Journal of Virological Methods 136 (2006) 166170

Human papillomavirus type 16 variant assignment by pyrosequencing

David C. Swan a, , Josef R. Limor b , Kara L. Duncan a , Mangalathu S. Rajeevan a , Elizabeth R. Unger a
a

Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, GA 30333, United States b Scientic Resources Program, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Public Health Service, U.S. Department of Health and Human Services, Atlanta, GA 30333, United States Received 3 February 2006; received in revised form 31 March 2006; accepted 2 May 2006 Available online 19 June 2006

Abstract Polymorphisms in human papillomavirus type 16 (HPV16) result in variants from the prototype sequence which can be designated according to geographic distribution and are broadly classied as European (E), African (Af), Asian (As), or Asian-American (AA). Detection of variants has been used to distinguish persistent HPV16 infection from re-infection in natural history studies, and variants have been associated with an increased risk of cervical disease in some populations. Variant determination usually relies on conventional Sanger sequencing of regions of the viral genome, with the major variant group assignments requiring the sequencing of only seven polymorphic sites spread over a 242-bp region of the E6 gene. We applied pyrosequencing to facilitate rapid sequencing and enable the simultaneous detection of multiple variants. A single-stranded template for pyrosequencing was prepared by amplifying a 314-bp fragment (nt 75-388) with a biotin at the 5 -end of the reverse primer to facilitate strand separation and purication. Polymorphisms at the nucleotide sites 109, 131, 132, 143, 145, 178 and 350 were determined in three separate sequencing reactions, one of which was a multiplex format. Pyrosequencing of 97 HPV16-positive exfoliated cervical samples conrmed the Sanger sequencing results; however pyrosequencing identied additional variants in several samples containing mixed variants. Published by Elsevier B.V.
Keywords: HPV16; Variants; Pyrosequencing; E6

1. Introduction Human papillomaviruses (HPVs) are classied on the basis of their genomic DNA sequence. An HPV type has less than 90% similarity with other types at the nucleotide level (Bernard et al., 1994); HPVs with more than 98% similarity are considered type variants. Among the HPVs, type 16 (HPV16) has been extensively sequenced to characterize its variants, and ve major variant groups have been identied on the basis of sequences in the long control region (LCR) and E5 open reading frame (Chan et al., 1992; Ho et al., 1991, 1993). These variant groups are referred to as European (E), Asian (As), Asian-American (AA), African-1 (Af-1), and African-2 (Af-2), loosely desig-

The ndings and conclusions in this report are those of the authors and do not necessarily represent the views of the funding agency. Corresponding author. Tel.: +1 404 639 1300; fax: +1 404 639 3540. E-mail address: dswan@cdc.gov (D.C. Swan). 0166-0934/$ see front matter. Published by Elsevier B.V. doi:10.1016/j.jviromet.2006.05.002

nating their geographic distribution. Sequencing of the E2, E6, L2, and L1 regions of the HPV16 genome (Eriksson et al., 1999; K mmer et al., 2002; Yamada et al., 1997) resulted in a the identication of European prototype (Ep) variants E-G350 [T350G], E-G131 [A131G], and E-C109 [T109C] and a North American variant NA-1 (Yamada et al., 1995). While we have not observed this in our own studies (Rajeevan et al., 2005), some data suggest that women infected with certain variants have a signicantly greater chance of developing a high-grade cervical lesion (Hildesheim et al., 2001; K mmer et al., 2002; a Villa et al., 2000; Zehbe et al., 1998). Detection of variants has also been used in natural history studies to distinguish persistent from recurrent infection (Mayrand et al., 2000; Xi et al., 1995). Nucleotide changes characteristic of a variant in one gene are generally linked to those in other genes, suggesting that variants are stable and are not subject to frequent recombination (Casas et al., 1999; Eriksson et al., 1999; Icenogle et al., 1991; Veress et al., 1999; Yamada et al., 1997). We recently reported that

D.C. Swan et al. / Journal of Virological Methods 136 (2006) 166170

167

sequencing a short segment of the genome in the E6 region (nt 75-388) is sufcient for the determination of major variant types (Swan et al., 2005). To date, variant determination has usually been made by use of the conventional Sanger dideoxy sequencing method. This approach is not optimal for short fragments, particularly for sequences close to the priming site, and is relatively insensitive to detecting multiple sequences in one sample. By contrast, pyrosequencing is optimal for short fragments and detects mixed sequences by estimating the proportions of sample with different nucleotides at variant (or polymorphic) positions. Pyrosequencing has been shown in a number of studies to be a viable and useful technique for detecting single nucleotide polymorphisms (SNP) (Alderborn et al., 2000; Fakhrai-Rad et al., 2002; Nordstrom et al., 2000) in cellular genes and for typing HPVs (Gharizadeh et al., 2001, 2005). In this study, we developed a rapid and quantitative procedure that allows detection of single or multiple HPV16 variants in a sample by pyrosequencing of a short E6 segment. 2. Materials and methods 2.1. Samples Exfoliated cervical cells were collected in PreservCyt (Cytyc Corporation, Marlborough, MA) uid as part of an ongoing study of HPV in a high-risk adolescent population (Tarkowski et al., 2004). DNA was extracted using MasterPure DNA purication kit (Epicentre Biotechnologies, Madison, WI). Residual nucleic acid extracts from 97 HPV16-positive samples previously sequenced for variant determination (Swan et al., 2005) were selected for analysis. Pyrosequencing results were obtained for all of these samples. 2.2. Pyrosequencing 2.2.1. Overview A sequencing primer is rst hybridized to a singlestranded, PCR-amplied DNA template in preparation for the pyrosequencing reaction. After the hybridization, the plate is placed in the automated pyrosequencer, PSQ 96MA (Biotage, Charlottesville, VA), with a dispensing cartridge containing nucleotides, enzymes (DNA polymerase, ATP sulfurylase, luciferase and apyrase) and substrates (adenosine 5 phosphosulfate and luciferin). Each nucleotide incorporation event is accompanied by release of pyrophosphate (PPi). ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5 -phosphosulfate. This ATP drives the luciferasemediated conversion of luciferin to oxyluciferin that generates visible light. Each light signal is proportional to the number of nucleotides incorporated. Apyrase, a nucleotide degrading enzyme, continuously degrades unincorporated dNTPs and excess ATP. When degradation is complete, another dNTP is added. Addition of dNTPs is performed one at a time. As the process continues, the complementary DNA strand is built up and the nucleotide sequence is determined from the signal peaks in the pyrogram (Alderborn et al., 2000). Optimal sequencing is

generally restricted to 20 bases from the end of the sequencing primer. The sequence to analyze is a short section of the DNA strand complementary to the biotinylated template strand that contains one or more polymorphisms. Pyrosequencing begins with the rst nucleotide after the end of the sequencing primer. The PSQ 96MA system determines the order (the dispensation order) in which the nucleotides will be added to the pyrosequencing reaction on the basis of the sequence to analyze. The rst nucleotide in the dispensation order is usually one not anticipated to be incorporated; this serves as an internal negative control. A similar negative control is used after a polymorphic region. With the PSQ 96MA system it is possible to create simplex or multiplex assays. In the simplex assay one sequencing primer is used, requiring that the polymorphic positions be on the same strand and within the extension limit of the pyrosequencing reaction. In multiplex assays, one sequencing primer is used for each polymorphic region so that several different sequencing reactions occur simultaneously. The polymorphic positions do not have to be on the same DNA strand or in the same region. The targeted regions must be compatible however so that incorporation results yield unambiguous sequences. 2.3. Amplication and sequencing primer selection HPV16 E6 gene amplication and sequencing primers were selected by using the PSQ Assay Design software. After indicating the polymorphic sites in the template DNA, the software attempts to nd suitable amplication and sequencing primers for each reaction. Numerous primer combinations are usually found and these are ranked based on optimal primer length, amplimer length, Tm and other criteria. For variant sequencing, the sequencing template (nt 75-388) was generated by using primers GACATTTTMTGCACCAAAAGAGA (primer #1) and biotin-CGGTTTGTTGTATTGCTGTT (primer #2), where M in the forward primer is C or A to include Af1 variants with

Fig. 1. Targeted variant positions in HPV16 E6. Changes at seven positions are shown for each of nine HPV16 variants. The HPV16 reference sequence nucleotide is given in row 2. Nucleotide sequence and numbering is based on the HPV16R reference sequence in the Los Alamos database (http://hpvweb.lanl.gov/stdgen/virus/cgi-bin/hpv organisms.cgi?dbname=hpv).

168

D.C. Swan et al. / Journal of Virological Methods 136 (2006) 166170

a C at nt 83. Four sequencing primers (see diagram below) targeted the variant (underlined) positions as follows: primer #3 targeted polymorphic site 109, primer #4 targeted polymorphic sites 131, 132, 143, 145, primer #5 targeted polymorphic site 178, and primer #6 targeted polymorphic site 350.

3. Results and discussion Three pyrosequencing reactions using four sequencing primers were performed on known HPV16-positive samples. Variants were classied by determination of the nucleotides at

Initial parameters were optimized by using DNA from the cervical epithelial cell-lines, SiHa (13 copies of integrated HPV16) and CaSki (400 copies of multicopy integrated HPV16). Template amount was optimized by testing a range from 5 to 500 ng with each of the sequencing primers. It was found that the pyrosequencing quality (peak height and sharpness) varied little over this range. Primer concentration was important, however, with 0.2 M being optimal. 2.4. Pyrosequencing reaction Sequencing templates were generated by amplication of a small E6 region (nt 75-388) from each extract. Reaction mixtures contained 0.2 M each primer, 0.075 U of AmpliTaq Gold DNA polymerase (Roche Applied Science, Indianapolis, IN), 200 M dNTPs, 4 mM MgCl2, 1 PCR buffer (Gibco-BRL, Gaithersburg, MD) and 5 l MasterPure extract (Epicentre). After an initial denaturation at 95 C for 9 min, reaction mixtures underwent 40 cycles at 95 C for 30 s, 55 C for 30 s, 72 C for 1 min. Ten microliters from each 100- l PCR sample were run on 2% agarose E-Gels (Invitrogen Corporation, Carlsbad, CA) to test for product. From positive samples, 20 l was taken for each pyrosequencing reaction and added to a 96-well plate. All subsequent reagents were from the PSQ SNP kit. Binding buffer (40 l), Streptavidin-coated Sepharose beads (3 l) and water were added to a nal volume of 80 l. The plate was agitated at 1400 rpm at room temperature for 10 min, after which the sequencing template was puried according to the Biotage Vacuum Prep Worktable protocol. The single-stranded, bead-bound template was transferred to the 96-well sequencing plate which already contained 39.5 l of annealing buffer and 0.5 l of site-specic sequencing primer (nal concentration 0.375 M) in each well. The plate was incubated at 80 C for 2 min then cooled to room temperature. Sequencing was performed in the PSQ 96MA apparatus according to the Biotage protocol.

positions 109, 131, 132, 143, 145, 178 and 350 (Fig. 1). The extremely uncommon North American variant (NA-1) (Yamada et al., 1997), which is a derivative of the AA and Af2 variants is indistinguishable from AA without additional identication of nt 532; NA-1 has wild-type A at nt 532, whereas AA has a synonymous G at this position. All the AA samples identied here were resequenced specically targeting nt 532; all were A532G and hence AA (data not shown). The predicted and actual sequencing results obtained by using sequencing primer #4 which targets nucleotides 131, 132, 143 and 145 are shown in Fig. 2. In the example shown the polymorphisms are 131 (A/A), 132 (G/G), 143 (C/C) and 145

Fig. 2. In the top panel is the predicted Ep pattern generated by the PSQ software; in the lower panel is the actual sequence pyrogram from primer #4 in a sample which contains only Ep sequence and no variant, i.e., 131A, 132G, 143C, 145G. The dispensation order was GATCGAGCTACAGCATGTGA in which the italicized nucleotides were added as controls; they are not in the template sequence. E and S shown ahead of the dispensation order below the lower panel indicate the addition of enzymes and substrate.

D.C. Swan et al. / Journal of Virological Methods 136 (2006) 166170

169

Fig. 3. Pyrograms from three sequencing reactions. Panel A shows a multiplex sequencing reaction using primers #3 and #5 in which the sequence is 109T and 178T. Panel B shows a simplex sequencing reaction from primer #4 in which the sequence is 131A, 132G, 143C, 145G. Panel C shows a sequencing reaction from primer #6 in which the sequence is 350T.

(G/G). Fig. 3 shows representative sequencing results from four sequencing primers. We performed blinded pyrosequencing on 97 HPV16 samples that had been previously sequenced (Sanger method) using BigDye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems, Foster City, CA) analyzed using the Applied Biosystems 3100 capillary sequencer. The pyrosequencing results were completely concordant with the Sanger results in 95 of the 97 samples [50 E, 10 Af1, 19 Af2, 1 As, 14 AA, and 1 mixed AA/Af-2]. In the remaining two samples Sanger sequencing detected only E variants while pyrosequencing identied an additional variant mixed with E: (1) 2530% E/7075% Af2; (1) 50% E/50% Af2. (The percentages were averaged from all the polymorphic sites in each sample.) The pyrosequencing method should be useful in large population-based studies requiring variant determination. An additional advantage is the ability to more clearly detect and evaluate the presence of more than one variant in an individual. References
Alderborn, A., Kristofferson, A., Hammerling, U., 2000. Determination of single-nucleotide polymorphisms by real-time pyrophosphate DNA sequencing. Genome Res. 10, 12491258. Bernard, H.U., Chan, S.Y., Manos, M.M., Ong, C.K., Villa, L.L., Delius, H., Peyton, C.L., Bauer, H.M., Wheeler, C.M., 1994. Identication and assessment of known and novel human papillomaviruses by polymerase chain reaction amplication, restriction fragment length polymorphisms,

nucleotide sequence, and phylogenetic algorithms. J. Infect. Dis. 170, 10771085. Casas, L., Galvan, S.C., Ordo ez, R.M., Lopez, N., Guido, M., Berumen, n J., 1999. Asian-American variants of human papillomavirus type 16 have extensive mutations in the E2 gene and are highly amplied in cervical carcinomas. Int. J. Cancer 83, 449455. Chan, S.Y., Ho, L., Ong, C.K., Chow, V., Drescher, B., D rst, M., ter Meulen, u J., Villa, L., Luande, J., Mgaya, H.N., et al., 1992. Molecular variants of human papillomavirus type 16 from four continents suggest ancient pandemic spread of the virus and its coevolution with humankind. J. Virol. 66, 20572066. Eriksson, A., Herron, J.R., Yamada, T., Wheeler, C.M., 1999. Human papillomavirus type 16 variant lineages characterized by nucleotide sequence analysis of the E5 coding segment and the E2 hinge region. J. Gen. Virol. 80, 595600. Fakhrai-Rad, H., Pourmand, N., Ronaghi, M., 2002. Pyrosequencing: an accurate detection platform for single nucleotide polymorphisms. Hum. Mutat. 19, 479485. Gharizadeh, B., Kalantari, M., Garcia, C.A., Johansson, B., Nyren, P., 2001. Typing of human papillomavirus by pyrosequencing. Lab. Invest. 81, 673679. Gharizadeh, B., Oggionni, M., Zheng, B., Akom, E., Pourmand, N., Ahmadian, A., Wallin, K.L., Nyren, P., 2005. Type-specic multiple sequencing primers: a novel strategy for reliable and rapid genotyping of human papillomaviruses by pyrosequencing technology. J. Mol. Diagn. 7, 198205. Hildesheim, A., Schiffman, M., Bromley, C., Wacholder, S., Herrero, R., Rodriguez, A.C., Bratti, M.C., Sherman, M.E., Scarpidis, U., Lin, Q.Q., Terai, M., Bromley, R.L., Buetow, K., Apple, R.J., Burk, R.D., 2001. Human papillomavirus type 16 variants and risk of cervical cancer. J. Natl. Cancer Inst. 93, 315318. Ho, L., Chan, S.Y., Burk, R.D., Das, B.C., Fujinaga, K., Icenogle, J.P., Kahn, T., Kiviat, N., Lancaster, W., Mavromara-Nazos, P., 1993. The genetic drift of human papillomavirus type 16 is a means of reconstructing prehistoric viral spread and the movement of ancient human populations. J. Virol. 67, 64136423. Ho, L., Chan, S.Y., Chow, V., Chong, T., Tay, S.K., Villa, L.L., Bernard, H.U., 1991. Sequence variants of human papillomavirus type 16 in clinical samples permit verication and extension of epidemiological studies and construction of a phylogenetic tree. J. Clin. Microbiol. 29, 17651772. Icenogle, J.P., Sathya, P., Miller, D.L., Tucker, R.A., Rawls, W.E., 1991. Nucleotide and amino acid sequence variation in the L1 and E7 open reading frames of human papillomavirus type 6 and type 16. Virology 184, 101107. K mmer, C., Tommasino, M., Syrj nen, S., Delius, H., Hebling, U., a a Warthorst, U., Pster, H., Zehbe, I., 2002. Variants of the long control region and the E6 oncogene in European human papillomavirus type 16 isolates: implications for cervical disease. Br. J. Cancer 86, 269273. Mayrand, M.H., Coutlee, F., Hankins, C., Lapointe, N., Forest, P., de Ladurantaye, M., Roger, M., 2000. Detection of human papillomavirus type 16 DNA in consecutive genital samples does not always represent persistent infection as determined by molecular variant analysis. J. Clin. Microbiol. 38, 33883393. Nordstrom, T., Ronaghi, M., Forsberg, L., de Faire, U., Morgenstern, R., Nyren, P., 2000. Direct analysis of single-nucleotide polymorphism on double-stranded DNA by pyrosequencing. Biotechnol. Appl. Biochem. 31, 107112. Rajeevan, M.S., Swan, D.C., Nisenbaum, R., Lee, D.R., Vernon, S.D., Rufn, M.T., Horowitz, I.R., Flowers, L.C., Kmak, D., Tadros, T., Birdsong, G., Husain, M., Srivastava, S., Unger, E.R., 2005. Epidemiologic and viral factors associated with cervical neoplasia in HPV-16-positive women. Int. J. Cancer 115, 114120. Swan, D.C., Rajeevan, M., Tortolero-Luna, G., Follen, M., Tucker, R.A., Unger, E.R., 2005. Human papillomavirus type 16 E2 and E6/E7 variants. Gynecol. Oncol. 96, 695700. Tarkowski, T.A., Koumans, E.H., Sawyer, M., Pierce, A., Black, C.M., Papp, J.R., Markowitz, L., Unger, E.R., 2004. Epidemiology of human papillomavirus infection and abnormal cytologic test results in an urban adolescent population. J. Infect. Dis. 189, 4650.

170

D.C. Swan et al. / Journal of Virological Methods 136 (2006) 166170 Yamada, T., Manos, M.M., Peto, J., Greer, C.E., Munoz, N., Bosch, F.X., Wheeler, C.M., 1997. Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J. Virol. 71, 2463 2472. Yamada, T., Wheeler, C.M., Halpern, A.L., Stewart, A.C., Hildesheim, A., Jenison, S.A., 1995. Human papillomavirus type 16 variant lineages in United States populations characterized by nucleotide sequence analysis of the E6, L2, and L1 coding segments. J. Virol. 69, 77437753. Zehbe, I., Wilander, E., Delius, H., Tommasino, M., 1998. Human papillomavirus 16 E6 variants are more prevalent in invasive cervical carcinoma than the prototype. Cancer Res. 58, 829833.

Veress, G., Szarka, K., Dong, X.P., Gergely, L., Pster, H., 1999. Functional signicance of sequence variation in the E2 gene and the long control region of human papillomavirus type 16. J. Gen. Virol. 80, 10351043. Villa, L.L., Sichero, L., Rahal, P., Caballero, O., Ferenczy, A., Rohan, T., Franco, E.L., 2000. Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasia. J. Gen. Virol. 81, 29592968. Xi, L.F., Demers, G.W., Koutsky, L.A., Kiviat, N.B., Kuypers, J., Watts, D.H., Holmes, K.K., Galloway, D.A., 1995. Analysis of human papillomavirus type 16 variants indicates establishment of persistent infection. J. Infect. Dis. 172, 747755.