Funct Integr Genomics (2009) 9:197–217

DOI 10.1007/s10142-008-0103-x

ORIGINAL PAPER

Insulin regulates milk protein synthesis at multiple

levels in the bovine mammary gland
Karensa K. Menzies & Christophe Lefèvre &
Keith L. Macmillan & Kevin R. Nicholas

Received: 21 August 2008 / Revised: 25 November 2008 / Accepted: 25 November 2008 / Published online: 24 December 2008
# Springer-Verlag 2008

Abstract The role of insulin in milk protein synthesis is involved in catabolism of essential amino acids and
unresolved in the bovine mammary gland. This study biosynthesis of non-essential amino acids. These data show
examined the potential role of insulin in the presence of that insulin is not only essential for milk protein gene
two lactogenic hormones, hydrocortisone and prolactin, in expression, but stimulates milk protein synthesis at multiple
milk protein synthesis. Insulin was shown to stimulate milk levels within bovine mammary epithelial cells.
protein gene expression, casein synthesis and 14C-lysine
uptake in mammary explants from late pregnant cows. A Keywords Insulin . Milk protein . Mammary gland .
global assessment of changes in gene expression in Microarray
mammary explants in response to insulin was undertaken
using Affymetrix microarray. The resulting data provided Abbreviations
insight into the molecular mechanisms stimulated by insulin AA amino acid
and showed that the hormone stimulated the expression of EAA essential amino acid
28 genes directly involved in protein synthesis. These genes NEAA non-essential amino acid
included the milk protein transcription factor, ELF5, BCAA branched chain amino acid
translation factors, the folate metabolism genes, FOLR1 HEC hyperinsulinemic-euglycemic clamp
and MTHFR, as well as several genes encoding enzymes I insulin
F hydrocortisone
P prolactin
Electronic supplementary material The online version of this article
(doi:10.1007/s10142-008-0103-x) contains supplementary material, NH no hormone
which is available to authorized users. IPA ingenuity pathways analysis
K. K. Menzies (*) : C. Lefèvre : K. R. Nicholas
Department of Zoology, University of Melbourne,
Parkville, VIC 3010, Australia Introduction
e-mail: karensa.menzies@gmail.com

C. Lefèvre
Historically, insulin has been attributed a role in prolifer-
Victorian Bioinformatics Consortium, Monash University, ation and maintenance in mammary tissue, but now an
Clayton, VIC 3080, Australia important role in milk protein synthesis is emerging. In
vitro studies in the mouse and rat have shown that there is
K. K. Menzies : K. L. Macmillan
an absolute requirement for insulin, in the presence of
School of Veterinary Science, University of Melbourne,
Werribee 3030, Australia prolactin and hydrocortisone, for the induction of milk
protein gene expression (Bolander et al. 1981; Choi et al.
Present address: 2004; Kulski et al. 1983; Nagaiah et al. 1981). However,
C. Lefèvre : K. R. Nicholas
the role of insulin in milk protein synthesis in the bovine
Institute of Technology Research and Innovation,
Deakin University, mammary gland remains equivocal. Mammary culture
Geelong 3217, Australia experiments in the 1970s and 1980s indicated that
198
induction of milk protein gene expression required the
complement of prolactin, hydrocortisone and insulin
(Andersen and Larson 1970; Choi et al. 1988; Djiane
et al. 1975; Servely et al. 1982). In contrast, more recent
studies by Sheehy et al. (2000) suggested milk protein
genes could be expressed in cultured mammary explants
from pregnant cows in the absence of insulin.
In vivo studies in cows employing the hyperinsulinemic–
euglycemic clamp (HEC) technique, which elevated circu-
lating insulin levels fourfold, increased milk protein yield
by 10–15% (Griinari et al. 1997; Mackle et al. 1999b,
2000b). This milk protein response was enhanced to 25–
30% in the presence of an additional exogenous amino acid
(AA) supply (Griinari et al. 1997; Mackle et al. 1999b,
2000b). In these HEC studies and that of McGuire et al.
(1995), infusion of either AA or branched-chain AA
(BCAA) alone did not enhance milk protein production
(Griinari et al. 1997; Mackle et al. 1999b, 2000b; McGuire
et al. 1995). Not all HEC studies in cows have shown an
increase in milk protein production (Metcalf et al. 1991),
and insulin did not enhance milk protein yield when
administered locally to the mammary gland using an intra-
mammary technique (Mackle et al. 2000a). However, in
both bovine and murine mammary tissue, insulin has been
shown to stimulate milk protein synthesis in vitro (Park et
al. 1979; Wang and Amor 1971). Collectively, these studies
suggest that insulin may play a role in milk protein
production, and it is conceivable that this role may be
partly a direct effect on the mammary gland.
Milk protein synthesis may be regulated at multiple
levels within the mammary epithelial cells including
transcription, post-transcription, translation and amino acid
supply. Therefore, it is conceivable that insulin has a role in
the synthesis of milk proteins and not simply expression of
the milk protein genes.
Hydrocortisone and prolactin play a role in both
transcription of the rodent casein gene and stabilisation of
the mRNA, whilst insulin is thought only to be involved in
transcription of the casein gene (Bolander et al. 1981;
Kulski et al. 1983; Nagaiah et al. 1981). More recent
investigations in the mouse have shown that insulin and
prolactin synergistically lengthen the poly(A) on β-casein
mRNA by increased phosphorylation of the cytoplasmic
polyadenylation element binding protein, resulting in
enhanced translation of the protein, presumably by affecting
accumulation of casein mRNA (Choi et al. 2004).
In the cow, a phosphorylation role for insulin has been
identified in translation. Barash (1999) found that the
combination of insulin and prolactin synergistically promoted
the phosphorylation of eIF4E-binding protein 1 (4E-BP1), an
initiation factor-binding protein, in cow mammary tissue. In
addition, 4E-BP1 was shown to be phosphorylated by MAP
kinase in response to insulin treatment in muscle and adipose
Funct Integr Genomics (2009) 9:197–217
tissues. Phosphorylation of 4E-BP1 results in the release of an
initiation factor for translation, eIF4E, and makes the latter
available for translation (Lin et al. 1994; Pause et al. 1994).
The elongation phase of protein synthesis in eukaryotes
has also been reported to be stimulated by insulin through
phosphorylation of eEF1 (Myers et al. 1994) and dephos-
phorylation of eEF2 (Redpath et al. 1996). The dephosphor-
ylation of eEF2 results in increased eEF2 activity and rate of
peptide elongation (Proud 1994). Furthermore, the activity
levels of eEF2 are high in bovine lactating mammary tissue
compared to that in heifers (Christophersen et al. 2002). An
increase in eIF4E transcripts in vivo in bovine lactating
tissue (Long et al. 2001; Toerien and Cant 2007) and eEF2
synthesis in NIH 3T3 mouse embryonic fibroblast cells
(Levenson et al. 1989) suggests that transcription and
phosphorylation of translation factors could be an important
regulatory mechanism for synthesis of milk proteins. A role
for insulin in transcription of genes for translation factors in
the bovine mammary gland remains to be elucidated.
The extraction rate of AA from the blood by the
mammary gland is very high and the overall efficiency of
mammary utilisation of AA for milk protein synthesis,
assessed by mammary uptake to output ratios, exceeds 80%
in the dairy cow (Clark et al. 1978; Mackle et al. 2000a, b).
However, the uptake of some essential AA (EAA), most
notably arginine, lysine and the BCAAs, is greater than
their output in milk (Mackle et al. 2000b; Mepham 1982).
Metabolism of these particular EAA is central for the
formation of the intracellular pool of non-essential AA
(NEAA) supply (Davis and Mepham 1976; Wohlt et al.
1977), which is inadequate to account for the needs of milk
protein synthesis (Clark et al. 1978; Mackle et al. 2000b).
Although in vivo studies involving short-term treatment
with insulin in cows have found little effect on mammary
uptake of AA (Metcalf et al. 1991), a sustained elevation in
plasma levels for several days utilising HEC technique
increased the fractional extraction of BCAA by 48% and
arginine and lysine by 20% (Mackle et al. 2000b), as well
increasing milk protein yield (Griinari et al. 1997; Mackle
et al. 1999a, b; Mackle et al. 2000b; McGuire et al. 1995).
Furthermore, in vitro studies in cultured bovine mammary
acini have shown that insulin stimulates uptake of the non-
metabolisable BCAA cycloleucine in a dose-dependent
manner (Park et al. 1979). Insulin has been shown to up-
regulate the Y+ transport system for the cationic AA, lysine
and arginine in mouse mammary culture experiments
(Kansal et al. 2000). A direct role for insulin to stimulate
the uptake of cationic AA in bovine mammary tissue
remains to be confirmed. In addition, the underlying
molecular mechanism by which insulin may stimulate
mammary epithelial cell uptake of the neutrally charged
BCAA by the L transporter system (Park et al. 1979), and
potentially of arginine and lysine by the Y+ transport
Funct Integr Genomics (2009) 9:197–217
system, remains to be elucidated. It is also conceivable that
insulin may play a role in the cellular metabolism of EAA
to meet the requirements of NEAA for milk protein
synthesis, and this also remains to be examined.
Most ruminant studies to date investigating the role of
insulin on milk protein production (Griinari et al. 1997;
Mackle et al. 1999b, 2000b; McGuire et al. 1995; Metcalf
et al. 1991) have been empirical and complicated by the
potential effects of whole body metabolism. Tissue culture
models permit the study of the direct effects of hormones
on the regulation of milk protein gene expression, providing
a greater understanding in the transcriptional regulation of
genes. These models also allow the study of milk protein
synthesis which may be regulated at the levels of post-
transcription, translation and amino acid supply.
The current study has exploited the mammary explant
culture model to investigate the direct role/s of insulin in
milk protein synthesis at multiple levels in the bovine
mammary gland. The use of Affymetrix microarray has
allowed a global assessment of mammary gene expression
and offers potential insight into the molecular mechanisms
underlying the insulin-stimulated milk protein synthesis.
Materials and methods
Animals
Pregnant Holstein–Freisan cows no later than 30 days prior
to parturition were slaughtered at the abattoir according to
the abattoir guidelines and the udders retrieved from the
production line. Mammary tissue samples were excised
under sterile conditions and transported to the laboratory in
Medium 199 with Earle’s salts (Gibco BRL Life Technolo-
gies, Melbourne, Australia) for mammary explant culture. The
stage of pregnancy was determined from farmers’ records of
cow insemination date and ultrasound pregnancy tests.
Tissue culture
Mammary explants from pregnant animals were prepared
and cultured in Medium 199 with Earle’s salts (Gibco BRL
Life Technologies) containing 5% foetal calf serum as
described previously (Nicholas and Tyndale-Biscoe 1985),
but without the addition of bovine serum albumin. Explants
were placed on siliconised lens paper which was floated on
5 mL of media. Explants were incubated at 37°C in 5%
CO2 and the media changed every second day. Hormones
were added at the following concentrations unless indicated:
bovine insulin (I), 100 ng/mL (Sigma-Aldrich, Melbourne,
Australia); hydrocortisone (F), 50 ng/mL (Sigma-Aldrich,
Melbourne, Australia) and ovine prolactin (P), 200 ng/mL
(National Hormone and Pituitary Program, USA). Explants
199
for extraction of total RNA were stored at −80°C until further
analysis.
Northern blot analysis—casein gene expression
Total RNA was extracted using an RNeasy Lipid Kit (Qiagen,
Sydney, Australia). Total RNA (10 μg) was electrophoresed
in MOPS 1% agarose gels at 100 V/cm using 10% MOPS
buffer, transferred to Zeta-Probe GT membranes and pre-
hybridised for 4 h at 42°C in 30% formamide hybridisation
buffer. Membranes were hybridised overnight at 42°C with a
32
P-α-s1-casein cDNA probe (4.5×105 cpm/mL) labelled
with [α-32P]dCTP (3,000 Ci/mmol; Perkin Elmer, Boston,
MA, USA) using DECAprime II random priming DNA
labelling kit (Ambion, Melbourne, Australia). Membranes
were washed once at room temperature with 2% SSC and
1% SDS, twice at room temperature with 1% SSC and 0.1%
SDS and twice at 42°C in 0.1% SDS and 0.1% SSC. The
32
P-labelled cDNA was detected using a phospho-imager
(Bio-Rad, Molecular Dynamics Typhoon Scanner).
Synthesis of casein
Mammary explants to be analysed for casein synthesis were
incubated with 33P (3,000 Ci/mmol; GE Health Care,
Melbourne, Australia) at 5 μCi/mL medium during the
final 6 h of culture. The incorporation of 33P into the casein
micelle was measured by calcium–rennin precipitation of
the casein micelle as previously described (Juergens et al.
1965). Casein synthesis is expressed as decay per minute
per milligram tissue for each treatment.
Lysine uptake
Lysine uptake in mammary explants was determined
following incubation with L-[U-14C]lysine (322 mCi/mmol;
MP Biomedicals, USA) at 0.5 μCi/mL of media for the
final 6 h of culture. Explants were weighed, washed
immediately by vortexing in ice-cold acetone twice,
followed by two washes in ice-cold 5% trichloric acid.
Explants were dissolved in 0.5 mL 500 mM NaOH at 50°C
for 48–72 h and the level of radioactivity determined after
the addition of 10 mL Ultima Gold scintillator fluid (Bio-Rad,
Melbourne, Australia). Amino acid uptake was expressed as
disintegrations per minute per milligram tissue.
Statistical analysis of lysine uptake
Linear mixed models fitted by GenStat 10th Edition were
used to analyse the two culture experiments of 14C-lysine
uptake in mammary explants. For 14C-lysine uptake in
mammary explants cultured over a 48-h time period, the
model was: lysine=constant+treatment+time+treatment×
200 Funct Integr Genomics (2009) 9:197–217

time+cow+cow×treatment+ɛ where lysine, the observed
lysine level; time, the effect of 0, 24 or 48 h and treatment,
the effect hormone treatment (i.e. NH, I, FP or IFP) are the
fixed effects and cow, the effect of cow; cow×treatment,
the effect of explant and ɛ, the residual random error are the
random effects. Overall significance tests were conducted
with REML F tests. Data is graphed as the mean±SEM for
uptake of 14C-lysine (decay per minute per milligram of
tissue) in cultured mammary explants.
For 14C-lysine uptake in mammary explants cultured in
different hormone treatments for 3 days after an initial 2-day
culture in the absence of exogenous hormones, the following
linear mixed model was used to analyse the data: lysine=
constant+treatment×time+cow+cow×treatment+ɛ where
the terms are defined as in the previous experiment. Note,
the treatment×time term corresponds to the seven-level
factor, the levels being FP, I, IFP(i), IFP(ii), IFP(iii), NH
(day 2) and NH (day 3). Overall significance tests were
conducted with REML F tests. Data is graphed as the
mean±SEM for uptake of 14C-lysine (decay per minute per
milligram of tissue) in cultured mammary explants.
Affymetrix microarray
Mammary tissue from four cows was used for microarray
analysis. Mammary explants from each cow were initially
cultured in media with NH for 5 days and then in media
containing FP or IFP for 3 days and total RNA extracted.
The RNA from two cows was pooled (#1 and #2, #3 and
#4) for each culture treatment FP, IFP and NH, and the
RNA samples analysed using Affymetrix® GeneChip
bovine genome arrays under contract to the Australian
Genomics Research Foundation. Microarrays were performed
in duplicate for each culture treatment FP, IFP and NH using a
total of six Affymetrix GeneChips.
Signal intensities were normalised using the robust
multi-array average (RMA) function in Bioconductor
(http://www.bioconductor.org) (Bolstad et al. 2003; Irizarry
et al. 2003). Differential gene expression was then assessed
using the differential expression analysis function of the
limma package (Smyth 2004). Genes that were differen-
tially expressed in mammary explants cultured in FP
compared to IFP formed the insulin-responsive (I-responsive)
dataset, and genes that were differentially expressed in
mammary explants cultured in NH compared to IFP formed
the IFP-responsive dataset. Version 2 of the bovine Affymetrix
chip annotation was used to assign gene descriptions to the
differentially expressed probe sequences. The bovine Affyme-
trix chip is not completely annotated and genes that were
described as ‘similar to x gene’ were designated that particular
gene’s description (Table 1).
To focus specifically on mammary function, both the
IFP- and I-responsive genes were assigned to cellular
function categories using information from NCBI Gene
Entrez and manual searching of the literature using the
NCBI Pubmed and Entrez gene databases. Where appro-
priate, genes were designated additional cellular functions.
To validate the mammary explant culture as an appropriate
model to investigate the molecular mechanisms underlying
milk protein synthesis, the IFP-responsive genes were
identified with key genes and cellular processes reported
in the literature to be differentially regulated during lacto-
genesis in the mammary gland. This included a comparison
with datasets from three studies reporting key regulatory
genes of lactogenesis in the mouse (Naylor et al. 2005;
Ramanathan et al. 2007; Rudolph et al. 2003) and
referencing to bovine studies. I-responsive genes important
for protein synthesis were identified using the information
collected from the NCBI database and computer software
that identified metabolic pathways within the dataset related
to amino acid metabolism, as described below.
Analysis of amino acid metabolic pathways of I-responsive
gene dataset
Canonical Pathway Analysis within Ingenuity Pathways
Analysis (IPA) software (Ingenuity® Systems; http://www.
ingenuity.com) was used to identify metabolic pathways

Table 1 The annotation summary of differentially expressed genes in IFP- and I-responsive genes in cultured mammary explants

Treatment Total IDs Annotated Hypothetical and Un-annotated Mapped to Mapped Mapped
transcribed locus Unigenesa to IPAa to IPAKa
Fully Similar to

Insulin up 125 47 63 28 10 107 101 90

Insulin down 139 45 45 30 19 86 81 65
Total 264 92 108 58 29 190 182 155
IFP up 439 138 172 113 26
IFP down 477 164 183 85 45
Total 916 302 355 51 69
a
Included for the I-responsive dataset is the numbers of genes that mapped to Unigenes, Ingenuity Pathways Analysis (IPA) and to IPA
Knowledge Base (IPAK) for Canonical Pathways Analysis
Funct Integr Genomics (2009) 9:197–217 201

that were significantly associated with the I-responsive
dataset. The IPA software does not interpret bovine
Affymetrix or Unigene IDs, so genes in the I-responsive
dataset were assigned corresponding human, mouse or dog
Unigenes, which resulted in 97% of the annotated genes I-
responsive genes being eligible for IPA analysis (Table 1).
The corresponding Unigene IDs for the I-responsive dataset
were uploaded into IPA software as up- and down-regulated
gene datasets, and the genes mapped to Ingenuity Pathway
Knowledge Base for analysis. The numbers of genes
mapped to Ingenuity Pathway Knowledge Base for each
dataset is outlined in Table 1. Preliminary functional
analysis of the I-responsive datasets by IPA (which
identified biological functions significantly associated with
a dataset) showed only the positively regulated genes that
were significantly associated with protein synthesis (data
not shown) and, therefore, only the up-regulated genes were
subject to Canonical Pathway Analysis. This identified
metabolic pathways from the IPA library of canonical
pathways that were significant to the dataset in two ways:
(1) A ratio of the number of genes from the dataset that
map to the pathway divided by the total number of genes
that map to the canonical pathway is displayed. (2) Fisher’s
exact test was used to calculate a P value determining the
probability that the association between the genes in the
dataset and the canonical pathway is explained by chance
alone. Canonical pathways that were related to amino acid
metabolism and were identified by IPA to be associated
with I-responsive dataset were selected. The relevance of
these genes with amino acid metabolism was further
assessed using the linked literature references to the gene
from IPA and manual searching of literature using the
NCBI Pubmed and Entrez gene databases. Genes within the
I-responsive dataset that were not associated with Ingenuity
Pathways Knowledge Base were manually screened and
assessed using the literature of NCBI Pubmed and Entrez
gene databases to determine if relevant to amino acid
metabolism.
SLC7A5 primer sets was performed using 28 cycles and 35
cycles for the FOLR1 primer set. PCR reactions were
electrophoresed through 1% TAE agarose gel with SYBR
Safe (Invitrogen, Sydney, Australia) DNA gel stain, the
PCR products visualised using UVP BIODoc-it System
(Pathtech, Australia) and saved by PCTV Vision software.
The primer sequences and PCR product sizes are outlined
in Table 2. To confirm correct amplification with FOLR1,
ELF5, EIF4E and SLC7A5 primer sets, the amplified
products were gel isolated and the sequence reactions and
subsequent analysis by an ABI Prism Genetic Analyser
were performed by the Pathology Department of The
University of Melbourne. Alignment of the resulting
nucleotide sequences was performed using BLAST, National
Centre for Biotechnology Information (NCBI) database
(http://www.ncbi.nlm.nih.gov).
Results
Milk protein gene expression
To examine if insulin is essential for milk protein gene
expression, mammary explants from four late pregnant
cows were initially cultured for 5 days in media with no
hormones (NH) to allow the effects of endogenous
hormones to subside, and then either hydrocortisone and
prolactin (FP) or insulin, hydrocortisone and prolactin (IFP)
was added to the culture media for 3 days. Analysis of gene
expression by Affymetrix microarray showed minimal
induction of α-s1-, α-s2-, β- and κ-casein gene expressions
in mammary explants cultured in NH for 5 days (Fig. 1a). In
explants cultured in FP for 3 days, there was no change in
expression level of α-s2- and β-casein genes compared to
explants cultured in NH. There was some increase in the
expression level of α-s2- and κ-casein genes in explants
cultured in FP compared to NH. Maximum expression of
all four casein genes in mammary explants required insulin

Reverse transcriptase PCR

Table 2 PCR primer sequences
First strand cDNA synthesis was performed using Super-
script™ III Reverse Transcriptase (Invitrogen Life Tech- Gene Primer Size (bp)
nologies, Melbourne, Australia). In a 20-μL reaction
FOLR 5′ GCTGTGCCTTTTAGTGTGTGTG 183
volume, 1 μg total RNA was used to generate cDNA. The 3′ TGGGCTTCTATGCTGGTGTT
polymerase chain reaction (PCR) was performed using the ELF5 5′ CATCCGCTCACAAGGTTACTC 287
GoTaq Green PCR kit (Promega, Sydney Australia), and in 3′ TCTTCCTTTGTCCCCACATC
a 20-μL reaction volume, 0.2 μL of the first strand reaction EIF4E 5′ GCGGCTCCACCTAAAA 196
was used as a template. Annealing temperature used for all 3′ ACAAGACAAAGGCGAATGAGA
the primers of the genes of interest was 50°C, and for the SLC7A5 5′ TTCACTTCACCCTCACGTCTC 204
UXT primers, 60°C. PCR for the housekeeping gene, UXT 3′ CCCCAACAAAACACAAAACTC
UXT 5′ GGTTGTCGCTAAGCTCTGTG 101
(Bionaz and Loor 2007), was performed at 20, 25, 30 and
3′ TGTGGCCCTTGGATATGGTT
35 cycles of amplification. PCR using ELF5, EIF4E and
202 Funct Integr Genomics (2009) 9:197–217

A 16000
* BLG required insulin in the presence of FP in the culture
α
αg--S1-casein
S1-casein
α
g-S2-casein
-S2-casein
media.
β -casein The increase in α-s1-casein gene expression in response
K-casein *
12000 to insulin in the presence of FP in mammary explants was
confirmed by Northern analysis. Northern analysis showed
α-s1-casein transcripts were undetectable in explants
intensity

8000
** cultured in NH for 5 days and in explants cultured in NH
** * and FP for a further 3 days (Fig. 2a). Incubation of explants
**
* with I together with FP for 3 days induced α-s1-casein gene
4000
* expression. The level of milk protein gene expression was
correlated with the concentration of I in the presence of FP
(Fig. 2b). Northern analysis showed there was no detectable
0
expression of the α-s1-casein gene in explants cultured for
NH FP IFP 3 days in NH and subsequently after a second incubation
hormone treatment for 3 days in NH. Minimal amounts of α-s1-casein gene
transcripts were observed when I was included in the media
B 5000 α -lactalbumin ** at a concentration of 12.5 ng/mL, and the level of gene
β -lactoglobulin * expression increased progressively to maximum levels
4000 when I was present at 1,000 ng/mL of media.

Casein synthesis
3000
intensity

To investigate if insulin can prime the mammary gland for

2000
1000 **
*
0 3 day culture in IF (Fig. 3a). Induction of α-s1-casein gene
NH FP IFP
hormone treatment
Fig. 1 Milk protein gene expression in response to insulin in cultured
mammary explants. Mammary explants were cultured with no
hormones (NH) for 5 days before culture in hydrocortisone and
prolactin (FP) or insulin, hydrocortisone and prolactin (IFP) for
3 days. a Maximum expression of the major milk casein genes in
explants required I in the presence of FP. Minimal expression of the
casein genes is observed in explants cultured in NH and some
induction of α-s2- and β-casein gene expression occurred in explants
cultured with FP. b Maximum expression of the major whey protein
genes required I in the presence of FP in cultured mammary explants.
Minimal expression was observed in explants cultured in NH and FP.
Data is from the microarray of total RNA, pooled for cows #1 and #2
and #3 and #4 and analysed using two Affymetrix GeneChips for each
hormone treatment. Gene intensity levels are presented as mean±range
between two GeneChips. Significant differences in gene expression
between hormone treatments are: *P≤0.001, NH and FP; **P≤0.001,
FP and IFP; ***P≤0.001, NH and FP
I-independent milk protein gene expression, mammary
explants from seven cows were initially cultured in media
with IF for 4 days prior to 3 days culture in media with FP
and IFP. There was no expression of α-s1-casein gene in
explants cultured in media with IF for 4 days or subsequent
expression in mammary explants cultured in only FP
occurred in explants from three cows. Transcripts of α-s1-
casein gene were observed in explants from all seven cows
cultured in IFP, and in mammary explants from cows #2
and #3, the amounts α-s1-casein gene transcripts were
similar to that in explants cultured in FP (Fig. 3a).
Subsequent analysis of casein synthesis in explants from
the same treatment groups showed synthesis of casein
proteins occurred in explants cultured in IF for 4 and 7 days
(254 and 205 dpm/mg tissue, respectively) (Fig. 3b).
Minimal synthesis of casein protein also occurred in
explants cultured in FP for 3 days (205 dpm/mg tissue)
whereas maximum synthesis occurred in explants cultured
in the complement of IFP (490 dpm/mg tissue).
Lysine uptake

Two experiments were performed to investigate the

(I) in the presence of FP in the culture media. Minimal
induction of the whey protein genes, α-lactalbumin
(LALBA) and β-lactoglobulin (BLG), was observed in
mammary explants cultured in NH for 5 days and FP for
3 days (Fig. 1b). Maximum induction of both LALBA and
potential of insulin to stimulate uptake of 14C-lysine in
cultured mammary explants. The first experiment addressed
whether the late pregnant mammary gland responded to
insulin for lysine uptake or acquired the capacity to respond
to insulin for lysine uptake. Mammary explants were
cultured for 48 h in either NH, I, FP or IFP and 14C-lysine
Funct Integr Genomics (2009) 9:197–217
A 18S
cow # 1 cow # 2 cow # 3
NH5 NH8 FP IFP NH5 NH8 FP IFP NH5 NH8 FP
B 18S
cow # 7 cow # 8
NH3 NH6 (i) (ii) (iii) (iv) (v) NH3 NH6 (i) (ii) (iii)
Fig. 2 The effect of insulin on α-s1-casein gene expression in
cultured mammary explants. Total RNA (10 μg) was assayed by
Northern analysis using an αS1-casein labelled probe. Upper panels
show equal loadings as determined by visualisation of 28S and 18S
ethidium bromide stained ribosomal bands. a Mammary explants were
cultured with no hormones (NH) for 5 days before culture in
hydrocortisone and prolactin (FP) or insulin, hydrocortisone and
prolactin (IFP) for 3 days. The expression of α-s1-casein (1,172 bp) is
observed in explants cultured in IFP and not in FP or NH. b Mammary
uptake was measured at 0–6 h (referred to as time 0 h), 24–
30 h (referred to as 24 h) and 48–54 h (referred to as 48 h).
The rate of 14C-lysine uptake did not increase significantly
in NH, I or FP within 24 h (all P>0.05) (Fig. 4a), but did
increase significantly in explants cultured with IFP (P<0.05).
Subsequent treatment for a further 24 h in either FP or NH
did not result in any change in 14C-lysine uptake (both
P>0.05). In contrast, explants cultured in media with either
I or IFP showed an increase in 14C-lysine uptake (both
P<0.05). The difference in 14C-lysine uptake by the explants
between the two treatments, I and IFP, was not significant
(P>0.05).
In the second experiment, mammary explants from three
cows were initially cultured in media with NH for 2 days
and then for 3 days in media with either I (100 ng/mL)
alone, FP alone or I (50, 100, 1,000 ng/mL) with FP. The
rate of 14C-lysine uptake in explants cultured in NH for
2 days represents a baseline value for lysine uptake
(Fig. 4b). Subsequent culture in NH or FP for 3 days did
not change the rate of 14C-lysine uptake in the explants
(both P>0.05). Insulin alone at a concentration of 100 ng/mL
stimulated uptake of 14C-lysine in explants (P<0.05), and
this rate was equivalent to that of explants cultured in I
(50 ng/mL) in the presence of FP (P>0.05). 14C-lysine
uptake increased progressively in explants cultured in FP
with incremental concentrations of I to a maximum rate
when I was present at 1,000 ng/mL of media (P<0.05).
203
28S
cow # 4
1172
IFP NH5 NH8 FP IFP
28S
cow # 9
1172
(iv) (v) NH3 NH6 (i) (ii) (iii) (iv) (v)
explants were cultured with no hormones (NH) for 3 days and then in
different insulin concentrations in the presence of FP for 3 days.
Titration of insulin concentrations used in the mammary explant
culture medium are (i) I=12.5 ng/mL; (ii) I=25 ng/mL; (iii) I=50 ng/
mL; (iv) I=100 ng/mL; (v) I=1,000 ng/mL. No induction of α-s1-
casein (1,172 bp) gene expression occurs in explants cultured in NH.
Minimal induction of α-s1-casein is observed in 12.5 ng/mL of insulin
and maximum induction of α-s1-casein occurs in explants cultured in
1,000 ng/mL of insulin
Microarray analysis, IFP-responsive genes
Mammary explants from four cows were initially cultured
in media with NH for 5 days and then in media containing
FP or IFP for 3 days. Microarrays were performed in
duplicate, pooling samples from two cows for each
hormone treatment, using a total of six Affymetrix
GeneChips. A total of 916 genes were differentially
expressed in mammary explants cultured in IFP compared
to NH (P<0.01). The expression of 439 of these genes was
up-regulated and 477 were down-regulated. A total of 657
genes were annotated with a gene description or ascribed
‘similar to’ by the Affymetrix software, and the remaining
268 were not associated with a gene description (Table 1).
To focus specifically on mammary function, the IFP-
responsive genes were assigned to cellular function cate-
gories, and this information is summarised in Table 3 and
detailed in Table 1 of the Supplementary Data. Of these
genes, 52 were identified as key lactogenic genes and
cellular processes reported in bovine and murine mammary
glands, and are shown in Table 4. These genes are directly
implicated in the synthesis of the main milk components;
protein (seven genes), lipid (12 genes), lactose and oligosac-
charides (three genes); innate immune factors (two genes), and
cellular processes associated with secretory activation; tight
junction closure (six genes), extracellular matrix synthesis (19
genes) and signal transduction (five genes).
204 Funct Integr Genomics (2009) 9:197–217

Fig. 3 A post-transcriptional
A 28S
role for insulin in casein
synthesis. Mammary explants 18S
were cultured in hydrocortisone
and prolactin (FP) or insulin,
cow # 1 cow # 2 cow # 3 cow # 4
hydrocortisone and prolactin
1172
(IFP) for 3 days after priming
the explants in insulin and
hydrocortisone (IF) for 4 days. a
Total RNA (10 μg) was assayed IF4 IF7 FP IFP IF4 IF7 FP IFP IF4 IF7 FP IFP IF4 IF7 FP IFP
by Northern analysis using an
αS1-casein labelled probe.
Upper panels show equal 28S
loadings as determined by 18S
visualisation of 28S and 18S
ethidium bromide stained cow # 5 cow # 6 cow # 7
ribosomal bands. Expression of 1172
the α-s1-casein gene (1,172 bp)
occurs in explants cultured in
IFP from all seven cows and in
explants cultured in FP from IF4 IF7 FP IFP IF4 IF7 FP IFP IF4 IF7 FP IFP
three cows: #1, #2 and #3. No
expression of α-s1-casein gene B
is observed in explants cultured 600
casein synthesis (dpm/mg tissue)

in IF, the experimental controls.

b The effect of insulin on casein 500
synthesis in mammary explants
from cows #2 and #3. Casein 400
synthesis in mammary explants
cultured in IF represents a 300
baseline level. There was no
increment in casein synthesis in
200
FP, but an increment is observed
in IFP. Casein synthesis is
100
presented as the mean±range
from two cows
0
IF 4 IF 7 FP IFP

hormone treatment

Microarray analysis, insulin-responsive genes
A total of 264 genes were differentially expressed (I-
responsive) in mammary explants cultured in IFP
compared to FP (P<0.01) (Table 1 and Table 1 of the
Supplementary Data). The expression of 125 of these
genes was up-regulated and 139 were down-regulated. A
total of 200 genes were annotated with a description or
ascribed a ‘similar to’ by the Affymetrix software, and the
remaining 85 were not identified with a gene description
(Table 1). Categorising the 200 annotated genes according
to cellular function showed that insulin is involved in a
range of cellular processes (Table 3), and 29 genes
responsive to insulin were identified to be involved in
protein synthesis (Table 5) at the level of gene transcription,
post-transcription, protein translation, post-translation
modification and amino acid supply. Ninety-seven percent
of the I-responsive annotated genes were assigned a
corresponding human, mouse or dog Unigene, and a total
of 182 genes (91%) mapped to Ingenuity Pathways
Analysis (IPA), of which 155 genes were eligible for
Canonical Pathways Analysis (Table 1). Canonical Pathways
Analysis (IPA software) showed four cellular pathways and
eight genes were significantly associated with the data set
(P<0.05) and directly related to amino acid metabolism
(Fig. 5).
PCR validation of insulin-responsive genes
The expression patterns of four I-responsive genes, as
determined by microarray analysis, were confirmed by
PCR. Minimal expression of the folate receptor 1 (FOLR1),
E74-like factor 5 (ETS domain transcription factor) (ELF5),
solute carrier family 7 (cationic amino acid transporter, Y+
system), member 5 (SLC7A5) and eukaryotic initiation
factor 4E (eIF4E) genes was observed in mammary
explants from four cows cultured in NH for 5 days and
FP for 3 days (Fig. 6). Maximum expression of these genes
occurred in mammary explants cultured in I in the presence
of FP for 3 days. The expression level of the housekeeper
gene UXT was consistent across explants in each treatment
for each cow.
Funct Integr Genomics (2009) 9:197–217 205

A 6000 FP insulin, in the presence of hydrocortisone and prolactin, in

I
lysine uptake (dpm/mg tissue)

IFP bovine mammary explants, which is consistent with

5000
NH * previous reports (Andersen and Larson 1970; Choi et al.
4000 * 1988; Djiane et al. 1975; Servely et al. 1982). Milk protein
gene expression is an integral part of lactogenesis, the
3000 process by which the pregnant mammary gland differentiates
to synthesise and secrete the major milk constituents
2000
(Brisken and Rajaram 2006; Muller and Neville 2001;
1000 Neville et al. 2002). In vivo, the first state of lactogenesis,
secretory differentiation, begins in the cow at mid-pregnancy
0 and is characterised by the expression of the major milk
0 24 48
time (hours) protein genes (Hartmann 1973; Neville et al. 2002). The
B second stage of lactogenesis, secretory activation, occurs at
6000
** parturition and is characterised by closure of tight junctions
*
lysine uptake (dpm/mg tissue)

5000 between mammary epithelial cells to initiate polarisation of

4000
* *
3000
2000
1000
0
NH2 NH3 FP I IFP(i)
hormone treatment
Fig. 4 The effect of insulin on lysine uptake in cultured mammary
explants. The effect of insulin on 14C-lysine uptake in mammary
explants cultured in no hormone (NH), insulin (I), hydrocortisone and
prolactin (FP) or insulin, hydrocortisone and prolactin (IFP). a 14C-
Lysine uptake by explants from the pregnant cow mammary gland is
not sensitive to hormones. After 48 h in culture, the explants acquired
the capacity for 14C-lysine uptake to be hormone-responsive: I alone can
stimulate 14C-lysine uptake. IFP is required for maximum stimulation of
lysine uptake in cultured mammary explants. *P<0.05, significant
increase in lysine uptake at 48 h. b The effect of insulin on 14C-lysine
uptake in mammary explants cultured in the absence of hormones for an
initial 2 days. Explants were then cultured in either I alone (100 ng/mL)
or (i) I=50 ng/mL; (ii) I=100 ng/mL; (iii) I=1,000 ng/mL in the
presence of FP. The uptake of 14C-lysine in cultured explants is
stimulated by I alone, and this stimulation is dose-responsive to insulin
in the presence of FP. Lysine uptake is greatest in explants cultured in
the presence of IFP. 14C-lysine uptake is presented as the mean±SEM in
mammary explants from three cows. Significant differences in lysine
uptake between hormone treatments are: *P<0.05, NH and I or IFP(i);
**P<0.05, IFP(i) and IFP(ii); ***P<0.05, IFP(ii) and IFP(iii)
Discussion
Assessment of the culture model
This is the first report using microarray analysis to assess
differential gene expression in cultured bovine mammary
explants. This study observed maximum induction of the
major milk casein and whey protein genes in response to
** the cells around a central lumen, as well as an increase in
milk protein gene expression and formation and secretion of
milk lipid droplets (Brisken and Rajaram 2006; Muller and
Neville 2001; Neville et al. 2002).
In addition to the milk protein genes, the milk protein
gene transcription factor E74-like factor 5 (ELF5) (Harris et
al. 2006) and genes associated with synthesis of other major
milk components, including lipid, lactose and immune
IFP(ii) IFP(iii)
factors, were up-regulated. Significant regulation of lipid
synthesis in the mammary gland has been observed to occur
at the mRNA level (Rudolph et al. 2003; Rudolph et al.
2007) and, accordingly, an increase in 12 genes involved in
lipid synthesis was observed. The nuclear acting peroxi-
some proliferator activated receptor gamma (PPARγ) gene
has been identified as a key regulator of lipid synthesis
(Anderson et al. 2007) and the data showed an increase in
gene expression of its coactivator, peroxisome proliferator
activated receptor gamma coactivator 1 alpha (PPARGC1A).
A single nucleotide polymorphism has also been identified
within the PPARGC1A gene that is associated with variation
on milk fat production (Weikard et al. 2005). Genes
encoding enzymes required for de novo synthesis of lipid
in the mammary gland include stearyl-coenzyme A desaturase
(SCD), iso-citrate dehydrogenase (IDH1) and fatty acid
synthase (FAS) (Anderson et al. 2007; Barber et al. 1997;
Rudolph et al. 2003) and the genes encoding these enzymes
are up-regulated in mammary explants cultured in the
presence of IFP. Similarly, the expression of genes encoding
enzymes also involved in triglyceride synthesis such as
acetyl-coenzyme A acetyltransferase 1 (ACAT1), acyl-CoA
synthetase long-chain family member 1 (ACSL1) (Finucane
et al. 2008), acyl-CoA synthetase long-chain family member
3 (ACSL3), very long-chain acyl-CoA synthetase homolog 1
(VLCS-H1) (Finucane et al. 2008) and Acyl-CoA synthe-
tase, short chain member 2 (ACSS2) were observed to be up-
regulated. Ruminants, in addition to being able to join fatty
acid chains to acetyl moieties, can also add butyryl-CoAs
(Barber et al. 1997) and an increase in expression of the gene
206 Funct Integr Genomics (2009) 9:197–217

Table 3 Summary of the cellular functions of I-responsive and IFP-responsive genes in cultured bovine mammary explants

Cellular function IFP-responsive I-responsive

Genes up-regulated Genes down-regulated Genes up-regulated Genes down-regulated

Milk proteins 7 – 7 –
Lipid synthesis 10 – 6 –
Lactose synthesis 4 – 2 –
Transcription and translation 49 31 20 10
Metabolic enzymes 61 32 27 8
Intracellular and vesicle trafficking 6 1 4 –
Hormones and growth factors 2 7 – 3
Receptors, transporters and binding proteins 38 54 11 20
Signal transduction 29 53 10 19
Structural proteins 42 25 5 3
Apoptosis 1 3 – 2
Immune related 18 53 10 8
Miscellaneous 56 88 14 16
Unknown 37 27 10 4
Hypothetical proteins 27 26 6 2
Transcribed 69 77 22 28
Un-annotated 26 45 10 19

for butyryl coenzyme A synthetase 1 (BUSC1) was observed
in the data. Xanthene dehydrogenase (XDH) and butyrophilin,
subfamily 1, member 1A (BTN1A1) are both involved in the
packaging and secretion of the lipid droplet (Anderson et al.
2007; Banghart et al. 1998; Mather and Jack 1993;
McManaman et al. 2004). The increment in expression of
these genes indicated that the cultured mammary explants are
not only synthesising lipid but also expressing genes
involved in packaging and secreting the droplet. This is
consistent with observations of the initiation of lipid
secretion in cultured bovine mammary explants (Collier et
al. 1977) as well as in cultured wallaby mammary explants
(Kwek et al. 2007) and cultured murine mammary tissue
slices (Da Costa et al. 1995).
Synthesis of the major milk sugar, lactose, in cultured
mammary explants is consistent with an increase in
LALBA gene expression, which encodes the rate-limiting
protein in lactose formation (Brodbeck et al. 1967; Soulier
et al. 1997). Furthermore, expression of the gene for solute
carrier family 2 (GLUT1), the major glucose transporter in
the bovine mammary gland (Zhao et al. 1996), was up-
regulated. Expression of the UDP-glucose pyrophosphorylase
2 (UGP2) gene is also enhanced, and this enzyme is involved
in the conversion of glucose to UDP-galactose, a substrate for
lactose (Jones 1967; Mellenberger and Bauman 1974). The
synthesis of lactose is critical for milk production as it is the
major milk osmole in the cow and is central to the formation
and secretion of the milk droplet (Mellenberger and Bauman
1974).
Milk has been long recognised as an important source of
protective factors for both the mammary gland and the
suckling young (Kolb 2002; Newburg 2005; Wheeler et al.
2007). Accordingly, an increase in expression of Mucin 15
(MUC 15) and lactotransferrin (LTF) genes was observed in
the cultured mammary explants, both of which code for
proteins that have been ascribed antimicrobial activities and
form part of the innate immune system (Arnold et al. 1980;
Kirkpatrick et al. 1971; Kolb 2002; Oram and Reiter 1968;
Pallesen et al. 2002; Pallesen et al. 2007; Tomita et al.
1991; van der Strate et al. 2001). Analysis of the IFP
dataset to assign cellular function highlighted a number of
differentially regulated genes with immune related roles,
including the adaptive immune system. Some of these
immune responses observed in the data may be ascribed to
the culture conditions, under which the explant tissue
undergoes the process of adjusting to and accommodating
its new environment. This presumably reflects the capacity
of the mammary gland to tightly regulate inflammatory
responses often orchestrated within the cells as it can be
damaging to the mammary epithelium (Sordillo et al.
1997).
A global assessment of the cellular functions occurring
in explants cultured in IFP showed differential regulation of
67 structural genes, of which 19 are involved in the
synthesis and regulation of the extracellular matrix. This
is critical for the epithelial–stromal signalling required for
full lobuloalveolar development, differentiation and milk
protein gene expression (Bissell and Barcellos-Hoff 1987;
Chen and Bissell 1989; Delcommenne and Streuli 1995;
Harris et al. 2006; Streuli et al. 1991). The transcription of
two matrix metalloproteinase (MMP) genes, MMP9 and
MMP13, was down-regulated and the expression of two
Funct Integr Genomics (2009) 9:197–217 207

Table 4 Genes involved in lactation that are differentially expressed in cultured bovine mammary explants

Affymetrix ID Gene symbol Gene description Fold change Reference

NH→IFP

Milk protein synthesis

Bt.3683.1.S1_at CSN1S1 Casein alpha-S1 ↑ 12.0 Choi et al. 1988
Bt.385.1.S1_at LGB Lactoglobulin, beta ↑ 25.5 Sheehy et al. 2000
Bt.5354.1.S1_at CSN1S2 Casein alpha-S2 ↑ 27.8 Sheehy et al. 2000
Bt.5381.2.S1_x_at CSN2 Casein beta ↑ 2.2 Choi et al. 1988
Bt.5396.1.S1_at LALBA Lactalbumin, alpha ↑ 10.9 Sheehy et al. 2000
Bt.583.1.S1_a_at CSN3 Casein kappa ↑ 2.1 Sheehy et al. 2000
Bt.4802.1.S1_at LTF Lactoferrin ↑ 1.9 Schanbacher et al. 1993
Bt.24887.1.S1_at ELF5 E74-like factor 5 (ETS domain ↑ 1.8 Harris et al. 2006
transcription factor)
Lipid synthesis and secretion
Bt.10036.1.S1_at ACAT1 Acetyl-coenzyme A acetyltransferase 1 ↑ 1.5
(acetoacetyl coenzyme A thiolase)
Bt.12640 ACSS2 Acyl-CoA synthetase, short chain ↑ 2.9
member 2
Bt.13324.1.S1_a_at IDH1 Isocitrate dehydrogenase 1 ↑ 1.7 Farrell et al. 1987;
(NADP+), soluble Bauman et al. 1970
Bt.17121.1.S1_at LOC523501 Similar to acyl-CoA synthetase ↑ 1.6
(ACSL3) long-chain family member 3
Bt.20920.1.S1_at PPARGC1A Peroxisome proliferator activated ↑ 1.6 Weikard et al. 2005
receptor gamma coactivator 1 alpha
Bt.22854.2.S1_at FASN Fatty acid synthase ↑ 2.0 Knudsen 1972; Amy
et al. 1989
Bt.23809.1.A1_s_at XDH Xanthene dehydrogenase ↑ 2.6 Bruder et al. 1982;
Sullivan et al. 1982
Bt.24210.1.S1_at MGC139933 Similar to acyl-CoA synthetase ↑ 1.9 Finucane et al. 2008
(ACSL1) long-chain family member 1
Bt.26921.1.A1_at LOC537062 Similar to very long-chain acyl-CoA ↑ 13.9 Finucane et al. 2008
(VLCS-H1) synthetase homolog 1
Bt.4604.1.S1_a_at BUCS1 Butyryl coenzyme A synthetase 1 ↑ 3.5 Barber et al. 1997
Bt.4788.1.S1_at BTN Butyrophilin ↑ 6.9 Jack and Mather 1990;
Franke et al. 1981
Bt.4798.1.S2_at SCD Stearoyl-coenzyme A desaturase ↑ 4.1 Kinsella 1970; Rudolph
et al., 2003
Lactose and oligosaccharide synthesis
Bt.5396.1.S1_at ALAC Alpha lactalbumin ↑ 10.9 Brodbeck et al. 1967;
Soulier et al. 1997
Bt.3567.1.S1_at UGP2 UDP-glucose pyrophosphorylase 2 ↑ 1.6 Jones 1967; Rudolph
et al., 2007
Bt.4646.1.S1_at SLC2A1 Solute carrier family 2 (facilitated ↑ 1.6 Zhao et al. 1996
glucose transporter), member
1 (GLUT1)
Innate immune factors
Bt.11217.1.S1_at MUC 15 Mucin 15 ↑ 6.7 Pallesen et al. 2002, 2007
Bt.7780.1.S1_at LTF Lactoferrin ↑ 1.9 Oram and Reiter 1968;
Kirkpatrick et al. 1971;
Arnold et al. 1980
Tight junction closure
Bt.12063.1.S1_at LOC514537 Similar to protocadherin 7 ↑ 1.8
(PCDHGB1) isoform b precursor
Bt.2696.2.S1_at LOC535363 Similar to OB-cadherin-1 ↑ 2.5
Bt.4817.2.S1_at MGC128478 Similar to claudin 11 ↑ 1.8
(CLDN11)
Bt.13868.1.S1_at OCLN Occludin ↓ 1.4
208 Funct Integr Genomics (2009) 9:197–217

Table 4 (continued)

Affymetrix ID Gene symbol Gene description Fold change Reference

NH→IFP

Bt.21028.1.S1_at LOC617453 Similar to claudin 5 ↓ 2.2

(CLDN5)
Bt.18570.1.S1_at LOC522269 Similar to actinin, alpha 4 ↑ 1.5

Extracellular matrix
Bt.11324.1.A1_s_at COL12A1 Collagen, type XII, alpha 1 ↑ 2.1
Bt.11420.1.A1_at P4HA3 Collagen prolyl 4-hydroxylase alpha ↑ 5.8
III subunit
Bt.16087.1.S1_at LOC521854 Similar to nidogen-2 ↑ 1.8
(NID2)
Bt.18456.1.S1_at LOC511854 Similar to fibulin 2 precursor, ↑ 2.6
(FIBLN2)
Bt.19502.1.A1_at LOC613849 Similar to alpha 1 type XIII collagen ↑ 2.0
(COL13A1)
Bt.25936.1.A1_at TIMP4 Tissue inhibitor of metalloproteinase 4 ↑ 1.4
Bt.29614.1.A1_at LOC511043 Similar to laminin 5 gamma 2 subunit ↑ 2.9
Bt.29721.1.S1_at FN1 Fibronectin 1 ↑ 2.7
Bt.3162.1.S1_at P4HB Procollagen-proline, 2-oxoglutarate ↑ 1.3
4-dioxygenase
Bt.3797.1.S1_at FMOD Fibromodulin ↑ 2.2
Bt.5136.1.S1_at TIMP3 Tissue inhibitor of metalloproteinase 3 ↑ 1.8
Bt.5240.1.S1_at CTGF Connective tissue growth factor ↑ 1.8
Bt.6449.1.S1_at FBLN5 Fibulin 5 ↑ 2.0
Bt.6509.3.S1_a_at LOC511043 Similar to laminin gamma-2 chain ↑ 1.8
precursor (laminin 5 gamma 2 subunit)
Bt.734.1.S1_at ADAM9 A disintegrin and metalloproteinase ↑ 1.5
domain 9
Bt.7955.2.S1_at MGC137826 Similar to procollagen C-endopeptidase ↑ 1.8
(PCOLCE) enhancer
Bt.12599.1.S1_at LOC508682 Similar to collagen alpha 1(VII) ↓ 1.6
(COL7A1) chain precursor
Bt.39.1.S1_at MMP13 Matrix metalloproteinase 13 ↓ 3.9
Bt.4714.1.S1_at MMP9 Matrix metalloproteinase 9 ↓ 2.2

Signal transduction
Bt.7033.2.S1_at FOLR1 Folate receptor 1 ↑ 3.1 Naylor et al. 2005;
Ramanathan et al. 2007
Bt.7236.1.S1_at PIK3R1 Phosphoinositide-3-kinase, regulatory ↑ 1.6 Ramanathan et al. 2007
subunit, polypeptide 1 (p85 alpha)
Bt.21465.1.S1_at IGFBP5 Insulin-like growth factor-binding ↓ 2.1 Rudolph et al. 2003
protein 5
Bt.4311.1.S1_at GNAI2 Guanidine nucleotide binding protein, ↓ 1.4 Rudolph et al. 2003
(G protein), alpha inhibiting activity
polypeptide 2
Bt.12315.1.S1_at LOC510559 Similar to TGF-beta masking protein ↓ 1.4 Rudolph et al. 2003
(TGFB1) large subunit (TGF-beta 1)

tissue inhibitors of metalloproteinase (TIMP), TIMP3 and
TIMP4, is up-regulated to preserve the integrity of
extracellular matrix, and this is consistent with MMP gene
expression in vivo (Green and Lund 2005; Rabot et al.
2007). Included also in this group of structural genes are
collagens and laminins, which are an integral component of
the signal transduction via integrins that is important for
milk protein gene expression (Delcommenne and Streuli
1995; Zutter et al. 1998). Genes encoding the tight junction
proteins such as claudins and occludin are also differentially
regulated, as well as cadherin genes (Schneeberger and
Lynch 2004). Cadherin molecules form the focal adhesion
points of the adhesion belt and presumably play a role with
tight junctions in polarising of the mammary epithelial cells
Funct Integr Genomics (2009) 9:197–217 209

Table 5 The insulin-responsive genes in cultured bovine mammary explants that are involved in protein synthesis

Affymetrix ID Gene symbol Gene description Fold change

FP→IFP

Regulation of transcription
Bt.24887.1.S1_at ELF5 E74-like factor 5 ESE-2a 1.4
Bt.3683.1.S1_at CSN1S1 Casein alpha-S1 2.0
Bt.385.1.S1_at LGB Lactoglobulin, beta 28.0
Bt.5354.1.S1_at CSN1S2 Casein alpha-S2 6.1
Bt.5381.2.S1_x_at CSN2 Casein beta 2.2
Bt.5396.1.S1_at LALBA Lactalbumin, alpha 10.2
Bt.583.1.S1_a_at CSN3 Casein kappa 1.4
Bt.4802.1.S1_at LTF Lactoferrin 1.5

Post-transcriptional regulation—methylation and 1-carbon pool

Bt.7033.2.S1_a_at LOC539750 (FOLR1) Similar to folate receptor alpha 4.2
Bt.7033.2.S1_at LOC516067 (FOLR1) Similar to folate receptor 1 precursor 2.9
Bt.20862.1.A1_at MGC142685 (MTHFD2) Similar to bifunctional methylenetetrahydrofolate 1.7
dehydrogenase/cyclohydrolase, mitochondrial precursor
Translation and RNA processing
Bt.7633.1.S1_at EEF1E1 Eukaryotic translation elongation factor 1 epsilon 1 1.3
Bt.1148.1.S1_at EIF4E Eukaryotic translation initiation factor 4E 1.3
Bt.27064.1.A1_at LOC514726 (MARS) Similar to methionine-tRNA synthetase 2 precursor 1.4
Bt.28989.1.S1_at LOC535264 (XPOT) Similar to exportin (tRNA) 1.5
Bt.4959.1.A1_at RPL35 Similar to ribosomal protein L35 1.8

Post-translation modification
Bt.13218.1.S1_at MGC128678 (SERP1) Similar to ribosome associated membrane protein 4 1.5
Bt.5523.1.S1_at LOC517052 (GOLPH2) Similar to golgi phosphoprotein 2 1.3
Bt.6149.1.S1_at LOC508773 (HYOU1) Similar to Hyou1 protein 1.6
Bt.910.2.S1_at UFM1 Ubiquitin-fold modifier 1 1.5

Amino acid and polyamine supply

Bt.13588.1.A1_at LOC533044 (PSAT1) Similar to phosphoserine aminotransferase isoform 1 2.2
Bt.14207.1.S1_at GCAT 2-Amino-3-ketobutyrate coenzyme A ligase 2.1
(glycine-C-acetyltransferase)
Bt.25099.1.S1_at LOC533630 (PSPH) Similar to phosphoserine phosphatase 1.9
Bt.3277.1.S1_at LOC616337 (ALDH18A1) Similar to pyrroline-5-carboxylate synthetase (ALDH18A1) 1.4
Bt.3520.1.S1_at PYCR2 Pyrroline-5-carboxylate reductase family, member 2 1.5
Bt.426.1.S1_at DBT Dihydrolipoamide branched-chain transacylase E2 1.3
(component of branched-chain keto acid
dehydrogenase complex)
Bt.5528.1.S1_at SLC7A5 Solute carrier family 7 (cationic amino acid 1.2
transporter, Y+ system), member 5
Bt.9078.2.S1_a_at LOC505916 (SRM) Similar to spermidine synthase 1.4
Bt.23250.2.S1_at GATM L-arginine:glycine amidinotransferase −1.5

around a central lumen and preventing paracellular commu-
nication (Brisken and Rajaram 2006; Nguyen and Neville
1998). The closing of tight junctions is a central process of
secretory activation and occurs at parturition when the
mammary epithelial cells begin to secrete protein, lipid and
other milk constituents into the alveoli lumen (Linzell and
Peaker 1973; Nguyen and Neville 1998; Stelwagen et al.
1997).
Three recent studies have exploited comparative
genomics to identify commonly regulated genes in different
experimental models: Rudolph et al. (2003) identified 78
key regulatory genes of secretory activation by trajectory
clustering of mammary microarray data from different time
points across murine pregnancy and lactation; Naylor et al.
(2005) used mammary transcript profiling of three mouse
models that exhibited failure of secretory activation to
210 Funct Integr Genomics (2009) 9:197–217

Fig. 5 Insulin-stimulated amino 4.0 0.125

acid metabolic pathways in cul-
tured mammary explants. Four 0.100
3.0
canonical metabolic pathways

-log(p-value)
involved in amino acid metabo-

Ratio
0.075
lism were associated (P<0.05) 2.0
with the I-responsive genes, as 0.050
0.05
analysed by the IPA software. 1.0 threshold
t
The association of the metabolic 0.025
Ratio
pathway with the I-responsive
0.0 0.00
dataset is measured in two ways,

Glycine, serine &threonine

Arginine &proline metabolism

Methionine metabolism

metabolism
degradation
Valine, leucine& isoleucine
by a ratio and P value (refer to
the text)

Pathway -log(p-value) Ratio Genes

Methionine metabolism 3.00E+00 2.63E-02 SRM, MARS
Valine, leucine & isoleucine degradation 2.72E+00 1.87E-02 DBT, ACAT2 , HMGCS1
Glycine, serine & threonine metabolism 2.13E+00 1.38E-02 PSPH, GCAT
Arginine & proline metabolism 2.03E+00 1.11E-02 SRM, P4HB

identify 35 key regulatory genes and Ramanathan et al. involved in lactation in the murine mammary gland (Naylor
(2007) identified 18 commonly differentially expressed et al. 2005; Ramanathan et al. 2007; Rudolph et al. 2003)
mammary genes in the super-lactating QSi5 mouse breed that are consistent with a number of genes differentially
and CBA mice. These studies have identified key regulatory regulated in the bovine mammary explant culture model.
genes, including genes coding for signalling molecules, The genes identified from these studies that code for key
signalling molecules include the folate receptor 1 (FOLR1)
(Naylor et al. 2005; Ramanathan et al. 2007) and
UXT 20 cycles phosphoinositide-3-kinase, regulatory subunit, polypeptide
1 (p85 alpha) (PIK3R1) (Ramanathan et al. 2007). The
UXT 25 cycles
expression of genes coding for guanidine nucleotide binding
UXT 30 cycles protein alpha inhibiting activity polypeptide 2 (Rudolph et al.
2003), insulin-like growth factor-binding protein 5 (IGF-
UXT 35 cycles
BP5) (Rudolph et al. 2003) and TGF-β masking protein,
FOLR1 large subunit (TGFβ1) were all down-regulated. The
EIF4E decrease in expression of the gene encoding TGFβ1
masking protein is in agreement with the down-regulation
ELF5
of TGF-β1 during lactation compared to mammogenesis in
SLC7A5 the cow (Plath et al. 1997), and during secretory activation in
N H5 FP IFP N
H5 FP IFP N H5 FP IFP N H5 FP IFP -v
e the mouse (Rudolph et al. 2003), and with the suggestion
that TGF-β signalling via β-catenin is inhibitory to secretory
cow#1 cow#2 cow#3 cow#4 activation (Jhappan et al. 1993).
Fig. 6 PCR validation of insulin-responsive genes. PCR analysis of It is apparent that mammary explants cultured with
cDNA generated from the mammary explant RNA from the four cows insulin, hydrocortisone and prolactin respond not only in
used for the microarray analysis [mammary explants were cultured terms of enhanced milk protein gene expression but cellular
with no hormones (NH) for 5 days before culture in hydrocortisone
processes typically associated with the transition of a
and prolactin (FP) or insulin, hydrocortisone and prolactin (IFP) for
3 days] showed that maximum SLC7A5 gene transcripts (201 bp) pregnant-like to lactogenic-like state of the mammary
occurred in explants cultured with I in the presence of FP. Maximum gland. Previous studies by Brennan and colleagues
transcripts of the genes FOLR1 (183 bp), ELF5 (287 bp) and EIF4E (Brennan et al. 2007, 2008a, b) have shown that bovine
(196 bp), shown to be insulin-responsive by microarray analysis, also
as well as wallaby and murine cultured mammary explants
occurred in explants cultured with I in the presence of FP. Equivalent
amounts of the housekeeper gene (UXT) transcripts (101 bp) was can survive, retain hormone responsiveness and maintain
observed in the cDNA samples from each cow tissue integrity in the absence of insulin or any other
Funct Integr Genomics (2009) 9:197–217
exogenous growth factors. Morphological evaluation of
bovine mammary tissues and mammary explants have
shown that the cellular architecture of mammary explant
tissue is maintained in culture (Brennan et al. 2008b).
Slides prepared from the mammary tissue of a pregnant
cow after culture in insulin, hydrocortisone and prolactin
showed that whilst the gland is predominantly composed of
stroma, the alveoli had expanded and epithelial cells were
flattened which was consistent with a lactating phenotype
(Brennan et al. 2008b). In addition, genes associated with
energy production pathways were up-regulated in bovine
mammary explants cultured without hormones confirming
that mammary cells are active even in the absence of
hormones. Therefore, this model is a useful one to study the
direct effect of hormones, in particular insulin, on milk
protein synthesis in the mammary gland.
Insulin and milk protein gene expression
The requirement for insulin for maximum induction of both
the major casein and whey milk protein genes is consistent
with previous studies by Andersen and Larson (1970),
Djiane et al. (1975), Servely et al. (1982) and Gertler et al.
(1982). Furthermore, titration of insulin in the media to a
concentration approaching physiological levels (Griinari et
al. 1997; Metcalf et al. 1991; Moyes 2004) resulted in
detectable milk protein gene expression. The standard
concentration of insulin (100 ng/mL) used in the culture
media in the current study is lower than previously reported
for bovine in vitro studies and is below the concentration at
which insulin binds IGF-1 receptors (Akers 2002). The
results in the current study differ to Sheehy et al. (2000)
who reported that maximal induction of milk protein gene
expression was insulin-independent. The result reported by
Sheehy et al. (2000) was possibly due to priming the
mammary gland with insulin since insulin has been shown
to have a priming role in rodent mammary gene expression
(Calvert and Clegg 1996). The current study re-examined
this outcome in mammary explants cultured in IF and
subsequently FP and IFP and observed the expression of
the α-s1-casein gene in explants cultured in FP from four of
the seven cows. This varied response to casein gene
expression in the absence of insulin may be attributed to
the time of collection of the mammary tissue; as the
pregnant cow approaches parturition, the sensitivity of the
mammary gland to hormones changes (Sheehy et al. 2004).
In addition, or alternatively, the sensitivity of the mammary
tissue to insulin priming may also vary between cows.
Transcription factors
A number of transcription factors were responsive to
insulin but only one to date, ELF5, has been directly
211
associated with milk protein gene expression and this was
in the mouse (Harris et al. 2006). This is the first report of
ELF5 gene expression in the bovine mammary gland and it
is possible that this is a major milk protein gene
transcription factor in the bovine mammary explants.
Earlier studies in the mouse showed ELF5, an ETS
transcription factor, to be an important regulator of
lobuloalveolar development and milk protein gene tran-
scription (Harris et al. 2006; Li et al. 2005; Oettgen et al.
1999). Whilst ELF5 has been shown to directly activate a
GGAA site in the WAP gene promoter (Thomas et al.
2000), the mechanism by which the gene regulates
transcription of the casein genes remains to be elucidated.
It has been suggested ELF5 has a negative regulatory
domain that inhibits DNA (Oettgen et al. 1999), but it is not
known if this is related to casein gene transcription.
Fibroblast growth factor (FGF) signalling is essential for
ELF5 expression in the lung epithelium and explant culture
studies suggest that this regulation of ELF5 by FGF is by
means of the PI3-kinase/Akt pathway (Metzger et al. 2007).
The PI3-kinase/Akt signalling pathway has been identified
as playing a central role in lactation (Lemay et al. 2007)
and the current data show insulin also stimulates PI3-kinase
in mammary explants. Insulin is known to signal via the
PI3-kinase/Akt pathway in peripheral tissues (Saltiel and
Pessin 2002) but this is the first report confirming that
insulin stimulates this molecular pathway in the bovine
mammary gland.
Post-transcriptional role for insulin
Maximum synthesis of the casein proteins required insulin,
in the presence of hydrocortisone and prolactin, providing
evidence of a post-transcriptional role for insulin in milk
protein synthesis. This is consistent with the microarray
data which reveals a number of genes coding for proteins
involved in protein synthesis at post-transcriptional and
translation levels, as well as packaging of proteins,
responsive to insulin in cultured mammary explants.
Translation of mRNA, and particularly the initiation of
translation, is considered one of the main acute regulatory
points of protein synthesis (Hershey 1991) and the current
observation of a role for insulin in both initiation and
elongation of translation compliments previous studies
(Barash 1999; Levenson et al. 1989; Lin et al. 1994; Myers
et al. 1994; Redpath et al. 1996). The current study showed
that insulin stimulates the expression of the gene encoding
eukaryotic initiation factor eIF4E which is crucial for
formation of the eIF4F trimer and its binding to the 5′
mRNA cap (Raught et al. 2001). Whilst phosphorylation of
eIF4E, as well as eIF2, is important for the control of
translation (Proud 2005; Raught et al. 2001), the observation
of a significant increase in eIF4E transcripts in bovine
212
lactating mammary gland compared to non-lactating (three-
fold) (Toerien and Cant 2007) and mammary tissue from
virgin, post-pubertal heifers (eightfold) (Long et al. 2001)
suggest that this protein has an important role in controlling
the initiation of protein translation.
The elongation initiation factors bring the two ribosomal
subunits, the mRNA and the initiator methionyl-tRNA,
together as an initiation complex from which elongation of
the peptide chain can proceed (Toerien and Cant 2007).
Interestingly, of all the seven aminoacyl-tRNA synthetases
stimulated in the explant culture model, only the gene for
methionyl-tRNA synthetase 2 precursor (MARS2), and the
initiator methionyl-tRNA is critical for the initiation
process (Trachsel et al. 1977), appeared to be regulated
by insulin.
Translation elongation in eukaryotes requires a set of
elongation factors (eEFs), including eEF1A and eEF1B,
which are involved in recruitment of the aminoacyl-tRNAs
onto the ribosome, and the factor eEF2, which mediates
ribosomal translocation (Christophersen et al. 2002; Le
Sourd et al. 2006; Riis et al. 1990). In bovine lactating
mammary tissue, the levels of eEF2 are high compared to
that of heifers, and in vitro insulin has been shown to
stimulate both the synthesis and activity of eEF2 protein
(Levenson et al. 1989; Proud 1994; Redpath et al. 1996).
The eEF1 protein is also phosphorylated in response to
insulin (Myers et al. 1994) and the data of the current study
suggest that insulin stimulates the expression of the gene for
eEF1 and confirm a potential role for insulin in the elongation
complex in the bovine mammary gland. Collectively, these
data provide strong evidence of a central role for insulin in
both the initiation and elongation processes of translation at
the transcription level during lactation in the bovine mammary
gland, complimenting its roles in phosphorylating translation
factors.
In addition, insulin stimulated the expression of four
genes involved in post-translational modification of proteins,
golgi phosphoprotein 2 (GOLPH2), Hyou1 protein (HYOU1),
ribosome associated membrane protein 4 (SERP) and
ubiquitin-fold modifier 1 (UFM1). A specific role for the
activity of these encoded proteins in processing of the milk
proteins remains to be established.
Folate metabolism
An interesting result from the current study is the potential
of insulin to enhance protein synthesis by stimulation of
genes involved in folate metabolism. Folate has the single,
important biochemical function in mammals to accept and
release one-carbon units (Choi and Mason 2000) and this
role is essential for the synthesis of purines and pyrimidines,
generation of methionine and the de novo synthesis of
methyl groups for the formation of the primary methylating
Funct Integr Genomics (2009) 9:197–217
agent, S-adenosylmethionine (Bailey and Gregory 1999). In
the cow, folate circulates in serum as a monoglutamate
(Girard and Matte 2005), the only form that is actively
transported across cell membranes via the membrane bound
receptor (Birn 2006), and this study showed that the
transcription of this folate receptor 1 (α) (FOLR1) gene is
responsive to insulin in mammary explants. Insulin also
stimulates the expression of the gene encoding the
ALDH1L1 (methylene tetrahydrafolate reductase, MTHFR)
enzyme which plays a central role in reducing folate to its
polyglutamate and active form, tetrahydrofolates (Barlowe
and Appling 1988; Shane 1989), which can then donate
one-carbon units, once folate enters the cell.
The folate requirements of the lactating dairy cow have
been extensively reviewed by Girard and Matte (2005). It
appears that a substantial increase in milk production
capacity in the past 50 years may have increased the folate
requirements in the dairy cow. The authors have also shown
folate dietary supplements experiments in primiparous
cows can enhance milk protein yields (Girard and Matte
2005; Girard and Matte 1998; Graulet et al. 2007). The
importance of the FOLR1 protein for cellular uptake of
folate was established by the analysis of renal folate
handling in mice with targeted gene knockouts of folate
binding proteins 1 and 2 (FOLR1 and FOLR2) (Birn et al.
2005). The current data shows genes involved in folate
metabolism are active in the mammary gland, and FOLR1
has been identified a key regulator of secretory activation,
as previously mentioned. This suggests that folate supple-
ments in the experiments described above by Girard and
Matte (2005), Girard and Matte (1998) and Graulet et al.
(2007) are acting directly on the mammary gland; however,
this remains to be confirmed.
Amino acid uptake
This study provides evidence that the Y+ cationic AA
transport system, identified by Baumrucker (1984) to
transport arginine and lysine into bovine mammary epithelial
cells, is stimulated by insulin in a dose-dependent manner and
this effect was enhanced in the presence of the lactogenic
hormones, hydrocortisone and prolactin. Furthermore, the
current data showing enhanced expression of the Y+
transporter, SLC7A5, gene in the presence of insulin suggests
that the stimulation of lysine uptake in cultured explants in
response to insulin is mediated, at least, at the level of
transcription of this lysine transporter gene. No stimulation of
lysine uptake in pregnant mammary tissue and stimulation
of lysine uptake in explants cultured for 48 h in insulin or the
combination of insulin, hydrocortisone and prolactin suggests
that the sensitivity of the system Y+ transporter for cationic
AAs to insulin in the mammary gland is acquired at the onset
of lactation. This is consistent with an increase in SLC7A5
Funct Integr Genomics (2009) 9:197–217
gene expression in bovine mammary tissue at the onset of
lactation (Finucane et al. 2008).
The current data showing stimulation of lysine uptake
and the Y+ cationic AA transport compliments the earlier
work by Park et al. (1979) reporting that insulin stimulated
the uptake of BCAA in mammary acini, confirming in vivo
studies showing that insulin enhances the uptake of the
BCAA and arginine and lysine in the bovine mammary
gland (Mackle et al. 2000b). Furthermore, these EAA are
absorbed in the greatest excess by the mammary gland
relative to their output in milk proteins (Clark et al. 1978;
Davis and Mepham 1976; Mepham 1982). Presumably, these
AAs are transaminated to contribute to the intracellular pool
of NEAA for milk protein synthesis (Clark et al. 1978; Davis
and Mepham 1976; Mackle et al. 2000b), suggesting a
central role for insulin in amino supply and availability
within the mammary gland for milk protein synthesis. It
should also be acknowledged that amino acids, particularly
leucine and other BCAA, can serve a signalling role for
protein synthesis in addition to serving as substrates (Kimball
and Jefferson 2005; Moshel et al. 2006) and, therefore, have
multiple roles in regulating protein synthesis in the mammary
gland.
Intra-mammary metabolism of amino acids
In addition to stimulating mammary uptake of EAAs,
metabolic pathway analysis of the current data indicated
that insulin plays an important role in intra-mammary
metabolism of the EAA and de novo biosynthesis of
NEAA. Insulin stimulates the expression of dihydrolipoamide
branched-chain transacylase E2 (DBT), the E2 component of
the mitochondrial membrane enzyme complex, branched-
chain alpha-keto acid dehydrogenase (BCKD) that is involved
in the decarboxylation of all three BCAA to produce
the corresponding branched-chain acyl-CoA derivatives
(DeSantiago et al. 1998). The activity of BCKD has been
shown to be elevated in the mammary gland of the lactating
rat, and interestingly, only the mRNA of E2 enzyme subunit
(i.e. DBT) of the BCKD complex is increased (DeSantiago
et al. 1998). This increase in DBT gene expression is thought
to be responsible for the increase in BCKD activity in the
lactating gland (DeSantiago et al. 1998). Thus, this data
compliments reports showing that insulin stimulates the
BCKD kinase in muscle cells (Nellis et al. 2002) and
suggests that insulin stimulates the capacity of the bovine
mammary gland to oxidise essential BCAA, providing
substrate for the synthesis of the NEAA required for milk
protein synthesis.
Insulin appears to play a role in a consolidated effort by
the bovine mammary gland to synthesise proline, a NEAA
of which uptake by mammary cells is insufficient to support
casein production in lactating cells (Clark et al. 1975;
213
Mepham 1982; Mepham and Linzell 1966). The EAA
arginine is taken up in excess by the mammary gland and
can be converted to delta1-pyrroline-5-carboxylate in the
mitochondria by arginase and ornithine aminotransferase,
which is then reduced to proline by pyrroline-5-carboxylate
reductase (P5CR). The activity of these three enzymes has
been reported in lactating bovine mammary tissue (Basch et
al. 1996; Basch et al. 1995; Clark et al. 1975) and this study
showed that insulin increased the expression of the P5CR2
gene. The down-regulation of the mitochondrial L-arginine:
glycine amidinotransferase (GATM) gene suggests that
insulin plays a role in protecting arginine and glycine from
creatine biosynthesis during lactation (Wyss and Kaddurah-
Daouk 2000). An increase in pyrroline-5-carboxylate
synthetase (ALDH18A1 or P5CS) transcripts suggests that
insulin also stimulates the reduction of glutamate to delta1-
pyrroline-carboxylate, providing another mechanism by
which insulin stimulates de novo biosynthesis of proline.
Glycine and serine are two NEAA required by the
bovine mammary gland not only for their incorporation as
AA residues into milk protein polypeptides, but are also the
primary sources for de novo synthesis of methyl groups
(Armentano 1994). Glycine may be synthesised from L-
threonine, the initial conversion of the L-threonine to 2-
amino-3-ketobutyrate involves L-threonine dehydrogenase,
and glycine-c-acetyltransferase (GCAT) then catalyses the
reaction between 2-amino-3-ketobutyrate and coenzyme A
to form glycine and acetyl-CoA. The current data suggests
that insulin enhances the later step in the formation of
glycine by increasing GCAT gene expression.
The de novo biosynthesis of serine from glycolytic
intermediates involves a phosphorylated pathway; the con-
version of 3-phosphohydroxypyruvate into 3-phosphoserine
by phosphoserine amidotransferase (PSAT1), which is subse-
quently dephosphorylated by phosphoserine phosphatase
(PSPH) to form L-serine (Baek et al. 2003). The current
study showed an increase in the expression of both the genes
encoding PSAT1 and PSPH, suggesting that insulin stim-
ulates de novo synthesis of L-serine at two levels in the
bovine mammary gland.
The polyamine, spermidine, may be synthesised from
AAs derived from arginine, such as ornithine, and has been
attributed a central signalling role for milk protein synthesis
(Oka 1974; Rillema et al. 2000). The importance of this
polyamine for lactation was first suggested by observations
in rodents of a marked increase in spermidine levels in
mammary tissue just prior to commencement of milk
protein synthesis in cultured mammary explants and at
parturition (Oka 1974), and thereafter changes in ratio of
spermidine to spermine paralleled milk yield (Mepham
1982). Interestingly, insulin has also been reported to
stimulate the activity of ornithine carboxylase, an enzyme
which catalyses the formation of putrescene, a precursor of
214
spermidine, in cultured mammary tissue (Aisbitt and Barry
1973). The current data shows an increase in the spermidine
synthase (SRM) gene in response to insulin, providing
another mechanism by which insulin may stimulate milk
protein synthesis.
The new data presented demonstrate that insulin has a
direct effect on the bovine mammary gland and confirms a
role for insulin in the coordinated induction of milk protein
gene expression. This requirement of insulin may primarily
be facilitated by the major milk protein transcription factor,
ELF5. This comprehensive assessment of insulin action
shows that the hormone stimulates milk protein synthesis at
multiple levels within the mammary epithelial cells. The
stimulation of FOLR1 gene expression and folate metabolism
is a previously unrecognised mechanism through which
insulin may regulate milk protein synthesis. This broad role
for insulin in the bovine mammary gland illustrates that
insulin has an equally important role in milk protein synthesis
as the other two lactogenic hormones, hydrocortisone and
prolactin.
Acknowledgements The work in this study was funded by Dairy
Australia and the CRC for Innovative Dairy Products.
References
Aisbitt RP, Barry JM (1973) Stimulation by insulin of ornithine
decarboxylase activity in cultured mammary tissue. Biochim
Biophys Acta 320:610–616
Akers MR (2002) Lactation and the mammary gland. Blackwell, USA
Amy CM, Witkowski A, Naggert J, Williams B, Randhawa Z,
Smith S (1989) Molecular cloning and sequencing of cDNAs
encoding the entire rat fatty acid synthase. Proc Natl Acad Sci
U S A 86(9):3114–3118
Andersen CR, Larson BL (1970) Comparative maintenance of
function in dispersed cell and organ cultures of bovine mammary
tissue. Exp Cell Res 61:24–30
Anderson SM, Rudolph MC, McManaman JL, Neville MC (2007)
Key stages in mammary gland development. Secretory activation
in the mammary gland: it’s not just about milk protein synthesis.
Breast Cancer Res 9:204
Armentano LE (1994) Impact of metabolism by extragastrointestinal
tissues on secretory rate of milk proteins. J Dairy Sci 77:2809–
2820
Arnold RR, Brewer M, Gauthier JJ (1980) Bactericidal activity of
human lactoferrin: sensitivity of a variety of microorganisms.
Infect Immun 28:893–898
Baek JY, Jun DY, Taub D, Kim YH (2003) Characterization of human
phosphoserine aminotransferase involved in the phosphorylated
pathway of L-serine biosynthesis. Biochem J 373:191–200
Bailey LB, Gregory JF 3rd (1999) Folate metabolism and requirements. J
Nutr 129:779–782
Banghart LR, Chamberlain CW, Velarde J, Korobko IV, Ogg SL, Jack
LJ, Vakharia VN, Mather IH (1998) Butyrophilin is expressed in
mammary epithelial cells from a single-sized messenger RNA as
a type I membrane glycoprotein. J Biol Chem 273:4171–4179
Funct Integr Genomics (2009) 9:197–217
Barash I (1999) Prolactin and insulin synergize to regulate the
translation modulator PHAS-I via mitogen-activated protein
kinase-independent but wortmannin- and rapamycin-sensitive
pathway. Mol Cell Endocrinol 155:37–49
Barber MC, Clegg RA, Travers MT, Vernon RG (1997) Lipid
metabolism in the lactating mammary gland. Biochim Biophys
Acta 1347:101–126
Barlowe CK, Appling DR (1988) In vitro evidence for the
involvement of mitochondrial folate metabolism in the supply
of cytoplasmic one-carbon units. Biofactors 1:171–176
Basch JJ, Wickham ED, Farrell HM Jr, Keys JE (1995) Ornithine-
delta-aminotransferase in lactating bovine mammary glands. J
Dairy Sci 78:825–831
Basch JJ, Wickham ED, Farrell HM Jr (1996) Pyrroline-5-carboxylate
reductase in lactating bovine mammary glands. J Dairy Sci
79:1361–1368
Bauman DE, Brown RE, Davis CL (1970) Pathways of fatty acid
synthesis and reducing equivalent generation in mammary gland
of rat, sow, and cow. Arch Biochem Biophys 140(1):237–244
Baumrucker CR (1984) Cationic amino acid transport by bovine
mammary tissue. J Dairy Sci 67:2500–2506
Bionaz M, Loor JJ (2007) Identification of reference genes for
quantitative real-time PCR in the bovine mammary gland during
the lactation cycle. Physiol Genomics 29:312–319
Birn H (2006) The kidney in vitamin B12 and folate homeostasis:
characterization of receptors for tubular uptake of vitamins and
carrier proteins. Am J Physiol Renal Physiol 291:F22–F36
Birn H, Spiegelstein O, Christensen EI, Finnell RH (2005) Renal
tubular reabsorption of folate mediated by folate binding protein
1. J Am Soc Nephrol 16:608–615
Bissell MJ, Barcellos-Hoff MH (1987) The influence of extracellular
matrix on gene expression: is structure the message. J Cell Sci
Suppl 8:327–343
Bolander FF Jr, Nicholas KR, Van Wyk JJ, Topper YJ (1981) Insulin
is essential for accumulation of casein mRNA in mouse
mammary epithelial cells. Proc Natl Acad Sci U S A 78:5682–
5684
Bolstad BM, Irizarry RA, Astrand M, Speed TP (2003) A comparison
of normalization methods for high density oligonucleotide array
data based on variance and bias. Bioinformatics 19:185–193
Brennan AJ, Sharp JA, Digby MR, Nicholas KR (2007) The tammar
wallaby: a model to examine endocrine and local control of
lactation. IUBMB Life 59:146–150
Brennan AJ, Sharp JA, Khalil E, Digby MR, Mailer SL, Lefevre CM,
Nicholas KR (2008a) A population of mammary epithelial cells
do not require hormones or growth factors to survive. J
Endocrinol 196:483–496
Brennan AJ, Sharp JA, Lefevre CM, Nicholas KR (2008b) Uncoupling
the mechanisms that facilitate cell survival in hormone-deprived
bovine mammary explants. J Mol Endocrinol 41:103–116 doi:JME-
08-0035 [pii]10.1677/JME-08-0035
Brisken C, Rajaram RD (2006) Alveolar and lactogenic differentiation. J
Mammary Gland Biol Neoplasia 11:239–248
Brodbeck U, Denton WL, Tanahashi N, Ebner KE (1967) The
isolation and identification of the B protein of lactose synthetase
as alpha-lactalbumin. J Biol Chem 242:1391–1397
Bruder G, Heid H, Jarasch ED, Keenan TW, Mather IH (1982)
Characteristics of membrane-bound and soluble forms of
xanthine oxidase from milk and endothelial cells of capillaries.
Biochim Biophys Acta 701(3):357–369
Calvert DT, Clegg RA (1996) Responses of glucose metabolism to
insulin in perfused mammary tissue of lactating rats: influence of
dietary history and recent insulin experience. Exp Physiol
81:131–140
Chen LH, Bissell MJ (1989) A novel regulatory mechanism for whey
acidic protein gene expression. Cell Regul 1:45–54
Funct Integr Genomics (2009) 9:197–217
Choi SW, Mason JB (2000) Folate and carcinogenesis: an integrated
scheme. J Nutr 130:129–132
Choi YJ, Keller WL, Berg IE, Park CS, Mackinlay AG (1988) Casein
gene expression in bovine mammary gland. J Dairy Sci 71:2898–
2903
Choi KM, Barash I, Rhoads RE (2004) Insulin and prolactin
synergistically stimulate beta-casein messenger ribonucleic acid
translation by cytoplasmic polyadenylation. Mol Endocrinol
18:1670–1686
Christophersen CT, Karlsen J, Nielsen MO, Riis B (2002) Eukaryotic
elongation factor-2 (eEF-2) activity in bovine mammary tissue in
relation to milk protein synthesis. J Dairy Res 69:205–212
Clark JH, Derrig RG, Davis CL, Spires HR (1975) Metabolism of
arginine and ornithine in the cow and rabbit mammary tissue. J
Dairy Sci 58:1808–1813
Clark JH, Spires HR, Davis CL (1978) Uptake and metabolism of
nitrogenous components by the lactacting mammary gland. Fed
Proc 37:1233–1238
Collier RJ, Bauman DE, Hays RL (1977) Lactogenesis in explant
cultures of mammary tissue from pregnant cows. Endocrinology
100:1192–1200
Da Costa TH, Taylor K, Ilic V, Williamson DH (1995) Regulation of
milk lipid secretion: effects of oxytocin, prolactin and ionomycin
on triacylglycerol release from rat mammary gland slices.
Biochem J 308( Pt 3):975–981
Davis SR, Mepham TB (1976) Metabolism of L-(U-14C)valine, L-(U-
14C)leucine, L-(U-14C)histidine and L-(U-14C) phenylalanine
by the isolated perfused lactating guinea-pig mammary gland.
Biochem J 156:553–560
Delcommenne M, Streuli CH (1995) Control of integrin expression by
extracellular matrix. J Biol Chem 270:26794–26801
DeSantiago S, Torres N, Suryawan A, Tovar AR, Hutson SM (1998)
Regulation of branched-chain amino acid metabolism in the
lactating rat. J Nutr 128:1165–1171
Djiane J, Delouis C, Denamur R (1975) Lactogenesis in organ cultures
of heifer mammary tissue. J Endocrinol 65:453–454
Farrell HM Jr, Deeney JT, Tubbs K, Walsh RA (1987) Role of the
isocitrate dehydrogenases and other Krebs cycle enzymes in
lactating bovine mammary gland. J Dairy Sci 70(4):781–788
Finucane KA, McFadden TB, Bond JP, Kennelly JJ, Zhao FQ (2008)
Onset of lactation in the bovine mammary gland: gene expression
profiling indicates a strong inhibition of gene expression in cell
proliferation. Funct Integr Genomics 8(3):251–264
Franke WW, Heid HW, Grund C, Winter S, Freudenstein C, Schmid
E, Jarasch ED, Keenan TW (1981) Antibodies to the major
insoluble milk fat globule membrane-associated protein: specific
location in apical regions of lactating epithelial cells. J Cell Biol
89(3):485–494
Gertler A, Weil A, Cohen N (1982) Hormonal control of casein
synthesis in organ culture of the bovine lactating mammary
gland. J Dairy Res 49(3):387–398
Girard CL, Matte JJ (1998) Dietary supplements of folic acid during
lactation: effects on the performance of dairy cows. J Dairy Sci
81:1412–1419
Girard C, Matte J (2005) Folic acid and vitamin B12 requirements of
dairy cows: a concept to be revised. Livest Prod Sci 98:123–
133
Graulet B, Matte JJ, Desrochers A, Doepel L, Palin MF, Girard CL
(2007) Effects of dietary supplements of folic acid and vitamin
B12 on metabolism of dairy cows in early lactation. J Dairy Sci
90:3442–3455
Green KA, Lund LR (2005) ECM degrading proteases and tissue
remodelling in the mammary gland. Bioassays 27:894–903
Griinari JM, McGuire MA, Dwyer DA, Bauman DE, Barbano DM,
House WA (1997) The role of insulin in the regulation of milk
protein synthesis in dairy cows. J Dairy Sci 80:2361–2371
215
Harris J, Stanford PM, Sutherland K, Oakes SR, Naylor MJ,
Robertson FG, Blazek KD, Kazlauskas M, Hilton HN, Wittlin
S, Alexander WS, Lindeman GJ, Visvader JE, Ormandy CJ
(2006) Socs2 and elf5 mediate prolactin-induced mammary gland
development. Mol Endocrinol 20:1177–1187
Hartmann PE (1973) Changes in the composition and yield of the
mammary secretion of cows during the initiation of lactation. J
Endocrinol 59:231–247
Hershey JW (1991) Translational control in mammalian cells. Annu
Rev Biochem 60:717–755
Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ,
Scherf U, Speed TP (2003) Exploration, normalization, and
summaries of high density oligonucleotide array probe level data.
Biostatistics 4:249–264
Jack LJ, Mather IH (1990) Cloning and analysis of cDNA encoding
bovine butyrophilin, an apical glycoprotein expressed in
mammary tissue and secreted in association with the milk-fat
globule membrane during lactation. J Biol Chem 265(24):
14481–14486
Jhappan C, Geiser AG, Kordon EC, Bagheri D, Hennighausen L, Roberts
AB, Smith GH, Merlino G (1993) Targeting expression of a
transforming growth factor beta 1 transgene to the pregnant
mammary gland inhibits alveolar development and lactation.
EMBO J 12:1835–1845
Jones EA (1967) Changes in the enzyme pattern of the mammary
gland of the lactating rat after hypophysectomy and weaning.
Biochem J 103:420–427
Juergens WG, Stockdale FE, Topper YJ, Elias JJ (1965) Hormone-
dependent differentiation of mammary gland in vitro. Proc Natl
Acad Sci U S A 54:629–634
Kansal VK, Sharma R, Rehan G (2000) Characterization of anionic
amino acid transport systems in mouse mammary gland. Indian J
Exp Biol 38:1097–1103
Kimball SR, Jefferson LS (2005) Role of amino acids in the
translational control of protein synthesis in mammals. Semin
Cell Dev Biol 16:21–27
Kinsella JE (1970) The absorption of fatty acids by functional bovine
mammary cells. Lipids 5(11):892–895
Kirkpatrick CH, Green I, Rich RR, Schade AL (1971) Inhibition of
growth of Candida albicans by iron-unsaturated lactoferrin:
relation to host-defense mechanisms in chronic mucocutaneous
candidiasis. J Infect Dis 124:539–544
Knudsen J (1972) Fatty acid synthetase from cow mammary gland
tissue cells. Biochim Biophys Acta 280(3):408–414
Kolb AF (2002) Structure and regulation of the murine gamma-casein
gene. Biochim Biophys Acta 1579:101–116
Kulski JK, Nicholas KR, Topper YJ, Qasba P (1983) Essentiality of
insulin and prolactin for accumulation of rat casein mRNAs.
Biochem Biophys Res Commun 116:994–999
Kwek JH, Wijesundera C, Digby MR, Nicholas KR (2007) The
endocrine regulation of milk lipid synthesis and secretion in
tammar wallaby (Macropus eugenii). Biochim Biophys Acta
1770:48–54
Le Sourd F, Boulben S, Le Bouffant R, Cormier P, Morales J, Belle R,
Mulner-Lorillon O (2006) eEF1B: at the dawn of the 21st
century. Biochim Biophys Acta 1759:13–31
Lemay DG, Neville MC, Rudolph MC, Pollard KS, German JB
(2007) Gene regulatory networks in lactation: identification of
global principles using bioinformatics. BMC Syst Biol 1:56
Levenson RM, Nairn AC, Blackshear PJ (1989) Insulin rapidly
induces the biosynthesis of elongation factor 2. J Biol Chem
264:11904–11911
Li N, Zhang Y, Naylor MJ, Schatzmann F, Maurer F, Wintermantel T,
Schuetz G, Mueller U, Streuli CH, Hynes NE (2005) Beta1
integrins regulate mammary gland proliferation and maintain the
integrity of mammary alveoli. EMBO J 24:1942–1953
216
Lin TA, Kong X, Haystead TA, Pause A, Belsham G, Sonenberg N,
Lawrence JC Jr (1994) PHAS-I as a link between mitogen-activated
protein kinase and translation initiation. Science 266:653–656
Linzell JL, Peaker M (1973) Changes in mammary gland permeability
at the onset of lactation in the goat: an effect on tight junctions. J
Physiol 230:13P–14P
Long E, Capuco AV, Zhao X (2001) Cloning of bovine eukaryotic
translation initiation factor 4E (eIF-4E) and its expression in the
bovine mammary gland at different physiological stages. DNA Seq
12:319–329
Mackle TR, Dwyer DA, Bauman DE (1999a) Effects of branched-chain
amino acids and sodium caseinate on milk protein concentration and
yield from dairy cows. J Dairy Sci 82:161–171
Mackle TR, Dwyer DA, Ingvartsen KL, Chouinard PY, Lynch JM,
Barbano DM, Bauman DE (1999b) Effects of insulin and amino
acids on milk protein concentration and yield from dairy cows. J
Dairy Sci 82:1512–1524
Mackle TR, Dwyer DA, Bauman DE (2000a) Intramammary infusion
of insulin or long R3 insulin-like growth factor-I did not increase
milk protein yield in dairy cows. J Dairy Sci 83:1740–1749
Mackle TR, Dwyer DA, Ingvartsen KL, Chouinard PY, Ross DA,
Bauman DE (2000b) Effects of insulin and postruminal supply of
protein on use of amino acids by the mammary gland for milk
protein synthesis. J Dairy Sci 83:93–105
Mather IH, Jack LJ (1993) A review of the molecular and cellular
biology of butyrophilin, the major protein of bovine milk fat
globule membrane. J Dairy Sci 76:3832–3850
McGuire MA, Griinari JM, Dwyer DA, Bauman DE (1995) Role of
insulin in the regulation of mammary synthesis of fat and protein.
J Dairy Sci 78:816–824
McManaman JL, Palmer CA, Anderson S, Schwertfeger K, Neville
MC (2004) Regulation of milk lipid formation and secretion in
the mouse mammary gland. Adv Exp Med Biol 554:263–279
Mellenberger RW, Bauman DE (1974) Metabolic adaptations during
lactogenesis. Fatty acid synthesis in rabbit mammary tissue
during pregnancy and lactation. Biochem J 138:373–379
Mepham TB (1982) Amino acid utilization by lactating mammary
gland. J Dairy Sci 65:287–298
Mepham TB, Linzell JL (1966) A quantitative assessment of the
contribution of individual plasma amino acids to the synthesis
of milk proteins by the goat mammary gland. Biochem J 101:76–
83
Metcalf JA, Sutton JD, Cockburn JE, Napper DJ, Beever DE (1991)
The influence of insulin and amino acid supply on amino acid
uptake by the lactating bovine mammary gland. J Dairy Sci
74:3412–3420
Metzger DE, Xu Y, Shannon JM (2007) Elf5 is an epithelium-specific,
fibroblast growth factor-sensitive transcription factor in the
embryonic lung. Dev Dyn 236:1175–1192
Moshel Y, Rhoads RE, Barash I (2006) Role of amino acids in
translational mechanisms governing milk protein synthesis in
murine and ruminant mammary epithelial cells. J Cell Biochem
98:685–700
Moyes T (2004) Variation in concentrations of insulin-like growth
factor-1 (IGF-1) in pasture-fed Holstein–Freisan Cows. Ph.D.
Thesis, The University of Melbourne, Australia School of
Veterinary Science
Muller WJ, Neville MC (2001) Introduction: signaling in mammary
development and tumorigenesis. J Mammary Gland Biol Neoplasia
6:1–5
Myers MG Jr, Grammer TC, Wang LM, Sun XJ, Pierce JH, Blenis J,
White MF (1994) Insulin receptor substrate-1 mediates phospha-
tidylinositol 3′-kinase and p70S6k signaling during insulin,
insulin-like growth factor-1, and interleukin-4 stimulation. J Biol
Chem 269:28783–28789
Funct Integr Genomics (2009) 9:197–217
Nagaiah K, Bolander FF Jr, Nicholas KR, Takemoto T, Topper YJ
(1981) Prolactin-induced accumulation of casein mRNA in
mouse mammary explants: a selective role of glucocorticoid.
Biochem Biophys Res Commun 98:380–387
Naylor MJ, Oakes SR, Gardiner-Garden M, Harris J, Blazek K, Ho
TW, Li FC, Wynick D, Walker AM, Ormandy CJ (2005)
Transcriptional changes underlying the secretory activation phase
of mammary gland development. Mol Endocrinol 19:1868–1883
Nellis MM, Doering CB, Kasinski A, Danner DJ (2002) Insulin
increases branched-chain alpha-ketoacid dehydrogenase kinase
expression in Clone 9 rat cells. Am J Physiol Endocrinol Metab
283:E853–E860
Neville MC, McFadden TB, Forsyth I (2002) Hormonal regulation of
mammary differentiation and milk secretion. J Mammary Gland
Biol Neoplasia 7:49–66
Newburg DS (2005) Innate immunity and human milk. J Nutr
135:1308–1312
Nguyen DA, Neville MC (1998) Tight junction regulation in the
mammary gland. J Mammary Gland Biol Neoplasia 3:233–246
Nicholas KR, Tyndale-Biscoe CH (1985) Prolactin-dependent accu-
mulation of alpha-lactalbumin in mammary gland explants from
the pregnant tammar wallaby (Macropus eugenii). J Endocrinol
106:337–342
Oettgen P, Kas K, Dube A, Gu X, Grall F, Thamrongsak U, Akbarali
Y, Finger E, Boltax J, Endress G, Munger K, Kunsch C,
Libermann TA (1999) Characterization of ESE-2, a novel ESE-
1-related Ets transcription factor that is restricted to glandular
epithelium and differentiated keratinocytes. J Biol Chem
274:29439–29452
Oka T (1974) Spermidine in hormone-dependent differentiation of
mammary gland in vitro. Science 184:78–80
Oram JD, Reiter B (1968) Inhibition of bacteria by lactoferrin and
other iron-chelating agents. Biochim Biophys Acta 170:351–
365
Pallesen LT, Berglund L, Rasmussen LK, Petersen TE, Rasmussen JT
(2002) Isolation and characterization of MUC15, a novel cell
membrane-associated mucin. Eur J Biochem 269:2755–2763
Pallesen LT, Pedersen LR, Petersen TE, Rasmussen JT (2007) Charac-
terization of carbohydrate structures of bovine MUC15 and
distribution of the mucin in bovine milk. J Dairy Sci 90:3143–3152
Park CS, Smith JJ, Eigel WN, Keenan TW (1979) Selected hormonal
effects on protein secretion and amino acid uptake by acini from
bovine mammary gland. Int J Biochem 10:889–894
Pause A, Belsham GJ, Gingras AC, Donze O, Lin TA, Lawrence JC
Jr, Sonenberg N (1994) Insulin-dependent stimulation of protein
synthesis by phosphorylation of a regulator of 5′-cap function.
Nature 371:762–767
Plath A, Einspanier R, Peters F, Sinowatz F, Schams D (1997)
Expression of transforming growth factors alpha and beta-1
messenger RNA in the bovine mammary gland during different
stages of development and lactation. J Endocrinol 155:501–511
Proud CG (1994) Translation. Turned on by insulin. Nature 371:747–
748
Proud CG (2005) eIF2 and the control of cell physiology. Semin Cell
Dev Biol 16:3–12
Rabot A, Sinowatz F, Berisha B, Meyer HH, Schams D (2007)
Expression and localization of extracellular matrix-degrading
proteinases and their inhibitors in the bovine mammary gland
during development, function, and involution. J Dairy Sci
90:740–748
Ramanathan P, Martin I, Thomson P, Taylor R, Moran C, Williamson
P (2007) Genomewide analysis of secretory activation in mouse
models. J Mammary Gland Biol Neoplasia 12:305–314
Raught B, Gingras AC, Sonenberg N (2001) The target of rapamycin
(TOR) proteins. Proc Natl Acad Sci U S A 98:7037–7044
Funct Integr Genomics (2009) 9:197–217
Redpath NT, Price NT, Proud CG (1996) Cloning and expression of
cDNA encoding protein synthesis elongation factor-2 kinase. J
Biol Chem 271:17547–17554
Riis B, Rattan SI, Clark BF, Merrick WC (1990) Eukaryotic protein
elongation factors. Trends Biochem Sci 15:420–424
Rillema JA, Collins S, Williams CH (2000) Prolactin stimulation of
iodide uptake and incorporation into protein is polyamine-
dependent in mouse mammary gland explants. Proc Soc Exp
Biol Med 224:41–44
Rudolph MC, McManaman JL, Hunter L, Phang T, Neville MC
(2003) Functional development of the mammary gland: use of
expression profiling and trajectory clustering to reveal changes in
gene expression during pregnancy, lactation, and involution. J
Mammary Gland Biol Neoplasia 8:287–307
Rudolph MC, McManaman JL, Phang T, Russell T, Kominsky DJ,
Serkova NJ, Stein T, Anderson SM, Neville MC (2007)
Metabolic regulation in the lactating mammary gland: a lipid
synthesizing machine. Physiol Genomics 28:323–336
Saltiel AR, Pessin JE (2002) Insulin signaling pathways in time and
space. Trends Cell Biol 12:65–71
Schanbacher FL, Goodman RE, Talhouk RS (1993) Bovine mammary
lactoferrin: implications from messenger ribonucleic acid
(mRNA) sequence and regulation contrary to other milk proteins.
J Dairy Sci 76(12):3812–3831
Schneeberger EE, Lynch RD (2004) The tight junction: a multifunctional
complex. Am J Physiol Cell Physiol 286:C1213–C1228
Servely JL, Teyssot B, Houdebine LM, Delouis C, Djiane J, Kelly PA
(1982) Induction of beta-casein mRNA accumulation by the
putative prolactin second messenger added to the culture medium
of cultured mammary epithelial cells. FEBS Lett 148:242–246
doi:0014-5793(82)80816-8 [pii]
Shane B (1989) Folylpolyglutamate synthesis and role in the
regulation of one-carbon metabolism. Vitam Horm 45:263–335
Sheehy PA, Nicholas KR, Wynn PC (2000) An investigation of the
role of insulin in bovine milk protein gene expression in
mammary explant culture. J Anim Sci 13:272–275
Sheehy PA, Della-Vedova JJ, Nicholas KR, Wynn PC (2004)
Hormone-dependent milk protein gene expression in bovine
mammary explants from biopsies at different stages of pregnancy. J
Dairy Res 71:135–140
Smyth GK (2004) Linear models and empirical bayes methods for
assessing differential expression in microarray experiments. Stat
Appl Genet Mol Biol 3:Article3
Sordillo LM, Shafer-Weaver K, DeRosa D (1997) Immunobiology of
the mammary gland. J Dairy Sci 80:1851–1865
Soulier S, Lepourry L, Stinnakre MG, Mercier JC, Vilotte JL (1997)
Expression of a bovine alpha-lactalbumin transgene in alpha-
lactalbumin-deficient mice can rescue lactation. In vivo relationship
between bovine alpha-lactalbumin expression content and milk
composition. J Dairy Res 64:145–148
217
Stelwagen K, Farr VC, McFadden HA, Prosser CG, Davis SR (1997)
Time course of milk accumulation-induced opening of mammary
tight junctions, and blood clearance of milk components. Am J
Physiol 273:R379–R386
Streuli CH, Bailey N, Bissell MJ (1991) Control of mammary
epithelial differentiation: basement membrane induces tissue-
specific gene expression in the absence of cell–cell interaction
and morphological polarity. J Cell Biol 115:1383–1395
Sullivan CH, Mather IH, Greenwalt DE, Madara PJ (1982) Purifica-
tion of xanthine oxidase from the fat-globule membrane of
bovine milk by electrofocusing. Mol Cell Biochem 44(1):13–22
Thomas RS, Ng AN, Zhou J, Tymms MJ, Doppler W, Kola I (2000)
The Elf group of Ets-related transcription factors. ELF3 and
ELF5. Adv Exp Med Biol 480:123–128
Toerien CA, Cant JP (2007) Abundance and phosphorylation state of
translation initiation factors in mammary glands of lactating and
nonlactating dairy cows. J Dairy Sci 90:2726–2734
Tomita M, Bellamy W, Takase M, Yamauchi K, Wakabayashi H,
Kawase K (1991) Potent antibacterial peptides generated by
pepsin digestion of bovine lactoferrin. J Dairy Sci 74:4137–
4142
Trachsel H, Erni B, Schreier MH, Staehelin T (1977) Initiation of
mammalian protein synthesis. II. The assembly of the initiation
complex with purified initiation factors. J Mol Biol 116:755–
767
van der Strate BW, Beljaars L, Molema G, Harmsen MC, Meijer DK
(2001) Antiviral activities of lactoferrin. Antiviral Res 52:225–
239
Wang DY, Amor V (1971) A study on the effect of insulin on DNA,
RNA and protein synthesis in mouse mammary gland tissue in
organ culture. J Endocrinol 50:241–249
Weikard R, Kuhn C, Goldammer T, Freyer G, Schwerin M (2005) The
bovine PPARGC1A gene: molecular characterization and asso-
ciation of an SNP with variation of milk fat synthesis. Physiol
Genomics 21:1–13
Wheeler TT, Hodgkinson AJ, Prosser CG, Davis SR (2007) Immune
components of colostrum and milk—a historical perspective. J
Mammary Gland Biol Neoplasia 12:237–247
Wohlt JE, Clark JH, Derrig RG, Davis CL (1977) Valine, leucine, and
isoleucine metabolism by lactating bovine mammary tissue. J
Dairy Sci 60:1875–1882
Wyss M, Kaddurah-Daouk R (2000) Creatine and creatinine metabolism.
Physiol Rev 80:1107–1213
Zhao FQ, Dixon WT, Kennelly JJ (1996) Localization and gene
expression of glucose transporters in bovine mammary gland.
Comp Biochem Physiol Part B Biochem Mol Biol 115:127–134
Zutter MM, Sun H, Santoro SA (1998) Altered integrin expression
and the malignant phenotype: the contribution of multiple
integrated integrin receptors. J Mammary Gland Biol Neoplasia
3:191–200