Está en la página 1de 14

Proyecto semestral Biología Sintética (BIO 440).

“Detección de Temprana de MIRAS en


Humanos”

Integrantes: Valeria Ansaldo


Sabina Lineros
Ana María Orellana
Alejandro Pinochet
Profesora : María Josefina Poupin Swinburn
Ayudante: María Jesús Salame
Fecha: 03/03/2021
Resumen del Proyecto

Problema u Oportunidad

Dentro de la inmensidad de genes presentes en el ser humano, se encuentra el


genoma mitocondrial, cuyas características son destacables, dado que este se encuentra
dentro de los organelos encargados de llevar a cabo la respiración celular en las células
eucariontes, y además, presenta una estructura de doble hélice circular comparable con la
del DNA bacteriano. Por otro lado, se debe mencionar que la herencia de este material
genético ocurre únicamente por la vía materna, pues en la fecundación, el DNA mitocondrial
del padre es marcado mediante ubiquitinación y posteriormente degradado (B. Pakendorf et
al. 2005). Finalmente, es relevante referirse a la tasa de mutaciones en el DNA mitocondrial,
ya que el DNA mitocondrial o mtDNA presenta una tasa de mutación espontánea 10 veces
superior a la del DNA nuclear (Solano et al. 2001). Esto último, se debe en pocas palabras a
la alta concentración de radicales libres de oxígeno producidos en la fosforilación oxidativa,
adicionado a la ausencia de proteínas histonas que compacten y estabilicen al DNA, y por
último, la menor regulación para reparar errores durante la replicación de este cromosoma
circular.
Teniendo en cuenta las características anteriormente mencionadas, se debe aclarar
también un aspecto importante de la regulación del mtDNA, pues muchas de las proteínas
necesarias para su replicación, reparación y estabilización se encuentran codificadas en el
DNA nuclear. Mutaciones en la codificación de estas proteínas pueden producir graves daños
o mutaciones en el mtDNA, como deleciones y depleciones.
Es este el caso del gen POLG ubicado en el cromosoma 15, que codifica para la
subunidad catalítica de la polimerasa gamma mitocondrial. Existen más de 50 mutaciones
conocidas para este gen, que derivan en distintas enfermedades mitocondriales y durante los
últimos años, el espectro clínico ocasionado por mutaciones en el POLG ha aumentado
significativamente.
En el presente informe se abordarán específicamente las mutaciones en el POLG1
que provocan el Síndrome de Ataxia mitocondrial recesiva (MIRAS), con el fin de encontrar
un método de detección temprana de esta enfermedad neurodegenerativa, siguiendo las
bases de la Ingeniería Genética para el análisis detallado de las secuencias de DNA, de las
mutaciones, el uso de enzimas de restricción y también la electroforesis en gel, entre otros.
Luego de analizar gran parte de la bibliografía e información existente sobre esta
enfermedad catalogada como rara, se llegó a la conclusión de que no existe un examen
estandarizado para su detección temprana, por lo que se define como una oportunidad para
innovar y solucionar este problema. Las enfermedades inusuales como el MIRAS, que afectan
a un bajo porcentaje de la población se suelen ver como un campo no rentable, pero nuestra
solución busca proveer un análisis más simple que los existentes y de bajo costo, que cumpla
con ser un análisis pre sintomático y predictivo, en caso de tener antecedentes familiares.
Estado del arte

El gen POLG1 fue identificado en el año 1996 y la primera mutación identificada fue de un
paciente que presentaba oftalmoplejía crónica progresiva y múltiples deleciones en el ADNmt
(ADN mitocondrial). Este gen está ubicado en el cromosoma 15q25 y se compone de 23
exones. (Bernardo, 2011)

El síndrome MIRAS se caracteriza por una serie de síntomas como ataxia sensitiva, epilepsia
(siempre asociada a MIRAS (Giráldez et al,2012)) , neuropatía etc (Ver la tabla N°1) y es
causada por dos mutaciones en POLG1, W748S y A467T (Mignarri et al, 2015). Las
mutaciones de POLG1 tiene como consecuencia la neurodegeneración que provoca cambios
fenotípicos en los pacientes que la padecen como oftalmoplejía externa crónica progresiva
aislada, síndrome hepato cerebral, ataxia espinocerebelosa con epilepsia y síndrome de
Alpers. (Torricelli, 2013)

Las personas que presentan estas mutaciones en POLG1 presentan daños en el mtDNA, es
decir, es un efecto que gatilla deleciones múltiples o depleciones en tejidos específicos. Estos
defectos generan una falla mitocondrial y falta de ATP (energía celular) provocando la muerte
neuronal (Torricelli, 2013).

Tabla N°1: Características clínicas de las ataxias recesivas. (Berardo, 2011).

Existen otras ataxias que presentan síntomas similares al MIRAS como Ataxia de Friedrich e
IOSCA y se suelen confundir al realizar los diagnósticos (Ver tabla 1). En particular MIRAS
fue detectada inicialmente en pacientes finlandeses y estudios han revelado que se presenta
entre pacientes de 5 a 50 años de edad, estos pueden presentar distintos síntomas a lo largo
de la enfermedad provocadas por las mutaciones que generan deterioro en tejidos que
dependen del metabolismo oxidativo como el sistema nervioso central, nervios periféricos,
ojo, músculo esquelético y órganos.

Como se dijo anteriormente la detección de esta enfermedad no es fácil, ya que se puede


confundir con otras ataxias y debe presentar y detectar más de uno de los síntomas para el
diagnóstico. Los síntomas más comunes que se presentan en la primera etapa son migrañas,
ataxia, neuropatía y falta o disminución de los reflejos, después, pueden presentarse
movimientos involuntarios, disartria, síntomas psiquiátricos y retrasos cognitivos (por la
neurodegeneración). Las convulsiones epilépticas si bien son comunes, no todos los
pacientes las presentan y si MIRAS parte en personas adultas es muy probable que las
condiciones epilépticas no se presenten y tengan polineuropatía sensorial o alteraciones en
la marcha y ataxia progresiva posterior. (Palin, 2013)

La ataxia mitocondrial recesiva produce aumentos en el ácido láctico por lo que se puede
detectar con exámenes de laboratorio midiendo los niveles de ácido láctico. Por otro lado,
produce hiperintensidades talámicas y se pueden visualizar sustancias blancas que se
detectan con resonancia magnética. (Arias, 2019) (Ver la imagen n°1)

Imagen N°1: Foto extraída de Autosomal recessive mitochondrial ataxic syndrome due to
mitochondrial polymerase mutations S. Winterthun*; G. Ferrari*.

Esta enfermedad no tiene cura y los doctores se preocupan de mejorar la calidad de vida de
los pacientes, uno de los tratamientos de la ataxia es suministrar valproato de sodio (VPA)
que es un fármaco antiepiléptico que se usa con frecuencia en esta enfermedad pero
lamentablemente este fármaco provoca insuficiencia hepática en pacientes con mutaciones
con POLG1 y como consecuencia tiene un trasplante de hígado. (Hynynen et al, 2014)
Objetivos

El objetivo general de este trabajo es el diseño de un mecanismo biotecnológico para


la detección temprana de MIRAS en humanos, aplicando los métodos vistos en la clase de
Biología Sintética.
Detectar esta enfermedad asociada al DNA mitocondrial es crucial para evaluar los
posibles tratamientos que permitan, ya sea, controlar dentro de lo posible los síntomas o
desacelerar el avance neurodegenerativo que esta implica.

Objetivos específicos:
- Identificar la secuencia en la que se encuentran ambas mutaciones (W748S y A467T)
que provocan MIRAS, dentro del gen POLG1 en el cromosoma 15 humano.
- Diseñar cebadores adecuados para amplificar esta secuencia. Los cebadores son los
mismos en un paciente sano como en un enfermo.
- Identificar una enzima de restricción que corte solo al DNA de la secuencia del
paciente sano.
- Realizar una electroforesis en gel con el objetivo de diferenciar el patrón del paciente
sano y el del paciente enfermo.
Metodología

Para poder realizar un diagnóstico certero sobre la presencia de la enfermedad es


necesario realizar un estudio genético capaz de detectar las mutaciones asociadas a esta
enfermedad, las cuales se encuentran en el DNA nuclear, específicamente en el gen POLG1
ubicado en el cromosoma 15.

Para lograr el objetivo, se buscó en GeneBank la secuencia FASTA del gen POLG1.
Teniendo esta secuencia se procede a crear una secuencia FASTA homóloga a la sana pero
que presenta las mutaciones A467T y W748S, es decir, simulando la secuencia de un
paciente enfermo. Luego, se identifica el fragmento de este gen que incluye ambas
mutaciones dentro de su secuencia, con el fin de amplificar solo este fragmento de menor
tamaño. Con esta secuencia corta, se procede a diseñar los primer forward y reverse que
permitan amplificar este fragmento, tanto en el paciente sano como en el enfermo. Teniendo
ambas secuencias FASTA y el par de cebadores, se prosigue utilizando la herramienta
bioinformática SnapGene:

Imagen N°2: programa utilizado snapgene versión 5.2.5

Con esta herramienta se simula la amplificación del fragmento seleccionado, tanto


para el gen sano (Figura 2) como para el gen mutado (Figura 1), mediante PCR como se
muestra en las siguientes imágenes:

Figura N°1: mapa de pasos para la realización del PCR con POLG1 mutado
Figura N°2: mapa de pasos para la realización del PCR con POLG1 sin mutaciones

Como se puede observar en ambas figuras previas, el fragmento amplificado consta


de 936 bp en ambos pacientes, al ser amplificado con el mismo par de cebadores.

Una vez hecha la amplificación del fragmento de DNA deseado, se procedió a analizar
ambos casos (enfermo y sano) para identificar alguna enzima de corte que varíe entre ellos,
para lo cual se utilizó la misma herramienta bioinformática, obteniendo un mapa de sitios de
unión para enzimas de restricción conocidas para cada fragmento, como se pueden ver en
las figuras 3 y 4:

Figura N° 3: mapa de la secuencia amplificada POLG1 sin mutación

Figura N°4: mapa de la secuencia amplificada POLG1 mutada


Observando ambos mapas se puede identificar que la secuencia sana incluye un sitio
de corte para la enzima BsaHI destacada con color amarillo en la figura 3.

Finalmente, ya realizada la amplificación y reconocido el sitio de corte para identificar


una enzima distinta entre el gen POLG1 mutado y sin mutar, se utiliza la enzima de restricción
BsaHI para ver las consecuencias en cada una de las muestras.

Por último, se lleva a cabo la electroforesis en gel para obtener los patrones de un
paciente sano y para un paciente enfermo, dando el siguiente resultado (Figura 5) en donde
se obtiene que el gen sano muestra dos fragmentos, uno de 871 pb y otro de 65 pb mientras
que el gen mutado no se corta teniendo únicamente 936 pb.

Figura N°5: Electroforesis del gen sano y gen mutado.

Teniendo los patrones del fragmento para un paciente sano y para un paciente enfermo, se
puede usar este resultado con el fin de realizar este procedimiento en una muestra
desconocida y compararla para identificar si esta posee o no las mutaciones específicas del
MIRAS.
Solución

Al analizar gran parte de la bibliografía e información existente sobre esta enfermedad


catalogada como rara, se llegó a la conclusión de que no existe un examen estandarizado
para su detección temprana, por lo que se define como una oportunidad para innovar y
solucionar este problema. Para poder dar inicio a lo mencionado anteriormente es necesario
definir ciertos conceptos previos para generar un entendimiento más completo.

En primer lugar, es necesario definir la principal herramienta que utilizamos para


nuestra solución y cómo ésta funciona. La herramienta corresponde al PCR, la reacción de
polimerasa en cadena, que corresponde a una reacción enzimática in vitro que amplifica
millones de veces una secuencia específica de ADN durante varios ciclos. Para poder realizar
esta técnica es necesario contar con distintos elementos. En primer lugar es necesario tener
una muestra de DNA denominada molde o templado, contar con partidores o primers
específicos para la secuencia que se busca amplificar, en este caso tuvimos que diseñar
primers específicos para amplificar la zona en donde se encuentran las 2 mutaciones
correspondientes a esta enfermedad, también se necesitan desoxirribonucleótidos
trifosfatados (dNTP´s), la enzima TAQ DNA polimerasa, un ion de magnesio, una solución
amortiguadora (Buffer) y agua, todos estos elementos se combinan en diferentes
procedimientos y etapas. (Tamay et al, 2013)

Molde: segmento de DNA en donde se encuentra la secuencia a amplificar mediante esta


técnica.

Primers: Secuencia de oligonucleótidos que delimitan la secuencia blanca que se desea


amplificar, su largo oscila entre los 15-25 pares de bases, su %G-C no debe ser superior al
55%, están compuesto por dos secuencias diferentes, una “forward” y una secuencia
“reverse”.

Taq Polimerasa: Enzima encargada de la síntesis de las nuevas cadenas de DNA

dNTP´s: Estos nucleótidos son las unidades estructurales utilizadas por la Taq Polimerasa
para crear las nuevas hebras, se agregan los 4 tipos de nucleótidos.

Buffer: Solución amortiguadora que se utiliza en la reacción, generalmente compuesta por


Tris-HCL y posee un ph cercano a 8.

ion Mg: Se utiliza como cofactor enzimático que influye en la especificidad de la reacción,
sus concentraciones oscilan entre los 0,5 y 2,5 mM

H2O: El agua se utiliza como disolvente en la reacción, esta debe ser destilada para evitar
que los ácidos nucleicos se degraden.

Para poder realizar este estudio genético es necesaria la obtención de una muestra
de sangre de un paciente sano y uno enfermo de MIRAS, ya que de estas se puede extraer
el material genético desde las células sanguíneas. (Jay et al, 2016)
Luego de la obtención de una muestra de sangre mediante una punción venosa en la
zona antecubital se ubican 15 ml de sangre en un papel de filtro, luego que esta seca a
temperatura ambiente se extrae una muestra de 1𝑚𝑚2y de esta muestra se procede a aislar
el DNA mediante procesos enzimáticos de ruptura de membranas y separación del material
genético. Luego de esto la muestra de DNA molde ya está lista para someterse a la técnica
de PCR.

Existe un Kit de la empresa Blackhills Diagnostic Resources el cual se utiliza para la


Ataxia de Friedreich´s, el cual es útil para inspirarse como modelo en la detección del tipo de
ataxia MIRAS ya que son muy similares. El único cambio que existiría con este kit para la
detección del MIRAS son los primers a utilizar ya que es necesario utilizar los primers
previamente diseñados que reconocen los sitios en donde se encuentran las mutaciones para
posteriormente realizar el PCR. Considerando lo anterior la idea es armar un kit inspirado y
basado en el kit de la empresa BDR, este kit incluye los reactivos e instrucciones para el PCR
con los primeros específicos para la ataxia MIRAS.

El procedimiento para realizar las mezclas de los reactivos para realizar el PCR
consiste principalmente en realizar una mezcla homogénea de los reactivos mediante
agitación y centrifugación para asegurar que no queden burbujas ni muestra en las paredes,
las cantidades y componentes más específicos se encuentran en el documento anexado (Kit
para la determinación del número de repeticiones del triplete GAA del gen FXN mediante
análisis de fragmentos fluorescentes).

Luego de la preparación de la muestra se debe dar inicio al proceso de


desnaturalización en el cual se busca calentar y separar las hebras de DNA, este proceso se
lleva a cabo en 1 solo ciclo en un termociclador a una temperatura de 98°c durante un tiempo
de 5 minutos. Esta etapa es muy importante ya que permite generar los templados que se
usaran como molde.(Tamay et al, 2013)

La segunda etapa de este proceso corresponde a la Hibridación, en esta etapa los


primers se unen a los extremos 3´ de las hebras moldes creando el complejo templado-primer,
es importante que durante esta etapa la temperatura sea 61°c ya que la temperatura de
melting de los primers diseñados es la ya mencionada. Esta temperatura se obtuvo gracias
al % G-C de ambos primers (Reverse 60% - Forward 75%), ver anexo n°3. Para esta etapa
es necesario la realización de 35 ciclos, divididos cada uno en 3 etapas, la primera
corresponde a 97°c durante 45 segundos, la segunda etapa utiliza una temperatura de 64°c
durante 45 segundos, y por último se utiliza una temperatura de 68°c durante un tiempo de 3
minutos + 10 segundos/CY.(Tamay et al, 2013)

La última etapa corresponde a la extensión, en esta etapa actual Taq polimerasa,


enzima que se encarga de realizar la síntesis de la nueva hebra de DNA, esta enzima utiliza
como sitio de inicio los primers, comienza a agregar los dNTP´s de manera muy rápida, estas
cadenas de nucleótidos se comienzan a extender de 5´a 3´ dando origen a los amplicones,
esta etapa debe llevarse a cabo bajo una temperatura de 72°c (a esta temperatura la enzima
es funcional) durante un tiempo de 30 minutos, requiere solo un ciclo. (Tamay et al, 2013)

Finalmente, para saber si la reacción se realizó correctamente y analizar los


resultados, se realiza una electroforesis con los amplicones obtenidos en el paso anterior de
extensión. Esta técnica funciona como filtro para separar las moléculas a través de su tamaño
mediante una carga eléctrica, donde gracias a que se carga negativamente los amplicones,
estos recorren una distancia en el gel preparado a un 1% CA (% concentración de agarosa)
hacia el polo positivo. Cabe destacar que el gel está marcado con una secuencia estándar
con los puntos de corte del fragmento analizado (marcador molecular), con el objetivo de
obtener el tamaño de las pb de cada fragmento ya que se comparan con fragmentos con las
pb ya conocidas. Si el paciente está sano debería marcar 2 fragmentos uno de 871 y otro de
65 mientras que si está enfermo debería tener un único fragmento mostrado en la
electroforesis, identificando la presencia o no de la enfermedad y por tanto de la mutación.
Bibliografía

● Arias, M. (2019). Claves para afrontar el reto diagnóstico de las heredoataxias


recesivas. Neurología, 34(4), 248-258.
● Berardo, A. (2011). El espectro clínico de las mutaciones en POLG. Neurología
Argentina, 3(2), 106-112.
● Blackhills Diagnostic Resources,
<https://www.bdrdiagnostics.com/?page_id=1440&lang=es>. Página web. 24 de abril
de 2021.
● Giráldez, B. G., Arce, V. S. A., Delgado, R. T., & Castrillo, J. M. (2012). Epilepsia en
otras enfermedades. Aspecto médico-legales, 105.
● Hynynen, J., Komulainen, T., Tukiainen, E., Nordin, A., Arola, J., Kälviäinen, R., ... &
Uusimaa, J. (2014). Acute liver failure after valproate exposure in patients with POLG1
mutations and the prognosis after liver transplantation. Liver Transplantation, 20(11),
1402-1412.
● Jay, L. M., Mateus, H., Fonseca, D., Restrepo, C. M., & Keyeux, G. (2006). PCR-
heterodúplex por agrupamiento: Implementación de un método de identificación de
portadores de la mutación más común causal de fibrosis quística en Colombia.
Colombia Médica, 37(3), 176-182.
● Mignarri, A., Cenciarelli, S., Da Pozzo, P., Cardaioli, E., Malandrini, A., Federico, A., &
Dotti, M. T. (2015). Mitochondrial recessive ataxia syndrome: a neurological rarity not
to be missed. J Neurol Sci, 349(1-2), 254-5.
● Palin, E. (2013). Disorders of mitochondrial DNA polymerase: a clinical, biochemical
and structural study.
● Tamay de Dios, L., Ibarra, C., & Velasquillo, C. (2013). Fundamentos de la reacción en
cadena de la polimerasa (PCR) y de la PCR en tiempo real. Investigación en
discapacidad, 2(2), 70-78.
● Torricelli, R. E. (2013). ATAXIA CRÓNICA EN PEDIATRÍA. MEDICINA (Buenos Aires),
73.
● Winterthun, S., Ferrari, G., He, L., Taylor, R. W., Zeviani, M., Turnbull, D. M., ... &
Bindoff, L. A. (2005). Autosomal recessive mitochondrial ataxic syndrome due to
mitochondrial polymerase γ mutations. Neurology, 64(7), 1204-1208. [NO CUENTA
COMO CITA EN CANTIDAD]
Anexos

Anexo n°1

Sección del gen que contiene las 2 mutaciones A467T y W748S.

Figura anexo N°1: fragmento de secuencia con las 2 mutaciones del gen para MIRAS

Anexo n°2

Fragmento de las secuencias para demostrar porqué se utilizó BsaHI como enzima de
corte:

Figura anexo N°2.1: secuencia paciente con la mutación W748S

Figura anexo N°2.2: Secuencia paciente sano


Diferencia en la enzima de corte presente entre el paciente sano (Figura anexo 2.1) y el
paciente que presenta la mutación W758S marcada con verde (Figura anexo 2.2). Donde el
sano tiene BsaHI y el enfermo no presenta esta enzima de corte.

Anexo n°3

Secuencias FASTA:
Se adjuntan las secuencias en un zip con los nombres POLG1 sano y POLG1 enfermo,
además las secuencias de los primers se pueden encontrar en POLG1 enfermo.dna con
POLG1 sano.dna del programa snapgene

POLG1 enfermo (temperatura 61ºc)


Primer forward 5 a 3 (75% GC)
CCGCAGCGTCGAGCAC
Primer reverse 5 a 3 (60% GC)
GCTGGGGGAAGGAAGCAATG

POLG1 sano (temperatura 61ºc)


Primer forward 5 a 3 (75%GC)
CCGCAGCGTCGAGCAC
Primer reverse 5 a 3 (60%GC)
GCTGGGGGAAGGAAGCAATG

Kit para la determinación del número de repeticiones del triplete GAA del gen FXN
mediante análisis de fragmentos fluorescentes

También podría gustarte