FACULTAD DE MEDICINA HUMANA

DEPARTAMENTO ACADÉMICO DE CIENCIAS BÁSICAS MÉDICAS

Guía de prácticas BIOLOGÍA CELULAR Y MOLECULAR 2007-II
Responsable de Prácticas: Dr Luis Rodríguez Delfín Profesores de Práctica : MSc Jhon W. García López Dr. Nestor Alayo Rodríguez MSc González Esparza Paola

1

INTRODUCCIÓN

La biología es la ciencia de la vida que estudia la estructura y función de los organismos vivos y sus componentes. Las aplicaciones de la investigación básica en biología molecular son numerosas, desde la tecnología para trasplantar corazones, manipular genes, diseñar fármacos contra microorganismos patógenos e incrementar la producción mundial de alimentos. La guía de prácticas del curso de Biología Celular y Molecular tiene como objetivo entrenar al estudiante con los procedimientos llevados a cabo en el laboratorio y desarrollar su pensamiento científico que lo lleve comprender los términos básicos de la Biología Molecular. El estudiante debe emplear esta guía en cada práctica de laboratorio y estar informado sobre la práctica que se llevará a cabo en cada sesión. La guía se ha dividido en tres partes de acuerdo a cada evaluación parcial. La primera parte comprende la célula y componentes celulares. La segunda parte incluye procesos celulares como respiración, permeabilidad, división celular y la visualización de organelas. En la tercera parte se analizara el proceso de meiosis, comprensión del código genético y técnicas de manipulación de ácidos nucleicos. El alumno debe cumplir con los objetivos planteados al final de cada práctica. Así mismo debe presentar un informe de cada práctica la semana siguiente a realizada la misma.

PAUTAS PARA PRESENTAR UN INFORME DE PRÁCTICAS El alumno debe presentar un informe de cada práctica realizada que incluya las siguientes partes: 1Carátula: título de la práctica, grupo y profesor de práctica. 2 Planteamiento del problema. 3Materiales y métodos 4Resultados: deberán incluir todas sus observaciones por medio de dibujos, esquemas y gráficas. Para las prácticas donde se observen muestras bajo el microscopio, debe adjuntar las fichas respectivas que se incluyen en esta guía. 5Discusión: comentarios sobre los resultados obtenidos y su relación con la hipótesis del trabajo. 6Referencias bibliográficas: libros y artículos a los que ha consultado para elaborar su informe.

2

PROGRAMACIÓN DE CONTENIDO


20-25 agosto 27-01 septiemb re 03-08 septiemb re 10-15 septiemb re 17-22 septiemb re 24-29 septiemb re 01-06 octubre 08-13 octubre 15-20 octubre 22-27 octubre 29-03 noviembr e 05-10 noviembr e 12-17 noviembr e 19-24 noviembr e 26-01 diciembr e 03-08 diciembr e

CONTENIDO
Metodología de Evaluación. Distribución de grupos de práctica. Bioseguridad. Microscopía

Técnicas de coloración. Preparación de muestra. Observación y reconocimiento de células procariotas Observación y reconocimiento de células eucariotas

Observación de la Permeabilidad Celular

Observación del movimiento celular: Ciclosis Observación de cilios y flagelos PRIMERA EVALUACION Observación de Inclusiones Citoplasmáticas Observación de organelas. Mitocondrias y Cloroplastos Técnicas de Extracción de Ácidos Nucleicos.

Ciclo celular: Mitosis Ciclo Celular. Meiosis

Código Genético.

SEGUNDA EVALUACIÓN

3

PRACTICA Nº 2
BIOSEGURIDAD Y MICROSCOPÍA PRIMERA PARTE: BIOSEGURIDAD
El trabajo en el Laboratorio requiere la observación de una serie de normas de seguridad que eviten posibles accidentes debido al desconocimiento de lo que se está haciendo o a una posible negligencia de los alumnos que estén en un momento dado, trabajando en el Laboratorio. A continuación alistamos una serie de medidas e indicaciones de seguridad que deben tomarse durante las prácticas de laboratorio.

NORMAS PERSONALES 1.Lea con atención, antes de cada práctica, las indicaciones de su guía. Siga todas las instrucciones a menos que el profesor realice alguna modificación. 2.Cada grupo de prácticas se responsabilizará de su zona de trabajo y de su material. Se trabajará con cuidado y de manera organizada. Así mismo se mantendrá cada mesa de trabajo limpia, seca y ordenada. 3.Es obligatorio la utilización de mandil que le cubra brazos, piernas, torso y pies. Están prohibidos el uso de sandalias, pantalones cortos, faldas, polos cortos, etc. en el laboratorio. La persona inapropiadamente vestida para trabajar en el laboratorio le será negado el ingreso. 4.No deben llevarse las manos a la boca ni a la cara pues pueden estar contaminadas. 5.Si tienes el pelo largo, es conveniente que lo lleves recogido. 6.Está terminantemente prohibido fumar, tomar bebidas ni comidas. 7.En caso de derrame, accidente o daño avise inmediatamente al profesor. 8.Al término de cada práctica limpiar el área de trabajo y lavar los materiales utilizados con agua de caño. Lavarse las manos meticulosamente con agua y jabón. Finalmente cerciorares que las llaves de gas y agua estén cerradas.

REACTIVOS QUIMICOS 1.Usar lentes de seguridad cuando trabaje con reactivos químicos peligrosos que puedan salpicar o derramarse. 2.Antes de utilizar un compuesto, asegurarse bien de que es el que se necesita, fijarse bien el rótulo. 3.Como regla general, no coger ningún producto químico. El profesor o profesora te lo proporcionará. 4.Nunca devuelva los sobrantes de los productos a los frascos de origen sin consultar con el profesor. 5.Es muy importante que cuando los productos químicos de desecho se viertan en la pila de desagüe, aunque estén debidamente neutralizados, debe dejarse que circule por la misma, abundante agua. 6.No tocar con las manos y menos con la boca, los productos químicos. 7.No pipetear con la boca. Utilizar una bombilla de succión.

4

8.Los ácidos requieren un cuidado especial. Cuando queramos diluirlos, siempre echaremos el ácido sobre agua. 9.Los productos inflamables (gases, alcohol, éter, etc.) deben estar lejos de fuentes de calor. Si hay que calentar tubos con estos productos, se hará al baño María, nunca directamente a la llama. 10.Manipule con precaución los solventes volátiles e inflamables como el éter, acetona y metanol. Nunca evapore estos solventes en una hornilla al abierto. Utilice siempre un sistema de condensación eficiente. 11.Si se vierte sobre ti cualquier ácido o producto corrosivo, lávate inmediatamente con mucha agua y avisa al profesor. 12.Al preparar cualquier disolución se colocará en un frasco limpio y rotulado convenientemente. 13.Encienda fuego en el laboratorio solo si no existen solventes inflamables en la vecindad. La persona que encienda el fuego debe primero verificar que no exista otra persona que este trabajando con solventes inflamables en el laboratorio.

MATERIAL DE VIDRIO 1Use material de vidrio limpio y no rajado. 2El vidrio caliente no se diferencia a simple vista del vidrio frío. Para evitar quemaduras use guantes o trapos. 3 Si tienes que calentar a la llama el contenido de un tubo de ensayo, observa cuidadosamente estas dos normas: -Ten sumo cuidado y ten en cuenta que la boca del tubo de ensayo no apunte a ningún compañero. Puede hervir el líquido y salir disparado, por lo que podrías ocasionar un accidente. -Calienta por el lateral del tubo de ensayo, nunca por el fondo; agita suavemente (mira la figura). EQUIPOS ELÉCTRICOS 1Manipule cualquier equipo eléctrico con las manos secas y asegúrese que el área de trabajo también este seca. 2Ningún cordón electrifico debe colgar fuera de la mesa de trabajo. 3Cuando desconecte algún equipo de tomacorriente, jálelo por el enchufe y no por el cordón.

UTILIZACION DE BALANZAS 1Cuando se determinan masas de productos químicos con balanza, se colocará papel sobre los platos de la misma y si el producto fuera corrosivo, se utilizará una luna de reloj. 2Se debe evitar cualquier perturbación que conduzca a un error, como vibraciones debidas a golpes, aparatos en funcionamiento, soplar sobre los platos de la balanza, etc. MANIPULACIÓN DE ESPECÍMENES 1Manipule los microorganismos crecidos en una placa petri o tubo de cultivo con extremo cuidado. Siempre utilice técnicas de esterilidad (a la llama del mechero, guantes, palillos estériles, etc.). 2Nunca llevar a la boca plantas o partes de ellas como semillas, frutos y hojas.

5

S
I. FUNDAMENTO

EGUNDA PARTE: MICROSCOPÍA

La invención del microscopio se atribuye a Johannes y Zacharias Jansen (1590) y el descubrimiento de la estructura celular de los organismos a Robert Hooke (1665). Posteriormente, en 1683 y con un microscopio muy rudimentario Leeuwenhoek descubrió un universo enmarcado sólo por decenas de micrómetros. Desde aquel entonces, el perfeccionamiento continuo al microscopio ha permitido a la Ciencia profundizar cada vez más en el conocimiento de la ultraestructura celular y de las relaciones intercelulares. MICROSCOPIO COMPUESTO El microscopio es un instrumento óptico que se compone de una serie de lentes para conseguir imágenes aumentadas de objetos diminutos que por su extrema pequeñez no son visibles al ojo humano. El microscopio compuesto está constituido de un SISTEMA OPTICO destinado a obtener una imagen aumentada del objeto, un SISTEMA MECANICO que sostiene los distintos elementos ópticos y los objetos que se van a examinar y un SISTEMA DE ILUMINACIÓN. CARACTERISTICAS DEL MICROSCOPIO Dado que la imagen del microscópio no es real sino virtual, se han determinado algunos términos de medida microscópica: En cualquier microscopio el poder de resolución define su rendimiento óptico, porque es su capacidad para ver como separados dos puntos que realmente lo están pero que nuestro ojo sólo puede ver como una entidad única (es decir es su capacidad de entregar imágenes bien nítidas). El máximo poder de resolución del microscopio óptico es de 0,2 micrómetros(0,2 µm), debido a que la longitud de onda de la luz utilizada (400-700 µm) es un factor limitante. El ojo humano tiene un poder de resolución de aproximadamente 100 micrómetros. El límite de resolución puede definirse como la distancia mínima que debe existir entre dos puntos para que se puedan distinguir como separados. El límite de resolución se puede calcular a partir de la siguiente ecuación: Kλ L.R. = K = constante = 0.61 A.N λ = longitud de onda de luz AN = apertura numérica de cada lente objetivo es su capacidad para captar la máxima cantidad de la luz difractada por el objeto. Depende del índice de refracción del medio. Recuerda: A menor límite de resolución mayor será el poder de resolución Resolución y magnificación Máximas Instrumento óptico Ojo humano Microscopio óptico Microscopio electrónico Resolución 0,1 mm 0,2 u 0,1 nm Magnificación 2500 1000 000

6

II. OBJETIVOS  Reconocer las partes del microscopio óptico. -Conocer su utilización para la observación de distintas muestras biológicas.

III. MATERIALES Y MÉTODOS En el laboratorio encontrarás: - Microscopio compuesto - Aceite de inmersión - Colorantes IV. PROCEDIMIENTO. Se reconocerán las partes de un microscopio óptico. Señalar las partes del mismo en el dibujo adjunto. 1. SISTEMA OPTICO. El sistema óptico está constituido por: Objetivos: sistema de lentes convergentes que actúa como una lente que se encuentran montados en el revolver. Lo usual es que cada microscopio tenga cuatro objetivos de diferentes aumentos ( 4x, 10x, 40x, 100x) los que se clasifican en:  Objetivos en seco: en los que el aire se interpone entre la lente y la preparación. Objetivos de inmersión: en el cual un líquido ( aceite) se interpone entre la lente y la preparación. Ocular: El ocular es una lente convergente que recoge la imagen intermedia producida por el objetivo y forma una nueva imagen virtual, derecha, y amplificada un cierto número de veces (X veces, según se indica en el propio ocular). Los aumentos más comunes son 10X y 16X. 2.-SISTEMA DE ILUMINACIÓN. Condensador: Sistemas de lentes convergentes que concentra el haz de luz sobre la preparación. Diafragma: Sirve para regular la cantidad de luz que llega a la preparación. Fuente de luz: Puede ser natural o artificial (ampolleta). Portafiltro: Opcional, sirve para colocar filtro de distintos colores para mejorar el contraste. 3.-SISTEMA MECANICO Tubo óptico: Cilíndrico ahuecado destinado a llevar el ocular en su extremo superior y los objetivos montados en el revólver en su extremo inferior. La longitud del tubo debe ser siempre precisa. Revólver: Pieza metálica situada en la parte inferior del tubo que por rotación sitúa los diferentes objetivos en posición de trabajo. Platina: Superficie plana con una perforación central para permitir el paso de la luz hacia preparación. Posee un carro que sostiene la preparación y que puede desplazarla hacia delante y hacia el lado izquierdo o hacia el lado derecho. Tornillo Macrométrico: Mecanismo de enfoque de avance rápido. Tornillo Micrométrico: Mecanismo de enfoque con precisión o ajuste fino.

7

Base o Pie: Estructura sólida y pesada que sostiene y da estabilidad a todo el instrumento. Columna: Vástago vertical que se articula con la base y con el tubo del microscopio y lleva el mecanismo de movimiento del mismo. NOTA IMPORTANTE. Presta mucha atención al manejo del microscopio que tienes a tu cargo. Debes hacerlo cuidadosamente porque son aparatos muy delicados y dejarás a consigna tu documento de identificación.

Manejo del microscopio óptico 1Colocar el objetivo de menor aumento en posición de empleo y bajar la platina completamente. 2Colocar la preparación sobre la platina sujetándola con las pinzas metálicas. 3Comenzar la observación con objetivo de menor aumento. Si la preparación es de bacterias emplear el objetivo de mayor aumento (objetivo de inmersión, ver punto 6). 4 Para realizar el enfoque: a. Acercar al máximo la lente del objetivo a la preparación, empleando el tornillo macrométrico. Esto

8

debe hacerse mirando directamente y no a través del ocular, ya que se corre el riesgo de incrustar el objetivo en la preparación pudiéndose dañar alguno de ellos o ambos. b. Mirando, ahora sí, a través de los oculares, ir separando lentamente el objetivo de la preparación con el macrométrico y, cuando se observe algo nítido la muestra, girar el micrométrico hasta obtener un enfoque fino. 5. Pasar al siguiente objetivo. La imagen debería estar ya casi enfocada y suele ser suficiente con mover un poco el micrométrico para lograr el enfoque fino. 4El empleo del objetivo de inmersión es siempre utilizando aceite de inmersión. CUESTIONARIO 1Mencione 3 normas de bioseguridad que no se hayan incluido en la práctica de hoy. 2Esquematice mediante un dibujo grande las 3 normas de bioseguridad que usted crea más importantes. 3Calcular la magnificación de las imágenes que observa 4Comparar el microscopio óptico con el microscopio electrónico 5Como se forma la imagen en el microscopio óptico

9

PRACTICA Nº 3
TECNICAS DE COLORACION. PREPARACION DE MUESTRAS
I. FUNDAMENTOS La coloración implica la penetración del colorante por fenómeno osmótico y su fijación se debe a fenómenos de absorción de partículas o iones. Químicamente la coloración es la unión de las moléculas del colorante con los elementos constituyentes de la célula. Algunas regiones celulares tienen pH alcalino y se tiñen con los colorantes ácidos; otros tienen pH ácido y se tiñen con colorantes básicos. Sin embargo es necesario señalar que tanto el núcleo como el citoplasma tienen características anfótericas de manera que se pueden teñir, el núcleo con algunos colorantes ácidos y el citoplasma con algunos colorantes básicos. El mecanismo de coloración de las muestras biológicas pueden ser afectados por: - Pureza del colorante - Concentración del colorante - pH de la solución del colorante - Temperatura del medio ambiente - Sustancias adicionales (mordientes) - Tiempo de coloración. Los preparados microscopicos, constituyen una serie de preparados rutinarios de laboratorios que tienen por objeto identificar en forma rápida el contenido de un determinado tipo de muestra, con la con la finalidad de resolver algún problema de interés particular. Los preparados microscopicos más frecuentes en Biología son: Preparados “en fresco” Preparados “en seco” Los preparados “en Fresco” son preparaciones microscópicas acuosas, que se caracterizan por que la sustancia examen, no está adherida de un modo fijo a la superficie de la lámina portaobjeto y por lo tanto, al ser manipulada ésta en diferentes posiciones se corre el riesgo de perder u estropear el preparado. Los preparados “en seco” son aquellos que sufren un procesamiento previo (extensión, fijación y coloración), y se caracterizan porque la sustancia examen se halla adherida a la superficie de la lámina portaobjeto y por lo tanto, al ser manipulada ésta en diferentes posiciones no se estropea o pierde la muestra. Es importante ejercitar al estudiante en el manejo y aplicación de estos factores que inciden básicamente en la complementación del aprendizaje del estudio de estructuras celulares, identificación de tejidos y microorganismo. II. OBJETIVO. 1. Diferenciar y explicar el fundamento de las distintas coloraciones 2. Realizar coloraciones con muestras biológicas III. MATERIALES Encontrarás en el laboratorio. - Microscopio óptico - Pipetas pasteur - Goteros - Agua destilada - Mechero - Azul de metileno - Safranina - Eosina - Violeta de genciana - Wright - Fucsina - Verde de Janus

10

- Giemsa Deberás traer de casa - Agua Estancada - Lancetas - Laminas - Laminillas - Mondadientes - Goteros IV. PROCEDIMIENTO

- Hematoxilina

COLORACION SIMPLE 1. Con un mondadiente extraer mucosa labial y realizar una extensión sobre la lamina 2. Fijar al calor moderamente o al ambiente 3. colorear de 1-5’ con safranina (o Eosina) o Azul de metileno (o violeta de genciana) 4. Secar al medio ambiente 5. observa la microscopio COLORACION DOBLE 1. Con un mondadiente extraer mucosa labial y realizar una extensión sobre la lamina 2. Fijar 3. Colorear con hematoxilina por 3-5’ 4. lavar con agua destilada y dejar secar 5. Colorear con eosina por 5-10’ 6. lavar con y dejar secar 7. observar al microscopio COLORACION NEUTRA 1. Realizar un frotis con una microgota de sangre 2. dejar secar o fijar con calor 3. Colocar mitad de volumen con Wright y mitad con buffer fosfato 6.8 4. dejar coloreando por 3-5’ 5. lavar con agua destilada 6. observar al microscopio PREPARADOS EN FRESCO 1. Colocar una gota de agua estancada en una lamina 2. colocar una laminilla 3. observar CUESTIONARIO 1. Fundamente la reacción química de la coloración 2. Describa los tipos de coloración

11

PRACTICA Nº 4
OBSERVACIÓN Y RECONOCIMIENTO DE CÉLULAS PROCARIOTES

I. es que

FUNDAMENTO La principal característica de la célula procariota carece de núcleo celular. Las bacterias, los organismos procariotes más representativos, comprenden por una parte, especies de importancia médica puesto que producen una de infecciones y padecimientos en el hombre y en animales pero, por otra parte, una gran mayoría representa beneficios para la agricultura, la industria y la salud humana y animal. Para observar este tipo de células se utiliza la Gram, técnica diseñada por el médico danés Hans Christian Gram. Esta consiste en poner en contacto las células bacterianas con colorantes como violeta de genciana, utilizando la solución de como mordiente. Esto forma un compuesto que se fija fuertemente en determinadas bacterias. la coloración que adquieran, las bacterias se clasifican en:

serie los

Tinción básicos lugol yodado Según

GRAM POSITIVAS: se tiñen fuertemente con violeta de genciana y adquieren una coloración violeta. GRAM NEGATIVAS: se tiñen muy superficialmente por lo que fácilmente se decoloran con solventes orgánicos. Se utiliza adicionalmente la safranina o fucsina, que se emplea como colorante de contraste, adquierendo una coloración rosada. La diferente tinción de bacterias se debe a la composición diferencial de sus paredes bacterianas. Las bacterias Gram positivas poseen una pared celular con mureina y ácido teitoico. En cambio, las Gram negativas tienen una pared mucho más compleja que contiene, además del peptidoglucano, una asociación de proteínas lípidos y lipopolisacáridos Además de la coloración esta técnica nos permite distinguir en las bacterias: a) morfología: cocos, bacilos, espirilos, cocobacilos, vibrios, etc) b) agrupación: pares, cadenas tétradas, racimos, sarcina

A: forma de caña o bacilos B: Redondos en líneas: estreptococos C: redondos en cúmulos: estafilococos D: Redondos en pares: diplococos E: Forma de espirales: espirilos F: En forma de coma: vibrios

12

II. OBJETIVOS  Reconocer los distintos tipos de bacterias según se tiñan o no con la Tinción Gram.

III. MATERIALES Encontrarás en el laboratorio:

º

Microscopio óptico - Alcohol acetona Soluciones para la tinción: - Fucsina o safranina - Violeta de genciana - Aceite de inmersión - Lugol - Mechero de alcohol Deberás traer de casa:  Laminas portaobjetos  Mondadientes Gotero Muestras bacterianas de origen natural: yogur, vinagre, sarro dental. IV. PROCEDIMIENTO La tinción Gram se realizará sobre las muestras de yogur, sarro dentario y vinagre que los alumnos traerán.

13

Bacterias del yogurt El yogur es un producto lácteo producido por la fermentación natural de la leche. A escala industrial se realiza la fermentación añadiendo a la leche dosis del 3-4% de una asociación de dos cepas bacterianas: el Streptococcus termophilus, poco productor de ácido, pero muy aromático, y el Lactobacillus bulgaricus, muy acidificante. En esta preparación se podrán, por tanto, observar dos morfologías bacterianas distintas (cocos y bacilos) y un tipo de agrupación (estreptococos, cocos en cadenas arrosariadas). Además, el tamaño del lactobacilo (unos 30µm de longitud) facilita la observación aunque no se tenga mucha práctica con el enfoque del microscopio. Bacterias del vinagre El vinagre es una solución acuosa rica en ácido acético resultante de la fermentación espontánea del vino o de bebidas alcohólicas de baja graduación. La acetificación del vino es producida por bacterias aeróbicas del ácido acético, principalmente Acetobacter aceti, aunque también Gluconobacter. Se trata de bacilos rectos con flagelos polares. Bacterias del sarro dental El sarro dental es un depósito consistente y adherente localizado sobre el esmalte de los dientes. Está constituido principalmente por restos proteicos, sales minerales y bacterias junto con sus productos metabólicos. La flora bacteriana de la cavidad bucal es muy variable dependiendo de las condiciones que se den en el momento de hacer la preparación, pero suelen abundar bacterias saprófitas, pudiéndose observar gran variedad de morfologías: espiroquetas, cocobacilos, diplococos y bacilos. Realizar los siguientes pasos para la tinción Gram de cada una de las 3 muestras indicadas. 1Realizar una extensión de la muestra de cultivo bacteriano sobre un portaobjetos 2Secar ante un mechero. 3Cubrir el preparado con violeta de genciana por 1 minuto. 4Enjuagar la lámina con agua destilada 5Añadir lugol por 1 minuto. 6Lavar con agua destilada y decolorar con alcohol acetona. 7Añadir fucsina o safranina y dejar que actúe por 1 minuto. 8Lavar con agua corriente, secar 9Coloque una gota de aceite de inmersión encima de la lámina cubreobjetos y observar al microscopio con el objetivo de inmersión. Deberás diferenciar los distintos tipos de bacterias que observas, tanto por su tamaño, color, forma, etc. CUESTIONARIO 1Qué tipos de morfología (cocos, bacilos, espirales, etc) aparecen en los frotis de los cultivos de yogur, sarro y vinagre? 2¿Por qué las bacterias Gram positivas se tiñen de azul y las Gram negativas de rosado? Explique el fundamento de la tinción Gram. 3Dibuje y nombre 3 bacterias Gram positivas y 3 Gram negativas (consulta libros de microbiología). 4Complete la siguiente figura, indicando las partes del microscopio óptico.

14

15

PRACTICA Nº 5
OBSERVACIÓN Y RECONOCIMIENTO DE CÉLULAS EUCARIOTAS
I. FUNDAMENTO En 1939, en base a observaciones realizadas por los científicos alemanes Schleiden y Schwan, se plasmó la teoría celular, la cual produjo un cambio radical en las ciencias biológicas. Esta teoría postula que los “cuerpos de todos los animales y vegetales están formados de células y que solo pueden aparecer nuevas células por división de las células preexistentes”. De ahí que los organismos por muy sencillos que sean están constituidos por unidades vivas denominadas células. La célula eucariota es más compleja que la célula procariota y contiene, a diferencia de esta última, núcleo celular. Los organismos más simples (protozoarios) están constituidos de una sola célula eucariota mientras que los más complejos o multicelulares están formados por un gran número de células eucariota que se hallan organizadas en tejidos, órganos y sistemas. II. OBJETIVOS

Observar y caracterizar células eucariotas de tipo vegetal (epidermis de cebolla y mucosa bucal).
Observar y caracterizar células eucariotas de tipo animal (epitelio bucal, tejido adiposo y sangre). III. MATERIALES Encontrarás en el laboratorio Microscopio óptico Cubeta de tinción Lugol  Frasco lavador Mechero de Alcohol  Alcohol absoluto Deberás traer de casa Cebolla Hisopos Tocino Agua estancada en frasco oscuro Materiales de disección: tijera, pinza, estilete. IV. PROCEDIMIENTO 4.1. Observación de células vegetales (Células epiteliales de Allium cepa) Las células de la epidermis de las hojas internas del bulbo de la cebolla, son de forma alargada y bastante grande. La pared celular celulósica se destaca muy clara teñida por el colorante. Los núcleos son grandes y muy visibles. En el citoplasma se distinguen algunas vacuolas grandes débilmente coloreadas. 1Separe una de las capas del bulbo de la cebolla. Con ayuda de una pinza desprenda la membrana epidérmica que cubre la parte interna de la cebolla y extiéndala en el portaobjetos. 2Utilizando una hoja de afeitar obtenga una porción de medio centímetro cuadrado, cúbrala con una

Lanceta estéril Hematoxilina Formol Eosina Sudan III

Láminas portaobjeto y cubreobjeto Gotero Bisturí u hoja de afeitar Levadura de pan

16

gota de lugol, coloque cuidadosamente el cubreobjeto y observe en el microscopio. 3Reconozca las partes de la célula vegetal. 4.2. Observación de organismos unicelulares 1 Coloque una gota de agua estancada sobre un porta objeto y cubran con una laminilla. 2 Observe con el objetivo de menor aumento. 3 Ajuste el diafragma para incrementar el contraste. 4 Observe la forma, tamaño y movimiento de los organismos unicelulares (ver figura adjunta).

17

Protozoarios más representativo

4.3. Observación de levaduras del pan

1 Diluya un trocito de levadura de pan (Saccharomyces cerevisiae) con agua destilada, en un tubo de
ensayo. 2 Observe con el objetivo de mayor aumento. 3 Ajuste el diafragma para incrementar el contraste. 4 Observe la forma y tamaño de estos organismos. 4.4. Observación de células animales (Epitelio bucal) El azul de metileno tiñe intensamente el núcleo y con menos color el citoplasma de las células. Éste suele ser algo granuloso. 1Con un hisopo limpio extraiga suavemente la mucosidad de la cavidad bucal. 2Deposite la mucosidad extraída en el centro de una lámina portaobjetos y extiéndalo con un frotis. 3Agregue unas gotas de AZUL de metileno y espere 3 minutos. 4Elimine el exceso de colorante utilizando agua y coloque un cubreobjetos. 5Observe la muestra a menor aumento y localice: células asociadas y dobladas. 6Luego visualice a mayor aumento y reconozca los componentes celulares. 4.5. Observación de células animales (Tejido adiposo) El Sudan III es un compuesto que tiñe lípidos de color rojo intenso. En el tejido adiposo, que contiene gran cantidad de grasas, se observarán los adipocitos teñidos por el Sudan III. 1Con ayuda de un bisturí, cortar una fina capa de grasa de tocino 2Colocarla en un portaobjetos y cubrirla con unas gotas de formol. Dejar actuar 4 minutos. 3Lavar la muestra con agua y cubrirla con unas gotas de Sudán III. Dejar actuar unos 5 minutos. 4Volver a lavar la preparación con agua, cubrirla con un cubreobjetos 5Observar al microscopio. 4.6. Observación de células animales (Sangre) Al microscopio las células sanguíneas se verán predominantemente los glóbulos rojos, hematíes o eritrocitos teñidos de color rojo por la eosina. No tienen núcleo y son más delgados por el centro que por los bordes. Los glóbulos blancos o leucocitos se identifican fácilmente por la presencia de núcleo, teñido de morado por la hematoxilina. Hay varias clases de leucocitos: Linfocitos: de tamaño aproximado al de los glóbulos rojos, tienen un solo núcleo que ocupa casi todo el glóbulo. -Monocitos: son los leucocitos mayores, poco frecuentes normalmente, núcleo grande, redondo, son los más móviles y su función principal es la fagocitosis. -Polimorfonucleares: núcleo fragmentado o arrosariado. Pueden ser eosinófilos, con abundantes granulaciones teñidas de rojo por la eosina, neutrófilos y basófilos.

Los eosinófilos, con granulaciones abundantes de
color rojizo y el núcleo teñido de color azul marino. Estos glóbulos aumentan su número en caso de parasitosis o procesos alérgicos.

Los basófilos presentan un núcleo teñido de rojo y
las granulaciones del citoplasma de color muy oscuro. -Las plaquetas no son visibles ya que precisan una técnica especial de tinción.

18

Efectúa los siguientes pasos para ambas coloraciones, Wright y Hematoxilina-Eosina:

1 Con ayuda de una lanceta desechable, realice una punción del pulpejo del dedo anular de la mano
izquierda, previa desinfección con algodón y alcohol. 2 Tome una gota de sangre y haga un frotis fino sobre el portaobjeto 3 Colocar el frotis extendido ya seco, sobre una base plana en posición totalmente horizontal. Para la coloración de Wright:

1Coloree con unas gotas de colorante Wright, inmediatamente agregar sobre el colorante el mismo
numero de gotas de agua destilada y mezclar rápidamente, soplando suavemente hasta que se forme una capa plateada . 2 Dejar reposar la mezcla por 8 - 10 minutos, observando la intensidad de color. 3Lave con agua corriente y dejar secar al medio ambiente, si es posible con la lamina en forma vertical. 4Observe al microscopio. Utilice el objetivo de 100X para la observación de las células y núcleos. 5Diferencie las diferentes formas de núcleo en los neutrófilos, basófilos , eosinófilos, monocitos y linfocitos. 6Dibuje cada forma de núcleo. Para la coloración de Hematoxilina-Eosina: 1Colocar el frotis de sangre sobre la cubeta de tinción y añadir unas gotas de alcohol absoluto y dejar que el alcohol se evapore para fijar la preparación. 2Cubrir con unas gotas de hematoxilina y dejar actuar durante 15 minutos. Evitar la desecación del colorante agregando más líquido. 3Lavar la preparación y añadir unas gotas de eosina dejándola actuar 1 minuto. 4Volver a lavar hasta que no queden restos de colorante. 5Dejar secar aireando el porta o bien al calor muy lento de la llama del mechero. 6Observar al microscopio. Utilice el objetivo de 100X para la observación de las células y núcleos. Diferencie las diferentes formas de núcleo en los neutrofilos, basofilos, eosinofilos, monocitos y linfocitos. Dibuje cada forma de núcleo. CUESTIONARIO 1¿Qué diferencias observó entre la célula vegetal y la animal? 2 Diseñe un cuadro donde aparezcan las principales diferencias entre las células bacterianas y las animales. 3Aliste 10 organismos unicelulares patógenos para el ser humano 4¿Qué es un protozoario?. ¿Cuáles son sus características mas importantes? 5¿Qué protozoarios patógenos son responsables de las siguientes enfermedades?. Especificar cual es el agente etiológico, agente vector, y en que consiste cada uno de ellos. a) Malaria terciaria. b) Disentería. c) Trychomonas o vaginitis. d) “Uta” o espundia e) Enfermedad de Chagas. 6¿Por qué los eritrocitos se tiñen con eosina y leucocitos con hematoxilina? 7¿Por qué hay que teñir las células adiposas con Sudán III? ¿Para qué sirve el formol?

19

PRACTICA Nº 6
OBSERVACIÓN DE LA PERMEABILIDAD CELULAR
I. FUNDAMENTO La membrana celular es una bicapa lipídica fluida y semi permeable, ya que permite el paso de algunos solutos hacia el interior de la célula. Según el medio en el que se encuentre la célula, la membrana dejará pasar algunos solutos, modificando así la turgencia de la célula.

Se dice que un medio es hipertónico, cuando la concentración del soluto en la solución es mayor en relación con otro medio de solución. Por ejemplo, si tenemos dos soluciones, la solución 1 con agua destilada y la solución 2 con una solución de azúcar al 10%, se dice que la solución 2 de azúcar es hipertónica en relación a la solución 1. Por el contrario, la solución 1 es hipotónica en relación a la solución 2 azucarada, es decir que la concentración del soluto es menor en relación con el otro medio. Un medio es isotónico, cuando la concentración de soluto es igual en ambos medios. La membrana celular permite el transporte de sustancias de manera selectiva. Muchas sustancias, además del agua, entran a la célula y salen de ella por efecto de los gradientes de concentración, aunque sólo unas cuantas (CO2 y O2) puedan hacerlo tan fácilmente como el agua. Si una membrana celular se deja atravesar por una sustancia, se dice que es permeable a dicha sustancia. El volumen celular cambia cuando el agua penetra o sale de la célula por un proceso denominado osmosis. II. OBJETIVO. 2.1 Observar y describir los fenómenos de difusión y ósmosis y su importancia en el intercambio de sustancias en la célula. III. MATERIALES Encontrarás en el laboratorio. - Microscopio óptico - Agua destilada - Tubos de ensayo - Algodón - Gradillas - Marcador de vidrio - Solución hipotónica NaCl 0.065 M - Ligadura - Solución hipertónica NaCl al 2% - Alcohol corriente - Solución isotónica de NaCl al 0.9% (suero fisiológico)

20

Deberás traer de casa - Láminas Portaobjetos y Cubreobjetos - Lanceta hematológica - 3 Goteros - 3 huevos - ½ litro de vinagre blanco - 200 gr. sal común IV. PROCEDIMIENTO

Parte A
1En tres tubos de ensayo numerados coloque: -1 ml. de solución hipotónica NaCl 0.01 % -1 ml. de solución isotónica de NaCl al 0.9% (suero fisiológico) -1 ml. de solución de hipertónica NaCl al 2%.

2Obtener 2ml de sangre venosa con la lanceta hematológica en un tubo limpio con heparina
3Dejar caer 5 gotas de sangre en cada uno de los tubos con un gotero. 4Agite los tubos y dejar en reposo durante 2 ó 3 minutos. 5Con un gotero coloque en una lámina portaobjeto una gota de cada uno de los tres tubos. 6Luego examine en el microscopio su aspecto. Observar qué efecto ha tenido las distintas soluciones sobre la morfología del eritrocito y explicar por qué.

Parte B
1. Colocar los tres huevos en un vaso de precipitación de 1 litro y verter el vinagre hasta cubrir completamente los huevos. Debe realizarse este proceso 24 horas antes de la práctica. 2. Al momento de la práctica lavar con mucho cuidado con agua de caño. 3. Frotar cuidadosamente con los dedos para sacar la cáscara por el lado de cámara de aire. Realizar este proceso hasta tener casi un tercio del huevo libre de cáscara. 4. Coloquen agua de caño en uno de los vasos de precipitación de 100ml y ubiquen allí uno de los huevos. El agua debe cubrir al huevo. 5. En otro vaso de precipitación colocar un huevo en la mezcla muy concentrada de sal en agua y colocar allí otro de los huevos. 6. Llenar el tercer vaso con agua destilada y poner allí el tercer huevo. 7. Dejar por una hora y observar. NOTA: En todos los vasos de precipitación, los huevos deben quedar sumergidos en el líquido. TABLA: Observación de resultados Solución de Sal Huevo Agua de caño Agua destilada

21

CUESTIONARIO
1. ¿Qué es una solución isotónica, hipotónica e hipertónica?. 2. Definir: a) Osmosis b) Difusión c) Diálisis d) Turgencia e) Plasmólisis f) Fagocitosis g) Pinocitosis 3. ¿Qué sucedería si colocara su muestra de sangre en glucosa al 5%? 4. ¿Cuál huevo se salió de su cáscara?, ¿En qué medio líquido estuvo sumergido? 5. ¿Cuál huevo se hundió más en su cáscara?, ¿En qué medio líquido estuvo sumergido? 6. ¿Cuál huevo conservó su volumen inicial?, ¿En qué medio líquido estuvo sumergido?

22

PRACTICA Nº 7
OBSERVACIÓN DEL MOVIMIENTO CELULAR. CICLOSIS
I. FUNDAMENTO El citoplasma celular esta formado por el hialoplasma y el morfoplasma. El hialoplasma es un medio acuoso, con un 85% de agua en el cual esta disuelta gran cantidad de moléculas formando una solución coloidal; prótidos (AA, enzimas, proteínas estructurales), lípidos, glúcidos (polisacáridos, metabolitos), ácidos nucleicos (nucleótidos, nucleósidos, ADN, ARN, ARNt, ARNr) sales e iones. El hialoplasma es un medio dinámico, ya que puede pasar del estado de sol a gel acumulando moléculas que establecen enlaces entre si y aumentando la viscosidad; pueden invertirse el proceso pasando el hialoplasma a sol al diluirse hasta que se separan las moléculas, esto permite la creación de corrientes internas o ciclosis y algunas células pueden emitir prolongaciones del citoplasma o SEUDOPODOS como órganos de desplazamiento. II. OBJETIVOS 2.1. Explicar los movimientos citoplasmáticos III. MATERIALES Encontraras en el laboratorio - microscopio compuesto - lugol Deberás traer de casa - Hoja de Elodea IV. PROCEDIMIENTO 4.1. Movimientos Citoplasmaticos: Ciclosis 1. Colocar una hoja de Elodea sobre una lamina portaobjetos 2. Agregar una gota de agua y colocar la laminilla 3. A menor y mayor aumento observar las células e identificar los cloroplastos 4. Con abundante luz observar los desplazamientos del citoplasma conjuntamente con los cloroplastos

PRACTICA Nº 8
OBSERVACIÓN DE CILIOS Y FLAGELOS
I. FUNDAMENTO El movimiento ciliar esta adaptado al medio liquido y es cumplido por pequeños apéndices especialmente diferenciados. Se trata de filamentos contráctiles variables en numero y tamaño, que reciben el nombre de flagelos, si son escasos y largos y cilios, si son cortos y numerosos. Estas prolongaciones motoras se presentan con relativa frecuencia en toda la escala zoológica y en algunas células vegetales. En los protozoarios, particularmente en los infurios; hay centenares o miles de pequeños cilios cuyo movimiento permite al organismo desplazarse con rapidez en el medio líquido. En regiones especiales de estos infusorios ciertos cilios se fusionan y forman apéndices cónicos más gruesos denominados CIARIOS, o las membranas conocidas como ondulantes. En Protozoarios, toda la clase flagelados se caracteriza por la presencia de flagelos. Entre los metazoarios, solo los espermatozoides tienen la propiedad de desplazarse como células aisladas por medio de esos apéndices. En cambio es relativamente fácil encontrar células epiteliales provistas de cilios vibrátiles y capaces de constituir verdaderas laminas ciliadas del cuerpo y determinar el movimiento del animal como es el caso de algunos platelmintos y nemertinos, larvas de equinodermos, moluscos y anélidos. II. OBJETIVOS 2.1. Reconocer el movimiento ciliar en Protozoos y Metazoos III. MATERIALES Encontraras en el laboratorio - microscopio compuesto - Estereoscopio - Ringer anfibio - Set de coloración neutra: Wrigth - Mechero de alcohol - Cajas Petri Deberás traer de casa

-

Sapo (Bufo spinciosus) Pipetas Pasteur Laminillas porta y cubreobjetos Agua estancada Tabla de disección

IV. PROCEDIMIENTO 4.1. Observación de cilios en epitelio bucal de sapo 1. Obtenga un sapo espinal, seccionando el neuro eje entre la medula espinal y el bulbo raquídeo 2. Coloque el animal en posición de cubito dorsal en una tabla de disección 3. Pasando un hilo grueso a través de la mandíbula inferior, fijándolo a la tabla de disección de modo que la boca del sapo quede abierta 4. Humedecer frecuentemente el epitelio bucal con solución Ringer anfibio 5. Sobre una zona determinada del epitelio bucal del paladar del sapo, colocar una pizca de carbón animal

6. Luego con la ayuda del estereoscopio, determine la dirección y sentido del movimiento
ciliar. Esquematizar 4.2. Observación de cilios en Protozoarios 1. Con una pipeta Pasteur, obtener una muestra de cultivo de protozoarios y realizar en fresco 2. Observar a menor y mayor aumento un Paramecium 3. Identificar los cilios en constante movimiento. Esquematizar 4.3. Observación microscópica de flagelo en espermatozoide

1. 2. 3. 4.

Sacrificar un ratón macho por dislocamiento cervical Extraer los testículos y colocarlos en solución salina al 0,67% Dividir el testículo en cuatro partes Cada parte se coloca en una lamina portaobjeto y aplastar ligeramente 5. Dejar secar por espacio de 15 minutos y colorear con Wrigth

PRACTICA Nº 9
OBSERVACIÓN DE LAS INCLUSIONES CITOPLASMATICA

I. FUNDAMENTO Todas las funciones intracelulares (síntesis de proteínas, replicación de DNA y rutas metabólicas en general) son realizadas gracias una compleja organización de las organelas. Una célula eucariota típica contiene organelas membranosas (retículo endoplasmático, aparato de golgi, peroxisomas, mitocondrias, etc.) y organelas no membranosas (ribosomas, proteosomas, etc.). Todas ellas efectúan una función puntual en la célula que le permite su supervivencia y replicación. La supervivencia de la célula depende, entre otros factores, de la obtención de energía neta. Dicho proceso está a cargo de las mitocondrias y/o de los cloroplastos. Las mitocondrias se encuentran en mayor número en células animales pero también pueden presentarse en células vegetales, mientras que los cloroplastos son exclusivos de células vegetales y algunas bacterias fotosintéticas. Las mitocondrias oxidan moléculas orgánicas utilizando oxígeno del aire como aceptor de electrones y forman ATP. Los cloroplastos capturan energía de la luz y la transforman en ATP mediante el proceso denominado fotosíntesis. II. OBJETIVOS 2.1. Observar y diferenciar las inclusiones citoplasmáticas: cromoplastos y cloroplastos. III. MATERIALES Encontrarás en el laboratorio: - Microscopio óptico - Verde de Janus - Agua destilada - Lugol Deberás traer de casa: - Hojas de Elodea (planta acuática que se conseguir en las tiendas donde venden pescaditos) - Hisopo - Materiales de disección: tijera, pinza,) - Estilete - Láminas portaobjetos y cubreobjetos -Tomate - Gotero

IV. PROCEDIMIENTO 4.1. Observación de cromoplastos en células de pulpa de tomate La pulpa del tomate nos muestra las células generalmente bastante sueltas unas de otras. En el citoplasma se percibe una serie de gránulos rojizos-anaranjados que son los cromoplastos. El núcleo puede llegar a observarse por su típico aspecto y tamaño. Es frecuente la presencia de gránulos de almidón de forma arriñonada. En las células menos alteradas por la compresión se ven grandes vacuolas incoloras. 1Cortar con el bisturí un pequeño trozo de uno o dos milímetros de grosor, de la parte pulposa del tomate. 2Llevarlo sobre un porta, sin poner agua. 3Poner el cubre-objeto y comprimir suavemente la preparación. 4Observar al microscopio 4.2. Observación de Leucoplastos en células de maíz 1. Obtener finos raspados de la semilla de maíz 2. Hacer preparados en fresco 3. Llevar al microscopio y a menor aumento y mayor aumento observar el hilio y las estrías de los granos de almidón 4. Esquematizar CUESTIONARIO

1¿Qué función cumplen las inclusiones citoplasmática en las células vegetales y animales,
respectivamente?

PRACTICA Nº 10
OBSERVACIÓN DE ORGANELAS. MITOCONDRIAS Y CLOROPLASTOS

I. FUNDAMENTO La supervivencia de la célula depende, entre otros factores, de la obtención de energía neta. Dicho proceso está a cargo de las mitocondrias y/o de los cloroplastos. Las mitocondrias se encuentran en mayor número en células animales pero también pueden presentarse en células vegetales, mientras que los cloroplastos son exclusivos de células vegetales y algunas bacterias fotosintéticas. Las mitocondrias oxidan moléculas orgánicas utilizando oxígeno del aire como aceptor de electrones y forman ATP. Los cloroplastos capturan energía de la luz y la transforman en ATP mediante el proceso denominado fotosíntesis. II. OBJETIVOS 2.1. Reconocer y diferenciar las organelas: Mitocondrias y Cloroplastos III. MATERIALES Encontrarás en el laboratorio: - Microscopio óptico - Verde de Janus - Agua destilada - Lugol Deberás traer de casa: Hojas de Elodea (planta acuática que se conseguir en las tiendas donde venden pescaditos) Hisopo Materiales de disección: tijera, pinza Estilete Láminas portaobjetos y cubreobjetos Gotero

IV. PROCEDIMIENTO 4.1. Observación de mitocondrias en células epiteliales humanas 1. Preparar un frotis de epitelio bucal con un hisopo. 2. Secar al medio ambiente. 3. Agregar unas gotas de Verde de Janus y dejar reposar por 3 minutos. 4. Elimine el exceso del colorante con agua destilada. 5. Observe al microscopio y describa la forma de las mitocondrias en la célula. 4.2. Observación de cloroplastos en células de Elodea

1 En un portaobjetos coloque una porción pequeña de hoja de Elodea y agregue una gota de agua.
2 Cubrir la muestra con una lámina portaobjetos. 3 Aprecie la forma de los cloroplastos y el movimiento de estos.

CUESTIONARIO 1. ¿Qué función cumplen los cloroplastos y mitocondrias en las células vegetales y animales, respectivamente?

PRACTICA Nº 11
PRIMERA PARTE: EXTRACCIÓN DE ADN
I. FUNDAMENTO El ADN es un polímero de desoxiribonucleótidos, que en eucariotes es el componente de la cromatina o material genético. En la cromatina el ADN se encuentra asociado a proteínas conocidas como nucleoproteínas de tipo histonas, protaminas y en menor proporción con proteínas de tipo ácidas. Para extraer el ADN sin arrastrar sus proteínas asociadas se podría emplear soluciones ácidas. Sin embargo, éstas soluciones podrían dañar la estructura de la hebra, de modo que se prefiere emplear solventes orgánicos como cloroformo, el cual extrae proteínas dejando insoluble al ADN.

La extracción de ADN de una muestra celular se basa en el hecho de que los iones salinos son atraídos hacia las cargas negativas del ADN, permitiendo su disolución y posterior extracción de la célula. Se empieza por lisar (romper) las células mediante un detergente, vaciándose su contenido molecular en una disolución tampón en la que se disuelve el ADN. En ese momento, el tampón contiene ADN y todo un surtido de restos moleculares: ARN, carbohidratos, proteínas y otras sustancias en menor proporción. Las proteínas asociadas al ADN, de gran longitud, se habrán fraccionado en cadenas más pequeñas y separadas de él por acción del detergente. Sólo queda, por tanto, extraer el ADN de esa mezcla de tampón y detergente, para lo cual se utiliza alcohol isoamílico, probablemente el único reactivo de esta práctica que no suele haber en una cocina. La secuencia general de extracción es la siguiente: 1Liberación del ADN en forma soluble por medio de la destrucción de los sistemas membranosos de los tejidos (membrana celular y nuclear). 2Separación de los complejos de nucleoproteína por denaturación de la parte proteica. 3Separación del ADN de las otras macromoléculas por solubilidad diferencial. 4Precipitación del ADN por insolubilidad en alcohol y bajas temperaturas. II. OBJETIVOS

1El objetivo fundamental de esta práctica es utilizar unas sencillas técnicas para poder extraer el ADN de un tejido animal y por el aspecto que presenta, confirmar su estructura fibrilar. 2A partir de la longitud enorme de las fibras también se confirma que en el núcleo el ADN se encuentra replegado. III. MATERIALES Encontrarás en el laboratorio: - 2 Tubos de prueba de 20 ml - Vaso de precipitación de 500ml. - 5 Baguetas - Medio de homogenización: - Etanol helado -Lauril Sulfato de Sodio (SDS o -Hielo SLS) 50 g - 5 Pipetas de 10ml - Cloruro de Sodio 8. 770 g - Baño María - Citrato de Sodio 4.110 g - Mortero con pilón - EDTA 0.292 g 0 Debes traer de casa - Choro (10 por mesa) o hígado de pollo (100 g) - Guantes - Materiales de disección: tijera, pinza, estilete. IV. PROCEDIMIENTO Para la extracción DE ADN del manto de choro, con etanol, seguiremos los siguientes pasos. 4.1. Homogenización del Tejido El método para desintegrar el tejido debe estar adaptado a las características de éste. Para grandes volúmenes de tejidos blandos, suelen usarse licuadoras esencialmente iguales a las licuadoras domésticas. Para volúmenes menores, en general es suficiente un MORTERO y un pilón. Tejidos más resistentes, como por ejemplo hueso o diente, necesitan tratamientos mecánicos especiales. Aquellos tejidos con células cuya pared celular es resistente, como por ejemplo vegetales, hongos o bacterias, requieren también condiciones drásticas. Uno de los métodos más utilizados consiste en congelar la muestra en nitrógeno líquido y, manteniéndola congelada, pulverizarla con un mortero. Así, además de desintegrar la muestra, se logra que ésta se mantenga a muy baja temperatura durante el tratamiento, con lo cual se evita la acción de enzimas endógenas que pudieran degradar el material de interés. En esta práctica se empleará un método de ruptura con mortero (sin congelamiento). La principal ventaja de este método es que se adapta bastante bien a tejidos muy diversos. Asimismo, dado que se opera a temperatura ambiente, las ribonucleasas celulares pueden degradar parcialmente las moléculas de ARN. Para ayudar a la solubilización de los componentes celulares, a la ruptura de membranas y de complejos protéicos, la solución de lisis contendrá un detergente iónico (dodecilsulfato de sodio, SDS). Este detergente dispersa los componentes de las membranas y desnaturaliza las proteínas. La solución de lisis contiene además el agente quelante de cationes divalentes, EDTA. Esto impide la acción de las ADNasas (dependientes de Mg ), aunque no tiene efectos sobre la mayor parte de las ribonucleasas. Seguir los siguientes pasos:
2+

1Las células se homogenizarán en un mortero empleando el medio de homogenización. ES
OBLIGATORIO el uso de guantes en todo momento para evitar la contaminación de la muestra con DNAasa proveniente del sudor de las manos que pueda degradar nuestras

muestras de ADN. 2Se lisarán las células agregando 20 ml de la solución de homogenización por cada gramo de tejido con que se inició el proceso. Los componentes como el SDS, permitirá por una parte la separación de las proteínas asociadas a la cromatina y por otra parte la ruptura de membranas. El NaCl produce el estallido de los núcleos para liberar así las fibras de cromatina. El EDTA es un agente quelante que inactiva a las DNAasas. 3Incubar !a mezcla en un Baño María a 60°C por 15 minutos exactos. El calor ablandará el tejido permitiendo que los componentes de la solución homogenizadora ingrese a la célula. Además, esta temperatura denatura muchas enzimas que interfieren con el procedimiento. 4Enfriar rápidamente la preparación en hielo, por 10 minutos a fin de detener cualquier proceso degradativo del ADN. 4.2. Precipitación del ADN La precipitación de los ácidos nucleicos permite su purificación y concentración. Se basa en la simultánea neutralización de las cargas negativas y deshidratación de la molécula, lo cual posibilita su agregación y precipitación. La precipitación es un fenómeno reversible (mediante la resuspensión en soluciones acuosas) y no debe ser confundido ni con la desnaturalización (potencialmente reversible) ni con la degradación (irreversible) de los mismos. Efectuar los siguientes pasos: 1Lentamente, agregar etanol helado por el borde interno del recipiente hasta que comience a aparecer una consistencia blanca que significa que el ADN ha precipitado. 2Suavemente, a medida que se agrega el etanol helado, girar enrollando a la vez con una bagueta de vidrio. 3Reconoce 3 fases en tu solución: la del alcohol (que flota en agua), la de tu tejido triturado (abajo del todo) y la interfase entre los 2 que contiene ADN precipitado. 4Poco a poco haciendo estos movimientos en una sola dirección, se logrará apreciar el ADN en la bagueta, asemejando una madeja de un hilo sumamente fino o como copos de algodón. Nota importante. El producto filamentoso obtenido de esta extracción no es ADN puro ya que, entremezclado con él, hay fragmentos de ARN. Una extracción "profesional" se realiza añadiendo enzimas que fragmentan las moléculas de ARN e impiden que se unan al ADN (protocolos de PURIFICACIÓN de ADN).

SEGUNTA PARTE: ELECTROFORESIS
I. FUNDAMENTO El problema de realizar separaciones de biomoléculas grandes es enfrentado frecuentemente en las ciencias de la vida, tanto para análisis cuali- como cuantitativos de mezclas o de preparaciones individuales. En la mayoría de casos es deseable causar el mínimo de daño a las moléculas de manera que sus propiedades no cambien de manera significativa. Los métodos actuales para la separación de biomoléculas descansan por lo tanto en procesos físicos que causan el mínimo de desnaturalización, lo cual resulta en la máxima retención de cualquier actividad biológica. Un gran grupo de métodos de separación están basados en algunas propiedades químicas o biológicas, o en interacciones de la molécula que se investiga, y algunas otras están basadas en diferencias en pesos moleculares o cargas netas, o a veces una combinación de las dos propiedades. Los métodos electroforéticos pueden diseñar se para explotar cualquiera de los dos, o ambos parámetros, aunque las diferencias en tamaño son las principales en el caso de las separaciones de ácidos nucleicos. La electroforesis en geles de agarosa es una técnica común en los laboratorios de Biología Molecular. El proceso consiste en la aplicación de una diferencia de voltaje a una muestra de ADN que se encuentra inmersa en un gel de agarosa, y esta a su vez en bañada por un buffer determinado. La generación de polos opuestos provoca la migración del ADN del polo cargado negativamente (Cátodo) al polo cargado positivamente (Anodo), debido a que el ADN tiene una carga neta negativa. Los geles de agarosa son el medio más popular para separaciones electroforéticas de ácidos nucleicos de mediano y gran tamaño. Las concentraciones más típicas de agarosa van de 0.3 hasta 2.5 %, y esta concentración depende de los tamaños de los ácidos nucleicos a separar. Aunque los geles de agarosa carecen de fuerza mecánica (especialmente los más diluidos), la manipulación se facilita por el uso de geles horizontales, los cuales pueden ser soportados por lámina de vidrio o de plástico El gel resultante es fotografiado en un aparato llamado transiluminador, presencia de bromuro de etidio, para poner en evidencia los fragmentos de ADN en el gel. En la presente práctica analizaremos la fotografía de un gel de agarosa y observaremos las distintas bandas de ADN que en él aparecen, discutiendo la razón por las que unas aparecen más arriba que otras. Realizaremos un análisis como el que se hace en ensayos de diagnóstico molecular y de clonación. II. OBJETIVOS -Comprobar la movilidad del ADN en un gel de agarosa -Analizar la utilidad de esta técnica en ensayos de biología molecular aplicada III. MATERIALES Y MÉTODOS Analizaremos la siguiente Lámina de un gel de agarosa y discutiremos cuál es el significado y la interpretación de esas bandas en el gel.

Discutir con el profesor: En el gel aparecen 3 carriles o calles, cada uno con una muestra distinta (M, 1 y 2). Los pocillos son jequecillos hechos en el gel para introducir ahí la muestra. 1¿qué hay en el primer carril? ___________________________________ 2qué tamaño tienen las 6 distintas bandas que aparecen en el carril 1? ______________ 3en la muestra 1, qué tamaño aproximado tienen las bandas de ADN? 4¿por qué aparece RNA en el gel y por qué aparece tan abajo, comparado al ADN? 5en la muestra 2, ¿los trozos de ADN son los mismos que en la muestra 1? 6¿qué significado tiene que algunas bandas sean más gruesas que otras? 7¿qué hubiera esperado encontrar si corría un gel con su ADN recién extraído? Dibujuelo. ______________________________________________________ CUESTIONARIO 1Esquematice los pasos seguidos en la práctica para extraer ADN de las células animales. 2¿Qué es la agarosa y qué importancia tiene en Biología Molecular? 3¿Qué es la poliacrilamida y cuál es su importancia en la biología Molecular? 4¿Qué paso hubiera sido necesario si se hubiera querido extraer proteínas y lípidos de la muestra homogenizada? 5Interprete el siguiente gel de agarosa, siendo lo más explícito posible.

PRACTICA Nº 12
DIVISIÓN CELULAR : MITOSIS
I. FUNDAMENTO

El ciclo celular es un proceso que consiste en la replicación de material genético y formación de
células hijas. Compromete dos etapas: La primera llamada interfase, donde no ocurre división celular propiamente dicha y la segunda de división celular (ver figura). Dependiendo del tipo de células donde se lleve a cabo, la división celular toma el nombre de Mitosis (si ocurre en células somáticas) o Meiosis (si ocurre en células germinales). La mitosis implica cuatro etapas: Profase, Metafase, Anafase y Telofase. En las dos primeras ocurre la duplicación de material genético y en las dos últimas se lleva a cabo la distribución de los cromosomas. El resultado final son dos células hijas diploides (2n).

II. OBJETIVOS Reconocer las distintas fases del ciclo celular en células somáticas de raíz de cebolla. III. MATERIALES Encontrarás en el laboratorio - Placa Petri - Orceína acética - Pinza de madera - Microscopio - Mechero de alcohol - Acido Acético

- Etanol 0 Traer el alumnado - Láminas portaobjetos y cubreobjetos - Papel toalla - Cebolla cultivada por 3 días - Materiales de disección: tijera, pinza punta fina. - Gotero estilete. IV. PROCEDIMIENTO Con 8 días de anticipación a la práctica preparar el cultivo de cebolla de la siguiente manera: En un vaso con agua, de preferencia de borde oscuro, colocar una cebolla mediana de tal manera que haga contacto la parte terminal de la cebolla con el agua y dejar en lugar semioscuro.

Preparación de la Muestra

1 Disponer de gran número de raíces de cebolla, haciendo cortes de la parte terminal
(aproximadamente de 0.5cm.) y depositar en una placa Petri. 2 Colorear con orceína por 10 minutos: contiene orceína A que interrumpe el proceso si se está dando en ese momento y reblandece la unión de las células muertas, así como orceína B que tiñe la cromatina o material hereditario. 3 Luego calentar la muestra sólo hasta que emane vapores por 2 veces consecutivas con intervalos de enfriamiento. 4 Trasladar las raíces a diferentes portaobjetos, separar solo el ápice (parte terminal de la raíz) y agregar una gotita de orceína y cubrir con el cubreobjeto. 5 Apretar la muestra suavemente con la yema de los dedos. 6 Secar el exceso de colorante con papel secante y llevar al microscopio para su observación a menor y mayor aumento.

Interfase

Profase Temprana

Profase Tardía

Metafase

Anafase Temprana

Anafase Tardía

Telofase Temprana

Telofase Tardía

Citocinesis

CUESTIONARIO 1¿Por qué hemos tomado muestras de la punta de las raicillas y no, por ejemplo, de una hoja de la cebolla, que habría resultado más sencillo? 2¿Qué diferencias y semejanzas existen entre la mitosis de una célula animal y una célula vegetal? 3¿Qué otros tipos de división celular conoces (tanto en eucariotas como en procariotas) que no sean el de la mitosis? 4¿Qué ocurriría si la mitosis no tuviese un control (no estuviese regulada) y las células estuvieran continuamente dividiéndose? 5Describa la fecundación en humanos

PRACTICA Nº 13
DIVISIÓN CELULAR : MEIOSIS
I. INTRODUCCIÓN La meiosis es un proceso celular, ligado a la reproducción sexual, por el cual, la célula madre de naturaleza diploide, da origen a los gametos de naturaleza haploide, de tal manera que en la fecundación se reestablece el número diploide de cromosomas. Así, mientras la mitosis es un proceso de división celular con formación de dos núcleos hijos con el mismo número de cromosomas que la célula original, en la meiosis en cambio hay dos divisiones celulares con reducción del número de cromosomas a la mitad. La meiosis es un proceso citológico que comprende dos divisiones celulares. En la primera división meiótica ocurre una serie de intercambios de material genético entre los cromosomas homólogos. Este fenómeno es un proceso complejo que comprende una larga profase en la que, para su mejor estudio y comprensión, se distinguen los estadios: Leptoteno, Cigoteno, Paquiteno, Diploteno y Diacinesis. Entre la telofase I y el comienzo de la segunda división meiótica, a diferencia con la mitosis, no hay un período de síntesis y duplicación del ADN, por lo demás la división meiótica II, tiene lugar como la mitosis normal en cada una de las células haploides (meiocitos de segundo orden), resultantes de la división meiótica I. II. OBJETIVOS: Al finalizar la presente práctica los alumnos estarán capacitados para:

2.1 Reconocer y diferenciar los estados fisiológicos por los que atraviesan los cromosomas
durante el proceso meiótico en células animales. III. MATERIALES Y METODOS Un excelente material para la observación de los procesos de división celular lo constituyen insectos de la especie Grillos asimilis “grillo domestico” y Laplatacris sp “langosta”. En los individuos machos debe recuperarse el testículo después de la disección en el que se estudiará la meiosis en células de maduración (espermatocitos) de la zona proximal al canal deferente. El material a usar en el presente ejercicio es el siguiente: Grillo o saltamontes machos Microscopio Estereomicroscopio Mechero de alcohol Cloroformo Carmín acético Carnoy Solución salina 0.7% Placas petri Laminas, laminilla Algodón Papel filtro Estilete de punta fina

IV: PROCEDIMIENTO Anasteciar los animales en las placas petri, colocando dentro de un pedazo de algodón embebido en cloroformo. Disecar el animal con la ayuda del estereomicroscopio o lupas, colocándolo en posición dorsal. Separar los testículos adicionándoles la solución salina procurando no exponer los órganos al aire para evitar posibles desecaciones. Seccionar los testículos en partes pequeñas de 2 a 3 mm y colocarlos en un vial con fijador carnoy por espacio de 30 min. Traspasar los fragmentos a una luna de reloj que contiene carmín acético y lleve al calor del mechero hasta que entre en ebullición por espacio de 15 segundos de 5 a 7 veces.

-

-

Retire el fragmento del testículo con una pinza de punta fina y colóquela sobre un portaobjetos y agréguela una gota de carmín acético. Tape la preparación con una laminilla cubre objetos y sobre esta ponga un papel absorbente. Presione el cubre objetos con la yema del dedo pulgar y luego con la extremidad plana de un lápiz presionar un poco mas fuerte hasta convertir el material del porta objetos en una capa delgada (squash). Al realizar esta operación, tenga cuidado para no romper el cubre objetos. Limpie el exceso de colorante del porta objetos con papel higiénico y lleve el preparado al microscopio para su observación a menor y mayor aumento. Observar y esquematizar.

PRACTICA Nº 14
CÓDIGO GENÉTICO Y TRADUCCIÓN DE PROTEÍNAS

I. FUNDAMENTO El proceso de traducción, es decir, síntesis de novo de proteínas, ocurre en el citoplasma, específicamente en los ribosomas del retículo endoplasmático rugoso (en humanos). La síntesis de una proteína requiere que previamente el ARNm de ese gen haya sido transcrito en el núcleo y exportado al citoplasma. Aquí el ARNm, que contiene la información genética necesaria para codificar la proteína, se asociará a los ribosomas del RER y con la intervención de una compleja maquinaria proteica así como de los ARNt específicos para cada aminoácido, se llevará a cabo la traducción.

El ARNm porta los codones, tripletes de nucleótidos, que codifican para un aminoácido. Mientras que los ARNt portan los anticodones, que le indican qué aminoácido van a portar y llevar hasta el complejo ARNm-ribosomasenzimas. El código genético es la combinación de tripletes que tienen la información necesaria para codificar un aminoácido. Existen 64 codones en el código genético, que codifican para los 20 aminoácidos que forman las proteínas y que además contiene 1 codón de inicio de la traducción y 3 codones de finalización de la misma. En esta práctica analizaremos la degeneración del código genético, discutiremos por qué no es realmente universal y realizaremos la traducción de algunos genes en sus respectivas

secuencias de aminoácidos. II. OBJETIVOS -

Reconocer los codones y anticodones posibles para los aminoácidos que forman las proteínas. Analizar posibles mutaciones en los codones que alteren la secuencia de una proteína y con ello su función.

III. MATERIALES - Lámina de la tabla del Código Genético - Lámina de la tabla de las alteraciones del Código Genético en mitocondrias y otros organismos.

Lámina 1. CÓDIGO GENÉTICO

-

Lámina 2. MODIFICACIONES DEL CÓDIGO GENÉTICO

IV. MÉTODOS 4.1. Antes de solucionar los problemas planteados, determine: a. número de codones de inicio ________________________ b. número de codones de finalización ___________________ c. aminoácidos codificados por 1 sólo codón _________________ d. aminoácidos codificados por 2 codones ___________________ e. aminoácidos codificados por más de 3 codones ____________________________ f. ¿qué cambios se han producido en el código genético de mitocondrias en humanos? g. Lista de aminoácidos esenciales y no esenciales

4.2. Discuta con su profesor y responda: ¿Por qué algunos aminoácidos son codificados por 1 sólo codón mientras que otros son codificados por 2 o más codones? 4.3. Los siguientes problemas deberán ser solucionados en clase con ayuda del profesor: Primer problema: Transcripción y traducción Se tiene la siguiente secuencia de ADN (cadena codante) que es parte del gen de transferrina. 5´ ATGGCATCCTACGATCAGTATCCTATACGC 3´ ……… (EL GEN CONTINÚA) Determine: 1la secuencia no codante del respectivo trozo del gen 2la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen 3Utilizando la tabla del código genético, deduzca la secuencia de aminoácidos que codificará dicha cadena (considerando que se incubó el ADN en un extracto crudo de células de reticulocitos de conejo que contenía los respectivo ARNt, enzimas, ATP, GTP, etc.) Segundo problema. Mutaciones en la secuencia de nucleótidos La secuencia de ADN del gen de transferrina, del problema 1, ha sufrido mutaciones por el efecto de radiaciones UV. Se secuenció el gen mutado y la secuencia obtenida fue la siguiente: 5´ ATGGCATCGTACGAACAGTAGCCTATACGC 3´ ………..(EL GEN CONTINÚA) Determine: 1la secuencia del ARNm respectivo, transcrito a partir del trozo de dicho gen 2la secuencia de aminoácidos que, tras esas mutaciones, se codifica 3qué mutaciones han sido conservativas y cuales no. Tercer problema. Traducción en mitocondrias Se cuenta con parte de la secuencia del gen de la proteína de Fe-S, que participa en la cadena transportadora de electrones en la mitocondria, y que es codificada dentro de la misma. La secuencia es de la cadena de ADN codante: ……. 5´ CCGTCAGAACTCGAAGCTCCGGACTTAGCT 3´ …… Determine: 1la secuencia de aminoácidos codificada en la mitocondria, a partir de dicha cadena nucleotídica 2¿cuál serían los aminoácidos cambiados si dicho gen se codificara en el citoplasma?________ ____________________________________________________________________________________

APÉNDICE 1: Preparación de colorantes
1. Acido-Alcohol: (decolorante para tinción Ziehl-Neelsen)  Ácido clorhídrico concentrado ........................................................ 3 ml

 Etanol 95% ..................................................................................... 97 ml
2. Azul de metileno: Colorante de contraste para tinción de flagelos.  Azul de metileno................................................................................1 g  Agua destilada...............................................................................100 ml

3. Azul de metileno de Loeffler: Tinciones simples.  Solución de hidróxido potásico al 1%.................................................1 ml   Azul de metileno, sol. saturada en etanol al 95%...............................30 ml Agua destilada...............................................................................100 ml

4. Colorante para esporas:  Solución acuosa saturada de verde malaquita 5. Colorante para flagelos de Leifson:  Solución A . Fucsina básica .........................................................................1,2 g Etanol 95%.............................................................................100 ml  Solución B Ácido tánico................................................................................3 g Agua destilada.........................................................................100 ml Solución C Cloruro sódico..........................................................................1,5 g Agua destilada.........................................................................100 ml Para preparar la solución de uso, se mezclan cantidades iguales de las soluciones A, B y C y se guarda en frasco cerrado herméticamente en la nevera donde es estable durante varias semanas.

6. Cristal violeta: Paroa tinción Gram y tinción simple.  Cristal violeta (violeta de genciana)....................................................0,5 g  Agua destilada.................................................................................100 ml

7. Eosina: Para observación de células sanguíneas.  Eosina...............................................................................................0,3 g   Ácido acético glacial......................................................................0,025 ml Agua destilada...................................................................................100 ml

8. Fucsina diluida: Para tinción Gram y tinción simple.  Fucsina fenicada de Ziehl-Neelsen......................................................10 ml  Agua destilada.................................................................................100 ml

9. Fucsina fenicada de Ziehl-Neelsen: Para tinción ácido-alcohol resistente.  Fucsina básica......................................................................................1 g   Etanol 95%........................................................................................10 ml Fenol 5% en solución acuosa............................................................100 ml

10. Hematoxilina: Para observación de células sanguíneas.  Hematoxilina.........................................................................................2 g  Agua destilada......................................................................................1 l 11. Lactofenol: Para preparaciones microscópicas en fresco de mohos.  Ácido láctico.....................................................................................100 ml    Fenol................................................................................................100 g Glicerol.............................................................................................200 ml Agua.................................................................................................100 ml

12. Lactofenol al Azul Algodón: Para preparaciones en fresco y tinciones de mohos.
 Solución de azul algodón Sol. saturada de azul algodón (azul anilina soluble)......................10 ml Glicerol.....................................................................................10 ml Agua.........................................................................................80 ml Mezclar esta solución con lactofenol a partes iguales 13. Lugol: Solución de yodo para tinción Gram.  Yodo...................................................................................................1 g  Yoduro potásico..................................................................................2 g  Agua destilada.................................................................................300 ml 14. Orceína A: Tinción de cromosomas.  Orceína................................................................................................2 g    Ácido acético.....................................................................................45,8 ml Ácido clorhídrico 1 mol/l......................................................................8,3 ml Agua..................................................................................................45,8 ml

15. Orceína B: Tinción de cromosomas.  Orceína................................................................................................2 g

 Ácido acético.....................................................................................55 ml
 Agua..................................................................................................55 ml

16. Safranina: Colorante de contraste para tinción Gram (preferible a la fucsina) y esporas.  Safranina.........................................................................................0,25 g  Agua destilada..................................................................................100 m

Sign up to vote on this title
UsefulNot useful