Está en la página 1de 168

KUINSKAS

Vadovlis auktj m okykl slaugos ir socialini moksl bei auktesnij m edicinos m okykl studijom s

1
Kaunas viesa" 2001

1. Genetins informacijos perdavimas i kartos kart: molekuli lygmuo / 10 1.1. Paveldimumo molekuli struktra / 10 1.1.1. DNR struktra / 10 1.1.2. RNR struktra / 14

>

1.2. DNR lstelje / 16 1.3. Genetins informacijos atsikartojimas: DNR dvigubjimas (replikacija) / 18 1.4. Genas - DNR molekuls dalis / 21 1.5. Organizm o genetins informacijos iraika: geno raika / 2 5 1.5.1. Genetins informacijos nuraymas (transkripcija): RNR sintez / 2 6 1.5.2. RNR brendimas / 2 8 1.5.3. Genetins informacijos perklimas polipeptido aminorgi sek / 2 9 1.5.3.1. Genetinis kodas / 2 9 1.5.3.2. tRNR - genetins kalbos vertja" / 3 2 1.5.3.3. Ribosoma - polipeptid sintezs fabrikas" / 3 3 1.5.3.4. Baltymo sintez (transliacija) / 3 3 1.5.4. Gen raikos reguliavimas / 3 6

c
3

2. G enetins informacijos p erdavim as i kartos j kart: lsteli lyg m u o / 4 0 2.1. Lstels ciklas / 4 0 2.2. Chromosomos - lstels paveldjimo nejos / 4 2 2.3. Chromosomos per mitoz: genetins informacijos rinkinio pastovumas lsteli kartose / 4 7 2.4. Chrom osom os organizm o lytinio dauginimosi laikotarpiu / 5 0 2.4.1. Lytinis dauginimasis - organizm genetinio vairavimo altinis / 5 0 2.4.2. Chromosomos per mejoz: gametos gauna lygiai pus dvigubojo chrom osom rinkinio / 51 2.4.3. Apvaisinimas sugrina dvigubjj organizm o somatini lsteli chromosom rinkin / 5 5 2.4.4. Ryys ta rp mejozs ir lytini lsteli susidarymo / 5 6 2.4.5. Mejozs taka kombinaciniam kintam um ui / 5 8 3. Genetins informacijos perdavim as i kartos kart: o rganizm lygm uo / 6 0 3.1. Genai dvigubajame chrom osom rinkinyje / 6 0 3.2. Nepriklausomas poymi ir juos lemiani gen paveldjimas / 6 2 3.2.1. M onohibridinis kryminimas: alternatyvius poymius lemia du aleliniai genai / 6 2 3.2.2. Dihibridinis kryminimas: nealeliniai genai paveldimi nepriklausomai vienas nuo kito / 6 6 3.2.3. X chrom osom oje esani gen paveldjimo ypatum ai / 6 9 3.3. Gen sankiba ir paveldjimo ypatum ai / 7 2 3.4. Kas ikreipia paveldjim pagal M endelio dsnius / 7 6 3.4.1. Gen sveika / 7 6 3.4.2. Kiti genetins informacijos realizavim lemiantys mechanizmai / 8 2 3.5. mogaus poymi paveldjimas / 8 4

n d a i i s E E K a H i 1. M utacinis k in ta m u m as / 92 1.1. M utacij vairov / 9 4 1.1.1. Lytini ir somatini lsteli mutacijos. Tiesiogins ir grtamosios mutacijos / 9 4 1.1.2. Genotip keiianios mutacijos / 9 4 1.1.2.1. Genom o mutacijos / 9 4 1.1.2.2. Chrom osom mutacijos / 9 6 1.1.2.3. Gen mutacijos / 1 0 0 1.1.3. M utacijos pagal fe n o tip o pokyius / 1 0 3 1.1.4. DNR paaid reparacijos sistemos gen m utacijos / 1.2. M utacij atsiradim o danumas ir prieastys / 1.2.2. Chemin m utagenez / 1 0 7 1.2.3. Aplinkos m utagenai / 1 0 8 2. M odifikacinis kin ta m u m as / 1 1 0 2.1. Reakcijos norma ir statistiniai m odifikacinio kintam um o dsningumai / 2.2. Teratologiniai reikiniai / 1 1 2 keitim as / 1 16 117 110 106 107 105

1.2.1. M utageninis jonizuojaniosios spinduliuots poveikis /

3. Nauji g e n e tin io k in ta m u m o altiniai: tikslingas g en etin s informacijos 3.1. Rekombinantins DNR molekuls konstravimas / 3.2. Polimerazin grandinin reakcija / 1 2 3 * | F 3.3. Gen technologijos taikymas / 125 3.3.1. Biotechnologijos produktai / 1 2 5 a tH 3.3.2. Transgeniniai organizmai / 1 2 6 3.3.3. Organizm klonavimas / 1 2 9 3.3.4. Gen terapija / 13 1 % ^ ^ 132

4. Paveldimosios m o n i ligos / 4.1. Chromosomins ligos / 1 3 3

4.1.1. C hrom osom skaiiaus pokyiai / 1 3 3 4.1.2. Struktriniai m ogaus chrom osom persitvarkymai / 4.2. M onogenins ligos / 1 3 9 4.2.1. Autosom ins dom inantikai paveldimos ligos /

136

4.1.3. Lytini chrom osom skaiiaus ir struktros pokyiai / 1 3 7 139

4.2.2. Autosomins recesyviai paveldimos ligos / 141 4.2.3. Su X chromosoma susijusios dominantikai ir recesyviai paveldimos ligos / 1 4 3 4.3. Neseniai atskleisti m onogenini lig atsiradimo mechanizmai / 1 4 7 4.3.1. Dinamins m utacijos / 4.3.3. Mozaikikumas / 148 149 147 147 4.3.2. Genom o spaudas (im printingas) /

4.3.4. Su m itochondrij DNR susijusios ligos / 4.4. Polinkio ligai paveldjimas / 1 4 9 4.5. Paveldima vio prigim tis / 151

4.6. Genetiniai paveldimj lig diagnozavim o m etodai / 5. m ogaus g e n o m o pro jektas / 156

153

4.7. Genetinis eim konsultavimas - asmens sveikatos prieiros paslauga / 1 5 4 6. G e n etin populiacij v airo v / 1 6 0 6.1. Populiacij genetins vairovs altiniai / 161 6.2. Lietuvos gyventoj genetins vairovs ypatum ai / Rekomenduojama literatra / Padkos odis / 174 172

167

Genetikos svoka

Fizini savybi paveldjimas m onij d o m in o irte b e d o m in a nuo seniausi laik1. Buvo pasilyta daugyb paveldjimo teorij, kurios ilgainiui nepasi tvirtin o . G. Mendelis (G. Mendel), austr vienuolis, gyvens ir dirbs ekijoje (M ora vija), Brno mieste, pirmasis suprato paveldjimo dsnius ir 1 8 5 6 -1 863-aisiais, pasitelkdamas matem atins statistikos principus, rod juos eksperimentais. G. Mendelis pirmasis apra, kaip ir kokiomis proporcijomis paveldjimo veiks niai (dabar inome, kad tai genai) bei j nulem ti poymiai yra perduodam i i kartos kart. Ir iandien, apsilank Brno mieste, rasite G. M endelio bibliotek ir lysveles, kuriose augalai fenotipikai pagal spalv pasiskirsto santykiu 3:1. Savo eksperim ent rezultatus mokslininkas paskelb 1865-aisiais Brno gam tos tyrintoj draugijos posdyje ir 1866-aisiais tos draugijos mokslo darbuose. Taiau to m eto botanikai M endelio dsni nepripaino, ir i vertinga media ga iguljo mokslo a utoritet staliuose iki 1900-j. Nuostabu ir tai, kad madaug tu o pat m etu (1 8 4 2 -1 859-aisiais) . Darvinas (Ch. Darwin) suformulavo evoliucijos teorij, o eugenikos2 pradininkas F. Goltonas (F. Galton) (beje, netikras . Darvino pusbrolis) intensyviai tyrinjo kie kybini poymi, kaip antai m ogaus gis, paveldjim. Prajus trejiems m etams nuo G. M endelio atradim o - 1869-aisiais veicar biologas F Myeris (F. Miescher) i lstels branduolio iskyr mediag, kuri . pavadino nukleinu, t. y. branduolio mediaga. Spaudai pateiktas jo straipsnio rankratis nepajudjo nuo redaktoriaus stalo dvejus metus, kol redaktorius pats patikrino ir sitikino F Myerio gaut rezultat patikim um u. Tik vliau, . 1871-aisiais, straipsnis buvo paskelbtas. M adaug po trylikos m et ( 1 8 8 2 - 1 885-aisiais) lstels branduolyje pa stebtos chrom osom os3 ( pavadinim 1888-aisiais pasil H. V. G. Valdejeris (H. W. G. W aldeyer)) ir nustatyta, kaip jos keiiasi ir juda per m itoz, t. y. lstelei dalijantis. Kur kas anksiau, dar XVIII a., buvo aprayti pagrindiniai m ogaus d efekt paveldjim o tipai. Prancz mokslininkas P.- L. M. de M o p e rtiu ji (P.- L. M. de M aupertuis) 1751-aisiais apra polidaktilijos (etojo rankos pirto) bei pig m entacijos tr k u m o (albinizm o) paveldjim ir nurod, kad ie poymiai pa veldim i skirtingai. A n g l gydytojas J. Edamsas (J. Adam s) atskleid ir apra ( 1 8 1 4 - 1 8 1 5-aisiais) pagrindinius paveldjim o dsningum us. Taigi nors atskiri fa kta i apie paveldjim o dsnius, j cito lo g in iu s p a g rin dus ir chem in p rig im t buvo ino m i jau XIX amiaus pabaigoje, taiau prajo dar daug laiko, kol ie fa kta i buvo a p ib e n d rin ti ir sukurtas iuolaiki nis g e n e tik o s mokslas, t. y. b io log ijo s m okslo aka, tiria n ti org an izm p a v e ld im u m ir k in ta m u m Pagrindin g enetikos svoka yra g e n a s 4. Jau G. M endelis ir jo sekjai ino jo p a ve ld im u m o vienet, tik kitu pavadinim u. Termin genas" (kaip, beje, g e n o tip o bei fe n o tip o te rm inu s) pasil dan m okslininkas V. L. Johansenas (V. L. Johannsen) 1909-aisiais. Skaitydam i io vadovlio skyrius suinosite, kas yra genas, susipainsite su jo chem ine p rig im tim i, veikim u ir kaip jis yra perduodam as palikuonim s. Kiekvienas ms tu rim e genus, paveldtus i savo tv. Juos galsime p e rd u o ti ir savo vaikams. Taigi genetika - tai mokslas, glaudiai susijs su m o g u m i. Kiekvienas visuom ens narys tu r t suprasti paveldjim o dsnin gum us, kad atsidrs kritin je situacijoje nep ad aryt le m tin g klaid. Genetika nra vien a bstraktus mokslas. Ji - ms g yvenim o dalis.

Pirmosios nuorodos apie orga nizm o poymi bei lig paveldji m aptinkam os hebraj Talmude (III-V a. pr. Kr.), kur sergstima dl pavojaus atlikti ritualin naujagi mi berniuk apipjaustym, jei j broliai ar vyrikosios lyties gimins i m o tin o s puss serga kraujo nekrejimo liga (hem ofilija). 2Eugenika (gr. eugenes - ge ros kilms) - teorija, teigianti, kad genetikos principais remiantis ga lima gerinti mogaus paveldimas savybes, kreipti mogaus evoliu cij pageidaujama linkme. ian dien eugenika visuotinai nepriim tina. 3gr. chrom - spalva; som a knas 4gr. genos - gim in, kilm Genetika palyginti jaunas mok slas. Taigi ir jos terminai vis dar ku riami. Iekoti lietuvik atitikm en vairi lygmen genetiniams pro cesams bei vienetams vardyti - to kia pagrindin knygos autoriaus pozicija. Todl terminai vartojami sinonimikai. Greta tarptautinio va rianto kaip teiktinesnis pateikiamas lietuvikas atitikm uo arba abu va riantai vartojami kaip lygiaveriai, danai juos papildant vairiais da lykin turin paaikinaniais odi deriniais ar vaizdiomis pakaitomis.

L /L J

Nobelio premijos u laimjimus, susijusius su paveldjimo ir jo molekulini pagrind tyrimais Nobelio premijos laureatai Darbai, u kuriuos suteikta Nobelio premija U atradim us tiria n t ankstyvojo em brioninio vystymosi genetin kontrol.

Metai Sritis

1995 Fiziologija E B. Liujisas (E. B. Lewis), . ir medicina K. Niuslein-Volhard (Ch.NssIein-Volhard) ir E F Vyauzas (E. F Wieschaus) . . . 1993 Fiziologija R D. Robertsas (R. J. Roberts) U pertrauktj gen atradim, . ir medicina ir F A. arpas (P. A. Sharp) . 1993 Chemija K. B. Miulis (K. B. Mulls) U DNR chemins sintezs metod vystym: u polimerazins grandi nins reakcijos (PGR) atradim. M. Smitas (M. Smith) U kryptingosios mutagenezs atra dim ir jos taikym tiriant baltymus. 1989 Fiziologija D. M. Biopas (J. M. Bishop) U retrovirusinionkogen lstelins ir medicina ir H. E. Varmusas (H. E Varmus) kilms iaikinim. . 1989 Chemija S. Altmanas (S. Altman) U RNR katalitini savybi atradim, ir T R. Cechas (T. R. Cech) . 1983 Fiziologija B. Maklintok (B. McClintock) Ujudrij genetini element atra ir medicina dim. 1980 Chemija P Bergas (P Berg) . . U nukleorgi, ypa rekombinantins DNR, biochemijos tyrimus. V Gilbertas (W. Gilbert) . U nukleotid sekos bakteriofago deir F Sangeris (F. Sanger)2 . oksiribonukleorgties molekulje nustatym. 1978 Fiziologija V Arberis (W. Arber), . U restrikcijos ferment atradim ir ir medicina D. Natanas (D.Nathans) j pritaikym molekulinje genetiir H. 0. Smitas (H. 0. Smith) koje. 1975 Fiziologija D. Baltimoras (D. Baltimore), U atradimus tiriant augli virus ir medicina R Dalbekas (R. Dulbecco) . ir lstels genetins mediagos sirH. M. Tiominas veik. (H. M. Temin) 1969 Fiziologija M. Delbrukas (M. Delbrck), U j atradimus tiriant virus geneir medicina A. D. Fleris (A. D. Hershey) tin struktr ir dvigubjimo mechair S. A. Liurija (S. E. Luria) nizmus. 1968 Fiziologija R. V Holi (R. W. Holley), . U genetinio kodo ir jo funkcijos sinir medicina H. G. Korana (H. G. Khorana) tetinant baltymus iaikinim, ir M. V Nirenbergas . (M. W. Nirenberg) 1965 Fiziologija F akobas (F. Jacob), . ir medicina A. Lvovas (A. Lwoff) ir. Mono (J. Monod) 1962 Fiziologija F H. K. Krikas (F. H. C. Crick), . ir medicina D. D. Votsonas (J. D. Watson) ir M. H. F Vilkinsas . (M. H. F Wilkins) . 1959 Fiziologija S. Ooa (S. Ochoa) ir medicina ir A. Kornbergas (A. Kornberg) 1958 Fiziologija G. K Bydlis (G. W. Beadle) ir medicina ir E. L. Teitumas(E. L. Tatum) U atradimus tiriant virus ir ferment sintezs genetin kontrol. U nukleorgi struktros ir jos reikms gyv organizm informacijos perdavimui iaikinim.

- 1 = ; ao enklo pateikiama - e c r o k r i papildo arba praa e a r x - = s genetikos temas, r<aat ~a t e g i n u s ar suteikia aru. iru aut. past ) . .

F y - a lm a i
- -aaviniai V c e . c prem ja F. Sangeriui s t f B k a c 958-aisiais u prow u s r j r r l ' o s (ypa insulino)

y n s
~*\ ass s e p tik a s vertintas

V x e ic z rs r-**

U ribonukleorgi ir deoksiribonukleorgi biosintezs tyrimus. U atradim, iaikinus, kad genai veikia reguliuodami tikslius cheminius procesus. J. Lederbergas (J. Lederberg) U atradimus tiriant genetin rekom binacij ir bakterij genetins media gos ukodavim. 1946 Fiziologija H. J. Maleris (H. J. Muller) U atradim, kad Rentgeno spindu ir medicina liai sukelia mutacijas. 1933 Fiziologija T H. Morganas (T. H. Morgan)3 U chromosom takos paveldjimui . ir medicina tyrimus.

P a v e ld im u m a s

J
Genetins informacijos perdavimas i kartos j kart: molekuli lygmuo

Jau XIX amiaus pabaigoje mokslininkai sitikino, kad lstels branduolys yra svarbus paveldjimui. ioje srityje ypa pam intinos H. de Fryso (H. de Vries) pangenezs idjos bei valgos, jo g paveldim um o vienetai gldi lstelje jos branduolyje ir perduodam i i lstels lstelei dalijantis. Antra vertus, sukl daug gin A. Veismano (A. VVeismann) darbai, bene labiausiai po . Darvino atkreip gam tos m okslinink dmes paveldim um o vienetus - chrom oso mas. Galiausiai nesidalijaniame lstels branduolyje buvo aptikta grdtoji mediaga, pavadinta c h r o m a tin u 1, ir nustatyta, kad chro m a tin sudaro baltymai, polisacharidai ir nukleorgtys. Ilg laik mokslininkai neinojo ma terialiosios paveldimumo prigimties, kuri gi lstels branduolio mediaga nukleorgtys ar baltymai perduoda informacij apie paveldimsias organizm o savybes. Net po T. H. M organo ir jo koleg chromosomins paveldimumo teorijos neturta tiksli m olekulinio lygmens duom en. Tik 1940 1953-iaisiais eksperimentais rodyta, kad paveldimum lemia deoksiribonukleorgtis. is laikotarpis laikytinas svarbiausiais molekulins genetikos raidos metais.

Deoksiribonukleorgt, arba DNR (ang. deoxyribonucleic acid, DNA), silo ma lietuvikai vadinti deoksiribobranduolio rgtimi (DBR). Ribonukleorgtis, arba RNR (ang. ribonucleic acid, RNA), lietuvikai vadintina ribobranduolio rgtimi (RBR). E u kariotai ir p ro k a rio ta i Genetins informacijos ukodavimas lstelje ir jos perdavimas dukterinms ls telms tiesiogiai priklauso nuo to, ar lstel turi membrana apsupt branduol2 ar , jo neturi. Pagal poym organizmai yra skirstomi : * branduolio neturinius prokariotus; branduol turinius eukariotus Prokariotai - tai primityviausi organizmai - bakterijos ir melsvadumbliai. Be to, prie j dar priskiriami virusai. Eukariotams priklauso dumbliai (iskyrus melsvadumblius), grybai, auktesnieji augalai ir gyvnai.

1. 1.
Paveldimumo molekuli struktra

DNR m olekul yra milinikas polimeras, kurio struktriniai vienetai (monom erai) yra d e o k s irib o n u k le o tid a i (daniausiai vadinami tiesiog nukleotidais), sujungti ilgas grandines. Kiekvienas deoksiribonukleotidas (1.1 pav.) sudarytas i trij ri m olekuli (tiksliau, j liekan): azoto turinios bazs, m onosacharido deoksiribozs ir fosfa to (fosforo rgties liekanos). A zo to turinios bazs nukleorgi m olekulse yra keturi ri: dvi i j - citozinas (C) ir tim inas (T) - yra pirim idinai, sudaryti i vieno anglies ir azoto atom iedo, o kitos dvi - adeninas (A) ir guaninas (G) - yra purinai, sudaryti i dviej ied. DNR m olekul purino bazi (A + G) visuom et tu ri tie k pat kiek ir p irim idino bazi (T + C). Tai argafo taisykl (pavadinta j nustaiusio m okslininko E. argafo (E. C hargaff) garbei). Taigi DNR su da ro k e tu ri ri n u k le o tid a i, s u ju n g ti k o va le n tin m is fo s fo d ie s te rin m is ju n g tim is (1.2 pav.). i DNR m olekuls n u kle o tid seka vadinam a p irm in e DNR s tru k t ra . Ji uraoma kaip keturi raidi A, T, C ir G, ym ini n u k le o tid bazes, rinkinys, pvz., ...ATTCATCCGAAA T G C .J r ta ip iki keli m ilijard raidi. Jau inom a, kad m ogaus lytin lstel tu ri apie 3,3 m ilijardo n u kle o tid bazi. Pirmins DNR s tru kt ro s nustatym as vadinam as s e k v e n a v im u 3. Dabar proces (dar visai nese niai reikalavus d id iulio kruoptaus rank d arbo ) atlieka k o m p iu te ri val dom i a u to m a tin ia i DNR analizatoriai (sekvenatoriai). 1944-aisiais O. T. Eiveris (O. T. A ve ry), M . M a k a rtis (M . M c C a rth y ) ir . M. M akliaudas (Ch. M. M acleod) iaikino DNR reikm paveldim um ui.

1 .1 .1 .
DNR struktra

Tai chrom osom as sudaranti lstels branduolio mediaga < gr. karyon - rieutas, rie uto branduolys 3Sekvenavimas (sekavimas) n u k le o tid sekos n u statym a s, svarbiausias pirmins geno struk tros tyrim o etapas.

1.1 pav.
N ukleotid sandara. Skaiiais nuo 1 iki 9 ir nuo 1' iki 5' ymima ato m o padtis molekulje

NH, H C |

NH
| u r a c ila s

g u an in as

*
FOSFATAS
-^rta s prisijungia prie nukleozido -oczes arba deoksiribozs penktojo C somo (ymimo 5') - OH grups

11
NUKLEOZIDAI
Nukleozidas sudarytas i azoto turinios bazs ir pentozs
P a v e ld im u m a s

NUKLEOTIDAI
Nukleotidas yra nukleozido monofosfatas (t. y. sudarytas i azoto turinios bazs, pentozs ir fosfato

N-glikozidin jungtis

O -P -O -C H ,
s,

eozid monofosfatai yra eorgi monomerai

PENTOZS

OH
c h 2^

;h ; o

r ib o z e

(ribonukleorgtyse)

OH
1" ch2

- bazs prisijungimo vieta

m
OH H

-h ; o DEOKSIRIBOZ (deoksiribonukleorgtyse)

Kadangi DNR koduoja paveldimj inform acij, n ukleo tida i joje tu ri bti isidst tam tikra tvarka. Be to, lstelei dalijantis dukterins lstels gauna tapaias DNR molekules. Taigi i n ukleotid seka tu ri bti nukopijuojam a labai tiksliai. Tapo akivaizdu, kad pirm in DNR m olekuls struktra sudaryta ta m tik ru tiksliai a pibrtu bdu. XX amiaus viduryje daug m okslinink varsi tarpusavyje bandydam i n u sta tyti, kaipgi sudaryta DNR m olekul.

I CH,

JX

B azn

K ? i\i i/i H H 0 1 0 -P = 0

Tarp lenktyniaujanij buvo F H. K. Krikas, D. D. Votsonas, R. Franklin (R. Fran . klin) ir M. H. F Vilkinsas (M. H. F Wilkins). D. Votsonas ir F H. K. Krikas, . . . surink visus tu o metu jau turim us duomenis apie DNR molekuls struktr, pirmieji sukr erdvin jos m odel (r. 1.3 pav., A). 1953-aisiais iedu a t radjai paskelb, kad DNR yra linijinis polimeras, sudarytas i dviej lygiagre i, bet prieingos krypties p olinu kle otid ini grandini, susivijusi viena apie kit ir sudarani dvivij spiral. Vijas vien prie kitos laiko vandenilins ju n g tys1, atsirandanios ta rp prieing vij purino ir p irim idino bazi. Taip atras ta ir aprayta vadinam oji a n trin DNR m o leku ls s tru k t ra . Taigi DNR m olekul primena susiskusias virvines koptles (r. 1.4 pav.), kuri onins kartels sudarytos i fosfato ir deoksiribozs, o skersinukai - i bazi por. iose porose bazs yra viena kit papildanios (kom plementarios): vienos bazs erdvin struktra dera prie kitos bazs erdvins struktros (panaiai kaip dstinio trinkels) ir sudaro atitinkamas polinukleotidines grandines. vel giant iilgai koptli nukleotid grandins bazi seka gali bti bet kokia. Ta iau kiekviename skersinyje turi bti tik ios poros: tim inas (T) - adeninas (A) arba citozinas (C) - guaninas (G). Tokios bazi poros yra k o m p le m e n ta riosios (papildaniosios). Svarbi DNR molekuls polinukleotidini grandini savyb yra tai, kad jos turi krypt. Prieing krypi grandins susidaro todl, kad gretimus nukleotidus jungianti fosfodiesterin jungtis atsiranda tarp vieno nukleotido deoksiribozs C atom o 5' padtyje ir kito nukleotido de oksiribozs C atomo 3' padtyje (1.2 pav.). Taip viename nukleotid grandins gale lieka nesujungta su kitu nukleotidu 5' C atomo fosfato grup (5' galas), o kitame - 3' C atom o -O H grup (3' galas). DNR molekuls yra sintetinam os nauj nukleotid prijungiant prija u susintetin tos grandins 3' galo (apie tai r. 1.3 sky riuje), todl io proceso kryptis ymima 5'->3'. Taigi ir nukleotid grandins krypt sutarta ymti 5 ' - > 3 \ o jai prieingos papildaniosios grandins krypt - 3 '->5'. DNR molekuls gali bti linijins ir iedo form os (r. 1.8 pav.). DNR molekuls pri klausanios eukariot lsteli branduoliui yra linijins, o priklausanios m ito chondrij, plastidi, plazmidi ir prokariot lsteli chrom osom om s - iedo formos. D. D. Votsono ir F. H. K. Kriko sukurtas modelis ne tik patvirtino visus anuo metu apie DNR inomus faktus, bet ir paaikino svarbiausias paveldjimo m o lekuls ypatybes: 1) kaip genetin informacija lstelei dalijantis tiksliai pakartojama ir per duodam a dukterinm s lstelms; 2) kaip i informacija perkeliama baltym o molekuls aminorgi sek; 3) kaip lstelje gali atsirasti paveldim genetins informacijos pokyi. r ---------------------------------------------------------------------------------------------------------------------- DNR molekuls ilgis daniausiai nusakomas nukleotid por (bp) skaiiumi. Ivestiniai dydiai: 1 kilobaz (1 kb) yra 1 tkstantis nukleotid por; 1 megabaz (1 M b) yra 1 milijonas nukleotid por.

1.2 pav. N ukleotidins grandins nukleotidus jung ia 3 '- 5 ' fosfodiesterin ju n g tis tarp vieno nu kle otido pentozs (DNR - deoksiribozs, RNR ribozs) C a to m o 3' padtyje ir kito nu kle otido pentozs C atom o 5' padtyje

12

1.3 pav. DNR m olekuls erdvin struktra: A - D. D. Votsonas (kairje) ir F. H. K. Krikas (deinje) prie j sukurto erdvinio DNR m olekuls m odelio; B - rutulinis modelis, kuriam e vairiaspalviai rutuliukai atitinka skirtingus atom us

Vandenilins jung tys yra ne patvarios, ta ig i viena DNR gran din gali lengvai atsiskirti nuo ki tos - isipinti. 2J. D. W atson. The D ouble He lix: A Personal A c c o u n t o f the Discovery o f the DNA. LionBook,

m U DNR struktros iaikinim D. D. Votsonui, F H. K. Krikui ir M. H. F. Vilkin. sui 1962-aisiais buvo suteikta medicinos ir fiziologijos srities Nobelio premija. Kva p gniauianti DNR molekuls struktros istorija aprayta D. D. Votsono knygoje Dviguba spiral " 2.

1S68.

DNR molekuls grandins yra lygiagreios, bet prieingos krypties

Spirals

5' galas

3' galas

DNR molekuls grandins kryptis:

bazi- vandenilins jungtys

Spirals ingsnis: 3,4 nm 0,34 nm

deoksiriboz fosfatas 3' galas


1.4 pav. DNR m olekuls antrin (erdvin) struktra. Kairje - lygiagreios, bet prieingos krypties nu kle otid grandins; deinje - susivijusi kopi" modelis

5' galas

r
1. Kokia mediaga susijusi su informacija apie paveldimsias organizmo savybes? 2 I ko sudaryti nukleotidai ir DNR molekul? 3. K vadiname DNR molekuls pirmine struktra ir kokia yra DNR molekuls erdvin struktra? 4. Kokios DNR molekuls bazi poros yra komplementariosios (papildaniosios) ir kodl?

Vienoje i DNR molekuls grandini yra tokios nukleotid sekos fragmentas: ... AGTACCG ATACTCG ATTTACG... Kokia bus antrosios (komplementariosios) DNR grandins atitinkamos dalies nu kleotid seka? V______________________________________________________________________ y

P a v e ld im u m a s

Komplementarioji (papildanioji) sveika tarp por sudarani

13

1 . 1.2
RNR struktra

Be DNR, yra ir kita nukleorgtis. Tai rib o n u kleo r g tis arba RNR (jos molekuli yra ne tik branduolyje, bet ir dtoplazm oje). RNR molekuls yra keli tip. 1.1 lentelje pateikiami pagrindiniai.
1.1 le n te l . P agrin din iai RNR m o lek u li tip a i

RNR tipas Informaci ns RNR

ymjimas RNR

Rys Tiek, kiek yra polipeptid

Funkcija Perduoda informacij apie polipeptido aminorgi sek i branduolyje esanios DNR dtoplazmoje esanias ribosomas. Prokariot, plazmidi, taip pat eukariot, mitochondrij ir plastidi DNR yra nebranduolin. Pernea aminorgtj j ribosom; iveria nukleotid kalb j aminorgi kalb". Kartu su ribosom baltymais sveikauja su RNR ir aminoaciltRNR.

Transpor tins RNR

ItRNR

Ribosom RNR

1 rRNR

mogaus - 60; prokariot - >20 (daugiau nei yra aminorgi) Prokariot: 5 S1 ; 16 S; 23 S Eukariot: 5 S; 5,8 S 18 S; 28 S

14

Apie svarbiausius RNR molekuli ypatum us ir funkcijas dar bus kalbama kituose ios knygos skyriuose. RNR daug kuo panai DNR (r. 1.2 lentel). Jos molekul taip pat yra polinukleotidin grandin, o pirmin struktra - nukleotid seka. Taiau skir tingai nei DNR, RNR nukleotiduose vietoje deoksiribozs yra riboz, o vietoj tim in o bazs (T) yra uracilas (U). RNR molekuls nukleotid grandins kryptis tokia pat kaip ir DNR molekuls nukleotid grandins - 5 '-> 3 ' (tik RNR mole kulje 5' ir 3' atomai yra ne deoksiribozs, bet ribozs). Be to, RNR molekul daniausiai sudaryta tik i vienos nukleotid grandins (kai kuriuose virusuose aptikta ir dvigrand RNR), o jos erdvin struktra nra tokia taisyklinga kaip dvigrands DNR molekuls. Antra vertus, kai kurie RNR molekuls fragm entai gali bti kom plem entars (papildantys vienas kit). Kai usilenkus vienagrandei RNR molekulei jie atsiduria vienas prieais kit, susidaro dvigrandiai frag mentai. Taip sukuriama tam tikra antrin RNR molekuls struktra, laikoma vandenilini jungi tarp papjJdaoii b a/i . Specifin erdvin struktra dl susidariusi dvigrandi frag m en t bdinga tam tikr tip RNR molekulms (r. 1.5.5 skyri ir 1.17 pav.). RNR molekul daniausiai bna linijin.

P v l*dj a e

m 1.2 lentel. DNR ir RNR panaumai ir skirtumai DNR DNR yra polimeras, sudarytas i keturi ri deoksiribonukleotid, sujungt fosfodiesterinmis jungtim is (pirmin DNR struktra). Deoksiribonukleotid sudaro azot tu rinti baz (A, T, G, C), monosacharidas deoksiriboz ir fosfatas. DNR molekul sudaro dvi viena apie ki t apsivijusios lygiagreios, bet prie ing krypi polinukleotidins grandi ns (antrin DNR struktra). Kai kuri virus DNR yra vienagrand. RNR RNR yra polimeras, sudarytas i keturi ri ribonukleotid, sujungt fosfo diesterinmis jun gtim is (pirm in RNR struktra). R ibonukleotid sudaro azot tu rin ti baz (A, U, G, C), monosacharidas riboz ir fosfatas. RNR molekul daniausiai yra viena grand Dl kartais susidarani dvi grandi fragment kai kuri tip RNR molekuli (tRNR, rRNR) antrin struktra bna specifin. Kai kuri virus RNR mo lekuls dvigrands.

Skaiius S rodo m akrom ole kuli, ir ypa j kom pleks, sedi m e n ta c ijo s (n u s d im o ) g re it, c e n trifu g u o ja n t m akrom olekules labai dideliu greiiu (ultracentrifu g u o ja n t). Kuo m olekul ar j kompleksas didesnis ir tankesnis, tu o greiiau jie nusda ce n trifu g u o ja n t labai dideliu greiiu. Tai gi is skaiius yra viena i m ole kuli arba j kom pleks mass ir dydio charakteristik.

DNR Eukariot lsteli branduolio ir kai kuri virus DNR molekuls yra linijins, o mi tochondrij, plastidi, plazmidi, kai kuri virus ir prokariot lstelse esan i chromosom - iedo formos. DNR molekuls ris neskirstomos. DNR molekuls labai ilgos ir gali turti net kelis imtus milijon nukleotid por.

RNR RNR molekuls daniausiai yra linijins.

RNR molekuls yra keli ri: iRNR, tRNR, rRNR. RNR molekuls daug maesns.

Pastaba. DNR ir RNR p o lin u k le o tid in e s g ra n d in e s s u d a ra n ty s n u k le o tid a i d a n ia u s ia i vadi


n a m i ir y m im i ta ip p a t k a ip ir ju o s e esanios a titin k a m o s bazs: A , G, C, T, U (k a i b tin a rib o n u k le o tid u s a ts k ir ti n u o d e o k s irib o n u k le o tid , p a s ta rie ji y m im i d A , dG, dC, dT). Ir n u k le o tid sekas s u ta rta u ra y ti tik iom is ra id m is (pvz., A AA TTG TAC C TTG G G C A C A). Taigi ura v is u o m e t re ikia p a tik r in ti p a g a l k o n te k s t , kas tu rim a g a lv o je - visas n u k le o tid a s a r tik j o baz.

00
plementarisias (papildanisias) poras sudarani bazi nebeilaiko dviej DNR grandini vienos greta kitos, ir ios atsiskiria - isipina. is procesas vadinamas DNR denatravimu arba lydymusi. Atstaius normalias slygas tarp komplementarij DNR grandini bazi vl susidaro vandenilins jungtys ir atsistato molekuls dvigrand antrin struktra (DNR renatruoja). Taiau renatruojant vandeni lins jun gtys gali susidaryti ne tik tarp tos paios DNR molekuls dviej komplementari (viena kit papildani) grandini bazi, b et ir tarp skirting DNR molekuli fragment, kuri nukleotid sekos yra komplementarios. Taip susida ro hibridins molekuls. is procesas vadinamas h ib rid iza cija H ib rid ai gali atsirasti ne tik tarp dviej DNR grandini, bet ir tarp DNR ir RNR arba tarp dviej RNR molekuli. Jei j terp, kurioje gausu ilg DNR molekuli, dsime trum p DNR arba RNR molekuli, kuri nukleotid seka atitiks tam tikr ilgos DNR molekuls fragment, ir DNR denatruosime, tai renatruojant trumposios vienagrands nukleorgties molekuls atitiks papildanisias sekas ir hibridizuosis (susijungs) su jomis. Pa ymjus hibridizavimui naudojamas trumpsias nukleorgties (DNR arba RNR) molekules (pvz., radioaktyviais izotopais arba fluorescuojaniomis mediagomis), galima nustatyti, kur susidar hibridas, t. y. kurioje didiosios DNR molekuls vietoje yra atitinkama nukleotid seka. Taip paymtos nukleorgties molekuls vadinamos g en etin iais (arba m olekuliniais) zondais. Jie plaiai taikom i molekulinje biologijoje (gen kartografavimas), molekulinje citogenetikoje (chromosom mikroanomalij nustatymas, chromosom tapymas), gen tech nologijoje (bakterij klono, turinio dom inant gen, suradimas tarp deimi tkstani kit klon - r. II dalies 3 . 1 skyri).
P a v e ld im u m a s

Nukleorugi hibridizacija ir genetiniai zondai Paklus temperatr arba padidinus terps pH, vandenilins jun gtys tarp kom-

LZ)

K la u s im a i

1. I ko sudaryta RNR molekul? - , 2. Kuo panaios ir kuo skiriasi DNR ir RNR molekuls? 3. Paaikinkite nukleorugi hibridizacij. Kaip ir kam taikom i molekuliniai zondai?
3Z3ria gr. r y c n s /- dos r a j o - a a - <r i 2r-> iim as Kai rz ie t a - a - cr - ' hibridizacia ; a _ " a c-s - a ria in s m olej e s ' i c r c "-a genai ir 1.1.

1 . 2 ;

DNR lstelje

DNR molekul daniausiai vaizduojama kaip itempta dviguba spiral. Taiau tokia ji tebna schemose. Gyv organizm lstels (juolab lstels branduolio) skersmuo daug maesnis u itiestos DNR molekuls ilg, todl i neivengia mai turi bti stangriai susivijusi. Prokariot lstelje tra viena iedo form os susiraizgiusi DNR molekul. Jos kompleksas su baltym ir RNR molekulmis danai vadinamas chromosoma, nors ir neturi eukariot chromosom ai bdingos struktros. Toks kompleksas lstelje sudaro nukleoid, kuris (skirtingai nei eukariot lstels branduolio) nra atribotas membranos. DNR molekul tam tikra vieta prisitvirtina prie ls tels membranos vidinio paviriaus. Eukariot lstels branduolyje yra nuo keleto iki keli imt linijini keli centim etr ilgio DNR molekuli, kuri kiekviena su baltym, RNR ir kai kurio mis kitomis molekulmis sudaro atskiras chromosomas (r. 1.3 lentel). mo gaus lstels dvigubojo chrom osom rinkinio DNR bendras ilgis yra apie 2,2 m, o daugumos lsteli branduolio skersmuo - tik keli mikrom etrai. Taigi kad tilp t branduolyje, DNR tu ri bti susivijusi, taiau taip, kad galt bti nu raoma ir dvigubti, o lstelei dalijantis dukterins lstels gaut tapaius chro m osom rinkinius.

16 m Uo DNR susivijimas lstels branduolyje Eukariot lstels branduolyje esanioms DNR molekulms bdinga keli lygi spiralizacija (1.5 pav.). Pirmiausia dviguba DNR spiral apsiveja apie erd, sudaryt i armini baltym histon, ir susiformuoja nukleosoma Apie kiekvien histon erd, sudaryt i 8 molekuli (po 2 molekules 4 ri histon H2A, H2B, H3 ir H4), apsivynioja apie 146-240 nukleotid por DNR atkarpa, o nukleosomas jungia 20-60 nukleotid por ilgio DNR fragmentas (tarpin arba jungianioji DNR). Elektronins mikroskopijos vaizduose tokia gija atrodo kaip karoliukai ant silo. H l histonas svei kauja su tarpine DNR, glaudindamas nukleosomas ir toliau kompaktizuodamas DNR. Susidarant solenoidams 10 nm skersmens nukleosom gija storja iki 30 nm. Solenoid gija dalyvaujant vairiems baltymams toliau vingiuojasi sudarydama chromatino kilpas, pritvirtintas prie chromosomos nehistonini baltym karkaso. Kilp dydis labai vairus, taiau vidutinikai vienoje kilpoje yra apie 100 000 nukleotid por didumo DNR atkarpa. Taip susukta ir suvingiuota DNR tesiekia 1/10 000 itiestos DNR molekuls ilgio. Lstelei dalijantis chromosoma ypa susivijusi ir madaug 100 000 kart trumpesn u itiest jos DNR molekul.

1 .3 le n tel. m ogaus chrom osom DNR m o lek u li dydis

mln. Chro moso ma 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y nukle otid por (Mb) 263 255 214 203 194 183 171 155 145 144 144 143 114 109 106 98 92 85 67 72 50 50 164 59

cm 8,94 8,67 7,28 6,90 7,18 6,22 5,81 5,27 5,24 4,90 4,90 4,82 3,88 3,71 3,60 3,33 3,13 2,89 2,28 2,45 1,7 1,7 5,58 2,00

Interfaziniame lstels branduolyje, kai DNR labiausiai isivyniojusi, aktyviau siai funkcionuojani jos dali tankis maiausias (euchrom atinas), o neakty vios dalys yra daug tankesns (h etero ch ro m atin as).

IZ \
1. 2. 3. 4.

K la u s im a i

Kodl DNR molekul lstels branduolyje turi bti susivijusi tam tikru bdu? Kuo skiriasi prokariot ir eukariot DNR form a lstelje? Kokie yra DNR molekuls susivijimo lygiai eukariot lstels branduolyje? I ko sudaryta nukleosoma?

I viso 3 280 Mb 112,38 cm

Echrom atino paalinus - r : - -s matyti DNR gijos

Nukleosoma

: - r - cfiromatino gijos ' _ eosom karoliukai s r ts io * )

cnromatino paalinus - s to n u s matyti baltyminis -"o m o s o m o s karkasas

NUKLEOSOMA
IvranOe X I Histon erdis H1 histonas

Tarpine (jungianioji) (20-60 np) Dvi vijos apie histon erdj

Chromosoma lstelei dalijantis (labiausiai sutankjs chromatinas)

1.3.
Genetins informacijos atsikartojimas: DNR dvigubjimas (replikacija)

D. D. Votsono ir F H. K. Kriko pasilytas dvigubos spirals modelis paaikina, . kaip genetin informacija perduodama i vienos lsteli kartos kitai. Prie lstels dalijimsi jos DNR molekuli skaiius turi padvigubti. Kadangi dvigubos DNR spi rals polinukleotidini grandini bazi poros yra komplementariosios (papildaniosios), atsiskyrusios DNR nukleotid grandins tampa matricomis nauj grandini sintezei (1.6 pav.). Taigi DNR dvigubjim as yra procesas, kuriam vykstant pagal vienos deoksiribonukleotid grandins sek sintetinam a antra (pap ild a n io ji) d e o k s irib o n u k le o tid g ra n d in Procesui pasibaigus su sidaro dvi tapaios dvigrands DNR molekuls, kuri kiekvienoje viena gran din yra sena, o kita - nauja (1.6 pav., 1.7 pav.). Toks DNR dvigubjim as yra pusiau k o n s ervatyvu s. DNR dvigubjim 1958-aisiais eksperimentais jrod M. Meselsonas (M. Meselson) ir F Stalis (F. Stahl). Taiau pai DNR dvigubjimo . idj kur kas anksiau suformulavo D. D. Votsonas ir F. H. K. Krikas. Vis DNR dvigubjimo proces galima suskirstyti tris etapus. 1. Isivyniojimas. Veikiant ferm entui DNR girazei ivyniojama motinins DNR molekuls dalis. Kitas ferm entas - DNR helikaz atskiria jos grandines, ir vandenilins jungtys tarp papildanij bazi nutrksta (1.7 pav.). Susidaro d v ig u b jim o pslel, kurios prieinguose galuose yra V raids fo rm o s d v ig u b jim o akuts (r. 1.8 pav ). '

18
N au jo n u k le o tid o priju n g im a s

Ilgjanios DNR grandins 3' paskutinysis nukleotidas

DNR molekuls statybins mediagos deoksiribonukleozidtrifosfatai:


D eoksiriboadenozintrifosfatas D eoksiribotim idintrifosfatas Deokslribocltidintrifosfatas

dATP I
d jjp

F]
^

Tf

dCTP F!

D eoksiriboguanozin- dG TP F l i Ba^yBT trifosfatas


BAZ

" O - P - O -P -

I O "

I O

- o- ch2 /o

Naujas nukleotidas (deoksiribocitidintrifosfatas, dCTP)


Susidarant fosfodiesterinei jungiai tarp ilgjanios DNR grandins 3' hidroksilo grups ir naujo nukleotido 5' fosfato, nuo deoksiribonukleozidtrifosfato atskyla dvi fosfato grups (pirofosfatas)

3' !
5' "I

Pirmaujanioji DNR grandin


5' 3'

Atsiliekanioji DNR grandin


3* "I

B
uo anksiau susintetinto DNR fragm ento i1ga lo paalinam as RNR pradmuo; arpas, susidars paalinant RNR, upildom as pratsiant pradm en <i anksiau susintetinto DNR fragm ento 5' galo; iviej gretim DNR fragm ent 5' ir 3' galai sujungiam i fosfodiesterine jungtim i.

S "1

1.7 pav. N auj DNR m olekuls g ra n d in i sintez vyksta 5 '- > 3 k ry p tim i. A. B, C - O kazakio fra g m e n ta i idstyti to kia tvarka, to k ia buvo s u s in te tin ti. Visas schem oje pa vaizduotas reakcijas ir procesus lemia a titin k a m i fe rm e n ta i (r. tekste)

2. Nauj nukleotid prijungimas. Katalizuojant fermentui DNR polimerazei nauji nukleotidai prijungiami prie sintetinamos DNR molekuls grandins 3' -O H galo papildymo principu: prie matricos (motinins grandins) T nukleotid j nauj grandin jungiamas A nukleotidas, prie C - jungiamas G ir atvirkiai (1.6 pav.). 3. Susijungimas. DNR molekuls (arba jos dalies eukariot lstelse) dvigubjimas pasibaigia, kai susitinka prieprieiais judanios dvigubjimo akuts. Tada fermentas DNR ligaz susintetint DNR grandini arba a titin ka m j fragm ent 5' ir 3' galus sujungia j vientis DNR grandin. DNR dvigubjim as prasideda ne bet kurioje DNR molekuls vietoje, o ten, kur yra ta m tikra nukleo tid seka, vadinama d vig ubjim o pradios signalu (r. 1.8 pav. p. 20).

Dvigrands DNR sintez S' -> 3 ' kryptimi DNR polimeraz pagal vienagrands DNR matric sintetina nauj DNR grandin 5'->3' kryptimi, t. y. prijungdama naujo nukleotido (deoksinukleozidtrifosfato) 5' fosfat prie jau susintetintos DNR grandins paskutiniojo nukleotido laisvos 3 ' -O H grups (1.6 pav.). is fermentas negali sintetinti DNR tik pagal vienagrand matric - reikalingas nors trumpas dvigrandis fragmentas su laisva 3 hidroksilo grupe, prie kurios prijungia mas naujas nukleotidas. DNR dvigubjimo pradioje tok dvigrand fragment - RNR pradmen (oligoribonukleotid) susintetina kitas fermentas RNR polimeraz, i karto sin tetinanti oligoribonukleotid pagal vienagrands DNR matric. Antra vertus, DNR molekuls grandins yra prieingos krypties. Vienos grandins kryptis yra 5 ' 3 \ o kitos - 3 '<~5. Todl dvigubjimo akutje viena matrica atsiveria 5 '-^ 3 ' kryptimi, o kita - 3 5' kryptimi (1.7 pav.). Vienos naujos grandins itisinei sintezei 5 '-> 3 ' kryptimi klii nra. Taiau kit grandin tekt sintetinti 3 ' 5 ' kryp timi, bet ia kryptimi nukleotidai negali bti prijungiami. Kaip tada vyksta ios DNR grandins sintez? Taip kaip ir turi vykti - 5 '- > 3 ' kryptimi. Eksperimentais rodyta, kad viena DNR grandin sintetinama greiiau, tad j imta vadinti pirmaujanija. Antroji grandin, pavadinta vluojanija, sintetinama liau ir ne itisai, bet 100-1000 nukleo tid ilgio gaballiais. ie gaballiai juos atradusio mokslininko R. Okazakio (R. Okaza ki) garbei buvo pavadinti Okazakio fragmentais. Kaip vyksta is procesas? Kai DNR helikaz atskiria vis naujus vienagrandius DNR fragmentus, pirmaujanioji DNR gran din be klii sintetinama 5 ' 3 ' kryptimi pagal 3 ' 5 ' matric. 5 ' 3 ' matricos atkarpa tam tikr laik dar lieka vienagrande. Netrukus prie ios matricos greta vei kianios helikazs prisitvirtina tam tikra RNR polimeraz ir 5 ' -> 3 ' kryptimi susintetina pradmen - oligoribonukleotid (atsiranda dvigrand atkarpa, sudaryta i DNR matri cos ir RNR). RNR polimeraz pakeiia DNR polimeraz ir nuo oligoribonukleotido 3 galo toliau sintetina papildanij DNR grandin, kol pasiekia prie tai susintetinto RNR pradmens 5 ' gal. Tada RNR fragmentas paalinamas, ir DNR polimeraz toliau sintetina naujj DNR fragment iki ankstesniojo DNR fragmento 5' galo. Galiausiai fermentas DNR ligaz sujungia i fragment galus fosfodiesterine jungtim i vientis grandin (1.7 pav.).

DNR dvigubjant j nauj grandin atsitiktinai gali pakliti ne tas nukleotidas. Tokios klaidos gali pakeisti genetin informacij, nes nauja DNR molekul nebe bus tiksli senosios molekuls kopija. Todl DNR polimeraz sintetindama nauj nukleotid grandin nuolat kontroliuoja, ar jos 3' gale esantis nukleotidas yra komplementarus DNR matricai. Aptikusi, kad k tik prie grandins prijung nekomplementar nukleotid, DNR polimeraz j i karto atmeta. Eukariot ir prokariot DNR dvigubjimas, dalyvaujant fermentams DNR polim erazei i r DNB iigazei, vyksta iek tiek skirtinga). Prokariot (bakterij) iedo formos DNR molekuls dvigubjimas prasideda tik viename take ir gali vykti viena kryptimi arba prieingomis kryptimis (1.8 pav., A), kol viena kryptimi judanti dvigubjimo akut sugrta dvigubjimo pradi arba prieingomis kryptim is judanios dvigubjimo akuts susitinka. DNR dvigubjimo greitis bakterijose labai didelis ir siekia net 106 nukleotid por per minut (viduti nikai prokariotuose - 500 nukleotid por per sekund). E u k a rio t chromosomose linijins DNR molekuls dvigubjimas prasideda i ka rto daugelyje tak(1 .8 pav.. B). Susidariusios DNR dvigubjim o pslels pleia si abiem kryptimis, kol susitinka su dvigubjimo procesu, prasidjusiu gretimoje pslelje. Eukariot DNR dvigubjimas vyksta liau nei prokariot. Antai mo gaus DNR dvigubja 50 nukleotid por per sekund greiiu. Lytin mogaus (stefe ctrrr' akagsaor rrer' ? r r a p it f & r <?<?<&&?&<?<{f7<?r. feS R ? dH d r tf r f gubjimo pradios tak visas DNR dvigubjimo procesas vyksta netiktinai grei tai - vos per kelias valandas.

L 2 ) K la u s im a i
1. Kokiu bdu DNR sandaroje ukoduota genetin informacija tiksliai atsikar toja dvigubjant DNR molekulei? 2. Kodl DNR dvigubjimas vadinamas pusiau konservatyviu? 3. Kokie pagrindiniai DNR dvigubjimo etapai? Trumpai apibdinkite, kas vyks ta per kiekvien j. 4. Kaip vyksta DNR sintez?
1.8 pav. Prokariot (A) ir eukariot /B ) DNR dvigubjim as

5. Kode1viena DNR grandin yra sintetinama itisai, o ta\a - Otoatao ! mentais?


6 . Kuo skiriasi eukariot ir prokariot DNR molekuls dvigubjimas?

A.

Prokariot iedo formos DNR molekul pradeda dvigubti vienam e take


Dvigubjim o pradios signalas

B.

Eukariot DNR molekulje

yra daug dvigubjimo pradios tak


M otinins DNR grandins Dvigubjim o pradios signalai

O
Skirtinguose organizmuose DNR dvigubjimas vyksta viena (c) arba dviem kryptimis (d) D vigubjim o akut D vigubjim o pslel

Dvigubjimas baigtas DNR grandins; m otinins dukterins

...$

1.4.
Genas - DNR molekuls dalis

Taigi DNR molekul lemia paveldimum, o jos pirmin struktra - DNR nukleotid seka apsprendia vis organizmo baltym ir vairi tip RNR struktr. Ir prokariot, ir eukariot lstelje paveldimumo vienet gen yra kur kas dau giau nei DNR molekuli (chromosom). Tad genai yra tik nedidels DNR mole kuli atkarpos. Genai bna dviej ri - struktriniai ir reguliuojantieji. Struktrinis genas (daniausiai vadinamas tiesiog genu) - tai DNR mole kuls dalis, lemianti tam tikros polipeptidins grandins arba tam tikros RNR sintez. Svarbiausia gen, lemiani baltym sintez, dalis yra koduojanioji. Joje gldi informacija apie tam tikro baltymo aminorgi sek. Prokariot gen koduojanioji dalis yra itisin, o eukariot daugumos gen struktra daug sudtingesn. 7-ajame XX amiaus deimtmetyje buvo pastebta, kad kai kuri eukariot gen baltym koduojani dal siterpusios nekoduojanios nukleo^ tid sekos dalija j fragm entus. Tokie koduojantys fragm entai buvo pavadinti e g zo n ais, o ta rp j siterp nekoduojantys fra g m e n ta i - in tro n ais (r. euka riot geno schem, 1.9 pav.). Vliau paaikjo, kad tokia struktra bdinga dau gumai eukariot gen. Vieno geno intron skaiius gali vairuoti nuo 1 iki daugiau nei 100. Egzon ir intron dydis taip pat vairuoja. Kai kurie intronai bna kur kas didesni nei egzonai. Viename i mogaus NF1 geno intron aptikti dar 3 nedideli genai. Antra vertus, kai kurie eukariot genai (pvz., histon genai) in tron neturi.

nekoduojanioji sritis 2 egzonas Nukleotid sekos prie gen ' 51reguliuojaniosios sritys

nekoduojanioji sritis

Polipeptido sintezs pradia

Polipeptido sintezs polj. A pabaiga UQdegos

Nukleotid sekos u geno

prijungimo signalas

1.9 pav. Eukariot geno ir svarbiausi -eguliuojanij srii schema. Geno pradia yra jo koduojaniosios DNR grandins 5' galas ties p rom otorium i, o geno pabaiga yra jo koduojaniosios DNR grandins 3' galas

Genomas (vok. g e n o m < gr. genos - gim in, kilm) - ter min pirmasis pavartojo vokiei mokslininkas H. Vinkleris (H. W in kler) 1920-aisiais. mogaus geno mas - tai visas viengubasis gene tins informacijos rinkinys, esantis kiekvienoje mogaus lstelje.

R eguliuojantieji genai tiesiogiai nekoduoja genetins informacijos. Taiau su i gen nukleotid sekomis sveikauja reguliavimo baltymai, btini kiekvieno struktrinio geno veiklai ir j kontroliuojantys. Reguliuojantieji genai daniausiai vadinami reguliuojaniosiomis nukleotid sekomis, reguliuojaniosiomis DNR sri timis arba reguliuojaniaisiais elementais - tai prom otoriai, stiprintuvai, slopin tuvai, ribiniai elem entai, atsako elem entai ir kt. (daugelis j b dingi tik eukariotams). Ir prokariot, ir eukariot struktrini gen veikl apsprendia vadinamasis promotorius. Tai tam tikra nukleotid seka (tiksliau, tam tikr nukleo tid sek derinys), isidsiusi ties struktrinio geno 5' galu, su kuriuo sveikauda mas fermentas RNR polimeraz pradeda RNR sintez (r. 1.5.1 ir 1.5.4 sk.). Eukariot geno ir jo veikl reguliuojani nukleo tid sek schema patei kiama 1.9 pav. Gen skaiius skirtinguose organizmuose labai vairus. Jei virusai j teturi nuo keli deimi iki keli imt, tai induoliai - net kelias deimtis tkstani. Organizm o viengubojo gen rinkinio visuma, bdinga visai biologinei riai, vadinama g e n o m u 1. Apibendrinant dera pastebti, kad biologinei riai bdin ga viengubojo chrom osom rinkinio DNR m olekuli (t. y. j nukleotid sek) visuma. Tam tikra genetin informacija gali ir nepriklausyti organizm o geno mui. Pavyzdiui, gen esama ir plazmidse (r. toliau). Taiau jie nra t plazmid turinio organizm o genom o dalis.

Prokariot genom as palyginti nesudtingas. Prokariot lstelse genetins informacijos rinkinys yra viengubasis, nes j lemia vienintel turim a chromoso ma - iedo form os dvigrand DNR molekul.

0 0
Virus genom gali sudaryti jvairi tip nukieorugi molekuls: iedo formos dvigrand DNR molekul, linijin dvigrand DNR molekul, iedo formos vienagrand DNR molekul, linijin vienagrand DNR molekul, linijin dvigrand RNR molekul, linijin vienagrand RNR molekul.

Prokariot genomai yra nedideli (nuo keli tkstani nukleotid por turini virus DNR iki keli milijon nukleotid por turini bakterij DNR - 1 . 1 0 pav.). Virusai turi nuo poros deimi iki keli imt gen, bakterijos - iki keli tkstani gen (r. 1.4 lentel), kurie isidst labai glaudiai. Baltymo arba RNR neko duojani srii yra nedaug (1.11 pav.). Dalis j gen dalyvauja operon veikloje (r. 1.5.4 sk. ir 1.22 pav.).

1.4 le n te l . Kai ku ri o rg a n iz m g e n o m o dydis

Organizmas mogus (Homo sapiens sapiens) Pel (Mus musculus) Vaisin musel (Drosophila melanogaster) Nematoda (apvalioji kirml) (Caenorhabditis elegans) Miels (grybai) (Saccharomyces cerevisiae) arnyno lazdel (bakterija) (Escherichia coli) Bakterija (Haemophilus influenzae)

Genomo dydis DNR ilgis (Mb) Gen skaiius 3 280 40 000-50 000 3 000 0,165 0,100 0,0014 0,004 0,0018 -3 0 000 15 000-25 000 11 800-13 800 8 355-8 947 3 237 1 740

Eukariot genomas kur kas sudtingesnis. Pagal lokalizacij skiriami: 1) branduolio genomas; 2) mitochondrij genomas; 3) plastidi genomas (pastarj turi tik augalai). Be to, branduolio genome yra daug vairi DNR nukleotid sek, kurios nekoduoja nei baltym, nei RNR.

Virusai Bakterijos Grybai I I


M iels Pupa

EU KARIOTAI

Augalai
Vaisin musel

Vabzdiai I I Moliuskai I
I I Ryklys

Kremzlins uvys | (

I
Kaulins uvys

I
Amfibijos Ropliai
1.10 pav. vairi organizm genom dydiai

PROKARIOTAI

Paukiai
I m ogui

induoliai

103

10

105

106

107

10

10"

10"

10

10'

Genom o dydis: nukleotid por skaiius vlengubajam e chromosom rinkinyje (logaritm in skal) - organizm klass genom dydi intervalas - konkreios biologins ries genom o dydis

Eukariot b randuolio DNR nukleotid sek vairo v

Cheminiais m etodais tiria n t eukariot b randuolio g en om o DNR buvo ap tiktos vairi tip nukleo tid sekos (r. 1.12 pav.). Unikalios nukleotid sekos - tai genai (tarp j intronai ir kitos nekoduojaniosios gen dalys) ir genams giminingos nukleotid sekos. Naujausi tyrim duomenimis mogaus ir kit induoli genomuose yra apie 40 0 0 0 -5 0 000 struktrini gen, taiau j koduojaniosios dalys tesudaro nuo 2,5% iki 10% viso genomo. Eukariot genai skiriasi tarpusavyje jau mintais struktros ypatu mais, dydiu bei funkcijomis. Be to, vieni j unikals, kiti sudaro gim ining gen eimas, kuri nariai isidst grupmis (pvz., hem oglobino baltym o globino genai) arba pasklid po vairias chromosomas (pvz., raumen baltym o aktino genai). Neretai pasitaiko ir vadinamj netikrj gen (pseudogen). Jie atsirado i normali gen, kurie ilgainiui pakito (evoliucionavo) prarasdami veiklum.

A. mogus
V28 V29-1 TRY4 TRY5

prml njmgi ..r

i i
10

u rm u i i r
20

[K t njjn fni
30

P - r j
40

50 kb Pav/pIHimiima;

B. Kukurzas
Adh1-F

I 1 ,
0

, 1,

M | !, ' i ' i1 i1 i 1 I 11,1 In , ^


10 20 30

, 1,

l1

\
40

|
50 kb

1.11 pav. Baltymus koduojani r nekoduojani DNR

C. arnyno lazdel Eschericia coli


IS186 IS1

'jk le o t id sek santykis . - =- ot (A, B) ir prokariot C genomuose labai skiriasi | - baltym us koduojanios nukleotid sekos (genai arba gen egzonai); - polip eptido nekoduojanios geno dalys;

50 kb

- pseudogenas;

U - pasikartojanios nukleotid sekos.

Kita svarbi grup yra p a s ik a rto ja n io s io s n u k le o tid sekos, kurios bna keli tip . Jos sudaro p a g rin d in m ogaus g e n o m o dal. 1. Paeiliui pasikartojanios n u kleo tid sekos. Tai dideli trum p (nuo vieno iki daugiau nei imto nukleotid por) kartotini nukleotid sek blokai: m ikropalydovin DNR (keleto nukleotid por pasikartojimas), minipalydovin DNR (chrom osom telomerose ir kitose chrom osom dalyse), palydovin DNR (chrom osom centrom er srityse). i nukleotid sek pasikartojim skaiius labai individualus, todl jos taikom os kaip ymenys teismo ekspertizje as m ens.tapatybei arba biologinei giminystei (kaip antai tvystei) nustatyti bei diagnozuojant paveldimsias ligas. 2. t e r p t in s n u k le o tid sekos yra isibarsiusios po vis b ra nd uo lio g e n o m . Jos skirstom os dvi p a g rin d in e s grupes: tr u m p i (keli im t n u k le o tid por) te rp tin ia i b ra n d u o lio e lem entai ir ilgi (keli t ksta ni n u k le o tid p or) te rp tin ia i b ra n d u o lio ele m e ntai. ios n u k le o tid sekos kilusios i klajojani gen t r a n s p o z o n , kurie siterpd am i vis naujas g en om o vietas per deim tis m ilijon organizm evoliucijos m et lm imt t ksta ni g e n o m o e le m e nt kopij atsiradim . terptin s n u k le o tid se kos svarbios evoliuciniam s ri tyrim am s.

m
Transpozonai - klajojantys genai Amerikiei mokslinink B. Maklintok (B. McClintock) tirdama kukurzus atrado DNR elementus, kuri kopijos gali klajoti po genom, siterpdamos tai j vien, tai j kit jo viet, neretai paveikdamos genus, j kuriuos patenka. U judrij genomo element atradim 1983-aisiais mokslininkei suteikta Nobelio premija. Atrasti irprokariot transpozonai. J veikiami kai kurie genai (pvz., suteikiantys atspa rum tam tikram antibiotikui) gali persikelti i vien bakterij j kitas.

MOGAUS GENOMAS

Branduolio genomas 3300 Mb 40 000-50 000 gen

Mitochondrij genomas 16,6kb 37 genai

-2 5 %
Genai ir su genais susijusios sekos
Unikalios ir vidutinikai pasikartojanios sekos

-7 5 %
Negenin DNR 2 rRNR genai 22tRNR genai 13 polipeptidus koduojani gen

-1 0 % Koduojanioji DNR

-90 %
Nekoduojanioji DNR

-6 0 %

-4 0 %

Unikalios arba Vidutinikai ir daug mao kopij sk. sekos pasikartojanios sekos

i
Pseudogenai Gen fragmentai 'W m m

Intronai, nekoduojanios geno dalys irkt.

Paeiliui pasikartojanios sekos

Isibarsiusios pasikartojanios sekos

1.12 pav. m ogaus ge nom o sandara. Kit eukariot organizm genom ai sudaryti labai panaiai

M ito ch o n d rij DNR

Kiekviena eukarioto lstel gali turti tkstanius m itochondrij', o kiekvieno je m itochondrijoje aptinkamos kelios iedo formos dvigrands DNR molekuls. Tai m'rtochondn DNR (mtONR1 Ji sudaryta i madaug 16 500 nukleotid por. ). MtDNR iek tiek skiriasi nuo branduolio DNR, ir m itochondrij genomas pana esnis j prokariot genom. M itochondrij genomas labai vientisas - beveik nra pasikartojanij nukleotid sek ir intron. mogaus mtDNR koduoja dvi ribosomines RNR, 22 transportines RNR ir 13 baltym, labai svarbi lstels energetiniams procesams. Zigotoje esanios m itochondrijos - taigi ir visos mtDNR molekuls - yra iskiriamos tik i kiauialsts citoplazmos, nes subrend spermatozoidai citoplazm os (tuo paiu ir m itochondrij su mtDNR molekulmis) beveik neturi. Tad tiria n t mtDNR vairov, galima analizuoti monijos moterikj paveldimu mo linij, nam ini gyvuli bei kultrini augal kilm.

'M ito c h o n d rijo s (gr. m ito s silas; c h o n d rio n - grdelis, gra nul) - lstels organoidai, besi telkiantys ten, kur lstels fu n k cijoms eikvojama daugiau ener gijos. M ito chond rijom s bdinga didel vairi fe rm en t koncen tracija.

m
Plastids yra augal lsteli organoidai. Kaip ir mitochondrijos, vis ri plastids yra sudarytos i iorins bei vidins membranos ir stromos, kurioje yra DNR, RNR, ribosomos ir vairs intarpai. Genetinmis savybmis plastids panaios m ito chondrijas: dauginasi dalijimosi bdu, turi savo DNR ir nepriklausomai nuo branduo lio gen apsprendia kai kuriuos paveldimus organizmo poymius.

CD
Plazmids yra maos (keli tkstani nukleotid por) iedo formos dvigrands DNR molekuls, turinios DNR dvigubjimo pradios signalo nukleotid sek. Jos daniausiai aptinkamos bakterijose, mieli, augal ir net kai kuri gyvn ls telse. Plazmids DNR nra lstels chromosomos dalis, todl dvigubja nepri klausomai nuo chromosomos DNR. Bakterij plazmids paprastai turi vien ar ke lis genus, kuri koduojami baltym ai suteikia bakterijai atsparumo tam tikriems antibiotikams.

1. Kaip sudarytas genas ir ko reikia, kad jis veikt? Kuo skiriasi eukariot ir prokariot gen struktra? 2. Kas yra genomas? 3. Kokie yra eukariot genomo nukleotid sek tipai? 4. Kurie mogaus genai yra unikals? 5. Kokia gali bti nebranduolin DNR? 6. Kaip sudaryta mitochondrij DNR molekul ir kuo ji skiriasi nuo branduolio DNR?

1 . 5 . Jau isiaikinome, kad genas - tai genetin inform acija, g l din ti DNR nu kleotid sekoje. Konkreti ios inform acijos iraika yra ta m tikras organizm o m orfologinis, fiziologinis, biocheminis, psichinis ar kitoks poymis. Visuma g enetini proces, pagrindiani organizm o poym io fo rm a vi msi pagal geno DNR n ukleotid sekoje ukoduot inform acij, vadinama g en o raika (1.13 pav.).

Organizmo genetins nformacijos ^aika: geno raika

1908-aisiais anglas, vaik gydytojas A. E. Garodas (A. E. Garrod) paskelb atlikt tyrim ivad apie tai, kad mediag apykaitos ligos, atsirandanios dl gim t me diag apykaitos sutrikim, yra paveldimos kaip ir k iti gen lemiami poymiai. Suvo ks, kad mediag apykaitos problem atsiranda dl konkretaus tos apykaitos proceso biologinio katalizatoriaus' fermento (t. y. baltymo) sutrikimo, A. Garodas pirmasis tiesio giai susiejo baltymus su genais. 1941-aisiais D. V. Bydlis(G. W. BeadiejirE. L. Teitumas (E. L. Tatum) suformulavo ivad - vienas genas - vienas fermentas" L. Polingo (L. Pauling) ir H. Itano (H. Eaton) tyrimai leido j patikslinti: vienas genas koduoja vien polipeptidin grandin, sudaryt i aminorgi (dabar jau inoma, kad kai kurie struktriniai genai gali koduoti tik dal polipeptidins grandins). Be to, strukt riniuose genuose yra ukoduota informacija ir apie visas RNR molekules.

C a o i a K r u s - -e o a g a , kua *""= es reakcijas, z s r ~ e kai nepa-

Bet kurio gyvo ems o rg a n izm o poym i visum os pagrindas yra vai riausios b altym m olekuls ir j atliekam os funkcijos. Inform acija apie i m oleku li pirm in s tru k t r - a m ino rg i sek g l di DNR m olekuls pir m inje s tru k t ro je - n u k le o tid sekoje. Taiau e u k a rio t DNR neprasi skverbia pro b ra n d u o lio m em bran, o baltym sintez vyksta cito plazm oje esaniose ribosom ose. Taigi ta rp lstels b ra n d u o lio DNR ir ribosom os rei kalingas ta rpininkas. is ta rp ininka s - tai in fo rm a c in rib o n u k le o r g tis (RNR). Nors p ro k a rio ta i n e tu ri b ra n d u o lio , a ts kiria n io DNR nuo citoplazmos, g e n etin inform acija i DNR ta ip pat pasiekia ribosom as pro RNR m olekules. Pagrindiniai geno raikos etapai yra: 1) g e n e tin s inform acijos n uraym as nuo geno DNR j RNR m olekul (t. y. RNR sintez); 2) polipeptido sintez pagal nurayt nuo geno j RNR genetin informacij. Tarp j siterpia dar vienas etapas - RNR molekuls brendimas. Inagrinkime kiekvien geno raikos etap.

Genetins informacijos nuraymas (transkripcija): RNR sintez

Genetins informacijos nuraymas (transkripcija1 yra procesas, per ) kur pagal dvigrands DNR molekuls vienos grandins nukleotid sek sintetinama viena ribonukleotidin grandin (RNR molekul). Informacijai i geno j ribosom perneti reikalinga RNR yra nukopijuojama nuo atitinkam gen. Tokiu pat bdu yra perraomos ir vis kit tip RNR molekuls (r. 1.1 lentel p. 14). Ribonukleotid grandins sintez i ribonukleozidtrifosfat katalizuoja2 (ipina DNR molekuls dvigrand struktr) fermentas RNR polimeraz (1.14 pav.). RNR sintez prasideda, kai RNR polimeraz prisitvirtina prie DNR promotoriaus ties struktrinio geno pradia (t. y. jo 5' galu) ir atskiria dal DNR molekuls grandini vien nuo kitos. Viena i grandini, toji, kurios 5' gale yra promotorius, tampa matrica RNR sintezei. RNR sintezs procesas pasibaigia, kai RNR polimeraz atsi traukia nuo DNR (daniausiai tai atsitinka, kai RNR polimeraz nuslenka iki kopi juojamojo DNR fragm ento - geno 3' galo ir pasiekia tam tikr nukleotid sek, vadinam baigms signalu) ir atsiskiria nuo baigtos sintetinti RNR molekuls. Prokariot kopijavimo baigms signalai (term inatoriai) jau yra itirti. Apie analogikus eukariot gen signalus inoma kur kas maiau. RNR sintez panai j DNR sintez, taiau esama ir skirtum (1.5 lentel).

Branduolio membrana

Branduolio membranos poros

Antikodonas

1.13 pav. Geno raikos etapai: nuo geno iki organizm o poym io Kitos polipeptido sintezei reikalingos mediagos:

Polipeptidas
Baltymo brendimas
'Transkripcija (lot. transcriptio perraymas) - pirm inis baltym o sintezs etapas. 2Kataliz (gr. katalysis - suar dymas) - chem ini reakcij greitinim as katalizatorium i.

- baltymo sintezs veiksniai; - energijos altinis GTP; - kitos molekuls.

Veiklus baltymas

Organizmo poymis

Koduojanioji DNR grandin

Matricin DNR grandin


RNR yra komplemetarioji (papildanioji) matricins DNR grandins atvilgiu: grandi ns orientacija prieinga (RNR ir matricin DNR grandin yra lygiagreios, bet prie ing krypi), nukleotid seka papildan ioji (tik nuraymo metu papildanij por su DNR grandins A RNR sudaro U, o vietoj deoksiribozs nukleotiduose yra riboz) RNR polimeraz

RNR atitinka koduojanij DNR grandin: tokia pat orientacija, tokia pat nukleotid seka (tik vietoj T RNR yra U, o vietoj deoksiribozs - riboz)

Naujo nukleotido prijungimas


RNR m olekuls nukleotid grandin ilgja, prie jos 3' paskutiniojo nukleotido 3 '-O H pri sijungiant naujam nukleotidui ir susidarant fosfodiesterinei jungiai. Sintezei naudojam i nukleozidtrifosfatai. F o sfodiesterins ju n g tie s sus id a rym o reak cija ta rp 3' pa sku tin io jo n u kle o tid o (ia - U) ir naujo nukle ozidtrifosfato (ia - G) vyksta ta ip pat, kaip ir sinte tinant DNR (r. 1 .6 pav, DNR dvigubjim as)

RNR statybins mediagosribonukleozidtrifosfatai:


Riboadenozintrifosfatas
R ib o u n d in trifo s fa ta s R ib o c itid in trifo s fa ta s

ATP UTP CTP GTP

trifosfatas

1.14 pav. RNR sintez vyksta pagal DNR matric


OH OH

m
1.5 lentel. P a grind iniai DNR ir RNR sintezs panaum ai b e i s k irtu m a i DNR RNR Eukariot lstelse ir DNR, ir RNR sintez vyksta branduolyje (iskyrus mitochondri jas ir plastides). Ir DNR, ir RNR sintez vyksta 5 ' 3 ' kryptim i komplementarumo (struktr atitikos) principu pagal vienagrands DNR matric. Nukleotidai sujungiami fosfodiesterine jungtim i. DNR sintetinama i deoksinukleozidtriRNR sintetinama i nukleozidtrifosfat fosfat dATP, dTTP, dCTP ir dGTP ATP, UTP, CTP ir GTP Papildaniosios nukleotid poros tarp DNR matricos ir sintetinamos deoksiribonukleotidins grandins: A-T, T-A, G- C, C-G. DNR sintez katalizuoja fermentai DNR polimerazs. DNR polimeraz negali p radti DNR grandins sintezs tik pagal vienagrand matric - btinas pradmuo. Pirmaujanioji DNR grandin sintetinama vientisai, o atsiliekanioji - Okazakio fragmentais. Papildaniosios nukleotid poros tarp DNR matricos ir sintetinamos ribonukleotidins grandins: T (DNR)-A, A (DNR)U, C-G, G-C. RNR sintez katalizuoja fermentai RNR polimerazs. RNR polimeraz gali pradti RNR gran dins sintez pagal vienagrand m at ric. RNR molekul sintetinama vientisai,

DNR DNR dvigubjant nukopijuojama visa DNR molekul.

RNR Per RNR sintez (nuraym) nukopijuo jama tik nedidel DNR grandins dalis. Daniausiai tai vienas genas, nors prokariot operon (r. 1.5.4 skyri) ir kai kurie eukariot genai (tRNR, rRNR) nu kopijuojami i karto po kelis. RNR polimeraz savo klaid netaiso, todl RNR sintezs klaidos daug danes ns.

DNR dvigubjant kopijuojama ypa tiks liai: DNR polimeraz pati aptinka ir itaiso savo klaidas. sintetinam DNR grandin per klaid patenka tik vienas i 109-1 0 " nukleotid.

L 2 i K lausim ai
1. Kas yra genetins informacijos nuraymas? Kokios slygos reikalingos, kad jis vykt? 2. Kaip vyksta RNR molekuls sintez? 3. Kokie svarbiausi DNR ir RNR sintezs panaumai bei skirtumai?

U d a v in ia i 1. Nurodykite informacins RNR nukleotid sek ioms gen (matricins DNR grandins) atkarpoms: a) AATCACGATCCJTC^GAGG; b) A fify ^ fttG G A ft G G C C A A G ; c) TCGCGTAAGCTGGCTTAGCCG; d)GCCTAGCTGCCGCTTAGTCTG; e) TCTGATCCTAGCCTAGGACTT. 2. Tyrimais nustatyta, kad informacinje RNR 34 % sudaro guaninas, 18 % uracilas, 28 % - citozinas ir 20 % - adeninas. Apskaiiuokite kiekybin santy k tarp A + T ir G + C DNR grandinje, nuo kurios nukopijuota i RNR.

1. 5 . 2 .
RNR brendimas

Susintetintos vairi tip RNR molekuls daniausiai dar nra veiklios. Jos turi gyti tam tikr struktr, t. y. subrsti, kad galt atlikti specifines funkci jas (r. 1.1 lentel p. 14). Brendimo laikotarpiu jos tam tikru bdu pakeiia mos: specials ferm entai nukerpa" nereikalingas susintetintos RNR molekuls dalis arba prijungia papildomas, kovalentikai pakeiia kai kuriuos nukleotidus. Prokariot ir eukariot lstelse brsta visos tRNR ir rRNR, o RNR brendimas bdingas tik eukariotams. Plaiau inagrinkime eukariot iRNR molekuls brendim (1.15 pav.). Ne subrendusi RNR molekul vadinama pirminiu nuorau, pre-iRNR arba heteroge nine branduolio RNR (hbRNR). Pirmieji jos brendimo etapai neatsiejami nuo nuraymo, nes prasideda paioje jo pradioje. Prie k tik susintetinto pre-iRNR molekuls 5' galo prijungiamas kiek pakeistas guanino nukleotidas - vadinamo ji kepur, sauganti sintetinamos molekuls 5' gal nuo ardani (katalizuojan i) ferm ent. Be to, ji nurodo maajam ribosomos subvienetui, kur prisijungti prie iRNR molekuls (r. 1.5.3.4 skyri). Pre-iRNR sintez vyksta tol, kol RNR polimeraz DNR matricos grandinje pasiekia tam tikr nukleotid sek, vadina m poliadenilinim o signalu (daniausiai ji bna ir nuraymo baigms signa las). Paskui prie iRNR grandins 3' gale dar prijungiama apie 1 0 0 -2 0 0 adenino nukleotid, t. y. susidaro vadinamoji iRNR molekuls poli-A uodega. i uodega apsaugo molekuls gal, prieing kepurei, nuo ferm ent poveikio. Galiausiai DNR grandin ir RNR polimeraz atsiskiria nuo susintetintos pre-iRNR nukleotid grandins. Pastebtina, kad baigta sintetinti pre-iRNR m olekuldar nra baigusi brsti. Prie jai persikeliant i branduolio citoplazm, dar turi vykti svarbiausias iRNR molekuls brendimo etapas - sukirpimas.

Pirminis iRNR nuoraas yra lygiai tokio pat ilgio kaip ir DNR grandin, nuo kurios jis buvo nuraomas. Eukariot lsteli pirminiuose iRNR nuorauose, kaip ir atitinkamuose genuose, nukleotid sekas, pagal kurias bus sintetinamas bal tymas, yra siterp nekoduojantys intronai, padalijantys koduojanij nukleoti d sek egzonus (1.9 pav., p. 21; 1.15 pav.). Tam tikri branduolio fermentai ikerpa intronus ir sujungia gretim egzon galus (1.15 pav.). Taip galiausiai suformuojama subrendusi veikli iRNR molekul, pro branduolio membranos po ras ikeliaujanti citoplazm, kur ribosomose vyksta polipeptid sintez. l_ 2 i K la u s im a i 1. Kokie svarbiausi iRNR molekuls brendim o etapai? 2. Paaikinkite pre-iRNR molekuls sukirpim.

1. 5 . 3 .
Genetins informacijos perklimas j polipeptido am inorgi sek 1. 5 . 3 . 1.
Genetinis kodas
Pagrindinis genetikos teiginys skambt taip - genas pagrindia baltym o (polipeptido) sintez. Geno DNR nukleotid sekoje gldi informacija apie poli peptido aminorgi sek. Panaiai kaip ir teksto, kur js skaitote, raidi sekoje yra ukoduota odi bei sakini reikm. Yra inoma 20 polipeptidus sudarani aminorgi, o skirting iRNR nukleotid - raidi", kurios gali koduoti baltymo struktr, tra keturios - U, A, C ir G. Taigi vien aminorgt turi koduoti daugiau nei vienas nukleotidas - viena raid. Jei aminorgt koduot du nukleotidai (dvi raids), galim derini tebt 16. Taigi j nepakakt 20-iai aminorgi koduoti. Kai kod sudaro trys raids, galim skirting derini yra jau 64, t. y. tikrai utenka visoms aminorgtims. Toks nukleotid trejetas (tripletas), koduojantis vien ami norgt, vadinamas kodonu. Kaip sintetinamo polipeptido aminorgi seka atitinka geno DNR nukleotid (kodon) sek, nusako genetinis kodas. Kitais odiais tariant, genetin kod galima bt pavadinti odynu genetins informa cijos - nukleotid sekos odiams" - kodonams iversti baltym kalbos o dius" - polipeptido aminorgtis ir skyrybos enklams sudti" - polipeptido sintezs pradios ir pabaigos signalams paymti. 2g
P a v e ld im u m a s

Dvigrand DNR
Promo torius Egzonas
Intronas Egzonas Koduojanioji grandin _______ Intronas Egzonas

5'
3'

Matricin grandin

Pirminis iRNR nuoraas (pre-iRNR)


5 '|E q zo n a s| I Egzonas 13'

M
iRNR brendimas:
Kepur

1. 5' ga le prijungiam a kepur, o 3' ga le - po li-A uo d e g a


Egzonas

p0ii-A uodega

^____
5' Egzonas Egzonas! AAAAAAA . 3'

2. Ikerpam i intronai ir s u jungiam i e g z o n galai

1.15 pav. iRNR m olekuls brendim as eukariot lstelje

kompleksas

Kepur 5'

Subrendusi iRNR molekul

ii

PolhA uodega

AAAAAAA. ~

1 3'

Genetinio kodo iifravimas Teoriniai ir eksperimentiniai genetinio kodo' iifravimo pagrindai buvo sukurti 19541965-aisiais. 1961-aisiais gauta pirmoji sintetin RNR molekul, sudaryta tik i uraciio baz turini ribonukleotid (poli-U RNR). Mgintuvlyje, kuriame buvo visos 20 bal tymo sintezei reikalingos aminorgtys, fermentai ir poli-U RNR, buvo susintetintas poli peptidas, sudarytas tik i fenilalanino liekan. Tokiu bdu rodyta, kad fenilalanino terpim baltym koduoja UUU kodonas. Tereikjo patikrinti, kokias aminorgtis
G en etinio kodo idja, beje, kilo fizikui teoretikui D. Gamovui (G. Gamov) (JAV). io te rm in o va rto se n a dar nenusistovjusi - stop kodonai; beprasmiai arba nonsens kodo nai; stabdantieji kodonai.

koduoja kiti nukleotid trejetai. Netrukus tai buvo atlikta patobulinus eksperimento slygas. Prie io darbo daug prisidjo ir ms tautietis Martynas Yas (JAV). I 64 galim kodon 3 ymi ne am inorgt, bet polipeptido sintezs pabai g ir vadinami baigm s kodonais2: UAA, U GA ir UAG. Am inorgtim s ko duoti lieka dar 61 kodonas, taiau baltymus sudarani aminorgi tra 20.

Koduojama aminorgtis
(vienaraidis simbolis)

GAG: E (glutamo rgtis) GAC: D (asparto rgtis)

Treiasis kodono nukleotidas (3') Antrasis kodono nukleotidas

Pirmasis kodono nukleotidas (5')

GUC: V (valinas)

Sintetinant pollpeptid aminorgi seka nuskaitoma nuo IRNR molekuls, todl genetinis kodas uraomas ribonuk leotid bazmis (A, U, G, C). DNR molekulje yra ne uracilas (U), bet tlminas (T), taigi atitinkamai keiiasi ir genetinio kodo ymjimas:

DNR - TTT ATG, TGT, ...

Genetinis kodas gali bti pateikiamas ir diagrama, ir lentele

iRNR - UUU, AUG, UGU,... J *


(F,

+
M,

*
C ,...)

aminorgtis - Phe, Met, C ys,...

Aminorgtis
Vienaraidis Triraidis simbolis simbolis A C D E F G H -I K L M Ala Cys Asp Glu Phe Gly His lie Lys Leu Met Pavadinimas Alaninas Cisteinas Asparto rgtis Glutamo rgtis Fenilai aninas Glicinas Histidinas Izoleucinas Lizinas Leucinas

Aminorgtis Kodonai (r n r )
GCA, GCG, GCU, GCC UGU, UGC GAU, GAC GAA, GAG UUU, UUC GGA, GGG, GGU, GGC CAU, CAC AUA, AUU, AUC AAA, AAG UUA, UUG, CUA, CUG, CUU, CUC S T V W Y X Ser Thr Vai Trp Tyr
-

Vienaraidis Triraidis simbolis simbolis N P Q R Asn Pro Gln Arg

Pavadinimas

Kodonai (r n r )
AAU, AAC CCA, CCG, CCU, CCC CAA, CAG AGA, AGG, CGA, CGG, CGU, CGC AGU, AGC, UCA, UCG, UCU, UCC ACA, ACG, ACU, ACC GUA, GUG, GUU, GUC UGG UAU, UAC UAA, UAG, UGA

Asparaginas Prolinas Glutaminas Argininas Serinas Treoninas Valinas Triptofanas Tirozinas Baigms (stop) kodonai

AUG Metioninas (kartu ir polipeptido sintezs pradios kodonas)

1.16 pav. Eukariot genetinis kodas

N ustatyta, kad 1 am ino rg tj gali ko duoti daugiau nei 1 kodonas. Gerai istudijuokite g en etin io kodo lentel 1.16 paveikslo apaioje. Tik 2 aminorgtis i 20 (m etionin ir trip to fa n ) koduoja 1 kodonas, o 3 am inorgtys (leucinas, argininas ir serinas) tu ri net po 6 kodonus. Vienas am inorgtis koduojani kodon yra ypatingas: A U G ne tik lemia am inorgties m etionino te rp im j p olipeptidin grandin, bet kartu ymi ir polipe ptid o sintezs pradi.

0 0
Genetinio kodo ypatybs 7. Genetinis kodas yra universalus, t. y. vis organizm vienodas. Pastaba. Eukariot mitochondrij DNR ir prokariot genetinis kodas truput skiriasi nuo eukariot branduolio DNR kodo. 2. Genetinis kodas yra isigims, t. y. daugum aminorgi koduoja daugiau nei vienas kodonas. 3. Genetinis kodas yra nesanklotinis, t. y. kodonai nepersidengia. 4. Genetinis kodas turi baltymo sintezs pradios signal AUG kodon ir pabaigos signalus - baigms kodonus UAA, UGA ir UAG.

L 2 l
1. 2. 3. 4.

K la usim ai

Kas yra genetinis kodas? Kokia jo pagrindin funkcija? Kodl 1 am inorgtj gali koduoti daugiau nei 1 kodonas? Kurie kodonai yra ypatingi ir kodl? Kokios svarbiausios genetinio kodo ypatybs?

U d a v in ia i 1. Polipeptido grandins dal sudaro ios aminorgtys: valinas - alaninas - glici nas - lizinas - triptofanas - valinas - serinas - glutaminas. Nurodykite DNR grandins, koduojanios i baltymo dalj, nukleotid sek. Pastaba. Jei am inorgtj koduoja keli kodonai, nukleotid sekai urayti pasi rinkite b e t kur. 2. Insulino B grandins pirmosios 10 aminorgi yra ios: fenilalaninas - valinas - glutaminas - histidinas - leucinas - cisteinas - glicinas serinas - histidinas. N urodykite DNR grandins, koduojanios i insulino dalj, n ukleotid sek (r. 1-ojo udavinio pastab). . ^ f*4 3. Insulino A grandins pirmosios 5 aminorgtys yra ios: ^ lizinas - izoleucinas - valinas - glutaminas - glutaminas. Nurodykite DNR grandins ir informacins RNR, koduojanios i insulino dal, nukleotid sek (r. 1-ojo udavinio pastab). 4. DNR molekuls, lemianios baltymo sintez, koduojaniosios grandins dalis sudaryta i i nukleotid: ...ACCATTGACCATGAA... Nustatykite aminorgi sek atitinkamame baltymo fragmente. 5. Tarkime, kad vidutinikai 1 aminorgties molekulin mas yra 110, o 1 nukleotido - apie 300. Apskaiiuokite, kokia bus baltymo, sudaryto i 240 aminorg i, molekulin mas. Apytiksliai vertinkite, kas sunkesnis: baltymas, sudarytas i i aminorgi, ar j koduojantis genas. 6. Hormon insulin sudaro A ir B grandins, sudarytos i 51 aminorgties. Skirting ri organizm (jauio, arklio, avino) i polipeptid aminorgi seka iek tiek skiriasi. Skirting aminorgi skaiius i gyvn insulino mole kulje pateikiamas 1.6 lentelje. Nustatykite kiekybin santyk tarp A + T ir G + C DNR grandinje, koduojanioje kiekvieno i i trij gyvn insulino molekul.

" i eres-.

Aminorgi

a a u jauio, avino ir arklio

n sttin c otekulje

-u-i'-crjss

Aminorgi skaiius insulino molekulje

jauio

S ien as
v a ir a s

4 5 1 6 3 5

avino
5 5 1 6 3 5 2 1 1 1 2

s e u e ru s
P je r a s ze r a a r ~as

S p -ra s

-?cnras _cnas -*? n ra s -> s:a ra s

1 1 1 2

l-rera;
^-D irva s A a - ir a s 3 . ra as 'j t 'S

6
1

6
1 3

6 3

6 3

arklio 5
4 2 6 3 5 2 2 1 1 2

6
1 2

6 3

S 7. 4-asis hem oglobino polipeptidas sudarytas i 8 aminorgi. i aminorgi kiekis skirtingi jose hem oglobinuose pateiktas 1.7 lentelje.
1.7 le n te l . A m inorgi skaiius h e m o g lo b in H bA , HbS, HbC, HbG ir H b D.orditaiin 4-ojo p o lip e p tid o g ra n d in je

Aminorgtis

Valinas
Histidinas Leucinas Treoninas Prolinas

Aminorgi skaiius hemoglobin 4-ojo polipeptido grandinje HbA HbS HbC HbG Hbn. Dzordztaun 1 2 1 1 1

1 1 1
2

Glutamo rgtis
Lizinas

1
0

Glicinas

1 1 1 1 1 0

1 1 1 1
2

1 1 1 1 1
1

1 1 1 1
2

Apskaiiuokite kiekyb n santyk tarp A + F ir G + C DNR gran dinje, koduojanioje vairi hemog obino for m 4-ojo polipeptid o grandin 8. Atstumas tarp greti m nuklee3tid DNR molekul e yra 0,34 nm. Koks bus ilgis geno, koduojan io norma hemog obin, jei baltyrr sudaro 287 am ino rgtys? y

1. 5 . 3 . 2 .
RNR molekul tik pernea genetin informacij apie baltymo pirmin struktr

tRNR - genetins kalbos vertja"

(aminorgi sek jo molekulje) i DNR j polipeptido sintezs fabrik" - ribosom. Ji nemoka polipeptid kalbos", todl pati negali atpainti aminorgi, ku rias pagal joje ukoduot informacij reikia terpti j polipeptido grandin. Taigi btinas vertjas i nukleorgi polipeptid kalb. i funkcij atlieka tRNR molekuls, kurios transportuoja aminorgtis ribosomas.

Aminoacil-tRNR
< - am inorgtis (alaninas)

tRNR tretin struktura

tRNR pirmin ir antrin struktra

3 ' A < A k c e p to rin is c g ala s

D idiosios kilpos

D vigrands sritys Kilpa

~A-U /G G Y m V
1.17 pav. Transportini RNR stru ktra : kairje pirm in ir antrin (pateikiam a kaip tRNRA la pavyzdys), deinje tre tin (erdvin)
C - lK

p-C-C-GrG^

i T T T T

V ienagrandis akceptorinis galas

G -C -G -C

>

ii
G'

Antikodonas

f e

Antikodonas
A ntikodonas skaitom as prieinga kryptim i nei kodonas, nes yra jam kom plem entarus (papildantis)

Antikodonas: 3-CGA-5' Kodonas: 5'-GCU-3'


Pagal atradimo viet - Dord taun (Georgetown).

7 r . s

tRNR yra nedidels (sudarytos i 7 3 -9 3 nukleotid) poliribonukleotidins gran dins. tRNR nukleotid grandinei susivijus, kai kurie jos fragmentai atsiduria prie komplementarisias (papildanisias) nukleotid sekas, ir tarp atitinkam ba zi atsiranda vandenilins jungtys (1.17 pav., p. 32). Nesusiporav" tRNR mole kuls fragm entai sudaro keturias kilpas. Tai antrin tRNR struktra, primenanti dobilo lap. Suartjus gretim om s molekuls dalims, tRNR galiausiai jgyja tre tin - apverstos L raids struktr. Am inorgtis prisijungia prie tRNR m o lekuls 3' (akceptoriniam e) gale esanio nukleotido ribozs. Kilpoje, esanioje prieingoje nei akceptorinis galas erdvins struktros dalyje, yra isidsts antikodonas. Tai 3 nukleotidai, kom plem entars konkreiam iRNR kodonui. tRNR sin te tin a m a ir brsta bra nd uo lyje , o a m in o r g ty s p riju n g ia m o s citoplazmoje. Tai atlieka specifiniai ferm entai (j yra 20 - po 1 kiekvienai aminorgiai). Kiekvienas i fe rm e nt tenka tik vienai i keli galim tRNR ir sujungia j su atitinkam a am inorgtim i aminoacil-tRNR. Specials baltymai padeda aminoacil-tRNR nukeliauti j ribosom, kur vyksta baltym o sintez. Kaip tRNR iveria nukleotid sekos kalb j aminorgi sekos kalb? 1) kiekviena tRNR m olekul tu ri specifin antikodon, kuriuo perskaito" jos atvilgiu kom plem entar iRNR molekuls kodon; 2) prie tam tikros tRNR molekuls gali bti prijungta tik 1 aminorgtis btent ta, kurios kodon atpasta tRNR antikodonas (sidmtina! - 1 am ino rgtis gali bti transportuojam a daugiau nei 1 tRNR!). K la u s im a i 1. Kokia yra tRNR funkcija? 2. Kokia tRNR molekuls pirmin, antrin ir tretin struktra? Kas yra antikodonas? 3. Kaip tRNR molekul perskaito" genetin informacij, gldini iRNR molekulje? 4. Kaip tRNR molekul susieja kodon su konkreia aminorgtimi?

33
P a v e ld im u m a s

1. 5 . 3 . 3 .
Ribosoma (1.18 pav.) yra rRNR (r. 1.1 lentel p. 14) ir baltym kompleksas.

Ribosoma [^peptid sintezs fabrikas"

Ribosomos, esanios prokariot ir eukariot lstelse, iek tiek skiriasi. Riboso m sudaro du subvienetai - didysis ir maasis. rRNR molekuls yra nukopijuoja mos nuo atitinkam DNR gen. Kartu su ribosom baltymais jos sudaro ribosom subvienetus, kurie keliauja i branduolio lstels citoplazm nepriklausomai vienas nuo kito. Vykstant polipeptido sintezei didysis ir maasis ribosomos subvienetas sudaro ribosom, o sintezei pasibaigus vl atsiskiria.

1.18 pav. : bcsom a. A - ribosomos n k f e . sukurtas rem iantis r'-tse ^o krista lo g ra fin ia is :. - t ; 5 - r bosomos subvienetai

A. RIBOSOMA
Peptidiltransferaz

B. RIBOSOMOS SUBVIENETAI
Maasis subvienetas Didysis subvienetas

Prokariot ribosoma: 70 S
30 S 50 S

CENTRAI: I - ijimo
(laisvos tRNR vieta)

P - peptidinis
(tRNR su auganiu poiipeptidu vieta)

A - acilinis
(aminoacil-tRNR vieta)

Augantis polipeptidas

40 S

60 S

Eukariot ribosoma: 80 S

1. 5 . 3 . 4 .
Baltymo sintez (transliacija1 )
L v a n sta d o - perneimas,

Baltymo sintez yra procesas, kurio m etu pagal informacij, gldini DNR n u kleo tid sekoje ir nurayt j iRNR m olekul, i am inorgi s in te tin am a p o lip e p tid in g ra n d in . Kokia aminorgtis tu ri bti terpta baltym o molekul, parodo iRNR kodonas. Polipeptido sintezs kompleks su daro ribosoma, iRNR, aminoacil-tRNR ir daugelis pagalbini baltym (baltym o sintezs veiksni).

Baltymo sintez yra sudtingas procesas, vykstantis trim is pagrindiniais eta pais (1.19 pav.): 1) polipeptidins grandins sintezs pradiaj(in/c/ac//a); 2) polipeptidins grandins ilgjimas (elongacija); 3) polipeptido sintezs pabaiga (te rm in a d ja ). Kiekvien i etap dar galima skirti j atskirus ingsnius" - ribosomos po slinkius, nes transliacija vyksta ingsnis po ingsnio" - kodonas po kodono. Juose visuose dalyvauja daugelis specifini baltym (prokariot ir eukariot baltym o sintezs pradios, ilgjimo ir baigms veiksniai). Svarbiausias baltymo sintezs energijos altinis yra guanozintrifosfato (GTP) molekuls. Eukariot ir prokariot lstelse polipeptid sintezs procesai iek tiek skiriasi, taiau esmi niai ingsniai yra tokie pat. ^ Pagrindiniai baltymo sintezs etapai (1.19 pav.) 1. Polipeptidins grandins sintezs pradia 7.7. Eukariot lstelse ribosomos maasis subvienetas sveikauja su kepure paym tu iRNR 5 ' galu ir slysta iRNR molekule 5 '-> 3 ' kryptimi iki pirmojo pradios kodono AUG. Prokariot iRNR molekuls 5 ' gale kepurs neturi, taiau ribosomos atpasta specifin i molekuli 5 dalies antrin struktr. 7.2. Dalyvaujant pradios veiksniams prie AUG kodono prijungiama pradedanioji Met-tRNR (t. y. aminoacil-tRNR, gabenanti metionin, kurio -NH2grup ublokuota). Met-tRNR antikodonas yra komplementarus iRNR AUG kodonui. 7.3. Prie maojo ribosomos vieneto prisijungia didysis ribosomos subvienetas, ir susi formuoja aktyvi ribosoma, kurioje yra trys tRNR buvimo centrai: acilinis (A) - aminoacil-tRNR prisijungimo vieta, peptidinis (P) - tRNR su augania polipeptidine grandine buvimo vieta ir ijimo (!) - laisvos tRNR buvimo vieta. Polipeptido sintezs pradioje P centre yra Met-tRNR. 2. Polipeptidins grandins ilgjimas 2 .7. Dalyvaujant ilgjimo veiksniams! A centr terpiama nauja aminoacil-tRNR, kurios antikodonas komplementarus antrajam iRNR kodonui (1.79 paveiksle - tai alanin ga benanti Ala-tRNR). 2.2. Kai ribosomos P centre yra Met-tRNR, o A centre - Ala-tRNR, j aminorgtys atsiduria ribosomos fermento peptidiltransferazs srityje viena greta kitos. Peptidiltransferaz katalizuoja transpeptidacijos reakcij: M et perkeliamas ant Ala, ir tarp M et karboksilo grups ir Ala amino grups susidaro pirmoji peptidin jungtis (polipeptidin grandin ilgja C galo kryptimi, nes pirmojo M et -NH2grup visada bna ublokuo ta). Taip susidaro dipeptidas, prijungtas prie antrosios tRNR, o pirmoji tRNR lieka laisva. 2.3. Ribosoma pasislenka 5 ' 3 ' kryptimi per vien iRNR kodon. Taip I centre atsidu ria laisvoji tRNR, P centre - tRNR su baigtu sintetinti dipeptidu, o A centras ties naujuoju iRNR kodonu lieka laisvas. 2.4. I I centro paalinama laisvoji tRNR. 2.1-2.4 ingsniai sudaro cikl, kuris kartojasi tol, kol ribosoma pasiekia vien i baig ms kodon. Vlesni ciklai nuo pirmojo skiriasi tuo, kad vykstant 2.1 ir 2.2 poslinkiams ribosomos P centre esanti tRNR turi ne vien aminorgt, bet kaskart ilgesn aminorgi grandin (sintetinam polipeptid). Ribosomos peptidiltransferazs zonoje viena greta kitos visada atsiduria P centre esanti peptidil-tRNR paskutinioji (galin C) aminorgtis ir A centre esanti aminoacil-tRNR aminorgtis. Prie P centre esanios tRNR prijungtas polipeptidas perkeliamas prie A centre esanios aminoacil-tRNR aminorgties, ir sudaroma nauja peptidin jungtis. Polipeptido sintez vyksta dideliu greiiu - vos per vien sekund susintetinamas 15-os aminorgi polipeptidas. 3. Polipeptidins grandins sintezs pabaiga 3.1. Kai ties ribosomos A centru atsiduria vienas i baigms kodon (UAG, UAA, UGA), polipeptido sintez sustoja, nes nra aminoacil-tRNR, kurios antikodonas bt jam komplementarus. 3.2. Baigms kodonus atpasta baltymai, vadinami atpalaidavimo veiksniais. Tokiam veiksniui atsidrus A centre, nuo paskutiniosios P centre esanios peptidil- tRNR paali namas baigtas sintetinti polipeptidas. 3.3. Ribosoma suskyla subvienetus, atpalaiduojama iRNR. Taigi visas baltymo sinte zs kompleksas suskyla sudedamsias dalis, kurios vl gali dalyvauti naujo polipeptido sintezje.

1. POLIPEPTIDINES GRANDINES SINTEZES PRADIA Ribosoma


O dviej suovienet) tRNR buvimo ribosomoje centrai Ties RNR pirmuoju AUG kodonu susiformuoja aktyvus polipeptido sintezs kompleksas. Pirmoji j ribosomos P centr perduodama aminorgtj gabenanti tRNR visada

RNR
AAAAAAAAAAA 3'

Kodonai

Poli-A uodega

2. POLIPEPTIDINES GRANDINS ILGJIMAS 2.1. Amicoacil-tRNR j ribosomos


A centr atgabena nauj amiTorgtj ir per antikodon sveikauja su nauju kom^ementariu iRNR ko-

2.4.

donu

Laisva tRNR paalinama i ribosomos I centro

35
P a v e ld im u m a s

2.1-2.4 ingsniai sudaro cikl, kuris kartojamas, kol ribosoma pasiekia baigms kodon (STOP)

2.2. Tarp aminorgi, kurias aminoacil-tRNR atgabeno nbosom, susidaro peptidin jungtis () 5'

2.3. Ribo soma pasis lenka per vien iRNR kodon, ir tRNR su ilgjaniu polipeptidu atsiduria P centre

3. POLIPEPTIDINES GRANDINS SINTEZS PABAIGA Susintetintas polipeptidas


< a nbosoma pasiekia baigms kodon (STOP), Susintetintas polipeptidas atpalaiduojamas, polipeptido sintezs kompleksas suyra j sudtines dalis

1 oaveikia atpalaidavimo veiksnys, ir polipeptido


srte z sustoja

Atpalaidavimo veiksnys
5' AAAAAAAAAAA 3'

w Polipeptidas

- Polipeptido sintezs komplekso dalys

1.19 pav. Pagrindiniai po lip eptido sintezs etapai

Kai pradinje iRNR dalyje gldini informacij perskaito" viena ribosoma ir pradeda keliauti iRNR molekule tolyn, prie iRNR gali prisijungti kita ribosoma. Da nai pagal t pad iRNR molekul polipeptidus sintetina isyk kelios ribosomos. Taigi susiformuoja vadinamoji polisoma. Kadangi prokariot susintetintos iRNR nereikia perkelti i branduolio citoplazm, ribosomos prisitvirtina prie dar nebaig tos sintetinti iRNR molekuls 5' galo. Ribosomos subvienetai bei baltymo sintezs veiksniai yra stabils ir dalyvauja daugelio polipeptid sintezje. sidmtina, kad iRNR molekuls - prieingai nestabilios: pasibaigus polipeptidins grandins sintezei (kartais po keli minui nuo paios iRNR sintezs), jos suardomos.
P a s ta b a . B a lty m o p o lip e p tid in g ra n d in s u d a ro ( ir p rie am in o a cil-tR N R p r iju n g to s ) n e am in o r g ty s , b e t j liekan os. Tai visada de ra p r is im in ti a p ib d in a n t i g ra n d in , nes d a n ia u s ia i v ie to j a m in o r g tie s lie k a n a " sa ko m a ( ir ra o m a ) tie s io g a m in o r g tis .

Susintetintas polipeptidas dar nra veiklus baltymas - jis turi jgyti tam tikr erdvin struktr. Kai kurie baltymai tam pa veikls tik juos modifikavus: a) nu kirp us" nereikalingas p olipe ptid o dalis (pvz., insulinas - r. II dalies 3.8 pav.); b) po g jtam j ar negrtam j pokyi pakitus kai kuri am inorgi liekanoms (susidarius disulfidiniam s tilteliam s; prijungus acetilo, fosfato, hidroksilo grupes, polisacharid, lipid molekules ir pan.); c) susidarius kompleksams su tokiais pat ar kitais polipeptidais bei nebaltyminmis molekulmis (kaip antai eritrocit baltymas hem oglobinas, kuris yra sudarytas i dviej a globino grandini, dviej |3 globino grandini ir 4 nebaltym ini hem).

1. Kas yra polipeptid sintez? Kur ji vyksta ir kas joje dalyvauja? 2. Kaip ribosoma suino, koki aminorgt reikia terpti sintetinam polipepti din grandin? 3. Kokie yra pagrindiniai polipeptido sintezs etapai? 4. Kaip prasideda polipeptido sintez? Kaip ribosoma suino", kurioje vietoje jai reikia prisitvirtinti prie eukariot ir prokariot iRNR molekuls? 5. Kaip ilgja polipeptidin grandin? Kokie pagrindiniai io etapo ingsniai? 6 . Kaip ribosoma suino", kad reikia baigti polipeptido sintez? Kaip baigiasi polipeptido sintez? 7. Kas vliau atsitinka sudedamosioms polipeptido sintezs komplekso dalims?

1. 5 . 4 .
Gen raikos reguliavimas
Kiekviena prokariot ir eukariot lstel turi vis tos ries organizmui bdin g gen rinkin. Taiau ar visi genai turi veikti nuolatos? Be abejo, ne. Juk ne visi gen koduojami baltymai yra nuolat reikalingi organizmui. Taigi pastovi vis gen veikla bt tiesiog neekonomika ir netgi alinga. Antra vertus, vieno ge no koduojamo baltymo reikia daug, kito - maai. Taigi gen veikla turi bti reguliuojama.

Prokariot gen raikos reguliavim as

Svarbiausia daugumos prokariot lsteli funkcija yra augti ir daugintis. Vie nas j gyvybingumui svarbias mediagas jos gauna i aplinkos ir jas perdirba, o kitas, kuri negali gauti i aplinkos arba gauna nepakankamai, pasigamina pa ios. Tad reikalinga tam tikra sistema, reguliuojanti su mediag apykaita susiju si gen veikl. Daniausiai vienos mediagos (pvz., kurio nors angliavandenio ar konkreios aminorgties) apykaita vyksta keliais etapais. Kiekvien j katalizuoja tam tikras fermentas. Taiau visus vienos mediagos apykaitoje veikiani ferm ent genus galima reguliuoti kartu. Prokariot organizm e tokios gen gru ps danai dalyvauja vadinamj operon veikloje.

L / _ J Operonas ir jo reguliavimo budai Inagrinkime operon ir jo veikim pagal arnyno lazdels Eschericia coli pieno cukraus laktozs ir aminorgties triptofano apykaitos ferment gen operon (lac ir trp) pavyzd. Operon sudaro (1.20 pav.): 1) grup struktrini gen, pagal kuriuos sintetinami vieno mediag apykaitos pro ceso fermentai (lac operone yra fermento laktazs genas ir du kiti genai, o trp operone keli triptofano gamybai btini ferment genai); 2) promotorius, nuo kurio pradedami nurainti struktriniai genai; 3) operatorius, prie kurio gali prisijungti i gen nuraym reguliuojantis baltymas, kurio erdvin struktra gali kisti, prisijungus induktoriaus ar korepresoriaus molekulei. is baltymas vadinamas represoriumi. J koduojantis genas operonui nepriklauso. Kaip reguliuojamas operonas? Kai represorius neprisijungs prie operatoriaus, RNR polimeraz, sveikaudama su promotoriumi, pradeda RNR sintez ir nurao visus struktrinius genus vien iRNR molekul, nuo kurios ribosomose sintetinamos atitinkam ferment (tarp j ir laktazs) molekulse. Prisijungs prie operatoriaus, represorius tampa klitimi RNR polimerazs sveikai su promotoriumi, ir operono struktriniai genai nenuraomi. Taigi nesintetinami ir atitinkami fermentai. Kaip represorius suino", kada jam reikia prisijungti prie operatoriaus? Galimi du pagrin diniai mechanizmai - indukcija arba represija. 1. Indukcijos pavyzdys yra lac operonas. E. coli lstel daugiausia vartoja gliukoz. Taiau kai jos nra, ima skaldyti laktoz. Kol terpje pakanka gliukozs, laktozs apykaitos ferment nereikia, ir lac operon blokuoja aktyvus represorius, prisitvirtins prie operato riaus. Jei gliukozs stinga, o terpje yra laktozs, laktozs molekul sveikauja su represo riumi ir taip pakeiia jo erdvin struktr, kad is nebegali sveikauti su operatoriumi. Nebelieka klii RNR polimerazs sveikai su promotoriumi, ir lac operono genai nurao mi. Taigi laktozs molekul yra lac operono mduktorius 2. Represijos pavyzdys yra trp operonas. Kol terpje pakanka triptofano, E. coli lstelei neverta eikvoti energijos ir gaminti j paiai. Triptofanas prisijungia prie neaktyvaus represoriaus ir, pakeisdamas jo erdvin struktr, leidia sveikauti su operatoriumi, t. y. blokuo ti trp operono gen nuraym. Taigi triptofanas yra korepresorius, nes be jo represorius neaktyvus. Kai terpje triptofano nra, nuo represoriaus molekuls atsiskiria korepreso riaus triptofano molekul, ir represorius, pasikeitus jo erdvinei struktrai, nebegali likti prisijungs prie operatoriaus. Nebelikus klities RNR polimerazs sveikai su promotoriu mi, vyksta trp operono gen raika. Taigi lstel gali pati pasigaminti triptofano. U tyrimus, kuriais remiantis 1961-aisiais buvo sukurta operono teorija, prancz moks lininkai F akobas (F. Jacob) ir. Mono (J. Monod) buvo apdovanoti Nobelio premija. . Prokariot gen, kuri veikla nra nuolatin (t. y. indikuojam arba represuoja m gen), raik galima reguliuoti tik valdant gen nuraym. Be promotoriaus ir operatoriaus komplekso yra inomi ir kiti prokariotini gen nuraymo kontro ls mechanizmai. Antra vertus, nors prokariot lstelse gen veikla daniausiai valdoma vykstant transkripcijai, kai kuri gen raika gali bti reguliuojama ir sintetinant baltym. Eukariot gen raikos reguliavim as Lyginant su vienalsiais prokariotais, daugialsi eukariot lstels yra kur kas tiksliau apibrtos paskirties. Konkreioms toki specializuot lsteli funkcijoms atlikti reikalingi tam tikri baltymai. Todl vairiose lstelse yra veikls skirtingi gen rinkiniai. Vien gen grup sudaro vadinamieji bendriniai genai, btini lstels gyvybingumui palaikyti ir aktyvs visose lstelse (kaip antai genai, koduojantys DNR, RNR ir baltym sintezei reikalingus fermentus bei kitus baltymus). Kit gen produktai btini specifinms konkretaus tip o lstels funkcijoms Todl tie genai veikia tik to tipo lstelse (pvz., pieno baltymus koduojantys genai veikls tik jauniklius maitinanios induolio patels pieno liauk lstelse). Be to, kai kurie genai turi pradti arba nustoti veikti, kai lstel gauna tam tikr signal. Netgi bendriniai genai aktyvs ne vis laik (antai DNR sintezei reikalingi fermentai ir kiti baltymai sintetinami tik prie lstels DNR dvigubjim). Eukariot gen raika valdoma keliais lygiais (1.21 pav.). Vienas svarbiausi reguliavimas vykstant nuraymui. Eukariot gen nuraymo reguliavimas kur kas sudtingesnis nei prokariot, taiau svarbiausi principai yra bendri.

ecr=-=.;''a_s molekuls, prii _ r . s c < z r :a m tik r regua- e. trukdo nuraymui c

T r s p pca ).

1. OPERONAS RNR polimeraz Represoriaus genas ^ Nuraymas

i l k
Operatorius Promotorius iRNR iRNR 3'

O Represorius

Baltymai (fermentai)

2. NURAYMO REGULIAVIMAS OPERONE INDUKCIJA (pavyzdys: lac operonas) REPRESIJA (pavyzdys: triptofano operonas)

A.

Terpje nra laktozs


Aktyvus represorius ^ Nuraymas nevyksta

A.

Lstelei pakanka triptofano


Aktyvus represorius Nuraymas nevyksta

Triptofanas
(k o re p re s o riu s )

l i m

I M Nesintetinami fermentai, reikalingi Trp susidarymui

Nesintetinama laktaz

B.

Terpje yra laktozs


Neaktyvus represorius

B.

Lstelei trksta triptofano


Neaktyvus represorius

Laktoz
(in d u kto riu s)

Nuraymas

Nuraymas

l l l l Sintetinama laktaz

III

Sintetinami fermentai, reikalingi Trp susidarymui

1.20 pav. Prokariot operonas ir jo reguliavim o bdai

Kas svarbiausia re g u liu o ja n t p ro k a rio t ir e uka riot gen nuraym 7. Geno nuraymui btinas promotorius, nes tik sveikaudama su promotoriumi

RNR polimeraz gali pradti iRNR sintez. Kadangi RNR sintez vyksta 5 '-> 3 ' krypti mi, promotorius turi bti isidsts ties struktrinio geno (t. y. koduojaniosios DNR grandins) 5 ' galu. 2. Kadangi promotorius yra tam tikr nukleotid sek rinkinys, skirtingi toki sek deriniai sustiprina arba susilpnina RNR polimerazs ir promotoriaus sveik. Taigi ir geno nuraymo intensyvum. Todl vieni promotoriai yra silpni "(prie gen, kuri koduojamo baltymo reikia nedaug), o kiti stiprs"(prie gen, kuri koduojamo baltymo reikia daug). 3. RNR sintezs procesui vykti yra btina, kad RNR polimeraz galt sveikauti su promotoriumi. vairs reguliavimo veiksniai padeda arba kliudo tokiai sveikai, leis dami arba neleisdami vykti geno nuraymui.

m
Reguliuojami prokariot genai, dalyvaujantys operon veikloje, tarp promotoriaus ir struktrinio geno turi operatori, su kuriuo sveikauja represoriaus molekul. Represoriui prisijungus prie operatoriaus, geno nuraymas negali vykti. Reguliuojami eukariot genai panai operatori nukleotid sek tarp promoto riaus ir struktrinio geno neturi. Taiau jie turi daugel vairi kit reguliuojanij nukleotid sek. Pagrindins toki reguliuojanij sek grups: gretimieji reguliuojantys elementai, isidst greta promotoriaus (5 ' pus je) arba net paiame promotoriuje. Jie veikia greta esanio geno nuraym, pad dami RNR polimerazei sveikauti su promotoriumi arba trukdydami tai sveikai; tolimieji reguliuojantys elementai, kurie gali bti nutol nuo geno per kelis tkstanius nukleotid por (kartais - netgi geno viduje) ir gali lem ti keli gen nuraym. Tokie reguliuojantieji elementai padeda nuraymui (stiprintuvai), truk do nuraymui (slopintuvai) arba stabdo gretimj reguliuojani element poveik (ribiniai elementai). 4. Genai, veikiantys tik tada, kai reikia j koduojamo baltymo. Kitaip tariant, i gen veikl galima suaktyvinti (geno aktyvinimas arba indukcija) arba prislopinti (geno slopinimas arba represija). Prokariot operono genas: indukuojamas, kai induktoriaus molekul inaktyvina represori; represuojamas, kai korepresoriaus molekul aktyvina represori. Eukariot genas: * aktvvinmas. kai prie atitinkam DNR reguliuojanij element prisijungia aktyva torius arba paalinamas represorius; slopinamas. kai prie atitinkam DNR reguliuojanij element prisijungia represorius arba nuo j paalinamas aktyvatorius. Aktyvatoriai ir represoriai taip pat gali bti aktyvinami ir inaktyvinami (jiems svei kaujant su koaktyvatoriais, korepresoriais ir kitomis baltym bei nebaltyminmis molekulmis). 5. Ir artimieji, ir tolimieji reguliuojantys DNR elementai valdo DNR polimerazs bei promotoriaus sveik, patys sveikaudami su vairi baltym (aktyvatori, represo ri ir pan.) molekulmis 6. Eukariot genas gali bti nuraomas, jeigu ir pats genas, ir jo nuraym le miantys DNR elementai yra paveiks RNR polimerazei, reguliavimo baltymams ir vairiems kitiems nuraymo veiksniams. Todl chromatinas geno srityje ir greta jo neturi bti tankus Taigi nuraym gali lem ti veiksniai, nuo kuri priklauso chroVaikius baltymas

1 kontrol

DNR

Pollpeptidas kontrole Maifctui m rfrum o kontrol U l i lM u i Vaikius baltymas

matino struktra.

Nors baltym koduojanio geno raikos pagrindas yra iRNR nuraymas ir atitinkam o polipeptido sintez, taiau susintetintas polipeptidas ar net veiklus baltymas daniausiai dar nra organizm o fenotipinis poymis. Dauguma kon krei organizm o poymi yra bendros daugelio baltym veiklos, j tarpusavio sveikos bei aplinkos veiksni poveikio rezultatas. Todl apibendrinant galima teigti, kad tam tikro geno raikos procesas - nuo gene gldinios informacijos iki galutins jos iraikos organizm e - yra kur kas ilgesnis ir sudtingesnis. Kiekvienoje geno raikos pakopoje dalyvauja daug skirting baltym (ferm en t, reguliatori, pagalbini baltym ir kt.), kuriuos koduoja kiti genai, veikiami tik jiems bding reguliavimo veiksni.

t r
:_ i

pav.
:-_
r.

ra kos

n o lygmenys

La

K la u s im a i

1. Kodl gen raika turi bti reguliuojama? 2. Kokie yra prokariot gen raikos reguliavimo ypatumai? 3. Kokie yra eukariot organizm geno raikos reguliavimo ypatum ai ir lyg menys? 4. Trumpai apibdinkite, kuo eukariot gen raikos reguliavimas panaus ir kuo skiriasi nuo prokariot gen raikos reguliavimo?

2.
Genetins informacijos perdavimas i kartos j kart: lsteli lygmuo

Lstel1 yra vis gyvj ems organizm pagrindas. Taip galima bt api bendrinti dar XIX amiuje sigaljusi lsteli teorij. 4-ajame XIX a. d e im tm e tyje M. leidenas (M . Schleiden) paskelb, kad visi augalai su daryti i lsteli. Lygiai po m et i te o rij praplt T. vanas (T. Schwann). A p ib e n d rin s ankstesnius lstels tyrin jim u s, m okslininkas p a tv irtin o , kad ne tik augal, bet ir vis gyvn o rg a n izm o sudaromasis elem entas yra lstel. Po m ikrosko p in i lstels ty rin jim lsteli teorija pltojosi ypa spariai. XIX a. viduryje atrasta lstels p ro to p la z m a 2, po poros d eim tm e i nusakyti lstels dalijim osi - m itozs procesai, amiaus p abaigoje - a p tik ti lstels o rg an oida i (struktriniai elementai).
P a s ta b a . N o rs viru s a i ir n ra lstels, ta ia u jie y ra gyvi. V irusai veikia ir d a u g in a s i tik p a te k j k ito o r g a n iz m o lstel.

2 .1.
Lstels ciklas

/ ----------------------------------------------------------------------------------------------------------------------- N Lstels ciklas - tai jos gyvavim o laikotarpis nuo lstels dalijim osi, kai ji susidaro, ligi kito jos dalijim osi, kai susidaro lstels palikuons (t. y. kita lsteli karta), arba paios lstels uvim o. \ ___________________________________ ____________________________________ / Visi gyvi organizm ai sudaryti i lsteli. Todl lsteli dalijimasis lemia ir kitus svarbiausius o rganizm o procesus: augim , atsinaujinim , dauginim si. Suaugusio m ogaus o rganizm sudaro m adaug 100 trilijo n (1 0 14) lste li. Sunku sivaizduoti, taiau toks sudtingas organizm as susiform uoja i vienintels pirm ins lstels zigotos p alikuoni. Lstels dalijimasis slygo jam as daugybs iorini ir vidini veiksni. Duomenys, nurodantys lstelms, kaip jis tu ri vykti, gldi org an izm o genuose. Kokiu bdu garantuojam as o rg an izm o genetins inform acijos perdavim as kitai lsteli kartai ir kitai o rganizm kartai lstelms dalijantis? Kaip toji inform acija gali kisti, kad palikuonys n eb t absoliuiai identikos tv kopijos? Kaip inia, p r o k a r io ta i dauginasi nelytiniu bdu lstelei tiesiog dalijan tis pusiau (toks dalijimasis vadinamas skilimu arba dvinariu dalijim usi). Taigi j lstels ciklas - augim as ir dalijimasis - yra ir viso j org an izm o gyvavi mas. Toki o rg a n iz m g en o m su da ra nti v ien inte l susiraizgiusi iedo

'Lstel (lot. cellula) - pirm a sis term in pavartojo R. Hukas (R. Hooke) 1665-aisiais. P ro to p la zm a (gr. p ro to - pir mas; plasm a - darinys) - klam pi gyvoji lstels mediaga. M itoz (gr. m itos - silas) lstels brandu olio ir visos ls tels netiesioginis dalijimasis, per kur susidaro dvi naujos vienodos lstels (c h ro m o s o m skaiius lstelje nesumaja). M e jo z (gr. m e io s is - su majimas) - augal ir gyvn subrendusi lsteli dalijimasis, po kurio chrom osom skaiius lste l je sum aja - pasidaro viengubas (haploidinis).

fo rm o s DNR m olekul (chrom osom a), p risitvirtinusi prie plazm ins m em b ranos, prie lstelei dalijantis padvigubja. Plazminei m em branai ts ta n t ir fo rm u o ja n tis pertvarlei dvi tapaios DNR kopijos po vien patenka d u k terines lsteles. E u k a rio t lsteli dalijim osi m echanizm as kur kas sudtingesnis. Toki o rg an izm lstels cikl sudaro keturios pagrindins stadijos (2.1 pav.), a tspindinios ir lstels genetins inform acijos rinkinio DNR bei c h ro m o som bsen. Per S stadij padvigubja lstels genetins inform acijos rinkinys. Branduoliui ir lstelei dalijantis, abu ie rinkiniai pasiskirsto d u k terines lsteles. Per G, (ir G0) stadij vyksta ypa intensyvi gen raika. Dalijantis e uka rio t lstelei tu ri pasidalyti ir citoplazm a, ir branduolys. A uktesnij e uka riot som atini lsteli b randuoli dalijim uisi bdinga m it o z 3, o lytins lstels form uojasi branduoliam s dalijantis m e jo z s 4 bdu.

(2,0 val.) Lstel ruoiasi dalijimuisi

(0,7 val.) MITOZ: dalijasi lstels branduolys Ir citoplazma

(6,3 val.) Lstel auga, joje daugja organoid

Gavusi signal, kad reikia dalytis, lstel grta G, stadij

Ramybs bsena
Lstel nebeauga, nesidalija, taiau atlieka specifines funkcijas

2.1 pav.
-a ste ie s c ik lo sta d ijo s. : : - s t e iuose p a ym ta s ta d ij tru k m , b c ->ga m o g a u s o d o s ; : _r r ~ s (fib ro b la s ta m s ), a p g in a m o m s lsteli k u lt ro je

Apribojimo takas
(7 val.) Vyksta DNR dvigubjim as ir kiti svarbs procesai

/
Perengusi R tak ls tel turi pereiti likusias lstels ciklo stadijas

\
Neperengusi R tako lstel gali pereiti ram ybs bsen G0

: ^ Eukariot lstels vairiais poiriais skirstom os daugel tip . G enetiniu p oiriu skiriam i du p ag rindiniai lsteli tipai: som atins arba kno lstels; lytins lstels arba gam etos, dalyvaujanios lytiniu bdu susidarant naujai organizm kartai. Gametos ir lstels, i kuri jos susiformuoja (pvz., sperm atogonijos ir oogonijos, spermatocitai ir oocitai) vadinamos g e n e ra ty v in m is lstelmis.

__________________________________J

Lstels ciklo tru km labai vairuoja ir priklauso nuo lsteli tipo. Kai kurios mogaus kno lstels (kaip antai plaui epitelio) baigia vis lstels cikl nuo vienos mitozs pabaigos ligi kitos mitozs pabaigos greiiau nei per 10 valand. Kepen lstels normaliomis slygomis pasidalija tik vien kart per metus. Taiau jei is organas regeneruoja po paeidimo, lstels ima dalytis labai intensyviai. Atskir lstels ciklo stadij trukm taip pat skiriasi priklauso mai nuo G, stadijos trukm s vairavimo. Kai kuriuose organuose ir audiniuose (kaul iulpuose, odoje, gleivinse) lstels dalijasi - tad ir lstels ciklas karto jasi - vis individo gyvenim. Pastebtina, kad daugelis lsteli, tapusios labai specializuotos, praranda gebjim dalytis (antai, suaugusio mogaus skeleto raumen lstels, smegen lstels neuronai). Taigi paskutinis toki lsteli ciklas tsiasi iki lstels uvim o (danai jis sutampa ir su paties organizm o m irtim i). Lstels cikl valdo daugelis vairi molekuli.

CD
Svarbiausios molekuls, kurios tiesiogiai dalyvauja reguliojant lstels cikl, yra baltymai ciklinai ir nuo ciklin priklausanios kinazs (fermentai, kurie valdo lstels cikl fosforilindami kitus baltymus ir ciklinus). vairs ciklinai sintetinami per specifi nes lstels ciklo stadijas ir suardomi, kai lstelei j nebereikia. iuo metu mokslinin kai intensyviai tiria ne tik ciklinus bei nuo ciklin priklausanias kinazes, bet ir kitus baltymus, reguliuojanius lstels gyvavimo cikl. ie tyrimai tiesiogiai susij su vio problemos sprendimu.

Eukariot lsteli genom sudaro nuo keli iki keli deimi linijini DNR molekuli, kuri kiekviena yra atskiros chromosomos pagrindas. Lstelei dalijan tis abi dukterins lstels turi gauti vienodus chromosom rinkinius - tokius pat, kaip ir tos lstels, i kurios jos susidar. Tik tokiu bdu yra isaugoma visai organizm riai bdinga genetin informacija. Kaip tai vyksta? 1) prie branduolio pasidalijim lstelei dalijantis mitozikai ir prie pirmj mejozin pasidalijim padvigubja kiekvienos branduolio DNR molekul (S stadi ja) (tuo paiu padvigubja ir chromosomos); 2) branduoliui ir citoplazmai dalijantis chromosomos turi pasiskirstyti taip, kad kiekviena dukterin lstel gaut po tok pat j rinkin. Chromosomos tiksliai perduoda eukariot lsteli genetin mediag - DNR dukterinms lstelms. Taigi kokios jos yra, kaip perduodamos kitoms lsteli ir organizm kartoms? J iuos klausimus atsakym ieko citogenetikai. r C itog e n etik a - tai genetikos sritis, tiria nti chrom osom lygmens paveldi m um o ir kintam um o dsningumus. '

f P i K la u s im a i
42 1. Kas yra lstels ciklas ir kokios stadijos j sudaro? Trumpai apibdinkite, kas vyksta lstelje per kiekvien jos ciklo stadij. 2. Kokie yra pagrindiniai eukariot lsteli dalijimosi bdai?

2 .2 .
Chromosomos lstels paveldjimo nejos
Kokia chromosom struktra ir kas jom s atsitinka per mitoz ir mejoz, moks lininkai inojo jau XIX amiaus pabaigoje. Daugiausia duomen apie tai sukaupta naudojant optin mikroskop (2.2 pav., A). Ilgokai ginytasi apie galim chromo som paskirt lstelje. J ryys su paveldimumu, kaip inia, iki pat XX amiaus pradios tebuvo miglota prielaida. Esminius paveldimumo dsningumus (apie juos bus kalbama 3-ajame skyriuje) G. Mendelis atrado dar XIX amiaus 6-ajam e-7-ajam e deimtmetyje. Taiau amininkams j esm suvokti trukd tai, kad nebuvo inomi paveldimumo veiksniai, nors abstrakiai apie juos ir galima buvo numanyti. Tik vliau, kai Mendelio dsnius 1900-aisiais nepriklausomai vienas nuo kito pakartotinai atrado ir vertino K. Korensas (C. Correns), E. von ermakas-Seisenegas (E. von Tschermak-Seysenegg) ir H. de Frysas, paaikjo, kad chromosomos sutampa su diskreiais paveldimumo vienetais. Paveldimumo veiks nius 1 9 0 2-1 903-aisiais teorikai pagrind vokietis T. Boveris (T. Bover) ir amerikietis V. S. atenas (W. S. Sutton), dar neinodami, kad geno pagrindas - tai chromo somoje esanti DNR molekul. Teiginys, kad genai yra chromosomose, yra labai supaprastinta samprata, nors ji ir atspindi pagrindin mokym o apie paveldjim idj.

2.2 pav. m ogaus metafazin chrom osom a. A - pro o p tin m ikroskop m atom os chrom osom os; B - elektroniniu skenuojaniu mikroskopu gautas erdvinis chrom osom os vaizdas; C - elektroniniu mikroskopu gautas chrom osom os vaizdas; D - chrom osom os pieinys; E - chrom osom os schema

Chrom osom struktra ir m orfologija

f.

Interfaziniam e lstels branduolyje chrom osom os labiausiai isivyniojusios ir sudaro branduolio m ediag chrom atin. io lstels gyvavimo laikotarpiu atskir chromosom nemanoma velgti nei pro optin, nei pro elektronin mik roskop. Taiau pavieni chromosom padtis branduolyje nra visikai atsitiktin. Akivaizdu, kad chromosomas geriausia tirti, kai jos labiausiai sutrumpjusios, tankiausios, o j m orfologin struktra aiki ir matoma pro optin mikroskop (2.2 pav.). Tokios bsenos jos yra metafazje (apie i ir kitas mitozs fazes plaiau kalbama 2.3 skyriuje). Todl jos taip ir vadinamos - metafazinmis chro mosomomis.

Regionas Petys Ruoas


26 25 _ 2 242 2 4.3 23 22 2 1 .3

Telomera Ruoas
Chrom osom a padvigubjus DNR Chrom osom a prie DNR dvigubjim

P
(trumpasis petys)

2 1 .2 14.3 14.2 14.1 13 i.

Centromera

11.2 r11.1 11.2 12 j 13.1 13.3 22

m m
Chromosomos schema Nudayta metafazin chromosoma
(3-ioji mogaus chromosoma)

(ilgasis petys)

q
r\

22 23 24 25.1 25.2 25.3 26.1 26.2 26.3 27 28 29

Telomera

Chromosomos ideograma
2.3 pav. Chromosoma. A - m etafazins chrom osom os dalys; B - pagrindiniai chrom o som tipa i iskiriami pagal centrom eros padt; C - chrom osom os dvigubajam e rinkinyje (skirtingom is spalvomis paymtos i m otinos ir i tvo gautos chrom osom os)

B
Palydovai

p = q
M etacentrin chrom osom a

P< q
S ubm e tace n trin chrom osom a

A k ro c e n trin chrom osom a

it n
P<< q
p= 0 T elocentrin chrom osom a

Seserins
chromatids

Neseserins
chromatids

\y

Metafazins chromosomos skiriasi savo dydiu ir forma. Kiekviena j turi pir min persmauk, vadinamj centromer, dalijani chromosom j trumpj (p) ir ilgj (q) pet (2.3 pav., A, p. 43). Kokia tikroji centromeros struktra, XX amiui baigiantis dar nebuvo nustatyta. Taiau b te n t centrom er susijusi su chro mosom os jud jim u lstelei dalijantis. Labai svarbios chrom osom dalys yra telom eros, t. y. tam tikros struktros paiuose chromosom pei galuose. Jos garantuoja chromosomos vientisum ir stabilum, linijins DNR molekuls gal dvigubjim, turi takos erdvinei lstels branduolio struktrai.

Chromosom telomerose esama daug paeiliui pasikartojani (TTAGGG)n arba labai panai sek, kuri skaii kontroliuoja fermentas telomeraz. Telomerazs aktyvumo sumajimas, tuo paiu ir i sek pasikartojim kiekio sumajimas, sie jamas su lstels m irtim i ir su individo senjimu. Kuo maiau chromosomos galuose lieka toki paeiliui pasikartojani sek, tuo trumpiau gyvena individas.

2.4 pav. Pro o p tin mikroskop m atom os norm alios mogaus (vyro) m etafazins chrom osom os (nudaytos ru o uotum ui irykinti)

Kadangi m etafazins chro m o som os analizuojam os sta nd artinia is citogenetiniais m etodais, j m o rfo lo g in io klasifikavim o pagrindas yra m etafazins ch ro m o som os stru kt ra bei fo rm a , ir pirm iausia - ce ntrom e ro s padtis (2.3 pav., B, p. 43). A k ro c e n trin i ch ro m o som tru m p u o s iu o s e peiuose dar skiriami b randuollio stru k t rin ia i elem entai, kuriuos sudaro rRNR gen sankaupos. Jie sudaro antrines ssmaukas, atribojanias tru m p j pei ga lines dalis - vadinamuosius palydovus (r. 2.3 pav. B ir 2.5 pav.). Iimtis - Y chro m o som a. C hrom osom os skiriasi ne tik centrom e ro s p a d tim i, bet ir dydiu (2.4 pav., 2.5 pav.).

Kiek ir koki chrom osom rinkini reikia lstelei

Prokariotai teturi vien iedo form os chromosom, o eukariot chromosom skaiius labai vairus. Tarp eukariot maiausiai chrom osom turi skruzdl M yrm ecia pilosula: pateli somatins lstels teturi vien chromosom por, o lytinse lstelse yra tik po vien chromosom . O tai rekordinis chrom o som skaiius nustatytas vienoje i papari ri. O p h io g lo s su m reticulatu m somatins lstels turi net po 630 chrom osom por (taigi po 1 260 chrom osom kiekvienoje lstelje!). Keletas vairi organizm chrom osom skaiiaus pavyzdi pateikti 2.1 lentelje. Kiekviena somatin eukariot organizm o lstel daniausiai tu ri dvigubj (diploidin) chromosom rinkin, ymim 2 n (iskyrus laikotarp, kai ji ruoiasi dalytis ar jau dalijasi). Kiekvienas dvigubajam (diploidiniam ) chrom osom rin kiniui priklausantis viengubasis (haploidinis) rinkinys (n) yra paveldtas i vieno tv. Kadangi chrom osom rinkinys dvigubasis, chromosom os jam e susipo rav. Vienos poros chromosomos, kuri struktra ir m orfologija daniausiai nesiskiria, vadinamos ho m ologinm is. Dera sidmti, kad viengubojo rinki nio pasikartojim kai kuri organizm (ypa augal) somatinse lstelse gali bti ir daugiau (3n, 4n, 6n). r \ Reikinys, kai somatinje lstelje yra daugiau kaip du kartotiniai viengubieji chrom osom rinkiniai (3n, An ir dar daugiau), vadinamas poliploidija.
v___________________________________________________________________________ J

Tai, kad besidalijanios lstels, turinios kelis vienodus chromosom rinki nius, tiksliai paskirsto chromosomas dukterinms lstelms, ities kelia didel nuostab. mogaus somatinje lstelje dvigubasis rinkinys yra 46 chromosomos (tai buvo nustatyta tik 1956-aisiais!). Panaus mogbedioni - impanzs, gori los ir orangutango - chromosom skaiius. J dvigubj chromosom rinkin sudaro 48 chromosomos. Tarp i prim at mogaus chromosomos panaiau sios impanzs chromosomas - skirtumai tesudaro 1 %. Be to, nustatyta, kad mogaus 2-oji chromosoma susidar i dviej impanzs chromosom.

36.3

3 5 &

XI 3 .1 6

- centrom era; - rR N R g e n sankaupa;


-

necen tro m e rin is hete ro ch ro m atin a s.

22.3 222 15.3 15 2 15.1 22.1 21.3

ii
21.1
21.2 21.3

iii

212 21.1
11.4 11.3 11.23

M
21.1 21.2
21.3

1:1
21.1
21.2 21.3 22.1 222 22.3 31.1 31.2 26.1 26.2 26.3 31.3

21.1

M
21.1

21.2
21.3

221 22 2
22.3

21.1 21.2

2J 1

26.1 262 26.3

12

15

13.3 13.2 13.1

112
11.1

11.32 11.31

2.5 pav. mogaus chrom osom ideogram os. Skaiiais kairje paym ti chrom osom ruoai

12 1 12.1
122 21.3

11.21

16

2.1 len tel. Kai kuri ri o rg a n iz m c h ro m o som skaiius so m atinse lstelse

Organizmas "1 mogus impanz Bizonas Kat Stambs raguoiai uo Asilas Oka Arklys Kiaul Avis Maliarijos plazmodijus Upinis vys Vaisin musel Mus Balandis Puis Linas

Gentis ir ris Homo sapiens Anthropopithecus pan Bison bison Felis catus Bos taurus, Bos indicus Canis familiaris Equus asinus Capra hircus Equus caballus Sus scrofa Ovis aries Plasmodium malariae Astacus fluviatilis Drasophila melanoqaster Musca domestica Columbia livia Pinus Linum usitatissimum

Dvigubasis chromosom skaiius 46 48 60 38 60 78 62 60 64 38 54 2 apie 116 8 12 80 24 30

"t

Lytiniu b d u b e s id a u g in a n ty s o rg a n iz m a i tu ri va d in a m sia s ly tin e s chrom osom as X ir Y. Lytins chromosomos skiriasi nuo kit chromosom, va dinam autosomomis, tuo, kad dvigubajame chromosom rinkinyje sudaro nehomologin por.

Chrom osom analizs m eto d a i

Dar ne taip seniai citogenetikai nesugebjo ne tik atskirti panai chromosom, bet ir irti atskir chromosom struktros detali. Tik sukrus naujus chromo som daymo metodus bei atsiradus iuolaikiniams molekulins citogenetikos ir elektronins mikroskopijos (2.2 pav., B ir C, p. 42) metodams, imta skirti ne tik atskiras chromosomas, bet ir chromosom struktr bei erdvinius chromosom vaizdus (2.2 pav.. B). Daugelis organizmo audini gali bti naudojami chromosom analizei. Gyvn chromosomoms tirti tinka baltieji kraujo kneliai leukocitai, kaul iulp lstels, vaisiaus lstels, odos, kepen ir kit audini lstels, augal - lap ir kit augalo dali lstels. Diagnostiniams mogaus chromosom tyrimams daniausiai nau dojami kraujo leukocitai.

CD
mogaus chromosom tyrimas kraujo leukocituose I tiriamojo asmens pirto steriliai paimami keli laai kraujo ir supilami mgintuvl, kuriame yra speciali mitybin terp. Ji reikalinga, kad lstels gaut j gyvybingumui palaikyti reikaling mediag ir galt daugintis. mgintuvl dar pilama fitohemagliutinino, skatinanio leukocitus dalytis. Madaug po trij par besidalijanios lstels sustabdomos metafazs stadijoje pylus kolchicino, kuris neleidia formuotis lstels verps tei. Btent ioje stadijoje chromosomos matomos geriausiai. Lieka jas ufiksuoti, nuday ti ir pro optin mikroskop pamatyti metafazines chromosomas (2.4 pav., p. 44).

'id e o g ra m a (gr. idea - svo ka, vaizdinys; g ra m m a - ramuo, ym intis vis svok). Kariotipas (gr. karyon - bran duolys; typ o s - fo rm a , pavyz d ys) - o rg a n iz m o s o m a tin i lsteli chrom osom visuma per m etafaz. Kiekviena organizm ris tu ri savit kariotip. Kario tip o to ly g u m to paties individo l s te l s e p a g rin d ia m ito z , ryje - mejoz.

Ilgainiui sukurti skirtingi chromosom daymo metodai, leidiantys atpainti kiek vien chromosom. Daniausiai taikomi vadinamieji diferencinio daymo metodai, pagrsti tuo, kad skirtingos struktros chromosom segmentai tam tikrais daais nusidao nevienodai intensyviai. Taigi irykja tam tikras skersinis chromosom ruouotumas (r. 2.4 pav.). Nudaytos chromosomos nufotografuojamos ir anali zuojamos. Gauti duomenys leidia suklasifikuoti visas tiriamojo individo chromo somas ir nustatyti, ar vis j skaiius normalus, ar analizuojam chromosom ruoeliai atitinka standartin grafin chromosom vaizd, vadinam id e o g ra m a 1 (2.5 pav.). Suklasifikuot chromosom rinkinys vadinamas kariotipu2 (2.6 pav.).

Molekulins citogenetikos metodai galina naudojant genetinius zondus ir vai rius ymenis pamatyti konkreias chromosomas arba tam tikras j dalis net ir interfaziniame branduolyje, tiksliai nustatyti vairias chromosom struktros ano malijas (r.ll dalies 4.1.2 skyri). Chromosom analizei vis plaiau taikom os kompiuterins skaitmenini vaizd analizs programos.

1. Kas yra chromosom a ir kokia jos paskirtis? 2. Kaip morfologikai klasifikuojamos chromosomos? Koki tip chromoso mas turi lytiniu bdu besidauginantys organizmai? 3. Kokios chromosom os vadinamos homologinmis? 4. Kiek chrom osom turi prokariot ir eukariot lstels? 5. Kok chromosom rinkin turi kiekviena somatin ir lytin eukariot orga nizmo lstel? 6 . Kaip vadinamas reikinys, kai somatinje lstelje yra daugiau nei du kar totiniai viengubieji chrom osom rinkiniai (3n, An ir dar daugiau)? Kokiems organizm ams jis bdingas? 7. Koki gyvn chromosom os struktrikai artimiausios mogaus chrom o somoms? 8. Kokius inote chrom osom tyrim o metodus? 9. Kaip vadinamas suklasifikuot chrom osom rinkinys ir kas yra ideograma?

2.6 pav.
m o g a u s k a rio tip a s , i c e c r - e s k a rio tip o a nalizs :$ - o ir o lo g in iu c h ro m o s o m p oro s s a y m to s s k irtin g o m is sp a lvo m is

2.3.
Chromosomos per mejoz: genetins informacijos rinkinio pastovumas steli kartose

Pirmoji lstel, nuo kurios prasideda vis lytiniu bdu besidauginani (apie lytin dauginimsi bus kalbama 2.4 skyriuje) eukariot organizm (taigi ir m o gaus) raida, yra dviem gametoms susiliejus susidariusi z ig o ta 1. Ji turi dvigubj chromosom rinkin (2n). iai lstelei ir jos palikuonms mitozikai besidalijant susiformuoja suaugs organizmas (iimtis - mejozikai besidalijanios lytins lstels, apie kurias dar bus kalbama). Per vis mogaus gyvenim vyksta apie 101 mitozini pasidalijim. 7 Pasibaigus lstels ciklo S stadijai, lstels branduolyje kiekviena chromosoma turi po dvi tapaias DNR molekules. Todl prie prasidedant mitozei vien chro mosom sudaro dvi seserins chromatids (2.3 pav., C). Chromatidi peiai atsiskyr (nors tebra susiglaud). Chromatids vien prie kitos laiko bendra centromera. Seserins chrom atids genetikai tapaios viena kitai ir pradi nei chromosomai, nes j DNR molekuls susidar dvigubjant pradins chromo somos DNR molekulei.

r . g o t - sujungta j por

Mitoz sudaro penkios fazs: profaz, prometafaz, metafaz, anafaz ir telofaz (2.7 pav.). Akcentuosime tik tuos m intj fazi ypatumus, kurie yra susij su genetins informacijos (t. y. DNR perdavj chromosom) pasiskirsty mu dukterinse lstelse. Profazs pradioje interfazinis chromatinas ima tankti, o pabaigoje susifor muoja jau pro optin mikroskop matomos atskiros chromosomos, sudarytos i dviej Seserini chromatidi. Formuojasi mitozs verpst. Prom etafazje (i faz 2.7 pav. nepavaizduota) branduolio membrana suyra fragmentus, ir chromosomos pasklinda po vis lstel. Prie kiekvienos chroma tids centromeros srityje prisitvirtina verpsts silai, sujungiantys chromatid su vienu i verpsts poli. Kadangi chromatids dar susijung per centromer, verpsts silai gali prisitvirtinti prie vienos chromatids tik i vienos chromoso mos puss. Taip kiekviena chromosoma sujungiama su abiem verpsts ir ls tels poliais, o seserins chromatids - su prieingais lstels poliais. Btent tai ir garantuoja, kad dukterins lstels gaus vienodus chromosom rinkinius. C hrom osom os toliau tankja trum pdam os ir stordamos, kol m e ta fa z je tam pa paios kompaktikiausios. Seserini chrom atidi peiai jau aikiai atsiskyr, taiau jas kartu vis dar laiko centrom e r . Todl ch ro m o som os ir gyja X raids fo rm . Verpsts sil te m p ia m o s prieingus verpsts polius, ch ro m o som os isidsto lstels ekvatoriaus p lo k tu m o je su fo rm u o d a m o s m e ta fa z in p lo k tel , kuri ir analizuojam a sta nd artinia is cito ge ne tiniais m etodais tir ia n t chrom osom as. A n afaz je kiekvienos chromosomos centromer pasidalija iilgai chromoso mos, ir seserins chromatids visikai atsiskiria. Taip i kiekvienos chromosomos, turinios dvi chromatids, susidaro po dvi vienodas dukterines chromosomas, turinias po vien chromatid. Kiekvien savarankik chromatid verpsts silai tempia vien lstels poli, o jos seser" - prieing poli. Taip prieingus lstels polius nukeliauja du tapats dukterini chromosom rinkiniai. T elofazje verpst inyksta, ir aplink kiekvien dukterini chromosom rin kin (kuriame yra tiek pat ir genetikai toki pat chromosom kaip ir motininje lstelje prie dalijimsi (ir S fazs) pradi) susidaro naujas branduolio apvalka las. Chromosom kompaktikumas ima mati. Telofazei baigiantis pasidalija citoplazma (t. y. vyksta citokinez), ir visikai susiformuoja dvi naujos dukterins lstels. Nuo lstels tipo ir gaunam signal apie organizmo arba audinio po reikius priklauso, kada jos pereina naujo lstels ciklo G, stadij arba ra mybs (mitozinio dalijimosi atvilgiu) bsen - G0 stadij.
c ' \

Vykstant m itoziniam lsteli dalijimuisi svarbiausia yra tai, kad: 1) dukterins lstels yra genetikai tapaios viena kitai ir m otininei lstelei, nes kiekvienos j chrom osom os DNR m olekul susidar d v ig ub ja nt m o ti nins lstels chrom osom DNR molekulms. Taip garantuojam as g en etin s informacijos tap a tu m a s o rg an izm o som atini lsteli kart sekoje (ios taisykls iimtys yra genetins informacijos persitvarkymai tam tikr tip ls telse ir somatins gen mutacijos - II dalies 1.1 skyriuje); 2) dukterinse lstelse yra tie k pat chrom osom kiek ir m otininje ls telje. Taigi g en etin s informacijos kiekis som atini lsteli kart sekoje yra pastovus: lsteli su dvigubuoju chrom osom rinkiniu atveju - 2 n -> 2 n. V______________________________________________________________________ /

Gyvn ir augal somatini lsteli mitoz iek tiek skiriasi (r. 2.7 pav.). La

biausiai skiriasi citokinez, nes augal lstels turi tvirtas sieneles. Protist ir gryb lstels taip pat dalijasi mitozikai, ir is procesas turi sav ypatum. Taiau visais mitozinio lsteli dalijimosi atvejais skirtumai nesusij su chromosomomis ir j pasiskirstymu dukterinse lstelse. Taigi genetins informacijos perdavimo kitoms lsteli kartoms principai eukariot lstelms dalijantis mitozikai yra bendri.

~3ZS ETAPAS

SCHEMA

GYVNO LSTEL

AUGALO LSTEL

NTERFAZ

3RO FAZ

M eta fa zin p loktel

M ETAFAZ

ANAFAZ

TELOFAZ

2.7 pav. Gyvn ir augal som atini lsteli m itoz

1. Kokios lstels dalijasi mitozikai? 2. Kokios fazs sudaro mitoz? Trumpai apibdinkite, kaip kinta chromoso mos per kiekvien faz. 3. Kas lemia, kad dukterins lstels gaut vienodus chrom osom rinkinius? 4. Kok chrom osom rinkin tu ri dukterins lstels pasibaigus mitozei? 5. Kas svarbiausia vykstant m itoziniam lsteli dalijimuisi?

2.4.
Chromosomos organizmo lytinio dauginimosi laikotarpiu

Organizm am s dauginantis nelytiniu bdu ir lstelms skylant arba dalijar tis mitozikai, palikuoniai gauna to k pat genetins inform acijos rinkin i genetiniu poiriu visai nesiskiria nuo tv ir vienas nuo kito. Tai labai apri boja organizm galimybes prisitaikyti veikiant gam tinei atrankai. Evoliucijos laikotarpiu susiform avo ir kitas d au ginim osi bdas - lytinis Lytinis d au g in im asis yra vairios organizm dauginim osi form os, kai nau jas organizm as form uojasi i zigotos, susidariusios susiliejant dviem lytinm: lstelms (g a m e to m s ), gautom s i skirting tos paios ries, bet priein gos lyties organizm . Per apvaisinim susiliejant genetikai skirtingom s (t. y tu riniom s skirtingus t pai gen aleli derinius) lytinms lstelms, i: zigotos susiformav nauji individai jau nebetapats nei vienam i tv, ne savo broliams ar seserims, susiformavusiems i skirtin g zigo t . Taigi daugi nantis lytiniu bdu vienos biologins ries individai apsikeiia genetine infor macija, ir susidaro nauji gen aleli deriniai. Taip didja palikuoni kintam um a: ir sukuriama biologins ries individ genetin vairov netgi nesikeiianp a tie m s genams. Jai svarbi g a m tin s a tra nka s svjityga. Aleliniais genais (aleliais) (gr. alllon - vienas kit, savitarpikai) vadinami konkretaus geno variantai, esantys tam tikros biologins ries individo toje paioje hom ologini (porini) chrom osom vietoje (lokuse). Vykstant mejozei aleliai patenka atskiras gametas. Jie pagrindia skirtingas to paties poymio iraikas, apie kurias dar bus kalbama.
V ....................................................................................... ......... ........ ................................................................................................>

2 . 4 . 1.
Lytinis dauginimasis organizm genetinio jVai ravimo altinis

GD
Primityviausias bdas apsikeisti genetine informacija yra kai kuri bakterij lytinis procesas, vadinamas konjugacijai Tam tikra plazmid, vadinama fertilum o2 veiks niu, vykstant konjugacijai i j turinios lstels pereina j jos neturini. i plazmid gali siterpti j lstels eimininks chromosomos DNR ir iokti i jos, danai pasi iupdama" kartu ir dal jos gen. Patekusi j nauj lstel ir siterpdama j jos chromosom, i plazmid perduoda naujajai eimininkei atsinetuosius ankstesns eimininks genus. Lytinis dauginimasis susijs su tam tikra problema. Jei organizmo lytins ls tels turt tiek pat chromosom kaip ir somatins, gam etom s susiliejus per apvaisinim kiekvienoje naujoje palikuoni kartoje chromosom skaiius didt geometrine progresija ( 1 n - > 2 n - > 4 n - > 8 n - > . . . ) i r labai greitai baigtsi katastrofa. Ilgainiui per evoliucij susiformavo ios problemos sprendimas - spe cialus lytini lsteli formavimosi bdas - m ejozinis lstels dalijimasis, dl ku rio lytins lstels turi tik viengubj chromosom rinkin (n). Mejozinis lstels dalijimasis bdingas tik lytikai besidauginantiems eukariotams.

CD
Lyi tip ai p a g a l tai, kokios gam etos susidaro

Kaip jau buvo minta, lytikai besidauginantiems organizmams bdingos lytins chromosomos (X arba X ir Y), nors galimi ir kai kurie k iti variantai. Pagal lytines chromosomas (taigi pagal tai, kokios susidaro gametos, turinios viengubuosius chro mosom rinkinius), organizm lytys skiriamos homogametin, kai abi dvigubojo chromosom rinkinio lytins chromosomos yra vienodos (XX) ir susidaro vienodos gametos, turinios po vien X chromosom, ir heterogametin, kai dvigubajame chromosom rinkinyje yra: 7) tik viena lytin chromosoma (X0 tipas, bdingas kai kuriems vabzdiams); 2) dvi skirtingos lytins chromosomos (XY tipas, bdingas induoliams, paukiams, vaisinei muselei (kaip riai). ia apsiribokime XY heterogametine lytimi, kuri bdinga mogui. Skirting klasi organizm lytys iuo atvilgiu gali nesutapti: je i induoli (taigi ir mogaus) homogametin lytis (XX) yra moterikoji, o heterogametine (XY) - vyrikoji, tai pauki homogametin lytis yra vyrikoji, o heterogametine - moterikoji.

Konjugacija (lot. c o n ju g a tio susijungimas) - laikinas susiliejimas apsikeiiant struktriniais (sudaro maisiais) elementais. 2lot. fertilis - vaisingas, vislus

LZ)

K la u s im a i

1. Koks yra m ejozinio lsteli dalijimosi tikslas? 2. Kokie lyi tipai iskiriami pagal susidaranias gametas? Apibdinkite iuo poiriu m oni lytis.

U d a v in ia i 1. irnio dvigubajame (2n) chrom osom rinkinyje yra 14 chromosom , ku kurzo - 20, vaisins musels - 8, balandio - 16, mogaus - 46 chromoso mos. Apskaiiuokite: a) kiek chrom osom yra irnio, kukurzo, vaisins musels, balandio ir m o gaus lytinse lstelse; b) kiek autosom ir kiek lytini chromosom yra somatinse vaisins musels, balandio ir m ogaus lstelse.
P a s ta b a . Vaisins m u sels ir in d u o li ( ta ig i i r m o g a u s ) h o m o g a m e tin ly tis (d v i vie n o d o s ly tie s c h ro m o s o m o s - X X ) y ra m o te ri k o ji, o h e te ro g a m e tin (d v i s k irtin g o s ly tie s c h ro m o s o m o s - X Y ) - vyrikoji. P auki - p rie in g a i.

2 .4 . 2 .
C hrom osom os per mejoz: gametos gauna lygiai pus dvigubojo chrom osom rinkinio
Pirmasis mejozinis dalijimasis Lstel mejozikai dalijasi du kartus, to d l p a g rind iniai jos gyvavim o e ta pai yra vienas po kito jvykstantys pirmasis ir antrasis m ejozinis dalijimasis (2.8 pav., p. 53).

Mejozs pradioje chromosom os bna jau iilgai padvigubjusios per interfazs S stadij ir (kaip ir m itozinio dalijimosi pradioje) sudarytos i dviej seserini c h ro m atid i , sujungt viena centromera. I p ro fa z . Chromosomos tankja ir trum pja kaip ir mitozs profazje, kol I profazs pabaigoje pasidaro tokios pat tankios kaip ir mitozs metafazje. Taiau kitais aspektais i ypa svarbi mejozs faz labai skiriasi nuo mitozs profazs. Jai vykstant kiekvienos hom ologins poros chromosom os (iskyrus heterogam etini individ X ir Y chromosomas) nuo gal pradeda glaustis, kol visu ilgiu susiglaudia bivalen tu s (t. y. vyksta hom ologini chromosom sinaps arba konjugacija). Atitinkam os hom ologini chrom osom vietos, taigi ir jose esantys tie patys genai, bivalente atsiduria vienas prieais kit. C \ Btina deramai skirti, kokios chromatids yra seserins ir kokios - neseserins. Vienos chromosomos (t. y. vienos diados) dvi chromatids yra seserins. Kitos bivalent sudaranios hom ologins chromosom os (antrosios diados) dvi chromatids bdamos seserins viena kitai yra neseserins antrosios diados chromatidms.

v ----------------------------------------------------------------------------------------------------- /
Kiekvien bivalent sudaro dvi seserini chromatidi poros (mejozje dar vadi nam diada). Todl jis dar vadinamas tetrada, nes i tikrj sudarytas i keturi homologini chromosom chromatidi. Sudariusios bivalent homologins chro mosomos apsiveja viena apie kit. Kai kuriose vietose vyksta chromatidi trkiai ir rekombinacija, per kuri neseserins chromatids apsikeiia fragm entais1 (2.8 pav.). Taigi vyksta genetiniai mainai, dl kuri neseserinse h o m o lo g i ni chrom osom chrom atidse susidaro nauji alelini gen deriniai. Taip atsitinka todl, kad ios chrom atids, nors ir tu ri tuos paius genus, taiau yra g e n e ti k a i n e ta p a io s, nes susidar d v ig u b ja n t dviem s kirtin go m s (t. y. turiniom s tuos paius genus, bet skirtingus j alelius) dviej h o m o lo g i ni chrom osom DNR molekulm s. Genetikai tapaios seserins ch ro m a ti ds susidaro dvig ub ja nt vienai DNR m olekulei.

Ss "sikinys dar vadinamas a n g o v e r iu (a n g . Crossing r e " - s jsikirtim a s, perkryiavis rra oersikryiavimu. Tai vie*aE i- a 'o a js i mejozs etap - segment apsikeitimas -c r - o o g in i chromosom. iC T o : - acra dar 1911-aisiais - '."cg a n a s, remdamasis anac j D r s-ais vaisini museli r r ---------a s

PavpIHirrmma;

Po rekom binacijos g en etin i m ain vietoje neseserins chrom atids persikryiuoja, t. y. susidaro chiazm os (r. 2.8 pav.), m atom os pro o p tin m ikro skop. Daniausiai chiazm os m ato m os keliose bivalento vietose (vienoje m ogaus ch ro m o so m o je vidutinikai j bna dvi). Tai liudija, kad per vien m ejoz vienam e bivalente vyksta keli neseserini chrom atidi apsikeitimai frag m en tais (t. y. rekom binacija gali vykti net keliose bivalento vietose). J vieta a tsitiktin : vyksta nt mejozei kitose to paties o rg an izm o lstelse, to kiose paiose h o m o lo g in i ch ro m o som porose rekom binacija vyksta skir tin go se neseserini ch ro m a tid i dalyse. A p sikeitim fra g m e n ta is skaiius daniausiai priklauso nuo chro m o som os dydio - kuo ji ilgesn, tu o dau giau chiazm m atyti. Nehom ologins X ir Y chrom osom os negali susiglausti ir sudaryti sinapss, kuri btina rekombinacijai. Taiau neseniai i chrom osom trum puosiuose peiuose buvo a p tikti nedideli hom ologiniai segm entai, ta rp kuri gali vykti sinaps ir rekombinacija. C hrom osom om s ta n k ja n t ir tru m p ja n t bivalentus sudaranios hom ologins chrom osom os pradeda atsiskirti nuo centrom er telom er link, bet iam procesui vykti tru k d o chiazmos, glaudinanios bivalento chrom osom as vien prie kitos. C hrom osom om s vis labiau atsiskiriant, chiazmos slenka te lom er link. I m e ta fa z . Branduolio m em brana suyra gabalus, o beveik visai atsi skyr bivalentai, vis dar glaudinam i chiazm, isidsto lstels ekvatoriaus ploktum oje. Susiformavusios verpsts silai, prisitvirtin prie kiekvienos chro m osomos centrom eros srityje, sujungia j su vienu i verpsts poli. Btina a tkre ipti dmes esmin skirtum ta rp mejozs I m etafazs ir mitozs metafazs.

Mitozs metafaz
Homologins chromosomos yra

Mejozs 1 metafaz
Homologinms chromosomoms visikai atsiskirti neleidia chiazmos. Verpsts silai kiekvienos chromoso mos centromeros srityje prisitvirtina tik i vienos puss. Chiazm glaudinamos vienos homologins poros chromosomos sujungiamos su prieingais lstels poliais. Todl su kiekvienu i poli sujungiamas genetikai

atskiros
Verpsts silai centromeros srityje prisitvirtina prie kiekvienos chromatids i abiej chromosomos pusi. Per centromer susijungusios vienos chromosomos chromatids sujungia mos ir su prieingais lstels poliais.Todl su kiekvienu i poli sujungiamas tapatus seserini chromatidi rinkinys: po vien tvins ir po vien motinins kilms kiekvienos homologini chromosom poros chromatid.

netapatus homologini chromosom rinkinys:


1) viena homologin chromosoma gauta i tvo, kita - i motinos; 2) tik atsitiktinumas lemia, kuri - tvin ar motinin homologin chromosoma prisijungs prie konkretaus poliaus; 3) I profazje vyko genetiniai mainai tarp neseserini chromatidi. Todl tvin chromosoma turi iek tiek motinins chromosomos aleli, o motinin - iek tiek tvins chromosomos aleli.

I a n a fa z . Vis h om olog ini por chrom osom os, sudaranios bivalentus, galiausiai visikai atsiskiria viena nuo kitos ir te m piam os verpsts sil kiek viena keliauja to poliaus, su kuriuo iais silais sujungta, linkme. Svarbiausia yra tai, kad kiekvienos chrom osom os seserins chrom atids ilieka neatsiskyrusios per centrom er (t. y. centrom era per pirmj mejozin dalijimsi nesidalija), ir prie kiekvieno i poli juda visa chrom osom a, sudaryta i dviej chrom atidi. Todl prie kiekvieno lstels poliaus nukeliauja t ik po vien k iek vien o s h o m o lo g in s poros chrom oso m .

I telofaz. Du viengubieji chromosom rinkiniai (n ) pasiekia prieingus lstels polius, apie juos susiformuoja branduolio membrana, lstels citoplazma pasidalija. Taip i vienos somatins lstels su dvigubuoju chromosom rinkiniu (2n) susidaro dvi lstels, kuriose yra jau tik pus chromosom (viengubasis chromosom rinki nys n). Todl pirm asis m e jo z in is d alijim as is y ra redukcinis: 2 n -> n .

I profaz:
Chromosomos Jau velgiamos kaip ploni silai

I metafaz

Homologins chromosomos pradeda iilgai glaustis (sinaps) Susiglaudusios homologins chromosomos sudaro bivalent (tetrad). Nors schemoje chromoso mos parodytos viena alia kitos, i tikrj jos yra viena prieais kit (r. skerspjv). vyksta rekombinacija, ir neseserins chromatids apsikeiia fragmentais

-c

=_

53
Chiazmos

Chiazmos

Kur vyko rekombinacija, chromatids persikryiuoja susidaro chiazmos

Bivalento chromosomas kartu laiko chiazmos

Chiazmos slenka bivalento gal link

GAMETOS

2 .8 pav. Mejozs fazi schema. Pavaizduota tik viena hom olog in i chrom osom pora

Alelini gen deriniai chrom osom ose jau gerokai pasikeit, persimai ir isiskyr, jei palygintum e su lstele prie pirmj mejozin dalijimsi. Tai vyko dl hom ologini chrom osom neseserini chrom atidi apsikeitimo segmen tais ir atsitiktinio kiekvienos hom ologins poros chrom osom pasiskirstymo dukterinse lstelse. Btina sidmti, kad gyvn heterogam etins XY lyties individ lstels, susidariusios po pirm ojo m ejozinio dalijimosi, skiriasi dar ir tuo, kad vien patenka X chromosom a, o kit - Y.

Antrasis mejozinis dalijimasis

Antrasis mejozinis dalijimasis vyksta po trum pos interfazs, vadinamos interkineze, nes jai vykstant DNR molekuls nedvigubja. Jis panaus mitozin dalijimsi. II m e ta fa z je i dviej chrom atidi (kurias jungia viena centromera) susidariusios X raids form os chromosom os isidsto lstels ekvatoriaus ploktumoje, ir susiformuoja verpst, kurios silai i abiej kiekvienos chrom o somos pusi prisitvirtina prie chrom atidi, sujungdami seserines chromatids su prieingais lstels poliais. II a n a fa z je centromeros pasidalija iilgai chro mosomos, ir dukterins chromosomos, susidariusios i atsiskyrusi seserini chrom atidi, tem piam os verpsts sil nukeliauja prieingus lstels polius. II telo faz s pabaigoje apie chrom osom rinkinius susiformuoja branduolio membranos, pasidalija ir citoplazma. Taip baigiasi antrasis mejozinis lstels dalijimasis, kuris yra ekvacinis, nes dukterins lstels gauna po tok pat viengubj chrom osom rinkin (n -> n ). Antrasis mejozinis dalijimasis ir mitoz esmingai skiriasi tuo, kad jo pradioje lstel turi viengubj (n) chrom osom rinkin (mogaus atveju - 23 chrom o somas). Po tok pat chrom osom rinkin gauna kiekviena dukterin lstel (n -> n ). Tipikos mitozs atveju m otininje lstelje yra dvigubasis chrom o som rinkinys, kuris ilieka ir dukterinje lstelje (2 n -> 2 n ).

CD
M ejozs ir mitozs skirtum ai

Mejoz Vyksta per gametogenez lytini liauk (gonad) lstelse (r. 2.6 skyri). Susideda i dviej vienas po kito vyks tani lstels dalijimusi. Vyksta homologini chromosom poravimasis. Rekombinacija tarp homologini chro mosom neseserini chromatidi btinas elementas. Po dviej mejozini dalijimusi susiforma vusiose lytinse lstelse yra redukuo tas (viengubasis) chromosom rinkinys (2n-$n).

M itoz Vyksta visose somatinse lstelse. vyksta per vien lstels dalijimsi. Homologini chromosom poravimasis nra prastas reikinys. Homologini chromosom rekombina cija nra prastas reikinys. Dukterinse lstelse ilaikomas dvigu basis chromosom rinkinys (2n ->2n).

r 21

K la u s im a i

1. Kokie etapai sudaro mejoz? Kokios i etap fazs? 2. Kuo pirmasis mejozinis lsteli dalijimasis panaus mitozin ir kuo jie skiriasi? Koks pirm ojo m ejozinio lsteli dalijimosi rezultatas? 3. Kuo ypatinga mejozs I profaz? 4. Kuo antrasis mejozinis lsteli dalijimasis panaus mitozin ir kuo nuo jo skiriasi? Koks yra jo rezultatas?

2 .4 . 3 .
Apvaisinimas sugrina dvig bj organizm o lsteli chrom osom rinkinj

Dauginantis lytiniu bdu apvaisinant dalyvauja per m ejoz susidariusios gametos, turinios v ie n g u b o j chrom osom rinkinj ir besiskirianios pagal lytines chromosom as. Jvykus apvaisinimui abi gam etos susilieja j pirmj nau jo jo organizm o darin - tvini organizm palikuonio lstel zigot. Susiliejus gam et branduoliam s atsistato dvigubasis chrom osom rinkinys, bdingas visoms tos ries organizm som atinm s lstelms. Nors gyvnams bdingi vairs apvaisinimo bdai, gam et suartjimas ir susi liejimas vyksta labai panaiai. Lytikai besidauginani augal apvaisinimas, va dinamasis apdulkinimas, vyksta kiek kitaip. Taiau koks bebt apvaisinimo tipas, g en etin iu poiriu jo esm yra ta pati: i dviej viengubj chro mosom rinkini lstelje atsistato dvigubasis chrom osom rinkinys (n + n -> 2n). Kaip jau buvo m inta, per gyvn lsteli mejoz susidaro dviej tip skir tingos lytins lstels, turinios arba X, arba Y chromosom . Apvaisinant da lyvaujanios gametos tu ri arba vienodas lytines chromosomas (abi turi po X chromosom ), arba skirtingas (viena turi X chromosom , o kita - Y). Todl lemia ir i zigotos besiform uojanio naujo organizm o lyt. Inagrinkime reikin remdamiesi m ogaus pavyzdiu. m ogaus so m a tini lsteli d vig ub aja m e 46 ch ro m o som rinkinyje yra 22 poros h o m o lo g in i a uto som ir dvi lytins chrom osom os: m ote r XX, vyr - XY. M oterys vien X ch ro m o som gauna i apvaisinim e dalyvaujanios m o tin o s gam etos, o kit - i tvo gam etos, o vyrai X chrom osom gauna tik i m o tin o s gam etos, o Y - tik i tvo gam etos.

~
e e

3 3
(D

Moterikosios gyvn gam etos vadinamos kiauialstm is, o vyrikosios sperm atozoidais. Kaip jos susidaro, aikinama 2.4.4 skyriuje.

Teorin tikim yb , kad apvaisinant kiauialst dalyvaus sperm atozoidas, tu rin tis arba X chrom osom , arba Y ch ro m o som , yra vienoda:
r Vyrikosios gametos (spermatozoido) lytins chromosomos Moterikosios gametos (kiauialsts) lytins chromosomos X (1/2) XX (1/4) XX (1/4) ^ (1/2) Y (1/2) XY (1/4) XY (1/4) N

x (1/2) X (1/2) I viso

d * o /z )
v

Taigi vyrikj ir m oterikj individ santykis tarp palikuoni turt bti 1 :

1. Kaip apvaisinim as pagrindiamas genetikai 2. Kaip kinta c h ro m o som rinkinys per apvaisi nim susiliejus vyrikajai ir m oterikajai gam etai? A r jis ilieka pastovus visose n au jo jo o rg an izm o lstelse?

Pasibaigus spermatogonij mitoziniam dalijimuisi, ios lstels toliau brsta ir susidaro I eils spermatocitai, kurie dalijasi jau mejozikai. vykus pirmajam (redukciniam) mejoziniam dalijimuisi i vieno I eils spermatocito susidaro du II eils spermatocitai, turintys po 23 chromosomas, kuri kiekviena sudaryta i dviej chromatidi. vykus antrajam mejoziniam dalijimuisi i dviej antros eils spermatocit susidaro keturi spermatidai. Jie daugiau nebesidalija ir galiausiai baig brsti tampa subrendusiais spermatozoidais. Spermatogenezs procesas yra gantinai intensyvus, ypa lyginant jj su oogeneze (r. skirtumus lentelje). io tipo gametos visikai subrsta madaug per 74 paras. Dar nuo 3 iki 13 par trunka spermatozoid transportas per sklin prielip. Pirmoji spermatozoid karta subrsta jaunuoliui sulaukus lytins brandos (apie 15-uosius gyvenimo metus). Kadangi spermatogonijos nuolat atsigamina m ito zinio dalijimosi bdu, j atsargos neisenka ligi gilios senatvs. Kartu ilieka ir spermatozoid gamyba bei vaisingumas. m ogaus o o g en e z ir apvaisinimas Moters pirmins lytins lstels oogonijos susiformuoja i gemalini lsteli po 2 0 -3 0 mitozini dalijimusi, kurie vyksta per kelis pirmuosius embriono raidos mnesius. Pasibaigus iam raidos etapui (treij mnes po apvaisinimo) oogoni jos ima brsti ir tampa I eils oocitais (2.9 pav.). Pamintina oogenezs ypatyb yra tai, kad I eils oocit atsargos kiauidse susiformuoja dar prie gimim, ir vliau naujos io tipo lstels nebesusidaro. Subrend I eils oocitai ima mejozikai dalytis dar prie gimim, taiau utrunka I profazje (trumpiausiai - iki lytins brandos, t. y. iki pirmosios ovuliacijos, o paskutinij io tipo lsteli I profaz tsiasi net iki moters lytinio aktyvumo laikotarpio pabaigos - apie 50-uosius gyvenimo metus). Pirmasis mejozinis dalijimasis baigiasi ovuliacija, kai susifor muoja 23 chromosomas (n ) turintis II eils oocitas, kur patenka beveik visa I eils oocito citoplazma, ir citoplazmos beveik neturinti lstel (vadinamasis pirmasis polinis knas). II eils oocite prasideda antrasis mejozinis dalijimasis, kuris vyksta iki II metafazs. Paskui lstel i kiauids patenka kiauintak, kur j gali apvaisin ti spermatozoidas. Jei apvaisinimas vyksta, spermatozoidas susilieja su kiauials te, i aktyvinasi, ir baigiasi jos mejoz. Susiliejus kiauialstei ir spermatozoidui chromosom rinkinys vl pasidaro dvigubasis (n + n -> Iri). Taigi zigotoje vl atsiranda 46 chromosomos. Per oogenez po abiej mejozini dalijimusi i I eils oocito susidaro tik viena kiauialst ir, daniausiai, trys poliniai knai, turintys po viengubj (n) chromo som rinkin (23 chromosomas). Ilga proceso trukm - nuo mejozs pradios iki jos galimos pabaigos - sudaro galimyb klaidoms atsirasti, kai chromosomos pasiskirsto dukterines lsteles. Tai gi kuo vyresn moteris, tu o ilgiau trunka mejoz (r. II dalies 4.1 skyri) ir didesn klaidos tikimyb. Kiekvienos subrendusios kiauialsts formavimasis susijs su tam tikros uuomazgini folikul dalies suvartojimu. Todl galiausiai apie 50-uosius moters gyvenimo metus ieikvojamos visos pastarj atsargos, ir lytini hormon bei kiauia lsi susidarymas baigiasi.

m
Vyr ir m o ter gam etogenezs skirtum ai

Gametogenezs etapas Pradia Trukm M itozini dalijimusi skai ius formuojantis gametai Vykstant mejozei i vienos kamienins lstels pasiga mina gamet Gamet susidarymo inten syvumas suaugusio asmens organizme

Vyrai lytin branda ~15-ieji gy venimo metai 60-74 dienos 30-500 4 spermatozoidai

Moterys ankstyvoji embriogenez 10-50 met 2 0 -3 0 1 kiauialst + 3 poliniai knai 1 kiauialst per 1 menstruacij cikl

100-120 mln spermato zoid viename ejakuliate

P a v e ld im u m a s

K la usim ai 1. Kuo skiriasi vyrikosios ir moterikosios lytins lstels? A r tarp j yra esmi ni genetini skirtum ? 2. Trumpai apibdinkite mogaus gametogenez. 3. Kokie yra spermatogenezs ypatum ai ir pagrindiniai etapai? 4. Kokie yra oogenezs ypatumai ir pagrindiniai etapai?

2 .4 . 5 .
Mejozs taka kom binaciniam kintam um ui
Kalbdami apie mejoz jau usiminme apie rekombinacij ir genetinius mainus. Taiau sid m tina, kad m ejoz yra ne tik redukcinis dalijimasis, dl kurio ka rt sekoje yra ilaikomas pastovus c h ro m o som skaiius, bet ir labai svarbus individ g enetins vairovs d id in im o bdas. Mejoz atveria kelius trim s pag rind iniam s m echanizm am s pasireikti, g en etin ei vairovei d id in ti p e rd lio ja n t alelini gen pasjans": 1) genetinei rekombinacijai, per kuri hom ologini chrom osom nesese rins chromatids apsikeiia segmentais, t. y. tarp j vyksta genetiniai mainai; 2) a ts itik tin ia m h o m o lo g in i ch ro m o som pasiskirstym ui dukterinse ls telse; 3) a ts itik tin ia m lytini lsteli susiliejim ui per apvaisinim. 1. K a ipjau isiaikinote skaitydami 2.4.2 skyri, g e n e tin re ko m b in a cija vyksta p irm ojo m ejozinio dalijim osi I profazje, kai neseserins h o m o lo g i ni ch ro m o s o m c h ro m a tid s apsikeiia fra g m e n ta is . Jei h o m o lo g in i chrom osom konjugacija vyksta normaliai, neseserins hom ologini chrom o som chromatids apsikeiia fragmentais, kuriuose yra to kie pat genai, taiau dalies j a le lia i gali b ti skirtin g i. Rekombinacija (2.8 pav.) tu ri vykti nepriekaitingai tiksliai (n e tg i vieno n u k le o tid o tik s lu m u !), nes genetiniai m ainai gali vykti o rg an izm u i svarbaus geno srityje. 2. A tsitiktinis h o m o lo g in i chrom osom pasiskirstymas d u kterin s e lstelse yra kitas veiksnys, didinantis genetin palikuoni vairov. Jis vyksta pirm ojo mejozinio dalijimosi I anafazje, kai hom ologins chromosom os atsi skiria ir nukeliauja prieingus lstels polius (2.8 pav., p. 53).

2.1 0 pav. Galimi lytini lsteli chrom o som deriniai, kai j pirm takje ho m o lo g in i chrom o som por skaiius (n) yra vairus. Pastaba. / rekom binacij, vykstani p e r m ejoz (dl kurio s neseserins chrom atids apsikeiia fragm entais), ia neatsivel giam a. S kirtingom is spalvomis (raudona ir m lyna) pa ym tos chrom osom os, gautos i m o tin o s ir i tvo

H om ologins vienos poros ch ro m o som os j prieingus lstels polius nu keliauja a tsitik tin a i, t. y. nra jo k io s tikim ybs, kad visos chrom osom os, paveldtos i tvo, patekt j vien lstels poli, o paveldtos i m o tin o s j kit. Vis d lto tikim yb , kad ta ip atsitiks, nra lygi nuliui, taiau labai maa ir lygi ( 1 /2 ) n. Kadangi m ogaus n = 23, tikim yb , kad vien d u k te rin lstel pateks vien tik tvins chrom osom os, o j kit - vien tik motinins, yra ( 1 /2 ) 23 = 1 /8 388 608. Taigi per pirmj mejozin dalijimsi fo rm u ojan tis naujoms lstelms dl atsitiktinio chrom osom pasiskirstymo vyksta dar vie nas genetins mediagos (alelini gen) persiskirstymas (2.10 pav.). Jis vyksta visoje chrom osom oje, skirtingai nei per rekombinacij, kai persiskirsto tik apkeistuose ch rom atidi frag m en tuo se esantys aleliniai genai. Galim skir tin g kom binacij ta rp tvo ir m otin os h o m o lo g in i c h ro m o som d u k te rinse lstelse skaiius yra 2", kur n yra chrom osom skaiius viengubajam e lstels c h ro m o som rinkinyje. Kadangi m ogaus vien gu ba jam e c h ro m o som rinkinyje yra 23 ch ro m o som os, dl a ts itik tin io h o m o lo g in i chro m o s o m pasiskirstym o d u k te rin s e lstelse gali su sid aryti 8 3 88 608 skirtin go s kom binacijos (223). Dera sidm ti, kad dl per m ejoz vykusios rekom binacijos kiekviena to kia chrom osom a jau nra visikai tvin arba visikai m otin in . Taigi drsiai galima teigti, kad nei viena i keli milijard vyrikj lytini lsteli ir imt m oterikj lytini lsteli, pasigaminani per vis lytikai subrendusio mogaus gyvenim, nra genetikai tapati. 3. Atsitiktinis lytini lsteli susiliejimas - genetinio vairavim o altinis. Lytinio dauginimosi laikotarpiu galima dar didesn palikuoni genetin vai rov. Per apvaisinim susilieja po vien atsitiktin gam et i dviej skirting lyi organizm. Taigi zigota gauna abiej tv viengubuosius chrom osom rinkinius ir joje galimi jau (223)2 = 70 368 744 000 000 skirtingi chrom osom deriniai. is skaiius gautas neatsivelgus mainus tarp neseserini chrom ati di. Tiktina vairov dar didesn. Tad akivaizdu, kad lytikai besidauginantys organizmai turi neribotas kombinacinio kintam um o galimybes, o tai labai svarbu evoliucijos procesui, kai gam tin organizm atrank lemia besikeiianios ap linkos slygos. Intensyvus nauj genetins informacijos derini susidarymas daniausiai galina organizmus kur kas geriau prisitaikyti prie aplinkos slyg. Nors kombinacinio kintam um o galimybs yra milinikos, negalima pamirti, kad kiekvienas i tv hom ologins chrom osom as bna gavs i savo tv, o kitai lsteli ir vaik kartai perduoda tik po vien (t. y. 50 %) h om ologin chrom osom . A n trj chrom osom (kiti 50 %) hom ologinei porai duoda ku ris kitas i tv. Taigi vaikai vis d lto panas savo tvus.

1. Kas yra kombinacinis kintamumas? 2. Kaip genetin vairov didina genetiniai mainai, vyk per pirmj mejozin dalijimsi? 3. Kaip genetin vairov didina atsitiktinis hom ologini chrom osom pasi skirstymas dukterinse lstelse? 4. Kaip genetin vairov didina atsitiktinis lytini lsteli susiliejimas, vyks per apvaisinim?

3.
Genetins informacijos perdavimas i kartos j kart: organizm lygmuo
1-ajame ir 2-ajame skyriuje isiaikinome m aterialij geno p rig im t, s t in o jom e kaip realizuojam a DNR m olekuls n u k le o tid sekoje s a u g o m * g en etin inform acija. A p ta r m e , kaip genetins inform acijos rinkiniai pe d uodam i lsteli kart sekoje. Zigota, susidariusi apvaisinimo m etu susiliejL dviem lytinm s lstelms, jau yra p irm o ji naujos o rg an izm kartos individ lstel. Taiau kol kas te ino m e , kaip ji gauna savo ch ro m o som - g e n e tins inform acijos s a ug oto j rinkin. Taigi dar n eaptartas vienas s v a r b i* aspektas - kokie yra genetins inform acijos raikos y p a tu m a i lytikai bes d au gina ni e uka riot p a likuo ni kartose.

3 .
Genai dvigubajame chromosom rinkinyje
'Tai vadinamoji M organo m o kykla. Jo kolegos - K. B. Bridis (C. B. Bridges), A. M. Stertevantas (A. M. Sturtevant), H. J. Maleris (H. J. Muller). 2Vaisin musel (D ro s o p h ila m e la n o g a s te r) dauginasi ypa spariai, subrsta per 1 0 -1 5 die n nuo kiauinli padjimo. Tai neabejotinas privalumas geneti nei mediagai tyrinti. Optimalioje tem peratroje (2 5 -2 6 C) isivys to nauja karta, tu r in ti daug ir vairi paveldimj poymi ir op tim al chrom osom skaii (diploidiniame rinkinyje - 8). Geno lokusas (lot. locus - vie ta) - vieta, genetin sritis, kuri chrom osom oje uima 1 genas. Skirting gen lokuso dydis nevie nodas. A leliniai genai yra toje paioje homologini chromosom srityje. Kitimai, atsirad vairiuose lokuso takuose, lemia skirting aleli atsiradim.
4

Gen kompleksas, kur organiz mas paveldi i tv, yra jo ge noti pas (gr. genos - kilm; typos atspaudas, pavyzdys). Iorini ir vidini poym i visuma - jo fe n o tipas (gr. p h a in o - parodau; ty p o s - atspaudas, pavyzdys). A bu iuos term inus, kaip inia, pasil dan mokslininkas V. L. Johansenas 1909-aisiais. O rg anizm o ta m tik ro poy m io vyravim o reikinys vadina mas dom inavim u, o vyraujantis poymis - dom inantiniu. Priein gas, i pairos inykstantis po ymis - recesyviniu. Pirmosios kartos palikuoniuose jis nesivysto, yra nuslopinamas, skirtingai nei vy raujantysis (dominantinis) poymis.

Kaip inia, chrom osom os perduoda genetin informacij. i idj te o ri k a pagrind T. Boveris ir V. S. atenas. T. Morganas su bendradarbiais1tyrindan vaisines museles (D roso p hila m e la n o g a s te r2 - 3.1 pav.) eksperimentais ro d chrom osom in paveldim um o teorij ir suform ulavo pagrindinius jos p r in c i pus. i teorija pagrsta tu o , kad paveldim um o vienetai genai yra s u k a u p t chromosom ose. Todl: 1) lytikai besidauginani o rg a n izm kiekvienoje som atinje lstelje yra dvigubas ne tik ch ro m o som , bet ir jose esani gen rinkinys. Kadan gi dvig ub aja m e rinkinyje chrom osom os bna porom is, kiekvienas ta m tik roj ch ro m o som oje esantis genas tu ri savo a ntrin in k kitoje h o m o lo g in s poros ch ro m o som oje (iim tis - h e te ro g a m e tin i individ lytini c h ro m o som genai); 2) lstelei dalijantis mitozikai dukterins lstels gauna po tok pat dvigubj chromosom , taigi ir gen, rinkin; 3) per mejoz atsiskiriant hom ologinm s (porinms) chrom osom om s kartu atsiskiria ir kiekvienos poros genai. Todl lytinse lstelse (gametose) tra vienas chromosom rinkinys, kuris kartu yra ir viengubasis gen rinkinys; 4) per m ejoz ir h o m olog in s chrom osom os, ir jose esantys kiekvienos poros genai isiskiria nepriklausom ai vienas nuo kito. Todl lytinse ls telse susidaro visi galim i j deriniai; 5) per apvaisinim susiliejus dviem lytinm s lstelms zigo to je vl atsista to dvigubasis ir ch ro m o som , ir jose esani gen rinkinys. Kadangi lytikai besidauginani e uka riot gen rinkinys yra dvigubasis, akivaizdu, kad vien o rg an izm o poym tu ri lem ti du genai, esantys toje paioje h o m o lo g in i c h ro m o som vietoje (vadinam ajam e lokuse3). Jau bu vo m inta, kad genai gali tu r ti va rian t (aleli), atsiradusi vykus to geno m utacijom s (apie gen m utacijas plaiau bus kalbama II dalies 1-ajame skyriuje). Taigi ta m tik ro p oym io form avim si pagrindia vienod arba s kirtin g konkretaus geno aleli pora. Genetikoje nuo p aveldim um o dsni a tradjo G. M e n de lio laik tokius genus prasta ym ti raidmis. Skirting geno aleli taka to geno lem iam am fe n o tip in ia m 4 o rg a n izm o poym iui daniausiai bna nevienoda. Didesn tak tu rin tis arba vyraujantysis (do m in a n tin is 5) geno alelis, lem iantis o rg an izm o d o m in a n tin io poym io fo r mavimsi, ym im as didija raide (pvz., A), o alternatyvusis (slopinamasis) geno alelis, lem iantis recesyvinio p oym io form avim si, ym im as maja raide (pvz., a).

C---------------------------------------------------------------------------------------------------------------------- N Aleliniai ir nealeliniai genai Konkretaus geno variantai, esantys toje paioje hom ologini chromosom vietoje (ir konkretaus individo, ir konkreios biologins ries individ apskri tai), yra to geno aleliai arba aleliniai g enai (pvz., A ir a yra A geno aleliai, taigi jie yra aleliniai genai). Genai, esantys skirtingose vietose (ir skirtingose nehomologinse chromoso mose, ir skirtingose tos paios chromosomos vietose) yra nealeliniai (pvz., A ir B yra nealeliniai genai). Taiau kiekvienas j gali turti savo aleli (pvz., A genas A ir a, o B genas - B ir b; A geno aleliai A ir a yra nealeliniai B geno aleli B ir b atvilgiu)1. v ______________________________________________________________________ / Kadangi ir dominantinis, ir recesyvinis alelinis genas yra toje paioje hom o logini chromosom vietoje, .galimi trys skirtingi j deriniai (3.2 pav.). Kai organizmas vienoje hom ologini chromosom poroje turi tuos paius alelinius genus (1-asis ir 3-iasis variantas), jis vadinamas ho m o zig o tiniu , o kai skirtingus (2-asis variantas) - heterozigotiniu. Be to, organizmus taip apibdi name pagal j turimas genetines savybes, t. y. alelinius genus, isidsiusius toje paioje hom ologini chromosom vietoje. reikin i esms ir apibria

un U X Y 2 3
3.1 pav. Vaisin musel D roso phila m e la n o g a s te r ir vyrikosios lyties individo dvigubasis chrom osom rinkinys Paprastai genai, esantys neh o m o lo g in s e chro m o so m o s e (arba toje paioje c hrom oso m o je, bet n u tol vienas nuo kito) lemia nepriklausom poymi pa veldjim. Plaiau apie tai - 3-iajame skyriuje. H om ozigotinis (gr. h o m o s vienodas, bendras; z y g o t - su ju n g ta j p o r ) - o rg a n izm a s , kurio abiej ho m olog in i chro mosom toje paioje vietoje yra tokie pat konkretaus geno varian tai (aleliai). Atsiranda susiliejus gametoms, turiniom s tokius pat alelius. Heterozigotinis (gr. heteros kitas; z ygo t - sujungta por) organizmas, kurio abiej hom olo gini chrom osom toje paioje vietoje yra skirtingi konkretaus geno variantai (aleliai). Atsiranda susiliejus gam etom s, turiniom s skirting aleli.
4

Individo poymi visuma apibriama kaip fenotipas, kurio susiformavim slygoja genotipas ir aplinkos poveikis4.

1
AA A fl
3.2 pav. Viena hom olog in i chrom osom pora gali tur ti dviej alelini gen derinius. A - dom inantinis (vyraujantysis) alelinis genas, a recesyvinis (slopinamasis) alelinis genas

Organizmas
h o m o zigo tin is

Organizmas
h etero zig o tin is

Organizmas
h o m o zigo tin is

Jei hom ologini chromosom toje paioje vietoje yra vienas arba du dominantiniai aleliniai genai (t. y. individas yra heterozigotinis arba homozigotinis dom inantinio alelio geno atvilgiu), jie nulems dom inantinio poymio pasi reikim. Taigi fenotipas bus dominantinis. Jei individas neturi dom inantinio alelinio geno (yra hom ozigotinis recesyvinio alelinio geno atvilgiu), pasireik recesyvinis poymis. Taigi fenotipas bus recesyvinis. Ms nagrinjamas 1-asis ir 2-asis variantas lems fe notipo dom inantin poym, o 3-iasis - pasireik kaip recesyvinio alelinio geno lemiamas fe notipo recesyvinis poymis.

m
Individas, kurio genotipas AA, yra homozigotinis; fenotipikai pasireikia domi nantinis poymis. Individas, kurio genotipas Aa, yra heterozigotinis; fenotipikai pasireikia domi nantinis poymis. Individas, kurio genotipas aa, yra homozigotinis; fenotipikai pasireikia recesyvi nis poymis.

prastai fen otip jvairov kur kas maesn nei g e n o tip jvai rov.

P a v e ld im u m a s

g e n o tip o svoka. Taigi individas pagal savo genotip (konkreius alelinius genus) gali bti homozigotinis2 arba heterozigotinis3. Taiau nedert pamirti, kad genas - tai informacija, gldinti DNR nukleotid sekoje, kurios konkreti iraika yra tam tikras organizmo morfologinis, fiziologinis, biocheminis, psi chinis ar kitoks poymis. Taigi konkretaus organizm o poymio ar poymi visumos formavimasis susijs ne tik su gen raika.

61

L Z l K la u s im a i
1. Koks svarbiausias organizm kart sekos paveldjimo vienetas? 2. Kokie genai yra aleliniai ir kuo jie skiriasi nuo nealelini gen? 3. Kas yra fenotipas ir kas slygoja jo susiformavim? 4. Kokie yra pagrindiniai alelini gen tipai pagal j lemiamus fenotipinius poymius ir kaip jie ymimi? 5. Kokie galimi genotip variantai, kai genas turi du skirtingus alelius? Kaip pagal juos skirstomi individai?

1. Nustatykite lytini lsteli (gamet) tipus, galinius susidaryti individams, kuri genotipas yra: a) AA; b) Rr; c) ss. 2. Kokios gametos susidarys organizme, kuris yra: a) homozigotinis pagal dom inantinj poym; b) heterozigotinis pagal dom inantinj poym; c) homozigotinis pagal recesyvin poym. 3. Vyrikosios lyties individo genotipas yra Nn. Nustatykite: a) kokio tipo gametos susidarys; b) koks bus kiekybinis io individo produkuojam lytini lsteli santykis; c) koks biologinis procesas pagrindia io lytini lsteli pasiskirstymo santyk, v

3.2.
Nepriklausomas poymi ir juos lemiani gen paveldjimas

Svarbiausius nepriklausom poym i paveldjimo dsningumus nustat G. Mendelis, pirmasis suprats, kad paveldimi ne patys poymiai, bet juos lemiantys genai. G. M endeliui, dar nieko neinaniam apie genus bei j pri gim t, genai tebuvo abstrakts paveldimumo pradai arba veiksniai. Taiau j buvimu pagrstos io genialaus mokslininko ivados atitinka iuolaikin pavel d im um o samprat. Nordamas nustatyti poymi paveldjimo ypatumus, G. Mendelis skmin gai pasirinko tyrim o objekt - irnius Pisum sa tivu m 1. Juos lengva auginti, galima gauti daug palikuoni, nes subrsta daug skl, kartos keiiasi labai greitai. Nors irniai yra savidulkiai, juos galima dirbtinai apdulkinti kryminiu bdu. Mokslininkas pradjs nuo 34-i skirting irni poymi savo svarbiau siems eksperimentams pasirinko 7-ias alternatyvi poymi poras. ia apsiri bosime tik kai kuriomis j. N orint num atyti, koks bus krym inim o rezultatas, pirmiausia reikia inoti, kuris poymis dom inuoja (kaip antai irnio anktis lygi ar nariuota; skla apvali ar rauklta ir t. t.). Visais iais atvejais pirmasis po ymis yra dom inantinis (vyraujantysis), o antrasis - recesyvinis (slopinamasis). I pradi G. Mendelis sitikino, kad jo pasirinktos veisls yra stabilios ir kart sekoje ilaiko konkret poym (pvz., irni su apvaliomis sklomis, dauginam savidulka, pirmosios, antrosios ir vis kit kart palikuoni sklos yra apva lios). Tada jis tokius irnius m kryminti vienus su kitais.

3 . 2 . 1.
M onohibridinis kryminimas: alternatyvius poymius lemia du aleliniai genai

p
Kryminamas individ kartas sutarta ymti taip: pradin tv karta - P (lot. paternus - tvikas); palikuoni kartos - F (lot. filialis - snaus, snikas), nurodant ir kartos numer. F, - pirmoji hibrid (sukrymint tv palikuoni) karta; F2 - antroji hibrid (tarpusavyje sukrymint F1individ palikuoni) karta.
Pastaba. Per G. M e n d e lio ty rim u s F3 ir tole sns k a rto s b u v o g a u to s a titin k a m o s ka rto s irn i
savidu lkos b d u . 'sjamasis irnis, dirvinis irnis

TVAI

(P)

AA

aa

l
A

\<GAMETOS f
A

A
a a

Aa
PALIKUONIAI

(F,)

F,

Aa

Pirmojoje gaut hibrid kartoje (F,) pasireik tik dom inantinis poymis. Toliau F, irniai buvo kryminami vieni su kitais. Dalis j palikuoni (F2) turjo dom inantin poym, o kita dalis - recesyvin. Kaip galima paaikinti tokius krym inim o rezultatus? Imkime tik vien alternatyvi poymi por (pvz., gelton ir ali skl spal v) ir pagal pateikt schem atlikime kryminimus. Toks kryminimas vadina mas m o n o h ib rid in iu , nes analizuojama tik viena alternatyvi poymi pora, kuri, kaip vliau paaiks, lemia tik viena alelini gen pora. Paymkime dom inantin poym (gelton skl spalv) raide A, o recesyvin poym (ali skl spalv) - a. Iki krym inim o G. Mendelis tokius irnius kart sekoje veis savidulkos bdu, atrinkdamas tik tuos augalus, kuri poymiai (skl spalva) skirtingose kartose buvo stabils. Taigi pagal tiriamj poym kryminimui pa rinkti irniai (P) turjo bti homozigotiniai: geltonieji - pagal dom inantin A alelin gen (AA genotipas), o alieji - pagal recesyvin a alelin gen (aa geno tipas). Kokios gametos susidarys iuose augaluose? A A genotipui susidarys tik A alelin gen turinios gametos, o aa genotipui - tik a alelin gen turinios gametos. Akivaizdu, kad sukryminus tokius augalus vien su kitu visi palikuo niai (F,) bus heterozigotiniai, t. y. j genotipas bus Aa. Fenotipikai vis F, irni sklos bus geltonos, nes pasireik tik dom inantinis A poymis. 4F, irnius palikus savidulkai, tolesnius eksperimento rezultatus patogiau pa teikti lentele arba vadinamja Peneto g a rd e le (gardel XX a. pradioje pa sil angl genetikas R. K. Penetas (R. C. Punnett)). Tai lentel, kurios kairiajame stulpelyje suraomi vis vyrikj gam et tipai, o virutinje eilutje - vis moterikj gam et tipai (nors galima ir atvirkiai). Visi galimi palikuoni alelini gen deriniai (genotipai) suraomi atitinkam stulpeli ir eilui san kirtose. Nagrinjamame pavyzdyje vis F, irni genotipas yra Aa. Todl juose susi form uos gametos, turinios arba A, arba a alelin gen. Svarstant toliau dera pateikti iek tiek tikim ybi teorijos element. Akivaiz du, kad kiekvieno tip o gam et susidarymo tikimyb iuo atveju yra 1/2 arba 50 %. Po apvaisinimo dvi gametos susilieja ir susidaro jose esani alelini gen deriniai, t. y. F2 genotipai. Taigi kiekvieno j susidarymo tikimyb yra lygi atitinkam gam et susidarymo tikim ybi sandaugai.
f gamel 05 Q

63
P a v e ld im u m a s

/ \
GAMETOS A ( 1/ 2) a
(1/ 2 )

namptn*: r ? l

A 0 /2 ) a (1/2)

A (1/2) A A (1/2 1/2 = 1/4) Aa (1/2 1/2 = 1/4)

a (1/2)

Aa (1/2 1/2 = 1/4) aa (1/2 1/2 = 1/4)

Peneto gardelje surayti visi galimi genotipai. Sujungus tokius paius geno tipus (iuo atveju Aa) j susidarymo tikimybs sudedamos, ir galiausiai skirtin gi genotipai susidaro tokiom is dalimis:

F2 IR N I FENOTIPAI: I

3 :1 I I

AA 1/4 I____ I

Aa

Aa

aa 1/4 I____I

1/4 + 1/4 = 1/2 I______________ I 1:2:1

F2 IR N I GENO TIPAI:

Taigi galutinis F2 irni g e n o tip s an tykis yra 1 : 2 : 1. ios kartos au gal tik aa g en otip o sklos bus alios. Todl aliaskli irni bus 1 /4 (25 %). A A ir Aa g e n o tip sklos bus geltonos. Todl g eltonskli irni bus 1 /4 + + 1/2 = 3 /4 (75 %). Taigi F2 f e n o tip s a n tyk is yra 3 : 1 (do m in a n tin is poym is : recesyvinis poymis). G. M e n d e lis gerai im an tik im y b i te o rijo s p ra dm en is ir savo inias skm ingai pritaik a tlik t e ksperim ent rezultatam s paaikinti. Kokie gi G. M e n de lio a tlik to jo krym in im o rezultatai? Kitaip ta ria n t, ko kios jo n ustatytos poym i paveldjim o taisykls? 1. Pirmosios k a rto s (F ,) v ie n o d u m o a rb a d o m in a v im o ta is y k l . Su krym inus dvi kart sekoje stabilias irni form as, besiskirianias pagal vie n poym , pirm osios kartos palikuo ni fe n o tip a s yra toks pat kaip vieno i tv. f ^ \ Pirmasis M e n d e lio dsnis arb a pirmosios hibrid kartos v ie n o d u m o dsnis. Sukryminus hom ozigotinius individus, kuri vienas yra hom ozigotinis pagal vien fenotipin poym lemiant dom inantin alelin gen, o antrasis - hom ozi gotinis pagal alternatyvj poym lemiant recesyvin alelin gen, vis pirm o sios palikuoni kartos fenotipas bus vienodas - dominantinis. v ______________________________________________________________________ / 2. Skilim o ta is y k l . Sukryminus du F, hibridinius irnius, ta rp F2 irni buvo abi pradins fo rm os, pasiskirst tam tik ru kiekybiniu santykiu: augal su d o m in a n tin iu poym iu buvo trys dalys, o su recesyviniu - viena dalis. ^ T > Antrasis M en d elio dsnis arba palikuoni isiskyrimo pagal fen o tip dsnis.

Sukryminus pirmosios kartos hetero zigo tiniu s hibridus vienus su kitais, antrosios kartos hibridai pagal j fe n o tip in iu s poymius isiskiria abi pradi nes tv form as santykiu 3 : 1, t. y. 75 % individ turs d o m in a n tin po ym, o 25 % - recesyvin.

_______________________________________________________ y
Kaipgi poym iai pasireik treiojoje, ke tvirto joje ir tolesnse hibrid kar tose? G. M endelis atliko ir tokius eksperim entus. Paliks F2 irnius savidulkai, jis nustat, kad recesyvin poym turj auga lai tolesnse kartose (F3, F4 ir 1.1.) pagal poymius nebeisiskyr, t. y. ta rp j palikuoni niekada nebeatsirado augal, turini d om in an tin poym. Ki ta ip buvo su F2 irniais, turjusiais d o m in a n tin poym . A n a liz u o ja n t j palikuonius, gautus savidulkos bdu, buvo iskirtos dvi grups. Pirmosios, kuri sudar 1/3 vis augal, turini d om inantin poym, palikuoniai pagal poymius nebeisiskyr - j tolesni kart palikuoniai tu r jo tik d om inantin poym. Kitaip buvo su likusiomis 2 /3 F2 augal, turini dom in antin poym. J palikuoniai pagal poymius isiskyr tuo paiu santykiu 3 : 1 (3 /4 dominantini ir 1/ 4 recesyviniu kaip ir antrosios kartos hibrid). Tiriant tolesnes kartas gauti panas rezultatai. G. Mendelis, dar nieko neinojs nei apie alelinius genus, nei apie g enotipus, padar esmin ivad - kiekvien poym lemia du paveldim um o pradai (juos pavadino veiksniais - faktoriais"), kurie susi daran t gam etom s isiskiria, o apvaisinant - vl susieina visais galimais deri niais. Nordamas p a tik rin ti i veiksni (taigi alelini gen) isiskyrimo hipo tez (kad F, individai buvo hetero zigo tinia i su g en otip u Aa), mokslininkas atliko a n a lizu o ja n iu o s iu s k rym in im u s. Jis sukrym ino heterozigotinius a u k ta g iu s irn iu s (Aa) su h o m o z ig o tin ia is pagal recesyvin poym emagiais irniais (aa). io krym inim o rezultat - F, gen otip us ta ip pat galima pateikti Peneto gardele.
P as ta b a . N o rs ia h e te ro z ig o tin is au g ala s p a y m ta s k a ip vyrikasis, o recesyvinis h o m o z i g o tin is - ka ip m oterikasis, taia u s u k e itu s ly tis re z u lta ta i nepasikeis.

...

Vyrikosios gametos v A (1/2) a (1/2)

Moterikosios gametos a (1/2) a (1/2) Aa (1/4) Aa (1/4) aa (1/4) aa (1/4)

......

Galiausiai F, irni s kirtin g g e n o tip (Aa ir aa) santykis buvo 1 : 1. Ir fe n o tipa i pasiskirst to kiu pat santykiu 1 : 1 . Taigi 50 % augal tu r jo dominantinj poym ir 50 % - recesyvin. Tokie rezultatai patvirtino hipotez, kad aleliniai genai isiskiria susidarant gametoms. G. Mendelis savo eksperimentais rod, kad recesyvin hom ozigotin individ sukryminus su heterozigotiniu individu F, individai pagal fenotip isiskiria santykiu 1 : 1 . Taiau kas atsitikt, jei dom inantin fenotip turinio individo genotipas bt homozigotinis? Mintyse atlikime tok eksperiment: auktagius hom ozigotinius (t. y. A A ) irnius sukryminkime su emagiais hom ozigo ti niais (aa) irniais. Bet ju k tai tipikas m onohibridinis kryminimas, kur jau inagrinjome su geltonskliais ir aliaskliais irniais! Akivaizdu, kad iuo at veju visi F, individai bus heterozigotiniai - taigi auktagiai. Ivada. Atlikus analizuojantj m onohibridin kryminim, galima nustatyti, ar dom inantin poym turinio individo atitinkamos genetins srities genotipas hom ozigotinis, ar heterozigotinis. V______________________________________________________________________ y Taigi analizuojamj individ reikia sukryminti su recesyvinio fe n o tipo ho m ozigotiniu individu: A- x aa (ia brknelis ymi arba A, arba a alelin gen). Priklausomai nuo analizuojam ojo individo genotipo, rezultatai gali bti dve jopi: 1) jei vis F, individ fenotipas dom inantis, tiriamasis dom inantinio fe n o tipo individas yra hom ozigotinis (AA); 2) jei madaug puss F, individ fenotipas yra dom inantinis, o likusij recesyvinis, tiriamasis dom inantinio fe n o tipo individas yra heterozigotinis (Aa). Analizuojantieji m onohibridiniai kryminimai taikom i ir dabar, o tiria n t m o ni poymi paveldjim jie ypa svarbs (r. II dalies 4.2 skyri).

O
Nei G. Mendelis, nei jo sekjai krymindami negavo tiksli santyki 3 : 1 arba I : I, tik apytikslius, nes kryminant gaunamas ribotas palikuoni skaiius. Taigi iuos san tykius jie turjo nustatyti patys. Ir ne tik nustatyti, bet ir velgti j susidarymo prie astis. Vykdydami vairius kryminimus ir nordami analizuoti gaut palikuoni pasiskirs tymo pagal fenotip santykius, turime tiksliai inoti, kokie yra tv genotipai. Taigi kokios gametos ir kokiais santykiais susidaro j organizmuose. Tik tada sudar Peneto gardel nustatysime palikuoni pasiskirstym pagal poymius.

r gkm
1. Koks kryminimas vadinamas m onohibridiniu? Kaip j atliko G. Mendelis? Nupiekite m onohibridinio krym inim o schem ir paaikinkite gautus rezul tatus. 2. Kodl G. Mendlis padar ivad, kad palikuonims perduodam i ne patys poymiai, bet juos lemiantys veiksniai (t. y. genai)? 3. Kas yra Peneto gardel ir kam ji taikoma? 4. Kaip paaikinti m onohibridinio krym inim o F2 kartos palikuoni fenotipini poymi isiskyrim santykiu 3 : 1 ? 5. Kas yra m onohibridinis analizuojantysis kryminimas? Paaikinkite, k ir kaip juo remiantis galima nustatyti.

U d a v in ia i 1. Kryminimui buvo paimti geltonskliai ir aliaskliai irniai: a) geltonsklis hom ozigotinis irnis x aliasklis irnis. Kokie bus pirmosios kartos hibrid fenotipai ir genotipai? b) geltonsklis heterozigotinis irnis x geltonsklis heterozigotinis irnis. Ko kie bus pirmosios kartos hibrid fenotipai ir genotipai? Koks j santykis? c) geltonsklis heterozigotinis irnis x aliasklis irnis. Kokie bus pirmosios kartos hibridai pagal j poym ir kokiu santykiu jie pasiskirstys? 2. Vaisins musels (Drosophila m elanogaster) rusva kno spalva dominuoja tamsios kno spalvos atvilgiu: a) atlikus daugel kryminim tarp rusvos ir tamsios kno spalvos museli gauti tokie F, palikuoniai: 117 rusvos kno spalvos museli ir 120 - tamsios. Kokie buvo kryminam museli (P) genotipai? b) sukryminus rusvas vaisines museles su tokios pat kno spalvos muselmis, F, palikuoniai buvo tokie: 1 392 rusvos musels ir 467 tamsios musels. Kokie buvo kryminam museli (P) genotipai? 3. Sukryminus pilkas vitas su baltais gaidiais visi F, palikuoniai buvo pilki. Toliau ie F, individai vl buvo sukryminti su baltomis vitomis. I antrojo kryminimo gauti 172 gaidiai ir vitos - 85 balti ir 87 pilki. Kokie buvo vis vit ir gaidi genotipai? Kuris poymis dominuojantis, o kuris - recesyvinis? 4. Juoda galvij kailio spalva dominuoja alios spalvos atvilgiu: a) kokie pagal poym bus F, palikuoniai tarpusavyje sukryminus heterozi gotinius galvijus? b) kokie pagal tiriamj poym gims veriukai sukryminus alus bulius su F, karvmis? 5. Juoda uns kailio spalva dominuoja rudos kailio spalvos atvilgiu. Juodakail patel kelis kartus buvo kryminama su rudakailiu patinu. Iviso gim 1 5 juod ir 13 rud unyi. Nustatykite tv ir j palikuoni genotipus. 6. Tarkime, kad moni deiniarankikumas dominuoja kairiarankikumo atvil giu. Deiniarankis vyras, kurio motina kairiarank, ved deiniarank moter, turini tris sibsus (brolius ir seseris), i kuri du kairiarankiai. Nustatykite: a) koks nuotakos genotipas; b) kokia tikimyb, kad iems sutuoktiniams gims kairiarankiai vaikai.

3 .2 .2 .
M onohibridinis kryminimas, kai analizuojama tik viena alternatyvi poymi

Dihibridinis kryminimas: nealeliniai genai paveldimi nepriklausomai vienas nuo kito

ir juos lemiani alelini gen pora, yra pats paprasiausias. Inagrinkime sudtingesn pavyzd, kai dvi alternatyvi poymi poras nulemia kryminamos dvi skirting (t. y. nealelini) gen aleli poros. Toks kryminimas vadinamas dihibridiniu. Be abejo, vietoj jau analizuot G. M endelio tirt irni poymi (augalo aukio ir skl spalvos) galima pasirinkti bet koki kit alternatyvi poymi por arba tirti kit organizm (tarp j ir mogaus) poymi paveldji m. Taiau, pagerbdami paveldjimo dsni atradj, toliau analizuosime jo atliktus bandymus su irniais. G. Mendelis krymino irnius, kuri sklos geltonos ir lygios, su aliais ir rauklt skl irniais. Akivaizdu, kad tai yra dvi poros alternatyvi poymi (sklos geltonos arba alios ir sklos lygios arba raukltos). Taigi turi bti ir du skirtingi nealeliniai genai, kiekvienas turintis po aleli por. Tada yra dvi skirtingos poros aleli - viena pora lemia skl spalv, o kita - skl pa viriaus lygum. Jau inome, kad geltona skl spalva dom inuoja recesyvins alios spalvos atvilgiu. Spalv lemianio geno alelius, kaip ir m onohibridinio krym inim o atveju, paymkime taip: dom inantin gelton spalv lemiant alel - A, o recesyvin ali spalv lemiant alel - a. Analogikai paymkime ir skl lygum lemianio geno alelius, tik pasirinkdami kitas raides. (Galite pasirinkti bet kokias raides.) Toliau alel, lemiant dom inantin skl lygum, ymsime B, o recesyvin skl raukltum lemiant alel - b. sidmkite, kad aleliniai genai A ir a nra aleliniai kitos poros - B ir b aleliams.

TVAI

Parinktos tv (P) form os buvo hom ozigotins: viena - pagal abi dominantines nealelini gen aleli poras, o kita - pagal abi recesyvines aleli poras.

O
AABB

" ,

&
aa b b

/ \r GA M E TO S i \ (a b) (g) \ Z
PALIKUONIAI

(F,)

J
AaBb TVAI

A p ta ria nt genotipus ir j lemiamus poymius, dera pastebti, kad, kai ievi nio augalo genotipas yra AA, sklos bna geltonos, BB - sklos lygios, aa sklos alios, bb - sklos raukltos. Kadangi ir skl spalv, ir lygum le mianius poymius turjo abu kryminimui paimti pradins tv kartos augalai, j genotipus turim e urayti kartu abiem skirtingom s nealelini gen aleli poroms: AABB ir aabb. J gametos gaus po vien alelinj gen i kiekvienos poros, t. y. vieno augalo - AB, o kito - ab. Sukryminus ias dvi irni formas gametos susilieja, ir skirting gen aleliai vl sudaro poras. Ivada - galimi F, augal geno tipai yra tik AaBb, o fenotipiniai vis F, augal poymiai - abu dom inantiniai (geltonos lygios sklos) < Palikus iuos augalus savidulkai, rezultatai jau bus kitokie Susidarant gam etom s tokiuose F, augaluose, abiej por aleliai (A, a ir B, b) lytinse lstelse pasiskirsto nepriklausomai, t. y. tikimyb, kad gameta gaus A alelinj gen yra lygi tikimybei, kad ji gaus a alelinj gen. Taigi kiekvieno atvejo tikimyb yra 1/2. Taip pat pasiskirsto ir antroji alelini gen pora: B (1/2) ir b (1/2). Tarkime, kad abi analizuojamj alternatyvi poymi poras lemian tys neaieliniai genai yra skirtingose (nehomologinse) chromosomose. Taigi i kiekvienos toki gen aleli poros gameta gauna tik po vien alelj, nes j garin t patenka tik viena kiekvienos hom ologins poros chromosoma. Gametose galimi tokie nealelini gen aleli deriniai, kuri kiekvieno tikim yb yra 1 /4 (25 %): B (1/2) b (1/2) AB (1/2 1/2 = 1/4) Ab (1/2 1/2 = 1/4) A (1/2) a (1/2) aB (1/2 1/2 = 1/4) ab (1/2 1/2 = 1/4) Galimiems palikuoni (F2) genotipam s nustatyti pagal gam et genotipus sudaroma Peneto gardel: r l\/loterikosios g< mtos a AB (1/4) Vyrikosios aametos l Ab (1/4) aB O /4) ab (1/4) AB (1/4) Ab (1/4) AABB (1/16) <\ABb (1/16) AABb (1/16) a^Abb (1/16) AaBB (1/16)___ &aBte-ft7T5) _A8bt17T6) Aabb (1/16) aB (1/4) AaBB (1/16) A a B b ^/T S T aaBB (1/16) aaBb (1/16) ab (1/4) AagJo44 Aabb (1/16) aaBb (1/16) aabb (1/16) N

(F,)

J
AaBb AaBb

67
P a v e ld im u m a s

I viso susidaro 16 galim gam et derini, t. y. genotip variant. iuo atve ju vaik genotipui neturi takos, kuris alelinis genas kurio i tv yra perduotas. Matyti, kad visi Peneto gardels striainje esantys genotipai yra tokie pat. Be to, yra ir daugiau pasikartojani genotip. Sudjus tapai genotip tikim y bes, galiausiai gausime tokius tiktinus F2 irni genotipus ir j dal Akivaizdu, kad F2 irni fe n o tip pasiskirstymas kitoks nei gen o tip : 9 /1 6 augal abu poymiai bus dom in an tinia i (1 /1 6 + 2 /1 6 + + 2 /1 6 + 4 /1 6 ), 3 /1 6 - pirmasis poymis dom inantinis, o antrasis recesyvinis, 3 /1 6 - pirmasis poymis recesyvinis, o antrasis dom inanti nis, ir tik 1/16 palikuoni dalis turs abu recesyvinius poymius. Taigi F2 individ pasiskirstymo pagal fenotipus santykis yra 9 : 3 : 3 : 1 -

F2 IR N I GENOTIPAI:

3
AABB (1/16) AaBB (2/16) aaBB (1/16)

Q
AABb (2/16) AaBb (4/16)

a
aaBb (2/16)

f2 ir n i f e n o t ip a i:

f e
AAbb (1/16) Aabb (2/16)

f e
(1+2)/16

(1+2)/16 9 : 3: 3:1

f e
1/16

f e
aabb (1/16)

(1+2+2+4)/16

Toks palikuoni santykis pagal fenotipus labiausiai tiktinas, kai kryminami individai yra heterozigotiniai pagal abu analizuojamuosius poymius ir kai neale liniai genai, kuri aleliai lemia skirtingas poymi poras, yra skirtingose (t. y. nehomologinse) chromosomose. Tik tada galioja nepriklausomo gen pasi skirstymo gametose dsnis. Kai norima isiaikinti, ar abu dominantinius poymius turintis individas yra hom ozigotinis ar heterozigotinis, pagal abu iuos poymius lemianius nealelini gen dom inantinius alelius atliekamas analizu o jan tysis dihibridinis kryminimas. Toks individas kryminamas su individu, kuris yra homozigotinis pagal abu mus dominanius poymius lemiani nealelini gen recesyvinius alelius: A-B- x aabb (brknelis ia ymi bet kurj atitinkamo geno alelj). Kaip ir analizuojaniojo monohibridinio kryminimo atveju, rezultatai gali bti skirtingi: 1) jei tiriamasis dominantinio fenotipo individas yra homozigotinis abiej neale lini gen aleli atvilgiu (AABB), tai vis F, individ genotipas bus heterozigotinis pagal abiej gen alelius (AaBb), o fenotipas - dominantinis pagal abu poymius; 2) jei tiriamasis dominantinio fenotipo individas yra heterozigotinis pagal abiej gen alelius (AaBb), tai F, individai pagal fenotip isiskirs ir pasiskirstys taip: AaBb (1/4) - fenotipas dominantinis pagal abu poymius; Aabb (1/4) - fenotipas dominantinis pagal pirmj poym ir recesyvinis pagal antrj; aaBb (1/4) - fenotipas dominantinis pagal antrj poym ir recesyvinis pagal pirmj; aabb (1/4) - fenotipas recesyvinis pagal abu poymius. Taigi palikuoniai pagal fenotip pasiskirstys santykiu 1 : 1 : 1 : 1. Patys nustatykite, kokie bus F, individ fenotipiniai poymiai, jei tiriamasis domi nantinio fenotipo individas yra homozigotinis pagal vieno nealelinio geno alelius ir heterozigotinis - pagal kito. Kalbant ir apie monohibridin, ir apie dihibridin kryminim, vis laik buvo akcen tuojama, kad poymius lemiantys vienos poros aleliniai genai yra homologinse chromosomose. Be to, dihibridinio kryminimo slygoje buvo padaryta prielai da, kad dvi aleli poros, lemianios skirting alternatyvi poymi poras, yra skirtingose nehomologinse chromosomose. Tik tada tose chromosomose esan tys genai paveldimi nepriklausomai. C \ Treiasis M endelio dsnis - nepriklausomo poymi paveldjimo dsnis teigia: kiekvien alternatyvi poymi por lemiani gen (veiksni - faktori, kaip juos vadino G. Mendelis) aleli pora susidarant gametoms isiskiria nepriklau somai viena nuo kitos. Gametose gali susidaryti visi manomi nealelini gen aleli deriniai. \ ______________________________________________________________________ /

Alternatyvius poymius lemiani nealelini gen aleli por, esani skirtingose chro mosomose, gali bti ir daugiau nei dvi. Individ pasiskirstymo pagal fenotip antrojoje hibrid kartoje santyk, kai yra n alelini gen por, nusako daugianaris (3 + l ) n.
Pastaba. Taiau n e visos e u k a rio t c h ro m o s o m o s tu r i savo h o m o lo g in p o r : h e te ro g a m e tin s (v a iria g a m e tin s ) ly tie s in d iv id X ir Y c h ro m o s o m o s n ra h o m o lo g in s .

1. Koks kryminimas vadinamas dihibridiniu? Kaip j atliko G. Mendelis? Nu piekite dihibridinio kryminim o schem ir paaikinkite rezultatus. 2. Koks yra genotip ir koks fenotip pasiskirstymas dihibridinio kryminimo F2 kartoje (krym inim o schema AABB x aabb)? 3. Kada poymiai paveldimi nepriklausomai? 4. Kaip atliekamas dihibridinis analizuojantysis kryminimas? Paaikinkite, k ir kaip ju o remiantis galima nustatyti.

1. Kokios gametos susidarys, jei individo genotipas yra: a) MmNnSsRr? b) MMnnssRR? c) DdeeFfHH?
Pastaba. Nealeliniai genai yra skirtingose chromosomose.

2. Vaisins musels rusva kno spalva (G) dom inuoja geltonos kno spalvos (g) atvilgiu, raudona aki spalva (S) - sepijos1 spalvos (s) atvilgiu, o nor mals sparnai (L) - lenkt sparn (I) atvilgiu. Nustatykite: a) kokios gametos susidarys organizme vaisins musels, kurios knas - gel tonas, akys - sepijos spalvos, o sparnai - lenkti; b) kokios gametos susidarys organizm e vaisins musels, kurios knas - rus vas, akys - raudonos, o sparnai - lenkti; c) kokios gametos susidarys organizm e vaisins musels, kurios knas - gel tonas, ir kuri yra heterozigotin pagal aki spalv ir sparn form lemianius nealelini gen alelius. 3. Tarpusavyje krym inant irnius, kuri anktys geltonos ir lygios, gauti tokie F, augalai: 3 - su geltonomis lygiomis anktimis; 1 - su geltonomis nariuotomis anktimis. F, irniai su geltonom is nariuotom is anktimis vl buvo krymina mi su augalais, turiniais geltonas lygias anktis. A n tro jo krym inim o palikuo niai, turintys geltonas nariuotas anktis, vl buvo kryminami su augalais, turiniais geltonas lygias anktis. J palikuoniai pasiskirst taip: 3 augalai su geltonomis lygiomis anktimis; 3 augalai su geltonomis nariuotomis anktimis; 1 augalas su aliomis lygiomis anktimis ir 1 augalas su aliomis nariuotom is anktimis. Nustatykite pradins tv kartos augal ir j palikuoni genotipus visuose trijuose kryminimuose. 4. Juoda uns kailio spalva dom inuoja kavos spalvos atvilgiu, o trum pas plaukas - ilgo plauko atvilgiu. Abi iuos poymius lemiani nealelini gen aleli poros yra skirtingose chromosomose: a) sukryminti du individai, heterozigotiniai pagal abu poymius. Kiek pro cent juo d trum paplauki unyi gims i tokio kryminim o? b) un veislyno savininkas, nordamas veisti juodus trum paplaukius unis, sigijo un ir kal. eimininkas nori bti tikras, kad jo naujieji unys neturi kavos spalv ir ilg plauk lemiani gen. Su kokiais unimis jis turi sukry minti savuosius, kad nustatyt j genotip?

69
P a v e ld im u m a s

v___________________________________________________________ y

3 .2 .3 .
X chrom osom oje esani gen paveldjimo ypatum ai

rusvai rudos

Vaisini museli (Drosophila m elanogaster) (3.1 pav., p. 61) kaip ir mogaus lyt lemia lytins chromosomos: XY chromosomas turi vyrikieji individai, o XX moterikieji. X chromosomoje esani gen paveldjimo ypatumus iaikino dar T. Morganas. Jis sukrymino baltak vaisins musels patinl su raudonake pate le ir gavo visus raudonakius abiej lyi palikuonius (3.3 pav.). Toks rezultatas paliudijo, kad labai graus raudon aki poymis dominuoja balt aki poymio atvilgiu. Pagal G. Mendelio nustatytus dsnius sukryminus F, individus vienus su kitais, individai pagal tiriamj poym kitoje kartoje turt pasiskirstyti santykiu 3 : 1 . Taigi trys dalys F2 kartos abiej lyi vaisini museli turi bti raudonaks, o viena dalis - baltaks. Taiau gauti rezultatai parod, kad visos baltaks mu sels buvo tik patinliai. Be to, patinliai buvo ne tik baltakiai, bet ir raudonakiai. Tokie bandym rezultatai leido G. Morganui su bendradarbiais padaryti ivad, kad raudon aki spalv lemiantis genas turt bti X chromosomoje. Kaip tai galima paaikinti? inome, kad raudon aki poymis dominuoja. Taigi j lemia dominantinis alelinis genas. Kadangi jis yra X chromosomoje, paymti galima XR Baltas vaisini museli akis turi lemti recesyvinis alelinis genas Xr. Tv kartos . patinlis buvo baltakis, todl turjo X chromosom, kurioje buvo recesyvinis alelinis genas, ir Y chromosom, neturini X chromosomos alelini gen.

Padtis, kai lstelje su dvigubuoju chromosom rinkiniu yra tik vienas tam tikro je chromosomos vietoje (lokuse) esantis konkretaus geno variantas (t. y., genotipe yra tik vienas geno alelis), vadinama h em izig otin e'. Hemizigotiniame organizme reikiasi daugelis X chromosomoje esani recesyvini patologini gen, lemiani kai kurias paveldimsias ligas (kaip antai hemofilija, spalvinis aklumas ir t. t.), nes daniausiai recesyvinis genas neturi dominantinio alelio.

Q +

T v a i (P)

Tv kartos patel buvo raudonak. Taigi turjo dvi X chromosomas, i kuri bent vienoje turjo bti dom inantinis raudon aki spalv lemiantis genas. Visos F, musels (ir patels, ir patinliai) buvo raudonaks. Toks rezul tatas manomas tik tada, kai P patels bna hom ozigotins pagal dominantin R alelin gen, t. y. j genotipas yra XR . Uraius genotipus kryminimas XR buvo toks:

PALIKUONIAI

(f,)

cf

3.3 pav. Vaisins musels raudonaks patels ir baltakio patinlio krym inimas

Toliau F, individai (visi raudonakiai) buvo kryminami vienas su kitu. F2 individ genotipam s nustatyti sudarome Peneto gardel: r F2
P a tin li g a m e to s

P ate li g a m e to s

* (1/2) Y (1/2)

XR(1/2) XR XR(1/4) ? XR (1/4) c Y f

Xr(1/2) XR X'(1/4) ? Xr Y(1/4) ^

'H em izigo ta (gr. h e m i - pu siau; z y g o t - sujungta por) lstel arba organizmas, kuriame to paties geno aleli yra ne po ra, o vienas. H em izigotin pad tis aptikta heterogametins lyties organizm lytinse chrom osom o se, visose haploidini organizm chromosomose.

Galutinis rezultatas toks: raudonaks patels (visos) - 1/2 vis F2 individ; raudonakiai patinliai (XR - 1 /4 vis F2 individ; Y) baltakiai patinliai (X'Y) - 1 /4 vis F2 individ. Taigi raudonakiai ir baltakiai patinliai F2 kartoje pasiskirst santykiu 1 : 1 . Kadangi patels turi dvi X chromosomas, pagal aki spalv lemiant gen jos gali bti trij genotip. Taip pat atsitinka, kai poym lemiantys genai yra autosomose (prisiminkite jau nagrintus m onohibridinio ir dihibridinio irni krym inim o pavyzdius) - XR (raudonaks), XR (raudonaks), XrX r (bal XR Xr taks). Patinliai turdam i tik vien X chromosom gali bti tik dviej geno tip - XR (raudonakiai) ir XrY (baltakiai). Y

Kaip jau buvo m inta, kita labai svarbi slyga M endelio dsniams pasi reikti (analizuojant dviej ar daugiau poym i paveldjim) - kai skirting nealelini gen aleli poros, lemianios skirtingus poymius, yra skirtingose chromosom ose, t. y. nehom ologinse autosomose. Taiau vienoje ch ro m o somoje yra tkstaniai gen. Kaip tada paveldimi genai ir kokie yra pavel dim gen ir j lem iam fe n o tip pasiskirstymo palikuoni kart sekoje dsningumai?

1. Kokie yra gen, esani lytinse chromosomose, paveldjimo ypatumai lyginant su autosom ini gen paveldjimu? Paaikinkite tokio paveldjimo prieastis. 2. Kaip vadinama padtis, kai genotipe yra tik vienas alelinis genas? Kaip fenotipikai pasireikia ioje padtyje esantys dominantiniai ir recesyviniai genai?

1. Vaisini museli genai, lemiantys aki spalv, yra X chrom osom oje. Rau don aki spalv lemia dom inantinis R genas, recesyvinis jo alelis r lemia balt aki spalv. Y chrom osom oje atitinkam os genetins srities (lokuso), kurioje bt R arba r aleliniai genai, nra. Nustatykite: a) koki tip gam etos susidarys ir koks bus j santykis raudonaks hom ozi g otins patels organizm e (atsivelgiant j genus ir chromosom as, kuriose jie yra); b) koki tip gam etos susidarys ir koks bus j santykis raudonakio patinlio organizm e; c) laboratorijoje su raudonakiais patinliais buvo krym inam os raudonaks vaisini museli patels. Tarp palikuoni buvo 69 raudonakiai ir baltakiai patinliai bei 71 raudonak patel. Kokie buvo tv ir vaik genotipai? 2. Kai kuri vit veisli genai, lemiantys plunksn baltum arba raibum, yra X chrom osom oje. Raibumas (R) dom inuoja baltos spalvos (r) atvilgiu. Prisiminkite, kad gaidiai yra h o m og am etin lytis. Taigi: a) pauktyne baltas vitas sukrym ino su raibais gaidiais. F, palikuoniai buvo raibi (ir gaidiai, ir vitos) ir krym inam i tarpusavyje. Tarp F2 palikuo ni buvo 594 raibi gaidiai bei 607 raibos vitos. Kokie tv kartos ir F, bei F2 palikuoni genotipai? b) sukrym inus raibus gaidius su baltomis vitomis gauti tokie palikuoniai (F,): 40 raib gaidi bei vit ir 38 balti gaidiai bei vitos. Kokie buvo tv ir vaik genotipai? 3. Kai kurie m ons neskiria spalv. Neskiriantys alios ir raudonos spalvos asmenys vadinami daltonikais. i savyb lemia recesyvinis d genas, esantis X chrom osom oje. N ormal spalv skyrim lemia dom inantinis D genas. Taigi: a) neskirianti spalv moteris itekjo u vyro, normaliai skirianio spalvas. Kaip skirs spalvas j sns ir dukterys? b) abu sutuoktiniai normaliai skyr spalvas. Jiems gim snus, neskiriantis spalv. Kokie buvo tv genotipai? c) normaliai spalvas skirianti moteris, kurios tvas spalv neskyr, itekjo u vyro, normaliai skirianio spalvas. Kokia tikim yb, kad jiems gims vaikas, neskiriantis spalv? d) normaliai skirianti spalvas moteris susituok su normaliai skirianiu spal vas vyru. Jiems gim spalv neskiriantis snus. Kokia tikim yb, kad ir kitas j snus neskirs spalv?

v______________________________________________ y

3.3.
Gen sankiba ir paveldjimo ypatumai

Nepriklausomas gen pasiskirstymas pagrstas tuo, kad skirting nealelini gen aleli poros yra skirtingose hom ologini chrom osom porose. Kaip kar t sekoje pasiskirsto genai, esantys vienoje hom ologini chrom osom poroje? Tokio paveldjimo dsningumus ityr T. Morganas ir jo mokiniai. Eksperimen tam s jie pasirinko vaisin musel, nes jos dvigubj chrom osom rinkin (2n), kaip inia, sudaro tik 8 chromosom os (3.1 pav., p. 61). Be to, j lengva veisti laboratorijos slygomis. A tlik t bandym rezultatai parod, kad vienoje chro m osomoje esantys genai daniausiai paveldimi kartu, t. y. pasireikia vadinamoji g en sankiba. Akivaizdu, kad iuo atveju nepriklausomo poymi, kuriuos lemia skirtingi vienoje chromosomoje esantys genai, paveldjimo nebus. G. Mendeliui tiesiog labai pasisek dihibridiniam kryminimui atsitiktinai pasirinkti irni poymius, kuriuos lemiantys genai yra skirtingose chromosomose - kitaip jis niekada nebt nustats F2 irni isiskyrimo ir pasiskirstymo pagal fenotip santykiu 9 : 3 : 3 : 1.

D
Gen sankib pirmieji pastebjo K Beitsonas (W. Bateson) ir R. K. Penetas, praslin kus 4-iems deimtmeiams po Mendelio eksperiment rezultato paskelbimo. Mintieji mokslininkai atkreip dmes, kad du augal - iuokart pelirni - poymiai pavel dimi priklausomai vienas nuo kito. Beje, reikin tuo laiku jie priskyr prie Mendelio dsnio iimi.

TVAI (F,)

cf

Esantys vienoje chromosomoje ir kartu paveldimi genai sudaro sankibos grup Tai k gi gausime analizuodami dviej skirting poymi paveldjim, jei juos
A ^ a a P a

BBOb " V

bODb v

Homologini chromosom pora Nealeliniai genai ir j aleliai bei j lemiami poymiai:

A - rusvas knas a - tamsus knas

Bb-

normals sparnai trumpi sparnai

$
A 4*

A
B

+ GAMETOS

cf
pa

A
b

t ia

a O

a b

bD

PALIKUONIAI

lemianios nealelini gen aleli poros yra vienoje chromosomoje? T. Morganas sukrymino rusvos spalvos museles, kuri sparneliai normals, su tamsios spalvos muselmis, kuri sparneliai sutrumpj. Visos F, musels buvo rusvos su normaliais sparneliais. Apibendrins jis padar ivad, kad ios kartos individai buvo heterozigotiniai pagal dvi nealelini gen (lemiani kno spalv (A genas) ir sparneli ilg (B genas) aleli poras, kur dominantiniai poymiai buvo rusva spalva (A alelis) ir normals sparneliai (B alelis), o recesyviniai - tamsi spalva (a alelis) ir sutrumpj sparneliai (b alelis). Buvo atliktas analizuojantysis kryminimas ir sukrymintos tokios dvigubai he terozigotins (AaBb) F, vaisini museli patels ir patinliai, kuri spalva tamsi, o sparneliai sutrumpj. Taigi kryminamieji buvo dvigubai homozigotiniai pagal recesyvinius poymius (aabb). Pagal Mendelio dsnius tokio analizuojaniojo dihibridinio kryminimo hipotetinis rezultatas turt bti palikuoni isiskyrimas pagal fenotip santykiu 1 : 1 : 1 : 1. Taigi F2 musels tu r t bti keturi skirting fenotip: 1 /4 rusv su normaliais sparneliais; 1/4 rusv su sutrumpjusiais spar neliais; 1 /4 tamsi su normaliais sparneliais ir 1/4 tamsi su sutrumpjusiais sparneliais. Akivaizdiai sitikinta, kad taip nra: F2 museli skirting fenotip santykis buvo 1 : 1. kryminim ir jo rezultatus galima paaikinti tik prielaida, kad abi skirting nealelini gen aleli poros, lemianios skirtingus organizmo poymius, yra toje paioje chromosomoje. Tada kryminam individ gametose susidaro ne keturi nepriklausomi variantai, o tik du Kadangi iame kryminime patinliai buvo hom ozigotiniai pagal abu recesy vinius genus, esanius vienoje chromosom oje, tai j abi hom ologins chromosomos turjo t pat analizuojam gen aleli rinkin Todl atsitiktinai susiliejus vyrikoms ir moterikoms gam etom s susidar tik du skirtingi palikuoni (F2) genotipai ir Palikuonys pagal fenotip taip pat buvo tik dviej tip. Taigi rezultatas toks pat kaip ir analizuojaniojo monohibridinio kryminimo atveju. Tai patvirtina prielaid, kad genai, esantys vienoje chromosomoje, paveldimi kartu.

Kryminant individus, dvigubai heterozigotinius pagal dvi nealelini gen, esani vienoje chromosom oje, aleli poras, lemianias alternatyvius fenotipinius po ymius, F2 individai pagal fenotip isiskiria santykiu 3 : 1 kaip ir per monohibridinj kryminim. Tolesni vaisini museli kryminimai parod, kad tai anaiptol ne vienintelis nukrypimas nuo M endelio dsni. Prisiminkime mejozs proces. Per pirmj mejozinj dalijimsi vyksta labai svarbus reikinys - hom ologini chromosom neseserini chromatidi rekombinacija (genetiniai mainai) (r. 2.8 pav., p. 53). Dl jos susidaro gametos, kuriose yra skirtingi gen aleli rinkiniai, neturj tvins form os. Antai hom ologini chrom osom poroje, kurioje yra dvi neale lini gen aleli poros Aa ir Bb, per pirmj mejozinj dalijimsi vyko viena rekombinacija, ir neseserins chromatids apsikeit fragm entais (3.4 pav.). Taip atskirose hom ologini chrom osom poros chromatidse susidar nauji t pai nealelini gen aleli deriniai: A. a > A B Ir b ^ BA b' (nerekombinantins chromatids) (rekombinantins chromatids),

todl galiausiai susiformavo keturios skirtingos gametos. Tai jau buvo aptarta 2.4.2 skyriuje. r ---------------------------------------------------------------------------------------------------------------------- n Individai, turintys naujus gen derinius, vadinami re ko m b in an tais, o j fenotipai - re ko m b in an tin iais fen o tip ais.

73
P a v e ld im u m a s

Homologini chrom osom pora Seserins chromatids

Rekombinacija per pirmj mejozinj dalijimsi Neseserins \ chromatids \ Po pirmojo mejozinio dalijimosi

Po antrojo mejozinio dalijimosi


3.4 pav. Per pirm j mejozinj dalijimsi vykus rekombinacijai vienos h o m olog in i chrom osom poros aleliai persiskirsto

^ ^

Nerekombinuota chromosoma

Rekombinuotos chromosomos

Nerekombinuota chromosoma

Chromosomos skirtingose gametose pasibaigus mejozei

Sukryminus daug individ (pvz., vaisini museli), besiskiriani pagal poymius, kuriuos lemia skirting vienoje chrom osom oje esani nealelini gen aleliai , ir ityrus gautus palikuonius, pasirod, kad ta rp j yra (nors ir nedaug) toki, kuri feno tipa s skiriasi nuo abiej tv, taigi yra rekombinantinis. Prieastis - rekombinacija (genetiniai mainai) ta rp neseserini tos chrom osom os chrom atidi. Ji vyko per mejoz fo rm u ojan tis vieno i tv gam etom s (3.4 pav., p. 73). Dl to susidar rekom binantins gametos. Tokioms gametoms dalyvavus apvaisinime, i susidariusi zigot susiformavo individai su rekombinantiniais fenotipais (3.5 pav.). Kaip jau inote, per mejoz rekombinacija vyksta kiekvienoje homologini chromosom poroje, be to, da niausiai daugiau nei vienoje vietoje. ia analizuojamame pavyzdyje turim a gal voje rekombinacija, vykusi tik tarp analizuojamj gen, ir dl to pakeiianti j aleli pasiskirstym gametose. Kitose ios chromosomos dalyse vykusi rekom binacija analizuojamj aleli pasiskirstymo ir j lemiam fenotip nekeiia. Genai, esantys vienoje chromosomoje, sudaro vien sankibos grup ir pa veldimi kartu, iskyrus tuos atvejus, kai tarp t gen per mejoz vyksta rekombi nacija.

Chrom osom gen o lap i sudarym as

Ilgainiui pastebta, kad egzistuoja tiesioginis ryys tarp chromatidi persikryiavimo bei genetini main danumo ir rekombinantini fenotip danumo. Rekombinantini fenotip danumu remiantis galima nustatyti atstum tarp gen ir sudaryti chromosom genolapius2. Atstumas tarp gen ypa svarbus, nes kuo toliau vienas nuo kito yra du vienoje chromosomoje esantys genai, tuo didesn tikimyb, kad per mejoz btent tarp j vyks genetiniai mainai. Genetinio atstu mo tarp gen matu prasta laikyti 1 % rekombinant palikuoni kartoje. Ms analizuotame pavyzdyje buvo nustatyta, kad 6 % F, palikuoni fenotipai buvo rekombinantiniai. Taigi atstumas tarp tuos fenotipus lemiani gen (pvz., A ir B) yra 6 slyginiai vienetai.

3.5 pav. Palikuoni genotipai ir fenotipai, kai apvaisinant dalyvauja rekom binantins gametos

Dvigubai homozigotinio individo

Heterozigotinio individo, kai per gametogenez vyko rekombinacija

GAMETOS

Apvaisinimas

Pastaba. Krym inim as iuo atveju tu r jo bti analizuojanty sis, t. y. heterozigotiniai individai, turintys visus dom inantinius po ymius, krym inam i su hom ozi g o tin ia is in d iv id a is , tu rin ia is visus recesyvinius poymius. Chromosom genolapj pirma sis teorikai pagrind ir sudar vienas T. H. M o rg a n o b e n d ra darbi - A. H. Stertevantas dar 1913-aisiais, tyrindamas vaisins musels chromosomas.

ZIGOTOS

PALIKUONI FENOTIPAI
Nerekombinantinis dvigubasis dominantinis Rekombinantiniai (neatitinkantys pavel djimo pagal Mendelio dsnius)

\
Nerekombinantinis dvigubasis recesyvinis

Norint vertinti atstumus tarp trij vienoje chromosomoje esani gen, reikia atlikti daugel kryminim ir pagal rekombinant dal tarp palikuoni nustatyti atstumus tarp kiekvieno i i nealelini gen. Pavyzdiui, chromosomoje yra trys genai A, B ir C. Kiekvienas j turi po du alelius. Kaip ie genai isidst chromosomoje? Galimi trys variantai: A -B -C , A -C -B ir B -A -C . Atlikus tyrimus nustatyta, kad atstumas: 1) tarp A ir B gen yra 6 vienetai; 2) tarp B ir C - 12,5 vieneto; 3) tarp A ir C - 18,5 vieneto. Pagal iuos atstumus galima idstyti genus tiriamojoje chromosomoje tik vienu bdu: A -B -C Nustaius daugelio gen linijin isidstym chrom osom oje ir apskaiiavus genetinius atstumus ta rp j, sudaromas g en etin is genolapis. Genetiniai at stumai rodo, kaip danai tarp gen vyksta rekombinacija, o ji skirtingose chro m osom vietose vyksta nevienodu danumu. Y chromosom os genetinio genolapio i viso nemanoma sudaryti, nes rekombinacija tarp Y ir X chromosom nevyksta. Pastebtina, kad genetiniai atstumai tarp gen neatitinka fizini atstum , kuriuos galima vertinti chromosomos frag m en to ilgiu, nukleotid por skaiiumi ir pan. Pagal pastaruosius sudaromi vairios skiriamosios gebos fiz in ia i g e n o la p ia i (pats tiksliausias fizinis genolapis yra visa atskiros chromosomos ar net viso genom o nukleotid seka). iuolaikiniai molekulins citogenetikos metodai jau leidia pam atyti konkret gen metafazinje chro mosomoje ir tiksliai nustatyti jo viet (citogenetinis genolapis).

1. Ar visi organizmo poymiai paveldimi nepriklausomai? Atsakym pagrskite. 2. Kas yra gen sankiba? 3. Kas yra gen sankibos grup? 4. Kiek gen sankibos grupi turi mogus ir kodl? 5. Kokie yra gen, esani vienoje chromosomoje, paveldjimo ypatumai? Nupiekite ir paaikinkite kryminim o, kai du nealeliniai genai yra toje paio je chromosomoje, schem. 6. Kaip paveldjim paveikia rekombinacija ir genetiniai mainai, vykstantys per mejoz? 7. Kaip apskaiiuojami genetiniai atstumai? K jie parodo? Kuo genetiniai atstumai skiriasi nuo fizini?

1. inom a, kad auktas p o m id o r stiebas d o m in u o ja em o stiebo atvil giu, o apvali vaisiaus fo rm a - kriaus fo rm o s atvilgiu. Be to, iuos skir tin g u s poym iu s le m ia n tys genai yra t o j e p a io je c h r o m o s o m o je . H e te ro z ig o tin is pagal abu p o y m iu s a ug alas b uvo s u k ry m in ta s su em astiebiu augalu, tu rin iu kriaus fo rm o s vaisius. Koki reikia tiktis F, p o m id o r ir kokiu santykiu pasiskirstys j fe n o tip a i? 2. Vaisini museli kno spalv ir sparn fo rm lem iantys nealeliniai ge nai yra vienoje ch rom osom oje. Tamsi kno spalva yra recesyvin rusvos spalvos atvilgiu, o tru m p i sparnai - ilg sparn atvilgiu. Rusvos ilgasparns patels, h ete ro zigo tin s pagal abu poym ius, buvo krym inam os su tam siais trum p asp arniais patinliais. Gauti to kie F, palikuoniai: 1 394 rusvi ilgasparniai, 1 4 18 tam ss trum p a sp a rn ia i, 287 tam ss ilgasparniai ir 288 rusvi tru m p asp arniai. Kokie tu r jo bti F, m useli poym i deriniai pagal M e n de lio dsnius? Kodl ta rp palikuo ni atsirado nauji poym i deriniai ir koks reikinys lm j atsiradim ? N ustatykite pradins kartos museli ir j palikuo ni gen otip us. V______________________________________________________________________ y

Apibendrindami tai, k suinojome apie gen (esani dvigubajame chromo som rinkinyje) paveldjimo dsningumus lytikai besidauginani organizm kart sekoje, vl grkime prie chromosomins paveldimumo teorijos, nes btent ji yra dar G. Mendelio atrast pagrindini paveldjimo dsningum teorinis pagrindas. s-----------------------------------------------------------------------------------------------------------------------s Chrom osom in p av eld im u m o teo rija a p ib d inam a eiais principais. 1. Skilimo (isiskyrimo) principas. Antrosios kartos palikuoni (F2) pasi skirstymas pagal fenotipus tam tikru santykiu aikinamas homologini chromo som pasiskirstymo gametose vykstant mejozei dsningumais. 2. N epriklausom o poym i p aveldjim o principas. Poymiai paveldimi nepriklausomai tik tada, kai juos lemiantys genai yra nehomologinse chromo somose. 3. Gen sankibos principas. Genai perduodami i kartos kart su ta chro mosoma, kurioje jie yra, nes ie genai yra sukib ir negali bti paveldimi nepri klausomai. i gen lemiami poymiai taip pat perduodami sukib" - taigi paveldimi kartu. 4. Gen sankibos grupi principas. Pagrindin gen sankibos grup suda ro genai, esantys vienoje chromosomoje. Todl sankibos grupi skaiius priklau so nuo chromosom viengubojo chromosom rinkinio n (t. y. skaiiaus lytinje lstelje). mogaus n = 23, taiau sankibos grupi yra 24, nes lytins chromoso mos yra skirtingos - X ir Y. 5. Rekombinacijos principas. Mejozs I profazje tarp homologini chro mosom neseserini chromatidi vyksta rekombinacija, kurios rezultatas - ap sikeitimas neseserini chromatidi fragmentais (t. y. vyksta genetiniai mainai). Todl homologinse chromosomose susidaro nauji nealelini gen aleli rinki niai. 6. Linijinio gen isidstymo chrom osomose principas. Genai chromo somose isidst linijikai (t. y. vienas paskui kit). Neseniai is teiginys papildy tas naujais duomenimis - kartais vien gen siterpia kitas ar net keletas gen.

3.4.
Kas ikreipia paveldjim pagal Mendelio dsnius
Kaip jau sitikinote, analizuojant poymi ir juos lemiani gen paveldjim pasitaiko atvej, kuri negalima paaikinti vadovaujantis tik Mendelio dsniais. Viena toki nukrypim prieastis yra homologini chromosom neseserini chro matidi rekombinacija, vykstanti per mejoz. Taiau net ir rekombinacija negalima paaikinti vis realiai nustatom paveldjimo ypatum. Esama ir kit mechanizm, lemiani atskir gen (ar j grupi) bei jais grindiam poymi paveldjim. Trumpai apvelkime kai kuriuos j: gen sveik, genomo spaud (imprinting), mozaikikum, nebranduolin paveldjim.

3 . 4 . 1.
Gen sveika
Anksiau nagrintuose pavyzdiuose gen poveikis buvo slygikai nepriklauso mas. Gali susidaryti spdis, kad organizmo genotip sudaro atskir nepriklauso mai veikiani gen rinkinys. Toks poiris bt klaidingas. Nors daugeliu atvej skirting gen poveikis slygikai nepriklausomas, bet dar daniau pasireikia vai rios j tarpusavio sveikos formos. Taigi genotipas yra ne pavieni gen rinkinys, o labai sudtinga genetin sistema. Visas genotip pagrindiani gen sveikas galima skirti dvi dideles grupes: 1) sveikos tarp alelini gen; 2) sveikos tarp nealelini gen. Net ir tais atvejais, kai organizmo poymis irykja sveikaujant tik dviem aleliniams genams, Mendelio dsniai akivaizdiai pasireikia tik esant visikajam dominavimui, t. y. kai vienas genas (dominantinis) visikai nustelbia kit gen (recesyvin), o F2 palikuonys isiskiria dvi grupes pagal fenotip santykiu 3 : 1 . Taiau yra ir kitoki dom inavim o tip. Ne k retesnis nei visikasis dom inavi mas yra nevisikasis (tarpinis) d o m in avim as, kai heterozigotiniai organiz mai Aa skiriasi nuo abiej hom ozigotini, t. y. ne tik nuo aa, bet ir nuo AA .

Alelini gen sveika

Todl F2 individ pasiskirstymas pagal fenotipinius poymius atitinka genotip pasiskirstym. Pavyzdys - juo d ir balt vit kryminimas: AA juodos x aa vi/ baltos Aa melsvai pilkos

F2

AA (1/4) : Aa (1/2) : aa (1/4). juodos melsvai pilkos baltos

Taigi individ pasiskirstymo pagal fenotipinius poymius santykis yra toks pat, kaip ir genotip - 1 : 2 : 1 . Kita alelini gen sveika vadinama sup erd o m in av im u . iuo atveju svei ka tarp alelini gen j tarpinj dom inavim panai tuo, kad heterozigotiniai organizmai skiriasi nuo abiej hom ozigotini, tik jie yra ne tarpiniai, bet po ymio intensyvumu pralenkia abu hom ozigotinius tvus (A A ir aa). Superdominavim galima urayti taip: A A < Aa > aa. F2 individ pasiskirstymo pagal genotip ir fenotip santykis taip pat sutam pa ir yra 1 : 2 : 1. 77 Polialelizmas. Ligi iol visi ms nagrinti pavyzdiai buvo pagrsti dviej ale lini gen raika. Tam tikro individo konkreioje homologini (porini) chromo som genetinje srityje galimi tik du aleliniai genai. Taiau analizuojant daugyb individ kartais toje paioje hom ologini chromosom vietoje alelini gen (to paties geno struktrini atmain) bna ir daugiau. Pavyzdiui, ABO sistemos kraujo grups. Jas lemia trys pagrindiniai aleliniai genai lA, lB ir l, taiau konkre tus individas gali turti tik du i j. Trys aleliniai genai gali sudaryti eis skirtingus genotipus, kurie lemia atitinkamus fenotipus, t. y. kraujo grupes (3.1 lentel). Taigi galiausiai yra keturios kraujo grups, nes aleliniai genai lA ir lByra dominantiniai recesyvinio l alelinio geno atvilgiu, o tarpusavyje veikia kodominantikai (r. toliau). sidmtina ir tai, kad ABO kraujo grupi sistemoje jau inoma ir daugiau pagrindini grupi atmain, kurias lemia kiti aleliniai genai. K odom inavim as yra toks dominavimo atvejis, kai abu aleliniai genai, kurie yra dominantiniai 3-iojo alelinio geno atvilgiu, atsidr individo genotipe kartu, form uoja ne kok nors tarpin poym (kaip tarpinio paveldjimo atveju), bet abu genai yra veikls ir kiekvienas reikiasi savaip. Ir io paveldjimo pavyzdys yra ABO kraujo grups. Heterozigotinis organizmas (AB kraujo grup) gamina abu antiknus - ir anti-A, ir anti-B. A kraujo grups asmenys gamina tik anti-B an tiknus, o B kraujo grups asmenys - tik anti-A antiknus. Taigi AB kraujo grupje ireikti abu kodominantiniai aleliai. Kai kuriais kodominavimo atvejais i viso nra normalaus recesyvinio alelio (nors recesyviniai aleliai gali atsirasti dl mutacij, apie kurias skaitykite II dalies 1-ajame sk.). Tada pagal fenotip galima tiksliai apibdinti genotip. Tokio kodo minavimo pavyzdys yra mogaus MN kraujo grups (3.2 lentel). Taigi ioje sistemoje yra tik du aleliniai genai, kurie homozigotinje padtyje nulemia arba M, arba N kraujo grupes, o heterozigotinje padtyje veikia kodominantikai ir nulemia MN kraujo grup. Susituokus dviem asmenims, kuri kraujo grup yra MN (MN x MN), gali gim ti vis trij kraujo grupi vaikai, o j fenotipinio pasiskirstymo santykis atitiks genotipin pasiskirstym: M M : MN : NN = 1 /4 : 1/2 : 1 / 4 = 1 : 2 : 1. inoma, tok santyk gautum e, jei eima bt daugiavaik. D o m in a v im o pasireikimas esant g e n o p le o tro p ijai. Pleotropija vadi namas reikinys, kai vienas genas lemia kelis organizm o poymius. Toks genas viena savybe gali bti visikai dom inantinis, kita - nevisikai dom inantinis, dar kita - kodominantinis arba superdominantinis. Gen pleotropijos pavyzdi rasite nagrindami paveldimsias m oni ligas (II dalies 4-asis sk.).

3.1 lentel. mogaus ABO sistemos genotipai ir j slygojamos kraujo grups

Genotipas Kraujo grup (fenotipas) |A |A A A IT |B |B B IB |0 B |A |B AB || 0

3.2 lentel, m ogaus M N sistemos g snotipai ir j slygojamc >s krau jo grups

Genotipas Kraujo grup (fenotipas) MM M NN N MN MN

3.6 pav. Siamo kat

i
L
J

A le lin i g en raikos p rik la u s o m y b nuo aplin ko s. Aplinkos slyg veikiamas genas i visikai d o m in a n tin io gali pasidaryti nevisikai dom inantiniu, o kartais net recesyviniu. Pavyzdiui, aplinkos tem peratra gali tu r ti didels takos augal ar gyvn tam tikr gen fe n o tipin ei raikai. A ntai Siamo kai (3.6 pav.) ir Himalaj triui (3.7 pav.) kailis aus, snukio, le tenli ir uodegos srityje bna tamsesnis. Himalaj triuiai yra hom ozigotiniai pagal recesyvin gen (), kurio produktas yra ferm entas, dalyvaujantis p ig m e n to m elanino sintezje. is ferm entas aktyvus tik emesnje nei 32C te m peratroje, t. y. tose kno dalyse, kurios labiau atla. Aplinkos reikm to geno lem iam am fe n o tip u i rodo bandymas (3.7 pav.). Tam tikr laik buvo aldomas Himalaj triuio kno plotelis, kur nuskustas baltas kailis. Ataug plaukai buvo nebe balti, o tam ss, nes gen o koduojam as fe rm e n ta s emesnje te m p era troje ta po aktyvus.

N ealelini gen sveika

Dar V. Beitsono (W. Bateson) atrasta nealelini gen sveika yra viena svarbiausi ir sudtingiausi iuolaikins genetikos p roblem . Tokie nealeliniai genai gali bti skirtingose tos paios h o m o lo g in i ch ro m o som po ros vietose arba i viso skirtin go se ch rom osom ose (pvz., m ogaus 1-osios, 3-iosios, 4-osios, 5-osios ir 7-osios ch ro m o som os konkreiose genetinse srityse). Kiekvienas toks individualus genas tu ri b e n t du alelius, vienas ku ri lemia poym , o kitas poveikio poym iui neturi. Turintis takos alelinis genas ym im as didija raide, o n etu rin tis takos - maja. Paprasiausia yra sveika ta rp d v ie j n e a le lin i gen por. Tik io reikinio nereikt p ainio ti su polialelizm u. Jei d a u gini aleli atveju tas pats genas gali tu r ti skirtingas alelines iraikas, kaip ABO kraujo grups lem iani lA, lB l atve , ju, tai poligeninis paveldjimas lemiamas daugelio skirtin g nealelini gen (pvz., A, B, C, D ir t. t.), kurie yra skirtingose tos paios chrom osom os vietose ar skirtingose chrom osom ose. Gen veiklai sum uojantis p ag rindia mas vieno poym io form avim asis. G en ai m o d ifik a to r ia i. Kiekvienam poym iui fo rm u o ja n tis galima iskir ti p a g rind in gen (arba genus) ir genus m o d ifika to riu s, keiianius p a g rin d in io g en o savybes. Taigi p ag rind in j veikla yra keisti arba reg u liu o ti (pvz., susilpninti arba su stiprin ti) p a g rin d in io nealelinio geno veikim . Dl to d ih ib rid in io krym in im o atveju F2 individam s n usta to m i neprasti pasi skirstym o pagal fe n o tip u s santykiai (daniausiai - 9 : 3 : 4 ) . E p istazin iai g e n a i. Tai recesyviniai nealeliniai genai, kurie visikai nu slopina kit nealelini gen - ir d o m in a n tin i , ir recesyviniu - veikim.

60

ta o
40

o'
"5 20 C L
D. 3.7 pav. Bandymas su Himalaj triuiu, liudijantis aplinkos tak geno veikimui. A - triuis prie eksperimen t; B - nuskustas triuio odos plotas aldomas; C - triuis eksperim entui baigiantis: aldom am e plote ata ugo tam ss plaukai

O emagiai gis Vidutinio gio Auktaugiai

3.8 pav. Populiacijos kiekybiniai poymiai: individ pasiskirstymas pagal g

Gauso dsnis - kitaip norm a lusis pasiskirstymas. Svarbus tikimy bi teorijai ir ten, kur ja naudoja masi. Remiantis iuo dsniu pa aikinama daug gamtos reikini, nes is dsnis nusako atsitiktinio dydio pasiskirstym, kuris gauna mas sumuojant daug kit dydi, tarp kuri nra dominuojani. Pa vadintas atradjo vok. matemati ko K. F Gauso (K. F. Gauss) gar . bei.

Kartais epistaziniai genai dar vadinami inhibitoriais arba supresoriais. Kai dvi nepri klausomas alternatyvi poymi poras lemia dviej skirting nealelini gen, esani skirtingose chromosomose, aleli poros, ir sveikos tarp t gen nra, pagal Mendelio dsnius F2 individams yra bdingas fenotip santykis 9 : 3 : 3 : 1. Taiau dl epistazs nuo io santykio nukrypstama. inomos kelios epistazs rys, slygo janios skirtingus fenotipini poymi santykius: 12 : 3 : 1, 13 : 3 ir kt. Poligeninis paveldjimas. Poymiai, kuriuos lemia keli vienodai veikiantys nealeliniai genai, vadinami poligeniniais. Daugel normali individo poymi (g, svor, odos ir plauk spalv ir pan.) nulemia daugelis nealelini gen, kuri veikla sumuojasi. Visi ie poymiai yra kiekybiniai. J skirtumai tarp individ nusta tomi vairiais matavimo vienetais (priklausomai nuo to, k matuojame). iems poymiams bdinga viena savyb, skirianti juos nuo kokybini poymi. Tai ne pertraukiamas poymio vairavimas. Statistikai ie poymio reikmi svyravimai ireikiami normalaus pasiskirstymo dsniu, dar vadinamu Gauso dsniu1. To kiam poymi pasiskirstymui bdinga tai, kad individai, turintys vidutines poymio reikmes, yra daniausi. Individ, turini didesnes arba maesnes u vidutin poymio reikmes, yra maiau nei individ, turini vidutines poymio reikmes.

ooo
aabbcc (labai viesi oda)

Sd

X
AABBCC (labai tamsi oda)

79 P a v e ld im u m a s

F,

oo A aBbCc

X
1

oo AaBbCc

Kiauialsts
20/64 h

OO

1/8 O

1 /8 O i
03

O d > o.

O oo ooo o o ooo o o ooo oo oo oo o o 0*0 o ooo

o oo oo o o oo o o oo oo o

1/8 O O*

1/8

o o o &

T .V o f! t E 66 oo .. o

o oo oo 0 0*0 oi oo oo o

OO

o oo oo* o oo o4 oo oo o o oo

1/8 O O

1/8
OC

1/8

1/8

1/8

oo oo oo oo o O i o* o o o o o o o** E o# o. o c. c* o o o** 0 o oo o

15/64

0. o**
. .

. .

1/ 8

c oo c & oo* t i ooo oo * oc* v

M
1/64

Odos pigmentacijos intensyvumas

3.9 pav. Poligeninis paveldjimas: odos spalvos priklausomyb nuo trij skirting nealelini gen aleli por

Kratutiniai poymio reikmi variantai yra reiausi. Toks pasiskirstymas tiksliai apraomas matematikai ir turi savo statistines charakteristikas. Paprastai kreiv, apibdinanti poymio pasiskirstym didelje individ grupje, yra varpo fo r mos (3.8 pav.).

m
Kaip paveldimi kiekybiniai poymiai, 1908-aisiais nustat ved mokslininkas H. Nilsonas-El (H. Nilson-Ehle). Jam pavyko aptikti paprasiausius kiekybini poymi pa veldjimo atvejus, kai poym lemia viena, dvi ar trys alelini gen poros, ir kiekvieno geno svarba poymiui yra apylyg. Jis iuos dsningumus nustat krymindamas raudongrdes ir baltagrdes kviei veisles. Pastebtina, kad kiekviena atskira kiekybin poym lemiani alelini gen pora kryminant paklsta Mendelio dsniams. Pavyzdiui, tarkime, kad odos pigmentacij lemia trys nepriklausomi nealeliniai genai A, B ir C, kuri kiekvie nas turi po du alelius (A ir a, B ir b, C ir c). J bendros raikos rezultatas yra odos spalvos (pigmentacijos) intensyvumas. paveldjimo atvej galima apibendrinti schema, pateikta 3.9 paveiksle (p. 79). F2 individ poymiai pagal fenotip (odos spalv) isiskiria santykiu 1 : 6 : 15 : 20 : 15 : 6 : 1. Akivaizdu, kad daugiausia yra individ su vidutinio intensyvumo pigmentacija, o maiausiai - po 1/64 populia cijos dal - asmen, kuri oda labai viesi arba labai tamsi. Lemiant kiekybin poym atskiro geno svarba tu o maesn, kuo daugiau gen pagrindia to poymio susiformavim. C---------------------------------------------------------------------------------------------------------------------- N Ivada Jei paveldimj poym lemia daug gen (poligenai), tai kiekvieno alelinio geno veikla sumuojasi. Fenotip danum o populiacijoje kreiv yra varpo fo r mos. Taigi atitinka Gauso pasiskirstym. ------------------------------------------------------------ ----------------------------------------------------------- /

1. 2. 3. 4. 5.

Kokios yra pagrindins gen sveik grups? Kas yra dauginiai aleliniai genai? Kokius inote j pavyzdius? Kas yra kodominavimas? Pateikite pavyzdi. Kaip apibdinti nealelini gen sveik? Kas bdinga kiekybini poymi paveldjimui? 6. Kaip populiacijoje individai pasiskirsto pagal kiekybin poym? Kokia yra

i poymi danio pasiskirstymo populiacijoje kreiv?

"N 1. Gls ied raudon spalv lemia alelinis genas R, o balt - r. Dl tarpinio paveldjimo heterozigotini augal iedai yra rausvi. Taigi: a) raudoniedis augalas apdulkintas baltaiedio augalo iedadulkmis. Koks bus F, augal genotipas ir fenotipas? b) rausvaiedis augalas apdulkintas raudoniedio augalo iedadulkmis. Ko kie bus F, augal genotipai ir fenotipai? 2. Avi P, genas lemia bauum (beragyst), P2 - rag iaugim. ios alelini gen poros dominavimas priklauso nuo individo lyties: vyrikosios lyties indivi dams (avinams) rag iaugim lemiantis P2 genas dominuoja bauum lemianio P, geno atvilgiu, kai tu o tarpu moterikosios lyties individams (avims) - priein gai: dominantinis yra bauum lemiantis P, genas, o rag iaugim lemiantis P2 genas yra recesyvinis. Nustatykite: a) kokie bus F, palikuoniai sukryminus raguot avin su baua avimi, kai abu tvai heterozigotiniai; b) kokie bus F, palikuoniai, jei tvai yra raguotas avinas ir baua avis, be to, abu homozigotiniai; c) kieno poym (tvo ar m otinos) i to paties kryminimo pavelds mote^ rikosios ir vyrikosios lyties palikuoniai;_________________________________

s T # > ------------------------------------------------------------------------------------------------------------- s
d) koks bus poymi skilimo santykis tarp F, individ, sukryminus heterozi gotin raguot avin su heterozigotine baua avimi. 3. mogaus ABO kraujo grupes lemia trys aleliniai genai: lA ir lByra dominantiniai (kodominavimas), o 1 yra recesyvinis. Genotipai lAlA ir lAl lemia A krau jo grup, lB ir lB - B kraujo grup, lAlB - AB kraujo grup, o ll - 0 kraujo lB l grup. Taigi: a) 0 kraujo grups moteris itekjo u hom ozigotinio A kraujo grups vyro. Jiems gim vienas vaikas. Kokia jo kraujo grup ir koks jo genotipas? b) 0 kraujo grups moteris itekjo u heterozigotinio B kraujo grups vyro. Kokias kraujo grupes gali turti j vaikai ir kokie galimi vaik genotipai? c) m otina yra hom ozigotin pagal lA alelin gen, o tvas - pagal lB alelin gen. Koks yra jiems gimusio vaiko genotipas ir kokia jo kraujo grup? d) 0 kraujo grups moteris itekjo u AB kraujo grups vyro. A r j vaikai turs tvo arba motinos kraujo grup? e) A kraujo grups heterozigotin moteris itekjo u 0 kraujo grups vyro. Kokios galimos j vaik kraujo grups? Koki kraujo grupi j vaikai negali turti? f) A kraujo grups heterozigotin moteris itekjo u heterozigotinio B krau jo grups vyro. Kokios galimos j vaik kraujo grups? 4. Apskaiiuokite bsim vaik ABO sistemos kraujo grupi tikimybes: a) vyrui ir monai nustatyta 0 kraujo grup. Kokia tikimyb, kad jiems gims vaikas, turintis 0, A, B arba AB kraujo grup? b) vyras ir mona yra heterozigotiniai pagal ABO kraujo grupi genus. Jiems abiem nustatyta A kraujo grup. Kokia tikimyb, kad jiems gims vaikas, tu rin tis 0, A, B arba AB kraujo grup? c) vyrui nustatyta 0, o monai - AB kraujo grup. Kokia tikimyb, kad jiems gims vaikas, turintis 0, A, B arba AB kraujo grup? d) abu tvai yra heterozigotiniai pagal B kraujo grup lemiant alelin gen. Kokia tikimyb, kad jiems gims vaikas, turintis B kraujo grup? 5. Kraujo grupi sistemos i tikrj yra sudtingesns. Taiau, tarkime, kad ABO kraujo grupes lemia trys genai, o rezus faktori - du aleliniai genai D (dominantinis) ir d (recesyvinis). DD ir Dd genotipai lemia Rh(+) veiksn, o dd - rh(-) veiksn. i dviej kraujo grupi sistem nealeliniai genai yra skirtingose chromo somose. Taigi: a) vyro genotipas pagal ABO ir Rh sistem kraujo grupes yra ddlAl, monos DdlB . Kokia tikimyb, kad jiems gims AB kraujo grups ir Rh(+) vaikas? lB b) Rh(+) moteris turi A kraujo grup, jos tvas buvo rh(-) ir turjo 0 kraujo grup. Ji itekjo u rh(-) vyro, turinio 0 kraujo grup. Kokia tikimyb, kad j vaikas pavelds abu tvo poymius? c) rh(-) vyras, turintis AB kraujo grup, ved Rh(+) moter, turini B kraujo grup. ios moters tvas buvo rh(-) ir turjo 0 kraujo grup. eimoje gim du vaikai. Pirmasis i j yra rh(-) ir turi B kraujo grup, o antrasis - Rh(+) ir 0 kraujo grups. Teismo medicinos ekspertai nustat, kad vienas vaikas gim i nesan tuokinio ryio (t. y. biologinis vaiko tvas yra kitas asmuo). Pagal kuri alelini gen por galima rodyti, kad vienas vaik yra kito tvo? 6. Kvieio grdo balt ir raudon spalv lemia trys poros alelini gen (poroje: dominantinis alelinis genas ir recesyvinis alelinis genas): R1 ir r1 R2 ir r2; R3 ir r3. ; Grdai balti, kai augalas homozigotinis pagal recesyvinius vis trij por ge nus. Bent vieno dominantinio alelinio geno buvimas grdo spalvai suteikia raudonumo. Kuo daugiau dominantini alelini gen, tu o intensyvesn raudo na grdo spalva. Taigi: a) sukryminus homozigotin raudongrd kviet su baltagrdiu F2 augal po ymiai isiskyr tokiu santykiu: 15 raudongrdi augal ir 1 baltagrdis auga las. Kiek por dominantini alelini gen turjo tvinis raudongrdis augalas? b) raudongrdis (tam tikro spalvos intensyvumo) hom ozigotinis kvietys bu vo sukrymintas su baltagrdiu. F2 augal poymiai isiskyr tokiu santy kiu: 1 baltagrdis augalas ir 63 raudongrdiai. Kiek raudongrdis tvinis kvietys tu r jo dom in an tini alelini gen por? v__________________________________ ____________________________________ /

3 .4 .2 .
Kiti genetins informacijos realizavim lemiantys mechanizmai
G en o m o spaudas (im p rin tin g as)

Ligi iol kalbdami apie paveldim um o dsnius, laikme, kad poym io susi form avim ui nesvarbu, kurioje i chrom osom - gautoje i tvo ar gautoje i m otinos - yra poym lemiantis genas. Taiau neseniai buvo pastebta, kad kai kurie induoli genai veikia tik vienoje i hom olog ini chrom osom , be to, priklauso nuo to, i kurio i tv ji yra gauta. Toks reikinys vadinamas g e n o m o spaudu (im p rin tin g u 1 Im printingas bna moterikasis, kai genai ). veikls tik i m otinos gautoje chromosomoje, ir vyrikasis, kai genai veikls tik i tvo gautoje chromosomoje (3.10 pav., A). Kaip is reikinys veikia paveldjimo ypatumus? spaudui (im printingui) jautrios konkreios genetins srities genai gali tu r ti aleli, lemiani skirtingus poymius. Taiau, kai veikia tik vienas i dviej gen, esani konkreioje hom ologins chrom osom poros vietoje, ne tenka prasms io geno aleli dom inavim o ar recesyvumo svokos (palyginki te su geno raika hem izigotinje padtyje). Kuris i tos genetins srities aleli lems poym, priklauso tik nuo hom ologins chromosomos kilms, t. y. nuo spaudo (im printingo) tipo. Geno raika, kai veiklus tik vienas i dviej geno variant, esani dvigubajame chrom osom rinkinyje, vadinama m o noaleline. C hrom osom om s pereinant j palikuoni kart (form uojantis gametoms arba i karto po apvaisinimo), kiekvienos chromosomos turtas spaudo tipas itri namas" ir perraomas" i naujo (3.10 pav.. B). Akivaizdu, kad puss chrom o som spaudo tipas pasikeiia. Taigi palikuoni fenotipiniai poymiai, lemiami spaudui jautri gen aleli, gali skirtis nuo tv poymi, tik nebus nulemti M endelio dsniams bding santyki.

Im printingas (ang. m p rin t ym, spaudas, pdsakas; im p rin tin g (veiksmaodin fo r ma) - spaudimas, atspaudimas, smigimas) - iuo atveju turim as galvoje tam tikro veiks mo rezultatas. Todl silytume vadinti spaudu.

B
Homologini chromosom pora

Cf
V Homologini chromosom pora tv lstelse M

V - vyrikasis spaudo (imprintingo) tipas M - moterikasis spaudo (imprintingo) tipas ) - veiklus genas - spaudas blokuoja geno raik

Perraomas spaudo (imprintingo) tipas

V
3.10 pav. A. G enom o spaudas (im printingas). Dalis gen (pvz., c) veikia tik i tvo gautoje chrom osom oje (vyrikojo tip o spaudas), kita dalis - (pvz., d) - tik i m otinos gautoje chrom oso moje (m oterikojo tip o spaudas). B. Keiiantis kartoms, puss tv chrom osom , perduodam vaikams, spaudo tipas pasikeiia

Galimi vaik homologini chromosom deriniai

i - spaudo tipas isaugotas p - spaudo tipas pakeistas

M ozaikikum as

M ozaikiku m as yra paveldjimo proporcijas ikreipiantis reikinys, kai or ganizmas turi dvi ar daugiau lsteli linij, kuri genomai skiriasi, nors jos visos kil i tos paios zigotos. Daniausiai mozaikikumas susiformuoja, kai dar nepraradusioje gebjimo dalytis lstelje vyksta mutacija. Taip atsiranda dvi lsteli linijos (klonai): normalios lstels ir lstels, kuri genotipas pa kits. Apie tai bus kalbama plaiau II dalies 4.3.3 skyriuje. Taiau galimas ir natralus moterikosios lyties induoli lsteli mozaikikumas, atsirandantis dl vienos i dviej X chromosom inaktyvinimo.

: / j
Klonas yra:

1) genetikai tapaios vienos lstels palikuons; 2) genetikai tapai organizm grup, kilusi i vieno individo jam dauginantis nelytiniu bdu.

X chromosomos inaktyvinim as

induoli (tarp j ir mogaus) lytins chromosomos X ir Y yra nehomologins, todl gen rinkiniai jose skirtingi. Moterikosios lyties individai (XX), t. y. patels, neturinios Y chromosomos, jos ir nepasigenda: Y chrom osom o je labai nedaug gen, o j dauguma lemia vyrikj lyties funkcij. Pastebti
P a v e ld im u m a s

na, kad X chrom osom oje yra daug abiej lyi organizmams svarbi gen. Neivengiamai tu r t ikilti problem, nes patinai, turintys tik vien X chro mosom, pastarosios gen turi dvigubai maiau nei patels, turinios dvi X chromosomas. Gamta i problem isprend taip, kad induoli pateli ls telse viena i dviej X chrom osom tam pa neaktyvi (t. y. joje neveikls dau guma gen), ir tokiu bdu sulyginama X chromosom os gen doz abiej lyi organizmuose. Embriono raidos pradioje lstels kakaip susiskaiiuoja" savo chromosomas ir palieka vien aktyvi, o kit (kitas, jei dl chromosom skaiiaus pokyi X chromosom esama daugiau - r. II dalies 4.1.3 skyri) inaktyvina taip sutankindama jos chromatin, kad interfaziniame branduolyje i chromosoma matoma kaip kompaktikas Baro knelis (r. II dalies 4 .8 pav., B).

\ Rud spalv lemiantis genas X chromosomoje:


0 X R alelinis ge nas 3.11 pav. 1 X r alelinis ge nas Vlio kiauto pieinio kats kailio spalvos prieastis yra vienos i hom ologini X chrom osom inaktyvi nimas. Nors kats kailio spalvingum lemia keli genai, galima teig ti, kad rudos kats yra hom ozigotins rud kailio spalv lemianio geno do m inan tinio alelio atvilgiu (XR genotipas). Recesyvinis XR Xr alelis leidia pasireikti kitiems kailio spalv lem iantiem s genams, todl hom ozigotins X'Xr ge notipo kats nebna rudos. Heterozigotini kai (XR genotipas) kailis bna X' ne rudas (kaip tu r t bti), bet vlio kiauto pieinio, nes skirtinguose lsteli klonuose veiklus yra tik XRarba Xr alelinis genas, esantis aktyvioje X chrom osom oje A n k s ty v u o ju e m b rio n o ra id o s la ik o ta rp iu k ie k v ie n o je l s te l je a ts itik tin a i in a k ty v in a m a (p a d a ro m a n e v e ik lia ) v ie n a i h o m o lo g in i X c h ro m o s o m

o Inaktyvinta (neveikli) X c h ro m o s o m a (X arba X r alelinis genas)

*
Zigota (XR Xr genotipas)

Embriono lstels

Genetikai tapai (XR genotipas) Xr odos lsteli klonai

Kuri i dviej X chromosom inaktyvinti, pasirenkama atsitiktinai: vienose ls telse tai i motinos gauta X chromosoma, kitose - gauta i tvo (nors gali bti ir iimi). Be to, toks pasirinkimas pastovus: jei jau tam tikroje lstelje inaktyvinama konkreti (pvz., gauta i motinos) X chromosoma, tai visose tos lstels palikuonse bus inaktyvinta btent i chromosoma. Taip susiformuoja dviej tip lsteli klonai. Jei patels X chromosomose yra skirtingi kurio nors geno aleliai (pvz., XA ir Xa), madaug pusje toki lsteli klon bus veiklus vienas alelinis genas (XA), o kitoje pusje - kitas (Xa). Tikriausiai visi esate m at kat vlio kiauto pieinio kailiu (3.11 pav.). To kia spalva yra akivaizdus X chrom osom os inaktyvinim o padarinys.

N ebranduolinis p aveldim um as

Auktesnij eukariot lstels, be branduolio DNR, tu ri ir m itochondrij DNR (mtDNR), o augalai - dar ir plastidi DNR. Be to, galimi ir kiti nechrom osomins DNR elem entai (pvz., plazmids). Tose citoplazm inse DNR m o lekulse yra savi genai, svarbs kai kuriems lstels gyvybiniams procesams. J paveldjimo ypatum us ianalizuokime remdamiesi mtDNR pavyzdiu. Kiekvienoje lstelje yra daug m itochondrij, o kiekvienoje m ito c h o n d rijo je - imtai mtDNR m olekuli. Akivaizdu, kad ia nra prasms kalbti apie recesyvini ir d o m in a n tin i aleli paveldjim pagal M endelio dsnius. Antra vertus, zigota m itochondrijas kartu su j mtDNR m olekulm is gauna tik i kiauialsts citoplazm os, todl jose esani gen ir j fenotipins iraikos ypatum ai perduodam i palikuonim s tik i motinos. Be jokios abejons, kad paveldjim lemiantys mechanizmai, kuriuos apvel gme, dar ne visi. Be to, visada reikia turti galvoje, kad organizmo fenotip slygoja ne vien genai, bet ir aplinkos poveikis. Antra vertus, ir patys genai gali kisti. Taigi kintamumas ir bus analizuojamas antrojoje io vadovlio dalyje.

1. Kokius inote mechanizmus, ikreipianius paveldjim pagal Mendelio dsnius? 2. Kas yra genom o spaudas (im printingas) ir kaip jis paveikia paveldjim? 3. Kas yra mozaikikumas ir kaip jis paveikia paveldjim? 4. K vadiname klonu? 5. Kas bdinga induoli X chromosom om s? Kaip tai paveikia X chromoso moje esani gen lemiam poymi paveldjim? 6. Kokia genetin informacija gldi citoplazmoje? Kokie jos ir jos lemiam poymi paveldjimo ypatumai?

3.5.
mogaus poymi paveldjimas

moni, kaip ir kit lytikai besidauginani organizm, poymius lemiani gen paveldjim reguliuoja G. M endelio atrasti dsniai. Taiau, kad t dsni veikim bt galima velgti tiesiogiai, poym turi nulem ti vienas genas. Be to, tiriamasis genas ir jo lemiamas poymis turi nuolatos pasireikti kart sekoje. Klasikinis paveldjimo pagal Mendelio dsnius pavyzdys buvo mogaus aki spalva. . B. Deivenportas (C. B. Davenport) 1907-aisiais paskelb aki spalvos paveldjimo tyrim rezultatus, kurie liudijo, kad ruda aki spalva yra dominantinis poymis, o mlyna - recesyvinis. Taiau vliau paaikjo, kad aki spalv lemia ne maiau kaip trys nealeliniai genai, kuri kiekvienas turi savo aleli. Taip pat reikiasi ir kiti akivaizds mogaus poymiai: plauk spalva, gis ir pan. Visi jie susij su daugelio gen veikimu. Todl sudtinga rasti normal mogaus poymj, kuris bt susijs tik su vienu genu. Kai iniasklaida itrim ituo ja ", kad atrastas n u tu kim o , intelektua lu m o ar dar koks nors genas, daniausiai tai tereikia, kad aptiktas vienas i daugelio gen (ir nebtinai reikmin giausias toje grupje), galini turti takos form uojantis atitinkamam poymiui.

eimos genealogijos sudarym as

'< gr. g e n e a lo g ia - gimins kart eil

Kiekvienas galim e isiaikinti, kaip ir koks poym is buvo paveldtas ms eimoje. N o rin t s itik in ti, ar eim oje konkretus poym is yra paveldimas, su darom as eimos arba visos gim ins g enealoginis medis. Per pastaruosius 60 m et ie dalykai Lietuvoje buvo priverstinai umirti. Situacija pasikeit tik po 1990-j. Genealogija tu ri b ti sudarom a laikantis ta m tik r taisykli. D uomenys apie eim pradedam i rin k ti nuo p ro b a n d o (taip vadinamas asmuo, kuris pirmasis i eimos nari kreipsi gydytoj ar genetik). Da niausiai gen ea lo gin ia i duom enys kaupiam i vienam poym iui ar ligai anali z u oti. Tuo pat m etu tir ti kelis poym ius labai sudtinga - tada kur kas sunkiau n u sta ty ti p oym io paveldjim o tip. G e n e a lo g in io m e d io b ra i y m a s . Braiant genealogin med vartojam i ta m tik ri sim boliai. Labiausiai paplitusi yra ta rp ta u tin g enealogijos sim b o li sistema (3.1 2 pav.). Galimi ir pap ild om i sim boliai, tik juos btin a pa aikinti. Tiriam j poym tu rin io individo sim bolis nuspalvinam as (arba tiesiog utuuojamas):G enealogin m ed nesunku nubraiyti ir ranka, taiau darb palengvina vairios specialios ko m piuterins p rogram os (pvz., Cyrilic, Progeny ir kt.). Program os, ku rio m is n audojasi m o k slininka i ir g y d y to ja i g e n e tika i, yra sudtingos ir labai brangios, taiau inte rn e te galite rasti ir daug paprastes ni n em oka m p rogram li. Kiekvienos g enealogijos m edio sudedam oji dalis yra vis su tiria m u o ju poym iu susijusi eimos ar gim ins nari d u o m e n apraas: 1) pavard, vardas, t vo vardas; 2) g im im o data: m etai, m nuo, diena; 3) ta u tyb ; 4) g im im o vieta: miestas, kaimas, rajonas (je i reikia - ir alis); 5) apiros rezultatai: ar asmuo tu ri mus d o m in a n t poym , ar jis svei kas, ar serga, o jei serga, paym im a diagnoz; 6) jei asm uo mirs, n uro d o m a m irties prieastis ir data. Labai svarbu surinkti kuo isamesnius duo m e nis apie visus genealogijos narius, nepriklausom ai nuo to, ar jie gyvi, ar mir. Visus iuos duo m e nis patogiausia pateikti lentele (3.1 3 pav., p. 87).

P a v e ld im u m a s

A ntra vertus, konkretaus m ogaus geno poveikis fe n o tip u i akivaizdiausiai pastebimas tada, kai to geno veikla sutrinka. Daniausiai toks sutrikimas lemia koki nors paveldim lig. Lig paveldjimas daug labiau dom ina vi suomen nei norm ali poym i paveldjimas, todl ioje srityje tyrim ai labai intensyvs (paveldimsias m oni ligas dar apvelgsime 4-ajame skyriuje). I Tobuljant genetini tyrim m etodam s, kasmet apraoma vis daugiau lig ir padi, kurias sukelia vieno geno pokyiai, taigi j paveldjime jau akivaizds t M endelio dsniai. mons - tai ne irniai ar vaisins musels - su jais eksperim ent, iekoda mas gen paveldjimo yp atu m , neatliksi. Taiau galima analizuoti poymi perdavim kart sekoje atliekant konkrei eim g e n e tin a n a liz ir nu sta ta n t j paveldjimo dsningum us. i analiz pagrsta tu o, kad kiekviena santuoka savo genetine esme - tai toks pat kryminim as, kaip jau ms nagrintieji irni ar vaisini museli krym inim ai, tik santuoka sudaroma pai sutuo ktini , o ne eksperim entatoriaus valia. N orint genetikai tirti eim inform acij reikia pateikti analizei tinkam a fo rm a . Tokia fo rm a yra g e n e a lo g ija 1. Tai: 1) eimos nari g en e alo g in is medis, kuriam e nurodytas kiekvieno as mens genetinis ryys su bet kuriuo kitu genealogijos nariu; 2) g e n e a lo g ijo s a p r a y m a s , k u ria m e p ate ikia m a g im in s asmenis apibdinanti inform acija, svarbi poym io ar ligos paveldjimo ypatum am s nustatyti.

G enealogij pradedam e nuo p ro ba nd o, kuris gen ea lo gin ia m e medyje pa ym im as rodykle ties kairiuoju apa tiniu jo sim bolio kam pu. Klausindam i p roband surenkam e duo m e nis apie jo vaikus, paskui apie sibsus (brolius ir seseris). Suraome kiekvieno asmens anketinius duomenis. Vaikai ir sibsai genealoginiam e medyje ym im i i kairs dein pagal g im im o eil. Kiekvie nos kartos individai idstomi vienoje eilje. Toliau renkami duom enys apie m otinos gimines. f G im inm is laikomi individai, turintys bent vien bendr protv. prasta tok protv skaiiuoti nuo proproseneli. \

----------------------------------------------------------------------------------------------------- y
M otina ir visi jos gimins genealogijoje daniausiai ymimi kairje pusje (nors tai nra privaloma - svarbu, kad vienoje genealogijoje bt laikomasi vieno principo). Po m otinos akos pereiname prie tvo ir jo gim ini akos. Kuo daugiau gimins kart pavyks aprpti, tu o tikslesni genetins analizs ivad galime tiktis.

Tarptautiniai genealogijos simboliai


Individuals
Simbolis Simbolio reikm
. - vyrikosios lyties asmuo O - moterikosios lyties asmuo - neinomos lyties asmuo O - analizuojamojo poymio neturi ( ~) O ^ O - gimini santuoka ~ neformali santuoka

eimos
Simbolis
Q Q - santuoka

Simbolio reikm

-o -n
O - v * -

|__ _z- x - dvi santuokos - nutraukta santuoka

3 0 ! O i - asmenikai apirtas, poymio neturi - asmenikai apirtas, turi poym

Santuoka ir i jos gim vaikai: O


t

- probandas

- dukt ir sunus

_ penki vaikai

PTl (? ) <^> _ asmenikai neapirtas, tikriausiai turi poym kaip probandas - mirs asmuo - autosominiu recesyviniu bdu paveldimo poymio neiotojas (heterozigotinis individas) O
3.12 pav. Tarptautin genealogijos sim boli sistema

O - ! d

S
O H CU

- su X chromosoma susijusio poymio neiotoja (heterozigotin moteris) - negyvagimis - savaiminis abortas - dirbtinis abortas - individas, neigyvens iki vieneri met amiaus

- vaik skaiius neinomas

O-rD

- neinoma, ar buvo vaik

B O

f f i t O ^ O O

O - ! EH

~ bevaik santuoka

r i* b
b

- neidentikieji (dizigotiniai) dvyniai - identikieji (monozigotiniai) dvyniai

U H O IU O ] ~ vaikintas asmuo ~

Baig braiyti genealogin med kartas paymime romnikais skaitmeni mis (pirm oji karta yra virutin). Kiekvienas individas genealoginiame me dyje turi savo kod, kur sudaro kartos numeris ir individo toje kartoje eils numeris. vairi kart individai num eruojam i i kairs dein arabikais skait menimis pradedant nuo 1. Pavyzdiui, III: 2 reikia treiosios kartos antrasis individas"; IV: 5 - ketvirtosios kartos penktasis individas" ir 1.1. Sudarius tok apytiksl genealogin med reikia pasistengti susitikti su kitais eimos ir gi mins nariais, kad bt galima juos apirti asmenikai ir prireikus patikslinti genealogij. Kaip pavyzd ianalizuokime J. P eimos dviej kart genealogij . (3.13 pav.). J. P eimoje probandas buvo vyrikis II: 3, sirgs neurofibrom ato. ze. ia liga sirgo ir jo sesuo II: 4 ir tvas I: 2. Probando sesuo II: 1 sirgo katarakta. Kiti asmenys buvo sveiki. Be to, probandas II: 3 ir jo sibsai buvo gim i gim ini santuokos. Taip trum pai galima apibdinti pateiktj pavyzd. Apirj bei apklaus visus gyvus asmenis (o apie mirusiuosius surink prieinamus duomenis) ir sukaup visus bendruosius duomenis, baigiame brai yti genealogin med bei sudarinti genealogij. Tada pereiname prie eimos (gimins) genetins analizs.

87
P a v e ld im u m a s 3.13 pav. J. P eimos genealoginis . medis ir genealoginiai duomenys. Patogum o dlei duom enys j lentel surayti i eils pagal kartas ir atskir kart asmenis, nors buvo renkami pradedant probandu

---Karta As mens eils Nr. kartoje 1 Pavard (moter mergautin), vardas, tvo vardas Jonaitien (Jonutait) Jon, Kazio Jonaitis Jonas, Jono Pranaitien (Jonaityt) Ona, Jono Petraitien (Jonaityt) Petronl, Jono Jonaitis Petras, Jono Onaitien (Jonaityt) Morta, Jono Jonaitis Povilas, Jono Gimimo data (m., mn., d.) Tautyb Gimimo vieta (miestas/ kaimas, rajonas) Semeliks, Trak raj. Auktadvaris, Trak raj. Auktadvaris, Trak raj. Auktadvaris, Trak raj. Auktadvaris, Trak raj. Auktadvaris, Trak raj. Auktadvaris, Trak raj. Asmens apiros rezultatai (jei'serga diagnoz) Sveika Jei mir, mirties prieastis ir data

1830 01 01

Lietuv

1920 10 10 Senatv 1863 12 30 Neurofibromatoz 1925 10 12

2 II 1

1823 02 02 1853 03 03

Lietuvis Lietuv

Sirgo neurofibromatoze Katarakta

1855 04 04

Lietuv

Sveika

1930 11 15

3 4

1856 02 03 1857 03 01

Lietuvis Lietuv

Sirgo neurofibromatoze Sirgo neurofibromatoze Sveikas

1900 12 11 Neurofibromatoz 1887 10 05 Neurofibromatoz 1958 04 25 Senatv

5 V

1860 02 12

Lietuvis

eimos g e n e tin analiz

A n a liz u o ja n t sudaryt gen ea lo gij aikinamasi: ar tiriam asis poym is paveldimas; galima ta rti, kad poym is paveldi mas, jei j tu ri kuris nors i p ro ba nd o gim ini; kaip tiriam asis poym is p erduodam as i kartos j kart; kokios lyties asmenys (vyrai ar m oterys) tu ri tok poym ; ar i tvo, ar i m o tin o s poym is perduodam as snums ar d ukterim s. I gaut duom en galima sprsti apie konkreius paveldjim o m echaniz mus ir genetikai p ro g n o z u o ti dar gim siani asm en g en o tip u s bei fe n o tipus. eimos poym i paveldjim o m echanizm ai gali bti vairs, taiau geriausiai yra itirtas paveldjimas pagal M e n de lio dsnius. m oni eim o se jie pasireikia lygiai taip pat kaip ir kryminant bet kurios kitos ries lytikai besidauginanius organizmus, turinius dvigubjj chromosom, taigi - ir jose esani gen rinkin. A n alizuo da m i genealogijas ir aikindamiesi, kaip eim oje paveldimas kon kretus mus d o m in a n tis poymis, tu rim e a tsim in ti, kad: 1) poym i, paveldim pagal M e n de lio dsnius, paveldjim o eim oje t i pas priklauso nuo to, koks alelinis genas - d o m in a n tin is ar recesyvinis, esantis a uto m o soje ar lytinje c h ro m o som oje - j lemia (3 .1 4 pav.); 2) paprasiausiu atveju tose paiose h o m o lo g in i c h ro m o som poros vietose bna du aleliniai genai (po vien kiekvienoje h o m o lo g in je chro m osom oje), to d l galim i trys s kirtin gi g e n o tip a i (pvz., A A , Aa ir aa); 3) mejozikai dalijantis lytini lsteli pirm takm s susidarys dviej tip ly tins lstels (gametos), turinios tik po vien alelin gen (A arba a; 3.15 pav.); 4) per apvaisinim viengubieji (haploidiniai) abiej lytini lsteli genom ai susilieja. Kokius alelinius genus turi susiliejanios lytins lstels, toks ir bus zigotos, taigi ir viso naujo organizm o, genotipas. Alelinis genas Chromosoma
AUTOSOMA DOMINANTINIS RECESYVINIS

Autosominis dominantinis Su X chromosoma susijs dominantinis

Autosominis recesyvinis Su X chromosoma susijs recesyvinis

3 .1 4 pav. Pagrindiniai alelini g e n 'ir j lem iam poymi paveldjimo tipai

Su Y chromosoma susijs
P O Y M IO P A V E L D J IM O T IP A S

m
Poymio paveld jim o genealogijoje atskir tip pavyzdiai 1

II III
Autosominis dominantis paveldjimas n m iv

o V o 2

Su X chromosoma susijs recesyvinis paveldjimas

ii

2 6 36 4

Autosominis recesyvinis paveldjimas


Pastaba. Utuuoti enklai rodo, kad asmuo turi tiriamj poym.

Genotipas

(a

3.1 5 pav. Alelini gen pasiskirstymo lytinse lstelse schema


L 100% 50% 50% 100%

r P i K la u s im a i 1. A r m o g u i galioja M e n de lio dsniai? 2. Su kokiom is p ro blem o m is tenka susidurti tiria n t m ogaus poym i paveldjim ? 3. Koks pag rind inis m on i poym i paveldjim o ty rim o m etodas? 4. Kokie duom enys reikalingi eimos g enealogijai sudaryti ir kaip jie pa teikiam i? 5. Kokie yra p ag rind iniai paveldjim o tipai? 89
P a v e ld im u m a s

U d a v in ia i 1. N upiekite eimos gen ea lo gin med. Probandas yra m ergina, kurios rank pirtai yra norm alaus ilgio. Jos tvo ir m otin o s pirtai ta ip pat n orm als.jP robando tvo sesers pirtai su tru m p j , o tvo brolio - norm als. M in to ji tvo sesuo susituok su vyru, ku rio pirtai norm als. Jiems gim usio snaus pirtai buvo kaip ir m otin o s su tru m p j . Probando senels (tvo m otin os) pirtai ta ip pat buvo trum p i, o senelio (tvo t vo) pirtai buvo norm als. Senels sesers (p ro b a n d o tvo tetos) pirtai ta ip pat buvo su tru m p j . Sutrum pjusius pirtus tu r jo ir p ro b a n d o proseneliai (tvo m otin os tvas ir m otina). Prosenelis buvo susituoks du ka rtu s^Jo antrosios m onos pirtai buvo norm als. I antrosios santuokos prosenelis susilauk dviej d u k te r su normaliais pirtais, ir keturi sn, kurie visi tu r jo sutrum pjusius pirtus. Visi prosenelio antrosios santuokos palikuoniai sukr eimas su io po ym io atvilgiu norm aliais asmenimis. Viena i prosenelio antrosios san tu oko s d u k te r pag im d tris vaikus, tu rin iu s norm alaus ilgio pirtus, dvi dukteris ir sn. Kita d u kt tu r jo berniuk su norm aliais pirtais. Vienas prosenelio snus tu r jo d ukte r, kurios pirtai buvo su trum pj. Antrasis snus susilauk dukters, tu rin io s norm alius pirtus, ir dar dviej d u k te r (id e n ti k j d vyn i ) s u tru m p ju s ia is pirtais. K itiem s dviem snums gim po vien berniuk su norm alaus ilgio pirtais. N ustatykite su tru m p ju si pirt paveldjim o tip. 2. N upiekite savo gim ins g en e a lo g in m ed (jo probandas esate js p a ts /p a ti). N ustatykite kokio nors p oym io paveldjim o savo gim inje dsningum us. Sudarykite g e n e a lo g in io m edio apra (r. 3.5 skyri). Inform acijos, kurios, js n uo m o ne , n e tu r t ino ti kiti, nepateikite.

K in ta m u m u vadinama bendra organizm savyb gyti nauj poym i, bding visiems tos paios ries individams.

v_______________________________________________________
Kisti gali visi organizm poymiai: iorins ir vidins sandaros, fiziologijos, elgsenos ir kt. Negalima rasti dviej visikai identik vienos gyvn poros palikuoni arba i to paties vaisiaus skl iaugusi vienod augal. Kadangi individai yra nevienodi, j populiacijos esti nevienalyts. Visi organizm pokyiai skirstomi j paveldimuosius ir nepaveldimuosius. N e p a v e ld im ie ji pokyiai yra modifikacijos, sukeliamos vairi aplinkos povei ki ir neperduodamos palikuoniams. Paveldim ieji pokyiai taip pat gali atsi rasti dl aplinkos poveikio, taiau jie yra perduodam i kitoms lsteli ar individ kartoms. Pagal atsiradimo pobd juos galima skirti rekombinantinius ir mutantinius. R eko m b in an tin ia i pokyiai atsiranda palikuoni kartoje vienaip ar kitaip derinantis ir kombinuojantis dviej tvini fo rm genetinei mediagai (genams bei chromosom om s). Kombinacin kintam um kaip palikuoni gene tins vairovs altin jau aptarm e I dalies 2.4.5 skyriuje. Kita paveldimj pokyi grup, viena svarbiausi evoliucijos varomj jg, yra m u tacijo s1. Dl atsitiktini prieasi atsirad paveldimi pokyiai pamau plinta ir kaupiasi populiacijose, jos nariams laisvai kryminantis tarpusavyje. Nors vien dl toki paveldim pokyi nauja populiacija atsirasti negali (o juo labiau - nauja organizm ris), jie yra svarbi mediaga atrankai ir btina evoliucini pokyi slyga. Paveldimumas ir kintam um as - tai skirtingos organizm o savybs, dl kuri palikuoniai bna ir panas, ir nepanas tvus bei protvius. Paveldimumas liudija tam tikr gyv btybi pastovum, iliekant per daugel kart, o kinta mumas - j gebjim kisti.

1.
Mutacinis kintamumas

lot. m u ta tio - pasikeitimas, permaina

Jau seniai pastebta, kad retkariais netiktai atsiranda individ, vienokiu ar kitokiu poym iu isiskiriani nuo kit savo ries individ. Tokie fe n o tip o pokyiai yra susij su g e n o tip o pokyiais. Todl i k in ta m u m o form a vadina ma m u tac in e, o atskiri pokyiai - m u tacijo m is M uta cij svok m oksle pradjo va rto ti ola nd botanikas F. de Frysas (19021903-aisiais). Jis pastebjo akivaizdius uolikus nakvios (O en othe ra ) nukrypim us nuo tipins io augalo form os. Be to, paaikjo, kad pokyiai yra paveldimi. H. de Frysas nustat pagrindines m utacij savybes. I. Pokyiai atsiranda staiga, uolikai. Pokyi turinio individo tvai j neturjo arba dalis to individo kno lsteli yra pakit naujai. 2. Mutacijos yra tiksliai apriboti pokyiai. Nesusidaro nepertraukiam kinta m um o eili, bding variaciniam kintam um ui (modifikacijoms). (Tai dar aptar sime tolesniuose ios knygos skyriuose.) 3. M utacij pagrst poymi kitim kryptis yra vairi. Taigi mutacijos gal bti ir naudingos, ir alingos. 4. Naujos mutacij form os ilieka pastovios kart sekoje. 5. Dl mutacijos pakitusiame organizme gali vykti nauja mutacija, lemiant nauj organizm o savyb (tiesiogin m utacija) arba pradins organizm o sa vybs atkrim (g rta m o ji m utacija). 6. Kadangi mutacijos vyksta labai retai, nauj mutacij daniausiai galima aptikti tik ityrus didel skaii individ.

M u ta cija laikomas tik toks genetins informacijos pokytis, kuris yra paveldi mas, t. y. perduodamas kitoms lsteli ar organizm kartoms. V_______________________________________________________________________ Be abejo, H. de Frysas savo mutacij teorijoje ne visk teisingai vertino ar numat, jei vertintum e iuolaikins genetikos mokslo poiriu. Mokslininkas man, kad mutacijos lemia tik stambius, esminius pokyius, dl kuri staiga gali susiformuoti naujos organizm rys. Be to, H. de Frysas tvirtino, kad kiekvienos ries raida susijusi su mutaciniais periodais. Taiau jis buvo ities valgus teigdamas, kad mutacijos yra vienas pagrindini evoliucijos veiksni. Pagal prigimt, pobd ir padarinius mutacijos skirstomos kelias grupes, ir tai padaryti galima vairiais bdais. Naujoms mutacijoms vardyti yra steigti tarptau tiniai mutacij nomenklatros komitetai. Taigi atradus nauj mutacij ir norint suteikti jai pavadinim (registruoti), reikia laikytis tarptautinio komiteto reikala vim. Daniausiai taikoma mutacij klasifikacija pateikta II dalies 1.1 paveiksle.

P\

K la u s im a i

1. A r visi genetins informacijos pokyiai yra mutacijos? 2. Kokios yra pagrindins mutacij savybs? 3. Kaip mutacijos klasifikuojamos? Trumpai apibdinkite pagrindinius j ti pus. 4. Kokie yra pagrindiniai genotip keiiani mutacij tipai?

93

Lem ianios DNR paaid reparacijos sutrikim us

M U TA C IJO S

Kokioje lstelje ir kokio pobdo

I I

Lytini lsteli Somatini lsteli

Tiesiogins Grtamosios

Pagal genotipo pokyius

Pagal fenotipo pokyius

Nebranduolins
(m itochondrij DNR, plastidi DNR)

Branduolins

Morfologins

Fiziologins

Biochemins

Genomo
(chrom osom skaiiaus pokyiai)

C hrom osom struktros persitvarkymai


M a k ro a n o m a lijo s
(matomos pro optin mikroskop)

Gen mutacijos

P o lip lo id ijo s
n

M ik ro a n o m a lijo s
(Nematomos pro optin mikroskop)

D idiosio s
(viso g eno ar d id e l s DNR atkarpos)

Takins

3 x-{ 4

(vienos ar keli nukleotid por)

Ikritos (delecios)

Ikritos Padvigu bjimai

A n e u p lo id ijo s
2n + 1

Vieno nukleotido pakaltos Tyliosios (polimorfizmai) Keiianios polipeptid

Skaitymo rmelio poslinkio Ikritos Intarpai

Promotoriaus Sukirpimo vietos

2n -1

Padvigubjim ai (d up likacios) A pgros (inversijos) Intarpai (insercijos) Translokacijos

Misens
(am inorgties pakaita)

Nonsens
(baigm s kodono susiform avim as)

1.1 pav. Daniausiai taikom a m utacij klasifikacija

1. 1.
M utacij vairov

M utacija gali atsirasti bet kurioje lstelje, tu rin io je DNR. Taiau jos pada riniai bus skirtingi priklausom ai nuo to, kurioje lstelje ji jvyko ir kas su ia lstele vyks toliau. Lstelse, i kuri form uojasi lytins lstels, ir paiose lytinse lstelse (t. y. generatyvinse lstelse) vykusios m utacijos daniausiai ilieka kart sekoje, t. y. tvai perduoda jas vaikams. Jei mutacija lemia poym, kuris nesu derinamas su organizmo ilikimu, tai individas us dar iki lytins brandos (danai net iki gimimo), ir tokios mutacijos savo palikuonims neperduos. Jei mutacija perduodama kitoms kartoms, tai palikuoni dalis, kurioje ji pasireik, priklausys nuo to, kok poym - dom inantin ar recesyvin lemia t mutacij turintis genas (t. y. naujas geno alelis). Mutacija, vykusi lytikai besidauginanio auktesniojo eukarioto somatinje lstelje, nebus perduodama kitoms kartoms, bet iplis tik tame audinyje, kurio lstelje jvyko i mutacija. Todl organizmai, kuriuose vyko somatins mutaci jos, daniausiai yra m ozaikiniai (r. II dalies 4.3.3 skyri), t. y. dalis organizmo turi genetikai pakitusias lsteles (tai mutavusios lstels klonas), o kita dalis normalias. Somatini lsteli mutacijos labai svarbios onkologijai. Daugelis piktybini augli daniausiai susiformuoja somatinje lstelje vykus mutacijai (r. II dalies 4.5 skyri). Antra vertus, kai kurios augalo somatinse lstelse vykusios mutacijos suteikia tam augalui vairi savybi reikaling m ogui (pvz., neprast lap ar ied form bei spalv, vaisi dyd bei skon ir pan.). Augal, turint toki m uta cij, galima padauginti vegetatyviniu bdu. Daugelis kultrini vaismedi ir dekoratyvini augal yra mutacij, vykusi somatinse lstelse, rezultatas. Todl yra dauginami tik skiepijant ar kitais vegetatyviniais bdais. Mutacijos, vykusios somatinse arba lytinse lstelse, gali bti tiesiogins ir grtamosios. Tiesioginmis vadinamos mutacijos i pradinio (laukinio) tipo j mutavus tip (mutant). Kalbdami apie mutacijas apskritai, daniausiai btent jas turim e galvoje. Grtamosiom is vadinamos tokios mutacijos, dl kuri atsi stato normalus organizmo poymis. Todl jos aptinkamos organizmuose, jau turiniuose atitinkam tiesiogin mutacij. Daniausiai tokios mutacijos vyksta genuose, ir atsistato genotipas buvs prie vykstant tiesioginei mutacijai. Jos yra bdingos mutantams - jau kart dl mutacij pakitusiems organizmams. Mutacijos vyksta retai. Gamtoje j vidutinis danumas yra apie 1 x 10"s 10~6. Tagi kiekvienoje kartoje i 100 000 alelini gen m utuoja tik vienas. Grtamo sios mutacijos ypa retos.

1 .1 .1 .
Lytini ir somatini lsteli mutacijos. Tiesiogins ir grtamosios mutacijos

1. Kuo paveldjimo poiriu skiriasi lytini ir somatini lsteli mutacijos? 2. Kokios mutacijos vadinamos tiesioginmis, o kokios - grtamosiomis? Kurios j yra danesns ir kodl?

1 .1 . 2 .
G enotip keiianios mutacijos
1.1.2 .1.
Genomo mutacijos
Genotip keiianios mutacijos gali vykti branduolyje arba kituose lstels organoiduose, turiniuose DNR arba RNR (mitochondrijose, plastidse). Su branduoliu susij trys pagrindiniai m utacij tipai: genom o, chrom osom ir gen mutacijos.

jG e n o m o m u tac ijo s yra tokios m utacijos, dl kuri pakinta ch ro m o som skaiius. Kisti gali visas viengubasis ch ro m o som rinkinys (n) (d a u g ti kar to tin kart skaii - p o lip lo id ija ) arba tik vienos chro m o som os skaiius (.a n e u p lo id ija ). P o lip lo id ija yra k a rto tin is v ie n g u b j c h ro m o s o m rin k in i skaiiaus p a d id jim a s (3 n, 4 n, 6 n ir pan.). Ji danesn a u g a l karalystje. D a u g e
lis m o g u i n a u d in g k u lt r in i g r d in i bei k ito k i a u g a l yra p o lip lo id in ia i: bulvs - te tr a p lo id in s (4 n), kvieiai - h e k s a p lo id in ia i (6 n) ir t. t.

G yvn poliploidija yra reta ir bdinga tik kai kuriom s uv, kirm li ir vabz di rims. Yra du pagrindiniai poliploid tipai: 1) autopoliploidai - kai tos paios augal ries chromosom rinkini skaiius pakinta dl lstels dalijimosi sutrikim arba dl somatini lsteli susiliejimo; 2) alopoliploidai - gaunantys savo chromosom rinkinius i skirting ri augal tolimosios hibridizacijos metodais. Poliploidai gali atsirasti ir natraliai, kai sutrikus mejozei visos lstelje esanios chromosomos nukeliauja j vien lstels poli, suformuodamos lytin lstel, turini dvigubjj chromosom rinkin (2n). Jei apvaisinimo metu ji susilies su normalia lytine lstele, turinia viengubj chromosom rinkin (n), zigota gis trigubj chro mosom rinkin (3n). Tai pats daniausias atvejis. Poliploidizacij galima sukelti ir dirbtiniu bdu, naudojant vairias chemines me diagas. Daniausiai tam taikomas kolchicinas, kuris blokuoja verpsts sil forma vimsi besidalijanioje lstelje. Todl chromosomos nenukeliauja j prieingus lstels polius, ir susiformuoja tetraploidins (4n) lstels. Nors kai kurios augal poliploidins mutacijos yra naudingos monms, taiau tokios mutacijos, vykusios mogaus organizme, yra alingos. Aneuploidija yra pavieni chromosom skaiiaus kitimas. Normalioje soma tinje lstelje kiekvienoje homologini chromosom poroje yra po dvi chromoso mas. is skaiius gali kisti abiem kryptimis - ir mati (2n - 1), ir didti (2n + 1). Aneuploidijos daniausiai atsiranda formuojantis lytinms lstelms. Jei lytinje lstelje vietoj vienos homologins chromosomos yra dvi, tai po apvaisinimo zigo toje bus jau trys homologins chromosomos. Toks atvejis vadinamas trisomija. Trisomijos daniausiai atsiranda todl, kad lstels pirmojo mejozinio dalijimosi anafazje vienos poros homologins chromosomos neatsiskiria ir abi patenka vien lstel. Reiau chromosomos neatsiskiria per antrj lstels mejozin daliji msi, seserinms chromatidms atsiskiriant vienai nuo kitos. Sutrikus seserini chromatidi atsiskyrimui viena lstel po antrojo mejozinio dalijimosi gauna dvi chromosomas (susidariusias i seserini chromatidi), o kita - negauna n vie nos. ie homologini chromosom arba seserini chromatidi neatsiskyrimo vykstant mejozei rezultatai pavaizduoti 1.2 pav. Paveiksle matom homologini chromosom atsiskyrimo klaidas per pirmjj mejozin dalijimsi nulemia tai, kad viena lstel gauna dvi homologins chromosomas (disomija, n + 1), o antroji n vienos ios poros homologins chromosomos (nulisomija, n - 1). Po antrojo mejozinio pasidalijimo dvi lytins lstels yra disomins, o kitos dvi - nulisomins (1.2 pav., B). Nors normaliai visos keturios turt bti monosomins (n) (1.2 pav., A).

1.2 pav. Vienos hom ologins poros chrom osom neatsiskyrimas form uo ja ntis gam etom s ir jo padariniai. A - norm ali mejoz; B - chrom osom neatsiskyrimas per pirm j mejozin dalijimsi; C - chrom osom neatsiskyrimas per antrj mejozin dalijimsi
Normalios monosomins gametos Apvaisinimas normalia gameta (n) Disomins gametos Nulisomins gametos . . NuliDBomine somjn gameta gameta Normalios m onosom jn^ gametos

Pirmasis mejozinis dalijimasis

Antrasis mejozinis dalijimasis

Galimos zigotos

2n
( 100 % )

\
2r>+1
(50%)

(D
2n-1
(50%)

\l

\ l

2n + 1 2n-1
(25%)


2/1
(50%)

(25%)

Normalus kariotipas

/ Aneuploidijos:
trisomija (2n+1) monosomija (2n-1)

Normalus kariotipas

Jas apvaisinus normaliomis monosominmis lytinmis lstelmis gali susidaryti 50 % zigot, turini po tris homologines chromosomas. Likusios 50 % zigot turs tik po vien homologin chromosom i tos chromosom poros. Seserini chromatidi neatsiskyrimo per antrj mejozin lsteli dalijimsi pa dariniai skiriasi nuo prie tai nagrintj. Pirma - galima tiktis, kad 50 % lytini lsteli (t. y. dvi gametos) bus normalios monosomins (1.2 pav., C). Antra - tik viena gameta gauna dvi vienos i dviej homologini chromosom kopijas, ir tik viena yra nulisomin. Naujausi tyrimai rodo, kad dauguma trisomini vaik papil dom chromosom (autosom) yra paveldj i savo motin. Seserins chromatids gali neatsiskirti ir vykstant mitozei bet kuriame organiz mo raidos tarpsnyje, tokiu bdu duodamos akstin aneuploidini lsteli klonams atsirasti ir slygodamos organizmo mozaikikum (apie mozaikikum skaitykite II dalies 4.3.3 skyriuje). Kaip jau buvo minta, vienos homologines chromosomos stygius zigotoje vadi namas monosomija. Kaip ir trisomija, monosomija atsiranda todl, kad chro mosomos per mejozin lstels dalijimsi neatsiskiria (tai gerai matyti 1.2 paveikslo B ir C dalyje), kai susidaro nulisomins gametos. Po apvaisinimo normalia lytine lstele tokios gametos turs tik po vien homologines poros chromosom. moni ligos, susijusios su chromosom skaiiaus kitimu, bus aptartos II dalies 4.1 skyriuje. Chromosom aneuploidija aptikta ir augal, ir gyvn pasaulyje. Daniausiai jos poveikis organizmui yra neigiamas.

1. Kas yra genom o mutacijos ir kaip jos skirstomos? 2. Kas yra poliploidija ir kokie jos ypatumai? 3. Kas yra aneuploidija ir kokie jos ypatumai?

1 .1 .2 .2 .

Chromosom mutacijos

Chromosom mutacijomis vadinami vairs chromosom struktriniai persitvar kymai: ikritos, padvigubjimai, apgros, intarpai, translokacijos ir kt. Pro optin mikroskop galima matyti chromosom struktros pokyius, jei jie apima didesn nei 4 milijon nukleotid por fragment (pvz., > 4 000 kb ikrita). Taigi kiekviena chromosom mutacija apima daugiau kaip vien gen, nes patys didiausi ge nai retai bna didesni nei 1 milijonas nukleotid por. Apie tokio fragm ento praradim arba atsiradim sprendiama pagal chromosom ruoelius - ar kurio nors trksta, ar vienu per daug. Vidutinis chromosomos ruoelis apima nuo 1 iki 10 M b DNR.

1.3 pav. Chromosomos fra gm e nto ikritos susidarymo schema

5 Trki> vietos ->


v

g +t

46,XX,del(16)(q13;q22)
1.4 pav. Moters kariotipas, kuriam e nustatyta 16-osios chrom osom os ilgojo peties (q) 1 3 -2 2 -o jo segmento ikrita. Kairje - kariotipas, deinje - 16-osios chrom osom poros ideogram a

-- -------1.

P
X cen

Kariotipas, kuriame yra chromosom pertvarka, bet ben dras genetins informacijos kiekis yra nepakits, vadinamas sub alansu o tu . Kariotipas, kuriame genetins informacijos kiekis yra pakits (trksta kurios nors chromosom os dalies arba yra kurios nors chrom osom os dalies papildom os kopi jos), vadinamas nesubalan su o tu . .________________________________________________________________________ > Visi chromosom struktros persitvarkymai susidaro jvykus

Vm/
Xcen 9

I
M

chromosom trkiams. Ikrita (delecija) - tai chromosomos dalies praradimas. Dl jos susidaro dvigubojo kariotipo prarastojo chromosomos fragm ento monosomija. Daniausiai ikritos, sudaranios apie 2 % viengubojo chromosom rinkinio (n), yra nesuderina

I X p22.3

1.5 pav. Moters kariotipas, kuriame raudona spalva paymtos X chromosomos centromeros (X cen). Kitas raudonas takas chromosomoje ymi X chromosomos tru m p o jo peties (p) 22.3 segment (Xp22.3) (r. Normal kariotip I dalies 2.5 pav.), kuriame yra steroidins sulfatazs genas. Kadangi yra tik vienas vieiantis takas, ymintis Xp22.3, antroji X chromosoma ios genetins srities neturi

mos su gyvybe. Chromosomos dalis gali ikristi bet kurioje chromosomos vietoje - ir gale, ir per vidur. Tokiai mutacijai atsirasti reikia dviej vykusi chromosomos trki. Ikritus fragm entui likusios chromosomos dalys turi vl susijungti. Tokia chromosoma yra trumpesn u normali. Ikrits fragmentas daniausiai pametamas. Schemoje (1.3 pav.) pavaizduota ikrita susiformavo ilgajame chromosomos petyje arti centrometros. 1.4 paveiksle pateiktas mo ters kariotipas, kuriame nustatyta 16-osios chromosomos ilgojo peties segmen to ikrita. Greta pateiktose atitinkam chromosom ideogramose matyti, kad i normalios 16-osios chromosomos ikrits vienas tamsus ruoas, kuris gerai matomas pro optin mikroskop. iandienins citogenetikos (mokslo apie chro mosomas) metodais jau bandoma nustatyti ir ikritas, nematomas pro paprast optin mikroskop. Molekuliniais citogenetiniais tyrim metodais, naudojant specialius genetinius ymeklius, chromosomoje galima paymti atskir ge n, kuris pro liuminescentin mikroskop matomas kaip vieiantis spalvotas takas chromosomoje. Jei chromosomos fragmentas, kuriame yra is genas, yra prarastas, tai vieianio tako nematysime. 1.5 paveiksle pateiktame mo ters kariotipe nustatyta, kad trksta tam tikro geno (steroidins sulfatazs geno). Padvigubjim as (duplikacija) yra chromosom mutacija, kai kuris nors chromosomos segmentas padvigubja, patrigubja ir pan. (1.6 pav.). Kartais tokie pasikartojantys chromosomos segmentai yra isidst paeiliui - vienas paskui kit. Pro optin mikroskop matomas padvigubjimas apima bent kele t gen. Jei normalios vienos homologins poros chromosomos yra vienodo ilgio, tai pateiktajame pavyzdyje viena chromosoma bus normalaus dydio (itai galima vertinti suskaiiavus tamsius ir viesius chromosomos ruous), o kita - pailgjusi tam tikru fragmentu, kuris pasikartoja ilgajame chromosomos petyje (1.6 pav. tok chromosomos fragm ent sudaro vienas didesnis tamsus ruoas, vienas maesnis tamsus ruoas bei tarp j esantys viess ruoai). Apgra (inversija) yra chromosom mutacija, kai kuris nors chromosomos segmentas apsiveria (t. y. apsisuka 180 kampu; 1.7 pav.). 1.7 paveiksle pa vaizduotas apsisuks palyginti nedidelis chromosomos ilgojo peties segmen tas. Apgrai atsirasti btinai turi vykti du chromosomos trkiai, kaip ir ikritai atsirasti, tik fragmentas tarp trki ne pametamas, o apsisuks vl susijungia su kitomis dviem chromosomos dalimis. Apgra gali jvykti tik kuriame nors chromosomos petyje arba apimti ir centromer. 1.8 paveiksle pateiktas karioti pas, kuriame nustatyta 10-osios chromosomos ilgojo peties fragm ento apgr a. Ji apima labai didel segment: beveik vis ios chromosomos ilgj pet nuo q 1 1.23 segmento iki q 26.3 segmento (r. ideogramas 1.8 pav. deinje, p. 98). Akivaizdu, kad dl apgros gen skaiius 10-ojoje chromosomoje nepakito, taiau pasikeit gen seka. Chromosomos trkiai gali vykti tarp gen, taiau bent vienas trkis gali atsirasti ir geno viduje, taip nutraukdamas jo raik.

Chromosomos fra gm e n to nuoseklaus padvigubjim o schema

Chromosomos fra gm e nto apgros susidarymo schema

1.8 pav. Vyro kariotipas, kuriame nustatyta 10-osios chromosomos ilgojo peties fragm ento apgra, apim anti beveik vis ios chromosomos ilgj pet nuo q 11.23 segmento iki q 26.3 segmento. Kairje kariotipas, deinje - 10-osios chromosom poros ideogramos

98

Daniausiai apgros n e tu ri poveikio o rg an izm o funkcijom s, taiau gali kilti nesklandum h o m o log in m s chrom osom om s susiglaudiant mejozs I profazje. Jei per i c h ro m o som pertvark b t p ertrau ktas svarbus genas, padariniai org an izm u i b t labai skauds. T ra n s lo k a c ijo m is vadinam os to kios ch ro m o som m utacijos, kai vykus trkiams pasikeiia segmento vieta toje paioje chromosomoje, segmentas per sikelia i vienos homologins chromosomos kit ioms apsikeiiant segmen tais, arba persikelia i vienos nehomologins chromosomos kit nehomologin chromosom, pastarosioms apsikeiiant segmentais (1.9 pav.). 1.9 paveiksle pavaizduotas apsikeitimas segmentais ta rp 4-osios chromosom os ilgojo peties ir 20-osios chromosom os ilgojo peties. Apie pakitusi chromosomos struktr sprendiama i jos ilgio, o kokiomis dalimis apsikeista, parodo ruouotumas. 1.10 paveiksle m atom e, kaip atrodo normalios ir translokuotos nehom olo gins 5-oji ir 8-oji vyrikojo kariotipo chromosomos. iuo atveju didelis 5-osios chromosomos ilgojo peties segmentas sukeistas su mau 8-osios chromoso mos tru m p o jo peties segmentu. Nors pasikeit atitinkam chrom osom dy dis, taiau bendras genetins mediagos kiekis tokioje lstelje nepakito. Taigi kariotipas yra subalansuotas. Daniausiai tokie chrom osom persitvarkymai individo fenotipe nepasireikia. Taiau jei trkio vieta yra veiklaus geno viduje, fenotipas gali pakisti.

Truki vietos 20-oji chrom osom a

S usijungim o vietos

'
Translokuota 4-oji chrom osom a Translokuota 20-oji chrom osom a

4-oji chrom osom a

1.9 pav. Chromosomos fra g m e n to translokacijos susidarymo schema

5-oji chromosoma
1.10 pav. V yro kariotipas, kuriam e nustatyta subalansuota translokacija ta rp 5-osios ir 8-osios chrom osom os (kairje). Deinje a titin k a m chrom osom ideogram os

8-oji chromosoma

1.11 pav. mogaus akrocentrins chromosomos, dalyvaujanios Robertsono translokacijose: viruje - ideogramos, apaioje m etafazins chrom osom os

Dl vykusios translokacijos homologins chromosomos per mejoz negali sudaryti nor mali bivalent, nes vykstant pirmajam mejoziniam dalijimuisi gali susiglausti tik tos chro mosom poros dalys, kuriose yra homologin DNR seka, o nehomologins dalys lieka lais vos. Per pirmj mejozin dalijimsi toliau vyks ta nt homologini chromosom atsiskyrimui jos gali neatsiskirti arba atsiskirti nevisikai, todl galiausiai lytinse lstelse (gametose) susidaro nesubalansuotas chromosom rin kinys. Tokioms gametoms susiliejus per ap vaisinim, naujos lstels (zigotos) chromo som rinkinys taip pat bus nesubalansuotas ir lems nepageidautinus i tokios zigotos su siformavusio individo fenotipo pokyius. inoma dar viena labai specifin chromosom translokacij ris. Tai vadinamo sios akrocentrini chromosom (1.11 pav.) Robertsono translokacijos (1.12 pav.). Chromosom trkiams vykus dviej akrocentrini chromosom trumpuosiuose peiuose ar net centromeroje, i chromosom ilgj pei, susijungusi per centromeras, susidaro viena nauja chromosoma, o trumpieji peiai prarandami.

99
K in ta m u m a s

chromosoma
1.12 pav.

chromosoma

chromosoma

Vyro kariotipas, kuriame ta rp 13-osios ir 14-osios chrom osom os nustatyta Robertsono translokacija (kairje). Nors i viso yra 46 chromosomos, iuo atveju i tik r j yra 13-osios chrom osom os trisom ija. Deinje - atitin kam chrom osom ideogram os

iuo m etu genetikams jau inomi ir daugelis kitoki struktrini chrom o som persitvarkym. Tyrjo arba gydytojo genetiko tikslas yra juos aptikti, nustatyti chromosomas, kurios dalyvavo struktrinse pakaitose, vertinti to ki persitvarkym reikm organizm o raidai.

1. Kas yra chrom osom mutacijos ir kokie pagrindiniai j tipai? 2. Kaip susidaro pagrindins chrom osom mutacijos? 3. Koks kariotipas yra subalansuotas ir koks - nesubalansuotas? 4. Kokie yra subalansuoto kariotipo pokyio padariniai j turiniam individui ir pastarojo palikuonims?

1 . 1. 2 . 3 .
Gen mutacijos
Gen m utacijom is vadinamos pavieni gen mutacijos. Nemaa dalis geno pokyi tip a titin k a ch ro m o som m utacijas (pvz., ikritos, intarpai). Esmi nis skirtum as yra pokyio dydis. C hrom osom m utacijos daniausiai nusta to m o s s te b in t pro o p tin m ikroskop ir apim a kelis ar net kelis im tus ir t kstanius gen. Kalbdam i apie gen mutacijas, jas suvokiam e kaip nukle o tid sekos pokyius v ie n o g e n o ribose. ias m utacijas galim a a p tik ti kry m in im o m etodais arba iuolaikiniais m olekulins genetikos m etodais. Tarp j p a m in tin i ir a u to m a tin is DNR n u kle o tid sekos nustatym as bei vadinam ieji g e n o m o lustai (arba genetins m ikroschem os) dau ge lio gen n u k le o tid sekai n u sta tyti. Sparti DNR te ch n o lo g ijo s paanga leido supras ti DNR n u kle o tid sek lygmens takini m uta cij p rig im t ir apim tis. A ntra vertus, c ito g e n e tin ia i (chrom oso m ty rim o ) m etodai ta ip pat labai ito buljo ir, kaip jau buvo m inta, leidia n u sta tyti ar apskritai atskiroje metafazinje ch ro m o so m o je yra ta m tikras genas, ar jo nra. Gen m utacijos bna vairi tip . J susidarymo m echanizm ai ta ip pat vairuoja. ios m utacijos gali veikti inform acijos nuraym nuo DNR RNR, iRNR brendim , baltym o sintez, susintetinto baltym o struktros ir funkcij pokyius. Galiausiai per daugel ta rp ini proces geno m utacijos paveikia ir organizm o fe n o tip . Gen m utacij analiz pradkim e nuo didiausi DNR nukleotid sekos pokyi ir laipsnikai pereikime prie maesni. Didiosios gen mutacijos, apimanios iki 4 m ilijon nukleotid por, yra dideli geno fra g m e n t , itiso geno ar net keli nedideli gen ikritos, padvigubjim ai ir intarpai, o maosios - takins m utacijos - susijusios tik su vienu ar keliais nukleotidais. Visuose organizmuose vykstanios gen mutacijos yra panaios. M ao s io m s (takin m s) gen m utacijom s priskiriamos vieno nukleotido pakaitos ir vieno ar keli nukleotid intarpai arba ikritos. 1. V ie n o n u k le o tid o p a k aito s yra daugelio paveldimj lig prieastis. Jos gali bti keli tip . Pagal tai, kaip vieno n u kleo tido pakaitos pakeiia kod o n , jos gali bti m/sens1 m utacijos, nonsens2 m utacijos ir tyliosios3 mutacijos.

vadintina keiianija m utaci ja, nes jai vykstant pakinta aminorgtis vadintina stabdanija m u ta cija, nes sukuria baigms kodonus vadintina nekeiianija muta cija, nes jai vykstant aminorgtis nepakinta

Aminorgtis:
1.13 pav. Hemoglobino P grandin koduojanio (3 globino geno 17-ojo nukleotido pakaita 6-ajame kodone nustatoma sergant pjautuvine anemija

(ThrXProXGiuXGIu).
ACT CCT GAG GAG .
4 5 6 7 .

Kodonas: Kodono Nr.: Kodonas: Aminorgtis:

normalaus hemoglobino P grandins genas S hemoglobino p grandins genas

ACT CCT GTG GAG . (T h ? X P ra X ^ D @ )'

1.14 pav. CFTR geno 1609 nu kleotido pakaita C -> T, sufo rm u ojanti baigms kodon (STOP)

DNR:
1609

Polipeptidas:

494

nukleotidas

-> CAG I TAG

Gln < I
STOP

aminorgtis

Dl m is e n s mutacij pakitus nukleotidui pasikeiia ir kodonas. Jis ima ko duoti jau kitos aminorgties terpim polipeptidin grandin. Taip baltyme viena aminorgtis pakeiiama kita aminorgtimi. Pokyio padarinius apspren dia polipeptido vieta, kurioje pakaita vyko, ir taka baltymo erdvinei struktrai, kuri galiausiai ir lemia nauj baltymo funkcij. Pjautuvins anemijos atveju he m oglobino P grandin koduojanio p globino geno 17-ojo nukleotido pakaita (A nukleotido pakeitimas T nukleotidu) pakeiia 6-osios polipeptidins gran dins aminorgties g lutam o rgt koduojant kodon GAG valin koduojaniu kodonu GTG (1.13 pav.).

Q
GCG G<~A (GCA) A I T GCT

1.15 pav. Alanin koduojanio GCA kod ono 3-iojo nukle otido pakaitos am inorgties nekeiia

Dl n o n s e n s mutacij kodonas, koduojantis kuri nors aminorgtj, pakeitus jame vien nukleotid, virsta bepras miu, t. y. nekoduojaniu jokios aminorgties arba baigms A^C GCC kodonu. Ribosomai prijus toki iRNR molekuls viet, baltymo sintez sustoja. Tokie kodonai yra trys (r. I dalies 1.5 skyri ir 1.15 pav.): TAA, TAG ir TGA. Suprantama, kuo ariau geno 5' galo susiformuoja baigms kodonas, tu o tru m pesn polipeptidin grandin susintetinama. Toks sutrumpjs baltymas daniausiai jau nebegali atlikti savo funkcijos. Pavyzdys galt bti CFTR geno mutacijos, lemianios sunki pavel dimj lig - cistin fibroz. Pats CFTR genas yra labai didelis ir turi 27 egzonus, apimanius daugiau nei 6 000 nukleotidu por, kurie koduoja 1 480 aminorgi polipeptidin grandin. Daugeliui serganij ia liga nustatoma 1 609 nukleotido pakaita C -> T, pakeiianti glutam o kodon CAG stop kodonu TAG (1.14 pav.). Todl baltymas, sintetinamas toki pacient organizme, yra sudary tas tik i 493 aminorgi vietoj 1 480, taigi madaug trigubai trumpesnis u normal. Toks baltymas nebeatlieka savo funkcijos, todl pasireikia cistin fibroz, nuo kurios pacientas daniausiai mirta dar vaikystje. Tyliosios takins mutacijos taip pat yra nukleotidu pakaitos. Joms vykstant daniausiai pakeiiamas treiasis kodono nukleotidas. Taiau dl to, kad genetinis kodas yra isigims, koduojama polipeptidins grandins aminorgtis lieka nepa kitusi (r. I dalies genetinio kodo lentel 1.15 pav.). Pavyzdiui, net trys GCA kodono treiojo nukleotido pakaitos nepakeiia koduojamos aminorgties alanino (1.15 pav.). Normali geno nukleotidu seka

11
K in ta m u m a s

> .A C T T C C GAG GAG AAG...

Normali koduojamo ^ polipeptido / aminorgi seka


1.16 pav. Skaitymo rmelio poslinkis geno nu kleotidu sekoje vyksta siterpus vienam papildom am nukleotidui

.. <Jh^<sgKG kjXGluXLysi..

i
ACT TC C G AG G AG AAG...
*

Itra C naps
Pakitusi geno nukleotidu seka ------->

ACTTCC . .(ThrXSer.; A r ^ X ^ ly > ^ lu >

N a u ja s s k a it y m o r m e lis - S e n a s s k a ity m o r m e lis

Pakitusi koduojamo polipeptido ' aminorgi seka

2. Skaitym o rm elio poslinkio mutacijos. Skaitymo rmelis daniausiai pasislenka dl takini mutacij. Taiau ne dl nukleotido pakaitos, bet dl to, kad vykus vieno ar keli nukleotid ikritai ar intarpui pasikeiia kodon skaity mo tvarka. Inagrinkime, kas atsitiks geno nukleotid sek siterpus vienam papildomam nukleotidui (1.16 pav., p. 101). Matyti, kad DNR nukleotid sekos skaitymo rmelis pasislenka atgal per vien nukleotid. Todl pakinta visa to lesn ios DNR sekos koduojamo polipeptido aminorgi seka. Taigi baltymo savybs stipriai pasikeiia arba genas apskritai tampa neveiklus. siterpus dviem nukleotidams rmelis pasislinks atgal per du nukleotidus, o padariniai bus tokie pat kaip ir siterpus vienam nukleotidui. Jei vienas ar keli nukleotidai ne siterpia DNR nukleotid sek, bet ikrenta ijos, skaitymo rmelis pasislenka taip pat kaip ir intarpo atveju, tik prieing pus (1.17 pav.). Dl intarpo arba ikritos pasislinkus skaitymo rmeliui naujoje kodon sekoje danai susidaro naujas baigms kodonas, ties kuriuo sustoja polipeptidins gran dins sintez. Tada imamas sintetinti trumpesnis polipeptidas (1.18 pav.). Taigi skaitym o rm elio poslinkio m utacij padariniai gali bti labai vairs.

1.17 pav. Skaitymo rm elio poslinkis i geno nukle otid sekos ikritus vienam nukleotidui

Normali geno nukleotid seka

- ... A C T T C A G A G G A G AAG CCC.

Normali k o d u o j a m o .. , Thr . Ser . Gkj x G,u . Lys > Pro ... polipeptido i aminorgi seka Ikrita G Pakitusi geno nukleotid seka ...A C T T C A G A G G A G AAG CCC...
V

i ACTTCA ... Thr X Ser * Arg Y rg X 'S o r)...


N a u ja s s k a it y m o r m e lis S e n a s s k a ity m o r m e lis

Pakitusi koduojamo polipeptido aminorgi seka

1.18 pav. Dl inta rp o arba ikritos pasislinkus skaitym o rmeliui naujoje kodon sekoje danai susidaro naujas baigms kodonas (STOP)

3. Geno promotoriaus mutacijos. Pagal nukleotid sekos pokyius ios mu tacijos bna vairios: kaip antai nukleotid pakaitos, ikritos, intarpai. Taiau jos keiia ne aminorgi sek baltymo molekulje, bet geno veiklos reguliavim, pakeisdamos nuraymo (tuo paiu ir baltymo sintezs) intensyvum. Promoto riaus mutacijos daniausiai silpnina jo sveik su RNR polimeraze. Dl to sumaja iRNR sintez, taigi maiau susintetinama ir galutinio jos produkto - baltymo. Be promotoriaus, mutacijos gali paveikti ir kitas u geno veikim atsakingas DNR nukleotid sekas (reguliavimo sekas, stiprintuvus, slopintuvus ir 1.1.).

Normali geno nukleotid seka

------ >

...A C T TCA G AG G AG AAG.. ... Thr - Ser Glu Glu X Lys .. i

... ACT TCA GAG GAG AAG C C C . Thr * Ser Glu XGlu Lys ' Pro >. I B . Ikrita

Normali koduojamo polipeptido aminorgi seka

A. Intarpas
... ACT TCAV GAG G AG AA G ... Pakitusi geno nukleotid seka: a S T ' ^ - * Sutrumpjs ------------ polipeptidas ...E a a a * 8 A * a .. ... <fhrX S e r)

... ACTTCA GAG GAG AAG CCC.. I ... ACT TAG AG G AG AAG CCC.

.T h r ^ E ]

4. iRNR s u k irp im o m u tac ijo s . Tikslus pre-iRNR m olekuls sukirpim as reikalingas norm aliai g en o raikai, kadangi intro na i tu ri b ti ikerpam i vie no n u k le o tid o tikslu m u . M utacijos j proces gali s u trikd yti. Kaip jau m inta I dalies 1.5 skyriuje, kritins vietos iRNR sukirpim ui iidsiusios ta rp egzon ir in tro n : in tro n o 5' gale - GT, o 3 ' gale - AG. M u ta cij, pakeiiani ias n u k le o tid sekas, padariniai bna labai vairs: kaip antai p e rs k a ito m a " in tro n o n u k le o tid seka (todl atsiranda p apildom os a m in o r g tys p o lip e p tid e ), o to je sekoje gali b ti ir baigm s kodonas; ikerpamas gretim as egzonas ir dl to p o lipe ptid as praranda atitinka m a s am ino rg tis ir t. t. Be to , to kios iRNR m olekuls daniausiai nra stabilios ir lstelje labai g re itai suardom os. Todl veiklus baltym as nesintetinam as. Kartais m utacijos sukuria naujas iRNR su kirpim o vietas, ir iRNR sukerpa ma netaisyklingai. Todl b altym inis a titin k a m o geno p ro du ktas bna nevi savertis. Tokios m utacijos gana danos. Kartais dl i m uta cij baltym as jgyja naujas biologines funkcijas. Tai yra ne maiau pavojinga nei visikas veiklum o praradim as, ir daniausiai lemia a utosom ines d om in an tikai pa veldim as ligas. 5. P a sikarto jan i j t rin u k le o tid sek isipltim o m utacijos dar va dinam os dinam inm is m utacijom is. Geriausiai itirtos to k io tip o m utacijos yra susijusios su sunkiom is m oni neurodegeneracinm is ligomis, todl jas analizuosime II dalies 4.3 skyriuje.

1. Kas yra gen m utacijos? Kuo jos panaios ch ro m o som m utacijas ir kuo nuo j skiriasi? 2. Kokie yra vieno n u k le o tid o pakaitos tipai? Kaip vieno n u k le o tid o pakai ta gali paveikti ind ivid o fe n o tip ? Pateikite pavyzdi. 3. Kas yra skaitym o rm elio m utacijos ir kokie galim i j padariniai? 4. A r takin m utacija, vykusi p o lip e p tid o n eko du ojan ioje DNR m ole kuls dalyje, gali paveikti gen o veikl? Atsakym pagrskite.

4 . 1. 3 .
M utacijos pagal fe n o tip o pokyius
Mutacijos skirstomos pagal tai, koks poymis - morfologinis, fiziologinis ar biocheminis - dl j pakito. Lengviausia pastebti m orfologini mutacij pasireikim. Tai skeleto ar kit m orfologini savybi pokyiai. Geriausiai inomos tos morfologins mutacijos, kurios kart sekoje paveldimos kaip autosominis dominantinis poymis. Tokie mogaus poymiai yra polidaktilija (vietoj normalaus pirt skaiiaus yra vienu daugiau), achondroplazija (labai sutrumpj galns - r. 1.19 pav.) ir kt. Pagal j (daniausiai lig) dan galima sprsti apie konkreios populiacijos mutacij danj. Tokios ligos, kaip jau minta, yra autosomines ir paveldimos dom inan tikai. Akivaizdu, kad kai kurios j bus paveldtos i ankstesni kart. Taiau nauj ligos atvej eimoje, kurioje anksiau ja serganij nebuvo, prieastis yra nauja mutacija. Stebdami populiacij (antai Lietuvoje registruodami ir kasmet suskaiiuodami, kiek gim naujagimi, sergani autosominmis dominantinmis ligomis, kuri tvai buvo sveiki ir kiek per t laik i viso gim naujagimi) galime vertinti kasmetin mutacij dan ir sprsti, ar konkreioje populiacijoje mutacij daugja, ar maja. Fiziologins mutacijos labiau bdingos augalams. Tai gali bti paveldimi vegeta cijos arba ydjimo trukms, apsivaisinimo, mediag transportavimo organizme pokyiai. Antai gerai inomas kukurz mutantas tinginys", atsirandantis, kai su trinka augal augimo hormono heteroauksino pasiskirstymas. Toki kukurz yra pakitusi geotropin reakcija: jie liauia ems paviriumi, o ne auga vertikaliai. Biochemins mutacijos. G. Bydlis ir E. Teitumas pirmieji pasil taikyti bio cheminius mutantus biocheminiams organizmo procesams tirti. Pirmiausia tai buvo atlikta su vaisini museli mutantais, kuri akys viesiai raudonos, kadangi dl mutacijos yra blokuojama rudo pigmento sintez.

1.19 pav. Naujagimis, kuriam nustatyta achondroplazija. Bdingas poymis - labai sutrumpjusios galns

Pastebtina, kad A. Garodas dar 1902-aisiais suprato, kad paveldimoji moni liga alkaptonurija atsiranda todl, kad fermentas hom ogentizo rgties oksi daz, atsakingas u hom ogentizo rgties apykait, yra neveiklus.

m
H om og e n tizo rgtis yra tarpinis aminorgi fenilalanino ir tirozino apykaitos

produktas (1.20 pav.). Dl io fermento stokos homogentizo rgtis gausiai iskiria ma su lapimu, kuris kiek pastovjs stipriai patamsja (todl ir pati liga anksiau buvo vadinama juodojo lapimo liga). Sutrikus homogentizo rgties apykaitai, jos produktai kaupiasi jungiamajame audinyje, formuojasi snari pakitimai, patamsja oda. 1996-aisiais - buvo klonuotas alkaptonurij lemiantis genas ir nustatyta jo pir min struktra.

Dabar jau inoma, kad beveik visus gyvj organizm mediag apykaitos bio cheminius procesus katalizuoja fermentai. Ferment aktyvumo jvairavimas yra pras tas reikinys. Taiau kratutins tokios vairovs reikms (ypa silpna arba ypa aktyvi veikla) lemia tam tikr paveldimj mediag apykaitos lig isivystym.
1.20 pav. Fenilalanino ir tiro zin o apykaitos schema. A, B, ir C ingsni blokavimas dl atitin kam us ferm entus koduojani gen mutacij sukelia nurodytas mediag apykaitos ligas

Tam tikr mediag apykaitos sutrikim lemia konkretaus ferm ento nevisavertikumas. Fermentai yra baltymai, tad j funkcijai svarbi erdvin struktra priklauso nuo polipeptidins grandins aminorgi sekos, kuri koduoja atitinkamas genas. Todl ir ferm ento veiklos pokyi prieastis pirmiausia reikia sieti su jo geno pokyiais. XX amiaus pabaigoje buvo inoma daugiau nei 350 vairi mogaus mediag apykaitos sutrikim, susijusi su per mau tam tikr ferment aktyvumu.

Fenilketonurija

Kelias, kai A ingsnis blokuotas

Tiroksinas Organizmo \
(skydliauks horm onas)

Alkaptonurija

Adrenalinas Juodieji ir rudieji melaninai


(odos, aki, plauk pigm entai)

Geltonieji ir raudonieji melaninai


(odos, aki, plauk pigm entai)

(antinksi horm onas)

Gen mutacij (ir kai kuri chromosom mutacij) atsiradimo prieastis yra

DNR paaid reparacijos sistem gen mutacijos

DNR paaidos. Mutacij dl DNR molekuls paaid atsiradimas yra sudtin gas procesas. Pati DNR paaida yra dar ne mutacija, tik potenciali prielaida mutacijai susiformuoti. Taigi DNR paaidos, kurios gali ta pti mutacijomis, vadi namos potencialiom is. J virtimas mutacija gali tru k ti kelis lstels ciklus. Potencialios DNR paaidos tampa mutacijomis dvigubjant DNR, vykstant re kombinacijai, p aaid itaisymui ir vadinamajai reparacijai.

D
DNR p i r p r c j a a d eaaia
DNR paaidos gali bti labai vairios: cheminiai bazi pokyiai, bazs praradi mas, gretim pirimidin (daniausiai T) sukibimas, netinkamo nukleotido terpimas komplimentarij (papildanij) grandin per DNR sintez, vienos ir abiej DNR molekuls grandini trkiai. Dauguma organizm turi pakankamai sistem vairioms DNR paaidoms paalinti, t. y. reparacijos sistem Be to, ios sistemos dirba taip, kad, je i pro vien j paaidai pavyko prasmukti" neitaisytai, j aptikti ir itaisyti turt kita sistema. Paprasiausias bdas paalinti DNR paaid yra atstatyti vieno ar daugiau pakitu si nukleotid pirmin pavidal. Tai daniausiai atliekama ikerpant paeistas purin ar pirimidin bazes. Akivaizdu, kad is procesas nra paprastas. I pradi paaida turi bti atpainta, vliau paalinta, o DNR grandins dalis, kurioje buvo paaida, suardyta. Pagal ilikus sveik papildantj DNR fragment vyksta papildoma (t. y. nesusijusi su DNR dvigubjimu) DNR sintez. Jai vykstant suardyta DNR grandin atstatoma be paaid. Per paskutinj etap susidar DNR grandins trkiai paali nami, t. y. naujas susintetintas DNR grandins segmentas sujungiamas su visa DNR grandine. Vis proces atlieka sudtingas reparacinis kompleksas. inomi vairs DNR reparacijos bdai. iame procese dalyvaujaniame reparaciniame komplekse svarbiausi vaidmen atlieka skirtingi fermentai, kuri sintez kontroliuoja vairs nealeliniai genai. DNR paaid reparacijos sistemos tokios galingos, kad paaid - taigi ir mutacij i viso neturt likti. Deja, taip nra. Tyrimais nustatyta, kad kai kuri paaid iliki mas yra genetikai uprogramuotas. O kakurie reparacijos tipai specialiai daro klaidas, ir DNR paaidos itaisomos tik tiek, kad nesutrikt organizmo gyvybingumas. Taip galiausiai susiformuoja m utacija

1.21 pav. Berniukas, sergantis pigm enti ne kseroderma. Bdingi ioriniai poymiai: daugyb veido odos pigm entin i dm i ir aizdeli, an t smakro piktybinis odos auglys (vys)

Yra inoma daugelis gen, kontroliuo jani DNR reparacijos procesus vairiuose organizmuose. vykus kurio nors geno mu tacijai, DNR paaid taisymas sutrinka. Su reparacijos sutrikimais susijs organizmo senjimas ir piktybini augli susiformavi mas. DNR reparacijos sutrikimai bdingi ir kai kuriom s paveldimosioms m oni li goms: pigmentinei kserodermai, Fankonio maakraujystei, Lui-Baro sindromui, tam tik roms storosios arnos vio formoms. P ig m e n tin k s e ro d e rm a (1.21 pav.) yra sunki odos liga, kuri gali ta p ti pacien to mirties prieastimi. Ja sergantiems net 1 000 kart did odos pokyiai taps piktybiniu odos viu. Bent 8-i nealelini gen, ko ntroliuo jan i 8-i DNR reparacijos fe rm e n t sintez, m utacijos gali bti pigm entins kserodermos prieastis. Serganij ia liga lstels ypa jau trio s ultravioleti niams spinduliam s, jon iz u o ja n ia ja i s p in d u liu o te i bei vairiem s chem iniam s m u ta g e n a m s (j poveikis a pta ria m a s II dalies 1.2.1 ir 1.2.2 skyriuose).

Dl ultravioletini spinduli poveikio sukibusias gretim as DNR molekuls pirim idin bazes aptinka ir paalina DNR paaid reparacijos sistema. Jai sutri kus padidja lsteli jautrum as iems m utageniniam s veiksniams, kadangi sukib bazs nebepaalinamos ir sukelia mutacijas. Oda yra kno paviriuje, taigi jos lsteles labiausiai veikia sauls spinduliai, ypa drabui neudeng tuose plotuose. Pirmiausia nukenia veidas. Todl tokie asmenys tu ri vengti tiesiogini sauls spinduli (ir jokiu bdu nesikaitinti papldim yje arba solia riume). Daniausiai sergantieji pig m e ntin e kseroderma mirta nuo vio ne sulauk n 20-ties. Pastebtina, kad ia kalbama apie dviej tip mutacijas. Reparacijos fe rm e n t mutacijos g en e raty vin se lstelse gali bti perduodam os vaikams. Antra vertus, dl i mutacij sintetinami nevisaveriai DNR reparacijos ferm entai, nevisikai itaisantys lsteli DNR paaidas. Tokios neitaisytos paaidos som atinse (odos ir kitose negeneratyvinse) lstelse virsta vairi gen mutacijomis, dl kuri ios lstels tam pa vio lstelmis. Taiau ios mutaci jos jau nra perduodam os kitoms individ kartoms.

1. Kas yra DNR paaida ir kuo ji skiriasi nuo mutacijos? 2. Kas lstelje itaiso DNR paaidas? A r visos paaidos itaisomos? 3. Kaip gali sutrikti DNR paaid itaisymo mechanizmas ir kokie gali bti io sutrikim o padariniai?

1. 2 .
Natraliomis slygomis pavienio geno mutacijos vyksta labai retai: jos susi

Mutacij atsiradimo danumas ir prieastys

form avim o per vien lstels dalijimsi tikim yb tesiekia 1,5 x 1 0 '6- 1 ,5 x 10-8. Taiau organizm o genomas turi keliasdeimt tkstani gen, o lsteli da niausiai kur kas daugiau. Todl bendras organizme vykstani mutacij skai ius tikrai nemaas. Antra vertus, organizm o palikuonims perduodamos tik mutacijos, vykusios lstelse, i kuri form uojasi gametos. Be to, daniausiai tik labai maa dalis susiformavusi organizmo gamet dalyvauja formuojantis naujoms zigotoms ir perduoda joms savo genus (taigi ir juose jau esanias paveld tas, ir naujai vykusias mutacijas). Nustatyta, kad apie 5 % vis vaisins musels gamet turi koki nors mutacij, o kiekvienas mogus yra net arti 10-ties muta vusi gen (lemiani sunki recesyviai paveldim lig) neiotojas. Be abejo, kiekviena mutacija turi savo prieast. Taiau konkreiu atveju ios prieastys daniausiai lieka neinomos. M utacij atsiradimo procesas vadina mas m u ta g e n e ze . Pagal tai, kaip vyksta m utagenez (natraliai, be aktyvaus mogaus sikiimo ar mogaus smoningai sukeliama), mutacijas galima skirstyti g am tin e s ir dirbtines. Ir vienos, ir kitos daniausiai atsiranda dl t pai m u ta g e n poveikio. M utagenais vadinami veiksniai, sukeliantys mutacijas. Daniausiai tai jonizuojanioji spinduliuot, kiti fiziniai veiksniai (pvz., aukta tem peratra), vairios chemins mediagos, virusai, bakterijos. M utagenai vei kia organizm bet kuriuo jo raidos m om entu - pradedant gameta ir baigiant suaugusiu organizmu.

1. Koks nauj mutacij atsiradimo danumas? 2. Kas yra mutagenez ir kokie veiksniai j sukelia?

1 . 2 .1 .
M utageninis jonizuojaniosios spinduliuots1 poveikis
M uta ge nin jonizuojaniosios spinduliuots poveik 1927-aisiais rod JAV genetikas H. J. Maleris. M utacijas sukelia vis ri jonizuojanioji spindu liuot (Rentgeno spinduliai, y spinduliai, neutronai, a ir (3 dalels). Ji gali sukelti ir paveldimuosius, ir nepaveldimuosius organizm o pokyius. Nepaveldim j pakitim dl jonizuojaniosios spinduliuots poveikio pavyzdiai yra pup ir irni margalapikumas, varpini jav stieb akojimasis ir pan. Jonizuojanioji spinduliuot ta ip pat sukelia m oni spindulin lig, kuri isi vysto dl nepaveldim j ir paveldimj pokyi. Jonizuojaniosios spindu liuots poveikis akivaizdiausiai pasireik po atom ini bom b sprogim vir Japonijos miest Hirosimos ir Nagasakio 1945-j rugpjio mnes ir 1986-j balandj vykus ernobylio (Ukraina) atom ins elektrins avarijai, kurios sukeltas aplinkos radiacinis utertumas daugel kart virijo sukeltj sprogus atom inm s b om bom s Hirosimoje ir Nagasakyje. Japonijoje dar ir dabar mons mirta dl atom ini sprogim spinduliuots poveikio, o erno bylio elektrins avarijos sukeltas aplinkos radiacinis utertumas turs takos dar daugelio m oni kart sveikatai ne tik Ukrainoje. Reikia skirti b e n d r j ir m u ta g e n in jonizuojaniosios spinduliuots po veik organizm ui. Maos jonizuojanij spinduli dozs organizm veikia stim uliuojam ai. Ilgesnis j poveikis netgi padidina organizm atsparum iai spinduliuotei. Didels dozs paeidia vairias organizm o sistemas. Kuo didesn doz - tu o didesni paeidimai. Taiau jei spinduliuots doz pada lijama dalis su pertraukomis tarp j, alingas poveikis bna kur kas maesnis. M u ta g e n in is jonizuo ja nio sio s spin du liu ots poveikis tiesiog proporcingas j dozei ir neturi slenksio: m utacijos prieastis gali bti net vienintelis kvantas. Mutageninis jonizuojaniosios spinduliuots poveikis vairus ir danai suke lia skirtingus chrom osom pokyius: paviens chrom osom os gali sulipti, sutrkinti, gali vykti lsteli poliploidizacija ir 1.1. Be to, gali vykti ir vairios takins gen mutacijos. Tyrimais rodyta, kad veikiant jonizuojanija spin duliuote galima gauti organizmus (m utantus), kurie turi m ogui nauding savybi. Todl jonizuojanioji spinduliuot buvo plaiai taikoma selekcijai ive d an t naujas kviei veisles ir m ikroorganizm us, gam inanius antibiotikus. Dabar ie m etodai pakeisti naujais gen technologijos metodais, kurie kur kas Veiksmingesni ir saugesni.

1. Kokias inote jonizuojaniosios spinduliuots ris? 2. Kuo mutageninis jonizuojaniosios spinduliuots poveikis skiriasi nuo ben drojo? 3. Ar jonizuojaniosios spinduliuots sukeltos mutacijos yra paveldimos?

1. 2 . 2 .
Chemin mutagenez
'spinduliuote, kuriai sveikau jant su mediaga arba terpe suku riami elektronai ir vairiariai jonai. Radiacinje saugoje - spinduliuot, galinti sukurti jo n poras biolo ginse mediagose arba terpse. Regimoji viesa ir ultravioletin spinduliuot neeina jonizuojan iosios spinduliuots svok._____

1932 1934-aisiaik buvo ro dyta, kad vaisini museli m utacijas galima sukelti ir c h e m in m ^ m ediagom is: jodu, sunkij m etal druskom is, a m o niaku, m etilchlorantrenu. Taiau chem ini m ediag m utagenikum as buvo pripaintas tik 1 9 4 3 - 1 948-aisiais, atradus ypa m utagenikus jun gin iu s, p a v a d in tu s s u p e r m u t a g e n a is . iuo m e tu ja u yra in o m a d e im ty s t k sta ni chem ini m uta ge n , kurie tip o lo g iz u o ja m i pagal chem in ir bio login poveik.

CD

Pagrindins chem ini m u ta g e n grups

7. Alkilinanios rediagos (t. y. mediagos, prijungianios alkilo grupes prie organini mediag molekuli). Tai patys stipriausi mutagenai (supermutagenai). \ 2. Peroksidai, susibarantys organizme vykstant mediag apykaitai. 3. Antim etabolitai\ tarp j - purino ir pirimidino bazi analogai (kofeinas, teofilinas, 2-aminopurinas ir t. t.). 4. Alkaloidai ir glikpzidai. 5. Akridinai. \ 6. Hidroksilaminai. 7. Sunkij metal druskos. 8. Aldehidai. 9. Pesticidai ir t. t. S*?1 Cheminiams m utagenam s, kaip ir jonizuojaniajai spinduliuotei, bdingas stim uliuojantis ma kohcentracij poveikis, m aksim um o reikinys (pasie kus tam tikr poveikio m aksim um toliau d id in a n t doz m utacij skaiius nebedidja), padidjs atspar'tnpas m utagenui organizm ilg laik veikiant maomis jo dozmis, didelis vairi chem ini ju n g in i specifikumas, pri klausomyb nuo vairi aplinkos ir vidini veiksni ir kt. Kaip ir jonizuojanioji spinduliuot, chemlrriai m utagenai genetin me diag gali veikti tiesiogiai ir netiesiogiai. Tiek jonizuojaniosios spinduliuots, tie k ir chem ini jun gin i m utageninis poveikis buvo rodytas eksperim entais paveikiant vairius organizm us m uta ge nu ir g a u na nt konkreias vairi tip mutacijas. Visus organizmus, ta rp j ir m og, n uo la t veikia aplinka, kurioje gausu vairi m utagen (pradedant jonizuojanija sauls spinduliuote ir baigiant vaistais bei kai kuriais maisto priedais). Be to, gam tinm is slygomis pasi reikia ir silpni m utagenai. Tai vairs m ediag apykaitos produktai, susi kaup organizm e neprastais kiekiais. m og ir kitus organizm us pastoviai veikia natralusis fonas, atsirandantis dl sauls spinduliuots, dl atom inio ginklo bandym atmosferoje, atom ini elektrini avarij ir kt. Organizmams, kuri gyvenim o tru km tru m p a , silpnas natralusis fonas daug m utacij nespja sukelti. Taiau organizm ai, gyvuojantys 1 000 ir daugiau m et (pvz., m am utm ediai arba sekvojos), per savo gyvavimo laikotarp gauna palyginti didel doz. Buvo pastebta, kad g a m tini m utacij danum as taip pat didja organiz mui senstant.

108

1. Kokius ino te chem inius m utagenus? 2. Kas bdinga chem ini m u ta g e n poveikiui?

1. 2 . 3 .
Aplinkos m utagenai
Genetik udavinys yra iaikinti aplinkos mutagenus ir pasilyti priemones, kaip nuo j apsisaugoti, t. y. apsaugoti mogaus bei kit organizm gen fond. Gamtin genetin kintam um daugiausia ir lemia g a m tin ia i m u tag e n a i, kurie buvo aptarti I dalies 1.2 skyriuje. Kita aplinkos m utagen grup yra dirb tin ia i m utagenai, nebdingi organizmui. Pltojant pramon, naudojant naftos produktus ir akmens angl energijai gaminti, ems kyje naudojant mineralines tras ir vairias chemines mediagas kovai su kenkjais bei pikto lmis, lig gydymui taikant naujus susintetintus vaistus, buityje - sintetinius skalbiklius, valiklius ir 1.1., aplink patenka vis daugiau teral, kuri daugelis turi toksini, mutagenini ar teratogenini savybi. vairi chem ini m ediag m utagenikum tiria m okslo aka g e n o to k s ik o lo g ija .

Aplinkos m utagenai gali bti lokals arba globals. Lokals m utagenai yra paplit tik konkreioje vietoje arba atskiroje populiacijoje. Globals m utagenai paplit po vis em. Pavyzdiui, atmosferoje ibandius atom inj ginkl arba vykus atomins elektrins katastrofai, radioaktyvus lietus ikrinta net u tkstan i kilom etr nuo sprogim o vietos. Daugelis atmosferos teral ardo em gaubiant ozono sluoksn, apsau gant nuo m utagenikj ultravioletini Sauls spinduli. Taigi jei nebus imtasi priemoni, gresia globalin katastrofa. Aplinkos m utagenai gali kauptis organizme. Ypa link kauptis tie m utage nai, kurie organizm o neperdirbami nekenksmingus junginius. Tai sunkij m etal jonai, daugelis pesticid. Antai heksachloranas lieka pavojingas net perjs kelis organizmus. Jis per bulvi gum bus ar paarines oles patenka gyvuli organizm, o per j ms ar pieno produktus - ir ms organizmus. ios mediagos ilgainiui kaupiasi organizme ir gali sudaryti mutagenikai pa vojing doz. Tokio pobdio m utagenai ypa pavojingi. M utagenikumas ga li bti specifinis tam tikrai organizm riai, t. y. konkreti mediaga vienos ries gyvnams yra mutagenas, o kitoms - ne. Todl sprsti, kas m ogui gali bti mutagenikai pavojinga, o kas nepavojinga, vadovaujantis tik kit gyvn tyrimais, nra paprasta. Yra kuriamos vadinamosios testo sistemos vairi che mini mediag m utagenikum ui tirti. Taiau jos nra tobulos ir ne visada parodo real t mediag poveik ir pavoj, gresiant m ogui. Pastebtina, kad n e t ir n em uta ge n iko s m ediagos v y k s ta n t o rg a n izm o m e d ia g apykaitai gali ta p ti m u ta g e n in ia is p ro d u kta is . Tai v a d ina m ie ji n e tie s io g in ia i m u t a g e n a i. Be to , b tin a a tsivelgti s in e rg in 1, ja u tr i n an t ir k o m u ta g e n in aplinkos m u ta g e n poveik. Sinerginis poveikis gali pasireikti tu o paiu m etu veikiant dviem ir dau giau m utagen, kai j bendras poveikis yra didesnis nei atskir m utagen poveiki suma. Akivaizdu, kad aplinkoje yra daug vairi m utagen, ir dau gelis j veikia organizm b te n t tu o pat metu. Esama duom en, kad nuo kurio nors nem uta ge n in io veiksnio organizmas gali pasidaryti jautresnis tam tikram m utagenui. Taigi m uta ge no poveikis gerokai padidja. A n ta i kepant ms, o ypa jai apdegus, i am inorgties trip to fa n o susidaro vairs mutageniniai junginiai, tarp j ir norgarmanas, ku ris pats nebdamas mutagenas net 40 kart padidina kancerogeno 4-dimetilam inobenzolio mutagenikum. Tai ja u trin a n tis poveikis. Kartais paviens chemins mediagos mutagenikumu nepasiymi, taiau pa naudotos kartu tampa mutagenais. Tai kom utagenikum as. Taigi labai svarbu nuodugniai itirti vairi chemini mediag (ypa naujai susintetint) poveik m ogui, nes visuomet esama pavojaus, kad dl jautrinan io arba kom utageninio efekto nem utagenins mediagos gali virsti stipriais mutagenais. Deja, tai nustatyti nra paprasta. Kiekvieno mogaus pareiga stengtis, kad jo aplinkoje bt kuo maiau m utagenini mediag, ir vengti galim kontakt su mutageniniais veiksniais. iek tiek nirok vaizd praskaidrina tai, kad 1949-aisiais buvo atrastos me diagos, slopinanios mutagen poveik. Jos buvo pavadintos antim utagenais. Taigi nors m utagen poveikio organizmui visikai ivengti, matyt, nepavyks nie kada, j galima suvelninti taikant antimutagenus. Organizme taip pat esama specifini antim utagen. Universalus antimutagenas yra gliutationas. Jo paskir tis lstelje yra sujungti bei inaktyvinti organizmui svetimas ir kenksmingas me diagas. Joms sveikaujant su gliutationu susidaro merkapturin rgtis, kuri i induoli organizmo paalinama su lapimu. 109
K in ta m u m a s

Sinerga (gr. synergia - bend ras veikimas) - sveika, vienalai kis poveikis.

1. Kokius inote g a m tinius m uta ge nu s ir j altinius? 2. Kokie yra d irb tin i m u ta g e n altiniai? 3. Kok poveik vadinam e sinerginiu, ja u trin a n iu , ko m u ta g e n in iu ? Kokius inote to k io p oveikio pavyzdius?

Modifikacinis kintamumas

O rganizm o fe n o tip pagrindia jo g en o tip o bei aplinkos sveika. Organiz mo gen ir genotipo raika i esms priklauso nuo aplinkos slyg. Kintamumo forma, susijusi su fenotipo pokyiu, vadinama modifikaciniu k in tam u m u , o m od ifikacijo s yra nepaveldimieji organizm o organ, poym i ir savybi po kyiai dl a p lin ko s poveikio. Taiau kaip ir paveldimj kintm um , m o d ifi kacijas taip pat lemia genotipas.

g.1.
Reakcijos norma ir statistiniai modifikacinio kintam um o dsningumai

jvairi poym i m o d ifik a c in io k in ta m u m o ribos esant skirtin go n gom s gali vairuoti. Poymio m o d ifik a c in io k in ta m u m o ribos v a d in a i, ^ poym io re akcijo s n o rm a . Vien p oym i reakcijos norm a yra labai plati, kit - daug siauresn. A n ta i karvs p ieningum as tiesiogiai priklauso ne tik nuo jos konkretaus g e n o tip o , bet ir nuo rimo bei prieiros. Pieningum galima gerokai p ad id inti p aren kan t reikiam geros kokybs paar kiekj. s id m tin a ta i, kad o rg a n iz m o m o d ifika cin is k in ta m u m a s fiks u o ja m a s b te n t tam tik ro poym io, kur lemia tas pats genotipas, atvilgiu (sk irtin gai eriamos vien od o g e n o tip o karvs duos skirtin g pieno kiekj). Maesnis kintam um as bdingas pieno riebum ui. Jis labiau priklauso nuo karvi veisls, t. y. nuo g e n o tip o io poym io atvilgiu. Keiiant paar racion pieno riebum as kinta nedaug. S kirting ri org an izm m o d ifika c in io k in ta m u m o atsakas j t patj ap linkos veiksn gali vairuoti. Pavyzdiui, I dalies 3.4.1 skyriuje jau m inta, kad Him alaj triu io lstels em oje te m p e ra t ro je pradeda sin te tin ti m e lanin, ta m sin a n t kail. O kai kuri kit gyvn (b a lto jo kikio, erm uonlio ir kt.) lstelse esant emai te m p e ra t ra i m elanino sintez slopinam a, kad iem kailis b t baltas ir nepastebim as a n t sniego. Kai kada net to paties o rg a n iz m o s k irtin g o s dalys s k irtin g o m is slygom is labai p a kin ta (pvz., vdryn ir papliauk lapai po vandeniu bna visai kitokie nei augantys vir vandens). M o d ifika cijo s daniausiai bna trum p alaik s ir pasireikia to je kartoje, kurioje veikia jas sukeliantis veiksnys. Jei kitose kartose jis nebeveikia, m o difikacija inyksta. Taiau inom os ir ilgalaiks m odifikacijos, iliekanios kitoje kartoje, o kartais n e t keliose kartose. A n ta i labai palankiom is slygo mis augani augal derlius bus geras ne tik tais paiais metais, bet ir kit m e t, nes augalai, iaug i palankiom is slygom is b ra n d in t augal skl, bus derlingesni u iaugusius i skl, su bran dint prastesnmis sly gom is. Taip yra to d l, kad p alankiom is slygom is b ra n d in t augal sklos bna stambesns, jose sukaupta daugiau n au ding m ediag. T pat galima pasakyti ir apie m ones. Daugel j poym i (g, inte lekt, odos spalv ir k t.) lemia poligenai (r. I dalies 3.4.1 skyri). Taiau i poym i raika priklauso ir nuo aplinkos slyg: esant ta m paiam ge n o tip u i, bet skirtin g o m s aplinkos slygom s susiform uos skirtin g i fe no tip a i. Kiekvieno p oym io m o d ifika cin io k in ta m u m o ribos yra skirtin go s (skirtinga reakcijos norm a). ia prasme paveldimas ne pats poymis, bet o rg an izm o (tiksliau, jo g e n o tip o ) gebjim as sveikaujant su raidos slygom is su kurti ta m tikr fe n o tip . Taigi konkretaus g e n o tip o individas gali gyti tik tam tikras poym io reikmes, kurios (priklausom ai nuo aplinkos slyg) gali svy ru o ti ta m tikrose ribose. Genotipas apibria ribas, o aplinka lemia konkre i poym io reikm. Plati reakcijos norm a nat ra lio m is slygom is gali b ti svarbi biologins ries ilikim ui ir suklestjim ui.

M odifikacinio k in ta m u m o statistiniai dsningum ai

Nuskinkime nuo vieno medio visus lapus ir imatuokim e j ilg. Pamatysi me, kad lap ilgio vairavimo ribos gana plaios. i lap genotipas vienodas (visi jie to paties augalo), taiau skiriasi slygos, kuriomis jie augo ant skirting ak. Nuskintus lapus idlioj pagal ilg nuo maiausio iki didiausio arba atvirkiai, gautum e io poymio kintam um o eil, vadinam variacine eile, nes j sudaro atskiri variantai. Taigi v aria n ta s yra poymio raidos pasireikimo vienetas. Suskaiiavus, kiek buvo vairi ilgi lap, pastebsime, kad jie pasi skirst nevienodai: vieno ilgio lap bus daugiau, kito - maiau. Daniausi bus vidutinio ilgio lapai, t. y. viduriniai variacins eils nariai, o abu kratutiniai nariai (ilgiausi ir trum piausi lapai) bus reiausi. Inagrinkime kit variacinio kintam um o pavyzd - kviei varpos varpeli skaiiaus kitim atskirose varpose. Tyrimams imkime genetikai vienodus gry naveislius augalus. Tarkime, kad ios veisls varpeli skaiius varpose svyruoja nuo 14 iki 20. Toliau vertinkime, kaip danai pasikartoja atskiri variacins eils variantai. Atsitiktiniu bdu surinkime 1 000 varp ir nustatykime, po kiek var peli yra kiekvienoje j. Tarkime, kad daniausios buvo varpos, turinios po 1 6 -1 8 varpeli. Varpos, turinios daugiau kaip 18 arba maiau kaip 16 varpe li, buvo retesns. Jos pasiskirst taip:

Eils variantai - varpeli skaiius varpoje Varianto pasikartojimas - varp skaiius

14 20

15 70

16 220

17 320

18 240

19 80

20 50

Sudj apatins eiluts skaiius gausime 1 000. Tai atitinka stebjim (analizuo jam varp) skaii. i variant pasiskirstym galima pateikti grafikai (2.1 pav.). Poymio kintamumo grafin iraika, atspindinti ir variacijos umoj, ir atskir va riant pasikartojimo danj, vadinama variacine kreive. Jeigu bandym bt atlikta daugiau, kreiv vis labiau artt prie varpo formos, t. y. is pasiskirstymas i matematikos kurso inomas kaip mintasis normalusis pasiskirstymas, t. y. pasiskirstymas pagal Gauso dsn. Kuo vienodesns raidos slygos, tu o silpniau ireiktas modifikacinis kinta mumas ir tu o trum pesn variacine eil. Ir atvirkiai, kuo aplinkos slygos vairesns, tu o platesnis modifikacinis kintamumas. N orint objektyviai vertinti kintamj poym, nepakanka itirti vien arba kelis individus. Tik ityrus didel skaii individ galima nubrti variacin kreiv.

2.1 pav. Kviei varp su skirtingu varpeli skaiiumi pasiskirstymas

Remiantis variacins eils duomenimis, galima nustatyti poymio vidutin dyd ne tik i variacins kreivs, bet ir taikant form ul S ty P ,)

M yra vidutinis dydis; v. - i-tasis variantas; p. - /-tojo varianto pasikartojim skaiius; n - bendras variacins eils nari skaiius; X - sandaug pagal kiek vien variant suma. Apskaiiuokime ms nagrinjamos variacins eils kviei varpeli skaiiaus varpoje vidurk: Z ( v . P ' ) - 14 20 + 15 70 + 16 220 + 17 320 + 18 240 + 19 80 + 20 x x 5 0 - 17 130. Bendras variacins eils variant skaiius n ia yra 1 000. Taigi variacins eils vidurkis M = 17 130 : 1 000 = 17,13. Tok rezultat matm e i variacins kreivs grafinio vaizdo (2.1 pav.) - da niausios buvo varpos, turinios 17 varpeli. Kadangi varpeli skaiius gali bti tik sveikasis (varpel arba yra, arba jos nra) tai ir apskaiiuotas vidutinis skai ius M = 17.

L 2 H K la u s im a i
1. Kas yra modifikacinis kintam um as ir modifikacijos? 2. Kas yra reakcijos norma? Nuo ko ji priklauso? 3. A r m ogui bdingas modifikacinis kintamumas? Atsakym pagrskite pa vyzdiais. 4. Koks ryys ta rp paveldjimo ir konkretaus kiekybinio poymio pasireiki mo? 5. Kas yra variantas, variacine eil ir variacine kreiv?

M odifikacijos daniausiai yra atitinkantys aplinkos poveik prisitaikomojo pobdio pakitimai reakcijos normos ribose. Pavyzdiui, jei m ogus treniruo

Teratologiniai reikiniai

jasi - stiprja jo raumenys, jei pastoviai prausiasi po altu duu - padidja jo atsparumas aliui. Bna ir kitokio pobdio modifikacij. Gali gim ti individai su dviem galvo mis, penkiomis galnmis vietoj keturi ir t. t. Tai te r a to lo g in ia i1 reikiniai. Jie dar vadinami gim tosiom is raidos a no m a lijo m is 2, nes pastarosios susi form uoja em briono ar vaisiaus stadijoje, ir naujagimis gimsta jau turdamas vien ar kit anomalij. ias anomalijas tiesiogiai arba netiesiogiai slygoja te ra to g e n a i. Tai veiksniai, galintys sukelti pastovius organizm o struktros ar funkcijos pokyius per embriogenez arba vaisiaus raidos laikotarpiu. Teratogeninis poveikis bdingas vairiems aplinkos veiksniams. Kaip antai kai kuriems vaistams, narkotikams, kitoms cheminms mediagoms. Tok poveik gali sukelti ir kenksmingos darbo slygos. Teratogenai pavojingiausi kritiniais em briogenezs arba vaisiaus raidos periodais. B tent tu o jie ir skiriasi nuo m u ta g e n in io poveikio. M uta ge na i sukelia atskiros lytins arba som atins lstels m utacij. Teratogenai m u ta cij nesukelia, taiau s u trik d o e m b rio n o (tai jau organizm as) ar vaisiaus norm ali raid. inom a, kai gim s kdikis tu ri koki nors raidos anom alij, jo eimai visai nebesvarbu, ar jos prieastis yra m uta ge nin is, ar teratogeninis poveikis. Taiau iais dviem atvejais visikai skirtinga tos anom alijos p a sikarto jim o eim oje p ro gn oz (r. to lia u). A n tra vertus, dera atsivelgti

gr. teras/-tos - apsigimimas, logos - mokslas Anom alija (gr. anomalia - ne lygumas) - nukrypimas, netaisy klingumas, nenormalumas.

tai, kad te ra to g e n in is poveikis fo rm u o ja si konkretaus g e n o tip o fo n e 3. m ogaus em brionas jautriausias te ra to g e n poveikiui nuo antrosios iki deim tosios ntu m o savaits. iuo laiko tarpiu fo rm u o ja si daugelis organ ir o rg a n izm o s tru k t r . Kiekviena m ogaus o rg a n izm o s tru kt ra ar org a nas tu ri savo jau tria usi (k ritin ) te ra to g e n poveikiui period (r. 2.2 pav.).

3 t.

y. veikiami genotipo

SltJ'riH Implrtltloi l|N, Ijnm n lnn

Vnlulim Gimimas

Ioriniai lyties organai

C entrin nerv sistem a


I I I I

S tuburas ir nervinis vam zdelis

R ankos Kojos A u sys


I

Akys
i

I
2.2 pav. m ogaus e m brion o vairi organ ir sistem form avim osi periodai, kritiniai teratogen poveikiui. Skaiiais viruje paymtos savaits po apvaisinimo. Mlynai paymti konkrei organ ir sistem form avim osi periodai, ypa jautrs teratog en poveikiui; geltonai paym ti maesnio ja u tru m o periodai

Dantys
I Nra teratogeninio poveikio

G om urys V irkin am asis traktas ir arnyn as


I

Viskas arba nieko

Inkstai ir lapim o traktas


!

Ioriniai lyties organai


I I

Praradimas iki implantacijos

Didiosios morfologins anomalijos

Funkcij sutrikimai ir nedidels morfologins anomalijos


K in ta m u m a s

M an om a, kad per pirmsias dvi savaites po apvaisinimo te ra to ge n poveikis vaisiaus raidai yra viskas arba nieko": j sukeltas pokytis arba visikai itaiso mas, arba lemia e m briono uvim. Po deimtosios ntum o savaits, kai daugelis e m b rio no stru kt r jau susiformav, te ra to ge n poveikis maiau pavojingas. Taiau dl jo gali sumati vaisiaus kno mas, susiform uoti centrins nerv sistemos anomalijos. Daniausiai te ra to ge nin io poveikio pa darinys yra daugins raidos anomalijos, t. y. vaikui gimus nustatom as ne vienas izoliuotas apsigimimas, bet daug ir vairi apsigim im . E ksp erim e ntuo ja n t su gyvnais ro d y ta , kad ja u tru m te ra to ge nin ia m s veiksniams gali lem ti individo gen otip as (ir m otin os, ir e m b rio n o arba vai siaus). M a d a u g 10 % vis g im t j n a u ja g im i raidos a n o m a lij yra t e r a to g e n in io p o v e ik io p a d a rin ia i. 1 9 5 8 - 1 962-aisiais Vakar Europoje buvo populiars ram inam ieji vaistai talid om ida s. ituos vaistus ypa pam go niosios, nes j va rto da m os pa sijusdavo daug geriau. 1961 -aisiai buvo rodytas ryys ta rp ta lid o m id o var to jim o ntu m o pradioje ir nau ja gim i galni ano m a lij (2.3 pav.).' Per tru m p laiko tarp gim daugiau nei 10 000 kdiki su vadinam osiom is ta lid o m id in m is e m b rio p a tijo m is. Talidom idinei e m b rio p a tija i bdinga tai, kad galns neturi ilgj kaul (galns panaios pelekus), nustatom os vairios irdies, aus, inkst, virkinam ojo tra k to anom alijos, g o m u rio nesuaugimas. A p ie 40 % to k i vaik m irta dar kdikystje. Kiti - sunks invalidai - integruojasi visuom en ir patys sprendia savas problem as.

2.3 pav. Kdikis, kuriam nustatyta talidom idin em briopatija. Bdingi ioriniai poymiai: stipriai paeistos galns (j visai nra arba jos labai tru m po s ir prim ena uvies pelekus)

Detaliai isiaikinus, kada ir kaip is vaistas buvo vartojam as, paaikjo, kad jo poveikiui kritinis e m b rio n o periodas yra nuo 20-osios iki 35-osios dienos po apvaisinim o. N enuostabu, kad po tokios katastrofos su ta lid o m id u imta labiau dom tis te ra to ge nin ia is veiksniais. iuo m etu skiriam os keturios pagrindins terato g e n in i veiksni grups: 1) vaistai ir chem ins m ediagos, v a rto to s per ntum ; 2) m otin o s infekcijos per ntum; 3) fizini veiksni poveikis niajai; 4) ltins m otin o s ligos. ro dyta, kad te ra to g e n in poveik tikrai tu ri ta m tikri veiksniai (r. 2.1 lentel). Visas te ra to g e n in i veiksni sraas tu r t b ti labai ilgas. Be to , jis n u o la t pap ild om as. Tokius sraus galim a rasti specialiuose inynuose. Pateiktieji pavyzdiai tik paliudija, kad m o tin o s (o kartais ir t v o ) k o n ta k tas su te ra to g e n a is iki vaisiaus u uo m a zgo s (danai ir vaisiaus raidos lai k o ta rp iu ) gali b ti sunki g im t j vaiko raidos a n o m a lij prieastis. Taip pa t svarbu suprasti, kad te ra to g e n a i ypa pavo jin gi niajai kritin iais (jautriaisiais) e m b rio g e n e z s ar vaisiaus raidos la iko ta rp ia is (2.2 pav.).

2.4 pav. Berniukas, kuriam nustaty tas alkoholinis fetalinis sindromas. Bdingi poymiai: dubusi nosies nugarl, ukrit aki vokai, bulvs form os nosis, plona virutin lpa, protinis atsilikimas, gim tosios irdies ydos

CD
2.1 lentel.

K ik r etka t r t g n n a v i s i i a u i iri e a o e i i i e k n a
Poveikis fenotipui

Veiksnys

A. M o tin os infekcins ligos p e r ntum ir j poveikis Virusai

Citomegalovirusas Pslelins (Herpes simplex) virusas Raudonuks virusas mogaus imunodeficito virusas (IV)
Bakterijos

Kurtumas, mikrocefalija (maagalvyst) Mikrocefalija Mikrocefalija, kataraktos, gimtosios irdies ydos Mikrocefalija ir kdikio mirtis

Sifilio sukljas
P arazitai

Smegen vanden ir kitos gimtosios ligos Smegen vanden, mikrocefalija, kataraktos, kurtumas ir kt.

Toksoplazmozs sukljas

B. Vaistai ir chemins mediagos, m otinos v a rto ti p e r ntum

Alkoholis Chlorokvinas Dietilstilbestrolis Liio druskos Fenitoinas Retinoidai Strptomicinas Tetraciklinas Talidomidas Valproin rgtis Varfarinas Kokainas

irdies ydos, mikrocefalija ir kt., alkoholinis fetalinis sindromas (2.4 pav.) Kurtumas ir kt. Gimdos anomalijos, lytini organ piktybiniai augliai gimtosios irdies ydos gimtosios irdies anomalijos, lpos ir gomu rio nesuaugimai Aus ir aki anomalijos, smegen vanden Kurtumas Dant emalio defektai r. aukiau (2.3 pav.) Nervinio vamzdelio defektai Nosies anomalijos ir kt. Placentos plyiai ir gimtosios vaisiaus raidos anomalijos

Taigi nepagrstas vaist vartojimas, piktnaudiavimas alkoholiu ar narkotikais, kontaktas su buityje naudojam om is ar kitomis chem inm is m ediagomis, turiniom is te ratogenikum o poym i, jonizuojaniosios spinduliuots po veikis, kai kurios infekcins ir ltins m otinos ligos ypa pavojingos ir nepa geidaujam os ntum o laikotarpiu, o kritiniais e m b rio no ir vaisiaus raidos laikotarpiais - ju o labiau. Jei to kio konta kto ivengti nepavyksta, geriausia pasikonsultuoti su gydytoju genetiku.

r
1. 2. 3. 4.

A r visos modifikacijos bna reakcijos normos ribose? Kas yra teratogenai? Kaip ir kada jie veikia organizm? Kuo teratogen poveikis skiriasi nuo m utagen poveikio? Kada mogaus embrionas jautriausias teratogen poveikiui ir kodl?

K in ta m u m a s

3
Nauji genetinio kintamumo altiniai: tikslingas genetins informacijos keitimas

Dar visai neseniai net nemanom a buvo sivaizduoti, kad ateis diena, kai galsime ne tik analizuoti vairi organizm (tarp j ir mogaus) genus, bet ir m anipuliuoti jais. ioje srityje daugiausia nuveik biotechnologijos ir gen tech nologijos mokslas. Gen technologija yra pagrsta manipuliacijomis su DNR u gyvos lstels rib (t. y. in vitro )1. iuolaikiniai gen technologijos metodai leidia kurti naujus genetinio kintam um o variantus laboratorijos slygomis ir gauti norim o genotipo bei fe n o tip o organizmus perkeliant kito organizm o ge n arba m od ifiku oja nt (pakeiiant) tam tikrus paties organizm o genus. Gen technologijos m etod taikymas sudar galimybes 2000-aisiais iifruoti vis mogaus genom ir pradti kurti naujus vairi paveldimj lig gydymo bdus, pagrstus manipuliacijomis su serganio asmens DNR (t. y. gen terapijos me todus).

R E K O M B IN A N T IN D N R

3.1 pav.
Rekombinantins DNR taikym o sritys

lot. padaryta dirb tin m is slyg o m is , paod. m g in tu v lyje"

Kokie yra svarbiausi ir esmingiausi rekombinantins DNR technologijos eta pai bei priemons, leidusios dirbtinai sukurti naujus genetinio kintam um o ob jektus? Tai: 1) restrikcijos e n d o n u k le a zi (ferm ent, kartais dar vadinam restriktazmis) atradimas; 2) DNR v e k to ri 1 sukrimas; 3) polim erazin s grand inin s reakcijos (PGR) atradimas ir automatizavi mas. Be to, gen technologijai labai svarbi oligonukleotid chemin sintez, gali nanti susintetinti bet kurios norimos nukleotid sekos DNR fragm entus (pvz., PGR pradmenis, geno fragm entus ir pan.). Taikant gen technologijos metodus su daugelio organizm DNR molekulmis vykdomos vairios manipuliacijos. Genetin mediaga (genai) gali bti perkelta i vien organizm DNR m olekuli kit organizm DNR molekules. I dviej skirting DNR m olekuli sukonstruotos naujos molekuls vadina mos re ko m b in a n tin m is DNR. Pagrindins rekombinantins DNR taikym o sritys pavaizduotos 3.1 paveiksle.

3/1
Rekombinantins DNR molekuls konstravimas

Rekombinantinei DNR molekulei sukurti (r. schem 3.2 pav.) reikia: 1) DNR molekuls (viso geno, geno dalies arba kito reikiamo DNR fragm en to), kuri norima perkelti konkret organizm; 2) vektoriaus, t. y. priemons svetimai DNR molekulei terpti kito organizmo recipiento lstel; 3) restrikcijos endonukleazi, kurios sukarpo svetim DNR molekul tam tikrus fragm entus ir perkerpa vektoriaus molekul; 4) fe rm e nto DNR ligazs (su iuo ferm entu jau susidrte, nagrindami DNR dvigubjim ir rekombinacij vykstant mejozei), kuris svetimos DNR fragm en t ir vektoriaus DNR sujungia j rekombinantins DNR molekul. Tokios naujos DNR molekuls terpiamos recipiento lsteles, kuriose jos: a) pagausinamos, ir vl iskiriamos bei naudojamos toliau; b) suteikia recipientui nauj savybi, nes ima veikti rekombinantins DNR mole kul implantuotas svetimas genas. Inagrinkime svarbiausius rekombinantins DNR krimo schemos elementus.

3.2 pav. Skirtos klonu oti lstelje rekom binantins DNR konstravimas

lot. v e c to r - vejas, nejas

Restrikcijos end o n u kleazs

Apie 1970-uosius bakterijose buvo atrasti ferm entai, perkerpantys abi dvigrands DNR molekuls grandines tik tam tikrose vietose. Jie buvo pavadinti restrikcijos1 e n d o n u klea zm is, nes buvo nustatyta, kad jie riboja virus (bakteriofag)2 dauginimsi kai kuriuose bakterij tamuose3. Svarbiausia gen technologijai yra tai, kad restrikcijos endonukleazs gali atpainti tam tikras DNR nukleotid sekas (daniausiai - 4 arba 6 nukleotid ilgio) ir b tent toje vietoje tiksliai perkirpti abi DNR grandines (3.3 pav.).

Daugumai nukleotid sek, vadinamj p l ndrom4 kuriuos atpasta re ai , strikcijos endonukleazs, bdinga tam tikra simetrija. Palindromu i pradi buvo vadinami odiai arba itisos frazs, kurias galima skaityti abiem kryptimis. Lietuvi kalboje palindrom rasti nelengva, taiau pabandykite taip perskaityti vard ,ANA", daiktavard SNS" arba nelabai sklandi fraz SDK UU KDS". O kaip atro do DNR palindromas? Jis taip pat skaitomas abiem kryptimis, tik skirtingose DNR grandinse. Pavyzdiui, restrikcijos endonukleaz EcoRI atpasta 6 nukleotid sek

5-ATC3 'GAT-' 3-TAGS 'CTA-'


(3.3 pav.). Nesunku pastebti, kad vien grandin skaitant 5 ' 3 ' kryptimi, o kit 3 ' - 5 ' kryptimi, nukleotid seka yra tokia pati: GAATTC. Todl daniausiai j i taip ir uraoma. Susidariusi DNR fra g m e n t abiej grandini 5' galuose (kerpant kai ku riomis restrikcijos endonukleazm is - 3' galuose) yra viengrandiai 1 -4 nu kleotid fra g m e n ta i - vadinamieji lipns g alai (3.3 pav.). Kai susitinka" du DNR frag m en tai, tu rin tys tokius paius lipnius galus (t. y. sukarpyti ta paia restrikcijos endonukleaze), jie sudaro papildanisias poras (lipns galai sulim pa"), stabilizuojanias to kj kompleks, o prijungus tam tikr kiek DNR ligazs to ki sulipusi" DNR fra g m e n t grandini galai sujungiam i fosfodiesterinm is jungtim is. Jau inomi ir taikom i keli imtai restrikcijos endonukleazi, iskirt i vairi bakterij. ioje srityje daug nuveik ir Lietuvos Biotechnologijos institutas. Kon kreios restrikcijos endonukleazs pavadinimas yra sudaromas i bakterijos, i kurios ji buvo iskirta, pavadinimo. Pavyzdiui, restrikcijos endonukleaz EcoRI iskirta i arnyno lazdels Escherichia c o li R l kamieno. Turdami daugyb molekulini irkli" - restrikcijos endonukleazi, dvigrand DNR molekul galime sukarpyti labai tiksliai. Todl gautus DNR fragm entus ga lima taikyti tolesnms manipuliacijoms. Deja, kol kas inomi ferm entai atpasta dar ne visas DNR nukleotid sekas. Sugalvota vairi bd (ir nuolat iekoma nauj), kaip gen technologijos metodais nustatyti pageidaujam tam tikros restrikcijos endonukleazs kirpimo viet.

V e kto riai

1 ang. restrict - ap riboti, su siaurinti 2 Bakteriofagas (gr. p h a g o s sudantis, suryjantis) - virusas, pakenkiantis bakterijom s, bakte rij virusas. tamas (vok. Stam m ) - gry na vienos ries m ikroorganizm kultra, iskirta i kurio nors vie no altinio (serganio organiz mo, aplinkos, fosilijos ir pan.).
4

gr. p a lin d ro m o s - sugrtan tis, bgantis atgal - odis arba fraz, eilraio eilut, vienodai skaitoma i kairs dein ir at virkiai

Gen technologijai svarbu, kad svetima DNR lengvai patekt lstel ir galt joje savarankikai dvigubti. Linijin DNR molekul tam netinka. Todl DNR mole kul, kuri reikia terpti lstel, sujungiama su tam tikra DNR molekule, vadinama vektoriumi. Daniausiai taikomi vektoriai yra plazmids ir kai kuri virus DNR (kai kada RNR). Plazmids patogios tuo, kad jose esantys atsparumo antibiotikams genai leidia parinkti lsteli auginimo terpes, kuriose ilikt ir daugintsi tik tos bakteri jos, kuriose yra toji plazmid. Paprasiausia DNR fragm ento klonavimo (kaip vek tori naudojant plazmid) schema pateikta 3.4 pav. (r. p. 120). Jei svetimos DNR fra g m e n t norim a tik pagausinti, visikai pakanka, kad vektoriaus DNR galt savarankikai d vig u b ti. Tokie vektoriai vadinam i k lo n a v im o v ek to ria is . Deja, plazmid ar b akte rio fag o gen om o DNR galima te rp ti tik palyginti nedidel svetimos DNR frag m en t. Jei reikia klo nuoti daug didesnius DNR gabalus (pvz., kuriant g enom bibliotekas), taikomi specials vektoriai - kaip antai i bakterijos chrom osom os sukurti BAC arba dirbtins mieli chrom osom os YAC.

Danai svarbu ne tik pagausinti svetim gen, bet ir gauti jo koduojam balty min produkt. Tam naudojami vadinamieji raikos (ekspresijos) v e k to ria i, kuriuose yra geno nuraym kontroliuojantys p ro m o to riai, o, jei reikia, ir kiti btini elem entai (pvz., iRNR poliadenilinim o signalas). Daniausiai reikia, kad svetimas genas lstelje veikt ne vis laik, o tik tada, kai yra btina. Tam parenkam i indukuojam ieji p ro m o to riai (prisim inkite lac o perono p ro m o to ri ir jo reguliavim). Antra vertus, kai svetimas genas terpiam as eukarioto organizm , daniausiai svarbu, kad jis veikt tik ta m tikram e audinyje (pvz., pieno liaukose) ir/arba tam tikru organizm o raidos periodu. Tada reikia pa rinkti pro m o to ri, kuris reikalingas tam audiniui arba aktyvus tik tam tikru raidos periodu. Kalbant apie vektorius, taikom us eukariot organizmuose, pastebtina, kad savarankika plazmid, patekusi eukarioto lstels branduol, ten ibna neil gai (taigi ir perkeltasis svetimas genas veikia laikinai). Toks genas veikia ilgai ir yra perduodamas lstels palikuonms, jei vektorius yra terpiamas lstels branduolio DNR. T padaryti sugeba retrovirusai, todl jie ir naudojami kaip eukariot vektoriai.

Restrikcijos endonukleaz EcoRI


R estrikcijos e n d o n u kle a z EcoRI a tp ajsta DNR m o le kuls n u k le o tid se k G AATTC ir p e rke rp a abi DNR g ra n d in e s (vietos p a ym to s rodyklm is)

3.3 pav. ; iT -''k c jo s endonukleazs := kymas konstruojant rekom binantin DNR molekul E coRI p e rk irp t DNR fra g m e nt 5 1g a lu o s e Isiki 4 n u kle o tid viena gra ndiai lip n s galai

L ipn us galai

S kirtin g DNR fra g m e n t (ve ktoriaus ir svetim os DNR) lip n s galai yra ko m p le m e n ta r s vieni kitiem s, to d l s u lim p a "

DNR ligaz DNR ligaz

DNR ligaz fosfodieste rin m is ju n g tim is su ju n g ia s u lip u s i s k irtin g DNR fra g m e n t g ra n d in i galus

Lstel recipiente

Jei norim DNR fragm ent (pvz., gen) reikia tik pagausinti arba dideliais kiekiais gam inti to geno koduojam baltym, rekombinantin DNR terpiama lengvai auginam ir spariai besidauginant organizm, t. y. bakterij (daniau siai - arnyno lazdel E. coli). Taiau bakterij susintetinti eukariot organizmo gen koduojami polipeptidai ne visada bna tokie, kaip eukariot lstelse, nes bakterijos neturi kai kuri eukariotams bding sistem, form uojani veikl baltym i susintetinto polipeptido. Antra vertus, danai rekombinantins DNR kuriamos btent tam, kad pakeist eukariotinio organizmo lstel. Taigi tenka tokias DNR jterpinti eukariotines lsteles, nors tai kur kas sudtingiau, nes DNR turi patekti ne tik lstel, bet ir jos branduol. Geno, kur reikia perkelti kit organizm , altinis gali bti tam tikros ries o rganizm o lsteli DNR. Taiau daniausiai yra sudtinga surasti joje vienin tel mus d om in an t gen. Kur kas daniau reikiamas genas paimamas i ati tin k a m o organizm o gen om o bibliotekos (r. toliau) arba jau tu rim o rekom bi nantins DNR klono (pvz., kai gen reikia i klonavim o vektoriaus perkelti raikos vektori).

Svetim a DNR

Konstruojama rekombinantin plazmid


(r. II da lie s 3.2 pav. ir 3.3 pav.) DNR molekuls sukarpytos ta paia restrikcijos endonukleaze

'
3.4 pav. DNR klonavimas bakterijose (E. coli) ta ika n t plazmidinj vektori Pradin plazmid

V
A ts p a ru m o a n tib io tik u i g e na s

Bakterin plazmid DNR ligaz

Rekombinan tin plazmid '

Ligavimo produktai

Ligavimo produktai perkeliami E. coli lsteles

Bakterijos (. c o l i ) :
- apdorotos taip, kad j sienels bt pralaidios svetimai DNR; - jautrios antibiotikui

Bakterijos paskleidiamos ant standios terps su antibiotiku

Bakterijos chromosoma

Plazmid turinti bakterija


Ant terps su antibiotiku igyvena tik turinios plazmid bakterijos

* 9
Kiekviena iaugusi bakterij (vienos lstels palikuons)

kolonija yra klonas

Plazmid bakterijoje dvigubja: susidaro plazmids DNR molekuli klonas

Kiekviename bakterij klone yra tos paios

plazmids DNR molekuli klonas


Rekombinantins plazmids klonas yra ir j j statyto

svetimo DNR fragmento klonas

Gen technologijos m etodais m an ip uliuo jan t eukariot genais, didelis kliu vinys yra sudtinga j struktra, ypa - intronai. Viena vertus, daugum a gen su intronais yra per dideli, kad juos bt galima veiksmingai klonuoti n au do ja nt plazm idinius arba virusinius vektorius. A n tra vertus, bakterijos neturi eukariot iRNR m olekuli brendim o sistemos, todl jose negali bti sintetinam as norm alus polipeptidas, koduojam as geno su intronais. tokius vektorius daniausiai terpiamas ne genom o, bet k o m p lem e n ta rio s io s DNR (kDNR) fragm entas.

C C I

K m l m n a i j DNR opeetroi
Naudojant vienagrand iRNR molekul kaip matric, su fermentu atvirktine transkriptaze galima susintetinti dvigrand DNR molekul. i DNR vadinama komplementarija DNR (kDNR), nes j i yra sintetinama papildymo (t. y. komplementarumo) principu pagal RNR matric. Tokia kDNR molekul nebeturi intron, nes yra susintetinta nuo subrendusios iRNR molekuls (3.5 pav.).

Vis tobuljant DNR trum p polinukleotidini grandini (oligonukleotid) che mins sintezs metodams, galima prie tu rim o geno prijungti norimos sekos fragm ent arba tokiu fragm entu pakeisti geno dal. Galiausiai galima net vis gen sudurstyti" i toki sintetini frag m en t (kaip ir buvo padaryta su insuli
K in ta m u m a s Intronas Egzonas Intronas Egzonas G enas N uraym as ir iRNR brendim as

no a ir [3 grandinmis).

Eukariot dvigrand genomo DNR


Prom otorius E gzonas

Kepur 5' ^ Egzonas

Subrendusi iRNR
E gzonas

Poli-A uodega

E gzonas A A A A A A A ... 3'

K om p le m en tariosio s (papildaniosios) DNR grandin s sintez vyksta pagal iRNR m atric

iRNR ir kDNR hibridas


5 'C
A A A A A A A ... T T T T T T T ...

A ntrosios kDNR grandin s sintez vyksta pagal viena gra nds kDNR m atric

3.5 pa v. < am plem entariosios DNR sintez

Dvigrand kDNR
A A A A A A A ... T T T T T T T ...

kDNR klonavim as

G en o m o b ib lioteka

G enom o biblioteka yra bakte rij arba b a k te rio fa g klon kolekcija, ku rioje kiekvieno atskiro klono reko m b ina ntin je DNR yra atskiras ta m tik ro o rg a n izm o lsteli DNR fra g m e n ta s, o visuose klonuose esantys fra g m e n tai apim a vis io o rg an izm o genom . Kaip kuriam a g e n o m o biblioteka, pavaizduota 3.6 paveiksle.

O rganizm o genom o bibliotekos krimas

I audinio lsteli iskiriam a organizm o genom o DNR

Vektorius (bakterin plazm id)

*
R estrikcijos endonukleaz sukarpo genom o DNR fragm entus

*
'S 'y
R estrikcijos endonukleaz perkerpa vekto- I riaus DNR J

Ligaz sujungia genom o DNR fragm ent su vektoriaus DNR rekom binantin plazm id. Kiekvienas g en om o DNR fragm entas patenka skirting plazm id

R ekom binuot plazm idi miiniu transform uojam os E. coli lstels. S kirtingos plazm ids patenka skirtingas lsteles

(D

f)

'd S
''**& *

R ekom binantini plazm idi atrank leidianioje terpje auginam i skirtingas rekom binantines plazm ids turin i E. coli lsteli klonai

3.6 pav. O rganizm o genom o bibliotekos krimas E. coli lstelse taika nt plazm idinj vektori

/ Reikiamo klono paieka

V
Genomo bibliotekos isaugojimas

N o rin t g e n o m o b ib lio te koje rasti klon, kuriam e yra reikiam as genas, galim a p asinaudoti a titin k a m u g e n e tin iu z o n d u (r. I dalies 1.1.2 skyri).

K la u s im a i

1. Kas yra reko m b in a n tin DNR ir kur ji gali b ti taikom a? 2. Kas yra restrikcijos e ndonukleaz ir kuo jos reikm ingos gen te c h n o logijai? 3. Kas gen te c h n o lo g ijo je yra vektorius? Kokie yra p a g rind iniai vektori tipai? 4. Kas yra ko m p le m e n ta rio ji DNR ir kaip ji sukuriam a?

3.2
Polimerazin grandinin reakcija

DNR fragm ent pagausinimas klonuojant juos bakterijose yra ilgas ir sudtin gas procesas. Atradus polimerazin grandinin reakcij (PGR) buvo sukurtas alternatyvus trum p (apie 300 nukleotid por) DNR fragm ent pagausinimo metodas. Polimerazin grandinin reakcija yra galingas metodas, galinantis greitai ir dideliais kiekiais pagausinti norim nedidel DNR arba RNR fragm ent. Kadangi gen daniausiai sudaro keli ar kelios deimtys tkstani nukleotid por, nau dojant PGR galima pagausinti tik nedidel jo dal (pvz., vien egzon). Kam gi reikia pagausinti tam tikr DNR fragm ent? Iskirtos i tiriam ojo individo biologi nio bandinio DNR paprasiausiai nepakanka vairioms genetinms manipuliaci joms arba jos analizei (kaip antai nukleotid sekos nustatymui). Be to, analizuoti daniausiai reikia tik tam tikr - btent mus dominani DNR molekuls dal, o ne viso genom o DNR. Gen ir kit dideli DNR fragm ent klonavimas bakterij lstelse ir t klon dauginimas taip pat leidia gauti didelius DNR kiekius. is metodas savo efektyvumo neprarado ir vis dar plaiai taikomas. Taiau, kai rei kia pagausinti nedidel DNR molekuls fragm ent, PGR yra kur kas paprastesnis ir greitesnis metodas. Kas reikalinga, kad bt galima neribotais kiekiais (pvz., milijon kart) pa gausinti norim DNR fragm ent? 1. Norint pradti reikiamo DNR fragm ento pagausinim (i pradi padvigubinim), reikia trum p o vienagrandio DNR fragm ento (pradmens), kuris atpaint norim pagausinti fragm ento dal. Kadangi DNR dvigubjimas vyksta 5' -> 3' kryptimi, tarkime, nuo tako A iki tako B, abiej atitinkam o DNR fragm ento sintezei reikalingi du pradmenys. Taigi veikia apie 20 nukleotid ilgio oligonukleotidai, kuri nukleotid sekos yra papildaniosios DNR taikinio (t. y. tos DNR molekuls dalies, kuri norime pagausinti) galams. Vienas pradmuo paymi sin tezs pradi A 5' r. p. 124). 3' grandinje, o kitas - B 3' < r 5' grandinje (3.7 pav. A,

123
K in ta m u m a s

2. Pradmenys gali prisijungti tik prie vienos DNR grandins. Taigi prie gausini mo pradi DNR grandines btina atskirti. Tai daroma DNR pakaitinant. 3. Pradmenims prisijungus prie atskirt DNR taikinio grandini, btina pagal pastarj nukleotid sek prailginti pradmenis. Tai daro fermentas DNR polimeraz. 4. Taiau auktoje temperatroje, reikalingoje DNR grandinms atskirti, DNR polimeraz praranda aktyvum. i problema buvo isprsta i bakterijos Thermus aquaticus, atrastos kartuose altiniuose, iskyrus auktai temperatrai at spari DNR polimeraz, pavadint Taq polimeraze. is fermentas nepraranda aktyvumo net 9 6 C temperatroje, reikalingoje DNR grandinms atskirti. 5. Btinos visos statybins" mediagos, i kuri sudaroma DNR grandin, t. y. visi keturi deoksiribonukleozidtrifosfatai, ir papildomos mediagos tinkamai re akcijos terpei sudaryti. Turdami visus mintuosius komponentus ir atlik visus procedros etapus, norim DNR fragm ent tik padvigubinsime. O j pagausinti ketinome imtus tkstani kart. Todl i procedr reikia kartoti. Taigi ji yra ciklin. Vien cikl (3.7 pav., B) sudaro: I. M otinins DNR molekuls grandini atskyrimas. --<r II. Dviej pradmen prisijungimas prie norimo pagausinti DNR fragm ento gran dini 3' galini nukleotid sek. III. Pradmens sekos liginimas pagal motinins DNR grandins nukleotid sek. is ciklas gali bti kartojamas tol, kol pakanka i pradi mgintuvl sudt statybini" mediag (apie 30 kart). Per kiekvien cikl gausinam DNR frag m ent kiekis padvigubja ir procedros pabaigoje galutinis DNR kiekis jau yra didesnis u pradin 105 106 kart (3.7 pav.. C). Tokio kiekio DNR jau pakanka tiesioginei mus dominanios DNR atkarpos analizei. PGR procesas yra autom ati zuotas ir atliekamas naudojant special prietais - automatin amplifikatori. Taikinio DNR daniausiai iskiriama i tyrjui prieinam o rganizm o lsteli. Jei tiriam a m ogaus DNR, ji daniausiai iskiriama i kraujo leukocit. Su prantam a, kad tiriamasis asmuo nori, kad jo kraujo bt imama kuo maiau,

3.7 pav. Polimerazin grandinin reakcija (PGR)

todl standartiniams tyrimams imama 10 ml kraujo i venos. Taiau DNR gali bti iskirta i bet koki lsteli, kurios turi DNR (akivaizdu, kad i eritrocit DNR neiskirsite, nes jie neturi branduoli, taigi ir DNR). Dabar taikant PGR galima prigausinti pakankam DNR kiek net ir i vienos lstels. Negana to, DNR gausinama ir tyrinjama iskiriant j ne tik i gyvj, bet ir i jau seniai mirusi organizm (pvz., faraon m umij ar kit moni, gyvenusi prie kelis tksta nius met, ikastini palaik, jau inykusi gyvn ikamose usilikusi audi ni gaballi). PGR bdu pagausin i palaik iskirt DNR, galime nustatyti, kokie buvo ms protvi genai. Jau atlikta netgi neandertalieio, gyvenusio prie 29 000 met, DNR analiz.

A . DNR taikinys ir PGR pradmenys


Dvigrand DNR molekul: DNR ta ik in y s

\
/

6 p rad m u o

B
3' !......... 5'

Fragmentas, kur reikia pagausinti

A p radm uo

B. PGR vyksta ciklais


P r a d in D N R m o le k u l

I. DNR grandini atskyrimas >

Paklus temperatr dvigrands DNR grandins atsiskiria

II. Pradmens prisijungimas

4-

Sumainus temperatr prie atitin kam DNR nukleotid sek prisijun gia komplementarieji (papildantieji) pradmenys

III. DNR sintez II.

X
f
'

Temperatrai atspari DNR polimeraz sintetina antrj DNR grandin

_ -----

--------------------

C . PGR metu DNR fragmentai gausja geometrine progresija

^ 4

4:

Kiekvienas susintetintas DNR fragmentas kitame PGR cikle tampa matrica naujos DNR grandins sintezei Po 30 PGR cikl susintetinta apie 1 mln.vienod DNR fragment

Pi K la u s im a i
1. Kas yra PGR ir kur ji gali bti taikoma? 2. Koks yra PGR principas?

Vienas naujausi bd mogaus insulinui gauti buvo rekombinantins DNR technologijos taikymas. Pavien bakterijos lstel negali susintetinti veiklios insu lino molekuls, nes pradin polipeptid btina tam tikru bdu suskaidyti frag mentus. Todl buvo sukurtos dvi bakterij linijos, kuri viena sintetino insulino A grandin, o kita - B grandin. Taigi sintetiniai insulino A ir B grandini genai buvo terpti atskiras bakterij plazmides. Gautos rekombinantins plazmids terptos E. coli lsteles (r. II dalies 3.1 skyri), ir sukurti du bakterij klonai: vienas sintetinantis insulino A grandin, o kitas - B grandin. Uauginus didel toki bakterij kiek biotechnologiniuose reaktoriuose, mintieji polipeptidai bu vo iskirti, igryninti ir sumaiyti taip, kad tarp j susidaryt disulfidins jungtys, kaip ir visaveriame natraliame mogaus insuline. Susintetintas insulinas buvo pirmasis medikamentinis produktas, kur imta gaminti dideliais kiekiais biotech nologiniu rekombinantins DNR metodu. Panaiai biotechnologiniais metodais gaminami ir daugelis kit baltymini pro dukt: mogaus augim o hormonas, eritropoetinas (inkst gaminamas augimo veiksnys, skatinantis eritrocit gamyb; jis taikomas gydyti ligoms ir bklms, kai organizme nepakanka eritrocit), kraujo krejimo veiksniai (pvz., VIII kraujo krejimo veiksnys, taikomas hemofilijai gydyti), interferonas (viui gydyti) ir kt. Gyvulininkystei taip pat taikomi hormonai, pagaminti vairiais rekombinantins DNR technologijos metodais. Antai gyvuli augim o hormon BST naudojant vietoj steroid msa bna liesesn, o karvs duoda daugiau pieno. Taigi taip gaunami nauji organizmo kintam um o variantai. Biotechnologiniais metodais gaminamos ir vairios saugesns bei veiksmingesns vakcinos. XX amiaus pabaigoje jau buvo sukurta hepatito B vakcina, ibando mos vakcinos prie chlamidijas, maliarij, AIDS, pslelin, Laimo lig, kokliu.

1. Kur gali bti taikom a gen technologija? 2. Kodl prireik biotechnologiniais metodais gam inti gam tines mediagas? 3. Kaip biotechnologiniu m etodu gaminamas insulinas? 4. Ar gali bakterijos sintetinti visus m ogui reikalingus baltymus? Kodl?

Transgeniniais vadinami organizmai, kuriuos dirbtinai terpta svetima DNR stabiliai susijungia su generatyvini lsteli branduolio DNR, ir yra perduodama t organizm palikuonims. Transgenini gyvn krimo technologija buvo atrasta bandymams naudo jant peles. Mikromanipuliatoriais svetimos DNR fragmentas (genas) terpiamas apvaisint kiauialst prie susiliejant kiauialsts ir spermatozoido branduoliams. iems genomams susijungus atsiradusi zigota jau yra transgenin, t. y. turi sveti m (terptj) gen. Transgenin zigota implantuojama kito moterikosios lyties individo - mots gimd (3.9 pav.). Itobulinus i procedr buvo sukurtos transgenins karvs, kiauls, avys (3.10 pav.), uvys, triuiai. Transgeniniai gyvnai daniausiai naudojami farmaciniams baltyminiams prepara tams gaminti, kai veiklaus baltymo negali susintetinti bakterijos. Stengiamasi padary ti taip, kad perkeltasis genas bt veiklus transgeninio gyvno pieno liauk lstelse. Tai labai patogu, nes reikaling produkt, kurio sintez lemia transgeninio gyvno DNR perkeltasis genas, galima iskirti i pieno. Pavyzdiui, transgenins avys naudo jamos keliems moni baltymams (tarp j kraujo krejimo veiksniui) gauti. 1 suaugusio gyvno (iuo atveju avies) organizm nem anom a perkelti sveti mo geno taip, kad j tu r t visos lstels (bent jau vieno audinio lstels). Todl i pradi genas perkeliamas bakterij plazmid, t. y. vektori, taiau ne klonavimo, o raikos vektori. Jei norime, kad tas genas veikt (t. y. reikia mo baltym o sintez vykt tik pieno liaukose), turim e parinkti atitinkam geno prom otori. Tokia rekom binantin plazmid terpiam a apvaisint kiauialst.

Jei ji skmingai siterpia zigotos genom (t. y. siterpdama nesuardo jokio svar baus avies geno), i tokios zigotos galiausiai susiformuoja avis, kurios visos ls tels turi perkeltj mogaus gen. Tada jau galima sitikinti, ar genas veikia tik pieno liaukose, ir i avies pieno iskirti jo produkt - mogaus baltym. Panaiai i transgenins okos pieno gaunamas mogaus antitrom binas III. T ra n s g en in iai a u g a la i sukuriam i taip pat ta ikan t gen technologijos me todus. Daniausiai to kie augalai kuriami ta m , kad bt atspars kenkjams, virusinms ligoms, herbicidams arba tu r t m ogui nauding savybi. Jau yra sukurta nemaai transgenini augal: soja, vilnamedis, liucerna, ryiai, bulvs, pom idorai. Svetima DNR augal lsteles terpia ma kitaip nei gyvn. I pradi paali nama lstels sienel (tokia lstel vadinama protoplastu). Protoplast suspensija sumaioma su svetima DNR, turinia perkeliamj gen. Paskui pa veikiama elektros srove, kad plazminje m em branoje atsirast m ayts sky luts, pro kurias protoplast patekt DNR. Vliau i tokio protoplasto susi form uoja visas transgeninis augalas.
3.3 pav. : : ; ' : niai transgenins krim o etapai 3.1 0 pa v. Transgenins avys, i kuri pieno iskiriamas m ogaus baltymas

127
K in ta m u m a s

I apvaisintos pels paimami oocitai Apvaisinto oocito probranduoliai:

Joocito vyrikj probranduolj suleidiama svetima DNR Mikroinjekcijos pipet Svetimos DNR tirpalas

Pels genomo DNR Keli oocitai su svetima DNR perkeliami hormonais stimuliuotos pels (mots) kiauintak

Klonuotas svetimos DNR fragmentas, turintis reikiam gen

Peliuk vada: - tansgeninis - normals

Transgenins pels genomo DNR, kuri atsitiktinio trkio vietoje nuosekliai sijung keli svetimos DNR fragmentai

Jei svetima DNR skmingai integravosi genomo DNR, visose transgenins pels lstelse yra svetimas genas (transgenas)

Vienas pavyzdi, kaip gen technologijos metodais pakeiiami augalai, yra transgeniniai pomidorai. Kai normals pomidorai prinoksta, tam tikras ferm en tas suardo pektin, standinant lsteli sieneles, ir prinok pomidorai suminktja. Taigi tenka skinti dar neprinokusius pomidorus, kad skinant ir transportuojant bt maiau paeidim. Vliau taikant tam tikras chemines mediagas tokie pomidorai prinokinami dirbtiniu bdu. Taiau, kad nokim skatinanios mediagos nepakenkt mogui, jas reikia inaktyvinti kaitinant. Tada pablogja pomidor skonis, ir tenka pridti dar kit mediag jam pagerinti. Taikant rekombinantins DNR technologij buvo sukurti pomidorai, kuri DNR buvo pakeista taip, kad ferm ento, ardanio pektin, genas tapo maiau aktyvus. Tokie pomidorai prinok nesuminktja ir yra skanesni. Taigi nebtina taikyti vis m intj che mini mediag ir reikia maiau pastang pomidorams apdoroti. Kitas transgeninio pom idoro pavyzdys susijs su T toksino genu. Dirvoemio bakterijos Bacillus thuringiensis gamina baltym T toksin, kuris selektyviai jun giasi prie tam tikr dirvoemio vabzdi epitelio lsteli ir jas suardo. Todl vabzdys sta. Pastebtina, kad T toksinas nekenksm ingas stu buriniam s gyvnams. iam baltymui jautrs vabzdiai yra daugelio augal (tarp j pomi dor ir kukurz) kenkjai, su kuriais sudtinga kovoti tradiciniais metodais. Tad nenuostabu, kad buvo stengiamasi gen technologijos metodais T toksino gen perkelti pomidorus ir kukurzus, kad ie ta pt atspars kenkjams. Supapras tinta procedros schema parodyta 3.11 paveiksle.

Bacillus thuringiensis
i daig iauga tran s g en in ia i

Iskiriama DNR
3.11 pav. T toksino gen turinio transgeninio pomidoro krim o schema. Daugelyje didij pasaulio miest (Londone, Paryiuje ir kt.) yra specialios parduotuvs, kuriose galima sigyti genetikai m odifikuot maisto produkt (msos, darovi)

p o m idorai, patys gaminantys T toksin, taigi atspars dirvoemio vabzdiams

I pavieni kultros lsteli regeneruojami pomidor daigai

Restrikcijos fermentai i DNR sukarpo gen dydio fragmentus

4
Lstels, turinios T toksino gen, dauginasi

/
Su DNR zondu nustatomas T toksino genas T toksino genas perkeliamas pomidoro lsteli kultr

Transgenini b akterij sukurta kur kas daugiau nei transgenini gyvn ir augal. Jos turi vairi monms nauding savybi: naudojamos augal apsau gai, vandens biologiniam valymui, chemijos pramonei, perdirbant mineralus. Kai kurios bakterijos gali misti nafta. Tikimasi jas genetikai m odifikuoti ir pritaikyti isiliejusia nafta utertiems papldimiams ir vandens telkiniams valyti. Kitos bakterijos gali paalinti sier i kurui skirtos anglies. Taigi tinka toksiniams atliek svartynams valyti. J vien bakterij tam buvo terptas genas, sutei kiantis atsparumo tokiems toksin kiekiams, nuo kuri kiti tamai sta. Tam, kad tokios bakterijos vliau netapt nesunaikinama grsme, jas buvo vesti vadinamieji saviudybs genai, kurie priversdavo jas susinaikinti atlikus darb. Daugelis kalnakasybos bendrovi naudoja bakterijas vairiems metalams gau ti. M anipuliuojant genais galima sustiprinti bakterij gebjim i nelabai sodri rd iskirti var, uran, auks. Rekombinantins DNR technologija gali bti panaudota ir karo pramonje kuriant ypa pavojing bakteriologin ginkl. Antra vertus, genetikai m odifi kuojant mikroorganizmus kuriamos apsaugos nuo tokio ginklo priemons. r 1. Kokie organizmai vadinami transgeniniais? 2. Kaip kuriami transgeniniai gyvnai ir augalai? 3. Kokius inote transgeninius gyvnus bei augalus ir kam jie reikalingi?

3. 3. 3.
Organizm klonavimas

Augalai klonuojam i1jau nuo seniausi laik. Tai vegetatyvinis dauginimas (skie pijimas, dauginimas atlankomis, auginiais ir pan.). iuolaikinis augal klonavimo bdas yra audini kultros, i kuri regeneruojami augalai (tai jau buvo minta kalbant apie transgeninius augalus). I nedidels lsteli grups susiformuoja kalius, kurio visos lstels yra genetikai identikos. Kali susmulkinus j dau gyb mayi gaballi ir sudarius specialias slygas i kiekvieno j iauga gene tikai tapats augalai. Visi jie - identiki vienos lstels klonai (kaip ir bakterij kolonijos ant standios terps). Gyvn klonavimas technologikai yra kur kas sudtingesnis procesas. Taiau ir natraliomis slygomis gali atsirasti du ar net daugiau genetikai tapai individ. Tai identiki (monozigotiniai) dvyniai. Identiki bna tik dvyniai, kurie susiformuoja pirmaisiais zigotos dalijimosi etapais, nes jie kil i vienos lstels (zigotos). mogui parpo prisidauginti individ, turini ypa nauding savybi. Tarkime, turime labai piening karv. Taiau ji kasmet atsiveda tik po vien veriuk. Taigi i viso ji susilauks madaug 10 veriuk, i kuri vidutinikai tik pus bus telyaits. Daniausiai karvs kiauidse vienu metu susiformuoja tik viena kiauialst, bet taikant hormonus, galima paskatinti daugelio kiauialsi susiformavim vienu metu. Jas galima su rinkti ir apvaisinti mgintuvlyje ypa gero veislinio buliaus sperma. Paskui atrenkami moterikieji gemalai, padalijami ir toliau klonuojami implantuojant atskirus gemalus j skirting karvi (moi) gimdas. Taip galima iplatinti tam tikr klon, pasiymint geresnmis savybmis. io proceso schema pateikta 3.12 paveiksle. Apibendrinus klonavimas yra: 1) tikslus vieno geno daugybs kopij pagaminimas naudojant rekombinantins DNR metodus (tai DNR klonavimas); 2) tikslus vienos lstels daugybs kopij pagaminimas (lsteli linijos sukri mas). Vis i lsteli genotipas yra tapatus pradins lstels genotipui; 3) tikslus genetikai tapataus daugialsio organizm o sukrimas taikant gen technologij ir mikromanipuliacijas. Visuomen, be abejo, kur kas labiau domina, kaip i vienos lstels galima klonuoti vis organizm.

1 29
K in ta m u m a s

Ypa gero s ve is l s b u liu s

Labai pie n in g a karv

3 .1 2 pa v. < - klonavim o schema

Surenkama sperma Patikrinamos X chrom osom os Gera sperma ualdoma Dirbtinis apsklinimas Embrionai padalijami ir perkeliami kit karvi gimdas

Hormonais stim uliuojant daugelis kiauialsi subrsta vienu metu

Paimami embrionai

Karvs mots paveikiamos hormonais, kad galt priim ti embrionus

Dalis em brion ualdomi ir gali bti panaudoti vliau

s r
jt Gim rTMT-tff Gr veriukai iT

/ J / i
atsi. glis, atala

V u yra dvyniai, t. y. klonai e *

identiki

c c

n u l k o a i a idoi l n v m s
Pirmasis klonuotas induolis buvo garsioji avis Doli (3.13 pav.), nustebinusi vis pasaul 1997-aisiais vasario 27-j. 1998-j liepos mnes buvo praneta apie pir mj klonuot pel vardu Kumulina. J klonavo mokslinink grup, vadovaujama dr. R. Janagimaio (R. Yanagimachi). Mokslininkai man, kad j taikyta klonavimo technika buvo kur kas tobulesn u t, kuri naudojo kotijos mokslininkai, klonuodami av. Vienos i lsteli, supani besivystani pels kiauids kiauialst, branduolys mikromanipuliatoriais buvo perkeltas kitos pels kiauialst. Taip pa keista kiauialst turjo dvigubj chromosom rinkin (vis branduol) i pirmo sios pels, o citoplazm - i antrosios. Pastaroji ir pagimd peliuk, kuris buvo pirmosios pels klonas. Kumulina igyveno dvejus metus ir septynis mnesius (tai g i septyniais mnesiais ilgiau nei paprasta pel) ir nudvs 2000-j gegus mnes. Senatvje ja i isivyst odos auglys (tokie augliai bdingi pagyvenusioms pelms), kuris buvo skmingai paalintas. Kitais poiriais Kumulina buvo sveika ir aktyvi ligi paskutinij gyvenimo dien. 2000-aisiais jau buvo klonuotos avys, karvs, okos, kiauls. Ypa sunku buvo klonuoti kiaules, nes j ntumas turi bti daugiavaisis. Taiau 2000-j kovo 5-j brit bendrovei PLL priklausanioje Virdinijos (JAV) laboratorijoje po Cezario pjvio pasaul ivydo penkios identikos kiaulaits (3.14 pav.). Jos visos buvo iaugintos i vienintels klonuotos suaugusios kiauls lstels. Kiaulaits buvo visikai identikos, todl ant upakalini kojyi teko urayti vardus. Pirmoji kiaulait buvo pavadinta M ili (naujojo tkstantmeio - millenium garbei). Paskutin gavo Dotkom vard ironika uuomina komercines interneto bendroves (.com).

130

Kiauli klonavim o buvo labai laukiama, nes daugelis j organ yra panas j m ogaus (mogaus ir kiauls irdis bei kepenys anatom ikai beveik iden tikos). Daug tkstani pacient visame pasaulyje (taip pat ir Lietuvoje) laukia irdies, kepen ar inksto transplantacijos. Apie 2 /3 to ki pacient mirta taip ir nesulauk d o n oro organo. m ogui tiesiogiai persodinti kiauls organ nem anom a dl ksenotransplantacijos1 barjero - juos atm eta m o gaus im unin sistema. Todl genetikai perkeisti kiauls organai jau netoli m oje ateityje suteikt galimyb daugeliui pacient. M anom a, kad jau po keleri m et ksenotransplantacijos barjeras bus perengtas, t. y. sergantiems m onm s bus galima persodinti klo n u o t ir genetikai perkeist kiauli ar bedioni organus. Antra vertus, tikim asi, kad apie 2020-uosius gyvnai bus klonuojam i tik nykstanioms rims gelbti, o m oni organai persodini mui bus auginam i laboratorijose audini technologijos m etodais i vienos klonuotos paties paciento lstels. O rganizm klonavimas gali d uo ti ne tik daug naudos, bet ir sukelti pavoj. Klonavimu prisidauginus daugyb genetikai tapai organizm (ypa au gal), labai sumainsime j genetin vairov. Jei kininkai augins tik kelias ypa produktyvias jav veisles, pasikeitus slygoms arba iplitus naujoms ligoms, kuriom s ios veisls neatsparios, visi javai us. Taip ir atsitiko Tailande ir Malaizijoje su alyvinmis palmmis, priklausaniom is tam paiam klonui: jos neatsparios grybelinm s ligoms ir sta nuo j. Gyvn klonavimas suke lia kur kas daugiau problem . Nepaisant to, m onija viliasi, kad klonavimas pads veikti ligas, kova su kuriom is vis dar neveiksminga.

3 .1 4 pav. Penki identik kiaulaii klonas

1. Kas yra klonas ir klonavimas? K galima klonuoti? 2. A r gam toje yra induoli (taigi ir mogaus) natrali klon? 3. Kokius inote klonuotus gyvnus? 4. Kuo m onm s svarbus kiauli ir m ogbedioni klonavimas? 5. Kokius pavojus gali sukelti organizm klonavimas?
1

gr. xenos - svetimas

3.3.4.
r j terapija

CD
Gen terapija - tai genetinio defekto itaisymas pakeiiant lstels genotip.

Gen terapijos metodai eksperimentikai taikomi: m onogeninm s ligoms (adenozindeaminazs imunodeficitui, eiminei hiper cholesterolemijai, cistinei fibrozei) gydyti; p iktyb iniam s augliam s (smegen augliams, piktybinei melanomai ir kai ku rioms karcinomoms) gydyti; infekcinms ligoms (AIDS) gydyti;
kitom s ltinm s progresuojanioms ligoms (Parkinsono ligai) gydyti. 3. G eneratyvini lsteli gen terapija. Somatini lsteli gen terapija geno

funkcij pakeiia tik konkreiame audinyje (ir tik kai kuriose lstelse). Kitai kartai sergantysis perduoda savo mutavus gen. Pataisyt" gen perduoti palikuonims bt galima tik pakeiiant gamet genotipus, taiau tokiems eksperimentams ne pritaria daugelis genetik. 4. Atskira gen terapijos rimi galima laikyti genines vakcinas (dar vadinamas DNR vakcinomis). prastins vakcinos - tai nukenksminti (negyvi ar susilpninti) mikro organizmai arba tam tikri j paviriaus baltymai. Taiau negyv mikroorganizm bei baltym vakcinos sukelia tik antikn gamyb, o lstelin imunin atsak suadinanios gyvos vakcinos ne tik neapsaugo nuo ligos, bet dar ir susargdina mog. Imunizavimui taikant DNR, kurioje yra vienas ar keli atitinkamo patologinio mikroorganizmo genai, paties organizmo lstels (pakanka ir nedidelio j skaiiaus) ima gaminti io mikroorganizmo baltymus. Taip suadinamas lsteli imuninis atsakas be rizikos, kad susilpninta gyvoji vakcina susigrins patogenikum. Gen imunizacija skiriasi nuo kit gen terapijos metod tuo, kad kai kurias mogaus organizmo lsteles terpia mas ne normalus mogaus genas, o svetimas mikroorganizmo genas. Baimintis, kad jis pakeis mogaus genom, nereikia, nes gen turinias lsteles netrukus sunaiki na jo paties koduojamo geno suaktyvinta organizmo imunin sistema. Galima tiktis, kad artimiausiu laiku gen terapija bus vis plaiau taikoma pagal Mendelio dsnius paveldimoms ligoms ir daugeliui kit lig gydyti. I_ 2 k K la u s im a i 1. Kas yra gen terapija? 2. Kokios pagrindins gen terapijos rys?

K in ta m u m a s

1. Lsteli, audini a r o rgan transplantacija gali bti vertinama kaip tam tikras gen terapijos variantas, nes perkeltos lstels funkcionuoja kaip donoro ge notipai, besiskiriantys nuo recipiento genotipo. Transplantuojant pakeiiamas bal tymas (sunki kombinuoto imunodeficito liga), organas (inkstas - suaugusij inkst policistozs atveju), baltymas ir organ transplantacijos problema yra audini nesu derinamumas ir audinio atmetimas. 2. Som atini lsteli gen terapija. Tai papildomas genetins mediagos ter pimas, lstels modifikacijos, mutavusio geno pakeitimas normaliu genu. iuo atve ju atsiranda nemaai technini keblum. Kaip antai: a) terapinio geno perklimas pasirinktj audin, t. y. to audinio lsteles. Su prantama, kad taip paprastai genas lstel nels" ir nesiintegruos j jos genom. Btini gen perneimo vektoriai. Daniausiai jais tampa retrovirusai. Ypa sunku vykdyti gen terapij, kai reikia perkelti labai didel gen, nes jo kDNR netelpa prastinius vektorius. Reikia iekoti kit bd genui audinio lsteles perneti; b) tinkam audinio lsteli pasirinkimas gen perneimui. Tai gali bti kaul iulp lstels, odos fibroblast lstels. Ypa sunku perkelti genus nesidalijanias lste les (neuronus, kepen lsteles, raumen lsteles). iais atvejais vektori funkcijas atlieka adenovirusai arba Herpes simplex virusai. Kitas kelias - priversti tas lsteles dalytis; c) galinti perkeltj gen funkcionuoti pasirinktoje lstelje. Perkeltasis genas turi gaminti tiek produkto, kiek reikia - nei daugiau, nei maiau. Taigi btina inoti reikalingas geno terapines (kaip ir bet kuri vaist) dozes.

131

Jau suinojote, kaip veikia ir kaip paveldimi normals (t. y. lemiantys norm a lius organizm o poymius) genai. Antra vertus, suinojote ir tai, kaip genai bei chromosomos, kuriuose jie gldi, gali kisti dl mutacij. Taiau kaipgi veikia ir kaip paveldimi mutav genai bei chromosomos? Sutrikusi gen veikla dl pa i gen ar chrom osom pokyi daniausiai lemia alingus viso organizm o pokyius, t. y. paveldimsias ligas. Daugiausia ini sukaupta apie m oni

4
Paveldimosios moni ligos

paveldimsias ligas.

iuolaikins mogaus genetikos duomenimis, visos mogaus ligos tam tikru poiriu yra paveldimos, nes visos jos vienaip ar kitaip susijusios su gen veikla ir jos pokyiais. Todl ios srities specialist pagrindinis udavinys - nustatyti gen (genotip) jtak vienos ar kitos ligos atsiradimui. Akivaizdu, kad yra lig, kuri atsiradimui genetini veiksni jtaka beveik lygi nuliui. Taiau, antra vertus, yra lig, kurioms atsirasti asmens genotipas turi lemiamos reikms, t. y. gene tini veiksni taka yra absoliuti. Kasdieniniame gyvenime daniausiai susiduria me su paplitusiomis ligomis (pvz., ateroskleroze, padidjusiu kraujospdiu, bron chine astma ir kt.), kai paveldimas tik polinkis sirgti jomis. Antra vertus, tikrai paveldimos (t. y. paveldimosios pagal Mendelio dsnius) ligos daniausiai yra labai retos. Todl visuomenei beveik neinomos. Kiekvienos paveldimos ligos prieastis genetine prasme yra mutacija. Taigi mutacinis kintamumas, aptartas II dalies 1-ajame skyriuje, yra bdingas ir m o gui, kuris iuo poiriu nra jokia iimtis. mogui yra bdingos chromosom skaiiaus bei chrom osom struktros mutacijos, ir vairios gen mutacijos. U kiekvienos j slypi konkreti liga. ios ligos, kartu su visomis kitomis ligomis, klasifikuojamos pagal ta rp ta utin lig klasifikacij. Be to, yra atskiras pavel dim j lig katalogas (j sudar V. A. Makjuzikas (V. A. McKusick)) mogaus paveldjimas pagal M endelio dsnius"1. katalog galite rasti ir internete2. 2000-aisiais jam e buvo pateiktas apraas daugiau nei 5 000 ret lig, pavel dim pagal Mendelio dsnius. Pagal paveldjimo ypatum us skiriamos penkios pagrindins paveldimj lig grups: 1) chromosomins ligos; 2) m onogenins ligos (t. y. ligos, kuri prieastis yra vieno geno pokyiai): autosomins dominantikai paveldimos; - autosomins recesyviai paveldimos; su X chromosoma susijusios recesyviai paveldimos; su X chromosoma susijusios dominantikai paveldimos; susijusios su Y chromosoma; 3) mitochondrins ligos (t. y. ligos, kuri prieastis yra mtDNR mutacijos); 4) genetins somatini lsteli ligos (vys); 5) daugiaveiksns ligos (paplitusios ligos, kai yra paveldima ne pati liga, bet polinkis ja sirgti).

McKusick V. A. M endelian Inheritance in Man. 12th edition. A Catalog o f Human Genes and G en etic Disonders. B altim ore, London, The Johns Hopkins University Press. 1998. h ttp ://w w w .p re s s .jh u .e d u / p re s s /b o o k s /title s /f9 7 / f9 7 m c m e .h tm

r Pt Klausimai
1. Kaip m oni ligos susijusios su paveldjimu? 2. Kokios pagrindins paveldimj lig grups? Kokius inote i grupi lig pavyzdius?

4.1.
Chromosomins ligos

4.1 pav. mogaus genetikos centre atliekam a chrom osom analiz: A - lstels auginam os m gintuvlyje specialioje m itybinje terpje; B - chemikai apdorotos lstels ir chrom osom os analizuojam os stebint pro o p tin mikroskop

Pagrindinis i lig diagnozavimo bdas - tai kariotipo tyrimas. Chromosom analizei taikant j ruouotum o tyrim bei iuolaikinius citogenetikos metodus (FISH, chromosom tapym ar genom o lyginamj hibridizacij), galima nusta tyti ne tik vairius chromosom skaiiaus pokyius (poliploidij, aneuploidij), bet ir vairius j struktros persitvarkymus, tarp j ir mikroikritas. iuos chromo som persitvarkymus galima identifikuoti ne tik metafazinse chromosomose, bet ir interfaziniame branduolyje beveik visais lstels (lytins, somatins) arba bet kuriuo individo raidos periodu: iki zigotos implantacijos gimdos sienel (preimplantacin diagnostika), per bet kur embriono ar vaisiaus raidos etap (prenatalin diagnostika), kdikiui k tik gimus arba bet kuriuo vlesniu gyveni mo tarpsniu. Daniausiai analizuojamos kraujo lsteli chromosomos. Prie tai lstels auginam os specialiomis slygomis, o po specialaus apdo rojim o analizuojamos pro optin mikroskop (4.1 pav.). Patyrs gy dytojas gali diagnozuoti pagrin dines ios grups ligas ir pagal klinikinius simptomus, t. y. i fenotipinio chrom osom mutacijos pasireikimo. vairs chromosom pokyiai nu statomi 7,5 % vis pradt ntu m (t. y. embriono stadijoje). Jei chromosom mutacijos nesuderi namos su gyvybe, ntumas nu trksta savaime. Taigi vlesniuose embriogenezs etapuose chromo som mutacij danumas maja, ir jos nustatomos jau tik 0,75 % naujagimi, t. y. vienas naujagimis i 150-ies turi kokj nors chromosom struktros ar skaiiaus pokyt. Jei toki m utacij danum stebtume toliau, tai sitikin tum e, kad vieneri m et vaikams j nustatoma kur kas maiau, nes naujagimiai, turintys kai kuriuos chromosom persitvarkymus, mirta dar pirmaisiais gyvenim o metais. Lytini chrom osom aneuploidijos bna daniausios ir sudaro apie 33 % vis galim chrom osom struktros ir skaiiaus persitvarkym , auto som aneuploidijos 25 %, nesubalansuoti chrom osom struktros persitvar kymai - 8 %. Aneuploidijos yra daugiau nei 50 % savai mini persileidim prieastis.

4.1.1.
Chromosom skaiiaus pokyiai

vairs poliploidijos atvejai - triploid ijo s (3 n) 69, XXX; 69, XXY arba tetraploidija (4n) 92, XXXX - m ogui baigiasi savaiminiu vaisiaus praradim u (per sileidimu). Ji yra didels dalies m ogaus e m b rio n uvim o prieastis. Dl triploid ijo s (3 n) sta apie 20 % em brion ir vaisi. Tik iimties atvejais gali g im ti naujagimis, tu rin tis trig u b j chrom osom rinkin (3n). Taiau jis mirta vos tik gims. Dl tetrap lo idijos (4n) apie 6 % m ogaus em b rio n sta jau trim is pirmaisiais ntum o mnesiais. Vis to ki em brion, vaisi ir naujagi mi uvim gali n ulem ti vairios raidos anomalijos, atsiradusios dl ch ro m o som rinkini skaiiaus padidjim o. Aneuploidijos kur kas danesns. Naujagimiams daniausiai nustatomos trisomijos: 21-osios chromosom os (Dauno sindromas), 13-osios chromosomos (Patau sindromas), 18-osios chromosomos (Edvardso sindromas). 21-osios chro mosomos trisomija arba Dauno sindromas buvo pirmoji mogaus liga, kurios atveju 1959-aisiais J. Leenas (J. Lejeune) su bendradarbiais nustat chrom o som skaiiaus pokyt.

I chrom osom m onosom ij m onm s nustatoma tik X chromosom os monosomija (r. II dalies 4.1.3 skyri), taiau autosom m onosomijos labai retos. Iimtis yra 21-osios chromosom os m onosomija, kai vaisius igyvena iki gim i mo, taiau toks naujagimis negyvybingas. Tai liudija, kad autosom m onoso mija nesuderinama su gyvybe. Bene svarbiausia prieastis - tai, kad praradus vien hom ologin autosom kartu prarandami ir genai, kuri raika dl geno mo jspaudo (im printingo) (r. I dalies 3.4.2 ir II dalies 4.3.2 skyrius) yra monoalelin. Autosom monosomijos m ogui ypa pavojingos, nes neigyvena ne tik visas organizmas, bet daniausiai net ir atskiros monosomins lstels. Chrom osom skaiiaus m utacij prieastis yra chrom osom neatsiskyrimas per mejoz (aneuploidijos) arba vienos kiauialsts apvaisinimas dviem ar daugiau sperm atozoid (poliploidijos). Kai chromosom os neatsiskiria vykstant mitozei, organizmas tam pa mozaikiku, t. y. jam e susidaro vienas lsteli klonas, kuriame chrom osom skaiius normalus, o kituose klonuose chrom o som skaiius yra aneuploidinis. Gyvybingas vaisius susiformuoja ir tais retais atvejais, kai vienos homologins poros chrom osom os zigotoje yra gautos tik i vieno kurio nors tv, o antrasis i tv tos poros chromosomos zigotai i viso neperduoda. Tai v ien tv d is o m ija 1. jsidmtina, kad gali susiformuoti zigota, kurioje dvigubasis (2n) chrom osom rinkinys gautas tik i tvo, nes m otinos viengubasis chrom o som rinkinys (pronukleusas2) buvo prarastas. Tai v ie n t v d ip loidija. Tokie vaisiai negyvybingi ir sta dar iki gim im o. 21-osios chrom osom os trisom ija, D au n o sindrom as3 (4.2 pav.) - tai daniausia chrom osom aneuploidija, nustatoma naujagimiams. Turintys Dau no sindrom yra protikai atsilik, emo gio, sutriks j imunitetas (todl danai serga infekcinmis ligomis), sutrikusi klausa, neretai nustatoma ir gim toji irdies yda. Toki vaik labai savita veido iraika. Vidutinikai 85 % naujagi mi, kuriem s nustatytas ios ligos kompleksas, mirta pirmaisiais savo gyve nim o metais dl gim tosios irdies ydos. Kiti gyvena daug ilgiau: kartais iki 50-ties ir net daugiau m et. 91 % Dauno sindrom o atvej prieastis yra 21-osios poros chromosom neatsiskyrimas per mejoz form uojantis m otinos lytinms lstelms, o 5 % form uojantis tvo lytinms lstelms. Apie 4 % atvej nustatomos Robertsono translokacijos, kai papildom os 21-osios chromosom os ilgieji peiai per centrom er susijungia su kita akrocentrine chromosoma (r. 1.1 skyri). Dauno sindromas nustatomas vienam naujagimiui i 7 0 0 -8 0 0 gimusi. Jei Lietuvoje iuo metu per metus gimsta apie 40 000 naujagimi, tai, tarus, kad ios ligos danumas Lietuvoje yra 1 : 700, per metus tu r t gim ti 57 sergan tys vaikai (40 000 : 7 000 = 57).

1 34

'v ie n t v disomija yra viena i po ym i pa veldjim o ne pagal M endelio dsnius prieasi. P ron ukleusa i (a n g . p r o n u cleus < lot. pro... iki, prie, pirma (ko nors); ang. nucleus - bran duolys) - pirm iniai zigotos bran d u o lio d a rin ia i, d v ie j ly tin i lsteli (gam et) branduoliai, dar nevisikai susiliej prie susidarant naujos lstels branduoliui. Sindrom as (gr. s y n d ro m sankaupa) - pastovus p irm in i vystymosi yd derinys, atsirads dl vieno bendro etiologinio veiks nio poveikio; ligos sim ptom kom pleksas.

4 .2 pav. Dauno sindromas. Kairje D auno sindrom u sergantis berniukas (bdingi ioriniai poymiai: plokias veidas, m ongolidam s bdinga odos klost, pridengianti vidin vok plyio kamp (epikantas), didelis lieuvis, strias aki plyys). Deinje moters kariotipas, kuriame nustatyta 21-osios chrom oso mos trisom ija

4.3 pav. : - : : : ~ _ aneup oidijos :: ; , be nuo m otinos amiaus

4.4 pav.
i '. a r d s o sindromas. C M y e - naujagimis, kuriam * i^ i5 T .* a s is sindromas r e oriniai poymiai: - s s =: a : nis andikaulis, -a . .5 os ausys, _ kaueliai, : e:=s dl odos pertekliaus). Z< H - vyro kariotipas, j - s ~ e - js ta ty ta 18-osios r ; ~ : s : ~ o s : risomija

Dauno sindromu serganio vaiko gimimas tiesiogiai priklauso nuo motinos amiaus. Kuo motina vyresn, tuo didesn tikimyb pagimdyti iuo sindromu sergant vaik. Panai, nors maiau ireikta, priklausomyb nustatyta ir kit trisomij (13-osios ir 18-osios chromosomos) atveju (4.3 pav.). Kritiniu gimdyvs amiumi laikomi 35-eri metai. Nuo 35-eri visos niosios turt pasitikrinti, ar j neiojamo vaisiaus nepaeid kokia nors chromosom anomalija. Taigi joms reikt atlikti prenatalins diagnostikos tyrimus. Pastebtina, kad rizika trisomijai pasikartoti eimoje, kai moteris jaunesn nei 30-ties, o pirmajam vaikui nustatyta trisomija, yra apie 1 -2 %. Taigi labai maai tiktina, kad ir antrasis vaikas turs trisomij. Taiau btina sitikinti, ar bent vienas i tv nra subalansuotos translokacijos neiotojas. Tam reikia itirti j chromosomas ir nustatyti kariotip. Jei vienas i tv yra subalansuotos translo kacijos neiotojas, rizika susilaukti vaik, turini chromosom anomalij, labai padidja. U Dauno sindrom kiek retesns 18-osios ir 13-osios chromosom trisomijos Edvardso ir Patau sindromai. Palyginti dar danesnis yra Edvardso sindromas. 18-osios chromosomos trisomija, Edvardso sindromas (4.4 pav ). Turini sindrom kariotipe aptinkama papildoma 18-oji chromosoma. is sindromas taip pavadintas pirmojo j apraiusio D. Edvardso (J. Edwards) garbei. Toks sindromas nustatomas vienam i 3 500 naujagimi. Taiau ityrus embrionus po savaimini persileidim paaikjo, kad mintoji trisomija pasitaiko vienam i 500 embrion.

135

K in ta m u m a s

Taigi didioji vaisi, turini chromosom skaiiaus pokyt, sta dar iki gimi mo. Naujagimiams, sergantiems Edvardso sindromu, bdingas ypa sunkus proti nis atsilikimas ir daugins fizins raidos anomalijos. Dl gim tj irdies yd j m irtingumas ypa didelis. Tik kai kurie sergantieji ia liga igyvena ligi 20-ties. Daniausiai papildoma 18-oji chromosoma gaunama i motinos, kai per gametogenez vykstant antrajam mejoziniam dalijimuisi chromosomos neatsiskiria (r. II dalies 1.2 pav.). 13-osios chrom osom os trisom ija, Patau sindrom as (4.5 pav ). Sergan ij kariotipe aptinkam a papildom a 13-oji chromosom a. is sindromas pava dintas j apraiusio 1960-aisiais K. Patau (K. Patau) garbei. Toks sindromas nu statomas apytikriai vienam i 5 000 naujagimi. Sergantiesiems Patau sindromu bdinga daugyb dideli raidos anomalij, paeidiani iorinius ir vidaus organus. Tik 1 5 -2 0 % toki naujagim i igyvena iki vieneri met; 44 % i j mirta per pirmj gyvenimo mnes; 70 % - per pirmuosius eis mnesius. Daniausia mirties prieastis yra irdies yda. Igyven ligi pilnametysts (tai bna labai retai) bna protikai atsilik, turi daugyb raidos anomalij, danai yra kurti ir akli. 136

4 .5 pa v. Patau sindromas. Kairje - naujagimis, kuriam nustatytas is sindromas (bdingi ioriniai poymiai: dub smilkiniai, siauras tarpuakis, plokia nosis buku galu, nesuaugusi lpa). Deinje - m oters kariotipas, kuriam e nustatyta 13-osios chrom osom os trisom ija

1. Kokios yra mogaus chrom osom skaiiaus pokyi prieastys? 2. Kaip mogaus chrom osom skaiiaus pokyiai susij su m otinos amiumi? 3. Koki autosom skaiiaus pokyiai nustatom i naujagimiams? Kokias ligas jie lemia?

4.1.2.
Struktriniai mogaus chrom osom persitvarkymai
Pagrindiniai chrom osom struktros pokyi tipai aptarti II dalies 1.1.2 sky riuje. moni populiacijose jie pasitaiko palyginti danai: 1 i 500 naujagimi turi koki nors chrom osom struktros anomalij. Visi chromosom struktros persitvarkymai susidaro vykus chromosom trkiams. Beveik visos galimos chrom osom struktrins mutacijos - translokacijos, ikritos, apgros ir kt. - nustatytos ir mogui. inomi keli sindromai, kuriuos lemia mogaus chrom osom struktros po kyiai: kats kniaukim o" sindromas, Volfo ir Hirhorno sindromas ir kt. 5 p- (kats k n iau k im o ") sindromas. Tai pirmasis autosom sindromas, kurio atveju buvo nustatyta ikrita. Kartu tai pirmasis sindromas, susijs su chrom osom struktros pokyiais, diagnozuotas Lietuvoje (1974-aisiais). Ser gantiems iuo sindromu vaikams (4.6 pav.) bdingas apskritas (mnulikas") veidas, gimtosios irdies anomalijos, j verksmas panaus kats kniaukim (toks ir sindrom o pavadinimas). J turintys vaikai stipriai protikai atsilik. Dau geliu atvej nustatoma nauja ikrita 5-sios chromosom os trum pajam e petyje.

M ikroik rit sindrom ai. Taikant molekulins citogenetikos metodus buvo nustatyta, kad kai kurie sindromai yra susij su labai nedidelmis chromosom ikritomis. Jie buvo pavadinti mikroikrit sindromais. M anom a, kad ios mikroikritos, nors yra maesns u 4 milijonus nukleotid por, vidutinikai ap ima kelis genus. Todl negali bti priskiriamos gen mutacijoms. Mikroikritos sujungia genotip keiianias vairi tip mutacijas vien eil pagal dyd, upil dydamos tarp ta rp optiniu mikroskopu m atom chrom osom struktros po kyi ir gen mutacij. 2000-aisiais buvo inomi jau penkiolika ios grups sindrom . Juos tiksliai d ia g n o zu o ti galima tik ta ik a n t genetinius zondus, yminius tam tikr nukleotid sek chromosomoje. Daugeliui mikroikrit sindrom bdingas serganiojo protinis atsilikimas ir didesns ar maesns gimtosios raidos anomalijos. Tai priklauso nuo ikritos dydio. Kaip ios lig grups pavyzdiai daniausiai pateikiami Praderio ir Vilio ir Angelm ano sindromai. DNR analizs metodais rodyta, kad apie 70 % pacient, kuriems nustatyti ie sindromai, bdinga nedidel ikrita 15-osios chromoso mos ilgojo peties q 11 q 13 srityje. Molekuliniai genetiniai tyrimai paliudijo, kad Praderio ir Vilio sindrom o atveju liga susijusi su SNRPN geno, koduojanio smegenyse funkcionuojant baltym, aktyvum o praradimu. Antra vertus, A n gelm ano sindrom o atveju, nors prarandama ta pati 15-osios chromosomos dalis, ligos fenotip lemia UBE3A geno, koduojanio tam tikr ferm ent, pra radimas. Ta pati mikroikrita slygoja du skirtingus sindromus dl genom o spaudo (im printingo) (r. I dalies 3.4.2 ir II dalies 4.3.2 skyri). Praderio ir Vilio sindromas nustatomas vienam i 15 000 naujagimi. I pra di vaikas atrodo ir elgiasi normaliai. Nuo dvej m et amiaus atsiranda elgse nos sutrikim ir isivysto didiulis niekaip nepatenkinamas apetitas. Todl vaikas labai nutunka. Jis ima vogti maist, valgo nemaistinius produktus, inaro imes tas konserv ir grim skardines. Tvams tenka urakinti aldytuv, indaujas, kur laikomi maisto produktai. Yra ir kit nekontroliuojam elgsenos problem: iaurumo protrkiai, staigus niris (inomi atvejai, kai ligoniai net padega savo namus). Todl sergantieji Praderio ir Vilio sindromu turi bti nuolat priirimi. Angelmano sindromas pasitaiko reiau - serga vienas i 25 000 gimusij. Li gos simptomai pradeda reiktis sulaukus vieneri met (prasideda traukuliai). Ser gantiems vaikams bdingas protinis atsilikimas, jie danai be prieasties juokiasi. Todl is sindromas kartais dar vadinamas laimingos lls" sindromu. inomi ir kiti su chrom osom m ikroikritomis susij sindromai. Tikimasi, kad netolim oje ateityje bus nustatytos j prieastys, dalis j tikriausiai bus vieno ar keli gen ikritos.

4.6 pav. M ergait, tu rin ti kats kniaukim o" sindrom. Bdingi ioriniai sindrom o poymiai: plokias veidas, migdolinis aki plyys, plokia nosies nugarl, epikantas, maas apatinis andikaulis

1. Koki tip chrom osom struktros pokyiai nustatom i m ogui? A r yra tik m ogui bding pokyi? 2. Kokius inote mogaus chrom osom struktros pokyi pavyzdius? Ko kias ligas jie lemia?

4.1.3.
Lytini chrom osom skaiiaus ir struktros pokyiai
Didiul X chromosoma sudaro apie 10 % viso mogaus genom o, o Y chro mosoma yra viena maiausi mogaus kariotipe. Jai bdingas didelis vairavimas, kur lemia ios chromosom os heterochromatinas. Y chrom osom oje nustatyta tik apie 30 m o g au s gen. M oter somatini lsteli interfaziniame branduolyje aptinkamas vadinama sis Baro knelis (4.8 pav., B), kurio nebna normalaus vyro lstelse. Tai inaktyvinta viena i dviej X chromosom (r. I dalies 3.4.2 skyri). Baro kneli skaiius mogaus dvigubajame chromosom rinkinyje rodo X chromosom skai i: jei X chromosom dvigubajame rinkinyje yra n, tai Baro kneli visada yra (n - 1). Todl X chromosomos aneuploidijos (ir trisomijos (ar net daugiau X), ir monosomijos) bei struktros pokyiai kur kas maiau pavojingi individo gyvybin gum ui nei autosom aneuploidijos.

4.7 pav. Klainfelterio sindromas. Kairje sergantis vyrikis (bdingi ioriniai poymiai: padidj krtys, apknum as); deinje kariotipas 49, XXXXY

4 .8 pav. Triplo X sindromas A - serganti mergait; B - toki pacieni lsteli interfazinis branduolys, kuriam e m atyti du baro kneliai - neveiklios X chrom osom os (paymtos rodyklmis); kai yra dvi X chrom osom os, branduolyje bna tik vienas Baro knelis

Lytini chromosom skaiiaus padidjimas bdingesnis vyrikosios lyties asme nims. Kariotipas 47, XXY, kuriame yra viena X chromosoma per daug, nustato mas sergant K lain felterio sindrom u. Jo danis - vienas atvejis 800 gimusi berniuk. iuo sindrom u sergantys vyrai nevaisingi ir turi lytins raidos sutri kim, jiems kyla m okym osi ir elgsenos visuomenje problem . Galimas ir kitas vyrikojo ka riotipo variantas, kai nustatom a daugiau Y chrom osom arba daugiau ir X, ir Y chrom osom . Pavyzdiui, trys papildom os X ch ro m o somos, t. y. 49, XXXXY (4.7 pav.). Pasitaiko atvej, kai ne tik vyras, bet ir moteris turi per daug X chromosom . Tai trip lo X sindrom as (4.8 pav., A). iuo atveju kariotipas yra 47, XXX. Toki m oter lsteli interfaziniam e branduolyje nustatom i du Baro kneliai (4.8 pav., B). Triplo X sindrom o danis yra 1 : 1 500 gim usi mergaii. Toki m ergaii ir m ote r fizin raida daniausiai norm ali, o intelekto sultjusi. Taigi sunkiau sekasi mokytis. Tiriant gyvus asmenis nepasitaik atvej, kad kariotipe tr k t kurios nors autosomos, o analizuojant X chromosomas toks reikinys - kariotipas 45, X0 nustatomas palyginti danai. Tai T ern e rio sindrom as (4.9 pav.). Jis nustato mas vienai mergaitei i 2 500 gyv gimusi. Dauguma toki mergaii esti emo gio, kartais bna nevaisingos ir turi lytins raidos sutrikim. Joms da nai nustatomas kaul iretjimas ir irdies bei kraujagysli ligos. Autosom ir lytini chrom osom skaii interfaziniame branduolyje galima nustatyti molekulins citogenetikos metodais (4.10 pav.). Tai padaryti galima iki ir po gim imo. Taigi dvi mogaus genetikos akos - m olekulin genetika ir citogenetika kelet deimtmei vystsi lyg ir atskiromis kryptimis, o XX amiaus pabaigoje jos susijung j m olekulin citogenetik.

4.9 pav. Ternerio sindromas. Kairje - moteris, kuriai nustatytas is sindromas (bdingi ioriniai poymiai: neisivyst antriniai lyties poymiai); deinje - kariotipas 45, X0

45,X0

Naudoti genetiniai zondai


13-oji chromosoma 21-oji chromosoma 18-oji chromosoma X chromosoma Y chromosoma

4 .1 0 pav. Interfazinio lstels brandu olio autosom ir i t n j chrom osom skaiiaus nustatym as molekulins ato gen etikos (FISH) bdu. Tirtos dviej asmen chromosomos. T y r im o i v a d o s : ' p-"^asis tiriam asis asmuo yra norm alus vyrikosios lyties individas; 2 a-trasis tiriamasis asmuo yra moterikosios lyties ' 3 . nas, sergantis Dauno sindromu

Pirmasis asmuo

------ 13 * 21

Kariotipas 46, XY

Antrasis asm uo

.A ,

le-j 4}
D

Kariotipas 47,X X ,+21

4.2.
Monogenins ligos

M onogeninm is vadinamos ligos, kurias lemia vairios v ien o g en o mutaci jos. M u tu o ti gali genai, esantys ir autosomose, ir lytinse chromosomose. J paveldjim kart sekoje pagrindia chromosom , kuriose jie isidst, pasi skirstymas dukterinse lstelse. Btent m onogenini lig atveju akivaizdiau siai pasireikia M endelio dsniai. Tai poymi ir atitinkam juos lemiani alelini gen dominavimas ir recesyvumas bei j skilimo dsni raika. Dominavimas arba recesyvumas pasireikia nepriklausomai nuo to, ar po ym lemiantis alelinis genas yra a u to so m o je, ar ly tin je chrom osom oje Todl m onogenins ligos pagal paveldjimo tipus taip pat skirstomos dom i nantikai paveldimas ir recesyviai paveldimas. Kadangi vyr kariotipe yra tik viena X chromosoma, tai joje esani gen lemiami poymiai pasireik visada (hem izigotin padtis). Moters kariotipe yra dvi X chromosomos, todl tursi me t pai dom inavim o ir recesyvumo sveik kaip ir autosom atveju. Su prantama, kad genai, esantys Y chrom osom oje (taigi ir su j m utacijomis susijusios fe no tipo padtys), visada bus paveldimi tik vyrikja linija, nes juos tvas perduoda tik snums.

l_2l K la u s im a i
1. Kokios ligos vadinamos monogeninmis? 2. Kokios yra pagrindins m onogenini lig grups?

4.2.1.
Autosom ins dom inantikai oaveldimos ligos
Daugiau nei pus jau aprayt paveldim j lig yra a uto so m in io dom in a n tin io tip o . 4.11 paveiksle pateiktas tipikas a uto so m in io d o m in a n tin io paveldjim o genealoginis medis (r. p. 140). paveldjim o tip galima sivaizduoti ta ip. Tarkime, kad A yra dom in an tin poym lem iantis alelinis genas, o a - alterna tyv recesyvin poym lem iantis alelinis genas. Kadangi A genas d o m in u o ja a geno a tvilgiu, tai A gen tu rin tys individai (ir h o m o z ig o tin ia i A A , ir hete ro zigo tinia i Aa) turs d o m in a n tin j poym . Daniausios m on i santuokos yra Aa x aa. Tokiu atveju p irm o jo s u tu o k tin io lytins lstels bus dviej tip , t. y. turs arba A, arba a alel, o a n tro jo s u tu o k tin io visos lytins lstels turs tik a alel.

I: 1

I: 2

O r
II: 1

O
II: 3 II: 4 II: 5 II: 6

o
II: 7 II: 8 II: 9

: 10 r i 1 :11 1
11:12

o 11:13

-d
II: 14

r o 2 ]
III: 1 II: 2 III: 3 II: 4

t o
III: 5

O t O t O r i
III: 6 III: 7 II: 8 III: 9 II: 10 III: 111II: 12

: 13 III: 14

O r i ( > T - r O O r i : 15 III: 16 111:17 III: 18 III: 19 III: 20 111:21 III: 22 2 3 III: 2 4 III: 25 III: 26III: 27

II:

A tO 1

IV
IV: 1

IV: 2 y/: IV: 3

7'IV: 4
IV: 5 IV: 6 IV: 7 IV: 8 IV: 9 IV: 10 IV: 11 IV: 12 IV: 13 IV: 14 IV: 1 5 IV: 16 IV: 17 IV: 18

4.11 pav. Probando, serganio autosom ine dom inantikai paveldima liga, eimos genealoginis medis

Galimi keturi lytini lsteli deriniai. Taiau ioje santuokoje gimusi vaik ge notipai bus tik dvejopi (4.12 pav.): 1/2 (50 %) Aa (dom inantin poym tu rin tys vaikai) ir 1/2 (50 %) aa (recesyvin poym turintys vaikai). Jei eimoje gim ini santuok nebuvo, o kiekvienoje genealogijos kartoje pasitaiko t pat poym turini vyr ir moter, labai tiktina, kad is poymis paveldimas autosom iniu dom inantiniu bdu. Konkretus pavyzdys galt bti genealogija, pateikta 4.11 paveiksle. ioje genealogijoje probandas-yra IV kar tos ketvirtasis asmuo (IV: 4). Pervelgus genealogij matyti, kad tiriamasis poymis bdingas ir vyrams, ir moterims. Taigi jis neturt bti susijs su lytimi (t. y. su X arba Y chromosoma). Probandas savo poym paveldjo i m otinos III: 5, ji - i savo tvo II: 4, o is - i savo m otinos I: 1. Analogikai galima nustatyti poymio paveldjim i ankstesni kart ir kitose genealogijos ako se (pvz., asmenys IV: 8 ir IV: 9, IV: 14 ir IV: 15). Visi ie asmenys tiriamj poym paveldjo i savo prosenels I: 1. Koks paveldjimo bdas ia galt bti? Pirmiausia, kaip jau buvo m inta, poym lemiantis genas yra autosomoje, nes j tu ri ir vyrai, ir moterys. Antra, poymis tu ri bti dom inantinis, nes jis pasireikia kiekvienoje kartoje. Be to, ioje genealogijoje nra n vieno as mens, turinio analizuojamj poym, kurio n vienas i tv tokio poymio neturt. Ikeliame hipotez, kad tiriamasis poymis yra autosominis dom i nantinis. Taigi vis j turini asmen (uspalvinti genealoginio medio simbo liai) genotipas yra arba heterozigotinis (Aa), arba dom inantinis hom ozigotinis (AA), o vis jo neturini asmen (neuspalvinti genealoginio medio simbo liai) genotipas yra recesyvinis hom ozigotinis (aa). Dabar turim e patikrinti, ar i hipotez tinka kiekvienam konkreiam genealogijos nariui. Visas aikinimas turi atitikti m onohibridinio krym inim o rezultatus, kai tiriam e dom inantinio alelinio geno ir jo lem iam o fe n o tip o paveldjim. Kaip rodo patirtis, daniausiai dom inantin poym turintys asmenys bna heterozigotiniai. Ms nagrinjamoje genealogijoje probando IV: 4 genotipas tu r t bti Aa. Jo sesers IV: 3 genotipas tu r t bti aa (ji neturi tiriam ojo poymio, taigi turi bti hom ozigotin pagal recesyvin alelin gen). J motina III: 5, tu rin ti poym, tu r t bti heterozigotin (Aa), o poymio neturintis tvas III: 6 - hom ozigotinis pagal recesyvin alelin gen (aa). Taigi akivaizdu, kad vyko analizuojantysis m onohibridinis kryminimas. Todl tv III: 5 ir III: 6 vaikai pagal fenotip tu r t pasiskirstyti santykiu 1 : 1 . Taip ir yra: snus IV: 4 turi dom inantin poym, o dukt IV: 3 - recesyvin poym. i konkreti eima atitinka 4.12 paveikslo schem. Analizuodami kitus asmenis, galime vienareikmikai pasakyti, kad visi neu spalvinti simboliai ymi asmenis, homozigotinius pagal recesyvin gen (aa), o visi uspalvinti - heterozigotinius asmenis (Aa). Kadangi tiriamj poym lemia domi nantinis A genas, tai poymis pasireikia heterozigotinio genotipo atveju. Galima abejoti tik dl I: 1 moters, nes neinome, kokie buvo jos tvai. Taiau jos genotip galima nuspti i vaik genotip. Jei i moteris bt homozigotin pagal domi nantin tiriamj poym (AA), tai visos jos lytins lstels turt dominantin A alel. Taigi ir visi jos vaikai turt tok alel gauti. Taiau, kaip matyti i genealogijos, kai kurie 1:1 moters vaikai (II: 2, II: 5, II: 14) tokio poymio neturi - negavo A alelio.

A

50%

TVAI

X
GAMETOS

(A) ( a )

v * ,

50%

( ^ ) - poymis pasireikia - poymis nepasireikia

4 .1 2 pav. Paveldjimas eimoje: a utosom inio dom inan tinio paveldjim o schema

Tai patvirtina, kad i moteris tikrai yra heterozigotin (Aa) tiriamj poym le mianio geno atvilgiu. ioje genealogijoje beveik visos santuokos tarp asmen, turini tiriamj poym, ir tokio poymio neturini asmen (pvz., 1:1 x I: 2 ir kt.) yra analizuojaniojo monohibridinio kryminimo pavyzdiai. Dominantinio po ymio, kurj lemia autosominiu dom inantiniu bdu paveldimas genas, atveju to kios santuokos bna daniausios. Konkreioje eimoje nerealu tiktis gauti tikslius palikuoni isiskyrimo pa gal poymius santykius, kokius nustat G. Mendelis, nes vaik skaiius papras tai yra ribotas: Lietuvoje - daniausiai vienas ar du vaikai. Kai vaikas tik vienas, nemanoma nustatyti koks yra poymio pasiskirstymo dsningumas toje ei moje. Taiau Mendelio dsniai leidia vertinti tikim yb, kad gims vaikas, tu rin tis dom inantin poym. Antra vertus, jei mus domina, kaip koks nors poymis paveldimas apskritai, o ne konkreioje eimoje, galima tirti daugyb eim ir skaiiuoti tiktinas as men, turini tam tikrus fenotipinius poymius, skilimo proporcijas. Kelios autosomins dominantikai paveldimos ligos pateiktos 4.1 lentelje.

4.13 pav. Kaul tra p u m o liga (osteoge nesis im perfecta) sergantis berniukas. Dl kaul li jo kojos stipriai deform uotos

4.1 len tel. A u to so m in s do m in a n ti k a i paveld im os ligos

Liga Hantingtono liga Miotonin distrofija Kaul trapumo liga (osteogenesis imperfecta) (4.13 pav.) eimin hipercholesterolemija Retinoblastoma Anksti prasidedantis krt ir kiauidi vys eiminis storosios arnos vys Neurofibromatoz

Kolagenas Mao tankio lipoproteinas pRb BRCA1 APC Neurofibrominas

1:10 000
1:500 1:15 000

1:200
1:7 000 1:4 000

4.2.2.
A utom osins recesyviai paveldimos ligos
M adaug tredalis vis lig, paveldim pagal M endelio dsnius, yra autoso mins recesyviai paveldimos. Taigi jas lemiantis alelinis genas, susidars m uta vus normaliam genui, yra recesyvinis ir lokalizuotas autosom oje (4.2 lentel).

4.2 len tel. D aniausiai p a te ik ia m i au to s o m in iu recesyviai p a veld im lig p a vyzd iai

Ligos 1. Pjautuvin anemija 2. Cistin fibroz (mukoviscidoz) 3. Tjaus ir Sakso liga 4. Goe liga 5. Fenilketonurija

TVAI

A
(a )
1 4 (25%)

GAMETOS

A
1/4(25%)

(a )

Dl geno mutacijos pakits baltymas (3 globinas Transmembraninj pralaidu m reguliuojantis baltymas Heksoaminidaz A P gliukozidaz Fenilalaninhidroksilaz Adenozindeaminaz

Ligos danis 1:650 (JAV juodaodiai) 1:2 500 (europieiai) 1:3 000 (ydai akenaziai) 1:600 (ydai akenaziai) 1:10 000 (Centrin ir Ryt Europa) Ypa reta

S
1/2 (50%)

6. Sunkaus kombinuo to imunodeficito liga

O O

- poymis pasireikia - poymis nepasireikia

4 .1 4 pav. Paveldjimas eimoje. A utoso m inio recesyvinio caveldiim o schema

Tarkime, kad A yra dom inantinis alelinis genas, lemiantis dom inantin po ym, o a - recesyvin poym lemiantis recesyvinis alelinis genas. Recesyvin poym turs tik hom ozigotiniai pagal recesyvin gen individai (aa) ir tokie asmenys sirgs. Tokie individai daniausiai gimsta tvams, kuri genotipas io geno atvilgiu yra heterozigotinis (Aa). Toki sutuoktini lytins lstels bna dviej tip - A ir a. Todl galimi keturi j deriniai. O i tokios santuokos gimusi vaik genotipai bus trys: 1 /4 (25 %) AA , 1/2 (50 %) Aa ir 1 /4 (25 %) aa (4.14 pav.). Recesyvinis poym is pasireik tik aa g enotipo atveju. A u to sominio recesyvinio paveldjimo pavyzdys pateikiamas 4.15 pav. (r. p. 142).

K in ta m u m a s

Dl geno mutacijos pakits baltymas Hantingtinas Proteinkinaz

Ligos danis

141

1:10 000 1:10 000

K galime pasakyti pavelg j j genealogin med? Probandas - berniukas IV: 1 turi mus d om inant poym. Tok poym turi ir jo sesuo IV: 3, taiau nei tvai (III: 3 ir III: 4), nei kiti gimins jo neturi. Taigi poymis pasireik tik vienoje kartoje. Kaip iuo atveju pritaikyti M endelio dsnius? Prisiminkime monohibridin kryminim , kai krym inant heterozigotinius (Aa) F, hibridus j palikuonys (F2) pagal fenotipinius poymius isiskiria santykiu 3 : 1, t. y. trys dalys palikuoni turi dom inantinj poym, o viena dalis - recesyvin poym, kurio neturi n vienas tv (F,). Analizuodam i 4.15 paveiksl, galime tarti kaip tik to k tiriam ojo poymio paveldjimo bd. Tai, kad ms atveju vaikai pagal poymius isiskyr santykiu 1 : 1, o ne 3 : 1, yra ne prietaravimas M endelio dsniui, o nukrypimas dl pernelyg mao vaik skaiiaus eimoje. Taigi probando IV: 1 genotipas tu r t bti aa, nes tik iuo atveju mus dom i nantis poymis pasireik. I genealogijos matyti, kad poym turi ir probando sesuo IV: 3. Jei poym lemiantis genas bt X chromosom oje, j tu rin ti mergait vien tok gen tu r t gauti su X chromosom a, paveldta i tvo. Taigi tvui is poymis taip pat tu r t bti bdingas (nes tvas bt hemizigotinis m intojo geno atvilgiu). Kadangi tvas tiriam ojo poym io neturi, galime galvoti, kad poym lemianio geno nra nei X, nei Y chrom osom oje (t. y. genas yra autosomoje), o savo prigim tim i jis yra recesyvinis. Todl ir probando sesers IV: 3 genotipas tu ri bti aa. Tiriamojo poymio neturintys i vaik tvai III: 3 ir III: 4 turi bti heterozigotiniai (Aa) recesyvinj poym lemianio alelinio geno neiotojai, kaip ir j tvai (II karta) ir bent vienas seneli (I karta). Kokie yra kit ios genealogijos nari genotipai, vienareikmikai sprsti nega lima. Pastebtina, kad probando tvai yra gimins (pirmosios eils pusbrolis ir pusseser). Apie gim ini santuokas dar bus kalbama 6.1 skyriuje.

4.1 5 pav. Probando, serganio autosom ine recesyviai paveldima liga, eimos genealoginis medis

c/ d
Pagrindiniai autosom ini recesyviai p aveld im lig kriterijai

1. Serganiojo tvai daniausiai bna sveiki. 2. Jei abu sutuoktiniai yra sveiki heterozigotiniai lig lemianio mutavusio geno neiotojai, ligos perdavimo palikuonims tikimyb yra 25 %. Taigi tikimyb, kad vai kas gims sveikas, yra 75 %. 3. Jei serga abu tvai, turi sirgti ir visi j vaikai. 4. Vyrai ir moterys serga vienodai danai. Sergant daugeliu paveldim j m ediag apykaitos lig, kuri paveldji mas yra autosom inis recesyvinis, daniausiai vienas i vyraujani sim ptom yra protinis atsilikimas (skirtingo lygio, gali bti ir labai sunkus). Panagrinki me fe n ilk e to n u rij - vien i Europoje ir Lietuvoje palyginti daniausi au to som ini recesyviai paveldim m ediag apykaitos lig, kurios pagrindinis sim ptom as yra protinis atsilikimas. Jis isivysto tada, kai liga negydom a arba pradedam a gydyti per vlai (daniausiai dl per vlai nustatytos diagnozs). i lig diagnozavus ir pradjus gydyti specialia dieta dar iki 3-iojo gyvenim o mnesio, rezultatai bna geri - auga fenotipikai norm alus asmuo. Tiesa, jo g e n o tip o (aa) gydymas dieta nepakeiia. Fenilketonurij lemia padtis, kai ferm entas feniialaninhidroksilaz (FAH) praranda savo funkcij ir nebegali katalizuoti aminorgties fenilalanino virtim o am inorgtim i tirozinu (r. 3.20 pav.). Todl organizm e susidaro fenilalanino perteklius ir kaupiasi kiti jo apy kaitos p roduktai, kurie negydant ligos galiausiai slygoja sunk serganiojo p ro tin atsilikim. U FAH sintez atsakingas FAH genas yra 12-osios chro m o som os ilgojo peties q 2 2 - q 2 4 segm ente. is genas apim a 90 000 n u k le o tid por, o jo b altym koduojani dalj sudaro 13 egzon. Nuo jo nuraom a 2 4 0 0 nu k le o tid iRNR m o le ku l . Taigi akivaizdu, kad k o d u o ja n io ji FAH g e n o da lis n e t 27 k a rtu s t r u m p e s n u vis g e n o ilg. FAH gene n u s ta ty ti keli im tai vairaus tip o m u ta c ij : i krit , n u k le o tid p a ka it , ska itym o rm e lio p oslinkio, iRNR su kirpim o vietos ir kitos m utacijos. A n a lizu o d a m i atski ras geno dalis sitikinsim e, kad vienose m uta cij p alygin ti nra daug, kai tu o ta rp u 6-ajame, 7-ajame ir 11-ajame egzone j n usta tyta ypa daug.

Kadangi fenilketonurija sergantis asmuo yra hom ozigotinis lig lemianio mu tavusio FAH geno alelio atvilgiu (aa genotipas), tai jis tur t bti homozigotinis ir pagal pai mutacij. Pavyzdiui, jei tokia mutacija yra nukleotido pakaita 12-ajame egzone, slygojanti polipeptidins grandins 408 aminorgties arginino pakeitim tripto fa nu (tokia mutacija uraoma R408VV - r. vienaraid aminorgi ymjim I dalies 1.16 pav.), serganiojo genotipas uraomas taip: R408W /R408W . Kaip jau minta, R408VV mutacijos atveju aminorgties pakaita FAH polipeptidinje grandinje atsiranda dl nukleotido pakaitos - pirmasis FAH geno 408 kodono nukleotidas C pakeiiamas j T. Istudijuokime FAH geno frag m en t (12-jj egzon), koduojant baltym o dal nuo 405 iki 415 aminorgties: Normali FAH geno 12-ojo egzono nukleotid seka Polipeptidins grandins 405 Thr aminorgtis Kodonas ACA R408VV mutacija ACA Thr 405 V 410 415 lle Pro Arg Pro Phe Ser Vai Arg Tyr Asp Pro ATA CCT CGG CCC TTC TCA GTT CGC TAC (pAC CCA 4' ATA CCT TGG CCC TTC TCA GTT CGC TAC GAC CCA lle Pro Trp Pro Phe Ser Vai Arg Tyr Asp Pro 410 415 >

Daniausiai tokia mutacija nustatoma abiejose 12-ose serganiojo fenilketo nurija chromosomose. Nustatyta, kad tam tikras fenilketonurij lemiani FAH geno mutacij rinkinys skirtingose populiacijose gali bti skirtingas. Lietuvos populiacijoje nustato mos FAH geno mutacijos, bdingos Ryt Europos, taiau neaptinkam os Piet ir Vakar Europos populiacijose. Kaip jau buvo minta, kai kurios autosomins recesyviai paveldimos ligos tam tikrose populiacijose pasitaiko daniau. Taip yra dl to, kad tose populia cijose ypa iplito kai kurios lig lemianios mutacijos (4.3 lentel). Tai rodo i populiacij genetins struktros ypatumus.
4.3 le n te l . A u to so m in s recesyviai p a veld im o s ligos, b u d in go s ko nkreiam g e o g ra fin ia m regio nu i

Liga a Talasemija (3 Talasemija Cistin fibroz Gliukozo-6-fosfatdehidrogenazs stoka gimtoji nefroz Adrenogenitalinis sindromas Tjaus ir Sakso liga

Geografinis regionas arba populiacija, kur ia liga sergama daniausiai Pietryi Azija Viduremio jros alys ir Pietryi Azija iaurs Europa Italija, Graikija, Afrikos alys Suomija Aliaskos eskim populiacija yd akenazi populiacija

4.2.3.
Su X chrom osom a susijusios dom inantikai ir recesyviai paveldimos ligos

Su X chromosom a susijs paveldjimas skiriasi nuo autosom inio tu o, kad genai, lemiantys poymius (taip pat ir ligas), yra X chromosom oje. Kadangi moterys tu ri dvi X chromosomas, o vyrai tik vien, tai d om inantinio ir recesyvinio paveldjimo atveju padariniai eimose yra skirtingi. Tvas savo X chrom o som perduoda tik dukterims, o m otina - ir dukterims, ir snums. Su X chrom osom a susijs recesyvinis paveld jim as. Tokio paveldjimo pavyzdys pateikiamas 4.16 pav. Turintis mus d om inant poym probandas yra 4-os kartos 5-asis asmuo (IV: 5). Jo antros eils pusbrolis IV: 1 taip pat tu ri poym. Akivaizdu, kad abu berniukai j paveldjo i savo m otin puss seneli II: 4 ir II: 6, nes pastarj brolis II: 1 tok poym turjo. Kadangi ioje genealo gijoje poym turintys asmenys buvo tik vyrai, todl poymis tu ri bti susijs su viena i lytini chrom osom (X arba Y). Taiau i genealoginio medio matyti, kad poym berniukai galjo paveldti tik i m otin ir seneli (m otin motin).

4.1 6 pav. Probando, serganio su X chrom osom a susijusia recesyviai paveldima liga, eimos genealoginis medis

Taigi poym lemiantis genas negali bti isidsts Y chromosomoje. Belieka X chromosoma. Poymis pasireik ne kiekvienoje kartoje (pasireik II ir IV kartose, o I ir III kartose nepasireik), todl galima manyti, kad poym lemiantis genas paveldimas recesyviniu bdu. Juo labiau, kad jis buvo perduodamas tik tarp pro bando motinos gimini. Norint tiksliai vertinti paveldjimo bd, reikia surayti genotipus asmen, turini analizuojamj poym, ir t asmen, kurie btini po ymio paveldjimo tiriamoje eimoje eilikumui paaikinti. Kadangi darme prielaid, kad tiriamasis poymis tu ri bti recesyvinis, o j lemiantis genas yra X chromosom oje, tai probando IV: 5 genotipas tikrai yra X rY. Probando m otina III: 7 turi bti io geno neiotoja, t. y. jos genotipas XR Kadangi vienoje jos X chrom osom oje yra dom inantinis alelinis R genas, Xr. recesyvinis poymis nepasireikia. Probando tvas III: 8 tiriam ojo poymio ne turi, todl jo genotipas tu ri bti XR Probandas i tvo gavo Y chromosom, o Y. i m otinos - X chromosom , turini recesyvin poym lemiant gen, t. y. Xr. Lygiai ta ip pat yra tiria m j poym tu rin io p robando antros eils pusbrolio IV: 1 atveju: jo m otina turi bti recesyvinio geno neiotoja XR Poym tu rin Xr. i berniuk m otinos III: 1 ir III: 7 X chrom osom su recesyviniu aleliu r (Xr) turjo paveldti i savo m otin II: 4 ir II: 6, kurios irgi yra io alelio neiotojos (XR Xr). Tuo labiau, kad jos turi brol II: 1 su fenotipikai ireiktu poymiu (t. y. jo genotipas turi bti XrY). Taigi II kartos asmen tv (probando proseneli) I: 1 ir I: 2 genotipai bus tokie: I: 1 - XR I: 2 - X R Analogikai galime parayti Y, Xr. ir kit ios genealogijos nari genotipus. Vis kit vyr genotipus (pagal ma tom fenotip, t. y. tiriam ojo poym io nebuvim jie yra sveiki) galima urayti vienareikmikai - XR Taiau remiantis tik genealogija moter, tiesiogiai ne Y. susijusi su vyrais, turiniais ireikt poymj, genotipus galima tik splioti XR ar XR . Antai probando seserys IV: 6 ir IV: 7 gali bti poym io heterozi Xr XR gotins neiotojos (XR Xr), bet gali ir neturti j lemianio recesyvinio alelinio geno (XR ). Tiksliai nustatyti j genotipus galima tik atlikus atitinkam gen XR m olekulinius genetinius tyrimus.

r o
Pagrindiniai su X chromosoma susijusi recesyviai paveldim lig kriterijai

1. Daniausiai serga tik vyrai. 2. Visi serganio asmens tvo gimins yra sveiki. 3. Serganio asmens motinos kai kurie vyrikosios lyties gimins (broliai, pusbroliai, dds ir kt.) taip pat serga.

4.17 paveikslo genealoginiame medyje lig lemiantis dominantinis mutavs B genas taip pat yra X chromosomoje isidsts XBalelis. Tik iuo atveju pasekms jau kitokios. Matyti, kad visos serganios moterys yra heterozigotins pagal gen. Nors jos ir turi dvi X chromosomas, taiau lig lemiantis genas yra dominan tinis. Visi vyrai, gav mutavus gen turini X chromosom , taip pat serga.

4 .1 7 pav.

Probando, serganio su X chromosoma susijusia dominantikai paveldima liga, eimos genealoginis medis
4 .1 8 pav.

Diueno raumen distrofija sergantis berniukas. Bdingas ligos poymis - blauzdos raumen hipertrofija

tll

4 .4 le n te l . Daniausios su X ch ro m o som a susijusios ligos

Liga 1. Hemofilija A (recesyvi) 2. Diueno raumen distrofija (DMD) (4.18 pav.) (recesyvi) 3. Trapiosios X sindromas (dominantin) 4. Leo ir Naiheno sindromas (recesyvi) 5. Spinobulbarin raumen atrofija 6. Testitulin feminizacija

Dl geno mutacijos pakits baltymas VIII kraujo krejimo faktorius Distrofinas FMR1 HGPRTaz Androgen receptorius Androgen receptorius

Berniuk ligos danumas

1:10 000
1:3 500 1:1 250 1:400 000

1:100 000 1:20 000

Daniausi su X chromosoma susijusi lig pavyzdiai pateikti 4.4 lentelje. i lig diagnoz daniausiai patvirtinama tiriant konkret gen ir identifikavus jas lemiani mutacij. Toki mutacij prigimtis labai vairi. DMD genas yra vienas didiausi mogaus genome - 2,5 Mb, t. y. 2,5 milijono nukleotid por. Y chrom osom oje esantys genai Poymi, kuriuos lemia Y chrom osom oje esantys genai, iki iol rasta labai nedaug. Vienas j - padidjs ausies kauelio plaukuotum as, vadinamas hip ertricho ze. is poymis bdingas tik vyrams ir pasireikia apie 30-uosius gyvenim o metus. m oni populiacijose jis gana paplits. gen vyrai per duoda tik snums kartu su Y chrom osom a (4.19 pav.). Taigi visi vyrikosios lyties palikuonys tu ri gauti ir gen, lem iant tiria m j poym. Taip vyrikis I: 2 hipertrichozs gen kartu su Y chrom osom a perdav savo snui II: 2, ankui III: 2 ir proankiui IV: 2. Taigi pateikme kelias genealogijas, kuriose akivaizds skirtingi poymi pa veldjimo tipai. Pastebtina, kad toki analiz geriausia atlikti vieno poymio atvilgiu (t. y. taikyti m onohibridinio krym inim o schem).
1

(Vi
1:1 1:2

O r-i -II: 1 4.19 pav. II: 2

- T II: 3

II: 4

Su Y chromosoma susijusios hipertrichozs paveldjimas (eimos genealoginis medis)

O r H III: 1

1
1 1 IV 2

11:2

111:3

111:4

III: 5

'V

IV: 1 y

(T i
IV: 3

K la us im a i 1. Kokie genealogijos ypatumai liudija, kad liga arba kitas fenotipo poymis yra autosominis dominantikai paveldimas? Apibdinkite j paveldjimo tip. 2. Kokie genealogijos ypatumai rodo, kad liga arba kitas fenotipo poymis yra autosominis recesyviai paveldimas? Apibdinkite j paveldjimo tip. 3. Kokie genealogijos ypatumai liudija, kad liga arba kitas fenotipo poymis yra susijs su X chromosoma? Apibdinkite su X chromosoma susijusius pa veldjimo tipus. 4. Kokie yra su Y chromosoma susijusi mogaus poymi paveldjimo ypatu mai? Kokius inote su Y chromosoma susijusius mogaus poymius?

U d a v in ia i 1. H ipertrichozs (plauk kuoktelis a n t ausies kauelio krato) genas isidsts mogaus Y chromosom oje. Kokia tikimyb, kad tvo, turinio hipertrichoz, vaikai pavelds j poymj? 2. A, B, C, D, E, F ir G genealogijoje nustatykite poymio paveldjimo tip. Nuspalvinti enklai reikia, kad asmuo turi tiriam j poym.

O j-n

o-y-o

iv

6|-n 6 h= -{5 t 4 6 4 6 4oi~5~6


A
O -p O

Oji5c>| a-^o m Qj6c>j=t5o66n6ja i v o i 6 646j^66i


B
i O j O j- B ~7>J

~oT4 66 6 3
iv

O ^ i 6
" ir 6 6 6 4 6 6

iv 6
v

^ i r ^ n

vi

6 46 b 4 666666466 i
D

____________ O j - m 6> O y --ei

i ii

___________ o ~ 4 ^ E ^ n io ^ i o ^ 4

IV

6ra6ra466 Ot 46466466 oi

i 6 664 n o 4

4.3
Neseniai atskleisti monogenini hgu atsiradimo mechanizmai

Kaip jau ne kart buvo minta, ligas, paveldimas pagal M endelio dsnius, lemia mogaus genom o kurio nors vieno geno mutacija. Taiau XX amiaus pabaigoje paaikjo, kad kai kuri toki lig atsiradim o mechanizm negalima paaikinti tik prastinmis gen m utacijom is (nukleotido pakaita, ikrita ar in tarpu ir pan.). Buvo atskleisti nauji keli pagal M endelio dsnius paveldim lig atsiradimo mechanizmai. Daugelis j jau buvo paminti, taiau dert apta rti juos plaiau.

4.3.1.
Dinamins mutacijos

I dalies 1.4 skyriuje jau buvo aptarti vairs pasikartojanij sek tipai. i sek pasikartojim skaiius vairuoja. Galimyb genus klonuoti, o vliau - ir nu statyti atskiras mutacijas, lemianias konkreias ligas, leido nustatyti, kad vai ruojanios trij paeiliui pasikartojani nukleotid sekos gali nepaprastai pailgti, kai susidaro naujos mutacijos, vadinamos trin u kleo tid in i pasikartojani sek isipltimu (TNPSI). 2000-aisiais buvo inoma vienuolika toki mutacij. TNPSI bdingas pasikartojim skaiiaus nestabilumas per mejoz. Todl jie dar vadinami dinam inm is mutacijomis. ios mutacijos lemia anticipacijos1 atsi radim. Kartais kart sekoje ne tik jaunja pacientai, bet ir sunkja liga.

Anticipacija vadinamas reikinys, kai kiekvienoje naujoje kartoje liga susergama vis anksiau. Pavyzdiui, tvas susirgo miotonine distrofija sulauks 55-eri, snus 48-eri, o ankas - 40-ies met.

Iplinta ne bet koki trinu kle otid pasikartojimai. Jie skiriami dvi pagrindi nes grupes. Pirmojoje grupje pasikartojanti seka yra (CGG)n. Pasikartojimai lemia chrom osom trki atsiradim, kuriuos galima nustatyti citogenetiniais tyrim o metodais. Geriausiai inomas (CGG)n pasikartojimas yra FRAXA geno (X chromosom os ilgojo peties 27.3 segmente) 5' nekoduojanioje dalyje. Jei gu sveikiems asmenims tokia seka kartojasi apie 30 kart (n = 30), tai sergan tiesiems trapiosios X sindromu nustatoma 2 3 0 -1 000 kart pasikartojanti se ka. Tokia mutacija lemia gim t protin atsilikim ir nustatoma vienam i 2 000 naujagimi. Antrajai grupei priskiriami (CAG)n TNPSI. Jie aptinkami daugeliu neurodegeneracini lig atvej. Geriausiai inoma Hantingtono liga. Sergant ia liga (CAG)n pasikartoja maesn skaii kart ir yra koduojanioje IT-15 geno dalyje. is ge nas lemia baltymo hantingtino sintez. Sveik moni IT-15 geno pirmajame egzone CAG seka pasikartoja nuo 15 iki 35 kart. Taiau asmenys, kuriems nustatomi 4 0 -1 2 1 pasikartojimai, jau serga sunkia nerv degeneracine Han tin gto no liga. i smegen liga daniausiai prasideda vos sulaukus 40-50-ties ir pasireikia nevalingais traukuliais (todl dar vadinama v. Vito okiu), haliucina cijomis bei elgsenos sutrikimais. Ji progresuoja ir per 1 0 -1 5 m et sunaikina mogaus intelektinius gebjimus, asmenyb, ir ligonis galiausiai mirta. Kuo dau giau (CAG)n pasikartojim nustatoma konkreiam asmeniui, tu o anksiau jis su serga ir sunkiau serga.

4.3.2.
Genomo spaudas (imprintingas)

et arrccacc - vyki nuspvul area "s vykis

Genom o spaudui ja u tr s genai bna veikls tik vienoje i chrom osom : (vieni - g autoje i tvo, kiti - i m otinos; r. I dalies 3.4.2 skyri). Taigi m u ta cijos, dl kurios prarandamas to kio geno veiklumas (chrom osom os mikroikritos, geno m utacijos) padariniai priklauso nuo to, kuris tv perdav savo palikuoniui chrom osom su tokia mutacija. Su gen om o spaudui jautriais genais susijusios vairios ligos. Geriausiai ino mas pavyzdys - II dalies 4.1.3 skyriuje jau m inti Praderio ir Vilio bei Angelm ano sindrom ai. i sindrom atveju nustatom a m ikroikrita 15-osios chro m osomos q 11 13 srityje, kurioje yra prieingiem s spaudo tipam s ja u tri q gen (4.20 pav., A). M ikroikrita apima srit, kurios genai aktyvs tvinje chrom osom oje ir neaktyvs m otininje (4.19 paveiksle jie paym ti raide H).

Todl, kai i ikrita yra i tvo gautoje chromosomoje, asmuo suserga Praderio ir Vilio sindromu (4.20 pav., B). Jei tokia chromosoma gauta i motinos, susirgti Praderio ir Vilio sindromu pavojaus nra, taiau iuo atveju yra prarandami ir kiti toje paioje mikroikritoje esantys genai, tik jie veikls motininje ir neveikls tvinje chromosomoje (4.20 pav.. C; ia tokie genai paymti J). Todl suserga ma Angelm ano sindromu. Genomo spaudui jautrs genai gali bti susij su sudtingais elgsenos fenoti pais, kaip antai polinkis alkoholiui, izofrenija. Antra vertus, nustatytas j ryys su lstels augim o reguliavimu. Todl toki gen mutacijos arba j spaudo reguliavimo sutrikimai yra viena vio (r. II dalies 4.5 skyri) prieasi.

Normalus fntps eoia

H ge n a i aktyvs
4 .2 0 pa v. G enom o spaudas (im printingas) mogaus 15-osios chrom osom os q 1 113 regione. V - vyrikasis spaudo tipas (i tvo gauta chrom osom a); M - moterikasis spaudo tipas (i m otinos gauta chrom osom a). G enom o spaudui jautrs genai arba gen grups: H - genai, veikls tik vyrikojo spaudo tipo chrom osom oje; J - genai, veikls tik m oterikojo spaudo tip o chrom osom oje

J genf'i aktyvs

{spaudas blokuoja gen raik

B / P a e i i Vlo r d r o r ii sindromas

\
aktyvs

Angelmano sindromas
V M

J genai

aktyvs

H ge n a i

q 1 1 -13 m ik ro i k rita

Normali chromosoma

Normali chromosoma

q 1 1-13 m ik ro i krita

4.3.3.
Mozaikikumas
Su vienu m ozaikikum o tipu, kuris bdingas norm aliam organizm ui, jau susipainote skaitydami I dalies 3.4.2 skyri - tai vienos i X chrom osom inaktyvinim as. Buvo m intos ir somatins chrom osom m utacijos, slygo janios genetikai skirting organizm o lsteli klon susiformavim. Soma tinse lstelse gali vykti ir gen mutacijos. Jos susiform uoja tada, kai dar nepraradusioje gebjim o dalytis lstelje vyksta mutacija. Taip atsiranda dvi lsteli linijos: normalios lstels ir lstels, kuri genotipas pakits. Kuo anks iau organizm o raidoje (ypa em b rio no stadijoje) vyksta m utacija, tu o dides nis bus j tu rin i lsteli klonas. Lsteli mozaikikumas gali atsirasti: a) dl chromosom rinkinio pokyio. Pavyzdiui, mozaikiniai Ternerio ir Dauno sindrom o variantai (atitinkam ai 46, XX / 45, X ir 46, XX / 47, XX +21); b) dl vairi gen mutacij. Paviense somatinse lstelse vykusios gen mutacijos danai lemia vio susiformavim; c) pirm ini generatyvini lsteli, i kuri form uojasi gametos, mutacijos. Jei jos bus mozaikins pagal mutacijos buvim ar nebuvim, tai ir dalis individo lytini lsteli turs mutacij, o kita dalis jos neturs. Tai gali bti bet kuri m onogenin lig lemianios mutacijos, taiau analizuojant serganiojo genea logij tikrai sudtinga atpainti M endelio dsni pasireikim.

4 . 3.4 .
Su m itochondrij DNR susijusios ligos

Iki XX amiaus paskutiniojo deimtmeio lstels citoplazmoje esaniai mito chondrij DNR (mtDNR) ir jos koduojamai genetinei informacijai buvo skiriama nedaug dmesio. Taiau neseniai paaikjo, kad mtDNR labai svarbi tiria nt mo gaus evoliucij ir ligas. Jos mutacijos lemia kai kurias sunkias nerv sistemos ligas, aklum, kurtum (II dalies 4.5 lentel), siejamos su mogaus senjimu ir degeneracinmis ligomis. Visa mogaus mtDNR nukleotid seka, taigi ir visi joje esantys genai jau nusta tyti (r. I dalies 1.4 skyri), taigi ir daugelio lig atveju inoma, kokios konkreios mutacijos jas lemia.

CD
4.S lentel.
Kai kurios m tD N R m utacij lem iam os ligos

Liga 1. Lberio paveldimoji optin neuropatija 2. MERF

Ligos poymiai Regos praradimas, vairs neurologiniai pokyiai Epilepsija ir griaui raumen skaidul paeidimas Regos sutrikimas, irdies blokada, raumen silpnumas, kurtumas Pieno rgties acidoz, insult panas priepuoliai, aklumas, intelekto praradimas

Lig lemianti mutacija ND4 geno 11778* nukleotido misens pakaita tRNRLs geno 8344 * y nukleotido pakaita ikritos 5 kb ikrit srityje tRNRL u geno 3243 e nukleotido pakaita (A -*G )

Paveldjimas Motinos linija

? 149
7

' N u ro d y ta s visos m tD N R n u k le o tid sekos, o n e k o n k re ta u s g e n o n u k le o tid a s

Analizuojant iomis ligomis sergani asmen genealogijas, daniausiai pa aikja, kad eimoje serga tik pats probandas, nors pasitaiko eim, kuriose liga perduodam a moterikja linija. Nustatyta, kad kai kurios mtDNR mutacijos susijusios ir su mogaus senji mu. Dal i mutacij asmuo gali bti paveldjs. Tada jo senjimas prasids anksiau ir vyks greiiau nei tu o atveju, kai mutacij skaiius ima spariai augti tik sulaukus tam tikro amiaus.

1. Kas bdinga kai kuri trinukleotidini sek pasikartojimo pailgjimams ir kaip jie susij su paveldimosiomis m oni ligomis? 2. Kaip genom o spaudas susijs su paveldimosiomis m oni ligomis? 3. Kas yra organizm o mozaikikumas ir kodl jis atsiranda? Kaip mozaikikumas susijs su paveldimosiomis ligomis? 4. Kas bdinga su m itochondrij DNR susijusioms m oni ligoms?

4.4.
nkio ligai ca.e djimas

Iki iol analizavome lig, susijusi su vieno geno veiklos sutrikimu, paveldji mo pavyzdius, t. y. m onogenines ligas. Taiau daugiau esama lig, kuri paveldjimo mechanizmas kur kas sudtingesnis. Apie tokias ligas danai sa koma, kad paveldimas polinkis sirgti jomis. Taiau jas lemia ir genetiniai, ir aplinkos veiksniai. Tai d a u g ia v e ik s n s ligos. sidmtina, kad daugiaveiksnes ligas slygoja genai, esantys skirtingose genetinse srityse, o j veikimas yra adityvus (suminis) - genetiniai veiksniai sumuojasi ir veikia kartu su vairiais aplinkos veiksniais.

K in ta m u m a s

3. Kernso ir Seiro sindromas 4. MELAS

m
Kaip v e rtin ti bendr g enetin i veiksni tak

Genetini ir aplinkos veiksni tak formuojantis konkreiam fenotipui galima apibrti formule: F = G + A, ia F yra fenotipo reikm, G - genotipo reikm, A - aplinkos reikm. Suprantama, kad populiacijoje kiekviena i reikmi gali vairuoti, todl jas pras ta apibdinti per j vairavimo reikmes - dispersijas (V), t. y. VF = V r + 1A . / G Tarkime, kad aplinkos vairavimas neturi takos asmens fenotipo formavimuisi. Ta da santyk tarp genotipo reikms vairavimo ir fenotipo reikms vairavimo galima apibrti p a v e ld jim o koeficientu h 2, t. y. Vc Jis parodo, koki dal fenotipui vairuojant sudaro genetini veiksni vairavimas. Taigi p aveld jim o koeficientas leidia vertinti, koki polinkio ligai p aveldji
mo dal sudaro g e n e tin i veiksni (gen) vairavim as
4.21 pav.

h2 = -

1 50

Naujagim io lpos ir g o m urio nesuaugimas

Daugelio daugiaveiksni lig paveldjimo koeficientai jau yra apskaiiuoti (r. 4.6 lentel). Apie konkrei lig inome tik tai, kaip ji paplitusi serganiojo (probando) giminje (t. y. kas i probando gim ini ja serga) ir kaip ji paplitusi visoje populiacijoje (tarkime, Lietuvoje). i duom en pakanka paveldjimo koeficientui apskaiiuoti.

m
4 .6 le n te l . Polinkio sirgti kai kuriom is daug iave iksn m is ligom is p a v e ld jim o ko efic ien tai

Daugiaveiksn liga 7. 2. 3. 4. 5. 6. 7. izofrenija Bronchin astma Lpos ir gomurio nesuaugimas Iemin irdies liga Padidjs kraujospdis Nervinio vamzdelio defektai Opalig

Paveldjimo koeficientas (%) 85 80 76 65 62 60 37

4 .2 2 pav. Nervinio vam zdelio defektas: kdikis su stuburo smegen ivara

I 4.6 lentels matyti, kad dau giaveiksni lig grupei priskiriamos vairios ligos: nuo dan ltins ei gos lig, kaip bronchin astma, iki raidos anomalij (apsigimim), kaip antai lpos ir gom urio nesuaugi mas (4.21 pav.), nervinio vamzde lio defektai (4.22 pav.) ir kt. Todl vyraujanti nuomon, kad tokie izo liuoti defektai (apsigimimai) tikrai paveldimi, yra klaidinga. Daugia veiksni lig atveju paveldima ne pati liga, o tik polinkis ja sirgti. Polinkis ligai paveldimas dalyvaujant 1 0 -2 0 skir ting nealelini gen, esani tose paiose arba nehomologinse chromosomose. Pavienio geno veikla paveldint polink ligai sumuojama, ir bendra paveldjimo koeficiento h 2 reikm gali svyruoti nuo 0 iki 100 % (r. 4.6 lent.). Kuo reikm didesn, tuo intensyvesni genetiniai ligos veiksniai.

L2l K la u s im a i
1. Kokios ligos yra daugiaveiksns ir k u o jo s skiriasi nuo m onogenini? 2. K rodo paveldjimo koeficientas? 3. Kokias inote daugiaveiksnes m oni ligas?

Viu vadinama grup lig, kurias jungia vienas bendras bruoas - nekontro liuojamas lsteli dauginimasis. Normali mogaus somatin lstel per vis indi vido gyvenim daniausiai pasidalija ne daugiau kaip 5 0 -6 0 kart. Taiau jei sutrinka kurios nors lstels kontrols mechanizmai, ji ima nekontroliuojamai dalytis. I tokios lstels palikuoni (klono) susiformuoja auglys. Pokyiai, le miantys lstels supiktybjim, gali atsirasti ir somatinje, ir generatyvinje ls telje. J prieastis paprastai bna vairios gen mutacijos, o ias gali sukelti vairs aplinkos veiksniai. Aplinkos veiksnio poveikis lstelei turi bti perduotas i aplinkos lstels branduol ir DNR. Toks poveikio perdavimas yra labai sudtingas procesas ir vadinamas signalo p e rd a v im o sistema. iuo m etu yra inoma daugiau nei 100 gen, dalyvaujani perduodant signal, taigi dalyvaujani ir lstels au gim o bei diferenciacijos procese. Kai signalas, kad lstel turi liautis dalytis, perduodamas lstels branduoliui, pastarajame pasikeiia gen, kuri produk tai reguliuoja lstels cikl, nuraymas: b lo k u o jam i g en a i, skatin an tys ls tels dalijimsi ir indukuojam i (suadinam i) genai, kuri pro d u ktai stab do lstels d a lijim s i (t. y. perjim i lstels ciklo G0 stadijos G, sta di j) (r. I dalies 2.1 pav.). vykus i gen m uta cijo m s (jas gali sukelti vairs m uta ge na i), su trikd o m a gen veikla, ir lstels dalijim asis ta m p a n e k o n tro liuojamas. Skiriam os trys p agrindins vio gen grups: 1) genai, kuri koduojami baltymai stabdo lsteli dalijimsi - vio supresijos genai; 2) genai, kuri koduojami normals baltymai aktyvina lsteli dalijimsi - onkogenai; 3) genai, kuri koduojami baltymai dalyvauja DNR paaid reparacijoje (r. II dalies 4.1.4 skyri). Pirmosios grups genai - v io supresijos g enai yra efektyvs bdami normalioje hom ozigotinje arba heterozigotinje padtyje. Taiau m utacijoms vykus abiej hom ologini chrom osom genuose, apsaugin funkcija praran dama, ir prasideda vio formavimasis. Tokio vio pavyzdys yra akies tinklains piktybinis auglys retinoblastoma, kur lemia RB1 geno, dalyvaujanio signalo perdavimo sistemoje, mutacijos. Antroji vio gen grup yra on ko g enai. Tai pakit protoonkogenai, kuri koduojami baltymai susij su pagrindiniais nor malaus lsteli augim o reguliatoriais. vykus mutacijai protoonkogene, jis gali tapti onkogenu, t. y. genu, kurio pastoviai aktyvus produktas gali slygoti nekontroliuojam lsteli dalijimsi. Onkogenai lstels lygmenyje daniausiai pasireikia kaip dominantiniai genai, t. y. utenka vieno alelinio onkogeno (t. y. mutavusio protoonkogeno), kad prasidt vio progresija. ios mutacijos nusta tom os beveik be iimties tik somatinse lstelse. Protoonkogen, kuri mo gaus genome yra daug, aktyvinimas dl mutacijos vyksta vairiai. Vienas bd tai - vairs chromosom struktros persitvarkymai, daniausiai translokacijos. Translokacij, dl kuri pasikeiia i gen raika, jau yra inoma deimtys.

q11.2

Filadelfijos chrom osom a

Normali

Translokuota

9-oji chromosoma

22-oji chromosoma

Vienos j padarinys - Filadelfijos chromosoma susiformuoja esant ltinei mieloidinei leukemijai (kraujo viui) (4.23 pav.). vykus tokiai mutacijai, vystosi kraujo vys. Filadelfijos chromosoma yra gerokai sumajusi 22-oji chromosoma, kurios beveik visas ilgasis petys pakeistas labai trum pu 9-osios chromosomos ilgojo peties galiniu fragm entu. Dl ios translokacijos c-abl protoonkogenas perkelia mas i jo prastos vietos 9-osios chromosomos q34 segmente 22-osios chromo somos q 1 1 segment, kur susijungia su kitu genu. Taip susidaro naujas hibridinis genas, koduojantis baltym, kuris lemia normalios lstels virtim vio lstele. Antra vertus, protoonkogen paversti onkogenu gali ir kitos mutacijos, pavyz diui, nukleotido pakaita.

19 2 0 18 9 10

21

17, 12 13 14 15 16 mm

22

i3
24 m~

1 235 6 7 8 t

*$* * *

l mm H

1i 1

i p

11

E IS

1,0 kb
a Skaitymo rmelio poslinkio ir nonsens mutacijos Misens mutacijos Sukirpimo vietos mutacijos

4.2 4 pav. BRCA1 geno schema (pavaizduoti tik egzonai (1 -2 4 )) ir da ugelio nustatyt takini m utacij vietos. Kai kuriuose egzonuose m utacijos ypa danos

Vio lstelei atsirasti daniausiai nepakanka tik vienos mutacijos, vykusios vio supresijos gene ar protoonkogene. Turi susidaryti keli toki m utacij derinys. Todl vio form avim osi procesas yra d a u g ia p a k o p is : i pradi, vykus kurio nors geno mutacijai, lstel ima nekontroliuojam ai dalytis; vykus dar porai mutacij kituose genuose, susiformuoja grybinis auglys; vykus m u tacijoms dar kituose genuose (antai vienas i j gali bti p53 genas), grybinis auglys tam pa piktybiniu ir jo lstels gali iplisti visame organizme. rodyta, kad daniausiai pradinis etapas arba vienas i vio formavimosi etap yra aplinkos veiksni (kancerogen) poveikis. Antai cigarei dmuose esantis kancerogenas benzopirenas stipriai veikia b tent p53 gen, sukelda mas jo mutacijas, kuri ryys su plaui viu jau nekelia abejoni. XX amiaus pabaigoje buvo rodyta, kad kai kurios vio form os paveldimos ne kaip m onogenins, bet kaip daugiaveiksns ligos. Taigi paveldimas polinkis sirgti jom is (pvz., retinoblastoma, Li ir Fraumeni sindromas, eiminis storosios arnos vys, neurofibromatoz, anksti prasidedantis krties ir kiauidi vys). Autosominis dominantikai paveldimas polinkis sirgti krties bei kiauidi viu susijs su apie 10 % vis krties ir kiauidi vio atvej. Mutacijos, lemianios j v, aptinkam os BRCA1 gene (4.24 pav.). is genas turi 24 egzonus ir apima 100 kb DNR. M anom a, kad jis veikia kaip genas supresorius. Kadangi kai kurios io geno mutacijos populiacijoje danesns, molekuliniais geneti niais metodais patikrinus sveikas moteris, galima nustatyti, ar j BRCA1 genas turi toki mutacij. Tai galina laiku imtis reikiamo gydymo ir neleisti viui isivystyti.

i _ 2 l K la u s im a i 1. Kokios yra vio gen grups? 2. Kaip vio supresijos genai yra susij su viu? 3. Kas yra ir kaip atsiranda onkogenai? Kas bdinga j veikimui? 4. A r visos vio form os yra paveldimos? Atsakym pagrskite.

4.6.
- m e tin ia i

h e *M m j lig : " a v im o ~ e :o d a i

Daugelis paveldimj lig diagnozuojamos, ypa pradinje ligos stadijoje, pras tais metodais. Taiau daniausiai jie leidia tik tarti toki lig. Diagnozei patiks linti vis plaiau taikomi specifiniai genetiniai tyrim o ir diagnozavimo metodai. Kai kurias ligas apskritai galima nustatyti tik tokiu bdu, nes kit objektyvi diagno zavimo metod ioms ligoms apskritai nra. Visos chromosomins ligos diagnozuojamos ityrus serganiojo (jei reikia, ir jo tv) kariotip. i procedra atliekama net ir akivaizdiausiais atvejais, kai fenotipiniai ligos poymiai aiks. Antai Dauno ligos diagnoz 100 % patvirtina tik citogenetiniais metodais aptikta papildoma 21-oji chromosoma. Monogenini ir kai kuri daugiaveiksni lig (tarp j ir vio) diagnostikai vis plaiau taikomi molekuliniai genetiniai paciento bei jo eimos nari tyrim o me todai. Kai yra inoma su liga susijusio geno nukleotid seka, atlikus polimerazin grandinin reakcij ir taip padauginus jo vien ar kelis egzonus, galima nustatyti nukleotid sek ir taip aptikti mutacij.

cn
s centre eta EH*^avimo

G l m geno m t c j a r n a ai uai tak

I karto tiesiogiai aptikti geno mutacij daniausiai bna labai sunku (tekt nustatyti itiso geno nukleotid sek). Todl paprastesniais ir greitesniais galim mutacij atrankos metodais i pradi patikrinami visi (arba tik kai kurie) geno egzonai - ar juose nra nu kleotid sekos pokyi apskritai. Aptikus, kad tam tikroje geno dalyje yra pokytis, jis iden tifikuojamas tiesiogiai nustatant atitinkamo DNR fragmento nukleotid sek (4.25 pav.).

153
K in ta m u m a s

Iii!
M k . ^

Ite lll

j
i rliit

' "ikitM 5h ; i
Tiesioginiais DNR tyrim o metodais galima identifikuoti konkrei mu tacij. Kai tokiu bdu mutacijos aptikti nepavyksta, galima nustatyti viso egzono ar net viso geno nukleotid sek ir rasti jos pokyt, t. y. mutacij. Kartais konkreios ligos fenotip gali lemti ne vieno, bet keli skirting nealelini gen mutacijos. Iekoti vienintels konkrei lig lemianios mutacijos i karto keliuose genuose pernelyg sunku. Todl pirmiausia reikia nustatyti, kuriame i j vyko mutacija. Tam naudoja ma serganio asmens eimos tam tikr genetini ymen sankibos su lig lemianiu genu analiz (4.26 pav.). Nustaius mutavus gen jau galima iekoti lig slygojanios io geno mutacijos. Tokiais pat metodais galima nustatyti ir mutacijas gen, formuojani paveldim polink ligai. Mintieji bdai taikomi plaiai paplitusioms ligoms, taip pat ir vairioms vio form om s diagnozuoti. iuo metu pats moderniausias nukleotid sekos nustatymo (taigi ir mutacij identifikavimo) metodas yra genetini lust (arba DNR mikroschem) technolo gija, leidianti vienu metu nustatyti net keli gen nukleotid sek. Taigi jei konkrei lig gali lemti keli gen mutacijos, galima i karto labai greitai nusta tyti vis j nukleotid sekas bei jose surasti t lig lemiant pokyt. ? m iim nw 1. Kaip nustatomos chromosomins ligos? 2. Kaip nustatomos monogenins ligos?

k. centre r j e h k t i ^ ymen i . r e i e c -naj lig - : - a e i . 2"\aJiz

4.7.
Genetinis eim konsultavimas asmens sveikatos prieiros paslauga

Genetinis konsultavim as yra informacijos apie ligos ar gimtosios anomali jos paveldimj pobd perteikimas konsultuojamam asmeniui ir genetiniai pata rimai eimai. Tok konsultavim sudaro penkios pakopos (r. p. 155). Ligos pasikartojimo eimoje rizikos vertinim gydytojas genetikas pateikia abiem sutuoktiniams kartu, nes danai tvas galvoja, kad vis atsakomyb turi prisiimti tik motina. Analizuodami vairius paveldjimo tipus sitikinome, kad lig lemiant alelin gen vaikui gali perduoti ir tvas, ir motina, ir abu tvai kartu. Genetins konsultacijos metu eimai pateikiama isami informacija apie ligos pasikartojimo eimoje rizik, ligos medicininius, socialinius bei ekonominius pada rinius ir eimos planavim o galimybes. K daryti konkreiu atveju, sprendia tik tvai. Gydytojo genetiko pareiga yra eimai suprantamiausiu bdu paaikinti visus galimus j pasirinkimo padarinius eima turt galvoti ne tik apie savo norus, bet ir apie gimsiant vaik, neumirti jo nor ir teisi. Sprendiant ias problemas, btina at sivelgti eimos planavimo galimybes ir metodus, kurie galimi ne tik Lietuvoje, bet ir Vakar Europoje ar iaurs Amerikoje ir pan. Btina isiaikinti ligos diagnozavi mo dar iki gimimo galimybes, dirbtinio apvaisinimo donoro sperma (kai vyras yra sunki paveldimj lig lemianio geno neiotojas), apvaisinimo mgintuvlyje (kai m oteris negali pastoti natraliai) ir kitas eimos planavimo galimybes.

4.2 7 p a v . m ogaus genetikos centro gydytojas genetikas konsultuoja pacient

4.2 8 p a v . m ogaus genetikos centras

fe

Vilniaus universiteto ligonins Santariki klinik

MOGAUS GENETIKOS CENTRAS


G e n etin is eim k o n s u ltav im as Gydytojo genetiko konsultacija
Genetinis konsultavimas Konsultavimas teratogen poveikio klausimais Prenatalin diagnostika Postnatalin diagnostika ir gydymas

Visuo tin is n au jag im i tikrin im a s fe n ilke to n u rija i ir gim tajai hipo tiro zei nustatyti

Genetiniai laboratoriniai tyrimai

Instrumentiniai vaisiaus tyrimai

? -TV
,
Molekuliniai genetiniai tyrimai

L ie tu v o s p a v e d im j lig ir < - jg im t j ra id o s d e fe k t re g is tra s

Citogenetiniai tyrimai

4.7.
Genetinis eim konsultavimas asmens sveikatos prieiros paslauga

4.2 7 p a v. m ogaus genetikos centro gydytojas genetikas konsultuoja pacient

4 .2 8 p a v . m ogaus genetikos centras

Genetinis konsultavim as yra informacijos apie ligos ar gimtosios anomali jos paveldimj pobd perteikimas konsultuojamam asmeniui ir genetiniai pata rimai eimai. Tok konsultavim sudaro penkios pakopos (r. p. 155). Ligos pasikartojimo eimoje rizikos vertinim gydytojas genetikas pateikia abiem sutuoktiniams kartu, nes danai tvas galvoja, kad vis atsakomyb turi prisiimti tik motina. Analizuodami vairius paveldjimo tipus sitikinome, kad lig lemiant alelin gen vaikui gali perduoti ir tvas, ir motina, ir abu tvai kartu. Genetins konsultacijos metu eimai pateikiama isami informacija apie ligos pasikartojimo eimoje rizik, ligos medicininius, socialinius bei ekonominius pada rinius ir eimos planavim o galimybes. K daryti konkreiu atveju, sprendia tik tvai. Gydytojo genetiko pareiga yra eimai suprantamiausiu bdu paaikinti visus galimus j pasirinkimo padarinius eima turt galvoti ne tik apie savo norus, bet ir apie gimsiant vaik, neumirti jo nor ir teisi. Sprendiant ias problemas, btina at sivelgti j eimos planavimo galimybes ir metodus, kurie galimi ne tik Lietuvoje, bet ir Vakar Europoje ar iaurs Amerikoje ir pan. Btina isiaikinti ligos diagnozavi mo dar iki gimimo galimybes, dirbtinio apvaisinimo donoro sperma (kai vyras yra sunki paveldimj lig lemianio geno neiotojas), apvaisinimo mgintuvlyje (kai moteris negali pastoti natraliai) ir kitas eimos planavimo galimybes.

Vilniaus universiteto ligonins Santariki klinik

MOGAUS GENETIKOS CENTRAS


VULSK G C

G e n etin is eim k o n s u ltav im as Gydytojo genetiko konsultacija


Genetinis konsultavimas Konsultavimas teratogen poveikio klausimais Prenatalin diagnostika Postnatalin diagnostika ir gydymas

Visuo tin is n au jag im i tikrin im a s fen ilke to n u rija i ir gim tajai hipotiro zei nustatyti

Genetiniai laboratoriniai tyrimai

Instrumentiniai vaisiaus tyrimai

Molekuliniai genetiniai tyrimai

L ie tu v o s __ p a v e d im j lig ir -<------ g im t j ra id o s d e fe k t re g is tra s

Citogenetiniai tyrimai

GENETINIO EIM KONSULTAVIMO PAKOPOS


eimos genealogijos sudarymas
(r. I dalies 3.5 skyri)

Vadovaujantis Europos Sjungos teiss norm om is bei visuotine mogaus tei si deklaracija (ypa jos dalimi apie pilieio teis j informacij), kiekviena ei ma turi teis tiksliai inoti, koks vaikas jiems gims - sveikas ar sergantis. Jei nustatytas gim tas defektas nesuderinamas su vaisiaus gyvybe arba ntu mas kelia pavoj m otinos gyvybei ir dl i prieasi eima nutar tok ntu m nutraukti, procedra turi bti atliekama statym num atyta tvarka (ms alyje - Lietuvos Respublikos statym ) ir tik medicinos staigose, turiniose tam teis. Pastebtina, kad pagal Lietuvoje galiojanius statymus nusprsti nutraukti tok ntum gali tik pati eima. Jei eima, nepaisydama to, kad vaikas sirgs konkreia liga, nutaria gim dyti, gydytojas genetikas privalo pateik ti informacij apie tos ligos gydymo galimybes, serganiojo medicinins ir so cialins reabilitacijos galimybes bei integravimo visuomen kelius. Lietuvoje g e n etin eim konsultacij gali te ik ti tik g ydyto jai genetikai (4.2 7 pav.). D ia g n o zu o ja n t paveldimsias ligas ta ip pat dalyvauja m edici nos genetikai, atliekantys specifinius gen etin iu s tyrim u s (chrom oso m bei m olekulinius genetinius tyrim us). Gydytojo genetiko ir m edicinos genetiko pareigos bei teiss yra num atytos a titinka m o je m edicinos norm oje. O teikti ias asmens sveikatos prieiros paslaugas Lietuvoje gali tik asmenys, tu rin tys ms alyje galiojanias licencijas. Pirmoji genetin konsultacija Lietuvoje buvo kurta 1971-aisiais Respublikinje klinikinje Raudonojo Kryiaus ligoninje. iuo m etu pagrindin staiga Lietu voje, kurioje teikiamos genetins konsultacijos, yra Vilniaus universiteto ligo nins Santariki klinik mogaus genetikos centras (h ttp :/w w w .s a n ta .lt/1 /) (4.28 pav.), kurtas 1991-aisiais kartu su Vilniaus universiteto Medicinos fakulte to mogaus genetikos centru (h ttp ://w w w .g e n e tica h u m a n a .lt/V U /in d e x.h tm ). Pastarojo veikl sudaro pedagoginis darbas bei mokslo tyrimai.

Probando ir jo gimini ityrimas

Diagnozs nustatymas

Genetins prognozs sudarymas ir pateikimas eimai


r - '- a - '- a ligos pasikartojim o je i moje rizika, t. y. tikim yb, kad: = c a s vaikas, gim s toje a n & e .s irg s tokia pat liga; ; -a x a s pavelds lig, _ r a serga vienas i tv; : s j^ jo k lin ia m s gim s vaikas K . e o s lig. kuria serga ) i sutuoktini gim ins.

Tolesnis eimos stebjimas

U D

mogaus g n t k s c n r , be genetinio konsultavimo, teikiamos ios pa e e i o ete slaugos: 1) atliekami tyrimai vairioms chromosominms ir paveldimosioms monogeninms ligoms bei gimtosioms anomalijoms nustatyti iki vaiko gimimo (4.29 pav.); 2) visi Lietuvos naujagimiai tikrinami dviem sunkioms paveldimosioms ligoms fenilketonurijai ir gim tajai hipotirozei nustatyti (ias ligas nustaius ir pradjus gydyti dar iki j pasireikimo, t. y. iki trij mnesi po gimimo, vaik vystymasis bna normalus) (4.30 pav.); 3) atliekamas ikisimptominis suaugusij asmen patikrinimas kai kurioms vlai prasidedanioms paveldimoms ligoms (pvz., Hantingtono ligai) nustatyti; 4) asmenys konsultuojami dl galimo teratogen poveikio j palikuoniams (r. II dalies 2.2 skyri); 5) registruojami ir analizuojami paveldimj lig bei gim tj raidos anomalij
Lietuvoje atvejai; 6) atliekami genetiniai tyrimai biologinei tvystei nustatyti ir kt.

4.2 9 pav. m ogaus genetikos centro 5>cytoja genetike ultragarsu tin a vaisi, nordama v e rtin ti jo bkl iki gim im o

iZ

i K la u s im a i

1. Kas yra genetinis eim konsultavimas? 2. Kokios pagrindins genetinio eim kon sultavimo pakopos? 3. Kas Lietuvoje genetikai konsultuoja ei mas? 4. Kur Lietuvoje yra genetinio eim kon sultavimo centras ir kas jame atliekama?

4.3 0 pav. Visuotinis naujagim i tikrinim as gim tajai h po tirozei ir fenilketonurijai " js ta ty ti: m ogaus genetikos cen tro m edicinos genetike tin a naujagim i kraujo bandinius

mogaus genomo projektas

2000-j birelio 26-j JAV prezidentas B. Klintonas (B. Clinton) kartu su Didiosios Britanijos p re m je ru i. Bleiru (T. Blair) paskelb pasauliui, kad jau baigtas mogaus genomo sekvenavimas. is mokslo laimjimas pasiektas tarptautinio mo gaus genom o projekto tyrj pastangomis. Pagrindiniai centrai - tai tarptautinis mogaus genom o projektas ir privati korporacija Celera". Prezidentas B. Klin tonas savo kalboje akcentavo, kad tai yra naujos - m olekulins medicinos eros pradia, eros, kuri atvers naujus kelius lig profilaktikai, diagno zavim u i ir gydym ui. mogaus genomo projektas formaliai buvo pradtas 1990-aisiais. Jis buvo nu matytas 15-ai met, taiau technologijos paanga leido pirmj etap baigti jau 2000-aisiais. Pagrindiniai projekto vykdytojai JAV yra Energetikos departamento mogaus genomo programa (vadovaujama A. Patrinos (A. Patrina)) ir Nacionalinis mogaus genomo tyrim o institutas (vadovaujamas F Kolinzo (F. Collins)). Be JAV, . iame projekte dalyvavo dar devyniolika ali, kuri parlamentai patvirtino mo gaus genom o program (Lietuvoje tokios programos nra): Australija, Brazilija, Kanada, Kinija, Danija, Europos Sjunga, Pranczija, Vokietija, Izraelis, Italija, Japo nija, Piet Korja, Meksika, Olandija, Rusija, vedija, Didioji Britanija. mogaus genomo organizacija arba HUGO (angl k. Human Genome Organi-

156

sation) padeda koordinuoti tarptautinius mogaus genomo tyrimus. Lietuvoje ios organizacijos tikrasis narys yra V. Kuinskas. Pagrindiniai mogaus genomo projekto (http://w w w .ncbi.nlm .nih.gov/genom e/ guide) tikslai yra ie: 1) nustatyti vis mogaus genomo DNR nukleotid sek (-3 ,3 milijard nukleo tid por! - r. I dalies 1.3 lentel); 2) identifikuoti visus mogaus genus (j tikriausiai yra apie 40 0 0 0 -5 0 000); 3) kaupti iuos duomenis kompiuterinse duomen bazse; 4) sukurti greitesnius, pigesnius ir veiksmingesnius DNR sekvenavimo metodus; 5) sukurti priemones (programin rang) sukaupt duomen analizei; 6) numatyti etinius, teisinius ir socialinius mogaus genomo projekto padarinius. Kodl tiek daug met prireik visam mogaus genomui sekvenuoti? Tai i tikrj milinikas darbas, savo reikme prilygstantis pirmajai moni ekspedicijai Mnul. Visas mogaus genomas sudarytas i 3,286 milijardo nukleotid por, t. y. vairi A, T, G, C derini, kurie tam tikra tvarka idstyti mogaus chromosomose (prisi minkite, kad pavien chromosoma yra atskira DNR molekul). Jei visas ias keturi raidi sekas suraytume atskiras knygas po 1 000 puslapi, susidaryt 200 tom. Jei skaitytume nesustodami 10 nukleotid per sekund greiiu, visoms ioms kny goms perskaityti prireikt 9,5 met. Nesunku sivaizduoti, kokia milinika yra i duomen baz ir kokie galingi turi bti kompiuteriai bei j programin ranga in formacijai analizuoti. Atskira problema yra i duomen saugojimas. Informacijai apie 1 milijono nukleotid sek rayti reikia 1 MB kompiuterio atmintins. Kadangi mogaus genome yra 3,286 milijardo nukleotid DNR, jos sekai rayti prireiks daugiau nei 3 GB kompiuterio atmintins. Ir tai tra informacija apie nukleotid sek. Taiau nemanoma apsieiti be papildom duomen: reikalingos duomen anotacijos, nukleotid sek laboratorini tyrim anotacijos, literatros paieka, duomen analiz, asmeniniai tyrj praneimai, automatins duomen analizs programos. Akivaizdu, kad susidaro didiuliai papildomos informacijos srautai. Buvo vykdomas ne tik mogaus genomo projektas, bet sekvenuojami ir kit organizm genomai (r. I dalies 1.4 lentel ir II dalies 5.1 pav.). vairi organizm tyrinjimai atveria paprastesnius bdus ir mogaus genomui suvokti bei tirti. Todl vykdant mogaus genomo program buvo sekvenuojami ir daugelio kit organizm genomai: arnyno lazdel E. coli, mieli S. cerevisiae, apva liosios kirmls C. elegans, vaisins musels D. melanogaster, pels M. musculus. Tyrim duomenys rodo, kad pels kaip ir mogaus (taip pat ir daugelio kit induoli - un, kai, triui, bedioni, m ogbedioni) genom suda ro apytikriai tiek pat nukleotid por DNR. Taigi beveik visi induoliai turi tiek pat funkcionali gen. Atskirai lyginant m ogaus ir pels genus, buvo nustatyta, kad beveik visiems mogaus genams galima rasti atitikm en (jo hom olog) pels genom e, iskyrus tas genom o vietas, kuriose vyko gen padvigubjimai.

Nustatyta, kad: mogaus baltymus koduojani gen skaiius tik du kartus didesnis nei apvalij kirmli ar musi genom o gen skaiius; imtai mogaus gen tiesiogiai paveldti i bakterij; vyr mutacij danis yra dvigubai didesnis nei m oter mutacij danis; rekombinacijos danis yra didesnis distaliniuose chrom osom regionuose ir ypa trum puosiuose chrom osom peiuose. Tiktina, kad per vien mejozinj dalijimsi kiekviename chromosom os petyje susidaro bent viena rekombinantin chromosoma; lyginant atskirus vis m oni genomus, j panaumai sudaro 99,9 %. Tai gi genetin m oni vairov (genetiniai skirtum ai tarp m oni) tra 0,1 %. m ogaus o rg a n iz m o g en o m e g en tankis yra m a d au g 1 genas kiek v ie n a m e 301 kb in te rv a le . Taiau skirtingose chrom osom ose jis nevieno das: pavyzdiui, 22-ojoje chrom osom oje jis didesnis nei 21-ojoje, nors jos beveik vienodo dydio ir yra maosios akrocentrins chrom osom os. Kaip jau inote, 21-osios chrom osom os trisom ija lemia Dauno lig. Todl labai svarbu nustatyti, kokie genai ioje chromosom oje lemia asmens protin atsilikim, gim tsias irdies ydas, padidjusi rizik sirgti leukemija ir kt. 21-ojoje chromoso moje yra nustatyta 14 gen, kuri mutacijos lemia m onogenines ligas (Alzheim erio lig, nesindromin kurtum , Aerio sindrom ir kt.) ir genai, lemiantys polink sirgti psichinmis ligomis bei viu. Nors 2000-j birelio 26-j ir buvo paskelbta, kad baigtas juodratinis" mogaus genom o variantas, taiau tai tra tikrojo darbo pradia. Dar reikia vardyti konkreius genus, nustatyti, kokias savybes jie lemia, isiaikinti kiek vieno geno veikimo mechanizm lemiant poym. Kokia mogaus genom o iifravimo ir su mogaus genom o projektu susiju si kit organizm genom tyrim reikm vairioms mokslo sritims bei j praktinis taikymas? 1. M o le k u lin medicina: lig diagnostikos tobulinim as (naujas lig diag nostikos etapas ta ikant DNR technologij); ankstyvas polinkio ligai nustaty mas; racionalesn vaist gamyba; gen terapija ir vaist veikimo kontrols sistema; farm akogenetika - optim alus vaist parinkimas konkreiam sergania jam, atsivelgiant jo genotip. 2. M ik ro o rg a n iz m g enom ika: nauj energijos altini sukrimas (biokuras); aplinkos teral nustatymas; apsauga nuo bakteriologinio bei cheminio ginklo; toksini atliek saugus ir efektyvus perdirbimas. 3. Rizikos jvertinim as: ma jonizuojaniosios spinduliuots dozi neigia mos takos mogaus sveikatai vertinimas; chemini m utagen bei v suke liani toksin pavojaus mogaus sveikatai nustatymas; paveldimj m utacij poveikio mogaus genom ui sumainimas. 4. B ioarcheologija, evoliucija ir m o n i migracija: evoliucijos tyrimai pagal gem alo lsteli mutacijas; atskir populiacini grupi migracij tyrimai pagal mtDNR nukleotid sekos vairavim; Y chromosom os pakait tip o m uta cij tyrimas vertinant vyr migracijos ypatumus; m utacinio proceso ypatum palyginimas su populiacijos amiumi bei istoriniais vykiais. 5. DNR techno log ija teism o m edicinoje ir n u s ta ta n t vairi org an izm b u vim , ta p a ty b bei kilm: tariam j nustatymas ir klaidingai apkaltint asmen iteisinimas remiantis nusikaltimo vietoje palikt biologini pdsak DNR tyrim ais; nusikaltim o ar k a tastro f auk asmenybs identifikavim as; tvysts arba kit giminysts ryi nustatymas; donor parinkimas organ transplantacijai; bakterij ar kit organizm , galini uterti aplink, nustaty mas; augal skl ar gyvn kilms ityrimas prie kryminim ; vartojim o pro dukt, kaip antai rafinuotas maistas ir vynas, kokybs patvirtinimas. 6. ems kis: genetins mediagos kryminimui parinkimas ir biologinis apdo rojimas kuriant augal veisles, atsparias ligoms, kenkjams, sausrai; ligoms atspares ni gyvuli veisli ivedimas. Nors nauda medicinai ir apskritai mogui neabejotina, taiau mogaus genomo iifravimas kelia nemaa etikos ir teiss klausim. Kritikai spja, kad genetine in formacija gali pasinaudoti draudimo bendrovs ir darbdaviai - gav informacijos,

kad asmuo paveldjo lig lemianius genus, atsisakyti tok asmen apdrausti arba priim ti darb. Taigi atsirast pagrindas asmens diskrim inavim ui. A ntra vertus, biotechnologins bendrovs siekia kuo skubiau u pa ten tu oti DNR nukleo tid sekas, kurios, m okslinink ir politik nuom one, tu r t bti vi siems prieinam os nem okam ai. Kokie svarbiausi etiniai, teisiniai ir socialiniai klausimai, susij su mogaus genom o tyrimais? 1 G a rbingum as p a n a u d o ja n t g e n e tin in form acij. Kas turi teis gauti informacijos apie asmens genetines ypatybes ir kaip ia informacija galima disponuoti? 2. G enetins inform acijos p rivatu m as bei kon fidencialum as. Kas yra genetins informacijos savininkas ir kas j saugo? 3 Psichologinis spaudim as ir asmens s tig m a tiza c ija 1 dl jo g en etin i y p a ty b i . Kaip informacija apie asmens genetin iskirtinum gali paveikti asmen ir kaip tok asmen priims visuomen? 4. G enetinis in d ivid o tes ta vim as (prenatalinis, ikisim ptom inis testavimas; visuotinis naujagim i tikrinim as paveldimosioms ligoms nustatyti; ikivedybinis patikrinimas; asmens genetinis ityrimas prie pradedant darb tam tikrom is aplinkos slygomis). Ar galima atlikti ikisim ptom in testavim ligai nustatyti, jei dar nra bd tai ligai gydyti? Ar gali tvai tikrin ti savo m aamet vaik dl paveldimosios ligos, kuria jis gali susirgti tik suaugs? 5. Reprodukcijos klausim ai. Ar medicinos personalas turi pateikti vis tiks li ir teising informacij tvams apie pasirinktos reprodukcijos padarinius, apie visus technologijos pavojus bei apribojimus? Ar reikalingas (ir kodl) vaisiaus genetinis ityrimas? 6. Gen te ra p ija , ta ik y ta lig g y d y m u i. Kas yra norma ir kas yra patolo gija? 7. K linikiniai aspektai. Kas ir kaip turi vertinti genetini tyrim kokyb ir patikim um ? Kaip tai pagrsti teisikai? Tokie ir panas klausimai kyla ta ikant naujausius mogaus genom o projek to duomenis praktikoje. Kas turi sprsti visus su genetine informacija susijusius socialinius, etinius ir teisinius klausimus Lietuvoje? Lietuvoje bioetinius klausimus, susijusius su asmens sveikatos prieira, spren dia Bioetikos komitetas. 2000-j birelio 26-j mogaus genom o sekvenavimo pabaigtuvi pristaty me JAV prezidentas B. Klintonas, kreipdamasis Didiosios Britanijos ministr pirminink T. Bleir, pasak: N kiek neabejoju, kad Js snaus Leo gim im o metai (2000-ieji) bus prisimenami kaip nuostabaus k tik paskelbto laimjimo metai. Manau, kad jo gyvenimo trukm k tik pailgjo 25-eriais metais". Kitame Atlanto vandenyno krante esantis T. Bleiras sutiko, kad dl mogaus genom o ityrimo jo berniukas augs paindamas ir suprasdamas dalykus, apie kuriuos jo senelis (taip pat Leo) n nesvajojo. Kaip ir Prezidentas B. Klintonas, a tikiu, kad iandieninis mokslinink praneimas yra perversmas, atveriantis keli didiulei paangai gydant v ir paveldimsias ligas. Be to, tai - tik pradia", - baigdamas kalbti akcentavo brit premjeras.

r P i Klausimai
1. Kas yra mogaus genom o projektas, kas j vykdo ir kokie jo pagrindiniai tikslai? 2. Kuo m ogui reikmingi gyvn genom tyrim ai? Kokius inote organiz mus, ypa svarbius tiria n t mogaus genom ? 3. Koks mogaus genom o gen tankis? 4. Kokios nebiologins problemos ikyla tiria n t mogaus genom bei taikant tyrim duomenis praktikoje?
i - . sgm atize pe rson suomens atstum tasis, nieki-a ~ a s ar kokiu nors bdu dis.-------^jo amas asmuo

Genetin populiacij jvairov

Kaip genas ir genomas, taip individas ir biologin ris yra ta rytum prieingi poliai, tam tikros genetins skals" pradia ir pabaiga. O skals viduryje yra organizm populiacijos, kuri gen rinkinys - genomas yra vienas, taiau at skiriems to rinkinio gen aleliams bdinga didel vairov. Populiacija1 - tai visuma vienos biologins ries individ, gyvenani tam tikroje teritorijoje ir turini bendr gen fond. Gen fon d as - tai gen ir j variant (aleli) visuma, bdinga tam tikrai organizm populiacijai, populiacij grupei arba visai riai. 'V _______________________________________________________________________> Konkreioje teritorijoje gyvenantys populiacijos individai glaudiau bendrau ja. Taigi ir kryminasi daniausiai tarpusavyje, o ne su kit populiacij individais. Todl susiformuoja ir yra ilaikomi tam tikri konkreios populiacijos gen fo n do ypatum ai, susij su vien ar kit gen aleli paplitim u. Skirting organizm ri populiacijos gen fo nd o form avim osi bei raidos dsningumai yra bendri. Tad nordami su jais susipainti, apsiribokime tik vie na rimi - H o m o sapiens, t. y. mumis paiais. iuo m etu m oni populiacij genetiniai tyrim ai visame pasaulyje tu r t bti labai intensyvs, nes genetiniai dab artini populiacij skirtum ai spariai nyksta dl vis intensyvjanios vairi ali gyven toj m igracijos ir rasi maiymosi. Dl i proces dingsta ir galimyb gauti genetins inform acijos apie m ogaus evoliucij. Nors iuolaikins genetins technologijos galina tyrin ti m ogaus evoliucij, rem iantis i seniai mirusi m oni ikastini lie kan gautais duom enim is, bet kokia bus j vert, jei nebus su kuo palyginti. Iki 1990-j moni populiacij vairov daniausiai buvo nustatoma tyrinjant tiksliai paveldimus vairi fe rm e n t slygojamus feno tipu s, kraujo grupes, serum o baltymus. Nuo 1990-j im ta spariai tyrin ti mtDNR tam tik r nukleotid sek vairavim m oni populiacijose, didelis dmesys skiriamas mikropalydoviniam s Y chrom osom os ymenims. M anom a, kad mtDNR atspindi m oni moterikosios populiacijos filogenez, nes ios molekuls paveldi mos tik per kiauialsts citoplazm . A ntra vertus, Y chrom osom os mikropalydoviniai ymenys galina tyrinti vyrikosios populiacijos dalies filogenez, nes Y chrom osom tvai perduoda tik snums. Populiacijose nustatom as didelis atskir poym i vairavimas, t. y. g e n e tin is p o lim o rfiz m a s 2.

Q D

G n t n up l m r i m vadinamas reikinys, kai vienoje populiacijoje aptinkami eeii o i o f z u

lot. p o p u la tio < p o p u lu s liaudis, minia Polimorfizmas (gr. p o lym o rph os - daugeriopas) - daugelio form , atm ain buvimas. 3Gradientas (lot. g ra d ie n s ingsniuojantis, einantis) - mat. vektorius, kurio skaitin reikm ir kryptis apibdina didiausi ska liarinio dydio kitim o greit.

ne maiau kaip du vienos genetins srities aleliniai genai, ir kiekvieno j atskirai paim tas danis yra didesnis nei naujai atsirandani mutacij danis. Paprasiausias moni genetinio polimorfizmo pavyzdys yra aleliniai ABO kraujo gru pi sistemos genai lA l Bir 1. i gen danis konkreioje populiacijoje yra akivaizdus. , Pagrindinis Europos genetinio kratovaizdio" ypatumas - tai alelini gen danu mo gradientas3 prasidedantis Artimuosiuose Rytuose ir einantis Viduremio jros pa , krante iaurs vakar kryptimi. j gradient suformavo neolitins emdirbysts pliti mas i Anatolijos (dabartin Turkija) Viduremio jros pakrante per Balkanus ir Cen trin Europ iaurs vakar kryptimi j Pranczij, Anglij, Skandinavij. Kita Europos genetinio kratovaizdio vairavimo dalis siejama su galima gyventoj migracijos srove i iaurins Kaspijos jros pakrants stepi iaurs vakarus. Pagal M. Gimbutien, tai ir yra indoeuropiei kilms centras. Nustatytas akivaizdus ryys tarp Europos populiacij lingvistini bei genetini ypa tum iplitimo rib. Daugelis toki rib atsirado dl vairi geografini barjer (kaip antai kaln). Tik keletu atvej jokie geografiniai veiksniai neturjo takos populiacij lingvistinio bei genetinio iplitimo riboms. Toki rib atsiradimas pagrstas politini, kultrini bei socialini veiksni. Taigi pasitelkus genetinius duomenis Europos demografin istorija suvokiama kur kas geriau. Genetiniai duomenys gali bti svarbs taip pat ir archeologini, istorini ir lingvistini altini analizei.

Klausimai
1. Kas yra organizm populiacijos ir kokie j genetiniai ypatumai? 2. Kaip tiriam i populiacij genetiniai ypatumai? 3. Kas bdinga Europos m oni populiacij genetiniam kratovaizdiui"? Kokios prieastys l m jo specifik?

6.1
acij lenetins vairovs a :iniai
Tos paios populiacijos individai skiriasi vieni nuo kit (6.1 pav.). Konkreios populiacijos vairov lemia gen mutacijos, chrom osom mutacijos ir rekombi nacija (r. II dalies 1 ir I dalies 2.4.5 skyrius). ie paveldimieji pokyiai - tai evoliucijos aliava. Naujus alelinius genus sukuria tik gen mutacijos, taiau skirtingiems genotipam s bei fenotipam s atsirasti didel tak turi ir chrom o som mutacijos bei rekombinacija. Paveldimieji pokyiai yra isaugomi ir per duodam i kart sekoje. Kaip jau buvo minta, visos populiacijos individ genetini srii visumos aleliniai genai sudaro populiacijos gen fond. Daniausiai gen fondas apibdi namas alelini gen daniu, kuris ireikiamas bendro alelini gen skaiiaus populiacijoje (arba tiriam oje individ grupje) procentine verte. Gen fo nd o alelini gen danio potencial pastovum arba pusiausvyr 1908-aisiais iaikino angl matematikas G. H. Hardis (G. H. Hardy) ir vokiei gydytojas V. Vainbergas (W. Weinberg). H ard io ir V a in b e rg o dsnis Kai populiacijos individai poruojasi atsitiktiniu bdu, o j skaiius yra neribo tai didelis, ir populiacijos neveikia nei migracija, nei gam tin tam tikr geno tip atranka, tai esant pastoviam m utavim o daniui genotip (alelini gen) danis lytikai besidauginanios populiacijos kart sekoje nekinta. v ______________________________________________________________________ / Taigi Hardio ir Vainbergo dsnis galioja tik tada, kai populiacijos neveikia tam tikri veiksniai, vadinamieji pagrindiniais evoliucijos veiksniais. Todl turi bti ilai komos ios penkios slygos: 1) mutacijos nevyksta arba tiesiogini ir grtam j m utacij danis yra vie nodas; 2) nra populiacijos individ migracijos;

161
K in ta m u m a s

6.1 pav. r-~ y^u s su Tibeto vaikais

3) poravimasis vyksta atsitiktiniu bdu: partneris nesirenkamas nei pagal ge notip, nei pagal fenotip. Taigi bet kurj populiacijos individ poravimosi partne riu gali pasirinkti bet kuris prieingos lyties tos paios populiacijos individas; 4) nra gen dreifo, nes populiacija labai didel; 5) nra tam tikr genotip atrankos. Tokioje populiacijoje dviej geno aleli atveju genotip pasiskirstym galima aprayti daugianariu p 2 + 2pq + q2 = 1; kai p yra A alelinio geno danis populiacijoje; o q - a alelinio geno danis toje populiacijoje. Be to,

P+

q = 1

Jei populiacijoje konkretus genas tu ri daugiau aleli, vis j dani suma vis vien yra lygi 1: p + q + ... + n = 1. Atitinkam ai galima vertinti ir kiekvieno konkretaus genotipo dan. Apskaiiuojant tiriamosios populiacijos vairi santuok dan ir tam tikro gen otip o vaik, gimusi tose santuokose, dan, galima matematikai rodyti teigin, kad keiiantis kartoms genotip ir juos form uojani alelini gen da nis nekinta. Taigi: A A gen otip o danis yra p 2; Aa gen otip o danis yra 2pq; aa gen otip o danis yra g 2. Remiantis Hardio ir Vainbergo dsniu nesunku apskaiiuoti dan alelinio geno, lemianio koki nors autosomin recesyviai paveldim lig konkreioje populiacijo je. Pavyzdiui, autosomin recesyviai paveldima liga fenilketonurija Lietuvoje serga vienas i 10 000 gimusi vaik. Serganio asmens atitinkamas genotipas yra aa, taigi jo danis q2 yra 1/10 000, o a alelinio geno danis -

Kadangi p = 1 - q, tai P 1 100 99, 100 '

Heterozigotini a alelinio geno neiotoj danis pagal Hardio ir Vainbergo dsn yra 2pq: 2 99 100 ' 1 0 0 1 _ 2-99 198 10000 10000~ 5 0 ' 1

Pq

Taigi Lietuvoje apytikriai kas 50-as m ogus yra fenilketonurij lemianio alelinio geno neiotojas, o tai jau nemaas danis. Nesunku suvokti, kad gam toje ideali (t. y. atitinkani Hardio ir Vainber go dsnio slygas) populiacij nra, nes veikia m intieji penki pagrindiniai evoliucijos veiksniai. Taigi alelini gen danis populiacijoje ir, be abejo, kart sekoje gali kisti - arba didti, arba mati. Trumpai apvelkime kiekvien i veiksni. 1. M u ta c ijo s p o p u lia c ijo je . K ie kvie no je p o p u lia c ijo je n u o la t vyksta m utacijos. Daugelis j m og ui (kaip ir kitiem s o rganizm am s) yra alingos. Populiacijos g e n e tin nata, kuri suform uoja visi mutav aleliniai genai, sumaina populiacijos individ reprodukcin tinkamum. Kartais mutacijos, bda mos alingos vienoje populiacijoje, kitoje populiacijoje j neiotojams suteikia pranaumo. Pavyzdiui, pjautuvin anemija sukelia sunki maakraujyst, ir ligonis anksti mirta. Serganij genotipas yra HbsHbs, ta igi jie yra h om ozi g otin ia i pagal m utavus h em og lo bin o baltym kodu ojan t P g lo bin o gen.

Asmenys, kurie yra heterozigotiniai pagal gen (HbsHbA), gyvenantys ende minse maliarijos srityse, turi biologin pranaum prie asmenis, kurie yra hom ozigotiniai pagal norm al gen (HbAHbA), nes heterozigotini individ nepuola maliarijos suklj perneantys uodai. Nustatyti, kokia yra tikroji po puliacijos genetin nata, nra paprasta. Daniausiai ji vertinama pagal skai i recesyvini gen, kurie hom ozigotinje padtyje lemia vaik mirt. Jau buvo m inta, kad kiekvienas normalus asmuo yra vidutinikai 10-ies m utavu si gen aleli, slygojani sunkias paveldimsias ligas (madaug pus j yra vaik m irties prieastis), neiotojas. Tai tu r t inoti kiekvienas visuomens narys. Tiriant mutavusi gen aleli paplitim ypa daug nuveik D. Krou (J. Crow). Taigi populiacijoje nra n vieno mogaus, kuris nebt recesyvinio alelinio geno, lemianio koki nors sunki paveldimj lig, neiotojas. Jei konkreioje eimoje nra serganij paveldimja liga, tai tra laimingas atsitiktinum as ir M endelio dsni pasireikimo pasekm (nes net susituokus dviem asmenims, heterozigotiniam s pagal tok pat lig lem iant gen, sirgt tik 25 % jiems gim siani vaik). Antra vertus, to k paveldimum svarbu atsivelgti, nes strategi jos visiems mutavusiems genams i populiacijos elim inuoti yra nerealios - itai m anom a padaryti tik eliminavus visus populiacijos narius. Todl pagrindin strategija tu ri bti nukreipta paiekai priem oni, kaip sumainti skaii bei poveik veiksni, sukeliani mutacijas. Naujos m utacijos populiacijoje retos, taiau jos vis dlto palyginti danos autosominiuose dom inantiniuose ir su X chromosom a susijusiuose genuose, kuri pokyiai pagrindia ligas, mainanias asmen vaisingum. Antai autosomins dom inantikai paveldimos ligos achondroplazijos atveju naujos m uta cijos nustatomos 90 % serganij, nors j danis visoje populiacijoje tra apie 1 /1 0 0 000. Apie 1/3 kai kuri su X chromosoma susijusi recesyviai pa veldim lig (pvz., hemofilijos A) atvej vyrams nulemia naujos mutacijos, ir tik 2 /3 atvej yra paveldimi i ankstesni kart. Visos ios mutacijos maina individo biologin tinkam um (apie j dar bus kalbama), todl gam tin atranka tokias mutacijas nuolat alina i populiacijos. Pastebtina, kad kai kuri nauj dom inantini mutacij danis priklauso nuo tvo amiaus. M anom a, kad naujos dom inantins m utacijos atsiradimo rizika padidja 1 %, kai tvas yra vyresnis nei 40-ties. Priklausomyb nuo m otinos amiaus nenustatyta. Beja, su m otinos amium i susijs ir chromosom neatsiskyrimo per mejoz padanjimas. Toks neatsiskyrimas lemia chrom osom aneuploidij (r. II dalies 1 skyri). Galiausiai populiacijoje sivyrauja tam tikra pusiausvyra tarp nauj mutacij atsiradimo danio ir asmen, turini ireikt ios mutacijos slygojam feno tip, gamtins atrankos intensyvumo. Mutavusius gen alelius, kuriuos gam tin atranka paalina i populiacijos, kitoje kartoje vl sugrina mutacinis pro cesas. Taigi sivyrauja pusiausvyra tarp nauj mutacij atsiradimo ir j elimina vimo i populiacijos dl gamtins atrankos. Apskaiiuota, kad mogaus gen m utavim o danis yra 1 x 10~4 x 10~6. 1 Todl tik viena gam eta i madaug 100 000 turi nauj mutacij. Be abejo, skirtinguose genuose bei vairiose to paties geno srityse jos vyksta nevienodai danai. 2. N e a ts itik tin s san tuo k o s. Kaip jau buvo m inta, a tsitiktine vadinama santuoka, kuri sudaroma neatsivelgiant santuokos partnerio genotip (apie j sprendiam a i fe n o tip o ), t. y. p a rtne ris pasirenkam as a ts itiktin a i. Pa stebtina, kad visikai atsitiktins m oni santuokos yra retos. Daniausiai sutuoktinis pasirenkamas pagal g, ivaizd, intelekto lyg, odos spalv (pvz., baltaodis ar juodaodis) ir pan. Tokios santuokos vadinam os neatsitiktinm is arba a s o rta ty v io m is 1. Jei santuoka su tok pat poym (ar kelis poymius) tu riniu asmeniu labiau pageidaujam a - asortatyvum as teigiamas, o jei to kios santuokos vengiama, asortatyvumas neigiamas. Asortatyvum o poymiai pastebimi net ir ligos atvilgiu (antai kurnebyliai partneriais danai pasirenka kurnebylius). Prie neatsitiktini santuok priskiriamos ir g im ini santuokos. Pasaulyje gausu populiacij, kuriose g im ini santuokos gantinai danos.

ang. assorted - gerai parink tas, vairus

Tokios santuokos ypa bdingos udaroms populiacijoms (izoliatams), t. y. populiacijoms, atskirtom s nuo kit populiacij geografini, rasini, religini, politini ir kit barjer. Gimini santuokos prastos Vidurio Ryt alyse, Pakis tane, Indijos pietuose ir kt. Kadangi kiekvienas asmuo turi bent kelis recesyvinius paveldimsias ligas lemianius alelinius genus, tuokiantis gim inms pa didja tikim yb, kad ie genai palikuoni organizm e atsidurs hom ozigotinje padtyje (aa), ir liga pasireik. Dabar pasaulyje gim ini santuok maja, nes nyksta izoliatai, ir santuokos tam pa vis labiau atsitiktins. Taiau santuok asortatyvumas tebra svarbus evoliucijos veiksnys. 3. M ao s populiacijos ir gen dreifas. Kitas reikinys, galintis kart seko je gerokai ikreipti pradin populiacijos alelini gen dan, yra atsitiktiniai ale lini gen dani svyravimai - g en dreifas. Nors jis vyksta ir didelse, ir maose populiacijose, pastarosiose kur kas didesn tikim yb, kad kuris nors retas fenotipas nedalyvaus fo rm u o ja n t nauj kart. Todl alelini gen, le miani t ret fenotip, danis kitoje kartoje bus maesnis. Gen dreifas yra atsitiktinis procesas. Taigi abejotina, kad jo rezultatai bus panas keliose po puliacijose. Danai staigus kokio nors alelinio geno danio sumajimas arba padidji mas (nes vieno alelinio geno daniui majant, kito (kit) to paties geno aleli nio geno danis didja (A 4 a)) yra susijs su staigiu populiacijos nari > skaiiaus sumajimu. Tai b u telio kaklelio" efektas. Daniausiai taip gali atsitikti po stichins nelaims, itikusios nedideles populiacijas (kaip antai sal gyventojus). Tik atsitiktinumas lemia, kurie individai igyvens ir form uos kitos kartos gen fond. Paprastai is efektas pasireikia, jei ilieka ne daugiau kaip 1/3 pradins populiacijos individ. Form uojant nauj kart dalyvauja tik tam tikri ilik genotipai. O kai genotip pasirinkimas maesnis, form uojam as ma iau vairus kitos kartos gen fondas. Tarkime, kad sunkiai pasiekiamame kaln slnyje gyvenanioje tautelje alelinis a, genas buvo danas (p = 0,7), o alter natyvusis alelinis a2 genas - daug retesnis (q = 0,3). vyko ems drebjimas, per kur daug gyventoj uvo. Tarp uvusij - atsitiktinai daugum sudar tie, kurie turjo a, alel. Todl kitoje kartoje po katastrofos io alelio danis populiacijoje labai sumajo (p = 0,3). Antra vertus, alelinio a2 geno danis q nuo 0,3 iaugo iki 0,7. Per kelet tolesni kart tokioje populiacijoje is alelis gali netgi fiksuotis (g = 1,0), o alternatyvusis a, alelis - visikai inykti (p = 0). is efektas buvo rodytas tiria n t daugel m oni populiacij. Geriausiai pavyko j pagrsti tiria n t gepard populiacijas, kuri genetinis vairavimas drastikai sumajo. fakt rod S. O'Brajenas (S. O'Brian). Gen dreifas yra danas reikinys vairiose nedidelse (ypa - naujose) popu liacijose: udarose religinse bendruomense, persiklli grupse ir pan. is gen dreifo variantas daniausiai susijs su populiacijos p radininko efektu. Tarkime, ta m tikra asmen grup i Europos persikl Am erik (pvz., ami sektos nariai, persikl i Vokietijos Pensilvanijos valstij JAV). Joje atsitikti nai buvo keli asmenys, turj m utavus d o m in a n tin ar recesyvin alelin gen. Todl ioje bendruom enje toks genas kur kas danesnis nei populiacijoje, nuo kurios m intoji b endruom en atsiskyr. Puikus to kio gen dreifo pavyz dys yra didelis vairiaspalv p orfirij lemiani gen danis ta rp baltaodi persiklli i Europos Piet A frik (vadinam j afrikaneri). Pirmieji per siklliai Piet A frik atvyko 1652-aisiais. Dabar yra apie 2,5 m ilijono j palikuoni, i kuri madaug 1 m ilijonas tu ri pirm j persiklli pavardes. Tiksliai inoma, kad visi 8 000 iuo m etu Piet Afrikoje gyvenantys vairiaspalve p orfirija sergantieji yra vienos poros, 1680-aisiais emigravusios i Olandijos, tiesioginiai palikuonys. 4. M ig racija ir rasi maiymasis gali lemti alelini gen danio nuokryp nuo tik tin atvej pagal Hardio ir Vainbergo dsn. M igrantai daniausiai pakeiia dviej populiacij gen fond - tos, i kurios ivyksta, ir tos, kuri atvyksta. Dl asmen m igravimo kontinentuose netgi gali susidaryti alelini gen danio gradientai. Antai AB0 kraujo grupi sistemos alelinio lB geno danis Azijoje yra > 25 %, o vakar kryptim i jis maja ir Didiojoje Britanijoje bei Pranczijoje yra < 10 %.

164

Rasi maiymasis yra ne maiau svarbus reikinys. Pavyzdiui, manoma, kad Piet Kalifornijos juodaodiai, atveti j iaurs Amerik i iaurs Afrikos madaug prie 300 met, dabar turi apie 16-22 % baltaodi gen (r. 6.8 pav., p. 169). Pastebtina, kad migracija ir rasi maiymasis maina populiacij vairov bei j alelini gen danio skirtumus. Taigi skirting populiacij gen fondai supa naja. Antra vertus, nors atskiros populiacijos dl migracijos bei rasi maiymosi ir supanaja, j gen fondas prasipleia, nes miri populiacij silieja nauji aleliniai genai, bdingi tik kuriai nors konkreiai populiacijai. 5. G am tins a tran ko s poveikis. Dl gamtins atrankos populiacijos prisi taiko prie gam tos ir gyvenimo slyg. Dar XIX amiuje . Darvinas rod, kad rys kinta laike, prisitaikydamos prie aplinkos veikiant atrankai. Pagrindinis kintam um o altinis yra naujos gen mutacijos ir rekombinacija per mejoz. Gamtin atranka iskiria konkreius genotipus ne pagal atitinkamus genus, bet pagal j fenotipin pasireikim. Suprantama, kad nuo genotipo fenotipinio pasireikimo priklausys, ar individas apskritai gims ir gims igyvens ligi lytins brandos, ar sulauks lytins brandos perduos savo genus kitoms kartoms (t. y. ar sulauks vaising palikuoni). Tai yra individo biologinis tin kam u m as (tam tikra prasme - prisitaikymo laipsnis). Teorikai svarstant - tai m utantinio genotipo biologinis tinkam um as, nes k tik teigme, kad pagrindinis kintam u mo altinis yra naujos mutacijos. Jei m utantinis organizmas neperduos savo gen kitai kartai, jo genai dings i populiacijos gen fondo. Kiekvienam po ymiui egzistuoja trys gamtins atrankos rys: kryptingoji, stabilizuojanioji ir iskirianioji atranka. Kryptingoji atra n ka (6.2 pav., A) vyksta tada, kai pra naum turi kuri nors kratutin fenotipo iraika (r. modifikacin kintamum). Stabilizuojanioji atranka (6.2 pav., B) vyksta tada, kai pranaesni vidutines poymio reikmes turintys individai, o didiausias arba maiausias poymio reikmes turintys individai (t. y. kratutiniai variantai) yra paalinami i populiacijos. is atrankos tipas dom inuoja m oni populiacijose. Iskirianiosios atrankos (6.2 pav., C) atveju du ar daugiau kratutini fenotip yra tinkamesni nei bet kuris i vidutines reikmes turini fenotip. Dl ios atrankos vienos ries indi vidai pagal tam tikrus kiekybinius poymius, kurie pradinje populiacijoje buvo pasiskirst tolydiai, gali isiskirti dvi skirtingas populiacijas. Taigi kryptingoji atranka pagrindia vien i kratutini poym io variant, stabilizuojanioji atranka - vidutines daniausio populiacijos poymio reikmes, o iskirianioji atranka - kratutinius fenotipus. Pastebtina, kad populiacijos genetin vairov prieingomis kryptimis nuolat veikia vairs procesai. Genetin vairov maina gamtin atranka, ypa drastikai j gali sumainti gen dreifas. Antra vertus, nuolat vykstanios mutacijos bei re kombinacija t vairov palaiko. Migracijos, rasi maiymasis ir gamtin atranka maina skirtumus tarp populiacij, besiskiriani viena nuo kitos pagal konkreius fenotipinius poymius bei tam tikr alelini gen dan. Kiekvienos populiacijos genetinis vairavimas - tai jos ilikimo besikeiianiame pasaulyje garantas. B. Stabilizuojanioji atranka C. Iskirianioji atranka 165
K in ta m u m a s

a -nc s to a i

->goji atranka

mK a s.
: 'eikm s

Klaus

1. Kas pagrindia genetin populiacij vairov ir genetin kiekvienos popu liacijos vairov? 2. K teigia Hardio ir Vainbergo dsnis? Kokios slygos btinos jam pasi reikti? 3. Ar m anom a i populiacijos visikai paalinti sunkias paveldimsias ligas lemianius mutavusius gen alelius? 4. Kodl genetiniu poiriu gim ini santuokos yra pavojingos? 5. Kas didina ir kas maina populiacij genetin vairov bei genetin konkre ios populiacijos vairov?

1. Albinizmas yra paveldimas kaip autosominis recesyvinis poymis. Tarkime, kad ios ligos (t. y. aa genotipo) danis populiacijoje q 2 yra 1 : 20 000. Nusta tykite albinizm slygojanio alelinio geno heterozigotini neiotoj dan toje populiacijoje. 2. Naujagimi tyrim ai fenilketonurijai ir galaktozemijai nustatyti paliudijo, kad i autosom ini recesyviai paveldim lig danis vairiose populiacijose yra skirtingas (r. lentel).

alis ekija Austrija veicarija Vokietija vedija JAV Kanada Naujoji Zelandija

Fenilketonurijos danis 1 : 6 000 1 : 12 340 1 : 16 644 1 : 10 935 1 : 43 226 1 : 13 630 1 : 39 681 1 : 18 168

Galaktozemijos danis 1 : 44 000 1 : 39 116 1 : 65 057 1 : 42 893 1 : 49 000 1 : 104 701 1 : 148 872 1 : 32 514

Apskaiiuokite: a) ias ligas lemiani alelini gen dan tirtose populiacijose; b) abi ligas lemiani alelini gen heterozigotini neiotoj dan tirtose populiacijose. 3. Yra populiacij, kuriom s bdingos ne visos keturios ABO sistemos kraujo grups, o tik dvi. iaurs Amerikos indn Jutos, Tobos, Navajo, Juodakoj gentim s ir Vakar Australijos aborigenams bdingos tik 0 (ll) ir A (lAl; lAlA) kraujo grups. 0 kraujo grups danio tyrim iose populiacijose rezultatai pateikti lentelje. Populiacija Jutai Tobai Navajai Juodakojai Australijos aborigenai Australijos bumenai 0 kraujo grups danis (%) 97,4 98,5 77,7 23,5 48,1 83,0

Nustatykite tirt populiacij genetin struktr, t. y. genotip, nulemiani kraujo grupes, dan.

v______________________________________________ J

4. Viena i kraujo grupi sistem - tai rezus faktoriaus sistema. Supaprasti nus bei apibendrinus galima teigti, kad Rh(+) genotip lemia dom inantinis alelinis D genas, o rh(-) fe notip - recesyvinis alelinis d genas. 85,8 % A m e rikos baltaodi yra rezus teigiami, t. y. Rh(+), o 14,2 % rezus neigiami. Apskaiiuokite: a) alelini D ir d gen dan bei galim genotip dan tirto je populiacijoje; b) kiek procent rezus teigiam asmen yra heterozigotiniai. 5. Baskams, gyvenantiems Pirn pusiasalyje ta rp Pranczijos ir Ispanijos, bdingas vienas didiausi pasaulyje rezus neigiam (rh(-)) fe no tip danis. Ityrus 400 bask nustatyta, kad 230 asmen fenotipas yra Rh(+), o 170 rh(-). Apskaiiuokite: a) alelini D ir d gen dan; b) genotip DD, Dd ir dd dan; c) kiek procent Rh(+) asmen yra heterozigotiniai.
Pastaba i u d a v in i s p r e n d im u s g a lite ra s ti k n y g o je : V. K uinskas. Tu i r ta vo g e n a i. K., viesa, 1998.

\ ______________________________________________________________________ y

B . 2 .

Lietuvos gyventoj genetins jvairovs ypatumai

Jau minjome, kad migracijos bei rasi maiymasis maina populiacij vairavim ir naikina j unikalumo pdsakus. Lietuvos populiacija (Lietuvos gyventojai) genetiniu poiriu dar nedaug tetyrinta. Taiau jau sukaupta nemaai duo men (V. Kuinskas, 2001), leidiani analizuoti Lietuvos populiacijos formavi msi, jos dabartin gen fond bei prognozuoti galimus jo pokyius ateityje. m oni populiacijos aplink Baltijos jr priklauso istorikai skirtingom s kultrom s ir lingvistinms grupms (6.3 pav.). Pietrytinje Baltijos regiono da lyje gyvena balt (lietuviai ir latviai) ir ugrofin (suomiai ir estai) tautos. Baltai, i kuri kilo lietuviai, prie daugel imtmei buvo apsupti kit balt geni. Tiktina, kad ios gentys prie 3 - 4 tkstantm eius gyveno didesnje te rito ri joje nei anuo metu gyven slavai ir germanai. Baltai buvo iplit nuo Vyslos vakaruose iki Dniepro baseino pietuose ir Volgos, Okos bei Maskvos upi rytuose. Ryt balt gyvenamosios teritorijos iaurje ribojosi su ugrofinais. ia me regione kuriai, iemgaliai, sliai bei latgaliai m jun gtis, ir vliau i j susiformavo latvi tauta. Pietuose iliko rytiniai baltai, i kuri ilgainiui susi form avo lietuvi ta uta (6.4 pav.). Kai pirm kart buvo pam intas Lietuvos vardas (XI amiaus pradia), veikiausiai jis buvo taikomas ne visai iandieni nei Lietuvai, bet tik jos daliai ta rp Nemuno, M erkio ir Neries upi pavadinti.

6.3 pav. -i, : : : : - i ; 'es g-^oes

jra

K in ta m u m a s

Lietuvi teritorija pietuose ribojosi su jotvin gi emmis, iaurje - su emai iais ir kuriais, o pietvakariuose - su vakar baltais - prsais. M intuoju laiko tarpiu prasidjo akivaizdi baltikj geni konsolidacija, kadangi jiems teko kautis su besiverianiais j balt teritorijas i vakar germanais (t. y. kryiuo iais, pusantro imto m et bandiusiais kalaviju pakriktyti baltikuosius pagonius) ir iek tiek vlesniais periodais - su slavais i ryt. Lietuva ta po balt geni - prs, jotvin gi , kuri bei kt. - konsolidacijos centru. Vlesniais amiais Lietuvos valstyb (Didioji Lietuvos kunigaiktyst) ilgainiui prarado savo teritorij, o galiausiai - ir savo nepriklausomyb, kuri atgavo 1918-aisiais metais, o pakartotinai - 1990-aisiais. iuo istoriniu procesu remdamiesi tu rim e suvokti, kaip formavosi Lietuvos gyventoj gen fondas, iskirti svarbiausius io proceso periodus ir velgti jam e balt geni atspindius. Lietuvos valstybs krimasis, prasidjs madaug prie t ksta nt met, buvo daugiau politinis aktas, nes balt gentys prie tai jau gyvavo tkstanius met. Taigi ios gentys turjo perduoti savo gen fond dabartiniam s Lietuvos gy ventojams. Todl ia prasme bt klaidinga Lietuvos populiacijos istorija laikyti tik pastarj t kstantm et. Kaip liudija archeologini tyrim duomenys, nuo neolito laik iuolaikins Lie tuvos teritorijos gyventoj nepakeit jokia kita etnin grup. Kitaip tariant, da bartins Lietuvos populiacijos aknys yra labai senos, o tikimyb, kad iuolaiki niai gyventojai ilaik senovs populiacij genetin struktr, tikrai didel. Pa grindiniai Lietuvos populiacijos formavimosi periodai pateikiami 6.5 paveiksle.

38

Ugrofinai

Baltijos jra
*

Latgaliai
R yg a

Kuriai /V

iemgaliai

Balt
Semba Notanga Narduva
E lb in g a s )

te rito rijo s
V iln iu s

Varm Barta

Dainava

G e n i rib o s D a b a rtin s L ie tu v o s te rito rija

Pagud

Jotvingiai Slavai (rusai)

Prsai
Ruimas Sasna Galinda Lubava 6.4 pav. Balt gentys prie 80 0 met

Slavai (lenkai)
V aruva

6.5 pav. Pagrindiniai Lietuvos populiacijos form avim osi etapai

Pirmieji mons Baltijos juros regiono pietryiuose


prie 12 0 0 0 -1 3 000 met (pasibaigus paskutiniajam ledynmeiui prie 16 000 met)

Indoeuropiei siverimas Balt geni formavimasis


prie 4 0 0 0 -5 000 met

Balt geni sjung formavimasis


prie 1 2 0 0 -1 600 met

6.6 pav. Lietuvi etnolingvistins grups (pagal Z. Zinkevii)


RUSIJA ESTIJA

Taigi pirm ieji gyventojai iose te rito rijo s e galjo atsirasti pasibaigus pasku tin iajam ledynm eiui (m adaug prie 16 000 m et). Prie 4 - 5 tkstanius m et ioje te rito rijo je pasirod ind oeuropieiai, o m adaug prie pusantro t ks ta n io m et m fo rm u o tis b alt geni sjunga. Suskirsius d a b a r tin Lietuv eias e tno lin gvistin es dalis (6.6 pav.) ir vliau jas a pjungus j dvi pagrindines (auktaiius ir emaiius), buvo vertintas daugybs g e n e ti ni tiksliai paveldim j poym i jvairavimas Lietuvoje. ie poym iai - tai dvylikos kraujo g ru p i sistem, kraujo serum o baltym ai, m tDNR jvairavi mas, Y chro m o som os m ikrop a lyd ovin i DNR ym en jvairavimas, a tuoni skirtin g Al in ta rp buvimas arba nebuvim as ta m tikrose g e n o m o v ie to se, kai kuri paveldimsias ligas lem iani m uta cij danis Lietuvos p o p u liacijoje. Tyrimai paliud ijo , kad vien alelini gen dan Lietuvos populiacijoje lm vakar taka, kit - ryt taka, o kai kuriuos alelinius genus gre tim o se populiacijose paskleid balt gentys. ABO kraujo g ru p i sistemos lA alelinio geno (ABO kraujo g ru p i sistem o 2 je esama ir daugiau alelini gen nei daniausiai m inim i l, lA ir lB dan ) Lietuvos p op uliacijoje veikiausiai slygojo didelis io geno paplitim as g re ti mose iaurs bei vakar populiacijose (6.7 pav.). is genas ypa danai aptinkamas piet A u k ta itijo je (D zkijoje) ir beveik to lygu s io geno da niui Lenkijoje. A le lin io g en o lB kuris daniausiai atspindi ryt (m o n g o lid ) , tak populiacijai, danis Lietuvos p op uliacijoje ta ip pat p alygin ti didelis ir n et didesnis nei kaim yninse populiacijose (6.8 pav.). A n tra vertus, rezus fa k to ri lem ianios kraujo g ru p i sistemos cde h a p lo tip o , lem ianio rh(-) fe n o tip , didelis danis liudija vakarietik gen tak. N ustatyta, kad is haplotipas danai pasitaiko ir Lietuvoje, ypa bdingas iaurs emaiiams (6.9 pav.).

LATVIJA

iaurs EMAIIAI vakar

ryt AUKJA|C|A1

vakar

LENKIJA

BALTARUSIJA

Suomiai

9%

vedai

Estai S-5%

8%
Lietuviai

2-5%
Lenkai

5%

6.7 pav. ABO kraujo grupi sistemos lA alelio pa plitim o danis 2 Baltijos jros regiono populiacijose

H a p lo tip a s ' - tai per evoliucijos proces v ie n o je c h ro m o som oje susifor mavusios gretim gen grups ar k iti g retim i genetiniai ymenys (kartotins nukleotid sekos, tam tikr restrikcijos endonukleazi kirpimo viet deriniai ir pan.). Kiekvienas toki ymen toje paioje homologins chromosomos vietoje turi savo atitikm en ir su ju o sudaro genotip.

6.8 pav. ABO kraujo grupi sistemos lB alelinio geno danis Europos populiacijose

gr. ha p lo o s - viengubas; ty pos - atspaudas, pavyzdys

6.9 pav. Rezus kraujo grupi sistemos cde haplotipo, slygojanio rh(-) fen otip , danis Europos populiacijose

6 .1 0 pav. Landtainerio ir V ynerio kraujo grupi sistemos alelinio LWb geno paplitim o danis Lietuvos etnolingvistinse grupse

iaurs
7,5%

EMAIIAI
a fc 1 6,0% A U K TA I IA I
vakar 5,1% piet
2,1%

Lietuvoje vidutinikai 5,7%

A. Baltijos jros regionas


Suomiai
2,5%

vedai
0,3%

Rusai Estai 2-0%


4,0%

Latviai
6,0%

Landtainerio ir Vynerio kraujo grupi sistemai ypa bdingas alelinio LWC geno paplitimas. Lietuvos etnolingvistinse grupse jo danumas vairuoja ir iaurs emaitijoje yra pats didiausias, o piet Auktaitijoje (Dzkijoje) - pats maiausias (6.10 pav.). Tiriant Baltijos regiono populiacijas nustatyta, kad is genas daniausias balt populiacijose (Latvijoje ir Lietuvoje), ugrofin (est, suomi) ir slav (lenk, rus) populiacijose jo danis maesnis, o german (ved) populiacijoje jis nesiekia n 1 % (6.11 pav.). io geno danis Azijos, Afrikos ir Vakar Europos populiacijose beveik lygus nuliui arba is alelinis genas ten apskritai neaptinkamas. Taigi tiktina, kad alelinis LWb genas gali bti skiriamasis gentinis" - baltikasis genas. Palyginti didelis jo danis gre tim ose populiacijose (Estijoje, Suomijoje, Rusijoje ir Lenkijoje) liudija, kad istoriniais laikais (t. y. kai balt gentys buvo iplit kur kas didesnje te rito ri joje - r. 6.4 pav.), is genas galjo bti iplatintas ir kaimyninje teritorijoje. Pastebtina, kad piet Lietuvoje jis retesnis, o iaurs Lietuvoje ypa danas, kaip ir kaimyninje Latvijoje. Kaip inia, iaurs vakar Lietuvos teritorijoje ir vakarinje Latvijos dalyje gyveno kuriai. Taigi tiktina, kad didesnis LWb geno danis iaurs Lietuvoje yra kuri gen fo n d o atspindys. Antra vertus, ma esn io geno dan piet Lietuvoje galjo lemti jotvin gi gen fo n d o taka. Tam tikr alelini gen danio ypatumai Lietuvoje buvo nustatyti ir tiria nt kitas genetines sistemas. Vakar tak Lietuvos populiacijai rodo Gc baltym ir a 1-antitiripsin koduojani tam tikr alelini gen danis. Pastebtina, kad kai kuri ugrofinam s bding alelini gen, kaip antai TF*DCHI, Lietuvoje apskritai neaptikta (6.12 pav.). Atsivelgiant io geno ir LWb geno danio populiacijose ypatumus, galima teigti, kad genai plito i balt ugrofin popu liacijas, o ne atvirkiai. Pagal Y chromosom os mikropalydovini DNR ymen tyrim o duomenis bu vo analizuojami genetiniai atstumai tarp vairi Baltijos regiono populiacij. Pagal juos sudarytas filogenezs medis (6.13 pav.) liudija, kad lietuviams ge netikai artimiausi yra latviai; estai ir vedai maiau artim i, o suomiai ir samiai (lapiai) apskritai sudaro atskiras akas. is filogenezinis medis i dalies atspin di populiacij geografin artum , i dalies - lingvistin. Taiau svarbiausia yra tai, kad balt populiacijos - lietuviai ir latviai jam e yra greta. Lyginant dvi pagrindines Lietuvos etnolingvistines grupes auktaiius ir emai ius pagal mtDNR vairavim, nustatyta, kad jos genetikai skiriasi. Tik vienas mtDNR tipas yra bendras ir auktaiiams, ir emaiiams, deimt tip nustatyti tik auktaiiams, trys - tik emaiiams. Be to, emaiiai pasirod es genetikai vienodesni nei auktaiiai pagal visus tirtus genetinius ymenis. Pagal geneti nius poymius labiausiai skiriasi iaurs emaiiai ir piet auktaiiai (dzkai).

Lietuviai
5,7%

Lenkai
2 ,0 %

B. Kitos populiacijos
veicarai - 0,1% Belgai - 0,0% Japonai - 0,0% Afrikieiai - 0,0%

6.11 pav. Landtainerio ir Vynerio kraujo grupi sistemos alelinio LWb geno paplitim o danis vairiose populiacijose

6.1 2 pav. TF*DCHI alelio danis (10 000 gyventoj) Baltijos jros regiono populiacijose

Suomiai
90

vedai

Estai
70 51

Latviai

iuo atveju dert prisiminti balt geni pasiskirstym ir likim vlesniais amiais. Tiktina, kad iaurs emaii gen fonde vis dar pasireikia kuri gen fo n d o indlis, o piet auktaii gen fonde randame jotvin gi gen fo nd o atspindi. Akivaizdius genetinius populiacij skirtum us gali paliudyti ir tam tikr m u tacij, lemiani kai kurias paveldimsias ligas, paplitimas Lietuvoje bei kitose Europos populiacijose. Kaip jau buvo minta II dalies 4.2.2 skyriuje, fenilalaninhidroksilazs geno R408VV mutacija slygoja fenilketonurij. Jos paplitimas kartu su haplotipu (t. y. restrikcinio polim orfizm o tip u) Nr. 2 ta rp Europos serganij fenilketonurij rodo, kad i mutacija pirmiausiai atsirado b a lt slav regione ir vliau iplito kitose Europos populiacijose (6.14 pav.). (3 chem okino receptoriaus geno alelis, turintis ccr5del32 mutacij, hom ozi gotinje padtyje, i dalies apsauganios m og nuo AIDS sukljo IV-1 in fekcijos, Europoje pasiskirsto kitaip. io alelio danis Europoje sudaro gradien t i iaurs pietus (6.15 pav.). Populiacijose aplink Vidurem io jr i m uta cija reiausia, o serganij AIDS - daugiausia. Antra vertus, iaurje i m uta cija danesn, o serganij AIDS kur kas maiau. ccr5del32 mutacijos danis Lietuvos populiacijoje (apie 12 %) yra tarpinis ir atitinka Lietuvos geografin padt pagal io alelio danio gradient. Apibendrinant dera pastebti, kad alelini gen ir haplotipu pasiskirstymas Lietuvoje nra atsitiktinis, ir jo ypatumus galima sieti su dabartins Lietuvos gen fo n d o formavimusi i balt geni gen fond. Kai kurie aleliniai genai rodo, kad takos Lietuvos gen fondui turjo vakar populiacij gen fondai. Be to, kit alelini gen tyrimai liudija ryt populiacij tak. Yra ir treia gen grup, rodanti, kad prie tkstant ir daugiau m et balt gentys buvo paplit daug didesniame areale, o nebaltik populiacij, dabar gyvenani iose teri torijose, gen fonde akivaizdi baltikj gen taka. Kalbant apie Lietuvos populiacijos gen fo n d o formavimsi, negalima apsiri boti tik paskutiniuoju tkstantm eiu - svarbu integraliai ianalizuoti bei su prasti vis balt geni kilm ir filogenez.

Lietuviai

6.13 pav. u--------Baltijos regiono populiacij filogenezs medis: populia cij porini Fst veri NJ medis pagal Y chrom osom os m ikropalydovini DNR ymen 16-ojo ha plotipo dan

VEDIJA

17%

Suomiai 13% ESTIJA 81% LIETUVA Danai vedai 14% Estai

Rusai 14% Mordviai 16% Totoriai

NORVEGIJA

0%

13%

KOTIJA DANIJA

20 %

66%
LENKIJA 55-61% Airiai 11% Britai

8-11% 12%
Vokieiai

Lietuviai 12% Lenkai

12%

DIDIOJI BRITANIJA

0%

PRANCZIJA

VOKIETIJA 24-26% EKIJA 69%

11%
Pranczai

13%

12% VEICARIJA

VEN5 T 6

A BULGARIJA 39% Portugalai >rtuga

10%

Slovakai 1u/o 13% Au* rai Vengrai /o g% Italai

11%
ITALIJA 1%

8%
Baskai

Bulgarai 5% Albanai 4% Graikai 4% Turkai 6%

6%

Ispanai

10%

Sardinai
4%

6 .1 4 pav. Fenilalaninhidroksilazs geno R408W m utacijos danis tarp serganij fenilketonurij vairiose Europos populiacijo se. ia parodyta tik R408VV m utacija, paveldima kartu su 2-uoju haplotipu 6.15 pav. (3 chem okino receptoriaus geno ccr5del32 mutacijos danis kai kuriose Europos populiacijose

L Z i Kiauiniai
1. Kaip formavosi Lietuvos populiacija ir jos gen fondas? 2. Kok alelin gen galime laikyti baltikuoju? 3. Koki populiacij tak Lietuvos populiacijos gen fondui liudija geneti niai tyrimai? 4. Kokios populiacijos yra genetikai artimiausios lietuviams?

R eko m en d u o jam a lite rat ra Lietuvi kalba 1. Juodka B. Nukleino rgi chemijos ir biochemijos pagrindai. Vilnius, Mokslas, 1988. 2. Kuinskas V. vadas j m ogaus p op uliacin genetik. Vilnius, Vilniaus universiteto leidykla, 1994. 3. Kuinskas V. Tu ir tavo genai. Kaunas, viesa, 1998. 4. M ad er S. S. Biologija. I knyga. Vilnius, Alma littera, 1999. 5. Ranelis V. Bendroji genetika. Vilnius, Moksl akademijos leidykla, 2000. 6. Sinkus A. mogaus chromosomins ligos. Vilnius, Mokslas, 1989. A ngl kalba 7. Ayala F. J., Kiger J. A. Jr. M odern Genetics. 2nd edition. California, Davis: Benjamin / Cummings Publ. Co., 1984. 8. A ppels R. Chromosome Biology. London, Chapman & Hall Ltd., 1997. 9. Borgaonkar D. S. Chromosomal Aberration in Man: A Catalog of Chromosomal Variants and Anomalies. 8th edition. New York, Wiley-Liss, 1997. 72 10. Brenner S., M ille r J. H. Eds Encyclopedia o f Genetics. London, Academic Press, 2001. 11. Friedman J. M., Dill F. J., Hayden M. R., M cGillivray B. C. Genetics. 2nd edition. Baltimore, Philadelphia, London, Paris, Bangkok, Buenos Aires, Hong Kong, M unich, Sidney, Tokio, W roclaw, Williams & Wilkins, 1996. 12. H artl D. L , Jones E. W. Genetics: Principles and Analysis. 4th edition. Sudbury, Massachusetts: Jones and Bartlett Publ., 1998. 13. King R. S., Stansfield W. D. Encyclopedic Dictionary o f Genetics: w ith German term equivalents and extensive German / English index. New York, Wiley-VCH Verlagsgemeinschaft W einheim , 1990. 14. M oo re Keith L , Persaud T V. N. Before We Are Born. Essentials . o f Embryology and Birth Defects. 5th edition. Philadelphia, London, Toronto, M ontreal, Sydney, Tokyo, W. B. Saunders Company, 1998. 15. An Internacional System fo r Human Cytogenetic Nomenclature (1995) / ed. by M itelm an F., Karger S., Basel, 1995. 16. Principles o f Gene M anipulation: An Introduction to Genetic Engineering / Old RW, Primrose SB. 5th edition. Blackwell Scientific Publications, Oxford, 1994. 17. Pasternak Jack J. An Introduction to Human M olecular Genetics: Mechanisms o f Inherited Diseases. Bethesda, Maryland, Fitzgerald Science Press, 1999. 18. Redei G. P Genetics Manual: Current Theory, Concepts and Terms. . Singapore, New Jersey, London, Hong Kong, W orld Scientific, 1998. 19. Rieger R., M ichaelis A., Green M. Glossary o f Genetics, Classical and molecular. 5th edition. Berlin, Springer Verlag, 1991. 20. Schinzel A. Catalogue o f Unbalanced Chromosome Aberrations in Man. 2nd edition. Berlin, New York, de Gruyter, 2001. 21. Weaver R. F., H edrick P. W. Genetics. 3rd edition. Dubuque, IA, Bogota, Buenos Aires, Caracas, Chicago, Guilford, London, Madrid, Mexico City, Seoul, Singapore, Sydney, Taipei, Tokyo, Toronto, W m . C. Brown Publishers, 1997. 22. W yn b ra nd t J., Ludman M. a nd oth. The Encyclopedia o f Genetic Disorders and Birth Defects: Facts on File Library o f Health and Living. 2nd edition. New York, 2000. 23. Vogel F., M o tu lsky A. G. Human Genetics. 3th edition. Berlin, Springer, 1996.

R eko m en d u o tin i in te rn e to adresai M o k y m o program os, elek tro n in iai vad o vliai

http://gened.em c.m a rico pa .ed u/B io/B I0 18 1/B IO B K /B ioB oo kT O C .htm l h ttp ://g e n s co p e .c o n co rd .o rg / h ttp ://v e c to r.c s h l.o rg /d n a ftb / http ://w w w .acce ssexce lle nce .o rg / h ttp ://w w w .u ltra n e t.c o m /~ jk im b a ll/B io lo g yP a g e s/

Inform aciniai tin klap ia i h ttp ://w w w .b io m e d n e t.c o m / h ttp ://w w w .b io e th ic s .n e t/ h ttp ://w w w .g e n e .u c l.a c .u k /h u g o / w w w .in fo b io g e n .fr h ttp ://w w w .n a tu re .c o m /g e n o m ic s / h ttp ://w w w .n c b i.n lm .n ih .g o v /g e n o m e /g u id e /h u m a n / h ttp ://w w w .o rn l.g o v /h g m is / h ttp ://jo e co o l.p a th o lo g y.w a sh in g to n .e d u /C y to g a lle ry / M okslins literatros d u o m en bazs 173

h ttp ://w w w .n c b i.n lm .n ih .g o v /e n tre z /q u e ry .fc g i? d b = O M IM h ttp ://w w w .n c b i. nlm .nih.gov/entrez/query.fcgi?db=P ubM ed

Leidinyje pateikiamos iliustracijos i Vilniaus universiteto ligonins Santariki klinik mogaus genetikos centro duom en bazs; asmeninio prof. habil. dr. V. Kuinsko archyvo; vairi in te rn e to svetaini: h ttp ://jo e c o o l.p a th o lo g y.w a s h in g to n .e d u /C yto g a lle ry /; h ttp ://m e m b e rs .a o l.c o m /_ h t_ a /c y to g e n la b /in tfis h .h tm ; h ttp ://m e m b e rs .a o l.c o m /_ h t_ a /c y to g e n la b /m e ta fis h .h tm ; h ttp ://v e c to r.c s h l.o rg /d n a ftb /; h ttp ://v e c to r.c s h l.o rg /d n a ftb /2 9 /c o n c e p t/in d e x .h tm l; h ttp :/w w w .a ch ie v e m e n t.o rg /a u to d o c/p a g e /w a tO p ro -1 ; h ttp ://w w w .2 . ri.bbsrc.ac.uk/library/press/dolly.jpg.