UNIVERSIDAD DE PUERTO RICO RECINTO DE HUMACAO DEPARTAMENTO DE BIOLOGÍA

INFORME HUELLA DIGITAL DEL ADN

El DNA Fingerprinting es una técnica que fue desarrollada por primera vez en 1986 por un grupo de especialistas con el fin de detectar patrones individuales con base en la información genética. sino que con tal de obtener una evidencia contundente recurren a un par de cabellos o semen. que sea imposible reconocer al niño(a). Tanto es así que muy a menudo los investigadores criminales no se enfocan tanto en encontrar huellas digitales encontradas en cualquier objeto. la huella digital del DNA se construye en base al análisis de fragmentos generados por el corte de regiones variables con enzimas de restricción. Ya es sabido que la técnica de huellas de ADN es una muy útil y bastante confiable para el esclarecimiento de crímenes. células. esta técnica también se ha convertido en un negocio. hablando estructuralmente y de sus propiedades. si es el caso de una violación. Sin embargo.INTRODUCCIÓN Muchos de nosotros hemos crecido con la mentalidad de que el peor error de un criminal era dejar sus huellas digitales en la escena de un crimen y esto se debe al bombardeo de la industria cinematográfica en que tarde o temprano dejar huellas era la perdición del sospechoso o culpable. Sin embargo. un producto de consumo que ofrecen un sin número de laboratorios privados. hoy día esta idea ha cambiado por lo que hoy se conoce como ³Huellas digitales del ADN´ (ó DNA Fingerprinting). el cual ofrece unas bolsas especiales para almacenar muestritas de cabello. sino que es un código de barras. hay que recalcar que estas huellas no se parecen en nada a la huella que imprime un dedo. . cabello. la sangre. etc. Se basa en el hecho de que cada individuo tiene una información genética única. que tiene por lema ³la seguridad de los niños es nuestro negocio´. Para esto se deben seguir cuatro pasos que se mencionan a continuación. los padres tienen a la mano una forma de identificarlos. Siendo así. contienen la misma información genética. Incluso hay un paquete llamado Fingerprint America. Por tal razón es que cualquier tejido o sólo unas cuantas células son suficientes para obtener la huella de una persona por el orden de los pares de bases en su ADN. Ahora. que se ofrecen ofertas de análisis de ADN para establecer la paternidad. registrar la identificación de los hijos. además de que todas las células y tejidos del individuo. uñas y saliva que son guardadas en congeladores y en el caso de un secuestro o pérdida. es decir. como todo en esta sociedad.

Segundo. separación. corte del DNA con enzimas de restricción. A continuación se presentará una síntesis y un breve análisis de cada uno de los casos. las envolturas que rodean a la célula y la membrana plasmática. Por último. también el manual proveyó el resultado de los análisis de ADN para cada caso. análisis de los pedazos de DNA. aislamiento del DNA genómico. para la simulación de restricción de enzimas el manual proveyó 4 secuencias de DNA para una pareja. se le conoce como polimorfismo de longitud de fragmentos de restricción. Al conjunto de fragmentos formados debido al corte del DNA. En tercer lugar. Para el análisis de estos casos se utilizó el manual de laboratio. MATERIALES Y MÉTODOS En este laboratorio para simular la técnica del DNA fingerprint se llevaron a cabo diferentes análisis de casos: simulaciones de restricción de enzimas. Esto es lo que compone la huella genética del individuo.Primero. dos para cada uno de ellos. Estas son endonucleosas. Esto se lleva a cabo utilizando detergentes que rompen tejidos. Para los dos casos de paternidad y el de homicidio. . Se eliminan proteínas y el RNA. Cuando el DNA está aislado se corta en pedazos más pequeños utilizando RE. se recupera el DNA a través de una precipitación diferencial con alcohol y sal. y así poder identificar a los padres y al y/o culpables del crimen. Los pedazos ya cortados del DNA se separan por tamaño. En primera instancia. quiere decir que reconocen secuencias específicas dentro del DNA y lo catalizan. En esta etapa se utiliza la técnica de hibridización que es la formación de enlaces de hidrógeno entre dos secuencias de DNA de origen diferente. casos de paternidad y casos de criminalidad.

Corte cada pedazo de DNA. Localiza la secuencia que reconoce la enzima Hae III. Se encontrarán dos secuencias de DNA para cada uno por ser individuos diploides. tanto de María como de José. a. José: Cromosoma materno 20bp 15bp 10bp 5¶ ATCTTGACCAATGTGAAAGGCCAATATAGCATTGGCCAAGCTCTC 3¶ 3¶ TAGAACTGGTTACACTTTCCGGTTATATCGTAACCGGTTCGAGAG 5¶ José: Cromosoma paterno 7pb 13pb 25pb 5¶ ATCTTGGCCAATGTGAAGGGCCAATATAGCATTGGTCAAGTTCTC 3¶ 3¶ TAGAACCGGTTACACTTCCCGGTTATATCGTAACCAGTTCAAGAG 5¶ María: Cromosoma materno 7pb 38pb 5¶ ATGTTGGCCAATGTGAGGACCAATATAGCATTGGCAAAGCTCG 3¶ 3¶ TACAACCGGTTACACTCCTGGTTATATCGTAACCGTTTCGAGAGC 5¶ .INTERPRETACIÓN Y RESULTADOS 1. Enzimas de Restricción: Se presentarán las regiones variables de los cromosomas número 19.

Sus tamaños son 7pb. 15pb. ¿Cuántos fragmentos se producen al cortar el cromosoma materno de José y de qué tamaños son? Se producen 3 fragmentos. 10pb. ¿Cuántos fragmentos se producen al cortar el cromosoma paterno de José y de qué tamaños son estos? Al cortar el cromosoma paterno de José se producen 3 fragmentos. el segundo 15pb y el tercero tiene 10pb. 7pb. . 13pb y 25pb. 13pb y 25pb respectivamente. El primer fragmento tiene 20pb. c. ¿Cuántos fragmentos se producen de la muestra de DNA de José y de qué tamaños son? Se producen 6 fragmentos de la muestra de DNA de José.María: Cromosoma paterno 7pb 28pb 10pb 5¶-ATCTTGGCCAATATCAAAGACCAATATAGCATTGGCCAAGCTCTC-3¶ 3¶-TAGAACCGGTTATAGTTTCTGGTTATATCGTAACCGGTTCGAGAG-5¶ b. Sus tamaños son 20pb. d.

e. Marcador de Tamaño 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 MARÍA ____________ JOSÉ ____________ ____________ ____________ ____________ ____________ ____________ ____________ ____________ ____________ . Separe por tamaño los fragmentos generados del DNA de José y María en una gelatina de agarosa.

Luego que todo volvió a la calma se dan cuentan los doctores y enfermeras que los bebés no habían sido identificados debidamente con sus pulseras. Los fragmentos generados por la enzima Hae III producen diferentes regiones. Los resultados mostraron una gran variabilidad en dos regiones en el cromosoma 17. Mezcla de bebés en un hospital En un hospital tres madres dan a luz un niño cada una. Sólo se encontraron dos fragmentos iguales entre María y José: con 7pb y 10pb. ¿Identifica esta prueba diferencias genéticas entre José y María? Sí. 2. Esto es variaciones en el patrón de fragmentos producidos de las moléculas de DNA son cortadas con enzimas de restricción. lo que provoca que rápidamente se desalojen a los pacientes y a los recién nacidos. Como resultado de todos estos hechos. Dado a los resultados del DNA de las tres parejas y los tres bebés y a las diferencias observadas en el patrón de bandas mostrados en la figura 3 del manual. el bebé 1 a los Stevenson y por último. Explique genéticamente a qué se deben éstas diferencias Estas diferencias se deben al polimorfismo de longitud de fragmentos de restricción. se ordena hacer pruebas de ADN a los tres bebés y a los padres. tiempo después de que nacen los bebés suena la alarma de incendio. no se sabía de quién era cada bebé. el bebé 2 a la familia Jones. se pudo concluir que: el bebé 3 pertenece a la familia Smith.f. con esta prueba se identificó que existen diferencias genéticas entre María y José. . por lo cual. Análisis de Casos I. g.

Le habían disparado. III. De acuerdo a los resultados del análisis del DNA del Sr. Los policías encontraron en el piso del museo un cuerpo que yacía muerto. se pudo observar las huellas digitales del ADN del Sr. Megabucks. las tres mujeres y los tres hijos y así analizar las regiones en que variaban las bandas. inteligentemente había dejado una muestra de sangre congelada para que pudiera ser utilizada en cualquier caso de que se reclamara su paternidad. A este se le encontró una cortadura reciente en la mano y el inspector ordenó hacer pruebas de ADN a Smink. Caso de cuchillo ensangrentado Ha ocurrido un robo en el Museo de Arte Nacional. tres mujeres reclamaron que habían tenido un hijo de él y por lo cual exigían parte de su herencia. la policía lo reconocía como el ladrón de joyas internacional Heinrich Millhouse. Al día siguiente la policía atrapa a Englewood Smink.II. a la sangre del cuchillo. y debajo del cuerpo encontraron un cuchillo ensangrentado. la ropa y el cuchillo conteste las siguientes preguntas: . Con el resultado dado en el manual. Inmediatamnte. Megabucks. Se tomaron muestras a las mujeres y sus respectivos hijos y se analizaron su sangre. Millhouse. Caso de paternidad Luego de la muerte de un hombre. a la sangre de la ropa de Millhouse y a la sangre de Millhouse. llamado Sr. Megabucks. compañero de crimen de Millhouse. Smink. la figura 4. Se concluyó que sí era el padre de unos de los tres niños y su hijo era el niño número 2. Sr.

b. De no haber sido así. Smink mató o hirió a su compañero Millhouse. Smink es culpable o no de herir o matar a Heinrich Millhouse. ¿Deben llevarse a cabo otras pruebas? Se ha demostrado que la técnica de DNA fingerprinting es una muy confiable ya que todos los individuos presentan un patrón distinto de las bases nitrogenadas.a. Es importante mencionar que su DNA aparece cuatro veces en regiones diferentes de la sangre encontrada en el cuchillo. ¿Debe ser liberado Smink? ¿Por qué? El señor Smink no debe ser liberado. Sin embargo. Smink y la sangre encontrada en el cuchillo. Según estos resultados. . c. su DNA no hubiese sido compatible con el DNA encontrado en el cuchillo en el lugar del crimen. opino que deben llevarse a cabo otras pruebas para determinar con aún mayor precisión si el Sr. Esto demuestra que estuvo en la escena del crimen y que sigue siendo sospechoso. ¿Cuál es tu interpretación de los datos? Presenta tus argumentos Los resultados mostraron una compatibilidad entre el ADN del Sr. pues se ha encontrado compatibilidad en en el fingerprint. el Sr.

Revista Electronica de PortalesMedicos.REFERENCIAS Baerga.gorgas.pa/museoafc/loscriminales/criminologia/huellagenetica.gob.mx/pdf/644/64407104. Manual de laboratorio. Genética. Hinke. 2007).com Recuperado el 5 de diciembre de 2010 de http://www. UPR Humacao. Las Huellas del DNA.com/publicaciones/articles/643/1/La-huella-genetica-en-Medicina-LegalADN-con-fines-forenses.portalesmedicos.html . Dr. (2003. Ciencias.uaemex.rincondelvago. La huella genética en Medicina Legal: ADN con fines forenses. Puerto Rico: Artes gráficas. Universidad Autónoma Nacional de México. Ricardo y Borges Lópes.html La Huella Genética.A.71. pág 30-31. (1980).com/dna-fingerprint-o-huella-genetica. C. J.pdf DNA (Deoxyribonucleic Acid) Fingerprint o huella genética.. no. Recuperado el 6 de diciembre de 2010 de http://www.. & Dávila. Recuperado el 5 de diciembre de 2010 de http://html. (3 de septiembre. Cintrón. I. Dr.html Rodríguez Jorge. I. julio). Nina. Recuperado el 5 de diciembre de 2010 de http://redalyc.

Sign up to vote on this title
UsefulNot useful