FACULTAD DE MEDICINA HUMANA FILIAL NORTE

DEPARTAMENTO ACADÉMICO DE CIENCIAS BÁSICAS

Guía de prácticas BIOLOGÍA CELULAR Y MOLECULAR 2011-II
Responsable de Prácticas Profesores de Práctica : :
Blgo Lezama Vigo, Hélmer Helí, MSc Blgo. Nolasco Cárdenas, Oscar, MSc. Blgo. Jerí Apaza, César Blgo. Murrugarra Bringas, Victoria Blgo. Alata Linares, Victoria, Mg Blgo. La Rosa Loli, Rafael, Mg Blgo. Quintana Cáceda, Milagros, MSc. Blgo. Vadillo Gálvez, Giovana. Q.F. Ramírez Rojas, Luisa. Ing. Quím. Benel Fernández, Doyle, Mg Ing. Quím. Waltersdorfer Mendoza, Martín. Blgo. Rodríguez Alayo, Néstor, Mg. Blgo. Baca Dejo, Francisco, Mg. Méd. Ruiz Velazco, María. Méd. Sánchez Castillo, Jampieer Blgo. Guzmán Vigo, César, Mg

APELLIDOS, NOMBRES:_________________________________________ GRUPO:___________DIA:____________ PROFESOR:______________
1

INTRODUCCIÓN

La biología es la ciencia de la vida que estudia la estructura y función de los organismos vivos y sus componentes. Las aplicaciones de la investigación básica en biología molecular son numerosas, desde la tecnología para trasplantar corazones, manipular genes, diseñar fármacos contra microorganismos patógenos e incrementar la producción mundial de alimentos. La guía de prácticas del curso de Biología Celular y Molecular tiene como objetivo entrenar al estudiante con los procedimientos llevados a cabo en el laboratorio y desarrollar su pensamiento científico que lo lleve comprender los términos básicos de la Biología Molecular. El estudiante debe emplear esta guía en cada práctica de laboratorio y estar informado sobre la práctica que se llevará a cabo en cada sesión. La guía se ha dividido en tres partes de acuerdo a cada evaluación parcial. La primera parte comprende la célula y componentes celulares. La segunda parte incluye procesos celulares como respiración, permeabilidad, división celular y la visualización de organelas. En la tercera parte se analizara el proceso de meiosis, comprensión del código genético y técnicas de manipulación de ácidos nucleicos. El alumno debe cumplir con los objetivos planteados al final de cada práctica. Así mismo debe presentar su guía de práctica terminada la misma.

2

PROGRAMACIÓN DE CONTENIDO


1

CONTENIDO
Introducción y organización de grupos de práctica. Bioseguridad, Niveles de riesgo biológico en un laboratorio. Microscopía técnicas de manipulación y enfoque de muestras Técnicas de coloración y observación de células Procariotas Observación de células Eucariotas

2

3 4 5

Demostración experimental del fenómeno de difusión Determinación de macromoléculas. Actividad enzimática Observación movimientos celular: Ciclosis Observación organelas y vacuolas celulares Mitocondria, Cloroplasto, Vacuolas PRIMERA EVALUACION Fermentación Mitosis Meiosis Fecundación

6

7 8

9
10 11

12 13

Extracción de DNA

14

Código Genético y Traducción de Proteínas

15

Estudio de Rasgos Genéticos en el Hombre

16

Examenes Finales

3

PRÁCTICA GUIADA Nº 1
BIOSEGURIDAD PRIMERA PARTE: BIOSEGURIDAD
El trabajo en el Laboratorio requiere la observación de una serie de normas de seguridad que eviten posibles accidentes debido al desconocimiento de lo que se está haciendo o a una posible negligencia de los alumnos que estén en un momento dado, trabajando en el Laboratorio. A continuación alistamos una serie de medidas e indicaciones de seguridad que deben tomarse durante las prácticas de laboratorio.

NORMAS PERSONALES 1. Lea con atención, antes de cada práctica, las indicaciones de su guía. Siga todas las instrucciones a menos que el profesor realice alguna modificación. 2. Cada grupo de prácticas se responsabilizará de su zona de trabajo y de su material. Se trabajará con cuidado y de manera organizada. Así mismo se mantendrá cada mesa de trabajo limpia, seca y ordenada. 3. Es obligatorio la utilización de mandil que le cubra brazos, piernas, torso y pies. Están prohibidos el uso de sandalias, pantalones cortos, faldas, polos cortos, etc. en el laboratorio. La persona inapropiadamente vestida para trabajar en el laboratorio le será negado el ingreso. 4. No deben llevarse las manos a la boca ni a la cara pues pueden estar contaminadas. 5. Si tienes el pelo largo, es conveniente que lo lleves recogido. 6. Está terminantemente prohibido fumar, tomar bebidas ni comidas. 7. En caso de derrame, accidente o daño avise inmediatamente al profesor. 8. Al término de cada práctica limpiar el área de trabajo y lavar los materiales utilizados con agua de caño. Lavarse las manos meticulosamente con agua y jabón. Finalmente cerciorares que las llaves de gas y agua estén cerradas.

REACTIVOS QUIMICOS 1. Usar lentes de seguridad cuando trabaje con reactivos químicos peligrosos que puedan salpicar o derramarse. 2. Antes de utilizar un compuesto, asegurarse bien de que es el que se necesita, fijarse bien el rótulo. 3. Como regla general, no coger ningún producto químico. El profesor o profesora te lo proporcionará. 4. Nunca devuelva los sobrantes de los productos a los frascos de origen sin consultar con el profesor. 5. Es muy importante que cuando los productos químicos de desecho se viertan en la pila de desagüe, aunque estén debidamente neutralizados, debe dejarse que circule por la misma, abundante agua. 6. No tocar con las manos y menos con la boca, los productos químicos. 7. No pipetear con la boca. Utilizar una bombilla de succión.

4

8. Los ácidos requieren un cuidado especial. Cuando queramos diluirlos, siempre echaremos el ácido sobre agua. 9. Los productos inflamables (gases, alcohol, éter, etc.) deben estar lejos de fuentes de calor. Si hay que calentar tubos con estos productos, se hará al baño María, nunca directamente a la llama. 10.Manipule con precaución los solventes volátiles e inflamables como el éter, acetona y metanol. Nunca evapore estos solventes en una hornilla al abierto. Utilice siempre un sistema de condensación eficiente. 11.Si se vierte sobre ti cualquier ácido o producto corrosivo, lávate inmediatamente con mucha agua y avisa al profesor. 12.Al preparar cualquier disolución se colocará en un frasco limpio y rotulado convenientemente. 13.Encienda fuego en el laboratorio solo si no existen solventes inflamables en la vecindad. La persona que encienda el fuego debe primero verificar que no exista otra persona que este trabajando con solventes inflamables en el laboratorio.

MATERIAL DE VIDRIO 1 Use material de vidrio limpio y no rajado. 2 El vidrio caliente no se diferencia a simple vista del vidrio frío. Para evitar quemaduras use guantes o trapos. 3 Si tienes que calentar a la llama el contenido de un tubo de ensayo, observa cuidadosamente estas dos normas: -Ten sumo cuidado y ten en cuenta que la boca del tubo de ensayo no apunte a ningún compañero. Puede hervir el líquido y salir disparado, por lo que podrías ocasionar un accidente. -Calienta por el lateral del tubo de ensayo, nunca por el fondo; agita suavemente (mira la figura). EQUIPOS ELÉCTRICOS 1 Manipule cualquier equipo eléctrico con las manos secas y asegúrese que el área de trabajo también este seca. 2 Ningún cordón electrifico debe colgar fuera de la mesa de trabajo. 3 Cuando desconecte algún equipo de tomacorriente, jálelo por el enchufe y no por el cordón.

UTILIZACION DE BALANZAS 1 Cuando se determinan masas de productos químicos con balanza, se colocará papel sobre los platos de la misma y si el producto fuera corrosivo, se utilizará una luna de reloj. 2 Se debe evitar cualquier perturbación que conduzca a un error, como vibraciones debidas a golpes, aparatos en funcionamiento, soplar sobre los platos de la balanza, etc. MANIPULACIÓN DE ESPECÍMENES 1 Manipule los microorganismos crecidos en una placa petri o tubo de cultivo con extremo cuidado. Siempre utilice técnicas de esterilidad (a la llama del mechero, guantes, palillos estériles, etc.). 2 Nunca llevar a la boca plantas o partes de ellas como semillas, frutos y hojas.

NIVELES DE RIESGO BIOLOGICO EN UN LABORATORIO
5

Clasificación de microorganismos por grupos de riesgo para el trabajo de laboratorio: Grupo de riesgo 1 (riesgo individual y poblacional escaso o nulo) Microorganismos que tienen pocas probabilidades de provocar enfermedades en el ser humano o los animales. Grupo de riesgo 2 (riesgo individual moderado, riesgo poblacional bajo) Agentes patógenos que pueden provocar enfermedades humanas o animales pero que tienen pocas probabilidades de entrañar un riesgo grave para el personal de laboratorio, la población, el ganado o el medio ambiente. La exposición en el laboratorio puede provocar una infección grave, pero existen medidas preventivas y terapéuticas eficaces y el riesgo de propagación es limitado. Grupo de riesgo 3 (riesgo individual elevado, riesgo poblacional bajo) Agentes patógenos que suelen provocar enfermedades humanas o animales graves, pero que de ordinario no se propagan de un individuo a otro. Existen medidas preventivas y terapéuticas eficaces. Grupo de riesgo 4 (riesgo individual y poblacional elevado) Agentes patógenos que suelen provocar enfermedades graves en el ser humano o los animales y que se transmiten fácilmente de un individuo a otro, directa o indirectamente. Normalmente no existen medidas preventivas y terapéuticas eficaces. BARRERAS DE CONTENCION Los laboratorios presentan diversas barreras de contención que previenen el escape y dispersión de agentes biológicos de riesgo. Barrera primaria: Es aquella que protege al personal y al ambiente inmediato del agente de riesgo (vestimenta de uso exclusivo, cabina de bioseguridad y equipos provistos de dispositivos de seguridad). Barrera secundaria: Es aquella que protege el ambiente externo contra los agentes de riesgo (diseño del laboratorio e implementación de equipos de seguridad de acuerdo al nivel de Bioseguridad). Barrera microbiológica: Es un dispositivo o sistema que evita o limita la migración de microorganismos entre los espacios situados a ambos lados del mismo y permite controlar la concentración de microorganismos en el ambiente, dentro de límites prefijados. Tiene como objetivo proteger al operador o al operador y al proceso. Barrera microbiológica parcial: Es un dispositivo o sistema que limita la migración de microorganismos entre los ambientes situados a ambos lados del mismo. En este tipo de barrera se recomiendan Prefiltros, Filtros HEPA (Filtros de alta eficiencia para el control de partículas en suspensión) así como cabinas de bioseguridad clase I o II, lo cual dependerá del tipo de trabajo que se efectúa en un determinado laboratorio. Barrera microbiológica absoluta: Es un dispositivo o sistema hermético, a prueba de filtraciones de aire o gas, que evita en forma total la migración de microorganismos entre el ambiente confinado por la barrera y el ambiente exterior de la misma. La barrera microbiológica absoluta puede confinar al producto o proceso, dejando al operador fuera de la misma o viceversa. En este caso se recomienda una cabina de bioseguridad de tipo III. Barrera química: Son dispositivos o sistemas que protegen al operador del contacto con substancias irritantes, nocivas, tóxicas, corrosivas, líquidos inflamables, sustancias productoras de fuego, agentes oxidantes y sustancias explosivas. En este caso se recomiendan una cabina de seguridad química. Barrera física: Son dispositivos o sistemas de protección individual o colectiva que protegen contra las radiaciones ionizantes, no ionizantes, ruidos, carga calórica, quemaduras y vibraciones excesivas.

NIVELES DE BIOSEGURIDAD
De acuerdo con el nivel de riesgo, el tipo de laboratorio, la barrera de contención requerida, los procedimientos y técnicas a usar, se han establecido los siguientes niveles de Bioseguridad.

6

Nivel de Bioseguridad I: Es aquel que corresponde a las actividades desarrolladas en un laboratorio básico, por personal adiestrado en los procedimientos que se ejecutan en él. En este nivel se trabaja con agentes clasificados en el Grupo de riesgo I por presentar un peligro mínimo para el personal del laboratorio y para el ambiente. En el nivel de Bioseguridad I no se requiere equipo especial ni un diseño específico de las instalaciones. El personal de estos laboratorios es generalmente supervisado por un científico con entrenamiento en microbiología. Nivel de Bioseguridad II: Es aquel que corresponde a las actividades desarrolladas en un laboratorio básico, por personal adiestrado en el manejo de agentes de riesgo del grupo II. Es similar al nivel I y en él se manejan agentes de peligro moderado hacia el personal y el ambiente, pero difiere del nivel I en las siguientes características: 1. El personal de laboratorio tiene entrenamiento específico en el manejo de agentes patógenos. 2. El acceso al laboratorio es restringido cuando se está realizando algún trabajo. 3. Se toman precauciones extremas con instrumentos punzo cortantes contaminados. 4. Ciertos procedimientos en los cuales pueden salpicar los agentes o aerosoles se llevan a cabo en cabinas de trabajo microbiológico. Nivel de Bioseguridad III: Es aquel que corresponde a las actividades desarrolladas en el laboratorio de contención. El personal debe contar con adiestramiento específico para el manejo de agentes de alto riesgo clasificados en el grupo de riesgo III. En el laboratorio se realiza trabajo con agentes que pueden causar un daño serio y potencialmente mortal como resultado de la inhalación o exposición a los mismos. El laboratorio cuenta con un diseño y características especiales tendientes a proteger al operador y al ambiente. Todos los materiales son manipulados utilizando vestimenta y equipo de protección siguiendo protocolos rigurosos. Los laboratorios se mantienen con una presión de aire negativa, lo cual ayuda a impedir que los agentes nocivos escapen al ambiente. Nivel de Bioseguridad IV: Es aquel que corresponde a las actividades desarrolladas en el laboratorio de contención máxima. Este nivel es el que se utiliza para trabajar con agentes biológicos clasificados en el grupo de riesgo IV por representar un alto riesgo individual de contagio y que además son un riesgo para la vida. Los agentes nuevos que presentan características antigénicas, patogénicas u otras similares a agentes de nivel III y IV son confinados a nivel IV hasta que exista suficiente información científica para establecer a cual grupo de riesgo pertenecen. El personal que trabaja en los laboratorios de nivel IV tiene entrenamiento específico y extensivo en el manejo de agentes infecciosos, y cuenta con entrenamiento para trabajar en el ambiente estéril y controlado. El laboratorio cuenta con un diseño y características especiales tendientes a proteger al operador y al ambiente. Todos los materiales son manipulados utilizando vestimenta y equipo de protección de características superiores a las exigidas para el trabajo en un laboratorio de nivel III. Los trajes están diseñados para cubrir la totalidad del cuerpo, presentan un sistema de respiración individual asociado y una leve sobrepresión interna para evitar así la entrada accidental de partículas infecciosas. Los laboratorios se mantienen con una presión de aire negativa , lo cual ayuda a impedir que los

agentes nocivos escapen al ambiente. TIPOS DE LABORATORIOS En relación con el grado de riesgo los laboratorios combinan las características de diseño, construcción, medios de contención, equipo, prácticas y procedimientos de operación necesarios para trabajar con agentes patógenos de los distintos grupos de riesgo. De esta manera los laboratorios se clasifican en 3 categorías: Laboratorio básico: Dividido en dos grupos, el de nivel de bioseguridad 1;y el de nivel de bioseguridad 2; Laboratorio de contención: con nivel de bioseguridad 3, y Laboratorio de contención máxima: con nivel de bioseguridad 4.

7

PRÁCTICA GUIADA Nº 1

1.-Complete los nombres de los distintos símbolos de bioseguridad que se presentan a continuación.

1.- complete el recuadro :
NIVEL DE BIOSEGURIDAD CARACTERISTICAS EJEMPLOS DE PATOGENOS

FECHA

ACTITUDINAL

MATERIAL 8

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº 2
MICROSCOPÍA Y ENFOQUE DE MUESTRAS

I.

FUNDAMENTO

La invención del microscopio se atribuye a Johannes y Zacharias Jansen (1590) y el descubrimiento de la estructura celular de los organismos a Robert Hooke (1665). Posteriormente, en 1683 y con un microscopio muy rudimentario Leeuwenhoek descubrió un universo enmarcado sólo por decenas de micrómetros. Desde aquel entonces, el perfeccionamiento continuo al microscopio ha permitido a la Ciencia profundizar cada vez más en el conocimiento de la ultraestructura celular y de las relaciones intercelulares. MICROSCOPIO COMPUESTO El microscopio es un instrumento óptico que se compone de una serie de lentes para conseguir imágenes aumentadas de objetos diminutos que por su extrema pequeñez no son visibles al ojo humano. El microscopio compuesto está constituido de un SISTEMA OPTICO destinado a obtener una imagen aumentada del objeto, un SISTEMA MECANICO que sostiene los distintos elementos ópticos y los objetos que se van a examinar y un SISTEMA DE ILUMINACIÓN. CARACTERISTICAS DEL MICROSCOPIO Dado que la imagen del microscopio no es real sino virtual, se han determinado algunos términos de medida microscópica: En cualquier microscopio el poder de resolución define su rendimiento óptico, porque es su capacidad para ver como separados dos puntos que realmente lo están pero que nuestro ojo sólo puede ver como una entidad única (es decir es su capacidad de entregar imágenes bien nítidas). El máximo poder de resolución del microscopio óptico es de 0,2 micrómetros(0,2 µm), debido a que la longitud de onda de la luz utilizada (400-700 µm) es un factor limitante. El ojo humano tiene un poder de resolución de aproximadamente 100 micrómetros. El límite de resolución puede definirse como la distancia mínima que debe existir entre dos puntos para que se puedan distinguir como separados. El límite de resolución se puede calcular a partir de la siguiente ecuación: Kλ L.R. = ____________ A.N λ = longitud de onda de luz AN = apertura numérica de cada lente objetivo es su capacidad para captar la máxima cantidad de la luz difractada por el objeto. Depende del índice de refracción del medio. Recuerda: A menor límite de resolución mayor será el poder de resolución Resolución y magnificación Máximas Instrumento óptico Resolución Magnificación Ojo humano 0,1 mm Microscopio óptico 0,2 u 2500 Microscopio electrónico 0,1 nm 1000 000 K = constante = 0.61

9

II. OBJETIVOS  Reconocer las partes del microscopio óptico.  -Conocer su utilización para la observación de distintas muestras biológicas. III. MATERIALES Y MÉTODOS En el laboratorio encontrarás: - Microscopio compuesto - Aceite de inmersión - muestras fijadas IV. PROCEDIMIENTO. Se reconocerán las partes de un microscopio óptico. Señalar las partes del mismo en el dibujo adjunto. 1. SISTEMA OPTICO. El sistema óptico está constituido por: Objetivos: sistema de lentes convergentes que actúa como una lente que se encuentran montados en el revolver. Lo usual es que cada microscopio tenga cuatro objetivos de diferentes aumentos ( 4x, 10x, 40x, 100x) los que se clasifican en:  Objetivos en seco: en los que el aire se interpone entre la lente y la preparación.  Objetivos de inmersión: en el cual un líquido ( aceite) se interpone entre la lente y la preparación. Ocular: El ocular es una lente convergente que recoge la imagen intermedia producida por el objetivo y forma una nueva imagen virtual, derecha, y amplificada un cierto número de veces (X veces, según se indica en el propio ocular). Los aumentos más comunes son 10X y 16X. 2.-SISTEMA DE ILUMINACIÓN. Condensador: Sistemas de lentes convergentes que concentra el haz de luz sobre la preparación. Diafragma: Sirve para regular la cantidad de luz que llega a la preparación. Fuente de luz: Puede ser natural o artificial (ampolleta). Portafiltro: Opcional, sirve para colocar filtro de distintos colores para mejorar el contraste. 3.-SISTEMA MECANICO Tubo óptico: Cilíndrico ahuecado destinado a llevar el ocular en su extremo superior y los objetivos montados en el revólver en su extremo inferior. La longitud del tubo debe ser siempre precisa. Revólver: Pieza metálica situada en la parte inferior del tubo que por rotación sitúa los diferentes objetivos en posición de trabajo. Platina: Superficie plana con una perforación central para permitir el paso de la luz hacia preparación. Posee un carro que sostiene la preparación y que puede desplazarla hacia delante y hacia el lado izquierdo o hacia el lado derecho. Tornillo Macrométrico: Mecanismo de enfoque de avance rápido. Tornillo Micrométrico: Mecanismo de enfoque con precisión o ajuste fino.

10

Base o Pie: Estructura sólida y pesada que sostiene y da estabilidad a todo el instrumento. Columna: Vástago vertical que se articula con la base y con el tubo del microscopio y lleva el mecanismo de movimiento del mismo. NOTA IMPORTANTE. Presta mucha atención al manejo del microscopio que tienes a tu cargo. Debes hacerlo cuidadosamente porque son aparatos muy delicados y dejarás a consigna tu documento de identificación.

MANEJO DEL MICROSCOPIO ÓPTICO
1 Colocar el objetivo de menor aumento en posición de empleo y bajar la platina completamente. 2 Colocar la preparación sobre la platina sujetándola con las pinzas metálicas. 3 Comenzar la observación con objetivo de menor aumento. Si la preparación es de bacterias emplear el objetivo de mayor aumento (objetivo de inmersión, ver punto 6). 4 Para realizar el enfoque: a. Acercar al máximo la lente del objetivo a la preparación, empleando el tornillo macrométrico. Esto debe hacerse mirando directamente y no a través del ocular, ya que se corre el riesgo de incrustar el objetivo en la preparación pudiéndose dañar alguno de ellos o ambos. b. Mirando, ahora sí, a través de los oculares, ir separando lentamente el objetivo de la preparación con el macrométrico y, cuando se observe algo nítido la muestra, girar el micrométrico hasta obtener un enfoque fino. 5. Pasar al siguiente objetivo. La imagen debería estar ya casi enfocada y suele ser suficiente con mover un poco el micrométrico para lograr el enfoque fino. 6 El empleo del objetivo de inmersión es siempre utilizando aceite de inmersión.

11

PRACTICA GUIADA Nº 2
1.- Indique todas las partes del microscopio

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

12

PRACTICA GUIADA Nº 3
PRIMERA PARTE: TECNICAS DE COLORACION. PREPARACION DE MUESTRAS
I. FUNDAMENTOS La coloración implica la penetración del colorante por fenómeno osmótico y su fijación se debe a fenómenos de absorción de partículas o iones. Químicamente la coloración es la unión de las moléculas del colorante con los elementos constituyentes de la célula. Algunas regiones celulares tienen pH alcalino y se tiñen con los colorantes ácidos; otros tienen pH ácido y se tiñen con colorantes básicos. Sin embargo es necesario señalar que tanto el núcleo como el citoplasma tienen características anfótericas de manera que se pueden teñir, el núcleo con algunos colorantes ácidos y el citoplasma con algunos colorantes básicos. El       mecanismo de coloración de las muestras biológicas pueden ser afectados por: Pureza del colorante Concentración del colorante pH de la solución del colorante Temperatura del medio ambiente Sustancias adicionales (mordientes) Tiempo de coloración.

Los preparados microscópicos, constituyen una serie de preparados rutinarios de laboratorios que tienen por objeto identificar en forma rápida el contenido de un determinado tipo de muestra, con la con la finalidad de resolver algún problema de interés particular. Los preparados microscópicos más frecuentes en Biología son: Preparados “en fresco” Preparados “en seco” Los preparados “en Fresco” son preparaciones microscópicas acuosas, que se caracterizan por que la sustancia examen, no está adherida de un modo fijo a la superficie de la lámina portaobjeto y por lo tanto, al ser manipulada ésta en diferentes posiciones se corre el riesgo de perder u estropear el preparado. Los preparados “en seco” son aquellos que sufren un procesamiento previo (extensión, fijación y coloración), y se caracterizan porque la sustancia examen se halla adherida a la superficie de la lámina portaobjeto y por lo tanto, al ser manipulada ésta en diferentes posiciones no se estropea o pierde la muestra. Es importante ejercitar al estudiante en el manejo y aplicación de estos factores que inciden básicamente en la complementación del aprendizaje del estudio de estructuras celulares, identificación de tejidos y microorganismo. II. OBJETIVO. 1. Diferenciar y explicar el fundamento de las distintas coloraciones 2. Realizar coloraciones con muestras biológicas III. MATERIALES Encontrarás en el laboratorio. - Microscopio óptico - Pipetas pasteur - Goteros - Agua destilada - Mechero - Azul de metileno - Safranina - Eosina - Violeta de genciana - Wright - Fucsina - Verde de Janus

13

- Giemsa IV. PROCEDIMIENTO

- Hematoxilina

PREPARADOS EN FRESCO 1. Colocar una gota de agua estancada en una lamina 2. colocar una laminilla cubreobjetos 3. observar PREPARADOS EN SECO 1. Colocar la muestra en la lamina 2. Realizar la coloración respectiva 3. Secar al medio ambiente 4. observa la microscopio

PARTE 2: OBSERVACIÓN Y RECONOCIMIENTO DE CÉLULAS PROCARIOTES,

I. FUNDAMENTO La principal característica de la célula procariota es que carece de núcleo celular. Las bacterias, los organismos procariotes más representativos, comprenden por una parte, especies de importancia médica puesto que producen una serie de infecciones y padecimientos en el hombre y en los animales pero, por otra parte, una gran mayoría representa beneficios para la agricultura, la industria y la salud humana y animal. Para observar este tipo de células se utiliza la Tinción Gram, técnica diseñada por el médico danés Hans Christian Gram. Esta consiste en poner en contacto las células bacterianas con colorantes básicos como violeta de genciana, utilizando la solución de lugol como mordiente. Esto forma un compuesto yodado que se fija fuertemente en determinadas bacterias. Según la coloración que adquieran, las bacterias se clasifican en: GRAM POSITIVAS: se tiñen fuertemente con violeta de genciana y adquieren una coloración violeta. GRAM NEGATIVAS: se tiñen muy superficialmente por lo que fácilmente se decoloran con solventes orgánicos. Se utiliza adicionalmente la safranina o fucsina, que se emplea como colorante de contraste, adquierendo una coloración rosada. La diferente tinción de bacterias se debe a la composición diferencial de sus paredes bacterianas. Las bacterias Gram positivas poseen una pared celular con mureina y ácido teitoico. En cambio, las Gram negativas tienen una pared mucho más compleja que contiene, además del peptidoglucano, una asociación de proteínas lípidos y lipopolisacáridos Además de la coloración esta técnica nos permite distinguir en las bacterias: a) morfología: cocos, bacilos, espirilos, cocobacilos, vibrios, etc) b) agrupación: pares, cadenas tétradas, racimos, sarcina A: forma de caña o bacilos B: Redondos en líneas: estreptococos C: redondos en cúmulos: estafilococos D: Redondos en pares: diplococos E: Forma de espirales: espirilos F: En forma de coma: vibrios II. OBJETIVOS

14

Reconocer los distintos tipos de bacterias según se tiñan o no con la Tinción Gram.

III. MATERIALES Encontrarás en el laboratorio:  Microscopio óptico - Alcohol acetona  Soluciones para la tinción: - Fucsina o safranina - Violeta de genciana - Aceite de inmersión - Lugol - Mechero de alcohol

IV. PROCEDIMIENTO La tinción Gram se realizará sobre las muestras de yogur, sarro dentario y vinagre que los alumnos traerán. Bacterias del yogurt El yogur es un producto lácteo producido por la fermentación natural de la leche. A escala industrial se realiza la fermentación añadiendo a la leche dosis del 3-4% de una asociación de dos cepas bacterianas: el Streptococcus termophilus, poco productor de ácido, pero muy aromático, y el Lactobacillus bulgaricus, muy acidificante. En esta preparación se podrán, por tanto, observar dos morfologías bacterianas distintas (cocos y bacilos) y un tipo de agrupación (estreptococos, cocos en cadenas arrosariadas). Además, el tamaño del lactobacilo (unos 30µm de longitud) facilita la observación aunque no se tenga mucha práctica con el enfoque del microscopio. Bacterias del vinagre El vinagre es una solución acuosa rica en ácido acético resultante de la fermentación espontánea del vino o de bebidas alcohólicas de baja graduación. La acetificación del vino es producida por bacterias aeróbicas del ácido acético, principalmente Acetobacter aceti, aunque también Gluconobacter. Se trata de bacilos rectos con flagelos polares. Bacterias del sarro dental El sarro dental es un depósito consistente y adherente localizado sobre el esmalte de los dientes. Está constituido principalmente por restos proteicos, sales minerales y bacterias junto con sus productos metabólicos. La flora bacteriana de la cavidad bucal es muy variable dependiendo de las condiciones que se den en el momento de hacer la preparación, pero suelen abundar bacterias saprófitas, pudiéndose observar gran variedad de morfologías: espiroquetas, cocobacilos, diplococos y bacilos. Realizar los siguientes pasos para la tinción Gram de cada una de las 3 muestras indicadas. 1 2 3 4 5 6 7 8 9 Realizar una extensión de la muestra de cultivo bacteriano sobre un portaobjetos Secar ante un mechero. Cubrir el preparado con violeta de genciana por 1 minuto. Enjuagar la lámina con agua destilada Añadir lugol por 1 minuto. Lavar con agua destilada y decolorar con alcohol acetona. Añadir fucsina o safranina y dejar que actúe por 1 minuto. Lavar con agua corriente, secar Coloque una gota de aceite de inmersión encima de la lámina cubreobjetos y observar al microscopio con el objetivo de inmersión.

15

PRACTICA GUIADA Nº 3
1.- completar el grafico

2.-Dibuje todas las muestras observadas en la práctica Muestra:_________ Coloración:_______ Aumento:________ Muestra:_________

Coloración:_______ Aumento:________

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________

FECHA

ACTITUDINAL

MATERIAL

16

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº4
OBSERVACIÓN DE CÉLULAS EUCARIOTES

I. FUNDAMENTO En 1939, en base a observaciones realizadas por los científicos alemanes Schleiden y Schwan, se plasmó la teoría celular, la cual produjo un cambio radical en las ciencias biológicas. Esta teoría postula que los “cuerpos de todos los animales y vegetales están formados de células y que solo pueden aparecer nuevas células por división de las células preexistentes”. De ahí que los organismos por muy sencillos que sean están constituidos por unidades vivas denominadas células. La célula eucariota es más compleja que la célula procariota y contiene, a diferencia de esta última, núcleo celular. Los organismos más simples (protozoarios) están constituidos de una sola célula eucariota mientras que los más complejos o multicelulares están formados por un gran número de células eucariota que se hallan organizadas en tejidos, órganos y sistemas. II. OBJETIVOS

 Observar y caracterizar células eucariotas de tipo vegetal (epidermis de cebolla y mucosa bucal).
 Observar y caracterizar células eucariotas de tipo animal (epitelio bucal, tejido adiposo y sangre). III. MATERIALES Encontrarás en el laboratorio  Microscopio óptico  Cubeta de tinción  Lugol  Frasco lavador  Mechero de Alcohol  Alcohol absoluto  Lanceta estéril Cebolla Hisopos Tocino Agua estancada en frasco oscuro Materiales de disección: tijera, pinza, estilete.

   

Hematoxilina Formol Eosina Sudan III

 Cubeta de tinción

    

 Láminas portaobjeto y cubreobjeto  Gotero  Bisturí u hoja de afeitar  Levadura de pan

IV. PROCEDIMIENTO 4.1. Observación de células vegetales (Células epiteliales de Allium cepa) Las células de la epidermis de las hojas internas del bulbo de la cebolla, son de forma alargada y bastante grande. La pared celular celulósica se destaca muy clara teñida por el colorante. Los núcleos son grandes y muy visibles. En el citoplasma se distinguen algunas vacuolas grandes débilmente coloreadas. 1 Separe una de las capas del bulbo de la cebolla. Con ayuda de una pinza desprenda la membrana epidérmica que cubre la parte interna de la cebolla y extiéndala en el portaobjetos.

17

2 Utilizando una hoja de afeitar obtenga una porción de medio centímetro cuadrado, cúbrala con una gota de lugol, coloque cuidadosamente el cubreobjeto y observe en el microscopio. 3 Reconozca las partes de la célula vegetal.

4.2. Observación de organismos unicelulares 1 2 3 4 Coloque una gota de agua estancada sobre un porta objeto y cubran con una laminilla. Observe con el objetivo de menor aumento. Ajuste el diafragma para incrementar el contraste. Observe la forma, tamaño y movimiento de los organismos unicelulares (ver figura adjunta).

4.3. Observación de levaduras del pan

1 Diluya un trocito de levadura de pan (Saccharomyces cerevisiae) con agua destilada, en un tubo de
2 3 4 ensayo. Observe con el objetivo de mayor aumento. Ajuste el diafragma para incrementar el contraste. Observe la forma y tamaño de estos organismos.

4.4. Observación de células animales (Epitelio bucal) El azul de metileno tiñe intensamente el núcleo y con menos color el citoplasma de las células. Éste suele ser algo granuloso. 1 2 3 4 5 6 Con un hisopo limpio extraiga suavemente la mucosidad de la cavidad bucal. Deposite la mucosidad extraída en el centro de una lámina portaobjetos y extiéndalo con un frotis. Agregue unas gotas de AZUL de metileno y espere 3 minutos. Elimine el exceso de colorante utilizando agua y coloque un cubreobjetos. Observe la muestra a menor aumento y localice: células asociadas y dobladas. Luego visualice a mayor aumento y reconozca los componentes celulares.

4.5. Observación de células animales (Tejido adiposo) El Sudan III es un compuesto que tiñe lípidos de color rojo intenso. En el tejido adiposo, que contiene gran cantidad de grasas, se observarán los adipocitos teñidos por el Sudan III. 1 2 3 4 5 Con ayuda de un bisturí, cortar una fina capa de grasa de tocino Colocarla en un portaobjetos y cubrirla con unas gotas de formol. Dejar actuar 4 minutos. Lavar la muestra con agua y cubrirla con unas gotas de Sudán III. Dejar actuar unos 5 minutos. Volver a lavar la preparación con agua, cubrirla con un cubreobjetos Observar al microscopio.

4.6. Observación de células animales (Sangre) Al microscopio las células sanguíneas se verán predominantemente los glóbulos rojos, hematíes o eritrocitos teñidos de color rojo por la eosina. No tienen núcleo y son más delgados por el centro que por los bordes. Los glóbulos blancos o leucocitos se identifican fácilmente por la presencia de núcleo, teñido de morado por la hematoxilina. Hay varias clases de leucocitos:  Linfocitos: de tamaño aproximado al de los glóbulos rojos, tienen un solo núcleo que ocupa casi todo el glóbulo. -Monocitos: son los leucocitos mayores, poco frecuentes normalmente, núcleo grande, redondo, son los más móviles y su función principal es la fagocitosis. -Polimorfonucleares: núcleo fragmentado o arrosariado. Pueden ser eosinófilos, con abundantes granulaciones teñidas de rojo por la eosina, neutrófilos y basófilos.

 Los eosinófilos, con granulaciones abundantes de color
rojizo y el núcleo teñido de color azul marino. Estos glóbulos 18

aumentan su número en caso de parasitosis o procesos alérgicos.

 Los basófilos presentan un núcleo teñido de rojo y las granulaciones del citoplasma de color muy
oscuro. -Las plaquetas no son visibles ya que precisan una técnica especial de tinción. Efectúa los siguientes pasos para ambas coloraciones, Wright y Hematoxilina-Eosina:

1 2 3

Con ayuda de una lanceta desechable, realice una punción del pulpejo del dedo anular de la mano izquierda, previa desinfección con algodón y alcohol. Tome una gota de sangre y haga un frotis fino sobre el portaobjeto Colocar el frotis extendido ya seco, sobre una base plana en posición totalmente horizontal.

Para la coloración de Wright:

1
2 3 4

5
6

Coloree con unas gotas de colorante Wright, inmediatamente agregar sobre el colorante el mismo numero de gotas de agua destilada y mezclar rápidamente, soplando suavemente hasta que se forme una capa plateada . Dejar reposar la mezcla por 8 - 10 minutos, observando la intensidad de color. Lave con agua corriente y dejar secar al medio ambiente, si es posible con la lamina en forma vertical. Observe al microscopio. Utilice el objetivo de 100X para la observación de las células y núcleos. Diferencie las diferentes formas de núcleo en los neutrófilos, basófilos , eosinófilos, monocitos y linfocitos. Dibuje cada forma de núcleo.

Para la coloración de Hematoxilina-Eosina: 1 Colocar el frotis de sangre sobre la cubeta de tinción y añadir unas gotas de alcohol absoluto y dejar que el alcohol se evapore para fijar la preparación. 2 Cubrir con unas gotas de hematoxilina y dejar actuar durante 15 minutos. Evitar la desecación del colorante agregando más líquido. 3 Lavar la preparación y añadir unas gotas de eosina dejándola actuar 1 minuto. 4 Volver a lavar hasta que no queden restos de colorante. 5 Dejar secar aireando el porta o bien al calor muy lento de la llama del mechero. 6 Observar al microscopio. Utilice el objetivo de 100X para la observación de las células y núcleos.

19

PRACTICA GUIADA Nº4
1.- ¿Por qué los eritrocitos se tiñen con Eosina y los Leucocitos con Hematoxilina? ______________________________________________________________________ ______________________________________________________________________ ______________________________ 2.-¿para qué sirve el FORMOL en la coloración de adipositos? ______________________________________________________________________________ ____________________________ 3. Dibuje las distintas muestras observadas en la práctica

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________

Coloración:_______ Aumento:________

Muestra:_________ Coloración:_______ Aumento:________

Muestra:_________

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________

FECHA

ACTITUDINAL

MATERIAL 20

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

21

PRACTICA GUIADA Nº 5
DEMOSTRACIÓN CUALITATIVA DE CARBOHIDRATOS, LÍPIDOS Y PROTEÍNAS CARBOHIDRATOS
I. FUNDAMENTACION Los carbohidratos, glúcidos, sacáridos son compuestos químicos formados por carbono, hidrogeno y oxigeno, cuya fórmula es parecida a CnH2nOn y los más sencillos contienen carbono y los elementos del agua en proporción 1:1, de aquí resulta el nombre de hidratos de carbono denominado por K. Schmid en 1,844. En la concepción moderna se define a los carbohidratos como Polihidroxiacetonas o Polihidroxialdehidos, pues los átomos de carbono están unidos a grupos alcohólicos (-OH hidroxilos) y a radicales hidrogeno; y por la existencia de grupos cetónicos (-CO) y grupos aldehídos (-CHO). Los carbohidratos son sintetizados en las hojas verdes de las plantas mediante el proceso de fotosíntesis en el cual a partir de elementos inorgánicos resultan compuestos orgánicos alimenticios. En fases posteriores, y partir de los carbohidratos se sintetizan las grasas y proteínas por lo que se define que la vida depende directa o indirectamente de los carbohidratos. II. OBJETIVOS 2.1. Identificar la presencia de CHO en substancias orgánicas 2.2. Verificar el poder reductor de algunos CHO 2.3. Inferir las principales características de los CHO 2.4. Esquematizar en forma sencilla los pasos de cada experiencia III. MATERIALES Encontraras en el laboratorio -tubos de ensayo - vaso de precipitación - embudos - solución de Fehling A y B - reactivo de Benedict - glucosa al 5% - galactosa al 5% - lactosa al 5% - sacarosa al 5% - almidón al 1% - Lugol

IV. PROCEDIMIENTO 4.1. Determinación de Carbohidratos Reductores Reacción de Fehling y Reacción de Benedict Ambos ensayos permiten el reconocimiento de carbohidratos reductores, contienen ion cúprico en medio alcalino que se reduce hasta óxido cuproso en presencia de azúcares con el hidroxilo hemiacetálico libre. En soluciones alcalinas a elevadas temperatura el azúcar se convertirá en D-gluconato y su ene-diol generándose dos fragmentos altamente reductores que reaccionan con el Cu++

22

1. En un tubo de ensayo colocar 1 mL de reactivo de Fehling A y 1 mL de Fehling B ó 2 mL de reactivo de Benedict 2. Llevar a calor hasta ebullición para asegurarse que no hay autorreducción 3. Observar y dejar enfriar 4. Agregar 0.5 mL de cada una de las muestras a evaluar de acuerdo al siguiente esquema 1 2 mL 2 2 mL 0.5mL 0.5mL 0.5mL 0.5mL 0.5mL 0.5mL 0.5mL 0.5mL 3 2 mL 4 2 mL 5 2 mL 6 2mL 7 2mL 8 2mL

Reactivo de Benedict Orina normal Orina diabético Jugo Sacarosa Almidón Galactosa Glucosa Agua

Fehling

o

5 Calentar en Baño María o al mechero. Observar los cambios de coloración 6. Explicar y esquematizar

LIPIDOS
I. FUNDAMENTACION Los lípidos son compuestos orgánicos formados fundamentalmente por carbono, hidrogeno y oxigeno; ocasionalmente pueden contener fósforo y nitrógeno y tienen las propiedades comunes de: 1. Ser relativamente insolubles en agua y 2. Son solubles en solventes orgánicos. Se consideran 2 grupos de lípidos: a) Lípidos simples constituidos por los ácidos grasos y alcoholes, por ejemplo: grasas neutras y cebos, b) Lípidos compuestos (Lipoides) aquellos que además de los ácidos grasos y alcoholes (glicerina y esfingosina) tienen otros componentes, en este último grupo se consideran los fosfatidos, cerebrósidos, esteroides y carotenoides. Los lípidos constituyen reserva alimenticia para diferentes organismos y se encuentran en todas las células. En las plantas se hallan en las semillas, frutos y granos. II. OBJETIVOS 2.1. Explicar la solubilidad de los lípidos 2.2. Determinar la presencia de lípidos en otras substancias orgánicas III. MATERIALES Encontraras en el laboratorio - tubos de ensayo - vaso de precipitación, o matraz Erlenmeyer - crisoles - placas petri - equipos (gradillas y mecheros de Bunsen) - alcohol - acetona - benzol - éter - Sudan III - Cloroformo - Bencina IV. PROCEDIMIENTO 23

4.1. Solubilidad de los Lípidos 1. Adicionar 1 mL de aceite comestible en tubos de ensayo que contengan: a. 1 mL de agua destilada b. 1 mL de alcohol c. 1 mL de acetona d. 1 mL de benzol e. 1mL de eter 2. agitar cada uno de los tubos y observar 3. dejar en reposo durante dos minutos y luego observar 4. ordenar los tubos según la solubilidad creciente 5. explicar y esquematizar 4.2. Reconocimiento de Lípidos en substancias orgánicas utilizando el Sudan III 1. Numere los tubos de ensayo del 1 al 5 2. Operar según el cuadro siguiente MATERIAL Leche Aceite comestible Yema de huevo Clara de huevo Pecana o mani molido Sudan III PROTEÍNAS I. FUNDAMENTACION Las proteínas son compuestos orgánicos formados básicamente por C, H, O, N, suelen, además, contener P y S y con menor frecuencia Fe, Cu, Mg, etc., estos elementos constituyen unidades monomericas denominadas AMINOACIDOS (20) ordenados en diversas secuencias o estructuras primaria (lineal), secundaria (transporte), terciaria y cuaternaria. El nombre de proteínas significa “LO PRIMERO”, “LO MAS IMPORTANTE”, con ello se trata de magnificar el valor biológico de las proteínas y las funciones mas importantes que cumplen en los organismos vivos, los músculos, la piel; compuestos de la sangre, los órganos, tendones, huesos; en fin, todas las células contienen proteínas, también la síntesis de hormonas y enzimas es posible solamente en presencia de proteínas, lo que se resume en la expresión “NO HAY VIDA SIN PROTENAS”. II. OBJETIVOS 2.1. Explicar las reacciones de precipitación de las proteínas 2.2. Explicar el fundamento de las distintas reacciones cualitativas en la identificación de proteínas 2.3. Diferenciar métodos para identificar proteínas III. MATERIALES Encontraras en el laboratorio - tubos de ensayo - vaso de precipitación - pipetas - HCL 75% - NaOH 10% - NaOH 40% - CuSO4 1% - CuSO4 10% - alcohol 75% - HNO3 1 3 mL 2 3 mL 3 mL 3 mL 3 mL 3 mL 3 mL 3 mL 3 cc 3 mL 3 4 5

24

IV. PROCEDIMIENTO 4.1. Reacciones de Precipitación 1. Numere 5 tubos de ensayo y coloque 3 mL de solución de albúmina en cada uno 2. Al primer tubo adicionar 1 mL de HCL 75% 3. Al segundo tubo adicionar 1 mL de NaOH 40% 4. Al tercer tubo adicionar 1 mL de CuSO4 10% 5. Al cuarto tubo adicionar alcohol al 75% 6. Al quinto tubo calentarlo ligeramente al mechero 7. Observar el cambio de estado del contenido de cada tubo 8. Explique y esquematice 4.2. Reacción de Biuret 1. Numere los tubos de ensayo del 1 al 5 2. Trabaje según el cuadro siguiente: TUBO No REACTIVO Solución de albúmina Jugo de semillas Leche de vaca Jugo de papas Suero sanguíneo NaOH 40% 1 2mL 2 2mL 2mL 2mL 1mL 1mL 1mL 1mL 2mL 1mL 3 4 5

3. Agite los tubos y agregue 5 gotas de CuSO4 1% en cada uno de ellos 4. Observe el cambio de coloración en cada uno 5. Explique, compare y esquematice 4.3. Reacción Xantoproteica 1. Numere los tubos de ensayo del 1 al 5 2. Trabaje según el cuadro siguiente: TUBO No REACTIVO 1 Solución de albúmina 2mL Leche Carne molida Semilla molida Gelatina HNO3 concentrado 1mL 2 2mL 2mL 2mL 1mL 1mL 1mL 2mL 1mL 3 4 5

3. Observe y caliente al mechero cada tubo 4. Observar el cambio de color en cada uno de ellos y dejar enfriar 5. Agregar 1 mL de NaOH 40% en cada tubo 6. Observar el cambio de color, explicar y esquematizar

25

PRACTICA GUIADA Nº 5
1.-Esquematice todas las reacciones observadas en la práctica.

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

26

PRACTICA GUIADA Nº 6
OBSERVACIÓN DE PERMEABILIDAD CELULAR
I. FUNDAMENTO

La membrana celular permite el transporte de sustancias de manera selectiva. Muchas sustancias, además del agua, entran a la célula y salen de ella por efecto de los gradientes de concentración, aunque sólo unas cuantas (CO2 y O2) puedan hacerlo tan fácilmente como el agua. Si una membrana celular se deja atravesar por una sustancia, se dice que es permeable a dicha sustancia.

El volumen celular cambia cuando el agua penetra o sale de la célula por un proceso denominado osmosis. En términos osmóticos las soluciones o medios separados por una membrana se pueden clasificar como hipertónicas, isotónicas e hipotónicas; se dice que un medio es hipertónico, cuando la concentración del soluto en la solución es mayor en relación con otro medio de solución. Por ejemplo, si tenemos dos soluciones, la solución 1 con agua destilada y la solución 2 con una solución de azúcar al 10%, se dice que la solución 2 de azúcar es hipertónica en relación a la solución 1. Por el contrario, la solución 1 es hipotónica en relación a la solución 2 azucarada, es decir que la concentración del soluto es menor en relación con el otro medio. Y una solución isotónica, se cuando la concentración de soluto es igual a la concentración de soluto de la otra solución. II. OBJETIVO. 2.1 Observar y describir los fenómenos de difusión y ósmosis y su importancia en el intercambio de sustancias en la célula. III. MATERIALES Encontrarás en el laboratorio. - Microscopio óptico - Agua destilada - Tubos de ensayo - Algodón - Gradillas - Marcador de vidrio - Solución hipotónica NaCl 0.065 M - Ligadura - Solución hipertónica NaCl al 2% - Alcohol corriente -Azul de metileno - Solución isotónica de NaCl al 0.9% (suero fisiológico)

27

IV. PROCEDIMIENTO

Parte A
1 En tres tubos de ensayo numerados coloque: -1 ml. de solución hipotónica NaCl 0.01 % -1 ml. de solución isotónica de NaCl al 0.9% (suero fisiológico) -1 ml. de solución de hipertónica NaCl al 2%.

2 Obtener 2ml de sangre venosa con la lanceta hematológica en un tubo limpio con heparina
3 4 5 6 Dejar caer 5 gotas de sangre en cada uno de los tubos con un gotero. Agite los tubos y dejar en reposo durante 2 ó 3 minutos. Con un gotero coloque en una lámina portaobjeto una gota de cada uno de los tres tubos. Luego examine en el microscopio su aspecto. Observar qué efecto ha tenido las distintas soluciones sobre la morfología del eritrocito y explicar por qué.

Parte B
1. Colocar los tres huevos en un vaso de precipitación de 1 litro y verter el vinagre hasta cubrir completamente los huevos. Debe realizarse este proceso 48 horas antes de la práctica. 2. Al momento de la práctica lavar con mucho cuidado con agua de caño. 3. Frotar cuidadosamente con los dedos para sacar la cáscara por el lado de cámara de aire. Realizar este proceso hasta tener casi un tercio del huevo libre de cáscara. 4. Coloquen agua de caño en uno de los vasos de precipitación de 100ml y ubiquen allí uno de los huevos. El agua debe cubrir al huevo. 5. En otro vaso de precipitación colocar un huevo en la mezcla muy concentrada de sal en agua y colocar allí otro de los huevos. 6. Llenar el tercer vaso con agua destilada y poner allí el tercer huevo. 7. en cada frasco se adicionó unas gotas de agua de metileno 8. Dejar por una hora y observar membrana y el contenido interno del huevo. NOTA: En todos los vasos de precipitación, los huevos deben quedar sumergidos en el líquido.

28

PRACTICA GUIADA Nº 6
1. Mencione y dibuje las diferencias encontradas en cada uno de los huevos sometidos a cada proceso. TABLA: Observación de resultados Solución de Sal Huevo Agua de caño Agua destilada

2. Dibujar todas muestras observadas en la práctica

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________

Muestra:_________ Coloración:_______ Aumento:________

FECHA

ACTITUDINAL

MATERIAL 29

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº 7
PRIMERA PARTE: OBSERVACIÓN DE MOVIMIENTO CELULAR. CICLOSIS
I. FUNDAMENTO El citoplasma celular esta formado por el hialoplasma y el morfoplasma. El hialoplasma es un medio acuoso, con un 85% de agua en el cual esta disuelta gran cantidad de moléculas formando una solución coloidal; prótidos (AA, enzimas, proteínas estructurales), lípidos, glúcidos (polisacáridos, metabolitos), ácidos nucleicos (nucleótidos, nucleósidos, ADN, ARN, ARNt, ARNr) sales e iones. El hialoplasma es un medio dinámico, ya que puede pasar del estado de sol a gel acumulando moléculas que establecen enlaces entre si y aumentando la viscosidad; pueden invertirse el proceso pasando el hialoplasma a sol al diluirse hasta que se separan las moléculas, esto permite la creación de corrientes internas o Ciclosis y algunas células pueden emitir prolongaciones del citoplasma o SEUDOPODOS como órganos de desplazamiento. II. OBJETIVOS 2.1. Explicar los movimientos citoplasmáticos III. MATERIALES Encontraras en el laboratorio - microscopio compuesto - Lugol - Hoja de Elodea IV. PROCEDIMIENTO 4.1. Movimientos Citoplasmáticos: Ciclosis 1. Colocar una hoja de Elodea sobre una lamina portaobjetos 2. Agregar una gota de agua y colocar la laminilla 3. A menor y mayor aumento observar las células e identificar los cloroplastos 4. Con abundante luz observar los desplazamientos del citoplasma conjuntamente con los Cloroplastos

SEGUNDA

PARTE:

OBSERVACIÓN DE CITOPLASMATICA

ORGANELAS

E

INCLUSIONES

I. FUNDAMENTO Todas las funciones intracelulares (síntesis de proteínas, replicación de DNA y rutas metabólicas en general) son realizadas gracias una compleja organización de las organelas. Una célula eucariota típica contiene organelas membranosas (retículo endoplasmático, aparato de golgi, peroxisomas, mitocondrias, etc.) y organelas no membranosas (ribosomas, proteosomas, etc.). Todas ellas efectúan una función puntual en la célula que le permite su supervivencia y replicación. La supervivencia de la célula depende, entre otros factores, de la obtención de energía neta. Dicho proceso está a cargo de las mitocondrias y/o de los cloroplastos. Las mitocondrias se encuentran en mayor número en células animales pero también pueden presentarse en células vegetales, mientras que los cloroplastos son exclusivos de células vegetales y algunas bacterias fotosintéticas. Las mitocondrias oxidan moléculas orgánicas utilizando oxígeno del aire como aceptor de electrones y forman ATP. Los cloroplastos capturan energía de la luz y la transforman en ATP mediante el proceso denominado fotosíntesis.

II. OBJETIVOS 2.1Observar y diferenciar orgánulos de células vegetales: cromoplastos y cloroplastos. -Reconocer y diferenciar mitocondrias. III. MATERIALES Encontrarás en el laboratorio: - Microscopio óptico - Verde de Janus - Agua destilada - Lugol - Gotero IV. PROCEDIMIENTO 4.1. Observación de cromoplastos en células de pulpa de tomate La pulpa del tomate nos muestra las células generalmente bastante sueltas unas de otras. En el citoplasma se percibe una serie de gránulos rojizos-anaranjados que son los cromoplastos. El núcleo puede llegar a observarse por su típico aspecto y tamaño. Es frecuente la presencia de gránulos de almidón de forma arriñonada. En las células menos alteradas por la compresión se ven grandes vacuolas incoloras. 1 Cortar con el bisturí un pequeño trozo de uno o dos milímetros de grosor, de la parte pulposa del tomate. 2 Llevarlo sobre un porta, sin poner agua. 3 Poner el cubre-objeto y comprimir suavemente la preparación. 4 Observar al microscopio 4.2. Observación de cloroplastos en células de Elodea

1 En un portaobjetos coloque una porción pequeña de hoja de Elodea y agregue una gota de agua.
2 3 Cubrir la muestra con una lámina portaobjetos. Aprecie la forma de los cloroplastos y el movimiento de estos.

4.3. Observación de mitocondrias en células epiteliales humanas 1 2 3 4 5 Preparar un frotis de epitelio bucal con un hisopo. Secar al medio ambiente. Agregar unas gotas de Verde de Janus y dejar reposar por 3 minutos. Elimine el exceso del colorante con agua destilada. Observe al microscopio y describa la forma de las mitocondrias en la célula.

PRACTICA GUIADA Nº 7
1. Dibuje y coloree las distintas muestras observadas en la práctica. Mencionando el aumento total.

Coloración:_______ Aumento:________

Muestra:_________ Coloración:_______ Aumento:________

Muestra:_________

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________

Coloración:_______ Aumento:________

Muestra:_________ Coloración:_______ Aumento:________

Muestra:_________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº 8
ACTIVIDAD ENZIMÁTICA PRIMERA PARTE: CATALASA
I. FUNDAMENTO Las enzimas son proteínas cuya función es acelerar (catalizar) reacciones químicas que ocurren dentro de la célula y que en ausencia de ellas no se llevarían a cabo o de lo contrario tomarían muchísimo tiempo. Como se aprecia en la siguiente figura, las enzimas son específicas para sus sustratos, los cuales quedan unidos complementariamente al sitio de unión de la enzima donde son modificados enzimáticamente, liberándose al final de la reacción los productos respectivos.

La catalasa es una enzima que se encuentra en las células de los tejidos animales y vegetales. La función de esta enzima en los tejidos es necesaria porque durante el metabolismo celular, se forma una molécula tóxica que es el peróxido de hidrógeno, H2O2 (agua oxigenada). Esta enzima, la catalasa, lo descompone en agua y oxígeno, por lo que se soluciona el problema. La reacción de la catalasa sobre el H2O2, es la siguiente:

La existencia de catalasa en los tejidos animales, se aprovecha para utilizar el agua oxigenada como desinfectante cuando se echa sobre una herida. Como muchas de las bacterias patógenas son anaerobias (no pueden vivir con oxígeno), mueren con el desprendimiento de oxígeno que se produce cuando la catalasa de los tejidos actúa sobre el agua oxigenada.
II. OBJETIVO. 2.1 Detectar la presencia de la enzima catalasa en un tejido animal. III. MATERIALES Encontrarás en el laboratorio - Gradillas - Pipetas-tubos de ensayo Deberás traer de casa - Hígado de pollo - Agua oxigenada

IV. MÉTODOS 1 Colocar en un tubo de ensayo unos trocitos de hígado. 2 Añadir 5 mililitros de agua oxigenada. 3 Se observará un intenso burbujeo debido al desprendimiento de oxígeno. 4 Discutir la formación de burbujas en distintas mesas, relacionándolo con la concentración de catalasa.

SEGUNDA PARTE: HIDROLÍTICA DE LA AMILASA
I. FUNDAMENTO

Mediante esta experiencia vamos a ver la actividad de otra enzima, la amilasa o ptialina, presente en la saliva. Esta enzima actúa sobre el polisacárido almidón, hidrolizando el enlace Oglicosídico, por lo que el almidón se terminará por transformar en unidades de glucosa. Es importante que recuerdes las reacciones características de glúcidos para comprender esta experiencia. II. OBJETIVOS. Comprobar que sólo bajo ciertas condiciones las enzimas funcionan óptimamente catalizando una reacción enzimática con su sustrato. III. MATERIALES Encontrarás en el laboratorio. - tubos de ensayo -gradillas -solución diluida de almidón y sacarosa IV. MÉTODOS 1. 2. 3. 4. Poner en una gradilla cuatro tubos de ensayo, numerados del 1 al 4. Proceder a llenar los tubos como lo indica la figura. Agregar 3 gotas de lugol a cada tubo Aparecerán diferencias entre los 4 tubos dependiendo de si hay o no almidón en el medio. Recuerda: reacción positiva, color violeta, hay almidón. Reacción negativa, no cambia color, no hay almidón. Nota: Para ayudarte y formar más saliva, piensa en un limón o en algo que te apetezca mucho comer... Así favoreces que se forme más saliva. - Baño maría - Vaso de precipitados - Lugol

PRACTICA GUIADA Nº 8
1.-¿En qué parte de las células encontramos la enzima catalasa y cuál es la función de dicha enzima?. ____________________________________________________________________________________ ____________________________________________________________________________________ 2.- ¿Qué factores, además de la temperatura, podrían afectar la actividad de una enzima?. ____________________________________________________________________________________ ____________________________________________________________________________________ 5. Dibuje las reacciones observadas en la práctica. e incluya alguna observación a sus resultados

________________________ ________________________ ________________________

________________________ __________________________ __________________________ __________________________ __________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº 9
METABOLISMO ANAEROBIO: FERMENTACIÓN ALCOHÓLICA

I. FUNDAMENTO La respiración celular es el proceso mediante el cual se oxidan moléculas energéticas (glucosa, principalmente), empleando al oxígeno como aceptor final de electrones, y obteniendo gran cantidad de energía para la realización de las funciones celulares básicas. La fermentación, por el contrario, es un proceso anaeróbio que implica la ruptura de alimentos por un proceso de degradación química que no requiere oxígeno. Los alimentos no son degradados completamente hasta CO2 y H2O (como ocurre en la respiración), sino hasta compuestos intermedios tales como ácido láctico (fermentación láctica) o alcohol (fermentación alcohólica). Esta ruptura incompleta de los alimentos significa que menos energía es disponible durante la fermentación que el liberado durante la respiración. Ambos procesos pueden tomar lugar en las células a la vez. Además, los primeros pasos en la ruptura de la glucosa en la respiración, son anaeróbicos. Anaeróbica Glucosa Aeróbica Glucosa CO2 + H2O Ciertas bacterias y hongos derivan todo sino parte de su energía de la fermentación y los productos finales son frecuentemente el alcohol y CO 2, el proceso en este caso es denominado fermentación alcohólica. Las levaduras y bacterias, las cuales conducen a la fermentación son capaces de emplear sus sistemas enzimáticos para liberar energía anaeróbicamente a partir de carbohidratos, particularmente almidón y azúcar. Ácido láctico

DESTINO DE LA GLUCOSA EN CONDICIONES AEROBIAS (RESPIRACIÓN) O ANAERÓBIAS (FERMENTACIÓN)
ADP ADP ATP + P P ATP

GLUCOSA

1 ETANOL

II. OBJETIVOS

2.1 Comprobar que ante la presencia de oxígeno, el azúcar es oxidado hasta CO2 y agua. 2.2 Comprobar que en ausencia de oxígeno, el azúcar es convertido en etanol y CO2 por las
2.3 levaduras, mediante el proceso de fermentación alcohólica. Comparar cualitativamente un proceso fermentativo vs. Respiración.

III. MATERIALES Encontrarás en el laboratorio -Tubos de ensayos -Reactivo de Fehling A y B - Gradillas - Baño Maria - Probetas -Algodón -Tiras de medidas de pH -Dicromato de potasio -Soluciones al 2% de fructosa, glucosa, almidón y sacarosa -Acido sulfúrico diluido

IV. MÉTODOS Fermentación alcohólica 1. Preparar los tubos como lo indica la tabla: REACTIVO Agua Destilada Sol. de levadura 1mL Solución de Glucosa Sol. Sacarosa Sol. Almidón Sol. Fructosa 1 .... 1mL 2 .... 1mL 2mL 2mL 2mL 2mL 3 .... 1mL 4 ..... 1mL 5 .... 1mL 6 .... 1mL

Sol. Glucosa 2mL 2. La muestra con glucosa sola nos servirá para realizar la reacción de Fehling y comprobar que es glucosa por su poder reductor. 3. Para colocar la levadura en el tubo, previamente se tiene que disolver una punta de espátula de la cepa de panificación de Sacharomyces cerevisae en un poco de agua. 4. Llenar los tubos cuidando que no queden burbujas de aire, para conseguir un ambiente de anaerobiosis. Colocar un globo en la boca de los tubos para que el sistema quede cerrado herméticamente. 5. Llevar todos los tubos a 37ºC por 30 min. 6. Anotar la formación de CO2 para cada tubo (La fermentación se evidenciará por la presencia de burbujas en el tubo y el globo hinchando, debido a la producción de CO2. 7. Detectar la presencia de glucosa aplicando reactivo de Fehling A y B, llevando a Baño Maria por 8 minutos 8. Medir el pH del medio. 9. Opcionalmente, el profesor del grupo detectará cuidadosamente la presencia de etanol en las muestras. Hay que tener mucho cuidado porque hay que manipular Ácido sulfúrico y puede ser peligroso el manejarlo. Se tomarán 2 ml. de la solución del tubo herméticamente cerrado y la ponemos en otro tubo de ensayo. Añadimos unos cristalitos de dicromato potásico y a continuación 2 ml. de acido sulfúrico diluido. Al calentar al baño María debe formarse un compuesto aromático característico, y se pone de manifiesto porque cambia de color de amarillento a verdoso. Es una reacción que nos indica que existe etanol. 10. Observar, comparar y discutir los resultados de los experimentos planteados.

PRACTICA GUIADA Nº 9
1.- Complete el dibujo y la tabla. .

CO2 glucos a pH etanol

_____________________________________________________________________________ _____________________________________________________________________________ _____________________________________________________________________________ _____________________________________________________________________________ _____________________________________________________________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº 10
DIVISIÓN CELULAR: MITOSIS
I. FUNDAMENTO El ciclo celular es un proceso que consiste en la replicación de material genético y formación de células hijas. Compromete dos etapas: La primera llamada interfase, donde no ocurre división celular propiamente dicha y la segunda de división celular (ver figura). Dependiendo del tipo de células donde se lleve a cabo, la división celular toma el nombre de Mitosis (si ocurre en células somáticas) o Meiosis (si ocurre en células germinales). La mitosis implica cuatro etapas: Profase, Metafase, Anafase y Telofase. En las dos primeras ocurre la condensación y ordenamiento de los cromosomas y en las dos últimas se lleva a cabo la distribución de los cromosomas. El resultado final son dos células hijas diploides (2n).

II. OBJETIVOS Reconocer las distintas fases del ciclo celular en células somáticas de raíz de cebolla. III. MATERIALES Encontrarás en el laboratorio - Placa Petri - Orceína acética - Pinza de madera - Microscopio - Mechero de alcohol - Acido Acético - Etanol

0 IV. PROCEDIMIENTO Con 8 días de anticipación a la práctica preparar el cultivo de cebolla de la siguiente manera: En un vaso con agua, de preferencia de borde oscuro, colocar una cebolla mediana de tal manera que haga contacto la parte terminal de la cebolla con el agua y dejar en lugar semioscuro.

Preparación de la Muestra

1 2
3 4 5 6

Disponer de gran número de raíces de cebolla, haciendo cortes de la parte terminal (aproximadamente de 0.5cm.) y depositar en una placa Petri. Colorear con orceína por 10 minutos: contiene orceína A que interrumpe el proceso si se está dando en ese momento y reblandece la unión de las células muertas, así como orceína B que tiñe la cromatina o material hereditario. Luego calentar la muestra sólo hasta que emane vapores por 2 veces consecutivas con intervalos de enfriamiento. Trasladar las raíces a diferentes portaobjetos, separar solo el ápice (parte terminal de la raíz) y agregar una gotita de orceína y cubrir con el cubreobjeto. Apretar la muestra suavemente con la yema de los dedos. Secar el exceso de colorante con papel secante y llevar al microscopio para su observación a menor y mayor aumento.

Interfase

Profase Temprana

Profase Tardía

Metafase

Anafase Temprana

Anafase Tardía

Telofase Temprana

Telofase Tardía

Citocinesis

PRACTICA GUIADA Nº 10
1.- dibuje las muestras observadas.

Muestra:_________ Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Coloración:_______ Aumento:________

Muestra:_________ Muestra:_________ Coloración:_______ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA Nº 11
DIVISIÓN CELULAR- MEIOSIS
I. INTRODUCCIÓN La meiosis es un proceso celular, ligado a la reproducción sexual, por el cual, la célula madre de naturaleza diploide, da origen a los gametos de naturaleza haploide, de tal manera que en la fecundación se reestablece el número diploide de cromosomas. Así, mientras la mitosis es un proceso de división celular con formación de dos núcleos hijos con el mismo número de cromosomas que la célula original, en la meiosis en cambio hay dos divisiones celulares con reducción del número de cromosomas a la mitad. La meiosis es un proceso citológico que comprende dos divisiones celulares. En la primera división meiótica ocurre una serie de intercambios de material genético entre los cromosomas homólogos. Este fenómeno es un proceso complejo que comprende una larga profase en la que, para su mejor estudio y comprensión, se distinguen los estadios: Leptoteno, Cigoteno, Paquiteno, Diploteno y Diacinesis. Entre la telofase I y el comienzo de la segunda división meiótica, a diferencia con la mitosis, no hay un período de síntesis y duplicación del ADN, por lo demás la división meiótica II, tiene lugar como la mitosis normal en cada una de las células haploides (meiocitos de segundo orden), resultantes de la división meiótica I. II. OBJETIVOS: Al finalizar la presente práctica los alumnos estarán capacitados para: 2.1 Reconocer y diferenciar los estados fisiológicos por los que atraviesan los cromosomas durante el proceso meiótico en células animales. III. MATERIALES Y METODOS Un excelente material para la observación de los procesos de división celular lo constituyen insectos de la especie Grillos asimilis “grillo domestico” y Laplatacris sp “langosta”. En los individuos machos debe recuperarse el testículo después de la disección en el que se estudiará la meiosis en células de maduración (espermatocitos) de la zona proximal al canal deferente. El material a usar en el presente ejercicio es el siguiente: Microscopio Mechero de alcohol Cloroformo Carmín acético Carnoy Solución salina 0.7% Placas petri Laminas, laminilla Algodón Papel filtro Estilete de punta fina

IV: PROCEDIMIENTO Anasteciar los animales en las placas petri, colocando dentro de un pedazo de algodón embebido en cloroformo. Disecar el animal con la ayuda del estereomicroscopio o lupas, colocándolo en posición dorsal. Separar los testículos adicionándoles la solución salina procurando no exponer los órganos al aire para evitar posibles desecaciones. Seccionar los testículos en partes pequeñas de 2 a 3 mm y colocarlos en un vial con fijador carnoy por espacio de 30 min. Traspasar los fragmentos a una luna de reloj que contiene carmín acético y lleve al calor del mechero hasta que entre en ebullición por espacio de 15 segundos de 5 a 7 veces. Retire el fragmento del testículo con una pinza de punta fina y colóquela sobre un portaobjetos y agréguela una gota de carmín acético. Tape la preparación con una laminilla cubre objetos y sobre esta ponga un papel absorbente. Presione el cubre objetos con la yema del dedo pulgar y luego con la extremidad plana de un

-

lápiz presionar un poco mas fuerte hasta convertir el material del porta objetos en una capa delgada (squash). Al realizar esta operación, tenga cuidado para no romper el cubre objetos. Limpie el exceso de colorante del porta objetos con papel higiénico y lleve el preparado al microscopio para su observación a menor y mayor aumento. Observar y esquematizar.

PRACTICA Nº 11 1.- Dibuje las muestras observadas.

Coloración:_______ Aumento:________

Muestra:_________ Muestra:_________ Coloración:_______ Aumento:________

Muestra:_________

Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Coloración:_______ Aumento:________

Muestra:_________ Muestra:_________ Coloración:_______ Aumento:________

Coloración:_______ Aumento:________

Muestra:_________ Muestra:_________ Coloración:_______ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRÁCTICA GUIADA N°12
FECUNDACIÓN
I. FUNDAMENTO La fecundación es el proceso de unión del óvulo y el espermatozoide, y en virtud de la cual se origina el cigoto o célula huevo. La fecundación en la especie humana es interna, pues se lleva a cabo en el interior del aparato reproductor de la hembra, concretamente en las trompas de Falopio.

En esta práctica se observará el proceso de fecundación entre un gameto masculino (espermatozoides) y un gameto femenino (ovulo), en erizo de mar. Se podrán observar los gametos o Células reproductoras masculina y femenina, cuyo núcleo sólo contiene un cromosoma de cada par. El óvulo es una célula redonda de gran tamaño. Posee un núcleo donde se alojan los cromosomas portadores de la información genética materna, y un citoplasma que posee sustancias nutritivas para alimentar al embrión en sus primeras etapas, en el caso de que ocurra la fecundación. El espermatozoide, o gameto masculino, es una célula pequeña con capacidad de movimiento para poder alcanzar al óvulo.

Según donde se encuentren el espermatozoide y el óvulo, existen dos tipos de fecundación: a) Fecundación EXTERNA, cuando tanto el macho como la hembra liberan sus gametos al medio externo, que es el agua, de manera que los espermatozoides nadan en el agua hasta encontrar a los óvulos. Es lo típico de todos los animales invertebrados acuáticos, y en los vertebrados se da en los peces y en los anfibios. b) Fecundación INTERNA, cuando el macho deposita sus espermatozoides en el interior de la hembra, y se mueven por el organismo de la hembra hasta encontrar al óvulo. En el erizo de mar no hay dimorfismo sexual de modo que externamente no se les puede diferenciar a las hembras de los machos. Las gónadas femeninas son de color rojo vinoso y las gónadas masculinas son de color amarillo grisáceo. En ambos casos se encuentran en las zonas interambulacrales (celoma) ubicado en el interior del hemisferio superior. A través de las glándulas genitales (5), las gónadas se comunican al exterior mediante el poro genital, por donde son derramados los huevos. La fecundación es externa porque los gametos se encuentran fuera de la cavidad genital y el óvulo se fecunda externamente.

II. OBJETIVOS - Identificar gametos masculinos y femeninos en erizo de mar. - Evidenciar el proceso de la fecundación. III. MATERIALES Encontrarás en el laboratorio - Microscopio - Placa Petri - Pipeta - Bagueta Traer el alumno - Portaobjetos - Cubreobjetos - Goteros - Materiales de disección: tijera, pinza,estilete. - Erizos de mar VIVOS en baldes con tapa y con agua de mar IV. PROCEDIMIENTO 4.1. Obtención de Óvulos y Espermatozoides 1. Usando el material de disección, cortar las púas del erizo a nivel del ecuador todo el contorno radial e introducir la punta de la tijera para perforar y cortar transversalmente el caparazón por la zona cortical, obteniendo 2 mitades: el aboral y el ventral; en el aboral (lado superior) en las placas interradiales (5) del celoma es donde se encuentra las gónadas en sus respectivas masas genitales de color crema para los MACHOS y rojo vinoso para las HEMBRAS. 2. Luego echar las gónadas en un petri con agua de mar y con la ayuda de una bagueta se trozan los ovarios para liberar los óvulos. En otro cristalizador, se hacen exactamente lo mismo con los testículos 4.2. Montaje y observación de gametos 1. Colocar en un portaobjeto, una gota de la muestra con óvulos y observar su forma y color 2. Colocar en un portaobjeto, una gota de la muestra con espermatozoides y observar su forma, tamaño, flagelo, etc. 3. Después de observar esta preparación coloque una gota del colorante cristal violeta sobre los gametos masculinos y observe nuevamente 3. Observar a mayor aumento ambos gametos. 4.3 Fecundación 1. De las muestras obtenidas, coloque en un portaobjeto una gota con óvulos y otra con espermatozoides y mezclar. 2. Observar a mayor y menor aumento 3. Observar con detenimiento los cambios que sufre el óvulo una vez fecundado.

PRACTICA GUIADA Nº 12
1. Dibuje y coloree las distintas muestras observadas en la práctica. Mencionando el aumento total.

Muestra:_________ Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

Muestra:_________ Muestra:_________ Coloración:_______ Coloración:_______ Aumento:________ Aumento:________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA Nº 13

PRIMERA PARTE: EXTRACCIÓN DE ADN
I. FUNDAMENTO El ADN es un polímero de desoxiribonucleótidos, que en eucariotes es el componente de la cromatina o material genético. En la cromatina el ADN se encuentra asociado a proteínas conocidas como nucleoproteínas de tipo histonas, protaminas y en menor proporción con proteínas de tipo ácidas. Para extraer el ADN sin arrastrar sus proteínas asociadas se podría emplear soluciones ácidas. Sin embargo, éstas soluciones podrían dañar la estructura de la hebra, de modo que se prefiere emplear solventes orgánicos como cloroformo, el cual extrae proteínas dejando insoluble al ADN.

La extracción de ADN de una muestra celular se basa en el hecho de que los iones salinos son atraídos hacia las cargas negativas del ADN, permitiendo su disolución y posterior extracción de la célula. Se empieza por lisar (romper) las células mediante un detergente, vaciándose su contenido molecular en una disolución tampón en la que se disuelve el ADN. En ese momento, el tampón contiene ADN y todo un surtido de restos moleculares: ARN, carbohidratos, proteínas y otras sustancias en menor proporción. Las proteínas asociadas al ADN, de gran longitud, se habrán fraccionado en cadenas más pequeñas y separadas de él por acción del detergente. Sólo queda, por tanto, extraer el ADN de esa mezcla de tampón y detergente. La secuencia general de extracción es la siguiente: 1 Liberación del ADN en forma soluble por medio de la destrucción de los sistemas membranosos de los tejidos (membrana celular y nuclear). 2 Separación de los complejos de nucleoproteína por denaturación de la parte proteica. 3 Separación del ADN de las otras macromoléculas por solubilidad diferencial. 4 Precipitación del ADN por insolubilidad en alcohol y bajas temperaturas.

II. OBJETIVOS 1 El objetivo fundamental de esta práctica es utilizar unas sencillas técnicas para poder extraer el ADN de un tejido animal y por el aspecto que presenta, confirmar su estructura fibrilar. 2 A partir de la longitud enorme de las fibras también se confirma que en el núcleo el ADN se encuentra replegado. III. MATERIALES Encontrarás en el laboratorio: 1 - 2 Tubos de prueba de 20 ml 2 - 5 Baguetas 3 - 1 embudo 4 - Etanol helado 1 - 5 Pipetas de 10ml 2 - Baño María 0 - Mortero con pilón 1 - Gasa esteril IV. PROCEDIMIENTO Para la extracción DE ADN del manto de choro, con etanol, seguiremos los siguientes pasos. 4.1. Homogenización del Tejido El método para desintegrar el tejido debe estar adaptado a las características de éste. Para grandes volúmenes de tejidos blandos, suelen usarse licuadoras esencialmente iguales a las licuadoras domésticas. Para volúmenes menores, en general es suficiente un MORTERO y un pilón. Tejidos más resistentes, como por ejemplo hueso o diente, necesitan tratamientos mecánicos especiales. Aquellos tejidos con células cuya pared celular es resistente, como por ejemplo vegetales, hongos o bacterias, requieren también condiciones drásticas. Uno de los métodos más utilizados consiste en congelar la muestra en nitrógeno líquido y, manteniéndola congelada, pulverizarla con un mortero. Así, además de desintegrar la muestra, se logra que ésta se mantenga a muy baja temperatura durante el tratamiento, con lo cual se evita la acción de enzimas endógenas que pudieran degradar el material de interés. En esta práctica se empleará un método de ruptura con mortero (sin congelamiento). La principal ventaja de este método es que se adapta bastante bien a tejidos muy diversos. Asimismo, dado que se opera a temperatura ambiente, las ribonucleasas celulares pueden degradar parcialmente las moléculas de ARN. Para ayudar a la solubilización de los componentes celulares, a la ruptura de membranas y de complejos protéicos, la solución de lisis contendrá un detergente iónico (dodecilsulfato de sodio, SDS). Este detergente dispersa los componentes de las membranas y desnaturaliza las proteínas. La solución de lisis contiene además el agente quelante de cationes divalentes, EDTA. Esto impide la acción de las ADNasas (dependientes de Mg2+ ), aunque no tiene efectos sobre la mayor parte de las ribonucleasas. Seguir los siguientes pasos: - Vaso de precipitación de 500ml. - Medio de homogenización: - Lauril Sulfato de Sodio (SDS o -Hielo - Cloruro de Sodio 8. 770 g - Citrato de Sodio 4.110 g - EDTA 0.292 g

SLS) 50 g

1 Las células se homogenizarán en un mortero empleando el medio de homogenización. ES
OBLIGATORIO el uso de guantes en todo momento para evitar la contaminación de la muestra con DNAasa proveniente del sudor de las manos que pueda degradar nuestras muestras de ADN.

2 Se lisarán las células agregando 10 ml de la solución de homogenización por cada gramo
de tejido con que se inició el proceso. Los componentes como el SDS, permitirá por una parte la separación de las proteínas asociadas a la cromatina y por otra parte la ruptura de membranas. El NaCl produce el estallido de los núcleos para liberar así las fibras de cromatina. El EDTA es un agente quelante que inactiva a las DNAasas. Incubar la mezcla en un Baño María a 60°C por 15 minutos exactos. El calor ablandará el tejido permitiendo que los componentes de la solución homogenizadora ingrese a la célula. Además, esta temperatura denatura muchas enzimas que interfieren con el procedimiento. Filtrar el homogenizado empleando la gasa esteril Enfriar rápidamente la preparación filtrada en una cubeta con hielo, por 10 minutos a fin de detener cualquier proceso degradativo del ADN.

3

4 5

4.2. Precipitación del ADN La precipitación de los ácidos nucleicos permite su purificación y concentración. Se basa en la simultánea neutralización de las cargas negativas y deshidratación de la molécula, lo cual posibilita su agregación y precipitación. La precipitación es un fenómeno reversible (mediante la resuspensión en soluciones acuosas) y no debe ser confundido ni con la desnaturalización (potencialmente reversible) ni con la degradación (irreversible) de los mismos. Efectuar los siguientes pasos: 1 Lentamente, agregar etanol helado por el borde interno del recipiente hasta que comience a aparecer una consistencia blanca que significa que el ADN ha precipitado. 2 Suavemente, a medida que se agrega el etanol helado, girar enrollando a la vez con una bagueta de vidrio. 3 Reconoce 3 fases en tu solución: la del alcohol (que flota en agua), la de tu tejido triturado (abajo del todo) y la interfase entre los 2 que contiene ADN precipitado. 4 Poco a poco haciendo estos movimientos en una sola dirección, se logrará apreciar el ADN en la bagueta, asemejando una madeja de un hilo sumamente fino o como copos de algodón. Nota importante. El producto filamentoso obtenido de esta extracción no es ADN puro ya que, entremezclado con él, hay fragmentos de ARN. Una extracción "profesional" se realiza añadiendo enzimas que fragmentan las moléculas de ARN e impiden que se unan al ADN (protocolos de PURIFICACIÓN de ADN).

SEGUNTA PARTE: ELECTROFORESIS
I. FUNDAMENTO El problema de realizar separaciones de biomoléculas grandes es enfrentado frecuentemente en las ciencias de la vida, tanto para análisis cuali- como cuantitativos de mezclas o de preparaciones individuales. En la mayoría de casos es deseable causar el mínimo de daño a las moléculas de manera que sus propiedades no cambien de manera significativa. Los métodos actuales para la separación de biomoléculas descansan por lo tanto en procesos físicos que causan el mínimo de desnaturalización, lo cual resulta en la máxima retención de cualquier actividad biológica. Un gran grupo de métodos de separación están basados en algunas propiedades químicas o biológicas, o en interacciones de la molécula que se investiga, y algunas otras están basadas en diferencias en pesos moleculares o cargas netas, o a veces una combinación de las dos propiedades. Los métodos electroforéticos pueden diseñar se para explotar cualquiera de los dos, o ambos parámetros, aunque las diferencias en tamaño son las principales en el caso de las separaciones de ácidos nucleicos. La electroforesis en geles de agarosa es una técnica común en los laboratorios de Biología Molecular. El proceso consiste en la aplicación de una diferencia de voltaje a una muestra de ADN que se encuentra inmersa en un gel de agarosa, y esta a su vez en bañada por un buffer determinado. La generación de polos opuestos provoca la migración del ADN del polo cargado negativamente (Cátodo) al polo cargado positivamente (Anodo), debido a que el ADN tiene una carga neta negativa. Los geles de agarosa son el medio más popular para separaciones electroforéticas de ácidos nucleicos de mediano y gran tamaño. Las concentraciones más típicas de agarosa van de 0.3 hasta 2.5 %, y esta concentración depende de los tamaños de los ácidos nucleicos a separar. Aunque los geles de agarosa carecen de fuerza mecánica (especialmente los más diluidos), la manipulación se facilita por el uso de geles horizontales, los cuales pueden ser soportados por lámina de vidrio o de plástico El gel resultante es fotografiado en un aparato llamado transiluminador, presencia de bromuro de etidio, para poner en evidencia los fragmentos de ADN en el gel. En la presente práctica analizaremos la fotografía de un gel de agarosa y observaremos las distintas bandas de ADN que en él aparecen, discutiendo la razón por las que unas aparecen más arriba que otras. Realizaremos un análisis como el que se hace en ensayos de diagnóstico molecular y de clonación. II. OBJETIVOS -Comprobar la movilidad del ADN en un gel de agarosa -Analizar la utilidad de esta técnica en ensayos de biología molecular aplicada III. MATERIALES Y MÉTODOS Analizaremos la siguiente Lámina de un gel de agarosa y discutiremos cuál es el significado y la interpretación de esas bandas en el gel.

PRACTICA GUIADA Nº 13
1.- Dibuje sus resultados

2.-Discuta y resuelva los siguientes enunciados M 1 2

En el gel aparecen 3 carriles o calles, cada uno con una muestra distinta (M, 1 y 2). Los pocillos son hechos en el gel para introducir ahí la muestra de ADN.

1 ¿qué hay en el primer carril?
____________________________________________________________________________________ 2 en la muestra 1, qué tamaño aproximado tienen las bandas de ADN? _______________________________________________________________________________ 3 ¿por qué aparece RNA en algunas nuestras y por qué aparece tan abajo, comparado al ADN? _______________________________________________________________________________ 4 ¿qué significado tiene que algunas bandas sean más gruesas que otras? _______________________________________________________________________________ 5 ¿qué hubiera esperado encontrar si corría un gel con su ADN recién extraído? Dibujelo. ______________________________________________________

FECHA

ACTITUDINAL

MATERIAL

PARTICIPACIÓN

FIRMA/ SELLO PROFESOR

PRACTICA GUIADA Nº 14
CÓDIGO GENÉTICO Y TRADUCCIÓN DE PROTEÍNAS

I. FUNDAMENTO El proceso de traducción, es decir, síntesis de novo de proteínas, ocurre en el citoplasma, específicamente en los ribosomas del retículo endoplasmático rugoso (en humanos). La síntesis de una proteína requiere que previamente el ARNm de ese gen haya sido transcrito en el núcleo y exportado al citoplasma. Aquí el ARNm, que contiene la información genética necesaria para codificar la proteína, se asociará a los ribosomas del RER y con la intervención de una compleja maquinaria proteica así como de los ARNt específicos para cada aminoácido, se llevará a cabo la traducción.

El ARNm porta los codones, tripletes de nucleótidos, que codifican para un aminoácido. Mientras que los ARNt portan los anticodones, que le indican qué aminoácido van a portar y llevar hasta el complejo ARNm-ribosomas-enzimas. El código genético es la combinación de tripletes que tienen la información necesaria para codificar un aminoácido. Existen 64 codones en el código genético, que codifican para los 20 aminoácidos que forman las proteínas y que además contiene 1 codón de inicio de la traducción y 3 codones de finalización de la misma. En esta práctica analizaremos la degeneración del código genético, discutiremos por qué no es realmente universal y realizaremos la traducción de algunos genes en sus respectivas secuencias de aminoácidos.

II. OBJETIVOS - Reconocer los codones y anticodones posibles para los aminoácidos que forman las proteínas. - Analizar posibles mutaciones en los codones que alteren la secuencia de una proteína y con ello su función. III. MATERIALES - Lámina de la tabla del Código Genético - Lámina de la tabla de las alteraciones del Código Genético en mitocondrias y otros organismos.

IV. MÉTODOS 4.1. Antes de solucionar los problemas planteados, determine:

a. número de codones de inicio ____________________________ b. número de codones de finalización _______________________ c. aminoácidos codificados por 1 sólo codón __________________ d. aminoácidos codificados por 2 codones ____________________ e. aminoácidos codificados por más de 3 codones ____________________________ f. ¿qué cambios se han producido en el código genético de mitocondrias en humanos? ____________________________________________________________________________________ ____________________________________________________________________________________ g. Lista de aminoácidos esenciales y no esenciales ____________________________________________________________________________________ ____________________________________________________________________________________ 4.2. Discuta con su profesor y responda: ¿Por qué algunos aminoácidos son codificados por 1 sólo codón mientras que otros son codificados por 2 o más codones? ____________________________________________________________________________________ ____________________________________________________________________________________ 4.3. Los siguientes problemas deberán ser solucionados en clase con ayuda del profesor: Primer problema: Transcripción y traducción Se tiene la siguiente secuencia de ADN (cadena codante) que es parte del gen de transferrina. 5´ ATGGCATCCTACGATCAGTATCCTATACGC 3´ ……… (EL GEN CONTINÚA) Determine: 1. la secuencia no codante del respectivo trozo del gen ___________________________________________________________________________________ 2. la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen ___________________________________________________________________________________ 3. Utilizando la tabla del código genético, deduzca la secuencia de aminoácidos que codificará dicha cadena (considerando que se incubó el ADN en un extracto crudo de células de reticulocitos de conejo que contenía los respectivo ARNt, enzimas, ATP, GTP, etc.) ___________________________________________________________________________________ ___________________________________________________________________________________ Segundo problema. Mutaciones en la secuencia de nucleótidos La secuencia de ADN del gen de transferrina, del problema 1, ha sufrido mutaciones por el efecto de radiaciones UV. Se secuenció el gen mutado y la secuencia obtenida fue la siguiente: 5´ ATGGCATCGTACGAACAGTAGCCTATACGC 3´ ………..(EL GEN CONTINÚA) Determine: 1. la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen ____________________________________________________________________________________ 2. la secuencia de aminoácidos que, tras esas mutaciones, se codifica ____________________________________________________________________________________ 3. qué mutaciones han sido conservativas y cuales no. ____________________________________________________________________________________ Tercer problema. Traducción en mitocondrias Se cuenta con parte de la secuencia del gen de la proteína de Fe-S, que participa en la cadena transportadora de electrones en la mitocondria, y que es codificada dentro de la misma. La secuencia es de la cadena de ADN codante: ……. 5´ CCGTCAGAACTCGAAGCTCCGGACTTAGCT 3´ …… Determine:

1. la secuencia de aminoácidos codificada en la mitocondria, a partir de dicha cadena nucleotídica __________________________________________________________________ 2. ¿cuál serían los aminoácidos cambiados si dicho gen se codificara en el citoplasma? __________________________________________________________________

PRACTICA GUIADA Nº 15
ESTUDIO DE RASGOS GENÉTICOS EN EL HOMBRE

I. FUNDAMENTO Las características de un organismo son el resultado de la herencia y de la interacción de los genes. Los principios de la genética establecidos por Mendel y Morgan y otros investigadores se aplican a todos los organismos vivientes, incluido el hombre. De la misma manera que en otros, algunos rasgos humanos son determinados por genes dominantes y otros por genes recesivos. Lo rasgos dominantes generalmente se encuentran con mayor frecuencia que los que se deben a genes recesivos. En la transmisión de la mayoría de los caracteres hereditarios, están involucrados varios genes, pero a menudo la variación de un solo gen, produce la variación de una sola característica lo que da lugar a dos formas distintas de expresión. Algunos genes (y su manifestación) están ligados al sexo, es decir que la característica respectiva solo se expresa en uno de los sexos. Frecuentemente el masculino (hemofilia por ejemplo). En este caso el gen en cuestión se encuentra localizado en el cromosoma X (el cromosoma Y se considera “genéticamente vacío”). En otros casos la manifestación genotípica es influenciada por el otro sexo (p.e. calvicie, es dominante en el varón y recesivo en la mujer). En este caso los genes respectivos están localizados en un cromosoma autosómico, pero su expresión esta condicionada a la acción secundaria de genes ubicados en el cromosoma X. II. OBJETIVOS 1. Determinar el fenotipo (expresión de las características) y su probable genotipo (Información genética en el cromosoma respectivo) tanto como sea posible. 2. Estimar la distribución de los genes dominantes y recesivos para cada rasgo genético observado en el grupo. III. MATERIAL Deberás traer de casa.

-Espejo -Lupa IV. PROCEDIMIENTO 1. Con la ayuda de un espejo o de un compañero determine un fenotipo para cada uno de los rasgos genéticos descritos a continuación. Haga sus anotaciones en su cuaderno de trabajo. 2. Cuando se trata de una característica dominante, no es posible determinar con certeza el genotipo, pues pueden estar presentes dos genes dominantes para esta característica (homocigosis) o un gen dominante y uno recesivo (heterocigosis). En consecuencia utilizaremos un guión (-) para representar el alelo desconocido. En cuanto al carácter recesivo, no hay dificultad en establecer el genotipo, los dos genes alelomórficos son recesivos. Anote su genotipo en la hoja de trabajo. 3. Tabule en la hoja de trabajo el número de alumnos con cada rasgo genético estudiado DONDE SE INCLUYA: rasgo estudiado, genes involucrados, dominancia o recesión, estado del gen expresado (homocigoto o heterocigoto), etc. RASGOS GENETICOS A SER ESTUDIADOS INDEPENDIENTES DEL SEXO 1. Enrollar la lengua: algunas personas tienen la aptitud de enrollar la lengua en forma de U. Esto es causado por un gen dominante (E). La gente que no posee este gen solo puede curvar la lengua ligeramente hacia abajo. 2. Lóbulos separados: un gen dominante (L) determina que los lóbulos de la oreja estén separados, es decir que no estén adheridos directamente a la cabeza. En otras personas los lóbulos de las orejas están adheridos directamente al costado de la cabeza. 3. Pico de viuda: algunas personas muestran la característica de que la línea de pelo baja hasta un punto definido en la mitad de la frente. Esto se conoce como “pico de viuda”, este rasgo resulta de un gen dominante (V). El gen recesivo determina la característica de una línea continúa en el pelo. 4. Meñique doblado hacia adentro: Un gen dominante (B) hace que la última falange del meñique se flexione hacia el dedo anular. Descanse ambas manos tendidas sobre la mesa, relaje los músculos y observe si su

meñique está flexionado o recto. 5. Iris pigmentado: Cuando una persona es homocigota para cierto gen recesivo (p) no hay pigmento en la parte anterior de los ojos y en cambio se muestra una capa azul detrás del iris. Esto determina que los ojos sean azules. Un alelo dominante de este gen (P) hace que el pigmento se deposite en la capa anterior del iris y enmascara el color azul en grado variable. Otros genes determinan la naturaleza y densidad exactas de este pigmento, originando los ojos pardos, violeta, verde y otros colores. Nota: Algunas veces la capa detrás del iris es gris y esto deberá considerarse como no pigmentado. 6. Pelo de la falange media: algunas personas tienen pelo en la segunda falange de la mano mientras otras personas no. La ausencia completa del pelo en todo, se debe a un gen recesivo (m) y su presencia se debe a su alelo dominante (M). Parece que hay un número variable de estos alelos que determinan si el pelo debe crecer en uno, dos, tres o cuatro dedos. Este pelo puede ser muy fino y será necesario usar una lupa y mirar cuidadosamente en todos los dedos, antes de decidir si está ausente en alguno de los dedos. 7. Músculo palmar largo: Cuando una persona es homocigota para cierto gen recesivo (l), presenta un músculo palmar largo, el cual puede ser detectado examinando los tendones que corren en la cara interna del antebrazo (altura de la muñeca) cierre el puño fuertemente y doble la mano hacia delante. Palpe los tendones. Si hay tres, usted tiene el músculo palmar largo. Si solo hay dos (el medial más grande no existe) usted no tiene este músculo. Examine ambas muñecas pues a veces está presente en un brazo y no en el otro, a causa de las variaciones en la expresión de los genes. Si lo encuentra en uno o ambos brazos, posee dos genes recesivos. Si no está presente en ambas muñecas tiene el gen dominante (L). 8. Forma del cabello: la forma natural del cabello de una persona puede ser lacia,

ondulada o crespa, con variantes intermedias. El mecanismo por el cual se origina la forma del cabello es algo complejo, pero puede asumirse que los responsables de esta característica son un par de genes con dominancia incompleta. Asumiendo que la forma de su cabello no ha sido modificada por tratamiento artificial, anote el genotipo respectivo según el siguiente código: CC= cabello crespo Cc= cabello ondulado cc= cabello lacio. 9. Pulgar desarticulable: algunas personas tienen la habilidad de desarticular las falanges de sus dedos pulgares, a causa de que los ligamentos de esta articulación son sumamente flojos, característica que es dominante sobre ligamentos firmes. Esta circunstancia permite retirar el dedo pulgar hacia atrás sacándolo de su articulación. Ensaye la posibilidad de desarticular el pulgar de cualquiera de sus manos SIN ayuda de la otra mano e identifique su genotipo respectivo así: JJ o Jj = pulgar desarticulable jj = pulgar no desarticulable.

10. Color del cabello: el color del cabello es determinado por la interacción de un gran número de factores; sin embargo, si consideramos solo las mayores categorías de color capilar, estas pueden explicarse por la interacción de dos pares de genes( herencia dihibrida): (D_) pigmento pardo presente, (dd) pigmento pardo ausente, (rr) pigmento rojo presente. De acuerdo con la ley de la distribución independiente, un individuo cualquiera puede tener alguna de las siguientes combinaciones de genes y color: DDRR, DDRr, DdRR : cabello oscuro (negro) DdRr, Ddrr, DDrr : cabello castaño u oscuro con tintes rojizos ddRr : cabello rubio Dr. : cabello claro (color arena)

INFLUENCIADOS POR EL SEXO 11. Segundo dedo más corto que el cuarto: mantenga sus dedos juntos y

ponga sus manos sobre una hoja de papel, de modo que sus dedos descansen en ángulo recto con una línea horizontal, que usted ha trazado antes sobre el papel. Mueva su mano hacia arriba o hacia abajo hasta que el extremo del cuarto dedo (anular) toque escasamente la línea. Mire su segundo dedo (Indice) y vea si toca la línea.si no lo hace el segundo dedo es más corto que el cuarto. Se cree que este segundo dedo más corto es el resultado de un gen influenciado por el sexo del individuo. Según esto el gen es dominante en lo varones y recesivo en las mujeres. Sc para el gen correspondiente al segundo dedo corto Sl para el gen correspondiente para el segundo dedo largo.

12. Voz para el canto: el tono de la voz para el canto es determinado por un solo par de alelos V y v que muestran dominancia incompleta y están influenciados por el sexo. Clasifique su voz par el canto según el siguiente cuadro: Genotipos Fenotipos Varón Mujer VV Vv vv Bajo Barítono Tenor Contraalto Meso soprano Soprano

13. Calvicie: esta es otra característica influenciada por el sexo y es controlada también por un par de alelos. Aunque esta característica no suele manifestarse antes de los 30 años, sus posibilidades personales de calvicie pueden presumirse por la presencia o ausencia de esta característica entre los miembros mayores de su familia tanto por la línea materna o paterna. Establezca su probable genotipo guiándose por el siguiente cuadro: Genotipos Fenotipos Varón Mujer HH Hh hh LIGADOS AL SEXO calvo calvo normal calva normal normal

14. Ceguera para el color (daltonismo): tipo más común de daltonismo es heredado como carácter recesivo ligado al sexo. Puesto que el gen es portado solamente por el cromosoma X es necesario indicar el cromosoma al especificar el genotipo. Son posible genotipos y fenotipos: Fenotipos Genotipos Mujer Varón N n Normal X X XNY Daltónico XnXn XnY

PRACTICA GUIADA Nº 15
NOMBRE:______________________________ GRUPO:___________ MESA:___________ FECHA:_________ PROFESOR:_____________________________ 1.- Anote su genotipo y fenotipo de cada característica evaluada.

Sign up to vote on this title
UsefulNot useful