Está en la página 1de 6

los genes de

Siguiendo los pasos del Proyecto Internacional del HapMap, el Instituto Nacional de Medicina Genmica est a escasos das de finalizar el mapa del genoma mexicano, cuya informacin no slo contribuir al estudio histrico y antropolgico del pas, sino a identificar las variaciones existentes entre la poblacin, teniendo importan-

mexico
F O T O : J A I M E

tes consecuencias para la medicina genmica al producir innovaciones en el diagnstico sobre los riesgos de algunas enfermedades como la diabetes, el cncer o la hipertensin. El doctor Gerardo Jimnez, director de dicho instituto, le abri las puertas a Da Siete para conocer el trabajo interno en sus laboratorios, y comparti datos interesantes como la alta probabilidad de que a finales de este ao puedan diagnosticar la agresividad de un tumor en mujeres con cncer de mama. Carmelita Len Martnez
ESTATURA: 1.50M, ORIUNDA DE OAXACA

N A V A R R O

Si se intenta clasificar a los americanos en razas o subrazas, puede adoptarse el esquema de Von Eickstedt, modificado por Imbellon. En l se habla de los istmidos en el sur de Mxico, Yucatn y el Istmo de Oaxaca, que comparten estatura baja (1.5 a 1.6 m.), crneo braquioide, muy corto, cuerpo robusto, cara ancha y baja, nariz ancha, tono de piel oscura.

60 DA SIETE 356

TECNOLOGA DEL GENOMA 61

Luis scar Albarrn Hernndez y Luis hijo


ESTATURA: 1.70M, PADRES Y ABUELOS DE GUERRERO. BISABUELO LIBANS
Los rasgos fsicos de los indgenas ms comunes son el color de la piel, que se asocia con pelo negro y lacio, poca barba o vello corporal y baja estatura, otras caractersticas que se agregan localmente son la forma de la cabeza o de la nariz.

n 2003 se descifr el Genoma Humano, permitiendo un mayor conocimiento de nuestra especie. Con ello sabemos que existe una cadena de cerca de metro y medio de largo, pero se compacta y se alberga en el ncleo de cada uno de los trillones de clulas que forman el cuerpo humano, y la cual est constituida de 3,200 millones de nucletidos o letras (adenina, guanina, timina, citocina) formando los cerca de 26,000 genes que se identificaron. De esta manera, los humanos compartimos el 99.9 por ciento de la secuencia del genoma humano, y el 0.1 por ciento restante de la secuencia vara entre cada individuo, siendo las combinaciones ms comunes aquellas en que cambia una sola letra, es decir, los polimorfismos de un solo nucletido, conocidos como SNPs (pronunciados snips) por sus siglas en ingls. Variaciones que se encuentran a lo largo de toda la cadena, lo que significa, por ejemplo, que algunos individuos tienen una T en determinada posicin del genoma, y otros pueden tener una G. (Ver pg. 68). Para el director del INMEGEN, Gerardo Jimnez, la genmica derrumba el concepto de razas porque ste indica grupos diferentes, pero esta ciencia nos dice que somos iguales en casi el 100 por ciento de la secuencia. En las razas los rasgos parecen ser muy dramticos, pero el ser blanco o negro se debe al cambio de una sola letra y viceversa. Con estos descubrimientos, se iniciaron proyectos como el HapMap, cuya finalidad es la elaboracin de un catlogo de bloques haplotipos en el genoma humano en tres poblaciones: africana, europea y asitica. Los haplotipos son variaciones que se heredan de generacin en generacin en bloque sin verse afectados en su estructura, y suelen ser compartidos entre la descendencia. Debido a que el proyecto internacional no inclua poblaciones latinoamericanas, Mxico inici sus trabajos para realizar su propio proyecto: Estructura Genmica y Mapa de Haplotipos de la Poblacin Mexicana, que permitiera realizar un anlisis inicial del grado de diversidad genmica entre los mestizos de las diferentes regiones del

El INMEGEN ha encontrado en ciertas poblaciones del pas letras de riesgo de enfermedades como la diabetes, la hipertensin y el cncer
pas. Esto, segn los investigadores, ser de vital importancia para conformar la plataforma nacional en medicina genmica. En principio, el estudio se bas en la ubicacin geogrfica para que ofreciera una muestra de mestizos de regiones distantes a lo largo y ancho del pas, en estados como Yucatn, Zacatecas, Sonora, Veracruz y Guerrero. As, se recolectaron muestras de sangre por lo menos de 140 individuos sin parentesco entre ellos, originarios (como sus padres y abuelos) del estado a estudiar. En una segunda fase se incorporaron los estados de Guanajuato, Durango y Campeche. En esta dinmica, el especialista indic que durante este perodo se ha encontrado en ciertas poblaciones del pas letras de riesgo de enfermedades como la diabetes, el cncer o la hipertensin, sin que esto signifique que por pertenecer a esas regiones vaya a padecer la enfermedad. Esto slo se debe a las historias poblacionales de la gente y no a la alimentacin o al entorno. Las mezclas hicieron que algunas variaciones se acumulasen ms en unas personas o en otras. Alcances de la medicina En un futuro no muy lejano, le gustara saber si va a responder negativamente a un medicamento, si tiene el riesgo gentico de padecer diabetes o hipertensin, o bien revertir estas enfermedades para no mermar su calidad de vida? Y si fuese mdico, saber qu exmenes y tratamiento especfico podra administrarle a sus pacientes? La medicina genmica permitir que las prescripciones sean ms personalizadas debido a que el nmero de posibles combinaciones
CLULA Con 23 pares de cromosomas

CROMOSOMAS Dentro est la cadena de ADN

CADENA DE ADN Nucletidos: T: Timina A: Amina G: Guanina C: Citocina


T G
TECNOLOGA DEL GENOMA 63

62 DA SIETE 356

Cada persona tiene caractersticas genmicas nicas, lo que da lugar a la individualidad bioqumica, resonsable de la predisposicin a enfermedades
que resultan de la variacin genmica, da como resultado que cada miembro de nuestra especie tenga caractersticas genmicas nicas, por lo que la individualidad de este tipo da lugar a la individualidad bioqumica, responsable de la predisposicin a padecer enfermedades comunes. La siguiente fase de este proyecto consistir en la identificacin de los cambios genmicos entre las distintas poblaciones y el anlisis de cerca de 1,400 genes causantes de enfermedades monognicas. Una vez que se obtenga el conocimiento del mapa del genoma de los mexicanos y de las respectivas variaciones genticas, el diagnstico podr ser certero previendo los riesgos de padecer alguna enfermedad, de las ya mencionadas por lo pronto, y la forma de evitarlas, as como las interacciones entre la conformacin gentica de cada individuo y su entorno ambiental. Todo esto, en definitiva, modificar las relaciones mdico-paciente, en las cuales se desenvuelve la medicina actual. De acuerdo con el diario espaol El Mundo, en ese pas ya se llevan a cabo pruebas genticas para predecir la metstasis, y es que el tratamiento tras un diagnstico de cncer depender de la informacin gentica que oculten las clulas de una pequea porcin del tumor. En funcin de ste, unos pacientes recibirn un frmaco y otros, uno diferente, y puede que algunos libren la quimioterapia si el ADN de su muestra tumoral dice que el riesgo de diseminacin es muy remoto. Todo esto se debe al Mamaprint, un dispositivo que evala el pronstico de esta enfermedad en mujeres que se han sometido a ciruga e indica el riesgo de sufrir una recada en funcin de la actividad de una seleccin de 70 genes.

Por lo anterior, el doctor Jimnez confa en que a finales del ao, la poblacin mexicana pueda contar con este tipo de diagnstico. Hay algunas variaciones en el genoma que predisponen a cncer, pero lo ms importante es podemos distinguir el grado de agresividad de un tumor al colocar un poco de tejido en un chip que identificar qu persona puede desarrollar metstasis o no. Esto ya es una realidad, aunque existen otras enfermedades que an se encuentran en experimentacin como el cncer de prstata, de colon y la leucemia, seala el mdico. Este es un claro ejemplo de que la medicina genmica se encuentra en la bsqueda de sistemas, diagnsticos o medicamentos ms efectivos que no sean txicos para gente que pudiera rechazarlos. Esto no quiere decir que los medicamentos existentes no sirvan, sino que las dosis debern ajustarse a cada persona cuyo ADN revele que pueden presentar una reaccin adversa a su consumo. Por ejemplo, en Inglaterra 1 de cada 300 nios con leucemia muere por el medicamento, ya que la actividad de la enzima que procesa el frmaco no responde debidamente intoxicndolo e incluso provocando su deceso, explica el mdico mexicano. Finalmente, una vez que se obtenga el mapa del genoma de los mexicanos, seala Jimnez Snchez, existen otros proyectos de investigacin iniciales como el anlisis genmico sobre el origen de la poblacin mestiza mexicana, identificacin de genes de riesgo a Degeneracin Macular Asociada a la Edad, mapeo de variaciones genmicas asociadas a enfermedad cardiovascular, genmica de la diabetes mellitus, farmacogenmica de Purinetol en leucemias peditricas, identificacin de genes asociados a Lupus Eritematoso, genmica de la obesidad humana y protemica de cncer de tiroides. Tal es la importancia de este rubro que un informe de la ONU concuerda con la visin de muchos pases, al pronosticar que la genmica, la protemica y la bioinformtica estarn entre las 10 reas mas importantes de desarrollo econmi co mundial durante los prximos 20 aos.

Carol Nava Gmez


ESTATURA: 1.60M, ORIUNDA DE ZACATECAS
En la misma clasificacin del alemn Von Eickstedt, se sealan a los plnidos, habitantes de los llanos norteamericanos altos (1.68 a 1.74 m.), crneo algo dolicoide y de bveda baja, esqueleto macizo, pmulos salientes y nariz aguilea; y a los sonridos, en el sur de California y oeste de Mxico, altos y dolicoides, esbeltos, de color oscuro, crneo pequeo, macrosquelia, nariz ancha y cara redondeada.

64 DA SIETE 356

TECNOLOGA DEL GENOMA 65

1986 1990

en el tiempo

2003
Se anuncia la conclusin casi total de la secuenciacin del genoma en ambos sectores en competencia con capital pblico y privado.

Se da inicio al Proyecto del Genoma Humano en una reunin internacional en Santa Fe, Nuevo Mxico se acord secuenciar los 3,200 millones de nucletidos del genoma humano de los que existen cuatro tipos: adenina (A), timina (T), citosina (C) y guanina (G).

2004
El International Human Genome Sequencing Consortium publica en la revista Nature la versin definitiva de la secuenciacin de la eucromatina del genoma humano. En nuestro pas, nace el Instituto Nacional de Medicina Genmica (INMEGEN) con el fin de generar una plataforma nacional que permita desarrollar aplicaciones mdicas del genoma humano para la atencin de los problemas de salud de los mexicanos.

La iniciativa se consolida. Los objetivos: producir mapas fsicos refinados de los cromosomas humanos; desarrollar un soporte tcnico para el estudio de la expresin de los genes del genoma humano y divulgar la informacin generada. El PGH es financiado por el gobierno de los Estados Unidos.

1995 1999

2005
En octubre 26 termina la prima fase del HapMap, donde se analizaron cerca de un milln de SNPs (single nucleotid polimorphisms) o polimorfismos de un solo nucletido, que son aquellas variaciones o combinaciones de una sola letra en diferentes posiciones de la cadena de ADN. En ese mismo ao, 20 expertos del Instituto Nacional de Medicina Genmica iniciaron el proyecto de investigacin sobre Estructura Genmica y Mapa de Haplotidos de la Poblacin Mexicana para conocer las particularidades del genoma de los habitantes que los predisponen a ciertas enfermedades.

El sector privado, a cargo de la empresa Celera Genomics, empieza por su parte el PGH.

Se publica la primera secuencia completa de un cromosoma humano (el cromosoma 22). Celera y PGH oficial discuten una posible colaboracin; fracasa por la poltica de liberacin de datos. Un ao despus, Celera anuncia haber secuenciado un 90 por ciento del genoma humano. En Mxico, un grupo de investigadores en ciencias mdicas y biomdicas, principalmente de la Secretara de Salud (SSA), de la UNAM, la Fundacin Mexicana para la Salud (Funsalud) y CONACYT, analiz a travs de un estudio de factibilidad, el impacto potencial que la medicina genmica podra tener para el pas a fin de que sta se pudiese incorporar al nuevo orden mundial en el campo de la salud.

2006
El INMEGEN es admitido como miembro del Public Population Project in Genomics (P3G), un consorcio internacional sin fines de lucro que tiene como objetivo promover la colaboracin entre investigadores en genmica poblacional, a travs de la creacin de una base de datos pblica, abierta, accesible y transparente.

2001

Alejandro Martnez Rosales


ESTATURA: 1.68M, ORIUNDO DE OAXACA
En estados de crecimiento tambin se clasifica a las personas de acuerdo a su origen, la constante es la braquiceflica, que es comn en la poblacin del sur del pas, son de cuello corto, estatura baja, cabeza cuadrada, man dbula acentuada, nariz amplia y con mentn en buena postura.

Celera Genomic (dirigido por Venter) y el International Human Genome Sequencing Consortium (coordinado por Francis Collins) publican en febrero en las revistas Science y Nature, respectivamente, la secuencia del genoma humano. Tambin en ese ao, en Mxico se crea el Consorcio Promotor del Instituto de Medicina Genmica, cuya misin sera llevar a cabo los estudios para el establecimiento de una institucin con el perfil de un instituto nacional de medicina genmica.

2007
Los resultados del borrador del mapa del genoma de los mexicanos se darn a conocer el prximo mes de julio en la celebracin del tercer aniversario de la creacin del INMEGEN. Sin embargo, El Universal public adelantos sobre el mapa del genoma mexicano, en el que se establece que los genes de la poblacin mexicana son el resultado de una mezcla de 35 grupos tnicos, distintos a los de Europa, Asia y frica; el 65 por ciento del componente gentico de los mexicanos es nico y se le ha denominado amerindio. Adems, revela que el 58 por ciento del genoma de la poblacin de Sonora tiene un componente mayoritariamente europeo y 22 por ciento, casi una cuarta parte del genoma de los guerrerenses, proviene de genes africanos.

2002
Comienza el Proyecto Internacional del HapMap, que tiene como finalidad la elaboracin de un catlogo de bloques de haplotipos en el genoma humano con tres poblaciones: africana, europa y asitica.

66 DA SIETE 356

TECNOLOGA DEL GENOMA 67

CIFRAS
1 DE CADA 300
NIOS CON LEUCEMIA LINFOCTICA AGUA, TENDR UNA REACCIN FATAL AL MEDICAMENTO QUE COMBATE ESA ENFERMEDAD, SEGN ESTUDIOS EN INGLATERRA. DE AH LA IMPORTANCIA DE LA FARMAGENMICA.

La MORBILIDAD Y MORTALIDAD relacionada a medicamentos se estima en 76 mil 600 millones de dlares, segn Johnson & Bootma, Arch Intern Med.

23
MIL GENES
SON UBICADOS EN EL MAPA, DE LOS CUALES 1,400 GENES SON CAUSANTES DE ENFERMEDADES MONOGNICAS.

1,200

individuos mestizos de seis estados de la repblica (Yucatn, Sonora, Guerrero, Veracruz, Zacatecas y Guanajuato) se incluyeron en el proyecto de variabilidad genmica y mapa de haplotipos: 50% hombres y 50% mujeres (100 hombres y 100 mujeres de cada estado), de los cuales se analizaron 300 muestras para elaborar el primer borrador del mapa.

CON LOS RESULTADOS DE LA PRIMERA ETAPA DEL HAP-MAP SE IDENTIFIC LA ASOCIACIN DE SNPS EN EL GEN QUE CODIFICA PARA EL FACTOR H DEL COMPLEMENTO PROTENA QUE PARTICIPA EN LA INFLAMACIN CON LA DEGENERACIN MACULAR ASOCIADA A LA EDAD, UNA DE LAS CAUSAS MS IMPORTANTES DE CEGUERA EN LOS ADULTOS MAYORES, SEGN UN ARTCULO DE LA REVISTA SCIENCE.

99.9

secuencia del genoma humano es compartida % de lalos seres humanos. El 0.1 por ciento restante por

vara entre cada individuo, siendo las variaciones ms comunes aquellas en que se cambia una sola letra, es decir, los polimorfismos de un solo nucletido, conocidos como SNPs por sus siglas en ingls.
CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATAT CGTCATCGTACTGCCCTACGGGACGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGT ACTGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTC TAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATGGGACTTTACCC ATGATATCGTCATCGTACTGTCTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGA CTGTCTAGTCTAAACACA/GTCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCC TACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTAC TGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACAT ATCGTCATGGTACTGACTGTCTAGCCTAAACACATCCCACTTTACCCATGCATCGTACTGACT GTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCA GCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTAC GACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGA CTGCATCGTACTGACTGCATCGTACTGACTGCACATATGACATACATAGACTTCGTACTGAC TGTCTAGTCTAAACACATCCCACATATCGTCATCGTT/CTGACTGTCTAGTCTAAACACATCC CACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTC ATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGT CTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGACTGTC TAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATA

SINGLE NUCLEOTIDE POLIMORPHISM


POLIFORMISMO DE UN SOLO NUCLETIDO

SNP

Leticia Coln Murillo


ESTATURA: 1.60M, MADRE Y ABUELOS DE MICHOACN Y PADRE Y ABUELOS DE TOLUCA. TATARABUELA MATERNA DE ESPAA Y TATARABUELO CHINO
Tambin se establece que en el centro del pas se ubica gente mesoceflica (clasificacin en ortodoncia), es decir, que comparten caractersticas de la dolicoceflica, estructura alargada, y la braquiceflica, es decir, altura media, cara redonda y mentn no pronunciado.

3,200
68 DA SIETE 356

millones de nucletidos o letras (A,G,T y C) componen el genoma humano.

Se ilustra una secuencia de 1,134 letras correspondientes a un fragmento de los 3,200 millones de letras que forman el genoma humano. Las regiones sombreadas ilustran que los genes son segmentos de la cadena, mientras que las flechas indican dos de las cerca de 10 millones de variaciones de una sola letra (single nucleotide polimorphisms o SNPs) en diferentes posiciones de la cadena. Estas variaciones confieren individualidad al genoma de cada uno de los miembros de la especie.

TECNOLOGA DEL GENOMA 69

La Unidad de Genotipificacin y Anlisis de Expresin cuenta con chips para anlisis de DNA genmico con capacidad de analizar 10,000, 50,000, 100,000 y hasta 500,000 SNPs simultneamente en muestras individuales para estudios poblacionales.

Cada muestra trae un cdigo de barras para guardar la confidencialidad de las personas. Los datos de la investigacin genmica es resguardada en la Unidad de Supercmputo y Tecnologa de la Informacin capaz de realizar medio trilln de operaciones por segundo.

Las muestras recabadas de los mexicanos son mantenidas a una temperatura de -20C cuando son utilizadas; en almacenamiento estn a -80C. Es por eso que la manipulacin y manejo de las mismas cumplen con estrictas medidas de sanidad.
FOTOS: LIZETTE MERCADO

ENTRE LA VIDA Y LA MUERTE


t e x t o : r o s s a n a f u e n t e s b e r a i n
nicamente decodificar el genoma de los caucsicos, de los asiticos y de los negros. Los mestizo, que configuramos la inmensa mayora de los habitantes no slo de Mxico, sino de Amrica Latina, no fuimos escogidos para esta etapa del proyecto mundial. La omisin fue subsanada por la accin del Estado mexicano que muestra su mejor rostro, aqul que le da sentido al gasto pblico, que lo ennoblece y que es capaz de concitar adems del apoyo ciudadano, el econmico de la iniciativa privada. Un equipo alrededor del doctor Gerardo Jimnez Snchez, bilogo molecular de la Universidad Johns Hopkins, repatriado a Mxico, para participar en este proyecto realiz la investigacin de ms de mil muestras de sangre recolectadas en seis estados del pas. Nunca he visto a Gerardo Jimnez, no lo conozco personalmente hasta el da en que escribo esto, pero estaba tan sorprendido y contento como yo la maana del 9 de marzo, cuando hablamos sobre el gran revuelo que caus la nota sobre la que habamos conversado la tarde previa. Le ped que nos dejara entrar al laboratorio a tomar fotos a verlos trabajar. Cumpli su palabra: Da Siete es la primera publicacin en registrar directamente en este numero un proceso de trabajo intenso y profesional, que culminar con la puesta a disposicin publica de la investigacin. Entre tanto, para que no piensen que traiciono a los mos, reconozco que otra portada de peridico en la que me toc participar, y que me dio igual grado de satisfaccin, fue cuando el 24 de noviembre de 1997 un trabajo de investigacin periodstica identific a Daniel Arizmendi Lpez, un secuestrador que cortaba las orejas de sus vctimas y que era protegido por autoridades policacas y polticas del Distrito Federal y Morelos. Tambin he escogido la muerte. La nota es la nota. En los dos extremos del periodismo. os periodistas en general eludimos las buenas noticias. La tarde del 8 de marzo de 2007, la encrucijada era obvia: una declaracin dura del presidente Felipe Caldern sobre el deseo de aplicar la pena de muerte en Mxico para algunos delitos y el anuncio de que se haban concluido los estudios del genoma del mexicano, se disputaban la portada. Muerte y vida, as de claro. En El Universal se opt por publicar a 8 columnas, con el mximo despliegue, que estaba Listo el Mapa Genmico de los mexicanos. Fue una apuesta por destacar un logro y no hacer eco de una amenaza, la ensima, en el ambiente de miedo que prevalece en el pas. El proyecto del Instituto Nacional de Medicina Genmica (INMEGEN), que se dar a conocer el prximo mes de julio, haba concluido y el director del centro, Gerardo Jimnez Snchez, adelantaba al peridico que el 65 por ciento del componente gentico de los mexicanos es nico. Se le ha denominado amerindio.

La primicia despert el inters de los colegas de la prensa local e internacional. Esto conducir al desarrollo en Mxico de una prctica mdica ms individualizada, ms predictiva y preventiva, una nueva generacin de medicamentos y diagnsticos mdicos personalizados, deca la nota de la radiodifusora BBC de Londres, que dio seguimiento a la informacin original. La aventura del genoma humano haba logrado capturar la imaginacin de la sociedad. Todos los hombres y mujeres, sin importar raza, edad o color, compartimos por igual el 99 por ciento del genoma humano; las variaciones en el 0.1 por ciento restante son las que nos confieren individualidad, es decir, nos hacen fsica y bioqumicamente diferentes. Hace menos de un lustro, en abril de 2003, se descifr por primera vez el genoma humano. Los estudios continuaron, pero en las muestras de protocolos de investigacin se seleccion

70 DA SIETE 356

TECNOLOGA DEL GENOMA 71