Está en la página 1de 9

ARTÍCULOS TÉCNICOS

Resumen
La técnica de viabilidad celular evalúa Empleo de la viabilidad celular
como herramienta para el control
los daños en la membrana celular, tanto
en las bacterias formadoras de flóculo
como en las filamentosas, causados por
adición de cloro sobre el fango activa-
do afectado por bacteria filamentosa
(Thiothrix-021N). El estudio fue rea-
lizado por la empresa Egevasa en la de la dosificación de cloro sobre
un fango activado con problemas
EDAR de Quart-Benàger (Valencia).
Para la identificación de la bacteria
filamentosa causante de la alteración
macroestructural del flóculo se em-
plearon criterios sobre las característi-
cas morfológicas y también tinciones
convencionales: Gram, Neisser y po-
lihidroxialcanoatos. Además, se utilizó
de bulking
la técnica de hibridación in situ (FISH),
para corroborar los resultados obteni- Por: Tatiana Montoya Martínez, ingeniero sanitario y ambiental1; Andrés Zornoza
dos, identificando de manera inequívo- Zornoza, licenciado en Ciencias Químicas1; Pau Granell Muñoz, ingeniero
ca la bacteria filamentosa responsable químico1; Gloria Fayos, licenciada en Farmacia1; Vicente Fajardo, licenciado
de la alteración. en Farmacia1; Francisco Zorrilla1, licenciado en Químicas; José Luís Alonso
Molina2; José Juan Morenilla Martínez, doctor ingeniero industrial3; Ignacio
Bernácer Bonora, licenciado en Farmacia3; Francisco J. Martínez Francisco,
Palabras clave: licenciado en Ciencias Químicas3
Bulking, EDAR, FISH, fango activado,
cloración, Thiothrix-021N. 1
Grupo Aguas de Valencia
Gran Vía Marqués del Turia, 19 - 46005 Valencia
Tel.: 963 390 270 - Fax: 963 931 362
Abstract www.egevasa.es
Suitability of the cellular viability 2
Universidad Politécnica de Valencia
technique as a control tool of the
Instituto de Ingeniería del Agua y Medio Ambiente (IIAMA)
chlorine dosage on the activated
Área de Química y Microbiología del Agua
sludge of a biological process affected
Camino de Vera, s/n - 46022 Valencia
by bulking
E-mail: alonso@ihdr.upv.es
This work demonstrates the suitability
of the cellular viability technique as a 3
Entitat de Sanejament d’Aigües de la Comunitat Valenciana (EPSAR)
control tool of the chlorine dosage on Comunitat Valenciana (EPSAR)
the activated sludge of a biological C/ Álvaro de Bazán, 10, Entlo . - 46010 Valencia
process affected by the overabundance Tel.: 963 604 555 - Fax: 963 603 469
of the filamentous bacteria (Thiothrix- http://epsar.cop.gva.es
021N). This technique was used to
establish the chlorine dosage according

U
to the observed damages on cellular
membranes of both, floc-forming 1. Introducción tratada en los decantadores secun-
bacteria as well as filamentous bacteria.
nos de los problemas co- darios (Kanagawa y col., 2000).
To identify the filamentous bacteria
responsible for the macro-structural múnmente encontrados en Para el control del bulking fila-
los reactores biológicos de mentoso se utilizan diferentes mé-
312 / SEPTIEMBRE / 2009

alteration of the flocs, several criteria


were met, including morphologic las estaciones depuradas de agua todos químicos, como la adición
characteristics as well as conventional residual (EDAR) es el bulking fila- de peróxido de hidrógeno, ozono y
microbiological stains: Gram, Neisser mentoso. Éste se origina por un cre- cloro. Este último método es el más
and polyhydroxyalkanoates. FISH was cimiento excesivo de determinadas empleado debido a las ventajas que
used to confirm the obtained results, bacterias filamentosas, que provoca presenta: disponibilidad del produc-
providing a definitve identification of
the filamentous bacteria responsible
una descompensación del flóculo a to, su poder desinfectante y bajo
for the alteration. nivel macroestructural. Si bien una coste. En cualquier caso, ninguno
baja proporción de bacterias fila- de estos métodos permite actuar
Keywords:
mentosas puede ser beneficiosa para únicamente y de manera selectiva
Bulking, WWTP, FISH, activated slud-
ge, chlorination, Thiothrix-021N. el flóculo, un crecimiento desmesu- sobre la bacteria filamentosa de in-
rado deteriora el proceso de separa- terés. Para reducir el bulking fila-
24 ción de la biomasa del agua residual mentoso por el método de cloración

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

es importante, por un lado, identi- de las sondas puede ser ajustada técnicas convencionales y posterior
ficar el tipo de bacteria filamentosa a diferentes niveles taxonómicos, confirmación inequívoca mediante
causante del episodio, pues no todas como son dominio, phylum, cla- FISH y, en segundo lugar, su erra-
son susceptibles a la cloración y, se, familia, género, especie para dicación mediante la dosificación
por otro, controlar la integridad del la identificación de las bacterias controlada de cloro por medio de la
flóculo y su resistencia ante el agen- (Amann y col., 1995). técnica de viabilidad celular.
te químico. Durante la dosificación de cloro
Las primeras claves de identifica- es necesario controlar la integridad 2. Materiales y métodos
ción para los microorganismos fila- del flóculo, dado que este agente El estudio se realizó en la EDAR
mentosos observados en las EDAR biocida afectará en mayor o menor de Quart-Benàger, que está situa-
fueron propuestas en los años seten- medida a todos los microorganis- da en la provincia de Valencia y a
ta por Eikelboom, quien los agrupó mos presentes. Una dosificación la que le llegan aguas residuales
en morfotipos (grupos), la mayoría excesiva afectaría de manera irre- de carácter doméstico e industrial.
de los cuales son nombrados con un versible a las bacterias formadoras Esta EDAR consta de un pretrata-
código de cuatro cifras en función de flóculo, lo que conllevaría el miento que incluye tres balsas de
de unas características morfológi- deterioro del proceso biológico de homogenización, cuatro decantado-
cas comunes y de las respuestas a depuración. Para detectar daños en res primarios (TRH: 5,5 h), cuatro
tinciones diferenciales. En la actua- la membrana celular de las bacterias reactores biológicos (TRC: 9 días,
lidad, los estudios realizados por se utiliza la técnica de viabilidad ce- TRH: 5,5 h), cuatro decantadores
Jenkins y col. (2004) y Eikelboom lular. secundarios (TRH: 7,5 h) y un tra-
(2000) sirven de referencia para la tamiento terciario por ultravioleta
identificación convencional de mi- para la desinfección del efluente.
croorganismos filamentosos. Esta La estabilización de fangos se reali-
forma de identificación no es es- Durante za en tres digestores anaerobios. El
pecífica porque pueden existir bac- la dosificación caudal total promedio de tratamien-
terias morfológicamente iguales y to es de 35.200 m3/d y la relación
con similar respuesta a tinciones, de cloro es media DBO5/DQO de entrada al
pero ser genéticamente distintas. necesario controlar proceso biológico es de 0,57.
Por este motivo, es necesario com-
plementar la información obtenida la integridad 2.1. Determinaciones
en la identificación convencional del flóculo fisicoquímicas
con el empleo de técnicas molecu- La determinación del índice de
lares basadas en el análisis del ADN volumen del fango diluido (IVFD)
y ARN (hibridación in situ - FISH) se realizó según el procedimiento
aplicadas a los sistemas de trata- La rápida reacción química del descrito por Jenkins y col. (2004).
miento biológico de agua residual cloro con otros compuestos hace El resto de determinaciones se rea-
(Amann y col., 1995). que sea necesario alcanzar una lizaron según recomienda el Stan-
La técnica de FISH se basa en buena y rápida mezcla con el fan- dard Methods (APHA y col., 1998):
la hibridación directa de la bacteria go activado, puesto que una mezcla índice de volumen del fango (IVF),
diana con una sonda complementa- deficiente conllevaría elevados con- V30, sólidos suspendidos totales
ria de una región del gen 16S ARNr sumos de cloro sin llegar a contro- (SST), sólidos suspendidos volá-
o 23S ARNr. El elevado número de lar el bulking. Los puntos más reco- tiles (SSV), demanda biológica de
moléculas de ARNr (103-105) es mendados para la adición de cloro oxígeno (DBO) y demanda química
una ventaja en la aplicación de la son: directamente en el tanque de de oxígeno (DQO).
312 / SEPTIEMBRE / 2009

técnica de hibridación al aumen- aireación y en la recirculación inter-


tar su sensibilidad (Amann y col., na o externa (Jenkins y col., 2004). 2.2. Determinaciones
1995). Una secuencia de DNA (son- En este trabajo se presenta la es- microbiológicas
da) puede unirse con una secuen- trategia seguida para solucionar un La observación óptica se realizó
cia de ARN complementaria (16S episodio severo de bulking ocasio- con un microscopio de contraste de
ARNr o 23S ARNr) y se produce un nado por la excesiva presencia de fases, Zeiss modelo Axiostar con
híbrido ADN:ARN. La sonda está la bacteria filamentosa Thiothrix- objetivos de 10x, 20x, 40x y 100x
marcada con un fluorocromo en el 021N que afectó a la EDAR de aumentos, equipado de microfoto-
extremo 5’, de tal forma que los hí- Quart-Benàger. Esta estrategia se grafía. La identificación de la bacte-
bridos formados se pueden detectar basó, en primer lugar, en la identi- ria filamentosa causante del episo-
fácilmente con un microscopio de ficación de la bacteria responsable dio de bulking se realizó siguiendo
epifluorescencia. La especificidad del episodio de bulking mediante las claves de identificación de mor- 25

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

Tabla 1
Sondas Secuencia (5’-3’) Nivel/Grupo % FAa Referencia
EUB 338 GCTGCCTCCCGTAGGAGT Bacteria 20% Amann y col. (1990)
GAM 42a GCCTTCCCACATCGTTT γ-Proteobacteria 35% Manz y col. (1992)
CBET 42a GCCTTCCCACTTCGTTT c para Gamma b
35% Manz y col. (1992)
HGC69a TATAGTTACCACCGCCGT Actinobacteria 25% Roller y col. (1994)

G123T CCTTCCGATCTCTATGCA Thiohrix 40% Kanagawa y col. (2000)


G2M GCACCACCGACCCCTTAG T. eikelbomii 35% Kanagawa y col. (2000)
TEI TCCCTCTCCCACATTCTA C para TNI c
40% Kim y col. (2002)
NLIMII175 GGCTCCGTCTCGTATCCG T. japonica d
20% Liu y Seviour (2001)
NLIMII 192 AGACTTTCCAGACAGGAG N. limicola II10 40% Liu y Seviour (2001)
Mpa-all-1410 GGTGTTGTCGACTTTCGGCG Microthrix 35% Levantesi y col. (2006)
Nota: a, porcentaje de formamida; b, competidora para GAM 42a; c, competidora para G123T; y d, Tetrasphaera japonica.

Tabla 1. Sondas empleadas en la hibridación para identificar el microorganismo causante del bulking.

fotipos propuestas por Eikelboom filamentosas que las técnicas con- 2.5. Dosificación de cloro
(2000) y Jenkins y col. (2004). La vencionales, porque se basa en se- La dosificación de cloro se rea-
confirmación genética del grupo y cuencias de nucleótidos específicas lizó en el punto de mezcla de la
especie de bacteria filamentosa se de las bacterias o grupos de bacte- recirculación externa del fango
realizó mediante FISH. rias que se quieren identificar.. En con el efluente de los decantadores
la Tabla 1 se presentan las sondas primarios (Figura 1b, antes de los
2.3. Hibridación in situ empleadas, la secuencia de nucleó- tornillos de Arquímedes), dada la
(FISH) tidos, el grupo y el porcentaje de imposibilidad de dosificar directa-
Esta técnica permite la identifi- formamida (FA) óptimo para la hi- mente sobre la recirculación, lugar
cación de bacterias que pertenecen bridación. en donde la adición de cloro sería
a un nivel taxonómico específico. más efectiva. Para garantizar en
Se han utilizado sondas de ADN 2.4. Tinción con todo momento la dosificación, se
marcadas con fluorocromos, que se fluorocromos para instalaron dos bombas (1+1) y 4
unen a la fracción del gen 16S ARN determinar la viabilidad depósitos de hipoclorito de 1.000 l,
ribosómico de la bacteria filamento- celular conectando cada una de las bombas
sa en el fango activo, produciendo Para realizar el control de la a dos depósitos. La dosificación se
una fluorescencia en las bacterias viabilidad, tanto de las bacterias realizó mediante una tubería perfo-
con la fracción de ARN ribosómico filamentosas como de las bacterias rada de polietileno de ¾ pulgadas a
coincidente. formadoras de flóculo, se empleó el lo largo de todo la arqueta previa a
Live/Dead BacLight (BL) Viability los tornillos de Arquímedes (Figu-
kit (Molecular Probes Inc., 1998). ra 1a). Diariamente fueron aforadas
En este método se emplean dos las bombas para garantizar la dosis
La técnica fluorocromos, el SYTO 9 (tinción aplicada.
312 / SEPTIEMBRE / 2009

FISH permite verde) y el yoduro de propidio (PI, Para el cálculo de la dosis de


tinción roja). Cuando la membrana cloro se siguieron las recomenda-
la identificación bacteriana se encuentra en buen es- ciones descritas por Ramírez y col.
de bacterias de tado (bacteria viable), la molécula (2000), que se basan en el cálculo
de SYTO 9 es capaz de entrar en de diferentes parámetros de fun-
un nivel taxonómico la célula, prevaleciendo una colo- cionamiento tales como: caudal de
específico ración verde. Si, por el contrario, recirculación (QRAS, m3/d), concen-
la membrana celular está alterada tración de sólidos suspendidos en la
(célula muerta o dañada), la molé- recirculación (SSRAS, mg/l), sólidos
cula de PI entrará en la célula y des- suspendidos totales del sistema,
Esta técnica resulta más fiable plazará a la molécula de SYTO 9, que incluye tanto los sólidos de los
26 para la identificación de bacterias presentando un color rojo. reactores como de los decantadores

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

a b

Figura 1.
Dosificación
de cloro
en la arqueta
de entrada
al tratamiento
biológico (a);
y depósitos
de hipoclorito (b).

secundarios (SSSistema, mg/l). A par- (determinaciones fisicoquímicas y logía celular cuadrada-discoidal, sin
tir de estos parámetros se calcula el microbiológicas), identificación del crecimiento epifítico (Figura 2b).
factor de frecuencia (F), que indica microorganismo causante del dete- La respuesta a las tinciones Gram
el número de veces que el fango rioro del proceso y adición contro- (Figura 2c), Neisser (Figura 2d) y
pasa por el punto de dosificación lada de cloro. gránulos de polifosfato (Figura 2f)
en un día, mediante la Ecuación 1. La utilización de cloro como fue negativa. Con la tinción Gram se
Ramírez y col. (2000) recomiendan biocida sobre la recirculación de observaron alternancias de espacios
valores de F superiores a 2,5. fango activado, procedente del tra- más intensos, aspecto característico
tamiento biológico es una práctica del tipo 021N. Aunque la tinción
F = (QRAS x SSRAS) / (1.000 x frecuente en EDAR con problemas Neisser fue negativa, ésta puso de
x SSsistema) (Ec1) de bulking filamentoso, aunque su manifiesto la presencia de gránulos
aplicación no permite un control Neisser positivo, color azul-violeta
Calculado el valor F, se determi- específico sobre una población bac- (Figura 2d, flecha amarilla), lo que
na el volumen de hipoclorito nece- teriana determinada. Antes de llevar indica acumulación de sustancias de
sario (VH, l/d). Éste se obtiene a a cabo la adición del agente biocida reserva.
partir de la concentración de cloro al fango activado es necesario co- Con la tinción Sudan Black (Fi-
como hipoclorito (CCL, g Cl/l), los nocer de forma inequívoca el tipo gura 2e) se observó la presencia de
sólidos suspendidos volátiles totales de bacteria filamentosa causante del gránulos de polihidroxialcanoatos
del sistema (SSVS, kg) y la dosis de problema de bulking, pues no todos teñidos de color negro o azul oscu-
cloro (D, g Cl/kg SSVd). La dosis los morfotipos de bacterias filamen- ro. Este material intracelular puede
de cloro se estableció a partir de ex- tosas son susceptibles al proceso de ser metabolizado para la generación
periencias realizadas por otros auto- cloración. de energía o producción de proteí-
res (Ecuación 2). Tras observar un continuo dete- nas durante los periodos en que el
rioro de las características de sedi- sustrato se encuentra en muy bajas
mentación del fango, se intensificó concentraciones (limitante), convir-
VH = (SSVS x D) / CCl (Ec.2) el seguimiento microbiológico del tiéndose por tanto en una ventaja
fango con el objetivo de identificar selectiva frente a otras bacterias fi-
la bacteria causante de este deterio- lamentosas y no filamentosas.
312 / SEPTIEMBRE / 2009

3. Resultados
Los resultados experimentales ro. En la visualización en contras- La observación microscópica del
que se muestran en este trabajo fue- te de fases del fango se observaba fango en contraste de fases, junto
ron obtenidos en la EDAR de Quart- que esta bacteria formaba puentes con las tinciones Gram, Neisser y
Benager durante el período en que interfloculares, con formas ligera- Sudán Black, apuntaban a que el
se produjo el continuo deterioro del mente curvadas (Figura 2a). Su bulking filamentoso estaba produci-
proceso biológico causado por un crecimiento principalmente fuera do por el tipo 021N. Sin embargo,
crecimiento excesivo de bacterias del flóculo la sitúa en condiciones este tipo de identificación morfoló-
filamentosas, bulking filamentoso, ventajosas frente al resto de micro- gica presenta limitaciones, puesto
y su posterior recuperación como organismos (Martins y col., 2004). que muchas bacterias filamentosas
consecuencia de las acciones que Los filamentos tenían una longi- pueden cambiar en su morfología
se realizaron: seguimiento conti- tud superior a 200 μm (diámetro como respuesta a los cambios pro-
nuo del estado del fango biológico aproximado 1,0 -2,0 μm) y morfo- ducidos en las condiciones medio 27

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

Figura 2. Características morfológicas y estructurales de la bacteria filamentosa: visualización en contraste de fases, 100x (a); visualización en contraste de fases,
1.000x (b); tinción Gram, 1.000x (c); tinción Neisser, 1.000x (d); tinción Sudan Black., 1.000x (e); y tinción de polifosfatos, 1.000x. (f).

El bulking
filamentoso es uno
de los problemas
más frecuentes
en las EDAR y
la solución a adopar
es diferente
Figura 3. Hibridación de la bacteria filamentosa: sonda G123T para la identificación de bacterias
filamentosas del género Thiothrix, 600x (a); y sonda G2M para la identificación de Thiothrix eikelboomii
en cada caso
sp. nov, 600x (b).

ambientales, y aunque algunas de Otros estudios realizados en cambios operacionales y las dosifi-
ellas pueden parecer morfológica- plantas con problemas de bulking caciones de cloro, en la Figura 4 se
mente la misma, varían considera- filamentoso han hecho posible iden- representa la evolución de los SSV
blemente en su fisiología y taxo- tificar algunos de los factores que del fango (SSVLM), la concentra-
nomía (Seviour, y col., 1997). Para favorecen al esponjamiento del fan- ción de cloro añadido, el tiempo de
corroborar el resultado obtenido go, tales como: el déficit de nutrien- retención celular (TRC), el IVFD
312 / SEPTIEMBRE / 2009

por las técnicas convencionales se tes, la deficiencia de oxígeno, la y la DQO a la entrada del reactor
empleó la técnica FISH (Figura 3), presencia de componentes reduci- biológico (DQOdec). Asimismo, se
que permite la correcta e inequívoca dos de azufre (Jenkins y col., 2004). indican los instantes de tiempo en
identificación de la bacteria, siem- El bulking filamentoso continúa los cuales fueron realizadas las dis-
pre que se emplee la sonda específi- siendo uno de los problemas más tintas actuaciones sobre el proceso.
ca correspondiente. frecuentes en EDAR y la solución Los primeros 17 días (Figura 4),
Las hibridaciones se realizaron- a adoptar es diferente en cada caso. corresponden a las condiciones de
con las diferentes sondas presenta- Con el objetivo de relacionar partida, período durante el cual la
das en la Tabla 1. La bacteria cau- algunos de los parámetros fisico- biomasa se encontraba estable. En-
sante de la espumación del fango químicos y operacionales del pro- tre los días 18 y 58 el crecimiento
fue Thiothrix eikelboomii sp. nov. ceso biológico con los instantes de de la bacteria filamentosa aumentó
28 (grupo Thiothrix-021N). tiempo en que fueron realizados los excesivamente, llegando a afectar

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

másica y el tiempo de retención ce-


lular, cambios que no repercutieron
en mejoras consistentes del pro-
ceso biológico. El primer cambio
operacional (día 23) consistió en
el aumento de la concentración de
oxígeno disuelto de 2,2 a 2,9 mg/l.
Posteriormente se puso en funcio-
namiento un reactor auxiliar (día
27) de 6.750 m3 (anóxico-aerobio).
Este cambio permitió reducir la car-
ga contaminante de entrada a los
reactores biológicos y mitigar los
cambios de la carga contaminante.
Esta medida estaba condicionada a
la finalización de unas obras de am-
pliación.
En el último cambio operacio-
nal, día 33, se redujo el TRC y, por
Figura 4. Evolución del IVF, SSVLM, DQO a la entrada del reactor biológico, dosis de cloro y tanto, la concentración de SSVLM.
las actuaciones operacionales realizadas. Con este cambio se buscó eliminar
una gran cantidad de fango afecta-
negativamente a las características Además, esto coincidió con un do. Sin embargo, el esponjamiento
del efluente. Durante este período aumento de la carga contaminan- del fango continuó aumentando,
se realizaron distintos cambios ope- te de entrada al sistema biológico hasta alcanzar valores de IVFD de
racionales con objeto de reducir la (Figura 4) debido, por un lado, 1.454 ml/g. Los valores de DBO5 de
presencia de filamentos. Entre los al aumento de vertidos lixiviados entrada al proceso biológico oscila-
días 59 y 89 se realizaron tres dosi- procedentes de una planta de trata- ron entre 310 y 680 mg/l, con una
ficaciones de cloro a distintas con- miento de residuos sólidos y, por el media de 463 mg/l, valores que con-
centraciones. En los últimos 21 días otro, a la rotura de una tubería in- tinuaron favoreciendo el crecimien-
se presenta la evolución y recupera- terna que transportaba el fango pro- to filamentoso.
ción del proceso biológico. veniente del decantador primario al Los distintos cambios operacio-
Durante los primeros 17 días del espesador de gravedad. Esta rotura nales realizados no repercutieron en
período experimental, cuando aún se produjo cerca del canal que reco- una notable reducción de bacterias
el proceso biológico no se había ge el clarificado del espesador, por filamentosas. Debido al continuo
visto afectado, la concentración SS tanto, el sobrenadante del espesador aumento de los valores de IVF y el
en el efluente (SSef) era inferior a 10 correspondió a un sobrenadante del progresivo deterioro de la calidad
mg/l. Los valores del IVF se encon- espesador más fango primario. Am- del efluente se optó por la aplica-
traron en torno a 100 ± 15 ml/g, pa- bas corrientes fueron recirculadas a ción de cloro sobre la salida de la
rámetro indicativo de la buena cali- la entrada de la planta depuradora. recirculación externa del fango. A lo
dad de sedimentabilidad del fango. El problema de bulking fue cada largo de este período fueron realiza-
Este valor fue tomado como valor vez más severo, hasta el punto que das un total de tres dosificaciones
de referencia una vez terminado el los filamentos dominaron tanto el de cloro comprendidas entre 6,30 y
período de cloración. espacio intraflocular como extraflo- 8,82 g Cl/kg SSVLM*d, cuyo efec-
312 / SEPTIEMBRE / 2009

Al comienzo del bulking fila- cular. Este incremento provocó va- to sobre el estado del fango bioló-
mentoso, la calidad del efluente no lores de IVF en torno de 200 ml/g, gico del proceso fue supervisado
se vio afectada, ya que las pequeñas valor asociado a problemas de bul- mediante la técnica de viabilidad
partículas dispersas fueron filtradas king (Pujol y col., 1990). Algunos celular. Esta técnica permite valo-
y fijadas sobre la bacteria filamen- estudios reflejan que existe una bue- rar en todo momento la integridad
tosa (Thiothrix 021N). En los días na correlación entre IVF y la longi- de la membrana celular, evitando de
18, 19 y 20 hubo problemas con el tud total del filamento e incluso en- esta forma, daños irreparables en las
suministro de oxígeno disuelto a los tre el IVF y el número de filamentos comunidades bacterianas y, por tan-
reactores biológicos, dando origen (Palm y col., 1980). to, en el proceso de depuración del
a un sistema biológico pobremente Se realizaron varios cambios agua residual.
aireado que favoreció el desarrollo operacionales sobre la consigna de Se realizó una prueba de viabili-
de la bacteria filamentosa. oxígeno en los reactores, la carga dad antes de la primera dosificación 29

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

Figura 5. Seguimiento de la adición de biocida al fango a partir de la prueba de viabilidad celular.

de cloro que se emplearía como con- tre 6,30 y 8,69 g Cl/kg SSVLM*d. concentración de cloro adicionado
trol (Figura 5a) para las siguientes La Figura 5c muestra una cantidad para el control de las bacterias fila-
muestras procesadas. Las distintas importante de filamentos dañados mentosas es también consumido por
muestras de fango analizadas por la identificados de color rojo. la materia orgánica presente, por lo
técnica de viabilidad celular duran- Tras la primera cloración, la con- que la dosis óptima efectiva para
te el período de cloración sirvieron sistencia del flóculo fue más débil la eliminación de estas bacterias se
y la calidad del efluente se vio de- encuentra por debajo de los valores
teriorada, obteniéndose un efluente indicados.
más turbio y con una mayor con- Tras la segunda adición de bio-
Tras una primera centración de sólidos suspendidos. cida, una elevada cantidad de fila-
cloración, En esta etapa se tuvo un ligero des-
censo de los valores del IVFD, pero
mentos fueron dañados, mostrando
una pérdida celular de los tricomas,
la consistencia no el suficiente como para alcanzar dejando visible la vaina. El máxi-
del flóculo una buena sedimentabilidad del
fango. La defloculación fue también
mo valor obtenido del IVFD du-
rante esta etapa fue de 360 ml/g. El
fue más débil contrastada con las observaciones tercer y último período de adición
y la calidad microscópicas del fango en campo
claro y contraste de fases.
de biocida se llevó a cabo entre
los días 87 y 89 con una dosis de
del efluente El segundo período de dosifica- biocida variable, entre 6,33 y 6,76
se vio deteriorada ción de cloro se realizó entre los días
68 y 71, con una dosis variable en-
g Cl/kg SSLM*d. Los valores de
IVFD comprendidos en esta etapa
312 / SEPTIEMBRE / 2009

tre 7,33 y 8,82 g Cl/kg SSVLM*d. se redujeron, pasando de 640 a 356


El efecto de la adición de cloro se ml/g. Los resultados de viabilidad
para determinar el grado de afec- reflejó sobre algunas zonas del mostraron que tanto el flóculo bac-
ción del biocida sobre la población flóculo (Figura 5d), por lo que se teriano como las bacterias filamen-
bacteriana y estimar los períodos de estableció como dosis máxima a tosas habían sido seriamente afec-
duración de aplicación de cloro. emplear 8,82 g Cl/kg SSVLM*d. tados (Figura 5e y Figura 5f), por
La adición del biocida se realizó La observación microscópica mos- lo que la cloración fue suspendida.
durante nueve días, distribuidos en tró un flóculo menos consistente, La información obtenida mediante
tres períodos. Durante el primer pe- de estructura abierta y abundantes la técnica de viabilidad celular per-
ríodo, entre los días 59 (Figura 5b) zonas aerobias, de pequeño tamaño mitió controlar en todo momento el
y 63 (Figura 5c), la concentración y sin un núcleo bien definido. Es grado de afección al que fue sujeta
30 de cloro adicionada se encontró en- importante resaltar que parte de la la comunidad biológica del fango,

TECNOLOGIA DEL AGUA


ARTÍCULOS TÉCNICOS

convirtiéndose esta técnica en una necesario controlar la integridad del plants by microscopic investi-
herramienta práctica en el campo de flóculo y su resistencia ante el agen- gation’. London, U.K.; IWA Pu-
la depuración de aguas residuales. te químico. Esto se puede realizar blishing, London.
Los resultados obtenidos en este mediante la técnica de viabilidad [5] Jenkins, D.; Richard, M.G.;
estudio ponen de manifiesto que celular que permite detectar daños Daigger, G.T. (2004). ‘Manual
para concentraciones de cloro en en la membrana celular tanto de on the Causes and Control of
el intervalo de 6,30 y 8,82 g Cl/ las bacterias formadoras de flóculo Activated Sludge Bulking and
kg SSVLM*d se consigue una im- como de las filamentosas. Foaming’. 3th Edition. Lewis
portante reducción en la población En este trabajo se ha demostrado publishers (Michigan).
de las bacterias identificada como la idoneidad de la técnica de viabi- [6] K
 anagawa, T.; Kamagata, Y.;
T. eikelbomii sp. nov. (grupo Thio- lidad celular como herramienta para Shinobu, A.; Kohno, T.; Horn,
thrix-021N). Esta reducción se vio el control de la dosificación de cloro. M.; Wagner, M. (2000). ‘Phylo-
reflejada en una mejora significativa Los resultados obtenidos mediante genetic analysis of and oligo-
de las características de sedimenta- esta técnica permitieron supervisar nucleotide probe development
bilidad del fango (valorada a través y valorar de manera exhaustiva la for Eikelboom type 021N fila-
del IVF) y, consecuentemente, en viabilidad y el grado de afección del mentous bacteria isolated from
una mejora de la calidad del agua fango durante el proceso de clora- bulking activated sludge’. Appl.
efluente. ción. La información obtenida me- Environ. Microbiol. 66, 5.043-
diante esta técnica la propone como 5.052.
4. Conclusiones una valiosa herramienta práctica en [7] M
 artins, A.M.P.; Pagill, K.;
La proliferación excesiva de el campo de la depuración de aguas Heijnen, J.J.; Van Loosdrecht,
bacterias filamentosas en el fango residuales. M.C.M. (2004). ‘Filamentous
biológico (bulking filamentoso) bulking sludge - a critical re-
afecta negativamente a sus carac- 5. Agradecimientos view’. Wat. Res. 38, 793-817.
terísticas de sedimentabilidad, pro- Se agradece la colaboración de [8] P
 alm, J.C.; Jenkins, D.; Parker,
vocando un deterioro de la calidad la Entidad Pública de Saneamien- D.S. (1980). ‘Relationship bet-
del efluente. Para poder controlar to de la Generalidad Valenciana ween organic loading, dissolved
y solucionar satisfactoriamente un (EPSAR) y al Grupo Aguas de Va- oxygen concentration and slud-
episodio de bulking filamentoso es lencia por su apoyo y respaldo a ge settleability in the completely
necesario identificar el tipo de bac- nuestro trabajo. mixed activated sludge process’.
teria filamentosa causante de dicho J. Water Polln Control Fedn. 52,
episodio. Las técnicas microbioló- 6. Bibliografía 2.484–506.
gicas convencionales son una herra- [1] Amann, R.I.; Binder, B.J.; Ol- [9] P
 ujol, R.; Vachon, A.; Martin,
mienta útil para realizar esta tarea son, R.J.; Chisholm, S.W.; De- G. (1990). ‘Technical manual
de identificación, pero es necesario vereux, R.; Stahl, D.A. (1990). for activated sludge monitoring
complementarlas con el empleo de ‘Combination of 16S rRNA (Guide technique sur le foison-
otras técnicas moleculares para ase- targeted oligonucleotide pro- nement des boues activées)’.
gurar la correcta e inequívoca iden- bes with flow cytometry for Document technique, FNDAE
tificación. analyzing mixed microbial po- Nº. 8.
En este estudio se ha mostrado la pulations’. Appl. Environ. Mi- [10] R amírez, G.W.; Alonso, J.L.;
estrategia seguida para solucionar crobiol. 56 (6), 1.919-1.925. Villanueva, A.; Guardino, R.;
un episodio severo de bulking oca- [2] Amann, R.; Ludwig, W.; Schlei- Basiero, J.A.; Bernacer, I.; Mo-
sionado por la presencia excesiva fer, K.H. (1995). ‘Phylogenetic renilla, J.J. (2000). ‘A rapid,
de la bacteria filamentosa Thiothrix identification and in situ detec- direct method for assessing
312 / SEPTIEMBRE / 2009

eikelboomii, perteneciente al grupo tion of individual microbial cells chlorine effect on filamentous
Thiothrix-021N, identificada de for- without cultivation’. Microbiol bacteria in activated sludge’.
ma inequívoca mediante la técnica Rev. 59 (1), 143-69. Wat. Res. 34, 3.894-3.898.
de hibridación in situ (FISH). Esta [3] American Public Health Asso- [11] Seviour, E.M.; Blackall, L.L.;
bacteria fue susceptible a la adición ciation, American Water Works Christensson, C.; Hugenhol-
de cloro aplicado como biocida en Association and Water Environ- tz, P.; Cunningham, M.A.;
concentraciones en torno a 8,8 g Cl/ mental Federation (1998). ‘Stan- Bradford, D.; Stratton, H.M.;
kg SSVLM*d. dard methods for the examina- Seviour, R.J. (1997). ‘The fi-
La adición de cloro afecta tam- tion of water and wastewater’. lamentous morphotype Eikel-
bién a los microorganismos que lle- 20th edition. Washington D.C. boom type 1863 is not a single
van a cabo proceso de depuración, [4] Eikelboom, D.H. (2000). ‘Pro- genetic entity’. J. Appl. Mi-
32 por lo que durante la cloración es cess control of activated sludge crob. 82: 411-21.

TECNOLOGIA DEL AGUA