Está en la página 1de 13

AMILASA La amilasa, denominada tambin ptialina o tialina, es un enzima hidrolasa que tiene la funcin de digerir el glucgeno y el almidn para

formar azcares simples, se produce principalmente en las glndulas salivares (sobre todo en las glndulas partidas) y en el pncreas. Tiene un pH de 7. Cuando una de estas glndulas se inflama aumenta la produccin de amilasa y aparece elevado su nivel en sangre. Fue la primera enzima en ser identificada y aislada por Anselme Payen en 1833, quien la bautiz en un principio con el nombre de diastasa. -Amilasa (Nombre alternativos: 1,4--D-glucano-glucanohidrolasa; glucogenasa) Las amilasas son enzimas dependientes de cloruro, completamente disfuncionales en ausencia de iones de cloruro. Actan a lo largo de cualquier punto de la cadena de los carbohidratos, descomponindolos en dextrina desde la amilopectina. Dado que puede actuar en cualquier punto de la cadena es ms rpida que la -amylasa. En los animales es una enzima digestiva mayor y su pH ptimo est entre 6.7 y 7.2.

1. El artculo encontrado: Cloning and Expression of the a-Amylase Gene from the Hyperthermophilic Archaeon Pyrococcus sp. KOD 1, and Characterization of the Enzyme

2. Organismo que contiene el gen: Hyperthermophilic Archaeon Pyrococcus sp: Se aisl una archaea hyperthermophilic, Pyrococcus sp. KODI cepa, de un solfatara en un muelle de Isla Kodakara, Kagoshima. La cepa KODI muestra algunas caractersticas tpicas del gnero Pyrococcus, tales como su contenido de GC(38%) y las condiciones de crecimiento (temperatura ptima, 95 C, pH ptimo, 7.0).

Su capacidad para fermentar extracto de levadura y triptona, y su crecimiento en una amplia gama de fuerzas inicas, son muy similares a las caractersticas de Pyrococcus furiosus. Sin embargo, el anlisis filogentico de su secuencia de 16s rRNA indic que este est situado ms cerca del genero Thermococcus que del Pyrococcus. 3. El gen fue obtenido del DNA. 4. Primers empleados: La regin en la primera mitad del fragmento fue amplificado por PCR con primer 1 y primer 2. Primer 1 y 2 corresponden a la regin N-terminal (nmeros 530 a

549nucletidos en la figura. 1) de la enzima madura y la regin de nucletidos (los nmeros 831-851 de la figura. 1)

FUGURA 1. Secuencia de nucletidos y aminocidos para el gen. Los que estn subrayados discontinuamente hacen referencia a la secuencia de los primers utilizados.

La clonacin PCR con primers lleva a la idea de que se tendra un nico fragmento de ADN para introducir en un plsmido, tanto el producto de PCR como el plsmido se digieren con las mismas enzimas de restriccin para que lo pueda insertar. PRIMER 1: GCAAAGTATTCCGAATCGA PRIMER 2: TAAAGGTCATAGCTGATATCG

5. Plsmido empleado: E. coli JM109 se utiliz para construir el ADN del plsmido. E.coli TG-1 se utiliza para subclonar fragmentos de genes para la secuenciacin de nucletidos. E.coli BL21 fue utilizado como sede para el PET-8c a sobreexpresan el gen de la amilasa de la cepa KODL. pUC18 y PET-8c fueron utilizados como vectores plsmidos. M13mp18 fagos y 19 se utilizaron para la preparacin de una sola cadena de ADN. Antes se llamaba pET-8c, ahora se llama pET-3d.

6. Los datos de la secuencia de nucletidos del gen de la amilasa reportados en el artculo se publicaron en las bases de datos bajo el acceso numrico D83793.

Figura 2.

Figura 3.

7. Identificacin de la secuencia de la protena.

Figura 4.

8. Despus de pasar cada uno a formato FASTA y correr el BLAST se encontr la siguiente comparacin con varios organismo:

NUCLEOTIDO

Figura 5. ORGANISMOS COMPARADOS:

Figura 6.

PROTEINA

Figura 7. ALGUNOS ORGANISMOS COMPARADOS

Figura 8.

Vemos que para las comparaciones de los nucletidos en diferentes especies (figura 6.) encontramos que la que ms se parece es la de Thermococcus kodakarensis KOD1 DNA con un porcentaje del 100% seguida por los siguientes resultados que van de mayor a menor similitud respecto a sus secuencias, la disminucin del % en las muestras no solo se deba a que haba una base nitrogenada diferente, sino tambin porque haban de ms:

RESULTADOS Pyrococcus sp. DNA for alpha-amylase, complete cds Thermococcus kodakarensis KOD1 DNA, complete genome Thermococcus sp. 'AEPII 1a' alpha-amylase precursor (BD5031) gene, complete cds Thermococcus sp. GU5L5 alpha-amylase precursor (BD5064) gene, complete cds Thermococcus sp. Rt3 amylase (amy) gene, complete cds Synthetic construct alpha-amylase precursor (BD5088) gene, complete cds Thermococcus sp. HJ21 alpha-amylase gene, complete cds Thermococcus sp. OGL-20P alpha-amylase (amy) gene, complete cds Uncultured organism alpha-amylase precursor (BD5063) gene, complete cds Thermococcus hydrothermalis strain AL662 alphaamylase (amy) gene, complete cds Thermococcus onnurineus NA1, complete genome

PORCENTAJE 100% 100% 63% 59% 59% 59% 58% 59% 59% 59% 59%

Ahora para las comparaciones de los nucletidos en diferentes especies (figura 8.) encontramos que la que ms se parece es la de alpha-amylase precursor [Thermococcus sp. 'AEPII 1a']con un porcentaje del 100% seguida por los siguientes resultados que van de mayor a menor similitud respecto a sus secuencias, la disminucin del % en las muestras no solo se deba a que haba un aminocido diferente, sino tambin porque haban de ms:

RESULTADO cytoplasmic alpha-amylase [Thermococcus kodakarensis KOD1] >dbj|BAA21130.1| alpha-amylase [Pyrococcus sp.] >dbj|BAD86073.1| alpha-amylase precursor, GH13 family [Thermococcus kodakarensis KOD1] alpha-amylase precursor [Thermococcus sp. 'AEPII 1a'] alpha-amylase precursor [Thermococcus sp. GU5L5] alpha amylase [Pyrococcus woesei] >gb|AAC45663.1| alpha amylase [Pyrococcus furiosus DSM 3638] >gb|AAB67705.1| alpha-amylase [Pyrococcus furiosus DSM 3638] cytoplasmic alpha-amylase [Pyrococcus furiosus DSM 3638] >gb|AAL80601.1| alpha-amylase [Pyrococcus furiosus DSM 3638] alpha-amylase [Pyrococcus woesei] alpha-amylase precursor [synthetic construct] amylase [Thermococcus sp. Rt3] Chain A, Crystal Structure Analysis Of The Hyperthermostable Pyrocoocus Woesei Alpha-Amylase >pdb|1MXD|A Chain A, Structure Of A (Ca,Zn)-Dependent Alpha-Amylase From The Hyperthermophilic Archaeon Pyrococcus Woesei >pdb|1MXG|A Chain A, Crystal Strucutre Of A (Ca,Zn)-Dependent Alpha-Amylase From The Hyperthermophilic Archaeon Pyrococcus Woesei In Complex With Acarbose alpha-amylase [Thermococcus sp. HJ21]

PORCENTAJE 100% 100% 98% 97% 97% 97% 94% 96%

94%

99%

9. El plsmido empleado fue pET-3d el cual presenta las siguientes caractersticas: Es un vector tipo bacterial. Presenta resistencia a la ampicilina por la presencia del gen -lactamase. Promotor: T7

Por lo tanto las enzimas de restriccin encontradas son Nco I y BamH I. Las enzimas de restriccin son protenas que se encuentran en las bacterias, en donde tienen la funcin de cortar secuencias de ADN extrao, tal como el de los virus que pueden invadirlas. Muchas de las enzimas de restriccin no cortan el ADN en forma aleatoria en cualquier parte de la molcula, sino que lo hacen en sitios especficos. Existen distintas enzimas de restriccin que reconocen determinadas secuencias de bases nitrogenadas y la cortan entre dos de sus nucletidos.

La enzima BamHI reconoce la secuencia GGATCC y hace un corte entre los nucletidos adyacentes de guanina, dejando extremos pegajosos expuestos. Por ejemplo, si se tiene una molcula de ADN con la siguiente serie de bases: AATTGTGGATCCTCCAGAA TTAACACCTAGGAGGTCTT La enzima de restriccin BamHI reconoce la secuencia GGATCC en ambos lados de la cadena y hace un corte entre las guaninas, quedando un corte como se ilustra a continuacin:

Si el ADNc se clona en el sitio NcoI, la protena expresada no ser una protena de fusin. Se puede observar en el esquema que NcoI prove el codn ATG del gen a clonar. Si al contrario, si la protena se clona al nivel de BamHI, ella ser una protena de fusin. Si estudias cuidadosamente el esquema presentado, podrs ver que ella comienza por los primeros 11 aminocidos de la regin lder del gen 10 (ste gen codifica la regin lder de la protena principal de la cpside del bacterifago T7). El plsmido pET-3 contiene tambin el terminador del bacterifago T7. Adems de un promotor bacteriano, el segundo factor ms importante para exprimir un gen eucariota en una bacteria, como la E. coli es el de tener un sitio eficiente de fijacin al ribosoma. Cuando se busca la expresin de un gen procariota, el sitio de fijacin del ribosoma de se gen es a menudo suficiente. Se procede entonces a clonar el gen de inters a lo largo del promotor (fuerte inducible), utilizando un sitio de restriccin en 5' de la secuencia Shine-Dalgarno, para obtener niveles de expresin elevados. El sitio de fijacin al ribosoma se puede mejorar y hacer eficiente si se desea la expresin de gens eucariotas y procariotas con sitios de fijacin poco eficientes. Esto se realiza insertando ADN al

gen de inters en un plsmido, como el pET-3d, y asegurndose que el segundo codn de se gen siga al codn ATG del vector. El ATG est incluido en el sitio de restriccin NcoI. El plsmido se digiere entonces por NcoI y la extremidad adhesiva se rellena con el fragmento Klenow de la ADN polimerasa I de E. coli.1

http://genemol.org/biomolespa/Expression-Ecoli/expression.html

Vemos con esto que las enzimas de restriccin que se seleccionaron no cortan el gen de la amilasa ya que estas no reconocieron como dianas secuencias cortas de ADN bicatenario 2.

Es el ADN de un virus en el que su material gentico est compuesto por ADN de doble cadena y se replica usando una ADN polimerasa dependiente del ADN, no usando el ARN como intermediario durante la replicacin. Son los virus ADN ms diversos y frecuentes y corresponden al Grupo I de la Clasificacin de Baltimore

10. Para finalizar del gen de amilasa, se tom una secuencia interna de 300 pb y con el mismo CLC se encontr la secuencia de protena para esos 300 nucletidos.

Y se obtuvo la siguiente secuencia de AA:

En los cuales los * con los puntos STOP de la secuencia.