Está en la página 1de 553

Genética clínica

Biblioteca Médica Virtual


EL LIBRO MUERE CUANDO LO FOTOCOPIA

AMIGO LECTOR:

La obra que usted tiene en sus manos posee un gran valor.


En ella, su autor ha vertido conocimientos, experiencia y mucho trabajo. El editor
ha procurado una presentación digna de su contenido y está poniendo todo su empe-
ño y recursos para que sea ampliamente difundida, a través de su red de comerciali-
zación.

Al fotocopiar este libro, el autor y el editor dejan de percibir lo que corresponde a la


inversión que ha realizado y se desalienta la creación de nuevas obras. Rechace
cualquier ejemplar “pirata” o fotocopia ilegal de este libro, pues de lo contrario
estará contribuyendo al lucro de quienes se aprovechan ilegítimamente del esfuer-
zo del autor y del editor.

La reproducción no autorizada de obras protegidas por el derecho de autor no sólo


es un delito, sino que atenta contra la creatividad y la difusión de la cultura.

Para mayor información comuníquese con nosotros:

Biblioteca Médica Virtual


Genética clínica

VICTORIA DEL CASTILLO RUIZ


Jefa del Departamento de Genética Humana,
Instituto Nacional de Pediatría, Facultad de Medicina,
Universidad Nacional Autónoma de México

RAFAEL DULIJH URANGA HERNÁNDEZ


Médico Genetista,
Profesor titular de la Asignatura de
Genética Clínica, Facultad de Medicina,
Universidad Nacional Autónoma de México

GILDARDO ZAFRA DE LA ROSA


Jefe del Departamento de Genética,
Hospital Español de México, Facultad de Medicina,
Universidad Nacional Autónoma de México

Dr. Carlos A. Mendoza Murillo

Biblioteca Médica Virtual


Editorial El Manual Moderno, S.A. de C.V.,
Av. Sonora núm. 206,
Col. Hipódromo,
Deleg. Cuauhtémoc,
06100 México, D.F.

(52-55)52-65-11-00

info@manualmoderno.com
@ quejas@manualmoderno.com

Genética clínica
D.R. 2012 por Editorial El Manual Moderno, S.A de C.V.
ISBN: 978-607-448-251-5
ISBN: 978-607-448-252-2 versión electrónica

Miembro de la Cámara Nacional


de la Industria Editorial Mexicana, Reg. núm. 39

Todos los derechos reservados. Ninguna parte de


esta publicación puede ser reproducida, almacenada
en sistema alguno de tarjetas perforadas o transmitida
por otro medio —electrónico, mecánico, fotocopiador
registrador, etcétera— sin permiso previo por escrito
de la Editorial.

es marca registrada de .
Editorial El Manual Moderno S.A. de C.V

Genética clínica / Victoria del Castillo Ruiz, Rafael Dulijh Uranga


Hernández, Gildardo Zafra de la Rosa. -- México : Editorial El
Manual Moderno, 2012.
xVii , PÉGINASILUSTRACIONESCM. Director editorial y de producción:
Incluye índice Dr. José Luis Morales Saavedra
ISBN 978-607-448-251-5
ISBN 978-607-448-252-2 (versión electrónica) Editora asociada:
Lic. Vanessa Berenice Torres Rodríguez
1. Genética médica – Sinopsis, etc. 2. Desórdenes genéticos –
Sinopsis, etc. 3. Metabolismo, Errores innatos del – Sinopsis, etc.
4. Polimorfismo genético – Sinopsis, etc. I. Castillo Ruiz, Victoria Portada:
del. II. Uranga Hernández, Rafael Dulijh. III. Zafra de la Rosa, DG. Víctor Hugo Gonzalez Antele
Gildardo.

616.042-scdd21 Biblioteca Nacional de México

Biblioteca Médica Virtual


Colaboradores

Dra. Carmen Aláez Verson Dr. Antonio Bravo Oro


Jefa del Laboratorio de Biología Molecular. Instituto Departamento de Neurología. División de Pediatría.
Nacional de Diagnóstico y Referencia Epidemioló- Hospital Central Dr. Ignacio Morones Prieto
gicos, (InDRE). Capítulo 11 y Anexo II del Capítulo 11
Tema selecto de genética II
Dra. Alessandra Carnevale Cantoni
Dr. Miguel Ángel Alcántara Ortigoza Directora de Investigación, Instituto Nacional de
Jefe del Laboratorio de Biología Molecular, Medicina Genómica.
Departamento de Genética Humana, Instituto Nacio- Capítulo 13
nal de Pediatría.
Anexo III del Capítulo 2, Anexos I y II del Capítulo 6 M. en C. Beatriz Castrejón Gallegos
Unidad de Investigación Médica en Genética Humana,
Dra. María Elisa Alonso Vilatela Hospital de Pediatría. Centro Médico Nacional Siglo
Jefa del Departamento de Genética. Instituto Nacional XXI, Instituto Mexicano del Seguro Social
de Neurología y Neurocirugía Dr. Manuel Velasco Anexo IV del Capítulo 12
Suárez.
Capítulo 8 y Anexo II del Capítulo 8 M. en C. Ricardo Martín Cerda Flores.
Facultad de Enfermería, Universidad Autónoma de
Dra. Claudia Álvarez Carreño Nuevo León.
División de Inmunogenética, Departamento de Anexo II del Capítulo 2
Trasplantes, Instituto Nacional de Ciencias Médicas y
Nutrición “Salvador Zubirán” Dr. Daniel Cervantes García
Tema selecto de genética IV Centro de Investigación y Desarrollo en Ciencias de la
Salud, Universidad Autónoma de Nuevo León
Dr. Adolfo Aguayo Gómez Capítulo 14
Departamento de Genética, Instituto Nacional de
Ciencias Médicas y Nutrición “Salvador Zubirán”
M. en C. Alicia B. Cervantes Peredo
Anexo VI del Capítulo VII
Servicio de Genética, Hospital General de México, OD
y Facultad de Medicina, Universidad Nacional
Dra. Ma. Antonieta de Jesús Aráujo Solís
Autónoma de México.
Jefe del Departamento Clínico de Genética Médica.
Hospital de Pediatría, Centro Médico Nacional Siglo Capítulos 2 y 9, Anexo I del Capítulo 2 y Tema selecto de
XXI, Instituto Mexicano del Seguro Social. genética I
Anexos II y III del Capítulo 5
Dra. Victoria Del Castillo Ruíz
Dr. Diego J. Arenas Aranda Jefa del Departamento de Genética Humana, Instituto
Unidad de Investigación Médica en Genética Humana, Nacional de Pediatría, Facultad de Medicina,
UMAE Hospital de Pediatría, Centro Médico Nacional Universidad Nacional Autónoma de México
Siglo XXI, Instituto Mexicano del Seguro Social Capítulos 3, 6 y 11, Anexos I, II y III del Capítulo 3 y
Capítulos 2 y 12 y Anexo IV del Capítulo 2 Anexos I y II del Capítulo 11

M. en C. Jazmín Arteaga Vázquez Dra. María del Carmen Esmer Sánchez


Departamento de Genética, Instituto Nacional de Departamento de Enseñanza e Investigación, Hospital
Ciencias Médicas y Nutrición “Salvador Zubirán” Central “Dr. Ignacio Morones Prieto”, San Luís Potosí
Anexos I y IV del Capítulo VII Capítulo 11 y Anexo I del Capítulo 11

Dr. Jaime Berumen Campos Dr. Hilario Flores Aguilar


Jefe del Laboratorio de Medicina Genómica, Investigador, Laboratorio de Biología Molecular y
Departamento de Medicina Experimental, Facultad de Encargado del Área Informática, Departamento de
Medicina, Universidad Nacional Autónoma de México, Inmunología e Inmunogenética, Instituto Nacional de
Hospital General de México, OD. Diagnóstico y Referencia Epidemiológicos, (InDRE)
Tema selecto de genética VII Tema selecto de genética II

Biblioteca Médica Virtual


VI Colaboradores

Dr. Francisco Flores Ramírez Dr. Luis Felipe Guzmán Rodríguez


Departamento de Genética, Hospital Infantil de División de Genética, Centro de Investigación
México Federico Gómez Biomédica de Occidente, Instituto Mexicano del
Anexo I del Capítulo 5 y Anexo IV del Capítulo 6 Seguro Social. Centro Universitario de Ciencias de la
Salud, Universidad de Guadalajara. Guadalajara,
Dra. Sara Frías Vázquez Jalisco, México.
Investigador en Ciencias Médicas, Laboratorio de Anexo IV. Capítulo 5
Citogenética, Departamento de Investigación en
Genética Humana, Instituto Nacional de Pediatría Dr. Jorge Luis Hernández Arriaga
Capítulo 4 y Anexo III del Capítulo IV Centro de Investigaciones en Bioética. Universidad de
Guanajuato
Dra. Constanza García Delgado Tema selecto de genética VI
Departamento de Genética, Hospital Infantil de
México Federico Gómez Dr. Juan Carlos Huicochea Montien
Anexo I del Capítulo 5 y Anexo IV del Capítulo 6 Departamento Clínico de Genética Médica. Hospital
de Pediatría, Centro Médico Nacional Siglo XXI,
Dra. Laura Gómez Laguna Instituto Mexicano del Seguro Social.
Servicio de Genética, Hospital General de México, OD Anexos II y III del Capítulo 5
y Facultad de Medicina, Universidad Nacional
Autónoma de México Dra. Bertha Ibarra Cortés
Capítulo 9 División de Genética, Centro de Investigación
Biomédica de Occidente, Instituto Mexicano del
Dra. Ariadna Estela González del Ángel Seguro Social. Centro Universitario de Ciencias de la
Subdirectora de Investigación Médica. Instituto Salud, Universidad de Guadalajara. Guadalajara,
Nacional de Pediatría. Jalisco, México.
Anexo III del Capítulo 2 y Anexo III del Capítulo 3 Anexo IV del Capítulo 5
Dra. María de Lourdes González del Rincón
Dra. Eligia Juárez Torres
Médico Genetista. Departamento de Genética
Unidad de Medicina Genómica, Hospital General
Instituto Nacional de Neurología y Neurocirugía
Manuel Velasco Suárez de México O. D. Departamento de Medicina
Capítulo 8 y Anexo I del Capítulo 8 Experimental, Facultad de Medicina, Universidad
Nacional Autónoma de México.
Dra. Clara Gorodezky Lauferman Tema selecto de genética VII
Jefa del Departamento de Inmunología e
Inmunogenética, Instituto Nacional de Diagnóstico y Dra. Silvia Jiménez-Morales
Referencia Epidemiológicos, (InDRE). Presidenta del Laboratorio de Inmunogenómica y Enfermedades
Consejo Directivo de la Fundación Comparte Vida, Metabólicas, Instituto Nacional de Medicina
A.C., Genómica
Tema selecto de genética II Anexo II del Capítulo VII

Dr. Julio Granados Arriola Dra. Susana Kofman Alfaro


División de Inmunogenética, Departamento de Servicio de Genética, Hospital General de México, O.
Trasplantes, Instituto Nacional de Ciencias Médicas y D. Facultad de Medicina Universidad Nacional
Nutrición “Salvador Zubirán” Autónoma de México
Tema selecto de genética IV Capítulos 9 y 10

Dra. Patricia Grether González Dra. Alejandra Lara Mejía


Médica cirujana especialista en Genética Médica. Jefa División de Inmunogenética, Departamento de
del Departamento de Genética del Instituto Nacional Trasplantes, Instituto Nacional de Ciencias Médicas y
de Perinatología Nutrición “Salvador Zubirán”
Capítulo 13 Tema selecto de genética IV

Dr. Mariano Guardado Estrada Dra. Esther Lieberman Hernández


Unidad de Medicina Genómica, Hospital General de Departamento de Genética Humana, Instituto
México O. D. Departamento de Medicina Experimen- Nacional de Pediatría, Facultad de Medicina,
tal, Facultad de Medicina, Universidad Nacional Universidad Nacional Autónoma de México
Autónoma de México. Capítulo 11 y Anexo II del Capítulo 11
Tema selecto de genética VII
Dr. Saúl Lira Albarrán
M. en C. Roberto Guevara Yáñez Departamento de Biología de la Reproducción “Dr.
Director del Laboratorio de Análisis Clínicos y Carlos Gual Castro”, Instituto Nacional de Ciencias
Citogenéticos BIOGEN. Médicas y Nutrición “Salvador Zubirán”
Anexo II del Capítulo 4 Capítulo 10

Biblioteca Médica Virtual


Colaboradores VII
Dr. Ruben Lisker Yourkowitzky Dra. Verónica Fabiola Morán Barroso
Profesor Emérito de la UNAM, Dirección de Jefa del Departamento de Genética, Hospital Infantil
Investigación del Instituto Nacional de Ciencias de México Federico Gómez
Médicas y Nutrición “Salvador Zubirán” Anexo I del Capítulo 5 y Anexo IV del Capítulo 6
Capítulo 1
Dr. Osvaldo M. Mutchinick Baringoltz
QFB. María A. López Hernández Jefe del Departamento de Genética, Instituto Nacional
Departamento de Genética, Instituto Nacional de de Ciencias Médicas y Nutrición “Salvador Zubirán”
Ciencias Médicas y Nutrición “Salvador Zubirán” Universidad Nacional Autónoma de México.
Anexo VI del Capítulo VII Capítulo 7 y Anexo I del Capítulo 7
Dra. Marisol López López
Dra. Karem Nieto Martínez
Departamento de Sistemas Biológicos, División de
Ciencias Biológicas y de la Salud. Universidad Servicio de Genética, Hospital General de México, OD
Autónoma Metropolitana, Unidad Xochimilco y Facultad de Medicina, Universidad Nacional
Capítulo 2, Anexo I del Capítulo 2 y Tema selecto de Autónoma de México
genética I Capítulo 9

Dra. Eunice López Muñoz Dra. Lorena Orozco Orozco


Unidad de Investigación Médica en Genética Humana, Departamento de Biología Molecular, Instituto
Hospital de Pediatría. Centro Médico Nacional Siglo Nacional de Pediatría, SSA
XXI, Instituto Mexicano del Seguro Social Anexo II del Capítulo VII
Anexo III del Capítulo 12
Dr. David José Dávila Ortíz de Montellano
Dra. Leonora Luna Muñoz Médico Genetista. Departamento de Genética
Departamento de Genética, Instituto Nacional de Instituto Nacional de Neurología y Neurocirugía
Ciencias Médicas y Nutrición “Salvador Zubirán” Manuel Velasco Suárez
Anexo I del Capítulo VII Capítulo 8 y Anexo III del Capítulo 8

Dr. Carlos Manzano Sierra Dra. Rocío Ortiz López


Departamento de Genética, Hospital Infantil de Centro de Investigación y Desarrollo en Ciencias de la
México Federico Gómez Salud, Universidad Autónoma de Nuevo León
Anexo I del Capítulo 5 Capítulo 14
Dra. Gabriela Martínez Cortes Dra. Rosenda Isabel Peñaloza Espinosa
Instituto de Investigación en Genética Molecular, Departamento de Sistemas Biológicos, Universidad
Centro Universitario de la Ciénega, Universidad de Autónoma Metropolitana, Unidad Xochimilco
Guadalajara (CUCI-UdeG) Capítulo 2 y Anexo II del Capítulo 2
Anexo I del Tema selecto de genética V
Dr. Francisco Javier Perea Díaz
Dr. Julio Mayorga Camargo
División de Genética, Centro de Investigación
Departamento de Biología de la Reproducción “Dr.
Biomédica de Occidente, Instituto Mexicano del
Carlos Gual Castro”, Instituto Nacional de Ciencias
Seguro Social. Centro Universitario de Ciencias de la
Médicas y Nutrición “Salvador Zubirán”
Salud, Universidad de Guadalajara.
Capítulo 10
Anexo IV del Capítulo 5
Dr. Juan Pablo Méndez Blanco
Unidad de Investigación en Obesidad, Instituto Biol. Fernanda Pérez Villagomez
Nacional de Ciencias Médicas y Nutrición “Salvador Encargada del área de preservación. Departamento de
Zubirán” Inmunología e Inmunogenética, Instituto Nacional de
Anexo V del Capítulo VII Diagnóstico y Referencia Epidemiológicos, (InDRE)
Tema selecto de genética II
M. en C. Dra. Bertha Molina Álvarez
Laboratorio de Citogenética, Departamento de Dra. Ma. Guadalupe Quiñonez Silva
Investigación en Genética Humana, Instituto Nacional Unidad de Investigación Médica en Genética Humana,
de Pediatría Hospital de Pediatría. Centro Médico Nacional Siglo
Capítulo 4 XXI, Instituto Mexicano del Seguro Social
Anexo I del Capítulo 12
M. en C. Nancy Monroy Jaramillo
Instituto Nacional de Neurología y Neurocirugía QFB. Miguel Ángel Ramírez Fernández
Manuel Velasco Suárez Huella Génica S.A. de C.V.
Anexo I del Capítulo 2 y Tema selecto de genética I Tema selecto de genética VII

Biblioteca Médica Virtual


VIII Colaboradores

M. en C. Sandra Elena Ramos Ángeles Dr. Rafael Dulijh Uranga Hernández


Departamento de Investigación en Genética Humana, Médico Genetista, Profesor titular de la Asignatura de
Instituto Nacional de Pediatría, Genética Clínica, Facultad de Medicina, Universidad
Capítulo 4 y Anexo III del Capítulo 4 Nacional Autónoma de México
Anexo VI del Capítulo 12
Dr. en C. Héctor Rangel Villalobos
Instituto de Investigación en Genética Molecular, Dr. Luis F. Valdés Corona
Centro Universitario de la Ciénega, Universidad de División de Inmunogenética, Departamento de
Guadalajara (CUCI-UdeG) Trasplantes, Instituto Nacional de Ciencias Médicas y
Tema selecto de genética V y Anexo I del Tema selecto de Nutrición “Salvador Zubirán”
genética V Tema selecto de genética IV

Dr. Miguel Ángel Reyes Servín Biol. Alejandra Vázquez Abundes


División de Inmunogenética, Departamento de Encargada de Citofluorometría y Acreditación.
Trasplantes, Instituto Nacional de Ciencias Médicas y Departamento de Inmunología e Inmunogenética,
Nutrición “Salvador Zubirán” Instituto Nacional de Diagnóstico y Referencia
Tema selecto de genética IV Epidemiológicos, (InDRE)
Tema selecto de genética II
Biol. Danaeé Rodríguez Uribe
Encargada de Histocompatibilidad. Departamento de M. en C. José Velázquez Aragón.
Inmunología e Inmunogenética, Instituto Nacional de Laboratorio de Biología Molecular. Instituto Nacional
Diagnóstico y Referencia Epidemiológicos, (InDRE) de Pediatría. Facultad Mexicana de Medicina de la
Tema selecto de genética II Universidad la Salle.
Anexo III del Capítulo 2
Biol. Alfredo de Jesús Rodríguez Gómez
Departamento de Investigación en Genética Humana, M. en C. Ana Claudia Velázquez Wong
Instituto Nacional de Pediatría, Unidad de Investigación Médica en Genética Humana,
Capítulo 4 Hospital de Pediatría. Centro Médico Nacional Siglo
XXI, Instituto Mexicano del Seguro Social
Dr. Augusto Rojas Martínez Anexo II del Capítulo 12
Centro de Investigación y Desarrollo en Ciencias de la
Salud, Universidad Autónoma de Nuevo León Dr. Carlos Alberto Venegas Vega
Capítulo 14 Médico Especialista en Genética Médica, Servicio de
Genética, Hospital General de México, O. D.
M. en C. Ruth Ruíz-Esparza Garrido Capítulo 10, Tema selecto de genética III
Unidad de Investigación Médica en Genética Humana,
Hospital de Pediatría. Centro Médico Nacional Siglo Dra. María Teresa Villarreal Molina
XXI, Instituto Mexicano del Seguro Social Dirección de Investigación, Instituto Nacional de
Anexo IV del Capítulo 12 Medicina Genómica
Anexo III del Capítulo VII
Dra. Martha Eugenia Ruiz Tachiquín
Unidad de Investigación Médica en Genética Humana, Dr. Camilo E. Villarroel Cortés
Hospital de Pediatría. Centro Médico Nacional Siglo Departamento de Investigación en Genética Humana,
XXI, Instituto Mexicano del Seguro Social Instituto Nacional de Pediatría,
Anexo V del Capítulo 12 Capítulo 4 y Anexo I del Capítulo 4
Dr. Fabio Abdel Salamanca Gómez. Dra. Emiy Yokoyama Rebollar
Titular de la Coordinación de Investigación en Salud, Departamento de Investigación en Genética Humana,
Centro Médico Nacional Siglo XXI, Instituto Instituto Nacional de Pediatría
Mexicano del Seguro Social Capítulo 6 y Anexo III del Capítulo 6
Capítulo 12
Dr. Gildardo Zafra de la Rosa
M. en C. Silvia Rosalía Sánchez Sandoval Jefe del Departamento de Genética, Hospital Español
Departamento de Investigación en Genética Humana, de México, Facultad de Medicina, Universidad
Instituto Nacional de Pediatría, Nacional Autónoma de México
Capítulo 4 y Anexo III del Capítulo 4 Capítulo 5

Biblioteca Médica Virtual


Prólogo

Opiniones y hablares de hoy día, ya catalogan como empre- ción de expertos allegados. Cometido necesariamente
sa riesgosa y acto de valentía, la elaboración y ulterior publi- pluriautorial, dada la enorme diversidad de nociones y
cación, a la manera tradicional, del libro científico. Augures habilidades involucradas, ambas obras comparten coau-
de mal agüero predicen su pronta y definitiva sumisión ante tores, si bien no en todos los casos disertan acerca de los
el tan mal llamado libro electrónico. Por fortuna, aún preva- mismos tópicos. Alternan con ellos genetistas de la nueva
lecemos quienes por convicción sostenemos que la obra hornada, investigadores en específicas áreas de nuevo
científica impresa en papel de calidad tipográfica, obviamen- conocimiento, tecnología y habilidades. Porque casi ine-
te a tono con los dictados tecnológicos modernos, perdura- vitablemente, en los tiempos que corren en el ámbito
rán como fuente permanente y privilegiada de información científico, progreso implica parcelación.
y referencia, y por lo tanto, instrumento principal para el Es decir, la tasa evolutiva actual de las ciencias genéti-
aprendizaje sólido y a profundidad y única manera de co-genómicas es de tal enormidad, que no basta ya la
cimentar el saber. La lectura concentrada del libro científico, permanente actualización nocional y de habilidades. No
sea o no de intención e índole didáctica, es pues requisito es raro que novedades tecnológicas incuben una nueva
ineludible para sustentar y dar sentido a cualquier informa- área de especialización profesional. Tampoco resulta
ción de último minuto obtenida mediante la ya omnipresen- pues aventurado, predecir prontas ediciones subsecuen-
te parafernalia digital. Más que leer en línea conviene hacer- tes de esta importante obra.
lo línea por línea. Porque sin duda alguna, Genética Clínica de los doc-
Es pues motivo de alabanza y hora de saludar a la tores Victoria del Castillo-Ruiz, Rafael D. Uranga-
parición de esta nueva aportación al conocimiento de la Hernandez y Gildardo Zafra-de la Rosa, por sus altos
vertiente clínica de las ciencias de la genética. méritos, ingresa hoy al universo de los libros imprescin-
Antecedente claro de este nuevo libro lo son las tres edi- dibles para quienes, en una calidad u otra, se desempe-
ciones de la obra que con igual título emanara del talento ñan, o viven en necesidad de saber más de esta no por
y la visión de J. Jesús Guízar Vázquez, con la colabora- añosa menos actual área de la medicina de hoy.

Silvestre Frenk

IX

Biblioteca Médica Virtual


Biblioteca Médica Virtual
Dedicatoria

A mi familia por su estímulo y apoyo incondicional para realizar esta obra.

A mi gran amigo el Dr. Jesús Guízar Vázquez (QEPD) por haberme invitado a participar en sus proyectos de difu-
sión de la Genética Clínica.

A la Dra. Ma. Elena Castillo Romero (QEPD) y al Dr. Gildardo Espinosa de Luna del Departamento de Embriología
de la Facultad de Medicina de la Universidad Nacional Autónoma de México por el esfuerzo realizado para la ense-
ñanza de la Genética Clínica en la carrera de Medicina.

A mis pacientes por ser siempre un reto y gran incentivo de estudio.

Dra. Victoria del Castillo Ruíz.

Poco son los momentos que tenemos en la vida para honrar a quien lo merece y nunca las circunstancias parecen ser
suficientes. No somos muchos lo que hemos tenido la oportunidad de conocer a un verdadero maestro, y aunque
podemos ofrecer muchas acepciones al término, yo me quedo con la siguiente: “persona sabia, con la suficiente humildad
para compartir su conocimiento, con la capacidad para graduar la dosis exacta de disciplina y cordialidad para formar
a un ser humano”.
En cada línea de la presente obra, se aprecia su injerencia, pues como si se tratara de transmisión mendeliana, gene-
tistas de varias generaciones vertieron su conocimiento de la misma forma en que él lo hacía. Dentro de sus anhelos
e inquietudes, muchas veces compartidos, nos motivaba a tener siempre la mente inquieta, aportando a la construc-
ción del conocimiento.
Su legado perdurará en la genética clínica del país y es un ejemplo claro de la fortaleza de la intelectualidad mexicana,
base de la subsistencia de nuestra tan golpeada patria.
Con respeto y agradecimiento, se dedica esta obra a la memoria del Dr. J. Jesús Guízar Vázquez.

Dr. R. Dulijh Uranga H.

A J. Jesús Guízar Vázquez.


Es justo reconocer en esta obra al Dr. José de Jesús Guízar Vázquez, quien logró conjuntar la labor editorial de más
de 70 especialistas en genética, con el fin crear una obra accesible, didáctica y actualizada, dirigida especialmente a los
estudiantes de medicina, pero también de utilidad para los médicos generales y especialistas.
En todo momento de la creación de esta obra lo recordamos como el sembrador editorial de la genética clínica en
México.

A la Maestra María Elena Castillo y del Dr. Gildardo Espinosa de Luna.


La asignatura de Genética Clínica en la Facultad de Medicina de la UNAM, se instituyó gracias a la apertura y disposi-
ción de la Maestra María Elena Castillo y del Dr. Gildardo Espinosa de Luna, quienes pusieron todo su entusiasmo,
trabajando junto con los profesores para el óptimo desarrollo del programa del Curso. Posteriormente continuaron
manteniendo su participación e interés para mejorar el contenido. Desafortunadamente la muerte sorprendió a María
Elena, a quien recordamos por su fino trato, siempre vigorosa, entusiasta y alegre.
El Dr. Gildardo Espinosa de Luna ha continuado la labor y ahora contamos con su participación y estímulo para
llevar al cabo esta obra, de la cual se debe sentir orgulloso puesto que él la inició y la impulsó; queda en nosotros nuestro
más sincero reconocimiento.

Dr. Gildardo Zafra de la Rosa.

XI

Biblioteca Médica Virtual


Biblioteca Médica Virtual
Contenido

Colaboradores...........................................................................................................................................................V

Prólogo....................................................................................................................................................................IX

Dedicatoria.......................................................................................................................................................XI

Capítulo 1. Importancia de la genética en medicina....................................................................................................1


Ruben Lisker Yourkowitzky

Capítulo 2. Bases moleculares de la herencia............................................................................................................11


Alicia B. Cervantes Peredo, Marisol López López,
Diego J. Arenas Aranda, Rosenda I. Peñaloza Espinosa

ANEXO I. Variación genética humana.............................................................................................................39


Marisol López López, Alicia B. Cervantes Peredo, Nancy Monroy Jaramillo

ANEXO II. DNA mitocondrial humano: polimorfismo y variabilidad en las poblaciones.................................45


Rosenda I. Peñaloza Espinosa, Ricardo M. Cerda Flores

ANEXO III. Fundamentos y aplicaciones de las principales técnicas


de diagnóstico molecular en enfermedades mendelianas............................................................49
Miguel Ángel Alcántara Ortigoza, Ariadna Estela González del Ángel,
José Velázquez Aragón

ANEXO IV. Telómero y telomerasa..................................................................................................................59


Diego J. Arenas Aranda

Capítulo 3. Nosología genética.................................................................................................................................63


Victoria del Castillo Ruíz

ANEXO I. Árbol genealógico en la historia genética........................................................................................85


Victoria del Castillo Ruíz

ANEXO II. Otros diagramas familiares............................................................................................................91


Victoria del Castillo Ruíz

ANEXO III. Abordaje del paciente dismorfológico..........................................................................................95


Victoria del Castillo Ruíz, Ariadna González del Ángel

Capítulo 4. Patología cromosómica.........................................................................................................................101


Sara Frías Vázquez, Bertha Molina Álvarez, Alfredo de Jesús Rodríguez Gómez,
Sandra Elena Ramos Ángeles, Silvia Rosalía Sánchez Sandoval, Camilo Villarroel

ANEXO I. Características clínicas de las autosomopatías...............................................................................127


Camilo Villarroel

XIII

Biblioteca Médica Virtual


XIV Contenido

ANEXO II. Técnicas de citogenética convencional.........................................................................................133


Roberto Guevara Yáñez

ANEXO III. Citogenética molecular...............................................................................................................141


Sara Frías, Sandra Elena Ramos Ángeles, Silvia Rosalía Sánchez Sandoval

Capítulo 5. Herencia mendeliana: parte I ...............................................................................................................147


Gildardo Zafra de la Rosa

ANEXO I. Acondroplasia..............................................................................................................................155
Verónica Fabiola Morán Barroso, Constanza García Delgado,
Carlos Manzano Sierra, Francisco Flores Ramírez

ANEXO II. Neurofibromatosis tipo 1.............................................................................................................161


Ma. Antonieta de Jesús Araujo Solís, Juan Carlos Huicochea Montien

ANEXO III. Síndrome de Marfan..................................................................................................................165


Ma. Antonieta de Jesús Araujo Solís, Juan Carlos Huicochea Montien

ANEXO IV. Anemia drepanocítica.................................................................................................................169


Bertha Ibarra, Luis Felipe Guzmán, F. Javier Perea

Capítulo 6. Herencia mendeliana: parte 2...............................................................................................................171


Victoria del Castillo Ruíz, Emiy Yokoyama Rebollar

ANEXO I. Distrofia muscular de Duchenne y Becker....................................................................................187


Miguel Ángel Alcántara Ortigoza

ANEXO II. Hemofilia tipo A..........................................................................................................................193


Miguel Ángel Alcántara Ortigoza

ANEXO III. Raquitismo hipofosfatémico ligado al X.....................................................................................199


Emiy Yokoyama Rebollar

ANEXO IV. Síndrome de Rett.......................................................................................................................203


Constanza García Delgado, Verónica Fabiola Morán Barroso, Francisco Flores Ramírez

Capítulo 7. Herencia multifactorial.........................................................................................................................207


Osvaldo Mutchinick Baringoltz

ANEXO I. Malformaciones congénitas...........................................................................................................215


Osvaldo M. Mutchinick, Jazmín Arteaga Vázquez,
Leonora Luna Muñoz

ANEXO II. Genómica del asma.....................................................................................................................221


Lorena Orozco, Silvia Jiménez-Morales

ANEXO III. Genética de la diabetes mellitus tipo 2.......................................................................................227


María Teresa Villarreal Molina

ANEXO IV. Genética de la hipertensión arterial esencial...............................................................................231


Jazmín Arteaga Vázquez

ANEXO V. Genética de la obesidad...............................................................................................................235


Juan Pablo Méndez Blanco

ANEXO VI. Genómica de la osteoporosis......................................................................................................239


María Aurelia López Hernández, Adolfo Aguayo Gómez

Capítulo 8. Mecanismos no clásicos de herencia.....................................................................................................243


María Elisa Alonso Vilatela, María de Lourdes González del Rincón,
David José Dávila Ortiz de Montellano

Biblioteca Médica Virtual


Contenido XV
ANEXO I. Síndrome de Prader Willi.............................................................................................................261
María de Lourdes González del Rincón

ANEXO II. Enfermedad de Huntington.........................................................................................................263


María Elisa Alonso Vilatela

ANEXO III. Enfermedad mitocondrial...........................................................................................................265


David José Dávila Ortiz de Montellano

Capítulo 9. Aspectos genéticos, moleculares y celulares de la diferenciación gonadal................................... .....269


Susana Kofman Alfaro, Karem Nieto Martínez,
Laura Gómez Laguna, Alicia Cervantes Peredo

Capítulo 10. Desórdenes del desarrollo sexual.......................................................................................................281


Susana Kofman Alfaro, Julio Mayorga Camargo,
Carlos Alberto Venegas Vega, Saúl Lira Albarrán

Capítulo 11. Errores innatos del metabolismo.........................................................................................................295


María del Carmen Esmer Sánchez, Antonio Bravo Oro,
Esther Lieberman Hernández, Victoria del Castillo Ruíz

ANEXO I. Fenilcetonuria...............................................................................................................................323
María del Carmen Esmer Sánchez, Victoria del Castillo Ruíz

ANEXO II. Mucopolisacaridosis con terapia de reemplazo enzimático..........................................................327


Victoria del Castillo Ruíz, Antonio Bravo Oro,
Esther Lieberman Hernández

Capítulo 12. Genética y cáncer...............................................................................................................................333


Diego J. Arenas Aranda, Fabio Abdel Salamanca Gómez

ANEXO I. Cáncer familiar.............................................................................................................................341


Ma. Guadalupe Quiñonez Silva

ANEXO II. Estudios citogenéticos en cáncer..................................................................................................345


Ana Claudia Velázquez Wong

ANEXO III. Cáncer de mama........................................................................................................................349


Eunice López Muñoz

ANEXO IV. Genómica y proteómica en cáncer..............................................................................................353


Beatriz Castrejón Gallegos, Ruth Ruíz Esparza Garrido

ANEXO V. Virus y cáncer..............................................................................................................................357


Martha Eugenia Ruiz Tachiquín

ANEXO VI. Poliposis adenomatosa familiar...................................................................................................361


Rafael Dulijh Uranga Hernández

Capítulo 13. Asesoramiento genético: diagnóstico predictivo y prenatal.................................................................365


Alessandra Carnevale, Patricia Grether González

Capítulo 14. Recursos terapéuticos y medicina genómica.......................................................................................381


Augusto Rojas Martínez, Rocío Ortiz López y Daniel Cervantes García

Temas selectos de genética

Tema selecto I. Farmacogenética y farmacogenómica.....................................................................................403


Marisol López López, Alicia Cervantes Peredo,
Nancy Monroy Jaramillo

Biblioteca Médica Virtual


XVI Genética clínica

Tema selecto II. Aplicaciones terapéuticas de las células


progenitoras y aspectos éticos........................................................................................ ......421
Clara Gorodezky, Carmen Aláez, Fernanda Pérez, Alejandra Vázquez,
Danaeé Rodríguez, Hilario Flores

Tema selecto III. Pruebas citogenéticas basadas en microarreglos...................................................................439


Carlos Alberto Venegas Vega

Tema selecto IV. Inmunogenética del complejo principal de histocompatibilidad...........................................445


Julio Granados Arriola, Claudia Álvarez Carreño, Alejandra Lara Mejía,
Miguel Angel Reyes Servín, Luis F. Valdés Corona

Tema selecto V. Genética de poblaciones........................................................................................................461


Héctor Rangel Villalobos

Anexo I. Orígenes y estructura vía paterna y materna de la población mestiza mexicana........................477


Héctor Rangel Villalobos, Gabriela Martínez Cortes

Tema selecto VI. Genética y bioética.............................................................................................................485


Jorge Luis Hernández Arriaga

Tema selecto VII. Tecnología de DNA para identificar individuos..................................................................495


Jaime Berumen Campos, Mariano Guardado Estrada,
Eligia Juárez Torres, Miguel Angel Ramírez Fernández

Índice......................................................................................................................................................................521

Biblioteca Médica Virtual


Biblioteca Médica Virtual
1 Importancia
de la genética
en medicina
Ruben Lisker Yourkowitzky

El ser humano se origina de la unión de dos células ALGO DE HISTORIA


sexuales, el óvulo y el espermatozoide que al juntarse
dan lugar al cigoto. La mitad de la dotación cromosó- Knudson (2005), conocido genetista médico recién falle-
mica de esta célula, proviene de la madre y el resto del cido, señala en un escrito en que describe su experiencia
padre. Por divisiones celulares sucesivas y el proceso de personal sobre la evolución de la genética y la medicina,
diferenciación celular, esta célula se convierte en que en el decenio de 1940-49, la disciplina que se cono-
recién nacido a menos que se pierda, ya que la tasa de ce hoy día como genética médica, no parecía existir,
abortos espontáneos es elevada, para algunos autores cuando menos en EUA. Otros autores de esa época opi-
de más de 50%. naron que la única tecnología disponible para los estu-
Todas las características fisiológicas o patológicas del dios genéticos en nuestra especie era el árbol genealógi-
individuo, son resultado de la interacción entre su estruc- co y que no fue sino hasta que Beadle y Tatum (1941)
tura genética y el ambiente en que se desarrolla. Para definieran la función de los genes con su propuesta de -
algunas características son más importantes los factores un gen una enzima- que marca el inicio de la bioquími-
hereditarios y para otras predominan las ambientales. Por ca genética. De hecho completan la descripción de
ejemplo, el grupo sanguíneo al que se pertenece depen- Garrod en 1902, de un error congénito del metabolismo,
de en especial de los genes que se heredan de los padres, la alcaptonuria, ya que aunque este autor sí se refirió a
mientras que los traumatismos son principal, pero no que una deficiencia enzimática era responsable de la
exclusivamente ambientales. Por ejemplo, una persona acumulación de sustrato, lo que a su vez producía la
con problemas de visión o audición de origen genético, enfermedad, omitió relacionarlo con un gen defectuoso.
es más probable que tenga un accidente en la calle, que En el mismo sentido, cabe la observación de Pauling et
quienes ven y escuchan con normalidad. al., (1949) de que la hemoglobina S tenía una movilidad
A pesar de lo anterior, por muchos años hubo desin- electroforética distinta a la hemoglobina normal, indi-
moderno Fotocopiar sin autorización es un delito.

terés por parte de médicos y genetistas de los proble- cando un cambio en su carga eléctrica y por tanto de la
mas hereditarios en la especie. Los primeros pensaban secuencia de aminoácidos, lo que le dio pie a plantear el
que los padecimientos genéticos eran demasiado infre- concepto de enfermedad molecular, que abrió un campo
cuentes como para ser de interés médico y los segun- fértil en la genética humana.
dos consideraban que eran poco útiles para estudios El número correcto de cromosomas en la especie, se
genéticos. El tiempo de gestación es muy prolongado desconocía, hasta la publicación de Tjio y Levan en 1956
(nueve meses), el tiempo requerido para que un recién y no menos importantes fueron dos datos citogenéticos,
nacido se pueda reproducir es largo, no menos de 13 primero la identificación de la trisomía 21 como respon-
años en las mujeres, más en los varones y, por último, sable del mongolismo por Lejeune en 1959 y luego la
no se pueden aparear al gusto del investigador como descripción de Nowell y Hungerford un año después, del
para hacer “experimentos de interés científico”. Sin cromosoma “Philadelphia”, primera aberración cromosó-
embargo, resulta que las enfermedades hereditarias no mica específica de una enfermedad maligna. Algo más de
son raras, sino que en su conjunto tienen trascendencia una década después se describió la técnica para obtener
© Editorial El manual

y el hombre es el animal que mejor se conoce, ya que las bandas Q en los cromosomas (Caspersson et al.,
de ningún otro se tiene información similar y las cru- 1971), lo que detonó el crecimiento explosivo de la cito-
zas de interés científico se realizan por azar con sufi- genética, hasta la actualidad. La genética humana siguió
ciente frecuencia como para ser informativas. creciendo con mayor o menor rapidez, hasta el adveni-

Biblioteca Médica Virtual


2 Genética clínica

miento de nuevas tecnologías, que dieron lugar a lo que mayor entre más cercanas están, lo que apoya de mane-
se llamó ra contundente la evolución de las especies por selección
natural propuesta por Darwin en 1859. A manera de
Nueva genética ejemplo, la proporción de diferencias entre los humanos
entre sí es del orden de 0.1% y las del humano con los
Este término fue acuñado por Comings en 1980 en refe- chimpancés, los “primos” más cercanos, es de alrededor
rencia al uso de las nuevas técnicas de biología molecu- de 1.5%.
lar para el diagnóstico prenatal de diversas enfermedades
en lo particular y para el estudio del genoma humano en
lo general. Algunas de ellas son: 1) las enzimas de restric-
ción, también llamadas endonucleasas, que son compo-
MEDICINA GENÓMICA
nentes normales de las bacterias que se caracterizan por
cortar el DNA de manera selectiva, en los sitios donde Conforme avanzó el PIGH resultó fácil predecir que los
reconocen una secuencia dada de nucleótidos (sitios de resultados serían importantes para la medicina. La pala-
restricción) lo que permitió por un lado fabricar molécu- bra genomics fue acuñada en 1987 en el primer número
las híbridas de DNA procedentes de especies diferentes, de la revista Genomics, cuyo principal artículo se llamó:
y por el otro identificar la presencia de sitios de restric- “Una nueva disciplina, un nombre nuevo y una nueva
ción específicos en el genoma, lo que se utiliza para el revista”. Por algún tiempo parecía que todo el asunto era
diagnóstico prenatal de diversas enfermedades; 2) la téc- difícil y complejo. Sin embargo Beaudet (1999) en su
nica de Southern desarrollada por un investigador britá- discurso de salida como presidente de la Asociación
nico de ese apellido, permite seleccionar in vitro dentro Americana de Genética Humana, sugirió que la medici-
de muchos fragmentos de DNA producidos de forma na genómica era simplemente el uso sistemático del aná-
experimental, aquel que es de interés; y 3) la reacción en lisis genotípico, de preferencia por el estudio directo del
cadena de la polimerasa que permite amplificar con rapi- DNA, para mejorar la calidad de la atención médica. Al
dez fragmentos cortos de DNA que han resultado de principio y como ya se señaló, la única tecnología dispo-
gran ayuda para el diagnóstico de muchas enfermedades nible era la elaboración del árbol genealógico (en espe-
genéticas. Éstas y otras tecnologías, sirvieron para que en cial datos clínicos), después se añadieron estudios de
1990 se iniciara un proyecto internacional que está revo- laboratorio para identificar algunos metabolitos alterados
lucionando la práctica de la genética médica y que se en enfermedades genéticas (p. ej., fenilcetonuria), análi-
conoció como el proyecto internacional del genoma sis electroforético de hemoglobina (hemoglobinas anor-
humano (PIGH) males), deficiencias enzimáticas (deficiencia de G-6-PD
Participaron en este proyecto seis países: Alemania, eritrocítica), alteraciones numéricas de los cromosomas
Francia e Inglaterra de Europa, China y Japón de Asia y (Down) y aberraciones estructurales diversas, desde
EUA del continente americano, siendo este último el que grandes como los isocromosomas y pequeñas, como las
contribuyó con mayor número de laboratorios e infor- microdeleciones. Al inicio las alteraciones del DNA se
mación. Sus dos objetivos principales fueron: 1) conocer inferían por los datos clínicos o por los trastornos en sus
la ubicación cromosómica de todos los genes (elaborar productos (proteínas) y ahora se pasa al estudio directo
un mapa genético); y 2) averiguar la secuencia completa del DNA. Estas consideraciones deben desmitificar la
de las 3 200 millones de pares de bases que integran el percepción de que la medina genómica es complicada y
genoma. Además se pretendía obtener la secuencia del sólo asequible a los iluminados (as), ya que se trata sólo
DNA de otros animales y plantas y se dedicó 5% del pre- del uso de nuevas tecnologías. Esto lleva a realizar los
supuesto para estudiar los efectos éticos, legales y socia- comentarios que siguen sobre algunos aspectos puntua-
les del proyecto. Hubo dos esfuerzos paralelos uno, el les de la genética humana actual.
internacional al que se hace referencia en este capítulo,
cuya cabeza inicial fue J. Watson y el otro liderado por C. Ejercicio de la medicina
moderno Fotocopiar sin autorización es un delito.
Venter de los laboratorios Celera Genomics, que usando
una metodología diferente tuvo los mismos propósitos. Hasta hace poco, el paradigma médico era diagnóstico,
El PIGH se inició en 1990 y se planeó que duraría 15 seguido de tratamiento y ahora está cambiando a predic-
años, pero ya para el inicios del 2001, se publicó el pri- ción seguida de prevención. Antes el enfermo acudía al
mer borrador de más de 90% del genoma humano, que médico por presentar alguna molestia y después de diag-
apareció en la revista Nature (Lander et al., 2001). En nosticarse el padecimiento, se le daba un tratamiento con
abril del 2003, se anunció la terminación del proyecto una tasa de éxito variable. Ahora, gracias a las herramien-
pocos días antes del 50 aniversario de la publicación tas proporcionadas por la medicina genómica, se podrán
semanal de Watson y Crick proponiendo la estructura identificar desde la más tierna edad muchas enfermeda-
del DNA. Hasta mayo de 2002 se habían secuenciado los des de forma total o parcial genéticas que podrán aque-
genomas de 877 virus, 81 microbios, la levadura jar a cada sujeto en el curso de su vida (predicción) y
Saccharomyces cerevisiae, el nemátodo Caenorhabditis ele- podrán desarrollarse las estrategias necesarias para preve-
© Editorial El manual

gans, el parásito del paludismo y otros organismos más. nirlas, que no necesariamente serán de tecnología com-
Para septiembre del 2008, la obra Mendelian Inheritance pleja. Un ejemplo sería el de los sujetos homocigotos
in Man de McKusick identificaba a 18 961 genes o feno- para la variante Z de la α-1 antitripsina, cuya frecuencia
tipos con herencia mendeliana. Un dato importante en población blanca estadounidense es de 1 en 5 000.
emanado del análisis de todos estos genomas es la gran Este genotipo se asocia a un alto riesgo de padecer enfi-
homología que hay entre las diferentes especies que es sema pulmonar y 50% de supervivencia para quienes

Biblioteca Médica Virtual


Importancia de la genética en medicina 3
fuman es del orden de 40 años, cifra que sube a los 60 Ésta es la situación en que se encuentran los padecimien-
años para quienes se abstienen de hacerlo. La medida tos multifactoriales, además de que el riesgo puede
preventiva es no fumar y resulta obvia la ventaja de pre- aumentar conforme avanza la edad del sujeto, lo que per-
venir sobre curar, tanto para el enfermo como para la mite tomar medidas preventivas más o menos exitosas.
sociedad. Se pueden distinguir dos casos diferentes: 1) la El mejor ejemplo de esta situación es el carcinoma de
identificación de los genes que necesariamente causan mama y ovario familiar. Una mujer nacida en una fami-
una enfermedad; y 2) la identificación de genes que lia con esta problemática, cuando tiene una mutación de
aumentan la probabilidad de padecer una enfermedad y varias posible en los genes BCRA-1, BCRA-2 o ambos,
que se pueden definir como genes de susceptibilidad. tiene una probabilidad de 90% de desarrollar cáncer de
Identificación de genes cuya presencia se asocia siem- mamá si vive hasta los 80 años. La conducta a seguir es
pre a enfermedad. Deben considerarse dos situaciones, difícil, se puede recomendar un seguimiento cuidadoso
aquellas en que es posible tomar medidas preventivas y con mastografías periódicas a partir de cierta edad, pero
en las que esto todavía no es posible hacerlo. Un ejemplo se ignora cuál es la edad para iniciar dicho programa y se
de las primeras es la fenilcetonuria. Ésta es una enferme- corre el riesgo de retrasarlo demasiado.
dad devastadora que se hereda en forma mendeliana Hay evidencia empírica de que la mastectomía bilate-
recesiva y cuya sintomatología, principalmente retraso ral preventiva reduce de manera considerable la morbili-
mental profundo, puede evitarse por completo mediante dad y mortalidad del padecimiento, pero se desconoce a
medidas dietéticas sencillas, como el cuidar que el recién qué edad realizarla y no se puede garantizar 100% de efi-
nacido afectado se alimente con leche libre de fenilalani- cacia, ya que aun con mastectomías radicales pueden
na o con concentraciones muy bajas de este aminoácido. permanecer algunas células glandulares capaces de vol-
Para que la estrategia funcione se requiere que el trata- verse malignas en el futuro. En una publicación de la
miento se inicie lo más temprano posible, de preferencia Clínica Mayo en 1999, aparecida en el New England
antes de cumplir un mes de edad y que se prolongue Journal of Medicine, mencionan que en un lapso de 33
durante años. La logística para lograr esto en México se años se realizaron 639 mastectomías bilaterales a muje-
puede complicar, porque se requiere de un programa res con riesgo elevado de tener este padecimiento, a juz-
permanente de tamiz neonatal y de un seguimiento efi- gar por su historia familiar. Se esperaba que sin la opera-
ciente de los pacientes cuyas pruebas diagnósticas al ini- ción 70 de ellas desarrollaran el tumor y sólo siete lo
cio son positivas, lo cual no parece ser la regla en la medi- hicieron, y se esperaba que 25 murieran y sólo dos lo
cina pública. Una situación diferente es la de la fibrosis hicieron. Sin embargo, mucha gente está en contra de
quística del páncreas, padecimiento caracterizado por esta solución, ya que además de lo dicho, está el dilema
problemas pulmonares y del páncreas, que también se de realizar una cirugía mayor con consecuencias psicoló-
puede diagnosticar muy temprano, pero no hay medidas gicas potencialmente graves, para quitar un tejido sano
para prevenirla en la actualidad y los pacientes suelen con el objeto de prevenir una enfermedad que tal vez
morir en la juventud. La única opción actual sería el nunca ocurra.
aborto electivo si se hace el diagnóstico cuando el emba- Por último es importante plantear un problema de la
razo es lo suficiente joven, lo que puede ser en embara- medicina predictiva. Se trata de cómo explicar a los
zos de alto riesgo, que son aquellos que ocurren en muje- enfermos que 1) una prueba positiva no es igual a estar
res con hijos previos afectados de esta enfermedad y la enfermos, que sólo indica un aumento de riesgo en rela-
otra es esperar el nacimiento con la esperanza de que ción con la que tiene la población general; y 2) que exis-
entre tanto surja algún tratamiento efectivo. ten resultados falsos negativos, porque las pruebas habi-
Una variante de esta situación lo constituyen los pade- tuales sólo identifican las mutaciones más comunes en
cimientos de aparición tardía como por ejemplo la corea determinada población y que existen otras más que tam-
de Huntington. Los hijos de pacientes con esta enferme- bién pueden producir la enfermedad, y que ni siquiera
dad tienen 50% de riesgo de tenerla, según que hereden son estudiadas con las pruebas habituales.
o no el gen anormal del paciente y la sintomatología
manual moderno Fotocopiar sin autorización es un delito.

comienza a manifestarse alrededor de los 40 años de Asociación gen enfermedad


edad. El diagnóstico molecular se puede realizar desde
muy temprano y el dilema radica cuando hay que comu- El resultado del PIGH mostró que una de las fuentes
nicárselo al paciente y a su familia. La prueba diagnósti- principales de variabilidad genética entre las personas
ca debe realizarse, porque los resultados negativos dan son los llamados SNP (single nucleotide polymorphisms).
tranquilidad. Hay cierto acuerdo en que puede pospo- Existen cuando menos tres millones de ellos en el
nerse la información hasta que los individuos presinto- genoma y se pensó que serian útiles para identificar el
máticos sean adultos jóvenes y estén pensando en formar componente genético de las características humanas nor-
su propia familia, ya que eso les permite informar al cón- males como la estatura o la inteligencia y, sobre todo, de
yuge potencial y planear su descendencia. Informar antes enfermedades comunes como diabetes, hipertensión
tiene quizá efectos negativos en la conducta y estilo de arterial, cáncer y muchas otras. La estrategia para lograr-
vida de los pacientes, quienes ni siquiera saben si van a lo ha sido el comparar la distribución de decenas de
vivir el tiempo suficiente para manifestar la enfermedad, miles de SNP a lo largo del genoma, en grupos de pacien-
que por cierto es altamente incapacitante y lleva a la tes y sus respectivos controles, en estudios conocidos en
© Editorial El

muerte en un promedio de 10 años. epidemiología como de “casos y controles”. La estrategia


Identificación de genes de susceptibilidad. Son aque- se denomina en inglés como “genome wide association stu-
llos cuya presencia significa un aumento en el riesgo de dies (GWAS)”, que puede traducirse como “estudios de
padecer una enfermedad, más no hay seguridad de ello. asociación genómica total (asociación entre algunas

Biblioteca Médica Virtual


4 Genética clínica

enfermedades y los marcadores genéticos [SNP] investi- existen diversos métodos para contender con este pro-
gados)”. La idea es que si algún marcador es más frecuen- blema. El asunto es preocuparse por esto y pensar bien
te en los casos que en los controles, pudieran estar de como integrar el grupo control.
manera directa o indirecta involucrados en el padeci-
miento y considerarse como factores de riesgo. Pruebas genéticas por Internet
Un buen ejemplo de este tipo de estudios es una
publicación de The Wellcome Trust Case Control Poco tiempo después de terminado el PIGH, se empezó
Consortium (2007) en que investigaron en población bri- a ofrecer por Internet pruebas genéticas para diagnosti-
tánica alrededor de 2 000 individuos para cada uno de car diversas enfermedades, lo que se conoce como DTC
siete enfermedades diferentes y los compararon con (direct-to-consumer genetic testing). La propaganda de los
3 000 controles compartidos para los siete grupos de vendedores hace énfasis en que los resultados ayudan a
enfermos. Estudiaron en cada caso a 500 568 SNP y las los usuarios y sus médicos a identificar genes de riesgo
enfermedades fueron: trastorno bipolar, enfermedad para diversas enfermedades y tomar medidas para redu-
coronaria, hipertensión arterial, enfermedad de Crohn, cirlas. También los usan para dar recomendaciones dieté-
artritis reumatoide, y diabetes mellitus tipos 1 y 2. ticas diversas como el uso de suplementos nutricionales
Encontraron varias asociaciones en las diferentes enfer- individualizados con base en el genoma personal. Otros
medades, todas con un efecto modesto en la presencia de supuestos usos de estas pruebas, van desde la obtención
la misma, pero concluyen diciendo que será una herra- del componente étnico del usuario, hasta predecir en qué
mienta útil para conocer la fisiopatología de las enferme- deporte podrían destacar los hijos de alguna persona.
dades genéticas multifactoriales. Aparte de que algunos de los objetivos son de entrada
A pesar de los buenos deseos, puede afirmarse que se muy poco probables, la diferencia fundamental entre las
han realizado numerosas investigaciones de GWAS y la DTC y las pruebas genéticas tradicionales, es que en la pri-
realidad es que en muchos de los estudios se encuentra mera, tanto la solicitud de la prueba como el consejo deri-
asociación estadística entre un padecimiento y uno o vado de los resultados, se realiza sin la intervención de un
más marcadores, pero cada uno de ellos explica poco de intermediario (casi siempre un médico) lo que no ocurre
la carga genética y su valor predictivo es bajo. Varios en el contexto habitual. Las pruebas se ofrecen y venden
investigadores empiezan a desesperarse y consideran que por Internet y cuando el usuario la compra, recibe del ven-
los GWAS no resultan adecuados para conocer el com- dedor un material para obtener la muestra biológica, que
ponente genético de las enfermedades estudiadas y apro- puede ser un simple hisopo para recoger células por raspa-
vechando la tecnología para obtener la secuencia de do de la mucosa bucal y se le regresan para procesarse. Al
bases del DNA ha mejorado de forma notable y se ha cabo del tiempo convenido, el consumidor recibe los
vuelto mucho más económica, lo conveniente es realizar resultados con recomendaciones adicionales.
la secuencia total del genoma de varios miles de personas Las supuestas ventajas del procedimiento, son que
y correlacionarlos con todas las características de los par- incrementan el acceso a diversas pruebas genéticas, lo
ticipantes, incluyendo datos personales, estado de salud, que da mayor autonomía y poder de decisión al usuario,
características antropológicas y resultados de estudios de además de aumentar la confidencialidad del resultado, ya
laboratorio y gabinete. El líder de este esfuerzo es Frank que no forma parte de un expediente médico. Tengo
Church de la Universidad de Harvard y los primeros dudas sin embargo, de qué tan confidencial es el resulta-
resultados se subieron a Internet en 2008. do, ya que todo el proceso se realiza por vía electrónica,
Para terminar con los GWAS, se debe señalar, que además de que los problemas potenciales son de peso. El
dado que se han vuelto muy populares (no requieren de usuario puede escoger pruebas fuera de contexto y sin
hipótesis sólidas y los resultados son casi siempre publi- entender bien sus alcances además de que en la actuali-
cables), para lograr resultados útiles, se requieren cuando dad no hay garantía de que las pruebas tengan validez
menos tres condiciones: 1) que las pruebas de laborato- analítica (que den resultados exactos) y validez clínica
rio empleadas sean confiables e identifiquen siempre los (que existan datos científicos que avalen el decir de las
moderno Fotocopiar sin autorización es un delito.
mismos marcadores; 2) que el grupo de enfermos tengan compañías que venden las pruebas).
en realidad el mismo padecimiento; y 3) que el grupo En 2006 la GAO (United States Government
control sea apropiado. Lo más fácil de conseguir es lo pri- Accountability Office) investigó varias compañías que
mero, ya que hay excelentes equipos de laboratorio para ofrecían pruebas genéticas por Internet, concluyendo
el propósito y la tradición de control de calidad de las que realizaban predicciones sobre la posibilidad de tener
pruebas de laboratorio es ya antigua y exitosa. Otro enfermedades genéticas sin fundamento científico. De
punto es motivo de cierta preocupación, ya que el diag- entonces a la fecha han aparecido nuevas compañías,
nóstico de cualquier “enfermedad” se hace cuando se supuestamente de buena calidad y decidieron realizar
asocian una serie de síntomas y signos de ella, pero en una investigación al respecto.
rigor pocas veces se dispone de alguna prueba indepen- Obtuvieron muestras duplicadas de cinco donadores y
diente de que tengan en realidad el mismo padecimien- las enviaron para analizar a cuatro laboratorios diferen-
to. Por último el asunto del grupo control correcto puede tes. Una de las muestras de cada laboratorio tenía datos
© Editorial El manual

ser complejo, en particular cuando los casos, como es reales sobre el género, edad, etnicidad e historia clínica
común provienen de población hospitalaria. De manera resumida y el duplicado se alteró cambiando la edad,
ideal, los controles deben obtenerse del mismo universo etnicidad e historia clínica. Se pidió a las compañías que
que los casos y no tener la enfermedad en cuestión. El no hicieran predicciones relacionadas con 15 enfermedades
prestar debida atención al asunto puede llevar a resulta- diferentes. Los resultados obtenidos diferían con fre-
dos espurios, que no son raros en este campo, aunque cuencia entre los cuatro laboratorios y no se alineaban

Biblioteca Médica Virtual


Importancia de la genética en medicina 5
con la historia clínica real de los participantes. Hubo proteger a terceros de posibles daños. Es posible que si
poca coincidencia entre las muestras que se enviaron en la primera entrevista que se tiene con el paciente se
duplicadas y se encontraron varios ejemplos en que las discute esta problemática se eviten un sinnúmero de
compañías hacían afirmaciones inadecuadas sobre el uso problemas.
de las pruebas e incluían en su publicidad propaganda Resultados inesperados. En un estudio hecho con
con afirmaciones no validadas, hechas sólo con el propó- otro propósito puede sugerir la existencia de no paterni-
sito aparente de vender los productos. El documento dad o que un hijo sea adoptado y debe decidirse de ante-
(GAO-10-847T) que contiene en detalle lo anterior, se mano a quién se le va a informar. Se puede averiguar si
puede obtener de manera gratuita de la página web de el padre o la madre es quien está transmitiendo la enfer-
esta oficina. medad y ello puede llevar a problemas en la pareja y, por
A continuación se presenta de forma abreviada, las último debe discutirse con los enfermos cuál es la postu-
recomendaciones recientes que hizo la Asociación ra del médico con relación a informar a terceros, como
Americana de Genética Humana sobre el particular, que compañías de seguros, empleadores potenciales y otros
tiene tres puntos principales: grupos.
Riesgos para familiares cercanos. Qué hacer cuando
• Transparencia. Con el objeto de promover la transparen- los resultados del paciente sugieren la posibilidad de que
cia y lograr que los proveedores y consumidores hagan algún miembro de su familia inmediata pueda estar afec-
decisiones informadas sobe la realización de DTC, las tado y el paciente no quiere que se les informe.
compañías deben proporcionar toda la información rele- Aceptando que la confidencialidad es un deber del médi-
vante de una manera fácil de entender. Esto incluye los co, también lo es la protección de terceros y surge un
datos relativos a la sensibilidad, especificidad y valor pre- dilema. Esto no es común, pero cuando ocurre se piensa
dictivo de las diferentes pruebas. También se deben pre- que pesa más el proteger a terceros, que respetar la con-
sentar las pruebas científicas en que se basan tanto los fidencialidad si concurre lo siguiente: a) se agotan todos
supuestos beneficios como las limitaciones de cada prue- los esfuerzos para convencer al paciente que debe pro-
ba. El proveedor debe hacer explícita su política sobre la porcionarse la información relevante a la familia; b) hay
privacidad de la información. alta probabilidad de daño para los familiares, incluyendo
• Educación a los proveedores. Los proveedores de las futuros hijos y que la información sería útil para evitar el
pruebas genéticas deben ser educados por organizacio- daño; c) el daño por evitar es grave; y d) sólo se planea
nes profesionales para asegurarse que comprenden los dar información directamente relevante a la salud de los
conceptos de validez analítica y validez clínica de las familiares. Ejemplos de familiares a quienes se le debe
pruebas, que les permita aconsejar a los usuarios sobre informar son hermanos de personas con enfermedades
los supuestos beneficios y limitaciones de las pruebas. autosómicas dominantes, con padecimientos ligados al
• Vigilancia de la calidad de las pruebas y los laborato- cromosoma X y aquellas en que la sintomatología incre-
rios. El gobierno federal debe certificar la calidad de menta en generaciones sucesivas como la distrofia mio-
los proveedores de estos servicios, para asegurar que tónica o el síndrome del cromosoma X frágil.
los posibles beneficios sean ciertos, además de estable- Información al cónyuge. Debe tenerse presente que
cer mecanismos de regulación permanentes. algunas enfermedades genéticas afectan de manera con-
siderable la vida del cónyuge, aunque el o ella no la
Estas recomendaciones parecen aceptables, pero es padezcan. Un buen ejemplo sería una historia familiar
importante agregar que otro punto en contra de la prác- positiva para la enfermedad de Huntington, en que si el
tica de las DTC, ejercidas con poco rigor científico, es sujeto a riesgo desarrolla la enfermedad, no sólo tiene
que si no se obtienen los resultados deseados, en el caso 50% de riesgo de transmitirla a sus hijos, sino también, a
de la nutrigenética por ejemplo, no sólo se desprestigian partir del inicio del cuadro clínico, por lo general al ini-
las pruebas realizadas, sino también las demás que en cio del quinto decenio, el cónyuge sano deberá dedicar
realidad pueden ser valiosas en el cuidado de la salud. El alrededor de 10 años a cuidar de cerca al enfermo, quien
manual moderno Fotocopiar sin autorización es un delito.

punto es disminuir el énfasis de lo comercial y perseguir con rapidez estará incapacitado para desarrollar cual-
la buena ciencia. quier tarea y después morir.
Por último, es necesario pensar que en poco tiempo
Confidencialidad habrá grandes bancos de datos con información genética
de numerosas personas y debe garantizarse la confiden-
Es un acuerdo implícito entre el médico y paciente en el cialidad. Debe decidirse quién puede tener acceso a esta
que el médico se compromete a no revelar la informa- información y en qué condiciones. No es difícil que las
ción del enfermo sin su permiso. Esto puede complicar- compañías de seguros, escuelas, gobierno y patrones
se, en particular en el campo de la genética médica, si al potenciales quieran acceso a esta información, lo que sin
realizar algún estudio surgen datos que fuera pertinente duda llevaría a una forma de discriminación genética que
revelar a: 1) el mismo paciente ante resultados inespera- es necesario evitar.
dos no relacionados con el motivo de la consulta; 2)
familiares cercanos porque surge la posibilidad de que Farmacogenómica
ellos puedan transmitir alguna enfermedad genética a su
© Editorial El

descendencia; y 3) a terceras personas que pudieran La variabilidad en la respuesta a medicamentos no sólo


verse afectadas por la patología encontrada en el pacien- es de origen genético, sino que depende, entre otros, de
te. El asunto no es sencillo, ya que el médico tiene como factores como edad, sexo, estado funcional hepático y
obligación, además de conservar el secreto profesional, el renal, así como tipo y gravedad de la enfermedad. Se

Biblioteca Médica Virtual


6 Genética clínica

buscan en la actualidad diferencias heredadas entre indi- tar fármacos para ser utilizados por sujetos con determi-
viduos que permitan predecir la respuesta a sus medica- nado perfil genético.
mentos, tanto en términos de eficiencia como de toxicidad. Un segundo ejemplo de enzimas que metabolizan
La meta de llegar a una medicina del todo personalizada varios fármacos, son los de la familia P450. Estas enzimas
está aún lejana, pero ya es posible individualizar algunos oxidantes se producen en el hígado e inactivan diversos
tratamientos farmacológicos, con base en datos genómi- productos químicos. De los 57 genes de esta familia
cos, para evitar aquellos mortales o inútiles en un indivi- identificados en humanos, hay dos muy importantes en
duo en particular, como en pacientes con leucemia aguda el manejo de medicamentos: uno es el que codifica para
que reciben 6-mercaptopurina. la enzima CYP3A4 que está involucrada con el metabo-
La importancia de los factores hereditarios en la res- lismo de alrededor de la mitad de los medicamentos que
puesta al uso de fármacos se identificó desde mediados recetan los médicos; el otro gen es de la enzima
del siglo pasado. En esa época se identificaron casos de CYP2D6, que metaboliza la cuarta parte de los fármacos
apnea prolongada después de administrar un relajante recetados. Las variantes de estos genes determinan el
muscular, la succinilcolina, utilizada de manera sistemá- grado de actividad enzimática, clasificando a las personas
tica para entubar a los enfermos quirúrgicos. Este rela- como con capacidad enzimática pobre, normal y elevada.
jante es metabolizado por lo común por la seudocolines- Dependiendo de la etnia, hasta 17% de la población
terasa sérica y cuando existe el estado homocigoto para puede tener variantes que afectan la velocidad metabóli-
la variante denominada atípica, el medicamento puede ca y por consiguiente hacer variar las concentraciones
persistir durante horas en la circulación, lo que lleva a circulantes de varios antihipertensivos, antiarrítmicos,
prolongadas apneas. También es historia vieja la ocurren- antidepresivos, neurolépticos y de otros fármacos como
cia de crisis hemolíticas consecutivas a la administración la codeína.
de un antipalúdico, la primaquina en sujetos con defi- Es evidente que el desarrollo tecnológico permitirá
ciencia de la glucosa-6-fosfato deshidrogenasa eritrocíti- estudios genotípicos en posibles usuarios de medicamen-
ca, la cual es común en la cuenca del Mediterráneo y el tos. Ello hará posible establecer la dosis óptima para cada
África ecuatorial. Esta deficiencia se describió desde el persona, lo cual tendrá un impacto positivo en la calidad
punto de vista clínico primero en la zona del Mediterrá- de vida de los enfermos.
neo y se denominó favismo, porque las crisis hemolíticas
ocurrían después de la ingestión de habas y siglos des- Terapia génica
pués se descubrió la deficiencia enzimática en soldados
negros durante la Guerra de Corea que presentaban cri- Es la manipulación del DNA de células vivas con el fin
sis hemolíticas al consumir primaquina. Se comprobó de curar o mejorar enfermedades. Se puede realizar en
después que el favismo se debía a la misma alteración, células somáticas o células germinales. En el primer caso,
aunque más acentuada. Un último ejemplo es la neuro- las complicaciones que puedan surgir no afectan más
patía periférica inducida por la isoniazida, utilizada en el que al sujeto en que se realizó el procedimiento, pero en
tratamiento de la tuberculosis. Ella se debe a diferencias el caso de las células germinales, se podría afectar a una
hereditarias en la capacidad de metabolizar (acetilar) a la o más generaciones de individuos, lo cual ha conducido
isoniazida, y entre más lento ocurre el fenómeno, mayor al consenso de que no se utilice más que en células somá-
la posibilidad de que se presente la neuropatía. Éstas y ticas hasta adquirir mucha más experiencia.
otras observaciones constituyeron el campo de la farma- El procedimiento consiste en introducir DNA purifi-
cogenética dedicado al estudio de variaciones (polimor- cado al paciente para restablecer la función de algún gen
fismos) de los genes encargados de codificar enzimas anormal. Un ejemplo es el de la hemofilia y otros son los
necesarias para el metabolismo de ciertos fármacos. intentos de destruir células cuyo crecimiento está fuera
La farmacogenómica, por otra parte, difiere de la far- de control como el cáncer. El gen terapéutico se introdu-
macogenética, ya que el nuevo campo trata de estudiar ce a las células deseadas mediante algún vector (por lo
a todos los genes involucrados en el metabolismo de un general un virus), lo que se puede realizar in vivo o más
moderno Fotocopiar sin autorización es un delito.
fármaco, y no sólo a uno de ellos. Además, analiza la comúnmente en lo que se llama ex vivo. En este caso se
variación genética de receptores de medicamentos en requiere extraer del paciente las células relevantes, para
las células blanco, lo cual puede determinar asimismo exponerlas al agente terapéutico, y después reintroducir-
su eficacia. las al organismo con la esperanza de haber “infectado” un
Hay ejemplos claros de una vía metabólica que tiene número suficiente de células. Este tipo de procedimien-
que ver con el metabolismo de uno o varios grupos de to tiene el potencial no sólo para curar enfermedades,
medicamentos. Uno de ellos son las variantes del gen de sino de “mejorar” algunas características personales, lo
la enzima tiopurina metiltransferasa, que metaboliza a que entra en el campo de la eugenesia. En este caso se
los compuestos que contienen dos azufres. Éstos en cir- suele hablar de ingeniería genética y no de terapia géni-
cunstancias normales no tienen ninguna importancia, ca, e involucra antes que nada la necesidad de realizar
pero los pacientes con el defecto manejan con lentitud juicios de calidad altamente discriminatorios de cuáles
varios fármacos antileucémicos, por ejemplo, mercapto- son las características deseables de nuestra especie.
© Editorial El manual

purina, tioguanina o azatiopurina. Esta lentitud puede Hasta hace poco había 907 proyectos de terapia géni-
llevar a toxicidad en la médula ósea y el hígado con ca aprobados a nivel mundial. En su mayoría son esta-
resultados fatales. De hecho, se recomienda ahora identi- dounidenses (613 de 907 = 60%) seguidos por 248 de los
ficar dichas variantes enzimáticas antes de que los enfer- países europeos (27%). Los 46 restantes (5%) están
mos reciban estos medicamentos y la FDA (Food and repartidos entre 10 países, incluyendo uno de México. Es
Drug Administration) considera la posibilidad de etique- importante hacer énfasis que la terapia génica es un tra-

Biblioteca Médica Virtual


Importancia de la genética en medicina 7
tamiento experimental que, a más de 15 años de haberse UNESCO el 11 de noviembre de 1997. En las palabras de
iniciado, sólo ha mostrado eficacia en niños con inmuno- Federico Mayor, presidente de ese organismo, “el compro-
deficiencia grave combinada conocida más por el acróni- miso moral contraído por los Estados al adoptar dicha
mo SCID del inglés severe combined inmunodeficency. Declaración es un punto de partida: anuncia una toma de
La SCID es una falla poco común del desarrollo del conciencia mundial de la necesidad de una reflexión ética
sistema inmunitario y los afectados mueren en los prime- sobre las ciencias y las tecnologías. Incumbe ahora a los
ros años de vida. Hay un SCID de herencia autosómica Estados dar vida a la Declaración con las medidas que deci-
recesiva por deficiencia de la adenosina deaminasa. La dan adoptar garantizándoles así su perenidad”.
otra se hereda en forma recesiva ligada al cromosoma X El documento resalta que el genoma humano es patri-
y se conoce también como deficiencia de cadenas gama. monio de la humanidad y que su protección tiene por obje-
A la fecha se ha empleado la terapia génica en 18 enfer- to garantizar la integridad de la especie y la dignidad de cada
mos de los que curaron 17 personas, restituyendo sus uno de sus miembros con independencia de sus caracterís-
funciones inmunes por cuando menos cinco años. ticas genéticas. La Declaración se integra por 25 artículos
Lo anterior se consideró como el primer éxito real de que se refieren a: 1) la dignidad humana y el genoma huma-
terapia génica en el hombre, con corrección de la anoma- no; 2) los derechos de las personas; 3) la investigación sobre
lía al insertar el gen terapéutico unido a un retrovirus el genoma humano; 4) las condiciones del ejercicio de la
atenuado que funcionó como vector. El procedimiento actividad científica; 5) solidaridad y cooperación internacio-
se hizo ex vivo “infectando” células troncales de médula nal; 6) el fomento de los principios de la Declaración; y 7)
ósea de los propios pacientes. Por desgracia, tres de los la aplicación de la Declaración.
pacientes más jóvenes, a continuación desarrollaron cua- No se comentan aquí otras declaraciones del comité
dros muy parecidos a la leucemia aguda, que podían arriba citado, por no ser directamente pertinentes al
explicarse por activación de algún encogen producido tema de este capítulo.
por la terapia misma, lo cual produjo una reacción muy
negativa contra la terapia génica. Sin embargo, el autor Aborto electivo
está de acuerdo con quienes piensan que el procedimien-
to debe considerarse como un tratamiento en fase expe- Las opiniones de los genetistas mexicanos sobre diversos
rimental, y que debe trabajarse más en ello por ser un asuntos éticos de la práctica de la medicina han sido ana-
procedimiento capaz de salvar vidas si se logra aprender lizadas con cierto cuidado por Lisker y Carnevale
a evitar sus complicaciones. (2006). El asunto del aborto electivo ante la presencia de
un embarazo cuyo producto tiene un problema genético
o malformación congénita graves es uno de los más dis-
cutidos y por mayor tiempo. Hasta hace poco sólo se
GENÉTICA ÉTICA Y SOCIEDAD podían diagnosticar in utero los trastornos cromosómicos
y pocos trastornos metabólicos, pero la situación está
La principal preocupación de la sociedad ante el progre- cambiando y pronto se podrán identificar la mayoría de
so de la genética, es que no se use de manera adecuada y las enfermedades mendelianas incluyendo algunas relati-
en lugar de ayudar a la gente, la perjudique. Hay temor vamente frecuentes. El aborto inducido es ilegal en la
de que pudiera usarse, por ejemplo, para negar el acceso mayoría de los Estados mexicanos excepto cuando el
a seguros de gastos médicos o de vida, e interferir con la embarazo resulta de una violación o pone en peligro la
adjudicación de empleos, en que lo que cuente ya no sea vida de la madre. En varios Estados se permite el proce-
la capacidad de desempeñarlos bien, sino si la “genética” dimiento cuando el feto tiene una malformación o enfer-
de la persona es adecuada o no para el trabajo. Podría medad genética graves y en el Distrito Federal se permi-
convertirse en una nueva forma de discriminación, basa- te por mera solicitud de la mujer hasta la semana 12 del
da en datos genéticos, que interpretados con ligereza lle- embarazo. La principal razón por la que las mujeres se
varían a muchas injusticias. Por fortuna todo esto se ha realizan un aborto es de tipo socioeconómico y rara vez,
manual moderno Fotocopiar sin autorización es un delito.

discutido de manera abierta y debe servir para evitar su tal vez 1% de las solicitudes obedecen a problemas gené-
ocurrencia. Al autor le parece útil discutir con cierto ticos. Una razón de peso para despenalizar el aborto es
detalle dos puntos: 1) el comité internacional de bioéti- que cuando se hace de manera ilegal conlleva una alta
ca de la UNESCO, que ha producido documentos nor- mortalidad y es problema de salud pública.
mativos internacionales; y 2) el asunto del aborto electi- El aborto electivo debido a la presencia de un proble-
vo, problema ético controvertido cuya discusión en el ma genético o malformación se le conoce en México y
ámbito de la genética médica es común. otros países como aborto eugenésico, apelativo que en la
opinión de autor busca descalificar de entrada al proce-
Comité Internacional de Bioética dimiento, ya que la palabra eugenesia se ha convertido
(CIB) de la UNESCO en un término negativo por los excesos cometidos en la
Alemania nazi en nombre de la eugenesia. Por otro lado
Este comité se creó en 1993 y al principio lo constituyeron la eugenesia tiene dos elementos: ser obligatoria y tratar
alrededor de 50 personas, la mitad de países en desarrollo, de mejorar la composición genética de la especie, que no
incluyendo cuatro de América Latina (Argentina, Chile, se cumplen en el aborto electivo del que se está hablan-
México y Uruguay). Su tarea fue generar un documento
© Editorial El

do, que es voluntario y busca evitar sufrimiento a las


denominado Declaración Universal sobre el Genoma familias y no mejorar la especie. De hecho el nombre
Humano y los Derechos Humanos que tras muchas modi- más apropiado es el de aborto por embriopatía, que des-
ficaciones se aprobó en la 29 Conferencia General de la cribe con exactitud la situación.

Biblioteca Médica Virtual


8 Genética clínica

Es importante recalcar que la decisión de un aborto le


corresponde a la pareja o a la mujer en caso de desacuerdo, BIBLIOGRAFÍA
porque es su cuerpo y carga con la mayor responsabilidad
en el cuidado de los hijos. El genetista sólo debe informar y Beaudet A. ASHG. Presidential address. Making genomic
asegurarse que la información se comprenda. El autor apro- medicine a reality, Am J Hum Gen 1999; 64: 1-13.
vecha para decir que las parejas también tienen el derecho Beadle GW, Tatum E. Genetic control of biochemical reactions
a decidir continuar los embarazos con fetos afectados de in Neurospora. Proc Nat Acad Sci USA 1941; 27: 499-506.
enfermedades genéticas graves si así lo desean, pues para Caspersson T, Zech L. Nobel Symposium 23. Chromosome
algunas, ello es preferible sobre realizar un aborto. Una últi- identification Academic Press, New York & London, 1973.
ma consideración sería el señalar que el autor no conoce a Knudson A. A personal sixty-year tour of genetics and medici-
nadie que esté a favor o “le gusten” los abortos. Se trata de ne 2005. En Chakravarti A y Green E (Editors) Ann Rev
Genomics & Hum Gen 6: 2005; 1-14.
una decisión difícil y siempre dolorosa para los padres, que
Lander E, Linton L, Birrer B y Cols. Initial sequencing and
algunos médicos aceptan como legítima, planteada como el analysis of the human genome. Nature 2001; 409: 860-
mal menor en circunstancias específicas. 921.
Se han realizado numerosa encuestas en México sobre Lisker R, Carnevale A, Villa A. Acceptance of induced abor-
la opinión del aborto inducido de la población general y de tion amongst medical students and physicians in Mexico.
médicos y estudiantes de medicina. En la experiencia de Rev Invest Clin 2006; 58: 305 – 312.
autor, la minoría está de acuerdo con el aborto por mera Lisker R, Carnevale A. Changing opinions of Mexican geneti-
solicitud de la pareja, alrededor de 50% está de acuerdo cists on ethical issues. Arch Med Res 2006; 37: 794-783.
cuando el producto tiene una malformación y la cifra de McKusick V. Mendelian Inheritance in man. J Hopk Press,
aprobación sube a más de 80% cuando la malformación es Baltimore, 2008.
Pauling L, Itano H, Singer S, Wells S. 1949. Sickle cell anae-
grave como la anencefalia. Las características de los médi-
mia, a molecular disease. Science 1949;110: 543-547.
cos tales como sexo, edad, especialidad o experiencia labo- Tjio J, Levan A. The chromosomas number in man. Hereditas
ral no tienen relación en su opinión sobre el aborto y lo 1959; 42: 1-5.
único que influye de manera definitiva es el grado de reli- The Wellcome Trust Case Control Consortium. Genome wide
giosidad, a mayor grado corresponde mayor rechazo del association study of 14,000 cases of seven common disea-
aborto inducido (Lisker et al 2006). ses and 3 000 shared controls. Nature 2007. 477: 661-678.

moderno Fotocopiar sin autorización es un delito.


© Editorial El manual

Biblioteca Médica Virtual


Importancia de la genética en medicina 9
Palabras clave
Proyecto Internacional del Genoma Humano
Medicina genómica
Medicina predictiva
Asociación gen enfermedad
Pruebas genéticas por Internet
Confidencialidad
Farmacogenómica
Terapia génica
Comité Internacional de Bioética
Aborto electivo
manual moderno Fotocopiar sin autorización es un delito.
© Editorial El

Biblioteca Médica Virtual


10 Genética clínica

PREGUNTAS DE AUTOEVALUACIÓN
1. Uno de los objetivos principales del proyecto inter- 6. La confidencialidad entre el paciente y su médicoes:
nacional del genoma humanos fue: A. Un compromiso casi irrelevante.
A. Desarrollar las nuevas tecnologías. B. Nunca debe romperse.
B. Conocer el genoma del maíz y del ratón. C. Hay situaciones en que puede romperse.
C. Averiguar la secuencia de los 3 200 millones de
pares de bases del genoma. D. Nunca debe darse información al cónyuge.
D. Aprender cómo se trata la progerie.

7. La farmacogenómica:
2. La medicina genómica es: A. Propicia la búsqueda de nuevos fármacos.
A. Muy difícil de comprender. B. Busca individualizar la dosis de cada medicamento.
B. Es el uso sistemático del análisis genotípico para
ejercer la medicina. C. Es irrelevante para el bienestar del enfermo.
C. Complicará mucho el quehacer médico. D. No se ocupa de los asuntos de toxicidad.
D. Imposible de realizar en los países pobres.

8. Terapia génica
3. El nuevo paradigma médico: predicción seguida de A. Debe realizarse en células germinales.
tratamiento es: B. Busca averiguar la etiología de las enfermedades.
A. Poco lógico para pensar que se pueda realizar.
B. Es claramente superior al actual paradigma, diag- C. Ha sido útil en el tratamiento del síndrome de
nostico seguido de tratamiento. inmunodeficiencia grave combinada.
C. Es más caro para los enfermos. D. No tiene ningún peligro.
D. Es más caro para la sociedad.

9. El Comité Internacional de Bioética


4. Los estudios de asociación gen-enfermedad
A. Utilizan la distribución de los SNP en grupos de A. Se creó a mediados del siglo XX.
casos y controles como criterio. B. Su primera tarea fue redactar un documento
B. No pueden servir para informar sobre el compo- sobre el genoma humano y los derechos humanos.
nente genético de caracteres normales, como la C. El documento nunca se aprobó.
estatura. D. No tiene ninguna utilidad.
C. Ya identificó el componente genético de la inteli-
gencia.
D. Ha mostrado resultados muy satisfactorios
10. El aborto electivo
A. Plantea una problemática novedosa.
5. La oferta de pruebas genéticas por Internet B. Se aceptó libremente en todo el mundo.
A. Es del decenio 1970-79. C. Es legal en Distrito Federal (México) hasta la
B. Los resultados de distintas compañías no coinci- semana 12 del embarazo por solicitud de la
den con frecuencia. madre.
C. Son muy confiables.
D. No requieren de mayor reglamentación. D. Recibió gran apoyo de las iglesias.

moderno Fotocopiar sin autorización es un delito.

C 10.
B 9.
C 8.
B 7.
C 6.
B 5.
© Editorial El manual

A 4.
B 3.
B 2.
C 1.
Respuestas correctas

Biblioteca Médica Virtual


2
Bases moleculares
de la herencia

Alicia B. Cervantes Peredo, Marisol López López, Diego J. Arenas Aranda, Rosenda I. Peñaloza Espinosa

INTRODUCCIÓN RNA, la información genética fluye de RNA a DNA


durante la conversión de los genomas virales a sus pro-
La vida como se conoce está especificada por los geno- genomas celulares de DNA. Este proceso, conocido
mas. Cada organismo posee un genoma que contiene la como transcripción inversa, es catalizado por la enzi-
información biológica necesaria para construir y mante- ma transcriptasa inversa. Otro flujo posible de la
ner un ejemplo viviente de ese organismo. La mayoría de información genética es de RNA a RNA, proceso que
los genomas están constituidos de ácido desoxirribonu- permite replicar los genomas presentes en la mayoría
cleico (DNA), a excepción de algunos genomas virales de los virus de RNA (figura 2-1).
en los que la información genética está contenida en La transcripción genera diferentes tipos de moléculas
moléculas de ácido ribonucleico (RNA). Este capítulo se de RNA, clasificadas en dos grupos principales: RNA
enfocará al genoma de los organismos eucariontes y en codificantes y RNA no codificantes (ncRNA). Los
particular al humano. mRNA son los únicos que contienen una secuencia que
En las células eucariontes las moléculas individuales puede ser decodificada para generar una molécula poli-
de DNA se encuentran en los cromosomas del núcleo y peptídica. Los ncRNA no sirven como molde para sinte-
de manera adicional cada mitocondria posee varias tizar polipéptidos y están implicados tanto en el proceso
copias de una pequeña molécula de DNA, al igual que de la expresión génica como en su regulación.
los cloroplastos de las células vegetales. Las principales En todos los seres vivos los genomas están constitui-
funciones de un genoma son almacenar la información dos por moléculas de DNA de doble cadena. La cadena
genética, duplicarla para transmitirla de una generación de DNA que tiene la misma secuencia que la molécula
a otra (replicación), permitir su expresión (transcripción de RNA se nombra como cadena sentido, mientras que
y traducción), y su capacidad para sufrir cambios (muta- la que sirve como molde o templado para la transcrip-
ción) que lleven a evolución. Una mutación es un cam- ción es la antisentido. Para que una secuencia de DNA
bio en la secuencia de nucleótidos del genoma que es pueda ser transcrita requiere de una secuencia específica
moderno Fotocopiar sin autorización es un delito.

permanente y heredable. de nucleótidos, llamada promotor. Cuando se transcriben


La información biológica contenida en un genoma ambas cadenas de una molécula de DNA, al transcrito
está codificada en la secuencias de nucleótidos de sus resultante de la cadena sentido se le llama RNA antisen-
moléculas de DNA o RNA y está dividida en unidades tido. Para que una molécula de RNA pueda ser traduci-
discretas denominadas genes. La información contenida da debe tener un marco de lectura abierto (ORF, open
en un gen es leída en posiciones adecuadas que inician reading frame), esto es contener un codón de inicio para
una serie de reacciones bioquímicas que se conocen la síntesis proteica y continuar con codones para al
como expresión génica. Este proceso comprende dos menos 100 aminoácidos, antes de la presencia de un
etapas: transcripción y traducción. En la primera se codón de paro. Dado que no existe puntuación en el
produce una copia de RNA del gen y la segunda resul- código genético toda molécula de DNA puede tener
ta en la síntesis de una cadena polipeptídica cuya potencialmente 6 diferentes marcos de lectura, tres para
secuencia de aminoácidos está determinada, vía códi- cada molécula de RNA, sentido y antisentido. Los
go genético, por la secuencia de nucleótidos del RNA mRNA incluyen en su parte central un ORF y en sus
© Editorial El manual

mensajero (mRNA). El dogma central, propuesto en extremos se encuentran secuencias que no se traducen y
1956 por F. Crick, establece el flujo de la información se conocen como UTR 5’ y 3’ (untranslated regions), y
genética de DNA a DNA, de DNA a RNA, y de RNA que son importantes en la estabilidad y unión de los
a proteínas. En los retrovirus, virus con genomas de mensajeros a los ribosomas para su traducción.

11

Biblioteca Médica Virtual


12 Genética clínica

DNA Replicación DNA

Núcleo
Transcripción
Transcripción
inversa hnRNA
Exón Intrón
5´CAP- AAAAAA-3

Replicación RNA 5´CAP- AAAAAA-3

5´CAP- AAAAAA-3 Citoplasma


mRNA

Traducción
Péptido naciente Proteína

Proteína

Ribosomas
-3´
5´-

Figura 2-1. Dogma Central de Biología Molecular. Flujo de la información genética en una célula eucarionte.

En la mayoría de los eucariontes las regiones codi- ESTRUCTURA DE LOS ÁCIDOS


ficantes, tanto para polipéptidos como para moléculas NUCLEICOS: DNA Y RNA
de ncRNA, están interrumpidas en segmentos deno-
minados exones separados por secuencias de interven-
ción no codificantes llamadas intrones. Ambos tipos Las moléculas de DNA y RNA están formadas por cadenas
de secuencias son transcritas a partir de la secuencia de polinucleótidos unidos por enlaces fosfodiéster y cada
del gen y, a continuación, los transcritos primarios son nucleótido consta de una base nitrogenada, un azúcar y un
procesados para obtener las moléculas de RNA madu- grupo fosfato. Las bases nitrogenadas son derivadas de la
ras o funcionales. Durante la transcripción de los purina, adenina (A) y guanina (G) o de la pirimidina, cito-
genes que codifican para polipéptidos, se sintetizan sina (C), timina (T) y uracilo (U). Las cuatro primeras se
transcritos primarios o RNA premensajeros, también encuentran en el DNA, y la timina es reemplazada por el
llamados RNA heteronucleares (hnRNA). A conti- uracilo en el RNA. Las bases nitrogenadas se unen con una
nuación los transcritos primarios son procesados en el pentosa formando un nucleósido. En el RNA, el azúcar es
núcleo para remover los intrones y empalmar a los la ribosa y en el DNA es la 2’-desoxirribosa. Los átomos de
exones, generando RNA maduros que son transporta- los anillos de las pentosas se designan con números primos
dos al citoplasma en donde los mRNA son traducidos para distinguirlos de los de las bases. La unión entre la base
a polipéptidos. y el azúcar es un enlace N - glucosídico, que se establece

manual moderno Fotocopiar sin autorización es un delito.


De forma clásica un gen había sido visualizado entre el N1 de las pirimidinas o el N9 de las purinas y la
como una unidad hereditaria constituida por una posición 1’ de la pentosa. Los nucleótidos se forman por la
secuencia nucleotídica de DNA o RNA que contiene unión de un grupo fosfato a cada nucleósido en el carbono
la información biológica que codifica para un produc- 5’ del azúcar. Para formar una cadena de polinucleótidos, el
to de RNA o para un polipéptido, e incluye las regio- grupo 5’- fosfato de un nucleótido se une de manera cova-
nes que están implicadas en regular su transcripción y lente formando un enlace fosfodiéster con el grupo 3’-
traducción. Sin embargo, en una región genómica, hidroxilo de la pentosa de otro nucleótido. Por lo tanto, una
pueden ser transcritas ambas cadenas de la molécula cadena de polinucleótidos tendrá un grupo 5’ -fosfato libre
del DNA, lo que implica que haya genes traslapados en un extremo y un grupo 3’- hidroxilo libre en el otro. Esto
con direcciones opuestas de transcripción. Por otra permite determinar la polaridad de cada cadena que puede
parte, debido a que en una misma cadena pueden ir de 5’ → 3’ ó de 3’ → 5’ (figura 2-2).
emplearse varios ORF generando diferentes productos En una célula, por lo general las moléculas de RNA
y al uso alternativo de exones, entre otros mecanis- existen como moléculas de una sola cadena, mientras
mos, los genes humanos por lo común codifican para que la estructura del DNA es una doble hélice compues-
varios productos funcionales, que pueden ser ncRNA, ta por dos cadenas antiparalelas de polinucleótidos. La
© Editorial El

polipéptidos o ambos. Por ello, la definición de gen estructura tridimensional de la doble hélice del DNA fue
debe permanecer como un término flexible y adaptar- propuesta en 1953 por J. Watson y F. Crick. Para ello, se
se a los nuevos datos científicos. basaron en tres evidencias fundamentales:

Biblioteca Médica Virtual


Bases moleculares de la herencia 13
Bases nitrogenadas

Purinas Pirimidinas
O NH2 NH2 O
O
N H CH3 H H H
N N N N
N N
H H
H O N H
N O N H O N
N NH2 N N H
Citosina (C) Timina (T) Uracilo (U)
Guanina (G) Adenina (A)

O O
HOCH2 OH HOCH2 OH

H H H H
H H H H

OH H OH OH
2’ Desoxirribosa Ribosa

Nucleósido Nucleótido
NH2
NH2
H Doble hélice de DNA
H N
N O 5´ 3´

R O P O O N H T A
O N H O
O O CH2
HOCH2 C G Esqueleto
H H azúcar-fosfato
H H T A
H H
H H
C G
OH H
OH H Pares
de bases
T A

Complementariedad entre las bases del DNA C G 0.34 nm


H T A
N O H N 3.4 nm C G
manual moderno Fotocopiar sin autorización es un delito.

N Surco menor
N H N
N N T A

N H O C G

H T A
Guanina Citosina
H C G

Surco mayor
N N H O
T A
N
N H N
N N 2.0 nm
© Editorial El

O
Timina Adenina
Figura 2-2. Componentes estructurales de los ácidos
nucleicos y estructura de la doble hélice del DNA.

Biblioteca Médica Virtual


14 Genética clínica

1. El conocimiento de que la molécula de DNA estaba en GC. Se han reconocido proteínas que interaccio-
compuesta de bases nitrogenadas, azúcares y grupos fos- nan con estructuras de DNA-Z por lo que éste pare-
fatos unidos en una cadena de polinucleótidos. cería ser un mecanismo más de regulación de la
2. Los resultados de los experimentos de E. Chargaff, que expresión génica.
demostraron que en moléculas de DNA de diferentes Las moléculas de RNA forman estructuras de doble
organismos, la cantidad de adenina siempre era igual a la hélice intracadena por apareamiento entre adenina y
de timina y la cantidad de guanina a la de citosina; por lo uracilo, y entre guanina y citosina, generando estructuras
que en una molécula de DNA la cantidad de purinas tallo-asa; estas estructuras se observan en todos los RNA,
siempre es igual a la de pirimidinas (reglas de Chargaff). y son necesarias para que realicen sus funciones. También
3. Las fotografías de difracción de rayos X de fibras de el RNA puede aparearse con el DNA (como ocurre
DNA, realizadas por R. Franklin y M.Wilkins, que mos- durante la transcripción) o con una segunda molécula de
traban que la molécula de DNA estaba organizada en RNA (p. ej., durante la remoción de intrones). En algu-
una estructura helicoidal dextrógira altamente ordenada nas regiones del genoma, como en una pequeña región
con dos periodicidades, una de 0.34 nm y otra de 3.4 nm del DNA mitocondrial (mtDNA) humano o en los teló-
a lo largo de toda la hélice, la cual tenía un diámetro meros de los cromosomas humanos, las moléculas de
constante de 2 nm. DNA pueden formar estructuras de triple hélice, forma-
das por tres cadenas de polinucleótidos. De manera adi-
En la doble hélice de DNA los azúcares y grupos fos- cional pueden encontrarse apareamientos no usuales
fatos quedan en el exterior de la molécula, formando entre las bases nitrogenadas como los cuartetos de gua-
un polianión debido a las cargas negativas de los gru- nina o apareamiento de Hoogsteen presentes en los teló-
pos fosfato, mientras que las bases nitrogenadas, de meros humanos.
naturaleza hidrofóbica quedan en el interior de la
hélice, orientadas paralelas entre sí y perpendiculares
con respecto a un eje central de la molécula del DNA.
Las cadenas se mantienen unidas por puentes de
ESTRUCTURA Y ORGANIZACIÓN DEL
hidrógeno entre las bases nitrogenadas complementa- GENOMA HUMANO
rias: A con T mediante dos puentes de hidrógeno y C
con G formando tres (figura 2-2). De todos los genomas existentes, el nuestro es el que
La estructura descrita antes corresponde a la forma reviste una mayor relevancia e interés en el área de la
B (DNA B), que se encuentra más en las condiciones genética médica. El genoma humano está compuesto
fisiológicas en las células procariontes y eucariontes. por dos genomas: un genoma nuclear complejo que
Sin embargo, el DNA puede adoptar diferentes tipos constituye 99.9995% de la información genética total
de estructuras dextrógiras dependiendo del grado de y un genoma mitocondrial simple que aporta el
hidratación (DNA A, C, D y E). Una forma más, el 0.0005% restante. El genoma nuclear haploide está
DNA Z, es la única con giro hacia la izquierda cada 12 constituido por 3 200 Mb (mega bases) y cada una de
pares de bases y sólo se forma con una secuencia alter- los 13 millones de células que componen el cuerpo
nada de purina y pirimidina, por lo general GC. El humano contiene básicamente la misma secuencia de
DNA Z existe en las células en ciertas regiones ricas nucleótidos (cuadro 2-1).

Cuadro 2-1. Características principales del genoma nuclear y mitocondrial humano


Característica Genoma nuclear Genoma mitocondrial
Tamaño 3.1 Gb 16.6 kb
N° de moléculas de DNA diferentes 23 (células XX) o 24 (células XY) Una molécula DNA circular

manual moderno Fotocopiar sin autorización es un delito.


N° total de moléculas por célula 46 en células diploide, 23 en gametos Varios miles (varía por tipo celular)
Proteínas asociadas Varias clases de proteínas histonas y no Casi libre de proteínas
histonas
N° de genes que codifican para proteínas ~ 21,000 13
N° de genes para ncRNA Desconocido, actualmente ~ 6,000 24
Densidad génica ~ 1/120 kb, no conocido 1/0.45 kb
DNA repetitivo > 50 % del genoma Muy poco
Transcripción Transcripción individual de la mayoría de Transcritos multigénicos se producen de
los genes ambas cadenas, pesada y ligera
Intrones Presentes en la mayoría de los genes Ausentes
Porcentaje de DNA que codifica para ~ 1.1% ~ 66%
proteínas
Uso de codones 61 codones para aminoácidos y 3 codones 60 codones para aminoácidos y 4 codones
de alto UAG, UAA, y UGA de alto UAG, UAA, AGA y AGG
Recombinación Al menos un evento para cada par de No evidente
homólogos durante la meiosis
© Editorial El

Herencia Mendeliana para los genes en el X y Exclusivamente materna


autosomas, paterna para los genes del Y
Gb = 109 pares de bases. kb = 103 pares de bases.

Biblioteca Médica Virtual


Bases moleculares de la herencia 15
Genoma nuclear Los genomas eucariontes contienen DNA con secuen-
cias de bases que se repiten en grado variable y que van
El genoma nuclear humano se encuentra dividido en 24 desde secuencias de copia única, hasta secuencias alta-
moléculas lineales de DNA de doble cadena, la más corta mente repetitivas. Las secuencias de copia única o de
de 50 Mb y la más larga de 263 Mb, cada una contenida bajo número de copias comprenden cerca de 40% del
en un cromosoma diferente. La cromatina es la estructu- genoma humano. El resto, corresponde a secuencias de
ra macromolecular compleja formada por DNA, RNA y DNA moderada o altamente repetitivas. Éstas pueden
proteínas que forma los cromosomas de las células euca- encontrarse repetidas en tándem, agrupadas en una
riontes. La eucromatina tiene una estructura relativa- región particular o dispersas por todo el genoma.
mente descondensada y en ella se encuentran las secuen-
cias transcripcionalmente activas, a diferencia de la hete-
rocromatina que está altamente condensada y puede ser Genes que codifican para polipéptidos
constitutiva o facultativa. El contenido de pares G-C La mayoría de los genes que codifican para cadenas polipep-
promedio del componente eucromático del genoma tídicas se encuentran en las secuencias de copia única. Pocos
nuclear humano es 41%, sin embargo, existe una varia- polipéptidos humanos están codificados por dos o más
ción considerable entre los cromosomas, desde 38% en copias de un gen. Cuando esto ocurre, con frecuencia están
los cromosomas 4 y 13 hasta 49% en el cromosoma 19. codificados por genes que se han duplicado y tienen estruc-
La composición de nucleótidos también varía a lo largo turas y funciones similares por la subsecuente divergencia
de cada cromosoma, lo que se manifiesta con propieda- evolutiva. Algunos se agrupan en regiones cromosómicas
des de tinción diferentes (bandas). Interesantemente, la específicas (clusters), mientras que otros están dispersos en el
proporción del dinucleótido CpG, es decir una citosina genoma constituyendo las familias multigénicas. Éstas pue-
adyacente a una guanina en la misma cadena en direc- den ser de dos tipos: las familias génicas clásicas que mues-
ción 5’→3’, se encuentra en el genoma con una frecuen- tran un alto grado de homología en sus secuencias y funcio-
cia cinco veces menor a la esperada de acuerdo al conte- nes, y las superfamilias génicas que tienen una limitada
nido de G-C. En el DNA de mamíferos, las citosinas de homología en sus secuencias, pero que están de manera fun-
los dinucleótidos CpG están metiladas en el carbono 5, cional relacionadas. Los genes de familias génicas clásicas que
produciendo 5-metil citosina (5mC) en ambas cadenas producen proteínas tanto con similitud funcional como
del DNA. A través de la evolución la desaminación gra- estructural tienden a estar agrupados. Algunos ejemplos son
dual de los residuos de 5mC llevó al cambio de CpG por los agrupamientos génicos de α-globina en el cromosoma
TpG, lo que explica su baja frecuencia. Estos dinucleóti- 16p y de β-globina en 11p, o la familia génica HOX (home-
dos metilados constituyen puntos calientes para muta- obox) que consiste en agrupamientos de cerca de 10 genes en
ciones en el genoma humano. En contraste, ciertas cuatro cromosomas. Las superfamilias de los genes, que están
regiones del genoma contienen una densidad mayor relacionados de manera distante en la evolución, tienden a
de secuencias CpG y reciben el nombre de islas CpG. situarse de manera dispersa en diferentes localizaciones cro-
Éstas por lo general se encuentran en los extremos 5’ mosómicas. Por ejemplo, los genes que codifican para la insu-
(promotor o primer exón) de la mayoría de los genes lina (cromosoma 11p) y su receptor (19p).
de mantenimiento celular, tienen un contenido de G-
C mayor de 50%, abarcan 1 a 2 kb y se encuentran
desmetiladas para permitir la transcripción de los Genes que codifican para moléculas de
genes adyacentes. ncRNA
En el genoma humano nuclear la densidad génica
varía considerablemente en las regiones cromosómicas. Algunos genes nucleares codifican para moléculas madu-
Esto fue inferido a partir de los patrones de bandas de los ras de ncRNA con diversas funciones. Entre ellas están
cromosomas metafásicos. A continuación, la hibridación los que participan en el proceso de la expresión génica
de fracciones purificadas de islas CpG sobre los cromo- que incluye a los RNA ribosomales (rRNA) y a los RNA
manual moderno Fotocopiar sin autorización es un delito.

somas corroboró que la densidad génica mayor se de transferencia (tRNA), implicados en la traducción del
encuentra en las regiones subteloméricas, existiendo cro- mRNA. Existen múltiples genes para rRNA, las molécu-
mosomas ricos en genes como el 19 y el 22, y otros las 28S, 18S y 5.8S de los rRNA citoplásmicos están
pobres como el 4. 18, X y Y. Estos datos fueron a conti- codificados en una sola unidad transcripcional que se
nuación confirmados por el análisis de la secuencia del repite en tándem 250 veces, comprendiendo cinco gru-
genoma humano. pos de aproximadamente 50 repetidos localizados en los
En la actualidad se asume que el genoma humano brazos cortos (p) de todos los cromosomas acrocéntricos
nuclear contiene alrededor de 20 000 genes codifican- humanos 13, 14, 15, 21 y 22. El rRNA 5S citoplásmico
tes para proteínas (1.1% del genoma nuclear) y al está codificado por varios cientos de copias génicas en 3
menos 6 000 genes codificantes para moléculas fun- regiones del brazo largo (q) del cromosoma 1. Los genes
cionales de ncRNA, dando un total de 26 000 genes. para los tRNA pertenecen a una gran familia génica dis-
Sin embargo, este número debe ser tomado de mane- persa que comprende más de 49 subfamilias diferentes,
ra provisional. Es interesante señalar que aunque la cada una con varios miembros que codifican para las
porción traducida del genoma es muy pequeña, una diferentes especies de tRNA (cuadro 2-2).
parte importante de él se transcribe, ésta incluye a los Los ncRNA incluyen a los RNA pequeños nucleares
© Editorial El

intrones de los genes que codifican para proteínas, (snRNA) (small nuclear) implicados en especial en el
(alrededor de 26% del genoma) y muchas otras proceso de remoción de intrones, así como a un gran
secuencias cuya función aún se desconoce. número de microRNA (miRNA) y RNA pequeños

Biblioteca Médica Virtual


16 Genética clínica

Cuadro 2-2. Tipos de RNA no codificante (ncRNA) humano y sus funciones


Principales tipos implicados en la expresión génica
Clase Ejemplos Funciones
RNA ribosomal (rRNA) 12S y 16S rRNA Componentes en ribosomas de mitocondrias
~120 a 5 000 nt 28S, 5.8S, 18S y 5S rRNA Componentes en ribosomas del citoplasma
RNA transferencia (tRNA) 22 tipos tRNA mitocondriales Unión a los codones del mRNA mitocondrial
~70 a 80 nt 49 tipos tRNA citoplásmicos Unión a los codones del mRNA citoplásmico
RNA pequeño nuclear (snRNA) Muchos, incluyendo
~60 a 360 nt U1, U2, U4, U5 y U6 snRNA Componentes principales del complejo removedor de
intrones y empalmador de exones
U5, U4atac, U6atac,U11 y U12 snRNA Componentes menores del complejo removedor de
intrones y empalmador de exones
U7 snRNA Terminación transcripción mRNA histonas.
RNA pequeño nucleolar (snoRNA) Más de 100 tipos diferentes
~60 a 300 nt 80 snoRNA con caja C/D Metilación sitio específica de 2’ OH de rRNA
15 snoRNA con caja H/ACA Modificación específica de rRNA por formación de
pseudouridina
U3 y U8 snoRNA Procesamiento de rRNA
Muchos más Implicados en regulación de expresión, incluyendo RNAi
Otras clases de ncRNA
No codificantes pequeños < 200nt
Clase Ejemplos Funciones
MicroRNA (miRNA) ~22 nt ~ 1 000 tipos Regulación expresión, RNAi
Piwi RNA (piRNA) ~ 24 a 31 nt > 15 000 Defensa contra transposones en línea germinal
principalmente
RNA pequeños de cuerpos de ~ 25 tipos Maduración de ciertas clases de snRNA en cuerpos de
Cajal (scaRNA) Cajal del núcleo
RNA pequeño interferente (siRNA) Endógenos >10 000 Derivados de pseudogenes y repetidos invertidos,
~ 21 a 22 nt regulación de la expresión génica
No codificantes pequeños < 200nt
Relacionados con inactivación del cromosoma X
XIST RNA (19.3 kb) Inicio inactivación cromosoma X
TSIX RNA (37.0 kb) Transcrito antisentido, apagado de XIST en X activo
Relacionados con el establecimiento de impronta
H19 RNA (2.3 kb) Apagado alelo materno de IGF2
KCNQOT1 (59.5 kb) Apagado de varios alelos paternos
RNA antisentido desconocido > 1500
HOTAIR (2.2 kb) Apagado de genes HOX
Antisentido MSX1 Regulación de MSX1
Misceláneos ~ 80 a 500 nt
RNA telomerasa (TERC) Componente de la telomerasa, templado para la síntesis
de DNA telomérico
7SK RNA Regulador negativo de la elongación por RNA polimerasa II
7SL RNA Componente de la partícula de reconocimiento (SRP)
para el transporte de proteínas de secreción en retículo
endoplasmático

manual moderno Fotocopiar sin autorización es un delito.


RNasa P Procesamiento de los tRNA nucleares
SRA1 RNA Co-activador de algunos receptores de esteroides
TTY2 RNA Familia transcritos específica de testículo
nt= nucleótido.

nucleolares (snoRNA) (muchos, sino la mayoría de los telomerasa, la enzima necesaria para la síntesis de DNA
cuales aún no han sido identificados), así como también en los telómeros. Los ncRNA, incluyendo muchos deri-
otras clases de RNA pequeños reguladores (< 200 nt), y vados de intrones, parece que componen una plataforma
decenas de miles de trascritos largos (> 200nt), incluyen- oculta de señales internas que controlan en varios nive-
do patrones complejos de transcritos sentido y antisenti- les la expresión génica desde la arquitectura de la croma-
do superpuestos, de los cuales se ignora su función en la tina a la memoria epigenética (Anexo regulación epige-
mayoría de los casos y a los que se les conoce como TUF nética y por RNAi).
(transcript unknown function). Otros genes codifican
ncRNA con funciones diferentes, como el RNA 7SL que
© Editorial El

Seudogenes y genes procesados


es un componente de la partícula de reconocimiento del
péptido señal requerido para la exportación de proteínas Existen secuencias en el genoma que tienen una gran
y TERC que codifica para el componente de RNA de la similitud con genes conocidos, pero que no son funcio-

Biblioteca Médica Virtual


Bases moleculares de la herencia 17
nales y que se denominan pseudogenes. Estas secuencias de 5 a 171 pb. La mayor parte del DNA satélite se loca-
son producto de eventos de duplicación génica, las cua- liza en los centrómeros de todos los cromosomas (hete-
les adquieren mutaciones en regiones codificantes o rocromatina constitutiva pericentromérica), por lo que
regulatorias que las vuelven defectuosas, lo cual resulta se ha sugerido que tenga una función estructural. Otros
en un pseudogén convencional o no procesado. Por tipos de secuencias de DNA satélite no pueden ser iden-
ejemplo, existe un pseudogén para α-globina y tres de β- tificados mediante centrifugación en gradientes de den-
globina en sus respectivos agrupamientos. En otros casos sidad. Se identificaron al inicio por la digestión de DNA
existen varios seudogenes localizados en cromosomas genómico con una endonucleasa de restricción que típi-
diferentes, como para el gen NF1 (neurofibromatosis camente tiene un sitio de reconocimiento en la unidad
tipo 1) del que hay al menos 11 seudogenes distribuidos de repetición básica de 171pb presente en todos los cen-
en cromosomas diferentes, incluso algunos de ellos loca- trómeros humanos. Estas secuencias alfa satélite o DNA
lizados en regiones pericentroméricas. Otras copias géni- alfoide constituyen la mayor parte de la heterocromati-
cas defectuosas pueden tener sólo algunas porciones de na centromérica, existiendo por divergencia evolutiva
las secuencias génicas, algunas veces un solo exón, y se secuencias específicas de cada cromosoma.
describen como fragmentos génicos. De manera alterna- El DNA minisatélite comprende dos familias de
tiva, existen seudogenes procesados, los cuales quizá se secuencias cortas de DNA: la telomérica y la hipervaria-
originaron por la inserción en el genoma de secuencias ble. Las secuencias repetidas teloméricas son necesarias
de DNA complementario o copia (cDNA) producidas para mantener la integridad de los cromosomas durante
por la acción de la transcriptasa inversa sobre un mRNA la replicación y son añadidas por una enzima especializa-
transcrito a partir de un gen funcional (retrotransposi- da denominada telomerasa. Además actúan protegiendo
ción). Al provenir de moléculas de cDNA los seudogenes de degradación y pérdida de material genético a los
procesados carecen de intrones. Debido a que la reinser- extremos de los cromosomas y son responsables de la
ción de los seudogenes procesados ocurre en posiciones función de los telómeros (Anexo Telómero). El DNA
al azar, rara vez se encuentran dentro de agrupamientos minisatélite hipervariable se localiza por lo común en
de familias multigénicas por lo que por lo general están regiones subteloméricas, aunque también se halla en
dispersos en el genoma. Es interesante señalar que en otras regiones del genoma incluidos intrones, y es alta-
algunos casos este proceso ha generado genes procesa- mente polimórfico por lo que utiliza para la identifica-
dos o retrogenes que mantienen un ORF funcional y que ción de individuos (huellas de DNA) (Anexo Variación
pueden expresarse por poseer promotores internos o genética humana). Las secuencias de DNA microsatélite
quedar bajo el control de secuencias en la zona de inser- se localizan a lo largo de todo el genoma, también son
ción. Un ejemplo de retrogén es el gen SRY del cromo- altamente polimórficas y se utilizan como marcadores
soma Y responsable de la diferenciación testicular en genéticos en estudios de evolución, ligamiento génico y
mamíferos, cuyo homólogo en el cromosoma X, SOX3, huellas de DNA (anexo variabilidad humana). Algunos
si presenta intrones. Es importante señalar que aunque se encuentran en regiones intragénicas y sus variaciones
los seudogenes y los seudogenes procesados no tengan un se asocian con la etiopatogenia de un grupo de padeci-
producto proteico funcional, una proporción significati- mientos conocidos como enfermedades por amplifica-
va de ellos se transcribe, y aun cuando esto no es sufi- ción de microsatélites (Anexo Mutación y enfermedad).
ciente para indicar si tienen una función biológica signi- DNA no codificante repetido disperso. En el genoma
ficativa, los datos actuales muestran que esta transcrip- humano también se encuentran secuencias de DNA no
ción se realiza en un nivel bajo y con un patrón específi- codificante altamente repetido que se encuentran dispersas
co de tejido o línea celular, lo cual podría generar ncRNA en todo el genoma y que se denominan repetidos dispersos
funcionales. o interespaciados. La mayor parte de este tipo de repetidos
han derivado de transposones (secuencias de DNA móviles
DNA no codificante altamente repetido que pueden migrar a diferentes regiones del genoma) y se
ha reconocido que más de 40% del genoma humano perte-
manual moderno Fotocopiar sin autorización es un delito.

El genoma humano nuclear contiene una gran cantidad nece a esta clase. Con base en la forma de transposición se
de familias de secuencias altamente repetidas. Al igual pueden clasificar en dos grupos: retrotransposones y trans-
que las familias multigénicas, el DNA repetitivo no codi- posones de DNA (cuadro 2-3).
ficante muestra dos tipos principales de organización: El mecanismo de transposición en los retrotransposo-
repetido en tándem y repetido disperso (cuadro 2-3). nes o retroposones es similar al que genera seudogenes
DNA no codificante repetido en tándem. Las secuen- procesados y retrogenes: una trasncriptasa inversa con-
cias de DNA repetidas en tándem consisten en bloques vierte al transcrito de RNA del retrotransposón en un
de DNA no codificante que tienen una localización pre- cDNA que se integra en diferentes posiciones del DNA
cisa en el genoma. Este tipo de secuencias se pueden genómico, generando nuevas copias del mismo. Tres cla-
subdividir en tres clases de acuerdo a su extensión y al ses de transposones de humanos utilizan este mecanismo
tamaño de la unidad de repetición: DNA satélite, mini- de copia y pegado: los elementos nucleares interespacia-
satélite y microsatélite (cuadro 2-3). dos largos, LINE (Long Interspersed Nuclear Elements),
Cuando se fracciona el DNA por sedimentación en un los elementos nucleares interespaciados cortos, SINE
gradiente de densidad, las secuencias altamente repetidas (Short Interspersed Nuclear Elements), y los elementos
© Editorial El

en tándem forman bandas satélites con respecto a los tipo retrovirus que contienen repetidos terminales lar-
picos principales del DNA genómico. Este DNA se gos, retrotransposones LTR (Long Terminal Repeats). Los
conoce como DNA satélite y está formado por series lar- retrotransposones pueden ser autónomos o no autóno-
gas de cientos de kilobases (kb) de repetidos en tándem mos. Por otro lado, los transposones de DNA migran de

Biblioteca Médica Virtual


18 Genética clínica

Cuadro 2-3. Principales clases de DNA humano altamente repetido


Secuencias repetidas en tándem (~7% del genoma nuclear humano)
Clase Tamaño Tamaño de la Localización cromosómica
(% del genoma) unidad repetida
DNA satélite Cientos de kb (6.5%) 5 a 171 bp Asociado con heterocromatina constitutiva
α (DNA alfoide) 171 bp Heterocromatina centromérica de todos los cromosomas
β (familia Sau3A) 68 bp Heterocromatina centromérica del 1, 9, 13, 14, 15, 21, 22, Y
Satélite 1 25 a 48 bp (rico A a T) Heterocromatina centromérica de la mayoría de los cromoso
mas y otras regiones heterocromáticas
Satélite 2 Formas divergentes La mayoría, posiblemente todos los cromosomas
de ATTCC/GGAAT
Satélite 3 ATTCC/GGAAT Brazos p acrocéntricos y heterocromatina en 1q, 9q y Yq12
DYZ19 125 pb ~ 400 kb en Yq11
DYZ2 Rico en A a T Yq12, periodicidad mayor de ~ 2470 bp
DNA minisatélite 0.1 a 20 kb En o cerca de todos los telómeros
Telomérico TTAGGG Todos los telómeros
Hipervariable 9 a 64 bp Todos los cromosomas, regiones eucromáticas, y
notablemente en regiones subteloméricas
DNA microsatélite < 100 bp 1 a 4 bp Ampliamente distribuido a lo largo de todos los cromosomas
Secuencias repetidas dispersas (~45% del genoma nuclear humano)
Clase Tamaño N° de copias en el Localización cromosómica
genoma (%)
LINE 6 a 8 kb ~ 1 000 000 (20%) Preferencialmente en bandas G oscuras, regiones ricas
en A a T
Familia L1 ~ 600 000 (17%)
Familia L2 ~ 370 000
Familia L3 ~ 44 000
SINE 100 a 400 bp ~ 1 750 000 (13%) Preferencialmente en bandas G claras, regiones ricas en
GaC
Familia Alu ~ 1 200 000 (12%)
MIR ~ 450 000
MIR3 ~ 85 000
Transposones LTR 1.5 a 11kb ~ 600 000 (9%) Dispersas en todos los cromosomas
Familias HERV 6 a 11 kb ~ 240 000 (4.6%)
MaLR 1.5 a 3 kb ~ 285 000 (4%)
Transposones DNA 80 bp a 3 kb ~ 330 000 (3%) Dispersas en todos los cromosomas
MER1 (Charlie) ~ 213 000
MER2 (Tigre) ~ 68 000
Otros (ej. marino) ~ 60 000
bp= pares de bases. kb= kilo pares de bases.

manera directa sin necesidad de copiar la secuencia: la pueden promover eventos de recombinación homóloga
secuencia se escinde y se reinserta en otro sitio del geno- no alélica, lo cual lleva a duplicaciones, deleciones o
ma (mecanismo de corte y pegado o conservativo). inversiones que conducen a mutaciones patogénicas, o
El tipo más común de la familia LINE son las secuen- que proveen una ventaja selectiva en la evolución. Estos

manual moderno Fotocopiar sin autorización es un delito.


cias LINE1 o L1. En humanos, esta familia es la única eventos de recombinación anormales pueden ocurrir
que continúa teniendo miembros activos que contienen tanto intra como intercromosomas (Anexo Mutación y
dos ORF. El ORF1 (1kb) codifica para una proteína de enfermedad).
unión a RNA (P40) y el ORF2 (4kb) codifica para una
proteína con un dominio de endonucleasa y otro domi- Genoma mitocondrial
nio de transcriptasa inversa; ambos transcritos provienen
de un promotor interno en el UTR 5’. La familia ALU es El genoma mitocondrial humano está definido por un
la más prominente de las SINE, el nombre de esta fami- solo tipo de molécula de DNA circular cerrada cuya
lia se debe a que fue originalmente identificada median- secuencia completa de nucleótidos fue establecida en
te la enzima de restricción AluI. Estas secuencias se ori- 1981. Tiene 16, 569 bp y 44% de G + C. Las dos cade-
ginaron por un evento de retrotransposición del gen que nas tienen una composición de bases diferente: la cade-
codifica para el RNA 7SL y que retuvo el promotor na pesada (H) es rica en guaninas y la cadena ligera (L)
interno para la RNA polimerasa III. Estas secuencias se en citosinas. A pesar de que el genoma mitocondrial es
transcriben activamente aun cuando carecen de un básicamente de doble cadena existe una pequeña región
marco de lectura abierto. Los miembros de la familia Alu en la cual es de triple hélice. Esto es debido a que un seg-
© Editorial El

están flanqueados por secuencias repetidas directas de 6 mento corto de la cadena pesada es replicado en un
a 18 pb, por lo que se asemejan a los transposones clási- segundo tiempo, dando una estructura conocida como
cos de DNA. Tanto los repetidos Alu como los LINE1 DNA 7S o asa de desplazamiento (asa D). Las células

Biblioteca Médica Virtual


Bases moleculares de la herencia 19
humanas por lo regular contienen miles de copias de la veces más rápido que el genoma nuclear, aun cuando no
molécula de DNA mitocondrial, mtDNA. A pesar de realice recombinación homóloga como un mecanismo
que la molécula de mtDNA es sólo 1/8 000 de un cro- obligatorio.
mosoma, en una célula nucleada humana el genoma Se ha postulado que la alta inestabilidad del mtDNA
mitocondrial constituye 0.5% del DNA total. En ovoci- es resultado de varios factores, entre los que destacan: el
tos maduros existen más de 100 000 copias del DNA alto índice de producción de intermediarios de oxígeno
mitocondrial, por lo que en este caso comprende la ter- reactivo, a partir de la cadena respiratoria, capaces de
cera parte del contenido del DNA celular total. producir daño oxidativo al genoma mitocondrial despro-
Al contrario de lo que ocurre con el genoma nuclear visto de histonas; el hecho de que el genoma mitocon-
humano, 93% del mtDNA corresponde a secuencias con drial se replique más que el nuclear. La mitocondria
productos funcionales. Contiene 37 genes, de ellos, 24 cuenta con mecanismos análogos a los que operan en el
codifican para ncRNA: 22 moléculas de tRNA y dos núcleo para la reparación de las lesiones producidas por
moléculas de rRNA, uno 16S (componente de la subu- exposición a oxidantes o a diversos fármacos. Estos inclu-
nidad grande del ribosoma mitocondrial) y otro 12S yen a todos los sistemas de reparación, incluyendo la
(componente de la subunidad pequeña del ribosoma maquinaría para la recombinación homóloga, sin embar-
mitocondrial). Los 13 genes restantes codifican para 13 go carece de los componentes del sistema de reparación
polipéptidos que forman parte de los complejos mul- por escisión de nucleótidos. La capacidad del genoma
tienzimáticos de la fosforilación oxidativa (sistema mitocondrial para fijar mutaciones rápidamente, aunada
OXPHOS): 7 subunidades del complejo I (NADH des- a su mecanismo de herencia permitió realizar estudios
hidrogenasa), 1 subunidad del complejo III (citocromo evolutivos. El trabajo de Wilson et al., estudiando las
b), 3 subunidades del complejo IV (citocromo oxidasa) variaciones en la secuencia del genoma mitocondrial en
y 2 subunidades del complejo V (ATP sintasa) que son diversos grupos humanos, sugiere fuertemente que el
sintetizadas en los ribosomas mitocondriales. El resto de DNA mitocondrial de todos los grupos humanos moder-
las proteínas mitocondriales, incluyendo la DNA pol γ, nos desciende de una secuencia ancestral única prove-
RNA pol, proteínas ribosomales y de los complejos de niente de una mujer que vivió hace alrededor de 200
fosforilación oxidativa, están codificadas en el genoma 000 años en el centro de África. Aplicando una metáfo-
nuclear y son traducidas en los ribosomas citoplasmáti- ra bíblica, la prensa bautizó a esta teoría como la “Eva
cos para a continuación ser importadas por la mitocon- Africana” (Anexo Variabilidad mtDNA).
dria. En la cadena H del mtDNA se encuentran 28 genes
(2 rRNA, 14 tRNA y 12 polipéptidos) y los nueve res-
tantes en la L. En ambas cadenas, los genes de los tRNA
están distribuidos entre los genes rRNA o codificantes de REPLICACIÓN
proteínas, lo cual es de gran importancia para el procesa-
miento del RNA mitocondrial. El código genético mito- La molécula de DNA debe duplicarse para que al divi-
condrial es usado para descifrar sólo 13 mRNA y difiere dirse la célula cada descendiente reciba la misma infor-
ligeramente del código genético nuclear; es decir, se pier- mación genética; a este mecanismo se le conoce como
de su universalidad en algunos tripletes, por ejemplo, autoduplicación o replicación. Para el inicio de la síntesis
UGA codifica para triptófano, en lugar de ser señal de de DNA, las dos cadenas de una molécula deben ser
paro, como lo es en el código nuclear. separadas. Cada cadena sirve como molde o templado
La única región del genoma mitocondrial que real- para que las DNA polimerasas (DNA pol) sinteticen
mente carece de una secuencia codificante es la región nuevas cadenas de DNA complementarias, utilizando los
del asa D. La replicación de las cadenas pesada y ligera es cuatro deoxinucleósidos trifosfatados (dATP, dCTP,
unidireccional y comienza en orígenes específicos. En el dGTP y dTTP) y a partir de la liberación de pirofosfato
primer caso, el origen es el asa D y hasta que se han sin- obtienen la energía necesaria para formar los enlaces fos-
tetizado alrededor de dos terceras partes de esta cadena, fodiéster de la molécula en crecimiento. Las moléculas
manual moderno Fotocopiar sin autorización es un delito.

queda expuesto el origen de la cadena ligera y puede hijas se forman por una cadena de la molécula original y
comenzar su síntesis. La transcripción de los genes mito- una recién sintetizada. Este mecanismo se denomina
condriales, a diferencia de los nucleares, se inicia en pro- semiconservativo y fue demostrado de forma experi-
motores presentes en el asa D y continúa en direcciones mental por Meselson y Stahl en 1958.
opuestas para las dos cadenas, recorriendo el círculo y La replicación del DNA se inicia en una secuencia
generando transcritos multigénicos. Los RNA maduros específica llamada origen de replicación (oriC en E. coli),
son generados subsecuentemente por el corte de los a partir de la cual procede en forma bidireccional y cons-
transcritos policistrónicos, aprovechando las secuencias tituye un replicón. Debido a la enorme cantidad de
de los tRNA. DNA, en el genoma humano existen múltiples replico-
El mtDNA tiene una tasa de mutación mucho más nes. A partir de cada uno se forma una horquilla en la
alta que el genoma nuclear. Es más susceptible de sufrir cual la replicación prosigue en forma bidireccional y ter-
cambios en su secuencia de nucleótidos y además existen mina donde se encuentra con la horquilla del siguiente
mecanismos que permiten su fijación rápida. Esto último replicón. La replicación se realiza durante la fase S del
parecería ocurrir por un mecanismo en cuello de botella ciclo celular, los replicones en la eucromatina inician
© Editorial El

debido a la reducción en el número de mitocondrias en antes que los replicones en la heterocromatina; los repli-
la célula germinal femenina, 100 a 500 y su posterior cones en o cerca de genes activos inician antes que los
proliferación en el ovocito maduro. Este mecanismo replicones en regiones inactivas. Las secuencias de los
parecería ser el responsable de que fije mutaciones 10 orígenes de replicación en eucariontes no están bien

Biblioteca Médica Virtual


20 Genética clínica

definidas a excepción de los de levaduras denominados quillas de replicación con direcciones opuestas en donde
ARS (por su nombre en inglés autonomously replicating podrán actuar las DNA polimerasas (figura 2-3).
sequences in S. cerevisiae). La distribución en el genoma Las DNA pol catalizan la adición de nuevos nucleóti-
humano de los orígenes de replicación está asociada a loci dos al extremo 3’ OH de la cadena en crecimiento, por
específicos localizados por lo general en genes que desde lo que en ambas cadenas la síntesis siempre procede en
el punto de vista transcripcional activos, codificantes dirección 5’→3’. La síntesis es continua en la cadena de
como los de β-globina, MYC o DNMT1 (DNA methyl- DNA que utiliza como molde a la orientada en la direc-
transferase 1) o no codificantes como los de rRNA. La ción 3’→5’ y se le denomina cadena líder; mientras que
expresión génica permite establecer dominios en la cro- la síntesis es discontinua en la cadena que usa como tem-
matina para que se establezcan las condiciones epigené- plado a la cadena complementaria 5’→3’ y se conoce
ticas necesarias para determinar su empleo como oríge- como cadena rezagada. Como resultado de esto la repli-
nes de replicación. cación es un proceso semidiscontinuo. Los segmentos de
En general, todas las células eucariontes hacen sólo DNA sintetizados de forma progresiva durante la sínte-
una copia precisa de cada uno de sus cromosomas en sis de la cadena rezagada son llamados fragmentos de
cada vuelta del ciclo celular. Esto significa que cada ori- Okazaki, en E. coli éstos abarcan de 2 000 a 3 000 nucle-
gen de replicación debe activarse sólo una vez por ciclo ótidos y en los eucariontes de 100 a 200 nucleótidos
y para ello se ensamblan complejos pre-replicativos en (figura 2-3).
los orígenes de replicación, los cuales sólo podrán ser Existen cerca de 20 tipos diferentes de DNA pol en
activados in situ en la fase S. Estos complejos incluyen un las células de mamíferos, la mayoría utilizan DNA como
heterohexámero formado por las proteínas ORC1-6 molde para sintetizar DNA y pertenecen a 4 familias. La
(origin replication complex 1-6) que se ensambla al final replicación del DNA nuclear requiere de las DNA pol α,
de la fase M y al que detrás se unen las DNA helicasas δ y ε, mientras que el mtDNA es replicado por la DNA
replicativas al final de la fase G1. Este complejo de heli- pol γ, el resto de estas enzimas participa en especial en
casa es un hetero-hexámero formado por seis proteínas procesos de reparación del DNA (cuadro 2-4). La DNA
relacionadas MCM2-7 (minichromosome maintenance 2- pol α es la única que posee la habilidad de iniciar una
7), el cual para poder unirse requiere de otras proteínas nueva cadena de DNA, tanto en la cadena líder como en
como CDT1 (chromatin licensing and DNA replication la rezagada; el resto requiere de una región de doble
factor 1) y CDC6 (cell division cycle 6) que forman parte cadena con un extremo 3’ OH libre. La DNA pol α
de los complejos prerreplicativos de G1. La activación de forma parte del complejo DNA pol α/primasa que con-
MCM2-7 en los orígenes de replicación requiere, entre siste de la subunidad catalítica (DNA polimerasa) y otras
otras, de la cinasa CDC7 (cell division cycle 7) e implica 3 subunidades: la subunidad B, necesaria para el ensam-
el reclutamiento de muchos otros factores a los orígenes blado y dos subunidades pequeñas que confieren la acti-
de replicación. Recién se describieron mutaciones en vidad de primasa (RNA polimerasa). La cadena pequeña
componentes de los complejos prerreplicativos (ORC1, de RNA-DNA (10 nt y 20 a 30 nt, respectivamente)
ORC4, ORC6, CDT1 y CDC6) asociadas con el síndro- producida por el complejo primasa/DNA pol α se deno-
me de Meier-Gorlin (MIM 224690), un tipo de enanis- mina cebador y es necesaria para iniciar la replicación de
mo autosómico recesivo, con rótula ausente o hipoplási- la cadena líder y de cada uno de los fragmentos de
ca y orejas muy pequeñas. La apertura inicial de la doble Okazaki de la cadena rezagada. El complejo DNA pol
hélice del DNA permite el establecimiento de dos hor- α/primasa es precedido por el complejo MCM, y las pro-

DNA ligasa I 5´

FEN1
Síntesis
discontinua

manual moderno Fotocopiar sin autorización es un delito.


RPA Cadena rezagada

RFC/PCNA

Dirección de crecimiento DNA pol α/ RPA


Complejo
primasa
DNA pol δ
MCM2-7
Complejo

Cebador DNA pol ε Cadena líder

5´ 3´
Topoosomerasas I y II RPA RPA PCNA/RFC
Síntesis continua

Figura 2-3. Avance de una horquilla de replicación. Se muestran los complejos proteícos y actividades enzimáticas que actúan en las células
© Editorial El

humanas. El origen de replicación de este replicón se encuentra a la derecha de la figura y a partir de ese punto, cuando el complejo MCM2-
7 es reclutado por los complejos pre-replicativos ORC1-6 y activado, la replicación procede en forma bidireccional, con cada horquilla avan-
zando en dirección opuesta. MCM: Complejo de mantenimiento del minicrosoma (Minichromosome maintenance complex); RPA: Proteína A de
replicación (Replication protein A); RFC: Factor C de replicación (Replication factor C); PCNA: Antígeno nuclear de proliferación celular
(Proliferating cell nuclear antigen); FEN1: Endonucleasa flap 1 (Flap endonuclease-1).

Biblioteca Médica Virtual


Bases moleculares de la herencia 21
Cuadro 2-4. Características de las DNA polimerasas humanas
DNA polimerasa dirigidas por DNA
DNA polimerasa Familia Función en replicación y/o reparación Características
α (alfa) B Inicia la síntesis en los orígenes de replicación y de los fragmentos Forma parte del primosoma
de Okasaky en la cadena retrasada
β (beta) X Síntesis en reparación por escisión de bases Alta fidelidad en la reparación
γ (gamma) A Síntesis y reparación del DNA mitocondrial Actividad exonucleasa 3’ 5’
δ (delta) B Principal polimerasa en la síntesis de la cadena rezagada, múltiples Actividad exonucleasa 3’ 5’
funciones en reparación, incluyendo por escisión de nucleótidos
ε (épsilon) B Síntesis de la cadena líder, múltiples funciones en reparación, Actividad exonucleasa 3’ 5’
incluyendo por escisión de nucleótidos
ζ (zeta) B Síntesis sobre lesión Propensa a error
η (eta) Y Síntesis sobre lesión Libre de error en dímeros TT
θ (teta) A Probable en reparación de enlaces cruzados entre las cadenas Hipermutación somática
del DNA, reparación por escisión de bases, síntesis sobre lesión
ι (iota) Y Síntesis sobre lesión, probable en reparación por escisión de Propensa a error
bases y de bases mal apareadas Se requiere en meiosis
κ (kappa) Y Síntesis sobre lesión, reparación por escisión de nucleótidos Propensa a error
λ (lambda) X Reparación por escisión de base, rupturas de doble cadena y Propensa a error
μ (mu) X recombinación VDJ
ν (nu) A Probable en reparación de enlaces cruzados entre las cadenas Propensa a error
del DNA
REV 1 Y Síntesis sobre lesión Propensa a error
TDT X Recombinación VDJ Transferasa terminal de
deoxinucleótidos
DNA polimerasas dirigidas por RNA (Transcriptasas Reversas)
Retrotranscriptasas de elementos LINE-1 Ocasionalmente convierten mRNA y otros La mayoría se encuentran silenciadas
o de elementos retrovirales endógenos RNA en cDNA, los cuales pueden integrarse
en cualquier sitio del genoma
Telomerasa (TERT) Replica el DNA de los extremos de los Utiliza un templado interno de RNA (TERC)
cromosomas lineales para evitar su
acortamiento
*Recombinación VDJ: rearreglos en genes de inmunoglobulinas.

teínas de unión a cadena sencilla (RPA, replicating prote- do una estructura tipo alerón (flap) en 5’, sobre la cual
ína A) que mantienen las cadenas separadas; formando el actúa la endonucleasa FEN1 (flap endonuclease-1) liberan-
primosoma. do el cebador. La DNA ligasa I forma el enlace fosfodiéster
De manera adicional, el desenrollamiento de la doble entre el extremo 3’- OH recién sintetizado y el 5’-P gene-
hélice es facilitado por la acción de las topoisomerasas. rado por el corte (cuadro 2-5).
Estas enzimas pueden cortar una sola cadena del DNA Existen otras helicasas, que pertenecen a la familia
(topoisomerasas I) o doble cadena (toposisomerasas II) RECQ, que permiten abrir estructuras complejas que se
para liberar la tensión generada y evitar el superenrolla- generan durante la replicación, en especial en la cadena
miento. Asimismo las toposisomerasas pueden aumentar rezagada, como la helicasa BLM (mutada en el síndrome
los giros de la doble hélice para generar superenrolla- de Bloom) (MIM 210900) y la helicasa WRN (mutada
miento. Una vez formados los cebadores, el primosoma en el síndrome de Werner) (MIM 277700), entre otras.
manual moderno Fotocopiar sin autorización es un delito.

es reemplazado por las enzimas que alargan la cadena, en Ésta última también participa en la apertura de los cuar-
la cadena líder actúa la DNA pol ε y en la rezagada la tetos de guanina presentes en los telómeros. Las horqui-
DNA pol δ. Las DNA pol de la familia B, excepto la α y llas de replicación avanzan a lo largo de los genomas line-
ζ, pueden remover nucleótidos del extremo 3’ por lo que ales, por lo general sin ningún impedimento y de mane-
además tienen actividad de exonucleasas 3’ →5’, lo que ra eventual la replicación alcanza el extremo de la molé-
les confiere capacidad de edición para quitar bases mal cula o se encuentra una segunda horquilla de replicación
apareadas y aumentar la fidelidad de la replicación. moviéndose en dirección opuesta. En eucariontes, tam-
La DNA pol ε es una enzima con una alta eficiencia en poco existen secuencias terminadoras homólogas a las de
el proceso de incorporación de nucleótidos, que requiere las bacterias. Es posible que al alcanzar la horquilla posi-
para ello de la interacción con otras dos proteína, PCNA ciones al azar, en que se encuentra con la siguiente, la ter-
(proliferating cell nuclear antigen, por razones históricas) y minación simplemente implique el ligamiento de los
RFC (replication factor C) que forman una abrazadera des- extremos.
lizante para la polimerasa y la anclan a la horquilla de repli- Una consecuencia de que las DNA polimerasas sólo
cación. De manera similar, la DNA pol δ forma también un puedan extender los cebadores en dirección 5’→ 3’ es
© Editorial El

complejo de elongación con PCNA y RFC para continuar que son incapaces de copiar los extremos 5’ de los cro-
la síntesis en la cadena rezagada. Cuando el complejo de mosomas lineales. Este problema es resuelto por la enzi-
elongación encuentra el extremo 5’ de fragmento de ma telomerasa quien extiende la síntesis de la cadena líder.
Okazaki (RNA) la síntesis de la cadena lo desplaza crean- Esta enzima tiene actividad de transcriptasa inversa y está

Biblioteca Médica Virtual


22 Genética clínica

Cuadro 2-5. Funciones requeridas en las horquillas de replicación de E. coli y mamíferos


Función E. coli Mamíferos
Complejos pre-replicativos - ORC1-6
Anclaje de la helicasa/ primasa DnaC CDT1/CDC6
DNA Helicasa DnaB Complejo MCM2-7
Mantenimiento cadena sencilla SSBP RPA
Síntesis del cebador DnaG DNA Pol α/ primasa
Abrazadera deslizante de la polimerasa β PCNA
Ancla de la abrazadera (ATPasa) Complejo γδ RFC
Síntesis DNA Núcleo de la DNA Pol III DNA Pol δ + DNA Pol ε
Dimerización de la holoenzima τ ?
Remoción del cebador DNA pol I FEN1
Unión de fragmentos DNA Ligasa DNA Ligasa 1

formada por dos componentes: uno de naturaleza proteica que si una purina es reemplazada por una pirimidina o
llamado TERT que presenta la actividad de transcriptasa viceversa se genera una transversión.
reversa y otro de RNA denominado TERC, que sirve como Los agentes físicos (rayos ultravioleta, X, gamma,
plantilla para la síntesis de novo del hexanucleótido repeti- entre otros), químicos (agentes alquilantes, oxidantes,
do en la secuencia telomérica. En ausencia de actividad de entre otros) y biológicos (virus, transposones, entre
telomerasa los telómeros se acortan después de cada ciclo otros) son capaces de producir mutaciones. Contra ellos,
de replicación (Anexo Telómero y telomerasa). las células tienen diversos sistemas de protección: las
Es importante recordar que en las células eucariontes el membranas celular y nuclear, la agrupación de genes en
DNA se encuentra en forma de cromatina, por lo que real- cromosomas y sistemas enzimáticos donde los mutáge-
mente la replicación implica la duplicación de esta estruc- nos son destruidos antes de que lesionen al DNA. En
tura durante la fase S del ciclo celular. Los nucleosomas son caso de que éste resulte dañado todavía existen procesos
desplazados hacia una u otra cadena durante el avance de capaces de repararlo de una manera exacta, permitiendo
la horquilla de replicación y rápidamente se incorporan recuperar su estructura original. De forma contraria, si el
histonas recién sintetizadas, las cuales llegan a la cadena de tipo y la cantidad de alteraciones fueran tan graves que
DNA por la acción de chaperonas como CAF1 (chromati- los mecanismos protectores resulten insuficientes se pro-
ne assembly 1) y ASF1 (antisilencing function 1) las cuales duce muerte celular. Los trastornos en el DNA, que no
interactúan con PCNA y permiten la incorporación de los son reparados ni provocan muerte celular, originan una
dímeros de H3 y H4 para el ensamblado de los nuevos mutación directa. Por otra parte, el DNA puede ser repa-
nucleosomas. El ensamblaje de los nuevos nucleosomas rado en forma inexacta, con lo que se establece una
termina con la asociación de dos dímeros de H2A y H2B, mutación indirecta. Es importante señalar que mientras
mediada por NAP1 (nucleosome assembly protein 1), con- algunas mutaciones son deletéreas, otras por el contrario
servándose las modificaciones presentes en los nucleoso- resultan benéficas y permiten que haya variabilidad y
mas de la molécula progenitora por acción de las enzimas selección natural, lo que conduce a cambios evolutivos.
que generan las modificaciones postraduccionales de las Los cambios en la secuencia de nucleótidos pueden
histonas y manteniendo el estado epigenético (Anexos producirse en regiones codificantes y no codificantes de
Fundamentos y aplicaciones de las principales técnicas de los genes y en las regiones intergénicas del genoma. Las
diagnóstico molecular en enfermedades mendelianas). consecuencias de los cambios en la secuencia de nucleó-
tidos serán diferentes dependiendo de dónde ocurran y si
manual moderno Fotocopiar sin autorización es un delito.
afectan o no la función de los genes. En genética médica
MUTACIÓN Y REPARACIÓN por lo general se utiliza el término mutación para definir
los cambios que afectan la función de los genes y alteran
El DNA es una molécula estable que tiene la capacidad el fenotipo o producen enfermedad (Anexo Mutación y
de mantener la información genética. Los trastornos que enfermedad), mientras que se utiliza el término polimor-
se producen por lo general son corregidos a través de fismo para hacer referencia a los cambios heredables en
diferentes mecanismos de reparación; no obstante, pue- la secuencia de nucleótidos que no producen enferme-
den generarse cambios estables en la secuencia de nucle- dad y constituyen parte de la variación normal entre los
ótidos, proceso conocido como mutación. Las mutacio- individuos (Anexo Variación genética humana). Dado
nes se producen por dos mecanismo principales: trastor- que los polimorfismos constituyen cambios estables en el
nos químicos de las bases que llevan a la incorporación genoma, su frecuencia debe ser de al menos 1% en la
de nucleótidos erróneos, o por errores en la replicación y población, esto para confirmar que es parte de la varia-
reparación del DNA que se traducen en la incorporación ción normal y que no se trate de una mutación de novo.
incorrecta de un nucleótido o en pérdida o adición de En la figura 2-4 se muestra el efecto de una mutación
nucleótidos. Cuando se presenta el cambio de un nucle- puntual y de la inserción de un nucleótido en un ORF. Si el
© Editorial El

ótido por otro, mutación puntual, si una purina es reem- cambio generado por una transición cae dentro de la redun-
plazada por otra purina o una pirimidina por otra pirimi- dancia del código genético, este cambio se denomina muta-
dina, este cambio se conoce como transición, mientras ción silenciosa o sinónima y por lo general se considera un

Biblioteca Médica Virtual


Bases moleculares de la herencia 23
A D
Secuencia normal Mutación de sentido equivocado no conservativa
5´... ARG TCT CAA AAG TTT ACG CGT ...3´ 5´... ARG TCT CAA GAG TTT ACG CGT ...3´

3´... TAC AGA GTT TTC AAA TGC GCA ...5´ 3´... TAC AGA GTT CTC AAA TGC GCA ...5´

met ser gln lys phe thr arg met ser gln glu phe thr arg

B E
Mutación silencioso o sinónima Mutación sin sentido
5´... ATG TCT CAA AAA TTT ACG CGT ...3´ 5´... ATG TCT CAA TAG TTT ACG CGT ...3´

3´... TAC AGA GTT TTT AAA TGC GCA ...5´ 3´... TAC AGA GTT ATC AAA TGC GCA ...5´

met ser gln lys phe thr arg met ser gln alto

C Mutación de sentido equivocado F Mutación por cambio en el marco de lectura


conservativa o neutral
5´... ATG TCT CAA AGG TTT ACG CGT ...3´ 5´... ATG TCT CAA CAA ATT TAC GCG ...3´
3´... TAC AGA GTT TCT AAA TGC GCA ...5´ 3´... TAC AGA GTT GTT TAA ATG CGC ...5´
met ser gln arg phe thr arg met ser gln gln ile tyr ala

Figura 2-4. Efecto de las mutaciones puntuales, transiciones y transversiones y de la inserción de un par de nucleótidos en un ORF.

polimorfismo de un solo nucleótido o SNP sinónimo; sin identificado > 130 genes cuyos productos participan en
embargo, este cambio puede afectar la estructura del DNA los diferentes mecanismos de reparación. Éstos pueden
o el mRNA y tener consecuencias en su función. Cuando dividirse en varios tipos de acuerdo al tipo de daño que
una transición o transversión resulta en un codón que deter- reconocen y a la forma en que éste es reparado. La
mina otro aminoácido se le llama mutación de sentido erró- importancia de los mecanismos de reparación se observa
neo y puede ser conservativa o neutra; si un aminoácido es en los graves padecimientos ocasionados por defectos en
reemplazado por otro del mismo tipo, este cambio puede ellos. En el cuadro 2-6 se muestran los principales siste-
corresponder a un SNP no sinónimo. Si el cambio de ami- mas de reparación del genoma humano, el tipo de daño
noácido es por uno completamente diferente que se produ- que reparan y las proteínas que participan en cada uno
jo una mutación de sentido equivocado no conservativa y es de ellos, así como los padecimientos que se producen
mucho más probable que tenga consecuencias en la función cuando se alteran sus funciones.
de la proteína. Se produce una mutación sin sentido, cuan- Los sistemas de reparación pueden actuar de forma
do el cambio origina que un codón codificante se vuelva de directa, es decir corrigiendo la alteración en las bases nitro-
paro, lo cual generará una proteína truncada o la degradación genadas o por escisión del fragmento dañado y resíntesis de
del mRNA. También puede ocurrir lo contrario, que un DNA, reparación por escisión de base (BER) o reparación
codón de alto se vuelva codificante, lo que generará que la por escición de nucleótidos (NER). De manera adicional
síntesis continué hasta el siguiente codón de paro, lo que pro- las roturas de doble cadena (DSB) en la molécula del DNA
manual moderno Fotocopiar sin autorización es un delito.

ducirá proteínas de mayor tamaño, que por lo general se plie- pueden ser reparadas por recombinación homóloga (HR) o
gan mal y se acumulan en las células. La inserción o deleción unión de extremos no homólogos (NHEJ). Cuando la
de nucleótidos en un ORF puede llevar a la adición o pérdi- replicación se realiza con daño en la molécula de DNA o
da de aminoácidos en la proteína si es un número múltiplo durante la recombinación, pueden quedar bases mal apare-
de tres (inserción o deleción en fase) o a que se produzca un adas que pueden ser corregidas por la capacidad de edición
cambio o corrimiento en el marco de lectura generando pro- de las DNA pol o por un mecanismo de escición específico
teínas diferentes y por lo general truncas o ausentes por la para bases mal apareadas (MMR) (figura 2-5). Por otra
generación de codones de alto prematuros (Anexo Mutación parte, algunas lesiones como los dímeros de pirimidina
y enfermedad y Fundamentos y aplicaciones de las principa- cuando no son reparados antes de la replicación, hacen que
les técnicas de diagnóstico molecular en enfermedades men- las DNA pol replicativas detengan la síntesis dejando hue-
delianas). cos en la molécula que son completados por DNA polime-
Los sistemas de reparación son tan complejos como la rasas de síntesis sobre lesión (TLS), por lo general propen-
maquinaría misma de replicación y tienen una participa- sas a error (cuadro 2-4).
ción importante en la sobrevivencia celular. Los sistemas Reparación directa. Este sistema revierte el daño al
© Editorial El

de reparación son capaces de reconocer diferentes distor- DNA, en humanos una enzima específica es capaz de desal-
siones en la molécula de DNA como señales para activar quilar la O6-metil-guanosina de manera directa (cuadro 2-
su acción y cada célula cuenta con varios sistemas capa- 6). En las bacterias y muchos otros organismos, los dímeros
ces de lidiar con el daño. En el genoma humano se han de timina pueden ser removidos en una reacción de fotorre-

Biblioteca Médica Virtual


24 Genética clínica

Cuadro 2-6. Principales sistemas de reparación del DNA en el humano y sus componentes
Sistema de Tipo de daño Componentes Funciones Padecimientos
reparación que repara por alteración en
reparación
Directo Metilación de O6G Metil-O-6- guanosina Eliminación del grupo metilo Cáncer
metil transferasa
Escisión de base Bases alquiladas, 8 DNA glucosidadas Rompimiento del enlace N- Glucosidasa MYH
(BER) oxidadas, Cada una identifica un glucosídico y liberación de base cáncer colon
incorporación de tipo de base alterada dañada
uracilo AP endonucleasa Corte enlace fosfodiéster,
generación de sitios apurínicos y
apirimídicos
DNA pol β Llenado hueco, maquinaria de
replicación
DNA ligasa Forma enlace fosfodiéster
Escisión de Dímeros de XPC/HR23 Reconocimiento daño en Xeroderma pigmentoso,
nucleótidos (NER) pirimidina, lesiones reparación global genoma
monoaductas Complejo UVDDB Reconocimiento daño en reparación
grandes XPE (DDB2) global,ligasa E3 de ubicuitina
DDB1
CSA Reparación acoplada a Síndrome de Cockaine,
transcripción, ligasa E3 de ubicuitina
CSB Reparación acoplada a
transcripción, ATPasa
dependiente de DNA
XPA Verificación de daño, localización Tricotiodistrofia
maquinaria reparación
XPB Helicasa TFIID 3’-5’
XPD Helicasa TFIID 5’-3’
XPF/ERCC1 Endonucleasa 5’
XPG Endonucleasa 3’
DNA pol δ/ε Llenado del hueco, maquinaria de
replicación
DNA ligasa III Forma enlace fosfodiéster
Bases mal Generadas por MSH2/MSH6 Reconocimiento bases mal Carcinoma de colon
apareadas (MMR) errores de apareadas y pequeñas hereditario no polipósico
replicación y MSH2/MSH3 inserciones-deleciones HNPC o síndrome de
recombinación MLH1/ PMS2 Reconocimiento y corte Lynch
MLH3
Maquinaria replicación Llenado del hueco
Recombinación Rupturas de doble ATM Señalización de daño Ataxia telangiectasia
homóloga (HR) cadena (DSB) MRE11/RAD50/NBS1 Producción cadena con extremo Síndrome Nijmegen
3’ libre
BRCA1 Señalización Cáncer mama, ovario,
BRCA2 Dirige RAD51 a la lesión próstata
RAD51 Homólogo a RecA, invasión

manual moderno Fotocopiar sin autorización es un delito.


Maquinaria replicación Llenado de huecos
Unión de extremos Rupturas de doble KU70/KU80 Reconocimiento daño
no homólogos cadena (DSB) Artemisa/DNA-PK Apareamiento
(NHEJ) DNA pol ? Síntesis
DNA ligasa IV Ligación
Reparación de Lesiones diaductas FANC A-M Reconocimiento daño, complejo de Anemia de Fanconi
enlaces cruzados con enlaces múltiples subunidades, ligasa E3
cruzados de ubicuitina Cáncer mama
FANCD2/BRCA2 Efectores reparación. Llevar RAD51
FANCI recombinación homóloga
RAD51
BRCA1 Señalización HR
Maquinaria de Llenado de huecos
replicación
Síntesis sobre Relleno huecos DNA polimerasas de Incorporación de nucléotidos DNA pol η
lesión dejados por DNA síntesis sobre lesión y cometiendo errores, mecanismo Variante de Xeroderma
© Editorial El

pol de replicación maquinaria de replicación altamente mutagénico pigmentoso


ante una lesión

Biblioteca Médica Virtual


Bases moleculares de la herencia 25
Agentes que lesionan al DNA Mutación

Actividad Radiación Radiación ROS Agentes Errores en


Gran metabólica ionizante U.V químicos replicación
cantidad Tolerancia al daño
de daño Síntesis sobrelesión
Dímeros Aductos Desaminación Bases mal
DSB SSB Sitio AP
pirimidina apareadas

Apoptosis Activación
NHEJ HR NER Directa BER puntos de
MMR revisión
Falla en
reparación
GGR TCR SP-BER LP-BER
Trasducción de
señales
Mutación Mecanismos de reparación

Arresto ciclo
Variabilidad celular
Enfermedades selección natural
hereditarias evolución
y cáncer
Apoptosis

Figura 2-5. Agentes que lesionan al DNA, daño que producen y mecanismos de reparación en las células humanas. Si el daño no es repara-
do adecuadamente puede llevar a la muerte celular o a producir mutaciones, las cuales puden resultar en enfernedad o en variabilidad , lo que
permite la selección natural y la evolución. DSB: Cortes de doble cadena (Double-strand breaks); NHEJ: Unión terminal no homóloga (Non-
homologous end joining); HR: Reparación recombinacional homóloga (Homologous recombinational repair); NER: Reparación por escisión de
nucleotide (Nucleotide excision repair); BER: Reparación por escisión de base (Base excision repair); MMR: Reparación de errors de aparea-
miento (Mismatch repair); GGR: Reparación global del genoma (Global genome repair); TCR: Reparación acoplada a la transcripción
(Transcription-coupled repair); SP-BER: Reparación por escisión de bases cortas (Short patch-base excision repair); LP-BER: Reparación por
escisión de bases de parche largo (Long patch-base excision repair).

activación que depende de la luz de onda visible y de una mientras que la TCR está íntimamente ligada a la RNA pol
enzima, la fotoliasa. En mamíferos se han encontrado enzi- II y es altamente específica y eficiente. Cuando la maquina-
mas relacionadas con la fotoliasa, aunque su función es dife- ria de transcripción de la RNA pol II encuentra una lesión se
rente, ya que participan en el control del reloj circadiano. detiene y la polimerasa es desplazada lo cual lleva a la unión
Reparación por escisión de base (BER). Este es el meca- de dos proteínas CSA (Cockayne syndrome A, MIM
nismo de reparación predominante contra las lesiones a 216400) y CSB (Cockayne syndrome B, MIM 133540) a la
bases producidas por hidrólisis, desaminación, radiaciones lesión, esta última perteneciente a la familia de remodelado-
ionizantes, especies reactivas de oxígeno (ROS), agentes res de cromatina SWI/SNF y con actividad de ATPasa esti-
alquilantes y análogos de bases. La eficiencia y especificidad mulada por DNA. Esta actividad parece ser indispensable
de este mecanismo está determinado por la existencia de para el reclutamiento de la maquinaria de reparación. En la
diferentes formas de DNA glucosidasas que remueven dife- GGR el daño es reconocido por XPC (xeroderma pigmento-
rentes tipos de bases modificadas por corte del enlace N-glu- sum C) y la proteína HR23B, con la unión posterior del
cosídico creando un sitio abásico (AP) o una ruptura de complejo D formado por DDB1 y DDB2 (XPE). A conti-
manual moderno Fotocopiar sin autorización es un delito.

cadena sencilla (SSB). Los sitios AP son eliminados por nuación ambas vías comparten la maquinaria de reparación,
acción de la endonucleasa AP (AP1), quien junto con una las actividades de helicasas XPB y XPD que forman parte
fosfodiesterasa rompen el DNA 5’ o 3’ del sitio AP respecti- del TFIIH y la unión de XPA y RPA que reclutan las activi-
vamente. El hueco generado puede ser de un solo nucleóti- dades de endonucleasas, XPG y XPF/ERCC1, lo cual
do (SP-BER, short patch) o de dos o más (LP-BER, long remueve el fragmento dañado, alrededor de 30 nt, el hueco
patch). A continuación el hueco es llenado por una DNA pol será llenado por las DNA pol δ/ε acompañadas de PCNA y
de reparación, la DNA pol β, y por último una DNA ligasa RFC y sellado por la DNA ligasa III.
III o I sella de acuerdo al tamaño, SP o LP respectivamente. Reparación de bases mal apareadas (MMR). Los errores
Reparación por escisión de nucleótidos (NER). Este en la replicación pueden generar apareamientos de bases
mecanismo es muy importante en la reparación del daño erróneos y pequeñas asas por inserciones o deleciones de
producido por la radiación ultravioleta, así como también en nucleótidos. Éstos son reconocidos por HMUTSα, un díme-
la generación de aductos grandes y enlaces cruzados entre las ro formado por las proteínas MSH2 y MSH6, o en
bases. La NER puede dividirse en dos clases, la reparación ocasiones por hMUTSβ formado por MSH2 y MSH3. Las
global del genoma (GGR) y la reparación acoplada a trans- proteínas localizadas en el DNA unen a hMUTLα, dímero
cripción (TCR). Ambos sistemas remueven de manera efi-
© Editorial El

formado por MLH1 y PMS2 con lo que se ensambla el


ciente el daño y utilizan algunos elementos comunes; sin complejo de reparación, que escinde la base mal apareada
embargo, las moléculas que detectan el daño son diferentes. de la cadena recién sintetizada y permite la resíntesis por
La GGR es un proceso al azar que ocurre de forma gradual, una DNA pol.

Biblioteca Médica Virtual


26 Genética clínica

Reparación por recombinación homóloga (HR). Éste tiene actividad de cinasa activando a otras proteínas
es un mecanismo eficiente para reparar las DSB genera- como BRCA1 y TP53. Asimismo, las helicasas de la fami-
das por reacciones bioquímicas complejas, radiaciones lia RECQ también son importantes en la reparación. Un
ionizantes o ROS. Muchas proteínas participan en él y es tipo de daño especial, la presencia de enlaces cruzados
un sistema libre de error que requiere de una región rela- requiere de un grupo de 12 proteínas denominadas
tivamente grande con secuencia homóloga. El primer FANC A-M, que se encuentran mutadas en la anemia de
paso para reparar las DSB por HR es la resección del Fanconi (MIM 227650), además para su reparación se
extremo 5’ para producir un extremo 3’ libre de cadena requiere la maquinaria de NER y de HR.
sencilla. En humanos esto se realiza por el complejo
MRN, formado por MRE11/RAD50/NBS. La proteína
central para realizar la recombinación es RAD51 (homó-
loga a RecA de E. coli), quien forma un nucleofilamento
EXPRESIÓN GÉNICA Y SU REGULACIÓN
capaz de invadir a la otra molécula, posterior a esto hay
síntesis de DNA y formación de uniones de Holliday que La información contenida en el DNA de las células se
deben ser resueltas por resolvasas y ligasas. expresa en dos pasos: transcripción y traducción. Cada
Unión de extremos no homólogos (NHEJ). Éste es un célula de un organismo contiene la misma información
mecanismo alternativo a la HR para reparar las DSB, el cual genética y la forma en que se expresa, determina sus
es propenso a error, por lo que por lo general sólo se emplea características y funciones. La regulación de la expresión
cuando no es posible usar HR, ambos mecanismos compar- génica ocurre en diferentes niveles, desde la estructura
ten proteínas de señalización y localización como BRCA1 y de la cromatina hasta la vida media de los productos fun-
BRCA2. La mayoría de las DSB no generan extremos liga- cionales. En general se consideran tres niveles principales
bles, por lo que estos tienen que ser generados. El proceso de control o regulación de la expresión génica:
se inicia por la unión de proteínas específicas a los extremos
• Control del inicio de la transcripción. Está determinado
rotos, el complejo Ku, un heretodímero formado por
por las secuencias del promotor localizadas corriente
KU70/KU80, que tiene propiedades para formar un puen-
arriba (5’) a una distancia fija del inicio del primer exón
te proteico. Además se requiere la actividad catalítica de la
del gen (nt +1). Requiere de modificaciones en la estruc-
DNA protein cinasa (DNA PK) para acercar los extremos
tura de la cromatina para la entrada de la maquinaria
del DNA a través de su interacción con las proteínas, a con-
transcripcional a la secuencia promotora y de la unión de
tinuación es reclutado otro grupo de proteínas que incluye
proteínas específicas llamadas factores de transcripción
a la DNA ligasa IV/XRCC4, artemisa, PINK y polimerasas
(TF) a sus secuencias blanco en el DNA.
de la familia X como pol λ y pol μ. También parecen nece-
• Control postranscripcional. Implica el procesamiento de
sitarse las proteínas ATM y el complejo MNR así como el
las moléculas de RNA, su transporte y localización, la
recambio de la histona H2A por su variante H2AX, todas
traducción del mRNA, estabilidad y degradación de los
ellas participantes también en el proceso de HR, para que la
RNA, síntesis de proteínas, procesamiento y localización
unión de los extremos no homólogos se realice en forma
de proteínas, estabilidad y degradación de estas últimas.
adecuada.
• Control epigenético. Se refiere a los cambios heredables
Síntesis sobre lesión (TLS). Éste es un mecanismo de
en la expresión génica, que no dependen de alteraciones
tolerancia de daño y altamente mutagénico. La síntesis
en la secuencia del genoma y que están determinados
sobre lesión implica el paso sobre la lesión incorporando
por la estructura de la cromatina. Este tipo de regulación
nucleótidos en la cadena opuesta. Las DNA polimerasas
puede actuar sobre un gen en particular o en regiones
de síntesis sobre lesión son propensas a error y actúan
específicas del genoma, incluso en cromosomas comple-
cuando las polimerasas replicativas se detienen ante daño
tos y ser transitoria o tener una larga duración y transmi-
generado por radiación UV o ionizante y por diferentes
tirse de una generación a otra (anexo Regulación epige-
agentes químicos. Una excepción tal vez la constituye la
nética y por ncRNA).
DNA pol η quien inserta adeninas en posiciones opues-
manual moderno Fotocopiar sin autorización es un delito.
tas a dímeros de timidina generados por luz UV Esta
polimerasa también puede replicar sobre sitios AP y Transcripción y su regulación
lesiones generadas por cisplatino. Las DNA pol de sínte-
sis sobrelesión pertenecen en especial a la familia Y, aun- El RNA es sintetizado por las RNA polimerasas (RNA
que también hay miembros de las familias A y X con esta pol) utilizando DNA como molde o templado y ribonu-
capacidad. En el cuadro 2-4 se muestran las DNA poli- cleósidos trifosfatados como precursores (ATP, CTP,
merasas de síntesis sobre lesión. GTP y UTP). El transcrito primario surge como una
Muchas enfermedades humanas que implican una cadena sencilla en dirección 5’→3’, que se va elongando
hipersensibilidad a agentes que lesionan al DNA, o con por adición de residuos de nucleósido monofosfato al
niveles elevados de daño al DNA celular, no son produc- extremo 3’-OH libre, en forma complementaria a la
to de defectos en los sistemas de reparación al DNA, sino cadena molde de DNA, lo que elimina un grupo pirofos-
de la respuesta celular al DNA dañado. Las células nor- fato de los ribonucleótidos trifosfatados. El extremo 5’
males reaccionan ante el daño al DNA por detención del de la molécula recién sintetizada siempre conserva un
ciclo celular, por diferentes procesos en los puntos de grupo trifosfato. Los transcritos recién sintetizados son
© Editorial El

chequeo, hasta que el daño es reparado, o llevando a la procesados en el núcleo para formar las moléculas de
muerte celular si es irreparable. Parte de esta maquinaria RNA maduras.
está controlada por la proteína ATM (ataxia telangiecta- Existen tres tipos diferentes de RNA pol en eucarion-
sia mutated). Esta proteína es sensora del daño al DNA y tes, con 12 subunidades proteicas en promedio. Para ini-

Biblioteca Médica Virtual


Bases moleculares de la herencia 27
ciar la transcripción se unen a sus promotores mediante Los TF tienen dominios conservados para unirse al
la formación de un complejo basal con TF específicos. En DNA y dominios de activación. Estos últimos son
el cuadro 2-7 se muestran las características de las tres diversos y se activan por diferentes mecanismos que
RNA pol, sus TF basales, así como los tipos de genes que incluyen adición y eliminación de grupos que modifi-
transcribe cada una. Los promotores de los genes que can su estructura como fosforilación, metilación, aceti-
transcriben las RNA pol I y II se ubican corriente arriba
del inicio del gen, mientras que los que transcribe la lación, entre otros, interacción con otros factores for-
RNA pol III pueden estar corriente-arriba o corriente- mando homodímeros, heterodímeros o tetrámeros,
abajo, dentro del gen mismo. Pero todos ellos a una dis- unión a ligandos, localización celular, entre otros. La
tancia fija del nt +1. Los promotores contienen diferen- acción de los TF modifica la expresión génica en los
tes tipos de secuencias conservadas evolutivamente que diferentes tejidos y en las diferentes etapas de la vida
influyen en la eficiencia de la transcripción. En los genes (cuadro 2-8).
humanos, unas de las más frecuentes son las “cajas” TATA En los diferentes tejidos la regulación de la trans-
(TATAAA o sus variantes), localizadas a 25 nt corriente cripción de un gen incluye mecanismos de control por
arriba (-25) del inicio de la transcripción y las ricas en
GC (GGGCGGG), ambas características de los genes de proteínas y ncRNA que seleccionan transcritos alter-
mantenimiento celular. Algunos genes transcritos por la nativos de un mismo gen. El uso de promotores dife-
RNA pol II, tienen además cajas CAAT localizadas a -80 rentes puede resultar en isoformas con distintas pro-
nt, que incrementan la eficiencia del promotor y otros piedades. Con frecuencia se generan transcritos con un
elementos corriente abajo conocidos como DPE (down primer exón diferente que pueden traducirse en un
stream promoter element) en +28 a +32 nt. Los TF que mismo polipéptido si se unen a los mismos exones sub-
forman los complejos basales de transcripción por lo secuentes; sin embargo, los mRNA tendrán estabilidad,
general son ubicuos, un ejemplo es la proteína de unión unión a ribosomas y vidas medias diferentes. Por otra
a la caja TATA (TBP) (TATA binding protein) que forma
parte del TFIID y se une a la región principal de los pro- parte, se pueden generar proteínas diferentes si cambia
motores con dicha caja, para permitir la unión de la RNA el marco de lectura. En otros casos, la presencia de pro-
pol II. El control del inicio de la transcripción incluye motores internos originará productos proteicos más
mecanismos que regulan la incorporación del primer pequeños con el mismo o diferente ORF.
nucleótido por las RNA polimerasas. Por ejemplo, la Durante la elongación y terminación de la transcrip-
RNA pol II necesita la fosforilación del extremo carboxi- ción existen también mecanismos de control, en especial
lo de su subunidad catalítica por el factor TFII H, una por interacción de proteínas específicas y ncRNA con
vez que se ha unido a su promotor para poder iniciar la estructuras secundarias en el transcrito, en el DNA
síntesis, en lo que se conoce como limpieza o abandono
del promotor (figura 2-6). molde o ambos. En el control de la elongación participan
Los niveles de expresión pueden modificarse por la complejos remodeladores de cromatina que facilitan el
participación de TF específicos que regulan en trans desplazamiento de las RNA pol por los nucleosomas y
(codificados por secuencias de DNA que están en molé- proteínas chaperonas de histonas como SSRP1 (structu-
culas diferentes del gen) al interaccionar con elementos re specific recognition protein), también llamada FACT,
reguladores o secuencias específicas en el DNA. Cuando Ésta interactúa específicamente con las histonas
los TF se unen a elementos potenciadores aumentan el H2A/H2B para permitir el desensamblado de los nucle-
nivel de transcripción y ésta se evita cuando se unen a osomas y la elongación de los transcritos.
silenciadores. Existen otro tipo de secuencias de DNA
que funcionan como aislantes o límites para impedir que Procesamiento del RNA y su regulación
los genes adyacentes sean transcritos o por el contrario
silenciados. Potenciadores, silenciadores, elementos de Las modificaciones postranscripcionales a los transcritos
respuesta y aislantes regulan en cis la expresión génica primarios de la RNA pol II, incluyen modificaciones en
(es decir sobre la misma molécula de DNA donde se sus extremos, la remoción de los intrones y empalme de
encuentran) y pueden localizarse incluso a miles de exones, edición, transporte y degradación. En cuanto
pares de nucleótidos de los promotores basales, tanto surge el transcrito primario, se adiciona al extremo 5’ un
manual moderno Fotocopiar sin autorización es un delito.

corriente arriba (5’), como corriente abajo (3’) o en nucleótido, 7-metil-guanosina trifosfato (7’mG), llama-
intrones. Las secuencias de nucleótidos de los elementos do Cap o caperuza que le sirve de protección contra la
reguladores están conservadas evolutivamente, repetidas degradación por exonucleasas 5’→ 3’, facilita la subse-
a lo largo del genoma y son reconocidas por TF con cuente eliminación de intrones y el transporte del núcleo
dominios específicos (figura 2-6). al citoplasma (figura 2-7).

Cuadro 2-7. RNA polimerasas de eucariontes, genes que transcriben, características y sus factores basales
de transcripción
Clase Genes que transcribe Características Factores basales
RNA Pol I rRNA 28S, rRNA 18S, rRNA 5.8S Un sólo transcrito 45S en nucleolo TIF-IA
TIF-IB (TBP)
UBF
RNA Pol II mRNA, snRNA, miRNA, RNA antisentido Transcripción de todos los genes que TFII A-H
codifican proteínas, sus transcritos TFIID (TBP)
© Editorial El

contienen Cap y cola poli(A)


RNA Pol III 5SrRNA, tRNA, U6snRNA, 7SLRNA, Algunos promotores son internos y otros TFIII A-C
7SKRNA, 7SM RNA, siRNA, se localizan corriente arriba. Transcribe un TFIII B (TBP)
retrotransposones Alu número importante de retrotransposones

Biblioteca Médica Virtual


28 Genética clínica

A Potenciador
distal Aislante

Potenciador 5´

Silenciador RF TATA INR DPE Potenciador 3´


RF RF
Elementos Núcleo
+1
promotor
proximales
promotor

TATA +1 DPE
Elementos reguladores 5’ Núcleo del promotor

Unión de TBP TBP


TAFs
a núcleo
promotor TFIID

TFIID
TAFs
TATA

Reclutamiento
TF basales TFIIB RNA pol II
RNA pol II TFIIF TFIIE TFIIH

TFIIF
RNA pol II
TFIIB TFIIE TFIIH
TATA

Complejo basal
transcripción
inactivo TFIIF
RNA pol II

manual moderno Fotocopiar sin autorización es un delito.


TFIIB TFIIH

TATA
TFIIE
Activación RNA P P
P
pol II, liberación P P
promotor e inicio P
transcripción TFIID RNA pol II

TATA
Cap

Figura 2-6. A. Elementos reguladores de la transcripción en eucariontes. Contiene distintos elementos potenciadores intercalados con
silenciadores y elementos aislantes, localizados a 25 kb en promedio, corriente arriba o abajo del núcleo del promotor que incluye la caja TATA,
© Editorial El

secuencias de inicio de la transcripción (INR) y elementos corriente abajo del promotor (DPE). B. Inicio de la transcripción de genes por
RNA polimerasa II. Se inicia por la unión de sus factores basales a la región promotora: TFII A-H, la proteína TBP que forma parte de TFIID,
y por último la RNA pol II, la cual es activada por fosforilación de su extremo carboxilo por TFIIH, lo que hace que se libere del promotor e ini-
cie la transcripción.

Biblioteca Médica Virtual


Bases moleculares de la herencia 29
Cuadro 2-8. Factores de transcripción, dominios de unión a DNA, mecanismos de activación y funciones
Factor transcripción Dominio unión a DNA Mecanismo activación Funciones
Superfamilia de receptores Dedos de zinc (ZF) Unión a ligando y dimerización Morfogénesis, expresión e
nucleares. Receptores a inhibición múltiples genes en
hormonas esteroides tejidos blanco
SP1 Dedos de Zinc Unión a caja GC (GGGCGG) Activación de genes del
ubicuo desarrollo temprano
Proteínas genes HOX, con Hélice-vuelta hélice, (HTH) Síntesis Encendido y apagado de genes
homeodominios durante desarrollo embrionario
OCT-1, OCT-2, PIT-1 Un homeodominio y un Unión a ligando y dimerización Activación de genes durante el
dominio POU desarrollo embrionario
NF-KB Dominio homólogo a REL, RHD, Transducción de señales, Respuesta inmune, control de
estructuras ß plegadas y fosforilación del inhibidor IKB apoptosis
dominios inmunoglobulinas y su degradación, dimerización
MYOD Hélice-asa-hélice, HLH Cambio de pareja, heterodímeros Diferenciación tejido muscular
FOS/JUN Cierre de leucina, LZ Transducción de señales y Unión a sitios AP1, regulación
heterodimerización ciclo celular, punto de restricción
CRE/ATF1 (Elemento de Cierre de leucina Transducción de señales Activa genes de sistema
respuesta a cAMP) nervioso y esqueleto

Como parte del mecanismo de terminación de la nina (A) del sitio ramificador para formar una estructu-
transcripción, en el extremo 3’ del transcrito primario la ra en asa.
secuencia AAUAAA es reconocida por un complejo pro- b) Corte en el extremo 3’ de la unión intrón-exón, liberan-
teico que corta 15-20 nt corriente abajo para liberarlo do el RNA intrónico como un asa.
del heterodúplex DNA-RNA. Inmediatamente después c) Reunión de los exones (figura 2-8).
es poliadenilado (unión de 200 adeninas aproximada-
mente) por la proteína unidora de poliadenilato (polyA Estas reacciones son mediadas por el complejo removedor
binding protein). Esta modificación es necesaria para per- de intrones y empalmador de exones, de naturaleza ribonu-
mitir el transporte del mRNA al citoplasma, evitar su cleoproteíca, compuesto de cinco tipos de snRNA y más de
degradación y aumentar el reconocimiento por los ribo- 100 proteínas. Los snRNA participantes en la mayoría de
somas para su traducción. Una excepción a esta modifi- los intrones de genes que codifican para polipéptidos son:
cación la constituyen los genes de histonas cuyos mRNA U1, U2, U4, U5 y U6. Este proceso está mediado por la
no son poliadenilados y la terminación implica un corte complementaridad de bases tanto entre las secuencias con-
en el extremo 3’ del transcrito primario dependiente de servadas en la unión exón-intrón y los snRNA, como entre
una estructura secundaria formada al interactuar con el ellos. Un segundo tipo de complejo participa para eliminar
extremo 5’ del snRNA U7. una clase de intrones poco frecuentes donde los dinucleóti-
El mecanismo de eliminacion de intrones y unión de dos conservados GT y AG son reemplazados por las secuen-
exones es dependiente de secuencias conservadas en los cias AT y AC respectivamente. En este caso los snRNA U11
límites exón-intrón. Por lo general el intrón inicia con el y U12 reemplazan las funciones de los snRNA U1 y U2
dinucléotido GT (GU a nivel de RNA) y termina con (figura 2-8 y cuadro 2-9).
AG. Además se requiere de una tercera secuencia intró- A partir de alrededor de 21 000 genes en el humano
nica, el sitio ramificador, localizada a aproximadamente se generan más de 200 000 proteínas diferentes. La
40 nt del extremo 3’ del intrón (figura 2-7). mayoría de nuestros genes presenta uso alternativo de
El mecanismo de eliminación de intrones y reunión exones que produce diferentes RNA maduros y un gran
de exones sigue la siguiente secuencia: número de proteínas con propiedades y funciones dife-
manual moderno Fotocopiar sin autorización es un delito.

a) Rotura en el extremo 5’ del intrón, ataque nucleofílico rentes, de acuerdo al tejido y etapa del desarrollo; este
por el nucleótido G terminal del sitio donador a la ade- proceso está regulado por ncRNA y proteínas.

nt + 1
inicio Sitio de
transcripción ramificación Señal de
ORF
Sitio CURA Sitio AUG UGA poliadenilación
donador aceptor Exones codificantes e intrones
AAUAAA
A AG GU A A
YYYYYYYYY AG
Exón 1 AGU
C G G Exón 2 Último exón

30 a 50 pb
UTR 5´ UTR 3´
© Editorial El

Figura 2-7. Estructura del transcrito primario de un gen codificante. Se muestran las secuencias necesarias para la remoción de los intrones
y empalme de exones, conservadas evolutivamente, y la señal de poliadenilación en el último exón.

Biblioteca Médica Virtual


30 Genética clínica

Cuadro 2-9. Funciones de los snRNA en la generadas al eliminar el intrón pueden ser unidas por la
remoción de intrones ligasa de tRNA en presencia de ATP. La maduración de
Complejo Función los tRNA es regulada por la vía de respuesta a las prote-
snRNP ínas no plegadas generada en el retículo endoplasmático.
U1 Unión al sitio donador, extremo 5’ del intrón Edición del mRNA. Es una forma de procesamiento
GU-AG (>98%) postranscripcional que consiste en la inserción, elimina-
U2 Unión al sitio de ramificación del intrón GU a AG ción o cambio de nucleótidos mediante enzimas. Las
U4, U5, U6 Interacción entre los dos sitios de corte inserciones o eliminaciones en el RNA parecen ser
U5 Interacción entre los dos exones exclusivas de las mitocondrias de protozoarios como los
U5, U6 Centro catalítico tripanosomas. En mamíferos no se han encontrado evi-
U11 Unión al sitio donador en intrones AU a AC dencias de inserciones o eliminaciones, aunque sí se han
(<2%)
observado algunas sustituciones en un número limitado
U12 Unión al sitio de ramificación en intrones AU
a AC de genes. Éstas se producen por desaminasas dependien-
tes de RNA que actúan sobre residuos de C y A. Por
snRNP complejo de ribonucleoproteína parte del complejo removedor de
intrones y empalmador de exones. ejemplo, la edición C-U ocurre en el mRNA humano del
gen APOB (apolipoproteína B). En el hígado se produce
una proteína de 4536 aminoácidos, APOB100, mientras
Los ncRNA recién sintetizados también son procesa- que en el intestino, la desaminasa de citosina APO-
dos de manera postranscripcional. Por ejemplo, los rRNA BEC1, convierte la citosina 6666 en uridina, generando
son transcritos en el nucleolo por la RNA pol I como una un codón de paro y una proteína de 2152 aminoácidos,
molécula 45S que es procesada para generar los rRNA APOB48, que es indispensable para convertir en quilo-
18S, 5.8S y 28S. El procesamiento lo inicia el snRNA U3 micrones los lípidos de la dieta.
con una serie de acciones de endo y exonucleasas para Transporte y degradación del mRNA. La estructura
generar las moléculas individuales. En el nucleolo, nume- de un mRNA es modificada por elementos actuando en
rosos ncRNA que forman dos grupos de snoRNA son cis y proteínas de unión a RNA actuando en trans para
responsables de aparear con los rRNA en los sitios en permitir su interacción con otras proteínas, poniendo en
que serán modificados. El grupo C/D identifica sitios contacto secuencias remotas. Esto genera señales de loca-
blanco para metilación y el grupo H/ACA especifica lización o tráfico para transportar a los mRNA como par-
sitios donde la uridina es convertida a seudouridina, estas tículas ribonucleoproteicas (RNP) a lugares celulares
modificaciones son necesarias para que los rRNA inte- específicos. Por ejemplo, la proteína FMRP participa en
ractúen con las proteínas ribosomales y formen riboso- la localización de algunos mensajeros en los axones, en
mas funcionales. Asi mismo los tRNA requieren de un donde son traducidos. Este mecanismo permite que las
procesamiento que implica la acción de reacciones sepa- proteínas lleguen en menos tiempo, que el generado por
radas de endonucleasa y ligasa. La endonucleasa recono- su transporte, al sitio en que ejercerán su función en una
ce la estructura secundaria/terciaria del precursor y corta célula. La mayor parte de los elementos que regulan este
a ambos lados del intrón. Las dos mitades del tRNA mecanismo se localizan en los UTR 3’ de los mRNA.

Núcleo
5´ 3´
Transcripción
Transcrito primario
5´m7Gppp 3´
Poliadenilación

manual moderno Fotocopiar sin autorización es un delito.


5´m7Gppp AAAA 3´

RNAsn

Asa del intrón

Complejo removedor de intrones


y empalmador de exones
U
5´m7Gppp G AG AAAA 3´

Exón 1 Exón 2
5´m7Gppp AAAA 3´
RNA maduro

Citoplasma
© Editorial El

Figura 2-8. Procesamiento post-transcripcional del transcrito primario de la RNA pol IIen una célula eucarionte. Adición de CAP (m7G) en el
extremo 5´, poliadenilación en el extremo 3´, remoción de intrones y empalme de exones para generar el mRNA

Biblioteca Médica Virtual


Bases moleculares de la herencia 31
Las modificaciones en ambos extremos del mRNA lo de 74 a 95 nucleótidos donde algunos de ellos son modi-
protejen de degradación por exonucleasas. La mayoría de ficados de forma postranscripcional para convertirlos en:
los mRNA eucariontes son degradados por cualquiera de seudouridina, inosina, dihidrouridina, 1-metilguanosina
dos vías dependientes de deadenilación catalizada por poli y ribotimidina. Estas modificaciones participan en el
(A) nucleasas En una de estas vías, cuando la cola de poli reconocimiento por las aminoacil-tRNA sintetasas, enzi-
(A) alcanza un tamaño crítico (aprox 10 nucleótidos) que mas que unen el aminoácido a su correspondiente tRNA
ya no es capaz de mantener la interacción con la proteína de formando, mediante hidrolisis de ATP, los aminoacil-
unión a poli (A), se desestabiliza el complejo de unión al tRNA.
Cap que incluye a los factores de traducción eIF4G, eIF4E, Los mRNA maduros en el citoplasma se acoplan a los
y eIF4A, lo que conduce a rearreglos posteriores para expo- ribosomas en presencia de factores de traducción. La
ner el extremo 5‘P Cap a la enzima decapitadora y a conti- información del mRNA se lee en dirección 5’ → 3’ y el
nuación a la digestión por exonucleasas en dirección 5’-3’. polipéptido crece del extremo amino al carboxilo, de
La enzima decapitadora compite por el Cap con el comple- acuerdo al código genético. Éste relaciona la combi-
jo de factores de inicio de la traducción de unión al Cap. En nación de tres nucleótidos o codón, con los aminoácidos
la otra vía, el exosoma, un complejo evolutivamente conser- transportados por los tRNA que poseen una región com-
vado, cataliza la digestión en dirección 3’-5’. La degradación plementaria o anticodón que se adapta al codón de
de los mRNA por lo general ocurre dentro de partículas manera específica. El código genético es el mismo para
citoplásmicas discretas, llamadas cuerpos de procesamiento todos los organismos (universal) con algunas excepcio-
(PB, processing bodies). De manera adicional existe una gran nes, en especial en los genomas mitocondriales. De los 64
variedad de partículas citoplásmicas que contienen mRNA tripletes, 61 especifican los 20 aminoácidos, por lo por lo
reprimidos para que no se traduzcan. Este mecanismo de que cada aminoácido tiene más de un codón, lo que se
represión y también otro mecanismo de degradación de conoce como redundancia o degeneración del código,
mRNA específicos es regulado por miRNA (Anexo excepto triptófano y metionina que tienen un solo
Regulación epigenética y por ncRNA). En general la vida codón; los tres codones restantes son señales de paro o
media de un mRNA eucarionte depende de secuencias y alto de la traducción. En la lectura del código no existe
estructuras específicas en él y de la presencia de factores puntuación entre los codones, simplemente se van leyen-
estabilizantes y desestabilizantes. do de tres en tres durante la traducción y es importante
Diversas vías de regulación son necesarias para mantener señalar que cada codón es específico para un aminoácido
la fidelidad y precisión de la expresión individual de los particular (figura 2-9).
genes. Uno de estos mecanismos de supervivencia detecta a Los ribosomas eucariontes están formados por dos
los mensajeros con defectos en el procesamiento en el subunidades compuestas por RNA y proteínas: una
núcleo y a aquéllos que contienen mutaciones que determi- pequeña (40S) constituida por el rRNA 18S y más de 30
nan codones de paro prematuro o su ausencia. Los transcri- proteínas y otra mayor (60S) que incluye los rRNA 28S,
tos con codones de alto prematuros son decapitados en el 5.8S y 5S, y más de 50 proteínas. Cada ribosoma tiene
citoplasma, antes de que se dé el acortamiento de la cola de tres sitios activos, el sitio A aceptor o aminoacil, donde
poli (A). En células de mamíferos, el mecanismo de detec- se une el aminoacil - tRNA entrante; el sitio P portador
ción de codones de paro prematuros parece depender de los de la cadena polipeptídica o peptidil y el sitio E de sali-
complejos de ribonucleoproteína que se ensamblan en las da (exit) a donde se desplaza el tRNA descargado para
uniones de los exones del mRNA. Los complejos EJC (exon salir del ribosoma. Un mensajero puede ser leído por
junction complex) participan en la regulación del transporte varios ribosomas activos (polisoma o polirribosoma) for-
núcleo-citoplasma y evitan que los transcritos primarios en mando cada uno, una cadena polipeptídica (figura 2-10).
los que no se han eliminado los intrones lleguen al citoplas- La síntesis de proteínas se divide en tres etapas: inicio,
ma. Una de las señales para la degradación de estos mensa- elongación y terminación. El inicio requiere del comple-
jeros es la presencia de los EJC después de un codón de alto. jo que se forma por la unión del tRNAimet al extremo 5’
A este mecanismo se le conoce como decaimiento de del mRNA, en presencia del factor eIF4, un multímero
manual moderno Fotocopiar sin autorización es un delito.

mRNA por codones de paro prematuros (NMD). Este es el proteico que incluye al complejo de unión al Cap (CBP,
mecanismo de supervivencia mejor estudiado en humanos, cap binding protein) y del factor de inicio eIF-3 para unir-
se calcula que aproximadamente 60 a 70% de los pre se a la subunidad 40S del ribosoma con ayuda del factor
mRNA tienen uso alternativo de exones y que 45% de éstos de inicio eIF-2 y GTP, que forman un complejo ternario
tienen al menos una forma que debe degradarse por NMD. con el tRNAimet . Este tRNA es diferente del tRNAmet
La presencia de codones de alto prematuro también es con- que reconoce los codones AUG internos y es el único
secuencia de mutaciones patogénicas en exones e intrones que se entra de manera directa al sitio P del ribosoma.
de muchos genes. La presencia de proteínas truncadas con Además, la cola de poli A y la distancia al extremo 3’ del
efectos dominantes negativos puede tener consecuencias mRNA también influyen en la unión del complejo de
más graves para una célula que la falta de un producto, por pre-iniciación al mRNA. Esta interacción está mediada
lo que estos mRNA también son regulados de forma pos- por la proteína de unión a la cola de poli A o PADP (pol-
transcripcional por NMD. yadenylate-binding protein), que se asocia con el comple-
jo eIF-4 y ocasiona el plegamiento sobre sí mismo del
Síntesis de proteínas y su regulación mRNA. Así, el tamaño de la cola de poli A interviene en
© Editorial El

la regulación del inicio de traducción de un mRNA par-


La traducción del mRNA se lleva a cabo en los riboso- ticular. A continuación el complejo avanza sobre el
mas con la participación de los aminoacil-tRNA, energía mRNA hasta encontrar el codón de inicio, casi siempre
y factores proteicos específicos. Los tRNA son moléculas AUG, que está contenido en la secuencia consenso

Biblioteca Médica Virtual


32 Genética clínica

Segundo nucleótido
U C A C
UUU phe F UCU ser S UAU tyr Y UGU cys C U
U UUC phe F UCC ser S UAC tyr Y UGC cys C C
UUA leu L UCA ser S UAA paro UGA paro A
UUC leu L UCG ser S UAG paro UGG trp W G

CUU leu L CCU pro P CAU his H CGU arg R U

Tercer nucleótido
C
Primer nucleótido
CUC leu L CCC pro P CAC his H CGC arg R
C A
CUA leu L CCA pro P CAA gln Q CGA arg R
CUG leu L CCG pro P CAG gln Q CGG arg R G

AUU ile I ACU thr T AAU asn N AGU ser S U


AUA ile I ACC thr T AAC asn N AGC ser S C
A AUC ile I ACA thr T AAA lys N AGA arg R A
AUG met M ACG thr T AAG lys N AGG arg R G

GUU val V GCU ala A GAU asp D GGU gly G U


GUA val V GCC ala A GAC asp D GGC gly G C
G GUC val V GCA ala A GAA glu E GGA gly G A
GUG val V GCG ala A GAG glu E GGG gly G G

Figura 2-9. Código genético. La secuencia nucleotídica de cada triplete o codón de mRNA especifica la incorporación del aminoácido indica-
do (en nomenclatura de tres y una letra) o la terminación de la cadena polipeptídica (paro).

Aminoácidos
libres

E
G Q
C M
tRNA
W C M NH2
I Q
Extremo amino Glutamil-tRNA

Q
H G C B N
A
Cadena polipeptídica F CUU
W
G
G Anticodón

manual moderno Fotocopiar sin autorización es un delito.


tRNA R
ACC
M G
UCC A
E P

CCA
UAC

5-´ AGG AUG


U GGU U
UGG -3´
Dirección del
ribosoma
mRNA Codón
© Editorial El

Ribosoma

Figura 2-10. Esquema general de traducción y síntesis de proteínas.

Biblioteca Médica Virtual


Bases moleculares de la herencia 33
5’-GCCPuCCAUGG-3’ denominada secuencia Kozak. para la disociación del complejo de traducción. Las subu-
Tanto la unión del complejo de pre-iniciación al mRNA, nidades ribosómicas regresan a la poza citoplasmática
como su migración hasta el codón de inicio son procesos para ser utilizadas nuevamente, mientras que los mRNA
dependientes de energía que requieren la hidrólisis de se degradan una vez traducidos. En la figura 2-10 se
ATP. A continuación se une la subunidad ribosómica 60S muestra un esquema general de la síntesis proteica y en
por hidrólisis de GTP mediada por el factor eIF-5 que el cuadro 2-10 un resumen de los factores proteicos que
libera a otros factores como el eIF-6 que se encontraba intervienen en ella.
asociado con la subunidad ribosómica grande libre, pre- Los mecanismos de control de la traducción son, des-
viniendo la unión de las subunidades 40S en el citoplas- pués del control transcripcional y la estabilidad del
ma. Esto último resulta en la formación del complejo de mRNA, los principales determinantes de los niveles fina-
inicio 80S, donde el tRNAimet ocupa el sitio P del riboso- les de proteína. Tanto el UTR 5’ como el UTR 3’ del
ma. Subsecuentemente, el sitio A es ocupado por el ami- mRNA pueden tener elementos que modulen la eficien-
noacil-tRNA especificado por el segundo codón del cia de la traducción Un punto importante de la regula-
mRNA, comenzando la etapa de elongación. La entrada ción del inicio de la traducción se establece entre las
de los diferentes aminoacil-tRNA al sitio A es mediada secuencias en el UTR 3’ y su interacción con la proteína
por el factor de elongación eEF-1, un complejo de 4 de unión a la cola de poli A y el factor de inicio de la tra-
subunidades con actividad de proteína G, e implica la ducción eIF4F, llevando a circularizar al mRNA y facili-
hidrólisis de GTP. La formación del enlace peptídico tar el inicio de la traducción o por el contrario, por la
entre la metionina del RNAtimet en el sitio P y el amino- unión proteínas que impiden esta interacción. El control
ácido del segundo tRNA en el sitio A, es catalizada por de la traducción dependiente del Cap ocurre en especial
la actividad de peptidiltransferasa de la subunidad ribo- durante su inicio, implicando a los eIF y proteínas acce-
sómica grande, cuya actividad incluye la deacilación del sorias. El inicio es afectado por diversos estímulos que
tRNA. Esta acción requiere de la hidrólisis de GTP modifican el estado de fosforilación de los factores eIF4E
unido al factor eEF-1. Una vez que se forma el dipépti- y eIF2 y a través de la unión de las proteínas de unión a
do correspondiente a los dos primeros codones del ORF, eIF4E, lo cual por último inhibe el inicio de la traducción
el siguiente paso es la translocación, que ocurre en tres dependiente del Cap. Bajo condiciones donde la traduc-
etapas: 1) el ribosoma se mueve en dirección 5 →3 , a lo ción dependiente del Cap es abolida, la traducción de
largo de tres nucleótidos de manera que el siguiente transcritos con sitios de unión internos para ribosomas
codón ocupa el sitio A, 2) el tRNA-dipéptido en el sitio (IRS) puede realizarse en forma independiente del Cap.
A se desplaza al sitio P y 3) el tRNA deacilado en el sitio Por ejemplo durante el ciclo celular, en la transición G1-
P se mueve a la tercera posición o sitio E, siendo a con- S, la traducción se realiza predominantemente en forma
tinuación expulsado del ribosoma. La translocación dependiente del Cap, mientras que durante el paso de
requiere de hidrólisis de GTP, mediada por el factor eEF- G2 a M, la traducción dependiente del Cap es inhibida y
2, dejando el sitio A libre para permitir la entrada del los transcritos se traducen preferentemente en forma
siguiente aminoacil-tRNA. El ciclo de elongación se independiente. Otro ejemplo interesante de control de la
repite continuamente hasta llegar al codón de termina- traducción se realiza en los ovocitos, donde los mRNA
ción donde se une alguno de los factores de liberación, presentan colas de poli (A) cortas y una vez ocurrida la
eRF, que reconoce cualquiera de los tres codones de ter- fertilización, éstas son alargadas en el citoplasma para
minación. La hidrólisis de GTP es necesaria para la libe- activar su traducción. Otros mecanismos de regulación
ración del polipéptido recién sintetizado, del tRNA y de la traducción incluyen la interacción de proteínas con

Cuadro 2-10. Factores proteicos que participan en la síntesis de proteínas


Factores de inicio
manual moderno Fotocopiar sin autorización es un delito.

Procariontes Eucariontes Función general


IF-1 eIF1A Bloquea sitio A
eIF1 asiste a eIF2 en promover unión de tRNAimet a subunidad 40S, promueve su disociación

IF-2 eIF2 Entrada del tRNA iniciador


eIF3 eIF2 es una GTPasa
eIF5B eIF3 estimula formación complejo ternario, su unión a 40S y el escaneo del mRNA
eIF5B implicado en la entrada del tRNA iniciador, es una GTPasa

IF-3 eIF1 Unión de subunidad pequeña al mRNA


complejo eIF4 Complejo eIF4 funciona en la unión al Cap
eIF3
Factores de elongación
EF-Tu, EF-G eEF1α Unión a GTP
EF-Ts eEF1β, eEF1γ Intercambio-GDP
EF-G eEF2 Translocación del ribosoma
Factores de liberación
© Editorial El

RF1 eRF1 Reconocimiento UAA/UAG


RF2 eRF2 Reconocimiento UAA/UGA
RF3 eRF3 Estimulación de otros RF

Biblioteca Médica Virtual


34 Genética clínica

estructuras clave del mRNA y la formación de RNA de ponentes de la cadena respiratoria, entre otras), los pero-
doble cadena por la complementaridad de bases de xisomas, lisosomas, entre otras. En el caso de las proteí-
moléculas antisentido y por último los mecanismos por nas de secreción, el péptido señal contiene 20 aminoáci-
RNA interferente, mediada en especial por miRNA, que dos en especial hidrofóbicos en el extremo amino. La
reprimen la traducción, llevan a la degradación del men- secuencia señal se transporta al retículo endoplásmico
sajero o ambos (Anexo Regulación epigenética y por por una partícula de reconocimiento de la señal SRP
ncRNA). (signal recognition particle), un complejo que contiene
ncRNA (citoplásmicos pequeños), RNA 7SL y seis pro-
Modificaciones postraduccionales, teínas específicas. El complejo SRP se une tanto al extre-
localización y degradación de proteínas mo creciente de la proteína como al ribosoma y los diri-
ge a una proteína receptora de SRP en la superficie del
El polipéptido que emerge del ribosoma por lo general lado citosólico de la membrana del retículo endoplásmi-
no es activo por lo que sufre modificaciones postraduc- co rugoso. De allí, el polipéptido puede pasar al lumen
cionales que incluyen su plegamiento, ruptura proteolíti- del retículo si su destino es exportarse de la célula, o es
ca, modificaciones químicas tales como unión a carbohi- detenido si tiene segmentos hidrofóbicos adicionales,
dratos, a lípidos, a grupos fosfato, hidroxilo, acetilo, entre como en el caso de las proteínas transmembranales. Las
otras, o eliminación de aminoácidos e interacción con proteínas mitocondriales, codificadas en núcleo, requie-
otras moléculas para formar la proteína activa. ren de un péptido señal mitocondrial con aminoácidos
La función de una proteína depende de su estructura hidrofóbicos y con carga positiva, que forman una α-
final, la cual está determinada por cuatro niveles: La pri- hélice anfipática. Las señales de localización nuclear
maria o secuencia lineal de aminoácidos; la secundaria o pueden estar localizadas casi en cualquier sitio de la
conformación que adopta el polipéptido por la interac- secuencia polipeptídica y consisten en segmentos de 4 a
ción entre sus aminoácidos, por lo general como α-hélice 8 aminoácidos con carga positiva, junto con residuos de
o β-plegada, estabilizada por puentes de hidrógeno entre prolina; la señal es bipartita y los aminoácidos positivos
los grupos carboxilo y amino de sus aminoácidos. La ter- se encuentran en dos bloques de 2 a 4 residuos, separa-
ciaria que resulta del plegamiento de diferentes dos por alrededor de 10 aminoácidos. Algunas proteínas
secciones de α-hélice, β-plegada y otras estructuras nucleares carecen de señales de localización propias,
secundarias menores, estabilizado por puentes de hidró- pero son transportadas al núcleo con la asistencia de
geno, fuerzas hidrofóbicas que determinan que aminoá- otras proteínas nucleares. Así mismo, para salir del
cidos con grupos no polares queden en la región interna núcleo las proteínas requieren de una señal de exporta-
de la proteína, o enlaces covalentes como puentes disul- ción nuclear propia o la adquieren por unión a otra pro-
furo entre residuos de cisteína. Por último la estructura teína que la posea. En cuanto a las proteínas lisosomales,
cuaternaria donde se asocian dos o más polipéptidos, la secuencia señal es un residuo de manosa 6-fosfato que
cada uno plegado en su estructura terciaria, en una pro- se adiciona en el lado cis del aparato de Golgi y es reco-
teína multimérica. Cada proteína adquiere su propia nocida por una proteína en el lado trans del Golgi. Un
estructura por lo general terciaria o cuaternaria, depen- ejemplo de modificaciones postraduccionales que regu-
diendo de su función, para el plegamiento participan lan la actividad de una proteína es el procesamiento de
proteínas chaperonas, como por ejemplo las proteínas de la insulina en la que se eliminan los primeros 24 amino-
choque térmico (Hsp70) que promueven el plegamien- ácidos de la preinsulina-proinsulina para dar proinsulina,
to cotraduccional. seguida por dos cortes adicionales que eliminan un seg-
Las proteasas eliminan segmentos de uno o ambos mento central dando las dos partes activas de la proteí-
extremos del polipéptido, mediante la actividad de na, las cadenas A y B, que son unidas por dos puentes
amino o carboxipeptidasas, resultando en una forma más disulfuro para formar la insulina madura.
corta de la proteína. Si las ruptura proteolíticas ocurren Una vez que las proteínas han cumplido su función,
internamente se generan diferentes segmentos proteicos son degradadas o modificadas para tener nuevas funcio-

manual moderno Fotocopiar sin autorización es un delito.


a partir del polipéptido recién sintetizado, y cada uno de nes en respuesta a los requerimientos de la célula. El
ellos puede constituir una proteína activa. Por otra parte, concepto de recambio proteico en una célula no sólo
es frecuente la eliminación de la metionina inicial del requiere de la síntesis de proteínas de novo, si no de eli-
producto primario de traducción, por ejemplo durante la minación de proteínas cuya función ya no se requiera, de
síntesis de la β-globina. Algunas proteínas son sintetiza- manera selectiva y rápida para contender con los cam-
das desde el inicio como poliproteínas con copias múlti- bios abruptos que ocurren bajo ciertas condiciones, por
ples unidas extremo a extremo; por ejemplo la ubicuiti- ejemplo en las transiciones claves del ciclo celular. Así
na, es sintetizada como poliproteína. Las proteínas de cada proteína tiene una vida media particular. En euca-
secreción y las de exportación requieren de una señal de riontes se ha observado que los aminoácidos del extre-
localización intracelular específica, la cual es una secuen- mo-N tienen un papel crítico en la estabilidad inherente
cia peptídica corta o secuencia señal o líder, que es eli- de la proteína, por ejemplo, la presencia de ocho amino-
minada por una peptidasa una vez alcanzado su objetivo. ácidos (Ala, Cys, Gly, Met, Pro, Ser, Thr, Val) se correla-
Por ejemplo, las hormonas sintetizadas en un tejido ciona con estabilidad (t 1/2 > 20 h), otros ocho (Arg, His,
(hipófisis) son cortadas para generar moléculas indivi- Ile, Leu, Lys, Phe, Trp, Tyr) con una vida media corta (t
duales que son exportadas y actúan en otros, o las prote- 1/2 2 a 3 min) y la de cuatro (Asn, Asp, Gln, Glu) con una
© Editorial El

ínas enviadas a compartimentos intracelulares como el desestabilización posterior a la modificación química.


núcleo (histonas, polimerasas, factores de transcripción, Una proteína dañada, modificada o con residuo N-termi-
entre otras), la mitocondria (proteínas ribosomales, com- nal desestabilizante es ubicuitinada por una enzima con-

Biblioteca Médica Virtual


Bases moleculares de la herencia 35
jugante de ubicuitina, UBCE (Ubiquitin-Conjugating tion, analysis of transcription, and evolution. Genome Res
Enzyme). La unión covalente de la ubicuitina, se realiza 2007;17(6):839-851.
entre la glicina en el C-terminal de ésta y en los residuos Zheng D, Gerstein MB: The ambiguous boundary between
de lisina de la proteína a degradar; de manera subsecuen- genes and seudogenes: the dead rise up, or do they? Trends
Genet 2007;23(5):219-224.
te son adicionados más residuos formando una cadena de
poliubicuitina. La proteína poliubicuitinada es reconoci-
da por un complejo múltiple de proteasas, el proteasoma Replicación
26S. La proteína es digerida en una reacción que requie-
Balakrishnan L, Gloor JW, Bambara RA: Reconstitution of
re ATP y libera péptidos cortos de 4 a 10 aminoácidos y
eukaryotic lagging strand DNA replication. Methods
ubicuitinas intactas para su reutilización. Los proteaso- 2010;51:347–357.
mas se localizan tanto en el citoplasma como en el Bicknell LS, Bongers EM, Leitch A, Brown S et al.: Mutations
núcleo de todas las células, pero no en el lumen de los in the pre-replication complex cause Meier-Gorlin syn-
organelos celulares de secreción. Las células cuentan drome. Nat Genet 2011;43(4):356-359.
además con otro mecanismo de degradación de proteí- Borlado LR, Méndez J: CDC6: from DNA replication to cell
nas, que actúa sobre todo en proteínas de membrana, cycle checkpoints and oncogenesis Carcinogenesis
receptores y sus ligandos, la endocitosis y unión a lisoso- 2008;29(2):237–243. doi:10.1093/carcin/bgm268
mas. La degradación de proteínas constituye el último Duncker BP, Chesnokov IN, McConkey BJ: The origin recog-
eslabón en la cadena de eventos que regulan la expresión nition complex protein family. Genome Biol
2009;1100:214. (doi:10.1186/gb-2009-10-3-214)
de un gen y determinan las características de una célula.
Ghosh S, Vassilev AP, Zhang J, Zhao Y, Depamphilis ML:
Assembly of the human origin recognition complex occurs
through independent nuclear localization of its compo-
BIBLIOGRAFÍA nents. J Biol Chem 2011;9. [Epub ahead of print]
Guernsey DL, Matsuoka M, Jiang H, Evans S et al.: Mutations
Referencias generales in origin recognition complex gene ORC4 cause Meier-
Gorlin syndrome. Nat Genet 2011;43(4):360-364.
Alberts B, Bray D, Hopkin K, Johnson A, Lewis J, Raff M, Johansson E, Macneill SA: The eukaryotic replicative DNA
Roberts K, Walter P: Essential cell biology, 2nd ed. Garland polymerases take shape. Trends Biochem Sci
Science. New York 2004:740. 2010;35(6):339-347.
http://www.ncbi.nlm.nih.gov/omim Labib K: How do Cdc7 and cyclin-dependent kinases trigger
Krebs JE, Goldstein ES, Kilpatrick ST: Lewin’s Genes X. Jones the initiation of chromosome replication in eukaryotic
and Bartlett Publishers. Boston, Mass., EUA 2010:930. cells? Genes Dev 2010;24(12):1208-1219.
Strachan T, Read AP: Human Molecular Genetics 4th ed. Stallons LJ, McGregor WG: Translesion synthesis polymerases
Garland Sciences. New York 2010:790. in the prevention and promotion of carcinogenesis. J
www.els.net Nucleic Acids (2010). Article ID 643857, doi:
10.4061/2010/643857 pii: 643857.
Zheng L, Jia J, Finger LD, Guo Z, Zer C, Shen B: Functional regu-
Estructura del genoma lation of of FEN1 nuclease and its link to cancer. Nuclei Acid
Res 2011;39(3):781–794. doi:10.1093/nar/ gkq884.
Bhuvanagiri M, Schlitter AM, Hentze MW, Kulozik AE: NMD:
RNA biology meets human genetic medicine. Biochem J
2010;430:365–377. doi:10.1042/bj20100699 365 Mutación y reparación
Gerstein MB, Bruce C, Rozowsky JS, Zheng D et al.: What is
a gene, post-ENCODE? History and updated definition. Arana ME, Kunkel TA: Mutator phenotypes due to DNA replica-
Genome Res 2007;17(6):669-681. tion infidelity. Semin Cancer Biol 2010;20(5):304–311.
Kehrer SH, Cooper DN: Sequencing the Human Genome: Novel doi:10.1016/j.semcancer.2010.10.003.
Insights into its Structure and Function. In: Encyclopedia of Hanawalt PC, Spivak G: Transcription-coupled DNA repair:
Life Sciences (ELS). John Wiley & Sons, Ltd: Chichester. two decades of progress and surprises. Nat Rev Mol Cell
manual moderno Fotocopiar sin autorización es un delito.

(July 2008) DOI: 10.1002/9780470015902.a0001899. Bio 2008;9:958-970.


pub2 Moldovan GL, D’Andrea AD: How the Fanconi anemia path-
Mattick JS, Makunin IV: Non-coding RNA. 2006. Hum Mol way guards the genome. Annu Rev Genet
Genet 2006, 15, Rev Issue 1, R17 –R29 doi:10.1093/ 2009;43:223–249.
hmg/ddl046 Rastogi RP, Richa, Kumar A, Tyagi MB, Sinha RP: Molecular
Pesole G: What is a gene? An updated operational definition. mechanisms of ultraviolet radiation-induced DNA dama-
Gene 2008;417(1-2):1-4. ge and repair. J Nucleic Acids 2010:592980. Article ID
Rowen L: Gene Structure and Organization. Encyclopedia of 592980, 32 pages doi:10.4061/2010/592980
Life Sciences 2005. John Wiley & Sons, Ltd. www.els.net. Sugasawa K: Xeroderma pigmentosum genes: functions inside
doi: 10.1038/npg.els.0005008 and outside DNA repair. Carcinogenesis 2008;29(3):
Szymanski M, Barciszewski J: Noncoding RNAs in Biology and 455–465. doi:10.1093/carcin/bgm282
Disease. In: Encyclopedia of Life Sciences (ELS). John Thoms KM, Kuschal C, Emmert S: Lessons learned from DNA
Wiley & Sons, Ltd: Chichester. (2009) DOI:10.1002/ repair defective syndromes. Exp Dermatol 2007;16
9780470015902.a0021437 (6):532-544.
Wright MW, Bruford EA: Naming ‘junk’: Human non-protein Waters LS, Minesinger BK, Wiltrout ME, D’Souza S, Woodruff
coding RNA (ncRNA) gene nomenclature Hum RV, Walker GC: Eukaryotic translesion polymerases and
their roles and regulation in DNA damage tolerance.
© Editorial El

Genomics 2011;5(2):90–98.
Zheng D, Frankish A, Baertsch R, Kapranov P et al.: Microbiol Mol Biol Rev 2009;73(1):134-154. doi:10.1128/
Seudogenes in the ENCODE regions: consensus annota- MMBR.00034-08

Biblioteca Médica Virtual


36 Genética clínica

Expresión y su regulación Ltd. www.els.net. doi: 10.1038/npg.els.0005501


Millevoi S, Vagner S: Molecular mechanisms of eukaryotic pre-
Fischer PM: Cap in hand. Targeting eIF4E. Cell Cycle mRNA 3’ end processing regulation. Nuc Acid Res
2009;(8:16):2535-2541. 2010;38(9):2757–2774. doi:10.1093/nar/gkp1176
Lejeune F, Maquat LE: RNA Processing and Human Disorders. Scheper GC, van der Knaap MS, Proud CG: Translation mat-
Encyclopedia of Life Sciences 2007. John Wiley & Sons, Ltd. ters: protein synthesis defects in inherited disease. Nat Rev
www.els.net. doi: 10.1002/9780470015902. a0005495. Genet 2007;8:711-723.
McGlincy NJ, Smith CWJ: Alternative splicing resulting in Van Der Kelen K, Beyaert R, Inzé D, De Veylder L:
nonsense-mediated mRNA decay: what is the meaning of Translational control of eukaryotic gene expression. Crit
nonsense? Trend Biochem Sci 2008;33(8): 385-393. Rev Biochem Mol Biol 2009;44(4):143-168.
doi:10.1016/j.tibs.2008.06.001 Wisdom GB: Postranslational modification and human disor-
Mendell JT, Dietz HC: Nonsense-mediated mRNA Decay. ders. Encyclopedia of Life Sciences 2005. John Wiley &
Encyclopedia of Life Sciences 2005. John Wiley & Sons, Sons, Ltd. www.els.net doi: 10.1038/npg.els.0005498

manual moderno Fotocopiar sin autorización es un delito.


© Editorial El

Biblioteca Médica Virtual


Bases moleculares de la herencia 37
PREGUNTAS DE AUTOEVALUACIÓN
1. ¿Cuáles de las siguientes bases nitrogenadas son deriva- 6. Los dímeros de pirimidina producidos por la luz ultra-
das de la pirimidina y se encuentran en el ácido ribonu- violeta son reparados en especial por:
cleico? A. Escisión de base.
A. Adenina y guanina. B. Escisión de nucleótidos.
B. Citosina y guanina. C. Unión de extremos no homólogos.
C. Adenina y timina. D. Reparación de bases mal apareadas.
D. Citosina y uracilo.
7. Un promotor puede ser definido como:
2. El tamaño del genoma humano haploide es de: A. El sitio al cual se unen proteínas específicas para
A. 6 000 000 pb. reprimir la transcripción.
B. 3 x 106 pb. B. El complejo proteico que ayuda a la RNA polimera-
C. 3 000 Mb. sa a iniciar la expresión de un gen.
D. 3 000 kb. C. La secuencia de DNA con la cual interacciona la
RNA polimerasa para iniciar la síntesis de RNA.
3. Los genes que codifican para tRNA son un ejemplo de: D. Las secuencias del DNA con las que interaccionan
A. Genes codificantes para polipéptidos. proteínas para incrementar la tasa de expresión.
B. Genes para RNA no codificante.
C. Heterocromatina facultativa. 8. La región del Cap o caperuza:
E. Seudogenes. A. Es adicionada a las moléculas de rRNA.
B. Se adiciona en el extremo 5’ de los mRNAm.
4. Durante la replicación del DNA humano la actividad C. Está presente en los transcritos de las RNA pol I y
de helicasa la ejercen: II.
A. RFC y PCNA. D. Se adiciona durante la terminación de la transcrip-
B. Complejo ORC1-6. ción del RNAm .
C. Complejo MCM2-7.
D. CDC6, CTD1 y RPA. 9. En los organismos eucariontes, los intrones de un gen
corresponden a las secuencias:
5. Debido a una mutación puntual en la región codificante de A. Codificantes
un gen que tiene 500 nucleótidos en su ORF, el codón B. Traducidas pero no transcritas
TGG correspondiente al residuo del aa 108 es sustituido C. Altamente repetitivas del genoma
por el triplete TGA en la cadena sentido del gen (5’ 3’) D. Removidas para formar los mRNA maduros
¿cómo será la proteína codificada por el DNA que tiene
esa mutación? 10. Durante el proceso de traducción de la información
A. Una proteína de 107 aminoácidos. genética:
B. Una proteína de 108 aminoácidos. A. Se sintetizan los RNAm.
C. Una proteína de 500 aminoácidos con la secuencia B. Participan las RNA polimerasas.
normal. C. Se procesan los rRNA 45S y proteínas ribosomales.
D. Una proteína de 500 aminoácidos pero con cambio D. Los ribosomas catalizan las formación del enlace
de un aa. peptídico.
manual moderno Fotocopiar sin autorización es un delito.

D 10.
D 9.
B 8.
C 7.
B 6.
B 5.
C 4.
B 3.
© Editorial El

C 2.
D 1.
Respuestas correctas

Biblioteca Médica Virtual


Biblioteca Médica Virtual
ANEXO I
Variación genética humana

Marisol López López, Alicia B. Cervantes Peredo, Nancy Monroy Jaramillo

INTRODUCCIÓN interpretar la variación genética entre los individuos.


Alrededor de 99.9% de la secuencia del DNA es idén-
La diversidad genética es una fuerza importante en la tica entre los diferentes individuos. El restante 0.1% es
evolución y es un proceso natural que modifica el feno- variable y aun cuando representa una pequeña propor-
tipo de los organismos. La alteración en la secuencia de ción del genoma total, es responsable de una variación
nucleótidos del DNA puede ser inducida por factores significativa en el fenotipo. La escala de diversidad en el
ambientales (como exposición a luz UV, radiaciones genoma humano es muy amplia, desde variaciones
ionizantes o a ciertas sustancias químicas) o puede ocu- microscópicas a nivel de cromosomas individuales
rrir de manera espontánea por errores en la replicación hasta variaciones a nivel de la secuencia del DNA. Estas
del DNA. En el último decenio ha habido un avance últimas incluyen más de 10 millones SNP. Los polimor-
científico muy importante en el conocimiento de la fismos genéticos son cambios en la secuencia del DNA
variación genética humana, y se ha asociado con la sus- que están presentes con una frecuencia > 1% de mane-
ceptibilidad, resistencia a diferentes enfermedades o ra natural en una población. La variación estructural
ambas, así como con la respuesta individual a la terapia visible al microscopio incluye heteromorfismos y rea-
farmacológica. rreglos cromosómicos balanceados (translocaciones,
El conocimiento de cómo está constituido el genoma inversiones, entre otros) que pueden tener tamaños
humano nuclear fue una de las metas del Proyecto del mayores a 3 Mb. Sin embargo, también existen variacio-
Genoma Humano (PGH). Iniciado a principios de 1990, nes submicroscópicas que van de menos de 3Mb hasta
el PGH publicó en 2001 un borrador de la secuencia del 1 kb en longitud. Recién se han descrito variaciones
genoma humano y en 2004 una secuencia que estructurales submicroscópicas que comprenden inser-
comprendía ≈99.7% de la región eucromática, ciones/deleciones (indel) de escasos nucleótidos y
interrumpida por sólo 300 huecos y con un error de un variaciones en el número de copias o CNV (figura 1).
nucleótido por cada 100 000 bases. La región eucromá- Los minisatélites, microsatélites (figura 2) y las inser-
tica abarca 3 Gb y corresponde a la región transcripcio- ciones de transposones también han sido identificadas
nal activa del genoma nuclear. Las 200 Mb restantes dentro de esta clase de variantes submicroscópicas y, en
están formadas por heterocromatina constitutiva que general, requieren de métodos genómicos para su iden-
está condensada de forma permanente. La heterocroma- tificación.
tina constitutiva está compuesta de grandes tramos de Los minisatélites y microsatélites son secuencias repe-
DNA repetido que son muy difíciles de secuenciar de tidas en tándem (una tras otra) compuestas de unidades
manera precisa. Por una razón similar, las unidades trans- cortas repetidas. Aunque el tamaño de la unidad de repe-
tición determina su clasificación en uno u otro grupo, a
moderno Fotocopiar sin autorización es un delito.

cripcionales repetidas en tándem que codifican para los


rRNA 28S, 18S y 5.8S tampoco fueron secuenciadas. la fecha no existe un consenso acerca de la definición
El estudio de las variaciones del DNA ha contribuido precisa de ambos tipos de repetidos. En este capítulo
de manera importante a las áreas biomédica y forense, en consideraremos a los STR desde repetidos mononucleó-
especial en el estudio de genes responsables y genes de tido [tractos de poli (A)] hasta los de clase pentanucleó-
susceptibilidad para varias enfermedades. Los tipos de tida. El tamaño de la unidad de repetición de los VNTR
variaciones genéticas empleadas en estos estudios han comprenderá de seis a varias centenas de nucleótidos. La
cambiado en los últimos 25 años y pueden clasificarse en longitud completa del tracto de repetidos también varía,
cinco clases principales: polimorfismos de restricción de siendo de 102 a 103 pb y < 10 a 102 pb para los minisa-
longitud variable o RFLP (restriction fragment length poly- télites y microsatélites, respectivamente.
morphism), minisatélites o VNTR (variable number of
tandem repeat), microsatélites o STR (short tandem repe-
at), polimorfismos de nucleótido sencillo o SNP (single- MINISATÉLITES O VNTR
© Editorial El manual

nucleotide polymorphism) y variaciones en el número


de copias o CNV (copy-number variation). La secuencias minisatélites son altamente polimórficas y
En particular, la secuencia del genoma humano pro- al parecer la alta variabilidad es resultado de errores
porcionó una mayor comprensión para catalogar e durante la replicación del DNA, en donde la polimerasa

39

Biblioteca Médica Virtual


40 Genética clínica

Polimorfismo de ATTGGCCTTAACCCCCGATTATCAGGAT
nucleótido sencillo ATTGGCCTTAACCTCCGATTATCAGGAT
(SNP)

Interción-deleción ATTGGCCTTAACCCCCGATTATCAGGAT
(INDEL) ATTGGCCTTAACCCCC - - TTATCAGGAT

Figura 1. Tipo de variaciones genéticas observadas en la


Variación en número ATTGGCCTTAGGCCTTAA CCCCCGATTATCAGGAT
secuencia y estructura del genoma humano.
de copias (CNV) ATTGGCCTTAA - - - - - - - CCCCCGATTATCAGGAT

aumenta o disminuye el número de unidades de repeti- MICROSATÉLITÉS O STR


ción; también errores en la recombinación pueden modi-
ficar el número de unidades de repetición presentes en Como en el caso del DNA minisatélite, la variación en
un alelo. La variación de estas secuencias es tal que se ha el número de repetidos STR se debe a errores cometi-
calculado que no existen dos individuos con exactamen- dos por la DNA polimerasa durante la replicación o a
te la misma combinación de alelos minisatélites. En 1985 eventos de recombinación desigual entre cromosomas
Jeffreys et al., desarrollaron sondas de DNA capaces de homólogos o entre cromátidas hermanas. Los microsa-
detectar de manera simultánea un gran número de loci télites pueden ser: polimorfismos de riesgo en enfer-
de minisatélites hipervariables. La hibridación de estas medades complejas (diabetes, depresión, entre otras),
sondas con DNA digerido y separado por electroforesis, mutaciones patogénicas (en el grupo de enfermedades
en condiciones de bajo rigor, detecta un patrón de frag- conocidas como enfermedades por amplificación de
mentos que es único para individuos no relacionados. microsatélites, p. ej., ataxias espinocerebelosas y
Estas propiedades de los minisatélites son la base de los enfermedad de Huntington) y emplearse en mapas de
análisis de huellas génicas o de DNA, por lo que si se asociación, ligamiento y genética forense. Los STR
analiza un número suficiente de minisatélites se puede pueden participar en forma tan variada como: a) ele-
establecer un perfil de DNA único para cada persona. mentos funcionales de unión a factores de transcrip-
De manera adicional, los VNTR contribuyeron de mane- ción y a otras proteínas que inhiben o promueven la
ra importante al estudio de los genes supresores de expresión; b) elementos motivo que afectan la eficien-
tumor. En la mayoría de estos genes se inactivan ambos cia del procesamiento del mRNA; y c) elementos que
alelos en el tejido tumoral (teoría del doble evento, o ini- tienen efectos físicos, tales como variar el espacio
ciación-promoción). Los VNTR fueron útiles para detec- entre motivos funcionales o alterar la estructura y las
tar, mediante hibridación tipo Southern, la pérdida de propiedades de fusión del DNA en sus proximidades.
una porción cromosómica o de un cromosoma completo Por estas razones, los STR son a priori muy buenos
(pérdida de heterocigosidad); esto es, la desaparición del candidatos funcionales (figura 2).
alelo materno o paterno. El primer análisis sistemático de A partir de la comparación de la secuencias de los geno-
la pérdida de regiones cromosómicas (análisis de aleloti- mas personales de Craig Venter y James Watson se hizo
pos) fue informado por Vogelstein et al., (1988) en cán- evidente la gran variabilidad genética interindividual. A la
cer colorrectal y a partir de estos resultados se estableció fecha, las nuevas técnicas de resecuenciación de genomas
el modelo de carcinogénesis de etapas múltiples en esta han permitido la formación de diversos consorcios inter-
neoplasia. Un análisis detallado subsecuente de 17p llevó nacionales para secuenciar al menos 1 000 genomas de
a la identificación de mutaciones en el gen TP53 y se individuos de todo el mundo (The 1 000 Genomes Project,
comprobó que era un gen supresor de tumor. http://www.1000genomes.org/). La motivación principal

moderno Fotocopiar sin autorización es un delito.


A
5- ACAGGGTGTGGG -3
Minisatélite
(VNTR) 3- TGTCCCACACCC -3

12
17

B
Microsatélite 5´- CACACACACACACAC -3´
© Editorial El manual

(STR) 3´- GTGTGTGTGTGTGTG -5´

7
Figura 2. Tipo de variaciones genéticas observadas en la 4
secuencia y estructura del genoma humano.

Biblioteca Médica Virtual


Anexo I 41
de estos estudios es mejorar la salud humana y el obje- genes humanos (> 11 000 transcritos). Los análisis fun-
tivo a largo plazo es descifrar el código de la variación cionales de zonas exónicas ricas en indel revelan produc-
genética natural para entender cómo los cambios en tos génicos con actividades de regulación a nivel de
nuestros patrones genéticos influyen en las caracterís- transcripción y traducción. De esta manera se sugiere
ticas humanas, incluyendo modificación de los estados que las indel contribuyeron a rasgos únicos de la especie
de salud-enfermedad y respuesta a los tratamientos al causar cambios a nivel de RNA o proteína.
médicos. Existen cinco clases principales de indel, incluyendo
1) inserciones y deleciones de un solo par de bases, 2)
expansiones monoméricas de un par de bases, 3) expan-
siones de multipares de bases de 2 a 15 pb de unidades
SNP de repetición, 4) inserciones de transposones y 5) indel
que contienen secuencias de DNA aleatorias.
El polimorfismo más común en el genoma humano es Al igual que los SNP y las CNV, las variaciones en los
la diferencia de un solo nucleótido o SNP, el cual ocu- indel son de gran interés porque pueden alterar caracterís-
rre aproximadamente cada 300 a 1 000 pb. Se estima ticas y ocasionar enfermedades. Las nuevas tecnologías de
que existen > 10 millones de SNP y los científicos secuenciación genómica de “la siguiente generación” (en
creen que estos cambios constituyen la base de la inglés next generation) junto con los proyectos de secuen-
mayoría de las enfermedades humanas. La mayoría de ciación del exoma han permitido identificar un gran núme-
los SNP tiene dos alelos posibles, por lo que hay una ro de indel en regiones codificantes sugiriendo que la
alta probabilidad de que todos los miembros de una mayoría de los humanos porta una carga genética substan-
familia sean homocigotos para un SNP particular; sólo cial de estas variaciones. Los indel han sido menos estudia-
una minoría de SNP son trialélicos. Aunque su bajo dos que los SNP; sin embargo, aquellos localizados en
polimorfismo podría descartarlos como marcadores regiones codificantes de seguro tendrán un impacto impor-
para estudios de ligamiento y mapeo génico, las venta- tante en la biología y en las enfermedades humanas. Una de
jas de los SNP en estudios de asociación son su gran las enfermedades genéticas humanas más estudiada, la
abundancia y el hecho de que pueden ser tipificados fibrosis quística, por lo común es causada por un indel den-
por métodos que no requieren electroforesis en gel. La tro del gen CFTR. La deleción en fase de tres pares de
detección del SNP está basada en análisis de hibrida- bases elimina un aminoácido (fenilalanina) que abole la
ción de oligonucleótidos, lo que permite el uso de tec- función del gen y produce la fibrosis quística. Por otro lado,
nologías automatizadas como los chips de DNA. los indel que ocurren en regiones promotoras alteran la
Dependiendo de la localización del SNP será el expresión del gen correspondiente.
efecto que tendrá en la regulación del gen o en el pro- En general, el DNA del genoma humano tiene una
ducto para el cual codifica. Existen polimorfismos copia de las regiones autosómicas (heredada de cada pro-
poco considerados en los estudios de asociación que se genitor) en cada cromosoma. Como resultado de la
localizan en las regiones transcritas de los genes, afec- secuenciación sistemática de genomas humanos median-
tan las funciones del RNA y en conjunto se denomi- te el uso de microarreglos de hibridación genómica com-
nan SNP estructurales del RNA (rSNP). A partir de las parativa (CGH) se descubrió que muchas regiones gené-
investigaciones de SNP relacionados con rasgos/enfer- ticas presentan variación en el número de copias o CNV
medades en estudios de asociación del genoma comple- (más o menos de dos copias) y se amplió el espectro de
to o GWAS (Genome Wide Association Studies) se sabe las variantes estructurales y de las CNV para incluir a
que 9% del total de los SNP están en regiones codifi- eventos más pequeños (mayores de 50 pb).
cantes y son no sinónimos; 43% de los SNP se localizan
en regiones intergénicas; 49% son rSNP (incluyendo
2% de SNP sinónimos, 2% ubicados en regiones no tra-
ducidas 5 y 3 , y 45% de SNP intrónicos). Los grupos CNV
manual moderno Fotocopiar sin autorización es un delito.

de SNP vecinos en un mismo cromosoma se heredan


en bloques y este patrón de SNP en un bloque se Las CNV corresponden a segmentos de DNA, repetidos
conoce como haplotipo. Para caracterizar este tipo de en un número de copias bajo, de 1kb a varias megabases
variación en las poblaciones se desarrolló el proyecto de longitud que contienen secuencias codificantes y no
HapMap, el cual será mencionado en la parte final de codificantes. Las CNV constituyen al menos 12% del
este apartado. genoma humano y contribuyen más a la diversidad genó-
mica entre los individuos que los SNP, si se considera el
número de nucleótidos implicado (figura A1-1). Las
INDEL CNV pueden ser heredadas o pueden haber ocurrido de
novo en la persona cuyo genoma está siendo examinado.
Los polimorfismos de indel se encuentran en promedio Algunas pueden no causar problemas médicos, pero
cada 7.2 kb de DNA en el genoma humano y su tamaño aquéllas que incluyen regiones codificantes pueden aso-
puede ser de 1 a 10 000 nucleótidos que están elimina- ciarse con enfermedades monogénicas o dando suscepti-
dos o insertados en la secuencia de tipo silvestre. Su con- bilidad o resistencia a enfermedades complejas y modifi-
© Editorial El

tribución en la divergencia de la secuencia entre los cando la respuesta a fármacos. Cuando las CNV alteran
genomas humano y de chimpancé es mayor que la de los el número de copias de un gen presente también se les
cambios nucleotídicos (3% vs 1.2%). Se han identificado conoce como cambios en la dosis génica. La alteración en
más de 840 000 indel que afectan poco más de 7 000 la dosis génica puede ser de ganancia de función como

Biblioteca Médica Virtual


42 Genética clínica

consecuencia de la duplicación o multiplicación de uno PRINCIPALES BASES DE DATOS


o varios exones e incluso de gen(es) completo(s) en la PÚBLICAS PARA EL MANEJO DE DATOS
región que abarca la CNV; en contraste, los eventos de
deleción producen una pérdida de función. En resumen, DE VARIABILIDAD GENÉTICA
el cambio en la secuencia nucleotídica de un gen (SNP)
o en su número de copias (CNV) puede conducir a cam- A un decenio del PGH una gran cantidad de SNP, indel
bios en la secuencia de sus aminoácidos o en la cantidad y CNV comunes en el genoma humano están disponi-
de una proteína y alterar su acción enzimática, su estabi- bles en las bases de datos públicas. En la página electró-
lidad o su capacidad de unión a otras moléculas. El cua- nica de NCBI (National Center for Biotechnology
dro 1 contiene algunos ejemplos de variaciones de Information www.ncbi.nlm.nih.gov) se encuentra la base
secuencia y estructurales del genoma humano. de datos de SNP denominada dbSNP. Además de datos

Cuadro 1. Ejemplos de variaciones genéticas de secuencia y estructurales (SNP, indel y CNV) con variación fenotípi-
ca normal y algunas asociadas con fenotipo clínico
A. Ejemplos de rSNP
GEN/producto rs (dbSNP)/locus Posición/variante Elemento de Fenotipo Enfermedad
respuesta afectado asociada
CCR5 (Receptor 5 rs2734225 -208G/T NF B Sobreproducción de Progresión acelerada
de quimiocina con en 3p21.31 CCR5 a SIDA en linfocitos T
motivo C-C) humanos
DARC rs1800846 en -46C GATA-1 Pérdida de la Resistencia a la
(Antígeno Duffy) 1q21 a q22 expresión de DARC malaria por P. vivax
en eritrocitos en individuos de
raza negra
HBG2 SNP195 en 149C/T GATA-1 Ganancia de función Talasemia alfa en
(Globina α) 11p15.5 de un sitio GATA-1 y melanesios
pérdida de la
expresión de la
globina α
B. Ejemplos de SNP
TFR2 rs80338889 en 2110A/C [Q690P] NA Patogénico Hemocromatosis
(Receptor de la 7q22 Tipo III
transferrina)
APOE rs429358 en 388T/C [C112R] NA Probablemente Es un factor de riesgo
(Apolipoproteína E 19q13.2 patogénico para enfermedad de
alelo épsilon 4) Alzheimer
HFE (Gen de la rs1799945 en 187C/G [H63D] NA Probablemente Hemocromatosis
hemocrormatosis) 6p21.3 dañina
C. Ejemplos de indel
CYP17A1 (gen que -TTC en 10q24.3 157_159delTTC NA Deficiencia de Hipertensión
codifica para el [Phe53del] 17-alfa-hidroxilasa/
polipéptido 1 del 17, 20-liasa
citocromo P450,
familia 17,
subfamilia A)
DRD2 rs1799732 en -/C Indel -141 NA Afecta eficiencia de Anorexia nerviosa
(Receptor 2 de la 11q23 la transcripción del
dopamina) gen

moderno Fotocopiar sin autorización es un delito.


CAPN10 (Calpaína) En 2q37.3 Indel 19 NA ND Diabetes mellitus tipo II
D. Ejemplos de CNV
Tipo Variación en Tamaño
el número de
copias
RHD Deleción en 0a2 6 kb 0 CNV produce Sensibilidad al grupo
(Grupo sanguíneo 1p36 ausencia del sanguíneo Rhesus p.ej.
Rh) antígeno D anemia hemolítica del
recién nacido cuando el
feto es Rh (+) y la madre
es Rh (-)
CCL3L1/CCL4L1 VNTR en 0 a 14 ND Riesgo reducido de Susceptibilidad disminuida
(ligando 3/4 de 17q21.1 y q12, infección por virus para desarrollar SIDA
quimiocina con respectivamente de HIV
© Editorial El manual

motivo C-C, similar


al 1)
FCGR3 (fragmento Del/dupl en 0 a 14 >5 kb Glomerulonefritis Lupus eritematoso
Fc de IgG, receptor 1q23.3 sistémico y otras
III o CD16) enfermedades autoinmunes
NA: No aplica; ND: No determinado.

Biblioteca Médica Virtual


Anexo I 43
sobre SNP, contiene información de polimorfismos tipo SNP específicos que identifican los haplotipos se conocen
microsatélite e indel de pequeña escala. La dbSNP pro- como SNP etiqueta (tag SNP). Éstos SNP etiqueta reducen
vee información de frecuencias específicas por pobla- el número requerido de 10 millones SNP existentes a solo
ción, datos de genotipos, condiciones experimentales y 500 000 SNP en un GWAS para investigar un fenotipo.
ligas a mapas [http://www.ncbi.nlm.nih.gov/snp]. Otra Por ello, el HapMap es una herramienta que permite a los
base de datos que sirve para el almacenamiento central investigadores encontrar genes y variaciones genéticas que
de datos de variación genética humana es la HGV afectan los estados de salud y enfermedad en el humano
(Human Genome Variation database). Esta base de datos [www.hapmap.org].
provee datos de estudios de asociación, resume todas las El Proyecto de los 1 000 Genomas es una colabora-
variaciones de secuencia conocidas en el genoma huma- ción internacional que está en desarrollo y cuyo objetivo
no y facilita la investigación de cómo los genotipos afec- principal es producir un catálogo público de la variación
tan en enfermedades comunes, en la respuesta a fárma- genética humana (2 500 genomas de 25 poblaciones),
cos y en otros fenotipos complejos [http://www.gwas- incluyendo SNP y variantes estructurales, junto con sus
central.org]. haplotipos. Este recurso apoyará los GWAS y otros estu-
El proyecto internacional del HapMap es un mapa de dios de investigación médica. Los investigadores también
haplotipos del genoma humano y fue posible gracias a la podrán estudiar recombinación, selección natural, así
elucidación de nuestro genoma completo. Los bloques de como estructura y mezclas de poblaciones en este catá-
haplotipos pueden contener una gran cantidad de SNP, logo [http://www.1000genomes.org/]. El cuadro 2 resu-
aunque sólo algunos pueden ser suficientes para identificar me los principales navegadores y bases de datos públicas
de manera inequívoca los haplotipos de un bloque. El que proporcionan información relevante de las distintas
HapMap es un mapa de estos bloques de haplotipos y los clases de variaciones genéticas.

Cuadro 2. Principales navegadores y bases de datos (BD) públicas que contienen información relevante
de las distintas clases de variaciones genéticas
Base da datos Dirección electrónica de la página Descripción
Navegador de genomas http://genome.ucsc.edu/ Este sitio contiene secuencias de referencia y ensamblados
de la UCSC (University en borrador para una gran colección de genomas. También
of California, Santa provee portales para la Enciclopedia de los Elementos de
Cruz) DNA (ENCODE) y Proyectos del Neandertal
Navegador de los http://www.ncbi.nlm.nih.gov/ Es una de las BD biomédica más completa para una gran
Institutos Nacionales de colección de genomas. Contiene sistemas de
Salud de los EUA, NCBI almacenamiento y herramientas de análisis para biología
(The National Center for molecular, bioquímica y genética
Biotechnology
Information)
Instituto Europeo de http://www.ebi.ac.uk/ Consorcio internacional que provee datos genómicos de
Bioinformática, parte diversos organismos, junto con una batería de herramientas
de los Laboratorios de de bioinformática
Biología Molecular
Europeos (EMBL-EBI)
Navegador ENSEMBL http://www.ensembl.org/ ENSEMBL es un proyecto de unión entre EMBL - EBI y el
Instituto Wellcome Trust Sanger para desarrollar un sistema
que produce y mantiene anotaciones de genomas de
manual moderno Fotocopiar sin autorización es un delito.

eucariontes seleccionados
BD de desbalances http://www.sanger.ac.uk/PostGenomics/decipher/ Esta BD contiene información de desbalances cromosómicos
cromosómicos y fenotipo submicroscópicos, reúne toda la información clínica
en humanos, empleando relacionada con microdeleciones/duplicaciones/inserciones,
recursos de ENSEMBL, translocaciones e inversiones y la despliega en el mapa del
DECIPHER genoma humano
Proyecto de la variación http://www.sanger.ac.uk/humgen/cnv/ Proyecto dirigido por el Instituto Sanger que incluye datos
en el número de copias de CNV en humano, obtenidos mediante nuevas tecnologías
de secuenciación, análisis de microarreglos, citogenética,
genética de poblaciones, genómica comparativa y
bioinformática
Base de datos de http://projects.tcag.ca/variation/ Catálogo curado de variación estructural (CNV, indel) en el
variantes genómicas genoma humano
Consorcio Wellcome http://www.wtccc.org.uk Identifica variaciones de secuencia que tienen influencia
Trust de casos sobre las causas principales de morbi-mortalidad en el
controles humano a través de GWAS (Genome Wide Association
Studies)
© Editorial El

NIEHS SNP http://egp.gs.washington.edu BD de SNP que se enfoca a relaciones entre exposiciones


ambientales, variaciones de secuencia inter-individuales en
genes humanos y riesgo a enfermedades en poblaciones de
los EUA

Biblioteca Médica Virtual


44 Genética clínica

al.: Natural genetic variation caused by small insertions


BIBLIOGRAFÍA and deletions in the human genome. Genome Research
2011. doi/10.1101/gr.115907.110.
Chen FC, Chen CJ, Li WH, Chuang TJ: Human-specific inser- Mullaney JM, Mills RE, Pittard WS, Devine SE: Small inser-
tions and deletions inferred from mammalian genome tions and deletions (INDELs) in human genomes. Human
sequences. Genome Research 2007;17:16-22. Molecular Genetics 2010;19;R2:131-136.
Eichler EE et al.: Nature 2007;447:161–165. Ng PC, Samuel Levy, Jiaqi Huang, Timothy B. Stockwell, Brian
Henrichsen CN, Chaignat E, Raymond A: Copy number P. Walenz et al.: Genetic Variation in an Individual
variants, diseases and gene expression Human Molecular Human Exome. PLOS Genetics 2008;4:8:1-15.
Genetics 2009;18:R1–R8. Venter JC, Adams MD, Myers EW, Li PW, Richard J et al.: The
Hernández-Romano J, Martínez-Barnetche J, Valverde- sequence of the human genome. Science 2001;291:1304-1351.
Garduño V: Polymorphisms in gene regulatory regions and Wain LV, Pedroso I, Landers JE, Breen G, Shaw CE, Leigh PN,
their role in the physiopathology of complex disease in the Brown RH, Tobin MD, Al-Chalabi A: The role of copy
post-genomic era. Salud Publica Mex 2009;51 suppl number variation in susceptibility to amyotrophic lateral
3:S455-S462. sclerosis: genome-wide association study and comparison
Lander ES, Linton LM, Birren B, Nusbaum C et al.: Initial with published loci. PLoS One 2009;4(12):e8175.
sequencing and analysis of the human genome. Nature Wheeler DA, Srinivasan M, Egholm M, Shen Y, Chen L et al.:
2001;409:861-921. The complete genome of an individual by massively para-
Mills RE, Pittard WS, Mullaney JM, Farooq U, Creasyet TH et llel DNA sequencing. Nature 2008;452:872-877.

manual moderno Fotocopiar sin autorización es un delito.


© Editorial El

Biblioteca Médica Virtual


ANEXO II
DNA mitocondrial humano:
polimorfismo y variabilidad en las poblaciones

Rosenda I. Peñaloza Espinosa, Ricardo M. Cerda Flores

El genoma mitocondrial (mtDNA) fue descrito por pri- Los datos obtenidos permitieron realizar filogenias
mera vez por Nass y Nass en 1963, secuenciado por moleculares comparando segmentos homólogos, dentro
Anderson et al., en 1981 y revisado por Andrews et al., de una misma población, o entre poblaciones de una
1999. El mtDNA presenta varios polimorfismos de un misma especie. Las relaciones filogenéticas entre pobla-
solo nucleótido (SNP) en la secuencia codificante y dos ciones se representan por árboles filogenéticos que con-
regiones altamente polimórficas (HV1 y HV2) que sisten en nodos conectados por ramas.
corresponden a nucleótidos -nt- 16090-16362 y 76-340, Existen diferentes procedimientos para la reconstruc-
respectivamente), ubicadas en la región control, (asa D o ción filogenética, y uno de los más utilizados es el de
“D-loop”). De acuerdo con Ford (1940) un polimorfis- “máxima parsimonia” o de “evolución mínima” que signi-
mo es la presencia de dos o más formas alélicas de un gen fica que la evolución ocurre de manera que los cambios
donde la más rara tiene una frecuencia mayor a 1% en la en los nucleótidos son igualmente probables en todas las
población general y no alteran la función génica. posiciones, lo que significa que el árbol elegido es el que
Utilizando la técnica de RFLP, diferentes investigado- requiere el mínimo número de mutaciones para explicar
res mostraron diferencias en patrones de sitios polimór- la distribución de los caracteres entre los individuos a
ficos a los que se denominó haplogrupos e informaron estudiar.
que son específicos de las poblaciones en todos los con- Uno de los primeros estudios de análisis de variabili-
tinentes. En África, de 70 a 100% de las poblaciones del dad mitocondrial en poblaciones humanas fue el de
subsahara están representadas por el haplogrupo L y sub- Cann et al., (1987), quienes analizaron individuos de
tipos. En Asia y Siberia los mtDNA pertenecen a los Asia, Australia, Nueva Guinea, Europa y África encon-
haplogrupos C, D, G y E, que son miembros de los trando resultados que les permitieron formular la hipó-
haplogrupos M, mientras que para el resto de Asia los tesis de la “Eva mitocondrial” donde resaltaron tres
haplogrupos son A, B, F, X6 y X7. En Europa, 99% del aspectos principales:
mtDNA pertenece a los 10 haplogrupos (H, I, J, K, M, T,
U, V, W y T) y en nativos de América sólo cinco haplo- 1. Que todos los tipos de mtDNA actuales se remontan a
grupos de Asia son observados (A, B, C, D y X). La des- un ancestro único.
cripción detallada de todos estos haplogrupos se observa 2. Que este ancestro es de origen africano.
en el cuadro 1. 3. Que surgió hace alrededor de 200 000 años.
moderno Fotocopiar sin autorización es un delito.

En México se han realizado estudios tanto en pobla-


ciones indígenas (Peñaloza-Espinosa et al., 2007; Esta interpretación está basada en el principio de coales-
Sandoval et al., 2009; Kemp et al., 2010; Moran et al., cencia que asume la existencia de un solo origen para todos
2011) como mestizas mexicanas (Green 2000; los organismos vivos, por lo que la variación en cualquier
Guardado-Estrada 2009) encontrando una amplia varia- segmento del DNA mitocondrial (o nuclear) en las genera-
ción entre ellas que va de 30 a 87.5% para el haplogru- ciones presentes deben proceder en última instancia de un
po A, de 14 a 53% para el B, de 0 a 31% para C y de 0 a único ancestro que existió en generaciones previas. Tal
12% para el D. El haplogrupo X se informó en dos ancestro femenino fue miembro de la población donde el
poblaciones (Peñaloza-Espinosa et al., 2007) y al hacer la resto de los linajes mitocondriales se fueron perdiendo con
secuenciación sólo se corroboró uno de ellos el paso de las generaciones, y sólo representa el punto
(Tarahumara). En cuanto a haplogrupos europeos y afri- donde los linajes convergen. Tal hipótesis ha sido muy con-
canos, éstos se observaron en baja proporción en pobla- trovertida debido a los métodos de reconstrucción filoge-
ciones indígenas y mayor en mestizas (cuadro 2). nética; sin embargo, ha servido de apoyo a otros estudios
© Editorial El manual

Estudios recientes de secuenciación completa del tanto de análisis de mtDNA como de otros marcadores
mtDNA demostraron que en América sólo se encuen- nucleares. Más tarde esta teoría fue apoyada por otros
tran los haplogrupos A2, B2, C1 y D1 (Achili et al., autores, y se realizaron otros estudios en diferentes pobla-
2009; Sandoval et al., 2009; Kemp et al., 2010). ciones de los cinco continentes incluyendo las amerindias.

45

Biblioteca Médica Virtual


46 Genética clínica

Cuadro 1. Haplogrupos del mtDNA humano


0h
Haplotipo Sitio Oligonucleótidos Población
Región control Polimórfico (sentido,
F
T antisentido)
Cyt b
V RNA12S A +663 HaeIII 534 a 553, América, Asia
725 a 706
RNA16S cadena H B 9pb-deleción 8 150 a 8 166, América, Asia
P 8 366 a 8 345
L C +13 262 AluI 13 197 a 13 213, América, Asia
E 13 403 a 13 384
ND1 ND5 D -5 176 AluI 5 151 a 5 170, América, Asia
I 5 481 a 5 464
Q L X -663 HaeIII 534 a 553, Asia, América
M
A S 725 a 706
ND2 N cadena L H +13 262 AluI 13 197 a 13 213,
C 13 403 a 13 384
W Y ND4 +5 176 AluI 5 151 a 5 170,
B
5 481 a 5 464
ND4L
0L COI +10 397 AluI 10 270 a 10 290,
R 10 579 a 10 557
COIII ND3 E -7 596 HhaI 7 367 a 7 384, Asia
D COII G
9 172 a 9 154
K ATPasa6 F -1 206 HincII 16 453 a 16 472, Asia
ATPasa8 1 696 a 1 677
G +4 830 HaeIII 3 108 a 3127, Asia
5 917 a 5 898
Figura 1. Representación esquemática del mtDNA. En la región con- H -7 025 AluI 6 890 a 6 999, Europa
trol están las regiones más polimórficas, además del origen de repli- 7 131 a 7 115
cación de la cadena pesada (OH), el origen de la transcripción de la I -1 715 DdeI 1 615 a 1 643, Europa
cadena pesada (HSP) y de la ligera (LSP). El origen de replicación 1 894 a 1 874
de la cadena ligera (OL) se encuentra entre la secuencia de los tRNA +8 249 AvaII 8 188 a 8 207,
N y C. Las proteínas ND-1 a ND6 incluyendo ND4L son del comple- 8 366 a 8 345
jo I, Cyp-b del complejo III, COI, COII del complejo IV y dos subuni-
+10 028 AluI 9 911 a 9 932,
dades de la ATPasa6y8 del Complejo V. Los tRNA están representa- 10 107 a 10 088
dos por las letras P, T, E, L, S, H, R, G, B, K, D, A, N, C, Y, W, I, Q,
J -13 704 BstOI 13 583 a 13 605, Europa
M, L, V y F.
13 843 a 13 824
K -9 052 HaeII 8 829 a 8 845, Europa
9 184 a 9 163
Por ejemplo, en África se encuentran distintos haplogrupos
+12 308 HinfI 12104-12124, 12338-
donde el L es el más frecuente con subgrupos L1, L2 y L3. 12309
En Europa y Asia son frecuentes los haplogrupos M y N L +3 592 HpaI 3 388 a 3 408, Africa
que se originaron en el este de África y a continuación se 3 717 a 3 701
dispersaron a los diferentes continentes sobre todo a Asia, M* +10 397 AluI 10 270 a 10 290, América, Asia
Europa. En europeos en general (caucásicos), también son 10 579 a 10 557
frecuentes los haplogrupos H, I, J, N1b, T, U, V y W, mien- T +13 366 13 172 a13 190, Europa
tras en la región siberiana predominan los haplogrupos G, BamHI 13 403 a 13 384
Y y Z y en América los más frecuentes son los haplogrupos +15 606 AluI 15 409 a 15 428,
A2, B2, C1, D1 y X originados en Asia. 15 701 a 15 682
El análisis de componentes principales (PCA) así U +12 308 HinfI 12 104 a 12 124, Europa

moderno Fotocopiar sin autorización es un delito.


12 338 a 12 309
como la construcción de redes son herramientas para
V -4 577 NlaIII 4 308 a 4 325, Europa
hacer estudios poblacionales (figura 2). 4 739 a 4 720
Por otra parte, se ha informado de una correlación entre W +8 249 AvaII 8 188 a 8 207, Europa
los haplotipos mitocondriales con el lenguaje en algunas 8 366 a 8 345
poblaciones como las europeas, pero no en otras como las -8 994 HaeIII 8 829 a 8 845,
amerindias donde sólo correlaciona con la región ya que la 9 184 a 9 163
llegada de españoles y africanos en la época de la colonia X -1 715 DdeI 1 615 a 1 643, Europa
cambió la historia (Sandoval et al. 2009; Kemp et al., 2010), 1 894 a 1 897
datos que correlacionan con otros marcadores autosómicos *Mestizos = C + D + E + G.
Tomado de www.mitomap.org
y del cromosoma Y (Cerda-Flores et al., 2002 a y 2002b;
Buentello et al., 2005 y 2008; Guardado-Estrada et al.,
2010; Gorostiza y González-Martin 2010). mutaciones acumuladas en los linajes de mtDNA (Álva-
© Editorial El manual

Las secuencias fundadoras han divergido a medida rez-Iglesias 2005).


que los grupos humanos se establecieron en las distintas De acuerdo a los resultados informados, podemos con-
regiones geográficas del mundo como lo demuestran los cluir que el Homo sapiens tiene un origen de alrededor de
haplogrupos mitocondriales específicos de cada conti- 200 000 años donde las poblaciones más antiguas son sub-
nente (figura 2). De esta manera ha sido posible rastrear saharianas caracterizadas por variantes del macro-haplo-
la historia de las poblaciones humanas a través de las grupo L. De ahí salieron a Eurasia hace cerca de 80 000

Biblioteca Médica Virtual


Anexo II 47
Cuadro 2. Porcentaje promedio de haplotipos de mtDNA en poblaciones mexicanas
Haplogrupo Peñaloza Sandoval Kemp Moran Green Guardado
et al. 2007 et al. 2009 et al. 2010* et al. 2011 et al. 2000 et al. 2010
A 51.2 50.5 49.0 42.7 33.6 51.1
B 28.8 17.6 28.0 23.6 26.5 17.8
C 11.1 28.5 17.1 20.4 23.3 18.5
D 5.3 2.7 5.6 4.5 5.8 5.9
Africano 0.6 0 0.2 - 4.5 0.7
Europeo 0 0 0.1 - 5.4 6.0
Desconocido 0 0.6 0 8.8 0.9 0
N ind./n pob 513/11 477/11 597/11* 110/2 223/2 270/17
N ind.=número de individuos en número de poblaciones. *Sólo se tomó en cuenta a las poblaciones mexicanas.

15 000

C+D A* 7 000-
A X
H,T,U,V,W,X 9 000
G A,C,D
I,J,K +/- -/- A*
B B 26 000-
40 000- 12 000- 34 000
50 000 +/+ 15 000
N F
+/- M
L3
L1
L2
60 000-
130 000- 70 000
170 000 A,C,D
70 000
B

+/-, +/+, o -/- = Dde l 10394 /Au l 10397 Tasa de mutación = 2.2 - 2.9 % / MYR
*=Rsa l 16329 Las estimaciones de tiempo son YBP

Figura 2. Representación de las migraciones humanas a través del mtDNA. (Adaptado de www.mitomap.org).

años por el estrecho de Omán hasta llegar a Australia y Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN,
Nueva Guinea en migraciones independientes. Otro grupo Turnbull DM, Howell N: Reanalysis and revision of the
pobló Asia hace 50 000 años aproximadamente, quienes Cambridge reference sequence for human mitochondrial
llegaron a través de los grandes ríos (modelo centrípeto de DNA. Nat Genet 1999;23:147.
expansión). Más tarde (45 000 años) se establecieron en Buentello ML, Peñaloza ERI, Salamanca GF, Cerda FRM:
Europa occidental donde es frecuente el haplogrupo U5 y Genetic admixture of eight Mexican indigenous popula-
tions: based on five polymarkers, HLA-DQA1, ABO, and
manual moderno Fotocopiar sin autorización es un delito.

otras variantes que hacen suponer un segundo doblamien-


RH loci. Am J Hum Biol 2008;20:647-650.
to hace 31 000 años. El Continente Americano se pobló Cerda FRM, Budowle B, Jin L, Barton SA, Deka R,
con grupos humanos procedentes de Asia hace cerca de 18 Chakraborty R: Maximum likelihood estimates of admix-
000 años y por último llegaron las islas del pacífico hace ture in Northeastern Mexico using 13 short tandem repe-
cerca de 8 000 años (Gorostiza y González-Martín, 2010). at loci. Am J Hum Biol 2002b;14:429-443.
Estos estudios han sido utilizados también en medicina Cerda FRM, Villalobos TMC, Barrera SHA et al.: Genetic
forense y relacionados con diversas patologías humanas. admixture in three mexican mestizo populations based on
D1S80 and HLA-DQA1 loci. Am J Hum Biol
2002a;14:257-263.
BIBLIOGRAFÍA Gorostiza A, González MA: Historia Natural del ADN mito-
condrial humano. En: Fósiles y moléculas. Aproximaciones
a la historia evolutiva de Homo sapiens. Antonio
Achilli A, Perego UA, Bravi CM et al.: The phylogeny of the González-Martín (Editor). Memorias de la Real Sociedad
four pan-American MtDNA haplogroups: implications for española de Historia Natural, Segunda época, Tomo VIII,
evolutionary and disease studies. PLoS ONE 2008; año 2010. ISSN: 1132-0869. ISBN: 978-84-936677-5.
3(3):e1764. Kemp BM, González OA, Malhi RS, Monroe C et al.:
© Editorial El

Álvarez IV, Mosquera MA, Cerezo M et al.: New Population Evaluating the Farming/Language Dispersal Hypothesis
and Phylogenetic Features of the Internal Variation within with genetic variation exhibited by populations in the
Mitochondrial DNA Macro-Haplogroup R0. PLoS ONE Southwest and Mesoamerica. Proc Natl Acad Sci USA
2009;4(4):e5112. doi:10.1371/journal.pone 2010;107:6759-6764.

Biblioteca Médica Virtual


48 Genética clínica

Morán BV, Peñaloza ERI, Castro SE et al.: Genetic structure of mtDNA haplogroups in 14 Mexican indigenous popu-
of three Native Mexican communities based on mtDNA lations. Hum Biol 2007;79:313-320.
haplogroups, and ABO and Rh blood group systems. RIC Sandoval K, Buentello ML, Peñaloza ER et al.: Linguistic and
2011 (En prensa). maternal genetic diversity are not correlated in Native
Peñaloza ERI, Arenas AD, Cerda FRM et al.: Characterization Mexicans. Hum Genet 2009;126:521-531.

manual moderno Fotocopiar sin autorización es un delito.


© Editorial El

Biblioteca Médica Virtual


ANEXO III
Fundamentos y aplicaciones de las principales
técnicas de diagnóstico molecular en
enfermedades mendelianas
Miguel Ángel Alcántara Ortigoza, Ariadna Estela González del Ángel, José Velázquez Aragón

La biología molecular, rama de la biología que se encar- enfermedad. Más aún, el genotipo podría predecir la
ga del estudio de las moléculas que contienen informa- respuesta terapéutica a nuevos fármacos como la
ción biológica, ha revolucionado en los últimos tres sapropterina, un cofactor enzimático que actúa tam-
decenios el diagnóstico de enfermedades mendelianas. El bién como molécula chaperona de la enzima fenila-
desarrollo y simplificación de las técnicas para la identi- lanina-hidroxilasa (PAH), y cuya administración a
ficación de mutaciones en genes causantes de estas pato- pacientes con fenilcetonuria (MIM #261600) con al
logías, ha llevado a que cada vez sea mayor el número de menos un alelo PAH p.Arg261Glu, les predice un
laboratorios en los que se realiza el diagnóstico molecu- mejor control de las concentraciones sanguíneas de la
lar como un proceso sistemático y a un costo cada vez fenilalanina con una dieta menos restringida. Por últi-
más accesible. El estudio por biología molecular de un mo, el genotipo puede en ocasiones predecir o expli-
paciente con una entidad mendeliana permite en car el modo de herencia esperado para una misma
muchos de los casos: enfermedad, como en las β-talasemias donde muta-
ciones amorfas ubicadas en el promotor o los
a) Establecer un diagnóstico certero en entidades donde se primeros dos exones del gen de la β-globina se here-
dificulta el diagnóstico clínico y de laboratorio/gabinete; dan de forma autosómica recesiva, mientras que algu-
por ejemplo, en la enfermedad de Alzheimer (MIM nas de las mutaciones antimorfas o con efecto domi-
#607822) de inicio temprano, el síndrome de Rett (MIM nante negativo ubicadas en el exón 3, se manifiestan y
#312750) o el grupo extenso de las ataxias espinocere- heredan de forma autosómica dominante.
belosas.
b) La identificación inequívoca de individuos portado- La gama de aplicaciones y utilidades del estudio molecular
res, en especial en trastornos autosómico recesivos en este tipo de pacientes es muy vasta, por lo que a conti-
como fibrosis quística o ligados al cromosoma X nuación se describirán de forma breve los fundamentos de
como la hemofilia A. las técnicas moleculares más empleadas y se ejemplificará
c) Proporcionar diagnóstico prenatal a parejas con un su aplicación con un trastorno monogénico en particular.
alto riesgo de recurrencia para una entidad mortal o
limitante de la supervivencia como en la atrofia mús-
culo espinal tipo I, el síndrome de Hunter o en la dis- Obtención de la muestra
moderno Fotocopiar sin autorización es un delito.

trofia muscular de Duchenne.


d) Establecer un diagnóstico presintomático en sujetos Para la realización de las pruebas moleculares es necesa-
que presentan el genotipo de riesgo, pero que aún no ria la purificación de los ácidos nucleicos a analizar. Por
muestran manifestaciones clínicas y en los cuales se lo general la molécula de elección es el DNA, ya que en
puede establecer un manejo preventivo, tal y como ella se pueden identificar en la mayoría de los casos los
ocurre en los síndromes de cáncer familiar como la cambios o mutaciones responsables de una patología.
neoplasia endócrina múltiple tipo 2 (MIM #162300 y Cualquier célula nucleada como leucocitos totales de
#171400), el carcinoma de mama y ovario familiar sangre periférica con anticoagulante EDTA o ACD, célu-
(MIM #612555 y #604370) o el síndrome de Lynch las de descamación de mucosa oral, tejidos embebidos en
tipo I (MIM ##120435). parafina, gotas de sangre seca depositadas en papel filtro,
e) Correlacionar el genotipo presente en el paciente con amniocitos o biopsias de vellosidades coriales son fuen-
el fenotipo esperado, como ocurre en la glucogenosis tes de DNA genómico para la realización de análisis
tipo II o enfermedad de Pompe (MIM #232300), en moleculares.
© Editorial El manual

la cual los afectados con un genotipo heterocigoto En algunos casos, cuando se requiere analizar el efec-
compuesto del gen GAA con una mutación grave y to de una mutación que altera el procesamiento del
una leve como la mutación intrónica leve c.-32- RNA o la expresión del gen, se requiere analizar el trans-
13T>G, presentan un fenotipo atenuado o tardío de la crito maduro o mRNA. Para la obtención del mRNA de

49

Biblioteca Médica Virtual


50 Genética clínica

interés se requiere una muestra de tejido idealmente no cia complementaria a los extremos de la secuencia géni-
fijado y fresco en donde el gen mutado se exprese, siem- ca de interés. La reacción de PCR se lleva a cabo por
pre y cuando la toma de muestras sea lo menos invasiva medio de una serie de cambios de temperatura progra-
y riesgosa posible y evaluando el costo-beneficio de la mados de forma automática en un equipo denominado
realización de la prueba molecular. Una vez purificado el termociclador, los cuales permiten los pasos requeridos
mRNA es convertido a DNA complementario o cDNA para la amplificación del fragmento de interés (figura 1).
por un procedimiento conocido como retrotranscrip- El ciclo de temperaturas se repite entre 25 a 35 veces y
ción. El cDNA generado es idéntico a la secuencia del dado que en cada ciclo se produce el doble de la cantidad
gen presente en el mRNA maduro (sólo exones). Este de copias de DNA que existían originalmente, al final de
cDNA es más estable que el RNA y puede ser analizado la reacción se obtienen billones de moléculas de la región
mediante las mismas técnicas que el DNA genómico. de DNA de interés a partir de cada molécula de DNA
original (235 = 3.4 x 1010 copias al final de la PCR). El
hecho de que la DNA polimerasa sintetice sólo la región
Reacción en cadena de la polimerasa flanqueada por los cebadores permite obtener fragmen-
(PCR) tos muy específicos y aislados del resto del genoma y que
son de interés para el diagnóstico molecular.
La reacción en cadena de la polimerasa o PCR (polyme- La técnica de PCR es sencilla y requiere poco tiempo para
rase chain reaction) es una técnica que conlleva la ampli- su realización. Para llevarla al cabo es necesario conocer la
ficación in vitro de una secuencia especifica de DNA. secuencia del fragmento de DNA que se planea amplificar,
Esta técnica fue desarrollada por Kary Mullis en 1983 y situación que ya no es una limitante gracias a la finalización
su impacto en la investigación genética fue inmediato del Proyecto del Genoma Humano; así, de acuerdo a ello, se
dado que permite amplificar millones de veces y de pueden diseñar los cebadores idóneos a través de diversos
manera dirigida una secuencia específica del genoma. La programas de cómputo disponibles en línea (GeneFisher:
PCR es uno de los pasos iniciales en muchas técnicas que http://bibiserv.techfak.uni-bielefeld.de/genefisher2/
en la actualidad se emplean de forma sistemática en la o PrimerBLAST: http://www.ncbi.nlm.nih.gov/tools/primer-
identificación de mutaciones génicas, como son la blast/index.cgi?LINK_LOC=BlastHomeAd). A continuación
secuenciación automatizada tipo Sanger y la amplifica- se describen los fundamentos de tres técnicas basadas en
ción múltiple de sondas ligadas o MLPA, las cuales se PCR para identificación de mutaciones responsables de
describen más adelante. enfermedad y un ejemplo de su aplicación en el abordaje
La técnica de PCR requiere una mezcla de reacción que diagnóstico de una entidad monogénica.
contiene: una solución amortiguadora, un cofactor enzimá-
tico como el cloruro de magnesio, una DNA polimerasa
DNA-dependiente termoestable (Taq polimerasa), una Fragmentos de restricción de longitud
mezcla equimolar de desoxirribonucleótidos trifosfato de polimórfica (RFLP) por PCR y ensayo de
adenina, guanina, citosina y timina, así como dos moléculas restricción (PCR-RFLP)
de oligonucleótidos de cadena sencilla de 16 a 24 nucleóti-
dos de longitud o cebadores, los cuales delimitan el frag- La determinación de los fragmentos de restricción de
mento que se desea amplificar, ya que contienen la secuen- longitud polimórfica, RFLP (restriction fragment lenght

Primer ciclo
Segundo ciclo

moderno Fotocopiar sin autorización es un delito.


Secuencia de
interés en DNA 5´ 3´ 5´ 3´
de doble cadena
5´ 3´ 3´ 5´

3´ 5´ 5´ 3´

3´ 5´ 3´ 5´

Desnaturalización Alineación Extensión


94° C 52-63° C 72°C
© Editorial El manual

Figura 1. Etapas de la PCR. Cada ciclo está compuesto por tres temperaturas llamadas de desnaturalización, alineación y extensión. La tem-
peratura de desnaturalización (95°C) permite que el DNA de doble cadena se separe en dos cadenas sencillas de DNA. La temperatura de ali-
neación permite la unión de los cebadores a sus cadenas complementarias, formando así regiones de DNA de doble cadena con un extremo
3’ libre. La temperatura de alineación es variable y está determinada por la secuencia de los cebadores. La temperatura de extensión (72°C)
es en donde se lleva a cabo la síntesis de las nuevas cadenas por una DNA polimerasa. En la actualidad se utilizan DNA polimerasas termo-
estables, como la Taq DNA polimerasa que es obtenida del microorganismo termofílico Thermus aquaticus, las cuales soportan varios ciclos
con temperaturas >90º C sin perder ostensiblemente su actividad catalítica.

Biblioteca Médica Virtual


Anexo III 51
polymorphism) por PCR y ensayo de restricción, es una sentido erróneo (p.Pro250Arg) que ocurre en el gen
de las técnicas más sencillas para el reconocimiento de FGFR3 (4p16.3) (figura 2).
mutaciones puntuales, deleciones o inserciones peque-
ñas previamente identificadas en una secuencia de Secuenciación
DNA. Esta técnica utiliza a las endonucleasas de res-
tricción de origen bacteriano, las cuales tienen la capa- La secuenciación de DNA es el método que permite
cidad de escindir los enlaces fosfodiéster de una molé- conocer el orden preciso que guardan los nucleótidos en
cula de DNA de doble cadena al reconocer una una secuencia específica de DNA. Para la detección de
secuencia palindrómica específica de entre 6 a 8 nucle- mutaciones es importante identificar cambios en la
ótidos de longitud. Existe una gran variedad de enzi- secuencia de estos nucleótidos con respecto a una
mas de restricción y cada una reconoce una secuencia secuencia de referencia de esa región o gen específico y
blanco específica para generar el corte. El sitio de res- poder determinar si esos cambios son responsables de
tricción puede estar presente o ausente en la secuencia una alteración en la proteína que explique la patología.
de DNA normal o bien generarse o perderse por la Han existido diferentes métodos para obtener la secuen-
presencia de una mutación, lo que determina el patrón cia nucleotídica de una región genómica y en la actuali-
de restricción de los RFLP. Para la implementación de dad existen metodologías con capacidad para obtener
esta técnica, la mutación conocida debe localizarse en secuencias de millones de nucleótidos en una sola reac-
un sitio de restricción reconocido por la enzima selec- ción. Sin embargo, la técnica desarrollada por Sanger en
cionada. Es importante conocer el patrón de restric- su versión automatizada es considerada como el estándar
ción o corte presente tanto en la secuencia normal, de referencia para definir un cambio a nivel de DNA y
como en la mutada para la interpretación de los geno- por ende para el diagnóstico certero de múltiples trastor-
tipos con base a los RFLP resultantes. El ejemplo de nos mendelianos que se caracterizan por una hetero-
enfermedad que podría diagnosticarse certeramente a geneidad alélica amplia donde predominan las mutacio-
través de la técnica de PCR-RFLP, sería una forma sin- nes puntuales, o pequeñas inserciones/deleciones, tal y
dromática de craneosinostosis coronal autosómica como ocurre en los síndromes de cáncer de mama y ova-
dominante o síndrome de Muenke (MIM #602849) rio familiar (MIM #612555, #604370) ligados a los
condicionada en el 100% de los casos por un estado genes BRCA1 y BRCA2, la esclerosis tuberosa (MIM
heterocigoto para la mutación puntual c.749G>C de #191100, #613254), la poliquistosis renal del adulto

Figura 2. Identificación del genotipo heterocigoto para la mutación


c.749C>G (p.Pro250Arg) en el gen FGFR3 mediante PCR-RFLP
en un caso familiar de síndrome de Muenke con expresividad varia-
ble y penetrancia incompleta. El caso índice (II-2) acudió por crane-
osinostosis bicoronal; su hermano (II-1) es tratado por hidrocefalia,
I pero no presenta craneosinostosis y II-3 se refería sana. Ambos
padres no tenían antecedentes de craneosinostosis en ellos, ni en
otros familiares. Así, ante la ausencia de antecedentes familiares de
1 2 craneosinostosis, se indico el estudio molecular para distinguir entre
una forma esporádica de craneosinostosis coronal (~85% de los
casos) o la forma autosómica dominante del síndrome de Muenke. El
diagnóstico molecular de este último, puede establecerse mediante
la amplificación por PCR de un fragmento de 337 pares de bases
II (pb), que incluye al exón 7 (191 pb) y 196 pb del intrón adyacente del
gen FGFR3. El producto de la PCR se restringe con la endonuclea-
sa NciI para su posterior análisis por electroforesis en un gel de aga-
manual moderno Fotocopiar sin autorización es un delito.

rosa. Los alelos normales presentan un único sitio de corte, lo cual


da lugar a un fragmento de 214 pb y otro de 123 pb (carril NL), mien-
1 2 3 tras que la presencia en estado heterocigoto de la mutación
p.Pro250Arg (c.749C>G) crea un segundo sitio de restricción, dando
MPM 1-2 II-1 II-2 II-3 I-1 (+) NL lugar a un fragmento adicional de 151 pb presente en el control posi-
tivo para la mutación en estado heterocigoto [carril (+)]. Nótese que
I-2 es heterocigota para la mutación y ésta la heredó a sus tres hijos,
sin embargo en II-3 no se lograron documentar dismorfias u otras
alteraciones neurológicas, esqueléticas o auditivas compatibles con
300 pb el síndrome, excepto por braquidactilia a expensas de falanges
214 pb medias cortas. En tanto, en I-2, II-1 y II-2 presentan dismorfias des-
200 pb 151 pb critas en este síndrome, tales como hipertelorismo, fisuras palpebra-
123 pb les dirigidas hacia abajo, ptosis palpebral y asimetría facial. Las dis-
100 pb
morfias faciales en I-2, II-1 y II-2, la hidrocefalia (poco frecuente en
este síndrome) y ausencia de craneosinostosis en II-1 y I-2, se expli-
can por la expresividad variable descrita en esta entidad. El resulta-
do es de suma importancia para el asesoramiento genético de esta
© Editorial El

familia, pues los afectados de esta forma autosómica dominante, tie-


nen un riesgo del 50% de transmitir el padecimiento a su descenden-
cia, independiente del sexo. Carril MPM: Marcador de pesos molecu-
lares, escalera de 100 pares de bases (pb).

Biblioteca Médica Virtual


52 Genética clínica

(MIM #173900), la hipercolesterolemia familiar (MIM facilita y se optimiza la obtención y certeza de los
#143890), neurofibromatosis tipo I (MIM #162200), resultados.
hemofilias tipos A (MIM #306700) y B (MIM #306900), Por otro lado, la automatización del procedimiento de
los síndromes de Marfan (MIM #154700), Wiskott-Aldrich secuenciación de DNA ha permitido que un genotipo
(MIM #301000), CHARGE (MIM #214800), Fabry (MIM patogénico pueda ser identificado en pocas horas, en
#301500), Hunter (MIM #309900), entre otros. especial cuando la mutación se ha caracterizado previa-
El método de secuenciación tipo Sanger se basa en la mente en una familia, ya sea en un individuo afectado o
interrupción de la síntesis de una nueva cadena de DNA en un portador, lo cual permite su aplicación al diagnós-
por métodos químicos utilizando como molde una cadena tico prenatal molecular de entidades mendelianas, tal y
sencilla de la región de la cual se desea obtener la secuen- como se ilustra con un caso familiar de la mucopolisaca-
cia. En un principio está técnica era laboriosa, empleaba ridosis tipo II o síndrome de Hunter (figura 5).
isótopos radioactivos y su resolución era limitada a secuen- Es importante mencionar que la secuenciación auto-
cias cortas de DNA, aunque en la actualidad la técnica se matizada tipo Sanger no es capaz de identificar estados
ha podido automatizar gracias al uso de equipos conocidos heterocigotos para deleciones y duplicaciones muy gran-
como secuenciadores capilares y a la incorporación de cua- des (del orden de kilobases o megabases), como ocurre
tro distintos fluorocromos en los dideoxinucleótidos A, C, en ~ 8% de los casos con síndrome de Rett clásico que
G, T para la identificación inequívoca de las bases nitroge- tienen deleción completa del gen MECP2 y en > 95% de
nadas que conforman la secuencia de un fragmento de los casos con neuropatía periférica Charcot-Marie Tooth
DNA. El principio de la reacción de secuenciación auto- tipo 1A (MIM #118220) que presentan una duplicación
matizada tipo Sanger se ilustra en la figura 3 y una anima- de todo el gen PMP22. Por ello es importante conocer el
ción del proceso puede consultarse en línea en espectro de mutaciones descritas en el trastorno mende-
http://www.dnalc.org/resources/animations/cycseq.html. liano a diagnosticar en el paciente y reconocer esta limi-
La secuenciación automatizada se considera el estudio tante de la técnica cuando se interpretan los resultados y
diagnóstico de primera línea en el síndrome de Rett así evitar la asignación de un genotipo erróneo y un ase-
(MIM #312750), un trastorno del neurodesarrollo domi- soramiento genético inadecuado. En enfermedades
nante ligado al cromosoma X que se considera la segun- monogénicas en donde predominan deleciones o dupli-
da causa genética más frecuente de retraso mental en caciones grandes se deben utilizar otras metodologías
mujeres y cuya prevalencia se estima en una afectada en moleculares como la MLPA, misma que a continuación
8 a 10 mil mujeres de 15 años de edad. Las pacientes se describe.
cursan con una pérdida progresiva de las habilidades
motoras y del lenguaje, presencia de conductas estereoti-
padas como movimientos anormales y repetitivos en Amplificación múltiple de sondas ligadas
manos, crisis convulsivas, detención del crecimiento y del (MLPA, multiplex ligation-dependent probe
perímetro cefálico. La supervivencia de las pacientes se amplification)
ve comprometida (30 a <40 años) por trastornos car-
diorrespiratorios, nutricionales, entre otros. Aunque exis- La amplificación múltiple de sondas ligadas o MLPA es
ten criterios diagnósticos de tipo clínico y de laborato- una variante de la PCR en la cual se pueden amplificar
rio/gabinete para el síndrome de Rett, la identificación diferentes secuencias de DNA en una misma reacción
de una mutación en el gen MECP2 (Xq28) por estudio utilizando un solo par de cebadores y bajo las mismas
molecular, es la única manera de establecer de forma cer- condiciones de ciclos de temperatura. Por esta técnica se
tera el diagnóstico de esta entidad, en especial en pacien- pueden amplificar regiones génicas cercanas o adyacen-
tes con las formas atípicas. El 80% de las mutaciones res- tes con la finalidad de determinar con certeza la dosis
ponsables de los casos con la forma clásica del síndrome génica en muestras de DNA de pacientes afectados de
se logran identificar a través del estudio de secuenciación deleciones o duplicaciones grandes en estado heterocigo-
automatizada de los exones 2, 3 y 4 del gen MECP2 to, homocigoto o hemicigoto. En el ensayo se pueden uti-
moderno Fotocopiar sin autorización es un delito.
(figura 4), aunque en realidad en el exón 3 y 4 es donde lizar como controles muestras de DNA con deleciones o
ocurren > 95% de las mutaciones responsables de las for- duplicaciones génicas grandes previamente caracteriza-
mas clásicas y atípicas. das y las cuales pueden involucrar desde un exón a varios
El estudio por secuenciación automatizada de varios de ellos o incluso loci aledaños. La capacidad de amplifi-
pacientes, de genes grandes multiexónicos o ambos, car varias sondas en la misma reacción, permite delimi-
genera una gran cantidad de datos, que requieren anali- tar con mayor precisión los puntos de rotura y reunión
zarse a través de programas bioinformáticos (p. ej., de las deleciones o duplicaciones, así como la extensión
BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi) que de dichos rearreglos.
comparen las secuencias obtenidas del paciente con las La MLPA permite el análisis mediante electroforesis
secuencias génicas de referencia, aunque otros progra- capilar de hasta 45 sondas diferentes amplificadas en una
mas de cómputo más sofisticados pueden identificar de sola reacción. Cada secuencia del DNA blanco (p. ej., un
inmediato todas las variantes patológicas y no patológicas exón) es reconocida por una sonda conformada por dos
© Editorial El manual

(polimorfismos) identificadas en un estudio de secuencia- mitades, denominadas sonda 5’ y sonda 3’. Si existe una
ción a gran escala, a través de conectarse automáticamente complementaridad de las dos sondas con la muestra de
a las bases de datos disponibles en línea como dbSNP DNA templado, se forma un enlace fosfodiéster entre
(http://bibiserv.techfak.uni-bielefeld.de/genefisher2/) ambas mediante la acción de una ligasa. Los extremos de
o de mutaciones (The Human Gene Mutation Database, ambas sondas poseen una secuencia artificialmente dise-
http://www.hgmd.cf.ac.uk/ac/index.php), con ello se ñada que es complementaria a un solo par de oligonucle-

Biblioteca Médica Virtual


Anexo III 53

A) DNA molde de cadena sencilla


5´ +12 +1
5´ GACCATTGGCAG 3´

Síntesis de DNA Cebador

La reacción de secuenciación automatizada


tipo Sanger, utiliza en baja proporción cuatro
T ddTTP didesoxi-desoxirribonucleótidos trifosfato
GddGTP (ddNTP´s), cada uno de ellos marcados con
fluoróforos distintos, además de las cuatro
C ddCTP bases nitrogenadas sin marcaje en la forma
A ddATP de desoxirribonucleótidos trifosfato (dNTP´s).

Tamaño del DNA


sintetizado
Aleatoriamente las hebras son
C Cebador+1
interrumpidas por la incorporación
de un ddNTP.
TC Cebador+2

G TC Cebador+3

C GTC Cebador+4

C CGTC Cebador+5

A CCGTC Cebador+6

A ACCGTC Cebador+7
B)
C T GCC AAT GG T CCC AG T T GG CCCC

Computadora
Electroferograma

Detector de
fluorescencia

Láser

- +
Muestra y Buffer Buffer
manual moderno Fotocopiar sin autorización es un delito.

Figura 3. A) Secuenciación de DNA por el método de Sanger automatizado. Generalmente el fragmento a secuenciar es un producto de PCR
de hasta 1 kilobase (1 000 pares de bases) de la región de interés. Este producto de PCR es desnaturalizado y en la presencia de un ceba-
dor comienza la síntesis de una nueva cadena de DNA por acción de una DNA polimerasa. En la reacción de secuenciación se incluyen deso-
xinucleósidos trifosfato (dNTP) de cada una de las bases nitrogenadas (adenina, citosina, guanina y timina), así como una proporción menor
de didesoxirribonucleótidos trifosfato (ddNTP) de cada una de las bases nitrogenadas marcadas con un fluoróforo distinto. La adición aleato-
ria de un didesoxinucleótido en las cadenas en crecimiento interrumpe la síntesis, dado que esta molécula no cuenta con el grupo hidroxilo en
el carbono 3’ de la pentosa, ello hace imposible la generación de un nuevo enlace fosfodiéster con otro dNTP o ddNTP. Lo anterior condicio-
na en cada reacción la generación de varias cadenas nucleotídicas de diferentes longitudes las cuales van marcadas en su extremo 3’ con
ddNTP que porta sólo un fluorocromo distintivo para la última base de la cadena. B) Las cadenas sintetizadas, al tener diferentes tamaños,
pueden ser separadas por electroforesis capilar de alta resolución y detectadas con un equipo óptico que determina el fluoróforo presen-
te al final de cada una de las cadenas interrumpidas. Dado que la cadena de tamaño más pequeño viaja más rápido por el capilar, será
la primera en ser detectada y al reconocerse el fluoróforo presente al final de esta cadena se puede establecer el nucleótido en el cual se
interrumpió su síntesis, la siguiente cadena que pase por el detector será aquella que tiene un tamaño en longitud mayor por un nucleó-
© Editorial El

tido más y nuevamente al detectar el fluoróforo presente al final, se puede determinar el nucleótido en el que fue interrumpida y así suce-
sivamente, al establecer en cada cadena sintetizada el nucleótido en el cual fue interrumpida su síntesis se puede obtener la secuencia
de nucleótidos del fragmento original de DNA. Un programa en una computadora acoplada al secuenciador reporta el orden de las bases
en un electroferograma.

Biblioteca Médica Virtual


54 Genética clínica

5´ Hebra sentido 3´

170 180 190


A G C C C C T C C C G G N G A G A G C A G A A A C C
}

CGA: Codón de arginina (alelo normal)



TGA: Codón de paro prematuro (alelo mutado)
5´ Hebra complementaria

220 230 240


G G T T T C T G T C T C N C C G G G A G G G G C T

moderno Fotocopiar sin autorización es un delito.


}

Figura 4. Diagnóstico del síndrome de Rett por secuenciación automatizada del gen MECP2. Se ilustra el hábito exterior de una paciente
con síndrome de Rett clásico en fase pseudoestacionaria, donde se aprecian los movimientos estereotipados de manos. El electroferograma
muestra una porción de las hebras sentido (5´- 3´) de la secuencia codificante del exón 4 del gen MECP2 y la flecha señala un estado hetero-
cigoto en la paciente para la mutación puntual sin sentido c.502C>T, dado que a nivel de proteína cambia al codon 168 de arginina (CGA) por
un codon de paro prematuro (TGA). La “N” significa que en esa posición existe una base mixta o empalmada, donde el pico azul representa la
citosina del alelo normal y el pico rojo, la timina del alelo mutante. Esta mutación se corrobora en las hebras complementarias o antisentido
© Editorial El manual

(estado heterocigoto “N” A/G). Más del 99.5% de los casos con síndrome de Rett se originan por mutaciones de novo en la espermatogénesis
y la mayoría de éstas consisten en transiciones C>T atribuibles a desaminación espontánea de citosinas metiladas en dinucleótidos CpG; en
este caso, nótese que la base siguiente a la mutación en la hebra sentido es precisamente una guanina.

Biblioteca Médica Virtual


Anexo III 55
His335

}
CA T T T A C C T C G G A T CA T G G T A A G C
c.1003
Secuencia
normal

Tyr

}
I
1 CA T T T A C C T C G G A T TA T G G T A A G C
II-1
Hemicigoto
c.1003C>T
II 20 (p.His335Tyr)
SDG
I-1 A T T T A C C T C G G A T N A T G G T A A G C
1 2
Heterocigota
c.1003C>T
(p.His335Tyr)

II-2 A T T T A C C T C G G A T T A T G G T A A G C
Hemicigoto
c.1003C>T
(p.His335Tyr)

Figura 5. Diagnóstico prenatal molecular del síndrome de Hunter a través de secuenciación automatizada dirigida del exón 7 del gen IDS
(Xq28). Esta entidad se hereda con un patrón recesivo ligado al cromosoma X, donde se estima que el 80% de las madres de casos únicos
como es el presente caso, son portadoras o heterocigotas asintomáticas para el rasgo. El caso índice cuenta con el diagnóstico clínico, enzi-
mático y molecular del síndrome de Hunter. La identificación de la mutación responsable del padecimiento en II-1 se llevo al cabo mediante la
amplificación por PCR y subsecuente secuenciación de los 9 exones que comprenden la secuencia codificante del gen IDS. La comparación
del electroferograma parcial del exón 7 de II-1 con la secuencia normal revela un genotipo hemicigoto para la mutación c.1003C>T del gen IDS
(flechas). Posteriormente se hizo la búsqueda dirigida de esta mutación en I-1 mediante PCR y secuenciación de sólo el exón 7, ya que es
aquí donde se ubica la mutación responsable. El electroferograma del exón 7 en I-1 reveló un estado heterocigoto (portador) para la mutación
presente en su hijo. La madre, posterior a asesoramiento genético, solicita diagnóstico prenatal. El cariotipo obtenido a partir de cultivo de
amniocitos se reportó con una fórmula 46,XY y debido a ello se procedió inmediatamente a la secuenciación directa del exón 7 a partir de DNA
genómico obtenido de la misma muestra de los amniocitos en cultivo. El electroferograma del producto de la gestación revela que éste here-
dó el mismo genotipo IDS que su hermano afectado. Adicionalmente el genotipo alterado se corroboró en la hebra antisentido del mismo exón
(dato no mostrado). Cabe mencionar que el tiempo requerido para el estudio prenatal molecular requirió de sólo dos días. El mismo procedi-
miento puede hacerse en células amnióticas o muestras de vellosidades coriales sin cultivo, aunque con este último material biológico se repor-
ta un riesgo del 1 a 5% para que el ensayo molecular se contamine con DNA genómico de origen materno.

ótidos o cebadores universales que permiten su amplifi- automatizada y el estudio de MLPA identifican el geno-
cación por PCR, siempre y cuando las sondas 5’ y 3’ se tipo responsable en casi 90% de las pacientes con las for-
hayan ligado. Los cebadores universales permitirán la mas clásicas. En poblaciones distintas a las de origen
amplificación de todas las sondas bajo las mismas condi- judío asquenazí o del norte de Europa, la secuenciación
ciones; los ensayos más recientes, incluyen un cebador automatizada del gen CFTR identifica cerca de 99% de
manual moderno Fotocopiar sin autorización es un delito.

universal marcado con una molécula fluorescente en el las mutaciones responsables, pero quizá < 1% de alelos
extremo 5’ el cual permite la detección de los amplico- mutados CFTR corresponden a deleciones grandes que
nes de las sondas a través de análisis de fragmentos por pueden ser identificadas por MLPA. Las deleciones de
electroforesis capilar en un equipo de secuenciación uno o más exones en el gen BRCA1 se encuentran pre-
automatizada. La distinción entre las diferentes sondas sentes hasta en 20 a 30% de los casos de síndrome de
ligadas y amplificadas correspondientes a cada una de las cáncer de mama y ovario familiar de origen holandés.
regiones blanco del DNA templado, se basa en el tama- Este tipo de mutación pasa inadvertido en el estudio de
ño en pares de bases de cada sonda ligada y amplificada. primera línea, que es la secuenciación automatizada, por
Lo anterior, se logra al añadir, en la sonda 3’, una secuen- lo que en pacientes con un resultado negativo, con datos
cia artificial o stuffer cuya longitud varía para cada sonda. clínicos y genealógicos altamente sugestivos de este sín-
Así, cada sonda específica de un exón o región génica drome de cáncer familiar, está indicado el estudio de
tendrá un tamaño específico y será fácilmente identifica- MLPA. Por último, la identificación de mujeres portado-
ble mediante análisis electroforético. En la figura AIII-6 ras o heterocigotas para deleciones de uno o más exones
se esquematiza el fundamento de la MLPA. en el gen DMD responsables de 40 a 60% de los casos
© Editorial El

La técnica de MLPA puede ser complementaria al con distrofinopatías, pueden llegar a documentarse de
estudio de secuenciación para incrementar la certeza manera certera con MLPA, y de igual forma, las duplica-
diagnóstica en algunas entidades mendelianas, como por ciones de uno o más exones de este gen y responsables
ejemplo el síndrome de Rett, ya que la secuenciación de 6 a 8% de los casos con distrofinopatía, pueden iden-

Biblioteca Médica Virtual


56 Genética clínica

Secuencia de unión Secuencia A Secuencia de unión


para primer X para primer Y
A) Sonda 5' Secuencia A Sonda 3' Secuencia A

Secuencia de Secuencia de
reconocimiento izquierda reconocimiento derecha

B) Alineación de sondas 5' y 3' en la secuencia A Alineación de sondas 5' y 3' en la secuencia B

Formación de enlaces fosfodiéster entre Formación de enlaces fosfodiéster entre


las sondas adyacentes por la acción de DNA paciente las sondas adyacentes por la acción de
una ligasa, posterior a la hibridación con una ligasa, posterior a la hibridación con
el DNA genómico el DNA genómico
C)

DNA paciente
Análisis de fragmentos en electroforésis capilar
D) Amplificación por PCR múltiple con un solo juego de cebadores E)

fluorescencia
Primer X Primer Y
3 300-

Nivel de
2 200-
1 100-
0-
Secuencia A B C D EF G H IJ K LM N O P Q R S

F) Sondas Secuencia “Stuffer” (60 a 450 nucleótidos)


MLPA
1 Análisis por
Nivel de fluorescencia

electroforesis capilar
2
Duplicación
3

n
Hibrida-
Ligación PCR Separación por tamaño del amplicón
ción

DNA genómico Dosis normal


desnaturalizado
Secuencias que hibridan a las
partes específicas del gen

Secuencia tipo
“Stuffer”
Secuencias complementarias
a los cebadores universales

moderno Fotocopiar sin autorización es un delito.


Figura 6. Fundamento MLPA. A) Las dos mitades de una sonda 5’ y 3’, contiene una secuencia nucleotídica para hibridar o unirse con el DNA
en estudio del paciente y una secuencia específica para un par de cebadores universales (primers X y Y). B) Las sondas 5´y 3´en presencia
del DNA desnaturalizado del paciente, se unen a éste por complementariedad. C) Si la secuencia de reconocimiento está presente en el DNA
del paciente las sondas 5´y 3´ quedan adyacentes y pueden ser unidas por la acción de una enzima ligasa, formando una sonda única. Esto
sucede con cada par de sondas que están incluidas en el ensayo. D) Las sondas ligadas son amplificadas por PCR con el uso de un par de
cebadores universales. E) Los productos obtenidos por PCR son analizados por electroforesis capilar y se comparan con un control normal
para determinar si existen deleciones o duplicaciones en estado heterocigoto en el DNA del paciente. F) La distinción entre las diferentes son-
das ligadas y amplificadas se establece a partir de las diferencias en el tamaño de la secuencia “stuffer” de cada sonda.

tificarse por la misma técnica tanto en casos masculinos patients with myopathies of unknown etiology: identifica-
afectados como en mujeres portadoras. tion of a novel mutation in the acid alpha-glucosidase gene.
J Child Neurol 2010;25:1034-1037.
© Editorial El manual

Boyadjiev SA: International Craniosynostosis Consortium.


Genetic analysis of non-syndromic craniosynostosis.
BIBLIOGRAFÍA Orthod Craniofac Res 2007;10:129-137.
Innis M, Gelfand D: Optimization of PCR’s. En: Innis M,
Alcántara OMA, González AA, Barrientos RR et al.: Screening Gelfand D, Snitsky J, White T. eds. PCR Protocols: a guide
of late-onset Pompe disease in a sample of Mexican to methods and applications, 1st ed. Academic Press, San

Biblioteca Médica Virtual


Anexo III 57
Diego, USA 1990:3-12. Witkowski J. eds. Recombinant DNA Genes and Genomes-
Jorde L, Carey J, Bamshad M, White R: Genetic variation: its A short course 3rd ed. Cold Spring Harbor Press, New York,
origin and detection. En: Jorde L, Carey J, Bamshad M, USA 2007:75-106.
White R. eds. Medical Genetics, 3rd ed. Mosby, St. Louis, Zurflüh MR, Zschocke J, Lindner M, Feillet F et al.: Molecular
USA 2003:29-106. genetics of tetrahydrobiopterin-responsive phenylalanine
Kozlowski P, Jasinska AJ, Kwiatkowski DJ: New applications and hydroxylase deficiency. Hum Mutat 2008;29:167-175.
developments in the use of multiplex ligation-dependent
probe amplification. Electrophoresis 2008;29:4627-4636.
Rodríguez Sánchez I; Barrera SH: La reacción en cadena de la
polimerasa a dos décadas de su invención. Ciencia UANL RECURSOS EN LA RED
2004;7(3):323-335.
Rose EA: Applications of PCR to Genome Analysis. FASEB J OMIM ® - Online Mendelian Inheritance in Man ®
1991;5:46-54. http://www.ncbi.nlm.nih.gov/omim
Strachan T, Read A: Amplifying DNA: PCR and cell based clo-
ning En: Strachan T, Read A. eds. Human Molecular Gene Reviews
Genetics 3. Garland Science, New York, USA 2004:122- http://www.ncbi.nlm.nih.gov/books/NBK1116/
154, 182-203.
Watson J, Caudy A, Myers R, Witkowski J: Basic tools of DNA Learning Center Cold Spring Harbor Laboratory
recombinant DNA. En: Watson J, Caudy A, Myers R, http://www.dnalc.org/
manual moderno Fotocopiar sin autorización es un delito.
© Editorial El

Biblioteca Médica Virtual


Biblioteca Médica Virtual
ANEXO IV
Telómero y telomerasa
Diego J. Arenas Aranda

Por el descubrimiento de cómo los cromosomas son protegidos


por los telómeros y la enzima telomerasa

Elizabeth Blackburn, Carol W. Greider y Jack W. Szostak


Premio Nobel de Fisiología y Medicina del 2009

En el DNA eucarionte existen tres tipos de secuencias loop” y vuelta D o “D-loop”, en esta última se forma una
con base en su cinética de reasociación. De éstas, las triple hélice. Se cree que estas estructuras protegen al
medianamente repetidas o DNA minisatélites están for- DNA telomérico de la posible degradación por exonu-
madas por diferentes tipos de secuencias, donde se inclu- cleasas.
ye a los telómeros (del griego telos “final”; meros “parte”). La cubiertina o “shelterin” está formada por seis prote-
El término telómero fue propuesto en el decenio de ínas la TRF1, TRF2, TIN2, POT1, TPP1 y RAP1. Se ha
1930-39 del siglo pasado por Hermann Muller y se loca- propuesto que este complejo de proteínas protege y
liza en los extremos de cada uno de los cromosomas regula la longitud del telómero, interactuando con la
eucariontes. Esta secuencia no codificante está constitui- enzima telomerasa para evitar que el telómero se recor-
da por repetidos de nucleótidos en tándem y una serie de te en cada proceso de replicación del DNA. También se
proteínas asociadas a los repetidos, formando una estruc- han informado otras funciones del telómero indepen-
tura especializada conocida como cubiertina (“shelte- diente de este proteico complejo (cuadro 2).
rin”). El tipo y el número de nucleótidos que forman el Se han descrito diferentes funciones del telómero
repetido varían entre las diferentes especies de eucarion- como la protección, estabilidad e individualidad del cro-
tes (cuadro 1). La longitud del telómero también varía mosoma. También se ha propuesto que funcionan como
dentro de cada especie, reflejando el número de veces un reloj molecular de envejecimiento, lo que favorece la
que las células somáticas se han dividido. eliminación de células senescentes. Otras funciones
En los seres humanos el telómero está formado por un incluyen la protección contra la pérdida de regiones
repetido de seis nucleótidos de secuencia TTAGGG, que codificantes y una nueva forma de regulación transcrip-
se repite miles de veces en las células somáticas de un cional, conocida como efecto del tamaño del telómero,
recién nacido, teniendo un longitud de 8-14 kb. Las célu- en la cual el tamaño del telómero afectará la expresión
las senescentes (envejecidas) presentan telómeros cortos de genes proximales a éste, de tal manera que en células
alrededor de 2 kb. El telómero termina en una cadena con telómeros cortos se activa la transcripción de los
sencilla de DNA que se enrolla sobre sí misma forman- genes cercanos y en células con telómeros grandes esos
do un par de estructuras conocidas como vuelta T o “T- genes no se transcriben.
moderno Fotocopiar sin autorización es un delito.

Cuadro 1. Teloméricos repetidos en diferentes eucariontes


Grupo Organismo Repetido telomérico (5´a 3´)

Vertebrados Humano, ratón, xenopus TTAGGG


Hongos filamentosos Neuroespora TTAGGG
Hongos mulaginosos Physarum TTAGGG
Protozoarios Trypanosoma TTAGGG
Tetrahymena TTGGGG
Oxytricha TTTTGGGG
Plantas superiores Arabidopsis TTTAGGG
© Editorial El manual

Insectos Bombyx mori (gusano de seda) TTAGG


Algas Chlamydomonas TTTTAGGG
Levaduras Candida albicans GGGGTCTGGGTGCTG

59

Biblioteca Médica Virtual


60 Genética clínica

Cuadro 2. Algunas funciones descritas de las proteínas asociadas al telómero


Funciones teloméricas Funciones telómero independientes

Protección y recombinación (TRF1, TRF2, TIN2, TPP1, RAP1) Silenciamiento de genes subteloméricos (RAP1)
Protección de los repetidos teloméricos (POT1) Moduladores de las rutas NF-κ B y Wnt (RAP1 y TERT)
Síntesis del telómero (TERT, TERC, TRF1) Regulación de células estemales (TERT)

En los trabajos realizados por Leonard Hayflick en sión el tamaño telomérico. A pesar de ese inconveniente
1965 se demostró que las células somáticas humanas se se han usado ampliamente para estudiar el tamaño del
pueden dividir en un número limitado de veces, no más telómero en diferentes células humanas sanas o enfermas
de 50 divisiones (después morían). Estas células enveje- y en términos generales se concluye que las células somá-
cidas o senescentes tienen telómeros cortos alrededor de ticas sanas recortan sus telómeros cada vez que se divi-
2 kb y mueren por apoptosis. El recortamiento de la den, lo cual no sucede en las células estemales y diferen-
región telomérica se da en cada proceso de replicación tes tipos de células neoplásicas (figura 1).
del DNA, concretamente en la replicación de la hebra El descubrimiento de una enzima con actividad de
rezagada o replicación discontinua se pierde un fragmen- transferasa terminal en el ciliado Tetrahymena por Carol
to de DNA, de tal manera que después de unas 50 divi- Greider y Elizabeth Blackburn en 1985 permitió enten-
siones celulares el tamaño del telómero tiene una longi- der cómo se sintetiza el telómero. Esta ribonucleoprote-
tud de unas 2 kb, característico de una célula senescente. ína polimerasa conocida como telomerasa está constitui-
La determinación del tamaño del telómero se realiza da por dos componentes, uno de naturaleza proteica lla-
por diferentes metodologías de biología o citogenética mado TERT que presenta actividad de reversa transcrip-
molecular, como fragmentos de restricción teloméricos tasa y otro de RNA denominado TERC que sirve como
(TRF, por sus siglas en inglés), FISH telomérico y PCR plantilla para la síntesis de novo de la secuencia telomé-
cuantitativo; sin embargo, los métodos empleados pre- rica. El gen humano que codifica esta enzima llamado
sentan el inconveniente de no poder definir con preci- hTERT, se localiza en 5p15.33 y se encuentra desde el

Células estemales embrionarias (ESC). Telomerasa +


14

12
Células pluripotenciales
inducidas (iPSC)
Tamaño Telomerasa (+)
telomérico
por TRF (kb)

Células somáticas Células neoplásicas


8 Telomerasa (-) Telomerasa (-)
ruta alterna

moderno Fotocopiar sin autorización es un delito.


6

4
Células neoplásicas
Telomerasa (+)

2
© Editorial El manual

Divisiones celulares

Figura. 1. Tamaño telomérico en diferentes tipos celulares.

Biblioteca Médica Virtual


Anexo IV 61
punto de vista transcripcional inactivo en las células crito que TERT es un modulador transcripcional de la
somáticas, como resultado de la metilación de su región ruta de señalización WNT-β catenina con una actividad
promotora. El gen TERC que produce la plantilla de de RNA polimerasa dependiente de RNA. También se ha
RNA se localiza en 3q26. demostrado que en la mitocondria se asocia a la endorri-
El gen hTERT está activo en las células estemales, éste bonucleasa procesadora de RNA mitocondrial, este com-
evita el recortamiento de los telómeros, lo que ocasiona plejo nuevo tiene una actividad de RNA polimerasa
que proliferen en forma continua sin alcanzar la senes- dependiente de RNA y se ha relacionado con la forma-
cencia celular, por lo que se definen como células inmor- ción de pequeños RNA interferentes (siRNA, por sus
tales. Las células neoplásicas también tienen el fenotipo siglas en inglés). Asimismo, se ha demostrado que el
de inmortalidad celular y aunque por lo general tiene estrés oxidativo ocasiona que TERT se exporte a la mito-
telómeros cortos, son telomerasa positivas. Una de las condria, dato que sugiere que esta enzima podría estar
principales formas de activación del gen hTERT en estas involucrada en la apoptosis mediada por daño oxidativo.
células es la amplificación génica, en algunos casos exis- Con respecto a los diferentes componentes de la
ten más de 40 copias del gen hTERT, como sucede en la cubiertina, la proteína RAP1 también tiene funciones
línea celular Lan 2 derivada de un neuroblastoma. independientes del telómero. Esta proteína está asociada
Recién se ha demostrado que en las células estemales al silenciamiento y regulación transcripcional de genes
pluripotenciales inducidas (iPSC, por sus siglas en inglés) subteloméricos, quizá sea uno de los factores candidatos
se reactiva la telomerasa y el telómero alcanza un tama- para entender una de las funciones asignadas a telómero,
ño equivalente al de las células embrionarias estemales, el efecto del tamaño de éste. También se ha demostrado
aunque el tamaño final del telómero se determina por el que actúa como un modulador esencial del factor nucle-
tamaño del telómero de las células precursoras de las ar κΒ en la ruta NF-κΒ.
iPSC. Estas evidencias están en contra de la idea estable- En los últimos años se ha demostrado que el telóme-
cida de que la telomerasa no elonga los telómeros. ro está involucrado en procesos diferentes a los que se le
Independiente del cáncer, se han informado otras conocían. Hoy en día se sabe que está asociado a la fun-
enfermedades asociadas a mutaciones en el gen hTERT ción mitocondrial, inflamación, desarrollo embrionario,
o en los genes que codifican las proteínas asociadas al regulación de la expresión génica, metabolismo, regula-
telómero, como disqueratosis congénita, síndrome mul- ción de la homeostasis de las células estemales, adhesión
tisistémico de envejecimiento prematuro, alta inciden- y cáncer. Hasta el momento se sabe poco de las funcio-
cia de cáncer esporádico, telómeros cortos y un incre- nes independientes del telómero que pudieran realizar
mento de la inestabilidad cromosómica. La forma más los componentes de la cubiertina, por lo que es de espe-
grave de esta enfermedad el síndrome Hoyeraal- rase que en un futuro cercano se descubran otras funcio-
Hreidarsson con un patrón de herencia ligado al cromo- nes del telómero.
soma X y caracterizado como una enfermedad multisis- El conocimiento en las células humanas, la función del
témica con retraso mental, microcefalia, retardo en el telómero y sus proteínas asociadas, permitirá desarrollar
crecimiento intrauterino y anemia aplásica. En esta estrategias terapéuticas novedosas que ayudarán a con-
enfermedad se han descrito mutaciones en los genes trolar las patologías humanas relacionadas con el mal
que codifican TERT y TERC. funcionamiento del telómero.
La anemia aplásica adquirida que se caracteriza por una
hipocelularidad en médula ósea. Los leucocitos de estos
pacientes tienen telómeros muy cortos respecto a los de BIBLIOGRAFÍA
individuos sanos de la misma edad. Se han descrito muta-
ciones en TERT, TERC y en los genes que codifican las pro- Blackburn E: Structure and function of telomeres. Nature
teínas asociadas al telómero TRF1, TRF2 y TIN2. 1991;350:569-572.
La fibrosis pulmonar idiopática es una enfermedad Greider C, Blackburn E: Identification of a specific telomere
progresiva que afecta la función respiratoria. A nivel pul- terminal transferase activity in Tetrahymena extracts. Cell
manual moderno Fotocopiar sin autorización es un delito.

monar existe fibrosis, inflamación intersticial y depósitos 1985;43:405-413.


de colágeno. La mayoría de los pacientes con disquerato- Hayflick, L: The limited in vitro time of human diploid cell
sis congénita desarrollan esta enfermedad. En la forma strains. Experimental Cell Research 1965;37:614-636.
familiar se han informado mutaciones en los componen- Hernández E, Herrera N, Salamanca F, Arenas D: Role of telo-
tes de la telomerasa. mere lenght in subtelomeric gene expression and its posi-
ble relation to cellular senescente. BMB reports
Diversos trabajos realizados en ratones han servido
2009;42;747-751.
para demostrar que la sobreexpresión de TERT induce a Martínez P, Blasco M: Telomeric and extra-telomeric roles for
un fenotipo antienvejecimiento resistente al cáncer telomerase and the telomere-binding proteins. Nature
mediante la sobreexpresión de los genes supresores de Reviews Cancer 2011;11:161-176.
tumor p53, p12 y ARF. Toftgård R: Maintenance of chromosomes by telomeres and the
La sobreexpresión de TERT también se ha relaciona- enzyme telomerase. The Nobel Assembly at Karolinska
do a funciones independientes del telómero. Se ha des- Institutet. The Nobel Prize in Physiology or Medicine 2009.
© Editorial El

Biblioteca Médica Virtual


Biblioteca Médica Virtual
3
Nosología genética

Victoria del Castillo Ruíz

HISTORIA CLÍNICA que condicionen culpabilidad ni que violen la confidencia-


lidad de la información obtenida.
Cada vez se reconoce más la importancia de la genética en La historia familiar debe mantenerse actualizada y con-
la práctica médica, los grandes avances tecnológicos mole- signar la mayor información de los familiares incluyendo
culares y genómicos han permitido identificar genes, carac- su sexo, edad y parentesco; nunca se deben pasar por alto
terizar mutaciones responsables, correlacionar el genotipo los antecedentes obstétricos ni la edad de los progenitores
con el fenotipo, asociar polimorfismos con padecimientos al nacimiento. Así, el antecedente de progenitores añosos
complejos e inclusive desarrollar estrategias para posibles (> 35 años) orientan a sospechar patología autosómica
tratamientos; sin embargo, es importante recalcar que la dominante de novo en el caso del padre o cromosómica si
etapa inicial de la sospecha e integración diagnóstica de una es la madre. La presencia de abortos múltiples, óbitos o
entidad genética debe ser a través de una buena historia clí- mortinatos sugiere que alguno de los padres pueda ser
nica con interrogatorio y exploración adecuados. portador de una translocación balanceada y por lo tanto, el
estudio citogenético es indispensable, ya que de obtenerse
un resultado anormal surge la posibilidad de diagnóstico
prenatal en una futura gestación. Asimismo, se ha visto
HISTORIA FAMILIAR relación de técnicas de fertilización asistida con el síndro-
me de Beckwith-Wiedemann cuya etiología implica alte-
La historia familiar debe contar siempre con un árbol ración en los procesos de impronta genómica.
genealógico o pedigrí (AI) que es la representación gráfi- Es el primer paso para establecer el riesgo de padeci-
ca de la historia médica familiar mediante la utilización de mientos genéticos, ya que datos como la consanguinidad
símbolos que permitirán reconocer características o pade- entre los padres obliga a descartar una patología autosómi-
cimientos en los sujetos que los posean. Es una herramien- ca recesiva o multifactorial y la presencia de varones afec-
ta valiosa que permite obtener información como por tados en diferentes generaciones relacionados por rama
ejemplo talla, edad actual, edad al morir, semanas de materna orientan hacia un problema recesivo ligado al X;
moderno Fotocopiar sin autorización es un delito.

embarazo, apellidos, entre otros, se deben agregar datos sin embargo, puede haber circunstancias que complican su
como, consanguinidad y grado de parentesco, el origen análisis como por ejemplo, ser caso único en familias
étnico, exposición a agentes ambientales, si hay afectados pequeñas, paternidad ilegítima, adopción, fertilización asis-
con otras manifestaciones del padecimiento, individuos tida, expresividad variable, penetrancia reducida, anticipa-
muertos, número de embarazos, abortos espontáneos o ción, endogamia o información falseada.
inducidos, óbitos, adopción o productos de diferentes Es conveniente considerar otros diagramas familiares
parejas, de tal forma que se cuente con una historia lo más que permiten obtener un mayor conocimiento del entor-
completa posible, sin olvidar que la información de fami- no familiar y social del paciente.
liares no afectados es tan importante como la de afectados.
El esquema básico es de tres generaciones lo que permite
recabar información confiable; sin embargo, si ésta es con-
fusa, incompleta o errónea es frecuente que se requieran OTROS DIAGRAMAS FAMILIARES:
varias sesiones para obtener todos los datos y de necesitar- GENOGRAMA Y ECOMAPA (AII)
© Editorial El manual

se revisión clínica e inclusive estudios de laboratorio y


gabinete de los familiares. Siempre debe regirse en un El genograma representa un documento independiente
marco de respeto a la situación sociocultural, religiosa y a al pedigrí que incluye información demográfica y funcio-
la autonomía del individuo o de la pareja, sin emitir juicios nal de la familia con datos médicos, emocionales, de

63

Biblioteca Médica Virtual


64 Genética clínica

comportamiento y de eventos críticos, así como de otro problemas de alimentación, hipoglucemia y crisis con-
tipo de relaciones no biológicas como compañeros de vulsivas.
cuarto o de trabajo, por lo que suele utilizarse en terapias Por lo general se considera que el cuadro clínico del
personales y familiares en especial a largo plazo, por lo paciente se debe a las secuelas de estas complicaciones
que se considera que no debe incluirse en el expediente perinatales; sin embargo, debe tenerse presente que
médico paciente. Utiliza símbolos parecidos a los del puede haber otras etiologías que deben ser investigadas
árbol genealógico usualmente de tres generaciones, pero como disgenesias cerebrales, inmunodeficiencias o algu-
con líneas de comunicación que representan relaciones nos errores innatos del metabolismo.
distantes o cercanas, abiertas o cerradas, agradables o
conflictivas. No influye en riesgos ni en decisión de prue-
bas genéticas, sino que representa un conocimiento más
completo del entorno del paciente y su familia.
ANTECEDENTES POSNATALES
El formato del ecomapa semeja una rueda, con el
cliente en el centro y las relaciones sociales y agencias Es muy importante llevar el seguimiento y graficar el cre-
están en círculo. Este “círculo de la vida” incluye jefes, cimiento y su velocidad en particular en entidades con
maestros, entrenadores, líderes religiosos, amigos, vecinos alteración de la talla, así por ejemplo, en el síndrome de
y familiares, con líneas de comunicación cercana o dis- Silver Russell y en acondroplasia hay detención prenatal
tante del cliente. y posnatal (figura 3-1A), en cambio padecimientos con
talla baja como el síndrome de Morquio y la hipocondro-
plasia (figura 3-1B) presentan talla normal al nacimien-
to. El desarrollo psicomotor debe valorarse de acuerdo a
ANTECEDENTES PRENATALES la edad gestacional y a la cronológica en todas las áreas
tanto cognoscitiva y motora como adaptativa y del len-
Deben recabarse porque pueden ser clave diagnóstica guaje.
como la duración de la gestación, por ejemplo, la gesta- Es importante detectar padecimientos crónicos en
ción prolongada se puede observar en algunas cromoso- cualquier sistema como trastornos endocrinos, cardiacos,
mopatías como la trisomía 18 o prematurez en síndrome renales, pulmonares, gastrointestinales, neurológicos y
de Turner; los productos múltiples deben ser siempre hematológicos, al igual que factores ambientales como
considerados como embarazos de riesgo, ya que con fre- infecciones o maltrato, que interfieran con el crecimien-
cuencia presentan defectos congénitos por constricción y to, desarrollo y funcionalidad del individuo.
compromiso vascular; debe investigarse la cantidad anor-
mal de líquido amniótico, pues la presencia de oligohi-
dramnios se puede asociar a malformaciones renales, PADECIMIENTO ACTUAL
mientras que polihidramnios obliga a sospechar atresia
esofágica. Los movimientos fetales de inicio tardío o dis-
Es fundamental especificar la edad de inicio de los sig-
minuidos pueden deberse a patología musculosquelética
nos y síntomas, algunos padecimientos tienen manifesta-
o neurológica. Así también deben contemplarse compli-
ciones desde el nacimiento como síndrome de Down o
caciones del embarazo como preeclampsia o eclampsia,
acondroplasia, otras aparecen en los primeros meses
hemorragias o enfermedades crónicas maternas como
como enfermedad de Tay Sachs, en los primeros años
diabetes, epilepsia o cardiopatías y contacto con agentes
como la distrofia muscular de Duchenne y las mucopo-
teratogénicos físicos, químicos o biológicos que pueden
lisacaridosis y algunas hasta la edad adulta como la corea
tener gran repercusión en el producto e interferir en su
de Huntington.
desarrollo. Si en un paciente con retraso psicomotor, car-
Dada la complejidad de los padecimientos genéticos,
diopatía congénita y cataratas existe el antecedente de
se deben investigar otros afectados, en cuyo caso hay
infección por rubéola durante el primer trimestre de la
que registrar el parentesco, género, edad de inicio y datos
moderno Fotocopiar sin autorización es un delito.
gestación, este dato orienta a un factor teratogénico bio-
clínicos similares o diferentes, por ejemplo, pueden estar
lógico como causante del problema y requiere la deter-
afectados abuelo y nieto lo que sugiere herencia ligada al
minación de anticuerpos para corroborar la impresión
X, o haber anticipación en padecimientos por expansión
diagnóstica.
de microsatélites como la corea de Huntington en que el
cuadro puede presentarse antes en la descendencia que
en el progenitor. La expresividad variable, la penetrancia
ANTECEDENTES PERINATALES incompleta y el mosaicismo germinal deben considerar-
se siempre al proporcionar el asesoramiento genético y
En relación a cuadros con daño neurológico es importan- establecer la evolución de algún padecimiento, así por
te consignar si el parto fue distócico o se requirió cesá- ejemplo, un progenitor con síndrome de Crouzon que no
rea, anestesia general o bloqueo, características de las ha tenido complicaciones puede no entender por qué
membranas y placenta, del producto hay que establecer hay que realizar una cirugía craneal en su hijo, o por qué
© Editorial El manual

la presentación, sufrimiento fetal, arteria umbilical padres sanos con un hijo con retinoblastoma bilateral
única, hipoxia neonatal, medidas de reanimación, califi- pueden tener riesgo en futuros embarazos.
caciones de Apgar y Silverman, peso, talla y perímetro No sólo es importante el diagnóstico, sino también se
cefálico en relación a la edad gestacional, así como infor- debe considerar el seguimiento longitudinal para valorar
mación de evolución en particular tórpida del recién la evolución del problema, complicaciones y la detección
nacido por hipo o hipertermia, hemorragia, infecciones, de otras anomalías. Es obligatorio que así como en el sín-

Biblioteca Médica Virtual


Nosología genética 65
A B

Figura 3-1. Talla baja desproporcionada. A. Paciente con acondroplasia, talla baja desproporcionada prenatal. Se aprecia con acortamiento
rizomélico, macrocefalia, frente prominente, puente nasal deprimido, hiperlordosis, signo del tridente. B. Madre e hija con hipocondroplasia.
Talla baja desproporcionada, pero con manifestaciones más leves que la acondroplasia.

drome de Down se debe vigilar periódicamente la fun- superior entre el inferior o de la relación brazada/talla,
ción tiroidea, el riesgo de leucemia y la inestabilidad de así por ejemplo, en acondroplasia la relación de segmentos
la unión craneovertebral, en el síndrome de Marfan hay es superior a uno por el acortamiento de las extremida-
que considerar los riesgos cardiovasculares del aneurisma des que contrasta con el tamaño del tronco y la macro-
aórtico, el deterioro visual por la subluxación de cristali- cefalia, mientras que en el síndrome de Marfan por la
no o el desprendimiento de retina y los pulmonares por dolicostenomelia la relación es menor de uno y la braza-
el neumotórax espontáneo, en la distrofia muscular de da es mayor que la talla por la aracnodactilia.
Duchenne se requiere valorar la función respiratoria y la Como se menciona en el AIII, la gran variabilidad y
cardiomiopatía dilatada o en los casos de premutación complejidad del paciente dismorfológico implica un
del X frágil se debe considerar el riesgo de tremor ataxia estudio integral para establecer el diagnóstico, etiología,
en varones y de insuficiencia ovárica prematura en las pronóstico y manejo. Por ello es muy importante desde
mujeres. el punto de vista clínico establecer la presencia de dis-
morfias mayores que son aquellas que comprometen
vida o función y de dismorfias menores las cuales no tie-
nen implicación médica importante, pero que son clave
EXPLORACIÓN FÍSICA para la integración diagnóstica. Asimismo, se deben con-
siderar edad de aparición es decir, si es congénito o pos-
manual moderno Fotocopiar sin autorización es un delito.

Es uno de los rubros más importantes de la historia clí- natal, y si el defecto es único o múltiple, en el primer
nica genética. Debe ser completa, minuciosa e intencio- caso si es una malformación resultante de la formación
nada que permita dilucidar los datos anormales y hacer defectuosa, una deformación condicionada por fuerzas
una correlación con el desarrollo embrionario, así como mecánicas, una disrupción por causas extrínsecas que
parámetros funcionales por ejemplo, neurológicos, interfieren con la formación de una estructura o una dis-
audiológicos o visuales. Es importante la revisión de plasia que representa una desorganización tisular. Debe
familiares de primer grado o de sus fotos para establecer recordarse que siempre que se detecta una anomalía, hay
si el paciente presenta variantes familiares o bien si el que buscar otras ocultas o que no son evidentes en una
fenotipo es anormal. En ocasiones y en especial en alte- evaluación inicial y cuyos efectos podrían observarse en
raciones de la talla se debe realizar una somatometría de etapas tardías de la vida.
las estructuras corporales (figuras 3-2A a 3-C), valorar la En caso de presentar defectos múltiples, se requiere
velocidad de crecimiento anualizada, graficarse de acuer- establecer si es un síndrome en el que patrón de anoma-
do al sexo y edad, así como relacionar la talla de acuerdo lías se deben a una etiología común que puede ser cro-
a la blanco familiar, ya que un paciente puede estar en mosómica, monogénica, ambiental o desconocida, una
© Editorial El

percentilas normales, pero quedar por debajo o por arri- secuencia por ser eventos secundarios a una alteración
ba de las correspondientes a la talla media familiar. Las primaria, una asociación que representa anomalías múl-
mediciones también permiten detectar si hay proporción tiples idiopáticas que se presentan juntas con una fre-
o desproporción a través de la relación del segmento cuencia mayor a lo esperado, un espectro que presenta

Biblioteca Médica Virtual


66 Genética clínica

A
A. Talla
B. Segmento inferior
C. Segmento superior
D D. Brazada

C Relación de segmentos

SS/SI = Talla- segmento inferior


Segmento inferior
A

Talla blanco familiar (TBF)

B Talla padre + talla madre


2

Hija: TBF – 6.5 cm ± 4 cm


Hijo: TBF + 6.5 cm ± 4 cm

Vertex
C

Glabela
Eurión

moderno Fotocopiar sin autorización es un delito.


Opistocráneo

Prostión

Gonión
Gnatión

Figura 3-2. Somatometría. Talla, brazada, relación de segmentos, perímetro cefálico. A. Somatometría. B. Perímetro cefálico. Los puntos de
referencia son glabela, euriones y opistocráneo. C. Índice cefálico. Porcentaje que representa el ancho cefálico en relación a la longitud.
Normal: 76 a 80.9%. Anchura. Medición con compás entre los puntos más prominentes de los parietales (eurion). Longitud. Medición con
compás entre glabela y opistocráneo.
© Editorial El manual

gran heterogeneidad clínica o bien un defecto de campo nóstico como “cuadro típico”, por ejemplo, de síndrome
de desarrollo que implica alteración en unidades de Down, ya que con ello se desconoce la variabilidad de
embrionarias. las manifestaciones y de acuerdo a la edad, se pueden
Se recomienda exploración general y por áreas con la pasar por alto datos tan importantes como hipotiroidis-
descripción detallada de los datos, no se encomienda mo, obesidad, leucemia o manifestaciones de enferme-
obviar la exploración aun cuando se considere un diag- dad de Alzheimer.

Biblioteca Médica Virtual


Nosología genética 67
INSPECCIÓN GENERAL sos padecimientos en particular con trastornos de pig-
mentación. La hipopigmentación generalizada se presen-
La inspección general permite valorar al individuo de ta en por deficiencia en la formación de melanina en el
manera general y si hay parecido con otros miembros de albinismo oculocutáneo y en menor grado en la fenilceto-
la familia, integra talla, facies, actitud, postura, marcha, nuria. Las manchas hipocrómicas lanceoladas se relacio-
proporciones, asimetrías, dismorfias, edad aparente, entre nan con esclerosis tuberosa. La poliosis que se refiere al
otras. Así por ejemplo, con una talla baja desproporciona- encanecimiento prematuro en la niñez o en el adulto
da se debe descartar una displasia ósea, pero si además joven, se puede presentar como un mechón blanco fron-
presenta facies burda, tronco corto, pecho en quilla y valgo tal y en pestañas, así como el piebaldismo se caracteriza
de rodillas se debe sospechar una mucopolisacaridosis tipo por máculas acrómicas desde el nacimiento localizadas
IV o si la talla baja cursa con obesidad de tronco y retraso sobre todo en frente, mentón, tórax y abdomen, represen-
mental podría sugerir el síndrome de Prader-Willi. tan datos fenotípicos de los diferentes tipos del síndrome
La asimetría corporal es muy heterogénea en aparien- de Waardenburg, que se distinguen desde el punto de
cia, etiología, localización y gravedad. Alrededor de 12% vista clínico por la presencia de distopia cantorum y que
de los recién nacidos tendrán durante los primeros seis se asocia a heterocromía del iris. La hipopigmentación se
meses de vida una preferencia posicional (mantener la puede manifestar con un patrón lineal y abigarrado que
cabeza de un lado la mayor parte del tiempo) que puede antes se conocía como hipomelanosis de Ito y que en la
ser la manifestación de un trastorno subyacente, por lo actualidad se denomina como mosaicismo pigmentario
que hay que buscar signos que permitan diferenciar la que se relaciona con alteraciones cromosómicas inespecí-
forma idiopática de la sintomática, entre esta última des- ficas en mosaico, en el que además se puede presentar un
tacan displasia acetabular, fractura perinatal de clavícula patrón en parches localizados o diseminados que se aso-
, tortícolis congénita, trastornos del sistema nervioso cen- cian a diversas manifestaciones extracutáneas en especial
tral y otros. neurológicas. La hiperpigmentación lineal en particular
La macrosomía con hemihipertrofia puede orientar al en extremidades y tronco, precedida de lesiones vesiculares
síndrome de Beckwith-Wiedemann, pero si por el con- y que cursa con alteraciones en diversos órganos sugiere
trario ésta cursa con talla baja, facies triangular, promi- incontinencia pigmenti, padecimiento dominante ligado
nencia frontal y comisuras labiales hacia abajo, hay que al X que afecta de manera fundamental al sexo femeni-
pensar en el síndrome de Silver-Russell. Una entidad no, ya que es mortal in utero para el sexo masculino. Uno
muy rara que condiciona asimetría por deformidades es de los marcadores hiperpigmentados más comunes son
la fibrodisplasia osificante progresiva que se caracteriza las manchas café con leche, si éstas son de bordes lisos y
por calcificación progresiva de tejidos blandos con inmo- se acompañan de pecas axilares, neurofibromas y nódulos
vilización permanente de las articulaciones. de Lisch se integra al diagnóstico de neurofibromatosis 1;
La marcha anormal atáxica con retraso mental y si presentan bordes irregulares y displasia fibrosa polios-
moria orientan al síndrome de Angelman; sin embargo, si tótica se considera el síndrome de McCune-Albright; si se
presenta datos cerebelosos y telangiectasias oculares asocian con talla baja prenatal y posnatal se debe sospe-
obliga a descartar el síndrome de inestabilidad cromosó- char el síndrome de Silver-Russell y se debe investigar
mica de ataxia telangiectasia, en tanto que la marcha anemia de Fanconi si cursan con alteración del eje radial,
equina es dato de neuropatía periférica, la de pato se pre- pancitopenia o ambas. La acantosis nigricans se caracte-
senta en luxación de cadera o distrofia muscular y la riza por placas hiperqueratósicas, hiperpigmentadas y
espástica en lesión piramidal. aterciopeladas que se distribuyen en los pliegues corpora-
Es importante describir los movimientos anormales les en particular nuca, axilas, antecubital y poplíteo, aun-
como temblores en la enfermedad de Parkinson, tics y que puede involucrar otras áreas como cuero cabelludo y
coreicos en la corea de Huntington, estereotipados en pezones, se relaciona con resistencia a la insulina y obesidad,
retraso del desarrollo y mental por ejemplo, son muy pero también es un signo en leprechaunismo, síndrome de
característicos los movimientos centrales como lavado de Costello y en mutaciones de FGF3 como el síndrome de
manual moderno Fotocopiar sin autorización es un delito.

manos en pacientes con síndrome de Rett. SADDAN y el de Crouzon con acantosis nigricans.
Siempre se debe corroborar que la edad aparente La fotosensibilidad es característica de algunos pade-
concuerde con la cronológica, si el individuo se aprecia cimientos autoinmunitarios como el lupus eritematoso
de menor edad hay que descartar problemas endocrino- sistémico; la luz ultravioleta causa gran daño en la piel y
lógicos como hipotiroidismo o deficiencia de hormona ojos de pacientes con albinismo; y en síndromes con
de crecimiento; en cambio si se aprecia de mayor edad, inestabilidad cromosómica entre ellos el síndrome de
se requieren descartar cuadros de envejecimiento pre- Bloom que tiene talla baja, facies larga con micrognatia
maturo como progeria o el síndrome de Hallerman- y prominencia mediofacial, riesgo de cáncer e incremen-
Streiff, de alteraciones de tejido conectivo como cutis to en intercambio de cromátides hermanas y el padeci-
laxa o el síndrome de Ehlers-Danlos o de encanecimien- mientos con falla en la reparación de nucleótidos; el más
to prematuro como en el síndrome de Waardenburg. conocido es el xeroderma pigmentoso (XP) que presen-
ta lesiones dérmicas y cambios de pigmentación en
zonas expuestas al sol, así como riesgo de cáncer de piel,
relacionados a XP está el síndrome de Cockayne con
PIEL
© Editorial El

fenotipo muy delgado, progeroide, talla baja y retraso


mental profundo y la tricotiodistrofia que cursa con
La piel es el órgano más grande del cuerpo, es reflejo del cabello quebradizo, escaso por deficiencia de azufre en
estado general de paciente y un orientador clínico a diver- el pelo.

Biblioteca Médica Virtual


68 Genética clínica

La ictiosis describe un trastorno de queratinización (figura 3-3A) con asimetría facial puede ser indicativa de
con descamación en piel extremadamente seca, se pre- los síndromes de Muenke o de Saethre-Chotzen por lo
senta en un grupo de genodermatosis de diferente que es importante revisar manos y pies para valorar pulga-
expresión clínica y formas de herencia mendeliana, por res, primeros ortejos y sindactilia cutánea, en estos casos es
ejemplo, la deficiencia de sulfatasa esteroidea es recesi- conveniente el estudio molecular de la mutación
va ligada al X, pero si cursa con asimetría corporal, cata- pro250arg en el gen FGFR3. La turricefalia es una cabeza
ratas y epífisis punteadas se integra la condrodisplasia alta con proporciones de largo y ancho cefálico menores,
punctata tipo Conradi-Hünermann cuya herencia es si cursa con exoftalmos, nariz en pico de loro y mandíbu-
dominante ligada al X; sin embargo, la forma más sor- la prominente se deben considerar características del sín-
prendente es el síndrome del feto colodión con transmi- drome de Crouzon; cuando la parte superior del cráneo
sión autosómica recesiva. presenta una forma cónica se le conoce como acrocefalia
Al apreciar la textura se puede sentir gruesa por infil- u oxicefalia que puede cursar con sindactilia como en el
tración como en las mucopolisacaridosis e hipotiroidis- síndrome de Apert. La dolicocefalia cuyo índice cefálico
mo, aterciopelada como en Ehlers-Danlos o delgada y es menor a 76% representa la sinostosis de la sutura sagi-
atrófica en síndromes progeroides, en hipoplasia dérmi- tal y es la más frecuente y representa de 40 a 60% de los
ca focal y la displasia focal dérmica facial del síndrome casos en su mayoría esporádicos y 6% son familiares con
de Setleis que dan la apariencia de marcas de fórceps. transmisión autosómica dominante, pero si es una recién
Se pueden observar problemas vasculares como los nacida de madre mayor de 35 años, hipotrófica, con daño
hemangiomas capilares en hemangiomatosis diseminada neurológico importante y manos empuñadas con sobrepo-
y en el síndrome de Maffucci que cursa con encondro- sición de dedos, se debe descartar trisomía 18. Una varian-
mas; en el síndrome de Sturge-Weber que es una faco- te por su morfología parecida a un barco es la escafocefa-
matosis con anomalías vasculares cutáneas con un nevo lia por ser las regiones anterior y posterior más afiladas. La
facial plano de color rojo vinoso, cerebrales, oculares y trigonocefalia se debe a la prominencia de la sutura metó-
calcificaciones corticales; las telangiectasias pueden pica, se puede presentar en fetopatía por valproato, en
sugerir síndromes de inestabilidad cromosómica como alteraciones cromosómicas en especial en los cromosoma
ataxia telangiectasia, síndrome de Bloom y otros como 9 y 11 por deleción 11q (síndrome de Jacobsen) y 9p, o
Cockayne y disqueratosis congénita. ante la presencia de facies tosca con hiperplasia gingival y
visceromegalia se sugiere estudiar la mucolipidosis II.
Pocos signos se consideran patognomónicos de una
entidad, tal es el caso del cuerno occipital que refleja una
CRÁNEO exostosis por calcificación de las inserciones de los mús-
culos esternocleidomastoideo y trapecio en el hueso
El tamaño, morfología, suturas y fontanelas pueden occipital. Este signo no está presente en el neonato ni en
orientar a diversas opciones diagnósticas. La microcefalia la etapa pediátrica temprana, aparece después de varios
puede estar presente desde el nacimiento o ser aparente años y se presenta sólo en el síndrome del cuerno occipi-
meses o años después y se acompaña por lo general con tal, sinónimo del Ehlers-Danlos IX, padecimiento muy
retraso psicomotor/mental en diversas entidades, por lo raro caracterizado por concentraciones bajas de cobre
que otras características fenotípicas dismorfológicas o por alteración en el transporte, con signos cutáneos,
neurológicas pueden orientar al diagnóstico, a saber, en el esqueléticos y déficit mental leve, es recesivo ligado al X
síndrome de Cornelia de Lange hay microcefalia y alélico con el síndrome de Menkes por lo que en el estu-
detención del crecimiento prenatal, sinofris y boca con dio de pelo puede presentar pili torti.
labio superior en forma de cupido, mientras que en el La mayoría de los defectos del cuero cabelludo son
síndrome de Rett el perímetro cefálico y el desarrollo benignos y suelen ser familiares, pero la presencia de
psicomotor es normal hasta los 6 o 18 meses de edad en nevo sebáceo obliga a descartar síndrome de Proteus; si
que hay pérdida de habilidades adquiridas y detención las lesiones corresponden a zonas de aplasia cutis (figura
manual moderno Fotocopiar sin autorización es un delito.
del crecimiento cefálico. La macrocefalia puede estar 3-3B) se deben buscar otras alteraciones, por ejemplo, si
relacionada con la talla alta como el síndrome de Sotos, hay defectos transversos de extremidades y cardiopatía
o baja como en acondroplasia, si se asocia con autismo se debe pensar en el síndrome de Adams-Oliver, pero se
deben buscarse mutaciones en PTEN, pero si se acompa- sospecha trisomía 13 ante la presencia de múltiples mal-
ña de asimetría corporal y además hay nevo sebáceo hay formaciones con microftalmia, ausencia de premaxila y
que pensar en el síndrome de Proteus, en cambio con polidactilia posaxial.
alteraciones vasculares, en el de Klippel-Trenaunay- Las características del pelo en relación a su crecimien-
Weber. to, implantación y características pueden orientar a
La persistencia de fontanelas abiertas inclusive hasta diversos diagnósticos. El pelo escaso se puede presentar
la edad adulta se puede presentar en problemas endocri- en diversas displasias ectodérmicas, en síndromes de
nos en especial hipotiroidismo, pero también en displa- Noonan y de Coffin-Siris y la calvicie es un signo de la
sias óseas como la cleidocraneal y la picnodisostosis, por distrofia miotónica, a nivel temporal y con retraso men-
otro lado, si la fontanela está a tensión se puede pensar tal profundo se puede pensar en el síndrome de Pallister-
en hidrocefalia. Killian debida a tetrasomía 12p y cuyo diagnóstico se
© Editorial El

Las craneosinostosis que se deben al cierre prematuro hace con cariotipo en fibroblastos; la hipertricosis es fre-
de algunas suturas craneales pueden provocar alteraciones cuente en la fetopatía por alcohol, en pacientes con cri-
en el crecimiento craneal y condicionar características sis convulsivas tratados con hidantoína y en el síndrome
faciales que orientan al diagnóstico, así la plagiocefalia de Cornelia de Lange.

Biblioteca Médica Virtual


Nosología genética 69
En relación a la implantación, ésta puede ser frontal de iris e hipoacusia se debe descartar síndrome de
alta o baja y es difícil separarlas de características de la Waardenburg I, o si se trata de varón con talla baja con
frente. En la línea alta suele relacionarse con frente acortamiento mesomélico, escroto en chal, criptorquidia
amplia, abombada o prominente como en el caso de y camptodactilia el diagnóstico a considerar es el de sín-
acondroplasia o de la displasia tricorinofalángica; si la drome de Aarskog. Puede haber lengüetas de pelo late-
frente es pequeña o estrecha la línea del pelo será baja rales hacia las mejillas en defectos de arcos branquiales
como en el síndrome de Cornelia de Lange. La implan- como en el síndrome de Treacher-Collins caracterizado
tación anormal en nuca suele ser baja (figura 3-3C) y se por hipoplasia cigomática, microtia, fisuras palpebrales
relaciona con cuello corto, es característica del cuello hacia abajo y coloboma de párpado inferior.
alado del síndrome de Turner, del síndrome de Noonan o La estructura del pelo permite sospechas diagnósticas,
del pterigión múltiple, o bien por la fusión de cuerpos si es fino y escaso en displasias ectodérmicas, en el sín-
vertebrales como en el síndrome de Klippel-Feil. drome tricorrinofalángico o en la hipoplasia cartílago
El crecimiento frontal hacia arriba con nariz fina e pelo; si es ensortijado con hipertelorismo y nariz bífida
hipoplasia de alas nasales debe orientar al síndrome de en el síndrome craneofrontonasal y con cardiopatía, piel
Johanson-Blizzard, en presencia de un varón con retraso redundante y pliegues palmares profundos en el síndro-
global del desarrollo debe investigarse α-talasemia con me cardiofaciocutáneo; si es débil, quebradizo y crespo
retraso mental ligada al X (ATRX). El pico de viuda en tricotiodistrofia, asociado a retraso psicomotor en el
(figura 3-3D) es una lengüeta descendente frontal media síndrome de Menkes y si además hay ictiosis, en el sín-
de la línea del pelo, por lo general relacionada a hiperte- drome de Netherton.
lorismo leve, por ejemplo, de acompañarse de surco en la La hipopigmentación se puede presentar en alteracio-
punta nasal se sospecha displasia frontonasal o síndrome nes metabólicas como fenilcetonuria, homocistinuria y
craneofrontonasal, si hay encanecimiento, heterocromía Menkes; los pelos plateados con trastornos inmunológi-

A B
manual moderno Fotocopiar sin autorización es un delito.

C D
© Editorial El

Figura 3-3. Trastornos craneales. A.Plagiocefalia. B. Zonas de aplasia cutis. C. Implantación baja del pelo en nuca. D. Pico de viuda.

Biblioteca Médica Virtual


70 Genética clínica

cos en el síndrome de Chediak-Higashi y poliosis en el o no ser progresivos, los cuales pueden involucrar las
síndrome de Waardenburg. diversas estructuras oculares y ser parte de diferentes
padecimientos. La separación orbitaria aumentada o
hipertelorismo se caracteriza por mayor distancia inter-
pupilar y es indicador de desarrollo facial anormal.
CARA Puede haber la impresión clínica por depresión del puen-
te nasal, epicanto o telecanto, por lo que idealmente hay
Hay que describir el aspecto general como la forma que que tomar medidas intercantal interna, intercantal exter-
puede ser redonda como en la deleción 5p y en el sín- na e interpupilar. Se presenta en diversas entidades con
drome de Down; alargada como la del síndrome de afección craneal como displasias frontonasal y craneo-
Marfan; triangular en el síndrome de Silver-Russell; cua- frontonasal, así también es característica del síndrome de
drada como en síndrome de Gorlin; corta por microrre- Robinow que tiene facies fetal, fisuras palpebrales anti-
trognatia como en la secuencia de Pierre Robin, si además mongoloides, hipertrofia gingival y talla baja. El hipote-
cursa con hipoplasia malar, microtia, fisuras antimongoloi- lorismo representa acercamiento orbitario y se le consi-
des y coloboma de párpado inferior se piensa en el sín- dera un importante marcador de desarrollo cerebral
drome de Treacher-Collins (figura 3-4A); con mejillas anormal como sucede en holoprosencefalia (figura 3-
redundantes como en el síndrome de Williams el cual se 4C) cuya máxima expresión es la ciclopia, cuadro no
origina por una microdeleción 7q11.23 que condiciona compatible con la vida posnatal.
deficiencia de elastina con otros datos clínicos de talla Los ojos pueden estar hundidos como en el síndrome
baja, retraso mental, hipercalcemia y estenosis supraval- de Freeman-Sheldon que tiene microstomía, facies de
vular aórtica; con mejillas hundidas como se aprecia en silbador y alteraciones de carpo y tarso, o prominentes
la lipodistrofia; la asimetría se puede presentar en crane- como en el síndrome de Crouzon y otras craneosinosto-
osinostosis, espectro facio-auriculo-vertebral (EFAV) y sis. Puede haber anoftalmia aunque es excepcional, lo
síndrome de CHARGE, puede ser parte de hemihiper- más común es microftalmia originada por teratógenos
trofia o sólo hacerse evidente al llanto lo cual obliga a como infecciones, alcohol o warfarina, o ser componen-
descartar la deleción 22q11; la facies aplanada o con te de padecimientos como trisomía 13, síndrome de
retrusión mediofacial se aprecia en los síndromes de Lenz, el oculodentodigital, síndrome de Goltz y EFAV.
microdeleción 22q13, Stickler y Smith-Magenis, en En ocasiones la impresión clínica es de ojo pequeño, pero
acondroplasia, en fetopatías por alcohol y warfarina y en en realidad el tamaño ocular es normal y lo que ocurre
condrodisplasia punctata (figura 3-4B); con prominencia es que hay blefarofimosis, si la fisura palpebral es peque-
mediofacial como en Hallerman-Streiff; la facies burda ña la primera entidad a considerar es el síndrome de ble-
se relaciona con hipotiroidismo y trastornos metabólicos farofimosis-ptosis-epicanto, pero si hay micrognatia,
en particular con depósito de metabolitos anormales paladar hendido y desviación cubital de los índices por
como en las mucopolisacaridosis y gangliosidosis; la hueso accesorio metacarpiano el diagnóstico a considerar
hipomimia facial se presenta en trastornos neuromuscu- debe ser el síndrome de Catel-Manzke, o si hay nariz
lares como distrofia miotónica, enfermedades mitocon- prominente y delgada con mentón afilado y apariencia
driales, miopatías congénitas, síndrome de Moebius por progeroide se establece el diagnóstico de síndrome de
parálisis bilateral del sexto y séptimo pares craneales y el Hallermann-Streiff. La forma almendrada de las fisuras
de Schwartz-Jampel caracterizado por ptosis, facies inex- palpebrales que presenta el síndrome de Prader-Willi
presiva, microstomía, camptodactilia y miotonía. también da la impresión de microftalmia, pero el globo
La frente tiene relación directa con la línea de implan- ocular es normal. La ptosis palpebral también puede
tación del pelo (triquion), así cuadros con una frente confundir con el tamaño del ojo ya que estrecha la fisu-
amplia, prominente o abombada como acondroplasia o ra palpebral, se presenta en cuadros trastornos mitocon-
displasia tricorrinofalángica se aprecian con implantación driales, síndrome de Moebius, síndrome de Noonan y en
alta, mientras que una frente angosta lo hace con la implan- la deleción 11p13 que condiciona el síndrome de WARG
moderno Fotocopiar sin autorización es un delito.
tación baja. Puede ser estrecha con distancia entre tempo- por las siglas en inglés de tumor de Wilms, aniridia, alte-
rales o parietales disminuida como ocurre en los síndromes ración de genitales y retardo mental. La dificultad para
de Seitles conocido como marca de fórceps, en el de Miller- abrir los párpados por sinequias también puede dar con-
Dieker originado por la microdeleción 17q13.3 y se carac- fusión con el tamaño del ojo como ocurre en el síndro-
teriza por daño neurológico importante con lisencefalia y me de Hay Wells conocido como AEC por sus siglas en
el de Schinzel-Giedion caracterizado además por hipertri- inglés de anquilobléfaron (figura 3-4D), displasia ecto-
cosis, surco infraorbitario e hipospadias; una frente inclina- dérmica y fisura labiopalatina. Sin embargo, en el caso de
da puede sugerir alteración de lóbulos frontales como en criptoftalmos no hay fisura palpebral, el ojo es rudimen-
trisomía 13. Los bordes supraorbitarios pueden ser hipo- tario y está cubierto de piel, con línea del pelo frontal
plásicos y los ojos parecen prominentes como en el síndro- aberrante, alteraciones en pabellones auriculares, en
me de Zellweger, en tanto si son hiperplásicos como en la genitales y sindactilia.
displasia frontometafisiaria los ojos se aprecian hundidos; el Otra característica de la hendidura palpebral es su direc-
© Editorial El manual

surco infraorbitario se presenta en la fetopatía por valpro- ción, si se traza una línea imaginaria que conecte los dos
ato, en cuadros con proptosis ocular y en el síndrome de cantos internos, el canto externo puede dirigirse hacia arri-
Schinzel-Giedion, éstos los pliegues infraorbitarios tam- ba (mongoloide) como en el síndrome de Down o hacia
bién se relacionan con edema facial. abajo (antimongoloide) como en síndromes de Treacher-
La exploración de ojos es básica, ya que existen pade- Collins y de Noonan. Las fisuras pueden ser largas como en
cimientos de aparición temprana o tardía y que pueden el síndrome de Kabuki que tiene además ectropión del pár-

Biblioteca Médica Virtual


Nosología genética 71
pado inferior que es la eversión del párpado y que también Cuando la esclera es delgada y se transparenta la
se presenta en la ictiosis lamelar, epidermólisis bulosa dis- coroides, se aprecia de una tonalidad azul grisácea, puede
trófica y en la neoplasia endocrina múltiple tipo IIB (figu- presentarse en recién nacidos normales y a continuación
ra 3-4E); cuando hay entropión las pestañas pueden irritar desaparece, pero de persistir puede orientar a trastornos
el ojo como ocurre en la duplicación 22q11. de tejido conectivo en especial osteogénesis imperfecta,
La córnea puede estar opaca por glaucoma congénito aunque se aprecia en síndromes de Marfan y Ehlers-Danlos.
que condiciona agrandamiento de la cámara anterior, lo Hay diversos tipos de cataratas de etiología mende-
cual es conocido como buftalmos y esclerocórnea es el liana o relacionada con diversos padecimientos cromosó-
término que implica opacidad congénita no progresiva. micos, con retraso mental como el síndrome de
Si se presenta con ictericia neonatal y estenosis pulmo- Marinesco-Sjögren o el de Lowe, a trastornos metabóli-
nar periférica debe pensarse en el síndrome de Alagille, cos como galactosemia, a displasias óseas como condro-
con paladar hendido en síndrome de Stickler, si se asocia displasia punctata o a factores ambientales como rubéola,
con estenosis anal, displasia de iris, hipodoncia y redun- prematurez e hipoxia.
dancia de cicatriz umbilical la sospecha diagnóstica debe Es importante la evaluación de la retina, ya que puede
ser síndrome de Rieger y es un dato posnatal en enfer- orientar a padecimientos lisosomales con la presencia de
medades lisosomales como mucopolisacaridosis, mucoli- la mancha rojo cereza, a infección prenatal por la presen-
pidosis o gangliosidosis. Ante la sospecha de cistinosis cia de retinocoroiditis, y en caso de asociarse retinosis
por raquitismo hipofosfatémico, acidosis metabólica, pigmentaria con obesidad e hipogenitalismo hay que
tubulopatía y daño renal es importante corroborar el considerar el diagnóstico de Bardet-Biedl.
depósito de cristales de cistina en córnea la cual puede Los dermoides epibulbares pueden ser parte del
erosionarse y complicarse con una queratopatía. espectro facio-auriculo-vertebral, pero hay que hacer un
En el iris se pueden presentar varias alteraciones que estudio cuidadoso de la piel para descartar el síndrome
pueden ser clave diagnóstica como las manchas de del nevo sebáceo lineal; si hay estenosis anal, alteración
Brushfield en el síndrome de Down, los nódulos de Lisch de pulgares y cardiopatía congénita se debe investigar el
en neurofibromatosis I, el patrón estelar en el síndrome síndrome de Townes-Brocks y el del cromosoma 22 mar-
de Williams y el anillo de Kayser-Fleischer en la enferme- cador.
dad de Wilson que cursa además con trastornos neuroló- Los conductos lacrimales pueden estar afectados
gicos y hepáticos como resultado del exceso de cobre por como en el síndrome de LADD que tiene aplasia, atresia
un defecto en su excreción. Puede haber colobomas de o hipoplasia tanto de conductos lacrimales como saliva-
párpados por fisuras faciales, en párpado inferior como les con xerosis en ojo y boca, además hay orejas acopa-
en el síndrome de Treacher-Collins (figura 3-4A), de iris das, hipoacusia y alteraciones digitales. La obstrucción de
hasta retina como en la deleción 4p y en el síndrome de la glándula lacrimal con senos en cuello sobre regiones
CHARGE (coloboma, cardiopatía, atresia de coanas, hemangiomatosas a lo largo del estrenocleidomastoideo
retardo en el crecimiento y mental, alteración en genita- y detrás de la oreja, que junto al filtrum estrecho sugie-
les y de pabellones auriculares). ren el síndrome branquiooculofacial (BOF).

A B C
manual moderno Fotocopiar sin autorización es un delito.

D E
© Editorial El

Figura 3-4. Trastornos faciales. A. Hipoplasia de malares, coloboma de párpado inferior, micrognatia en síndrome de Treacher-Collins. B.
Facies aplanada e hipoplasia nasal en condrodisplasia punctata. C. Holoprosencefalia. D. Anquilobéfaron. E. Ectropión.

Biblioteca Médica Virtual


72 Genética clínica

Es importante revisar las características de cejas y pes- Robinow lo tiene largo, mientras que en el de Cohen es
tañas, si están ausentes o muy escasas debe sospecharse corto y en el síndrome de Aarskog es ancho.
alguna displasia ectodérmica o padecimientos que la La exploración de la cavidad oral y todos sus elemen-
tengan por ejemplo, la hipoplasia cartílago pelo; la defi- tos son muy importantes: labios, encías, dientes, lengua,
ciencia o interrupción lateral de las cejas así como exage- paladar, úvula. Si bien hay gran variabilidad en relación
ración del arco natural orienta al síndrome de Kabuki y familiar y étnica, hay datos que caracterizan a diversos
escasas pero con engrosamiento medial es dato del sín- padecimientos, por ejemplo, la boca en forma de carpa
drome tricorrinofalángico; con cejas rectas, ojos hundi- porque las comisuras están hacia abajo es dato clave en
dos y retraso mental se debe descartar deleción 1p36; el síndrome de Silver Russell (figura 3-5C); la microsto-
por otro lado, la confluencia de cejas pobladas se deno- mía con mentón en H es evidente en el síndrome de
mina sinofris, es muy característica del síndrome de Freeman-Sheldon (figura 3-6A), en el de hipoglosia
Cornelia de Lange que tiene hipertricosis y pestañas lar- hipodactilia y en el Schwartz-Jampel, en tanto la
gas (figura 3-5A), se observa también en la mucopolisa- macrostomía se aprecia en fisuras transversas y en el
caridosis III, en algunos pacientes con síndrome de EFAV; el labio superior delgado destaca en el síndrome
Waardenburg y en el síndrome de microdeleción 9q34 de Cornelia de Lange y en la fetopatía por alcohol; los
que tiene estigmas de síndrome de Down y desarrolla labios gruesos dan a la facies un aspecto tosco y se refie-
obesidad troncal; la distiquiasis o doble fila de pestañas ren por ejemplo en mucopolisacaridosis y en mucolipi-
suele irritar la conjuntiva y puede ser el primer signo dosis, también son signo cardinal del síndrome de
para diagnosticar el síndrome de linfedema-distiquiasis, Williams y del síndrome de Coffin-Lowry padecimiento
se aprecia también en el síndrome de Setleis. ligado al X con retraso mental y dedos hinchados con
La revisión y descripción de la nariz implica tanto el apariencia de “salchicha” en el que destaca además una
tamaño, como el puente nasal, dorso, punta, columnela, curva muy marcada en el labio superior; un surco por
alas nasales y narinas. La nariz larga, prominente afilada debajo del labio inferior se considera un dato importan-
con alas nasales poco desarrolladas se aprecia en el sín- te del síndrome de Aarskog.
drome de Hallermann-Streiff, en el oculodentodigital y En general, las fisuras labiopalatinas se consideran de
en el Johanson-Blizzard; es pequeña aplanada en la con- etiología multifactorial, sin embargo la presencia de
drodisplasia punctata, en la fetopatía por warfarina y en hoyuelos en el labio inferior (figura 3-6B) sugieren el sín-
holoprosencefalia en la que pueden tener una sola nari- drome de van der Woude, autosómico dominante con
na (cebocefalia), o con proboscis (etmocefalia). El penetrancia incompleta y expresividad variable, también
puente nasal prominente es característico del síndrome pueden presentarse fosetas en el síndrome de pterigión
de Wolf (deleción 4p), en el de Waardenburg, en el de poplíteo y aunque inconstantes cuando están presentes
Cohen que tiene retraso mental, obesidad e incisivos conjuntamente con la facies aplanada, cejas arqueadas,
grandes y en el velocardiofacial con nariz referida como fisuras palpebrales grandes con ectropión de párpado
piriforme; el puente nasal aplanado es parte de diversas inferior y cojinetes en dedos apoyan el diagnóstico del
entidades por ejemplo, síndrome de Down, acondropla- síndrome de Kabuki.
sia y Stickler. La punta bulbosa con narinas pequeñas y Si hay pequeñas máculas pigmentadas de labios y
filtrum largo es típica del síndrome tricorrinofalángico, mucosa oral la primera opción a considerar debe ser el
la punta con surco o bífida se relaciona con displasia síndrome de Peutz-Jeghers que cursa con pólipos ha-
frontonasal, en tanto la columnela prominente con martomatosos y riesgo a desarrollar cáncer, otras opcio-
punta redonda y lóbulos auriculares levantados sugiere nes son el complejo de Carney que presenta además
el síndrome de Mowat-Wilson; la columnela que se hiperactividad endocrina con mixomas cardiacos y el
extiende por debajo del nivel de las alas está presente en síndrome de LEOPARD (por sus siglas en inglés) carac-
el síndrome de Rubinstein-Taybi; las narinas anteverti- terizado por lentigines múltiples diseminadas en cara
das se relacionan con los síndromes de Cornelia de cuello y tronco, alteraciones ecocardiográficas, estenosis
Lange, Williams y Robinow; el septum aplanado es de la pulmonar, anormalidad en genitales, retraso en el
moderno Fotocopiar sin autorización es un delito.
común en la secuencia de oligohidramnios; si es ancho crecimiento y sordera.
conocido de “pugilista” se menciona en acrodisostosis y La lengua pequeña o microglosia se presenta en casos
en displasia craneometafisiaria (figura 3-5B). Puede de hipoglosia-hipodactilia y en el síndrome orofaciodigi-
haber otros datos independientes de la morfología nasal tal, en ocasiones la posición lingual da la apariencia de
como encefalocele anterior a la altura de la glabela, los microglosia como en la glosoptosis de la secuencia de
pólipos y papilomas pueden tener relación con padeci- Robin por micrognatia y paladar hendido. La protrusión
mientos con riesgo de desarrollar cáncer con el síndro- lingual puede ser por lengua grande que es la macroglo-
me de Costello y el de Cowden. sia verdadera o por cavidad oral pequeña que representa
El filtrum representa la distancia nasolabial, está en la macroglosia relativa. La forma verdadera en un neonato
porción media en la región entre el labio superior y la macrosómico, con defecto de pared abdominal, viscero-
columnela, consta de un surco flanqueado por dos plie- megalia e hipoglucemia sugiere síndrome de Beckwith
gues o pilares; sus variaciones son rasgos cuantitativos y Wiedemann; si hay macrosomía, macrocefalia y surco
© Editorial El manual

cualitativos en relación a longitud (largo, corto), ampli- mediolingual profundo el diagnóstico a considerar es el
tud (ancho, angosto), profundidad (liso, profundo) y apa- de Simpson-Golabi-Behmel; con hipotonía hay que sos-
riencia ( alineación, rafe medio, hoyuelo). pechar enfermedad de Pompe; si hay asimetría lingual se
En la fetopatía por alcohol es característico el filtrum debe revisar la corporal en busca de hemihipertrofia y a
liso, en tanto que en la fetopatía por valproato y el sín- mayor edad puede presentarse en mucopolisacaridosis.
drome tricorrinofalángico es largo y liso, el síndrome de La macroglosia relativa obliga descartar hipotiroidismo,

Biblioteca Médica Virtual


Nosología genética 73

C
manual moderno Fotocopiar sin autorización es un delito.

Figura 3-5. Dismorfias faciales. A. Síndrome de Cornelia de


Lange. Sinofris, fisuras antimongoloides, pestañas largas, nari-
© Editorial El

nas antevertidas. B. Displasia craneometafisiaria. Facies de


pugilista. C. Síndrome de Silver-Russell. Facies triangular, frente
amplia, boca con comisuras hacia abajo y labios delgados.

Biblioteca Médica Virtual


74 Genética clínica

síndrome de Down y un cuadro fenotípicamente muy sugiere holoprosencefalia, la macrodontia orienta al sín-
parecido que es la deleción 9q34. La lengua anormal lisa drome de Cohen, los dientes cónicos a la displasia ecto-
por pérdida de papilas se asocia; con la disautonomía dérmica anhidrótica, los dientes neonatales al síndrome
familiar o síndrome de Riley-Day que es una entidad con de Ellis-van Creveld que además presenta frénulas gingi-
insensibilidad al dolor, hipertermia, diaforesis, daño neu- volabiales y la dentina opalescente con la osteogénesis
rológico y trastornos gastrointestinales; la lengua lobula- imperfecta.
da se presenta en el grupo de síndromes orofaciodigital. Las características de la mandíbula pueden orientar al
En encías se puede presentar hiperplasia gingival en diagnóstico, por ejemplo, prácticamente su ausencia en
tratamientos con hidantoínas y ciclosporina, si está pre- los casos de agnatia y facies corta por micrognatia que
sente en neonatos se debe sospechar el síndrome de representa mandíbula pequeña en su longitud y ancho,
Robinow y enfermedad de células I; las frénulas gingivo- en tanto la retrognatia es el desplazamiento posterior
labiales (figura 3-6C) son un signo cardinal del síndrome mandibular. La micrognatia se presenta en muchas enti-
de Ellis-van Creveld que es una displasia ósea de costilla dades de diversas etiologías, es característica del síndro-
corta con polidactilia, displasia ungueal, y cardiopatía me de Treacher-Collins (figura 3-4A), de la secuencia de
congénita; asimismo son comunes en el pterigión poplí- Pierre Robin con glosoptosis y paladar hendido, de aso-
teo y en síndromes de hipoglosia-hipodactilia en los que ciarse con inestabilidad respiratoria torácica y falta de
se extienden hacia el paladar y piso de lengua. osificación costal se hace el diagnóstico del síndrome
El paladar hendido aislado en especial la porción cerebro-costo-mandibular; con dedos índices desviados
blanda se puede presentar en el síndrome de van der cubitalmente sugiere el síndrome de Catel-Manzke; si se
Woude, el velocardiofacial y en displasias óseas como acompaña de talla baja, microtia y ausencia de rótula se
Stickler y Kniest. La úvula puede estar bífida y ser un sospecha el síndrome de Meier-Gorlin. El prognatismo
signo indicador de paladar hendido submucoso; la voz representa la protrusión anterior, hay que valorar si es
nasal e insuficiencia velofaríngea requiere estudio de por mayor crecimiento mandibular o bien por la retru-
FISH para detectar la deleción 22q11.2 en el síndrome sión mediofacial, suele manifestarse con el desarrollo
velocardiofacial. craneofacial en acondroplasia, X frágil y síndrome de
Los dientes pueden presentar diversas alteraciones Crouzon. La morfología del mentón es muy variada pero
entre otras por alineamiento, tamaño, forma, número o puede ser orientadora, por ejemplo, el mentón afilado es
estructura, que son características de algunas entidades, un rasgo de la deleción 1p36 y en forma de H es carac-
por ejemplo, el incisivo maxilar único (figura 3-6D) terístico del síndrome de Freeman-Sheldon (figura 3-

A B

moderno Fotocopiar sin autorización es un delito.


C D
© Editorial El manual

Figura 3-6. Dismorfias cavidad oral. A. Síndrome de Freeman-Sheldon. Microstomía con mentón en H. B. Síndrome de van der Woude.
Fosetas labiales. C. Frénulas gingivolabiales. D. Holoprosencefalia. Incisivo central único.

Biblioteca Médica Virtual


Nosología genética 75
6A). Es importante recordar que la asimetría mandibu- resonancia magnética de hueso temporal contribuyen a
lar y del mentón suelen estar condicionadas a microso- esclarecer el diagnóstico, ya que permiten detectar alte-
mía hemifacial. raciones clásicas de la entidad como son la hipoplasia
Las alteraciones de pabellones auriculares involu- del yunque, el defecto Mondini y en particular, la
cran combinación de tamaño: grandes o pequeñas, ausencia de los canales semicirculares; la oreja arruga-
forma: recortada, acopada, arrugada, prominentes, crip- da (figura 3-7C) destaca en el síndrome de Beals con
totia y posición: bajas, rotadas. Las orejas grandes y pro- fenotipo marfanoide, prolapso mitral y contracturas en
minentes son características del síndrome de X frágil, especial en dedos.
padecimiento dominante ligado al X que se debe a la Es frecuente que haya hoyuelos preauriculares en
expansión del trinucléotido CGG del gen FMR1 en especial frente a la cruz de la hélice, en tanto los apén-
Xq27.3 cursa con facies alargada, retraso mental, con- dices preauriculares están frente al trago y en ocasiones
ducta autista y en varones macroorquidia. La microtia se extienden por la mejilla hasta el ángulo de la boca,
con o sin atresia de conducto auditivo externo (CAE) alrededor de 90% de éstos son unilaterales y menos de
se clasifica en cuatro tipos, el I es una oreja más peque- 5% se relacionan con síndromes, en particular con sín-
ña con rasgos conservados, el tipo II tiene forma de gan- dromes de arcos branquiales EFAV, Treacher-Collins,
cho en su extremo superior, el tipo III es el prototipo Townes-Brocks y BOR; si se acompañan de cardiopatía
como apéndice vertical cartilaginoso con atresia CAE congénita, estenosis anal y coloboma de iris, el diagnós-
(figura 3-7A) y el IV o anotia que es la forma más tico a considerar es síndrome de ojo de gato por mosai-
grave, por lo común se relaciona con microsomía hemi- cismo de trisomía 22.
facial y es parte del EFAV; diversos padecimientos pueden Hay variaciones en todas las partes del pabellón, las
tener microtia como ejemplo, aneuploidía cromosómi- hélices pueden estar más o menos dobladas, la antihéli-
ca, fetopatía diabética, fetopatía por alcohol, síndromes ce, trago y antitrago pueden estar más o menos promi-
de Treacher-Collins y de Meier-Gorlin. Las orejas aco- nentes, rebordes extras en la cruz de la hélice y de la
padas se observan en el síndrome de LADD, en el bran- antihélice; los lóbulos pueden estar ausentes, muy gran-
quiootorenal (BOR) que se caracteriza por fístulas des como en el síndrome de Kabuki, levantados como en
branquiales, hoyuelos preuriculares, hipoacusia y alte- el Mowat-Wilson, bífidos, lobulados, pegados y pueden
raciones renales como agenesia, hipoplasia o quistes, y tener marcas que son claves diagnósticas como los plie-
en el síndrome de CHARGE (figura 3-7B), sin embargo, gues que se describen en el síndrome de Beckwith
ante la duda diagnóstica la tomografía computarizada o Wiedemann (figura 3-7D).

A B

C D
manual moderno Fotocopiar sin autorización es un delito.
© Editorial El

Figura 3-7. Dismorfias en pabellón auricular. A. Microtia tipo III. B. Síndrome de Charge. Microtia y orejas acopadas. C. Oreja arrugada. D.
Pliegues y surcos en el lóbulo.

Biblioteca Médica Virtual


76 Genética clínica

Una de las alteraciones más referida en dismorfología malformación o falla de segmentación de las vértebras cer-
es la implantación baja de pabellones auriculares, para vicales, la implantación del pelo es baja y la movilidad del
determinarla el inicio de la parte ascendente de la hélice cuello está limitada en todas las direcciones, el primer
debe quedar por debajo de las siguientes líneas: padecimiento a considerar es el síndrome de Klippel-Feil
que tiene fusión de cuerpos vertebrales cervicales aunque
1) Trazar una línea horizontal imaginaria entre los cantos puede haber involucro de otras regiones de la columna, la
externos que debe alcanzar la cruz de la hélice (figura 3- afección es casi exclusiva del sexo femenino y puede
8A). cursar con malformaciones renales y de genitales internos
2) Trazar una línea horizontal del canto externo al occipu- femeninos, datos que se imbrican con la asociación
cio que debe cruzar la parte de unión de la oreja a la MURCS, por otro lado, la fusión de cuerpos vertebrales, la
cabeza. hipoacusia y el fenómeno de Duane por parálisis del sexto
par hacen la triada clásica del síndrome de Wildervanck. La
La rotación de las orejas es normal hasta 30°, por lo alteración cervical puede ser por aplanamiento de los cuer-
tanto para considerar la rotación posterior el ángulo debe pos vertebrales como ocurre en el síndrome de Morquio o
ser mayor de los 30°, en realidad este es un dato erróneo con displasias óseas como la espondiloepifisiaria congénita;
por lo común señalado. si un varón presenta el cuello corto y deformidad de
Para medirlo se traza una línea perpendicular al plano Sprengel (desplazamiento hacia arriba de la escápula) hay
de Frankfurt que conecta el margen inferior de la órbita que investigar la ausencia congénita de vas deferens (vasos
al punto más alto del meato auditivo para hacer ángulo deferentes) y revisar malformaciones renales y segmenta-
con el eje longitudinal medial de la oreja que va del ción cervical anormal. La presencia en cuello de fístulas,
punto más inferior del lóbulo al más alto de la hélice quistes branquiales y hoyuelos obliga a revisar alteración
(figuras 3-8B y 3-8C) renal, ya que son signos cardinales del síndrome de BOR;
sin embargo, si se presentan sobre región hemangiomatosa
e involucro ocular, se debe pensar en el síndrome de BOF.
CUELLO
El cuello alado con piel redundante como consecuencia de TÓRAX
edema nucal intrauterino e implantación baja del pelo en
nuca (figura 3-3C) se puede presentar en síndromes de Es importante explorar la proporción ya que hay varias
Turner, Noonan y Costello. El cuello corto es resultado de displasias óseas que cursan con tronco corto por tener

A A A A

B C

moderno Fotocopiar sin autorización es un delito.

*
© Editorial El manual

Figura 3-8. Posición, medición y rotación de pabellones auriculares. A. Para determinar la posición de las orejas: trazar una línea horizontal
imaginaria entre los cantos internos hasta la oreja, debe llegar a la cruz de la hélice. Se considera implantación baja si la cruz queda por deba-
jo de la línea. B. Las flechas indican el largo y ancho de la oreja. C. Rotación del pabellón auricular. Se mide el ángulo formado por una línea
perpendicular al plano de Frankfurt (en línea punteada) que va del reborde infraorbitario a la parte más alta del meato auditivo externo con el
eje longitudinal medial Se considera rotación posterior cuando mide > 30 °.

Biblioteca Médica Virtual


Nosología genética 77
platispondilia como las displasias espondiloepifisiaria o do y en la adolescencia; sin embargo, hay situaciones en
disostosis múltiple como en las mucopolisacaridosis que las que es anormal, por ejemplo, en un lactante hipotró-
presentan una lengüeta anterior, algunas lo tiene estre- fico con retraso intrauterino, retraso en el desarrollo y
cho como el síndrome de Ellis-van Creveld en ocasiones lipodistrofia generalizada la sospecha debe ser lepre-
el problema pulmonar es tan restrictivo que son morta- chaunismo; la presencia de ginecomastia puberal con
les como la displasia tanatofórica y la displasia torácico datos de hipogonadismo implica estudiar síndrome de
asfixiante de Jeune. El tórax en escudo es amplio, conve- Klinefelter o síndrome de Kallman, pero con caracteres
xo, con teletelia como el que se describe en síndrome de sexuales secundarios normales y lentigines en piel la
Turner y displasias con afectación vertebral y costal. La impresión diagnóstica se orienta hacia el complejo de
escoliosis puede ser idiopática o deberse a hemivértebras Carney lo que amerita evaluación de mixomas cardiacos.
como en la asociación VATER y las displasias espondilo- Es importante consignar las alteraciones de las estruc-
torácica y espondilocostal; a fusión de cuerpos vertebrales turas intratorácicas como esófago, corazón y vías respirato-
como en el síndrome de Klippel-Feil, por neurofibroma- rias tanto anatómicas como funcionales, las cuales pueden
tosis I, por trastorno de tejido conectivo como en el sín- ser únicas o formar parte de síndromes.
drome de Marfan, por debilidad muscular en miopatías
y distrofias o por limitación articular como en pterigión
múltiple.
El pecho excavado (figura 3-9A) es la deformidad torá- ABDOMEN
cica con depresión del esternón y de la unión costoesternal,
la contraparte es la protrusión del esternón denominada En la pared abdominal se pueden presentar alteraciones
pecho en quilla, carinatum o de pichón. Por lo general son como la extrofia vesical o de cloaca; la ausencia de la
datos aislados no relacionados a síndromes, entre los que musculatura con piel laxa, alteraciones renales y criptor-
destacan el síndrome de Marfan, fenotipos marfanoides quidia que hacen la triada del síndrome de Prune-Belly
como el síndrome de Beals y la homocistinuria y el síndro- conocido como abdomen de ciruela pasa, afecta en espe-
me de Noonan. cial a varones y se debe a obstrucción urinaria prenatal y
Un fenotipo torácico diferente se observa con los megavejiga que condiciona oligohidramnios e hipoplasia
hombros caídos con pérdida de la configuración hori- pulmonar. La gastrosquisis (figura 3-9B) es una de las
zontal de la parte superior del tórax, es característica de malformaciones de mayor incremento en los últimos
la displasia cleidocraneal que tiene talla baja, persistencia decenios de etiología no definida, probablemente disrup-
de fontanelas abiertas y retraso en la erupción de la den- tiva vascular, que se relaciona con productos de madres
tición permanente. Si los hombros bajos se asocian a jóvenes y delgadas, con retraso en el crecimiento intrau-
hipoacusia hay que revisar apéndices preauriculares, terino. Es un defecto pequeño de 1 a 3 cm a través de los
quistes branquiales y alteraciones renales que sugieran el músculos rectos, lateral, por lo general a la derecha del
síndrome otofaciocervical que se considera una variante anillo umbilical, por el cual hay salida del intestino y de
del BOR; si hay ptosis palpebral y cardiopatía la sospe- manera eventual de otros órganos hacia la cavidad
cha será de síndrome de Noonan y en ocasiones forman amniótica, lo que condiciona que se malrote, irrite e
parte del síndrome de Holt-Oram que tiene cardiopatía inflame.
y defectos radiales. La región umbilical puede tener alteraciones menores
La ausencia o hipoplasia del músculo pectoral mayor como la redundancia de piel periumbilical que es carac-
por disrupción vascular condiciona la secuencia Poland que terística del síndrome de Rieger o el desplazamiento
se caracteriza por asimetría del hemitórax, mama y extre- hacia arriba que tiene el síndrome de Robinow; puede
midad superior ipsolateral la que suele presentar sindacti- haber hernias pequeñas que cierran de forma espontá-
lia y braquidactilia, y en ocasiones se asocia con parálisis del nea, de mayor tamaño pueden ocurrir en trisomías 21,18
sexto y séptimo par que dan el síndrome de Moebius. y 13, en hipotiroidismo congénito y en mucopolisacari-
En las mamas puede haber variantes como los pezo- dosis y defectos muy grandes como el onfalocele (figura
manual moderno Fotocopiar sin autorización es un delito.

nes supernumerarios o politelia que presentan algunos 3-9C) que se asocia en particular con el síndrome de
padecimientos como el síndrome de Rubinstein-Taybi, Beckwith-Wiedemann y con aneuploidía; a diferencia de
el de Pallister-Killian (tetrasomía 12p) y el Simpson- la gastrosquisis, el onfalocele involucra al cordón umbili-
Golabi-Behmel. La atelia o hipotelia puede ser aislada cal, los órganos que salen de la cavidad abdominal son
con patrón monogénico, pero si además cursa con atresia intestinos, hígado y bazo que permanecen en el saco del
de coanas, ano imperforado y defectos de cuero cabelludo peritoneo visceral, el defecto es de mayor tamaño y tiene
se relaciona con el efecto teratogénico del carbimazole mayor riesgo de otras malformaciones congénitas.
utilizado para tratamiento de tirotoxicosis; puede aso- La hernia inguinal es diez veces más frecuente en
ciarse con la ausencia de glándula mamaria (amastia) varones, la mayoría son no sindrómicas y relacionadas a
como ocurre en la secuencia Poland; es importante revi- prematurez; sin embargo, también se han relacionado
sar extremidades, ya que con ausencia de dedos de la con mayor frecuencia en algunos síndromes. La presen-
región cubital se integra el síndrome cubital-mamario y tación bilateral en una mujer debe alertar a la posibilidad
si hay ectrodactilia puede corresponder al síndrome de insensibilidad a la acción de andrógenos, son comunes
EEC. La teletelia con tórax en escudo en una mujer en mucopolisacaridosis y en trastornos del tejido conec-
© Editorial El

puede sugerir síndrome de Turner y los pezones inverti- tivo como Marfan, Ehlers-Danlos y cutis laxa, en síndro-
dos se relacionan con defectos de glucosilación. me de Williams, Aarskog y Noonan.
La ginecomastia que representa el crecimiento Ante la sospecha diagnóstica hay que considerar que
mamario en el varón puede observarse en el recién naci- los órganos abdominales y retroperitoneales también

Biblioteca Médica Virtual


78 Genética clínica

deben ser estudiados con objeto de detectar algún pade- Pueden ser componente sindromático de padecimien-
cimiento gastrointestinal, hepático, de vías biliares, bazo, tos es como el síndrome de WARG por microdeleción en
riñón y vías urinarias. 11p13, síndrome de Dennys-Drash que tiene nefropatía,
α talasemia con retardo mental ligada al X, síndrome de
Smith-Lemli-Opitz que es un defecto del metabolismo
del colesterol que cursa con retraso mental, estrecha-
GENITALES Y PERINÉ miento bitemporal, narinas antevertidas y sindactilia en
pies y síndrome de Schintzel-Giedion.
Los genitales ambiguos pueden ser por falta de viriliza- El hipogenitalismo es más fácil de detectar en el sexo
ción en un producto masculino o virilización en producto masculino por micropene que se puede presentar por
femenino, por lo general se detectan desde el nacimien- alteración a nivel gonadal o de sistema nervioso central.
to por presencia de falo, clitoromegalia, hipospadias, Es característico de varios síndromes como CHARGE,
escroto hipoplásico o bífido, criptorquidia, labios mayo- Robinow, Prader-Willi y Bardet-Biedl el cual cursa con
res escrotalizados o fusionados, aunque en ocasiones la obesidad, retraso mental, polidactilia posaxial, distrofia
sospecha es hasta la adolescencia o adultez por gineco- retiniana y anomalías renales. En la adolescencia puede
mastia, virilización, problemas reproductivos o cáncer presentarse por retraso puberal en el síndrome de
gonadal. La sola presencia de hipospadias penoescrotal o Klinefelter y en Kallman.
perineal, y la criptorquidia bilateral ya representan alte- El escroto en chal (figura 3-9D) es un repliegue de la
raciones de la diferenciación sexual que ameritan estudio piel sobre la base del pene con apariencia de arco gótico,
integral. Hay diversas causas entre otras, cromosómicas, se debe a un desplazamiento caudal leve del tubérculo
monogénicas como hiperplasia suprarrenal congénita, genital y representa un signo cardinal del síndrome de
insensibilidad a la acción de andrógenos y deficiencia de Aarskog. Si el desplazamiento es mayor hay transposi-
5 α reductasa, por teratógenos químicos por administra- ción penoescrotal como la que se presenta en la secuen-
ción de hormonales durante la gestación o biológicos por cia de defectos uroseptales, por septación anormal de la
tumores ováricos o adrenales maternos y desconocidas. cloaca que condiciona un canal común anal y uretral con
Por el defecto anatómico en la extrofia vesical y de cloa- malformaciones renales y por lo común cardiopatía. La
ca también se compromete secundariamente el desarro- revisión perineal debe involucrar siempre la región anal
llo de los genitales. ya que algunas alteraciones son muy evidentes como la

A B

D moderno Fotocopiar sin autorización es un delito.

C
© Editorial El manual

Figura 3-9. Dismorfias en tórax, abdomen y genitales. A. Pecho excavado. B. Gastrosquisis. C. Onfalocele. D. Síndrome de Aarskog. Escroto
en chal, hernioplastía inguinal bilateral.

Biblioteca Médica Virtual


Nosología genética 79
atresia, pero en ocasiones pueden manifestarse por cons- síndrome de Larsen que cursa con luxaciones de gran-
tipación como en la estenosis e inclusive pueden pasar des articulaciones, a seudoartrosis que se presenta en
desapercibidas, como el desplazamiento anterior. Ante su neurofibromatosis, a trastornos renales como raquitismo
presencia deben buscarse datos que orienten al síndrome hipofosfatémico, a enfermedades lisosomales como
de ojo de gato por mosaico de trisomía 22, al de Townes- mucopolisacaridosis e inclusive a la ausencia o hipopla-
Brocks, a la asociación VATER, al Pallister-Hall, al velo- sia de rótula que da una apariencia aplanada a la rodilla
cardiofacial y alteraciones de línea media como el síndrome en particular al flexionarla, es un rasgo característico del
de Opitz G que cursa con pico de viuda, hipertelorismo e síndrome uña-rótula y del síndrome de Meier-Gorlin; la
hipospadias. deformidad de Madelung no es congénita, aparece des-
Una anomalía esporádica es el apéndice caudal que pués de los seis años de edad y es un signo distintivo de
representa una cola en la región lumbar o sacrococcígea, desproporción del antebrazo con radio incurvado y su
no tiene componente esquelético pero contiene, grasa, epífisis distal inclinada hacia fuera, se relaciona con el
músculo, nervios y vasos sanguíneos. Su presencia ameri- gen SHOX en pacientes con síndrome de Turner y con
ta investigar alteración espinal subyacente al igual que la displasia de Leri-Weill.
marcadores cutáneos pilosos, hoyuelos, lipomas o senos. En manos y pies se presentan diversas características
Pueden asociarse a algunos síndromes por lo que es que suelen concordar entre las cuatro extremidades y
importante revisar datos de retraso mental, hiperteloris- que se transmiten como no sindrómicos de manera men-
mo, facies burda y estrechamiento frontal que orienten al deliana, pero a su vez, pueden ser claves diagnósticas en
Pallister-Killian; la facies aplanada, fisuras palpebrales un componente sindromático, por ejemplo, en manos, la
alargadas con ectropión, hoyuelos labiales y cojinetes polidactilia posaxial de la trisomía 13 o del síndrome de
digitales sugieren el síndrome de Kabuki y ante macroso- Biedl-Bardet; la polidactilia preaxial en síndromes de
mía, paladar hendido, lengua con surco profundo medial, LADD, Holt-Oram y Townes-Brocks; la sindactilia en
cardiopatía e hipospadias hay que sospechar el de secuencia Poland, oculodentodigital, acrocefalosindacti-
Simpson-Golabi-Behmel. lias como Apert y Saethre-Chotzen; la clinodactilia más
frecuente es el incurvamiento del quinto dedo por hipo-
plasia de la falange media, es común en varios síndromes
como Down, Aarskog y Silver-Russell; la braquidactilia o
EXTREMIDADES dedos cortos involucra uno o varios dígitos es un grupo
de entidades como la tipo E que implica el acortamien-
La desproporción de extremidades condiciona alteracio- to de cuarto y quinto metacarpianos que se aprecia en el
nes de la talla, si es baja puede ser por tronco corto o síndrome de Turner; la mano en tridente tiene dedos
extremidades cortas como en diversas displasias óseas, cortos y anchos que le dan esa configuración por la sepa-
enfermedades lisosomales, hipotiroidismo y raquitismo ración de los dedos índice y anular del medio, es casi
entre otras; por otro lado, la talla alta por lo general es exclusiva de acondroplasia y sus variantes alélicas displa-
por extremidades largas como en síndrome de Marfan, sia tanatofórica y SADDAN; la contraparte está repre-
Beals y homocistinura. Pueden manifestar asimetría por sentada por la aracnodactilia que son dedos largos y finos
sobrecrecimiento como en el síndrome de Beckwith- como los del síndrome de Marfan y los cuadros marfa-
Wiedemann, en neurofibromatosis 1, en mosaicismo noides del síndrome de Beals y la homocistinuria; la
somático como el síndrome de Proteus y el Klippel camptodactilia representa una contractura en flexión de
Trenaunay-Weber o en contraparte, por hipodesarrollo uno o todos los dedos, si se asocia con ptosis, facies inex-
como en el síndrome de Silver-Russell, asimismo hay que presiva, microstomía y miotonía la sospecha es de sín-
considerar tanto los defectos de reducción que pueden drome de Schwartz-Jampel, en general, hay también hay
ser unilaterales o bilaterales, por ejemplo, por bandas contracturas en otras articulaciones y pueden tener
amnióticas, secuencia Poland, Holt-Oram e hipoglosia- sobreposición de dedos como en artrogriposis, trisomías
hipodactilia como el aumento de volumen localizado 13 y 18 (figura 3-10A), síndromes de Beals, Freeman-
manual moderno Fotocopiar sin autorización es un delito.

por neoformaciones como exostosis, neurofibromas, cal- Sheldon, aquinesia fetal, Smith-Lemli-Opitz y pterigión
cificaciones o hamartomas. múltiple. Los dedos pueden ser fusiformes porque el
Se refieren más de 150 padecimientos genéticos con estrechamiento próximo-distal de los dedos es acentua-
contracturas, como ejemplo, artrogriposis, trisomías 13 do, son característicos del síndrome de Cohen y aunque
y 18, distrofia muscular congénita, síndrome de se considera que es muy raro detectarlos en recién
Freeman-Sheldon, síndrome de Beals, secuencia de oli- nacidos, de presentarse podrían orientar al síndrome de
gohidramnios, aquinesia fetal, displasia diastrófica, entre Marfan neonatal. El pulgar ancho suele estar aplanado
otras; puede haber localizadas en codo como en acon- con respecto a los otros dedos y tener angulación anor-
droplasia, en manos por camptodactilia, en pies como mal de la falange terminal, es un signo cardinal del
pie equino varo; la limitación articular puede ser conse- síndrome de Rubinstein-Taybi, y puede estar presente
cuencia de luxaciones o de pterigión. Por otro lado, la también en síndromes de Pfeiffer, Apert y Robinow. La
hiperflexibilidad articular que representa laxitud liga- hipoplasia o ausencia de pulgar como alteración del eje
mentaria que puede presentarse en hipotonía, pero que radial puede involucrar el radio y la eminencia tenar, es
desaparece al mejorar el tono; es frecuente en trastornos un dato del síndrome de Cornelia de Lange, pero deben
© Editorial El

del tejido conectivo como síndrome de Marfan y en el investigarse otras malformaciones a nivel vertebral, car-
grupo de Ehlers-Danlos. Pueden exhibir deformidades diaco, renal, gastroenteral que se imbrincan en los síndro-
debidas a contracturas, displasias óseas, huesos frágiles mes de VATER, trombocitopenia con aplasia radial
como osteogénesis imperfecta, a luxaciones como en el (TAR) y anemia de Fanconi, la cual tiene pancitopenia,

Biblioteca Médica Virtual


80 Genética clínica

hiperpigmentación cutánea y riesgo de cáncer. El pulgar mosaico de trisomía 8; sin embargo, si se asocia con cra-
trifalángico conocido como digitalizado es parte del cua- neosinostosis hay que considerar el síndrome de Beare-
dro del síndrome de LADD, del Townes-Brocks y del Stevenson y con trastornos para la alimentación, retraso
Holt-Oram. Los defectos del eje cubital que involucran en el desarrollo y pliegues palmares profundos se debe
al cúbito y los cuarto y quinto dedos, orientan al diagnós- pensar en el síndrome de Costello.
tico del en especial del síndrome cubitomamario y del Las uñas en manos y pies pueden estar hipoplásicas o
síndrome de Miller que presenta características faciales ausentes en la displasia ectodérmica o síndromes que la
como el Treacher Collins, se presenta también en la presenten como la displasia de Ellis-van Creveld; con sor-
embriopatía por diabetes y en el síndrome de Cornelia dera y retraso mental sospechar el síndrome de DOOR
de Lange. La ectrodactilia es otra forma de oligodactilia (sordera, uñas hipoplásicas, osteodistrofia y retardo); la
con ausencia de dedos medios y mano hendida, puede displasia ungueal con forma triangular concentrada hacia
involucrar derivados ectodérmicos en los síndromes el lado radial se encuentra en el síndrome uña-rótula. La
AEC, EEC y su variante alélica extremidad-mama que uñas cortas tienen crecimiento y fuerza normales pero dis-
tiene hipoplasia de pezones y glándula mamaria sin fisu- minución del eje longitudinal, se manifiestan en braqui-
ra labiopalatina, La persistencia de almohadillas fetales dactilias por acortamiento de falanges, son comunes en el
es rasgo característico del síndrome de Kabuki, también síndrome de Williams y en síndrome de Mainzer-Saladino
se observan en la deleción 22q13 que tiene retraso men- que cursa con insuficiencia renal crónica por nefronopti-
tal leve y retraso en el lenguaje y en los síndrome de sis, retinosis pigmentaria y en ocasiones con malformación
sobrecrecimiento de Weaver y Sotos. Aunque ningún de cerebelo. La división longitudinal de la uña por la pre-
patrón de dermatoglifos es patognomónico para un sín- sencia de una cresta que la divide y se rompe en esa zona,
drome, algunos pliegues se presentan con mayor fre- afecta en especial a los pulgares aunque puede ocurrir en
cuencia, por ejemplo, el pliegue simiano en trisomía 21, otros dedo, es patognomónica de la displasia craneofron-
pliegues profundos con piel redundante en el síndrome tonasal.
de Costello y en el cardio-facio-cutáneo y pliegue como
palo de hockey en la fetopatía por alcohol.
En pies destaca la polidactilia prexial con gran expre-
sividad variable, desde una forma subclínica del dedo LABORATORIO Y GABINETE
ancho por duplicación de la falange terminal hasta el
dedo completo supernumerario. La inserción proximal Los estudios de laboratorio y gabinete deben encaminar-
de un hallux adicional a la situación normal se considera se a la corroboración del diagnóstico presuncional y a la
un marcador de embriopatía diabética (figura 3-10B); se búsqueda de otros defectos que no siempre son detecta-
puede acompañar de diversas alteraciones, por ejemplo, bles en el examen físico inicial; en este rubro se incluyen
la presencia de polidactilia posaxial en manos y preaxial no sólo las diversas técnicas especializadas citogenéticas,
en pies con sindactilia y macrocefalia orienta al síndrome moleculares, bioquímicas y genómicas, sino también estu-
de Greig, que en ocasiones cursa con hidrocefalia y dios habituales de sangre u orina, de radiología simple, con
ausencia del cuerpo calloso que son datos que se super- medio de contraste, tomografías y resonancias magnéticas,
ponen con el síndrome acrocalloso; si hay plagiocefalia pruebas funcionales, electroencefalograma, electrocardio-
orienta al síndrome de Saethre-Chotzen; si se acompaña grama y ecocardiograma, entre otros e igualmente deben
en cavidad oral con fisuras, lengua lobulada, frénulas gin- quedar considerados todos los estudios que se realicen
givolabiales se debe sospechar alguno de los tipos de oro- durante la gestación como ultrasonografía, marcadores
faciodigital o si hay facies fetal, micropene e hiperplasia séricos y amniocentesis, sin olvidar la importancia del
gingival, en síndrome de Robinow. El hallux ancho tamiz neonatal.
puede coincidir con pulgares anchos como ocurre en el Debe recalcarse la importancia de tener un diagnósti-
síndrome de Rubinstein Taybi y en el Pfeiffer o tenerlos co lo más preciso posible para solicitar los estudios espe-
normales como en el síndrome de Saethre- Chotzen; un cíficos, por ejemplo, solicitar asesoramiento genético una
moderno Fotocopiar sin autorización es un delito.
hallux valgus corto es característico de la deformidad mujer de 28 años de edad por antecedentes maternos de
condicionada por fibrodisplasia osificante progresiva; la cáncer de mama y desea saber el riesgo de padecerlo. Al
polidactilia posaxial también se presenta con la de elaborar el árbol genealógico informa que su madre
manos en el síndrome de Bardet-Biedl. Un dato de signi- murió accidentalmente a los 30 años de edad, la abuela
ficancia es la sindactilia del segundo y tercer dedos que y una tía murieron por cáncer de mama, un tío por cán-
es un componente del síndrome de Smith-Lemli-Opitz cer de pulmón y dos primos, hijos de la tía con cáncer
y del Pallister-Killian, de alteraciones cromosómicas en murieron, pero se desconocen datos. El planteamiento es
particular deleción 13q, y si cursa con fístula traqueoeso- si solicitar el estudio molecular de BRCA1 y BRCA2 es
fágica, atresia duodenal o ambos puede tratarse del sín- el más adecuado, por lo que se debe contar con más
drome de Feingold. La oligodactilia concordante con la información y datos de las neoplasias y muertes de los
de manos se presenta por bandas amnióticas, en el sín- familiares. En una siguiente sesión informa que la abue-
drome de Adams-Oliver y en el de Miller; la braquidac- la y la tía tuvieron cáncer de mama bilateral que inició
© Editorial El manual

tilia del cuarto y quinto dedos además de la equivalente entre los 30 y 35 años de edad, que el tío presentó un
en manos, asociada a talla baja, facies redonda, cuello cáncer cerebral con metástasis a pulmón, uno de los pri-
corto, calcificaciones en partes blandas con o sin hipocal- mos tuvo osteosarcoma y el otro, astrocitoma; con estos
cemia representa un signo cardinal de la osteodistrofia datos la sospecha es del síndrome de Li-Fraumeni y el
hereditaria de Albright. La sola presencia de pliegues estudio a solicitar debe ser de p53, es decir que de haber-
plantares profundos (figura 3-10C) implica descartar se realizado el estudio de inicial planteado para cáncer de

Biblioteca Médica Virtual


Nosología genética 81

A B

Figura 3-10. Dismorfias en manos y pies. A. Trisomía 18. Mano empuñada con superposición de dedos. B. Polidactilia preaxial con inserción
proximal en embriopatía diabética. C. Pliegues plantares profundos en mosaico de trisomía 8.

mama éste hubiera sido normal, lo que implicaba un ase- 50% si son padecimientos autosómicos dominantes,
soramiento incorrecto, ya que en realidad la consultante mientras que en otros, si el factor etiológico es un terató-
no estaba exenta de riesgo para desarrollar cáncer. geno y se elimina, el pronóstico es bueno para futuras
gestaciones; sin embargo, en otras situaciones como en la
fenilcetonuria materna el control de los niveles de feni-
lalanina durante la gestación es fundamental para evitar
MANEJO
manual moderno Fotocopiar sin autorización es un delito.

daño al producto. De acuerdo al problema se deben


informar opciones como diagnóstico predictivo, de hete-
El diagnóstico exacto puede orientar hacia el manejo y rocigotos y diagnóstico prenatal con marcadores séricos
evitar complicaciones, tal es el caso de un neonato maternos, ultrasonido prenatal y técnicas invasivas como
macrosómico en el que se establece el diagnóstico de biopsia de vellosidades coriónicas o amniocentesis, así
Beckwith-Wiedemann, lo que obliga al médico a identi- como otras opciones reproductivas.
ficar y corregir la hipoglucemia que por lo general se aso-
cia a este padecimiento y así evitar el daño cerebral
secundario. El manejo médico-quirúrgico de estos pro- Cuadro 3-1. Mitos en relación a la herencia
blemas siempre debe ser integral y por tanto multidisci- • Si hay un solo afectado, el problema no es hereditario
plinario, inclusive de requerirse con apoyo psicológico, y • Todos los defectos congénitos son hereditarios
debe abarcar no sólo al paciente sino también al núcleo • La madre hizo algo que condicionó el defecto congénito
familiar. • El problema se debió a algún evento externo o maldición
Un componente importante del manejo es brindar un • Con 25% de riesgo, si hay un afectado, los siguientes tres
estarán sanos
asesoramiento genético de certeza que permita propor- • Con 50% de riesgo, se tendrá uno sano y uno afectado
cionar información sobre el padecimiento, su pronóstico,
© Editorial El

• El orden de las gestaciones influye, la primera y la última


eliminar mitos con respecto a la herencia (cuadro 3-1) y son las de mayor riesgo
establecer riesgos de recurrencia y de ocurrencia en otros • En cáncer de mama, el varón no tiene riesgo ni lo transmite.
• Si el problema es hereditario, no tiene tratamiento
familiares. En algunos casos el riesgo puede ser hasta de

Biblioteca Médica Virtual


82 Genética clínica

Hennekam RCM, Cormier-Daire V, Hall J,Mehes K, Patton M,


BIBLIOGRAFÍA Stevenson R: Elements of morphology: Standard termino-
logy for the nose and philtrum. Am J Med Genet A
Bennett RL: The Practical Guide to the Genetic Family 2009;149A:61-76.
History. 2nd ed. New Jersey: Wiley-Blackwell Inc, 2010. Jones KL: Smith’s Recognizable Patterns of Human
Biesecker LG, Aase JM, Clericuzio C, Gurrieri F, Temple IK, Malformation. 6a ed. Philadelphia: WB Saunders 2006.
Toriello H: Elements of morphology: Standard terminology Jorde LB, Carey JC, Bamshad MJ, White RL: Genética
for the hands and feet. Am J Med Genet A 2009;149A:93- Médica. 3ª ed. Madrid: Elsevier, 2005:305-324.
127. Kase JS, Visintainer P: The relationship between congenital
Carey JC, Cohen MM Jr, Curry CJR, Devriendt K, Holmes malformations and preterm birth. J Perinat Med 2007;
LB, Verloes A: Elements of morphology: Standard termi- 35:538-542.
nology for the lips, mouth, and oral region. Am J Med Milunsky JM, Zhao G, Maher TA, Colby R, Everman DB:
Genet A 2009;149A:77-92. LADD syndrome is caused by FGF mutations. Clin Genet
Cervantes BDE, Villarroel CE, Medrano HA et al.: Setleis syndro- 2006:69:349-354.
me in Mexican-Nahua sibs due to a homozygous TWIST2 Nussbaum RL, McInnes RR, Willard HF: Thompson and
frameshift mutation and partial expression in heterozygotes: Thompson Genetics in Medicine. 7th ed. WB Saunders,
review of the focal facial dermal dysplasias and subtype Philadelphia 2007:51-78.
reclassification. J Med Genet 2011;48(10):716-720. Nuysink J, van Haastert IC, Takken T, Helders PJM:
Firth HV, Hurst JA, Hall JG: Oxford Desk Reference. Clinical Symptomatic asymmetry in the first months of life: diffe-
Genetics. Oxford University Press 2005. rential diagnosis. Eur J Pediatr 2008;167:613-619.
Grupo Mexicano de Consenso en Endocrinología Pediátrica. Reardon W: The bedside dysmorphologist. New York: Oxford
Enfoque diagnóstico del crecimiento normal y de sus alte- University Press, 2008.
raciones. Publicaciones Técnicas. Academia Mexicana de Sánchez G, Guízar VJJ: La historia clínica en genética. En
Pediatría AC. 1997:23-51. Guízar VJJ. Diagnóstico y Manejo de las Enfermedades
Hall BD, Graham JM Jr., Cassidy SB, Opitz JM: Elements of Genéticas. 3ª ed. México: El Manual Moderno, 2004:177-
morphology: Standard terminology for the periorbital 192.
region. Am J Med Genet A 2009;149A:29-39. Stevenson RE, Hall JG. Human malformations and related
Hall JG, Allanson JE, Gripp KW, Slavotinek AM: Handbook of anomalies. 2nd ed. New York: Oxford University Press,
Physical Measurements, 2nd ed. New York: Oxford 2006.
University Press, 2007. Toriello HV: Role of the dysmorphologic evaluation in the
Harper PS: Practical Genetic Counselling. 5th ed. Oxford: child with developmental delay. Pediatr Clin N Am 2008;
Butterworth-Heinemann, 2000:3-55. 55:1085-1098.

moderno Fotocopiar sin autorización es un delito.


© Editorial El manual

Biblioteca Médica Virtual


Nosología genética 83
PREGUNTAS DE AUTOEVALUACIÓN
1. Los hemangiomas capilares se consideran una: 6. La mano en tridente es un signo característico en:
A. Malformación. A. Síndrome de Marfan.
B. Deformación. B. Acondroplasia.
C. Displasia. C. Síndrome de Morquio.
D. Disrupción. D. Pancitopenia de Fanconi.

2. Las técnicas de fertilización asistida se relacionan con 7. La presencia de obesidad, retraso mental, polidactilia
una mayor frecuencia del siguiente síndrome: posaxial, distrofia retiniana, anomalías renales e
A. Down. hipogenitalismo son datos del síndrome de:
B. Acondroplasia. A. Bardet-Biedl.
C. Silver-Russell. B. Prader-Willi.
D. Beckwith-Wiedemann. C. Aarskog.
D. Robinow.

3. La talla esperada para la hija de una pareja en la que el


padre mide 1. 78 m y la madre 1.65 m será: 8. La gastrosquisis se caracteriza por:
A. 1.78 a 6.5 cm. A. Involucro del cordón umbilical.
B. 1.65 m ± 4 cm. B. Defecto de rectos anteriores a nivel infraumbilical.
C. 1.65 m a 6.5 cm. C. Salida de intestinos a cavidad amniótica.
D. 1.58 m + 4 cm. E. Mayor riesgo de otras malformaciones que el onfalo-
cele.

4. La talla baja prenatal y posnatal con facies triangular,


boca en forma de carpa, hemihipotrofia y manchas café 9. La hipomimia facial se encuentra en el síndrome de:
con leche sugiere: A. Kabuki.
A. Síndrome de Silver-Russell. B. Poland.
B. Neurofibromatosis tipo 1. C. Freeman-Sheldon.
C. Displasia fibrosa poliostótica. D. Schwartz-Jampel.
D. Síndrome de Noonan.

10. La presencia de pliegues plantares profundo sugiere:


5. La polidactilia preaxial con inserción proximal del A. Trisomía 8.
hallux es un dato cardinal de: B. Trisomía 13.
A. Síndrome de Holt-Oram. C. Trisomía 18.
B. Embriopatía por alcohol. D. Trisomía 21.
C. Embriopatía diabética.
D. Síndrome de Greig.
manual moderno Fotocopiar sin autorización es un delito.

A 10.
D 9.
C 8.
A 7.
B 6.
C 5.
A 4.
B 3.
© Editorial El

D 2.
C 1.
Respuestas correctas

Biblioteca Médica Virtual


Biblioteca Médica Virtual
ANEXO I
Árbol genealógico en la historia genética

Victoria del Castillo Ruíz

Un componente básico e indispensable de todo expe- neos o inducidos, óbitos, adopción o productos de dife-
diente clínico es el árbol genealógico o pedigrí que es la rentes parejas. Es importante establecer si el matrimonio
representación gráfica de la historia médica familiar es consanguíneo y el grado de parentesco que permita
mediante la utilización de símbolos, algunos de uso más determinar la proporción en que comparten su material
común (figura 1) y otros de menor frecuencia, por ejem- genético (figura 3):
plo, motivados por técnicas de reproducción asistida
(figura 2). Es el primer paso para establecer el riesgo de Primer grado comparten la mitad de sus genes la relación
padecimientos genéticos y debe regirse en un marco de con padres, hijos y hermanos que incluyen a los gemelos
respeto a la situación sociocultural, religiosa y a la auto- dicigotos.
nomía del individuo o de la pareja, sin emitir juicios que Segundo grado comparten 25% de genes: abuelo- nieto, tío-
condicionen culpabilidad ni que violen la confidenciali- sobrino, medios hermanos, dobles primos hermanos.
dad de la información obtenida. Tercer grado tienen 12.5% de genes comunes: primos her-
Para la elaboración del árbol es importante utilizar un manos, medio tío-sobrino.
lenguaje sencillo, común y respetuoso, pero a la vez con Cuarto grado comparten 6.25% de su material genético:
un interrogatorio intencionado que permita obtener medios primos hermanos, tío-sobrino de primos hermanos.
información lo más completa posible. Se debe empezar Quinto grado tienen 3.12% de genes en común los primos
con el probando conocido también como caso índice, segundos.
propositus si es varón o propósita si es mujer (individuo
afectado a partir del cual se hace la historia) o por el con- Es frecuente que se requieran varias sesiones para obte-
sultante (familiar sano que solicita asesoramiento), los ner todos los datos, ya que en ocasiones la información
cuales son identificados con una flecha; posteriormente, inicial es confusa, incompleta o errónea, por lo que
se agregan los familiares de primer grado, los de segundo puede requerirse la revisión clínica de familiares para
y así de forma sucesiva, en general, un esquema básico comparar rasgos fenotípicos e inclusive de ser necesarios
contempla tres generaciones, pero si la información es se les deben realizar estudios de laboratorio o gabinete.
confiable se pueden tener otras más. Las generaciones se Datos como la consanguinidad entre los padres obliga a
refieren con números romanos y en cada una se colocan descartar una patología autosómica recesiva o multifac-
los individuos de izquierda a derecha, del mayor al torial y la presencia de varones afectados en diferentes
menor e identificándolos con números arábigos, empe- generaciones relacionados por rama materna orientan
moderno Fotocopiar sin autorización es un delito.

zando siempre con el número uno. hacia un problema recesivo ligado al X.


Cada característica o padecimiento tendrá un símbo- La elaboración del árbol es importante para un ade-
lo especial que permitirá reconocer a los sujetos que la cuado análisis del mismo y de esa forma tratar de esta-
posean, se pondrán tantos signos como se consideren blecer la etiología del cuadro con objeto de valorar los
necesarios, pero siempre deberán hacerse todo tipo de riesgos y opciones reproductivas que se puedan plan-
aclaraciones pertinentes al pie del árbol. En cada indivi- tear. A continuación se mencionan algunos datos claves
duo se pueden agregar datos como talla, edad actual, en el pedigrí que orientan a un patrón de herencia
edad al fallecimiento, semanas de embarazo, apellidos, (figuras 4A-F):
entre otros, de tal forma que se cuente con una historia
familiar lo más completa posible, sin olvidar que la infor- a) Cromosómico:
mación de familiares no afectados es tan importante • Multimalformaciones con retraso en el desarrollo físi-
como la de afectados. co y mental.
Muchos datos no se obtienen de forma espontánea, • Retraso mental en particular con otras dismorfias.
© Editorial El manual

por lo que deben preguntarse de manera intencionada, • Alteraciones de la diferenciación sexual (hipogonadismo,
por ejemplo, el origen étnico, exposición a agentes ambigüedad de genitales, amenorrea, ginecomastia).
ambientales, si hay afectados con otras manifestaciones • Trastornos reproductivos (esterilidad/infertilidad,
del padecimiento, individuos muertos, abortos espontá- abortos de repetición, óbitos, mortinatos).

85

Biblioteca Médica Virtual


86 Genética clínica

Hombre Portadora de carácter recesivo


ligado al X
Mujer
Sexo no especificado

Afectados
E Embarazo
Caso índice, propositus (-ta)

Consultante Óbito
semanas

Aborto espontáneo, afectado


(sexo, semanas) 3 2 4 Número de individos

Interrupción gestación

Fallecido (a) Gemelos dicigotos

Apareamiento

Gemelos monocigotos
Pareja separada

Consanguinidad
Heterocigotos
Descendencia
Portadores presintomáticos

a) b)
Sin descendencia Adopción

a) por decisión
b) infertilidad

moderno Fotocopiar sin autorización es un delito.


1 2
I Generaciones en números romanos
Individuos en números arábigos

1 2
II

Figura 1. Simbología del árbol genealógico.


© Editorial El manual

Biblioteca Médica Virtual


Anexo I 87

D D Donador de esperma

D Embarazo con esperma de la pareja pero con óvulo de donadora

S Embarazo con gametos de una pareja y útero subrogado

a) b)

D D Embarazo con esperma de la pareja y


óvulo y útero de
a) mujer no emparentada
b) hermana de la esposa

D D Adopción programada con donadores de gametos


manual moderno Fotocopiar sin autorización es un delito.

Figura 2. Simbología del árbol genealógico en reproducción asistida.


© Editorial El

Biblioteca Médica Virtual


88 Genética clínica

GRADO DE GENES
PARENTESCO EJEMPLOS COMPARTIDOS

PRIMER GRADO
Padres-hijos 1/2

Hermanos

SEGUNDO GRADO
Tio-sobrino 1/4
Abuelo-nieto

Medios hermanos

Dobles primos hermanos

TERCER GRADO
Primos hermanos 1/8

Medio tío-sobrina

CUARTO GRADO

Tío-sobrina con un 1/16


salto generacional

Figura 3. Proporción de genes compartidos en diferentes grados de parentesco.

manual moderno Fotocopiar sin autorización es un delito.


• Femenina con talla baja aún sin estigmas de síndrome • No hay transmisión de varón a varón, sólo a través de
de Turner. mujeres.
b) Autosómico dominante (figura 4A). • Todas las hijas de un varón afectado serán porta-
• Transmisión vertical de generación a generación. doras.
• Ambos sexos afectados. • El 50% de los hijos de una portadora estarán afec-
• Transmisión de varón a varón. tados.
• Riesgo habitual de transmisión del 50%. e) Dominante ligado al X (figura 4E).
• Excepciones: mutación de novo, no penetrancia (figu- • Mayor afectación en varones, inclusive mortalidad.
ra 4B). • Si es mortal, múltiples abortos masculinos y sólo
c) Autosómico recesivo (figura 4C). mujeres afectadas.
• Transmisión horizontal. • Si no es letal, el varón afectado transmite el gen a
• Ambos sexos afectados. todas sus hijas.
• Mayor frecuencia de consanguinidad. • No hay transmisión de varón a varón.
• Por lo general ambos padres sanos con riesgo de recu- • La mujer afectada transmite el gen al 50% de su des-
© Editorial El

rrencia de 25%. cendencia.


d) Recesivo ligado al X (figura 4D). f) Multifactorial.
• Por lo general sólo varones afectados, emparentados • Saltos generacionales.
por rama materna. • No hay patrón definido de herencia.

Biblioteca Médica Virtual


Anexo I 89
A) autosómico B) no penetrancia C) autosómico
dominante recesivo

D) recesivo ligada al X E) dominante ligada al X F) mitocondrial

Figura 4.Ejemplos de árboles genealógicos.

• Mayor riesgo en relación a número de afectados, con- En conclusión, el árbol genealógico es una herramienta
sanguinidad, severidad, parentesco cercano y sexo con muy valiosa que permite: apoyar el diagnóstico clínico,
menor frecuencia de afectación. establecer patrones de herencia, calcular riesgos de recu-
g) Mitocondrial (figura AI-4F). rrencia, determinar opciones reproductivas, identificar
• Transmisión sólo vía materna. individuos en riesgo, distinguir otros factores de riesgo,
• Ambos sexos afectados. establecer decisiones de manejo y seguimiento, mantener
• Expresividad muy variable. actualizada la historia familiar, explorar la comprensión
de la información proporcionada y educar al paciente y
Existen otras situaciones que pueden complicar el análi- a la familia.
sis como son: Es conveniente complementarlo con otros diagramas
• Familia pequeña, ya que ante un cuadro clínico no defi- familiares que permitan obtener un mayor conocimien-
nido en hijo único sin antecedentes familiares resulta to del entorno familiar y social del paciente.
muy difícil establecer un patrón de herencia.
• Mutación de novo, autosómica o ligada al X.
• Expresividad variable. BIBLIOGRAFÍA
• Penetrancia reducida.
• Genes autosómicos con expresión limitada o influencia- Bennett RL: The Practical Guide to the Genetic Family History.
2nd Edition New Jersey: Wiley-Blackwell Inc, 2010.
da por el sexo, por ejemplo, malformaciones uterinas o
Bennett RL, Steinhaus KA, Uhrich SB et al.: Recommendations
cáncer de próstata.
manual moderno Fotocopiar sin autorización es un delito.

for standardized human pedigree nomenclature. Am J Hum


• Paternidad ilegítima. Genet 1995;56:745-752.
• Adopción, por lo común se desconoce información de Del Castillo V: Importancia del árbol genealógico. En Salas M,
los padres biológicos y de sus familias. Peñaloza JL, Armas F, Macías M. Guía para el Diagnóstico
• Retraso en la aparición de síntomas, por ejemplo por y Terapéutica en Pediatría. 4ª ed. México: Masson Doyma,
anticipación. 2004:516-524.
• Selección de pareja, pues hay tendencia a que individuos Del Castillo V: El árbol genealógico y su importancia. En
con ciertas características o patologías como sordera, Gámez J, Juárez I. Orientación Diagnóstica en Pediatría.
México: Méndez Editores, 2006:94-103.
ceguera o con displasias óseas, escojan parejas similares.
Kingston HM: ABC of Clinical Genetics. 3rd ed. London: BMJ
• Endogamia (matrimonios en poblaciones pequeñas con Books 2002:5-7.
< 5 000 habitantes). Steinhaus KA, Bennett RL, Uhrich SB et al.: Inconsistencies in
• Información no proporcionada o falseada, por descono- pedigree nomenclature in human genetics publications: a need
cimiento de la historia familiar o de forma intencional for standardization. Am J Med Genet 1995;56:291-295.
por sentimientos de culpa, pena o temor. https://familyhistory.hhs.gov
© Editorial El

Biblioteca Médica Virtual


Biblioteca Médica Virtual
ANEXO II
Otros diagramas familiares

Victoria del Castillo Ruíz

El genograma y el ecomapa son instrumentos gráficos por lo tanto resulta útil colocar la edad de cada persona
que permiten conocer de manera rápida la estructura, el dentro de su figura.
funcionamiento de la familia y sus relaciones. Informan En relación al registro familiar, se considera tanto la
sobre patrones complejos, origen y evolución de situacio- información demográfica que incluye edades, fechas de
nes en la dinámica del grupo familiar. Son independien- nacimiento, muertes, situaciones, ocupaciones y nivel de
tes al pedigrí y debe recalcarse que no influyen en la educacional, como la información funcional que recaba
decisión de pruebas diagnósticas ni en los riesgos de datos médicos, emocionales y del comportamiento de dis-
recurrencia considerados por el padecimiento. tintos miembros de la familia, tales como ausentismo en el
trabajo o alcoholismo. Los sucesos familiares críticos inclu-
yen transiciones importantes, cambios de relaciones, migra-
GENOGRAMA ciones, fracasos y éxitos. La información recogida sobre

El genograma es la representación gráfica de una conste-


lación familiar multigeneracional (tres generaciones) que Hombre
por medio de símbolos proporciona una visión de la Mujer
estructura familiar y sus interacciones a modo de foto- Óbito
grafía, lo que permite recoger, registrar, relacionar y
exponer categorías de información del sistema familiar, Embarazo
en un momento determinado de su evolución y utilizar-
lo para la resolución de problemas, ya que puede ayudar Aborto
a los miembros de una familia a verse a sí mismos de una
manera distinta. Las personas están organizadas dentro Aborto inducido
del sistema familiar según generación, edad y sexo y el
Símbolos de relación entre dos miembros
lugar que ocupen dentro de la estructura familiar puede
influir en el funcionamiento, sus pautas de relación y el Relación cercana
tipo de familia que forme en la siguiente generación.
Separación
moderno Fotocopiar sin autorización es un delito.

Para construirlo se consideran tres niveles: trazado de


la estructura familiar, registro de la información sobre Divorcio
familia y delineado de las relaciones familiares.
La columna vertebral de trazado de la estructura fami- Unidos , buena relación
liar es una descripción gráfica de la forma en que los dife- Muy unidos
rentes miembros de la familia están biológica y legalmente
ligados entre sí de una generación a otra, para lo cual se uti- Distantes
lizan símbolos de género similares al árbol genealógico; sin
embargo, los símbolos para embarazo, aborto y óbito son Pobre relación o conflictiva
diferentes (figura 1). Se deben incluir todas las parejas con
Flujo de energia
matrimonios, separaciones o divorcios, segundas nupcias, el
orden del nacimiento de los descendientes y adopciones.
Hogar inmediato
Con una línea circular se registran los miembros de la fami-
© Editorial El manual

lia que viven en el hogar inmediato.


Es importante señalar la fecha en la que se realiza el
genograma, ya que el resto de la información y los suce-
sos importantes se calculan en relación con dicha fecha, Figura 1. Símbolos en el genograma.

91

Biblioteca Médica Virtual


92 Genética clínica

FAMILIA X
Empresa
Familia extensa

49 58 37
María José Luisa

10 28 25 20
Sebastián Lina Pedro Pablo

Amigos Universidad
Club juvenil

Figura 2. Genograma de la familia X.

cada persona se sitúa junto a su símbolo, en el margen del manos, ya que han pasado las etapas del desarrollo por
genograma o si fuera necesario, en una hoja separada. separado.
Se debe completar el genograma con el trazado de las Es importante observar en el genograma aquellas
relaciones entre los miembros de una familia que se edades que difieran mucho de la norma para su fase del
obtendrán tanto por información de éstos como por ciclo vital y que deben ser objeto de mayor estudio. Las
observaciones directas (figura 2). fechas de nacimientos, muertes, abandono del hogar, de
Un vistazo a la estructura del genograma suele mos- casamiento, separación y divorcio que aparecen en el
trar la composición de la familia, es decir, si es una fami- genograma son muy útiles a este respecto. Puede ser
lia nuclear intacta, una familia con uno de los padres significativo explorar los motivos de elección en una
solamente, una familia que volvió a casarse, una familia pareja con una marcada diferencia de edad, la edad de
de tres, entre otros. procreación, o una familia donde todas las hijas, ya
La posición fraterna y el género puede tener una par- adultas, permanecen solteras y en el hogar.
ticular importancia para la posición emocional de una Al estudiar el genograma a veces se pueden identificar
persona dentro de la familia de origen y en las futuras pautas multigeneracionales de éxito o de fracaso y ciertas
relaciones con su cónyuge e hijos, del hijo mayor se configuraciones estructurales sugieren temas o problemas
esperan grandes cosas en comparación al menor, excep- críticos para la familia, por ejemplo, se puede observar:
to si es el único hombre y las mayores son mujeres. La
diferencia de edades es muy importante en esta rela- - Multitud de separaciones, divorcios o ambos.
ción; por lo general, los hermanos con una diferencia de - Preponderancia de mujeres profesionales de éxito: artís-
edad mayor de seis años son más hijos únicos que her- ticos, científicos, políticos, entre otros.

manual moderno Fotocopiar sin autorización es un delito.


Escuela

Deportes
Padres

CASO
INDICE
Trabajo

Familia
extensa

Amigos
© Editorial El

Figura 3. Líneas de comunicación en el entorno de un caso.

Biblioteca Médica Virtual


Anexo II 93
- Frecuencia en adoptar hijos. jo, recreación, educación, servicios de salud, instituciones
- Mujeres por línea paterna que están solteras. educativas, religión, entre otros.
- Hermanos de una familia que contraen matrimonio con Se mira el entorno en el que se desenvuelve la familia
hermanas de otra familia. con conocimiento del ambiente en el trabajo, lo recreati-
- Reiteración en la elección de un tipo de profesión: maes- vo, salud, prestación de servicios, entre otros. Representa
tros, médicos, comerciantes, entre otros. una técnica para observar las redes de apoyo con las que
cuenta la familia y reconocer así la protección que estas
Los cambios, transiciones y traumatismos críticos de la vida redes puedan brindar a la situación familiar.
pueden tener un impacto sorprendente sobre un sistema Como se observa en la figura 3, el formato del ecoma-
familiar y sus miembros, las pérdidas de familiares, de posi- pa es diferente al del genograma. Semeja una rueda en la
ción social o emigraciones suelen condicionar etapas difíci- que el caso índice está en el centro y las relaciones socia-
les de superar. Por ello, es importante relacionar los sucesos les y agencias están en círculo.
familiares que aparecen en el genograma con el contexto Este “círculo de la vida” incluye jefes, maestros,
social, económico y político en el cual ocurren. entrenadores, líderes religiosos, amigos, vecinos y fami-
liares, con líneas de comunicación cercana o distante al
paciente.
ECOMAPA
BIBLIOGRAFÍA
El ecomapa es usado para la comprensión del entorno en
que se desarrolla la vida de las familias a cargo. Su uso Bennett RL: The Practical Guide to the Family History. 2nd ed.
sistemático tiene el propósito de representar la familia y New Jersey: Wiley 2010:11-15.
sus contactos con sus suprasistemas, es decir, con el www.aniorte-nic.net.
ambiente que les rodea, ya sea la familia extensa, traba- http://aprendenlinea.udea.edu.com
manual moderno Fotocopiar sin autorización es un delito.
© Editorial El

Biblioteca Médica Virtual


Biblioteca Médica Virtual
ANEXO III
Abordaje del paciente dismorfológico

Victoria del Castillo Ruíz, Ariadna González del Ángel

Se conoce como dismorfología a la rama de la genética clí- Cuadro 2. Etiología de los defectos congénitos
nica que estudia las anomalías morfológicas en el ser
humano en combinación con el conocimiento de los Causas % en recién nacidos vivos
mecanismos del desarrollo y de la historia natural de
diversas anormalidades. Incluye aquellos defectos estruc- I. Genética 30 a 40
turales que se originan antes de nacer, los cuales genérica- a) Cromosómica 6
b) Monogénica 7.5
mente son conocidos como malformaciones congénitas. Se c) Multifactorial 20 a 30
presentan en 3 a 5% de los neonatos; sin embargo, esta fre-
cuencia se duplica en el transcurso de la vida debido a la II. Ambiental 8 a 12
presencia de problemas no detectables en el periodo neo- a) Enfermedades 4a6
natal como los que involucran corazón, riñón o cerebro. maternas
Como se aprecia en el cuadro 1, el mayor impacto de estas b) Uteroplacentarias 2a3
c) Teratógenos 2a3
alteraciones ocurre en las pérdidas gestacionales, sin - Físicos
embargo, tienen una contribución importante en la mor- - Químicos
talidad pediátrica en especial perinatal y en el primer año
de vida. En el cuadro 2 se observa que alrededor de la ter- IV. Embarazos múltiples 0.5 a 1
cera parte de los casos de defectos congénitos son de etio-
logía cromosómica, monogénica o multifactorial, sin V. Desconocida 40 a 60
embargo, en aproximadamente la mitad de ellos su etiolo-
gía aún es desconocida.
Como se refiere en el cuadro 3, para el abordaje del lo más completa posible que contemple la historia fami-
paciente es fundamental contar con una historia clínica liar y los antecedentes prenatales, perinatales y posnata-
les. Cabe señalar la relación inversamente proporcional
de defectos congénitos con la edad gestacional (2.7% a
Cuadro 1. Impacto de los defectos congénitos término vs 5.9% en prematuros), además en prematuros
Incidencia (%) el riesgo de malformaciones se incrementa significativa-
mente con menor edad gestacional (9.3%).
moderno Fotocopiar sin autorización es un delito.

Abortos espontáneos La exploración física del paciente debe ser minuciosa,


Primer trimestre 80 a 85 detallada e intencionada que permita discriminar entre
Segundo trimestre 25 la variabilidad normal y lo realmente anormal e interpre-
tar los datos desde un punto de vista de desarrollo
Anomalía mayor morfológico. Por lo común es necesaria la revisión de
Evidente al nacimiento 2a3
Evidente posteriormente 2a 3 familiares de primer grado o de sus fotos para establecer
si el paciente presenta variantes familiares o bien si el
Anomalía menor 15 fenotipo es anormal.
Los estudios de laboratorio y gabinete deben enca-
Mortalidad perinatal 25 minarse a la corroboración diagnóstico presuncional a
través de las diversas técnicas citogenéticas, molecula-
Mortalidad en el primer año 25 res, bioquímicas e inclusive genómicas con microarre-
glos; también es importante la búsqueda de otros
© Editorial El manual

Mortalidad del primer al noveno año 20 defectos que no siempre son detectables en el examen
físico inicial, como cardiopatías, defectos renales,
Mortalidad de los 10 a 14 años 7.5 maduración esquelética y pruebas hormonales o fun-
cionales. En este rubro quedan considerados todos los

95

Biblioteca Médica Virtual


96 Genética clínica

Cuadro 3. Historia clínica No debe pasarse por alto el desarrollo posnatal, el


cual debe ser longitudinal para poder determinar el esta-
Historia familiar do general de salud del paciente, así como su crecimien-
Edad de progenitores al nacimiento y estado de salud
Otros familiares afectados to, desarrollo psicomotor, progresión del problema y la
Abortos múltiples, óbitos detección de otras anomalías, mediante la evaluación clí-
Consanguinidad nica, de laboratorio y gabinete.
Comparación de características fenotípicas
Antecedentes prenatales
Producto único o múltiple
Duración de la gestación CLASIFICACIÓN DE LOS DEFECTOS
Exposición a teratógenos
Enfermedades maternas: diabetes, epilepsia CONGÉNITOS
Complicaciones: hemorragias, fiebre, toxemia
Movimientos fetales (tiempo de inicio y fuerza) Se pueden clasificar por las áreas involucradas, por la edad
Cantidad de líquido amniótico de detección, por su fisiopatogenia y por proteína involu-
Resultado de procedimientos diagnósticos ( ultrasonido,
marcadores séricos y amniocentesis) crada. Desde el punto de vista clínico, es útil considerar
Antecedentes perinatales que a través de una adecuada historia clínica se debe esta-
Complicaciones en parto o cesárea blecer si el defecto es congénito o de aparición posnatal y
Presentación fetal si es único o múltiple (figura 1).
Características de placenta y membranas
Estado y adaptación neonatal (Apgar, Silverman, mediciones
corporales) Defectos únicos
Evolución neonatal (alimentación, anomalías evidentes,
complicaciones) Se clasifican en malformaciones, deformaciones, disrup-
Antecedentes posnatales ciones y displasias y cada uno de ellos tienen diferentes
Crecimiento somático (perímetro cefálico, peso y talla) implicaciones con relación a la presentación clínica, etio-
Desarrollo psicomotor
Estado de salud general logía, riesgo de recurrencia, pronóstico y manejo.
Progresión o no del problema La malformación se presenta en 2 a 3 % de los recién
Detección de otras anomalías nacidos como resultado de un defecto intrínseco del
desarrollo en un órgano, parte de éste o de una región
corporal debido a una morfogénesis incompleta, redun-
estudios que se realicen durante la gestación como dante o aberrante, por lo general de etiología multifacto-
ultrasonografía, marcadores séricos y amniocentesis. rial. Esto implica que hay alteración en los procesos de

ESTUDIO DEL PACIENTE DISMORFOLÓGICO

Historia clínica y exploración física Inicio postnatal


para determinar

Genética Ambiental Desconocida

Inicio prenatal

moderno Fotocopiar sin autorización es un delito.


Malformación

Deformación
Anomalía única
Disrupción

Displasia

Síndrome

Secuencia

Anomalías múltiples Asociación


© Editorial El manual

Espectro

DefCD

Figura 1. Abordaje del paciente con defectos estructurales. DefCD, defecto de campo de desarrollo.

Biblioteca Médica Virtual


Anexo III 97
formación, determinación de ejes y organogénesis, los Cuadro 5. Ejemplos de deformaciones
cuales están controlados por genes que codifican para
diversas proteínas, por ejemplo, de señalización, recepto- Localización Tipo de deformación
res, factores de transcripción, componentes de matriz Craneofacial Dolicocefalia
extracelular y sistemas de transporte. Como se observa Plagiocefalia
Facies plana de Potter
en el cuadro 4, la más común es la incompleta en donde Deformación nasal
ocurre una detención del desarrollo, la mayoría de las Deformaciones auriculares
alteraciones son de etiología multifactorial como en el Micrognatia
caso de los defectos del tubo neural y las fisuras labiopa- Asimetría mandibular
Tortícolis
latinas, que representan dos de las malformaciones más
Tórax Pecho en quilla
frecuentes. Pecho excavado
La deformación se presenta en 1 a 2% de los recién naci- Escoliosis postural
dos como una alteración secundaria en la morfología o Extremidades Luxación de la cabeza del radio
posición de una estructura normal originada por la acción Luxación de cadera
de factores mecánicos, malformativos o funcionales que Torsión tibial
actúan en etapa fetal. Las causas mecánicas son las más Articulaciones en flexión
Pie equino varo
comunes y condicionan compresiones en diferentes partes Talo valgo
del feto, por ejemplo, la primera gestación que se asocia con
resistencia de la pared uterina y abdominal, y por otras cau-
sas como oligohidramnios, presentación fetal anormal, ma- por ejemplo, hamartomas. Este tipo de alteración tiende
crosomía, embarazos múltiples, alteraciones uterinas como a persistir o empeorar con la edad.
miomas uterinos o útero bicorne. Asimismo, malformacio- Debe tomarse en cuenta que las malformaciones y las
nes neurológicas y del aparato urinario o problemas funcio- displasias son acontecimientos primarios en la embriogé-
nales neuromusculares y del tejido conectivo condicionan nesis y en la histogénesis, mientras que las deformaciones
deformaciones como luxación de cadera o pie equino varo, y disrupciones son acontecimientos secundarios que
entre otras que se mencionan en el cuadro 5. afectan el desarrollo normal. Es importante identificar el
La disrupción se presenta en 1 a 2% de los recién tipo de defecto por la relevancia que tiene en relación al
nacidos como resultante de la acción de factores extrín- pronóstico y manejo; por lo general, las deformaciones se
secos del desarrollo en especial vasculares, anoxia, infec- manejan de forma conservadora, mientras que las mal-
ciones, radiaciones y mecánicos, que condicionan un formaciones y disrupciones por lo común necesitan cirugía,
bloqueo o interrupción del proceso normal embrionario en tanto las displasias pueden requerir ambos manejos.
o fetal. Las anomalías resultantes muestran pérdida tisu- Por último, también varía el riesgo de recurrencia puesto
lar, diferenciación aberrante entre tejidos contiguos y que en las malformaciones es más elevado (2 a 5%), en
una formación incompleta con la consecuente interrup- relación a los otros defectos.
ción o destrucción total o parcial de una región corpo- De acuerdo a su importancia médica, estas anomalías
ral, como sucede por ejemplo, con las bandas amnióticas, se dividen en mayores y menores. Un defecto mayor se
que en ocasiones condicionan alteraciones similares a presenta en 2 a 3% de los recién nacidos y es aquel que
malformaciones primarias como fisuras faciales o reduc- compromete vida o función, por ejemplo, labio y paladar
ción de extremidades. hendido, defectos de cierre del tubo neural o cardiopatí-
La displasia resulta de una organización y función as congénitas.
tisular anormal que puede ser localizada o generalizada, Los defectos menores no tienen implicación médica
importante, pero tienen repercusión estética y son claves
para la integración diagnóstica, como apéndices preauri-
Cuadro 4. Clasificación y ejemplos de culares, epicanto o pliegue simiano; éstos se presentan en
manual moderno Fotocopiar sin autorización es un delito.

malformaciones 15% de los recién nacidos y es muy importante su iden-


tificación en particular en relación al número, ya que
Tipo Ejemplos de malformaciones
permite sospechar alteraciones mayores. Se considera
A) Morfogénesis incompleta
que el riesgo de un defecto mayor ante la presencia de
Falta de desarrollo Ausencia de narina, agenesia renal
uno menor es de 3%, mientras que con tres o más meno-
Hipoplasia Microcefalia, micrognatia
res, el riesgo se eleva hasta 90%. En el cuadro 6 se pre-
Cierre incompleto Labio/paladar hendido, coloboma de
iris, defectos tubo neural
sentan algunos ejemplos de dismorfias menores.
Separación incompleta Sindactilia
Septación incompleta Comunicación interventricular Defectos múltiples
Migración incompleta Extrofia de la cloaca Por lo general los defectos estructurales congénitos afec-
Rotación incompleta Malrotación intestinal tan sólo un sitio del cuerpo, mientras que el resto presen-
Eliminación incompleta Atresia de coanas, divertículo de ta un desarrollo normal; sin embargo, puede ocurrir que
de forma temprana Meckel
existan múltiples defectos menores o mayores en un
Localización temprana Criptorquidia, implantación baja de
persistente pabellones auriculares, individuo que pueden definir un patrón específico de
© Editorial El

B) Morfogénesis redundante Apéndices preauriculares, polidactilia


anomalías, lo cual tiene implicaciones con relación a
C) Morfogénesis aberrante Glándula tiroides mediastinal, bazo
etiología y pronóstico. Estas entidades se dividen en sín-
ectópico drome, secuencia, asociación, espectro y defecto de
campo de desarrollo.

Biblioteca Médica Virtual


98 Genética clínica

Cuadro 6. Ejemplos de defectos congénitos menores los esfínteres urinario y anal. El riesgo de recurrencia
dependerá del evento primario.
Cráneo Genitales Una asociación es un patrón de anomalías múltiples
Foramina parietal Hidrocele idiopáticas de la blastogénesis, que se presentan juntas
Parietal prominente Hipoplasia escrotal
Occipucio plano Escroto en chal con una frecuencia mayor a lo esperado, pero no se les
Pabellones auriculares Ano y periné reconoce como un síndrome, secuencia o defecto de
Apéndices preauriculares Periné corto o largo campo de desarrollo. Un ejemplo es la asociación VATER
Hoyuelos auriculares o VACTERL, acrónimo que identifica las anomalías a
Ojos Dorso nivel vertebral, anal, fístula traqueoesofágica, cardiaca,
Heterocromía del iris Hoyuelos sacros renal y radial. Las asociaciones por lo general tienen un
Coloboma de iris Marcador piloso lumbosacro riesgo de recurrencia muy bajo; sin embargo, debe hacer-
Epicanto se diagnóstico diferencial de padecimientos monogénicos
Nariz Piel que modifiquen el pronóstico, por ejemplo, con anemia
Columnela corta Nevos de Fanconi, entidad autosómica recesiva que tendría
Punta de la nariz bulbosa Hipertricosis
Narinas antevertidas Hemangioma plano
25% de recurrencia.
Manchas café con leche El espectro comprende entidades con múltiples ano-
Cavidad oral Uñas malías que muestran gran variación clínica, como el
Frenillo corto Surcos en uñas espectro oculoauriculovertebral o facioauriculovertebral
Incisivos pequeños Hiperconvexas que puede tener afección prácticamente en todas las
Cuello Manos áreas del organismo, aunque se caracteriza en especial
Fístulas branquiales Clinodactilia del quinto por microtia, microsomía hemifacial, alteraciones oftal-
dedo mológicas y vertebrales.
Ancho Pliegue palmar único El defecto de campo de desarrollo es una alteración
Corto Braquidactilia
en la unidad embrionaria en la que el desarrollo de
Tórax Pies
estructuras complejas a partir de las sencillas, se determi-
Pezones supernumerarios Sindactilia entre el
segundo y tercer ortejo na y controla con relación al espacio y tiempo de mane-
Teletelia ra coordinada, sincrónica y jerárquica. Su etiología es
Abdomen Articulaciones heterogénea y se reconocen dos tipos: monotópico que
Diástasis de rectos Camptodactilia involucra estructuras contiguas como en holoprosencefa-
Hernia umbilical Cúbito valgo lia y el politópico que abarca estructuras anatómicas
distantes que comparten mecanismos de control en su
desarrollo como en los síndromes radio-corazón.

Se define como síndrome al patrón de anomalías múlti-


ples relacionadas a una etiología común que puede ser ANOMALÍAS DE INICIO POSNATAL
cromosómica, monogénica o teratogénica. Sin embargo,
en 40 a 60% de las ocasiones la etiología se desconoce y Siempre debe tenerse en cuenta que algunos cuadros dis-
se considera que son entidades esporádicas. morfológicos iniciarán de forma posnatal sus manifesta-
Con los avances en biología molecular cada día se
ciones clínicas. Pueden deberse a causas genéticas como
tendrán mayores conocimientos de las entidades consi-
alteraciones del tejido conectivo (síndrome de Marfan,
deradas de etiología desconocida, así por ejemplo, ya se
osteogénesis imperfecta, Ehlers Danlos, entre otros);
han logrado identificar genes responsables de algunos
trastornos metabólicos como enfermedades por atesora-
síndromes como el de Beckwith Wiedemann (factor de
miento, padecimientos neuromusculares y cuadros
crecimiento IGF2), el de Rubinstein Taybi (activador
transcripcional CBP), el del síndrome CHARGE antes hamartoneoplásicos. La hipoxia, traumatismos e infec-

moderno Fotocopiar sin autorización es un delito.


asociación (chromodomain helicase DNA-binding protein- ciones son parte de la etiología ambiental en este rubro.
7 CHD7 y semaphorin-3E SEMA3E), o bien mecanis-
mos como impronta genómica y disomía uniparental en
la región 15q11-13 que explican los síndromes de CONCLUSIONES
Prader Willi y Angelman.
Se considera una secuencia a la cascada de eventos En todo paciente con defectos congénitos es prioritario
secundarios a una alteración primaria resultante de cual- contar con un diagnóstico certero, ya que esto permitirá
quiera de los defectos únicos, por lo tanto, las secuencias definir la conducta a seguir con relación a las siguientes
podrán ser malformativas, deformativas, disruptivas o dis- áreas:
plásicas. Por ejemplo, el paladar hendido y la glosoptosis
en la secuencia Robin, se originan por micrognatia extre- a) Identificación de anomalías ocultas: deben buscarse altera-
ma debida diversas etiologías como déficit de crecimiento, ciones que no son evidentes en una evaluación inicial y
© Editorial El manual

oligohidramnios, trastorno neurogénico o del tejido conec- cuyos efectos podrían observarse en etapas tardías de la
tivo. Otro ejemplo, es la secuencia de defectos de cierre de vida. Así, en un paciente con diagnóstico establecido de sín-
tubo neural, en donde la falla en el cierre del tubo neural drome de Marfan, es obligado realizar estudios de gabinete
primario origina un mielomeningocele, asociado a hidro- para identificar anomalías aórticas, así como ectasia dural,
cefalia y diversos grados de daño cerebral, así como pará- b) Pronóstico: el conocimiento de la evolución de un deter-
lisis de los miembros inferiores y pérdida de la función de minado padecimiento permite establecer un pronóstico

Biblioteca Médica Virtual


Anexo III 99
de función y supervivencia, por ejemplo, un paciente de establecer un diagnóstico preciso e iniciar el manejo
anencefálico siempre tiene muy mal pronóstico para la temprano, integral y multidisciplinario que permita la
vida a corto plazo, mientras que en una polidactilia sim- mejor función y calidad de vida de los pacientes y de sus
ple, por lo general es bueno tanto en función de la mano familias.
como en supervivencia; sin embargo, si esa polidactilia es
parte de cuadro sindromático como una trisomía 13, el
pronóstico es por completo diferente. BIBLIOGRAFÍA
c) Manejo: un diagnóstico exacto puede orientar hacia el
manejo y evitar complicaciones, tal es el caso de un neo- Aase JM: Dysmorphologic diagnosis for the pediatric practitio-
nato macrosómico en el que se establece el diagnóstico de ner. Pediatr Clin North Am 1992;39:135-156.
Cohen MM: The child with multiple birth defects. 2nd ed.
Beckwith-Wiedemann, lo que obliga al médico a identifi-
New York: Oxford University Press; 1997:3-53.
car y corregir la hipoglucemia que por lo general se aso- Epstein CJ: The new dysmorphology: application on insights from
cia a este padecimiento y así evitar el daño cerebral basic developmental biology to the understanding of human
secundario. El manejo médico-quirúrgico de estos proble- birth defects. Proc Natl Acad Sci 1995;92:8566-8573.
mas siempre debe ser integral y por tanto multidisciplina- Graham JM: Clinical approach to human structural defects.
rio y debe abarcar no sólo al paciente, sino también al Seminars Perinatology 1991;15:2-15.
núcleo familiar. Hall BD: The state of the art of dysmorphology. Am J Dis
d) Asesoramiento genético: es importante brindar un aseso- Child 1993;147:1184-1189.
ramiento genético de certeza en relación a riesgo de recu- Harper PS: Practical Genetic Counselling. 5th ed. Oxford:
Butterworth-Heinemann 2000:83-91.
rrencia y de ocurrencia en otros familiares. En algunos
Jones KL, Jones MC: A clinical approach to the dysmorphic child.
casos el riesgo puede ser hasta de 50% si son padecimien- En Rimoin DL, Connor JM, Pyeritz RE, Korf BR. editors.
tos autosómicos dominantes, mientras que en otros, si el Emery and Rimoin’s Principles and Practice of Medical
factor etiológico es un teratógeno y se elimina, el riesgo es Genetics. 5a ed. New York: Churchill Livingstone 2007:889-
prácticamente nulo en futuras gestaciones. De acuerdo al 899.
problema se deben informar opciones de diagnóstico pre- Jones KL: Dysmorphology approach and classification. En Jones
natal con marcadores séricos maternos, ultrasonido pre- KL ed. Smith’s Recognizable Patterns of Human
natal y amniocentesis. Malformation. 6a Ed. Philadelphia: WB Saunders 2006:1-6.
Jorde LB, Carey JC, Bamshad MJ: Genética Médica. 4a ed.
Barcelona: Elsevier Mosby; 2011:292-310.
El paciente dismorfológico se caracteriza por una gran Kase JS, Visintainer P: The relationship between congenital
variabilidad clínica y complejidad etiológica, por lo que malformations and preterm birth. J Perinat Med 2007;35:
representa uno de los mayores retos para todo médico. 538-542.
Es necesario que el médico de primer contacto cuente Lacombe D: Transcription factors in dysmorphology. Clin
con los conocimientos básicos de la dismorfología, a fin Genet 1999;55:137-143.
manual moderno Fotocopiar sin autorización es un delito.
© Editorial El

Biblioteca Médica Virtual


Biblioteca Médica Virtual
4 Cromosomas
y patologia
cromosómica
Sara Frías Vázquez, Bertha Molina Álvarez, Alfredo de Jesús Rodríguez Gómez,
Sandra Elena Ramos Ángeles, Silvia Rosalía Sánchez Sandoval, Camilo Villarroel

CICLO CELULAR ciones celulares altamente especializadas como las fibras


musculares o neuronas al entrar al estado G0 abandonan
El ciclo celular está formado por una serie de etapas que de manera indefinida el ciclo celular y ya no pueden pro-
permiten que la célula se duplique y se divida para pro- liferar (figura 4-1).
ducir dos células hijas, es un mecanismo esencial para la De acuerdo a la capacidad de crecimiento y división,
vida celular. En especies unicelulares como las bacterias se pueden distinguir tres categorías celulares: 1) células
y levaduras, al dividirse cada célula produce un nuevo altamente especializadas que una vez que se han diferen-
organismo completo. En especies pluricelulares, se ciado pierden la capacidad proliferativa y permanecen en
requieren secuencias largas y complejas de divisiones ese estado hasta que mueren, como las células nerviosas,
celulares para producir un organismo funcional; en orga- musculares o eritrocitos, 2) células que no proliferan y
nismos adultos, la división celular es necesaria para reem- no se dividen en condiciones normales, pero que al reci-
plazar las células que mueren de manera programada y bir el estímulo adecuado pueden activar la síntesis de
las que han sido dañadas por agentes externos. El ciclo DNA y dividirse, como las células hepáticas y los linfoci-
celular varía un poco de organismo a organismo, pero tos, 3) células que en condiciones normales tienen una
ciertas características son universales. gran capacidad proliferativa y que en algunos tejidos
Con base en las actividades celulares visibles al humanos mantienen una renovación celular continua
microscopio óptico, el ciclo celular tiene dos fases prin- debido a la constante formación de células nuevas; por
cipales: la fase M o de división y la interfase. La división ejemplo, las espermatogonias que dan origen a los game-
o mitosis es la fase en la que los cromosomas duplicados tos masculinos, las células hematopoyéticas que produ-
se separan y se forman dos células hijas. La interfase es el cen eritrocitos y leucocitos, y las células de la base de
periodo entre las divisiones celulares, donde la célula epitelios que recubren las cavidades corporales y la
crece y efectúa diversas actividades metabólicas. La superficie del cuerpo.
interfase está formada por las fases G1, S y G2 que se
moderno Fotocopiar sin autorización es un delito.

encargan del crecimiento celular y de la replicación del Fases del ciclo celular
material genético. En general, el ciclo celular está forma-
do por las fases G1, S, G2, M en las que se llevan a cabo Fase G1. Es una etapa de crecimiento celular, donde los
diversas actividades celulares de una manera ordenada, organelos se duplican y la célula mantiene su metabolis-
secuencial y con dirección que permiten que las células mo normal; existe una síntesis de RNA y proteínas muy
proliferen de acuerdo a los requerimientos del individuo. activa que permite que la célula tenga las moléculas
Cuando un organismo ya no requiere de la proliferación necesarias para que pueda transitar a la fase S e inicie de
continua de un tipo celular específico, esas células aban- manera adecuada la replicación del DNA. Tiene una
donan el ciclo celular y entran en periodo de latencia duración entre 10 y 12 h y durante este tiempo la célula
denominado G0, que puede durar días, semanas o años; duplica su tamaño y masa debido a la síntesis de todos
esto no significa que entren en reposo, ya que estas célu- sus componentes. En esta fase, cada cromosoma es una
las presentan un metabolismo activo, pero sin capacidad molécula simple de DNA (una cromátida).
proliferativa y si reciben el estímulo adecuado abando- Fase S. Es la etapa de síntesis de DNA, cada cromosoma se
© Editorial El manual

nan el estado G0 y entran al ciclo celular en la etapa G1, duplica y al final de fase S queda formado por dos cro-
como ocurre en los linfocitos cuya proliferación o activa- mátidas hermanas (idénticas). Al iniciar la replicación, se
ción del ciclo celular puede inducirse por interacción duplican los centriolos y se sintetizan las histonas que
con el antígeno adecuado. En contraste, algunas pobla- van a utilizarse para constituir los nuevos nucleosomas

101

Biblioteca Médica Virtual


102 Genética clínica

Metafase-telofase
Punto de verificación
G2/M Punto de verificación
ciclina B/A-Cdk-1 M, activación de
entrada a M APC, salida de
M M (2n)

Crecimiento celular
(4n) reparación Crecimiento celular (2n)
postreplicativa duplicación de los organelos

G2 G1

S
Punto de verificación
G1/S
ciclina E/A-Cdk2
Replicación del DNA y entrada a S y
duplicación de los cromosomas compromiso con la
replicación

Figura. 4-1. Fases y regulación del ciclo celular. El crecimiento celular y replicación del DNA se realizan en G1, S y G2 de la interfase y la divi-
sión celular en la mitosis. El tránsito de la célula en las fases del ciclo se regula a través del complejo ciclina-Cdk específico.

que se van a asociar al DNA recién replicado. Tiene una Fase M. Es el proceso de división celular en donde una célu-
duración de 6 a 8 h. Las células en fase S pueden ser la duplicada da lugar a dos células hijas idénticas. Está
reconocidas directamente en el microscopio por medio formada por profase, prometafase, metafase, anafase,
de autorradiografía, en un cultivo asincrónico se utilizan telofase y citocinesis. Esta etapa dura de 30 min a 1 h.
nucleótidos marcados y durante la replicación del DNA
la célula los incorpora de igual manera que el nucleótido El tiempo total del ciclo celular y de cada una de sus
sin marca que se encuentra normalmente en la célula. fases varían dependiendo del tipo celular. Las células
Esta marca puede ser radioactiva, por lo general en la humanas que se encuentran proliferando en cultivo tie-
forma de timidina tritiada (3H-timidina), o química, al nen un ciclo celular de 24 h: 23 h en interfase y 1 h en
usar un análogo artificial de la timidina denominado bro- mitosis. Sin embargo, en células de rápida división como
modesoxiuridina (BrdU). Cuando se utiliza marca radio- las embrionarias, de la dermis o la mucosa intestinal, el
activa, los núcleos en fase S pueden identificarse por ciclo celular dura una o pocas horas mientras que en
autorradiografía mientras que cuando se usa BrdU, los otros tipos celulares puede extenderse por días, semanas
núcleos se detectan con un anticuerpo anti-BrdU marca- o años como en los ovocitos. Las metodologías de marcaje
do con fluorescencia al observarlos en un microscopio de de síntesis de DNA y el índice mitótico permiten estimar
fluorescencia o bien cuantificándolos en un citómetro de la duración de las etapas S y M al considerar, la fracción
flujo. Esta fase del ciclo ha sido un blanco para el trata- de las células marcadas y en mitosis como una fracción
miento de padecimientos cancerosos, ya que la mayoría del ciclo completo. Otra metodología que se usa en la
moderno Fotocopiar sin autorización es un delito.
los fármacos utilizados afectan la replicación del DNA y actualidad es la citometría de flujo, con pulso y caza de
provocan la muerte de las células que se están reprodu- marcaje con BrdU se puede determinar el tiempo total
ciendo activamente. del ciclo celular y al teñir el DNA con ioduro de propi-
Fase G2. La célula sigue creciendo, continua con la síntesis dio, con base en la cantidad de DNA se puede conocer la
de proteínas y RNA y se prepara para realizar la mitosis. proporción de células en cada fase del ciclo celular.
Para esto, es indispensable que la célula realice la com- Con la finalidad de preservar la información genética
pactación del DNA, que forme los cromosomas mitóti- codificada por los cromosomas, todas las células alternan
cos y que existan los elementos necesarios para dividirse, de manera muy estricta y ordenada los procesos de repli-
de tal manera que existe acumulación de las proteínas de cación y segregación durante el ciclo celular, utilizando
condensación, se realiza la fosforilación de las histonas y mecanismos bioquímicos altamente regulados.
se sintetiza tubulina. Un evento muy importante que se
presenta en G2 es la reparación post-replicativa del DNA Regulación del ciclo celular
© Editorial El manual

que la célula activa cuando existe daño cromosómico;


cuando se detecta el daño, la célula se detiene en esta En la mayoría de las células existen varios puntos de veri-
fase y si es capaz de reparar todas las lesiones transita a ficación del ciclo celular en los cuales la célula se detie-
la etapa de mitosis para dividir a la célula, si esto no ocu- ne si los eventos previos no se han realizado. Cuando la
rre, entonces la célula muere por apoptosis. Esta etapa replicación no se termina, la célula no puede realizar la
dura de 2 a 4 h. mitosis y si los cromosomas no están adecuadamente

Biblioteca Médica Virtual


Cromosomas y patologia cromosómica 103
adheridos a los microtúbulos del huso mitótico, la sepa- cios de tiempo y permitir o inhibir la progresión adecua-
ración de cromosomas se retrasa. La progresión a través da del ciclo celular. Esta capacidad de orden, se debe en
de G1 y G2 se retrasa si el DNA se daña con radiación o especial a que existen proteínas reguladoras secundarias
con agentes químicos, esta detención proporciona tiem- que inactivan al complejo y a que las proteínas que no se
po para que la célula repare el DNA dañado y así pueda utilizan (como las ciclinas), son eliminadas por el com-
proseguir con el ciclo celular. Los puntos de verificación plejo de degradación ubiquitina-proteosoma.
de las actividades celulares se regulan por medio de seña- Existen cuatro clases de complejos Cdk-ciclinas que
les extracelulares o intracelulares que pueden promover controlan la progresión del ciclo celular:
o inhibir la proliferación celular.
El sistema de control del ciclo celular se basa en la 1. G1-Cdk promueve el tránsito de G1 a S, participan la
regulación cíclica de la actividad de un complejo confor- Cdk4 o Cdk6 y la ciclina D.
mado por una ciclina y una cinasa dependiente de cicli- 2. G1/S-Cdk compromete a la célula para iniciar la replica-
na (Cdk); además participan otras proteínas reguladoras ción, participan la Cdk2 y la ciclina E.
que activan o inhiben la actividad de dichas moléculas, 3. S-Cdk permite que se inicie la replicación, participan la
como Wee1, Cdc25, p21 y p27. Las Cdk son enzimas Cdk2 y la ciclina A.
cinasas cuya actividad depende de la unión de la ciclina 4. M-Cdk promueve los eventos de la mitosis: participan la
como subunidad reguladora. Las ciclinas son sintetizadas Cdk1 y la ciclina B.
y destruidas en tiempos específicos durante el ciclo celu-
lar, por lo tanto regula la actividad de la cinasa de una Regulación de la actividad del complejo
manera tiempo dependiente; en contraste las Cdk per- Cdk-ciclina (figura 4-2)
manecen en concentraciones constantes durante todo el
ciclo celular. Las células humanas contienen 13 loci codi- Al formarse el complejo Cdk-ciclina, existen cambios
ficadores para Cdk y 25 para ciclinas. Sin embargo, sólo conformacionales de la subunidad catalítica de la Cdk
algunos juegos de complejos participan en el tránsito del que producen el movimiento de un asa flexible de la
ciclo celular, que incluyen las cinasas interfásicas CDK2, cadena polipeptídica que permite que la Cdk exponga
CDK4 y CDK6, la mitótica CDK1 también conocida regiones susceptibles de fosforilarse o desfosforilarse,
como CDC2 y 10 ciclinas que pertenecen a los grupos regulando así su actividad. La unión de la ciclina propor-
A, B, D y E. ciona una activación parcial de la Cdk, la actividad total
La activación de los complejos Cdk-ciclinas disparan se logra cuando la cinasa CAK (cinasa activadora-Cdk)
los eventos del ciclo celular al actuar en diferentes espa- fosforila un aminoácido de treonina cercano a la entrada

Cdk Ciclina

A. Complejo ciclina-Cdk

Cdk parcialmente Cdk totalmente


Cdk inactiva activa activa
ATP ATP CAK ATP
P
manual moderno Fotocopiar sin autorización es un delito.

Ciclina
Sitio activo
y asa

B. Activación de Cdk por unión con la ciclina y fosforilación de CAK

Fosfato inhibitorio

Fosfatasa Cdk
Cdc25
P
Figura. 4-2. Regulación de la actividad del complejo ciclina-Cdk. A.
P P El complejo regulador está formado por una ciclina y una cinasa
Cinasa dependiente de ciclina (Cdk) con sitios de fosforilación. B. La Cdk al
Wee1 Ciclina
unirse con la ciclina tiene cambios conformacionales que la activan
Complejo inactivo Complejo activo parcialmente, para su actividad total requiere de una fosforilación en
© Editorial El

el sitio activo. C. Cuando la cinasa está fosforilada en dos sitios (acti-


vador e inhibitorio) no tiene actividad, si la fosfatasa Cdc25 le quita el
fosfato del sitio inhibitorio entonces la Cdk se activa, esta acción
C. Regulación de la actividad de Cdk por acción de fosfatasa y cinasa puede revertirla la cinasa Wee1.

Biblioteca Médica Virtual


104 Genética clínica

del sitio activo de la Cdk, esto provoca un cambio con- (pre-RC); entonces la S-Cdk activa inicia la síntesis del
formacional mayor que incrementa la actividad de la DNA y al fosforilar a Cdc6, a ORC y a las proteínas
Cdk y permite que la cinasa fosforile a sus proteínas Mcm provoca el desensamblaje del pre-RC y la degrada-
blanco específicas e induzcan los procesos celulares ción de Cdc6 y Mcm, lo cual evita que la replicación del
correspondientes a la fase en la que estén actuando (G1, DNA se repita.
S o M). Existen moléculas que detectan DNA no replicado
La actividad del complejo Cdk-ciclina puede inhibir- por lo que un señalamiento negativo inactiva a Cdc25 y
se por la degradación de la ciclina o por la fosforilación M-Cdk permanece fosforilada e inactiva hasta que se
de un par de aminoácidos que se encuentran en el sitio complete la replicación.
activo de la enzima. Esta fosforilación inhibitoria la rea- En el punto G2, si el DNA está totalmente replicado
liza la proteína cinasa Wee1 y la desfosforilación activa- y el daño reparado, al final de esta fase hay acumulación
dora la fosfatasa Cdc25. de cinasas, ciclina M y proteínas reguladoras. El punto de
Los complejos Cdk-ciclina también pueden regularse control de daño al DNA que permite que la célula tran-
por la unión de proteínas inhibitorias de Cdk (CKI) tales site a la fase M es la fosforilación de Cdc25.
como p21 o p27 que se asocian al complejo distorsionan- En el control de la fase M, la cinasa mitótica inhibe sus
do el sitio activo de la enzima. Existe una gran variedad inhibidores y activa a sus activadores, es decir tiene retroa-
de proteínas CKI, en especial actúan en el control de las limentación positiva; en G2 tardía, se forma el complejo M-
fases G1 y S. Cdk que consiste en Ciclina B/CDK1 también llamado
El control del ciclo también depende de la proteólisis MPF (factor promotor de la mitosis), la enzima CAK fos-
cíclica y son dos los complejos enzimáticos que actúan en forila a la Cdk en su sitio activo pero permanece inactiva
diferentes tiempos del ciclo para degradar a las proteínas debido a la fosforilación inhibitoria en la tirosina 15 por
clave en el sistema de control: SCF (Skp1/Cullin/F-box acción de la cinasa Wee1. El evento crucial para que se dis-
proteín) y APC (anaphase-promoting complex); la destruc- pare la actividad de M-Cdk y la célula transite a mitosis, es
ción de ciclinas ocurre por un mecanismo dependiente de la activación de la fosfatasa Cdc25, la cual remueve el fos-
ubiquitina en donde el complejo enzimático activo reco- fato inhibitorio que retiene a M-Cdk. Al mismo tiempo, la
noce una secuencia de aminoácidos específica en la cicli- actividad inhibitoria de la cinasa Wee1 es también suprimi-
na y le adhiere múltiples copias de ubiquitina, marcando da, asegurando que la actividad M-Cdk se incremente
a la proteína para que sea destruida por el proteosoma. En abruptamente. Las cinasas que activan a Cdc25 son polo
las fases G1 y S, el complejo SCF ubiquitiniza a las cicli- cinasa y la propia M-Cdk activada.
nas-G1/S y a los inhibidores que controlan el inicio de la Una vez que la célula entra en mitosis, se induce la
fase S. En la fase M, el complejo APC ubiquitiniza a la condensación cromosómica, la formación del huso mitó-
ciclina-M y a otros reguladores de la mitosis. tico, la alineación de los cromosomas en metafase, la
Cada complejo ciclina-Cdk funciona como un monitor sujeción de los cromosomas por los microtúbulos para
molecular que censa que los eventos celulares específicos realizar la segregación y la división citoplasmática.
de cada fase del ciclo celular se hayan completado y pro- Durante el tránsito de metafase a anafase, existe otro
voca que la célula continúe con las actividades de la punto de verificación en el que la célula decide realizar la
siguiente fase. segregación cromosómica; para esto, todos los cromosomas
El principal punto de control del ciclo es la entrada a deben estar unidos a los microtúbulos del huso por medio
G1, se requiere un tamaño adecuado de la célula, pre- del cinetocoro, APC se fosforila y activa por Cdc20, éste
sencia de nutrientes, integridad del DNA, factores de fosforila a la separasa que se desprende de la securina y la
crecimiento y el punto de control de proliferación; exis- separasa rompe la cohesina que une a las cromátidas her-
ten otros estímulos externos en G1 que controlan la manas y las disocia. Si algún cromosoma no está anclado al
entrada de las células a la fase S como la fosforilación de huso, la separación de las cromátidas hermanas se detiene,
la proteína Rb (retinoblastoma) que reduce su afinidad se recluta la proteína Mad2 que funciona como una señal
por el factor transcripcional E2F y permite que éste acti- de bloqueo para la acción del APC y la célula se detiene en
manual moderno Fotocopiar sin autorización es un delito.
ve la expresión de los genes de fase S. Cuando hay daño mitosis. Si todo está correcto, la mitosis terminará y las
al DNA en G1, el factor de transcripción p53 se activa células hijas se encontrarán en fase G1, listas para iniciar un
por múltiples modificaciones postraduccionales. Esto nuevo ciclo celular o para entrar en G0.
resulta en la acumulación de p53 y en la transcripción de
sus genes blanco, uno de los cuales es p21 (CKI), inhibi-
dor de la cinasa dependiente de ciclina. Esta CKI es
capaz de inhibir el complejo CDK/ciclina de la fase S,
MITOSIS, MEIOSIS Y GAMETOGÉNESIS
Cdk2 con las ciclinas A o E, resultando en un arresto del
ciclo celular. De manera alternativa, ante el daño al DNA Mitosis
p53 puede inducir una respuesta apoptótica.
En la fase S, para evitar la sobrerreplicación del geno- Con la mitosis los cromosomas replicados se segregan en
ma, existe un sistema de control de silenciamiento que dos células hijas (figura 4-3), en general no dura más de
asegura que cada origen de replicación sea activado sólo una hora y durante este proceso la célula detiene los pro-
una vez por ciclo celular: en G1 tardía, Cdc6 se asocia cesos metabólicos, transcripcionales y traduccionales.
© Editorial El

con el complejo ORC (origin recognition complex) en el


sitio de inicio de la replicación y las proteínas Mcm se Etapas de la mitosis
ensamblan en forma de anillos a los lados del origen de Profase. La transición de interfase a mitosis es la profase y
replicación, constituyendo el complejo prerreplicativo se caracteriza por los siguientes eventos:

Biblioteca Médica Virtual


Cromosomas y patologia cromosómica 105
Mitosis Meosis

Profase Profase I

Meosis I
Metafase I
Metafase

Anafase I y
Anafase Telofase I

Telofase
Meosis II

Células hijas Células hijas

Figura. 4-3. Diferencias entre mitosis y meiosis. La mitosis se realiza en células somáticas y germinales, mientras que la meiosis está limita-
da a las células germinales. En la mitosis hay un ciclo de replicación del ADN seguido por una división celular, en la meiosis hay un ciclo de
replicación del ADN seguido por dos divisiones, lo que genera cuatro células haploides. En la mitosis las células hijas son 2n2C, por lo que
cuantitativa y cualitativamente son iguales que la célula madre, en la meiosis las células hijas son 1n1C y realizaron recombinación, por lo que
las células hijas en la meiosis son cuantitativa y cualitativamente diferentes a la célula madre, lo que produce una variabilidad genética que la
mitosis no genera. En la mitosis la fase G2 dura alrededor de 4 h, en la meiosis el periodo S es más largo y el periodo G2 es más corto o ine-
xistente. En la mitosis, cada uno de los cromosomas es independiente, en la meiosis los cromosomas homólogos, se aparean durante la pri-
mera división meiótica y se mueven hacia el ecuador celular juntos. En cuanto a su duración, la mitosis es un proceso corto de 50 a 60 min,
mientras que la meiosis puede ser muy larga, en el hombre 24 días y en la mujer hasta más de 40 años.

Condensación cromosómica. Es un proceso progresivo peroxisomas no se desintegran y se segregan de forma


indispensable para que los cromosomas no sufran por lo general simétrica a las células hijas.
alteraciones debido al estrés mecánico a que se some- Prometafase. Los extremos + de los mt de los ásteres se
ten durante la segregación cromosómica, ocurre gra- mueven mediante polimerización hacia el centro de
cias a la actividad de la condensina y la topoisomera- la célula buscando cromosomas. Cuando los cromoso-
sa II, además las cromátidas hermanas del cromosoma mas llegan a tener sus dos cinetocoros conectados por
replicado y condensado se mantienen unidas gracias a mt de polos opuestos son jalados y empujados por el
la cohesina, que se encuentra a lo largo de los brazos huso mediante la polimerización-despolimerización
cromosómicos y en el centrómero. La cohesina locali- de tubulina y con la ayuda de proteínas motoras tipo
zada a lo largo de los brazos se separa durante la pro- cinesinas y dineínas. Con esto se alcanza la congrega-
fase mientras que la del centrómero se retiene hasta ción de los cromosomas en el ecuador celular y finali-
anafase. za la prometafase.
Formación del huso mitótico. Los microtúbulos (mt) del Metafase. La condensación cromosómica continua y los
citoesqueleto interfásico se desensamblan y reorgani- cromosomas se colocan en la placa metafásica de tal
zan para formar el huso mitótico. El primer paso es la manera que los cinetocoros de cada cromátida se
nucleación de mt alrededor de los centrosomas for- orientan hacia polos opuestos. La placa metafásica se
manual moderno Fotocopiar sin autorización es un delito.

mando los ásteres, cuyos mt tienen un extremo menos mantiene gracias al equilibrio entre las fuerzas opues-
(-) asociado al centrosoma y un extremo más (+) al tas de los polos sobre los cromosomas y las cromáti-
cual se adicionan dímeros de tubulina a mayor veloci- das hermanas se mantienen unidas gracias a la cohesina
dad. Cada áster migra a posiciones opuestas dentro de centromérica.
la célula, estableciendo así el huso mitótico bipolar. Anafase. En esta fase los centrómeros se escinden permi-
Los mt continúan creciendo por sus extremos + hasta tiendo que cada cromátida migre hacia polos opues-
que los mt cinetocóricos encuentran al cinetocoro de tos. La anafase se divide en anafase A y anafase B.
una de las dos cromátidas hermanas y se anclan a él. Durante la anafase A, el complejo APC ubiquitiniza a
Los mt que no encontraron un cinetocoro, llamados la segurina marcándola para su destrucción y libera a
mt interpolares, continúan creciendo por su extremo la proteína separasa. La separasa degrada a la cohesi-
+ hasta que se superponen con los extremos + de los na de los centrómeros y con ellos las cromátidas se
mt del polo contrario, quedando así un huso mitótico separan y ceden a las fuerzas de los mt cinetocóricos.
funcional. Durante la anafase B, los mt interpolares se superpo-
Desaparición de la envoltura nuclear y fragmentación nen por sus extremos + y se deslizan uno sobre otro
del aparato de Golgi. Para que los mt cinetocóricos para alargar el huso mitótico, alejando los polos celu-
© Editorial El

interactúen con los cromosomas, la envoltura nuclear, lares y los dos juegos cromosómicos.
el aparato de Golgi y el retículo endoplásmico se Telofase. Los mt cinetocóricos desaparecen y los cromo-
desintegran y dispersan. Las mitocondrias, lisosomas y somas quedan libres. Los cromosomas comienzan a

Biblioteca Médica Virtual


106 Genética clínica

descondensarse y la envoltura nuclear se reintegra. El proceso de recombinación de los cromosomas homó-


Durante la telofase tardía los cromosomas empiezan a logos inicia en leptoteno cuando la proteína SPO11
transcribir y se restablece el nucleolo. genera roturas de doble hebra en el DNA que se señali-
Citocinesis. El citoplasma se divide para dar lugar a dos zan con la histona H2AX fosforilada, después se remue-
células hijas. La citocinesis empieza desde la anafase, ven cierto número de nucleótidos para generar hebras
cuando se forma en el ecuador celular, un cinturón de sencillas de DNA que serán recubiertas por la proteína
actina y miosina que se contrae y da lugar a un surco RAD51 y se llevará a cabo la reparación por recombina-
de división. El surco de división se hace más profun- ción homóloga, de esta manera se promueve el entrecru-
do, hasta que la cintura que se forma llega a tocar los zamiento o recombinación cromosómica. La actividad
mt remanentes del huso mitótico. Por último la célu- de estas proteínas ocurre en zonas electrodensas conoci-
la se estrangula dando lugar a dos células hijas. das como nódulos de recombinación que son los sitios en
los que se lleva a cabo el entrecruzamiento entre los cro-
Meiosis mosomas homólogos.
En el paquiteno se finaliza la sinapsis y el complejo sinap-
La meiosis es un tipo de división celular que evolucionó tonémico se ha formado por completo, su elemento cen-
de la mitosis, está presente en los organismos con repro- tral esta conformado por las proteínas SYCP1, SYCE1 y
ducción sexual y su aportación es reducir el contenido de SYCE2. Esta etapa es muy larga e incluye la maduración
DNA de diploide 2n4c (diploide con 4 copias de DNA) de los sitios de recombinación en entrecruzamientos.
a haploide 1n1C (haploide con 1 copia de DNA), así Existen sitios preferenciales para realizar la recombinación
como generar variabilidad genética mediante la recombi- conocidos como “hot spots”, y otros sitios en los que muy
nación cromosómica y la segregación al azar de los cro- rara vez ocurre, conocidos como “cold spots”.
mosomas de origen paterno y materno, culminando en En el diploteno desaparece el complejo sinaptonémico y
una célula haploide y recombinante que es el gameto. los cromosomas permanecen unidos por medio de quias-
Mediante la fusión de los gametos femeninos con los mas, que se formaron a través de uniones covalentes entre
gametos masculinos se forman cigotos que darán origen la cromátida de un homólogo y una cromátida no herma-
a nuevos organismos y gran variabilidad genética en la na del otro homólogo. En este punto la recombinación se
población. ha completado y los cromosomas homólogos no mantie-
Presenta una profase muy larga, seguida de dos divisio- nen más la sinapsis, los quiasmas se consideran la evidencia
nes celulares llamadas meiosis I y meiosis II. Antes de ini- de la recombinación. Durante esta etapa los cromosomas
ciar la meiosis se presenta una fase S premeiótica y entre homólogos aún se mantienen unidos como un bivalente
la primera y segunda división hay una interfase muy corta gracias a los quiasmas y tienden a separarse prematuramen-
que no realiza replicación del DNA. Se divide en meiosis te si los quiasmas no se generan, lo cual puede tener como
I durante la cual se realizan los eventos que darán lugar a consecuencia la generación de aneuploidías. Si el gameto
la recombinación y segregación cromosómica al azar aneuploide participa en la fertilización puede generarse un
generando gametocitos secundarios con 23 cromosomas producto anormal o la muerte del embrión. La mayor parte
de dos cromátidas cada uno (1n2C) y meiosis II, un pro- de las aneuploidías se generan durante la primera división
ceso parecido a la mitosis en la que se obtienen las célu- meiótica de la ovogénesis y la frecuencia de dichos errores
las precursoras de los gametos con 23 cromosomas de una se incrementa con la edad materna.
sola cromátida (1n1C) (figura 4-3). Durante el diploteno crece el ovocito y hay actividad
metabólica y transcripcional intensa que provee al ovoci-
Etapas de la meiosis: meiosis I to con el RNA necesario para la síntesis proteica duran-
te la ovogénesis y el desarrollo embrionario temprano
Profase de la meiosis I. Se divide en: leptoteno, cigoteno, después de la fertilización. En la meiosis femenina en
paquiteno, diploteno y diacinesis. En leptoteno los cro- este punto la célula entra en la etapa de dictioteno, la
mosomas homólogos, comienzan a alinearse pero no se cual se caracteriza por un arresto prolongado del proce-
moderno Fotocopiar sin autorización es un delito.
aparean. En esta etapa se forma un eje cromosómico que so meiótico. Inicia de manera tardía en la vida fetal y ter-
mantiene unidos a los cromosomas que es conocido mina antes de la ovulación cuando aumentan los niveles
como elemento axial, formado por las cohesinas REC8 y de hormona luteinizante.
SMC1B y las proteínas del complejo sinaptonémico Durante la diacinesis el huso meiótico se ensambla y los
SYCP3 y SYCP2. cromosomas se preparan para su segregación, finaliza
Durante el cigoteno, los cromosomas homólogos se ali- con la desaparición del nucléolo, la rotura de la envoltu-
nean y aparean; y por medio de su sinapsis se genera el ra nuclear y el inicio del movimiento de las tétradas hacia
complejo sinaptonémico; una estructura en forma de la placa metafásica. Se incrementa la actividad del factor
escalera con filamentos proteicos que conecta a los cro- promotor de la mitosis (MPF), el cual fosforila a una gran
mosomas homólogos y que funciona como un andamia- cantidad de proteínas preparando a la célula para la divi-
je que permite que las cromátidas hermanas lleven a sión del material genético.
cabo su actividad de entrecruzamiento. Al mismo tiem- Prometafase de meiosis I. La membrana nuclear desapare-
© Editorial El manual

po los elementos axiales comienzan a cerrarse a modo ce. Se forma el cinetocoro en cada cromosoma y una vez
de cremallera y a partir de entonces se les conoce como que los cromosomas están anclados por microtúbulos del
elementos laterales del complejo sinaptonémico. En huso comienzan a moverse.
esta etapa se denomina como bivalente o tétrada al Metafase de meiosis I. Los dos cromosomas homólogos de
complejo formado por un par de cromosomas homólo- cada bivalente están conectados al huso meiótico de
gos en sinapsis. polos opuestos y las cromátidas hermanas están conecta-

Biblioteca Médica Virtual


Cromosomas y patologia cromosómica 107
das por microtúbulos del mismo polo del huso, lo ante- espermatozoides sino hasta la madurez sexual, alrededor
rior asegura que las cromátidas migren juntas al momen- de los 13 años de edad. El proceso de espermatogénesis
to de ser separadas. La orientación de los cromosomas puede dividirse en tres etapas: 1) espermatocitogénesis,
materno y paterno es azarosa, por lo tanto cada polo 2) meiosis, y 3) espermiogénesis.
recibe un conjunto al azar de cromosomas.
Anafase y telofase de meiosis I. Ocurre la separación de los Espermatocitogénesis. Las espermatogonias proliferan por
cromosomas homólogos, lo cual requiere la disolución de mitosis y permanecen unidas por puentes citoplasmáticos
los quiasmas y la pérdida de cohesión entre los brazos de finos, generando clonas sinciciales. Este proceso inicia
las cromátidas hermanas. Lo anterior se logra gracias a la cuando las células germinales primordiales (CGP) llegan a
rotura de las moléculas de cohesina que unen a las cro- la cresta urogenital y continua hasta generar a los esperma-
mátidas; sin embargo, la cohesión en el centrómero entre tocitos primarios. Los espermatocitos primarios pasarán
las cromátidas hermanas permanece, debido a que las por una primera división meiótica para generar esperma-
proteínas de la familia shugoshina, SGO1/SGOL1 y la tocitos secundarios y las espermátidas se generarán con
fosfatasa PP2A protegen a la cohesina situada en esta una segunda división meiótica (el proceso a detalle se
zona. En telofase I ocurre la segregación completa de los puede leer más adelante). El hombre es muy sensible a la
cromosomas homólogos. pérdida de células en esta etapa, lo cual resulta en un
La intercinesis es la fase entre las dos divisiones meióti- número menor de espermatozoides a lo esperado.
cas y por lo general es corta y sin fase S. En esta etapa las Espermiogénesis. Es un proceso de remodelación para que
células se conocen como espermatocitos secundarios y las espermátidas lleguen a su estructura final, incluye la
ovocitos secundarios con un contenido 2C de DNA, la formación del acrosoma, la condensación del núcleo y la
mitad de lo que posee un espermatocito primario y el elongación de las espermátidas para formar el flagelo. El
doble de un espermatozoide. citoplasma en exceso se empaca en un cuerpo residual,
Meiosis II. Se rompe nuevamente la envoltura nuclear. Los que será eliminado. Las espermátidas se mueven a través
cromosomas se compactan nuevamente y se alinean en la del epitelio seminífero hasta quedar en la cara luminal de
placa metafásica durante la metafase II. La progresión de los túbulos seminíferos. La espermatogénesis dura entre
la meiosis en los ovocitos se detiene en la metafase II, 74 y 76 días y las espermatogonias entran en el proceso
este arresto se debe a factores que inhiben la activación alrededor de cada 16 días. Los puentes citoplasmáticos
del complejo promotor de anafase (APCCdc20) con lo entre las células permiten la comunicación celular y
cual se evita la degradación de la ciclina B. Si las concen- coordinan el proceso.
traciones de ciclina B se mantienen elevadas en el ovoci-
to, la célula no puede pasar a la siguiente fase meiótica y Ovogénesis
se libera sólo cuando el ovocito es fertilizado. La fertili-
zación induce la entrada de iones de calcio, la activación En las mujeres, la población oogonial entera pasa por un
del complejo APCCdc20 y la degradación de la ciclina B. proceso de proliferación mitótica fetal e inicia la meiosis
El ovocito entonces completa la segunda división meió- en el quinto mes de vida intrauterina, pero la mayoría
tica, inicia la anafase II con la repartición de los cromo- muere en el séptimo mes; la profase meiótica I se arres-
somas hacia los polos opuestos de la célula. La meiosis II ta antes del nacimiento y se reinicia en un pequeño con-
culmina con la telofase II, en la cual se reintegra la envol- junto de la población de ovocitos a intervalos periódicos
tura nuclear, por último se obtienen células haploides a partir de la pubertad.
con contenido 1C de DNA.
Fase preantral. Alrededor de 200 000 folículos primordiales
Gametogénesis llegan viables a la pubertad, pero 99.9% sufrirá atresia y
no será ovulado. Una cohorte de folículos primordiales se
La meiosis es parte del proceso gametogénico, inicia con recluta cada ciclo menstrual y entra en la fase preantral de
los gametocitos primarios de 46 cromosomas duplicados la foliculogénesis. Durante esta fase, los folículos crecen y
manual moderno Fotocopiar sin autorización es un delito.

con contenido 2n4C de DNA. Durante la meiosis I la en el citoplasma de los ovocitos ocurren la transcripción
célula divide a los cromosomas homólogos en un par de activa de DNA y síntesis de RNA y proteínas (madura-
gametocitos secundarios. Esta división es sexualmente ción del citoplasma), con esto la célula se prepara para
dimórfica: en los varones resulta en dos espermatocitos reiniciar la meiosis una vez fertilizada e iniciar el desarro-
secundarios, mientras que en las mujeres resulta en un llo post-fertilización del embrión. Al final de la fase pre-
ovocito secundario y un cuerpo polar. La segunda división antral las células de la granulosa que rodean al ovocito
meiótica separa a las cromátidas hermanas y también es presentan receptores para estrógenos y para la hormona
dimórfica, en los varones ocurre inmediatamente después foliculoestimulante (FSH), y las células de la teca que a
de la primera división y produce cuatro espermátidas. En su vez rodean a las células de la granulosa desarrollan
las mujeres, el tiempo de la segunda división meiótica está receptores para la hormona luteinizante.
coordinado con la ovulación y la fertilización, dando lugar Fase antral. La fase preantral puede ocurrir en ausencia de
a un ovocito haploide y otro cuerpo polar. En ambos casos, la FSH y la LH, pero a partir de la fase antral el aporte
los productos son células gaméticas con número haploide de gonadotropinas, en especial FSH, es esencial para la
de cromosomas 1n y contenido 1C de DNA. sobrevivencia del folículo. Sólo los folículos más grandes,
y con mayor número de receptores para FSH, reciben la
© Editorial El

Espermatogénesis estimulación suficiente para desarrollarse y solo uno o


Los varones nacen con una población de células madre dos se desarrollan en un folículo de de Graaf, el resto
espermatogoniales que no ha iniciado la producción de sufrirá atresia. Las células del folículo median la reanu-

Biblioteca Médica Virtual


108 Genética clínica

dación de la meiosis y la progresión del ovocito a meta- densar el DNA en forma de cromosomas confiere varias
fase II. Estas células también promueven la maduración ventajas: 1) protege la integridad del material genético
citoplásmica para que la fertilización y pre-implantación durante el estrés químico y mecánico de la división celu-
se lleven a cabo. Los ovocitos dentro de los folículos de lar, 2) mantiene unidos los cromosomas replicados o
de Graaf reanudan la maduración meiótica en respuesta cromátidas hermanas hasta la anafase, 3) genera una
a las gonadotropinas preovulatorias (FSH y LH), lo cual estructura tridimensional que permite el ensamblaje de
se manifiesta como la rotura de la vesícula germinal, un cinetocoro en donde se anclan los microtúbulos del
dando lugar a los ovocitos secundarios. huso mitótico, 4) permite realizar una adecuada distribu-
En resumen, los productos de la meiosis incluyen: ción del material genético durante la mitosis o meiosis,
5) la superficie de los cromosomas sirve como sitio de
- La generación de gametos haploides que al fusionarse reconocimiento para la formación de la nueva envoltura
darán origen a un individuo diploide. nuclear y con ello la reconstitución de un núcleo interfá-
- Diversidad genética debido a dos eventos: 1) la segre- sico. Una vez realizada la segregación cromosómica, el
gación al azar de los cromosomas homólogos durante cromosoma se descondensa, para volver a ser la cromati-
la anafase I, 2) la existencia de 2 a 3 entrecruzamien- na nuclear hasta que la célula se vuelva a dividir.
tos en promedio por cromosoma que permite el inter-
cambio de material genético entre los homólogos. Lo
anterior permite la generación de variabilidad entre
Niveles de condensación de la cromatina
gametos e individuos, de tal modo que los cromoso- (figura 4-4)
mas heredados nunca son idénticos a los paternos o
maternos. Nucleosoma. El primer nivel de condensación o nucleoso-
- Número apropiado de cromosomas a las células hijas, ma está formado por una partícula corazón (por core
debido a que los quiasmas son esenciales para la que particle en inglés) que se forma por un segmento de
los cromosomas en la anafase I se segreguen de mane- DNA de 146pb que rodea un octámero de histonas, tam-
ra correcta. bién incluye un segmento de DNA de unión (DNA lin-
ker en inglés) de aproximadamente 60pb y una proteína
H1 que se encuentra entre el octámero y el DNA de
unión. La partícula core consta de un disco formado por
CROMATINA, CROMOSOMAS Y un octámero de histonas, organizado en cuatro heterodí-
CARIOTIPO HUMANO meros, dos de H2A-H2B y un tetrámero (H3-H4)2, la
dimerización está mediada por sus dominios C-terminal,
Estructura de la cromatina mientras que los N-terminal de cada histona forman una
cola larga y flexible, susceptible de ser modificada para
En las células diploides de la especie humana, existen 6 fines de regulación funcional. Las histonas son proteínas
400 millones de pares de bases repartidos en 46 molécu- básicas ricas en arginina y lisina y positivamente carga-
las de DNA, un cromosoma es la forma condensada de das, de manera que atraen al DNA cargado negativamen-
cada una de estas 46 moléculas; cada uno porta la infor- te, el cual se enrolla sobre el disco proteico haciendo
mación genética de una gran cantidad de genes situados contacto por el surco menor, le dá 1.7 vueltas y continúa
a lo largo de su secuencia de bases, por lo que cada cro- hacia el octámero siguiente; el resultado es una fibra de
mosoma se considera como un grupo de ligamiento de alrededor de 10 nm de diámetro, parecida a un rosario en
genes y el conjunto de los 46 cromosomas o 23 pares donde el DNA que queda entre un nucleosoma y otro se
cromosómicos junto con el DNA mitocondrial -situado denomina DNA de unión, su longitud varía de un tejido
fuera de los cromosomas- constituyen nuestro patrimo- a otro y de una región cromosómica a otra de manera
nio genético. Los cromosomas se encuentran en forma de que el nucleosoma completo varía de 186 a 200 pb. Este
cromatina en el núcleo en interfase y durante la división DNA de unión interactúa con una quinta proteína histo-

moderno Fotocopiar sin autorización es un delito.


celular el DNA se replica y se condensa como cromoso- na, llamada H1, con lo que se forma el nucleosoma com-
ma metafásico antes de la mitosis o meiosis, de manera pleto que consta del DNA de aproximadamente 200pb
que su longitud es aproximadamente 10 000 veces y 9 histonas, las del octámero o particula "core" y la H1,
menor que la del DNA extendido, esto se logra por su que interviene en el siguiente nivel de compactación, la
asociación con proteínas histonas y no histonas. El con- fibra de 30 nm de diámetro. La modificación covalente
© Editorial El manual

Figura. 4-4. Niveles de compactación de la cromatina; a) fibra de


2nm molécula de DNA, b) fibra de 10 nm: nucleosoma, c) fibra de
30 nm: solenoide o zigzag, d) fibra de 80 a 300 nm: primer domi-
nio de asas o cromonema, e) fibra de 700 nm: cromátida, f) cro-
a b c d e f mosoma metafásico de 1 400 nm.

Biblioteca Médica Virtual


Cromosomas y patologia cromosómica 109
de las colas N-terminal de los nucleosomas es muy nes de DNA que se transcriben. Nishino en 2012 sugiere
importante en la regulación de la función del DNA, pero que el cromosoma metafásico humano consiste de fibras
existen otras modificaciones del nucleosoma también de nucleosomas de 10 nm arreglados a manera de fractales,
relacionadas con su actividad. Las variantes de las histo- dejando en el centro a las condensinas; esto elimina a la
nas H2A y H3 que se encuentran en casi todas las célu- fibra de 30 nm y a las estructuras de asas como parte del
las se han relacionado con funciones específicas, la cromosoma metafásico humano, sin embargo debido a que
variante H2AX, se encuentra sustituyendo a H2A en si se han encontrado en otras especies y en otros estadios
puntos específicos a lo largo de toda la cromatina, es una del ciclo celular, no se puede concluir que en humano no
especie de sensor que cuando existe rotura del DNA se existan estas configuraciones en la condensación de la cro-
fosforila, se le llama entonces γ H2AX y sirve como señal matina. Posterior a esta compactación cuando la célula
para que la maquinaria de reparación del DNA se ubique entra en mitosis, la fibra de cromonemas se vuelve a con-
en el sitio dañado; otras variantes de H2A están relacio- densar dejando en el centro el esqueleto de proteínas no
nadas con la actividad transcripcional del sitio en donde histonas, para formar el cromosoma mitótico, en donde
están localizadas, la H2AZ se encuentra en eucromatina cada cromátida tiene alrededor de 1 μm de diámetro y
y la macroH2A en heterocromatina facultativa sobre el empaqueta al DNA en una proporción de 10 000:1.
cromosoma X inactivo. Entre las variantes de H3, una de Por último, con algunos métodos de tinción, se pueden
ellas, la H3.3 está también relacionada con actividad encontrar a lo largo de cada cromosoma, dominios de
transcripcional positiva y la otra tiene una función muy cromatina que comparten características estructurales y
importante en la formación del cinetocoro sobre los cro- funcionales, y constituyen segmentos cromosómicos sufi-
mosomas condensados y se le conoce como CENP-A. En cientemente largos como para ser visualizados bajo el
general se puede decir que la asociación del DNA con microscopio óptico como bandas cromosómicas.
histonas no tiene sólo una función estructural, sino que
confiere a la cromatina la habilidad de regular la expre- Eucromatina, heterocromatina e
sión génica y de señalizar y permitir la asociación con inactivación del X
otros componentes celulares. El nucleosoma empaca la
fibra de DNA en una razón de 7:1. En 1928, Heitz notó que en el núcleo en interfase, des-
Fibra de 30 nm. Aunque existe controversia sobre la presen- pués de la división celular, había algunos segmentos por
cia de la fibra de 30 nm en el cromosoma metafásico lo general situados en la periferia nuclear, que permane-
humano, esta configuración es la que prevalece en los cían muy condensados y presentaban una intensa tin-
núcleos en interfase y es altamente dinámica, puede transi- ción, diferente al resto de la cromatina; a estas regiones
tar hacia la fibra de 10 nm cuando se encuentra de forma les llamó heterocromatina; al resto de la cromatina le
transcripcional activa. Existen dos modelos estructurales denominó eucromatina. En la actualidad se sabe que la
para este nivel de compactación de la cromatina, el mode- eucromatina se encuentra empaquetada laxamente por
lo del solenoide y el del zigzag. La fibra de 30 nm de diá- lo que en las micrografías fotónicas y electrónicas apare-
metro se forma a partir de la fibra de nucleosomas de 10 ce como clara; el marcaje positivo con uridina tritiada
nm, por interacciones proteína-proteína de las histonas H1, indica que es muy activa en transcripción y se replica de
que tienen la propiedad de formar agregados proteicos que forma temprana durante la fase S del ciclo celular. En la
acercan a los nucleosomas uno con otro para hacer una eucromatina se encuentran por lo general genes activos
configuración de 6 a 8 unidades, que puede ser en espiral que se relacionan con las funciones celulares basales y
en el modelo del solenoide en donde el DNA de unión se propias de la especialización de la célula que se estudie.
curva o bien en zigzag en donde el DNA de unión está La heterocromatina tiene como principal característi-
recto. La fibra de 30 nm se mantiene no sólo por la interac- ca que no transcribe y se encuentra altamente condensa-
ción entre proteínas H1, también se ha observado que es da; cuando se heterocromatiniza una región se tiene que
necesaria la interacción entre la cola de H4 de un nucleo- condensar, para realizar la condensación se requiere de la
soma y el dímero H2A-H2B del octámero contiguo. A este transcripción de pequeños segmentos de las dos hebras
manual moderno Fotocopiar sin autorización es un delito.

nivel, el DNA está empacado en una razón de 40:1. del DNA que generan sRNA no codificantes o, ncRNA,
Dominios de asa. El siguiente nivel de compactación son los como se transcriben las dos hebras, estos ncRNA son
dominios de asa, el primero son las fibras de 80 a 100 nm complementarios y forman RNA de doble hebra o
o cromonemas, que pueden todavía encontrarse en croma- dsRNA, el cual es procesado por la enzima Dicer que
tina de forma transcripcional activa, cada una de estas asas por una parte forma RNA de una sola cadena o ssRNA
se forma porque la fibra de 30 nm, se ancla a un esqueleto que interfiere con RNA mensajero naciente y por otra,
de no histonas, que está formado en especial por dos pro- recluta a la enzima SUV39H1, una metiltransferasa de
teínas: ScI y ScII (por Scaffold I y II), la primera de éstas se histonas que metila la lisina 9 de la histona H3, esta enzi-
ha identificado como topoisomerasa II, a ellas se adhieren ma actúa sobre un segmento de cromatina laxa, genera
las fibras de 30 nm mediante regiones de DNA distribui- H3K9met y en este segmento se recluta la proteína HP1,
das de manera regular a lo largo del cromosoma y que se que compacta la cromatina y la vuelve heterocromatina.
les conoce como regiones MAR o SAR (del inglés matrix Existen dos tipos de heterocromatina: la constitutiva,
attachment region o scaffold attached region) y con la partici- que se encuentra como tal durante toda la vida de un
pación del complejo proteico llamado condensina. Se pro- organismo y la heterocromatina facultativa, que en un
© Editorial El

pone que la topoisomerasa II actúa no sólo como proteína momento dado puede ser o haber sido eucromatina de
estructural, sino que puede desenrollar moléculas de DNA acuerdo al estado de desarrollo ontogénico. Ambos tipos
y regular su grado de superenrollamiento en las asas por lo de heterocromatina comparten el tener una cromatina
que también puede intervenir en la regulación de las regio- muy compacta, el tener una extremadamente baja tasa

Biblioteca Médica Virtual


110 Genética clínica

de transcripción y el replicar de forma tardía durante la X están activos en la ovogénesis y todos los gametos reci-
fase S del ciclo celular. ben un cromosoma X activo.
La heterocromatina constitutiva en humano tiene las
siguientes características: a) nivel reducido de recombi- El X inactivo se convierte en heterocromático, de manera
nación meiótica, b) baja densidad génica, c) inactivación que se condensa en interfase y forma el llamado corpúscu-
de genes eucromáticos por efecto de posición, d) replica- lo de Barr (figura 4-5C), no transcribe y replica de manera
ción tardía en fase S, e) inactividad transcripcional, f) tardía durante la fase S del ciclo celular. El cromosoma X
enriquecimiento de secuencias de DNA satélites alta- no se inactiva por completo y algunos genes permanecen
mente repetitivos y remanentes de elementos transponi- activos: a) genes de la región seudoautonómica, que tienen
bles. Se localiza en especial en los telómeros, en todas las sus correspondientes alelos en el cromosoma Y y recombi-
regiones centroméricas y pericentroméricas de los cro- nan, b) genes localizados fuera de la región seudoautonó-
mosomas 1, 9,16 y en la región distal del cromosoma Y. mica tanto en Xp como en Xq, con alelos relacionados
Está formada por secuencias simples y altamente repeti- sobre el cromosoma X; estas dos clases de genes tienen dos
das, llamadas satélites, que pueden ser α, β, I, II y III copias activas tanto en varones como en mujeres, c) genes
(figura 4-5A); su composición de bases siempre es rica localizados sólo en el cromosoma X sin el alelo correspon-
en A-T, aunque las secuencias que componen los diver- diente en el Y, como el gen de la sulfatasa esteroidea, cuya
sos bloques pueden diferir de un cromosoma a otro; de deficiencia causa una forma de ictiosis ligada al X.
hecho los sitios heterocromáticos principales contienen La inactivación se lleva a cabo por un “switch” llama-
DNA satélites específicos y reconocibles tanto química do centro de inactivación del X o Xic, que se encarga de
como citológicamente y en general no transcribe, razón mantener un cromosoma X activo por cada dos sets
por la cual puede existir una amplia variación en el haploides. Se sabe que esta inactivación se acompaña de
tamaño de estas regiones, sin que afecte el fenotipo una falta de acetilación en la histona H4, trimetilación
(figura 4-5B). en lisina 27 de H3 (H3 K27me3), monoubiquitinación
Si se encontrara un gen en una de estas regiones, para en lisina 119 de H2A (H2A K119ub1), así como por una
activarse debe abandonar la heterocromatina y por el metilación en las islas CpG, las cuales normalmente per-
contrario cuando un gen activo se mueve -por lo gene- manecen sin metilación en las regiones activas. Dentro
ral por translocación- a un sitio de heterocromatina, se de Xic, localizado en Xq13, se ha mapeado un gene lla-
inactiva; a este fenómeno se le lla-ma efecto de posi- mado XIST, que se mantiene activo en el X inactivo y
ción y la heterocromatinización de la región eucromá- viceversa, por lo cual se piensa que éste es el gene que
tica termina hasta donde se encuentra un elemento dirige la inactivación. El RNA que transcribe tiene 17 kb,
barrera. es poliadenilado, pero tiene varios codones de paro, lo
A la heterocromatina constitutiva se le han adjudica- que hace suponer que no codifica para una proteína, sino
do funciones de protección a regiones importantes den- que realiza su función como RNA per se, ya que se
tro del cromosoma, como los centrómeros y telómeros. expresa sólo en líneas que contienen más de un X, en
La heterocromatina facultativa, difiere de la constituti- células cromosómicamente normales es femenino-espe-
va en que tiene secuencias similares al DNA activo y bajo cífico. El proceso de inactivación implica la interacción
condiciones celulares diferentes, los genes que contiene física de los Xic de ambos cromosomas X y después se
pueden estar activos o inactivos. Uno de los mejores ejem- identifican tres pasos:
plos de heterocromatina facultativa es la que resulta de la
inactivación de uno de los dos cromosomas X en las hem- Primero: iniciación. En la iniciación varios sitios del locus Xic
bras de los mamíferos y tiene como función la compensa- actúan: al inicio opera un mecanismo de conteo de cromo-
ción de dosis génica entre los dos géneros. somas X, que asegura que sólo un X por set diploide se
En humanos, los cromosomas sexuales son hetero- inactivará; participa una región de aproximadamente 20pb
mórficos, el cromosoma Y es muy pequeño y contiene que se encuentra hacia 3’ dentro de Xic. Una segunda fun-
muy pocos genes en especial para la diferenciación de los ción de la región Xic es la selección mecanismo que deter-
moderno Fotocopiar sin autorización es un delito.
testículos y espermatogénesis, mientras que el cromoso- mina al azar cual cromosoma X que se inactivará (o se
ma X es grande (5% del genoma haploide) y contiene mantendrá activo), la selección se ha localizado en varios
cerca de dos mil genes; este desbalance en dosis génica puntos dispersos dentro de Xic, en especial una región lla-
entre varones y mujeres se ha resuelto silenciando de mada Xce (por X choice element), y los loci TSIX (trans-
forma transcripcional mediante heterocromatinización a crito de la hebra complementaria de XIST), DXPas34 y
uno de los dos X. En las mujeres, un cromosoma X de XITE que participan en el proceso de selección.
cada célula se inactiva al azar, siguiendo la hipótesis de Segundo: dispersión. La señal de inactivación se dispersa en
Lyon, que propone: cis desde el centro de inactivación, hacia ambos lados y a
lo largo de todo el cromosoma X, interviene el transcri-
1. Durante la vida intrauterina de las mujeres, en etapa de to de XIST, pero no se ha detectado una secuencia blan-
blastocisto uno de los dos cromosomas X se inactiva. co de este RNA, aunque se ha involucrado como punto
2. La inactivación actúa al azar sobre cualquiera de los dos de reconocimiento a las secuencias LINES, muy abun-
© Editorial El manual

X: paterno o materno. Una vez que en una célula se inac- dantes en el cromosoma X.
tivó alguno de los dos X, la inactivación es estable y here- Tercero: mantenimiento. El estado inactivo se mantiene en el
dable, de manera que éste continuará inactivo en todas X a través de la vida de esa célula y de sus descendientes.
las células que se deriven de ella. Para el mantenimiento se requieren otros factores que
3. El cromosoma X inactivo se reactiva durante la meiosis actúan en trans, es decir que provienen de fuera del cromo-
en las células germinales, por lo que ambos cromosomas soma, entre otros las metilasas de DNA que metilan los

Biblioteca Médica Virtual


Cromosomas y patologia cromosómica 111
p36.3
p36.2

p36.1 1

p34.3
p34.2
p34.1
p33
p32.3

9
p31.3

B
p31.1

p22.3 p23
p22.2 p13.3
p22.1
p13.2
p21.3
p21.3 p13.1
p21.1 p21.1 p13 p12.3
p13.3 p13.3 p11.3
p12.1
p13.2
p13.1 p12 p11.2 p11.2 p11.2
p12

q11.2 q11.2 q11.21


q12 q12 q11.22
q12 q12.1

q21.1 q13 q11.23


q21.3
q21.3 q21.1 q21
q21.1
q22 q22.1
q23.1 q21.3 q21.3 q12
q22.1 q22.1 q22.1

q24.1
q29.3
q22.3
q31.1 q24.1 16 Y
q31.2 q31.1

q31.3 q24.3
q31.3 Heterocromatina centromérica
q32 q31.1
q31.1
q32.1 q31.3 Heterocromatina constitutiva
pericentromérica y distal del Y
q32.2 q32.1
q32.3 q34.1 Regiones polimórficas con
variación de tamaño
manual moderno Fotocopiar sin autorización es un delito.

q41 q32.3
q34.3
q42.1 9 Acrocéntricos

q43
q44
A
1 C

Figura. 4-5. Heterocromatina. A. DNAs componentes de la heterocromatina constitutiva a) satélite en la heterocromatina centromérica, b) satélite
y satélites I, II y III en las regiones pericentroméricas sobre todo de los cromosomas 1, 9,16 y Y. B. Heterocromatina constitutiva revelada por ban-
das C, se observan polimorfismos de los bloques oscuros heterocromáticos entre cromosomas homólogos 1 y 9, C. Heterocromat