Está en la página 1de 3

La tiroestimulina, un heterodmero de dos nuevas

subunidades de glucoprotenas humanas que activan


al receptor de hormona estimulante de la tiroides.
Koji Nakabayashi1, Hirotaka Matsumi1, Alka Bhalla1, Jeehyeon Bae1, Sietse
Mosselman2, Sheau Yu Hsu1 and Aaron J.W. Hsueh1
1
Divisin de Biologa Reproductiva, Departmento de Ginecologa y Obstetricia,
Escuela de Medicina Universidad de Stanford, Stanford, California, USA
2
Departmento de Farmacologa, Organon Inc., Oss, Holanda
Direccin para correspondencia: Aaron J.W. Hsueh, Department of
Gynecology and Obstetrics, Stanford University School of Medicine,
Stanford, California 94305-5317, USA.
Telfono: (650) 725-6802; Fax: (650) 725-7102;
E-mail: aaronahsueh@stanford.edu

La tirotropina humana (TSH), la luteotropina (LH), la folitropina (FSH), y la


gonadotropina corinica son miembros de la familia de hormonas glicoprotenas
heterodimricas. Las subunidades alfa comunes forman heterodmeros no covalentes
con diferentes subunidades . Recientemente se han identificado dos nuevos genes
como hormonas de glicoprotena humana, alfa 2 (A2) y 5 (B5). Utilizando un
ensayo de doble hbrido en levadura, se descubrieron las dos subunidades como
socios de heterodimerizacin potencial. Anlisis Inmunolgicos confirmaron la
heterodimerizacin de A2 y B5 en clulas transfectadas y su colocalizacin en la
pituitaria anterior. Glicoprotenas heterodimricas recombinantes A2/B5 purificadas
utilizando intercambio de catin cromatografa de fraccionamiento de tamao
activaron receptores TSH humanos pero no receptores LH y FSH y mostraron una
alta afinidad a los receptores TSH en un experimento de receptores radioligandos. El
heterodmero tambin estimul la produccin de cAMP la incorporacin de timidina
por clulas tiroidales cultivadas y aument los niveles de suero de tiroxina en ratas
con TSH suprimido in vivo. Esta nueva hormona de glicoprotena heterodimrica se
llam tiroestimulina basado en su actividad estimuladora de la tiroides. La expresin
de tiroestimulina en la pituitaria anterior conocida para manifestar receptores TSH
sugiri un mecanismo paracrino. El actual descubrimiento de un nuevo ligando
basado en metodologa genmica puede facilitar la comprensin de los roles
fisiolgicos de sistemas receptores TSH extratiroidales y la base estructural y
funcional de la sealizacin del receptor por hormonas de glicoprotenas
relacionadas.
Introduccin
La tirotropina humana (TSH), la folitropina (FSH), la lutropina (LH), y la
gonadotropina (CG) corinica son miembros de la familia de las hormonas de la

glicoproteina derivadas de heterodimerizacin de una subunidad alfa comn con


subunidades hormona especficas. Esas hormonas fueron originalmente purificadas
de la pituitaria anterior (TSH, LH, y FSH) y de la placenta (CG humana) y se
observa que activan receptores acoplados de protena G especficos en la tiroides
(receptor TSH) y gnadas (receptores LH y FSH), respectivamente (1-4). Esas tres
hormonas de glicoprotena derivadas de la pituitaria forman la base de los sistemas
de retroalimentacin objetivo pituitario-perifricos clsicos y son esenciales para el
desarrollo y la diferenciacin de los tejidos tiroidal y gonadal. Particularmente TSH
es esencial para la produccin de yodotironinas por la glndula tiroides y los
desrdenes en el eje pituitaria-glndula tiroides-hormona tiroides llevan a disturbios
de esencialmente todos los rganos y caminos metablicos (5-6).
Basados en las investigaciones de GenBank, identificamos dos genes similares a
subunidades de hormonas de glicoprotenas humanas adicionales y los denominamos
alfa2 (A2) y 5 (B5), debido a sus similaridades estructurales a subunidades
conocidas y a la cronologa del descubrimiento (7). (Los nmeros de acceso del
GenBank para A2 y B5 son AF403384 y AF403430, respectivamente.) A2 y B5 han
conservado residuos de cistena, similares a aquellos encontrados en subunidades
alfa y bien caracterizadas(8,9) importantes para la formacin de las ligazones
claves de los bisulfuros. Como todas las otras subunidades de hormonas de
glicoprotenas, A2 y B5 poseen la estructura de nudos nica de la cistina que es
caracterstica de las protenas relacionadas con TGF-, la PDGF, y las familias de
protenas morfogenticas de los huesos (10,11). Ya que la subunidad putativa A2 es
propensa a combinarse tanto con subunidades conocidas o nuevas para producir
hormonas heterodimricas bioactivas, realizamos un screen de interaccin proteinaproteina de doble hbrido en levadura para identificar potenciales socios de
dimerizacin para e interacciones encontradas entre A2 y B5. Generamos Abs
contra A2 y B5 para confirmar las interacciones entre esas subunidades putativas y
su colocalizacin en la pituitaria anterior. Siguiendo las pruebas para la activacin de
receptores de hormonas de glicoprotenas, se encontr que el heterodmero A2/B5
estimulaba TSH pero no a los receptores de gonadotropina in vitro e in vivo. La
presente metodologa proporciona un nuevo paradigma para el descubrimiento de
ligandos polipeptidos heterodimricos en baja abundancia utilizando bioinformtica,
doble hbrido en levadura, y receptor de ligandos en metodologa coincidente.
Mtodos
Pruebas de doble hbrido en levadura y anlisis RT-PCR. Se evaluaron interacciones
entre A2 y diferentes subunidades de hormonas de glicoprotenas en el sistema de
doble hbrido en levadura usando vectores pGBT9 GAL4-rea de aglutinacin (BD)
y pGADGH GAL4-rea de activacin (AD) (12). Se evalu la ligazn especfica de
diferentes pares de protenas pecific con base en la activacin de los genes
reportados GAL1-HIS3 y GAL4-lacZ (Clontech Laboratories Inc., Palo Alto,
California, USA). La regin madura del cADN A2 fue fusionada al GAL4-AD en
un vector de plataforma en levadura, pGADGH. Similarmente los cADN
codificando otras subunidades de hormonas de glicoprotenas sin los peptidos de
sealizacin se fusionaron al vector GAL-4BD del pGBT9. Se evaluaron
interacciones especficas de diferentes pares de protenas con base en la activacin

del gen reportado GAL1-HIS3 medianamente deficiente en leucina, triptofan e


histidina pero en la presencia de 5 mM 3-aminotriazola (13). Se testearon al
menos10 diferentes colonias expresando cada par de protenas de fusin.
Para el anlisis de RT-PCR de la expresin de ARNm deA2 y B5 mRNA, los tejidos
se recolectaron de ratas macho Sprague-Dawley de 50 das (Simonsen Laboratories
Inc., Gilroy, California, USA). El total de ARNm se extrajo utilizando el reagente
mRNA TRIzol (Life Technologies Inc., Grand Island, New York, USA) antes de RT
para obtener cADN. La amplificacin PCR del cADN se realiz bajo condiciones de
alto rigor (desnaturalizacin: 94C, 30 segundos; atemperado y extension: 6872C,
3 minutos, 35 ciclos). Los cebadores especficos son: cebador flujo arriba A2,
CATCCCAGGCTGCCACTTGCACCCCTTC; cebador flujo abajo A2,
CTTTCTGAGGCTGCTGATGGTGCAGC; cebador flujo arriba B5,
ATGGCCCTCCTCCTTCTGGCTGGCTAT; B5 cebador flujo abajo,
CTCCGCAGTCACAGCGGATGGCCACGG. La omisin del paso RT lleva a una
prdida de los productos PCR.
Generacin de Ab s para A2 y B5 e inmunoanlisis. Para la produccin de Ab,
cADN que corresponden a la regin madura del A2 o B5 humano fueron
subclonados en el interior del vector pGEX-4T-1 (Amersham Pharmacia Biotech,
Piscataway, New Jersey, USA). Despus de la transformacin en Escherichia coli
cepa BL21 (Invitrogen Corp., Carlsbad, California, USA), la espresin de las
protenas de fusin que consistan de enzima glutationa S y A2 o B5 madura se
introdujo siguiendo el tratamiento con isopropil-1-tio--D-galactosida. Las protenas
de fusin en el lisato bacterial se purificaron usando una columna de afinidad de
glutationa-Sefarosa 4B, emulsionada en un un ayudante de Freund, e inyectada en
conejos (Strategic BioSolutions Inc., Newark, Delaware, USA) para generacin
Ab.Se purific IgG usando la columna Proteina G Sefarosa 4 Flujo Rapido
(Amersham Pharmacia Biotech).
Esta es una muestra de mis traducciones
Original: Ingls.
Si deseas el texto completo o necesitas otras traducciones.
Best Translations
Language Consultant
Traducciones tcnicas y cientficas
bestcl@yahoo.com
Santiago - Chile

También podría gustarte