Está en la página 1de 4

TALLER BIOINFORMÁTICA #1: Traducción y estructura de proteínas

CURSO DE BIOQUÍMICA

Docente: Juan Rebollo

Ejercicio 1. Analizando una secuencia de ADN.

Utilizando métodos de alto rendimiento, los científicos ahora pueden secuenciar genomas
completos en un período de tiempo muy corto. La secuenciación de un genoma es un gran logro
en sí mismo, pero en realidad es solo el comienzo del estudio de un organismo. Se pueden realizar
más estudios tanto en el laboratorio como en la computadora. En este problema, utilizará una
computadora para ayudarlo a identificar un marco abierto de lectura (ORF), determinar la proteína
que expresará y encontrar la fuente bacteriana de esa proteína. Aquí está la secuencia de ADN:

TACGCAATGCGTATCATTCTGCTGGGCGCTCCGGGCGCAGGTAAA
GGTACTCAGGCTCAATTCATCATGGAGAAATACGGCATTCCGCAA
ATCTCTACTGGTGACATGTTGCGCGCCGCTGTAAAAGCAGGTTCT
GAGTTAGGTCTGAAAGCAAAAGAAATTATGGATGCGGGCAAGTT
GGTGACTGATGAGTTAGTTATCGCATTACTCAAAGAACGTATCACA
CAGGAAGATTGCCGCGATGGTTTTCTGTTAGACGGGTTCCCGCGT
ACCATTCCTCAGGCAGATGCCATGAAAGAAGCCGGTATCAAAGTT
GATTATGTGCTGGAGTTTGATGTTCCAGACGAGCTGATTGTTGAG
CGCATTGTCGGCCGTCGGGTACATGCTGCTTCAGGCCGTGTTTATC
ACGTTAAATTCAACCCACCTAAAGTTGAAGATAAAGATGATGTTAC
CGGTGAAGAGCTGACTATTCGTAAAGATGATCAGGAAGCGACTGT
CCGTAAGCGTCTTATCGAATATCATCAACAAACTGCACCATTGGTT
TCTTACTATCATAAAGAAGCGGATGCAGGTAATACGCAATATTTTAA
ACTGGACGGAACCCGTAATGTAGCAGAAGTCAGTGCTGAACTGG
CGACTATTCTCGGTTAATTCTGGATGGCCTTATAGCTAAGGCGGTT
TAAGGCCGCCTTAGCTATTTCAAGTAAGAAGGGCGTAGTACCTACA
AAAGGAGATTTGGCATGATGCAAAGCAAACCCGGCGTATTAATGG
TTAATTTGGGGACACCAGATGCTCCAACGTCGAAAGCTATCAAGC
GTTATTTAGCTGAGTTTTTGAGTGACCGCCGGGTAGTTGATACTTC
CCCATTGCTATGGTGGCCATTGCTGCATGGTGTTATTTTACCGCTTC
GGTCACCACGTGTAGCAAAACTTTATCAATCCGTTTGGATGGAAG
AGGGCTCTCCTTTATTGGTTTATAGCCGCCGCCAGCAGAAAGCACT
GGCAGCAAGAATGCCTGATATTCCTGTAGAATTAGGCATGAGCTAT
GGTTCAC

A.) Primero, intente encontrar un marco abierto de lectura en este segmento de ADN. En las
bacterias, un marco abierto de lectura en un fragmento de ARNm casi siempre comienza con AUG,
que corresponde a ATG en el segmento de ADN que codifica el ARNm. Según el código genético
estándar, hay tres codones de parada en el ARNm: UAA, UAG y UGA, que corresponden a TAA,
TAG y TGA en el segmento de ADN original. Estas son las reglas para encontrar un marco de
lectura abierto en este fragmento de ADN bacteriano:
1. Debe comenzar con ATG. En este ejercicio, el primer ATG es el codón de inicio. En una búsqueda
genética real, no tendría esta información.

2. Debe terminar con TAA, TAG o TGA.

3. Debe tener al menos 300 nucleótidos de longitud (codificando 100 aminoácidos).

4. El codón de inicio ATG y el codón de parada deben estar en el marco. Esto significa que el
número total de bases en la secuencia desde el codón de inicio hasta el de parada debe ser
uniformemente divisible por 3.

Sugerencias: pruebe esta búsqueda pegando la secuencia de ADN en un programa de


procesamiento de texto (Ms Word o bloc de notas) y luego busque los codones de inicio y
finalización. Una vez que haya encontrado un par, resalte el texto del ORF propuesto y use la
función de conteo de palabras del programa para contar el número de caracteres entre (o
incluidos) los codones de inicio y finalización. Este número debe ser divisible por 3.

También puede usar una fuente de ancho fijo como Courier, agrandar el tamaño del texto y
ajustar los márgenes para que cada línea contenga solo tres caracteres (un codón). Una vez que
encuentre el primer ATG, elimine los caracteres que lo preceden. Luego busque un codón de
parada que se ajuste a todos en una línea (está en el mismo marco de lectura que el codón de
inicio).

B.) Es cierto que el método anterior resulta un poco tedioso, por eso intentaremos con uno más
fácil: Seleccione toda la secuencia de ADN nuevamente y cópiela. Luego, vaya a la herramienta
Traducir (Translate) en el servidor ExPASy (https://web.expasy.org/translate/). Pegue la secuencia
en el cuadro titulado "DNA or RNA sequence (Please enter a DNA or RNA sequence)". Luego
seleccione "Verbose (" Met "," Stop ", espacios entre residuos)" como formato de salida y haga clic
en "TRANSLATE (Traducir secuencia)".

La página "Results of translation (Resultados de la traducción)" que aparece contiene seis marcos
de lectura diferentes. ¿Qué es un marco de lectura y por qué hay seis? Identifique el marco de
lectura que contiene una proteína (más de 100 aminoácidos continuos sin interrupciones por un
codón de parada) y anote su nombre. Ahora regrese a la página de la herramienta Traducir, deje la
secuencia de ADN en el cuadro de secuencia, pero seleccione “Compacto (“ M ”,“ - ”, sin
espacios)” como formato de salida. Vaya al mismo marco de lectura que antes y copie la secuencia
de proteínas (con abreviaturas de una letra) comenzando con "M" para la metionina y terminando
en "-" para el codón de parada. Guarde esta secuencia en un archivo de texto separado.

C.) Ahora identificará la proteína y la fuente bacteriana. Vaya a la página de NCBI BLAST
(https://blast.ncbi.nlm.nih.gov/Blast.cgi). Haga una búsqueda BLAST simple usando su secuencia
de proteína, usando la herramienta Protein Blast. En la página BLAST, seleccione "Protein-protein
BLAST". Ingrese su secuencia de proteínas en el cuadro "Buscar". Utilice los valores
predeterminados para el resto de la página y haga clic en el botón "¡ BLAST!".
Su proteína debe ser la primera en la lista de resultados de BLAST. ¿Cuál es la proteína y cuál es la
fuente (organismo)?

Ejercicio 2. Traducción

En el siguiente ejercicio trabajará con las secuencias de cDNA para hemoglobina humana,
comparando la secuencia encontrada en personas normales con la secuencia encontrada en
personas con anemia de células falciformes. Las herramientas disponibles en la página del NCBI le
permitirán localizar rápidamente el defecto específico que se encuentra en el ADN de las células
falciformes al alinear las dos secuencias y buscar un desajuste. Luego debes usar otra herramienta
para descubrir el marco correcto de lectura para las secuencias de codificación en los cDNAs,
buscando codones de inicio y de parada, y alineando las dos traducciones de secuencias de
aminoácidos, debes localizar el cambio de aminoácidos exacto que aparece en la hemoglobina de
células falciformes.

>”normal -hemoglobin”

Sequence:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTC
CTGAGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGG
CCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGT
CCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCT
TTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGG
CCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTG
TGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGG
TTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGAT
TCTGCCTAATAAAAAACATTTATTTTCATTGC

>”sickle-cell -hemoglobin”

Sequence:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTC
CTGTGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGG
CCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGT
CCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCT
TTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGG
CCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTG
TGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGG
TTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGAT
TCTGCCTAATAAAAAACATTTATTTTCATTGC

A. ENCUENTRA LA MUTACIÓN: El programa BLASTn le permitirá alinear y comparar las secuencias


de ADN. Ubique las secuencias coincidentes y no coincidentes.

BLASTn es un programa que alinea secuencias de ADN o proteínas y las compara para encontrar
diferencias. Podemos usarlo para encontrar la mutación en el ADN de las células falciformes.

¿Es esta una mutación puntual o una mutación de desplazamiento de marco? Describe la
mutación exacta en el ADN de las células falciformes.

B. TRADUCIR EL ADN: BLASTx es una herramienta que le permite traducir rápidamente su


secuencia de ADN en una secuencia de aminoácidos. Al comparar las traducciones de todos los
marcos posibles (3), podrá ver todas las posibles secuencias de proteínas a las que se puede
traducir su secuencia de ADN. La secuencia de aminoácidos más probable de todas las secuencias
posibles es la más larga.

¿Qué consecuencias tiene la mutación a nivel de proteína (secuencia de aminoácidos)?

Describa la estructura secundaria y terciaria de la hemoglobina

LINKS:

BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi

BLASTn (NUCLEÓTIDOS): https://blast.ncbi.nlm.nih.gov/Blast.cgi?


PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

BLASTp (PROTEÍNAS): https://blast.ncbi.nlm.nih.gov/Blast.cgi?


PROGRAM=blastp&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

TBLASTx (Traducir nucleótidos a proteínas): https://blast.ncbi.nlm.nih.gov/Blast.cgi?


PROGRAM=tblastx&PAGE_TYPE=BlastSearch&BLAST_SPEC=&LINK_LOC=blasttab&LAST_PAGE=blas
tn

Clustal Omega (Alinear secuencias): https://www.ebi.ac.uk/Tools/msa/clustalo/

Códigos de los aminoácidos: http://bioinformatica.uab.es/genetica/pr7/codi%20aa_sp.htm

Traducir (Translate) ADN en el servidor ExPASy https://web.expasy.org/translate/

Predicción de estructura secundaria: Jpred4: https://www.compbio.dundee.ac.uk/jpred/

También podría gustarte