PERIFRICO Consta de nervios perifricos que unen al encfalo y a la mdula espinal con el resto del cuerpo, incluyendo los msculos, los rganos de los sentidos y los rganos de los sistemas digestivos, respiratorio, excretor y circulatorio. En los nervios perifricos existen axones de neuronas sensitivas y motoras. Las neuronas sensitivas llevan informacin sensitiva hacia el sistema nervioso central que proviene de todas las partes del cuerpo; y las neuronas motoras llevan respuestas o seales desde le sistema nervioso central a los rganos y msculos. La porcin motora del sistema nervioso perifrico puede subdividirse en dos partes: el sistema nervioso somtico y el sistema nervioso autnomo.

6.15. Sistema nervioso autnomo

311

GUA METODOLGICA DE BIOLOGA

El sistema nervioso somtico controla los movimientos voluntarios al activar los msculos esquelticos. El sistema nervioso autnomo controla las respuestas involuntarias al influir sobre rganos, glndulas y msculo liso. El sistema nervioso autnomo es controlado tanto por la mdula como el hipotlamo del encfalo (fig. 5.20) El sistema nervioso autnomo (fig. 6.15) consta de dos divisiones, el sistema nervioso simptico y el parasimptico; estos dos sistemas hacen contacto sinptico con los mismos rganos, pero producen efectos opuestos. El sistema nervioso simptico prepara al cuerpo para las situaciones estresantes o que requieran actividad, del tipo pelea o huida mientras que el sistema nervioso parasimptico domina durante tiempos de descanso, dirige el mantenimiento de actividades como la digestin.

ORGANOS DE LOS SENTIDOS Desde el nacimiento se entra en contacto con el mundo que nos rodea en diferentes formas. A travs del sistema nervioso y los rganos de los sentidos se reciben los estmulos como sensaciones de color, luz, sonido, dolor. Los rganos de los sentidos son el gusto, el olfato, el tacto, la vista y el odo. Las seales del mundo exterior son captadas por los receptores de los sentidos como estmulos que se envan al encfalo. En el cuerpo humano se presentan 3 tipos de receptores que se clasifican como: Quimiorreceptores. Estimulados por substancias qumicas que se encuentran en el aire, en el agua y en los alimentos. Estos receptores se encuentran en la boca y en la nariz. Mecanorreceptores. Se encuentran en la piel y en los odos y responden a las vibraciones, la presin y otros estmulos mecnicos. Fotorreceptores.-Se encuentran en los ojos y son estimulados por la luz.

312

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Con la informacin proporcionada elabora un cuadro sinptico de cmo est organizado el Sistema Nervioso

313

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental sobre los rganos de los sentidos y construye un mapa conceptual de los mismos.

314

GUA METODOLGICA DE BIOLOGA

6.10. CMO FUNCIONA EL SISTEMA ENDOCRINO?


Junto con el sistema nervioso, controla muchas de las funciones del cuerpo, por medio de mensajeros qumicos llamados hormonas. Una hormona es una sustancia qumica producida por una clula que afecta el metabolismo de otra clula. Las glndulas endocrinas liberan sus secreciones directamente en el torrente sanguneo. Las ms importantes son: hipfisis, tiroides, paratiroides, pncreas, suprarrenales, ovarios, testculos Las glndulas exocrinas liberan sus secreciones sobre la superficie interna o externa de los tejidos cutneos, la mucosa del estmago o el revestimiento de los conductos pancreticos. Las hormonas se producen en pequeas cantidades, se liberan al espacio intercelular, viajan por la sangre, afectan tejidos que pueden encontrarse lejos del punto de origen de la hormona y su efecto es directamente proporcional a su concentracin. Sus efectos son: Estimulante. Promueve actividad en un tejido. Ejemplo: prolactina Inhibitorio. Disminuye actividad en un tejido. Ejemplo: somatostatina Antagonista. Cuando un par de hormonas tiene efectos opuestos entre s. Por ejemplo: insulina y glucagn Sinergista. Cuando dos hormonas en conjunto tienen un efecto ms potente que cuando se encuentran separadas. Ejemplo: hGH y T3/T4 Trpica. Esta es una hormona que altera el metabolismo de otro tejido endocrino. Ejemplo: gonadotropina

ACTIVIDAD A continuacin realiza una investigacin documental y completa los recuadros vacos del nombre de la glndula, del nombre de la hormona o la funcin de sta, segn corresponda

315

GUA METODOLGICA DE BIOLOGA

GLAN DULA

HORMONA Somatotropina (hormona de crecimiento humana, (hGH)

FUNCIN Acelera indirectamente el anabolismo proteico, absorcin y catabolismo de grasas; disminuye el catabolismo de carbohidratos. Una hipersecrecin en la niez genera gigantismo, en la adultez genera acromegalia. Hiposecrecin en la niez produce enanismo hipofisiario o proporcional. Estimula secrecin lctea en las glndulas mamarias. Hipersecrecin causa galactorrea en personas no lactantes

Hipfisis Anterior

Tiroideoestimulante TSH Promueve el crecimiento y desarrollo normal de la corteza adrenal y estimula sus secreciones Estimula maduracin de folculos primarios y secrecin de estrgenos en la mujer. Estimula desarrollo de tbulos seminferos y mantiene espermatognesis en el hombre.

Luteinizante (LH)

Estimulante de Melanocitos (MSH) Antidiurtica (vasopresina) ADH

Se cree que ayuda a mantener la sensibilidad de la adrenal a la ACTH. Hipersecrecin se distingue porque promueve pigmentacin en los melanocitos.

Hipfisis Posterior

Producida por el hipotlamo, se almacena en la pituitaria. Estimula contraccin uterina y expulsin de leche. Contribuye junto con la prolactina una lactancia exitosa.

Epfisis

Melatonina

316

GUA METODOLGICA DE BIOLOGA

Triyodotironina Tetrayodotironina T3, T4

Regula (disminuyendo) la concentracin de calcio en la sangre estimulando la actividad de los osteoblastos (estimula depsito de sales en huesos) y reduciendo la de los osteoclastos

Paratiroides

Paratohormona PTH

Timosinas

Familia de hormonas que estimulan la produccin y maduracin de linfocitos T

Mineralocorticoides (aldosterona, etc)

Corteza adrenal

Acelera la gluconeognesis y el catabolismo lpido.

Gonadocorticoides

Mdula adrenal

Prolongan e incrementan el efecto de la estimulacin simptica del sistema nervioso autnomo en situaciones de estrs.

317

GUA METODOLGICA DE BIOLOGA

Glucagn

Estimula la entrada de nutrientes a las clulas y favorece su metabolismo. Disminuye concentracin de glucosa en sangre

Somatostatina

Testculo

Desarrollo y mantenimiento de caractersticas sexuales femeninas y ovulacin.

Ovario
Progesterona

Mucosa gastrointestinal

Gastrina Secretina Colecistocinina

318

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Ubica cada glndula y escribe su nombre en la lnea. Colorea cada glndula de distinto color

319

GUA METODOLGICA DE BIOLOGA

6.11. CMO FUNCIONA EL SISTEMA REPRODUCTOR?


En la reproduccin sexual se necesita la participacin de la pareja ya que cada uno aporta su clula sexual correspondiente que lleva la mitad de la informacin gentica, para que al unirse las dos clulas (fecundacin) den origen al nuevo ser con rasgos de los dos participantes, presentndose variedad y lo ms importante evolucin.

SISTEMA REPRODUCTOR MASCULINO. En el cuerpo del hombre, las caractersticas primarias incluyen las gnadas, llamadas testculos, y un sistema de rganos sexuales accesorios que consisten principalmente en una serie compleja de conductos, tres conjuntos de glndulas llamadas prstata, glndulas bulbouretrales o de Cowper y vesculas seminales, finalmente el pene (rgano de penetracin) (fig. 6.16). Estas estructuras en conjunto contribuyen a la formacin y transporte del lquido seminal. As, los espermatozoides producidos en los testculos, y el lquido seminal secretado por los conductos y glndulas, se mezclan para formar el semen. Los testculos son rganos tanto citgenos o productores de clulas nuevas, como glndulas endocrinas, ya que elaboran y secretan hormonas sexuales. El lquido seminal que se mezcla con los espermatozoides antes de la eyaculacin tiene gran importancia y variedad de funciones; principalmente sirve como medio de transporte para los espermatozoides, pero adems sirve para lubricar los conductos a travs de los cuales pasan los espermatozoides, ayuda a protegerlos de los efectos nocivos de la acidez del tracto genital femenino, y contiene sustancias nutritivas para ellos.

SISTEMA REPRODUCTOR FEMENINO. Las caractersticas sexuales de la mujer, como ya se mencion, tambin se distinguen como primarias y secundarias. Las caractersticas sexuales secundarias, caracterizan a una mujer en su exterior. Desde luego se hallan bajo el influjo constante de las hormonas sexuales femeninas. El sistema reproductor femenino est formado por ovarios, oviductos o trompas de Falopio, tero y vagina, que se conocen como rganos reproductores internos. Adems los genitales externos o vulva, que consisten en los labios mayores, labios menores y cltoris.
320

GUA METODOLGICA DE BIOLOGA

Fig. 6.16. Sistema reproductor masculino

ESTRUCTURA Testculo Epiddimo y conducto deferente Uretra. Pene

FUNCION Produce espermatozoides y testosterona.

Almacenan y conducen espermatozoides a la uretra.

Conduce el semen desde el conducto deferente y la orina desde la vejiga al meato urinario (punta externa). Deposita los espermatozoides en el sistema reproductor femenino. Secretan substancias que contienen fructuosa (fuente de energa) y prostaglandinas (se supone que ocasionan cambios en la posicin de los rganos reproductores femeninos para asegurar y ayudar al transporte de los espermas en su interior durante la bsqueda del vulo). Se retan sustancias bsicas que neutralizan la acidez vaginal, adems contienen factores que aumentan la motilidad de los espermatozoides.

Vesculas seminales.

Prstata. Glndulas de Cowper (bulbouretrales).

Secretan moco para lubricar la uretra peneana y la vagina. Tabla 6.4. Principales rganos del Sistema Reproductor Masculino

321

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental y explica qu sucede en la siguiente figura de los tbulos seminferos.

322

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental y explica qu sucede en la siguiente figura del ovario

323

GUA METODOLGICA DE BIOLOGA

Fig. 6.17. Sistema reproductor femenino

ESTRUCTURA Ovario Trompa de Falopio u oviducto

FUNCION Produce vulos, progesterona y estrgenos

Transportan los vulos desde los ovarios hasta el tero

tero

El endometrio se engruesa para anidar al vulo. Aloja y alimenta al feto cuando hay embarazo Funciona como receptculo de los espermatozoides durante el coito Sitio de extrema sensibilidad Se hincha al llenarse de sangre durante la excitacin sexual.

Vagina Vulva Cltoris

324

GUA METODOLGICA DE BIOLOGA

ANTICONCEPCIN El criterio para recomendar y utilizar un mtodo anticonceptivo en los jvenes y adolescentes es muy diferente del empleado para las personas de mayor edad. En la vida sexual de los jvenes hay que tomar en cuenta diversos factores como la frecuencia de actividad sexual, el desarrollo fsico y emocional, el tipo de pareja (s es estable o no), as como la actividad y la motivacin para la utilizacin de los mtodos anticonceptivos. Hay diferentes mtodos anticonceptivos que pueden ser utilizados por jvenes y adolescentes. Es el Mdico quien deber orientarlos y guiarlos, para que de manera conjunta se tome una decisin adecuada a cada situacin. Solo los llamados anticonceptivos de barrera como el condn y las espumas, jaleas y vulos anticonceptivos, no requieren de la consulta mdica para su prescripcin. Los mtodos y tcnicas anticonceptivas se clasifican en diversos grupos segn determinadas caractersticas: los anticonceptivos de barrera fsica, de barrera qumica, los anticonceptivos hormonales, los dispositivos intrauterinos (DIU), los mtodos naturales y los mtodos quirrgicos o definitivos. Muchos de estos anticonceptivos pueden ser en realidad una mezcla o combinacin de dos o ms mtodos y cada uno de ellos tienen las indicaciones de uso para obtener buenos resultados y alcanzar su mxima efectividad.

ACTIVIDAD Se conformarn equipos de cuatro integrantes. Utilizando los conocimientos acerca de la estructura y funcionamientos de cada uno de los rganos y sistemas del cuerpo humano realiza un mapa conceptual integrador donde seales la interrelacin que existe entre los diferentes rganos de los diferentes sistemas. Realzalo en varios pliegos de papel bond y seala con un mismo color los rganos pertenecientes a cada sistema. Se sugiere que elaboren un mapa conceptual por cada sistema (como el mapa del sistema digestivo de la pgina 298), para que despus los juntes e interrelaciones. Debes incluir todos los rganos y sistemas del cuerpo. Al final, en plenaria se presentar el mapa conceptual.

325

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Realiza una investigacin documental y llena el siguiente cuadro de los mtodos anticonceptivos

326

GUA METODOLGICA DE BIOLOGA

ACTIVIDAD Completa la tabla escribiendo el nombre de los rganos y las funciones que realiza cada sistema del cuerpo humano
SISTEMA RGANOS FUNCIN

Tegumentario

Muscular

seo

Digestivo

Respiratorio

Circulatorio

Linftico

Excretor

Nervioso

Endocrino

Reproductor

327

GUA METODOLGICA DE BIOLOGA

EVALUACIN A travs de esquemas impresos de cada uno de los sistemas del cuerpo humano se le indicar al alumno que identifique y escriba las estructuras que los componen. ACTIVIDADES DE APRENDIZAJE: Resolucin de las actividades de la Gua Metodolgica Elaboracin de modelos anatmicos Investigacin documental Reportes de laboratorio en V de Gowin Construccin de mapas mentales. Elaboracin de material de difusin. ACTIVIDAD ESPECFICA: Portafolio de evidencias Examen departamental tipo CENEVAL o PISA Laboratorio (evaluacin V-Gowin) Actividades de aprendizaje Actividad especfica por unidad

DIAGNSTICA

FORMATIVA

SUMATIVA

30% 20% 20% 30%

MATRIZ DE VALORACIN DE COMPETENCIAS Criterios Relaciona la estructura y funcin de los diferentes rganos y sistemas del cuerpo humano a travs de mapas mentales Ponderacin Logros: Pre-formal Identifica la estructura y la funcin de los diferentes sistemas del cuerpo humano a travs de mapas mentales. Receptivo Relaciona la estructura y funcin de algunos rganos de los sistemas del cuerpo humano a travs de mapas mentales Puntos 10 Resolutivo Relaciona la estructura y funcin de los rganos y algunos sistemas del cuerpo humano a travs de mapas mentales Autnomo Relaciona la estructura y funcin de los rganos y sistemas del cuerpo humano a travs de mapas mentales Estratgico Relaciona como la estructura de rganos y sistemas del cuerpo humano trabajan de manera conjunta desempeando una funcin coordinada. Puntos 30

Puntos 5

Puntos 20 Puntos 30 Aspectos a mejorar :

BIBLIOGRAFA BSICA Atlas Visual del Cuerpo Humano (2009). Arquetipo Grupo Editorial. Reimpresin. Audesirk , T. y Byers, B. (2008). Biologa. Ciencia y Naturaleza. Segunda Edicin. PearsonPrentice Hall.
328

GUA METODOLGICA DE BIOLOGA

Tortora, Gerald y J. Anagnostakos, J. (2011). Introduccin al Cuerpo Humano. Fundamentos de Anatoma y Fisiologa, sptima edicin. Ed. Mdica Panamericana. Tortora, Gerald y J. Anagnostakos, J. (2011). Principios de Anatoma y Fisiologa. 11 edicin. Ed. Mdica Panamericana. Tres Guerras Jess: (2009) Anatoma y Fisiologa del Cuerpo Humano. Ed. Mc. Graw Hill/ Interamericana. Espaa.

BIBLIOGRAFA COMPLEMENTARIA

Atlas visual de las ciencias. (2007). Revista On Line de Educacin. www. Grupo Docente.com. Editorial ocano. Geneser, Finn. (2000). Histologa, Tercera Edicin, Ed. Mdica Panamericana. Gilroy, Anne M. Prometeheus: (2011) Atlas de Anatoma Fichas de autoevaluacin. Ed. Mdica Panamericana. Kardong, Kenneth V. (1999). Anatoma Comparada, funcin, evolucin. Primera Edicin en espaol, Ed.McGraw-Hill/Interamericana. Espaa. Nelson, Gideon E. (2002) Principios de Biologa. 3ra. Reimpresin de la Segunda Edicin, Editorial Limusa Willey. Mxico. Villee, Claude A. (2000) Biologa. Octava Edicin. Editorial Mc Graw-Hilll,

VIDEOS RECOMENDADOS Atlas del Cuerpo Humano. Discovery Channnel. Vol. 4 La piel (DVD en espaol) Atlas del Cuerpo Humano. Discovery Channnel. Vol. 5 Glndulas y Hormonas (DVD en espaol) La Increble Mquina Humana. National Geographic Cuerpo humano. Planeta de Agostini. Universo Interior. Video Shark.

TICs http://kidshealth.org/teen/en_espanol/cuerpo/lungs_esp.html
329