GUÍA METODOLÓGICA DE BIOLOGÍA

BENEMÉRITA UNIVERSIDAD AUTÓNOMA DE PUEBLA

Benemérita Universidad Autónoma de Puebla
VICERRECTORÍA DE DOCENCIA
DIRECCIÓN GENERAL DE EDUCACIÓN MEDIA SUPERIOR

GUÍA METODOLÓGICA DE BIOLOGÍA
PLAN 06

AUTORES

PASCUAL VICENTE MUÑOZ MA. DOLORES RAMOS VERA JORGE ANTONIO VIDAL ARGÜELLO MIRIAM ROMERO TORRES

AGOSTO 2011

GUÍA METODOLÓGICA DE BIOLOGÍA

GUÍA METODOLÓGICA DE BIOLOGÍA, PLAN 06

Dr. Roberto Enrique Agüera Ibañez
RECTOR

Dr. José Ramón Eguibar Cuenca
SECRETARIO GENERAL

Ma. Esther Gámez Rodríguez
ABOGADA GENERAL

Mtro. José Jaime Vázquez López
VICERRECTOR DE DOCENCIA

Lic. Jorge Luis Lima Villegas
DIRECTOR GENERAL DE EDUCACIÓN MEDIA SUPERIOR

Lilián Ruiz Córdoba
SECRETARIA ACADÉMICA DE LA DGEMS

Esta guía metodológica se elaboró en la Dirección General de Educación Media Superior de la Benemérita Universidad Autónoma de Puebla

D.R. © BENEMÉRITA UNIVERSIDAD AUTÓNOMA DE PUEBLA CALLE 4 SUR 104, COL CENTRO C.P. 72000. PUEBLA, PUE. MÉXICO AGOSTO DE 2011

2

GUÍA METODOLÓGICA DE BIOLOGÍA

PRESENTACIÓN
El trabajo que a continuación se presenta es producto de la conjunción entre los objetivos trabajados en ciclos anteriores con el modelo constructivista del conocimiento dentro del Modelo Universitario Minerva de la Benemérita Universidad Autónoma de Puebla y el enfoque en el desarrollo de competencias de acuerdo a la Reforma Integral de la Educación Media Superior (RIEMS), integrando la Asignatura de Biología al Marco Curricular Común (MCC) que permitirá dar en un futuro la flexibilidad y el enriquecimiento del currículo del bachillerato. Los bloques que se presentan son los siguientes: BLOQUE 1. LA BIOLOGÍA COMO CIENCIA BLOQUE 2. CÉLULA, ESTRUCTURA Y FUNCIÓN BLOQUE 3. HERENCIA Y VARIACIÓN BLOQUE 4. LA EVOLUCIÓN DE LOS SERES VIVOS BLOQUE 5. BIODIVERSIDAD Y MEDIO AMBIENTE BLOQUE 6. INTRODUCCIÓN A LA ANATOMÍA Y FISIOLOGÍA HUMANA En cada bloque se especifican las competencias genéricas y sus atributos, posteriormente se presentan las tablas de objetivos específicos; conocimientos previos, declarativos, procedimentales y actitudinales/valorales, así como los contenidos específicos, mapas conceptuales, los criterios de evaluación de acuerdo al Programa de Estudios de la Asignatura, orientaciones didáctico-pedagógicas y la bibliografía, vínculos a sitios web de interés (TIC’s y TAC’s) y material audiovisual para desarrollar las actividades. Bloque 1. La Biología como Ciencia. Analiza a la Biología como una ciencia construida desde lo social y fundamentada en paradigmas, para reconocerse como un ser biológico y social, contrastando el carácter intra e interdisciplinario de esta ciencia con otras.

3

GUÍA METODOLÓGICA DE BIOLOGÍA

Bloque 2. Célula, Estructura y Función. Relaciona la composición química con la estructura y fisiología celular, para valorar la importancia de la célula como unidad estructural y funcional de los seres vivos a través del análisis de los procesos celulares. Bloque 3. Herencia y Variación. Investiga los fundamentos que permiten delinear las bases genéticas de la herencia para argumentar su desarrollo histórico, así como su impacto en la vida actual, valorando la trascendencia del proyecto genoma humano y su alcance en las aplicaciones de la biotecnología a través de la resolución de problemas, elaboración de cariotipos y la realización de un ensayo. Bloque 4. Evolución de los Seres Vivos. Investiga las principales teorías sobre el origen y evolución de los seres vivos para explicar la diversidad, a través de la comparación de los cambios genéticos, que han manifestado a través del tiempo. Bloque 5. Biodiversidad y Medio Ambiente. Interrelaciona el medio ambiente y su biodiversidad con el flujo de materia y energía de cada ecosistema para ubicarlos y valorar el equilibrio de la biosfera a través de una visita guiada a áreas naturales y la elaboración de un mapa mental integrador. Bloque 6. Introducción a la Anatomía y Fisiología Humana. Identifica la organización del cuerpo humano y la función que desempeñan los sistemas en el mantenimiento de la homeostasis del mismo, para tomar decisiones en el cuidado de su cuerpo a través del uso de modelos anatómicos.

4

GUÍA METODOLÓGICA DE BIOLOGÍA

JUSTIFICACIÓN

El nivel educativo medio superior en México emprende una transformación de fondo a través de la Reforma Integral de la Educación Media Superior (RIEMS) acordada en 2008 entre la Asociación Nacional de Universidades e Instituciones de Educación Superior (ANUIES) y la Secretaría de Educación Media Superior de la Secretaría de Educación Pública (SEP – SSEMS), en dicha reforma, la vertiente más relevante lo es la orientación pedagógica educativa basada en el desarrollo de competencias; enfoque cuyas intenciones es demasiado pertinente en un país como México, en donde se requiere de la formación de personas capaces de dirigir una nación hacia la búsqueda de verdaderos cambios que se reflejen primeramente en el individuo y posteriormente en la sociedad de la que forma parte. Por consiguiente, se requiere de la formación integral, partiendo necesariamente desde la convivencia con prácticas o actividades de aprendizaje implementadas en primer lugar para el crecimiento en el factor desarrollo humano, en este caso específico del estudiante, a quien se le prepara a ser una persona diferente, con actitud propositiva, en la mirada de mejorar su realidad, en diversos casos, de los cuales pueden mencionarse: el contribuir al desarrollo sustentable, a propiciar una sociedad democrática, utilizar de forma responsable la tecnología, y conformar un proyecto de vida que implique dar respuesta a los retos que le corresponde vivir. Ante este compromiso, la asignatura de Biología que se imparte en el segundo año del Plan de estudios 06 del nivel medio superior de la Benemérita Universidad Autónoma de Puebla (BUAP), busca al igual que las otras asignaturas del plan curricular de contribuir en la preparación de ciudadanos que necesita la sociedad, la cual es cada vez más compleja y demandante. En este tenor, la asignatura se ubica dentro de tres marcos que son:
5

GUÍA METODOLÓGICA DE BIOLOGÍA

• Marco mundial, en donde el fenómeno de la globalización permea el ambiente educativo a través de la incorporación de una cultura científica nacional, que rescata como eje de apoyo los mejores conocimientos elaborados en el mundo, encaminando su aplicación a formar personas críticas, creativas, competentes, capaces de incidir en aquellos ámbitos en los que se desenvuelve para mejorar su entorno nacional. • Marco nacional, que se caracteriza por la RIEMS que establece Competencias a desarrollar en el estudiante y docente; constituyendo así el marco curricular común del Sistema Nacional de Bachillerato. Esta educación en competencias enfatiza el acento en el “Saber Hacer”, es decir, visualizar la movilización práctica y no ociosa de los conocimientos, habilidades, aptitudes y actitudes que el estudiante aprende a través de su formación escolar, en donde éste sea capaz de aplicarlos en la solución de problemas y/o retos que se le presentan en la vida académica, cotidiana y más allá de su trayectoria escolar. • Marco institucional, constituyéndose en el Modelo Universitario Minerva (MUM), cuyo sustento base lo es el enfoque metodológico constructivista sociocultural, orientación que el nivel medio superior universitario manifiesta en el desglose de su mapa curricular, a la vez derivándose en un equilibrio entre las aéreas de Ciencias Naturales y Exactas, Ciencias Sociales, Lenguaje y Humanidades. Asimismo se establece un tronco común, que incluye la readecuación y adaptación de los programas de diversas asignaturas con la finalidad de brindar a los estudiantes una educación que les permita una vez que egrese del nivel medio superior, acceder de forma crítica y ética al nivel superior y/o incorporarse al campo laboral. Bajo este contexto, la asignatura de Biología ofrece junto con las demás asignaturas en su relación interdisciplinar, transdisciplinar y transversalidad saberes que contribuyen al crecimiento cognitivo y cognoscitivo del estudiante

6

implica el dominio de las principales metodologías y enfoques propios de distintas áreas de conocimiento. además tienen un enfoque práctico en distintos contextos. Específicamente la Biología pertenece al área de las ciencias experimentales. y social. habilidades. aplicar y transformar en contextos específicos. pero no imposible. Dicho de otra manera. no puede ser concebida sin la aplicación de actividades experimentales de sus contenidos. La idea principal es avanzar hacia la preparación de individuos con cualidades individuales. resolución de problemas cotidianos y la comprensión racional de su entorno. Y las Disciplinares que capacitan al estudiante para procesar. a través de una serie de actividades que le permitan el desarrollo y adquisición de competencias indispensables para la vida.GUÍA METODOLÓGICA DE BIOLOGÍA hacia su aprendizaje y autoaprendizaje y a la generación de conocimientos que va a favorecer al avance de la cultura. Por lo que implica generar ambientes de aprendizaje en donde se pretende desarrollar un conjunto de competencias que integran conocimientos. la ciencia y la tecnología. útiles a lo largo de la vida. de carácter ético. Por su carácter experimental. como son las de tipo: Genérico que describen fundamentalmente conocimientos. contribuir y desarrollar la formación por competencias es tarea compleja. sin omitir el rigor de las disciplinas y favorece acciones responsables hacia el medio ambiente y a sí mismo. académico. que están orientadas hacia la aplicación de métodos y procedimientos de las ciencias. 7 . a fin de propiciar la formación integral del estudiante. actitudes y valores integrados que permiten la realización de diversos desempeños o tareas. habilidades y actitudes. el conocimiento organizado en las disciplinas.

“Cultura Física” e “Informática” en segundo año ASIGNATURAS PRECEDENTES: Química. Educación Ambiental y Salud. “Psicología y Desarrollo Humano” en primer año. y una relación horizontal con “Matemáticas”.GUÍA METODOLÓGICA DE BIOLOGÍA PROGRAMA EDUCATIVO (PE): NIVEL MEDIO SUPERIOR ASIGNATURA: BIOLOGÍA CÓDIGO: PROG 0015 NIVEL: MEDIO SUPERIOR CRÉDITOS: 10 UNIDAD ACADÉMICA: PROGRAMA EDUCATIVO: MODALIDAD EDUCATIVA: NIVEL EDUCATIVO: CÓDIGO: NOMBRE DE LA ASIGNATURA: UBICACIÓN EN EL MAPA CURRICULAR: NIVEL MEDIO SUPERIOR PLAN 06 ESCOLARIZADA BACHILLERATO 0015 BIOLOGÍA SEGUNDO AÑO CORRELACIÓN: La relación vertical que tiene este programa con respecto a su ubicación en el mapa curricular es con “Química”. Psicología y Desarrollo Humano ASIGNATURAS CONSECUENTES: Física. “Física” y materias propedéuticas como “Educación Ambiental y para la Salud”. “Temas Selectos de Biología” y “Bioquímica” en tercer año. Temas Selectos de Biología y Bioquímica. CARGA HORARIA DEL ESTUDIANTE TEORÍA HORAS CRÉDITOS PRÁCTICA HORAS CRÉDITOS ESTUDIO INDEPENDIENTE HORAS CRÉDITOS TOTAL HORAS CRÉDITOS 4 2 6 10 8 .

1 ¿Qué relación tiene la Biología con el desarrollo social 1.4 ¿Cuál es la importancia de la Biología en la solución de problemas del entorno social? 1.1 ¿Cuáles hechos históricos condujeron al planteamiento de la Teoría Celular? 2.6 ¿Cuál es la relación tejido-órgano-sistema? 40 45 48 50 80 86 88 BLOQUE 3 .5 ¿Cómo se pasa de una célula a la pluricelularidad? 2.3 ¿Cómo está estructurada y cómo funciona una célula? 2.5 ¿Cuáles son las características de los niveles de organización de la materia? 3 5 9 11 12 16 17 25 30 35 BLOQUE 2 – CÉLULA.GUÍA METODOLÓGICA DE BIOLOGÍA ÍNDICE Presentación Justificación Índice Propósitos BLOQUE 1 – LA BIOLOGÍA COMO CIENCIA 1.4 ¿Cómo se reproducen las células? 2.6 ¿Cuáles son las aplicaciones más importantes de la Genética? 9 92 97 100 101 102 113 119 .1 ¿Cuáles hechos históricos condujeron al desarrollo de la Genética? 3.3 ¿Cuál es el objeto de estudio de la Biología? 1.3 ¿En qué consisten las leyes establecidas por Mendel sobre la herencia? 3. ESTRUCTURA Y FUNCIÓN 2.5 ¿Qué es una mutación? 3.2 ¿Qué diferencias y similitudes encontramos en los conceptos de Genética? 3.HERENCIA Y VARIACIÓN 3.2 ¿Qué diferencia hay entre célula procarionte y eucarionte? 2.2 ¿Cuáles son los paradigmas en los que se basa de la Biología? 1.4 ¿Qué diferencia hay entre los patrones hereditarios mendelianos y los no mendelianos? 3.

7 ¿Cómo funciona el sistema linfático? 6.5 ¿Cuáles son las evidencias de la evolución? 135 139 139 144 148 156 BLOQUE 5 – BIODIVERSIDAD Y MEDIO AMBIENTE 5.5 ¿Cuál es la dinámica de los ecosistemas? 5.4 ¿Cómo funciona el sistema digestivo? 6.9 ¿Cómo funciona el sistema nervioso? 6.5 ¿Cómo funciona el sistema respiratorio? 6.2 ¿Cómo funciona el sistema muscular? 6.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 4 – EVOLUCIÓN DE LOS SERES VIVOS 4.3 ¿Cuál es el sistema actual de clasificación de los seres vivos? 5.11 ¿Cómo funciona el sistema reproductor? 281 286 288 291 294 298 300 304 305 307 315 320 10 .7 ¿Cuáles son las grandes divisiones de la biósfera? 180 185 191 195 232 248 257 265 BLOQUE 6 – INTRODUCCIÓN A LA NATOMÍA Y FISIOLOGÍA HUMANA 6.1 ¿Cómo funciona el sistema tegumentario? 6.8 ¿Cómo funciona el sistema excretor? 6.3 ¿Cómo funciona el sistema óseo? 6.3 ¿Cómo se originaron las células eucariontes? 4.4 ¿Cómo explica la evolución la diversidad de los seres vivos? 4.1 ¿Cómo se clasifican a los seres vivos? 5.2 Los virus ¿vivo o no vivo? 5.6 ¿Cómo se equilibran los ciclos biogeoquímicos? 5.10 ¿Cómo funciona el sistema endócrino? 6.4 ¿Cómo se relaciona la biodiversidad con el medio ambiente? 5.1 ¿Qué es la evolución biológica? 4.6 ¿Cómo funciona el sistema circulatorio? 6.2 ¿Cómo se originó la vida? 4.

5. Atributos: 5. 5. Disciplinares Básicas 1.3 Asume una actitud constructiva. jerarquías y relaciones. 13. Atributos: 6. 8. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo. definiendo un curso de acción con pasos específicos. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. considerando otros puntos de vista de manera crítica y reflexiva.5 Sintetiza evidencias obtenidas mediante la experimentación para producir conclusiones y formular nuevas preguntas. 6. Desarrolla innovaciones y propone soluciones a problemas a partir de métodos establecidos. biológica. física y ecológica de los sistemas vivos. Obtiene. Fundamenta opiniones sobre los impactos de la ciencia y la tecnología en su vida cotidiana. Rectifica preconcepciones personales o comunes sobre diversos fenómenos naturales a partir de evidencias científicas. 14. 5. 11 . Identifica problemas. 12. coherente y sintética. 5.GUÍA METODOLÓGICA DE BIOLOGÍA PROPÓSITOS DE LA ASIGNATURA: Analizar los conceptos y procesos biológicos sustentados en el respeto hacia la vida y su entorno. Diseña modelos o prototipos para resolver problemas. 6.2 Toma decisiones a partir de la valoración de las consecuencias de distintos hábitos de consumo y conductas de riesgo. asumiendo consideraciones éticas. para generar mejores explicaciones de los fenómenos que se llevan a cabo en los seres vivos de manera crítica.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. Sustenta una postura personal sobre temas de interés y relevancia general. 4.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad.2 Ordena información de acuerdo a categorías. 9. 7. consultando fuentes relevantes y realizando experimentos pertinentes. formula preguntas de carácter científico y plantea las hipótesis necesarias para responderlas. sus procesos vitales y el entorno al que pertenece. instrumentos y equipo en la realización de actividades de su vida cotidiana. Atributos: 8. 2. satisfacer necesidades o demostrar principios científicos. Emite juicios de valor sobre la contribución y alcances de la ciencia como proceso colaborativo e interdisciplinario en la construcción social del conocimiento. actitudes y valores. Participa y colabora de manera efectiva en equipos diversos. Analiza las leyes generales que rigen el funcionamiento del medio físico y valora las acciones humanas de impacto ambiental. Relaciona los niveles de organización química.1 Propone maneras de solucionar un problema o desarrollar un proyecto en equipo. 6. Aplica normas de seguridad en el manejo de sustancias. Competencias a desarrollar en la Asignatura: Genéricas 3.2 Evalúa argumentos y opiniones e identifica prejuicios y falacias. a través de la movilización de conocimientos.4 Estructura ideas y argumentos de manera clara. registra y sistematiza la información para responder a la pregunta de carácter científico. Atributos: 3. habilidades. reflexiva y creativa aplicándolas en la resolución de problemas en diversos contextos. 8. Elige y practica estilos de vida saludables. 11.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 1 La Biología como ciencia 12 .

GUÍA METODOLÓGICA DE BIOLOGÍA 13 .

Interrelaciona la Biología. definiendo un curso de acción con pasos específicos. 8. Fomenta la tolerancia y disponibilidad en el trabajo colaborativo durante la realización de proyectos. 4. Reflexiona de manera informada y crítica sobre las implicaciones de la investigación científica en los diferentes ámbitos social. • • • 5. Analiza los cuatro paradigmas que dan el carácter de cientificidad a la Biología. 5. Actitudinales/ Valorales Valora el impacto de los avances de la Biología en la sociedad actual. registra y sistematiza la información para responder a la pregunta de carácter científico. consultando fuentes relevantes y realizando experimentos pertinentes. Argumenta la relación que existe entre la Biología con la Tecnología y la Sociedad. formula preguntas de carácter científico y plantea las hipótesis necesarias para responderlas. Construye un mapa mental de la interrelación de la Biología. Jerarquiza los niveles de organización de la materia viva Explica las características distintivas de los seres vivos y las ejemplifica. para reconocerse como un ser biológico y social. Emite juicios de valor sobre la contribución y alcances de la ciencia como proceso colaborativo e interdisciplinario en la construcción social del conocimiento. Fundamenta el campo de acción de la Biología y sus principales ramas. Obtiene. familiar y personal. 14 . jerarquías y relaciones.1 Propone maneras de solucionar un problema o desarrollar un proyecto en equipo.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. CRITERIOS DE DESEMPEÑO Contrasta los paradigmas de la Biología a través de un debate en plenaria Emplea el método científico para desarrollar un proyecto de investigación. Identifica problemas. Declarativos Conceptúa a la Biología como una ciencia. Contrasta los paradigmas de la Biología a través de un debate en plenaria Emplea el método científico para desarrollar un proyecto de investigación. contrastando el carácter intra e interdisciplinario de esta ciencia con otras.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE 1: LA BIOLOGÍA COMO CIENCIA TIEMPO: 18 horas UNIDAD DE COMPETENCIA: Analiza a la Biología como una ciencia construida desde lo social y fundamentada en paradigmas. COMPETENCIAS Genéricas/Atributos Disciplinares 5. sus ramas y ciencias auxiliares a través de la elaboración de un mapa mental. 1. SABERES Procedimentales Investiga las aportaciones y aplicaciones de la Biología y sus ramas por medio de un glosario. sus ramas y ciencias auxiliares.2 Ordena información de acuerdo a categorías.

• Mapa mental acción (BOA) • Libros y Revistas • Asesoría metodológica y • Proyecto de electrónicas. Escribe el nombre de tres científicos que hayan contribuido al estudio de la Biología _______________________________________________________________________ 3. Escribe cuáles son los pasos del método científico _______________________________________________________________________ _______________________________________________________________________ 15 . • Artículos de divulgación • Debate • Proyecto de investigación temática • Curso extracurricular investigación en revistas científicas • Pintarrón sobre metodología de la investigación EXPLORANDO TUS CONOCIMIENTOS 1. ¿Qué estudia la Biología? _______________________________________________________________________ 2. Escribe una aplicación de algún conocimiento o descubrimiento biológico que conozcas _______________________________________________________________________ _______________________________________________________________________ 5. ¿Con qué ciencias se relaciona la Biología? _______________________________________________________________________ 4.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • Clase Magistral • Base orientadora de la ESTRATEGIAS DE APRENDIZAJE • Glosario • Mapa mental • Debate RECURSOS DIDÁCTICOS • Guía metodológica • Internet EVIDENCIAS Y/O PRODUCTOS • Actividades de la guía metodológica del alumno.

Ya vimos que la Biología es una ciencia muy extensa. Matemáticas. la interacción con el medio y con otros organismos. teorías y principios y varios enfoques metodológicos para abordar el estudio de la vida. Geografía. LA BIOLOGÍA DENTRO DEL CONTEXTO DE OTRAS CIENCIAS La Biología es una ciencia tan compleja que para alcanzar sus objeticos.GUÍA METODOLÓGICA DE BIOLOGÍA 1. Además. la evolución. Historia. Surge de manera formal en el siglo XIX y ha definido su objeto de estudio a lo largo de la historia. Las ciencias que auxilian a la Biología para lograr investigaciones completas se denominan ciencias auxiliares. la agricultura y la cría y mejora de animales. la ingeniería genética. se apoya en otras disciplinas científicas. como la medicina. integra temas fundamentales en el estudio de los organismos. la herencia. entre otras. ha establecido conceptos. se ha transformado en una ciencia que busca comprender las funciones y las estructuras de los seres vivos. Tiene también una amplia gama de aplicaciones prácticas y ha contribuido al desarrollo de una gran cantidad de campos aplicados. Física. 16 . donde el conocimiento biológico es fundamental. la biotecnología. La Biología en la actualidad ha conformado una gran trama conceptual y metodológica que ha logrado comprender y explicar la enorme complejidad de los seres vivos. Este campo de conocimiento que inició como la descripción y la clasificación del mundo viviente. con ramas muy variadas que se dividen a su vez en otras disciplinas. Las principales se enuncian a continuación: Química. como son: el desarrollo. sus conocimientos tienen importantes consecuencias en la sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el uso de los recursos naturales.1 ¿QUÉ RELACIÓN TIENE LA BIOLOGÍA CON EL DESARROLLO SOCIAL? La Biología es la ciencia que estudia a los seres vivos.

Relaciones evolutivas entre los seres vivos Funciones orgánicas de los seres vivos Herencia de los caracteres biológicos Estructura y funciones de los tejidos Estructura de los seres vivos. es decir. métodos y objetos de estudio.2 ¿CUÁLES SON LOS PARADIGMAS EN LOS QUE SE BASA LA BIOLOGÍA? Han existido una gran cantidad de investigaciones en los diferentes campos de estudio de la Biología. grandes programas de investigación que se encuentran en el origen de la Biología moderna son los siguientes: 17 . Desarrollo de los óvulos fecundados Comportamiento animal Variación de las especies a lo largo del tiempo. Vida en el pasado Clasificación y nomenclatura de los seres vivos Virus Animales 1.GUÍA METODOLÓGICA DE BIOLOGÍA RAMA Anatomía Bacteriología Bioquímica Botánica Citología Ecología Embriología Etología Evolución Filogenia Fisiología Genética Histología Morfología Paleontología Taxonomía Virología Zoología OBJETO DE ESTUDIO Estructura de los organismos Bacterias Composición química de la materia viva Plantas Estructura y funciones de las células Ecosistemas. sin embargo las que se retoman por su gran contribución al campo de estudio de la Biología ya que se definieron nuevos conceptos.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Haz una investigación documental de otras ramas de la Biología que no estén en el cuadro anterior y llénalo en la siguiente tabla Rama Objeto de estudio 18 .

¿Cómo puede contribuir la Genética a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 19 .GUÍA METODOLÓGICA DE BIOLOGÍA Responde las siguientes preguntas 1. ¿Cómo puede contribuir la bioquímica a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 3. ¿Cómo puede contribuir la entomología a las investigaciones de otras ciencias? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ 2.

lo que se considera científico —o más en particular. como modelo de problemas y soluciones de una sociedad científica determinada. de la regulación del medio interno de los organismos. En este orden de ideas. coautor quien llegó a las mismas conclusiones de manera independiente a Darwin. La Biología se constituyó como ciencia hasta el siglo XIX en un proceso que inició en 1838 con la formulación de la teoría celular y que culminó en 1900 con el descubrimiento de las leyes de la herencia. los conceptos y las teorías. De esta manera. enunciado por Claude Bernard y contenido en la 20 . los datos empíricos. El paradigma incluye los problemas relevantes a resolver. aunque es rechazada por ciertos sectores. quienes escriben la versión definitiva de su enunciado en 1839 (fig. A esta teoría hay que añadir a Alfred Rusell Wallace. la cual. lo objetivo— queda determinado por las convenciones de los miembros de la comunidad y así resulta imposible decidir la superioridad científica de un paradigma sobre otro. esto es. que abordan problemas de carácter general y que por ello se denominan como paradigmas globales de la Biología. los criterios y juicios de valor compartidos por la comunidad. los procedimientos experimentales. las formas reconocidas como válidas para solucionarlos.GUÍA METODOLÓGICA DE BIOLOGÍA • • • • Teoría Celular Teoría de la evolución Teoría del gen Teoría de la homeostasis El paradigma constituye un cuerpo de conocimientos teóricos y metodológicos que son reconocidos durante cierto tiempo. etc. Es en esta etapa cuando se formulan paradigmas de orden superior. genera una polémica que ya se da en el seno de una comunidad científica constituida. siendo en este periodo cuando por vez primera contamos con conceptos unificadores de orden general y con una posible aceptación universal. esto es. 3. el primer paradigma global es la teoría celular formulada por Teodoro Schwann y Matias J Schleiden.3) El segundo paradigma es la teoría de la evolución formulada por Charles Darwin en su obra El origen de las especies (1859). El tercer paradigma es la teoría de la homeostasis.

Prefijo significado ejemplo significado a anti auto bio cito cloro di. en el texto Experimentos sobre Hibridación de las Plantas.GUÍA METODOLÓGICA DE BIOLOGÍA obra Lecciones sobre los Fenómenos de la Vida Comunes a los Animales y los Vegetales. publicado en 1878. Erich Tschermak y Hugo De Vries. opuesto por si mismo vida célula verde dos verdadero vegetal luz sangre relativo a plantas diferente agua 21 . ACTIVIDAD Completa la siguiente tabla con la información que se te solicita. pero que carece de impacto científico hasta su redescubrimiento en 1900 al haber llegado a esas mismas conclusiones Carl Correns. El cuarto paradigma son las leyes de la herencia formuladas por el monje agustino Gregorio Mendel en 1865. bi eu fito foto hemo herb hetero hidro sin contra. Dicha información debe estar relacionada con la asignatura de Biología. Investiga y añade 10 prefijos y sufijos distintos a los mostrados.

GUÍA METODOLÓGICA DE BIOLOGÍA hiper hipo por encima de por debajo de homeo igual homo iso macro micro poli proto igual igual grande pequeño muchos primero pseudo "falso vita zoo vida animal Sufijo dermis piel fago fase significado ejemplo significado comida estado 22 .

producción inflamación rompimiento estudio de medición condición. 23 . enfermedad pie alimento ACTIVIDAD En cada espacio escribe el nombre de cada uno de los paradigmas de la biología. afín a origen. su autor(es) y el año de su creación. Escribe en cada inciso la relación existente entre los dos paradigmas interrelacionados según indican las flechas.GUÍA METODOLÓGICA DE BIOLOGÍA filo gen itis lisis logía metro osis podo trofos que lo atrae.

GUÍA METODOLÓGICA DE BIOLOGÍA a) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ b) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ c) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ d) ___________________________________________________________________________________ 24 .

A pesar de su enorme diversidad. qué puedes concluir al término de está actividad con respecto a los paradigmas de la Biología ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ 1.GUÍA METODOLÓGICA DE BIOLOGÍA ___________________________________________________________________________________ ________________________________________________________________________________ e) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ f) ___________________________________________________________________________________ ___________________________________________________________________________________ ________________________________________________________________________________ Finalmente. Los seres vivos tienen una estructura organizada. en tanto que una piedra o el agua de lluvia no lo son. pues ésta permite 25 . Éstas son las siguientes: Organización. a partir de ella. la organización se hace más compleja. un rosal o una gallina son seres vivos. los seres vivos de nuestro planeta comparten una lista de características que los distinguen como tales. Su unidad primordial es la célula.3 ¿CUÁL ES EL OBJETO DE ESTUDIO DE LA BIOLOGÍA? Cualquier persona puede reconocer que una hormiga.

Tu cuerpo está formado por sustancias en constante transformación. que orientan sus hojas hacia la luz. Multiplican su número de células a partir de una sola. participan en reacciones químicas. los osos polares tienen una gruesa capa de grasa bajo la piel que los ayuda a sobrevivir en temperaturas por debajo de los cero grados centígrados. Tú crecerás varios centímetros más y al llegar a cierta edad. es decir. Esto hace suponer que todos los seres vivos tienen un mismo origen: una especie que evolucionó de maneras distintas para dar lugar a la enorme cantidad de especies. Irritabilidad. o al menos una parte de él. A pesar de que algunos objetos no vivos pueden tener una o más de estas características (algunos cristales de roca pueden crecer. Adaptación.GUÍA METODOLÓGICA DE BIOLOGÍA generar tejidos. El conjunto de reacciones químicas ocurridas en un ser vivo se lama metabolismo. las plantas crecen en dirección a la luz y las personas nos rascamos cuando nos pica un mosquito. En tu interior éstas se combinan y se descomponen. tu crecimiento se detendrá. Tu cuerpo está formado por células que a su vez constituyen tejidos (como la piel) órganos como el corazón). ¿Has observado cachorros de algunas mascotas? Crecimiento. Movimiento. como las plantas. Por ejemplo. Generalmente el movimiento ocurre para conseguir alimento. únicamente los seres vivos las reúnen todas. protegerse para huir de algún depredador. Es la facultad de desplazar el cuerpo de un punto a otro. Los seres vivos tienen capacidad para adaptarse y sobrevivir en un ambiente determinado.1) 26 . 1. Responden a estímulos del medio ambiente. lo que los hace crecer. órganos y sistemas. las cuales obtienes mediante la alimentación y la respiración. Por ejemplo. Los seres vivos producen descendencia similar a ellos. A esa primera especie se le llama ancestro común y una prueba irrefutable de su existencia es que todos los seres vivos del planeta usan la misma sustancia química para heredar sus características: el ácido desoxirribonucleico (ADN) (fig. Reproducción. Metabolismo.

1 lombriz de tierra. ACTIVIDAD ESPECÍFICA . __________________________________________________________________________ __________________________________________________________________________ c) ¿Cuál es la unidad fundamental de la que estamos constituidos todos los seres vivos? ____________ .PROYECTO EN MI CONTEXTO Por equipo. a) ¿La roca posee alguna característica por la que pudiera ser considerada ser vivo?. Organizados en equipos.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD 1. 1 planta. 2. escojan un tema sobre Biología que les guste para trabajar un proyecto que desarrollarán durante esta unidad. ¿por qué? __________________________________________________________________________ __________________________________________________________________________ b) Para que se considere que un ser está vivo. observen con una lupa las características de 1 roca. puede tener una sola de las características analizadas o debe tenerlas todas? Explícalo.. Considera los siguientes aspectos para desarrollarlo 27 . En el siguiente cuadro comparativo de los tres objetos de estudio marquen el recuadro que señale la característica correspondiente que posea.

la metodología. su contribución al conocimiento es limitado. Fuentes de información Las fuentes de información son muy pocas o ninguna. Algunas fuentes no son confiables por lo que no contribuyen al desarrollo del tema. resolver el problema. motiva la investigación y contribuye de manera satisfactoria al conocimiento.GUÍA METODOLÓGICA DE BIOLOGÍA RÚBRICA PARA EVALUAR UN PROYECTO DE INVESTIGACIÓN Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Asignatura: PONDERACIÓN CRITERIOS EXCELENTE (4) MUY BIEN (3) La pregunta o problema es relevante y aunque motiva la investigación. Si utiliza fuentes. pero su solución es predecible y su contribución al conocimiento es limitado. La información recopilada tiene relación con el tema pero algunas no están al día o no son relevantes. la establece. pero metodología y tiene dificultad para criterios a ser establecer los utilizados. Las fuentes son confiables y contribuyen al desarrollo del tema. Tiene adecuada para dificultad resolver el problema. la investigación. TOTAL El Problema o la pregunta La pregunta y el problema son relevantes. pero establece la tiene dificultad para metodología a establecer los utilizar o ésta no es criterios. DEFICIENTE (1) La pregunta o problema tiene muy poca o ninguna relevancia y posibilidad de solución. Las fuentes de información son variadas y múltiples. El propósito de la investigación no es Establece el propósito claro o no se de la investigación. son apropiados para el problema. éstas no son confiables ni contribuyen al tema. La criterios a ser metodología utilizados. Las fuentes son confiables (aceptadas dentro de la especialidad) y contribuyen al desarrollo del tema. seleccionando la No establece los metodología para criterios o éstos no resolver el problema. Establece el Establece el propósito de la propósito de la investigación. La información recopilada tiene relación con el tema. No motiva la investigación. Metodología de investigación Las fuentes de información son variadas y múltiples. 28 . La información tiene poca o ninguna relación con el tema principal. La utilizada es metodología utilizada adecuada para es adecuada para resolver el problema. La información recopilada es actualizada pero incluye algunos datos que no son relevantes o no tienen relación con el tema. Las fuentes de información son limitadas o poco variadas. No metodología. BIEN (2) La pregunta o problema es relevante. es relevante y actualizada.

. Tiene dificultad manteniendo objetividad al expresar las ideas y sustentando la conclusión con los datos. 2005) Referencias 29 . Mantiene objetividad en el análisis de los datos. Establece relaciones entre los datos (diferencias y similitudes). Recopila y organiza los datos de acuerdo al área de estudio. Tiene dificultad corroborando los datos y manteniendo la integridad en la recopilación de los mismos. Responde parcialmente a los objetivos o no responde. No sustenta la conclusión con los datos. Comentarios: REFERENCIAS: (Pimienta. Tiene dificultad sustentando la conclusión con los datos. También tiene dificultad relacionando los datos con el conocimiento previo Recopila muy pocos datos o ninguno. Tiene dificultad haciendo inferencias de los datos y relacionándolo con el conocimiento previo. Puede hacer inferencias de los datos. Análisis Responde a los objetivos.Tiene dificultad estableciendo relaciones entre los datos (diferencias y similitudes) y haciendo inferencias. No corrobora los datos y tampoco mantiene la integridad de los mismos. Total: Documentación Mantiene objetividad en el análisis de los datos. Mantiene objetividad en el análisis de los datos. Corrobora los datos. Responde a los objetivos.GUÍA METODOLÓGICA DE BIOLOGÍA Recopila y organiza los datos de acuerdo al área de estudio. 2005) (Pimienta. Establece relaciones entre los datos (diferencias y similitudes). Incluye fuentes de información que no están citadas en la investigación. Guía para la planeación docente. Mantiene objetividad al expresar las ideas. Corrobora los datos. Tiene dificultad documentando las fuentes de información o no las documenta. Los relaciona con el conocimiento previo. Tiene dificultad estableciendo relaciones entre los datos (diferencias y similitudes). Tiene dificultad utilizando los formatos del área de estudio en la citación de las fuentes. Conclusión Las fuentes de información están documentadas y propiamente citadas. Se sustenta con los datos. Constructivismo: Estrategias para aprender a aprender. Tiene dificultad manteniendo la integridad en la recopilación de los datos. Recopila y organiza los datos de acuerdo al área de estudio. Mantiene integridad en la recopilación de los datos.. Metodología Constructivista. Mantiene objetividad al expresar las ideas. Éstos tienen poca o ninguna credibilidad. Las fuentes de información presentan algunos errores. no los altera para su beneficio. Mantiene poca o ninguna objetividad en el análisis de los datos. No utiliza los formatos establecidos. Mantiene muy poca o ninguna objetividad al expresar las ideas. Responde a los objetivos. Las fuentes de información están documentadas. No puede hacer inferencias o relacionar los datos con el conocimiento previo.

C. han cambiado en diferentes épocas. TECNOLOGÍA Y SOCIEDAD La Biología es la ciencia que se encarga del estudio de los seres vivos y de los fenómenos y procesos que ocurren en los seres vivos. 30 . Aunque el término se utilizó por primera vez hasta el siglo XIX. y de logos. tratado o estudio. Al iniciar el camino de la racionalidad. La Biología en la actualidad ha conformado una gran trama conceptual y metodológica que ha logrado comprender y explicar la enorme complejidad de los seres vivos. por seguir un método que surge de la observación.GUÍA METODOLÓGICA DE BIOLOGÍA 1. de la comparación de hechos y de la aceptación o rechazo de argumentos para aceptar una idea como válida.5 ¿CUÁL ES LA IMPORTANCIA DE LA BIOLOGÍA EN LA SOLUCIÓN DE PROBLEMAS DEL ENTORNO SOCIAL? BIOLOGÍA. en función de factores científicos. la ciencia se convirtió en una actividad fundamental ya que planteó una alternativa a las posturas metafísicas para comprender el mundo que nos rodea. Las primeras explicaciones sobre el mundo natural recurrieron a la intervención de factores sobrenaturales. La Biología se cuestiona exclusivamente sobre el mundo natural y se caracteriza. Desde el año 580 a. la búsqueda de explicaciones sobre la naturaleza transitó por diferentes rutas hasta llegar a nuestra época en que la ciencia en general (y la biología en particular) se ha convertido en una actividad social fundamental. Para ello las comunidades de científicos han establecido normas y criterios que hacen que sus explicaciones tengan un considerable grado de certeza. al igual que las otras ciencias. Su definición deriva etimológicamente del griego bios. estos criterios no han sido siempre los mismos. hasta nuestros días. Sin embargo. donde el conocimiento biológico es fundamental. la disciplina se ejercía desde muchos años atrás con otros nombres. vida. A lo largo de la historia la búsqueda de conocimiento sobre la naturaleza ha sido abordada de muy diferentes formas y ha perseguido fines diversos. En la actualidad la ciencia ha eliminado estos elementos metafísicos y basa sus explicaciones en causas naturales. Además. sociales e históricos. filosóficos. sus conocimientos tienen importantes consecuencias en la sociedad ante la crisis ambiental y la necesidad de plantear nuevas estrategias en el uso de los recursos naturales.

La ciencia no es sólo un conjunto de diferentes formas de conocimiento. La Biología además ha promovido el desarrollo del quehacer humano con la generación de fármacos y vacunas para evitar enfermedades. La ciencia busca la organización sistemática del conocimiento acerca del mundo. Pero. a través de los años. con la creación y 31 . por lo tanto. pero una de sus intenciones es generar conocimiento nuevo acerca del universo. • Existe un único método para estudiar la realidad. Puede reelaborar problemas antiguos. Debido a esta situación se construyeron enfoques filosóficos que se propusieron explicar la actividad de los científicos. se convirtió en el método de demostración que establecía la diferencia entre la metafísica y la ciencia. • La actividad científica es socialmente neutra. La física. La ciencia es el resultado del esfuerzo de generaciones anteriores y la cooperación de las contemporáneas y éstas son fundamentales para su desarrollo futuro. su naturaleza es claramente social. El positivismo afirma que: • Las teorías se construyen a través del método experimental. se otorgaron grandes presupuestos para impulsarlas. uno de ellos fue el positivismo de Augusto Comte (1798-1857).GUÍA METODOLÓGICA DE BIOLOGÍA La Biología como ciencia surge de manera formal en el siglo XIX. ¿por qué se dice que la biología es una ciencia? ¿Qué es lo que caracteriza al conocimiento científico que lo hace distinto a otro tipo de conocimiento? ¿Cómo se construyen las teorías científicas? En el siglo XIX. la revolución industrial y la burguesía impulsaron de manera importante el desarrollo de las ciencias naturales. • La ciencia está formada por conocimientos verdaderos. que trascendió hasta nuestros días. cuando se define con precisión su objeto de estudio y se establecen referentes teóricos y metodológicos que unifican el estudio de los seres vivos. las ciencias que utilizaban el experimento comenzaron a destacar y a ofrecer resultados aceptables. pretende formular teorías que expliquen las relaciones que existen entre diferentes clases de fenómenos y procura explicar por qué los hechos ocurren de cierta manera y bajo ciertas condiciones. El método experimental cobró gran importancia y. sino que es también el producto de una actividad humana que tiene una naturaleza específica. y en algunos aspectos es una concepción que se mantiene en la enseñanza de la ciencia. la química y la biología servían para desarrollar la industria y.

GUÍA METODOLÓGICA DE BIOLOGÍA mejoramiento de nuevas cepas de organismos vivos de uso agrícola. En el caso de las leguminosas. El Proyecto Genoma Humano ha generado la participación de países de todo el mundo que colaboran de manera coordinada. un mapa físico de las posiciones reales. y la determinación de la secuencia de bases del ADN Novedades en la ciencia El Proyecto Genoma Humano se propuso en 1990 como un estudio a 15 años. en febrero de 1996 establecieron varios acuerdos los participantes (más de 2000 científicos de más de 20 institutos en 6 países). En el verano del año 2000 se publicó el genoma "en bruto". Desde entonces se abrieron varios caminos a seguir. ya que la información genética se considera como la "verdadera herencia" humana. Aunque en un principio se pensó que las aplicaciones y los beneficios serían inmediatos. Se ha calculado que más de 70 millones de toneladas de nitrógeno se incorporan anualmente a la biosfera mediante este proceso.000 millones de pares de bases. que tienen la capacidad de transformar el nitrógeno disuelto en el suelo en compuestos que las plantas pueden aprovechar (sales de amonio) y con ellos fabricar ácidos nucléicos (ADN y ARM) y proteínas (fijación del nitrógeno). 32 . donde el desarrollo de Terapia Génica o estudiando el genoma humano por completo ha abierto las posibilidades de evitar patologías asociadas a factores genéticos. de más de 3. donde habita la bacteria y pasa sales de amonio a la raíz. fácilmente se dieron cuenta de que hay mucho trabajo por delante. en el que se secuenciaría el genoma humano completo. se encuentran bacterias del genero Rhizobium. El primer cromosoma completo (el cromosoma humano 22) se publicó en diciembre de 1999. para abril de 2003 se terminó la secuencia completa y se publicó en agosto de 2004. para cumplir los objetivos planteados inicialmente: crear un mapa genético de los lugares relativos de los genes. Sin embargo. como el fríjol. Mediante una asociación simbiótica entre la bacteria y la raíz se forma una protuberancia. En un principio no quedaba claro si toda la información que se obtuviera sería del dominio público o solo propiedad de empresas privadas. Este tipo particular de bacterias que "infectan" al fríjol son de la especie Rhizobium etli. ganadero y forestal o incluso en campos como la Genómica. El más importante acuerdo fue que se proveería de una serie de datos para toda la comunidad científica.

como Brucella. aunque no son bacterias iguales. Esto sugiere que. De manera que se ha encontrado que una sección llamada "plásmido simbiótico" en las moléculas de ADN que porta la mayor parte de los genes involucrados en la capacidad de nodular al fríjol y fijar nitrógeno. Aunque en México se cuenta con un buen nivel de desarrollo científico y con la capacidad de vincularlo a la generación de nuevas tecnologías. LAS CARACTERÍSTICAS DE LA CIENCIA: EL MÉTODO CIENTÍFICO La ciencia (del latín scientia. Por ejemplo. podrían utilizar formas comunes para interactuar con diferentes tipos de células. La ciencia se basa exclusivamente en los hechos del mundo natural y no en las creencias. y en bacterias patógenas del ser humano. se buscan las causas y las consecuencias del fenómeno y se trata de explicarlo sin que en ningún momento las creencias religiosas o de cualquier otra índole afecten el estudio. analítica y comunicable porque sigue un método para sus estudios y los analiza antes de tomar cualquier resolución. por lo que invierten gran parte de su producto interno bruto en la generación de nuevas patentes de las tecnologías creadas por sus científicos. como Agrobacterium que provoca tumores. hasta cierto punto. lo cual permite que sea. En América Latina. Morelos. hace falta la participación de la sociedad civil y del Estado para aumentar la inversión en estos rubros y para forjar una cultura científica más sólida. En países como Japón o China se ha comprendido que el desarrollo científico es la base del crecimiento. objetiva. Otro descubrimiento aun más interesante es que este plásmido tiene genes que se parecen a otros presentes en bacterias patógenas (dañinas) de plantas. que provoca una infección grave llamada brucelosis. conocimiento) es un proceso dinámico de adquisición. un grupo de investigadores mexicanos se ha dedicado a analizar la secuencia completa del genoma de Rhizobium etli. Así nos damos cuenta de que la ciencia es sistemática.GUÍA METODOLÓGICA DE BIOLOGÍA Esta asociación y formación del nódulo está determinada por un "dialogo" molecular entre ambas partes. En el Centro de Ciencias Genómicas (CCG) de la UNAM. en un estudio científico de los sismos que ocurren frecuentemente en México. siempre trata que los otros especialistas estén enterados de los resultados 33 . por lo que resulta muy importante identificar los "sucesos" moleculares que intervienen en este proceso. Además. organización y acervo de conocimientos que son el resultado de aplicar el método científico. colocándonos en desventaja con los demás países del llamado "primer mundo". el desarrollo de la innovación científico/tecnológica se ha estancado. en Cuernavaca.

Siguiendo en el ejemplo de los sismos. como en el caso de los modelos preventivos para el desalojo de edificios durante un sismo. 34 . Por fin. Pasteur había observado a través de microscopios. si no es que todas. la selección de planteamientos de diversas ideas y hasta contrapuestas corrientes teóricas y la elaboración propia del texto. que causaba gran mortandad entre las aves. obtuvo algunos que él consideró podían ser los causantes de la enfermedad. con la finalidad de encontrar y obtener microorganismos. experimentación (rojo). La composición del marco teórico implica: la revisión de la literatura sobre el tema. La ciencia es explicativa por su naturaleza clara e informativa. ACTIVIDAD Identifica y subraya de distinto color cada uno de los pasos del método experimental que siguió Louis Pasteur: observación y planteamiento del problema (amarillo). y los cultivó en caldos especiales. composición del marco teórico. Así. formulación de hipótesis. Pasteur se dedicó a estudiar diferentes tejidos de las gallinas enfermas. bien podían ser causadas por ellos. donde se mantenían vivos por varias semanas Posteriormente. hipótesis (verde). De esta forma se pueden evitar algunas catástrofes. pero sobre todo es verificable porque los resultados pueden reproducirse para confirmar los conocimientos. El planteamiento del problema. consiste en hacer una pregunta que guíe todo el proceso de la investigación. a muchos microorganismos. es predictiva porque genera modelos que se adelantan a los hechos. experimentación confirmación o rechazo de la hipótesis. resultados y conclusión (azul).GUÍA METODOLÓGICA DE BIOLOGÍA para escuchar sugerencias y críticas. A mediados del siglo XIX. se informa a la población para que tome las medidas pertinentes y se minimicen los daños. Pasteur se dedicó a estudiar una enfermedad llamada cólera de las gallinas. suponía que algunas enfermedades. La formulación de la hipótesis consiste en simples afirmaciones sujetas a comprobación que lleguen a explicar los fenómenos. El método científico plantea los siguientes pasos: planteamiento del problema. inyectó algunos de estos microorganismos en gallinas sanas: todas enfermaron de cólera y murieron. Es lo que se va a explicar científicamente en algún grado.

entonces hay que replantear la hipótesis original para volver a comenzar. la materia viva ocupa los cuatro últimos lugares. 1. al combinarse. esta formada principalmente por carbono. en cambio. estableciendo con el tiempo una teoría o ley. ¿A qué se llama materia? Todo lo que podemos ver y tocar es materia. Pero también son materia algunas cosas que no podemos ver. obtenemos agua. si. calcio. neutrones y electrones. Si no es así. por ejemplo. 35 . La célula es la unidad fundamental por la cual están constituidos todos los seres vivos y en general se acepta que. combinamos el H2 con oxígeno. se alcanza una conclusión que recopila los resultados y la comprobación o no de la hipótesis. En el caso específico del aire esto no es tan evidente. pueden producir a nivel macroscópico una célula viva. Finalmente.5 ¿CUÁLES SON LAS CARACTERÍSTICAS DE LOS NIVELES DE ORGANIZACIÓN DE LA MATERIA? Por sorprendente que parezca.GUÍA METODOLÓGICA DE BIOLOGÍA A través de la experimentación la hipótesis puede ser comprobada una y otra vez. Estos elementos. ¿Qué es la materia viva? Dentro de los niveles de organización. como el aire. que es un gas incoloro. hidrógeno. oxigeno y nitrógeno. carbono) que están formados por átomos. Si combinamos átomos de hidrógeno entre sí obtenemos hidrógeno molecular (H2). las interacciones entre las distintas moléculas que ocurren a nivel microscópico. Los seres vivos están formados por materia que a su vez está formada por elementos químicos (como el nitrógeno. Los físicos han descubierto un variado número de partículas subatómicas como protones. La materia ocupa una cierta porción de espacio que se denomina volumen. forman biomoléculas que interactúan entre si dentro de la forma viva mas simple que es la célula. otro gas. una molécula. La materia viva llamada también materia orgánica. ningún organismo es un ser vivo si no consta al menos de una célula LOS NIVELES DE ORGANIZACIÓN DE LA MATERIA La materia en el universo está organizada.

cloroplastos. la célula es la porción más sencilla de la materia viva que es capaz de realizar todas las funciones vitales. Los tejidos están ordenados en estructuras funcionales. El conjunto de todos los biomas integran a la biosfera. Las funciones biológicas básicas se llevan a cabo por un sistema o aparato. que es una de las miles de millones de galaxias que conforman el Universo. por ejemplo el hombre. cuando se habla de la selva. Estas constituyen la materia prima que forman los virus y las células. En la mayor parte de los individuos pluricelulares. que es la capa de la Tierra donde existe vida. epitelial. en el mismo tiempo. nervioso. por ejemplo la población de elefantes de la sabana africana. las células se organizan de acuerdo a sus características y funciones conformando tejidos como el conectivo. y el conjunto de ecosistemas forman un bioma caracterizado por las condiciones climáticas que determinan un gran biosistema regional. es decir. Los organismos pluricelulares están formados por sistemas que actúan en forma coordinada y precisa. muscular. 36 . Un individuo es un solo organismo de una especie determinada. Desde aquí. Si combinamos moléculas entre sí. Esta comunidad comparte el mismo lugar físico que presenta características particulares y cuando se relacionan con el medio físico constituye a un ecosistema. Por ejemplo. denominadas órganos como el corazón y los pulmones en los animales. formamos grandes y complejas moléculas: las macromoléculas. Se puede decir que la vida aparece como propiedad definitoria en el nivel celular. Estas poblaciones interactúan de distinta manera con otras poblaciones del lugar constituyendo una comunidad. o las hojas y las raíces en las plantas. como proteínas y ácidos nucleícos. y que comparten el mismo hábitat forman una población. En el nivel subcelular múltiples moléculas se ensamblan y dan lugar a estructuras especializadas como los organelos celulares (mitocondrias.GUÍA METODOLÓGICA DE BIOLOGÍA La vida surgió a partir de átomos y moléculas. entre otros). surgen otros niveles superiores de organización que estudian los astrónomos como que nuestro planeta Tierra es parte de un Sistema Solar que a su vez pertenece a una galaxia. la Vía Láctea. no nos referimos a la selva amazónica o a la africana sino a todas las selvas del orbe. que es una asociación coordinada de tejidos y órganos. Cuando se reúnen a todos los individuos de una misma especie que viven en un mismo lugar.

aminoácidos. algas. estómago Sistema circulatorio. Primero delimita el campo de acción de la Biología. Oxígeno Monosacáridos. digestivo. Polisacáridos. respiratorio Organismos pluricelulares. ácidos nucléicos. animales y vegetales superiores Parvada de aves. el profesor o algún alumno voluntario hará lo mismo tratando de incluir todas las ciencias investigadas por todos los alumnos. epitelial. banco de atunes Bosque Ecosistemas y biomas terrestres y acuáticos: Bosque tropical. Célula procarionte y eucarionte Organismos unicelulares: bacterias. los niveles de organización de la materia de forma descendente. estrellas. lípidos complejos. galaxias y universo ACTIVIDAD Escribe en una hoja de tu libreta y en forma de lista. 37 . cloroplastos. pulmones. muscular. nervioso Corazón. virus Organelos celulares: mitocondrias. neutrones y electrones Carbono. En forma grupal. ubica cada ciencia utilizando llaves o corchetes de acuerdo al nivel o los niveles correspondientes a su campo de estudio. Hidrógeno. arrecifes de coral Todos los biomas del planeta Planetas. nucleótidos. levaduras.GUÍA METODOLÓGICA DE BIOLOGÍA NIVELES DE ORGANIZACIÓN DE LA MATERIA Subatómico Atómico Molecular Macromolecular Subcelular Celular Tisular Órganos Sistémico Organismos Poblacional Comunitario Ecosistema Biosfera Cosmológico Protones. ribosomas. proteínas. Con el trabajo documental de las ramas de la Biología investigadas. protozoarios Tejidos conectivo.

P. pp 48 38 . Primera edición México. p 26. Nueva Imagen UNAM. Vázquez. y Molina Cerón. M. México. y Hernández. (1998) Genómica en México. La Ciencia en la Historia. Publicaciones Cultural.D. ACTIVIDADES DE APRENDIZAJE: • Glosario • Mapa mental • Debate ACTIVIDAD ESPECÍFICA: • Proyecto de investigación FORMATIVA SUMATIVA Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad 30% 20% 20% 30% BIBLIOGRAFÍA BÁSICA Bernal. M. Pérez Granados. pp 1242 González. M. Biología I. (2004) Biología General. pp 1226 Cervantes. 1. J. Biología Ed. México. Núm. (1994).A. C. Santillana. Estratégico Realiza un proyecto de investigación aplicando los pasos del método científico de forma crítica.L.GUÍA METODOLÓGICA DE BIOLOGÍA MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios Emplea el método científico para desarrollar un proyecto de investigación Pre-formal Realiza un proyecto de investigación sin aplicar los pasos del método científico Receptivo Realiza un proyecto de investigación aplicando los pasos del método científico con orientación del docente Resolutivo Realiza un proyecto de investigación aplicando los pasos del método científico de forma clara y precisa Autónomo Realiza un proyecto de investigación aplicando los pasos del método científico de forma crítica y reflexiva.R. reflexiva y propositiva Ponderación Logros: Puntos 30 Puntos 60 Puntos 80 Puntos Aspectos a mejorar : 100 Puntos 100 EVALUACIÓN DIAGNÓSTICA Aplicación de un examen diagnóstico y la retroalimentación por medio de una lluvia de ideas. (2006). ¿Como ves? Año I. México. Vector. Publicaciones Cultural. (2007). México.

Biología: "Ciencia o Naturalismo”. 960 pp. (1999). Rodríguez. http://www. España. Segunda Edición. Trillas. 60-74 Gómez Caballero.lunanueva. Kapicka y Lundgren. México.mec. Fondo de Cultura Económica. Mc Graw Hill. UNAM. Temas para un Futuro Biólogo. la Dinámica de la Vida. D.pdf VIDEOS RECOMENDADOS Cosmos de Carl Sagan Paradigmas de Joe Baker TIC Proyecto Biósfera. (2003. en Ciencia y Desarrollo.cl/files/articulos/El_Origen_de_la_Vida_en_la_Ti erra_v3. 569 pp. México 111 pp. serie Flash. (2004) El Origen de la Vida sobre la Tierra. 56-86. http://recursos. México. y Pantoja Alor. pp. J. (1986). México. Colección Esto es Química ¿y qué? Facultad de Química. Boletín de la Sociedad Geológica Mexicana. J. García. A. Italia. Biología.) El Origen de la Vida desde un Punto de Vista Geológico. L. Biología. 36 pp. I. (1975). (1997). Segunda edición. (1993). 737 pp. Universit`a degli studi di Genova.unam. La Vuelta al Mundo del Doctor Balmis o los Desconocidos Niños Héroes en Genética para el Futuro. Consejo Nacional para la Enseñanza de las Biología.pdf Lazcano Araujo. Núm. UNAM. 91 pp. Rojas Peña.cnice. (1984).mx/~alaniz/SGM/200356Gomez. México. Quinta reimpresión. (1996). 107 pp. mayo junio. (1996) El Origen de la Vida. Tomo LVI. Buican. H. CECSA. Historia de la Biología. México.. Acento editorial. México. I. Ledesma M. A. pp.F. 7077.geociencias. 1. CONACYT. México. Un Universo en Expansión..es/biosfera/ 39 . http://www. Llera Domínguez. pp.GUÍA METODOLÓGICA DE BIOLOGÍA BIBLIOGRAFÍA COMPLEMENTARIA Biggs.

estructura y función 40 .GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 2 Célula.

SABERES Procedimentales Elabora una línea del tiempo del descubrimiento de la célula. instrumentos y equipo en la realización de actividades de su vida cotidiana.5 Sintetiza evidencias obtenidas mediante la experimentación para producir conclusiones y formular nuevas preguntas. 13. Obtiene.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE: LA CÉLULA: ESTRUCTURA Y FUNCIÓN TIEMPO: 45 horas UNIDAD DE COMPETENCIA: Relaciona la composición química con la estructura y fisiología celular. la tecnología. Usa responsablemente el material de laboratorio en el trabajo experimental Relaciona la composición química con la estructura y función celular Identifica los procesos celulares 41 . consultando fuentes relevantes y realizando experimentos pertinentes. la sociedad y el ambiente en contextos históricos y sociales específicos. 5. 14. Valora la importancia de los procesos celulares para la conservación de la vida. Desarrolla modelos experimentales que demuestren los procesos celulares. registra y sistematiza la información para responder a preguntas de carácter científico.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. COMPETENCIAS Genéricas/Atributos Disciplinares 5. Relaciona los niveles de organización química. 6.2 Ordena información de acuerdo a categorías. 4. 1. para valorar la importancia de la célula como unidad estructural y funcional de los seres vivos a través del análisis de los procesos celulares. 12. Declarativos Explica la teoría celular Actitudinales/Valorales Valora la importancia del trabajo colaborativo. sus procesos vitales y el entorno al que pertenece. el desarrollo de la teoría celular hasta la época actual Construye un cuadro de doble entrada de los componentes celulares. jerarquías y relaciones. Aplica normas de seguridad en el manejo de sustancias. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo. física y ecológica de los sistemas vivos. biológica. Utiliza el microscopio como instrumento para el estudio de la célula Desarrolla un mapa conceptual integrador de la estructura y los procesos celulares. Establece la interrelación entre la ciencia.

GUÍA METODOLÓGICA DE BIOLOGÍA CRITERIOS DE DESEMPEÑO Explica el descubrimiento de la célula. el desarrollo de la teoría celular hasta la época actual a través de una línea del tiempo. Describe los tipos de célula mediante el uso del microscopio compuesto y reporta los resultados en una V de Gowin. • Conocimiento educativo • Cuadro de divulgación • Mapa • Actividades • Reporte • Resolución prácticas tape reactivos de • Materiales y laboratorio • Bata blanca 42 . • • • • ESTRATEGIAS DE ENSEÑANZA • Aplicación de preguntas generadoras • Dinámicas ESTRATEGIAS DE APRENDIZAJE • Elaboración de una línea del tiempo • Elaboración RECURSOS DIDÁCTICOS • Aula • Microscopio • Laboratorio virtual • Videos • Software • Revistas • Pizarrón • Plumones • Cañón • DVD • Guía metodológica • Manual de • Masking EVIDENCIAS Y/O PRODUCTOS • Línea del tiempo • Reporte grupales • Presentaciones de un cuadro de doble entrada y manejo del microscopio conceptual integrador de laboratorio a través de una V de Gowin de actividades de la guía metodológica de la práctica V de Gowin conceptual integrador de doble entrada • Mapa de power point sobre los niveles de organización celular experimentales. Relaciona la composición química. la estructura y función celular a través de un cuadro de doble entrada. Analiza la estructura y los procesos celulares mediante un mapa conceptual integrador.

GUÍA METODOLÓGICA DE BIOLOGÍA 43 .

¿Cuál consideras que es el instrumento más importante para el estudio de la célula? _________________________________________________________________ 4.GUÍA METODOLÓGICA DE BIOLOGÍA EXPLORANDO TUS CONOCIMIENTOS 1. En el siguiente recuadro dibuja una célula 3. Existen organismos macroscópicos y microscópicos ¿Menciona algunos ejemplos de los últimos? ______________________________________________________________________ __________________________________________________________________ 2. ¿Quién descubrió la primera célula? _________________________________________________________________ 5. Escribe las funciones que realiza una célula ______________________________________________________________________ ____________________________________________________________ 44 .

tejidos y algunos presentan sistemas. en donde los obreros son las enzimas. Acuérdate de llevar una secuencia cronológica de los acontecimientos. 45 . Posteriormente en plenaria expondrán la línea del tiempo 2. Anota en ella el año. ya que vigilan que las actividades se realicen de acuerdo con las indicaciones contenidas en la molécula de ADN. 3. Con esa información elabora una línea del tiempo donde se pueda evidenciar los antecedentes de la teoría celular. de ahí derivó el término de célula. plantas y animales los cuales se diferencian de los unicelulares por que están formados por órganos. A estos espacios los llamó celdillas debido a que se parecían mucho a las celdas que ocupaban los monjes en el monasterio. en el ambiente se localizan organismos unicelulares.1) al observar un corte fino de corcho. Sin embargo. glóbulos rojos. Por lo tanto. ACTIVIDAD 1. El primero en observar bacterias.2. Algunas moléculas reguladoras hacen las veces de capataces. Pero también existen organismos pluricelulares como los hongos. los personajes y sus postulados. no fue el primero en observarlas.1 ¿CUÁLES HECHOS HISTÓRICOS CONDUJERON AL PLANTEAMIENTO DE LA TEORÍA CELULAR? Descubrimiento de la célula En 1665 el científico inglés Robert Hooke (fig. la cual se localiza en el núcleo o centro de control. a pesar de que es a Hooke a quien se le da el crédito de descubrir las células. Realiza una investigación documental a cerca de la Teoría Celular 2. en el siglo XVII (fig. protozoarios y espermatozoides fue el holandés llamado Anton van Leeuwenhoek. como las bacterias y los protozoarios entre los que se encuentran las amibas y el Paramecium. 2.2). nombre del científico y una breve oración de la aportación que hizo.GUÍA METODOLÓGICA DE BIOLOGÍA La célula es la unidad estructural y funcional de todos los seres vivos. Toda célula está delimitada por una membrana celular lo cual le permite funcionar como una fábrica porque en ellas se requiere de materia prima para la producción de sustancias útiles. identificó una serie de estructuras parecidas a un panal de abejas.

particularmente la invención del microscopio.3). Todos los seres vivos están compuestos de una o más células. permitió la exploración de un mundo que antes era inaccesible para el ojo humano. Con ello se formulan los dos primeros principios de la teoría celular: 1. respectivamente. Fig. zoólogo y botánico. 46 . La célula es la unidad estructural de la vida. una serie de naturalistas y científicos iniciaron la búsqueda de células en tejidos animales y vegetales. 2. Fue en 1855 que el patólogo alemán Rudolf Virchow (fig. Sin embargo. el desarrollo tecnológico. su hipótesis dio lugar al tercer postulado de la teoría celular: 3. no fue suficiente con tener instrumentos o técnicas que permitieran observar las estructuras o fenómenos vivos para poder entenderlos y explicarlos. esto abrió un sinfín de posibilidades y formas de aproximación al estudio del mundo microscópico. 2. quienes en 1838 y 1839 descubrieron que todos los animales y vegetales están formados de células (fig.2.1 Robert Hooke Fig.2 A.3) concluyó que las células proceden de otras células semejantes. fue necesario también contar con marcos conceptuales que permitieran interpretarlos. Un ejemplo de ello lo constituye el planteamiento de la teoría celular. entre ellos se encuentran los alemanes Friedrich Theodor Schwann y Matthias Jakob Schleiden. 3. 2.GUÍA METODOLÓGICA DE BIOLOGÍA En el siglo XVII. Leeuwenhoek A partir del descubrimiento de Hooke. Las células sólo pueden originarse por división de una célula preexistente.

Los seres vivos están formados por una o más células. morirían. La célula se origina a partir de células preexistentes. T. Virchow De aquí se concluye que la célula es la unidad: • Anatómica. ¿Con cuál de los postulados de la teoría celular se relaciona el hecho de que las células de tu piel se mantengan vivas? ¿Por qué? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 47 . • Fisiológica. • De origen. ACTIVIDAD Contesta las preguntas siguientes con respecto a la Teoría Celular 1. se nutren. 2.3 M. Las células de tu piel respiran. Schleiden. Schwann y R. excretan. si no efectuaran estas funciones.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Cada célula lleva a cabo todas las funciones vitales.

Las células procariontes (pro.2 ¿QUÉ DIFERENCIAS HAY ENTRE CÉLULAS PROCARIONTES Y EUCARIONTES? Existen dos tipos celulares básicos clasificados con base en su organización y complejidad estructural: procarionte y eucarionte. Este hecho. están constituidas por células. Después de haber tenido un “raspón”. el ejemplo característico son las bacterias. a su vez.2. músculos. núcleo) no tienen núcleo verdadero.GUÍA METODOLÓGICA DE BIOLOGÍA 2. Tu cuerpo está formado por piel. 48 . Estas partes. el ADN se encuentra disperso en el citoplasma constituyendo un solo cromosoma o unido a la membrana citoplásmica (fig. se forma una “costra” con sangre coagulada y los restos muertos de células. ¿Con cuál de los postulados de la teoría celular se relaciona? ¿Por qué? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 2. antes y Karion. etc. y bajo la costra tu piel se regenera ¿Con cuál de los postulados de la teoría celular se relaciona la regeneración de tu piel? ¿Por qué? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 3.4). huesos.

Por otro lado. retículo endoplásmico. Fungi. De acuerdo con la clasificación de seis reinos. En algunas bacterias se ha observado in vitro (en laboratorio) que bajo ciertas circunstancias realizan un proceso llamado conjugación. sin embargo. cada componente tiene una función especializada (fig. a partir de la cual se producen células hijas con la mitad del número de cromosomas de la célula madre. en el que un fragmento de ADN denominado plásmido puede pasar de una bacteria a otra. La complejidad de las células eucariontes se basa en el desarrollo de compartimentos internos que originan diversas estructuras subcelulares denominadas componentes celulares como: mitocondrias. por ejemplo. complejo de Golgi. 2. protegiéndola de las agresiones del medio externo y da forma a la célula. De aquí que los ribosomas procariontes se denominen 70s y los eucariontes 80s por su coeficiente de sedimentación. 49 . tanto estructural como funcionalmente. siendo la base de la reproducción sexual. peroxisomas y citoesqueleto. Presentan una pared celular que rodea completamente a la membrana celular. donde el material genético (ADN) duplicado se condensa en estructuras llamadas cromosomas y se divide en dos células hijas. verdadero y Karion. cloroplastos. Por lo general. el ADN se duplica y las dos copias se separan y se forman dos células hijas idénticas. una nueva generación de bacterias puede aparecer cada 20 o 40 minutos. De ellas derivaron las células eucariontes actuales presentes en los cuatro reinos restantes: Protista. vacuolas. las células eucariontes se dividen por mitosis. ribosomas. núcleo) son mucho más complejas. Las células germinales sufren meiosis. El ADN se localiza dentro de una doble membrana llamada envoltura nuclear que lo separa del resto del citoplasma y conforma un núcleo verdadero.GUÍA METODOLÓGICA DE BIOLOGÍA Las células procariontes son de menor tamaño que las eucariontes. centriolos. por esta razón la reproducción es más rápida que en las eucariontes. las células eucariontes (eu. las células procariontes sólo están presentes en los reinos Arqueobacteria y Eubacteria. Las células procariontes son microorganismos asexuados (sin sexo).5). presentan una diferencia sustancial en cuanto al tipo de ARN ribosomal que lo forman. La división celular de las células procariontes se da por división binaria o bipartición. Plantae y Animalia. lisosomas. Los dos tipos celulares poseen ribosomas encargados de la síntesis de proteínas.

el crecimiento y el desarrollo. Esta estructura está basada en moléculas orgánicas e inorgánicas. la reproducción.4. Las células intercambian materia y energía con el medio.5.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. etc.3. se encuentra su complejidad. esto es. el crecimiento. Esta energía se encuentra almacenada en una molécula altamente energética denominada ATP (adenosíntrifosfato). ¿CÓMO ESTÁ ESTRUCTURADA Y CÓMO FUNCIONA UNA CÉLULA? Entre las propiedades que comparten las células y que a la vez pueden considerarse como características de los seres vivos. Las células son entidades complejas y organizadas en términos de orden y regularidad. Morfología de una célula procarionte Fig. Los autótrofos transforman la energía solar en 50 . la cual pertenece al grupo bioquímico de los nucleótidos. Todos los seres vivos se alimentan. la capacidad de autorregularse. La complejidad de la vida va desde las partículas subatómicas y los átomos. la organización de estos átomos en moléculas de pequeño y gran tamaño como agua. el que tienen ADN necesario para la reproducción. toman del medio las sustancias necesarias para obtener energía. el mantenimiento de su medio interno. proteínas y ácidos nucleicos a su vez se organizan en estructuras subcelulares que constituyen a las células. el intercambio de materia y energía con el medio. 2. Morfología de una célula eucarionte 2. 2. así como la especialización celular y la capacidad de responder a estímulos. como el movimiento. esto se refiere a que las células incorporan nutrientes para transformarlos a partir de una serie de reacciones químicas que realizan y con ello obtienen la energía útil a la célula para realizar todas sus actividades.

51 . los heterótrofos tienen que transformar los alimentos en otros más sencillos y a partir de éstos sus células se encargan de sintetizar otros compuestos más complejos que utilizan para reparar tejidos y llevar a cabo todas sus actividades.GUÍA METODOLÓGICA DE BIOLOGÍA energía química a través de la fotosíntesis. escribiendo las características que las hacen distintas. Toda esta serie de reacciones que se llevan a cabo en el interior de la célula gracias a la presencia de las enzimas o biocatalizadores en conjunto se llama metabolismo. Éste consta de dos fases: una fase de degradación donde moléculas grandes se transforman en moléculas pequeñas llamada catabolismo y una fase de síntesis donde se forman moléculas grandes a partir de moléculas pequeñas llamada anabolismo. ACTIVIDAD Realiza una investigación documental para completar el siguiente cuadro comparativo entre célula procarionte y eucarionte. en cambio.

y el conjunto de órganos forman sistemas. forman órganos. Cilios Complejo de Golgi y flagelos) Lisosomas Microfilamentos Filamentos intermedios 52 Ribosomas ORGANELOS Mitocondria Cloroplasto Núcleo Vacuolas Microcuerpos Vesículas . La célula. Sin embargo. moverse. etc. molécula que identifica a cada ser vivo y que contiene las instrucciones para todo el funcionamiento celular: la reproducción. Todas las células responden de manera específica para cada sustancia o agente externo o interno. Dichos componentes de acuerdo a su composición química y la función que desempeñan se clasifican en: SISTEMAS MEMBRANOSOS SISTEMAS NO MEMBRANOSO Citosol o hialoplasma Membrana celular Inclusiones citoplasmáticas Retículo endoplásmico: liso y Citoesqueleto rugoso Microtúbulos (Centriolos. las hormonas. por tanto. A esta capacidad de respuesta celular se le denomina irritabilidad. la cantidad de agua. ya que si falla se presentan alteraciones que pueden ser determinantes y causar la muerte celular. a su vez. Los mecanismos reguladores de la célula son tan importantes que un cambio en la secuencia del ADN debe ser identificado y corregido por la célula. dan origen a los tejidos y estos. crecimiento y funcionamiento de la célula. propiedad importante para el funcionamiento celular. de la misma manera las biomoléculas como: aminoácidos. modificar su actividad metabólica. Las células responden a los estímulos del medio como el alimento. la cantidad de electrólitos. la síntesis de proteínas. el desarrollo. etcétera. iniciar la división celular. se presentará una mutación. proteínas carbohidratos. las sustancias químicas. como la reproducción. de no ser así. Algunas mutaciones son tan severas que causan la muerte del organismo. las mutaciones no letales y no dañinas producen la variabilidad genética que permite que los seres vivos evolucionen. Esto permite a las células sobrevivir.GUÍA METODOLÓGICA DE BIOLOGÍA Las células mantienen constante su medio interno a través de un proceso de equilibrio fisiológico denominado homeóstasis. Cuando las células con una función específica se unen entre sí. la luz. posee mecanismos reguladores de todo su funcionamiento. los factores de crecimiento. dichas información se encuentra contenida en la secuencia de nucleótidos del ADN. lípidos y ácidos nucléicos constituyen los componentes de la célula. la presión o la cantidad de agua. Las células tienen ADN.

MEMBRANA CELULAR La membrana celular es la que limita y da forma a la célula. si se trata de una célula animal. carbohidratos y colesterol. está constituida por una doble capa de fosfolípidos. es decir. su composición química es lipoproteíca. 53 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD A través de un diagrama de Venn establece las diferencias y similitudes entre una célula animal y una vegetal. proteínas periféricas e integrales. pero si es de origen vegetal presenta ergosterol.

sin embargo. por ejemplo el glicerol. éstos dos últimos en la misma proporción que en el agua (2:1). y se les conoce así por tener carbón. Posteriormente integra equipos de tres compañeros y compartan su información obtenida a través de sus respectivas investigaciones. A continuación elaboren un cuadro sinóptico donde se pueda evidenciar la clasificación de las proteínas por su: composición química. Fórmula general de un aminoácido ACTIVIDAD 1. en la que se enfatice su definición. 4. hidrógeno y oxígeno.6). CnH2nOn 54 . expongan su cuadro sinóptico para hacer una retroalimentación. 2.GUÍA METODOLÓGICA DE BIOLOGÍA Las proteínas: son compuestos orgánicos formados por aminoácidos (fig. clasificación y función. un carboxilo y un radical como se puede observar en la siguiente fórmula general.6. Fig. En plenaria. estructura y función. forma. Los carbohidratos: son miembros de una familia de compuestos orgánicos que se caracterizan por tener varios grupos hidroxilos y por lo menos potencialmente un grupo aldehídico o cetónico. 2. 3. Un alcohol polivalente es una molécula orgánica que tiene más de un radical alcohólico (C — OH). los cuales se caracterizan por tener un grupo amino. La palabra carbohidrato literalmente significa carbón con agua (carbón hidratado) o hidrato de carbono. 2. Realiza una investigación documental a cerca de las proteínas. en la fórmula empírica se observa que eso no es cierto.

ACTIVIDAD 1. desempeñan su principal función biológica como energéticos. 4. carbohidratos y proteínas. desempeñan funciones estructurales y de reserva. Además. A continuación en plenaria. Las moléculas cuyo tamaño coincida con el tamaño del poro o sean más pequeñas que éste podrán atravesar la membrana fácilmente. el primero participa en la fluidez y estabilidad de las membranas biológicas. que de ellos se obtiene energía para procesos vitales. glúcidos (glucos en griego significa dulce) o azúcares. Lo importante de este modelo es que denota la calidad dinámica de la membrana celular. clasificación y función de los carbohidratos y los lípidos.7). Singer y G. Un gramo de carbohidratos proporciona 4 calorías. b) la solubilidad en lípidos y c) el potencial eléctrico de la membrana. El colesterol y el ergosterol son esteroles.GUÍA METODOLÓGICA DE BIOLOGÍA También se les conoce como sacáridos (sacar en latín significa azúcar). Existen varios mecanismos por medio de los cuales la membrana es selectivamente permeable: a) el tamaño del poro. en 1972. 55 . Para explicar su estructura. los biólogos S. o sea. Posteriormente consensada la información elaboren un mapa conceptual integrador donde se pueda evidenciar la función. Los fosfolípidos son ejemplos de lípidos compuestos formados por la unión de ácidos graso. Integra equipos de tres compañeros y compartan su información obtenida a través de sus respectivas investigaciones. 3. 2. un alcohol denominado glicerol y ácido fosfórico. 2. la carga eléctrica de los iones determina en un momento dado qué tipo de moléculas la atraviesan. Nicholson. elaboraron un modelo llamado mosaico fluido (fig. Químicamente están constituidas por una doble capa de lípidos.L.J. expongan su mapa conceptual para hacer una recapitulación y retroalimentación. en la que se enfatice su definición. Realiza una investigación documental sobre los carbohidratos y lípidos. Algunas moléculas como los gases pueden atravesar la membrana debido a que son solubles en los lípidos de ésta y finalmente. y el segundo se transforma en vitamina D debido a la radiación ultravioleta En la década de 1950 se observaron por primera vez al microscopio electrónico las membranas celulares. clasificación y función.

Las membranas de la mayor parte de los vegetales y de las bacterias no contienen colesterol. Los grupos polares de cada capa de fosfolípidos se orientan hacia el exterior de la bicapa y pueden interactuar con las moléculas de agua que los rodean. las cadenas hidrofóbicas del fosfolípido se encuentran orientadas hacia el interior de la bicapa. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ______________________________________________________________________________ Argumenta cuál es la relación que existe entre el colesterol y el estrógeno ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ _______________________________________________________________________________ Los lípidos más abundantes en la membrana son los fosfolípidos. Esta bicapa de lípidos tiene consecuencias en la estructura y funcionamiento de las células. En ciertas membranas también existe colesterol. sustancia que en ciertas células animales puede constituir hasta 50%.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. Debido a la cohesión y formación 56 . Explica la importancia del colesterol en tu organismo y argumenta los daños que puede ocasionar el exceso.

pero ancladas por grupos de ácidos grasos o por otras proteínas a la superficie extracelular o citoplásmica. que se localizan por completo fuera de la bicapa de lípidos. Cada una se encuentra localizada y dirigida en una posición particular de la bicapa lipídica. Modelo de mosaico fluido de la membrana celular Las proteínas de la membrana varían desde una docena hasta 50 tipos diferentes. que penetran en la bicapa de lípidos. Pueden ser proteínas integrales. siempre son estructuras íntegras continuas. Gracias a la flexibilidad de la bicapa de lípidos. respectivamente. Se encuentran unidos a los lípidos y las proteínas en forma de glucolípidos y glucoproteínas. Otro tipo de proteínas son las periféricas. las membranas son deformables y pueden cambiar toda su forma como ocurre durante la locomoción o la división celular. 57 .7.GUÍA METODOLÓGICA DE BIOLOGÍA espontánea de las bicapas nunca se observan membranas con bordes libres. 2. La composición de carbohidratos de la membrana depende del tipo de célula. y la cantidad de éstos varía entre 2 y 10% del peso total. Fig. la mayoría atraviesan completamente la bicapa y tienen regiones que sobresalen en ambos lados de la membrana hacia el espacio extracelular y el citoplásmico.

Se observan dos tipos de retículos endoplásmicos. d. b. Delimita y protege la célula. RETÍCULO ENDOPLÁSMICO El retículo endoplásmico es un sistema membranoso que se distribuye a través del citoplasma. desde la membrana nuclear hasta la membrana plasmática. movimiento celular. inhibiendo o estimulando actividades internas como el inicio de la división celular. Es un líquido viscoso de consisten cia gelatinosa y su estructura corresponde a la de un coloide (sistema constituido por agua y diferentes moléculas de elevado peso molecular). pues regula el intercambio de sustancias entre el interior y el exterior de la célula siguiendo un gradiente de concentración. que se diferencian entre sí por los siguientes aspectos: 58 . c. etc. el rugoso (RER) y el liso (REL) (fig. a toda la porción citoplasmática que carece de esta estructura se le da el nombre de citosol o hialoplasma (parte líquida del citoplasma). la elaboración de más glucógeno. lo cual permite que se encuentre en movimiento continuo (ciclosis) favoreciendo el intercambio de sustancias con el medio exterior.GUÍA METODOLÓGICA DE BIOLOGÍA La membrana celular cumple varias funciones: a. recibe el nombre de morfoplasma (parte coloidal). comprendida entre la membrana celular y la membrana nuclear. el citoplasma presenta un estado fluido (sol) y otro viscoso (gel). por tanto. por ejemplo. ya que impide el libre intercambio de materiales de un lado a otro. CITOPLASMA El citoplasma es la masa coloidal química y morfológicamente compleja. liberación de calcio de las reservas internas.8). 2. Poseen receptores químicos que se combinan con moléculas específicas que permiten a la membrana recibir señales y responder de manera específica. Es una barrera selectivamente permeable. Permite el paso o transporte de solutos y de agua de un lado a otro de la célula. en el que están suspendidos los organelos y las microestructuras celulares. pero al mismo tiempo proporcionan el medio para comunicar un espacio con otro. La parte del citoplasma que está atravesado por una red de fibras y filamentos denominada citoesqueleto.

El RER es un conjunto de canales con forma de cisternas en cuyas paredes membranosas se realiza la síntesis de proteínas con la intervención de los ribosomas (ARNr). el ARN mensajero y el ARN de transferencia. 59 .8. Mientras que en el retículo endoplásmico rugoso se realiza la síntesis proteica y la maduración de las proteínas de exportación y las que se transportan a otros componentes celulares. A medida que el RER se aleja de la membrana nuclear externa y se distribuye en el citoplasma.GUÍA METODOLÓGICA DE BIOLOGÍA a. b. Como consecuencia desarrollan funciones diferentes. Fig. En el retículo endoplásmico liso se sintetizan algunos fosfolípidos. hay una zona de transición donde cambia de forma (canales y cisterna) y se observan los retículos con tubos anastomosados entre sí y cuyas paredes membranosas carecen de ribosomas. hormonas esteroides y ácidos grasos. según sus actividades. d. Retículo endoplásmico rugoso Las células tienen cantidades distintas de REL o RER. Por ejemplo. c. las células que secretan gran cantidad de proteínas tienen una gran actividad de RER. El RER presenta ribosomas adheridos a sus membranas y el REL recibe este nombre porque no las tiene. 2.

por ejemplo.9. Transforma las proteínas y los residuos de carbohidratos para formar glucoproteínas presentes en la superficie externa de la membrana celular.9 y 2. 2. 60 .10. Después de un tiempo (de tres a cinco minutos). ensambla glucolípidos y glucoesfingolípidos. leucina tritiada. Se toman muestras a lo largo del tiempo después de aplicar el marcador radiactivo. Almacena las glucoproteínas en vesículas para ser enviadas a otras partes de la célula. Fig. asimismo. Complejo de Golgi Fig.10). la distribución de proteínas y lípidos que reciben del retículo endoplásmico. tales como: Formar vesículas como los lisosomas. se realiza la siguiente experiencia: se toma el páncreas de una rata y se corta en fragmentos. Relación entre RER y complejo de Golgi ACTIVIDAD Para determinar el lugar de síntesis y el camino que siguen las proteínas segregadas por las células del páncreas antes de salir de la célula. los fragmentos de páncreas se transfieren a un medio que contiene el mismo aminoácido pero sin marcar (no radiactivo). algunas de estas proteínas son enzimas que se envían a los lisosomas. Realiza funciones específicas. Estos fragmentos se mantienen en un medio fisiológico que contiene un aminoácido marcado. consiste en cisternas aplanadas. discordes con rebordes amplios relacionados con vesículas emergentes. (fig.GUÍA METODOLÓGICA DE BIOLOGÍA COMPLEJO DE GOLGI El complejo de Golgi. 2. 2.

b) Muestra B: 15 minutos después del marcado con leucina tritiada. las muestras son fijadas y preparadas para su examen histoautoradiográfico. c) Muestra C: cuando se examina una muestra tomada 20 minutos después del marcado. se constata que la radiactividad está localizada en la región del retículo endoplásmico rugoso situada en la proximidad de los dictiosomas del Complejo de Golgi. se observan proteínas radiactivas en los dictiosomas 61 . a) Muestra A: se constata que tras 5 minutos se puede observar radiactividad en la región basal de la célula. a nivel del retículo endoplásmico rugoso.GUÍA METODOLÓGICA DE BIOLOGÍA Inmediatamente después de tomarlas.

Contienen gran cantidad de enzimas hidrolíticas (digestivas) que degradan todas las moléculas inservibles para la célula. Funcionan como estómagos de la célula y además de digerir cualquier sustancia que ingrese del exterior (lisosomas secundarios o vacuolas digestivas). ingieren restos celulares viejos para digerirlos. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ¿Qué relación hay entre el retículo endoplásmico y el complejo de Golgi? ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ LISOSOMAS Los lisosomas son vesículas con una estructura muy sencilla y están rodeados solamente por una membrana.GUÍA METODOLÓGICA DE BIOLOGÍA d) Muestra D: en las muestras tomadas 60 minutos después de la experiencia. sólo se observa radiactividad en las vesículas que rodean las cisternas del complejo de Golgi. Analizando esta experiencia. 62 .11). Cuando las células enferman. 2. por tanto son llamados autofagosomas o vacuolas autofágicas o digestivas (fig. explica dónde se sintetizan las proteínas segregadas por las células pancreáticas y cuál es el camino que siguen hasta que salen de la célula. los lisosomas rompen su membrana y las enzimas encerradas en su interior destruyen toda la célula en un proceso denominado autolisis. e) Muestra E: 4 horas después. la radiactividad sólo se detecta en el exterior de la célula. en la cara de maduración de los dictiosomas.

lipasas. nucleasas.11. fosfatasas. Algunas de soporte. otras de almacenamiento de agua. originándose así los lisosomas. aislados en grupos llamados polirribosomas o en la parte externa del retículo endoplásmico rugoso. desechos metabólicos o alimentos y otras ayudan a la célula a eliminar el exceso de agua del interior. fosfolipasas. Hay diferentes tipos de vacuolas. Formación de lisosomas a partir del complejo de Golgi VACUOLAS Son sacos rodeados también por una sola membrana.GUÍA METODOLÓGICA DE BIOLOGÍA Actualmente se conocen unas 40 enzimas lisosómicas. unas son temporales y otras permanentes. por ejemplo: insulina. como las enzimas digestivas y las hormonas proteicas. Éstos realizan la síntesis de proteínas de membrana y de proteínas que algunas células secretoras exportan hacia sus alrededores. 63 . Las proteínas que son transportadas dentro de los canales. RIBOSOMAS Los ribosomas se encuentran libres en el citoplasma. todas ellas son hidrolasas ácidas del tipo de las proteasas. glucosidasas y sulfatasas. Las enzimas hidrolíticas de los lisosomas se forman a partir del retículo endoplásmico rugoso y posteriormente son empaquetadas por el complejo de Golgi. se mueven por los extremos cercanos al complejo de Golgi. 2. Fig.

La subunidad más pequeña contiene más o menos 30 proteínas diferentes y las más grandes de 45 a 50.14). 2. existen en cantidad abundante alrededor de la célula para que al agitarse les permitan desplazarse en el medio que generalmente es líquido (fig.12). son cilindros huecos de 25 nm de grosor. CITOESQUELETO La gran variedad de filamentos proteínicos del interior de las células le confieren cierta consistencia a éstas. uno para secuencia corta de tres nucleótidos del ARNm. 2. permiten el desplazamiento de los cromosomas a través del huso mitótico o acromático y participan activamente en transportar organelos o nutrientes dentro de la célula. Entre estas estructuras se encuentran las siguientes: Microtúbulos Estas estructuras. como las hormonas de la hipófisis y del hipotálamo. ARNt y ARNr. Los cilios. otro para el ARNt que ha descargado el aminoácido y un sitio donde la enzima peptidil transferasa trabaja formando enlaces peptídicos entre los aminoácidos adyacentes. que son estructuras en forma de pelos microscópicos. Los cilios y flagelos de algunos organismos unicelulares están formados por microtúbulos y participan en la locomoción y desplazamiento de estos. Los microtúbulos están formados por una glucoproteína que se conoce con el nombre de tubulina (figuras. 2. La superficie del ribosoma tiene cuatro sitios de unión. que en conjunto se llaman citoesqueleto. Dan soporte a las células. todas estrechamente unidas con los ARN ribosomales (fig. En los axones nerviosos de las neuronas. otro para el ARNt nuevo que lleva el aminoácido específico para que se ensamble a la cadena polipéptidica nueva. 64 . están en el citoplasma.GUÍA METODOLÓGICA DE BIOLOGÍA Los ribosomas completos están formados por dos subunidades de diferente tamaño. los microtúbulos participan en el transporte de las proteínas y otros compuestos.13 y 2.15). forman el huso acromático durante la mitosis. Durante la síntesis de proteínas se establece un contacto entre los ARNm. La subunidad pequeña se ajusta a la más grande como un engrane solamente si hay ARNm que deba ser traducido.

15). ensanchadas en el ecuador. y 2. 2. se replica y da lugar a dos estructuras iguales. estrechas en los extremos y a la que llamamos huso acromático.13. Durante su trayectoria organizan poco a poco entre ellos el huso acromático. 2. Al inicio de la división celular. A estos filamentos se les denomina de actina porque están formados por la proteína o microfilamentos. Los centriolos son estructuras cilíndricas de las células animales y de las células de algunos vegetales inferiores (fig. 2. 65 . 2. Los pares de cilindros se separan lentamente. Filamentos intermedios Los filamentos intermedios tienen un diámetro de 10 nm.GUÍA METODOLÓGICA DE BIOLOGÍA Filamentos de actina o microfilamentos Existen otras estructuras que forman el citoesqueleto compuestas de proteínas contráctiles y presentes en gran cantidad en las células de músculo esquelético. tales como la miosina o participan en la formación de las uniones intercelulares. 2. es decir. ya que su grosor es de 6 a 8 nm (fig. Cuando inicia la división celular. Cuando los filamentos han llegado a polos opuestos se obtiene una figura semejante a dos conos unidos por su base. CENTRÍOLO Y HUSO Cerca del núcleo hay una pequeña estructura que se llama centriolo o centro organizador de microtúbulos. emigrando cada par a los polos opuestos de la célula.13). Se pueden asociar con otras proteínas. los centriolos emigran a polos opuestos. están formados por una gran variedad de proteínas y participan directamente en mantener la forma de la célula y darle fuerza ténsil a ésta (figs.14.16). De cada centriolo se proyecta un racimo de filamentos de proteína contráctil formando figuras llamadas áster.16). como ya se mencionó anteriormente. Los centriolos vistos al microscopio electrónico se aprecian como cilindros huecos formados por nueve tripletes de microtúbulos (fig.

GUÍA METODOLÓGICA DE BIOLOGÍA Figura 2. 2. Disposición del citoesqueleto en la célula Fig.13.14.15.12. Estructura de un ribosoma Fig.16. Estructura de un centriolo Fig. 2. 2. 2. Fibras del Citoesqueleto Fig. Estructura de un cilio 66 .

En el interior de las células vegetales se encuentran los cloroplastos. Esquema general de la fotosíntesis La fotosíntesis es un proceso que utilizan las plantas. Fig.18. que forman la membrana interna. La luz solar contiene energía que ingresa a la atmósfera terrestre. 2. éstos se apilan formando estructuras llamadas granas (fig. La fotosíntesis se resume en la siguiente ecuación química: 67 . los cuales almacenan el pigmento verde llamado clorofila que capta la luz solar.17). Los cloroplastos están constituidos de una membrana externa que delimita al organelo del citoplasma y rodea al estroma dentro del cual se encuentran sacos membranosos llamados tilacoides. sólo una pequeña fracción de ésta es interceptada por los organismos fotosintéticos. 2. a partir de dos compuestos disponibles en el medio ambiente: el agua y el dióxido de carbono del aire. algas y algunas bacterias para sintetizar su alimento. presentes únicamente en las células vegetales y en protistas fotosintéticos. la fotosíntesis se lleva a cabo en los cloroplastos. que contienen un pigmento de color verde llamado clorofila.GUÍA METODOLÓGICA DE BIOLOGÍA CLOROPLASTOS Los cloroplastos son organelos de doble membrana. Este pigmento absorbe la energía de la luz solar y la cede para la elaboración (síntesis) de carbohidratos como la glucosa. usando como fuente de energía la luz solar que transforma en energía de enlaces químicos. En los organismos eucariontes. El oxígeno que se libera en la atmósfera sirve para efectuar el proceso respiratorio.

que no requiere la luz. Por el contrario. Estructura de un cloroplasto La fotosíntesis (fig. Fue Benda. Cada año la fotosíntesis de todos los vegetales del planeta fija unos 100 millones de toneladas de carbono. 68 .17. 2.18) tiene dos etapas: la fase luminosa que incluye una serie de reacciones que dependen de la luz. en 1897.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. quien las denominó mitocondrias (mito = hilo. Se ha calculado que si el CO2 consumido en la fotosíntesis no fuera repuesto por los procesos de respiración celular. Se le conoce como oscura porque no importa que la luz del Sol esté o no presente irradiando luz. se efectúa de cualquier forma. y la fase oscura. Fueron descritas por primera vez por Altman en 1884. desde el CO2 hasta los compuestos orgánicos. lento que todo el O2 en unos 2. MITOCONDRIA Con el microscopio óptico las mitocondrias aparecen como bastones o raquetas. cuantos meses.000 años. 2. chondrios = gránulo).

Cada una de unos 7 μm de espesor y entre ambas membranas hay un espacio de unos 8 μm (espacio perimitocondrial o intermembranal). El interior de la mitocondria está constituido por un contenido más o menos líquido denominado matriz mitocondrial (fig. Estos organelos presentan una doble membrana (externa e interna). la forma de la mitocondria podría compararse muy bien a la de un cacahuate.19. Las dimensiones de la mitocondria pueden ser desde 0. que constituyen tabiques denominados crestas. Estructura de una mitocondria Por regla general. número y forma son muy variables. sin embargo. 2. Fig. los túbulos distales del riñón y otras células que necesitan una gran fuente de energía son mucho más abundantes. 2. Éstas no llegan de un lado a otro de la mitocondria. todas las células de los organismos eucariontes tienen mitocondrias. En el hígado se calcula que hay unas 1000 mitocondrias por célula.GUÍA METODOLÓGICA DE BIOLOGÍA Su tamaño. en las células del corazón.19). 69 . Se distribuyen dentro de la célula en relación con los lugares donde la aplicación de esa fuente de energía es más intensa.5 μm hasta 5 o 7 μm de longitud. Tridimensionalmente. Nuestros glóbulos rojos y las amibas carecen de mitocondrias. y en un estadio del ciclo de vida del microorganismo protista denominado Tripanosoma brucei sus mitocondrias prácticamente desaparecen. por lo que la compartimentación que introducen es abierta. La membrana interna presenta invaginaciones hacia el interior. pero hay excepciones.

No es continua. parte de la energía desprendida de la glucosa. Está rodeado por un par de membranas concéntricas denominadas en conjunto envoltura nuclear o membrana nuclear. ¿qué pasa dentro de éstas? Es aquí donde comienza la respiración celular. Fig. Durante este proceso. se incorpora a una molécula de ATP (adenosín trifosfato). proceso que en las células eucariontes se lleva a cabo en un organelo especializado que es la mitocondria. 2. NÚCLEO Es el organelo más prominente de la célula y se localiza en cualquier sitio del citoplasma. Ahí son utilizadas en las funciones celulares de los órganos y también ayudan para todas las actividades diarias del cuerpo (fig. 2. pero. las moléculas de ATP salen de las mitocondrias y viajan a todas las células del cuerpo. sino que posee 70 .20).GUÍA METODOLÓGICA DE BIOLOGÍA El oxígeno del aire que respiramos llega a cada una de nuestras células a través de los glóbulos rojos que lo acarrean. con ayuda del oxígeno.20 Esquema general de la respiración celular La ecuación general de la respiración celular es: Una vez sintetizadas.

El nucleoplasma es un medio acuoso de solución coloidal en estado semigel. ACTIVIDAD Realiza un esquema global ilustrado que muestre la interrelación entre los reactivos y productos de las reacciones de la fotosíntesis y de la respiración celular. El poro es un complejo proteínico que controla el paso de sustancias a través de la envoltura nuclear.GUÍA METODOLÓGICA DE BIOLOGÍA poros que permiten el paso de las cadenas de ARNm. Además de que esta envoltura separa el contenido nuclear o nucleoplasma del citoplasma. 71 . rica en proteínas y es donde están suspendidos los cromosomas. sintetizadas del núcleo al citoplasma para que realicen su función.

Estructura del núcleo Los cromosomas son estructuras que se forman de ADN altamente compactado. pues son ricas en aminoácidos.21. por lo tanto tienen carga positiva (fig.21). 2. los cuales a menudo cambian de forma y tamaño.GUÍA METODOLÓGICA DE BIOLOGÍA Se considera que esta membrana y el núcleo tienen la misma relación que la membrana plasmática y el citoplasma. 2. que regulan de la misma manera los materiales que pasan hacia dentro y fuera del núcleo. 72 . 2. se utiliza el término cromatina. Cuando se encuentran en este estado. Las histonas son proteínas básicas. tales como la lisina y la arginina. o sea. Las nucleoproteínas son estructuras complejas formadas por ácidos nucleicos y proteínas del tipo de las histonas que en conjunto se denominan nucleosomas. Cuando una célula inicia su división éstos desaparecen y cuando termina la división celular aparecen nuevamente (fig. Fig. éstos contienen un grupo amino libre capaz de adquirir un protón por poseer un par de electrones no compartido.22). Dentro del núcleo se encuentra uno o más nucléolos que son pequeños cuerpos amorfos. La cromatina se encuentra formada por una nucleoproteína.

esenciales en el avance del conocimiento del desarrollo de la estructura y función los seres vivos.22. por lo cual las histonas se enlazan fuertemente con el ADN.GUÍA METODOLÓGICA DE BIOLOGÍA El ADN lleva carga negativa debido a la presencia de numerosos grupos fosfatos. para la elaboración de proteínas. 2. En general. El núcleo es el centro de regulación de la célula. Estructura de la cromatina Para poder comprender la función del núcleo tenemos que adentrarnos al estudio de otras biomoléculas. y del control de las funciones celulares. de la conservación de la información y herencia genética. La célula inicia la división y la cromatina se organiza en los cromosomas. Contiene los factores hereditarios de la célula. término que quiere decir cuerpos coloreados. En general se les considera como macromoléculas naturales. cuya función principal es la de contener y permitir la transcripción y traducción de la información genética (código genético). información que se centra en el Dogma Central de la Biología. es el centro de control. polímeros de nucleótidos de una cadena (ARN) o dos cadenas (ADN). los ácidos nucléicos. 2. sobre todo en los aspectos de la reproducción celular. permitiendo así que sus características pasen a sus descendientes. sustancias importantes para la estructura y funcionamiento de las células. 73 . La continuidad celular: Es necesario para la reproducción y regeneración de las partes perdidas. cuyas principales funciones son: 1.

estructura tridimensional.. para que a partir de la información colectada se elabore un diagrama de Venn de diferencias y similitudes de los ácidos nucléicos ADN ARN ACTIVIDAD Realiza una investigación documental y completa el siguiente cuadro de los tipos de ARN 74 . etc. funciones.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los ácidos nucléicos: unidades que los conforman (niucleótidos). tipos.

Razonaron. ¿Cómo podía el ADN. Es decir. entonces. que estaba dentro del núcleo. que se encuentra en el citoplasma. El ARN tenía varias características que lo hacían un firme candidato: • Un esqueleto de azúcares y fosfatos (a pesar de que tiene un azúcar distinto. ADN → Proteínas Pero si esto era cierto. la molécula de ADN debía dirigir la síntesis de proteínas. dirigir la síntesis de proteínas fuera del mismo? A Crick se le ocurrió la idea de que debía existir un intermediario. esta debía funcionar como un código. sería más fácil entender su función.GUÍA METODOLÓGICA DE BIOLOGÍA tipo de ARN forma localización función ¿EL DOGMA CENTRAL DE LA BIOLOGÍA ES UNIVERSAL? Watson y Crick sospecharon que una vez esclarecida la estructura del ADN. Para mitad de los 50’s se sabía que la secuencia de nucleótidos en el ADN daba origen a una secuencia de polipéptidos. que si el ADN era la molécula que transmitía la información genética a las células hijas. ADN → ¿? → Proteínas Un posible candidato para intermediario era el ARN. faltaba dilucidar una pieza del rompecabezas ya que se sabía que las proteínas se sintetizaban fuera del núcleo. ya que el ARN tiene ribosa en vez de desoxirribosa). 75 .

y que esta puede pasar al ADN de sus huéspedes. ya que las ideas científicas sólo son aceptadas hasta que aparezca evidencia experimental que las desmienta. la ciencia es un ente dinámico. Estas excepciones atañen. lo que es lo mismo. como el VIH. • El ARN es una cadena sencilla. durante algún tiempo esta idea adquirió cierta dimensión de verdad absoluta en la mayoría de los libros de texto. Si bien Crick usó el término dogma en un sentido figurado y quizá con humor.GUÍA METODOLÓGICA DE BIOLOGÍA • Tanto el ADN como el ARN usan las mismas bases nitrogenadas. una vez que la información llega a las proteínas. a su vez. Ese proceso ocurre en sentido contrario al esquema de Crick. • El uracilo se puede unir a la adenina como lo hace la timina. ya que la información pasa del ARN al ADN. las proteínas no pueden influir en los genes. que especifica que el ADN se traduce en ARN y este. dirige la producción de proteínas. Es decir. estas no pueden ser cambiadas o. entre otras situaciones o elementos. Crick sintetizó esta idea a lo que llamó el Dogma Central de la Biología. Según este postulado. En 1971 se descubrió que algunos virus. No obstante. a los priones. salvo notables excepciones. Además. Actualmente el dogma ha sufrido cierta fisura. llevan su información en forma de ARN. pues han surgido una serie de elementos que implican la ampliación de este dogma tan categórico. ribozimas y la enzima transcriptasa inversa. la información fluye de manera unidireccional: no puede moverse de las proteínas al ADN. que no se asienta en dogmas. actualmente se sabe que tanto el ARN como las proteínas pueden influir en la expresión del código genético. 76 . pero el ARN tiene uracilo en vez de timina.

traduciendo el lenguaje nucléico al lenguaje proteíco. 2.24). La información contenida en el ARNm es "leída" por estructuras llamadas ribosomas. es por lo tanto: ADN → ARN → Proteínas Fig. y así sucesivamente. La información contenida en el ADN se transcribe a una molécula de ARN (proceso llamado transcripción) que recibe el nombre de ARN mensajero o ARNm. 2. La relación que hay entre ambos lenguajes recibe el nombre de Código Genético (fig. Este proceso se denomina traducción.21): 1. TTT por Lisina. El flujo de información para la expresión de los genes. la palabra GTG en ácidos nucléicos en proteína se traduce por Histidina.GUÍA METODOLÓGICA DE BIOLOGÍA Podemos resumir el Dogma Central de la Biología como sigue (fig. Así. 2. Dogma Central de la Biología 77 .23. 2.

transcripción y traducción). Considerando tu modelo responde las siguientes preguntas.23). ¿Qué sucede para separar las dos hebras de ADN? 5. el nuevo individuo recibe la mitad del ADN de cada uno de sus padres. En el modelo que construiste ¿qué sería la polimerasa? 6. ACTIVIDAD Haz una investigación documental acerca de los procesos involucrados en el Dogma Central (duplicación. ¿Cuál es la finalidad de construir una secuencia de bases de ADN? 7. como copia exacta del ADN parental. Si el ADN se transmitiera a la célula o al individuo hijo sin variación. Así. Ahora bien: en la reproducción sexual. 2. ¿En qué momento del ciclo celular ocurre la replicación del ADN? 3. ¿Qué paso de este modelo representa la transcripción? 8. Por equipo. Esto lo hace el ADN duplicándose a sí mismo en el proceso conocido como replicación. ¿Qué pasos del modelo representan la traducción? 9. este individuo es genéticamente distinto de ambos: así es como la reproducción sexual genera variabilidad. ¿Cómo es la secuencia de las moléculas hijas de ADN con respecto a la original? 2. ¿Cómo está relacionada la secuencia de bases en los ácidos nucléicos con la secuencia de aminoácidos en las proteínas? 78 . 1. estaríamos ante la reproducción clónica (fig. ¿Qué pasaría si el ADN no se duplicara antes de la división celular? 4.GUÍA METODOLÓGICA DE BIOLOGÍA Pero la otra función del ADN es la de transmitirse a su descendencia. idea y construye un modelo para representar cada proceso.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Utilizando el código genético deduce. ¿Cuál sería el ARNm y el polipéptido resultantes de la siguiente secuencia de ADN? CCGCGGCATATTTATGGCAAAAGC ARNm → Polipéptido → ¿Cuántos codones posee el ARNm? ¿De cuántos aminoácidos formarían el polipéptido? __________________ __________________ 79 .

el núcleo sería el ingeniero porque es quién “ordena y dirige” la construcción del edificio (proteína) Nucléolo Aquí se sintetizan los tipos de moléculas de ARNr que se usan en la formación de los ribosomas.4 ¿CÓMO SE REPRODUCEN LAS CELULAS? CICLO CELULAR La reproducción es una función básica de los seres vivos.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Si hiciéramos la analogía de la síntesis proteica con la construcción de un edificio. 2. La reproducción tiene una íntima relación con la transmisión de caracteres hereditarios y la evolución de las especies. Por ejemplo. es un proceso que les permite a las especies la continuidad de la vida tanto en el tiempo porque las perpetua. como en el espacio porque sustituye a los organismos que mueren y se mantiene el número de individuos. 80 . ¿cuáles serían los protagonistas de dicha obra y por qué? Escribe la letra dentro del paréntesis que corresponda Explica en cada caso el porqué asignaron esa respuesta. Los nucléolos son esenciales para la síntesis de proteínas y de ácidos ribonucleicos.

GUÍA METODOLÓGICA DE BIOLOGÍA El proceso de división celular por el cual una célula da origen a dos células idénticas con igual dotación de cromosomas. mientras que. Para lograr esta división. previo a la fase S. 81 . Para dividirse. 2. por lo que en el periodo G1. En el caso de las células somáticas humanas cada célula que se divide da lugar a dos células hijas con 46 cromosomas. siendo notables excepciones las neuronas y los miocitos. se denomina mitosis. en el cual el ADN no está compactado y forma una fina red dentro del núcleo. lo cual ocurre durante el periodo S o fase de síntesis (de ADN). después del periodo S. Al final del periodo G2 ocurren las fases de la mitosis. constituyendo lo que se denomina el ciclo celular.24. las cuales se suceden en un tiempo de una a dos horas. en el periodo G2 los cromosomas ya aparecerán formados por dos cromátidas unidas por el centrómero. cada cromosoma estará constituido por una simple cromátida. ocurren transformaciones y fenómenos que se suceden de manera cíclica. se dice que la célula está en el periodo de interfase. la célula ha tenido que duplicar previamente su material genético. Ciclo celular La mayoría de las células del organismo se divide periódicamente. Cuando no se manifiestan los fenómenos de la división.

en donde cada célula tendrá toda la información genética para la totalidad de las características del organismo. En los organismos pluricelulares. sana 82 . En la telofase se forman dos núcleos hijos (cariocinesis) y el citoplasma también completa su división (citocinesis) mediante un plegamiento de la membrana que comienza desde la periferia en la parte media y progresa hacia el centro de la célula.24). restituye las células muertas. 2. la cual es la subunidad proteica de los microtúbulos. de tal manera que finalmente se obtienen dos células hijas con igual dotación de cromosomas y citoplasma (división ecuatorial). migre hacia el polo respectivo de la célula. los cromosomas que ya se habían duplicado en el periodo de síntesis de la interfase. migrando uno de ellos por la periferia del núcleo hacia el otro polo de la célula. En la anafase ocurre la división longitudinal del centrómero. La membrana nuclear deja de hacerse visible y se observan los centríolos. sino que además. En la profase. lo que permite que cada cromátida se separe y. los cromosomas se colocan en el plano ecuatorial de la célula y aparecen unidos por el centrómero con el huso acromático. de modo que cada célula tenga exactamente el mismo número y tipo de cromosomas que las demás células de la misma especie.GUÍA METODOLÓGICA DE BIOLOGÍA DIVISIÓN CELULAR Mitosis Es un proceso continuo con fases consecutivas que se definen según las características morfológicas que presentan los cromosomas (fig. los centríolos son los sitios donde se ensambla la tubulina. unida por su centrómero al huso acromático. Esto garantiza que la información genética (juego de cromosomas) se distribuya exactamente en cada uno de los núcleos hijos. se acortan y aparecen como bastones compactos. la división mitótica no solamente puede dar origen a nuevos individuos por reproducción vegetativa en plantas o por fragmentación en animales. que también se han duplicado. que forma el huso mitótico. La mitosis asegura la distribución exacta y equitativa de los cromosomas en cada una de las células hijas. En la metafase.

así que las células hijas son exactamente iguales a la progenitora. Esto conlleva una variabilidad mínima. En este mecanismo de reproducción no interviene el sexo. por lo que se denomina reproducción asexual.25. como muchas plantas. Con una rama de un árbol se puede obtener un árbol entero idéntico genéticamente al original. una ventaja en condiciones ambientales estables y una desventaja cuando estas condiciones cambian. en los que es un medio auxiliar de reproducción. Otros tipos de reproducción asexual ocurren también en organismos unicelulares e incluso pueden darse en organismo superiores. Los organismos unicelulares se reproducen habitualmente mediante mitosis. la mitosis es una forma de producir mucha progenie idéntica. regenera tejidos dañados o perdidos del cuerpo. 2. En organismos unicelulares. formando. por su capacidad de adaptabilidad.GUÍA METODOLÓGICA DE BIOLOGÍA heridas y en algunos casos. Fases de la mitosis 83 .

denominado entrecruzamiento (crossingover). que tiene notable importancia en la evolución y variación genética de las especies que se reproducen sexualmente.26. es precedida de la duplicación de los cromosomas.GUÍA METODOLÓGICA DE BIOLOGÍA Meiosis Un mecanismo más complejo y perfecto de reproducción es la reproducción sexual que acontece en los organismos con diferenciación sexual y está mediada por células gaméticas haploides que se fusionan para formar un cigoto diploide. lleven a cabo un tipo de división especial denominado meiosis (fig. denominadas primera y segunda divisiones meióticas. 84 . 2. sólo una de ellas. la primera. este mecanismo exige que células diploides que originan gametos. directamente o indirectamente después de una serie de divisiones mitóticas. Fases de la meiosis La meiosis permite la reducción del número de cromosomas por medio de dos sucesivas divisiones celulares. Como compensación.26). 2. Los cromosomas homólogos se aparean en la primera división de la meiosis y realizan un proceso de intercambio de material genético.

completándose la migración hacia los polos en la telofase II. los dos cromosomas de cada par se separan. cada una de las dos células obtenidas en la meiosis I originará a su vez otras dos. los cromosomas bivalentes.GUÍA METODOLÓGICA DE BIOLOGÍA En la profase I. los cromosomas se colocan en el plano ecuatorial de la célula y en la anafase II ocurre la división longitudinal del centrómero. orientando sus centrómeros hacia cada uno de los polos. En la metafase I. dirigiéndose cada uno al polo celular correspondiente. o sea. formando los llamados cromosomas bivalentes y luego intercambian porciones de su material en lo que constituye el punto de entrecruzamiento. ACTIVIDAD Completa la siguiente tabla de diferencias entre mitosis y meiosis escribiendo en el espacio el enunciado correspondiente a la descripción 85 . se colocan en el plano ecuatorial de la célula. cada una de ellas con un número simple o haploide de cromosomas en condiciones normales. los cromosomas homólogos se aparean o sinapsan en toda su longitud. Por consiguiente. Esta separación de los homólogos constituye la base física de la segregación de los alelos. la cual es seguida por la meiosis II. En la metafase II. cuatro en total. el cual se manifiesta citológicamente por los llamados quiasmas. después de haber llevado a cabo el entrecruzamiento. En la telofase I se completa la primera división de meiosis. Durante la anafase I.

las lleva a cabo cada célula. Las células se miden en micras (µm).GUÍA METODOLÓGICA DE BIOLOGÍA 2. excretar el exceso de líquido y evadir a los depredadores. los eritrocitos se convierten en sacos de forma discoidal llenos de hemoglobina. Las células presentan formas diversas que en general se relacionan con su función. procurarse alimento. los espermatozoides poseen un flagelo que les da una gran movilidad. forma y función de las células Casi todas las células son microscópicas. ACTIVIDAD Elabora en tu libreta un cuadro de doble entrada con las siguientes características SISTEMAS MEMBRANOSOS LOCALIZACIÓN COMPOSICIÓN QUÍMICA MORFOLOGÍA FISIOLOGÍA SISTEMAS NO MEMBRANOSOS ORGANELOS 86 . que juntos suministran apoyo mecánico. las células del cartílago se rodean de una matriz característica que contiene polisacáridos y la proteína colágeno. la milésima parte de un milímetro. Se considera a los protozoarios como los paramecios y las amibas organismos unicelulares complejos. como responder ante estímulos del ambiente. es decir. pues su función reproductora así lo requiere. las células del músculo esquelético contienen una red de filamentos alineados con precisión y compuestos de proteínas contráctiles.5 ¿CÓMO SE PASA DE UNA CÉLULA A LA PLURICELULARIDAD? Tamaño. por tanto las células procariontes miden entre 1-5 µm y las eucariontes de 10 a 30 µm en animales y hasta 100 µm en vegetales. que transporta oxígeno. ya que todas las actividades celulares que realizan. Por ejemplo.

compáralas entre sí de acuerdo a su función y explica porqué tienen esa estructura. 87 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga y dibuja tres o mas tipos diferentes de células humanas.

Debido a la complejidad del mismo. se recomienda que se construya en varios pliegos de papel bond para poder extenderse. conectivo. especializada para una tarea específica. hueso. Un tejido es un grupo de células y de material extracelular que forman una unidad estructural y funcional. liso y cardiaco. Este mapa conceptual se expondrá al grupo para su evaluación. Existen tres tipos de tejido muscular: el esquelético. el tejido adiposo y la sangre • El tejido muscular está especializado en el movimiento y utiliza filamentos proteicos que se deslizan. ligamentos.GUÍA METODOLÓGICA DE BIOLOGÍA 2. la actina y la miosina. RUBRICA PARA EVALUAR UN MAPA CONCEPTUAL Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Asignatura: 88 . • El tejido epitelial forma membranas que cubren las superficies corporales interna y externa y también origina las glándulas • El tejido conectivo generalmente contiene una cantidad considerable de material extracelular e incluye a la dermis. ACTIVIDAD ESPECÍFICA Por equipo. Los órganos están compuestos de tejidos los cuales se componen de células.6. cartílago tendones. elabora un mapa conceptual de una célula eucarionte hipotética donde interrelaciones a todos los componentes celulares con sus funciones. Los tejidos animales incluyen el tejido epitelial. ¿CUÁL ES LA RELACIÓN TEJIDO-ÓRGANO-SISTEMA? El cuerpo animal está compuesto de sistemas los cuales a su vez están formados por dos o más órganos. • El tejido nervioso está especializado en la generación y conducción de señales eléctricas. muscular y nervioso.

Y al leer los conceptos con sus relaciones.. Muestra cada concepto una sola vez. y sobre Especificación la línea escribe frases de conectores y o palabras claves que nexos entre los indican la relación conceptos. no tienen sentido por sí mismo. y sobre la línea escribe frases o palabras claves que indican la relación existente entre dichos conceptos. tienen sentido por sí mismo. 2005) 89 . Solo utiliza algunas líneas para unir los conceptos. pero no lo hace en todas las líneas BIEN (2) Identifica los conceptos y solo muestra dos ramas que se derivan del concepto principal Ordena los conceptos del más general al más específico. pero no escribe frases o palabras claves que indiquen la relación existente entre dichos conceptos. aunque haya los conceptos relaciones que tengan relacionándolos que marcarse de un vertical y extremo a otro de la horizontalmente hoja y se pueden según el grado apreciar varias de inclusividad relaciones entre conceptos de manera clara y correcta Muestra cada concepto varias veces. Muestra cada concepto una sola vez. y no escribe sobre la líneas frases o palabras claves que indiquen la relación existente entre dichos conceptos. aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja. Y al leer los conceptos con sus relaciones. pero sólo se pueden apreciar algunas relaciones entre conceptos de manera clara y correcta Utiliza líneas para unir los conceptos. existente entre dichos conceptos. PUNTAJE Jerarquización de los conceptos de mayor a menor inclusividad Muestra cada concepto una sola Organización de vez. TOTAL: COMENTARIOS: REFERENCIAS:(Garza. pero no muestra ramas que se derivan del concepto principal No ordena los conceptos del más general al más específico. Metodología Constructivista. no tienen sentido por sí mismo. aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja.GUÍA METODOLÓGICA DE BIOLOGÍA PONDERACIÓN CRITERIOS EXCELENTE (4) Identifica los Identificación de conceptos y tiene conceptos del varias ramas que se tema derivan del concepto principal Ordena los conceptos del más general al más específico. pero no se pueden apreciar relaciones entre conceptos de manera clara y correcta DEFICIENTE (1) Identifica solo los conceptos. Guía para la planeación docente. MUY BIEN (3) Identifica los conceptos y tiene algunas ramas que se derivan del concepto principal Ordena los conceptos del más general al más específico. aunque haya relaciones que tengan que marcarse de un extremo a otro de la hoja y no muestra relaciones entre conceptos de manera clara y correcta Utiliza líneas para unir los conceptos. Y al leer los conceptos con sus relaciones. 2002) (Pimienta. tienen poco sentido por sí mismo. 2000) (Núñez Chan. haciéndolo en todas las líneas Utiliza líneas para unir los conceptos. Y al leer los conceptos con sus relaciones.

Cervantes M. Puntos 80 Aspectos a mejorar : Autónomo Argumenta diferencias y semejanzas de los procesos celulares mediante un mapa conceptual integrador. Los Mecanismos de la Vida. Ponderación Logros: Puntos 30 Puntos 60 Puntos 100 EVALUACIÓN DIAGNÓSTICA Aplicación de un examen diagnóstico y la retroalimentación por medio de una lluvia de ideas. 90 . México pp.GUÍA METODOLÓGICA DE BIOLOGÍA MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios Analiza la estructura y los procesos celulares mediante un mapa conceptual integrador. Puntos 100 Estratégico Fundamenta los procesos celulares a través de un mapa conceptual integrador. (2005) Biología General. Madrid España pp. Pre-formal Investiga la estructura y los procesos celulares mediante un mapa conceptual Receptivo Identifica la estructura y los procesos celulares mediante un mapa conceptual integrador. 53 y 62-64. Biología Celular y Molecular. y Hernández M. Publicaciones Cultural 2ª reimpresión. 52. Resolutivo Establece diferencias y semejanzas entre la estructura y los procesos celulares mediante un mapa conceptual integrador.50. Ediciones Cultural. 126-141 Lodish. Editorial Médica Panamericana 5ª edición. ACTIVIDADES DE APRENDIZAJE: • Línea del tiempo • Cuadro de doble entrada • Reporte de laboratorio en V-Gowin ACTIVIDAD ESPECÍFICA: • Mapa conceptual integrador Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad FORMATIVA SUMATIVA 30% 20% 20% 30% BIBLIOGRAFÍA BÁSICA Atlas de Biología. Harvey (2005).

GUÍA METODOLÓGICA DE BIOLOGÍA Overmire. (1987) Las Células de la Mente. Fondo de Cultura Económica. pp. Biología. La Ciencia desde México 30. México. 70-100 Vázquez C. R. 72-125 BIBLIOGRAFÍA COMPLEMENTARIA Bojorquez Castro. México.com Proyecto Biósfera. La Vida Celular. Consejo Nacional de Ciencia y Tecnología Tapia.mec.bioxeo. M. SEP/Santillana. Villarreal.cellsalive. (2001) Biología. Luis (2000). Asociación Nacional de Universidades e Institutos de Enseñanza Superior George Dreyfus (2002). 611páginas. La Vida y sus Procesos. 75-95 Valdivia.htm Cells alive http://www.com/plabioca. Granillo y P.es/biosfera/ 91 . Programa Nacional de Formación de Profesores.S. Ed Mc Graw-Hill 3ª edición. Ed. Fondo de Cultura Económica. (2004). Biología. Ricardo. Consejo Nacional de Ciencia y Tecnología VIDEOS RECOMENDADOS • Gran Planeta Celular • Cosmos de Carl Sagan TIC’s Bioxeo – Recursos Biología http://www. pp.cnice. http://recursos. Ed. pp. Antonio (1986). (2003). Publicaciones Cultural. Colección Espejo de Urania. Limusa México. La Ciencia desde México 18. Las Membranas de las Células. Salomón B Martín. B. México Peña. Bachillerato General Publicaciones Cultural Primera Edición. (2006) Biología. La Célula.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 3 Herencia y variación MI FAMILIA 92 .

GUÍA METODOLÓGICA DE BIOLOGÍA 93 .

Valora el respeto a la decisión de los padres a tener o no un hijo con alguna enfermedad hereditaria. consultando fuentes relevantes y realizando experimentos pertinentes. registra y sistematiza la información para responder a preguntas de carácter científico. Ejemplifica las aplicaciones más importantes de la Genética. así como su impacto en la vida actual. CRITERIOS DE DESEMPEÑO Investiga los hechos históricos premendelianos mediante una línea del tiempo. • • • • 94 . Actitudinales/Valorales Fomenta el respeto y tolerancia hacia personas con enfermedades hereditarias y/o con rasgos físicos diferentes.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE: HERENCIA Y VARIACIÓN TIEMPO: 29 horas UNIDAD DE COMPETENCIA: Investiga los fundamentos que permiten delinear las bases genéticas de la herencia para argumentar su desarrollo histórico.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. elaboración de cariotipos y la realización de un ensayo. SABERES Procedimentales Realiza una línea del tiempo del desarrollo histórico del campo de la Genética Aplica los conceptos de la genética en las leyes de la herencia para la resolución de problemas de genética. Declarativos Analiza los hechos históricos que condujeron al estudio de la Genética Analiza las leyes de la genética mendeliana para comprender el mecanismo de la herencia. Aplica las Leyes de Mendel a través de la práctica de su método experimental y los diferencia de patrones hereditarios no mendelianos Categoriza e identifica a las mutaciones como mecanismos generadores de enfermedades hereditarias. por medio de la construcción y el diagnóstico de un cariotipo. valorando la trascendencia del proyecto genoma humano y su alcance en las aplicaciones de la biotecnología a través de la resolución de problemas. Realiza una práctica de rasgos hereditarios para identificar el fenotipo de sus compañeros y predecir su posible genotipo. Explica los patrones hereditarios mendelianos y no mendelianos Describe las mutaciones como mecanismos de variabilidad genética. Fundamenta opiniones sobre los impactos de la ciencia y la tecnología en su vida cotidiana. asumiendo consideraciones éticas. COMPETENCIAS Genéricas/Atributos Disciplinares 6. Desarrolla un ensayo sobre el impacto de las aplicaciones de la Genética sobre algunas actividades humanas. Obtiene. 2. Categoriza las mutaciones como mecanismos que producen enfermedades hereditarias y las detecta mediante la elaboración de cariotipos. 4. Critica de forma informada las aplicaciones actuales de la Genética que permita la toma de decisiones apegadas a la Bioética. Analiza las aplicaciones actuales de la genética mediante la investigación y elaboración de un ensayo.

• Ensayo. Escribe 2 enfermedades hereditarias ______________________________________________________________________ 95 . • Resolución de experimentales. EXPLORANDO TUS CONOCIMIENTOS 1. Escribe 5 rasgos que se hereden ______________________________________________________________________ 4. • Cañón. • Artículos de EVIDENCIAS Y/O PRODUCTOS • Línea del tiempo • Reporte de la práctica V preguntas generadoras • Dinámicas grupales • Presentaciones de comparativo • Elaboración de un cuadro de Gowin • Entrega de un • Ensayo • Árbol genealógico • Problemario resuelto cariotipo sinóptico • Resolución de problemas • Construcción de árbol power point sobre mutaciones y enfermedades hereditarias. • Pizarrón. • Actividades genealógico • Investigación • Cuestionarios. ¿De qué están compuestos los genes? ______________________________________________________________________ 3. • Revista electrónicas. • Manual de prácticas. • Videos • Ilustraciones y actividades de la guía. • Computadora. • Reporte de actividades animaciones sobre temas de genética • Software educativo. • Laboratorio virtual. • Resolución de divulgación científica. ¿Por qué te pareces a tus padres?__________________________________________________________________ 2. problemario. • Plumones. • Problemario. • DVD experimentales a través de una V de Gowin.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • Aplicación de ESTRATEGIAS DE APRENDIZAJE • Elaboración de un collage • Elaboración de un cuadro • RECURSOS DIDÁCTICOS Guía metodológica.

Elabora un glosario con un mínimo de 20 términos.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD: GLOSARIO Para analizar mejor este bloque es importante y necesario que antes te familiarices con la terminología de genética. 96 .

mientras que otros ni siquiera consideraban que este tipo de mezclas eran necesarias. Los héroes folclóricos de Rusia y Escandinavia.) enunció la teoría de la pangénesis. La esposa de Minos.C. El camello y el leopardo también se apareaban de vez en cuando. 3. pero los mecanismos no eran conocidos. y que el esperma solo lo estimulaba. moscas.) pensaba que el semen masculino y el flujo menstrual se mezclaban en la concepción. el holandés Anton van Leeuwenhoek descubre "animáculos" en el esperma humano y de otros animales. enriqueciendo así el linaje nacional. Aristóteles (384-322 a.LAS IDEAS PREMENDELIANAS Muchas veces hemos oído expresiones como “este niño es idéntico a su papá” o bien “tiene los ojos de la abuela”. Muchas leyendas se basaron en extravagantes posibilidades de apareamiento entre individuos de diferentes especies. según los primeros naturalistas. Durante el siglo XVIII. es decir.1 ¿CUÁLES HECHOS HISTÓRICOS CONDUJERON AL ESTUDIO DE LA GENÉTICA? . la escuela ovista pensaba que el futuro ser se encontraba dentro del óvulo. según la cual cada parte del organismo enviaba su información hereditaria a los órganos reproductores. y posteriormente la información de ambos padres se mezclaba como un fluido.) nacían por generación espontánea. de los que estos hombres derivaban su gran fuerza. el folklore reflejó las nociones tempranas e imperfectas acerca de la naturaleza de las relaciones hereditarias. dentro de cada espermatozoide (Fig. las formas "simples" (gusanos. se apareó con un toro y produjo el Minotauro. Se procreaba y se observaban ciertos rasgos físicos semejantes entre padres e hijos.1) y afirmaban que la hembra sólo proveía el ambiente para el desarrollo de la futura generación.C. Algunos otros. eran tradicionalmente los hijos de mujeres que habían sido capturadas por osos. Así. 97 . a un animal tan poco probable como la jirafa. que eran incapaces de explicar de otro modo.GUÍA METODOLÓGICA DE BIOLOGÍA 3. imaginaron ver a un "pequeño hombrecito" al que llamaron homúnculo. Los filósofos griegos sostenían varias ideas: Hipócrates (460-377 a. etc. según la mitología griega. Por el contrario. como los espermistas. sabemos que algunas características de los individuos han sido heredadas de sus progenitores ¿Cómo sucede esto? A lo largo de la historia de la humanidad se desconocían los detalles científicos de cómo funcionaba la herencia.

GUÍA METODOLÓGICA DE BIOLOGÍA En el siglo XIX. ¿Por qué le llamó Ley de la Segregación a su segunda Ley? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 98 . pues el material hereditario blanco y negro. nunca podría separarse de nuevo. una vez mezclado. la teoría de la mezcla explicaba que la unión de óvulos y espermatozoides producía una descendencia que era una "mezcla" de los rasgos de los padres. ¿Sabía Mendel qué era un gen? ¿Por qué? _____________________________________________________________________________________ _____________________________________________________________________________________ 2. ¿Por qué utilizó Mendel en sus experimentos chícharos y no otra planta? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 3. Ley de la Uniformidad? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ 4. A base de esta hipótesis podría predecirse que la progenie de un animal negro y de uno blanco sería gris y que su progenie también lo sería. ACTIVIDAD: Realiza una investigación documental y en tu libreta contesta las siguientes preguntas: 1. ¿Por qué Mendel llamó a la 1ª.

1) Tabla 3. con el título Experimentos en Hibridaciones de Plantas. Mendel seleccionó para su investigación siete rasgos del chícharo: textura y color de la semilla. llamadas genes.1. forma y color de la vaina y longitud del tallo (tabla 3.GUÍA METODOLÓGICA DE BIOLOGÍA EL EXPERIMENTO DE MENDEL Se podría decir que el nacimiento de la Genética ocurrió cuando el fraile agustino Gregor Mendel (1822-1884) realizó experimentos acerca de la herencia en chícharos (Fig. Mendel cimentó las bases de la Genética actual explicando que los rasgos heredables son contenidos en unidades discretas.2) y en 1865 presentó su investigación a la Sociedad de Historia Natural de Brünn (actual República Checa). Los siete rasgos del chícharo que estudió Mendel 99 . No fue hasta 1930 cuando se comprendió completamente el alcance de su obra. que se heredan por separado en cada generación. específicamente en relación con la teoría de la evolución de Darwin. 3. posición y color de la flor.

Por otro lado. 3. posición de las flores. agrégale los hechos más relevantes que marcaron el curso de la genética. a partir del trabajo de Mendel. el color de cabello. forma de la hoja. expone varios conceptos básicos para la comprensión de los mecanismos de la herencia: El fenotipo es la apariencia de un organismo. 3. mientras que la letra “a” minúscula refiere al gen para el tallo bajo que corresponde a un rasgo recesivo. Empleó un par de letras que representan los genes que intervienen en cada rasgo estudiado.GUÍA METODOLÓGICA DE BIOLOGÍA Mendel ideó un mecanismo para simbolizar y comprender la transmisión de los rasgos hereditarios. el genotipo es la constitución genética de un organismo que determina 100 . en el tamaño de la planta. la letra “A” mayúscula representa al gen para tallo alto. 3. color de ojos. que es un rasgo dominante.2 Gregor Mendel ACTIVIDAD Retomando la línea del tiempo de célula.2 ¿QUÉ DIFERENCIAS Y SIMILITUDES ENCONTRAMOS EN LOS CONCEPTOS DE LA GENÉTICA? La genética actual. color de piel. altura. Por ejemplo. Fig. etc.1 El homúnculo Fig. todo lo que podemos observar como resultado de la expresión de la información genética. Por ejemplo.

Ley de la segregación de los caracteres Los alelos de un carácter en los híbridos de la primera generación se segregan durante la formación de los gametos sin mezclarse y se reúnen de nuevo de todas las formas posibles en la fecundación para originar a los individuos de la segunda generación (fig. el cruzamiento inicial entre dos variedades se llama generación paterna. los genes “A” y “a” son alelos porque ambos codifican para la misma característica (tamaño de la planta). lo que permite su segregación en distintos gametos durante la meiosis. Además. en un lugar físico específico. Las generaciones sucesivas a partir de este cruzamiento se denominan F2 y así sucesivamente. Para facilitar la notación. Segunda ley . o F1. 3. Los genes alelos son determinados segmentos de ADN que determinan un rasgo hereditario. el primero tiene sólo alelos dominantes (AA) y el segundo lleva sólo alelos recesivos (aa). Los cromosomas homólogos tienen los mismos genes. dominante y recesivo. aunque se puede inferir al analizar las proporciones fenotípicas. se dice que el genotipo es homocigoto (raza pura).Ley de la uniformidad de la primera generación Al cruzar entre sí individuos de razas puras distintas para un determinado carácter. ESTABLECIDAS POR MENDEL. conocido como locus. cada gen se ubica en un cromosoma del par homólogo. se llama primera generación filial. aunque con expresiones distintas: alta y baja. se obtiene una generación de individuos híbridos. En el ejemplo anterior. 3. ubicados en los mismos loci (plural de locus).GUÍA METODOLÓGICA DE BIOLOGÍA al fenotipo y que no es observable directamente. Cuando el individuo porta alelos distintos (Aa). respectivamente. genéticamente iguales para ese carácter y cuyo fenotipo es producto del carácter dominante. 101 . ya fuese para la forma de las semillas o para las plantas. o P1. Cuando un organismo tiene alelos iguales. y su descendencia. Cada gen se ubica en uno de los cromosomas homólogos. su genotipo es heterocigoto (híbrido).3 ¿EN QUÉ CONSISTEN LAS LEYES.3). SOBRE LA HERENCIA? Primera ley .

se rigen por las leyes de Mendel. herencia autosómica dominante y recesiva. enfermedad de Huntington.Ley de la herencia independiente de los caracteres Cada uno de los caracteres hereditarios se transmite a los descendientes con absoluta independencia de los demás (fig. Si por el contrario aparece un solo fenotipo entonces es homocigoto (fig. Esto implica que los patrones hereditarios.GUÍA METODOLÓGICA DE BIOLOGÍA Tercera ley .4) Cruzamiento de prueba Al cruzar un fenotipo con el padre homocigoto recesivo se puede determinar el genotipo desconocido. Si una persona tiene un alelo dominante defectuoso desarrollará la enfermedad. 3. 3. herencia intermedia. codominancia. alelos múltiples. Por otro lado. Se heredan de esta forma: braquidactilia. genes ligados. tanto rasgos normales como alteraciones hereditarias. determinación del sexo. 102 .7). poligenia y herencia multifactorial. Se conoce como autosómica porque el gen se encuentra en un cromosoma somático o autosoma.5). polidactilia y aniridia. Por ejemplo. 3. aquellos rasgos que no cumplen dichas leyes quedan incluidos en la herencia no mendeliana. Por ejemplo. HERENCIA MENDELIANA Herencia autosómica dominante En este tipo de herencia sólo se necesita uno de los genes para que se exprese una característica o una mutación (Fig. acondroplasia.4 ¿QUÉ DIFERENCIA HAY ENTRE LOS PATRONES HEREDITARIOS MENDELIANOS Y LOS NO MENDELIANOS? Los principios establecidos por Mendel se agrupan en un modelo genético denominado herencia mendeliana. La característica o anomalía será más extrema o severa en los individuos homocigotos que en los heterocigotos. 3. Si se producen dos fenotipos distintos quiere decir que el progenitor desconocido era heterocigoto para ese carácter. herencia ligada al sexo.

cuya dotación cromosómica es de 46. se heredan de esta forma. puesto que llevan un alelo normal y otro alterado. fenilcetonuria y fibrosis quística.8 Herencia autosómica recesiva En la mujer ocurre la inactivación de uno de los cromosomas X (que resulta en la formación del corpúsculo de Barr observado en los núcleos interfásicos). Son personas fenotípicamente normales. que definen los caracteres sexuales. albinismo. y cromosomas sexuales o gonosomas. Se heredan de forma autosómica recesiva la anemia drepanocítica (o falciforme). 103 . Fig.GUÍA METODOLÓGICA DE BIOLOGÍA Herencia autosómica recesiva Se expresa únicamente cuando en el genotipo de un individuo están los dos alelos recesivos que pueden ser normales o mutados (Fig.7 Herencia autosómica dominante Fig. entre otras. Los portadores son heterocigotos para el gen. pero que pueden transmitir su alelo defectuoso a sus hijos. proceso que mantiene el equilibrio génico en ambos sexos al igualar el contenido de ADN cromosómico activo. Casi todas las enfermedades causadas por la falta de una enzima esencial. cada célula somática contiene 22 pares de autosomas más un par sexual XX si se trata de una mujer (homogaméticas) y 22 pares de autosomas y un par XY si se trata de un varón (heterogaméticos). 3.8). 3. 3. En el humano. Determinación del sexo Existen dos tipos de cromosomas: autosomas que contienen genes que determinan las características somáticas.

6 Determinación del sexo La determinación del sexo ocurre en la fecundación y depende de los gametos. por lo que en el 50% de los casos se formarán mujeres y en el otro 50% se formarán hombres (fig.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.4 Tercera ley de Mendel Fig. 104 . 3.6).5 Cruzamiento de prueba Fig. 3. 3.3 Primera y segunda leyes de Mendel Fig. 3. Al ser aleatoria. 3. un óvulo puede ser fecundado por cualquiera de los dos tipos de espermatozoides que se han producido.

así como cualquier patología o enfermedad presente en tus familiares y elabora tu árbol genealógico. 105 . con base en las leyes de Mendel y. Expón tu árbol genealógico explicando el fenotipo entre los familiares presentados y el origen posible de las características y enfermedades.¿A QUIÉN ME PAREZCO MÁS Y POR QUÉ? Construye tu árbol genealógico. la transmisión de caracteres hereditarios (genotipo). Se elabora con el fin de detectar algunas anomalías genéticas y para establecer las probabilidades que tiene un padre de procrear un hijo con un rasgo determinado.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . específicamente. El análisis genealógico puede detectar la herencia autosómica dominante y recesiva. Los consejeros genéticos emplean la genealogía para determinar en las parejas si serán capaces de producir hijos sanos. y la herencia ligada al sexo así como pueden observarse las relaciones de consanguinidad y la unión entre personas estrechamente relacionadas. Un árbol genealógico o genograma es un gráfico que muestra las relaciones de parentesco y la transferencia de los rasgos hereditarios a través de varias generaciones en una familia. Analiza en tres generaciones de tu familia dos características normales que se presenten por herencia autosómica dominante y/o recesiva.

una de tallo largo y otra de tallo corto. Se cruza una planta de pulpa roja y tamaño normal. 4. Los heterocigotos con el genotipo C1C2 tienen cabello ondulado. Se cruzan dos plantas de chícharos. 31 amarillas normales. Si una persona con cabello rizado tiene un hijo con una persona de cabello lacio. utiliza el cuadro de Punnett. con otra amarilla y normal y se obtienen: 30 plantas rojas normales. Se cruzan tomates rojos híbridos y de tamaño normal homocigotos con la variedad amarilla enana. Comprobar el resultado realizando un cuadro de Punnett.PROBLEMARIO DE HERENCIA MENDELIANA Con base en las Leyes de Mendel. con lo que se obtiene una proporción fenotípica de 1:2:1 (Fig. 50% cabello ondulado (C1C2) y 25% cabello lacio (C2C2). Otros rasgos con herencia intermedia son la braquidactilia y anemia falciforme. 3. 2. se obtiene en la primera generación individuos con un rasgo intermedio al de los dos progenitores puros. El color rojo de la pulpa del tomate depende de la presencia de un factor R dominante sobre su alelo r para el amarillo. una de vainas verdes y flores axilares (VVAA) con otra de vainas amarillas y flores terminales (vvaa). 3. en humanos la textura del cabello está influida por un gen con dos alelos dominantes incompletos. en uno de sus experimentos. Utilizando la cuadricula de Punnett. ¿Qué proporción de tomates rojos que salen en la F1 serán enanos? (Los alelos dominantes son el tamaño normal y el color rojo). Esto ocurre porque uno de los alelos para la textura del cabello ejerce una dominancia incompleta sobre el otro alelo. muestra el genotipo y fenotipo que obtuvo en la F1 y F2. 9 rojas enanas y 10 amarillas enanas. tendrán hijos con cualquiera de los tres tipos de cabello. Resuelve el siguiente problemario en tu libreta. cruzó dos plantas de chícharo de líneas puras. con las siguientes probabilidades: 25% cabello rizado (C1C1). todos sus hijos saldrán con cabello ondulado (F1). ¿Cuáles son los genotipos de las plantas que se cruzan?. Por ejemplo.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . Si dos personas con cabello ondulado se casan (F2). Mendel. HERENCIA NO MENDELIANA Herencia intermedia o Dominancia incompleta Al cruzar distintas líneas puras entre sí (dominantes y recesivas). El tamaño normal de la planta se debe a un gen N dominante sobre el tamaño enano n. 106 .9). que llamaremos C1 (cabello rizado) y C2 (cabello lacio). 1. Obtén genotipos y fenotipos de F1 y F2.

Así los fenotipos de la F2 no se presentan como 9:3:3:1. sin embargo. Sin embargo.GUÍA METODOLÓGICA DE BIOLOGÍA Genes ligados Los genes se separan independientemente durante la meiosis. el color de flor púrpura (P) domina sobre el rojo (p). y la forma larga de polen (L) domina sobre la redonda (l). Un ejemplo de ligamiento lo constituyen los genes del grupo sanguíneo Rh y los genes HLA (complejo de histocompatibilidad) Fig. en el chícharo dulce (Fig. los genes para el color de la flor y la forma del polen están en el mismo cromosoma de tal manera que los genes se distribuyen juntos durante la meiosis y se heredan juntos. existen grupos de genes en un mismo cromosoma. 107 . toda la F1 tiene flores púrpuras y polen largo.9 Herencia intermedia Fig.10 Genes ligados Por ejemplo.10). Cuando un chícharo homocigoto de polen largo y de flor púrpura se cruza con uno de polen redondo y de flor roja. sino que tienen 75% de plantas de polen largo y flor púrpura y 25% de polen redondo y flor roja. 3. 3. 3.

muchos de los cuales desempeñan un papel en la masculinidad. En cambio. pocos de los cuales tienen un papel específico en la reproducción de rasgos femeninos y la mayoría no tienen su equivalente en el cromosoma Y.11 Herencia ligada al cromosoma X: daltonismo Fig. Fig. el cromosoma X contiene más de 1000 genes.GUÍA METODOLÓGICA DE BIOLOGÍA Herencia ligada al sexo Existen rasgos determinados por genes que se encuentran en cualquiera de los dos cromosomas sexuales: X o Y. las proporciones que se obtienen en la descendencia. el cromosoma Y contiene unas cuantas docenas de genes. así como los mecanismos por los cuales se heredan. la mayoría de este tipo de herencia los genes anómalos se encuentran en el cromosoma X y son recesivos. por lo que se debe tener el gen dañado en dosis doble (homocigosis) para que se produzca la enfermedad en la mujer 108 . Por esta razón. 3. 3.12 Experimento de Morgan Así se tiene que. codificando rasgos que son importantes en ambos sexos como la visión del color. cambian respecto a los genes que se encuentran en los cromosomas somáticos. la coagulación de la sangre y ciertas proteínas estructurales de los músculos. En los humanos.

En cambio. 25% de hijos sanos (su cromosoma X lleva el gen dominante) y 25% de hijos enfermos (su cromosoma X lleva el alelo dañado). 109 . 25% de hijas portadoras (heterocigotas). En sus trabajos.11). Morgan en la mosca de la fruta. Si una mujer portadora se une a un hombre sano. Las moscas de ojos blancos tienen alelos puros para ese rasgo. El descubrimiento de los genes ligados al sexo fue hecho en 1910 por Thomas H. sólo la mitad es de ojos de color rojo y la otra mitad. la cual ha tenido aportaciones posteriores. el 25% de los descendientes de la F2 presentaron ojos blancos y el 75% restante ojos rojos. Esta mosca posee características externas claramente observables. ya que la descendencia obtenida de ellas presenta las dos características. El color natural o silvestre es rojo. en cada fecundación tendrá una probabilidad del 25% de hijas sanas (que no lleven el gen). Morgan estudió esta característica y observó que algunas moscas tenían ojos de color blanco. 3. Estos resultados permiten inferir que el rasgo de color de ojos está controlado por dos alelos. 3. en donde el gen que determina el color rojo es dominante sobre el gen para el color blanco. Si se analiza el sexo y color de ojos de los individuos de la F2. o llevar uno normal y uno dañado (heterocigota o portadora). Morgan cruzó machos de ojos blancos con hembras de ojos rojos. y en la actualidad puede resumirse en los siguientes postulados: • Los genes que determinan los factores hereditarios del fenotipo se localizan en los cromosomas.GUÍA METODOLÓGICA DE BIOLOGÍA y en el varón solo se necesita uno (Fig. las moscas hembras de ojos rojos pueden tener genes para ojos de color rojo o blanco. Con base en lo anterior. de color blanco. Drosophila melanogaster (Fig. ya que originan solo progenie con ojos blancos. surge la teoría cromosómica de la herencia. se puede comprobar que todas las hembras son de ojos rojos. en tanto que los machos. Una de ellas es el color de ojos. Las mujeres con fenotipo normal pueden no llevar el gen (homocigotas dominantes). todos los individuos de ambos sexos tenían ojos rojos Cuando las moscas de la F1 se cruzaron entre sí.12). pero hay una serie de variantes en este rasgo hereditario. En la F1. A través de sus investigaciones logró determinar qué ese rasgo estaba ligado al cromosoma X.

son consecuencia de tres distintos alelos de un sólo gen (IA. B. A su vez. AB u O. Los alelos múltiples se originan por diferentes mutaciones en un mismo gen. • Los genes se encuentran dispuestos linealmente a lo largo de cada cromosoma. • Los genes alelos se encuentran en el mismo locus de la pareja de cromosomas homólogos.2 y Fig. por lo que tienen sangre tipo AB. A.13 Codominancia y alelos múltiples 110 .2 Grupos sanguíneos Fig.GUÍA METODOLÓGICA DE BIOLOGÍA • Cada gen ocupa un lugar específico o locus (en plural es loci) dentro de un cromosoma concreto. Este gen codifica una glucoproteína específica que se localiza en la superficie de los glóbulos rojos o eritrocitos. Codominancia y alelos múltiples Los alelos múltiples son una condición en la que hay más de dos alelos alternativos probables que definen ciertos rasgos. es decir. IB e iO) presente en el cromosoma 9. los alelos IA e IB son codominantes sobre iO que es recesivo. 3. 3. por lo que en los organismos diploides cada carácter está regido por una par de genes alelos. Un ejemplo clásico son los alelos del sistema de grupos sanguíneos ABO (Tabla 3. Los 4 grupos sanguíneos. Tabla 3.13) y los del complejo de histocompatibilidad (HLA). ambos son fenotípicamente detectables en heterocigosis.

ACTIVIDAD En tu libreta elabora un cuadro comparativo sobre los tipos de herencia mendeliana y no mendeliana. un ejemplo de ello es la reina Victoria de Inglaterra. hipertensión arterial. Analiza el siguiente genograma y determina cuál es el patrón genético que sigue la hemofilia apoyándote en la teoría cromosómica. luxación congénita de cadera. esquizofrenia. etc y muchos padecimientos sistémicos: lupus eritromatoso. estenosis pilórica. el ambiente influye sobre muchos rasgos poligénicos.¿CÓMO SE TRANSMITE LA HEMOFILIA? En las familias reales puede observarse en sus genogramas un alto grado de consanguinidad. psicosis maniacodepresiva. portadoras y enfermo/a. epilepsia. diabetes mellitus. defectos del tubo neural. Entre los padecimientos que se heredan en forma multifactorial se encuentran la mayoría de los defectos del nacimiento: labio y paladar hendido. A la suma de los factores herencia-ambiente se le conoce como herencia multifactorial. ya que era tradicional y beneficioso casarse entre los miembros de la realeza. 111 . cardiopatías.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . Además. Especificando por qué se presentan personas sanas.

Al unirse una mujer de visión normal a un hombre con miopía. Un varón de ojos azules se casa con una mujer de ojos pardos. b) El padre. b) Con la vaca B también con cuernos se produce un ternero con cuernos. En la especie humana la Miopía es un rasgo dominante (M). sabiendo que el color pardo domina sobre el color azul. el padre de ojos pardos y tenía un hermano de ojos azules. Léelos con detenimiento y razona el patrón hereditario. La jaqueca es debida a otro gen también dominante (J). tienen un hijo con visión normal. Razonar cómo será el genotipo de todos ellos. Determina el genotipo de: a) La madre. Del matrimonio nació un hijo con ojos pardos. ¿Cuál de los ratones A y B será homocigoto y cuál heterocigoto? Razona la respuesta. 2.GUÍA METODOLÓGICA DE BIOLOGÍA PROBLEMARIO DE HERENCIA NO MENDELIANA Resuelve en tu libreta los siguientes problemas de genética. ¿Cuáles son los genotipos del toro y de las tres vacas? 3. En la especie vacuna. Un hombre que padecía de aniridia y cuya madre no. 5. se casó con una mujer que sufría jaqueca. ¿Qué proporción genotípica y fenotípica cabe esperar en un matrimonio entre un hombre daltónico y una mujer portadora? 6. Un toro sin cuernos se cruza con tres vacas: a) Con la vaca A que tiene cuernos se obtiene un ternero sin cuernos. y que probabilidad de que su siguiente hijo sea miope. 4. c) El hijo. ¿Qué proporción de sus hijos sufrirán ambos males? 112 . La aniridia (dificultades en la visión) en el hombre se debe a un factor dominante (A). pero cuyo padre no la sufría. d) Explica cómo se pudo presentar este suceso. es dominante sobre la presencia f. e) Determina qué posibilidad tiene la pareja de que su siguiente hijo tenga visión normal. la falta de cuernos F. Un ratón A de pelo blanco se cruza con uno de pelo negro y toda la descendencia obtenida es de pelo blanco. c) Con la vaca C que no tiene cuernos se produce un ternero con cuernos. 1. Otro ratón B también de pelo blanco se cruza también con uno de pelo negro y se obtiene una descendencia formada por 5 ratones de pelo blanco y 5 de pelo negro. Elabora un árbol genealógico para explicarlo. La madre de la mujer era de ojos azules.

La capacidad de plegar la lengua exprésala como uncaracterística dominante y la incapacidad de plegar la lengua como una característica recesiva. y mutantesa los organismos que exhibían estos cambios. De Vries denominó mutaciones a estos cambios hereditarios repentinos. el cruce entre plantas que producen rábanos redondos (RRRR) y las que producen rábanos alargados (RARA) producen rábanos ovalados (RRRA). el fenotipo de plegar su lengua en U. Sin embargo. como lo hace cualquier otra característica hereditaria. si tienen 8 hijos ¿Cómo serán fenotípicamente sus hijos? 10. en 113 . 9. En un cuadro de Punnett representa la posible descendencia del cruce de dos plantas. Si ambos padres tiene sangre tipo A ¿Qué posibilidades hay de que tengan un hijo con tipo sanguíneo O? Fundamenta tu respuesta. Las mutaciones junto con la recombinación genética aumentan la variabilidad genética de las especies. Los conceptos propuestos por de Vries no resultaron tan erróneos. en sus estudios sobre herencia mendeliana en plantas. 3.GUÍA METODOLÓGICA DE BIOLOGÍA 7. lo que contribuye a su adaptación al medio ambiente y. A partir de lo ocurrido de Vries planteo una hipótesis. donde determinó que estas variantes surgían como resultado de cambios súbitos en los genes y que la variante producida por un gen cambiado se transmitía luego a la progenie. El Defecto de Albinismo es una característica recesiva. 8. Con base a la información obtenida realiza un árbol genealógico expresando el genotipo de cada integrante. En los rábanos. una de rábanos redondos con una de rábanos ovalados. aunque la mayoría de sus ejemplos no eran muy válidos. Investiga en tus familiares.5 ¿QUÉ ES UNA MUTACIÓN? El botánico Hugo de Vries en el año de 1901. el concepto de mutación como fuente de la variación genética demostró ser de suma importancia. encontró que la herencia en la mayoría de las especies generalmente era ordenada y predecible. pudo observar que cada cierto tiempo aparecía alguna variante que no estaba presente ni en los progenitores ni en ningún antecesor de estas mismas plantas. Si una mujer albina se une a un hombre de color normal cuyo padre es albino.

químicos (agentes alquilantes. también lo hará la secuencia de aminoácidos en las proteínas formadas. Podemos establecer dos grandes grupos de mutaciones en relación con el tipo de células en las que se producen: somáticas y germinales. una variación determinada puede darle a un individuo o a su progenie una ligera ventaja. Si no existieran las mutaciones no existiría la gran biodiversidad planetaria. pueden generarse cambios en la secuencia de bases. óvulos y espermatozoides. pero desaparece en el momento en que muere el individuo en que se originó. no obstante. pueden transmitirse como rasgos hereditarios diferenciadores a los descendientes del organismo en los que tuvo lugar la mutación. X. Sin embargo. cromosómico y genómico MUTACIONES GÉNICAS O PUNTUALES Las mutaciones a nivel molecular son llamadas génicas o puntuales y afectan la constitución química de los genes cambiando la secuencia de nucleótidos (Tabla 3.GUÍA METODOLÓGICA DE BIOLOGÍA definitiva. el ADN es una molécula estable que contiene la información genética. los mutágenos. Se originan por: 114 . a la evolución de las mismas. que inducen varias clases de cambios heredables perjudiciales o benéficos y pueden ser: físicos (rayos ultravioleta. Para resumir entonces:"Una mutación es un cambio heredable en el material genético de una célula". En un ambiente heterogéneo o cambiante. De acuerdo al dogma central de la biología. como así también un efecto negativo provocando la extinción de una especie. oxidantes) y biológicos (virus y transposones).3). En la naturaleza las mutaciones ocurren al azar y espontáneamente. las mutaciones en las células germinales. Una mutación en una célula somática. pero se conocen varios agentes externos. sin embargo al cambiar dicha información. puede provocar alteraciones en el organismo en el que se presente. TIPOS DE MUTACIONES Las mutaciones pueden darse en tres niveles diferentes: molecular (génicas o puntuales). provocando alteraciones que generalmente son corregidas a través de diferentes mecanismos de reparación. gamma).

que puede ser terminal o intercalar (Fig.14). Donde debería haber un nucleótido se inserta otro. Por ejemplo. Ocurre cuando se añade o agrega uno o más nucleótidos. 3. Ocurre un traslape de pares de nucleótidos complementarios de una zona del ADN a otra Deleción.15). Mediante dos giros de 180° dos segmentos de nucleótidos de hebras complementarias se invierten y se intercambian. 3. Estas mutaciones pueden ocurrir por: Deleción. Inversión. en lugar de la citosina (C) se instala una timina (T). Es la pérdida de un segmento cromosómico.GUÍA METODOLÓGICA DE BIOLOGÍA Sustitución. Cuando ocurre en los dos extremos. por tanto a su estructura. Inserción. Se pierde o elimina uno o más nucleótidos produciendo un error de lectura durante la traducción que conlleva a la formación de proteínas no funcionales. 115 . Translocación.3 Mutaciones puntuales o génicas MUTACIONES CROMOSÓMICAS El cambio afecta a un segmento de cromosoma (mayor de un gen). Tabla 3. la porción que porta el centrómero une sus extremos rotos y forma un cromosoma anular(Fig.

3. Fig.17 Translocación Translocación.16). el producto resultante tendrá tres cromosomas 21.14 Deleción Fig.17).16 Inversión Fig. por lo que al fecundarse con el gameto contrario. Isocromosomas: Se origina durante la meiosis o mitosis. Intercambio de segmentos entre cromosomas no homólogos. Algunos tipos de translocaciones producen abortos tempranos. 3. los gametos de esa persona llevarán el cromosoma translocado más uno normal. Cuando un segmento cromosómico rota 180° sobre sí mismo y se coloca en forma invertida. uno de los brazos del cromosoma original se pierde y los brazos del isocromosoma resultante son genéticamente idénticos entre sí pero en sentido inverso (Fig. al translocarse todo el cromosoma 21 a otro cromosoma como el 14 (14/21). También se pueden formar portadores de trisomías como la del 21 (síndrome de Down). que puede ser o no recíproca (Fig. 3. 3. 116 . 3. por lo que se altera el orden de los genes en el cromosoma (Fig.GUÍA METODOLÓGICA DE BIOLOGÍA Inversión. Como consecuencia.15 Cromosoma anular Fig. 3. cuando la división del centrómero se produce según el plano transversal en vez de vertical.18). 3.

Pueden ser: Euploidía Se da cuando la mutación afecta al número de juegos completos de cromosomas.19). es decir. Son causadas por errores en la separación (disyunción) de los pares de cromosomas homólogos durante la meiosis. Los organismos poliploides generalmente son más grandes y vigorosos presentando habitualmente gigantismo. café. Aneuploidía Afecta al número de cromosomas individualmente y se debe al fenómeno de no disyunción ocurrido durante la meiosis cuando los cromosomas homólogos no se separan y ambos se incorporan a un mismo gameto (Fig.18 Isocromosomas MUTACIONES GENÓMICAS Son alteraciones en el número de los cromosomas propios de la especie. tabaco. afecta a todo el genoma. 3. no separándose ninguno de estos. manzana. y poliploidía: si presentan más de dos juegos cromosómicos. Esto ha sido empleado en numerosas plantas cultivadas donde el tamaño de hojas. fruto o flor es económicamente importante.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. semilla. 117 . Se pueden clasificar por el número de cromosomas que se tengan en: monoploidía o haploidía: si las células presentan un solo juego de cromosomas. Este tipo de mutaciones también recibe el nombre de aberraciones o variaciones cromosómicas. por ejemplo en alfalfa. lila y crisantemo. pera. plátano. 3.

pues el único cromosoma X que tienen está activado. No presentan cuerpo de Barr como las mujeres normales. cuando fecunden a otro normal. Monosomías La falta de un cromosoma produce una monosomía. XX + 21 ó 47. donde sus células tienen un número anormal de cuerpos de Barr.20) y. 3. XXX) y la polisomía XYY (47. se pueden presentar a nivel de cromosomas somáticos (autosomas). En el humano. como el caso delsíndrome de Klinefelter (47. como la trisomía del cromosoma 21 que produce el síndrome de Down (47.GUÍA METODOLÓGICA DE BIOLOGÍA Si este gameto fecunda a otro se originará un cromosoma triplicado (trisomía). Otros síndromes son el triequis o metahembras (47. por ello. los cromosomas sexuales (gonosomas) pueden afectarse. 3. 118 . el individuo tendrá un cromosoma menos (monosomía). de igual forma también habrá gametos que tendrán un cromosoma menos (Fig. se presenta el síndrome de Turner (45. XYY). Fig. XXY). X). 3.20 Trisomías y monosomías en cromosomas sexuales Fi Trisomías En el humano.Asimismo. XY + 21).19 La no disyunción produce monosomías y trisomías g.

ALTERACIONES EN LOS AUTOSOMAS SÍNDROME TIPO DE MUTACIÓN CARACTERÍSTICAS Y SÍNTOMAS DE LA MUTACIÓN Los afectados tienen retardo mental en diferente grado. boca pequeña. se detallan las características de algunas mutaciones que se pueden dar en la especie humana. aspecto hombruno. Síndrome de Down Síndrome de Edwars Síndrome de Patau Trisomía 21 Trisomía 18 Trisomía 13 ó 15 ALTERACIONES EN LOS CROMOSOMAS SEXUALES Síndrome de Klinefelter 44 autosomas + XXY Son varones estériles con rasgos femeninos. dobleces característicos en el cuello y retardo mental moderado. escaso desarrollo de las gónadas y retraso mental. un tamaño mayor de dientes. acné. Infantilismo y escaso desarrollo de las mamas y los genitales externos. polidactilia. bajo coeficiente intelectual. Las mujeres son fértiles y los transmiten al 50% de su progenie. Los afectados presentan estatura elevada. 3. altos y de conducta controversial. Son fértiles. los hombres son estériles. atrofia de ovarios. lengua salida. baja estatura. comportamiento antisocial y la espermatogénesis puede o no estar alterada. corazón defectuoso.6 ¿CUÁLES SON LAS APLICACIONES MÁS IMPORTANTES DE LA GENÉTICA? Andrea es una chica de 40 años muy agraciada vive con su pareja que es Ricardo y planean tener un hijo. solo que no se atreven debido a que en las familias de ambos hay antecedentes de Síndrome de Down. En la pubertad no menstrúan ni desarrollan caracteres sexuales secundarios. Síndrome del duplo Y 44 autosomas + XYY Síndrome de Turner Síndrome de Triple X 44 autosomas + X 44 autosomas + XXX Mujeres con baja estatura. personalidad infantil. ¿Si ellos fueran tus amigos. lesiones cardiacas. boca pequeña. Labio leporino.GUÍA METODOLÓGICA DE BIOLOGÍA A continuación. cráneo ancho y marcha lenta. Anomalías en la forma de la cabeza. conducta agresiva. Son mujeres fértiles de apariencia normal pero con tendencia al retardo mental. mentón huido. cómo podrías ayudarlos? 119 . párpados rasgados. lesiones cardiacas.

A partir del alelo mutado se generan moléculas de hemoglobina anormales. Secuencia de ARNm: Secuencia proteica: 120 . Utilizando la tabla del código genético escribe la secuencia de aminoácidos que se sintetiza a partir de la hebra inferior del ADN.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD La anemia falciforme es una enfermedad que se debe a una mutación en un nucleótido del gen que tiene información para la fabricación de la hemoglobina. La secuencia de ADN que se muestra a continuación pertenece al gen que tiene la información para fabricar un fragmento de la hemoglobina normal: GTGCACCTGACTCCTGAGGAG CACGTGGACTGAGGACTCCTC a.

El primero es aquel que se imparte antes del nacimiento de un niño afectado y el segundo es el que se da cuando. o bien presentarse por primera vez. b. sobre todo. dentro de una familia. independientemente de que la causa sea o no genética (hereditaria). existe el antecedente de uno o más casos con alguna alteración que puede ser hereditaria y en relación con la cual se consulta. sólo que en vez de T tiene U. Por lo que. dietético o de rehabilitación y. coordinados por un genetista. El equipo que lo imparte está conformado por varios especialistas (ginecoobstetras. endocrinólogos. etc). informar sobre las medidas preventivas que pueden tomarse. Val-His-Leu-Trip-Pro-Val-Glu Compara esta secuencia con la anterior y determina cuál es el nucleótido que sufrió la mutación responsable de la anemia falciforme ¿De los tres tipos principales de mutación que existen ésta es de tipo? _______________________ ¿Y a la vez a cual subtipo pertenece? ____________________________ ¿Qué sucedió? _____________________________________________________ CONSEJO GENÉTICO El Consejo Genético es el estudio que se realiza a través de la valoración clínica y estudios especializados para saber si existe riesgo de que en una familia se pueda repetir. alguna malformación congénita (alteración del desarrollo anatómico que se presenta durante la vida intrauterina y se manifiesta al nacimiento) o cualquier enfermedad. la práctica del asesoramiento o consejo genético es muy importante en la prevención de enfermedades hereditarias y síndromes con malformaciones congénitas (que se presentan al nacimiento).GUÍA METODOLÓGICA DE BIOLOGÍA Acuérdate que la hebra de ARNm obtenido a partir de “leer” la hebra inferior del ADN es de secuencia igual a la hebra superior. sobre el manejo terapéutico. Para impartir consejo genético se deben tener en cuenta los aspectos médicos y psicológicos tanto del paciente como de su familia. trabajadores sociales. cirujanos. Este Consejo Genético puede ser previo a/o después de. El estudio deberá explicar cuál será la evolución del defecto de nacimiento o enfermedad por la que se consulta. 121 . psicólogos. El fragmento de proteína que figura a continuación pertenece a la hemoglobina falciforme.

que permite ver al feto por medio del endoscopio.GUÍA METODOLÓGICA DE BIOLOGÍA Las causas más frecuentes para solicitar asesoramiento genético son: personas que sufren un padecimiento genético. Entre estos procedimientos está la amniocentesis. posteriormente realiza un mapa conceptual sobre el proyecto del genoma humano. 122 . Es importante hacer notar que para algunos cromosomas las investigaciones han resultado muy fructíferas. entre otras. aborto de repetición. parejas con un hijo afectado. La fetoscopía. consanguinidad y mismo grupo étnico. En los últimos años la localización de genes ha tenido un notable avance. que consiste en tomar una muestra de líquido amniótico que se analiza por medio de un cariotipo. Se estima que. Al confirmar el diagnóstico se toman las medidas terapéuticas y preventivas requeridas. trasplantes de células. tales como restricciones dietéticas.unam. deben ser unos treinta mil genes.alumno. codificada en 23 pares de cromosomas contenidos en cada una de las células del cuerpo. ACTIVIDAD Realiza la lectura del artículo que se encuentra en el siguiente link http://www. familias con parientes afectados. y la ultrasonografía.000 millones de pares de bases del ADN del genoma humano.mx/algo_leer/Genoma. manipulación genética y tratamiento quirúrgico prenatal. pues en 1990 ya se habían localizado más de 600. como es el caso del cromosoma X. Consistió en obtener la secuencia completa de más de 3. que utiliza ondas de sonido de alta frecuencia para producir una imagen del feto en una pantalla. administración de enzimas. en total. detectándose cualquier anomalía cromosómica numérica o estructural. PROYECTO GENOMA HUMANO El Proyecto Genoma Humano (PGH) se inició en 1988 y se concluyó en el 2004. Algunos trastornos genéticos se pueden descubrir antes del nacimiento por medio de una serie de pruebas que constituyen el diagnóstico prenatal.pdf. es de gran valor para el diagnóstico de algunas malformaciones fetales.

ya que en el resto de países de nuestro entorno se les incluye dentro del término más amplio de "nuevos alimentos" (en inglés "novel foods"). Director del Instituto Agroquímica y Tecnología de Alimentos IATA-CSIF. Realiza un ensayo al respecto. Valencia. Daniel Ramón. considerando los aspectos bioéticos. y como comentamos al principio. ACTIVIDAD ESPECÍFICA: TRANSGÉNICOS Analiza el siguiente artículo cuestionando para qué y cómo puedes utilizar los organismos transgénicos y qué repercusiones pueden tener en ti el consumirlos. los ganaderos han obtenido durante siglos nuevas razas de vacuno que produjeran más leche y los agricultores han conseguido variedades vegetales de mayor interés agronómico. Prof. en el diseño de los alimentos transgénicos se utilizan técnicas de ingeniería genética. a partir del genoma de un individuo 123 . ya que desde la antigüedad el hombre viene modificando el patrimonio genético de animales o plantas para crear nuevas razas de animales o variedades vegetales cuyo rendimiento industrial sea más adecuado. Pero conviene recordar que ha funcionado. Los alimentos transgénicos no representan algo nuevo.GUÍA METODOLÓGICA DE BIOLOGÍA INGENIERÍA GENÉTICA Es un conjunto de técnicas cuyo objetivo principal es la creación de nuevas combinaciones genéticas basándose en la manipulación directa del ADN. Por contra. Fecha de Publicación: Abril de 1999 Alimentos transgénicos: objetivos y valores Alimento transgénico es aquel en cuyo diseño se han utilizado técnicas de ingeniería genética. y que la inmensa mayoría de alimentos animales o vegetales de nuestra dieta están constituidos por especies obtenidas mediante esta estrategia. Mediante el cruce sexual. Con ello se pretende obtener productos cuyas características respondan más adecuadamente a las exigencias del productor o del consumidor. Al llevar a cabo estos cruces. Se trata por lo tanto de una técnica basada en el azar en la que la probabilidad de encontrar la combinación genética adecuada es muy baja. En estas. Esta denominación se utiliza sólo en España. los mejoradores combinan de forma aleatoria los miles de genes de los genomas de dos cepas parentales intentando encontrar un genoma resultante que reúna los genes beneficiosos de ambos progenitores.

GUÍA METODOLÓGICA DE BIOLOGÍA

donador se aísla el gen que interesa expresar, se modifica in vitro y se introduce, ya sea en el genoma del propio individuo, ya sea en el genoma de un organismo receptor que puede ser un animal, un vegetal, o un microorganismo. Recordemos que el término transgénico hace referencia a la expresión de un gen proveniente de una especie de forma distinta. Así, sólo aquellos alimentos transgénicos en los que se hayan expresado genes de otras especies tendrían una denominación correcta. Las diferencias entre los alimentos de la biotecnología tradicional y los alimentos transgénicos son sólo técnicas. Por un lado, las técnicas de ingeniería genética son mucho más precisas que el cruce sexual, por lo tanto se pueden obtener resultados mucho más adecuados en un menor tiempo. Además, la ingeniería genética implica direccionalidad, o lo que es lo mismo, mayor control sobre el producto final frente al azar del cruce sexual. Finalmente, son mucho más potentes al permitir transferir genes de una especie a otra, o incluso de un reino a otro. Sin duda, esta última característica tiene repercusiones de índice ético o social. Se han comercializado unos pocos alimentos transgénicos, aunque muchos otros están en fase de experimentación o comercialización. Pueden ser transgénicos que portan múltiples copias del gen de la hormona de crecimiento de la trucha y ganan tamaño mucho más rápido con el consiguiente beneficio para el productor. La ingeniería genética permite expresar determinados genes en determinados tejidos. Así, se han expresado genes que codifican proteínas de alto valor añadido en la glándula mamaria de diferentes mamíferos. Son fármacos de alto valor añadido como el activador del plasminógeno o el factor antihemofílico, con lo que un rebaño de tamaño medio podría producir la suficiente cantidad de estos productos para poder atender la demanda de todos los enfermos actuales durante un año. Un beneficio espectacular para el consumidor. También se han aplicado técnicas de ingeniería genética en el caso de los alimentos fermentados. Se han construido bacterias lácticas o levaduras transgénicas que portan genes de otros organismos. Los resultados son quesos en los que es posible controlar, e incluso acortar, los tiempos de maduración sin pérdida de calidad, o vinos con un incremento de aroma afrutado, una característica organoléptica muy apreciada por el consumidor centroeuropeo. Basta echar un vistazo a los periódicos nacionales durante los últimos tres meses para comprender que, a pesar de sus enormes posibilidades, existe un debate social en torno a la comercialización de los alimentos transgénicos. Los miedos asociados a su ingesta son mucho mayores que los asociados al uso de cualquier otro producto de la ingeniería genética. ¿Por qué? Podemos encontrar varias razones pero la más importante es que con los alimentos transgénicos el consumidor siempre tiene la opción de escoger. Podemos decidir entre
124

GUÍA METODOLÓGICA DE BIOLOGÍA

consumir tomate transgénico o uno convencional, pero no sobre inyectarnos insulina transgénica, ya que no existe la alternativa contraria. A este hecho sumemos que alimentación es algo más que la necesidad fisiológica de obtener energía: alimentación es cultura. En este contexto deben entenderse todos los recelos en torno a la ingesta de estos productos. ¿Cual es la situación actual? Hay una disputa entre dos polos: las compañías multinacionales productoras y los grupos de presión (fundamentalmente organizaciones ecologistas) con sus mensajes contrarios. Esta controversia unida a la falta de divulgación científica adecuada confunden al consumidor que se pregunta: ¿son seguros los alimentos transgénicos? Desde un punto de vista científico la respuesta es clara: son al menos tan seguros como aquellos convencionales de los que proceden. Partamos de la base en que en alimentación, como en cualquier otra faceta de la vida, es imposible hablar de riesgo cero. Por eso los riesgos deben definirse por comparación con situaciones conocidas. Todos los alimentos transgénicos han tenido que pasar una serie de pruebas de laboratorio encaminadas a demostrar su inocuidad sanitaria. Como ejemplo baste decir que la compañía productora del tomate FlavrSavt TM, el primer alimento transgénico comercializado, tardó cuatro años en realizar todas las pruebas exigidas por la agencia estatal FDA (Food and DrugAdministration) hasta obtener el permiso de comercialización. Así ha sido con todos los alimentos que se han comercializado hasta la fecha, y así seguirá siendo, ya que la legislación americana y europea lo contempla. Las pruebas requeridas se basan en determinar la composición nutricional del alimento transgénico y detectar su posible alergenicidad o toxicidad. Todas estas pruebas no se exigen al resto de alimentos, aunque así debiera ser. Desde distintos frentes se ha postulado el riesgo que para el medio ambiente supone la construcción de estos alimentos, sobre todo la de los vegetales transgénicos. A menudo se habla de la posible transferencia de los genes exógenos desde la variedad transgénica a variedades silvestres. Esta transferencia se produce frecuentemente en la Naturaleza, en algunas especies convencionales más que en otras. Por eso podemos afirmar que, por ejemplo en Europa, la transferencia de genes es imposible si utilizamos maíz transgénico y probable si utilizamos soja transgénica. Resulta por lo tanto evidente que el control sobre este tipo de experimentos debe ser riguroso. Y de hecho así lo es al deberse aplicar las distintas reglamentaciones que legislan al respecto. En 1992, el Gobierno estadounidense declaró a través de la FDA que no necesitaba desarrollar una legislación especial para los alimentos transgénicos, al considerar que la existente para la comercialización de variedades obtenidas por métodos genéticos convencionales cubría todos los aspectos necesarios. Conviene destacar que con ello el legislador americano decidió

125

GUÍA METODOLÓGICA DE BIOLOGÍA

evaluar sólo el producto final en cuanto a su inocuidad sanitaria, obviando la técnica usada (cruce sexual vs ingeniería genética) para su diseño. La Comunidad Europea sin embargo decidió desarrollar una legislación específica para estos productos que considera tanto el alimento final como las técnicas utilizadas. El pasado mes de Julio se aprobó el Reglamento para la comercialización de los nuevos alimentos, que entre otros, incluye los alimentos transgénicos. En esta normativa se diseña un entramado burocrático por el que cada alimento transgénico deberá superar antes de su comercialización la aprobación por parte de un comité de expertos científicos nombrado por la Comisión Europea, así como el visto bueno de comités de cada uno de los países miembros. En Japón o Canadá también disponen de legislación para la comercialización de los alimentos transgénicos bastante similar, en cuanto a la aprobación por parte de comités, a la europea. Una de las cuestiones más consideradas en la reglamentación europea es la del etiquetado. ¿Deben ser etiquetados los alimentos transgénicos? Esta cuestión implica una pelea por intereses. Las compañías productoras son, en general contrarias a dicho etiquetado ya que temen una bajada en las ventas. Pero el consumidor tiene todo el derecho a estar informado. Las autoridades americanas han decidido etiquetar sólo aquellos alimentos transgénicos cuya composición varíe con respecto al convencional equivalente, o aquellos que contengan genes de reserva ética (un gen de animal expresado en un vegetal con el consiguiente problema para los vegetarianos), organismos modificados genéticamente vivos (un yogurt producido con una bacteria láctica transgénica), o la aparición en su composición de un producto con un efecto tóxico probable en una subpoblación (aparición de fenilalanina y riesgo para la fenilcetonúricos). La legislación europea es muy similar, pero ha sido objeto de un amplio debate, de forma que en estos momentos se prevé la modificación de dicho reglamento en lo concerniente al etiquetado y se prevé la obligatoriedad del etiquetado para todos los alimentos transgénicos. Curiosamente algunas compañías han decidido asumir, sin necesitarlo, el riesgo del etiquetado. Por ejemplo, Zeneca en Inglaterra decidió etiquetar una sopa obtenida a partir de tomates transgénicos, a pesar de la decisión del gobierno británico que le eximía del mismo. Acompañaron esta decisión con una campaña publicitaria explicando al consumidor la modificación genética introducida en el tomate transgénico, y el producto se ha vendido sin problemas. En este mismo país algunas cadenas de supermercados han anunciado públicamente que etiquetarán todos los alimentos transgénicos que se vendan en sus estanterías, independientemente de que así lo determinen los comités pertinentes. En resumen, el etiquetado es una cuestión de defensa e información del consumidor. La etiqueta es exigible, pero la etiqueta debe ser informativa. Y para ser informativa hace falta introducir al consumidor en términos como biotecnología, ingeniería genética y nutrición.
126

GUÍA METODOLÓGICA DE BIOLOGÍA

Se han realizado encuestas en varios países como Estados Unidos y Japón, así como en varios estados miembros de la Comunidad Europea. En general, los europeos somos los menos proclives a la comercialización de los alimentos transgénicos, aunque existen distintos criterios. Los países nórdicos, Austria y Luxemburgo, mantienen las posturas más contrarias. Existen una serie de criterios comunes entre todos los encuestados que se pueden resumir en: a) el consumidor acepta en mayor grado los alimentos transgénicos de origen vegetal y fermentado, y en mucha menor medida los de origen animal; b) se muestran más proclives a aceptar los alimentos transgénicos cuyo diseño favorece al consumidor, y menos los que favorecen al productor, y c) hay una exigencia mayoritaria del etiquetado. Los alimentos transgénicos son una realidad incuestionable. Los científicos que trabajamos en estos temas no podemos obviar sus claras repercusiones sociales y debemos hacer frente a nuestra obligación de informar a la sociedad sobre sus presuntos riesgos y sus enormes posibilidades.

RUBRICA PARA EVALUAR PORTAFOLIO DE EVIDENCIAS Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Asignatura:

PONDERACIÓN CRITERIOS EXCELENTE (4) MUY BIEN (3) BIEN (2) DEFICIENTE (1) PUNTAJE

Presentación del portafolio

Identifica y selecciona de una forma clara y detalla las actividades realizadas.

Identifica y selecciona parcialmente de una forma clara y detallada las actividades realizadas. El nivel de expresión escrita es clara pero no fundamental para su comprensión Utiliza información fundamental en ideas y argumentos sin un criterio

Identifica pero no selecciona de una forma clara y detalla las actividades realizadas. El nivel de expresión escrita es poco clara y no fundamental para su comprensión Utiliza información fundamental en ideas sin argumentos sin un

No identifica ni selecciona de una forma clara y detallada las actividades realizadas. El nivel de expresión escrita no es clara ni fundamental para su comprensión. Utiliza información sin ningún fund, ideas ni argumentos y sin un criterio

El nivel de expresión escrita es Redacción clara y clara y fundamental comprensiva para su comprensión. Inclusión de información diversa seleccionada Utiliza información fundamental en ideas y argumentos con un criterio

127

GUÍA METODOLÓGICA DE BIOLOGÍA
actual, y con criterio Equilibrio entre la información aportada procedente de fuentes externas, del profesor y la propia adecuado a su nivel adecuado a su nivel. Informa y aporta ideas propias relacionándolas con fuentes externas y las del profesor. Integra y relaciona todas las actividades y actúa con coherencia a la hora de organizar el portafolios Informa y aporta ideas propias sin relacionarlas con fuentes externas y con las del profesor. Integra y relaciona todas las actividades pero no actúa con coherencia a la hora de organizar el portafolios Selecciona actividades complementarias y optativas sin capacidad para decidir lo que se va a evaluar. Aporta contenidos, e ideas, sin sugerencias propias que lo hagan distinto del resto de sus compañeros. Asiste y participa en clase, realiza tareas complementarias sin adquirir un compromiso personal con la asignatura para lograr una buena evaluación. criterio adecuado a adecuado a su su nivel. nivel. .informa pero no aporta ideas ni las relaciona con fuentes externas ni con las del profesor No informa ni aporta ideas relacionadas con fuentes externas y con las del profesor No integra ni relaciona las actividades ni actúa con coherencia a la hora de organizar el portafolios No selecciona actividades complementarias ni optativas con capacidad para decidir lo que se va a evaluar. No aporta contenidos ideas ni sugerencias propias que lo hagan distinto del resto de sus compañeros Asiste pero no participa en clase ni realiza tareas complementarias, ni adquiere un compromiso personal con la asignatura para lograr una buena evaluación.

Organización e integración del portafolios

Integra pero no relaciona todas las actividades ni actúa con coherencia a la hora de organizar el portafolios Selecciona pocas actividades complementarias y optativas sin capacidad para decidir lo que se va a evaluar Aporta pocos contenidos ideas y sugerencias propias que lo hagan distinto del resto de sus compañeros Asiste y participa en clase, sin realizar tareas complementarias ni adquiriendo un compromiso personal con la asignatura para lograr una buena evaluación.

Selecciona actividades Selección de complementarias y actividades optativas con complementarias y capacidad para optativas decidir lo que se va a evaluar. Aportación de contenidos, ideas y sugerencias propias en las actividades Aporta contenidos, ideas, y sugerencias propias que lo hacen distinto del resto de sus compañeros. Asiste y participa en clase, realiza tareas complementarias adquiriendo un compromiso personal con la asignatura logrando una buena evaluación

Implicación, participación y compromiso

Total
REFERENCIAS: (Núñez Chan, 2002)

CLONACIÓN La clonación es la acción de reproducir a un ser de manera perfecta en el aspecto fisiológico y bioquímico de una célula originaria, es decir que, a partir de una célula de un individuo se crea otro exactamente igual al anterior. Un clon es el conjunto de individuos que desciende de otro por vía vegetativa o asexual. La clonación existe en la naturaleza paralelamente a la reproducción sexual. Los descendientes de los microorganismos que iniciaron la vida, eran idénticos a sus padres.

128

GUÍA METODOLÓGICA DE BIOLOGÍA

En 1997, IanWilmut, anunció que había clonado una oveja llamada Dolly. Esta oveja se convirtió en el primer mamífero clonado. En la clonación de Dolly se obtuvo un óvulo de oveja, se elimina su núcleo, se sustituye por un núcleo de célula de oveja adulta procedente del tejido mamario y se implanta en una tercera oveja que sirve como mamá de "alquiler" puesto que será la que lleve el embarazo (Fig. 3.20).

TERAPIA GÉNICA Es un tratamiento que reemplaza genes defectuosos por otros sanos. En el futuro, las enfermedades hereditarias podrán detectarse y curarse a tiempo gracias a este procedimiento. En 1990, se inició el primer estudio clínico de terapia génica humana, con una niña que recibió una transfusión de leucocitos procesados mediante ingeniería genética, para contener el alelo normal; en la actualidad la niña tiene un sistema inmune funcional En 1994 se iniciaron estudios experimentales para combatir la fibrosis quística, una enfermedad pulmonar hereditaria. Con técnicas de ingeniería genética se incluyó en un virus el gen normal. El virus se introdujo en los pulmones por medio de un aerosol bucal para que penetrara a las células que con esta información pudieran sintetizar la proteína que al faltar produce la enfermedad.

Fig. 3.20 Clonación de la oveja Dolly

129

capaz de regenerar uno o más tipos celulares diferenciados. Células madre órgano-específicas ó multipotenciales. mediante un proceso químico. capaces de originar las células de un órgano concreto en el embrión. Investiga cómo se obtenía anteriormente la insulina y responde las siguientes preguntas en tu cuaderno. es el de las células de la médula ósea. Elabora una conclusión con base en la lectura y en tus respuestas. sólo en Argentina los precios de la insulina bajarían 30%.com/vacas-clonadas-para-producir-insulina/(Adaptación) 2. El ADN de las vacas se ha modificado para que generen leche con el precursor de la insulina. se ha conseguido que el fármaco final sea igual a la hormona que los humanos sanos producen naturalmente. etc. Un ejemplo de células madre órgano-específicas. Y además. ¿Por qué? 4.biotecnologica. De él se extrae una molécula idéntica a la del ser humano. retina. Así.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD: LECHE CURATIVA El propósito de esta actividad es identificar los avances de la manipulación genética. cerebro. y son capaces de generar todos los diferentes tipos celulares del cuerpo. páncreas. se purifica y se transforma en un medicamento inyectable. Fuente: “Vacas clonadas para producir insulina”. 1. ¿Si fueras diabético usarías insulina con este origen? 5. Lee con atención la siguiente noticia Científicos argentinos han creado una vaca transgénica que produce insulina en su leche. También existen en más órganos como piel. se clasifican en dos grupos: Células madre embrionarias ó pluripotenciales que derivan de la masa celular interna del blastocisto del embrión (7-14 días). ¿Crees que esta técnica sea mejor que las anteriores?. CÉLULAS MADRE Célula madre o stemcell se define como una célula progenitora. músculo cardíaco y esquelético. es muy rentable: con ella. es decir. grasa subcutánea. y también en el adulto. Se cultivan tanto en in vitro (en el 130 . que pueden generar todos los tipos celulares de la sangre y del sistema inmune. autorenovable. Disponible en http:///www. Consultado el 6 de julio de 2010. 3. En animales superiores.

es preciso que los conocimientos y avances en Ingeniería Genética se consideren patrimonio de la humanidad. Por todo ello. como in vivo (en un modelo animal) utilizándolas en la reparación de tejidos dañados. y que los organismos internacionales creados para ello sean capaces de vencer las reticencias que crean los intereses políticos y económicos. con consecuencias aún 131 .GUÍA METODOLÓGICA DE BIOLOGÍA laboratorio). si no pluripotenciales. logrando una legislación adecuada y justa. que recoja las voces razonables de todos los sectores sociales. se encuentran algunos problemas que causa la aplicación de la Ingeniería Genética: Sanitarios. Es decir. A pesar de todo. En la línea germinal se pide su prohibición en todo aquello que sea recomponer un programa genético humano. Los trabajos con embriones humanos con fines puramente experimentales se consideran un atentado a la dignidad de la especie humana. Se ha comprobado que células madre de adulto pueden reprogramarse (transdiferenciarse). o que el uso de fármacos de diseño provoque efectos secundarios no deseados. por lo que es imperioso el desarrollo de la Bioética y de una legislación adecuada para que estos nuevos conocimientos generen un desarrollo positivo y no se conviertan en una forma de control y exterminio. ya no serían multipotenciales. La ética y las leyes no han avanzado al mismo ritmo que la ciencia. Pueden aparecer nuevos microorganismos patógenos que causen enfermedades desconocidas. IMPLICACIONES BIOÉTICAS EN LA GENÉTICA Los avances vertiginosos de la genética y otras ciencias nos hacen preguntarnos si el ser humano está listo para manejarlos correctamente. la aplicación de estas técnicas de trasferencia de células madre de adulto para el recambio y reparación de tejidos enfermos está todavía en sus comienzos. Ecológicos. Al liberar nuevos organismos en el ambiente puede provocarse la desaparición de especies contra las que se lucha. y dar lugar a otros tipos celulares que hasta ahora se pensaba que eran incapaces de generar. Frente a los múltiples beneficios que ofrece este campo.

Puntos 100 EVALUACIÓN 132 . de un de un ensayo. pueden crear diferencias aún más grandes entre países ricos y pobres. elaboración resumen. de un ensayo. Sociales y políticos. En el campo de la Terapia Génica es defendible este procedimiento cuando se utilice en células somáticas para corregir enfermedades. Éticos y morales. La experimentación en la especie humana puede atentar contra su misma dignidad. Puntos 20 Puntos 40 Puntos 80 Puntos 100 Aspectos a mejorar : Estratégico Analiza las aplicaciones actuales de la genética mediante la investigación y elaboración de un ensayo crítico y reflexivo. por ejemplo. Las aplicaciones de la biotecnología en el campo de la producción industrial. El sondeo génico en personas puede llevar a consecuencias nefastas en la contratación laboral. Criterios Analiza las aplicaciones actuales de la genética mediante la investigación y elaboración de un ensayo. Ponderación Logros: MATRIZ DE VALORACIÓN DE COMPETENCIAS Pre-formal Receptivo Resolutivo Autónomo Analiza las Analiza las Investiga las aplicaciones Analiza las aplicaciones aplicaciones actuales de la aplicaciones actuales de la actuales de la genética actuales de la genética genética sin mediante la genética mediante una la investigación mediante la investigación elaboración y la investigación muy de un elaboración y elaboración completa y ensayo. ya que cumplen una función en la cadena trófica de la naturaleza. agrícola y ganadera.GUÍA METODOLÓGICA DE BIOLOGÍA desconocidas. Se puede pensar en posibles nuevas contaminaciones debidas a un metabolismo incontrolado. y atenta contra la intimidad a que tiene derecho toda persona.

(2008). SEP/Altea. Colección Espejo de Urania. Los Transgénicos. México. pp. B. Audesirk. Valdivia. P. Editorial Prentice Hall. R.GUÍA METODOLÓGICA DE BIOLOGÍA DIAGNÓSTICA Examen diagnóstico Lluvia de ideas ACTIVIDADES DE APRENDIZAJE: • Problemario • Actividades de la Guía metodológica • Línea de Tiempo • Cariotipo y diagnóstico • Investigación documental • Ensayo • V de Gowin de actividades experimentales ACTIVIDAD ESPECÍFICA: • Portafolio de evidencias Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad FORMATIVA SUMATIVA 30% 20% 20% 30% BIBLIOGRAFÍA BÁSICA De Erice E. SEP/Usborne. Biología. S. Reimpresión de la Segunda Edición.Edición. Editorial Limusa Willey. (2006). BIBLIOGRAFÍA COMPLEMENTARIA Claybourne. (2009). México. México. 2ª. Nelson. Gómez Roig. B. La Vida y sus Procesos. y González A. Ana. El Gran Libro de los Genes y el ADN. Editorial Publicaciones Culturales. G y Byers. 704. (2002). T. pp. 399. La ciencia de la vida. Granillo. Audesirk. 3ra.E. México. SEP/Libros del Escarabajo. Genes y ADN. Biología. Biología. (2004). Villarreal M. Editorial McGraw Hill. 133 . E. (2006). México. Principios de Biología. 1ª. Walter. (2004). Colección Astrolabio. Colección Espejo de Urania. Gideon E. México. Ciencia y Naturaleza. pp. 407. Edición.

botanica. Facultad de Ciencias. Noguera Solano.cl/blog/2001/01/genograma_arbol_genealogico. SEP/Planeta.org My Heritage http://www. Laboratorio de Historia de la Biología y Evolución. (2000).org/esp/genomica/index. La Clonación 1.es/biosfera/ Embryos http://www.embryos. México. H.es/genealogia Genograma http://chato. García.myheritage. Colección Esto es Química ¿y qué?. R. E.h tm 134 . Colección Espejo de Urania. y Ruiz Gutiérrez.uba.html Mutaciones http://www. SEP/Libros del Escarabajo.cnba. México.html Proyecto Biósfera. (1997). (2003). Universidad Nacional Autónoma de México. México.GUÍA METODOLÓGICA DE BIOLOGÍA Cherfas.cnice. El Genoma Humano.ar/Pakete/Dibulgeneral/LasMutaciones/Mutaciones. R. UNAM.mec. Jeremy (2003). VIDEOS RECOMENDADOS • Película GATACA • Película La Isla TIC’s Action Bioscience http://actionbioscience. http://recursos. Gómez Roig. Genética para el Futuro. Colección Astrolabio. Facultad de Química.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 4 Evolución de los Seres Vivos 135 .

Declarativos Analiza el concepto de evolución de los seres vivos mediante el video “Darwin y el árbol de la vida”. 6. consultando fuentes relevantes y realizando experimentos pertinentes. • • 136 . Explica las distintas teorías sobre el origen de la vida. Ilustra las ideas de Lamarck. Asume una postura de respeto hacia los diferentes puntos de vista. Reflexiona las implicaciones de la actividad humana como un aspecto modificante en la evolución de los seres vivos.2. registra y sistematiza la información para responder a la pregunta de carácter científico. Rectifica preconcepciones personales o comunes sobre diversos fenómenos naturales a partir de evidencias científicas. Actitudinales/V alorales Participa de forma colaborativa en equipos diversos. • CRITERIOS DE DESEMPEÑO Argumenta las diferentes teorías acerca del origen de la vida mediante una investigación documental. Debate en forma grupal el tema expuesto en equipo sobre las teorías del origen de la vida. Interpreta un mapa mental de las evidencias de la evolución. 6. Debate en forma grupal el tema expuesto en equipo sobre las teorías evolutivas.3 Asume una actitud constructiva. Estructura ideas y argumentos de manera clara. SABERES Procedimentales Redacta una reseña sobre el video proyectado. Obtiene. COMPETENCIAS Genéricas/Atributos Disciplinares 5. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. 8.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. Evalúa argumentos y opiniones e identifica prejuicios y falacias. Argumenta las distintas teorías evolutivas.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE: EVOLUCIÓN DE LOS SERES VIVOS TIEMPO: 18 hrs UNIDAD DE COMPETENCIA: Investiga las principales teorías sobre el origen y evolución de los seres vivos para explicar la diversidad. que han manifestado a través del tiempo. interculturalidad y creencias. Argumenta las características de las diferentes teorías evolutivas para determinar los factores que influyen en los cambios genéticos con base en la adaptación de las especies mediante la elaboración de carteles. Darwin-Wallace y Neodarwinismo en equipo mediante un cartel. a través de la comparación de los cambios genéticos. 5. coherente y sintética. Diseña una línea de tiempo sobre la evolución de una especie.4. 7. reflexiona y compara los cambios genéticos que se han manifestado en los seres vivos como origen de la biodiversidad a través de una línea del tiempo. Analiza.

Darwin-Wallace y Neodarwinismo en equipo Mapa mental de las evidencias de la evolución Línea de tiempo sobre la evolución de una especie • • EXPLORANDO TUS CONOCIMIENTOS 1. ¿Existen pruebas de que la evolución existe? ¿cuáles? ________________________________________________________________ ________________________________________________________________ 137 . Ilustraciones y animaciones. Artículos de divulgación en revistas científicas. Presentaciones en Power Point. Equipo multimedia • • EVIDENCIAS Y/O PRODUCTOS Actividades de la guía didáctica del alumno Cartel sobre las ideas de Lamarck. Plumones.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • • • • • • Lluvia de ideas Análisis de medios Clase Magistral Debate Base orientadora de la acción (BOA) Asesoría metodológica y temática del bloque. • • • • • • ESTRATEGIAS DE APRENDIZAJE Exposición Debate Mapa mental Cartel Ejercicios de Guía metodológica Línea de tiempo • • • • • • • • • RECURSOS DIDÁCTICOS Guía metodológica Video “Darwin y el árbol de la vida”. Pintarron. Libros y Revistas electrónicas. Escribe 3 personajes relacionados con la evolución ________________________________________________________________ ________________________________________________________________ 4. Escribe 5 palabras que se te vienen en mente al leer la palabra “Evolución” ________________________________________________________________ ________________________________________________________________ 2. ¿Evolucionan todas las cosas? ________________________________________________________________ 3.

GUÍA METODOLÓGICA DE BIOLOGÍA 138 .

4. Así entonces. sólidamente conectadas y fácilmente disponibles en museos. crecientes. sin ella no es posible entender las propiedades distintivas de los organismos. de una generación a otra. La evolución biológica puede ser imperceptible o trascendente. con unos pocos supervivientes. más crucial actualmente para el bienestar humano. La evolución es un concepto asombroso y convincente. la ciencia y para nuestra comprensión del mundo. desde cambios sutiles en la proporción de diferentes alelos dentro de una población (tal como los que determina el grupo sanguíneo) hasta las alteraciones sucesivas que marcan el desarrollo desde el organismo más primitivo hasta los seres vivos más complejos. A través de los años han surgido diversas teorías que tratan de explicar cómo surgió la vida en nuestro planeta y cómo ésta ha cambiado a través del tiempo. la evolución biológica es un cambio en las propiedades de las poblaciones de organismos que va más allá de su vida individual. Las pruebas que la sustentan son abundantes. La evolución es el gran principio unificador de la Biología. ni las relaciones de mayor o menor proximidad que existen entre las distintas especies. todo lo que existe en el universo es objeto de su propio proceso evolutivo.1 ¿QUÉ ES LA EVOLUCIÓN BIOLÓGICA? En el sentido más amplio. sus adaptaciones al medio ambiente.9% de las especies que han existido alguna vez sobre la Tierra están actualmente extintas. y en un cúmulo de estudios científicos evaluados por expertos de todo el mundo. libros y revistas. de hecho. Desde esta perspectiva.2. El 99. la evolución consiste en una serie de cambios que se presentan a lo largo del tiempo involucrando a todo cuanto existe y es objeto de estudio por parte de la ciencia.GUÍA METODOLÓGICA DE BIOLOGÍA 4. 139 . Los cambios evolutivos son aquellos que se heredan a través del material genético. La historia de la vida es una historia de extinción y muerte. una de las más antiguas en filosofía. ¿CÓMO SE ORIGINÓ LA VIDA? La cuestión sobre el origen de la vida y por ende de los seres vivos es.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – EL PENSAMIENTO DEL ORIGEN DE LA VIDA A TRAVÉS DEL TIEMPO Realiza una investigación documental acerca de las 4 teorías más relevantes acerca del origen de la vida y a partir de ésta. completa la siguiente línea del tiempo anotando el año. teoría (experimento) y fundamento en la fecha correspondiente en el lado que corresponda a la corriente ideológica de la teoría. en trabajo por equipo. autor. Abiogenistas Biogenistas Siglo II Siglo XVII Siglo XVIII Siglo XIX Siglo XX 140 .

Posteriormente preséntalo en plenaria grupal. 141 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – TEORÍAS SOBRE EL ORIGEN DE LA VIDA A partir de la investigación documental elabora por equipo un mapa mental de los experimentos de las teorías que explicaron el origen de la vida.

proteínas. Escribe los símbolos y fórmulas correspondientes en orden de evolución. Convierte el siguiente esquema en fórmulas químicas correspondientes a cada átomo o molécula que se describe. Lípidos Proteínas Carbohidratos Ácidos nucleícos Alcoholes Ácidos grasos Aminoácidos Monosacáridos Bases nitrogenadas Ácido fosfórico Hidrocarburos Formaldehido Ácido cianhídrico Metano Agua Amoníaco Carbono Hidrógeno Oxígeno Nitrógeno 2.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – LA EVOLUCIÓN QUÍMICA 1. carbohidratos y ácidos nucléicos) escribe una fórmula condensada. En las biomoléculas (lípidos. 142 .

GUÍA METODOLÓGICA DE BIOLOGÍA 143 .

Responde las siguientes preguntas ¿Qué relación existe? ___________________________________________________________________________________ ___________________________________________________________________________________ __________________________________________________________________________ ¿Cuál fue la tendencia de esta evolución molecular? ___________________________________________________________________________________ _____________________________________________________________________________ 4. De este tronco común surgirían en la evolución tres modelos de células procariontes: arqueas. la teoría más aceptada en la actualidad es que: 144 . por lo que se puede pensar que se adaptaron a vivir en todos los ambientes posibles y "ensayarían" todos los posibles mecanismos para realizar su metabolismo.3 ¿CÓMO SE ORIGINARON LAS CÉLULAS EUCARIONTES? Carl Woese en 1980 denominó protobionte o progenote al antepasado común de todos los organismos actuales (eubiontes) y representaría la unidad viviente más primitiva. Así.GUÍA METODOLÓGICA DE BIOLOGÍA 5. solamente existieron estas formas celulares. urcariotas y bacterias Durante un período de más de 2.000 millones de años. La evolución celular se produjo en estrecha relación con la evolución primitiva de la atmósfera y de los océanos terrestres. pero dotada ya de la maquinaria necesaria para realizar la transcripción y la traducción genética.

2). Algunas células “aprendieron” a fabricar las moléculas orgánicas mediante la fijación y reducción del CO2. A partir de ellas. Se iniciaba así la fotosíntesis. Empezó una revolución del oxígeno que causaría la muerte de muchas formas celulares para las que fue un veneno. esta primitiva célula en un momento dado. englobaría (fagocitosis) a otras células procarióticas más pequeñas que tuvieran estructuras primitivas para metabolizar el CO2 atmosférico. 4. tuvo como origen la liberación de O2 y por tanto la transformación de la atmósfera reductora en la atmósfera oxidante que hoy conocemos. que perdió su pared celular. Estas formas celulares tienen organización procarionte y son de pequeño tamaño. podría haber ocurrido una especie de “primera crisis ecológica” a nivel molecular. en su teoría endosimbiótica (fig. La incorporación intracelular de estos primitivos procariontes a la primitiva célula urcariota.1 y 4. si no hubiera sido porque en algún momento de la evolución celular. realizando una nutrición heterótrofa aerobia.. otras se adaptarían a su presencia y algunas otras aprendieron a utilizarlo para sus reacciones metabólicas.. 145 . utilizarían como alimento las moléculas orgánicas presentes en el medio (sopa primigenia). lo que le permitió aumentar de tamaño. Como estas moléculas terminarían por agotarse. y otras capaces de absorber la luz solar e iniciar el proceso fotosintético estableciéndose de esta manera una relación endosimbiótica conocida con el nombre de urcariota. con lo cual la célula anaerobia pudo convertirse en aerobia.500 millones de años. como un proceso de nutrición autótrofa. propone que se originaron a partir de una primitiva célula procarionte. le proporcionaría dos características fundamentales de las que carecía: • La capacidad de un metabolismo oxidativo.GUÍA METODOLÓGICA DE BIOLOGÍA Las primeras células serían heterótrofas anaerobias. se piensa que evolucionaron las células eucariontes. Lynn Margulis. TEORÍA ENDOSIMBIÓTICA El siguiente paso en la evolución celular fue la aparición de las eucariontes hace unos 1. El empleo del agua en la fotosíntesis como donante de electrones. lo que dio lugar a la respiración aerobia.

Para comprender mejor esta teoría es pertinente definir el término simbiosis. Fig.1.GUÍA METODOLÓGICA DE BIOLOGÍA • La posibilidad de realizar la fotosíntesis y por tanto ser un organismo autótrofo capaz de utilizar como fuente de carbono el CO2 para producir moléculas orgánicas. con algunas particularidades metabólicas que no se encontraban en los individuos separados y esta asociación se transmite de generación en generación. Esquema de la posible secuencia de eventos que originaron a las diversas células eucariontes Fig. el término endosimbiosis se refiere a una relación simbiótica al interior de la célula. Por tanto.2 Proceso de Endosimbiosis 146 . 4. 4. Se trata de una asociación prolongada de individuos (coexistencia) de diferente clase en una unidad morfológica con ventajas mutuas y significativas.

organelos presentes en las células eucariontes. Estos organelos poseen ADN. componentes esenciales para su duplicación independiente del núcleo celular. Poseen ADN circular al igual que las bacterias actuales. ARNt. Fig. 147 . 4. La importancia de estas observaciones radica en sugerir que estos organelos fueron organismos unicelulares capaces de autoreplicarse y sintetizar la totalidad de sus proteínas por si mismos. tienen dimensiones y morfología parecidas a la de las bacterias. Representación del tiempo biológico en horas.3. ARNm.GUÍA METODOLÓGICA DE BIOLOGÍA Los fundamentos de la teoría endosimbiótica son: Las mitocondrias y cloroplastos. ribosomas.

que dice que los seres vivos fueron creados por Dios.4. Esto fue una gran contribución al primitivo concepto de que todas las especies se originaban de un creador perfecto y por tanto no podían cambiar debido a su origen. o Escala de la Naturaleza. desde que éstas fueron creadas. De esta manera explicaba la existencia de organismos extintos que se conocían sólo por sus restos fósiles. pero algunos desaparecieron como consecuencia de diferentes cataclismos (el más reciente. 148 . es decir lo que decía el Génesis del Antiguo Testamento. que pretendían darle forma científica a la explicación bíblica sobre la crea-ción (también llamadas creacionistas). En 1795. George de Cuvier (1769-1832) postuló la teoría del catastrofismo. expuso la teoría del uniformismo. George de Buffon (1707-1788) propuso que las especies (pero solo las no creadas por acción divina. Afirmaban que no hay procesos de cambio. La otra línea de pensamiento se basa en las teorías transformistas que establecen que las especies derivan unas de otras por una transformación a través del tiempo. En la Edad Media se aceptaba la tradición judeocristiana. el diluvio universal). que las características de los seres vivos permanecieron invariables y que el número de especies en la Tierra siempre fue igual. Éstas comprenden las teorías fijistas apoyadas hasta el siglo XVIII. James Hutton. para explicar su concepto del avance de las cosas vivientes desde lo inanimado a las plantas. Las que sobrevivían permanecían invariables y tras cada catástrofe se producía una nueva creación divina.GUÍA METODOLÓGICA DE BIOLOGÍA 4. luego a los animales y finalmente pone al hombre en la "cumbre de la creación".. con su especial creación del mundo construido literalmente en seis días. que las especies no han aparecido de la noche a la mañana y que deben tener antecesores.) pueden cambiar. ¿CÓMO EXPLICA LA EVOLUCIÓN LA DIVERSIDAD DE LOS SERES VIVOS? Aristóteles desarrolló su Scala Naturae.500 millones de años. A través de la historia se postularon dos líneas del pensamiento acerca de la evolución biológica. acaecidos en épocas remotas que acabaron con la fauna y flora existentes. que planteaba que ciertos procesos geológicos operaron en el pasado de la misma forma que lo hace hoy en día llegando a establecer la edad de la Tierra en 4..

su libro “Los Principios de la Geología” tuvo un profundo efecto en Charles Darwin y Alfred Wallace. Dentro de las teorías más relevantes para explicar el proceso evolutivo están: • Teoría de los caracteres adquiridos . los alimentos crecen en una progresión aritmética (por ejemplo. Robert Thomas Malthus (1766-1834) escribió el libro “Ensayo sobre el Principio de Población”.) lo que trae como consecuencia las guerras y la muerte por hambruna. donde menciona que mientras las poblaciones humanas crecen en una proporción geométrica (por ejemplo. 32.). que los animales tenían que competir entre los de su misma especie y con los de distintas especies para sobrevivir. 4. 6. 4. Oparin 149 . Darwin pensó que en el reino animal pasaba lo mismo. deduciendo la “lucha por la existencia” (principio del pensamiento maltusiano).Jean Baptiste Lamarck • Teoría de la selección natural . Louis Pasteur Fig. 8.4. A. 8. 4. etc.Charles Darwin y Alfred Rusell Wallace • Teoría neodarwinista – Theodore Dobzhansky Fig. I. 4.5. 2.GUÍA METODOLÓGICA DE BIOLOGÍA Durante el siglo XIX El británico Charles Lyell refinó las ideas de Hutton. y concluyó que el efecto lento. constante y acumulativo de las fuerzas naturales había producido un cambio continuo en la Tierra. etc. 16.

LA CAUSA Y EL CUELLO DE LAS JIRAFAS 1. . De esta costumbre (de esforzarse por llegar) resulta. A. casi siempre árida y sin hierba.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . le obligan a comer hojas de los árboles ya esforzarse continuamente por llegar. que sus patas delanteras se han vuelto más largas que las traseras y que su cuello se ha alargado de tal manera que la jirafa. tendrían tendencia a desaparecer" Autor_______________________________ 150 . vive en lugares en los que la tierra . cabeza y lengua muchos alargados. Estos se reproducirían entre sí y dejarían descendencia que habría heredado las mismas características corporales. el más grande de todos los mamíferos.EL EFECTO. Haz un mapa mental de cada uno. los individuos que llegaran más alto y que en tiempos de escasez fuesen capaces de llegar aunque fuera un poco más arriba que los demás. sin levantarse sobre las patas traseras. . en todos los individuos de su raza. se salvarían con más frecuencia. Lee detenidamente los siguientes textos. patas delanteras."La jirafa. . y esto debe ser un ventaja en tiempos de escasez. mientras que los individuos menos favorecidos por los mismos conceptos. es curioso observar el resultado en la forma particular y la talla de la jirafa (Camelo pardalis): sabemos que este animal. tiene toda una estructura admirablemente adaptada para comer en las ramas más altas de los árboles. después de un largo tiempo. eleva su cabeza y alcanza seis metros de altura " Autor_____________________________ B."En relación a las costumbres. La jirafa puede así obtener comida al que no llegan otros ungulados que viven en el mismo lugar. Al originarse la jirafa.. por su elevada estatura y por su cuello..

GUÍA METODOLÓGICA DE BIOLOGÍA 2. Interpreta las relaciones lógicas de ambos texto argumentativos y distingue el modelo explicativo de Darwin del de Lamarck. TEXTO A HECHO que se expone TEXTO B RAZONES que se dan para explicar el hecho 151 .

no ocurren saltos ni interrupciones. publicó en 1866 sus descubrimientos sobre las leyes de la herencia. • Todos los organismos semejantes están relacionados por medio de su historia evolutiva. • El proceso evolutivo es continuo y gradual en todos los individuos.GUÍA METODOLÓGICA DE BIOLOGÍA AUTOR del texto RELACIONES LÓGICAS: ¿Cuál es la causa? ¿Cuál es la consecuencia? Un punto crucial de las teorías darwiniana y lamarkista es que no explican adecuadamente las variaciones que presentan los individuos y que tienen que ser forzosamente heredadas. en donde una forma pase a otra muy distinta. 152 . Darwin nunca tuvo conocimiento de tales investigaciones lo que le impidió comprender la relación existente entre la selección natural y “los efectos del uso y del desuso”. Mendel. es decir. esto es. pero no al total de la especie. En resumen. sin embargo. la evolución de las especies no está forzada ni dirigida por una presión ajena a dicho proceso. • La selección natural condiciona el curso del proceso evolutivo. las cuales han ocurrido a lo largo del tiempo. sino que es un resultado aleatorio. podemos considerar las ideas de Darwin en cuatro puntos: • Las especies se originan unas de otras por una serie de variaciones y mutaciones aleatorias. únicamente afectaría a un grupo numeroso de organismos. donde se observan antepasados comunes. en caso contrario.

GUÍA METODOLÓGICA DE BIOLOGÍA

MECANISMOS DE LA VARIABILIDAD
Después de varias discusiones entre los científicos sobre la evolución, parecía que se había comprendido como se había generado el proceso evolutivo en el ámbito de la selección natural, pero surgía una pregunta ¿Cómo se producía la variedad en la descendencia? Esto se debía a la presencia de flora y fauna muy parecida, que existía en diferentes partes del mundo; un ejemplo se dio en la variedad de tortugas y pinzones existentes en las islas Galápagos observadas por Darwin. Apoyándose en los experimentos de Mendel sobre genética, se vio que las características de los padres son transmitidas a los hijos, pero que estos adquieren características diferentes, esto se debe a los mecanismos generadores de variabilidad. Los mecanismos más importantes son: Reproducción sexual. Esta se da con la unión de los gametos masculino y femenino que origina a un individuo con características semejantes, pero diferentes a sus padres, es decir, se combinan, no se mezclan los caracteres paternos y maternos, a través de los genes. Mutaciones. Son cambios que son producidos en el material genético de los padres, y los hijos reciben dicha información ya alterada con lo cual se favorece al nuevo individuo ofreciéndole ventajas. Las mutaciones sólo son heredables cuando afectan a células reproductoras Microevolución. Es el proceso por el cual, a partir de una especie ya existente, se origina otra, y puede ocurrir por: Aislamiento geográfico: Esto se da cuando dos poblaciones de organismos similares quedan aisladas por barreras geográficas, evolucionan de forma distinta. Por ejemplo, las poblaciones de mamíferos de Australia al quedar aisladas evolucionaron de modo distinto a las del resto del mundo. Tendencias evolutivas diferentes: Es cuando en algunos individuos de una población se producen variaciones genéticas, que pueden dar origen a otra línea evolutiva. No interviene, pues, la selección natural. Por ejemplo, el elefante africano tiene orejas más grandes que el asiático, porque vive en regiones más cálidas y las orejas le permiten eliminar mayor cantidad de calor.
153

GUÍA METODOLÓGICA DE BIOLOGÍA

Fig. 4.6. Sinopsis del proceso evolutivo

ACTIVIDAD – FÓSIL VIVIENTE Se ha descubierto que existen una cuantas especies que son iguales a como eran hace millones de años. Dentro del campo de la biología se les denomina pancrónicas; aunque comúnmente son llamadas “fósiles vivientes”. Una especie de este tipo es el celacanto, un pez que tiene fósiles de una antigüedad de 80 m.a., pero que actualmente se le encuentra en aguas profundas cercanas a Madagascar. En el pasado habitaron prácticamente todos los océanos. Tomando en cuenta la teoría de la evolución por selección natural, encuentra las razones que expliquen por qué el celacanto no ha cambiado en 80 m.a.
154

GUÍA METODOLÓGICA DE BIOLOGÍA

ACTIVIDAD – LA SELECCIÓN NATURAL DE DARWIN Y WALLACE Elabora un mapa conceptual de la Teoría de la Selección Natural de Darwin que incluya por lo menos los siguientes conceptos: sobrepoblación, lucha por la existencia, variaciones, cambio gradual, poblaciones, adaptaciones, sobrevivencia del más apto, selección natural, medio ambiente, transmisión de rasgos heredables, especiación, extinción.

155

GUÍA METODOLÓGICA DE BIOLOGÍA

TEORÍA NEODARWINISTA En 1937, Theodore Dobzhansky publica su libro "Genética y el Origen de las Especies" donde incorporó a la teoría de Darwin, los postulados de las leyes de Mendel además de los conocimientos que ya se tenían sobre genética, bioquímica y paleontología, haciendo una síntesis y resultando en la Teoría Sintética de la Evolución o Neodarwinista. Ésta se basa en los cambios evolutivos que se llevan a cabo en las poblaciones, y no en los individuos (hay que recordar que Darwin únicamente observó las variaciones en los organismos). Un organismo nace, crece y con el tiempo muere, a través de su vida los individuos pueden sufrir cambios, pero su constitución genética permanece constante. Por otro lado, la constitución genética de una población puede variar de una generación a otra mediante procesos internos (mutaciones y recombinación génica) y procesos externos (selección natural y aislamiento reproductivo). Sus afirmaciones básicas son: • • • • Tal y como sostuvo Darwin, la evolución ocurre por selección natural. La variabilidad genética en una población se debe a la existencia de mutaciones. La selección natural actúa sobre las poblaciones y no sobre individuos aislados. La evolución ocurre a lo largo de miles y millones de años. Los cambios que se producen en las especies son pequeños y graduales.

4.5 ¿CUÁLES SON LAS EVIDENCIAS DE LA EVOLUCIÓN? La teoría de la evolución se basa en una serie de pruebas aportadas por diferentes disciplinas científicas y que infieren que todos los seres vivos actuales son el resultado de la evolución. Actualmente la comunidad científica no duda del hecho de la evolución, aunque hay diferentes hipótesis sobre cómo ha tenido lugar. Se puede poner un símil histórico para entender esta idea: ningún historiador pone en duda que el imperio romano cayó (esto es un hecho aceptado), pero, cuáles fueron las causas de la caída del imperio romano? Para responder esta pregunta hay diferentes ideas, diferentes hipótesis alternativas, que se ponen a discusión entre los historiadores.

156

GUÍA METODOLÓGICA DE BIOLOGÍA

Aunque hoy en día no hay que "demostrar" la evolución, en otras épocas sí que se ponía en duda y datos paleontológicos, anatómicos y embriológicos han sido utilizados como pruebas del hecho evolutivo. Son pruebas que permiten estable-cer relaciones de parentesco entre diferentes seres vivos. También los estudios de comparación de proteínas y ácidos nucléicos que aportan nueva luz sobre las relaciones entre los organismos.

ACTIVIDAD – LA PRUEBAS DE LA EVOLUCIÓN I. Evidencias embriológicas

Distintas etapas embrionarias de algunos vertebrados

La comparación de embriones de diferentes grupos de vertebrados ha sido considerada una prueba más de la evolución. 1. Escribe los argumentos que crees que usan los evolucionistas para apoyar sus ideas. _______________________________________________________________________________________ _______________________________________________________________________________________

157

GUÍA METODOLÓGICA DE BIOLOGÍA

_______________________________________________________________________________________ _______________________________________________________________________________________ 2. ¿Crees que la embriología comparada puede servir para establecer la noción de antepasado común? ¿Por qué? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ II. Evidencias anatómicas: Órganos homólogos, las extremidades de los vertebrados Investiga el nombre de cada uno de los huesos que constituyen las extremidades delanteras de los vertebrados mostrados en la siguiente imagen. Ilumina de diferente color cada hueso y escribe su nombre. Observa y responde: 1. ¿Por qué se puede decir que las extremidades de los vertebrados tienen la misma organización? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 2. Describe, a partir del modelo de organización general, las transformaciones que resultan de la adaptación al vuelo de los vertebrados.

_______________________________________________________________________________________ _______________________________________________________________________________________ 3. Formula una hipótesis que explique las semejanzas que has constatado en la organización de las extremidades de los vertebrados

158

GUÍA METODOLÓGICA DE BIOLOGÍA 159 .

GUÍA METODOLÓGICA DE BIOLOGÍA III. Evidencias anatómicas: órganos análogos Observa detenidamente los animales de la siguiente imagen. Haz una investigación documental en tu libreta sobre otros tres órganos análogos e ilustrala con dibujos 160 . ¿Qué tienen en común ambos animales? _______________________________________________________________________________________ _______________________________________________________________________________________ 2. 1. ¿podrías decir que tienen la misma función? y ¿tienen el mismo origen? ¿por qué? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 3. Si comparas las extremidades traseras de la rana y el saltamontes.

GUÍA METODOLÓGICA DE BIOLOGÍA IV. ¿Qué semejanzas encuentras entre los vestigios de las extremidades posteriores de la ballena y del pitón? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 161 . Evidencias anatómicas: órganos vestigiales. 1.

Evidencias paleontológicas Razona qué esperaríamos encontrar en el registro fósil si no hubiera cambio.GUÍA METODOLÓGICA DE BIOLOGÍA 2. _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ Haz una investigación documental extensa en tu libreta de cuáles son los órganos vestigiales que presenta el ser humano V. ¿Crees que se pueda encontrar una explicación que no implique evolución a la existencia de órganos vestigiales como estos? Razona tu respuesta. si no hubiera evolución y compara tus reflexiones con el registro fósil que muestran las figuras. Formula una hipótesis para explicar las coincidencias observadas entre estos dos organismos (cuidado de no utilizar argumentos "lamarkistas" en su explicación) _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 3. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ 162 .

GUÍA METODOLÓGICA DE BIOLOGÍA Diferentes géneros de animales parecidos a los caballos actuales 163 .

2. Levadura . Oveja – Chimpancé E.Coliflor D. Cascabel – Polilla C. Los números se refieren al número de aminoácidos diferentes en el citrocromo C de la especie comparada. plantas y microorganismos. Evidencias bioquímicas. ¿Cuál par de especies está mas estrechamente relacionada entre sí? ¿Por qué? A. Se pueden establecer ciertas comparaciones entre la secuencia de aminoácidos correspondientes a especies muy diferentes.GUÍA METODOLÓGICA DE BIOLOGÍA VI. En el siguiente cuadro se presentan las diferencias entre las secuencias de aminoácidos del citrocromo C obtenidas de diferentes animales. con una diferencia de 51 aminoácidos en la cadena del citocromo C. Esta molécula está presente en la mayoría de los organismos. 1. el organismo que está evolutivamente más cercano al hombre es _____________________. El citocromo C es una pequeña proteína (aproximadamente de unos 110 aminoácidos) que interviene en el transporte de electrones de la cadena respiratoria de los vegetales y animales. Caracol – Chirivía _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ 164 . De acuerdo con el cuadro. con una diferencia de ______________________ y el más lejano es ________________________. Humano – Carpa B.

En la figura puedes observar seis regiones biogeográficas y algunos animales característicos. b) Región Neártica: Norteamérica. e) Región Oriental: Asia tropical. lo que le da un gran peso en el proceso de comprobación de la Evolución. Evidencias biogeográficas Según la Biogeografía existen siete grandes regiones en las que se presenta homogeneidad adaptativa florística. faunística y obviamente climatológica: a) Región Paleártica: Europa y zonas nórdicas de Asia. con base en él completa el siguiente cuadro con la información que se te pide: 165 . c) Región Neotropical: Sudamérica. d) Región Etiópica: África. g) Región Oceánica: Islas oceánicas. Puede decirse que la Biogeografía es la ciencia que conjunta muchas evidencias e igualmente aporta pruebas propias y muy actuales. Nueva Zelanda y Nueva Guinea. f) Región Austral: Australia.GUÍA METODOLÓGICA DE BIOLOGÍA VII.

GUÍA METODOLÓGICA DE BIOLOGÍA 166 .

Un fósil no sólo se refiere a huesos. álamo) se obtuvieron del cruzamiento de diversas variedades que. Se desarrollará una raza. 167 . Cuando una población queda separada por barreras geográficas (como el mar. tejido o conchas conservadas en forma de roca sino que también se usa para designar toda huella o prueba dejada por algún ser vivo en el pasado. Básicamente son dos los métodos usados para calcular la edad de los fósiles: la datación relativa y la datación radiométrica. También pueden producirse nuevas especies por poliploidía y es una especiación extraordinariamente rápida ya que la producción de cromosomas se produce durante una generación.GUÍA METODOLÓGICA DE BIOLOGÍA ESPECIACIÓN La especiación es el proceso de generación de nuevas especies a partir de una y es el resultado de la adaptación. Este fenómeno es poco común en animales pero muy frecuente en vegetales. una subespecie o una variedad y si la duración del aislamiento geográfico es mayor. FÓSILES Los fósiles constituyen una prueba para el estudio de la evolución de la vida. De hecho. Si las condiciones ambientales perduan por muchas generaciones. sus depredadores y la probable causa de su muerte. un río o una cordillera). Los fósiles índice sólo se encuentran en rocas de una época especifica por lo tanto pueden determinar de manera indirecta la edad geológica de las rocas de un estrato dado. Técnicas de fechación en fósiles. muchas de las plantas domésticas (trigo. Permiten interpretar el ambiente que habitaron. Se considera que una nueva especie puede originarse por este mecanismo cada millón de años. producen híbridos poliploídes. modificando algunas de sus características. Esto requiere que se produzcan barreras reproductoras entre las especies incipientes. se habrá generado en la población una serie de cambios que la harán diferente de la población original. sus características fisiológicas y su relación evolutiva con otras especies. tabaco. por lo general. el desierto. manzano. algodón. la ausencia de fertilización indica que cada una es una especie diferente. dientes. ésta se adapta progresivamente a las nuevas condiciones ambientales por medio de la selección natural. cuando las dos poblaciones vuelven a estar en contacto.

Explica cómo evolucionó y las adaptaciones que tuvieron que llevarse a cabo para llegar a la especie actual. Describe lo que sucedió en cada especie 168 . Esta es la línea evolutiva de la ballena azul.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – CÓMO SE ORIGINARON LAS BALLENAS Describe las transformaciones que resultan de la adaptación a la vida acuática de los vertebrados como la ballena.

los fósiles encontrados en capas profundas son más antiguos que los hallados en capas superficiales.1 y fig. Cada isótopo se transforma en otro en un tiempo determinado llamado vida media que es el lapso en que la mitad de los isótopos de una muestra se transforman en isótopos de otro elemento (Tabla 4. Este método es muy impreciso. Datación radiactiva. 169 . Esto permite calcular relativamente.GUÍA METODOLÓGICA DE BIOLOGÍA __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ __________________________________________________________________________ _________________________________________________________________________ Datación relativa. y las más superficiales las más recientes. siempre y cuando sea posible calcular la edad de un estrato. aunque se usa en combinación con la datación radiométrica (fig. Así. Permite medir tiempos geológicos que se asignan en base a la velocidad de desintegración de los isótopos radioactivos. por simple comparación.8). Las capas más profundas son las más antiguas. 4. la edad aproximada de los fósiles. 4.7). La corteza terrestre se forma por capas de rocas super-puestas.

4.7.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – TIPOS DE FOSILES Realiza un mapa conceptual a partir de una investigación documental sobre los tipos de fosilización que existe. Ejemplifica e ilustra tu mapa. 4.8 Datación radiactiva del C14 170 . Fig. Datación relativa Fig.

1 Vida media de algunos elementos 171 . 4.6 Diferentes tipos de Fósiles Tabla 4.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.

quedarán 100 . De acuerdo con lo anterior. ¿qué edad aproximada tendrá este fósil? ______________________________ 3.) ____________________________ 172 . Tomemos como ejemplo el carbono 14. es decir. Si en un fósil se observa que su cantidad de carbono 14 se ha reducido 20%. Así.10 = 90 unidades de este elemento 1 000 años después. ¿Qué porcentaje de carbono 14 se encontrará después de 10 000 años? _____ 2. 1. las cantidades faltantes en la tabla. Para realizar algunos cálculos.9 = ___________ unidades En la siguiente tabla se han organizado los resultados anteriores junto con los cálculos de otros dos periodos de 1 000 años. 10 unidades. Comprueba los valores dados y calcula. usando el mismo procedimiento.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD – UN CRONÓMETRO PARA EL PASADO En esta actividad se explicará cómo se obtienen las cantidades restantes de elementos radiactivos a través del tiempo para el fechamiento de fósiles. en los primeros 1 000 años se habrá desintegrado 10% de las 100 unidades. Las cantidades para el siguiente periodo de 1 000 años (del año 1 000 al 2 000) se calculan como sigue: Cantidad desintegrada = 10% de 90 unidades = _____________ unidades Cantidad sobrante después de 2 000 años = 90 . Si en un fósil se observa que su cantidad de carbono 14 se ha reducido 35%. ¿qué edad aproximada tendrá este fósil? (Sugerencia: continúa los cálculos de la tabla anterior hasta llegar a este porcentaje. comencemos con una cantidad de 100 unidades de este isótopo radiactivo. el cual se desintegra aproximadamente 10% cada 1 000 años.

¿Por qué evolucionaron las células de consumidoras a productoras? 173 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDADES DE CIERRE DE BLOQUE 1. ¿Qué hubiera sucedido si la atmósfera primitiva hubiera contenido oxígeno? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 2.

¿Cuál es el efecto de la fotosíntesis sobre la atmósfera primitiva? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 4.GUÍA METODOLÓGICA DE BIOLOGÍA _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 3. ¿Por qué es importante el estudio de la Química para el conocimiento de los seres vivos? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 6. ¿A qué se debe la aparición de los organismos multicelulares? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 5. Sugiere pruebas específicas que apoyen la idea de que las modificaciones provocadas por la acción directa del medio no se heredan _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 174 .

de una especie animal o vegetal por acción de la selección natural? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 9.GUÍA METODOLÓGICA DE BIOLOGÍA 7. ¿Cómo explica la selección natural las diferencias en coloración o forma entre especies próximas que ocupan medios distintos. o entre razas de una misma especie que se encuentran en medios diferentes? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 10. ¿En qué se diferencian y en qué se asemejan la selección artificial y la selección natural? _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ ______________________________ 8. o la desaparición en un lugar. ¿En qué punto la teoría larmarkiana de la adaptación no está de acuerdo con las pruebas de que hoy disponemos? 175 . ¿Cómo puede explicarse la extinción.

desde hace 1. y a pesar de no tener ningún parentesco. Explica el papel del aislamiento geográfico en el origen de las especies. _________________________________________________________________________________ 176 .GUÍA METODOLÓGICA DE BIOLOGÍA _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ 11. el cual estuvo sometido a la presión selectiva de un ambiente adverso en las zonas más al norte. el que difiere del Ursus arctos. dentadura tipo netamente carnívora. desde los bosques caducifolios hasta la tundra. lo que produjo una nueva especie: el oso polar (Ursus maritimus). _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________________________________ _______________________________________________________________ 13. se asemejan estructuralmente. ¿qué debe ocurrir al gen para que el carácter quede permanente en el grupo? ________________________________________________________________________________ 12. cabeza y hombros aerodinámicos y cerdas rígidas en las plantas de los pies. que lo aíslan del frío y le dan tracción en el suelo helado. Identifica a qué evidencias corresponden los siguientes ejemplos: − La familia de las cactáceas en los desiertos de América y la familia de las Euforbiáceas en los desiertos asiáticos y africanos desarrollan tallos carnosos con tejidos almacenadores de agua y espinas protectoras contra la pérdida de la misma. se separó un grupo. ____________________________________________________________ − Los osos pardos (Ursus arctos). Se dice que de esta especie tan difundida. en el color de su pelaje.5 millones de años estuvieron ampliamente distribuidos en el hemisferio norte. Una vez ocurrida una mutación. siendo su dieta básicamente vegetariana y ocasionalmente carnívora.

origen de las células eucariontes. ACTIVIDAD ESPECÍFICA: • Línea de tiempo sobre la evolución de una especie. ACTIVIDADES DE APRENDIZAJE: • Exposición por equipo. pero los cetáceos son animales de sangre caliente. de la evolución a la pluricelularidad y de la evolución por selección natural. incluye a ballenas. ¿Por qué los marsupiales están diseminados por Australia y apenas viven en otras partes? _______________________________________________________________________________________ _______________________________________________________________________________________ _____________________________________________________________________ ACTIVIDAD ESPECÍFICA Elabora un mapa conceptual integrador que resuma los eventos del origen de la vida. • Cartel sobre las ideas de Lamarck. Examen departamental tipo CENEVAL o PISA 30% Laboratorio (evaluación V-Gowin) 20% Actividades de aprendizaje 20% Actividad específica por unidad 30% FORMATIVA SUMATIVA 177 . _________________________________________________________________________________ 14. pulmonados y en el interior de sus aletas hay huesos que indican una mano tetrápoda. • Participación en el debate sobre las teorías del origen de la vida y evolutivas. • Ejercicios de la guía didáctica. • Mapa mental de las evidencias de la evolución.GUÍA METODOLÓGICA DE BIOLOGÍA − La familia de los cetáceos. delfines y marsopas y sus rasgos externos son semejantes a los de los tiburones y a otros peces grandes. La rúbrica para su evaluación es la misma que para el bloque de Célula (página 91) EVALUACIÓN DIAGNÓSTICA Aplicación de examen diagnostico y lluvia de ideas. Darwin-Wallace y Neodarwinismo en equipo.

http://www. http://www.php 178 . Chamizo. 285-315.GUÍA METODOLÓGICA DE BIOLOGÍA MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios: Analiza.org (reproducido con permiso de Science Magazine). No. J. (2004) La Selección Natural: Cómo Funciona la Evolución. 168 páginas. Universidad Nacional Autónoma de México. Segunda Edición. T.F. BIBLIOGRAFÍA COMPLEMENTARIA ActionBioscience. Revista ¿Cómo ves? Dirección general de Divulgación de la Ciencia. los seres vivos Puntos: 80 Puntos: 100 Aspectos a mejorar : Ponderación: Logros: Puntos: 60 BIBLIOGRAFÍA BÁSICA Audesirk . Puntos: 100 Busca información sobre los cambios que han manifestado los seres vivos..L. (2008). Biología. Ciencia y Naturaleza. A. La ciencia. CECSA México. J. Tellería J.astroseti. Año 12.org/sopa.Prentice Hall. (1987).org.actionbioscience. y Byers. reflexiona y compara los cambios genéticos que se han manifestado en los seres vivos como origen de la biodiversidad a través de una línea del tiempo Pre-formal: Receptivo: Resolutivo: Autónomo: Estratégico: Propone cambios evolutivos en los seres vivos con base en las condiciones medio ambientales actuales.html Bada. Puntos: 30 Compara los cambios manifestados en los seres vivos. Oram. (1991). B. Biología. Argumenta Registra los los diferentes factores factores que evolutivos influyen en determinantes los cambios en los seres que sufren vivos.org/esp/evolution/futuyma. España. pp. Nueva visita al Experimento de Miller en Astroseti. A. Zoología evolutiva de los vertebrados. Una entrevista con Douglas Futuyma en ActionBioscience. (2006).L. Sistemas Vivientes. (2003) Sopa Prebiótica. 128-135.org. J. R. y Lazcano. Editorial Síntesis. Pearson.

N.es/biosfera/ RECURSOS DIDÁCTICOS • • • • Video Cosmos de Carl Sagan Video La Eva Genética – Discovery Channel Video Las Galápagos Video Darwin y el árbol de la vida – BBC de Londres 179 . (2000) Las Especies.org/espanol/articulos/405 Ingman.GUÍA METODOLÓGICA DE BIOLOGÍA Eldredge.es/personal/cxc_9747/neodarwinismo.mec.html Evolutionibus (2004) El neodarwinismo y la Teoría Sintética http://www.actionbioscience.actionbioscience.org/esp/evolution/ingman.html TIC’s Proyecto Biósfera.org/esp/evolution/eldredge.apologeticspress.org http://www. http://recursos.cnice. (2001) El ADN Mitocondrial Esclarece la Evolución Humana en ActionBioscience.html Major. (2005) Creación vs Evolución: Darwin y la Evolución en ApologeticsPress.terra. T.org http://www. M. la Especiación y el Medio Ambiente en ActionBioscience.org http://www.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 5 Biodiversidad y Medio Ambiente 180 .

Clasifica a los seres vivos de acuerdo a Carl Woese en tres dominios y seis reinos. Distingue los factores bióticos y abióticos de un ecosistema. sus recursos naturales y considera la importancia de los ecosistemas locales.2 Toma decisiones a partir de la valoración de las consecuencias de distintos hábitos de consumo y conductas de riesgo. médica y económica. Obtiene. Fundamenta que la ecología es el estudio de las relaciones de la biodiversidad con su medio ambiente.1 Elige las fuentes de información más relevantes para un propósito específico y discrimina entre ellas de acuerdo a su relevancia y confiabilidad. Fundamenta opiniones sobre los impactos de la ciencia y la tecnología en su vida cotidiana. Explica la estructura y función de los ecosistemas haciendo énfasis en el flujo de la materia y la energía. 2. Distingue los diferentes tipos de ecosistemas. CRITERIOS DE DESEMPEÑO 181 . imágenes e importancia. Elabora una presentación en power point de cada reino con características. económica y social de los seres vivos para su aprovechamiento racional. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. Realiza actividades experimentales para identificar características generales de los seres vivos reportando los resultados en una V de Gowin.3 Asume una actitud constructiva. biológica. Identifica las causas y efectos de los problemas ambientales en los ecosistemas Actitudinales/Valorale s Valora la importancia médica. 4. señalando su importancia ecológica. 8. Relaciona los niveles de organización química. a través de visitas guiadas a áreas naturales de su comunidad. física y ecológica de los sistemas vivos. COMPETENCIAS Genéricas Disciplinares 3. SABERES Procedimentales Identifica a los seres vivos utilizando las reglas de la nomenclatura taxonómica binomial de Linneo a través de claves dicotómicas. 13. UNIDAD DE COMPETENCIA: Interrelaciona el medio ambiente y su biodiversidad con el flujo de materia y energía de cada ecosistema para ubicarlos y valorar el equilibrio de la biosfera a través de una visita guiada a áreas naturales y la elaboración de un mapa mental integrador. Analiza las leyes generales que rigen el funcionamiento del medio físico y valora las acciones humanas de impacto ambiental. registra y sistematiza la información para responder a preguntas de carácter científico. asumiendo consideraciones éticas. 6. Declarativos Explica la clasificación taxonómica de los organismos de acuerdo a las reglas de Linneo. consultando fuentes relevantes y realizando experimentos pertinentes 11. Describe los niveles taxonómicos propuestos por Woese: Tres dominios y seis reinos. Organiza grupos y mesas de debate sobre las causas y consecuencias del deterioro ambiental y las alternativas para el manejo responsable de la biosfera Fomenta la conservación de la flora y fauna de su región/comunidad.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE V: BIODIVERSIDAD Y MEDIO AMBIENTE TIEMPO: 45 hrs.

ESTRATEGIAS DE ENSEÑANZA • Aplicación de preguntas generadoras • Presentaciones ESTRATEGIAS DE APRENDIZAJE • Elaboración de presentaciones en power point. Valora la importancia de la interrelación de los seres vivos con su medio ambiente a través de visitas guiadas a áreas naturales. • Software • Pizarrón escrito de problema ambiental. escrito de visita guiada. de visita guiada • Resolución • Plumones • Papel • Reporte • Mapa • Clave Bond mental integrador. de divulgación científica • Videos • Libreta de apuntes. • Mapa mental integrador de actividades experimentales utilizando la V de Gowin. • RECURSOS DIDÁCTICOS • Guía metodológica de practicas educativo • Manual EVIDENCIAS Y/O PRODUCTOS • Portafolio electrónico con las presentaciones de power point. lápices.GUÍA METODOLÓGICA DE BIOLOGÍA Elabora un mapa mental integrador de los ciclos biogeoquímicos y la relación con el equilibrio ecosistémico • • • Analiza la estructura y las relaciones entre los componentes de los ecosistemas en un mapa mental integrador. aplicando la V de Gowin. plumas. 182 . • Reporte de power point de los diferentes reinos dicotómica Investigación documental de actividades de guía metodológica. • Debate en plenaria. • Reportes de actividades experimentales utilizando la metodología de la V de Gowin. • Visita guiada. • Actividades • Reporte • Cañón • DVD • Laboratorio • Artículos • Reportes experimentales. Realiza actividades experimentales sobre biodiversidad y medio ambiente.

Escribe el nombre científico de un organismo (que no sea el hombre. Sabias que México es un país megadiverso ¿por qué? ______________________________________________________________________ ______________________________________________________________________ 5. ¿Qué es la Biodiversidad? ______________________________________________________________________ ______________________________________________________________________ 4.GUÍA METODOLÓGICA DE BIOLOGÍA EXPLORANDO TUS CONOCIMIENTOS 1. Homo sapiens) ______________________________________________________________________ ______________________________________________________________________ 3. ¿Cuántos y cuáles son los reinos de los seres vivos? ___________________________________________________________________ ___________________________________________________________________ 2. Dibuja una cadena alimenticia 183 .

GUÍA METODOLÓGICA DE BIOLOGÍA 184 .

1) desarrolló un método de clasificación que aún se utiliza en la actualidad. El botánico sueco Carlos Linneo (1707-1778) (fig. Se basa exclusivamente en caracteres externos de los organismos. Asimismo utiliza datos comparativos para responder preguntas en relación con el nivel taxonómico. ecológicos y paleontológicos. proporciona métodos que facilitan la identificación de los organismos. Esta clasificación considera características morfológicas similares entre los organismos (homologías). el proceso evolutivo y la filogenia (origen de los organismos). NOMENCLATURA BINOMIAL DE LINNEO.GUÍA METODOLÓGICA DE BIOLOGÍA 5. Sistema natural. La Sistemática se encarga de estudiar las semejanzas o diferencias entre los organismos. forma u otros caracteres de los seres vivos. hábito. Existe la necesidad de ordenar y organizar el elevado número de seres vivos para facilitar su conocimiento y análisis.1 ¿CÓMO SE CLASIFICAN A LOS SERES VIVOS? La diversidad biológica o biodiversidad se refiere a la enorme variedad de organismos vivos que existen en nuestro planeta. daño. Por lo tanto la Taxonomía biológica se encarga de elaborar inventarios de la biodiversidad a nivel mundial o regional.5 millones). elabora un sistema de clasificación que sea aceptado mundialmente. así como también les asigna la nomenclatura adecuada. también utiliza otros estudios como los citológicos. embriológicos. Este naturalista seleccionó rasgos físicos como tamaño y forma. Existen varios tipos de clasificación: Sistema artificial. estudia las implicaciones evolutivas y por último proporciona un nombre exclusivo para cada grupo de seres vivos o fósiles. Sistema filogenético. se cree que existen alrededor de diez millones de organismos diferentes de los cuales solo se conocen científicamente 15 % (1. ubicándolos en diferentes categorías. que permitían una clasificación con base en las 185 . Señala que la variedad de formas de vida del planeta se relaciona con los procesos evolutivos de los seres vivos y por compartir ancestros comunes. considera el beneficio. La Taxonomía se encarga de clasificar a los seres vivos y ubicarlos en grupos específicos llamados taxones. 5. Un sistema estrictamente utilitario. color.

GUÍA METODOLÓGICA DE BIOLOGÍA relaciones estrechas de los organismos. una serie de niveles en los que la categoría mayor abarca a todas las demás. género. sólo son aplicables a una lengua. familia. REGLAS DE LA NOMENCLATURA BINOMIAL. es cada vez más general e incluye organismos cuyo antepasado común era cada vez más remoto en su relación evolutiva. y así sucesivamente. Cada categoría. considerando el número de similitudes y el tipo de estructura de sus sistemas reproductores. que se ubicaría por encima del reino. El nombre científico de un organismo se forma de hecho de las dos categorías más pequeñas: el género y la especie. que sólo pueden cruzarse entre sí y tienen un antecesor común. A Linneo se deben las agrupaciones de los organismos por sus semejanzas en categorías taxonómicas. orden. Hay ocho categorías principales: especie. Actualmente existe la tendencia de integrar una categoría nueva: el dominio. la primera palabra identifica el género en el que se clasifica el organismo. es decir. todas las especies con caracteres semejantes las agrupó en la categoría superior llamada género y todos los géneros similares en familia. clase. la segunda representa a la especie y por lo general es un nombre que describe al organismo. reino y dominio (Tabla 5. regla que hasta la actualidad es universalmente aceptada. Linneo también estableció la nomenclatura binomial para designar a las especies. donde Canis refiere a que el organismo pertenece al grupo de los carnívoros y familiaris indica que es un animal domesticado que sirve de compañía a la familia. a menudo dos o más organismos no 186 .1). que puede definirse como el conjunto de individuos similares estructural y funcionalmente. por ejemplo: El perro doméstico lleva por nombre Canis familiaris. pero estos tienen los siguientes inconvenientes: No son universales. división o Filo. Los primeros nombres que tuvieron las plantas y animales eran nombres vernáculos o nombres comunes. desde especie hasta dominio. por ejemplo él clasificó a las plantas con flores. por ejemplo. NIVELES TAXONÓMICOS. La unidad de clasificación de los seres vivos es la especie. En este sistema el nombre científico de los organismos está escrito en latín. Las categorías taxonómicas forman un orden jerárquico o posición taxonómica.

1 Posición taxonómica de algunas especies de plantas y animales país Estados Unidos Alemania Holanda Dinamarca Suecia Portugal Francia España Italia Noruega nombre común Sparrow english Haussperling Musch Grasspurv Hussparv Pardal Moineau domestique Gorrión Passera oltramontana Grasspurv Fig. Avena Dominio Reino Eukaria Plantae Roble blanco Eukaria Plantae Anthophyta Dicotyledoneae Fagales Fagaceae Quercus Quercus alba Elefante Eukaria Animalia Chordata Mammalia Proboscidea Elephantidae Elephas Elephas maximus Águila calva Eukaria Mosca de la fruta Eukaria Animalia Chordata Aves Falconiformes Falconidae Haliacetus Haliacetus leucocephalus Animalia Arthropoda Insecta Diptera Drosophilidae Drosophila Drosophila melanogaster División o Magnoliophyta Filo Clase Orden Familia Género Especie Liliopsida Poales Poaceae Avena Avena sativa Tabla 5. Carlos Linneo Tabla 5.2.GUÍA METODOLÓGICA DE BIOLOGÍA relacionados tienen el mismo nombre común.2). 6. El gorrión es un ejemplo de la confusión originada cuando se usan nombres comunes siendo su nombre científico en todos los países Paisser domesticus (Tabla 5. 1. Nombres vulgares del gorrión 187 .

Pyrus malus L. Las normas básicas para la escritura de los nombres científicos son: • Se usa el latín o palabras latinizadas. Puede ser el nombre de una persona latinizado en conmemoración. malus = manzana en latín. por ejemplo. un nombre en conmemoración a una persona. Lam es abreviación de Lamarck y L de Linneo. hojas redondeadas. • Al final del nombre científico se acompaña el apellido abreviado del autor que lo describió. Así. Quercus rotundifolia.GUÍA METODOLÓGICA DE BIOLOGÍA El nombre científico de una especie es una combinación de dos palabras en latín: El nombre genérico. por ejemplo. el nombre científico se escribe con letra cursiva (o itálica). el resto del nombre va en minúscula. ACTIVIDAD Investiga dos ejemplos donde el uso de nombres comunes conlleve a confusión. el pino piñonero es Pinus pinea L. Es un sustantivo en singular o una palabra tratada como tal (nombre uninominal). se subraya.. Centáurea boissieri. El nombre específico. por ejemplo. proviene de Boissier. Cuando se escribe a mano o a máquina. por ejemplo. un sustantivo en aposición (o yuxtaposición) con el género. • Cuando se imprime. Argumenta qué se tendría que hacer e ilústralo con imágenes de las especies involucradas. 188 . el encino es Quercus rotundifolia Lam. Por lo general es: un adjetivo. • La primera letra del género va en mayúscula.

No se te olvide utilizar las reglas de nomenclatura científica Dominio: Reino: Phylum: Clase: Orden: Familia: Género: Especie: Nombre común: ___________________________________________________________________________________ Dominio: Reino: Phylum: Clase: Orden: Familia: Género: Especie: Nombre común: 189 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga la posición taxonómica de tres especies e ilústralas con una imagen.

¡No olvides respetar las reglas de nomenclatura binomial. ________________________ 2.GUÍA METODOLÓGICA DE BIOLOGÍA Dominio: Reino: Phylum: Clase: Orden: Familia: Género: Especie: Nombre común: ¿Cuál de las tres especies investigadas está menos estrechamente relacionadas con las otras dos? ¿Por qué? __________________________________________________________________________________________ __________________________________________________________________________________________ ________________________________________________________________________________________ ACTIVIDAD Consulta la página electrónica: http://www.gob. Busca y enlista 15 especies con su nombre común y científico.biodiversidad. 1.pdf. ________________________ 190 .mx/pdf/NOM-059-ECOL-2001.

GUÍA METODOLÓGICA DE BIOLOGÍA

3. ________________________ 4. ________________________ 5. ________________________ 6. ________________________ 7. ________________________ 8. ________________________ 9. ________________________ 10. ________________________ 11. ________________________ 12. ________________________ 13.________________________ 14.________________________ 15.________________________

5.2 LOS VIRUS, ¿VIVO O NO VIVO?
Los virus son parásitos intracelulares que no poseen metabolismo ni organización celular por lo que se les sitúa en el límite entre lo vivo y lo inerte. Son tan pequeños (entre 20 y 300 milimicras: µm) que sólo se pueden ver a través de un microscopio electrónico. Algunos tienen formas geómetricas regulares (icosaedro, helicoidal, etc.) algunos parecen bastones, cristales, filamentos, esferas y otros poseen una cabeza redonda, provista de una pequeña cola (Fig. 5.2).

191

GUÍA METODOLÓGICA DE BIOLOGÍA

Un virus es básicamente un agregado de material genético —ya sea ADN o ARN— dentro de una cubierta proteica llamada cápside, la cual, a su vez, está conformada de fragmentos denominados capsómeros. Algunos tienen una capa lipoproteica denominada envoltura viral (Fig. 5.3).

Fig. 5.2 Comparativo de tamaño y forma de varios grupos de virus

Los virus no se consideran dentro de los seis reinos de la vida, ya que carecen de muchas características propias de los seres vivientes. Los virus tienen diferentes
192

GUÍA METODOLÓGICA DE BIOLOGÍA

células hospederas ya que infectan a los animales incluido el hombre; a las plantas y los bacteriófagos que afectan a las bacterias. Cada tipo es independiente del resto, es decir, que los virus de plantas no pueden infectar animales ni bacterias y viceversa. Los virus son específicos de un cierto tipo celular siendo muy selectivos con sus hospederos y con las vías de entrada para infectarlos. Los métodos de entrada son muy especializados, y es una de las formas en las que los virus detectan a sus víctimas.

ACTIVIDAD Realiza una investigación documental sobre los virus y destaca su importancia económica, científica y médica a través de un mapa conceptual.

193

GUÍA METODOLÓGICA DE BIOLOGÍA

Fig. 5.3. Estructura del bacteriófago T4 y del virus VIH

ACTIVIDAD Consulta algunas referencias electrónicas y de tu biblioteca, contesta las siguientes preguntas: ¿Qué es un Prión? __________________________________________________________________________________________ ____________________________________________________________________ ¿Qué es un Viroide? __________________________________________________________________________________________ _____________________________________________________________________ Menciona algunas vacunas que previenen contra enfermedades de tipo viral. __________________________________________________________________________________________ ________________________________________________________________________________________

194

GUÍA METODOLÓGICA DE BIOLOGÍA

Comenta brevemente sobre el virus del papiloma humano y cuáles son sus consecuencias. __________________________________________________________________________________________ __________________________________________________________________________________________ __________________________________________________________________________________________ __________________________________________________________________________________________

REPLICACIÓN DE LOS VIRUS. Los virus tienen un solo propósito: reproducirse. Para llevarlo a cabo, tienen que apoderarse de la materia, la energía y la maquinaria de la célula hospedera adecuada introduciendo su material genético en la misma, fusionando la cubierta viral con la pared o la membrana de la célula y liberando sus genes dentro de ella. Si es un virus ADN, su material genético se inserta en el ADN de la célula hospedera. Si es un virus ARN (retrovirus), debe primero cambiar su ARN en ADN, poder insertarse. Después, los genes virales se copian muchísimas veces, los virus emplean las enzimas del hospedero para producir cápsides y otras proteínas virales. Los nuevos genes virales y las proteínas se ensamblan en partículas virales. Los nuevos virus se liberan de la célula hospedera sin destruirla o, eventualmente, el número de virus es tan grande que rompen la pared celular del hospedero para salir e infectar a otras células.

5.3 ¿CUAL ES EL SISTEMA ACTUAL DE CLASIFICACIÓN DE LOS SERES VIVOS?
PROPUESTA DE 3 DOMINIOS – 6 REINOS. Desde Aristóteles hasta Linneo, los biólogos dividían el mundo de los seres vivos en dos reinos: vegetal (Plantae), individuos inmóviles, autótrofos y fotosintéticos, y animal (Animalia), organismos móviles y heterótrofos. En 1866, el alemán Ernst Haeckel sugirió la conveniencia de constituir un tercer reino: el Protista, que comprendiera a los organismos unicelulares (bacterias, algas, hongos y protozoarios). En 1937, Chatton estableció un cuarto reino, el Monera, para abarcar a todos los organismos procariontes (bacterias y cianofitas), diferenciándolos de los eucariontes (plantas, animales y protistas). En 1969, el biólogo R. H. Whittaker, establece un
195

GUÍA METODOLÓGICA DE BIOLOGÍA

esquema de clasificación que reúne los organismos en cinco reinos. Él distinguió el reino Fungi (hongos y levaduras) como un reino separado de las otras formas de origen vegetal. Los hongos carecen de pigmentos fotosintéticos pero tienen núcleos y paredes celulares. En 1990, Carl Woese comprobó que por la secuenciación del ARNr, los procariontes se dividían en dos grupos: eubacterias y arqueobacterias. Propuso un nuevo taxón superior al reino que llamó dominio. Todos los seres vivos se agruparían en 3 dominios: Archaea (arqueobacterias), Bacteria (eubacterias) y Eukarya (protistas, hongos, animales y plantas) (fig. 5.4)
ACTIVIDAD Investiga e indica en la figura de abajo, el nombre de cada paso del proceso de replicación de un bacteriófago:

1. _____________

2. ________________ 6. ______________

3. _____________ 5. ______________

4. _________________

196

arkhaios = antiguo.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Presentan formas unicelulares procariontes. Se han encontrado en lagos congelados en la Antártida (hasta -7°C). Viven en regiones con altas concentraciones de sal como el Mar Muerto (con siete veces la concentración del agua de mar). incluido hidrógeno. aunque no todas lo son. dióxido de carbono y azufre. Halófilas. Algunos tipos importantes de arqueas son: Metanógenas. manantiales calientes.4. Las arqueas se nutren de varias sustancias para obtener energía. o sea que viven en condiciones extremas. respiraderos de las profundidades marinas y en los estómagos de rumiantes. Sicrófilas. Termoacidófilas. Sus paredes celulares carecen del peptidoglucano presente en todas las eubacterias. Viven a temperaturas muy bajas. bakterion = bastón) se encuentran actualmente restringidas a hábitats marginales por lo que son extremófilas.. Habitan en ciénegas y pantanos. plantas de tratamiento de aguas negras. Árbol evolutivo de los seis reinos de seres vivos DOMINIO ARCHAEA REINO ARQUEOBACTERIA Las arqueobacterias (del gr. Se desarrollan en manantiales azufrosos y respiraderos volcánicos en condiciones de alta temperatura y pH bajo. 5. 197 .

5. Anabaena. La membrana celular es una bicapa lipídica como la de eucariontes rodeada por una 198 . Spirulina y Lyngbya. El citoplasma tiene un aspecto granular fino debido a la presencia de una gran cantidad de ribosomas y algunas bacterias tienen ADN menores extracromosómicos autónomos llamados plásmidos.GUÍA METODOLÓGICA DE BIOLOGÍA DOMINIO BACTERIA REINO EUBACTERIA Organismos procariontes. Nostoc. caroteno y ficocianina. Los pigmentos no están contenidos en cloroplastos como en las células eucarióticas sino que forman parte de un sistema de membranas localizadas hacia el borde de la célula (fig. tienen pared celular compuesta de peptidoglicano y no poseen organelos membranosos ni formas multicelulares.5. Contienen clorofila además de otros pigmentos como xantofila. esta última les proporciona el color azul. No poseen núcleo verdadero sino un cromosoma circular.5) Las cianobacterias se reproducen por fisión binaria o por fragmentación. 5. Se clasifican en dos divisiones: Cyanobacteria o Cyanophyta (autótrofas) y Schizophyta o Eubacteria (heterótrofas). Fig. Las cianobacterias o cianofitas (algas azul-verdes) de hábitat acuático. Morfología de una cianobacteria Las eubacterias son organismos unicelulares aparentemente simples. Entre los géneros más representativos de estas algas están: Oscillatoria.

que la protege del ataque de linfocitos del sistema inmune del hospedero.6). Pueden presentar nutrición autótrofa (fotosintética y quimiosintética) o heterótrofa (saprofita y parasitaria). además. especial y largo resultando en nuevas combinaciones genéticas. hueco. Morfología de una eubacteria Fig. las bacterias pueden ser: aerobias y anaerobias (facultativas. Muchas bacterias. Existen cientos de especies de bacterias. les sirve para deslizarse (fig 5. Formas de las bacterias La mayoría de las bacterias se reproducen asexualmente por fisión binaria. Una forma de reproducción sexual es la conjugación en la que se transfieren plásmidos a través de un pelo sexual (pilli). bacilos. se reproducen por esporulación que consiste en formar endosporas cuando las condiciones no son favorables permaneciendo latentes por mucho tiempo.6. vibrios y espirilos (fig.GUÍA METODOLÓGICA DE BIOLOGÍA pared celular de péptidoglicano. Fig. en especial los bacilos. obligadas y estrictas). 199 .7). 5. 5. Algunas bacterias infecciosas tienen una capa viscosa que rodea a la pared celular llamada cápsula. 5. y. pero todas ellas tienen una de las cuatro formas existentes: cocos.7. De acuerdo a su respiración.

9). multicelulares) y variedades nutricionales (heterótrofos. autótrofos o una combinación de ambos). plantae y animalia cuya principal característica es estar constituidos por células eucariontes. mastigóforos. Fig. 5. Tienen un núcleo formado por varios cromosomas y limitado por una envoltura nuclear. fungi. las cianobacterias ayudaron a formar y cambiar el medio ambiente inicial de la Tierra. crisofitas y pirrofitas). DOMINIO EUKARYA A este dominio pertenecen los reinos protista. Ejemplos de protozoarios 200 .GUÍA METODOLÓGICA DE BIOLOGÍA Importancia evolutiva. REINO PROTISTA Los protistas se dividen en tres grandes grupos: las algas protistas (euglenofitas. Incluye una variedad de tipos de eucariontes (unicelulares. pero algunos lo pueden hacer sexualmente por medio de la conjugación. 6. Casi todos los protistas se reproducen asexualmente por fisión binaria. coloniales.9). 5. 5. acrasiomicetos y oomicetos) y protozoarios (sarcodinos. cloroplastos y corpúsculos basales (fig. Hace unos 2 mil millones de años. Morfología de la Euglena Fig.8. protistas fungales (mixomicetos. Poseen organelos como mitocondrias. cilióforos y esporozoarios) (fig.9. creando el oxígeno atmosférico lo que permitió el desarrollo de formas de vida más complejas.

10. Las estructuras reproductoras son características que se usan para clasificar los hongos. La mayoría de los hongos están constituidos de filamentos ramificados. Los hongos necesitan humedad. El reino Fungi se clasifica en cuatro divisiones: zigomicetos. 5.10) y deuteromicetos (fig. Fig. La reproducción asexual puede ocurrir por fragmentación de las hifas. ascomicetos. La mayoría son saprofitos.GUÍA METODOLÓGICA DE BIOLOGÍA REINO FUNGI Un hongo es un organismo constituido por células eucariontes con paredes celulares de quitina. o tubos. 5. secretan enzimas digestivas a su alrededor que degradan la materia orgánica que después absorben. también pueden producir esporas sexuales y asexuales. Morfología de Agaricus (basidiomiceto) Fig. 201 . consumen los restos y los desperdicios de otros organismos y otros son parásitos. poca luz. llamados hifas. Ejemplos de deuteromicetos Los hongos son heterótrofos. basidiomicetos (fig.11).11. Éstas crecen y se ramifican formando redes complejas llamadas micelios. desde unicelular (levadura) hasta pluricelulares (grandes setas). 5. 5. Varía en tamaño.

202 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Con apoyo de la bibliografía recomendada. También esquematiza el ciclo de vida de un champiñón. investiga cómo se conforma un liquen (dibuja un esquema) y que tipo de asociación ecológica representa.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental acerca de la importancia de los organismos pertenecientes REINO IMPORTANCIA ECONÓMICA IMPORTANCIA ECOLÓGICA IMPORTANCIA MÉDICA Eubacteria Protista Fungi Comentario final ___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 203 .

También se encuentran en aguas tropicales. Sus células poseen pared celular compuesta de celulosa. Contienen. Tienen aspecto filamentoso y ramificado. tallos. además de clorofila a y c. DIVISIÓN RODOFITAS (ALGAS ROJAS) Son mayormente marinas tropicales. La mayoría son acuáticas. Su crecimiento es grande y rápido. En 6 meses alcanza su largo máximo de entre 50 y 100 m. filamentosas o membranosas. No tienen raíces. Pueden llevar a cabo la fotosíntesis a grandes profundidades (hasta a 175 m) debido a la ficoeritrina y a otros pigmentos que son azules (fícobilinas).12). fícoxantina. Incluyen a las algas eucariontes (rodófitas. clorófitas) y briofitas DIVISIÓN FEOFITAS (ALGAS PARDAS) Es un grupo de especies bentónicas marinas de las costas rocosas frías. u otro polisacárido. algunas desarrollan rizoides para adherirse al sustrato. La mayoría son multicelulares. ni hojas verdaderas. Las feofitas más abundantes son los Macrocystis. (fig. La pared celular está formada de celulosa. Pueden crecer de 30 a 65 cm en un día. feofitas. Algunas depositan carbonato de calcio en la superficie de sus células que les dan consistencia dura y quebradiza (conocidas como algas coralinas) (fig. 204 . como las grandes masas de algas flotantes del género Sargassum. embebidos en una matriz de galactosa.GUÍA METODOLÓGICA DE BIOLOGÍA REINO PLANTAE Las plantas son organismos eucariontes que van desde unicelulares hasta árboles enormes. generalmente llamados kelps.13). El reino Plantae incluye a las plantas no vasculares y a las plantas vasculares o traqueofitas. 5. Obtienen sus nutrientes por medio de la fotosíntesis y absorción. 5. que da el color pardo u olivo. PLANTAS NO VASCULARES Estas plantas no poseen tejido vascular y son las más sencillas y antiguas.

almacenan su alimento como almidón. de varios metros de tamaño.12. tierra y en los árboles. Ejemplos de feofitas DIVISIÓN CLOROFITAS (ALGAS VERDES) Grupo diverso que coloniza todo tipo de hábitats: agua dulce y salada. 5. Fig. Una vez concluido el cuadro realiza una reflexión del ¿porqué si todas son algas no se encuentran en el mismo reino? Argumenta tu respuesta. Desarrollan estructuras corporales que van desde unicelulares hasta formas masivas.11. Ninguno de ellos se mueve. Los pigmentos (clorofilas a y b) y las sustancias químicas en las paredes celulares de las algas verdes son muy parecidos a los de las plantas vasculares. Generalmente. ACTIVIDAD Realiza una investigación documental a cerca de las diferencias químicas entre los distintos grupos de algas y completa el siguiente cuadro de doble entrada. nieve. 5. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 205 . pero las corrientes de agua llevan los espermatozoides hasta los óvulos. Ejemplos de rodófitas Fig.GUÍA METODOLÓGICA DE BIOLOGÍA La mayoría de las algas rojas producen óvulos y espermatozoides en estructuras especializadas de sus ramas.

Este grupo incluye las hepáticas y los musgos. Todas son plantas pequeñas con pocos centímetros de largo. 206 .GUÍA METODOLÓGICA DE BIOLOGÍA ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ TIPO DE ALGA PHYLUM/REINO TIPO DE CLOROFILA OTROS PIGMENTOS RESERVAS PARED CELULAR AZUL VERDE Cianofita Reino Eubacteria a VERDE Carotenos (rojo) Xantofilas (amarillo) Sílice CAFÉ Pirrófita Reino Protista Almidón Grasas ROJA ayd Celulosa DIVISIÓN BRIOFITAS (MUSGOS Y HEPÁTICAS) Las briofitas son las únicas plantas terrestres no vasculares.

No tienen raíces. donde pueden crecer otras especies de plantas. Las briofitas favorecen la fertilidad de los suelos. ni hojas verdaderas.GUÍA METODOLÓGICA DE BIOLOGÍA Viven en ambientes húmedos. 207 . tallos. casi todas viven agrupadas lo que les permite retener humedad. esquematiza la estructura y el ciclo de vida de un musgo. ACTIVIDAD Busca en un libro de biología de tu biblioteca. Las estructuras parecidas a raíces llamadas rizoides anclan a la planta a la tierra.

PLANTAS SIN SEMILLA (CRIPTÓGAMAS) DIVISIÓN PTERIDOFITAS (HELECHOS) Los helechos crecen en tierras húmedas. En el interior de los esporangios están las esporas que son liberadas al exterior para su germinación. Se encuentran en la mayoría de los ambientes terrestres y en muchos ambientes acuáticos. también sirven de sostén estructural a la planta. y unas hojas o frondas de diferentes tamaños con venas ramificadas llamadas pínnulas. en bosques. Se dividen en dos grupos: coniferofitas (gimnospermas) y antofitas (angiospermas). el agua y los minerales van desde la tierra a todas las partes de la planta a través de un tejido conductor especializado: el xilema. Este grupo se divide en dos grandes categorías: plantas sin semilla que incluyen a las pteridofitas (helechos) y por el otro las plantas con semilla que comprenden a las coniferofitas (coníferas) y a las antofitas (plantas con flores). de alimento para el embrión y de una cubierta externa. Los alimentos y otras sustancias elaboradas se transportan por el floema. en campos abiertos. Tienen hojas duras cubiertas por materiales cerosos como la cutina y adaptadas para retener agua.000 especies. Presentan un tallo más o menos desarrollado pero generalmente reducido a un rizoma subterráneo. Una semilla es una estructura que se compone de un embrión vegetal. en árboles y en riscos. 208 . donde algunas especies de helechos arborescentes alcanzan hasta 25 m de alto. Ambos tejidos están formados por células rígidas. El alimento almacenado en las semillas le suple la energía para las etapas tempranas de crecimiento.GUÍA METODOLÓGICA DE BIOLOGÍA DIVISIÓN TRAQUEOFITAS: PLANTAS VASCULARES Grupos de plantas más complejos. La mayoría de las plantas de semilla están adaptadas para la vida en tierra. En el envés de las frondas se disponen los esporangios agrupados en soros. que como resultado. PLANTAS CON SEMILLA (FANERÓGAMAS) Estas plantas se reproducen al formar semillas y son las más abundantes con más de 200. La mayoría crece en bosques pluviales tropicales. La mayor parte de las plantas vasculares están adaptadas a una vida terrestre.

un helecho en maceta. rizomas. Investiga sobre las plantas pteridofitas. fronda en crecimiento. hojas recicladas.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Materiales por equipo: libro de biología. lupa. 209 . esporangios. pinnula. soros. con apoyo de tu profesor identifica y realiza un dibujo indicando las siguientes partes del helecho: fronda.

el óvulo se transforma en semilla y el ovario que lo rodea madura hasta convertirse en una estructura llamada fruto. Cupressus (cedro). las cuales no están rodeadas de un fruto. 210 . Abies (oyamel). Entre las coníferas más conocidas se encuentran los géneros: Pinus (pinos). Crecen como árboles o arbustos. lo cual les permite seguir realizando la fotosíntesis y crecer lentamente en épocas difíciles. Las coníferas son plantas que producen conos: la estructura que contienen las semillas de la planta. Después de ser fecundado. DIVISIÓN CONIFEROFITAS (CONÍFERAS) Las coníferas viven en latitudes frías y a grandes alturas. ginkgofitas (ginkgos) y principalmente las coniferofitas (coníferas). y Juniperus (táscate) DIVISIÓN ANGIOSPERMAS (PLANTAS CON FLORES) Son más diversas que las gimnospermas. Existen 215. adaptadas a condiciones secas y frías: son perennifolias (hojas verdes todo el año). aumenta las posibilidades de la planta de tener una reproducción exitosa.000 especies aproximadamente. Taxodium (ahuehuete). que es una característica de este grupo. La flor. Las angiospermas incluyen diversas formas biológicas. en grupos grandes y densos que forman extensos bosques. En este grupo se encuentran las cicadofitas (cícadas). Una parte de la flor es el ovario que contiene los óvulos.GUÍA METODOLÓGICA DE BIOLOGÍA GIMNOSPERMAS (PLANTAS SIN FLORES) Las gimnospermas tienen semillas desnudas. Producen una resina en su savia que es "anticongelante". Se encuentra en gran diversidad de hábitats. lo que les permite seguir transportando nutrientes a temperaturas por debajo del punto de congelación. hojas aciculadas (forma de aguja) y escamosas cubiertas de una cutícula gruesa que impide la evaporación. Se dividen en dos clases: monocotiledóneas y dicotiledóneas.

211 . y menciona la importancia económica de las coníferas.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Consulta páginas de internet y esquematiza el ciclo de vida del pino.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. Expongan en plenaria de grupo 212 . 10 plantas con flor. Con el siguiente esquema. dibújalas en el papel bond y señala a que clase pertenece. lupa. Materiales en equipo: semillas diversas. Haz lo mismo con las semillas. observa tus plantas e identifica sus estructuras. papel bond.

médica. indicando la importancia económica. En un papel bond. apóyate de libros de biología y utilizando las TIC. e industrial de las plantas angiospermas. puedes citar ejemplos que utilices en tu vida cotidiana.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Elabora un cuadro sinóptico de la clasificación del reino Plantae donde incluyas a todas la divisiones o phyla . Comparen los mapas de todo el grupo 213 . recortes o dibujos. realiza un mapa mental. con imágenes. ACTIVIDAD Trabaja en pareja.

guiándote del siguiente esquema. hojas recicladas. Material en equipos: cinco flores diferentes. 214 . dibuja y señala cada parte. Observa e identifica las estructuras de las flores que llevaste a clase.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. lupa.

anélidos. Entre ellos tenemos a la amiba. y vejiga urinaria. nematodos. conductos respiratorios y pulmones. (Fig. sistema nervioso. tejidos conectivos. uretra. El mesodermo es la capa intermedia que origina la pared interna del tubo digestivo. pared de la cavidad celómica.GUÍA METODOLÓGICA DE BIOLOGÍA REINO ANIMALIA Los animales son organismos eucariontes. recubrimiento de la boca y nariz. Obtienen sus nutrientes principalmente mediante la ingestión. algunas esponjas. Presentan funciones desarrolladas de coordinación y movimiento. 5. 5. dermis. hígado. a manera de imágenes especulares. sangre. sistema excretor y reproductor (fig. mesenterio. La simetría bilateral es aquella en la cual un solo plano pasa a lo largo del animal dividiéndolo en dos partes. Son móviles en muchos estadios de su vida. Simetría. Durante el desarrollo embrionario el embrión adquiere capas celulares a partir de las cuales se originan todos los tejidos.13). moluscos. Simetría es la posibilidad de dividir al individuo en partes iguales a partir de un eje que pase por su centro. cnidarios. etc. y su clasificación se basa en las siguientes características que comparten: Número de capas germinales. La simetría radial es aquella en la que el organismo puede ser dividido por cualquier plano que pase a partir de la boca a lo largo del cuerpo en partes iguales. órganos y sistemas. Por ejemplo la mosca y el hombre. Sus células carecen de pared celular y se organizan en tejidos. artrópodos. platelmintos. El ectodermo es la capa externa que da origen a epidermis y sus derivados. páncreas. pluricelulares y heterótrofos. CARACTERÍSTICAS TAXONÓMICAS DE LOS ANIMALES La diversidad de este reino es enorme. El endodermo es la capa interna que da origen al esqueleto. músculos. izquierda y derecha. Por ejemplo las medusas y las estrellas de mar. 215 . equinodermos y cordados.14). vasos sanguíneos. Existen unos 30 phyla de animales pero sólo 9 son importantes por el número de especies que los integran: poríferos. Un organismo es asimétrico cuando no se pueden obtener partes iguales debido a que su forma es completamente irregular. debido a que la mayoría posee un sistema nervioso.

Los animales eucelomados presentan órganos internos en una cavidad corporal limitada por peritoneo (mesodermo) como es el caso de la lombriz de tierra y el ser humano (Fig. 5. 5. su desarrollo y posición en relación al tubo digestivo (dorsal. 5.16) Esqueleto. Los organismos pseudocelomados (falso celoma) sí tienen órganos internos dentro de un espacio corporal no delimitado pero éste no es de origen mesodérmico. Cefalización. Los animales metaméricos son: anélidos. como en el caso de la lombriz intestinal. como en los cordados. Capas embrionarias y presencia de celoma Celoma. 5.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. como en los cnidarios. El metamerismo es una repetición seriada de segmentos semejantes a lo largo del eje longitudinal del cuerpo.13. (fig. como es el caso de las esponjas y los gusanos planos. Cordón Nervioso Central. artrópodos y cordados (fig. El esqueleto está conformado por las estructuras que dan sostén al cuerpo. Los animales se clasifican en acelomados si su cuerpo es sólido sin otra cavidad que la del tubo digestivo. delimitado por mesodermo. en su lugar. Son importantes para la clasificación. 216 . Metamerismo. o ventral. La cefalización es la diferenciación de un extremo cefálico o cabeza (centro del sistema nervioso y los órganos de los sentidos) y uno posterior o caudal. Algunos animales. y que contiene las vísceras. como en los artrópodos). 5. cada segmento se llama metámero y está representado por un número de estructuras variable dependiendo del grupo animal del que se trate.17).13). presentan una red nerviosa.15). El celoma es la cavidad general del cuerpo. Puede ser externo o exoesqueleto como en el calamar o erizo de mar o puede ser interno o endoesqueleto como en el humano (fig.

5. oblonga. Presentan una abertura principal (ósculo) que utilizan para la excreción. Son diblásticos.16. Fig. no tienen poder de locomoción. Presentan una gran variedad de formas: redonda.GUÍA METODOLÓGICA DE BIOLOGÍA Características Únicas.18). Sus cuerpos están llenos de poros que utilizan para la circulación del agua. no reaccionan a los estímulos y no tienen un medio aparente para capturar alimento. Sus esqueletos están formados por espículas (de calcio o sílice) o de fibras proteicas de espongina. 217 . Cefalización Fig. Tipos de simetría Fig. Son las características únicas exclusivas de un phylum que no comparte con ningún otro y le otorga singularidad. Tienen una cavidad interna llamada espongiocele (fig.14. 5.17. Ejemplos de metamerismo Fig. aplastados adheridos a rocas. de vaso. Su color varía. desechos orgánicos y detritos (desechos orgánicos muy finos). 5. Esqueleto PHYLUM PORIFEROS (ESPONJAS) Las esponjas viven adheridas a rocas o en el fondo marino. 5.15. 5. pero el ectodermo es interno y el endodermo es externo. Su alimento consiste en organismos microscópicos. Varían en tamaño desde 1 cm hasta más de 2m de diámetro. otras forman crecimientos costrosos.

Son los más simples de todos los metazoarios. Poseen simetría radial.) que les sirven de ataque y defensa. Poseen una red nerviosa a través de su cuerpo que los hace sensibles a los estímulos. Presentan una cavidad con funciones digestivas conocida como celenterón con una boca por la cual ingresan los alimentos y se excretan los desechos y materiales digeribles (Fig. conectivo y reproductor. nervioso.GUÍA METODOLÓGICA DE BIOLOGÍA Su reproducción es asexual y consiste en la gemación en la cual la esponja origina yemas sobre alguna parte de su cuerpo que eventualmente forman adultos maduros. Tipos biológicos de cnidarios Fig. PHYLUM CNIDARIOS O CELENTERADOS La mayoría son marinos y su distribución es cosmopolita. Los celenterados se clasifican en tres grupos distintos: hidrozoarios (hidras.18. Anatomía de una esponja 218 . Poseen nematocistos (estructuras urticantes. 5.19. muscular.19). Fig. Clasificación. poseen una capa no germinal de material gelatinoso entre el endodermo y el ectodermo de nominada mesoglea. 5. Obelia y Physalia). También presentan reproducción sexual. escifozoarios (medusas) y antozoarios (anémonas y corales). Tienen los cinco tejidos básicos: epitelial. Son diblásticos. 5.

21). no tienen sistema digestivo. 5. 5. el sistema nervioso consta de un anillo periesofágico de que parten nervios longitudinales en dirección anterior y posterior. 5. Carecen de aparato respiratorio y circulatorio. Presentan sexos separados y dimorfismo sexual. Tienen boca y ano. Existen parásitos y los hay de vida libre. trematodos (fasciola) y cestodos (solitaria. sin embargo. aparato excretor poco desarrollado. estos últimos.20). Todas las formas tienen sistema nervioso.GUÍA METODOLÓGICA DE BIOLOGÍA PHYLUM PLATELMINTOS (GUSANOS PLANOS) Todos son tribásticos. Se dividen en tres clases turbelarios (planarias y nudibranquios). en el fango y en los organismos descompuestos (Fig. Fig. Ejemplos de platelmintos Fig. son comunes en la tierra. Anatomía de un nematodo 219 . PHYLUM NEMATODOS (GUSANOS REDONDOS) Son vermes cilíndricos y delgados con los extremos puntiagudos. excretor y reproductor. equinococo) (Fig.20. acelomados y con simetría bilateral. 5.21. Los hay parásitos y de vida libre.

PHYLUM MOLUSCOS Es un grupo de invertebrados de cuerpo blando que poseen un manto que. oligoquetos (lombriz de tierra) e hirudíneos (sanguijuelas) (Fig. Tienen un par de nefridios para la excreción en cada segmento del cuerpo. Los artrópodos incluyen alrededor de 1 millón de especies que ocupan prácticamente todo tipo de hábitat. tórax y abdomen. 5. pelecípodos o bivalvos (almeja. ostión). Han desarrollado el primer celoma (cavidad interna) verdadero. gasterópodos (caracol de jardín) y cefalópodos (pulpo. Presentan un pie ventral musculoso que utilizan para moverse. 5. en riachuelos de agua dulce. siendo el tubo interno el tracto digestivo. calamar y nautilo) (fig. secreta una concha dura de calcio. en charcas y en los océanos.22). Poseen un exoesqueleto segmentado formado de quitina. El tracto digestivo es completo y tiene dos aberturas: la boca y el ano. El tracto digestivo está completo. Los moluscos son un grupo numeroso de organismos que se encuentran en hábitats que van desde los mares hasta los desiertos. 220 . desde el fondo de los mares hasta las cumbres más altas de las montañas. que pueden sufrir modificaciones para convertirse en órganos masticadores o copuladores. Se clasifican en cinco clases distintas: anfineuros (quitón). PHYLUM ARTROPODOS. que se usa para raspar el alimento. El cuerpo está dividido en tres partes: cabeza. escafópodos (colmillo de elefante).GUÍA METODOLÓGICA DE BIOLOGÍA PHYLUM ANÉLIDOS (GUSANOS ANILLADOS) El cuerpo de los anélidos se compone de secciones llamadas segmentos. ostra. Viven en el suelo. El plano corporal es un “tubo dentro de un tubo”. Dentro de la boca de muchos moluscos hay una estructura llamada rádula. a menudo. Tienen un sistema circulatorio cerrado donde la sangre siempre está dentro de los vasos. Presentan apéndices articulados pares para la locomoción o natación. Poseen simetría bilateral.23). Poseen pequeñas cerdas o quetas que utilizan para la locomoción. Los anélidos se dividen en tres clases: poliquetos (gusanos marinos).

Han dado origen a los únicos invertebrados voladores. Son principalmente terrestres. Los quelicerados tienen seis pares de apéndices en el cefalotórax. Basándose en la especialización de los segmentos. los artrópodos se dividen en 4 subphyla: quelicerados (arañas. garrapatas). Clasificación. El cordón nervioso es ventral al tubo digestivo. funcionan como órganos de alimentación.23. presentan simetría bilateral. escorpiones. unirramios. El primer par son quelíceros. 5.GUÍA METODOLÓGICA DE BIOLOGÍA Han desarrollado el más alto grado de cefalización de todos los invertebrados. crustáceos (cangrejo. los pedipalpos. Ejemplos de anélidos Figura 5. a excepción de los cefalópodos. el segundo par. son celomados (poseen un celoma reducido). Casi todos son carnívoros. Fig. ácaros y garrapatas. Presentan ojos simples llamados ocelos. cochinilla).22. (milpiés) y Hexápodos (insectos). Además. escorpiones. 5. modificados como pinzas o colmillos. Ejemplos de moluscos SUBPHYLUM QUELICERADOS El cuerpo se compone de dos partes: cefalotórax y abdomen. Presentan ojos compuestos con una visión tipo mosaico. un sistema circulatorio abierto y sexos separados. La clase arácnida incluye arañas. los cuatros pares restantes son patas ambulatorias.24) 221 . (Fig.

El cuerpo de la mayoría de los crustáceos es segmentado compuesto de dos partes: cefalotórax y abdomen. y mandíbulas. los cangrejos. Las langostas. En la mayoría el exoesqueleto se endurece con compuestos de calcio. además de la quitina. 5. Ejemplos de quelicerados SUBPHYLUM CRUSTÁCEOS La mayoría de los crustáceos son marinos. que son apéndices sensoriales. Son de hábitat terrestre. mientras que otros.24. 5. viven en lugares húmedos de la tierra. los camarones. 222 .25) SUBPHYLUM UNIRRAMIOS El subphylum Uniramia contiene la mayor cantidad de especies y el mayor número de organismos. que son partes bucales para masticar y romper el alimento. las pulgas de agua y las cochinillas son ejemplos de crustáceos (Fig. Reciben este nombre debido a que sus apéndices no están ramificados. Tienen un par de antenas. Presentan dos pares de antenas.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. como las cochinillas. aunque hay algunos dulceacuícolas.

5. En ocasiones tienen uno o dos pares de alas articuladas en el tórax. 223 . tórax y abdomen. Es el grupo más grande de artrópodos terrestres. Presentan metamorfosis.28). 5. Incluye a los ciempiés que poseen un par de patas en cada segmento y a los milpiés con dos pares de partas por segmento (Fig.26) SUBPHYLUM HEXAPODOS O INSECTOS Los insectos se encuentran en casi todos los ambientes habitables de la Tierra.25. por lo que son los únicos invertebrados que pueden volar.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Su cuerpo se divide en tres: cabeza. Presentan tres pares de patas.27). La cabeza tiene dos ojos compuestos y ojos simples. Ejemplos de crustáceos Los quilópodos presentan un cuerpo alargado formado por múltiples segmentos. incluyen un par de antenas y varios pares de piezas bucales (5. proceso por el cual el animal pasa de etapa de larva a adulto (5.

Las larvas tienen simetría bilateral y son parecidas a las de los cordados más primitivos. Metamorfosis incompleta y completa PHYLUM EQUINODERMOS Son los únicos que poseen un pie ambulacral en forma de tubo que usan para la locomoción. Carecen de cabeza y segmentación (Fig. Tienen branquias dérmicas y pedicelarios que las protegen. equinoideos (erizo de mar). Brazos generalmente múltiplos de cinco y poseen glándulas digestivas denominadas ciegos hepáticos. Los equinodermos se clasifican en cinco clases: asteroideos (estrella de mar). Son los únicos que poseen un exoesqueleto de espinas calcáreas y un endoesqueleto de placas dérmicas. 5. 5. crinoideos (lirio de mar) y holoturoideos (pepino de mar). Poseen un sistema nervioso radial sin cerebro.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.27. ofiuroideos (estrella serpiente). 5. Presentan ano en posición dorsal y una boca ventral. Tienen la simetría radial más avanzada. Son triblásticos.26.28. Anatomía del saltamontes Fig. aprensión y para abrir las conchas de moluscos con los que se alimentan. Ejemplos de quilópodos Fig.29). 5. 224 .

Presentan un endoesqueleto de tejido vivo en el cuál se insertan los músculos y también proporciona protección a órganos internos vitales. Poseen un sistema nervioso dorsal tubular. Son eucelomados (con celoma verdadero) con simetría bilateral. y que son ejemplos de posibles eslabones que vincularían a vertebrados e invertebrados. 225 .30). Tienen hendiduras branquiales faríngeas. urocordados (ascidias) y cefalocordados (anfioxo) (Fig. 5. cefalización y metamerismo (segmentación del cuerpo). 5. Anatomía de una estrella de mar PHYLUM CORDADOS Los cordados evolucionaron a lo largo de unos 500 millones de años. Los cordados superiores constituyen el subphylum vertebrados constituido por animales con espina dorsal.31).GUÍA METODOLÓGICA DE BIOLOGÍA Fig.. o vestigios de ellas. presentan una gran variedad de formas. Tienen notocorda que es una varilla delgada y flexible que da sostén al cuerpo y un cordón nervioso dorsal que corre a lo largo de la superficie superior del cuerpo Los cordados inferiores están formados por organismos menos evolucionados. Estos están clasificados en tres subphyla: hemicordados (gusano bellota) (Fig. que muestran algunos de los rasgos característicos de los cordados.29. evidencia de su gran capacidad de adaptación. Un corazón situado en la parte ventral y un sistema circulatorio cerrado. 5.

En medio del hocico hay una sola abertura nasal. En general. Casi todos tienen escamas y aletas. Respiran por branquias. Tienen un endoesqueleto que provee protección a los órganos internos. tienen un corazón de dos cámaras. aunque las aletas están modificadas en las diferentes especies. La mayoría de los tiburones son largos y delgados y pueden nadar rápidamente. el esqueleto se compone principalmente de hueso. ni escamas ni dientes verdaderos. peces cartilaginosos. otras son ovovivíparas. La reproducción es sexual.31. peces óseos. 5. son predadores y se alimentan de peces y otros animales marinos. donde son fecundados por los espermatozoides. Las hembras liberan sus huevos al agua. Algunas especies son ovíparas. La mayoría poseen también una vejiga natatoria. aves y mamíferos. reptiles. Las rayas tienen cuerpo aplanado y aletas pectorales anchas en forma de alas. anfibios. que es una estructura llena de gases que ayuda a mantener al pez a flote en el agua. Fig. Branchiostoma CLASE AGNATOS (PECES SIN MANDÍBULA) No tienen aletas pareadas. En los tiburones y las rayas. Fig. Este subfilo se divide en siete clases: peces sin mandíbula. 5.30. 226 .GUÍA METODOLÓGICA DE BIOLOGÍA SUBPHYLUM VERTEBRADOS Estos animales presentan una columna vertebral. Ejemplo de cefalocordado. Ejemplos de hemicordados CLASE CONDROICTIOS (PECES CARTILAGINOSOS) Los tiburones y las mantas (rayas) constituyen esta clase ya que tienen esqueletos de cartílago y no de hueso. los sexos están separados y presentan fecundación interna. CLASE OSTEOICTIOS (PECES ÓSEOS) En los peces óseos.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y completa el siguiente cuadro de doble entrada. Posteriormente en plenaria se presenta para su retroalimentación. CARACTERISTIC AS UNICAS METAMERISMO CEFALIZACION CAPAS GERMINALES ESQUELETO PHYLUM Poriferos Cnidarios Platelmintos Nematodos Anélidos Moluscos Artrópodos Equinodermos Cordados 227 CORDON NERVIOSO CENTRAL SIMETRIA CELOMA CLASES .

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental acerca de la importancia de los organismos del reino Animalia PHYLUM Poriferos IMPORTANCIA ECONÓMICA IMPORTANCIA ECOLÓGICA IMPORTANCIA MÉDICA Cnidarios Platelmintos Nematodos Anélidos Moluscos Artrópodos Equinodermos Cordados Comentario final ___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 228 .

CLASE MAMÍFEROS Un mamífero es un vertebrado que tiene pelo. CLASE REPTILES Estos animales son poiquilotermos. El huevo de los reptiles tiene un cascarón que evita que se seque en la tierra. El corazón de cuatro cámaras de un mamífero es una doble bomba que mantiene la sangre desoxi229 . al menos parte del tiempo y respiran por pulmones. caudados (salamandras) y apodos (cecilias). Los anfibios fueron los primeros vertebrados en adaptarse a la vida terrestre. pulmones bien desarrollados. Sus patas delanteras se han modificado y se han convertido en alas. Los reptiles se clasifican en cuatro ordenes: rincocéfalos (tatuara). la mayor parte de los anfibios jóvenes son acuáticos y respiran por medio de las branquias. Los huevos se fecundan dentro del cuerpo de la hembra. y son homeotermos. pero algunas especies pasan mucho tiempo en el agua. Sus cuerpos están adaptados para satisfacer los requisitos del vuelo: tener poco peso y mucha potencia. huesos finos y huecos. quelonios (tortugas) y escamosos (lagartos y serpientes). CLASE AVES Las aves presentan bocas modificadas en picos. gruesa e impermeable y protege al cuerpo de la desecación en climas muy cálidos y secos. Como adultos. cubiertos con una piel seca y escamosa. Tienen un corazón de 4 cámaras.GUÍA METODOLÓGICA DE BIOLOGÍA CLASE ANFIBIOS Los anfibios son vertebrados que tienen branquias cuando son larvas y pulmones cuando son adultos. Después que salen de los huevos. Este período de inactividad se conoce como hibernación. El vuelo es una de las características más importantes en las aves. Poseen órganos reproductores adaptados a la fecundación interna. Los anfibios se dividen en tres ordenes: anuros (ranas y sapos). los anfibios viven en tierra. La piel de los reptiles es seca. cocodrilos (lagartos). Sus patas traseras sirven de sostén al cuerpo. Están adaptados para la reproducción en tierra. Sus cuerpos están cubiertos con plumas y pueden mantener constante la temperatura de su cuerpo (son homeotermos). Los anfibios son poiquilotermos y permanecen inactivos durante el tiempo frío.

ardilla). perezoso). Realicen el siguiente cuadro de doble entrada que resume las características principales de los seis reinos de seres vivos. insectívoros (topo. equidna). Las glándulas mamarias. tigre. la parte que es el centro de interpretación sensorial y que controla las respuestas musculares. oso). proboscídeos (elefante) y primates (lémures. que se encuentran en las hembras. ACTIVIDAD Trabaja en pareja. tlacuache). secretan leche que sirve como alimento para las crías durante las etapas del crecimiento inicial. Los mamíferos se clasifican en varios ordenes: monotremas (ornitorrinco. gorila). expónganlo en plenaria para compartirlo con todo el grupo. En general los mamíferos son más inteligentes que otros vertebrados. marsupiales (canguro. musaraña). chimpancé. El embrión se desarrolla en el cuerpo de la madre dentro de un órgano muscular llamado útero. Cada mamífero tiene dientes de diferentes tipos para diferentes funciones.GUÍA METODOLÓGICA DE BIOLOGÍA genada separada de la oxigenada. carnívoros (lobo. el cerebro. sirenios (manatí). En el mamífero. roedores (ratón. La mayoría de los mamíferos paren sus crías vivas. quirópteros murciélagos). cetáceos (ballena. rinoceronte). es muy grande. pinnípedos (foca. Una vez concluido. Anota el nombre común con su nombre científico. perisodáctilos (caballo. delfín). 230 . morsa). artiodáctilos (alce. cabra). desdentados (oso hormiguero. ACTIVIDAD Elabora un álbum de los órdenes de la clase Mammalia donde incluyas las características de cada uno con ejemplos e ilustraciones de los miembros que componen cada uno. venado.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental acerca de la importancia de los organismos del phylum Cordados CLASE Agnatos IMPORTANCIA ECONÓMICA IMPORTANCIA ECOLÓGICA IMPORTANCIA MÉDICA Condroictios Osteoictios Anfibios Reptiles Aves Mamíferos Comentario final ___________________________________________________________________________________________ ___________________________________________________________________________________________ ________________________________________________________________________________________ 231 .

y el nivel mínimo que compete a la ecología es el de organismo. El término Ecología fue propuesto por el biólogo alemán Ernst Haeckel en 1869. es la parte de la Biología que estudia las interrelaciones de los organismos entre sí y con su medio. el término biosfera o ecósfera se aplica al sistema biológico amplio. un cardumen de atunes es un ejemplo de población. Por ejemplo: un tiburón. una hormiga. ACTIVIDAD Dibuja un diagrama en que se ilustre la relación que hay entre la Ecología y las materias que integran tu plan de estudios. los fenómenos y procesos estudiados por los ecólogos han sido observados y estudiados desde hace varios siglos.GUÍA METODOLÓGICA DE BIOLOGÍA 5. Así. Los organismos no viven aislados. un conjunto de ecosistemas forma un bioma caracterizado por un tipo vegetal determinado o cualquier otro aspecto del paisaje. proveniente del griego oikos (casa) y logos (tratado). constituye la unidad básica de la ecología y es un complejo formado por una serie de factores fisicoquímicos y los seres vivos que interactúan constantemente ocupando un área determinada. ¿CÓMO SE RELACIONA LA BIODIVERSIDAD CON EL MEDIO AMBIENTE? La Ecología es una ciencia del siglo XX que nació como una respuesta al progresivo y acelerado proceso de deterioro y desequilibrio medio ambiental que padece la biosfera de nuestro planeta. La comunidad es el conjunto de poblaciones vegetales y animales de diferentes especies que interactúan en un hábitat al mismo tiempo. pero muchos de los conceptos de Ecología son anteriores al término en un siglo o más.4. que abarca a todos los organismos vivos del planeta y sus interacciones con el medio físico. El ecosistema. Si bien la Ecología. un alga. como ciencia tiene apenas poco más de un siglo de vida. Al estudiar las relaciones entre los organismos y el ambiente en que viven. cuando habitan al mismo tiempo en un mismo lugar forman una población. Cada nivel tiene conceptos y atributos particulares. Un individuo es un solo organismo de una especie determinada. Por último. 232 . utilizando diferentes niveles de organización o integración. prácticamente autosuficiente. un junco. la Ecología sistematiza el conocimiento que genera.

es decir. año y su aportación. adaptaciones anatómicas. camuflaje.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Elabora un collage con distintos recortes donde señales los niveles de organización de la naturaleza que estudia la Ecología (organismo. comunidad. si se le considera en relación con otros individuos de igual o diferente especie. Hay tres tipos de adaptaciones al ambiente: • Morfológicas o estructurales. químico y biológico que le rodea. población. bioma. ADAPTACIONES AL AMBIENTE Para entender qué es una adaptación biológica. Sin embargo. donde señalen nombre del científico. agresivas. ecosistema. debe tenerse claro. Por ejemplo. el individuo es afectado por componentes que no tienen origen vital. mimetismo. ¿CUÁLES SON LOS FACTORES DE LOS ECOSISTEMAS? En forma aislada. que van heredándose de una generación a otra para incrementar sus expectativas de sobrevivencia al medio físico. 233 . sonidos o colores de animales más peligrosos. los factores abióticos de su ambiente. se observa que es afectado por diferentes factores bióticos. biosfera) ACTIVIDAD Investiga junto con otro compañero el desarrollo histórico de la “Ecología” y preséntenlo en la línea de tiempo trabajada anteriormente. que solo los seres vivos pueden desarrollarla a través de procesos evolutivos de selección natural. Cambios externos que permiten que un organismo se confunda con el medio o imite formas.

Por ejemplo. 1. Son cambios de conducta de los organismos que permiten ajustarse a su ambiente o trasladarse periódicamente a otro. ¿Cómo se relacionan los factores bióticos y abióticos? _______________________________________________________________________________ _______________________________________________________________________________ 2. diapausa. que comparten cierto tipo de alimentos y que. hibernación. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ ______________________________________________________________________________ POBLACIÓN La población es el conjunto de individuos de la misma especie que habitan en un área determinada. ¿Qué impacto ocasiona el desequilibrio de alguno de los factores en el ambiente? Plantea un ejemplo. al reproducirse. conductas. intercambian información genética. ACTIVIDAD Realiza una investigación documental de los factores abióticos y bióticos y a partir de lo investigado elabora en tu libreta un mapa conceptual de los factores que constituyen a los ecosistemas. estivación. poiquilotermia y homeotermia. Por ejemplo. • Conductuales. migración. cuando las condiciones ambientales son desfavorables. invernación. 234 .GUÍA METODOLÓGICA DE BIOLOGÍA • Fisiológicas o funcionales son aquellas que guardan relación con el metabolismo y funcionamiento interno de diferentes órganos o partes del individuo.

al parecer sin inconveniente? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ¿Qué tipo de adaptación han desarrollado los osos polares. distribución de edades. y a qué tipo de adaptación corresponde? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ACTIVIDAD Haz una investigación sobre las características dinámicas de la población: densidad. fisiológicas y conductuales) y escribe dos ejemplos de cada una ¿Por qué la ballena. hasta de 800 metros. curva de sobrevivencia. y por qué? ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ______________________________________________________________________________________ ¿Por qué muchas aves nidifican entre las rocas. potencial biótico.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los tipos de adaptaciones al ambiente (morfológicas. tasa de crecimiento. proporción de sexos. tasa de mortalidad. distribución espacial. migración 235 . puede estar expuesta a grandes diferencias de presión. tasa de natalidad.

la mortalidad y las migraciones a partir del año 2002. las relaciones que se establecen entre la natalidad. _______________________________________________________________________________ _______________________________________________________________________________ ¿Qué le podría ocurrir a la población B en el transcurso de los próximos años? _______________________________________________________________________________ _______________________________________________________________________________ Explica en la población A. En cuál de las poblaciones de la gráfica se evidencia el potencial biótico? ¿Por qué? _______________________________________________________________________________ Menciona dos causas que determinaron en ambas poblaciones la reducción del número de organismos.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD La gráfica siguiente representa las curvas de crecimiento de dos poblaciones: A y B. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ 236 .

237 . incrementa la acción de la resistencia ambiental. Describe la gráfica y específica en qué casos ocurre una curva convexa. “La incidencia de los factores limitantes del medio ambiente sobre la población. _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _______________________________________________________________________________ _____________________________ ACTIVIDAD – CURVA DE SOBREVIVENCIA La siguiente gráfica representa la curva de sobrevivencia de las poblaciones.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Explica y ejemplifica el siguiente planteamiento. una curva cóncava y una línea recta.

Sitúa en la gráfica el límite máximo ambiental. Explica el comportamiento de esta población de gaviotas del año 2000 al 2005. ___________________________________________________________________________________ ___________________________________________________________________________________ _____________________________________________________________________________ 3. 1. si se vierten en los mismos desechos tóxicos industriales. Argumenta 3 medidas que pueda aplicar el hombre para proteger el equilibrio de los ecosistemas costeros. ___________________________________________________________________________________ ___________________________________________________________________________________ ___________________________________________________________________________________ 238 . Explica que le sucederá a los ecosistemas de las zonas costeras de Cuba. ___________________________________________________________________________________ ___________________________________________________________________________________ __________________________________________________________________________ 2.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD La siguiente gráfica representa el comportamiento de una población de gaviotas en una zona costera de Cuba.

ocupan sucesivamente nichos diferentes. que se alimenta de plantas. El nicho ecológico no es un espacio demarcado físicamente. Para describir el nicho ecológico de un organismo es preciso saber qué come y qué lo come a él. Depende de las adaptaciones estructurales del organismo. mientras que las tortugas adultas son consumidores primarios y se alimentan de plantas verdes como apio acuático. Algunos organismos. En un hábitat particular pueden vivir varios animales o plantas. fisiológicos y bióticos que necesita un organismo para vivir.GUÍA METODOLÓGICA DE BIOLOGÍA HÁBITAT Y NICHO ECOLÓGICO El hábitat de un organismo es el lugar donde vive. Puede ser útil considerar al hábitat como la dirección de un organismo (donde vive) y al nicho ecológico como su profesión (lo que hace biológicamente). pero siempre es una región bien delimitada físicamente. aire. cuáles son sus límites de movimiento y sus efectos sobre otros organismos y sobre partes no vivientes del ambiente. gusanos e insectos. suelo y agua. o las grandes zonas continentales. Ilústralo con imágenes. pero la rana adulta es un consumidor secundario y digiere insectos y otros animales. ACTIVIDAD Busca tres ejemplos de especies donde describas su hábitat y nicho ecológico. comen caracoles. 239 . los animales con distintas fases en su ciclo vital. y limitado por ejemplo la parte inferior de un leño podrido. tortugas jóvenes de río son consumidores secundarios. el nicho ecológico es el estado o el papel de un organismo en el ecosistema. En contraste. En cambio. de sus respuestas fisiológicas y su conducta. Puede ser vastísimo. químicos. Una sola especie puede ocupar diferentes nichos en distintas regiones. por ejemplo. su área física. en función de factores como el alimento disponible y el número de competidores. Una de las generalizaciones importantes de la ecología es que dos especies no pueden ocupar el mismo nicho ecológico. sino una abstracción que comprende todos los factores físicos. o muy pequeño. Un renacuajo es un consumidor primario. como el océano. alguna parte específica de la superficie de la tierra.

Fig. terremotos y la depredación. Por ejemplo: alimento. 240 .32 Potencial biótico y resistencia ambiental Los factores denso-dependientes o intrínsecos son los que afectan y surgen dentro de la mima población. rapacidad. competencia interespecífica.GUÍA METODOLÓGICA DE BIOLOGÍA POTENCIAL BIÓTICO Y RESISTENCIA AMBIENTAL Cuando el índice de crecimiento en condiciones favorables es máximo (potencial biótico) las poblaciones tienen la capacidad máxima de aumentar el número de individuos. etc. Los factores denso-independientes o extrínsecos son los que afectan a la población y provienen del exterior. El balance de los ecosistemas surge del balance interno que existe entre el potencial biótico de cada especie con la resistencia ambiental del hábitat.32). En cambio. la resistencia ambiental es la suma de factores denso-dependientes y denso-independientes que contribuyen a disminuir el nacimiento y sobrevivencia de los organismos de una población (Fig. lucha por recursos limitados. 5. Por ejemplo: factores climáticos. 5. competencia intraespecífica. el fuego. enfermedades.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Grafica cómo sería la resistencia ambiental de la cucaracha y del oso panda. Explica el por qué de cada caso Cucaracha Oso panda Expón la importancia de la curva de sobrevivencia para una compañía de seguros de vida 241 .

GUÍA METODOLÓGICA DE BIOLOGÍA RELACIONES ENTRE POBLACIONES Entre los individuos de una comunidad se establecen múltiples y diversas interacciones. describe un ejemplo e ilústralo en cada caso. A su vez.RELACIONES INTRAESPECÍFICAS Investiga en que consiste cada una de las relaciones intraespecíficas. La relación que se establece entre los individuos de una misma especie y una misma población. se denomina intraespecífica. Asociación familiar: Asociación gregaria: Asociación colonial: Asociación estatal: 242 . la relación entre organismos de diferentes especies dentro de la comunidad se denomina interespecífica ACTIVIDAD .

CONCEPTO DE COMUNIDAD Comunidad es el conjunto de poblaciones de animales y plantas que ocupan un área determinada con interdependencia mutua entre los individuos que la constituyen.RELACIONES INTERESPECÍFICAS Considerando la tabla de abajo rellena los espacios vacios con los simbolos +.ó 0 de las especies A y B de acuerdo a la descripción de la interacción. Las comunidades pueden clasificarse por el tamaño y forma de vida de los organismos en: 243 . manteniendo un cierto equilibrio dinámico. . La variedad de poblaciones que conforman una comunidad determina su diversidad.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD . Realiza una investigación donde documentes un ejemplo de cada una de las relaciones interespecíficas. así como las relaciones de dominancia y cobertura.

Por ejemplo. En ecología vegetal es el conjunto de plantas pertenecientes a un límite de altura dado. Comunidad menor. Cuando una especie destaca por su biomasa y abundancia y es la que controla el flujo de energía dentro de la comunidad. selva.34. se han hecho una serie de divisiones en capas de las comunidades que integran al ecosistema. 5.33. taiga.GUÍA METODOLÓGICA DE BIOLOGÍA Comunidad mayor. el pino (Pinus sp) es la especie dominante del bosque de coníferas.5. Por ejemplo. desierto.34) Fig.). distinguiéndose cuatro estratos: arbóreo. arbustivo. por lo que depende de las comunidades contiguas. el acahual (zonas de crecimiento secundario en las selvas) y malpaís (zona de crecimiento sobre suelos volcánicos). Estratificación de las comunidades Con objeto de facilitar el estudio de la distribución de los organismos. Biomas o grandes conjuntos de organismos que habitan una amplia zona geográfica (tundra. subarbustivo y rasante o mucinal (Fig. 5. Ecotono entre un bosque caducifolio y un bosque de coníferas Fig. etc. Estratificación en un bosque 244 . denominadas estratos. Comunidad dominante. Se determinan en relación con su extensión.

anual o mensual). media. • Barreras climáticas. Un ecotono suele contener a organismos de cada una de las comunidades y además organismos característicos de la comunidad ecotonal. Distribución de las comunidades. como la temperatura (media. la forma en que se reparten los recursos. es decir.34).GUÍA METODOLÓGICA DE BIOLOGÍA La composición de una comunidad se refiere a la enumeración de elementos que la conforman. La tendencia hacia una diversidad y densidad aumentada en las uniones de las comunidades se denomina efecto de borde. • Barreras biológicas. Entre éstas se hallan: • Barreras físicas. como la tierra para los animales acuáticos y el agua para muchos de los animales terrestres o la variación de las características del suelo y del agua. hacer una lista de las especies que integran la comunidad. Los factores externos que limitan la distribución de las comunidades se denominan barreras. a más individuos más densidad. enemigos. Estas barreras de transición entre dos o más comunidades diversas se denominan ecotonos (5. enfermedades. 245 . etc. como la ausencia de alimento apropiado o la presencia de competidores eficaces. pero en todo caso es más angosta que las áreas de las comunidades adyacentes. es decir. La estructura se relaciona además con el comportamiento de algunos de estos elementos. etc. la humedad (relativa. No sólo es la descripción del arreglo espacial en el plano vertical y horizontal de la comunidad sino también conocer las relaciones numéricas entre los organismos. El término densidad no debe confundirse con diversidad que es el número de poblaciones de especies distintas que conforman una comunidad. por lo que es muy rico en diversidad y que caracterizan a un lugar determinado. estacional o extrema). Densidad y diversidad en las comunidades Se entiende por densidad al número de individuos de una misma especie que conforman una población en un área determinada. Las comunidades vegetales dominantes en su estado de clímax tienen una fisonomía distinta a la de otras comunidades de plantas. las cuales a su vez determinan el tipo de comunidades de animales. que es una zona de unión que puede ser escasa o de una extensión lineal considerable.

dependiendo de la magnitud de la perturbación que da inicio: primaria y secundaria.36). 5. cuando los líquenes o musgos se establecieron (Fig. Las características de este espacio ya son distintas de las que prevalecían al comienzo de la colonización. SUCESIÓN ECOLÓGICA La sucesión ecológica es el proceso gradual que implica un reemplazamiento de individuos o de comunidades enteras. pero no siempre ocurren estos casos. En la sucesión de comunidades primero se dan pequeños cambios llamados microsucesiones que progresivamente conforman la sucesión principal. deshielos. por ejemplo. Las sucesiones se dan por cambios en los factores abióticos (humedad. por esto las sucesiones están relacionadas con la evolución de las especies. 5. a este proceso se le denomina sucesión secundaria y es el que constantemente se desarrolla en todas las comunidades naturales. por el cual la composición de especies de una comunidad se modifica como consecuencia de perturbaciones o cambios drásticos. los líquenes y musgos. Se denomina sucesión primaria a aquella que ocurre cuando la colonización empieza sin influencia de la comunidad anterior.) o por la llegada o introducción de organismos foráneos u oportunistas que originan una serie de competencias con las especies autóctonas y en la que se impone la más adaptada.GUÍA METODOLÓGICA DE BIOLOGÍA Las poblaciones en las comunidades son poco diversas cuando están sujetas a factores fisicoquímicos fuertemente limitativos pero la densidad aumenta si una población se ha adaptado a estos factores y las otras no como en el caso de la Artemia sp que es abundante en las salinas. 246 . su biomasa servirá de sustrato a otras que sobrevivirán en el espacio que las pioneras dejaron. A las especies que ocupan las primeras etapas de la sucesión se les denomina pioneras. etc. se adhieren a la roca volcánica y obtienen sus nutrientes disueltos en el agua de lluvia que retienen mediante estructuras de absorción. Por ejemplo. Si la perturbación no es tan drástica. Se reconocen dos tipos de sucesión. Posteriormente. movimientos orogénicos.35). como producto de la muerte de los organismos (Fig. algunos organismos o sus propágulos seguirán en el sitio y tendrán influencia durante la colonización. temperatura. cuando especies mueren. cuando un volcán hace erupción y no quedan elementos de la comunidad previa.

ilústralo. A medida que la sucesión avanza. cercana al clímax.35. 5. Fig. la composición permanece también estable. para alcanzar un máximo en una etapa intermedia. aun en aquellas comunidades aparentemente estables. en pequeña o mediana escala.5. La diversidad de especies también aumenta durante las primeras etapas sucesionales.36. suceden muertes y reemplazamientos de especies. En términos prácticos. ¿Qué tipo de sucesión ocurriría en una franja vacía en un bosque nacional y por qué? Fig. podemos referirnos a esta etapa como aquella en que la comunidad se reemplaza con las mismas especies y.GUÍA METODOLÓGICA DE BIOLOGÍA A la etapa terminal de la sucesión se le denomina clímax. La colmatación de lagos es un ejemplo de sucesión ecológica primaria ACTIVIDAD Investiga un ejemplo de sucesión ecológica primaria y otro de sucesión secundaria. Sin embargo. por tanto. en todas las comunidades. las relaciones tróficas se vuelven más complicadas. El metabolismo o funcionamiento de las comunidades cambia a lo largo de la sucesión. que desencadenan procesos sucesionales. Sucesión ecológica secundaria 247 .

000 mm anuales. Los mecanismos de control. por un lado.5 ¿CUÁL ES LA DINÁMICA DE LOS ECOSISTEMAS? Los ecosistemas se autoconservan y se autorregulan. Por ejemplo. desarrollándose diferentes ciclos de materiales y múltiples transferencias de energía. en pleno mar de las Antillas. pues se recolectaban miles de huevos semanalmente para venderlos. Durante siglos enteros esa zona. Ya una crónica holandesa del año 1592 citaba la región de Tortuguero como zona tradicional de desove de las tortugas marinas. especie de acacia. Bosques de menor altura se localizan en el borde de las áreas pantanosas y en las márgenes de los cursos de agua. son los que regulan el almacenamiento y la liberación de elementos nutritivos. En los suelos pantanosos se encuentra el cativo. en las playas hay numerosos cocoteros y palmeras que crecen prácticamente al borde del mar. Para poder visitar el parque hay que hacerlo navegando en barca por los cientos de canales y lagunas pantanosas que lo forman. Su extensión abarca 21. debido a su aislamiento. la producción y descomposición de sustancias orgánicas. los hombres de ciencia han comprobado que es notable el incremento de la población de tortugas de diferentes especies que van a desovar en esas playas. y por el otro. el pumpunjoche y el guácimo blanco. ACTIVIDAD PARQUE NACIONAL TORTUGUERO Lee detendamente la siguiente lectura El Parque Nacional Tortuguero está situado en la región noreste de Costa Rica. Sólo en su parte occidental están los cerros de Sierpe.GUÍA METODOLÓGICA DE BIOLOGÍA 5. Sólo desde el aire se puede uno dar idea del conjunto de esta inmensa selva lluviosa tropical. que alcanzan 300 metros de altitud. La creación del área como parque nacional puso fin a todos los desmanes. que llega a alcanzar 60 metros de alto. gavilanes y cedros machos. conservó prácticamente inalterados todos sus valores naturales. En ellos crecen árboles como el sangrillo. donde las preci-pitaciones pluviales oscilan entre los 3. En los años cincuenta de este siglo fue cuando se dejó sentir la presión humana con más fuerza. en los últimos años. En Tortuguero se localizan diferentes tipos de vegetación. y ya. en la desembocadura del río Tortuguero. una de las zonas más lluviosas del país. 248 . Tortuguero constituye una inmensa llanura empantanada.000 hectáreas de tierra firme. así como las aguas territoriales costarricenses frente a ellas.000 y los 5. A su lado proliferan nísperos.

Esta migración de la tortuga verde se debe a que Costa Rica no tiene praderas submarinas donde las tortugas encuentran la base de su alimentación. La tortuga de carey es una de las más pequeñas de la especie marina. Aunque toda esta rica y variada fauna es importante. uno de los mamíferos más amenazados de extinción. lo que destaca en Tortuguero es la zona de de-sove de las tortugas marinas. En la parte occidental de Tortuguero. gavilanes. Numerosos caimanes viven en la orilla de los canales y aves de los más vistosos colores y variados tamaños anidan en ese espléndido lugar. garcillas. en zonas no pantanosas. pelícanos. que además se ¡unta en grandes grupos para reproducirse. A diferencia de la tortuga verde. que cubre el caparazón del animal. se localizan los bosques de cedro macho y de gavilán. miles de tortugas se concentran para desovar en una sección comprendida entre la boca del río Tortuguero y la desembocadura del Parismina. se alimenta fundamentalmente de grandes cantidades de plantas acuáticas flotantes. entre las que destacan tucanes. de movimientos lentos. de agosto a noviembre. La tortuga verde realiza la puesta cada dos o tres años y en cada ocasión desova cuatro o cinco veces. de unos dos metros de longitud. Jamaica. la danta o tapir. Otra especie muy interesante es el gaspar. Entre los tesoros zoológicos que albergan estas veintiún mil hectáreas protegidas destaca el manatí. Este inofensivo animal. Cada año. La especie se aparea en julio y agosto en dos bancos de fondo rocoso. cuyos antepasados vivieron hace más de 90 millones de años. máximo depredador del parque. considerado auténtico fósil viviente. de bellísimo color pardo oscuro. 249 . utilizado en joyería. Cuba y Florida. Se le persigue para obtener de ella el carey.GUÍA METODOLÓGICA DE BIOLOGÍA Los bosques de palmas o yolillales ocupan grandes extensiones y se dan en suelos que están inundados la mayor parte del año. un pez de agua dulce. el oso hormiguero gigante y el manigordo. así como monos de diversas especies. sustancia traslúcida. guacamayos. La más abundante de todas es la verde. frente a la desembocadura de Tortuguero. Se han realizado estudios sobre la migración de las especies que visitan Tortuguero y se ha comprobado que se distribuyen por todo el Caribe Occidental. la de carey no anida en forma masiva en Tortuguero. halcones. desde la parte oriental de Venezuela hasta Yucatán. Los bosques de Tortuguero están recorridos por el ¡aguar. oropéndolas y colibríes. pájaros fragata. zopilotes. Tres especies abandonan el mar para desovar en sus playas: la tortuga verde. acompañados de guacimos y tabacones. Actualmente se han identificado unas 350 especies. la de carey y la caguama o caballera.

¿Cuál es la especie dominante de tortugas en la región citada en el texto? 9. cangrejos y estrellas de mar. 3. ¿Para qué se persigue a la tortuga de carey? 10. Transcribe el nombre de una barrera geográfica que se cita en el texto. y cuáles los de una menor? 250 . Su presencia en las playas de Tortuguero es esporádica y no se puede considerar como habitual. ¿Cuál es el mayor depredador de tortugas? 6. ¿Qué fenómeno biológico destaca en Tortuguero? 8. Una vez leído el texto.GUÍA METODOLÓGICA DE BIOLOGÍA La tortuga caballera se caracteriza por el tamaño grande de su cabeza y porque se alimenta principalmente de erizos. El desove de las tortugas constituye uno de los fenómenos biológicos más interesantes que se pueden observar en Tortuguero. ¿Cuál es el área que ocupa la comunidad de los individuos referidos en el texto? 2. 7. 5. ¿Cuáles serían los integrantes de una comunidad mayor en Tortuguero. ¿Cuál es el mamífero amenazado en Tortuguero? 4. contesta las siguientes preguntas: 1. Transcribe el nombre de una población en Tortuguero. Transcribe el nombre de cinco especies de la comunidad que se alberga en los bosques de Tortuguero.

Así. ocuparía un tercer nivel. por lo que se dispone de mayor cantidad de energía en cada paso. hasta llegar a los desintegradores que cerrarán el ciclo.37). Fig. durante la transferencia de masa y energía hay una enorme pérdida de energía que se libera en forma de calor. un jaguar por el contrario. considerando que se tarta de un herbívoro. Por ejemplo. ocuparían un cuarto nivel. en ella se indica quién se come a quién (Fig. se dice que se localizan en el mismo nivel trófico. 5. los vegetales ocupan el primer nivel trófico. que es menor si la cadena es más corta.37.5. los organismos pueden ser productores o consumidores. mientras que una oveja ocuparía el segundo nivel trófico. En este flujo de energía. Flujo de materia y energía en el ecosistema 251 .39). 5.GUÍA METODOLÓGICA DE BIOLOGÍA CADENA ALIMENTICIA La cadena alimenticia es la serie de transformaciones que sufren la energía y la materia al pasar a través de los organismos que integran una comunidad. como los buitres. los organismos que se alimentan de carnívoros. el cual se denomina nivel trófico. En una cadena alimenticia (Fig. puesto que se alimenta de carne. Cuando los organismos comparten la misma fuente de energía. cada eslabón de una cadena alimenticia representa un nivel diferente de alimentación.

Las algas y las cianobacterias también son productores fotosintetizadores. Estas bacterias toman la energía de productos químicos provenientes del interior de la Tierra y con ella producen azúcares. por medio de la fotosíntesis.2. la energía solar para convertir el CO2 en glucosa (u otro azúcar). 5. Otros productores son las bacterias quimiosintéticas que viven en las profundidades oceánicas. Niveles tróficos 252 . como las plantas. Tipos de consumidores Fig. Los ejemplos más destacados son las plantas. Los consumidores o heterótrofos obtienen su energía de los enlaces de carbono originados por los productores. Es posible distinguir cuatro tipos de heterótrofos basándose en lo que comen: CONSUMIDOR herbívoros carnívoros omnívoros detritívoros NIVEL TRÓFICO primario secundario o superio todos los niveles --------------- FUENTE ALIMENTICIA plantas animales plantas y animales detrito Tabla 5.38. que usan.GUÍA METODOLÓGICA DE BIOLOGÍA Los productores o autótrofos convierten la energía ambiental en enlaces de carbono. como en la glucosa.

por ejemplo. Igualmente. menos biomasa contendrá. Aún cuando muchos organismos tienen dietas muy especializadas (como es el caso de los osos hormigueros). los saltamontes comen hierbas. como se muestra en la Figura 5. Cadena alimenticia REDES ALIMENTICIAS El mundo real es mucho más complicado que una simple cadena alimenticia.38). y la única manera de desenredar las cadenas es seguir el curso de una cadena hacia atrás hasta llegar a la fuente. etc. 5. 253 . Las ranas y sapos. mientras más alejado esté un nivel trófico de su fuente (detrito o productor). Los omnívoros comen tanto animales como plantas. Un principio general es que.40. los carnívoros (excepto algunos muy especializados) no limitan su dieta sólo a organismos de un nivel trófico. Una representación más realista de quien come a quien se llama red alimenticia.GUÍA METODOLÓGICA DE BIOLOGÍA Es importante observar que muchos animales no tienen dietas especializa das. Los gavilanes no limitan sus dietas a lagartijas.39. si es del tamaño adecuado y se encuentra a una distancia apropiada. no discriminan entre insectos herbívoros y carnívoros. Podemos ver que una red alimenticia consiste de cadenas alimenticias interrelacionadas. la rana lo capturará para comérselo sin que importe el nivel trófico (Fig. Fig. 5. en la mayoría no sucede así. Un concepto muy importante es el de biomasa. las lagartijas comen otras cosas aparte de saltamontes. PIRÁMIDES ALIMENTICIAS Mediante las cadenas alimenticias se va constituyendo la biomasa que es la estructura viva de un ecosistema y que se expresa en peso y calorías.

Por ejemplo. un árbol individual puede ser muy grande. algunos animales pequeños se alimentan de los frutos de árboles. La biomasa tiende a disminuir conforme se avanza en la cadena alimenticia. 5. de hecho.40 Red alimenticia La estructura trófica de un ecosistema se representa gráficamente mediante una pirámide. quizás. En términos de peso combinado. hay más individuos de animales que de árboles. mientras que un animal individual (en el caso que estamos analizando) puede pesar. un kilo. los árboles de un bosque superan a los animales pero. 254 . debido a que el número de autótrofos es mayor al de consumidores (Fig. ahora bien. 5. No es confiable el número de organismos en este caso debido a la gran variación en la biomasa de organismos individuales. Esta reducción en la biomasa se debe a varias razones: • No todos los organismos en los niveles inferiores son comidos • No todo lo que es comido es digerido • Siempre se pierde energía en forma de calor Es importante recordar que es más fácil detectar la disminución en el número si lo vemos en términos de biomasa.44).GUÍA METODOLÓGICA DE BIOLOGÍA Fig. con un peso de cientos de kilos.

Pirámide de número de individuos Fig.5.GUÍA METODOLÓGICA DE BIOLOGÍA Hay tres tipos de pirámides alimenticias: por número de individuos (Fig. que es usada por el organismo o perdida en forma de calor 255 . Pirámide de biomasa Fig.42.5. Pirámide trófica FLUJO DE ENERGÍA A TRAVÉS DEL ECOSISTEMA La energía "fluye" a través del ecosistema como enlaces carbono-carbono.44.41) y de energía (Fig. Pirámide de energía Fig.43) Fig. 5. 5. Cuando ocurre la respiración. 5.5.42). de biomasa (Fig. estos enlaces se rompen y el carbono se combina con el oxígeno para formar CO2 y se libera energía. 5.41.43.

¿Quiénes están en la base de la red alimenticia?_________________________________ 2.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Elabora una red alimenticia utilizando dibujos. recortes o estampas de 12 organismos. todos los herbívoros murieran por una epidemia ¿Qué pasará con los vegetales? ____________________________________________________________________________ 3. ¿Qué pasará con los animales carnívoros? __________________________________________________________________________ 4. Si en un ecosistema. Recuerda la posición de cada uno de acuerdo al nivel trófico al que pertenece y traza la dirección de la flecha hacia quién es comido. 1. ¿Qué pasaría en la atmósfera si no existieran organismos productores? ___________________________________________________________________________ 256 .

• La energía y nutrientes pasan de un organismo a otro a través de la cadena alimenticia a medida que un organismo se come a otro. La energía no se recicla en los ecosistemas.6 ¿CÓMO SE EQUILIBRAN CICLOS BIOGEOQUÍMICOS? La materia se compone de distintos elementos químicos. • Los nutrientes inorgánicos son reciclados pero la energía no 5. y su destino final es perderse en forma de calor. el primero está compuesto por materiales abundantes de escaso dinamismo y de orden inerte (sin vida). En esta etapa. • El destino final de la energía en los ecosistemas es perderse como calor. algunos de ellos indispensables para los seres vivos porque constituyen parte del citoplasma. uno mayor y el otro menor. más velozmente entre los seres vivos y su medio. Los autótrofos obtienen estos nutrientes inorgánicos del suelo o el agua que rodea la planta. el cual es mucho más activo y se desplaza. En la biosfera esos elementos circulan a lo largo de trayectorias mayores y menores. todos los organismos mueren y se convierten en detrito. el nitrógeno de los aminoácidos (las unidades de las proteínas). • Los descomponedores extraen la energía mantenida en los restos de los organismos. Los nutrientes inorgánicos son reciclados.GUÍA METODOLÓGICA DE BIOLOGÍA Toda la energía proviene del sol. En resumen. la energía no. Estos son pasados de organismo a organismo cuando uno es consumido por otro. Algunos de estos nutrientes inorgánicos son el fósforo de dientes. Los nutrientes inorgánicos no contienen uniones carbono-carbono. 257 . alimento para los descomponedores. Al final. la energía restante es extraída (y perdida como calor) y los nutrientes inorgánicos son devueltos al suelo o agua para ser utilizados de nuevo. en el flujo de materia y energía se puede generalizar que: • La fuente primaria de energía (en la mayoría de los ecosistemas) es el sol. por tanto. conocidas como ciclos biogeoquímicos. esta fracción se llama pozo de intercambio. huesos y membranas celulares. y el hierro en la sangre. mientras que el segundo se compone por una menor cantidad de materiales. Los componentes de cada ciclo se conocen como pozos.

5. Al morir el animal.45). 258 . porque antes de aprovecharlo es necesario transformarlo en nitratos solubles. una buena proporción de los cuerpos de los seres vivos está constituida por agua (70% en humanos) y dos terceras partes de la superficie terrestre están cubiertas por este líquido. etc. por su localización. CICLO DEL AGUA El agua es un compuesto esencial para la vida en nuestro planeta. que son la estructura primaria de las proteínas (Fig. actúan las bacterias putrificantes que producen amoniaco. los ciclos biogeoquímicos se clasifican en gaseosos (ciclos del agua. Desde el punto de vista ecológico. si son del tipo desnitrificante. nitrógeno y carbono) y sedimentarios (ciclos del azufre y fósforo) CICLO DEL NITRÓGENO El nitrógeno constituye el 78% del aire.GUÍA METODOLÓGICA DE BIOLOGÍA Los ciclos se clasifican bajo diferentes puntos de vista: por su función. 5. los seres vivos no usan el nitrógeno en forma gaseosa. De esta manera. o nitratos si actúan las nitritobacterias. sobre los cuales actúan las nitritobacterias o bacterias putrificantes para producir nitratos o nitrógeno molecular con los que. el agua es una molécula de gran estabilidad que permite que muchas sustancias químicas se disuelvan en ella y se vuelvan accesibles para los seres vivos (Fig. los nitratos pasan al suelo y están disponibles para que los absorban las plantas a través de su raíz. Las plantas convierten los nitratos en aminoácidos. amoniaco o ácido úrico. Esta transformación la realizan bacterias fijadoras de nitrógeno en las raíces de leguminosas. a pesar de esta gran abundancia. se reinicia el ciclo. se descompone en compuestos de amonio que son atacados por otras bacterias que producen nitrógeno atmosférico (N2). Gracias a sus características fisicoquímicas. Las proteínas vegetales pueden seguir uno de dos caminos: • Transformarse en proteínas animales que se convierten en urea. por el estado físico de los materiales.46). finalmente. • Cuando muere la planta.

Los animales dependen del agua presente en los tejidos pulmonares para realizar el intercambio gaseoso y tomar el vital oxígeno del aire. ya sea como vapor de agua disperso o en forma de nubes. o bien en mantos acuíferos subterráneos. ríos y lagunas.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Las plantas extraen el agua del subsuelo. Parte de los acuíferos corren como ríos subterráneos. En forma gaseosa se encuentra en la atmósfera. pasando del estado líquido al de vapor. como mares. la utilizan y la regresan a la atmósfera en forma de vapor de agua por medio de la transpiración de sus hojas. Ciclo del nitrógeno Las plantas toman a través de sus raíces los nutrientes del suelo disueltos en agua. El agua se encuentra almacenada en forma sólida en las enormes masas de hielo polar. Ahí se condensa y regresa a la superficie en forma de lluvia. 5. El movimiento del agua descrito por el ciclo hidrológico se realiza mediante procesos físicos. desembocando nuevamente en cuerpos de agua exteriores. El agua se evapora de todas las superficies donde se encuentra. nieve o granizo y se vuelve a almacenar en los cuerpos de agua. en su forma líquida. moviéndose por la atmósfera.45. Buena parte del agua de lluvia se permea a través del suelo hasta llegar a los mantos freáticos. incluidos los glaciares. 259 . donde se almacena. en todos los cuerpos de agua.

forma parte de los aminoácidos. el 80% restante recarga el suelo y los mantos freáticos. Además. la compactación del suelo y la tala de los bosques han disminuido la cantidad de agua que se infiltra en el subsuelo y aumentado la que regresa a los océanos. porque a pesar de ser un elemento menor sus estados de oxidación le permiten combinarse con muy variados cationes bajo condiciones fisicoquímicas contrastantes (Fig. la extracción del agua subterránea por medio de pozos para la irrigación ha alterado también estas proporciones. 260 . este elemento desempeña un importante papel en el metabolismo de plantas y animales. CICLO DEL AZUFRE El ciclo del azufre es de particular interés. Ciclo del agua Se estima que el 20% de la lluvia anual se deposita en los océanos. 5.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Por otro lado.46. la pavimentación.47). Pero estas proporciones se han visto seriamente alteradas por la actividad humana. cistina y cisteína. ya que la creación de presas. 5.

pero la combustión de petróleo (o sus derivados) y del carbón incrementan su concentración. • Sulfatos (combinado con múltiples cationes) comunes en depósitos sedimentarios en fondos lacustres y marinos por descomposición incompleta de la materia orgánica. en contraste. denominadas "desulfovibriones". En el proceso de la producción primaria se incorpora el azufre en forman sulfatos y.GUÍA METODOLÓGICA DE BIOLOGÍA En la corteza terrestre. Presentes en las rocas ígneas. 261 . 5. Ciclo del azufre Este ciclo y el del nitrógeno se afectan cada vez más debido a la contaminación atmosférica porque los óxidos de nitrógeno y de azufre circulan rápidamente y en poca concentración. está relacionado con emanaciones de carácter volcánico y es producido por la oxidación incompleta del ión sulfuro.47. También participa en la reducción bacteriana de los sulfatos. gaseosa y sólida de la superficie terrestre. Este elemento se caracteriza porque implica las fases líquida. el azufre se puede encontrar en distintas combinaciones: • Sulfuros. Fig. la excreción de los animales aporta sulfatos al ciclo. • Estado nativo: se presenta en forma de moléculas unidas. reducen los sulfatos (SO4 → H2S) y otras más oxidan los sulfuros (tiobacilos). Algunas bacterias transforman: H2S → S → SO4 y otras.

5. grasas y proteínas. Ciclo del carbono (dióxido de carbono) CICLO DEL CARBONO (DEL DIÓXIDO DE CARBONO) El metabolismo de los seres vivos requiere de muchos compuestos para su desarrollo y contienen un importante elemento: el carbono. • Al morir plantas y animales se descomponen las sustancias orgánicas de que están formados. es que este gas es usado por los vegetales en la producción de carbohidratos (Fig. 262 .GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Otro aspecto importante.48). que pasa de nueva cuenta a la atmósfera.48. Los carbohidratos siguen distintos trayectos: • Un animal los consume al alimentarse de plantas para obtener energía liberando CO2. En la atmósfera se encuentra el dióxido de carbono (CO2) y la proporción que representa es sostenida por plantas y animales porque es un producto final de la respiración. como carbohidratos. 5.

el cual originará turba. Desafortunadamente. las plantas superiores contienen tres décimas del 1% de su materia seca en fósforo. al quedar sepultadas y al someterse a grandes presiones forman carbón. así. Los herbívoros tienen un porcentaje mucho más alto de fósforo en su esqueleto y también lo eliminan a gran velocidad mediante las heces fecales. también es un componente de los ácidos nucléicos. La mayor reserva de fósforo está en la corteza terrestre y en los depósitos de rocas marinas.GUÍA METODOLÓGICA DE BIOLOGÍA • Las plantas. de moléculas almacenadoras de energía (ATP). Durante este ciclo: • Se libera fósforo de las rocas y el suelo hacia los ecosistemas. éste retoma al suelo para después sedimentarse en los lagos y en los mares. donde se disuelve en el agua del terreno para ser utilizado por los vegetales. que al ser empleados como combustibles o por influencias climáticas. la participación del hombre ha provocado alteraciones al acelerar las pérdidas de fósforo por la excesiva extracción de roca fosfatada de origen geológico antiguo. 263 . aunque una buena parte se aloja en los sedimentos de aguas profundas y poco profundas. en los cuales se alimentan básicamente de peces. lignito o petróleo. proporción similar al contenido de las rocas ígneas. y se encuentra también en los huesos y dientes de animales. El fósforo es un elemento que forma parte del citoplasma celular. hulla. El fósforo biológico forma parte del esqueleto de los vertebrados (como fosfatos de calcio) y sólo una pequeña cantidad participa en el citoplasma celular. 5. también las corrientes marinas ascendentes han hecho aflorar sedimentos ricos en fósforo orgánico. CICLO DEL FÓSFORO El ciclo de este elemento tiene como pozo depósito las rocas de la corteza. regresa a la atmósfera como CO2. del cual es liberado para incorporarse en los ecosistemas.49). Un epiciclo de este elemento está vinculado con las aves marinas que depositan gradualmente guano en los litorales. en estos últimos se forman nódulos con una alta proporción de P2O5 (30%) (Fig.

Fig. como se denomina al excremento de muchas aves. • El guano.49.GUÍA METODOLÓGICA DE BIOLOGÍA • Los animales obtienen fósforo al alimentarse de las plantas o de otros animales que las hayan ingerido. 5. Este gran proceso cíclico permite mantener la salinidad marina y un intercambio de elementos entre mar y tierra con la participación innegable de la atmósfera. también deposita pequeñas cantidades de fosfatos en la tierra o en el agua. • Al morir las plantas o animales liberan fósforo que se reintegra al suelo. Dicho elemento puede disolverse o ser acarreado por las lluvias a los mantos acuíferos o al océano. es que forman el gran ciclo geoquímico realizado entre los océanos y las masas continentales. por ejemplo. los vientos de procedencia marina transportan una parte significativa del sodio que las corrientes fluviales proporcionan a las aguas oceánicas. la integración de las interfases agua. Ciclo del fósforo La conclusión fundamental del estudio de los ciclos biogeoquímicos. Así. tierra y aire de la superficie terrestre funcionan como un solo y gran ecosistema denominado biosfera 264 .

7 ¿CUÁLES SON LAS GRANDES DIVISIONES DE LA BIOSFERA? La cualidad más relevante del ecosistema estriba en su independencia energética. Sin embargo es posible construir. El ecosistema ocupa entre todas las categorías de organismos ecológicos un lugar principal porque representa la unidad de convivencia energéticamente autárquica más pequeña. unidades ecológicas superiores de mayor cuantía.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Utiliza los esquemas de los diferentes ciclos biogeoquímicos para responder a las siguientes preguntas 1. ¿Cómo han alterado las actividades humanas el ciclo del carbono y cuáles son las consecuencias para el clima futuro? __________________________________________________________________________________________ __________________________________________________________________________________________ _________________________________________________________________________________________ 3. su autarquía.¿Qué hace que el ciclo del fósforo sea fundamentalmente diferente de los ciclos del carbono y del nitrógeno? __________________________________________________________________________________________ __________________________________________________________________________________________ _________________________________________________________________________________________ 5. 265 . Es así como todos los ecosistemas de estructura y organización semejante se agrupan bajo el concepto de bioma. Rastrea una molécula de fósforo de una roca rica en fosfato al ADN de un carnívoro. en un plano abstracto. ya que se conjugan todos los eslabones necesarios para constituir un ciclo energético completo. Explica cómo llega el gas nitrógeno del aire a la plantas __________________________________________________________________________________________ __________________________________________________________________________________________ 4. ¿De donde proviene el CO2 que utilizan las plantas en la fotosíntesis? __________________________________________________________________________________ 2.

Un bioma es una comunidad de plantas y animales con formas de vida y condiciones ambientales similares e incluye varias comunidades y estados de desarrollo. por el contrario. no nos referimos a la selva amazónica o a la selva africana sino a todas las selvas del orbe. Explica el porqué de esta afirmación 266 . No suele haber línea de demarcación precisa entre biomas adyacentes. Los biomas no se distribuyen en forma aleatoria sino. sino que. Haz escuchado el comercial que dice “Apaga la luz porque se inunda Tabasco”. por el contrario. BIOMAS TERRESTRES Son extensas regiones geográficas. Un bioma no es un lugar. presión atmosférica. El conjunto de todos los biomas viene a integrar por último la biosfera. altitud. Se nombra por el tipo dominante de vegetación. es decir por factores fisicoquímicos llamados abióticos. suelo. es una categoría. ¿Esperarías encontrar exactamente las mismas especies de animales y plantas en la región de la tundra de Alaska y en la región de la tundra de los Andes? ¿Por qué? 4. Cuando hablamos de la selva. ¿Qué diferencia existe entre el bioma desierto y el ecosistema desierto? Escribe un ejemplo 2. ¿Por qué se encuentran biomas similares en grandes latitudes y en grandes altitudes? 3. cada uno se superpone en una vasta zona de transición llamada ecotonía. formadas por los diversos ecosistemas terrestres donde viven comunidades de plantas y animales (bióticos). En el siguiente cuadro comparativo se dan a conocer algunas características abióticas y bióticas de los Biomas Terrestres (Tabla 5.3) ACTIVIDAD Contesta en tu libreta las siguientes preguntas respecto a los biomas 1. y cuya distribución está determinada por el clima.GUÍA METODOLÓGICA DE BIOLOGÍA Los biomas son las comunidades típicas de las grandes regiones climáticas. con una cierta regularidad tanto en el plano horizontal (latitud) como en el vertical (altitud). que poseen características y adaptaciones apropiadas para el ambiente en que se desenvuelven.

su recuperación es casi imposible de lograr.GUÍA METODOLÓGICA DE BIOLOGÍA Bioma Localización Regiones cercanas a casquetes polares: Alaska. periodos secos. Biomas Terrestres Suelo Permanentemente helado. foca. musgos. zorro plateado. epífitas (p/e. etc. Puerco Espín. lianas y enredadera. Robles. de lluvia anual Tabla 5. EUA y en México en laderas de la Sierra Madres y el eje volcánico transversal Clima Polar frío todo el año. Sur de Veracruz. Ébano.3. debido a que la mayor parte de los nutrientes se encuentran en los seres vivos y no en el suelo. centro de Canadá. Norte de Groenlandia y Siberia Al sur de la tundra. cuyas hojas en forma de aguja son perennes (siempre verdes) lo que les permiten soportar bien las heladas y perder poca agua. serpientes e insectos. alces. nevadas intensas y cortos periodos de verano. parte de Chiapas y Tabasco. Avellanos. Michoacán (Sierra Madre Occidental) Países centrales de Europa. Olmos. Ciervo. osos polar. alcanzan temperaturas 10 a 20°C en verano y -15ºC y +5ºC en invierno. Cedro. Si este ecosistema es destruido. No es apto para la agricultura (en tres o cuatro cosechas pierde sus nutrientes). Norte de Canadá. ya que el suelo desnudo se hace costroso. Durango. Caoba. en las aguas superficiales gran diversidad de peces. La temperatura media anual es de 23'C. la capa más profunda siempre es helada llamada Permafrost Flora Fauna Tundra Sur Caribú. Roedores. Alces. Teca. tormentas. lobo blanco. en los estratos más bajos: batracios. aves canoras. Entre 500 y 1000 mm. Ardillas. Canadá. el suelo es de color grisáceo y muy ácido.15ºC y 5ºC 300 mm. marta y visón Bosque Caducifolio Bosque de Coníferas Los suelos son ricos porque la meteorización es alta y la actividad biológica también. Castores. orquídea). de lluvia anual Templado con las cuatro estaciones del año bien marcadas y alternancia de lluvias. Lobos. debido a la lenta descomposición del material vegetal de la superficie. Del nivel o estrato superior: monos. Se encuentra en las regiones ecuatoriales o cercanas a él. y en la norte Reno. Congo. de lluvia anual Frío o templado y húmedo. en la cuenca del Amazonas de América del Sur. Árboles de 10-20 mts. etcétera con mucha humedad y escasa luminosidad. hojas que chorrean para evitar el exceso de agua y el lavado de nutrientes. De 250 a 500 mm. herbívoros: venados. pingüino y aves Tundra Líquenes. con inviernos largos. plantas herbáceas. El suelo es de tipo pantanoso débil y pobre. centro de EUA. Las temperaturas medias oscilan entre . de lluvia anual Todas las regiones cercanas al ecuador tienen en común el ser calurosas. jabalíes. en zonas de las altas montañas: Siberia. Las especies de árboles que forman el bosque son muy numerosas: Hayas. y reptiles. y en México. en ambas. Gato montés. etc. solo unos centímetros se deshiela en verano. Musaraña y Linces. Castaños. Arbustos. y algunas coníferas enanas Relieve accidentado. su color es café forestal. Bosque Tropical 267 . tienen una temperatura que oscila entre los 20-25ºC. Árboles de conífera como el Pino y el Abeto. Helechos. Nogal. en México Chihuahua. De los 2000-10000 mm.

Praderas. de lluvia anual Se localiza en África. Mamíferos: zorra. nogales. Es cálido con largos periodos de sequía. roedores y aves de rapiña. Entre los 250 y 600 mm. La arena es un sustrato común. plantas herbáceas hierbas. Estepa y Pampas Su vegetación es predominan los pastizales. El fuego agiliza el crecimiento de las hierbas y frena el desarrollo de los árboles. contribuyendo a la sequedad ya que drena rápidamente la escasa precipitación. en zonas centrales de África. plantas herbáceas y matorrales Gacela. lo que facilita la propagación de incendios. de lluvia anual Acumula mucho humus formado por la gran cantidad de materia orgánica que aportan las hierbas al suelo. lobo. Perú. Su temperatura oscila entre 20 a 29 °C. avestruz. 268 . Sabana Desierto Se desarrollan cactus. América y Australia. Son de tipo calcáreo y altamente salino. coyote. pastos y gramíneas Representados por: Antílopes. Linces y algunos roedores Los árboles están dispersos los más frecuentes son Acacias y Baobabes. Arcilloso e impermeable. Los suelos pueden ser de color: marrón claro. Chile. algunos reptiles. gris o amarillentos. etc. Búfalos y grandes mamíferos carniceros. El suelo negro de la pradera (chernoziem) está entre los mejores para cultivar maíz y trigo. Australia. América del Norte (pradera) y en la del Sur (pampa) Es semidesértico con largos periodos de sequía. Antílope. Elefantes. temperaturas medias de 23º C 600 mm. Cebras. Presenta alternancia de una estación húmeda y otra seca y árida. siendo poco productivos. yucas. Lobo. (se descomponen rápidamente).GUÍA METODOLÓGICA DE BIOLOGÍA Ucrania hasta Mongolia. Un promedio de 200 mm. Asia. Jirafas. Suroeste de EUA y en el noroeste de la República Mexicana en Sonora Desértico puede alcanzar una temperatura hasta de 58º C por la mañana y por la noche en algunas zonas han llegado hasta -5ºC o 6ºC. Rinocerontes. acelerando la mineralización del suelo y plantas que se adaptan a esas condiciones. Coyote. de lluvia anual Se ubica en regiones tropicales.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga y colorea en el planisferio los Biomas terrestres del mundo. 269 . Utiliza un código de colores para identificarlos.

270 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga y colorea en el mapa los Biomas que existen en México. Utiliza un código de colores para identificarlos.

incendios forestales. construir un mapa mental de la crisis ambiental interrelacionando las causas y consecuencias de estos problemas. lluvia ácida. introducción de especie exóticas. efecto invernadero. extinción de especies. Usa sólo los nombres de los problemas Elabóralo en un pliego de papel y exponlo al grupo. por equipo. A partir de lo investigado. deterioro de la capa de ozono.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Retoma la actividad del mapa conceptual de causas y consecuencias de la crisis ambiental y los esquemas de los ciclos biogeoquímicos e indica con un asterisco qué parte del ciclo es afectada y cuál es el problema que lo ocasiona ACTIVIDAD ESPECÍFICA Haz una investigación documental sobre los siguientes problemas ambientales documentando su definición así como sus causas y consecuencias: contaminación del aire. caza. suelo y agua. 271 . pérdida de biodiversidad. deforestación. calentamiento global. tráfico de especies. sobrepastoreo.

Utiliza menos del Utiliza más del 50% 50% de imágenes de imágenes. Solo hace uso de flechas o de código de símbolos. para desarrollar adecuadamente el tema. DEFICIENTE (1) Seleccionan con mucha dificultad la idea principal y palabras e ideas subordinadas son incorrectas. Ubican la idea principal al centro pero presentan de 3 a 4 errores al agrupar las palabras e ideas subordinas de acuerdo a su naturaleza y/o jerarquía. Agrupación. Solo hace uso de flechas o de código de símbolos. COMENTARIOS: REFERENCIAS: (Landsberger. La mayoría de las palabras e ideas están mal conectadas. Agrupación. y ramas se presentan jerarquía y por código de colores ramas distintos. 2005) 272 . jerarquía y ramas se presentan por código de 2 o menos colores. Agrupación. jerarquía y ramas la mayoría se presentan por código de colores distintos. jerarquía Agrupación. Las palabras e ideas Ubicación y subordinadas se agrupación presentan en forma radial y se agrupan de acuerdo a su naturaleza y jerarquía. en el en el mapa. Utiliza flechas y/o código de símbolos. Presentan pequeños errores (1 o 2) al agrupar las palabras e ideas subordinadas de acuerdo a su naturaleza y jerarquía. Imágenes del mapa TOTAL: Utiliza más del 90% Utiliza más del 70% de imágenes que son de imágenes.GUÍA METODOLÓGICA DE BIOLOGÍA RUBRICA PARA EVALUAR MAPAS MENTALES Institución educativa: Nombre del docente: Nombre del alumno: Año/grupo: Fecha: Nombre de quien evalúa: PONDERACIÓN CRITERIOS EXCELENTE (4) Identifican fácilmente la idea principal e incluyen todas las palabras y/o ideas subordinadas. jerarquía y ramas solo algunas se presentan por código de colores distintos. Varias de las palabras e ideas están conectadas incorrectamente. por colores Ubican la idea principal en el centro. sin él. y la de gran colorido. a través de flechas o usando un código de símbolos. Con mapa y estas son de muy poco color o poco colorido. Agrupación. MUY BIEN (3) Seleccionan la idea principal e incluyen casi todas las palabras e ideas subordinadas para desarrollar el tema BIEN (2) Tienen cierta dificultad para seleccionar la idea principal e incluyen algunas de las palabras e ideas subordinadas para desarrollar el tema. Logra establecer conexiones Conexiones adecuadas entre las e palabras e ideas intergrupos claves. No ubican la idea principal al centro y/o presentan 5 o más errores al agrupar las palabras e ideas subordinadas de acuerdo a su naturaleza y/o jerarquía. PUNTAJE Asignatura: Bloque/tema: Autoevaluación: Coevaluación: Evalúa el profesor: Contenidos Ubican la idea principal en el centro. Algunas de las palabras e ideas (1 o 2) no están conectadas correctamente. mayoría son de gran colorido en el mapa.

como el sodio y el cloro cloruro de sodio. la zona limnética (las aguas alejadas de la orilla) y la zona profunda ubicada debajo de la anterior. charcas. constituye el agua libre hasta la profundidad máxima que alcanza a penetrar la luz. Los ecosistemas dulceacuícolas. y la que estudia los ecosistemas de agua salada se llama oceanografía. En la tabla 5. Índico. y donde el zooplancton constituye el principal componente de la comunidad de consumidores de primer orden. calcio y potasio. El agua del mar. por lo que está integrado por dos grandes tipos de ecosistemas: los de aguas quietas.GUÍA METODOLÓGICA DE BIOLOGÍA ECOSISTEMAS ACUÁTICOS ECOSISTEMAS OCEÁNICOS Éstos cubren entre el 70 y 71% de la superficie terrestre formada por el agua marina. Zona limnética. El océano está dividido por los continentes y grandes archipiélagos en cinco partes que son los Océanos: Pacífico. pantanos y las turberas llamados bioma léntico. Atlántico. que constituyen cerca del 90 % de los elementos disueltos en el agua de mar. constituyen el 1% de agua dulce. y ríos llamados bioma lótico. contiene sustancias sólidas en disolución. BIOMAS LÉNTICOS Se distinguen 3 zonas: el litoral. Ártico y Antártico. ECOSISTEMAS DULCEACUÍCOLAS La ciencia que estudia los ecosistemas de agua dulce se llama Limnología.4 se presentan algunos factores bióticos y abióticos de los océanos. y los de aguas de movimiento como: fuentes. 273 . magnesio. aquí se produce el máximo desarrollo de fitoplancton. arroyos. pues la luz penetra hasta el fondo. como los lagos. aquí es más abundante la vida. es el punto clave entre los océanos y la atmósfera en el ciclo hidrológico de la naturaleza. Litoral lacustre (lagos y lagunas).

Organismos planctónicos. Talud Continental: continuación de la Plataforma que se puede considerar ya como verdadera zona Oceánica. crustáceos. Fótica: es la zona hasta donde penetra la luz llegando esta hasta los 200 m de profundidad. Ésta aumenta 1 atmósfera por cada 10 m de profundidad. Plataforma Continental: parte del Continente pero sumergida. Viven flotando en las aguas y se mueven principalmente arrastrados por las corrientes.5% Organismos pelágicos. Tabla 5. etc. PRESIÓN ATMOSFÉRICA ZONAS DE LUZ SALINIDAD Aproximadamente del 3. con una profundidad media de 200 m y pendientes generalmente suaves.000 m. corales. huevos. ballenas. anélidos. Suele contener vida marina en abundancia y la mayor parte de la pesca se realiza en esta zona. Algunas características de Ecosistemas Marinos FORMAS DE VIDA TOPOGRAFÍA 274 . los organismos que se encuentran en las profundidades marinas pueden llegar a soportar presiones de unas 1000 atmósferas. Por ejemplo: cardúmenes de peces. por ejemplo. estrellas.. con una media de 7000 a 8000 m de profundidad. Aquí se encuentra la cuarta parte de la producción mundial de petróleo y gas procedente de las rocas que se encuentran debajo de estas plataformas. calamares. pequeños crustáceos. que pueden llegar a medir miles de kilómetros de largo. peces de fondo. etc Organismos bentónicos. Se localizan en el fondo oceánico. protozoos. su anchura es muy variable de una zona a otra. Se localizan en las aguas libres. Fosas abisales: Son las partes más profundas de los océanos. medusas. Afótica: a partir de 200 m. Son numerosos entre ellos están las algas. sin relación con el fondo oceánico. Por ejemplo: algas microscópicas (fitoplancton). moluscos.) Plataforma litoral o costera: es la zona más cercana a la tierra. presenta pendientes muy acusadas y va desde 200 m hasta 4. donde no hay luz. etc.GUÍA METODOLÓGICA DE BIOLOGÍA CARACTERÍSTICAS TEMPERATURA DESCRIPCIÓN La media oscila entre 2 – 30oC.4. larvas.

los que pueden dar origen a islas. rica en oxígenos y con una baja densidad. principalmente. donde suele formar meandros: establece curvas regulares. una zona de agua fría profunda. moluscos etc. Un río que termina en una boca muy ancha y profunda se llama estuario.GUÍA METODOLÓGICA DE BIOLOGÍA Zona profunda. Curso medio. Curso inferior. 275 . algunos gusanos. lo cual se debe. capaces de sobrevivir con poca luz y baja concentración de oxígeno. Al fluir el río. Fluye en áreas relativamente planas. que sufren escasez de oxígeno en el hipolimnion durante el verano BIOMAS LÓTICOS Conforme a su curso se clasifican en: Curso Superior. llamadas deltas. el cual contiene tanto agua dulce como salada pues es el punto donde se unen ambas. que pueden llegar a formar lagos en herradura. los hongos descomponedores. el hipolimnion. De acuerdo a su tipología ecológica se clasifican en: Lagos oligotróficos con nutrientes escasos. coincide con las áreas montañosas de una cuenca determinada. La erosión es mayor y los ríos suelen formar valles en forma de V al encajarse en el relieve aunque hay excepciones. Aquí se alternan las áreas o zonas donde el río erosiona y donde deposita parte de sus sedimentos. de plancton. se encuentra por debajo de la zona limnética. a las fluctuaciones de la pendiente y a la influencia que reciben con respecto al caudal y sedimentos de sus afluentes. Lagos eutróficos ricos en nutrientes y con una elevada productividad primaria debido al denso fitoplancton y a la vegetación de los márgenes. y sus habitantes más característicos son: las bacterias.. Generalmente. acarrea grandes cantidades de sedimentos.

un estuario y un arrecife de coral. ESTUARIO MANGLAR ARRECIFE DE CORAL 276 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga e ilustra las características de un manglar.

ecosistemas y componentes componentes sus relaciones de los de los en un mapa ecosistemas ecosistemas mental en un mapa de una forma mental crítica y integrador. reflexiva. en integrador.GUÍA METODOLÓGICA DE BIOLOGÍA EVALUACIÓN DIAGNÓSTICA Se toma en cuenta los conocimientos previos a partir de la técnica lluvia de ideas y de la aplicación del examen diagnóstico. sugiriendo propuestas para la conservación de los ecosistemas Puntos: 100 Ponderación Logros: Puntos: 30 Puntos: 60 Puntos: 80 Puntos: 100 Aspectos a mejorar : 277 . Estratégico Analiza la estructura y las relaciones entre los componentes de los diferentes ecosistemas en un mapa mental integrador. ACTIVIDADES DE APRENDIZAJE: FORMATIVA • Ejercicios de la guía metodológica • Debate grupal • V de Gowin • Presentación de exposiciones en power point ACTIVIDAD ESPECÍFICA: • Mapa mental integrador • Reporte de visita guiada a áreas naturales • Portafolio • Rúbrica Examen departamental tipo CENEVAL o PISA 30% Laboratorio (evaluación V-Gowin) 20% Actividades de aprendizaje 20% Actividad específica por unidad 30% SUMATIVA Criterios Analiza la estructura y las relaciones entre los componentes de los ecosistemas en un mapa mental integrador. un mapa mental integrador. MATRIZ DE VALORACIÓN DE COMPETENCIAS Pre-formal Receptivo Resolutivo Autónomo Identifica los Describe Analiza la Analiza la componentes algunos estructura y estructura y de los componentes las relaciones las relaciones de los entre los entre los ecosistemas.

249-300. Biología. Colombia. CECSA. Coello. (2003). Ed. (2005). y Villareal. Biosca. México. Preservación de la Naturaleza. H. (2003). Publicaciones cultural. (2004) Biología Experimental. (1994). La Prensa Médica Mexicana. México.htm Marten. 715-736. Océano País España Barnes. Enfermedades Parasitarias. pp 4-8 BIBLIOGRAFÍA COMPLEMENTARIA Cervantes. La Vida y sus Procesos. Publicaciones Cultural. (2000) Biología. 655 pp. A. México. y Barnes N.D.tecnun. México. Curtis H. A. J. (1989). Granillo. Cronquist.S. México. País España. Ed. Atlas Mundial del Medio Ambiente. SEP/Santillana. y Hernández M. pp. Interamericana. Cultural S.Tesoros de la Biodiversidad. Conceptos Básicos del Desarrollo Sustentable. et al. (2006).R. B. Quinta reimpresión. (2005) Las Plantas. Valdivia. S. Zoología de los Invertebrados. El Mundo de la Ecología.es/asignaturas/ecologia/hipertexto/05PrinEcos/120BiomTer. Joseph y Tola José. Vázquez Conde. Correo del Maestro. P. Bernal. Colección Espejo de Urania. Nueva Imagen UNAM. G. Vázquez. Libro electrónico Ciencias de la Tierra y del Medio Ambiente: Tema 5: Principales ecosistemas >> Biomas terrestres. Publicaciones Cultural. Botánica Básica. Biología General. Ecología Humana. D. México. Publicaciones Cultural.. www. (1998). 427477.GUÍA METODOLÓGICA DE BIOLOGÍA BIBLIOGRAFÍA BÁSICA Banchs. (1986). J. (1992). México. Biología I. A. México. F. México. A. (2006). Ed. México. pp 12-26 Biagi. Editorial Médica Panamericana. C. pp. Cervantes M. pp. P. R. 278 . (1980). La Ciencia en la Historia. Nesman. 376 pp.

php 279 . Buican. (1996). Biología. 960 paginas. Acento editorial.org (reproducido con permiso de Science Magazine).biodiversidad.html Revista electrónica Biodiversitas http://www. Nueva visita al Experimento de Miller” en Astroseti. 91páginas.org/sopa.gob. la dinámica de la vida. (2003) “Sopa Prebiótica. Consejo Nacional de Ciencia y Tecnología Fondo de Cultura Económica. México. España. VIDEOS RECOMENDADOS • El Mundo de los Insectos • Biodiversidad • Sexo en el arrecife • Planeta Tierra • Video La Marcha de los Pingüinos • Huella ecológica en la web • Videojuego en línea Honoloko • Literatura del tema TIC’s Action Bioscience http://actionbioscience. D. (1987) De las bacterias al hombre: la Evolución. Historia de la Biología. A.org/esp/biodiversidad/index. Bada. 737 páginas.astroseti. México. http://www. Biología. Consejo Nacional para la enseñanza de la Biología.php Biggs. segunda edición. CECSA. La ciencia/ 25 desde México. (1999). Kapicka y Lundgren. y Lazcano. (1975). serie Flash. Mc Graw Hill. J.L.mx/Biodiversitas/resultados.GUÍA METODOLÓGICA DE BIOLOGÍA Piñero Daniel.

mx Consejo Nacional de Ciencia y Tecnología: Revista Ciencia y Desarrollo http://www.GUÍA METODOLÓGICA DE BIOLOGÍA Comisión Nacional para el Conocimiento y Uso de la Biodiversidad http://www.gob.mx/wwfmex/ecosistemas.gob.ilce.edu.cbd.forest.df.mx 2010 Año internacional de la Biodiversidad http://www.es/biosfera/ Secretaria del Medio Ambiente http://www.org.ve/~rubenhg/ Naturaleza Mexicana http://www.mec.ula.sma.mx/redescolar/proyectos/reinos_pri2006/index.conabio.int/2010/welcome/ La Vida entre Reinos http://redescolar.conacyt.cnice.mx/comunicacion/revista 280 .php Proyecto Biosfera .Ministerios de Educación y Ciencia http://recursos.htm LibroBOTÁNICAOnLine http://www.wwf.

GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE 6 Introducción a la Anatomía y Fisiología Humana 281 .

Reflexiona de manera crítica e informada sobre las medidas de higiene y salud para tener una buena calidad de vida. para tomar decisiones en el cuidado de su cuerpo a través del uso de modelos anatómicos. congruente con los conocimientos y habilidades con los que cuenta dentro de distintos equipos de trabajo. Promueve y difunde a través de periódicos murales. SABERES Procedimentales Describe la estructura y función de los tejidos del cuerpo humano a través de modelos y observación al microscopio de muestras histológicas.6 Utiliza las tecnologías de la información y comunicación para procesar e interpretar información. Muestra actitudes de respeto al trabajo y opiniones de sus compañeros.2 Toma decisiones a partir de la valoración de las consecuencias de distintos hábitos de consumo y conductas de riesgo. Decide sobre el cuidado de su salud a partir del conocimiento de su cuerpo.3 Asume una actitud constructiva. Declarativos Identifica la estructura y función de los tejidos del cuerpo humano.GUÍA METODOLÓGICA DE BIOLOGÍA BLOQUE DE APRENDIZAJE VI: INTRODUCCIÓN A LA ANATOMÍA Y FISIOLOGÍA HUMANA TIEMPO: 25 horas UNIDAD DE COMPETENCIA: Identifica la organización del cuerpo humano y la función que desempeñan los sistemas en el mantenimiento de la homeostasis del mismo. Elabora reportes de laboratorio a través de una V de Gowin. • 282 . Construye modelos anatómicos para identificar los órganos de los respectivos sistemas Relaciona la estructura y función de los diferentes órganos y sistemas a través de mapas mentales Aplica y difunde medidas de higiene y salud para prevenir enfermedades a través del uso de medios de comunicación. conferencias y trípticos la importancia de tomar medidas para prevenir enfermedades.2 Ordena información de acuerdo a categorías jerarquías y relaciones. 5. Identifica la estructura y función de los órganos y sistemas del cuerpo humano. 9. sus procesos vitales y el entorno al que pertenece. 5. 8. satisfacer necesidades o demostrar principios científicos. Relaciona la estructura y función de los diferentes órganos y sistemas a través de mapas mentales. COMPETENCIAS Genéricas/Atributos Disciplinares 3. Diseña modelos o prototipos para resolver problemas. Explica las medidas de higiene y prevención de la salud Actitudinales/ Valorales Se desempeña activa y responsablemente en trabajos individuales y por equipo. Identifica órganos y sistemas en un pollo. CRITERIOS DE DESEMPEÑO • Identifica la estructura de los órganos y sistemas del cuerpo humano a través de modelos anatómicos. 12.

• Investigaciones modelos • Investigación documentales • Reporte mentales documental. material de difusión • Reporte • Presentaciones en • Modelos de los de laboratorio en V de Gowin de actividades de la guía metodológica • Computadora • Cañón • Apoyo • Mapa mental • Material de difusión • Resolución bibliográfico • Laboratorio experimental • Muestras biológicas e histológicas de disección • Estuche EXPLORANDO TUS CONOCIMIENTOS 1. Escribe el nombre de cinco huesos del cuerpo _________________________________________________________________________ 283 . • Elaboración de anatómico humano power point de laboratorio (V de Gowin) sistemas del cuerpo humano.GUÍA METODOLÓGICA DE BIOLOGÍA ESTRATEGIAS DE ENSEÑANZA • Clase magistral. • Actividades ESTRATEGIAS DE APRENDIZAJE • Elaboración de mapa mental • Construcción RECURSOS DIDÁCTICOS • Guía metodológica • Videos • Láminas • Rotafolio • Modelo experimentales • Ilustraciones • Mapas de EVIDENCIAS Y/O PRODUCTOS • Actividades de la guía metodológica de biología. ¿En dónde se lleva a cabo el intercambio gaseoso en la respiración pulmonar? _________________________________________________________________________ 3. Escribe el nombre de tres glándulas del cuerpo _________________________________________________________________________ 2. ¿Qué diferencias hay entre venas y arterias? _________________________________________________________________________ 4.

GUÍA METODOLÓGICA DE BIOLOGÍA 284 .

el muscular y el tejido nervioso (Tabla 6.1.1). INTRODUCCIÓN La anatomía es la rama de la medicina que estudia la forma y estructura del cuerpo así como sus partes constitutivas. que forma el corazón • Músculo liso. el conjuntivo. forma encéfalo y médula espinal (sistema nervioso Central) y tejido nervioso (Sistema nervioso periférico) Tabla 6. los médicos estiman que entre el 40% y 70% de todas las alteraciones funcionales (enfermedades) tienen origen psicosomático atribuible a la vida personal y social de cada individuo. cartílago. que forma órganos internos como el tubo digestivo. Esta unidad morfológica y fisiológica se logra por medio de un elevado nivel de organización estructural y numerosos mecanismos de control relacionados entre sí. vasos sanguíneos Forma el sistema nervioso. La neurona es la unidad estructural y funcional. El cuerpo humano no es simplemente un agregado de órganos. sino una unidad organizada y bien coordinada que funciona como un todo integrado. El cuerpo humano esta integrado por diferentes sistemas. hueso (soporte). sociales y culturales en la vida de un individuo no son ajenas al funcionamiento fisiológico del cuerpo. mientras que la fisiología estudia la función de las diferentes estructuras corporales. Las influencias personales.GUÍA METODOLÓGICA DE BIOLOGÍA 6. que forma la musculatura corporal • Músculo cardiaco. que son agrupaciones de diferentes tejidos especializados con una función establecida. enzimas y sudor Unión y sostén de otros tejidos IMPORTANCIA • Forma membranas que cubren el cuerpo y revisten cavidades • Forma glándulas endocrinas (hormonas) y glándulas exocrinas (sudor) Forma tendones (unión). estos sistemas están formados a su vez por órganos. sangre y linfa (transporte) y el estroma de los ovarios (sostén) Está dividido en tres grupos: Conectivo Muscular Contracción por la presencia de actina y miosina • Músculo estriado. Se reconocen cuatro tipos fundamentales de tejidos: el epitelial.1 Nervioso Conducción de impulsos nerviosos 285 . TEJIDO Epitelial FUNCIONES Protección y producción de hormonas.

GUÍA METODOLÓGICA DE BIOLOGÍA 6.1. ACTIVIDAD Realiza una Investigación documental de las funciones que tiene la piel. A partir de esta información realiza un mapa conceptual de las funciones de la piel.5 metros cuadrados. en un adulto cubre un área total de más de 1. 286 . La piel se conoce como tegumento y se compone de uno o más tejidos que protegen al cuerpo del ambiente. ¿CÓMO FUNCIONA EL SISTEMA TEGUMENTARIO? El órgano más grande del cuerpo es la piel.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Escribe los nombres correspondientes a cada estructura que señalan las líneas de la siguiente figura esquemática. Haz una investigación experimental y escribe la función de cada parte. 287 .

intestinos.).1. regulados por centros nerviosos especializados y por hormonas. En el humano se han clasificado en tres tipos: esquelético o estriado. El músculo cardiaco se localiza en el espesor de las cavidades del corazón. la unión de un gran número de miocitos forman las fibras musculares que al unirse a su vez forman órganos llamados músculos. El músculo liso se le llama así porque no presenta bandas o estrías y se localiza en las paredes de las vísceras huecas (estómago. físicos y químicos. Fig. El músculo esquelético se le denomina así porque se encuentra adherido al esqueleto y estriado porque al microscopio se observan bandas o estrías. a diferencia de los músculos cardiaco y liso que presentan automatismo. ¿CÓMO FUNCIONA EL SISTEMA MUSCULAR? El sistema muscular está constituido por células que reciben el nombre de miocitos. 6. Las células del músculo esquelético o estriado y del cardiaco.1). su estructura es similar a la del músculo esquelético o estriado. las del músculo liso cuentan con un solo núcleo oval casi central. liso y cardiaco. son células alargadas con muchos núcleos. unas anchas constituidas por proteínas contráctiles de miosina y otras bandas o estrías delgadas constituidas por proteínas contráctiles de actina (fig. 6. vasos sanguíneos. etc.GUÍA METODOLÓGICA DE BIOLOGÍA 6.2. 288 . Contracción muscular La diferencia es que el músculo esquelético funciona en forma voluntaria median-te estímulos nerviosos.

aducción. extensión. En la imagen coloca el tipo de movimiento de que se trate en la letra correspondiente. supinación. pronación. depresión. oclusión. dilatación y oposición. abducción. 289 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Investiga en qué consisten los siguientes movimientos voluntarios de los músculos: flexión. elevación.

Músculos importantes en el ser humano Los músculos cardiaco y liso que presentan automatismo y regidos por centros nerviosos especializados.1). Figura 6. las contracciones involuntarias del corazón (sístole y diástole). La diversidad de movimientos que se efectúan se debe a la combinación de contracción y relajación de los músculos esqueléticos. 6. cuya finalidad es la locomoción). es necesario que existan músculos en su región anterior. para volver a extenderse se necesita que se contraigan músculos localizados en su región posterior (fig. por ejemplo para “doblar” el brazo.2. los movimientos del tubo digestivo a los cuales se les denomina perístalsis. 290 .GUÍA METODOLÓGICA DE BIOLOGÍA La contracción de un músculo se debe a la atracción de sus fibras por estímulos que cambian sus cargas de tipo eléctrico que al encontrarse de diferente carga se atraen dando como resultado el acortamiento del conjunto. los músculos jalan no empujan. función presente casi en la totalidad de los organismos heterótrofos para poder buscar su alimento. por lo tanto para que exista un movimiento completo es necesario que existan músculos antagónicos. tenemos como ejemplo de sus movimientos.

el humano esta constituido por la unión de diversos huesos en numero promedio de 204. formando cavidades como las del cráneo y cavidad torácica. 6. La unión de los diversos huesos van a formar una estructura que sirve de armazón. de soporte a la cuál se le denomina esqueleto. constituidos de calcio y fósforo que forman a los huesos (fig. ¿CÓMO FUNCIONA EL SISTEMA ÓSEO? El sistema óseo está constituido por células que reciben el nombre de osteocitos.2. • Producir elementos formes de la sangre como son los glóbulos rojos y blancos. como las vibraciones sonoras en el oído. 6. • Proteger a órganos muy delicados. al esqueleto se le van a unir una gran cantidad de diversos músculos que le van a dar movimiento.GUÍA METODOLÓGICA DE BIOLOGÍA 6. • Participar en la conducción sensorial. • Almacén de calcio y fósforo.3. Las funciones del esqueleto son: • Servir como una estructura sólida que constituye un armazón que da soporte y forma. en el interior de la médula ósea.2). Estructura de un hueso largo 291 .

Los huesos se clasifican en: • • • • Huesos largos (húmero. caras.3. fémur. huesos de la cadera. 292 . tibia. 6. Huesos del cráneo A los huesos localizados sobre la línea media del cuerpo se les denomina esqueleto axial (huesos del cráneo. hueso del pecho y sacro) (fig. peroné) Huesos cortos (falanges) Huesos planos (huesos del cráneo. huesos de la cadera) Huesos irregulares (vértebras.3) a los huesos localizados a los lados de la línea media del cuerpo se les denomina esqueleto apendicular (huesos de los brazos y piernas. A los huesos planos se les consideran las siguientes regiones. cubito. huesos del carpo y metacarpo) A los extremos de los huesos largos se les denomina epífisis y a su cuerpo diáfisis. 6. columna vertebral.GUÍA METODOLÓGICA DE BIOLOGÍA Fig.2). bordes y ángulos (fig. 6. omoplatos. radio.

son varios los elementos que participan los cuales son: ligamentos y tendones.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Ilumina el esqueleto axial y de un color. En ambos casos escribe el nombre de los huesos principales que reconozcas. 293 . meniscos y líquido sinovial. Utiliza un segundo color para iluminar el esqueleto apendicular. La unión de los diversos huesos se les llama articulación. cápsula articular.

GUÍA METODOLÓGICA DE BIOLOGÍA

6.4. ¿CÓMO FUNCIONA EL SISTEMA DIGESTIVO?
La digestión es el proceso mediante el cual el alimento que ingiere un organismo es descompuesto en moléculas lo suficientemente pequeñas como para que entren las células. Entre estas moléculas se encuentran los monosacáridos, los aminoácidos, ácidos grasos, hierro y otros minerales. Por esta razón el alimento debe ser ingerido, digerido y absorbido. En los animales superiores la digestión tiene lugar en un largo tubo que va desde la boca al ano y que tiene diferentes zonas especializadas para cada proceso de la digestión.

Figura 6.4. Sistema digestivo

294

GUÍA METODOLÓGICA DE BIOLOGÍA

Las funciones de la digestión son: • Ingestión. Los alimentos son introducidos al tracto digestivo por un orificio generalmente llamado boca. • Destrucción mecánica. Los alimentos se rompen en partes más pequeñas la intervención de los colmillos y otras piezas dentales y el mezclado de la cavidad digestiva. • Destrucción química. Las partículas de los alimentos se exponen a enzimas y líquidos digestivos a fin de que las moléculas grandes se desdoblen en unidades más pequeñas. • Absorción. Las moléculas pequeñas deben pasar a las células (Fig. 6.5). • Eliminación. Los materiales no digeribles deben ser expulsados del cuerpo.

Fig. 6.5. Estructura interna del intestino delgado

295

GUÍA METODOLÓGICA DE BIOLOGÍA

ESTRUCTURA Cavidad bucal

FUNCIÓN Es el lugar de entrada de los alimentos al organismo. Está provisto de 32 dientes encargados de triturar el alimento. Conduce el bolo alimenticio hacia el esófago, donde la epiglotis evita que el alimento pase al tracto respiratorio.. Conduce los alimentos hacia el estómago. Es una bolsa musculosa en forma de J en donde los alimentos son transformados por acción de los jugos gástricos. Es un tubo de 7 m de largo que tiene en su interior una serie de microvellosidades encargadas de absorber a la sangre los alimentos. Es un tubo grueso y corto.. Por él se expulsa la sustancias no absorbidas por las vellosidades intestinales y se absorbe el agua. Almacena los residuos Expulsa las heces fecales
Tabla 6.2. Órganos principales del sistema digestivo

Faringe Esófago Estómago

Intestino delgado

Intestino grueso Recto Ano

ESTRUCTURA Páncreas (jugo pancreático) Hígado (bilis) Glándulas parótidas Glándulas del intestino delgado

FUNCIÓN Desdobla las proteínas intactas, convierte las dextrinas en maltosa y desdobla las grasas neutras. Emulsifica las grasas neutras y participa en la absorción de los productos de la descomposición de las grasas neutras. Producen y secretan amilasa salival (ptialina) Glucólisis y proteólisis
Tabla 6.3. Glándulas anexas del sistema digestivo

296

GUÍA METODOLÓGICA DE BIOLOGÍA

ACTIVIDAD A partir de las Tablas 6.2 y 6.3 y con la información proporcionada en esta guía, construye un mapa conceptual integrador que involucre la ruta del alimento, los órganos por donde pasa, las glándulas anexas, las funciones de la digestión.

297

GUÍA METODOLÓGICA DE BIOLOGÍA

6.5. ¿CÓMO FUNCIONA EL SISTEMA RESPIRATORIO?
Se llama sistema respiratorio al conjunto de estructuras del organismo que permite la captación del oxígeno del aire y la eliminación del dióxido de carbono producido en su interior. Este proceso se conoce como respiración. El sistema respiratorio transporta el aire hacia los pulmones y realiza el intercam-bio gaseoso (Fig. 6.6) que se lleva a cabo en ellos. Esta constituido por órganos de transporte y órganos de intercambio gaseoso, que permiten la llegada de oxígeno a la sangre y la eliminación del bióxido de carbono. Los pulmones son los órganos más importantes de este sistema y se encuentran protegidos por una membrana de doble capa llamada pleura. Se encuentran alojados en las partes laterales de la cavidad torácica, cubiertos principalmente por las costillas. El pulmón derecho es mayor que el izquierdo consta de tres lóbulos, mientras que el otro solo tiene dos. Durante la inhalación la cavidad torácica se expande, esto sucede cuando el diafragma y los músculos intercostales se contraen levantando las costillas hacia arriba y hacia fuera. La exhalación se produce cuando los músculos se relajan, la relajación hace que las costillas se muevan hacia abajo y hacia adentro disminuyendo el tamaño de la cavidad torácica y obligando al aire a salir de los pulmones.

ÓRGANO
Nariz Faringe

ESTRUCTURA
Fosas nasales Cámara común al aparato digestivo y respiratorio Formada por secciones de cartílago y cuerdas vocales Tubo flexible con paredes de cartílago cubiertos con membranas mucosas Tubos flexibles cartilaginosos Tubos flexibles cartilaginosos

FUNCIÓN
Humedece calienta y purifica el aire Conduce el aire hacia la laringe y expulsa moco y partículas Produce tonos de voz e interviene en el proceso de la tos. Conducto de paso que da origen a los bronquios Conducen el aire hacia los pulmones Conducen el aire hacia los alvéolos

Laringe Tráquea

Bronquios Bronquíolos

Tabla 6.4. Órganos conductores del sistema respiratorio

298

GUÍA METODOLÓGICA DE BIOLOGÍA

ACTIVIDAD Escribe el nombre del órgano que corresponda e ilumínalo de diferente color

El aire que queda en los pulmones después de la exhalación impide que los alvéolos se colapsen. Durante la respiración normal se introducen 500 ml de aire, de los cuales 350 ml llegan a los alvéolos. La frecuencia respiratoria se controla por el centro respiratorio del encéfalo, cada contracción es estimulada por impulsos que provienen de células nerviosas. El centro respiratorio ajusta la frecuencia respiratoria y el volumen para cumplir con las necesidades del cuerpo.
299

y por el aire exhalado en los pulmones. entre la aurícula y ventrículo izquierdo esta la válvula mitral. nutrición. regulación de la temperatura corporal. llamado nodo sinusal. Son pequeñas y con una poderosa pared muscular. 6. 6. están constituidos por las arterias. De toda esta labor se encarga la sangre.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. ¿CÓMO FUNCIONA EL SISTEMA CIRCULATORIO? El sistema circulatorio sirve para llevar los alimentos y el oxígeno a las células. y para recoger los desechos metabólicos que se eliminarán por los riñones. en la orina. por ellas fluye rápidamente la sangre a presión debido a la elasticidad y resistencia de sus paredes. rico en dióxido de carbono (CO2). interviene en la regulación ácido-base y en la concentración de agua celular El corazón. Las funciones básicas del sistema circulatorio son la oxigenación celular (parte de la respiración celular).6. venas y capilares. los ventrículos.7. La presión del sistema venoso es muy baja. que provienen de un tejido especializado a manera de marcapasos natural situado en la aurícula derecha. estos impulsos eléctricos producen el latido del corazón. es un órgano situado en el interior del tórax entre ambos pulmones está integrado por músculo estriado cardiaco. 300 . Actúan como válvulas de control a través de las cuáles se manda sangre hacia los capilares. Las arteriolas son las últimas ramas del sistema arterial. Las arterias salen del corazón. Las venas transportan sangre de los tejidos hacia las aurículas del corazón. Alvéolos pulmonares Fig. Este órgano funciona como bomba y presenta dos cavidades superiores llamadas aurículas y otras dos inferiores.6. (Fig. 6. Son gruesas y elásticas y nacen en los ventrículos aportan sangre a los órganos del cuerpo. La contracción del corazón está determinada por impulsos eléctricos. Entre la aurícula y el ventrículo derecho hay una válvula llamada tricúspide. que está circulando constantemente. Intercambio gaseoso 6. transporte de hormonas. Los vasos sanguíneos.8) Las gruesas paredes del corazón forman el miocardio.

La sangre está contenida en el cuerpo en cantidad de unos 4 a 6 litros. nutrientes. Son sumamente delgados que penetran por todos los órganos del cuerpo. el plasma. En los capilares se realiza el intercambio gaseoso entre la sangre y las células.___________________________________ 2. 3. uno de contracción o sístole. Intercambian líquidos.______________________________________ 301 .______________________________________ 9.___________________________________ 12.______________________________________ 13.______________________________________ 11.______________________________________ 7.______________________________________ 6. Las vénulas reciben la sangre de los capilares antes de llamarles venas. ACTIVIDAD Identifica y escribe el nombre de cada estructura que señalan los números y líneas sobre el esquema del corazón. Esto genera la presión arterial que es más alta durante la sístole y disminuye durante la diástole.______________________________________ 4. En ella se distingue una parte líquida.______________________________________ 10.GUÍA METODOLÓGICA DE BIOLOGÍA sus paredes son delgadas y poco elásticas. hormonas y otras sustancias entre la sangre y los espacios intersticiales. el corazón presenta dos movimientos o latidos. leucocitos y plaquetas). y otro de dilatación o diástole.______________________________________ 8.______________________________________ 5. las células sanguíneas o elementos formes (eritrocitos.______________________________________ 1. y una parte sólida. electrolitos. Para movilizar la sangre.

la sangre se oxigena. regresando al corazón por medio de las cuatro venas pulmonares que desembocan en la aurícula izquierda. 6.9). Circulación sanguínea 302 .GUÍA METODOLÓGICA DE BIOLOGÍA Circulación sanguínea La sangre procedente del organismo (circulación sistémica) llega a la aurícula derecha a través de dos venas principales: la vena cava superior y la vena cava inferior. La contracción de este ventrículo conduce la sangre hacia los pulmones. 6. impulsa la sangre a través de un orificio.9. la válvula auriculoventricular. ya que se cierra por completo durante la contracción del ventrículo derecho. Cuando esta cavidad se contrae. En su recorrido a través de los pulmones (circulación pulmonar). La válvula bicúspide o mitral evita el reflujo de sangre del ventrículo hacia la aurícula izquierda (fig. la sangre pasa al ventrículo izquierdo y desde allí a la aorta gracias a la contracción ventricular. Fig. La válvula tricúspide evita el reflujo de sangre hacia la aurícula. Cuando la aurícula derecha se contrae. hacia el ventrículo derecho.

A partir de ésta elabora un mapa conceptual 303 .GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los componentes de la sangre.

7 ¿CÓMO FUNCIONA EL SISTEMA LINFÁTICO? En el organismo humano existen dos tipos de sistemas de transporte: el sistema circulatorio y el sistema linfático. Estas partículas son muy grandes para que puedan difundir al interior de los capilares sanguíneos. Para esto es necesaria la acción de los leucocitos que tienen como función reconocer a los antígenos. estas se recombinan viajando por estos vasos quilíferos. La respuesta inmunológica se efectúa en dos partes. El sistema linfático consta de: una red de capilares linfáticos que conducen linfa y de tejido linfático formado por nodos linfáticos. Dar la respuesta inmunológica. por esto se denominan células T. Las funciones principales de éste sistema son: A. bazo y tonsilas (amígdalas). para defender el cuerpo al exponer bacterias y virus a los leucocitos. Estas células se reproducen en la médula ósea y de aquí pasan a la sangre. el bazo. Una vez en la linfa. en tanto que los otros se llaman células B. estas partículas de grasa representan el 1% del fluido linfático. los nodos linfáticos y algunas células como los linfocitos T y los linfocitos B forman el sistema inmunológico del cuerpo. son bombeadas hacia una gran vena que llega al corazón. Algunos linfocitos primero pasan por el timo. a los nodos linfáticos y al bazo. que forman una red distribuida por todo el cuerpo. El intestino delgado tiene muchos capilares linfáticos. 304 . C. Limpiar y regresar los desechos celulares a la sangre. B. al que se integran. El timo.GUÍA METODOLÓGICA DE BIOLOGÍA 6. un tipo de glóbulos blancos. Después de una comida rica en grasa. Una parte de estos desechos se dirige al extremo venoso del capilar. los órganos linfáticos como el timo. Como resultado del metabolismo celular. el resto hacia los extremos venoso del capilar. Transportar grasas del intestino al torrente sanguíneo. se difunden sustancias de desecho hacia el líquido extracelular. El sistema linfático produce linfocitos. pero pueden moverse fácilmente a través de las aberturas de la células capilares linfáticas. el resto hacia los extremos cerrados de los vasos linfáticos. primero el cuerpo debe reconocer el antígeno y segundo debe buscar la manera de deshacerse de él. Después de absorber las grasas digeridas en el interior de los vasos quilíferos o linfáticos.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre la respuesta inmune humoral y celular y dibuja un esquema de las mismas 305 .

siempre pensamos en la eliminación de produc-tos de desecho.10. 6. determina la cantidad de agua y de sales que hay en el organismo en cada momento. carente de células sanguíneas y de proteínas que se van acumulando en la cápsula renal antes de pasar.11). un sistema regulador del medio interno. La excreción es además. cada uno de los cuales está asociado a una cápsula renal (cápsula de Bowman). Estructura del riñón 6. La sangre llega al riñón (fig. ¿CÓMO FUNCIONA EL SISTEMA EXCRETOR? Cuando hablamos de excreción.8. es sólo una de sus funciones. En conjunto.10) por medio de la arteria renal. y expulsa el exceso de ellas de modo que se mantenga constante la composición química y el volumen del medio interno (homeostasis). 6. El sistema urinario elimina los productos nitrogenados. A través de las redes de los capilares se produce un ultrafiltrado. la vejiga urinaria por medio del uréter. principalmente la urea. un glomérulo y una cápsula renal forman un corpúsculo renal. 6. a través de pequeñas redes de capilares que se conocen como glomérulos. el asa de Henle y túbulo contorneado distal. y regula el equilibrio hídrico y salino (electrolitos). finalmente el ultrafiltrado llega al túbulo colector. Esta sin embargo. es decir.11. La orina que se produce en el riñón pasa a los cálices menores y de éstos a los cálices mayores. Estructura de una nefrona 306 . constituyéndose así la primera parte de una nefrona (fig. Durante este recorrido la composición del líquido va variando y el agua es recuperada. sucesivamente por el túbulo contorneado proximal. La eliminación final de la orina se realiza a través de la uretra.GUÍA METODOLÓGICA DE BIOLOGÍA 6.

¿CÓMO FUNCIONA EL SISTEMA NERVIOSO? El cuerpo humano es una maravilla en complejidad y coordinación. al estar leyendo esta página se realizan procesos muy complejos en el cerebro. a veces simultáneamente. 6. Por ejemplo. Asimismo se pueden percibir sonidos que se producen alrededor o sentir frío o calor al palpar un libro con los dedos. 307 . En el interior del cuerpo el corazón late. la sangre circula. si se piensa un poco en él se advertirá que lleva acabo muchas actividades. el estómago realiza la digestión y los pul-mones transportan aire. Todas estas actividades se realizan simultánea y requieren de un centro de control que las coordina: el sistema nervioso. algunas voluntarias y otras no.9.GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD. Completa el siguiente cuadro con los datos faltantes en cada recuadro.

Fig. la cual puede estar localizada a cierta distancia. 6. • Transmitir la señal a otras células nerviosas. estructuras que reciben información proveniente del medio tanto interno como externo (receptores). glándulas o músculos. el axón y las terminales sinápticas. • Conducir la señal a la terminación nerviosa correspondiente. Hay. Así como también estructuras que envían mensajes apartes del cuerpo que producen una respuesta específica (efectores). La neurona es la unidad fundamental del sistema nervioso y básicamente cumple las siguientes funciones: • Recibe la información del medio interno o externo y de otras neuronas.12 neurona El sistema nervioso se divide para su estudio en sistema nervioso central y sistema nervioso periférico. en el sistema que nos ocupa. Cada neurona (fig. 6. LAS NEURONAS El sistema nervioso está compuesto por células. Esta información y mensajes van en forma de señales eléctricas (impulso nervioso). 308 .GUÍA METODOLÓGICA DE BIOLOGÍA El sistema nervioso cumple con dos funciones básicas que son la coordinación de las diferentes acciones del cuerpo y la coordinación de las respuestas del cuerpo al mundo externo. • Integra la información que recibe y producir una señal de respuesta adecuada.12) está constituida por cuatro regiones distintas: las dendritas. el cuerpo celular o soma. llamadas neuronas. muy especializa-das e incapaces de reproducirse. • Coordinar las actividades metabólicas que mantienen la integridad de la célula.

y el líquido cefalorraquídeo. mesencéfalo y procencéfalo (fig. que son membranas de tejido conectivo.14). La médula oblonga controla diversas funciones autónomas como respirar. que protege al encéfalo. 6. El puente interviene en la transición entre el dormir y el despertar y entre los diversos estadios del sueño. las meninges (duramadre. y la columna vertebral. 6. El rombencéfalo está formado por la médula oblonga .13.GUÍA METODOLÓGICA DE BIOLOGÍA SISTEMA NERVIOSO CENTRAL Consta de encéfalo y médula espinal. aracnoides y piamadre). Médula espinal El encéfalo se localiza dentro de la cavidad craneana y tiene un peso aproximado de 1500g. En el centro de la médula espinal se localizan cuerpos de neuronas formando un área en forma de mariposa que es llamada la sustancia gris. Los órganos que protegen al sistema nervioso central son el cráneo. Consta de 3 partes: rombencéfalo. que es un líquido claro parecido a la linfa que actúa fundamentalmente como amortiguador. 309 . Inicia respuesta. Es la parte del sistema nervioso que recibe y procesa la información de los receptores. el puente y el cerebelo. La médula espinal (fig. El sistema nervioso central consiste principalmen-te en neuronas de asociación. que protege a la médula espinal. la presión sanguínea y la deglución. La médula espinal tiene como funciones conducir señales desde y hacia el encéfalo y controlar las actividades reflejas. El cerebelo coordina las actividades musculares(como caminar). Fig. 6. Está rodeada por haces de axones llamados sustancia blanca.13) es un cable neural que se extiende dentro del canal de la columna vertebral. desde la base del encéfalo hasta la cadera. genera pensamientos y emociones. almacena recuerdos. la frecuencia cardiaca.

de la piel y del interior del cuerpo. en el tono muscular y en ciertos movimientos y reflejos. que se comunican mediante una gran haz de axones. El sistema límbico comprende al hipotálamo. la memoria y la iniciación de acciones voluntarias. 6. Filtra la entrada de información sensorial antes de que llegue a las regiones conscientes del encéfalo. cumple una función importante en el sueño. tranquilidad. Estas estructuras trabajan juntas para producir las emociones más básicas. incluyendo miedo. Incluye principalmen-te a las áreas motora y sensitiva y áreas de asociación que analizan la información sensorial y planean los movimientos. el sistema límbico y la corteza cerebral. La corteza cerebral se divide en dos partes llamadas hemisferios cerebrales. sed y placer y las respuestas sexuales. La corteza cerebral es el centro del procesamiento de información. como la proveniente de las vías auditiva y visual. el cuerpo calloso. El procencéfalo. El sistema límbico es un grupo de estructuras localizado en un arco que se encuentra entre le tálamo y el cerebro. El tálamo lleva información sensorial al sistema límbico y al cerebro. es la capa más externa del procencéfalo. la amígdala y el hipocampo.GUÍA METODOLÓGICA DE BIOLOGÍA El mesencéfalo contiene la formación reticular. rabia. en aspectos emotivos.14. En los humanos la corteza cerebral constituye la mayor parte del encéfalo. Encéfalo 310 . Fig. impulsos y conductas. llamado también cerebro. comprende las siguientes partes: El tálamo. porciones del tálamo.

Sistema nervioso autónomo 311 . La porción motora del sistema nervioso periférico puede subdividirse en dos partes: el sistema nervioso somático y el sistema nervioso autónomo.15. incluyendo los músculos. respiratorio.GUÍA METODOLÓGICA DE BIOLOGÍA SISTEMA NERVIOSO PERIFÉRICO Consta de nervios periféricos que unen al encéfalo y a la médula espinal con el resto del cuerpo. los órganos de los sentidos y los órganos de los sistemas digestivos. Las neuronas sensitivas llevan información sensitiva hacia el sistema nervioso central que proviene de todas las partes del cuerpo. En los nervios periféricos existen axones de neuronas sensitivas y motoras. excretor y circulatorio. y las neuronas motoras llevan respuestas o señales desde le sistema nervioso central a los órganos y músculos. 6.

20) El sistema nervioso autónomo (fig.GUÍA METODOLÓGICA DE BIOLOGÍA El sistema nervioso somático controla los movimientos voluntarios al activar los músculos esqueléticos. del tipo “pelea o huida” mientras que el sistema nervioso parasimpático domina durante tiempos de “descanso”.15) consta de dos divisiones. el olfato. estos dos sistemas hacen contacto sináptico con los mismos órganos. • Mecanorreceptores. 6. El sistema nervioso autónomo controla las respuestas involuntarias al influir sobre órganos. • Fotorreceptores. ORGANOS DE LOS SENTIDOS Desde el nacimiento se entra en contacto con el mundo que nos rodea en diferentes formas. dirige el mantenimiento de actividades como la digestión. la vista y el oído. Estos receptores se encuentran en la boca y en la nariz. 5. la presión y otros estímulos mecánicos. El sistema nervioso autónomo es controlado tanto por la médula como el hipotálamo del encéfalo (fig. sonido. En el cuerpo humano se presentan 3 tipos de receptores que se clasifican como: • Quimiorreceptores. pero producen efectos opuestos. El sistema nervioso simpático prepara al cuerpo para las situaciones estresantes o que requieran actividad. en el agua y en los alimentos. A través del sistema nervioso y los órganos de los sentidos se reciben los estímulos como sensaciones de color.-Se encuentran en los ojos y son estimulados por la luz. el sistema nervioso simpático y el parasimpático. 312 . luz. el tacto. Los órganos de los sentidos son el gusto. Estimulados por substancias químicas que se encuentran en el aire. dolor. Se encuentran en la piel y en los oídos y responden a las vibraciones. Las señales del mundo exterior son captadas por los receptores de los sentidos como estímulos que se envían al encéfalo. glándulas y músculo liso.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Con la información proporcionada elabora un cuadro sinóptico de cómo está organizado el Sistema Nervioso 313 .

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental sobre los órganos de los sentidos y construye un mapa conceptual de los mismos. 314 .

Sus efectos son: • Estimulante. Una hormona es una sustancia química producida por una célula que afecta el metabolismo de otra célula. del nombre de la hormona o la función de ésta. Las más importantes son: hipófisis. Las hormonas se producen en pequeñas cantidades.10. ¿CÓMO FUNCIONA EL SISTEMA ENDOCRINO? Junto con el sistema nervioso. tiroides. Disminuye actividad en un tejido. Ejemplo: hGH y T3/T4 • Trópica. la mucosa del estómago o el revestimiento de los conductos pancreáticos. afectan tejidos que pueden encontrarse lejos del punto de origen de la hormona y su efecto es directamente proporcional a su concentración. viajan por la sangre. Cuando un par de hormonas tiene efectos opuestos entre sí. por medio de mensajeros químicos llamados hormonas. páncreas. Cuando dos hormonas en conjunto tienen un efecto más potente que cuando se encuentran separadas. Esta es una hormona que altera el metabolismo de otro tejido endocrino. se liberan al espacio intercelular. suprarrenales. ovarios. Ejemplo: somatostatina • Antagonista. Promueve actividad en un tejido. Ejemplo: prolactina • Inhibitorio. paratiroides. Ejemplo: gonadotropina ACTIVIDAD A continuación realiza una investigación documental y completa los recuadros vacíos del nombre de la glándula. Por ejemplo: insulina y glucagón • Sinergista. testículos Las glándulas exocrinas liberan sus secreciones sobre la superficie interna o externa de los tejidos cutáneos.GUÍA METODOLÓGICA DE BIOLOGÍA 6. Las glándulas endocrinas liberan sus secreciones directamente en el torrente sanguíneo. según corresponda 315 . controla muchas de las funciones del cuerpo.

GUÍA METODOLÓGICA DE BIOLOGÍA GLAN DULA HORMONA Somatotropina (hormona de crecimiento humana. absorción y catabolismo de grasas. Hipersecreción causa galactorrea en personas no lactantes Hipófisis Anterior Tiroideoestimulante TSH Promueve el crecimiento y desarrollo normal de la corteza adrenal y estimula sus secreciones Estimula maduración de folículos primarios y secreción de estrógenos en la mujer. Estimula contracción uterina y expulsión de leche. Hiposecreción en la niñez produce enanismo hipofisiario o proporcional. Luteinizante (LH) Estimulante de Melanocitos (MSH) Antidiurética (vasopresina) ADH Se cree que ayuda a mantener la sensibilidad de la adrenal a la ACTH. Hipersecreción se distingue porque promueve pigmentación en los melanocitos. (hGH) FUNCIÓN Acelera indirectamente el anabolismo proteico. disminuye el catabolismo de carbohidratos. Epífisis Melatonina 316 . Una hipersecreción en la niñez genera gigantismo. Estimula secreción láctea en las glándulas mamarias. se almacena en la pituitaria. Contribuye junto con la prolactina una lactancia exitosa. Hipófisis Posterior Producida por el hipotálamo. en la adultez genera acromegalia. Estimula desarrollo de túbulos seminíferos y mantiene espermatogénesis en el hombre.

T4 Regula (disminuyendo) la concentración de calcio en la sangre estimulando la actividad de los osteoblastos (estimula depósito de sales en huesos) y reduciendo la de los osteoclastos Paratiroides Paratohormona PTH Timosinas Familia de hormonas que estimulan la producción y maduración de linfocitos T Mineralocorticoides (aldosterona. 317 .GUÍA METODOLÓGICA DE BIOLOGÍA Triyodotironina Tetrayodotironina T3. Gonadocorticoides Médula adrenal Prolongan e incrementan el efecto de la estimulación simpática del sistema nervioso autónomo en situaciones de estrés. etc) Corteza adrenal Acelera la gluconeogénesis y el catabolismo lípido.

GUÍA METODOLÓGICA DE BIOLOGÍA Glucagón Estimula la entrada de nutrientes a las células y favorece su metabolismo. Ovario Progesterona Mucosa gastrointestinal Gastrina Secretina Colecistocinina 318 . Disminuye concentración de glucosa en sangre Somatostatina Testículo Desarrollo y mantenimiento de características sexuales femeninas y ovulación.

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Ubica cada glándula y escribe su nombre en la línea. Colorea cada glándula de distinto color 319 .

Estas estructuras en conjunto contribuyen a la formación y transporte del líquido seminal.11.16). ¿CÓMO FUNCIONA EL SISTEMA REPRODUCTOR? En la reproducción sexual se necesita la participación de la pareja ya que cada uno aporta su célula sexual correspondiente que lleva la mitad de la información genética. ya que elaboran y secretan hormonas sexuales.GUÍA METODOLÓGICA DE BIOLOGÍA 6. SISTEMA REPRODUCTOR FEMENINO. oviductos o trompas de Falopio. glándulas bulbouretrales o de Cowper y vesículas seminales. Los testículos son órganos tanto citógenos o productores de células nuevas. llamadas testículos. como ya se mencionó. y el líquido seminal secretado por los conductos y glándulas. y contiene sustancias nutritivas para ellos. las características primarias incluyen las gónadas. Las características sexuales secundarias. 6. finalmente el pene (órgano de penetración) (fig. útero y vagina. presentándose variedad y lo más importante evolución. también se distinguen como primarias y secundarias. caracterizan a una mujer en su exterior. El líquido seminal que se mezcla con los espermatozoides antes de la eyaculación tiene gran importancia y variedad de funciones. labios menores y clítoris. ayuda a protegerlos de los efectos nocivos de la acidez del tracto genital femenino. que consisten en los labios mayores. Desde luego se hallan bajo el influjo constante de las hormonas sexuales femeninas. SISTEMA REPRODUCTOR MASCULINO. Así. pero además sirve para lubricar los conductos a través de los cuales pasan los espermatozoides. principalmente sirve como medio de transporte para los espermatozoides. tres conjuntos de glándulas llamadas próstata. se mezclan para formar el semen. los espermatozoides producidos en los testículos. En el cuerpo del hombre. Las características sexuales de la mujer. que se conocen como órganos reproductores internos. como glándulas endocrinas. El sistema reproductor femenino está formado por ovarios. y un sistema de órganos sexuales accesorios que consisten principalmente en una serie compleja de conductos. Además los genitales externos o vulva. 320 . para que al unirse las dos células (fecundación) den origen al nuevo ser con rasgos de los dos participantes.

GUÍA METODOLÓGICA DE BIOLOGÍA Fig. Sistema reproductor masculino ESTRUCTURA Testículo Epidídimo y conducto deferente Uretra. Secretan moco para lubricar la uretra peneana y la vagina. Glándulas de Cowper (bulbouretrales). Principales órganos del Sistema Reproductor Masculino 321 . Almacenan y conducen espermatozoides a la uretra.16. 6. Vesículas seminales. Próstata. Secretan substancias que contienen fructuosa (fuente de energía) y prostaglandinas (se supone que ocasionan cambios en la posición de los órganos reproductores femeninos para asegurar y ayudar al transporte de los espermas en su interior durante la búsqueda del óvulo). Se retan sustancias básicas que neutralizan la acidez vaginal. Deposita los espermatozoides en el sistema reproductor femenino. además contienen factores que aumentan la motilidad de los espermatozoides. Pene FUNCION Produce espermatozoides y testosterona.4. Tabla 6. Conduce el semen desde el conducto deferente y la orina desde la vejiga al meato urinario (punta externa).

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y explica qué sucede en la siguiente figura de los túbulos seminíferos. 322 .

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y explica qué sucede en la siguiente figura del ovario 323 .

Aloja y alimenta al feto cuando hay embarazo Funciona como receptáculo de los espermatozoides durante el coito Sitio de extrema sensibilidad Se hincha al llenarse de sangre durante la excitación sexual.GUÍA METODOLÓGICA DE BIOLOGÍA Fig. 6. progesterona y estrógenos Transportan los óvulos desde los ovarios hasta el útero Útero El endometrio se engruesa para anidar al óvulo.17. Vagina Vulva Clítoris 324 . Sistema reproductor femenino ESTRUCTURA Ovario Trompa de Falopio u oviducto FUNCION Produce óvulos.

Realízalo en varios pliegos de papel bond y señala con un mismo color los órganos pertenecientes a cada sistema. jaleas y óvulos anticonceptivos. el tipo de pareja (sí es estable o no). los anticonceptivos hormonales. Se sugiere que elaboren un mapa conceptual por cada sistema (como el mapa del sistema digestivo de la página 298). Utilizando los conocimientos acerca de la estructura y funcionamientos de cada uno de los órganos y sistemas del cuerpo humano realiza un mapa conceptual integrador donde señales la interrelación que existe entre los diferentes órganos de los diferentes sistemas. no requieren de la consulta médica para su prescripción. ACTIVIDAD Se conformarán equipos de cuatro integrantes. 325 . para que después los juntes e interrelaciones. en plenaria se presentará el mapa conceptual. Los métodos y técnicas anticonceptivas se clasifican en diversos grupos según determinadas características: los anticonceptivos de barrera física. así como la actividad y la motivación para la utilización de los métodos anticonceptivos. los métodos naturales y los métodos quirúrgicos o definitivos. Solo los llamados anticonceptivos de barrera como el condón y las espumas. Es el Médico quien deberá orientarlos y guiarlos. En la vida sexual de los jóvenes hay que tomar en cuenta diversos factores como la frecuencia de actividad sexual. Al final. Debes incluir todos los órganos y sistemas del cuerpo. para que de manera conjunta se tome una decisión adecuada a cada situación. Muchos de estos anticonceptivos pueden ser en realidad una mezcla o combinación de dos o más métodos y cada uno de ellos tienen las indicaciones de uso para obtener buenos resultados y alcanzar su máxima efectividad. Hay diferentes métodos anticonceptivos que pueden ser utilizados por jóvenes y adolescentes.GUÍA METODOLÓGICA DE BIOLOGÍA ANTICONCEPCIÓN El criterio para recomendar y utilizar un método anticonceptivo en los jóvenes y adolescentes es muy diferente del empleado para las personas de mayor edad. de barrera química. el desarrollo físico y emocional. los dispositivos intrauterinos (DIU).

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Realiza una investigación documental y llena el siguiente cuadro de los métodos anticonceptivos 326 .

GUÍA METODOLÓGICA DE BIOLOGÍA ACTIVIDAD Completa la tabla escribiendo el nombre de los órganos y las funciones que realiza cada sistema del cuerpo humano SISTEMA ÓRGANOS FUNCIÓN Tegumentario Muscular Óseo Digestivo Respiratorio Circulatorio Linfático Excretor Nervioso Endocrino Reproductor 327 .

Reimpresión. y Byers. Segunda Edición. 328 . T. (2008). ACTIVIDADES DE APRENDIZAJE: • Resolución de las actividades de la Guía Metodológica • Elaboración de modelos anatómicos • Investigación documental • Reportes de laboratorio en V de Gowin • Construcción de mapas mentales. B. ACTIVIDAD ESPECÍFICA: • Portafolio de evidencias Examen departamental tipo CENEVAL o PISA Laboratorio (evaluación V-Gowin) Actividades de aprendizaje Actividad específica por unidad DIAGNÓSTICA FORMATIVA SUMATIVA 30% 20% 20% 30% MATRIZ DE VALORACIÓN DE COMPETENCIAS Criterios Relaciona la estructura y función de los diferentes órganos y sistemas del cuerpo humano a través de mapas mentales Ponderación Logros: Pre-formal Identifica la estructura y la función de los diferentes sistemas del cuerpo humano a través de mapas mentales. Puntos 30 Puntos 5 Puntos 20 Puntos 30 Aspectos a mejorar : BIBLIOGRAFÍA BÁSICA Atlas Visual del Cuerpo Humano (2009). PearsonPrentice Hall. Ciencia y Naturaleza. • Elaboración de material de difusión. Audesirk . Arquetipo Grupo Editorial. Biología.GUÍA METODOLÓGICA DE BIOLOGÍA EVALUACIÓN A través de esquemas impresos de cada uno de los sistemas del cuerpo humano se le indicará al alumno que identifique y escriba las estructuras que los componen. Receptivo Relaciona la estructura y función de algunos órganos de los sistemas del cuerpo humano a través de mapas mentales Puntos 10 Resolutivo Relaciona la estructura y función de los órganos y algunos sistemas del cuerpo humano a través de mapas mentales Autónomo Relaciona la estructura y función de los órganos y sistemas del cuerpo humano a través de mapas mentales Estratégico Relaciona como la estructura de órganos y sistemas del cuerpo humano trabajan de manera conjunta desempeñando una función coordinada.

Ed. • Universo Interior. Editorial océano. 11ª edición. Mc. Histología. España. Ed. Fundamentos de Anatomía y Fisiología. Revista On Line de Educación. 4 La piel (DVD en español) • Atlas del Cuerpo Humano. www. (2007). Villee. Ed. Discovery Channnel.GUÍA METODOLÓGICA DE BIOLOGÍA Tortora. Gerald y J. 5 Glándulas y Hormonas (DVD en español) • La Increíble Máquina Humana. (2002) Principios de Biología. Editorial Limusa Willey. (1999). Tres Guerras Jesús: (2009) Anatomía y Fisiología del Cuerpo Humano. Nelson. BIBLIOGRAFÌA COMPLEMENTARIA Atlas visual de las ciencias. Anatomía Comparada. función. J. Prometeheus: (2011) Atlas de Anatomía Fichas de autoevaluación. México. Gideon E. Anagnostakos. España. Médica Panamericana. VIDEOS RECOMENDADOS • Atlas del Cuerpo Humano. (2011). Geneser.org/teen/en_espanol/cuerpo/lungs_esp. 3ra. (2000) Biología. (2000). Ed.McGraw-Hill/Interamericana. Planeta de Agostini. Tortora. Reimpresión de la Segunda Edición. Anagnostakos. Gilroy. Ed. Médica Panamericana. Kardong. Principios de Anatomía y Fisiología. Primera Edición en español. Introducción al Cuerpo Humano. Anne M. (2011). Tercera Edición.com. evolución. séptima edición. J.html 329 . Gerald y J. National Geographic • Cuerpo humano. Médica Panamericana. Claude A. Vol. Vol. Editorial Mc Graw-Hilll. Grupo Docente. Ed. Finn. Médica Panamericana. TIC’s http://kidshealth. Octava Edición. Kenneth V. Discovery Channnel. Video Shark. Graw Hill/ Interamericana.

Sign up to vote on this title
UsefulNot useful