Está en la página 1de 69

UNIVERSIDAD AUTÓNOMA DE SAN LUIS POTOSÍ

FACULTAD DE MEDICINA

MAESTRÍA EN CIENCIAS EN INVESTIGACIÓN CLÍNICA

“Asociación de la variante S72N del gen CRTC3 con la composición corporal


en una población adolescente de la ciudad de San Luis Potosí”

TESIS QUE PARA OBTENER EL GRADO DE:

Maestra en Ciencias en Investigación Clínica

PRESENTA:

LBT. América Susana Mares García

DIRECTOR DE TESIS:

Dr. en C. Antonio Augusto Gordillo Moscoso

ASESORES:

M. en C. Úrsula Fabiola Medina Moreno M. en C. Francisco Valadez Castillo


M. en C. Mauricio Pierdant Pérez Dra. en C. Leticia Yáñez Estrada
Dr. Víctor Mateo Saavedra Alanís

San Luis Potosí, S.L.P. Febrero 2014


INDICE DE FIGURAS

Contenido Página
Figura 1. Porcentaje de niños con sobrepeso y obesidad por país 8
Figura 2. Diferencias fenotípicas de los ratones con dieta alta en grasas. 12
Figura 3. Traslocación del CRTC defosforilado al núcleo y su efecto. 14
Figura 4. Localización cromosómica del gen CRTC3. 15
Figura 5. Localización de la Serina 72 de la proteína CRTC3. 15
Figura 6. Mecanismo de acción de la proteína CRTC3 mutada. 16
Figura 7. Fases de la PCR. 18
Figura 8. Patrón de bandas obtenidas por PCR-RFLP. 20
Figura 9. Asociación del genotipo con los niveles de colesterol total. 35
Figura 10. Asociación del genotipo con los niveles de LDL. 36
Figura 11. Asociación del genotipo con la circunferencia de la cadera. 36
Figura 12. Asociación del genotipo con el Porcentaje de Grasa Corporal. 37
Figura 13. Asociación del genotipo con la percentila del IMC. 37

1
INDICE DE CUADROS Y TABLAS

Contenido Página
Cuadro 1. Clasificación de la percentila del IMC según la CDC para 6
niños y jóvenes de 12 a 19 años.
Tabla 1. Prevalencia de sobrepeso y obesidad de 2006 a 2012 en 9
hombres y mujeres de 12 a 19 años.
Tabla 2. Comparación de las características de ratones knock-out vs 12
wild-type para el gen CRTC3.
Tabla 3. Resultados de la asociación entre la variante S72N y medidas 13
antropométricas en México-Americanos.
Tabla 4. Descripción de las variables antropométricas y perfil 29
glucolipídico de la población estudiada.
Tabla 5. Clasificación por percentila del IMC de la población. 30
Tabla 6. Descripción de las variables antropométricas y perfil 31
glucolipídico clasificados de acuerdo a la percentila del IMC.
Tabla 7. Descripción de las variables antropométricas y perfil 32
glucolipídico clasificados por percentila del IMC por sexo.
Tabla 8. Distribución de las frecuencias alélicas por sexo. 33
Tabla 9. Distribución de genotipos por percentilas del IMC y sexo. 33
Tabla 10. Interacción entre las variables explicativas: CRTC3 y SEXO. 34
Tabla 11. Asociación entre la variante S72N y las variables de salida. 35

2
ABREVIATURAS

IMC: Índice de Masa Corporal


IOTF: International Obesity Task Force
INSP: Instituto Nacional de Salud Pública
OMS: Organización Mundial de la Salud
ENN: Encuesta Nacional de Nutrición
ENSANUT: Encuesta Nacional de Salud y Nutrición
CDC: Centers for Disease Control and Prevention
ACT: Agua Corporal Total
MLG: Masa Libre de Grasa
PGC: Porcentaje de Grasa Corporal
MG: Masa Grasa
SNP: Single-Nucleotide Polymorphism
CRTC: Co-activador Transcripcional Regulado por CREB
NCBI: National Center for Biotechnology Information
PCR: Reacción en Cadena de la Polimerasa
ADN: Ácido Desoxirribo-Nucleico
dNTPs: Desoxi-Nucleótidos Tri-Fosfato
RFLP: Restriction Fragment Length Polymorphism
-/-: Genotipo knock out, ninguno de los alelos expresa el gen
+/-: Genotipo heterocigoto, sólo uno de los alelos expresa el gen
+/+: Genotipo wild type, ambos alelos expresan el gen
NOM: Norma Oficial Mexicana
AA: Genotipo homocigoto para el polimorfismo
AG: Genotipo heterocigoto para el polimorfismo
GG: Genotipo homocigoto para la secuencia original
ICC: Índice Cintura-Cadera
HDL: High Density Lipoprotein
LDL: Low Density Lipoprotein
VLDL: Very Low Density Lipoprotein

3
RESUMEN

OBJETIVO: Determinar si existe asociación entre la variante S72N del gen


CRTC3 y la composición corporal y/o la presencia de dislipidemias, en adolescentes
mexicanos.

MATERIALES Y MÉTODOS: Se obtuvieron medidas antropométricas,


bioimpedancia eléctrica, perfil glucolipídico y genotipo para el SNP rs8033595 del
gen CRTC3, obtenido por PCR-RFLP, de una muestra aleatoria de 48 alumnos de
secundaria de la Ciudad de San Luis Potosí. Para la genotipificación se extrajo ADN
genómico de muestras sanguíneas, se amplificó un fragmento del gen CRTC3 por
PCR punto final y se digirió con la endonucleasa BsrDI.

RESULTADOS: La prevalencia global de sobrepeso más obesidad en la


población estudiada fue de 35% y la frecuencia alélica del SNP rs8033595 fue del
32%. El polimorfismo rs8033595 del gen CRTC3 se asocia con mayores niveles de
colesterol total en sangre, LDL y circunferencia de cadera, en adolescentes del sexo
masculino.

CONCLUSIONES: El polimorfismo rs8033595 del gen CRTC3 se asocia


directamente con los niveles de colesterol total en sangre, LDL y la circunferencia de
la cadera en adolescentes del sexo masculino.

4
I. ANTECEDENTES

La prevalencia de obesidad y sobrepeso ha aumentado alrededor del mundo,


incluso en países en desarrollo se han vuelto tan comunes que ahora sustituyen a la
desnutrición y enfermedades infecciosas como los principales problemas de salud
pública.1

Aunque se ha demostrado que la obesidad es una enfermedad multifactorial en


la que interaccionan factores ambientales y genéticos, la gran variación entre
poblaciones humanas no ha permitido identificar un elemento que condicione a
desarrollar obesidad, o modifique el curso y/o la respuesta a tratamiento de la
misma.2

I.1 SOBREPESO Y OBESIDAD

La obesidad, incluyendo al sobrepeso como un estado premórbido, es una


enfermedad crónica caracterizada por el almacenamiento en exceso de tejido
adiposo en el organismo, acompañada de alteraciones metabólicas, que
predisponen a la presentación de trastornos que deterioran el estado de salud,
asociada en la mayoría de los casos a patología endócrina, cardiovascular y
ortopédica principalmente, y relacionada a factores biológicos, socioculturales y
psicológicos.3

I.2 ANTROPOMETRÍA

La mayoría de los estudios epidemiológicos sobre obesidad utilizan el Índice


de Masa Corporal (IMC), procedimiento simple y sin costo, que es un indicador de la
densidad corporal según lo determinado por la relación de peso con la altura
corporal. Se calcula al dividir el peso en kilogramos sobre la altura al cuadrado en
metros, resultando como unidad kg/m2. El IMC se correlaciona con la grasa corporal
(tejido adiposo), y su relación varía con la edad y el sexo.

En adultos, la Organización Mundial de la Salud (OMS) y la International


Obesity Task Force (IOTF), en la que han participado expertos de nuestro país,
5
definen el sobrepeso como riesgo para la salud cuando el IMC se encuentra entre 25
y 29.9 kg/m2 y la obesidad cuando es igual o mayor a 30 kg/m2.

En los niños y jóvenes, debido a que la constitución corporal varía con la edad
y además depende del sexo, se utilizan las tablas de percentiles, estas toman en
cuenta dichas variables.

En México, el INSP en base a los resultados de la ENN de 1999 y la


ENSANUT de 2006, recomienda utilizar en niños de 2 años o más las gráficas
elaboradas en el Centro de Estadísticas de Salud en colaboración con los Centros
para el Control y la Prevención de Enfermedades (CDC) y la IOTF.4 El percentil es
comparado con niños/jóvenes de la misma edad y sexo.

En el Cuadro 1 se muestran las categorías que la CDC establece para niños y


jóvenes de 2 a 19 años.

Clasificación CDC IMC (kg/m2)


Bajo peso < percentila 5
Peso normal < percentila 85
Sobrepeso > percentila 85 < percentila 95
Obesidad > percentila 95

Cuadro 1. Clasificación de la percentila del IMC según la CDC para


5
niños y jóvenes de 12 a 19 años.

I.3 COMPOSICIÓN CORPORAL

Además de calcular el IMC es importante valorar la composición corporal; la


bioimpedancia eléctrica ha demostrado ser un método seguro, reproducible y
confiable. Es un método electro-físico por medio del cual se puede estimar el agua
corporal total (ACT), la masa libre de grasa (MLG) y el porcentaje de grasa corporal
(PGC) de cada sujeto. Su bajo costo, rápida operacionalidad, poca dificultad técnica
y su carácter no invasivo lo califican como uno de los métodos recomendados para
estimar la composición corporal.

6
La bioimpedancia eléctrica se fundamenta en la oposición de las células, tejidos o
líquidos corporales al paso de una corriente eléctrica. La MLG contiene la mayoría
de fluidos y electrolitos corporales, siendo un buen conductor eléctrico (baja
impedancia u oposición), mientras que la masa grasa (MG) actúa como un aislante
(alta impedancia). El valor de la impedancia corporal (medida en ohms) proporciona
una estimación directa del ACT y permite estimar indirectamente la MLG y la MG.6

I.4 RIESGOS PARA LA SALUD

La presencia de sobrepeso y obesidad en edades tempranas aumenta el


riesgo de desarrollar enfermedades que antes eran consideradas exclusivas de
adultos, tales como:

o Hipertensión arterial y dislipidemias (factores de riesgo de enfermedades


cardiovasculares). El 70% de los niños obesos tienen al menos un factor de
riesgo de enfermedad cardiovascular, el 39% tiene 2 o más.
o Intolerancia a la glucosa, resistencia a la insulina, y diabetes tipo 2.
o Apnea del sueño y asma.
o Problemas ortopédicos, de articulaciones, y molestias músculo-esqueléticas.
o Hígado graso, cálculos biliares y reflujo gastro-esofágico.
o Discriminación y baja autoestima.
o Cáncer de mama.7

El mecanismo mediante el cual la obesidad causa el incremento en la morbi -


mortalidad por enfermedad cardiovascular, está relacionado a la presencia de
factores de riesgo como hipertensión, dislipidemias, diabetes tipo 2 y resistencia a
insulina.

I.5 PREVALENCIA

El sobrepeso y la obesidad son el quinto factor principal de riesgo de


defunción en el mundo, cada año fallecen por lo menos 2.8 millones de personas
adultas como consecuencia del sobrepeso o la obesidad; además, el 44% del riesgo

7
de padecer diabetes, el 23% de cardiopatías isquémicas y entre el 7% y el 41% de
algunos cánceres, son atribuibles al sobrepeso y la obesidad.

La OMS estima que en 2010 el número de niños menores de 5 años con


sobrepeso y obesidad era de aproximadamente 43 millones en todo el mundo
(Figura1).8

Figura 1. Porcentaje de niños con sobrepeso y obesidad por país.

De acuerdo a la ENSANUT 2012, en México, la prevalencia de sobrepeso y


obesidad en hombres y mujeres de 12 a 19 años es del 35%. Esta cifra aumentó 5%
respecto a la reportada en 2006 (Tabla 1).

En el estado de San Luis Potosí, el 30.9% de los adolescentes presentaron


sobrepeso más obesidad, con mayor prevalencia para las mujeres (34.6%) en
comparación con los hombres (27.5%). En las zonas urbanas, la cifra de sobrepeso
más obesidad aumentó de 27.7% en 2006 a 33.8% en 2012.9

8
Tabla 1. Prevalencia de sobrepeso y obesidad de 2006 a 2012 en
hombres y mujeres de 12 a 19 años.

I.6 CAUSAS

La obesidad es una enfermedad de causa multifactorial, y su prevalencia ha


aumentado debido al cambio en la dieta así como en la actividad física, pero además
es importante reconocer la influencia que tiene la herencia genética en el aumento
de peso.

Como un desorden complejo, la obesidad incluye factores tanto genéticos


como ambientales, la mayor parte de la variación en el IMC está explicada por la
herencia genética, pero los factores culturales y sociales explican aproximadamente
el 30% de la variación. Factores ambientales, incluyendo el aumento en la ingesta
de alimentos y un estilo de vida poco activo, juegan un rol importante en el aumento
de peso corporal y obesidad.10

I.6.1 AMBIENTE “OBESOGÉNICO”

Actualmente se reconocen diversos factores obesogénicos, como el aumento


en la ingesta de calorías y la disminución en la actividad física, además de que gran
parte de las calorías ingeridas provienen de dulces, sodas, botanas y comida rápida,
y estos alimentos tienen una alta densidad energética y bajo contenido de fibra.11

9
En México se ha experimentado una transición en los patrones de
alimentación y actividad física, dentro de los factores documentados como grandes
determinantes del desarrollo de enfermedades crónicas están:

Dietas sumamente bajas en frutas y vegetates y densamente calóricas:


o Aumento en el consumo de postres y refrescos.
o Aumento en el consumo de grasa.
o Reducción en el consumo de proteínas e hidratos de carbono
complejos.
Actividad física baja.12

I.6.2 GENÉTICA DE LA OBESIDAD

La contribución genética al peso corporal ha sido establecida en estudios de


familias, por ejemplo: la relación que existe entre padres-hijos, estudios de gemelos
y de niños adoptados. Reportando que entre el 40 y el 70% de la variación del IMC
se debe a la herencia.13

El reconocimiento de las bases genéticas de la obesidad ha dirigido los


estudios a identificar genes causales para entender las vías metabólicas de control
de masa y grasa corporal en humanos, con el objetivo de diseñar tratamientos y
estrategias de prevención.

En 2006 se reportaron 127 genes candidatos en el Human Obesity Gene


Map, para los cuales existía por lo menos un estudio que describía una asociación
positiva con la obesidad, pero estas variantes son muy poco comunes en la
población.

A pesar de que está bien documentado que la obesidad en humanos tiene un


fuerte componente genético, aún no se conocen todos los genes que pueden influir
en la predisposición de un individuo a aumentar de peso, y de los que ya han sido
identificados carecen de repetibilidad entre distintas poblaciones.

10
Los factores genéticos que afectan a la obesidad pueden dividirse en
categorías dependiendo del proceso en el que influyen:

- Estimulantes del apetito: neuropéptido Y.


- Inhibidores del apetito: Leptina, receptor de leptina, proopiomelanocortina.
- Gasto energético: proteínas de acoplamiento
- Regulación del metabolismo: receptor adrenérgico β-2 y 3
- Adipogénesis: Receptores activados por proliferadores de peroxisomas,
receptor de vitamina D, receptor X retinoide.10

Si bien es cierto que existen tipos de obesidad severa causadas por


mutaciones en un solo gen (también llamada obesidad de causa monogénica), como
es el caso del sistema del hipotálamo: leptina-melanocortina, en el cual están
implicados los genes del receptor de melanocortina 4 MC4R, leptina y/o su receptor,
estos desórdenes representan menos del 5% de todos los casos de obesidad
severa. Esto sugiere que la genética de la obesidad en humanos es
heterogénea.14,15

Por lo anterior se han seguido analizando variaciones genéticas asociadas a


obesidad que logren ser reproducibles entre distintas poblaciones, en el 2010 se
realizó un estudio en California donde se encontró una asociación entre la expresión
del gen CRTC3 y el aumento de peso. Este estudio se realizó en una primera fase
experimental con ratones, los resultados indicaron varias diferencias entre los
distintos genotipos, probando primero una dieta normal y posteriormente una dieta
alta en grasas (HFD), uno de los cambios más notables fue la ganancia de peso en
los ratones wild-type con la dieta HFD (Figura 2). En la Tabla 2 se muestra la
comparación entre los ratones wild-type y los knock-out.

11
Dieta Knock-out Wild-type
Normal (chow) Más sensibles a la insulina 50% más tejido adiposo

Mayor consumo de oxígeno 35% más ganancia de peso


Dieta alta en grasas (HFD)
Mayor gasto energético Adipocitos más grandes
60% de las calorías
Tasas elevadas de lipólisis Mayores concentraciones de
provenientes de grasas
Esteatosis hepática AGL en circulación

Tabla 2. Comparación de las características de ratones knock -out vs wild-type para el gen CRTC3.

A B

Figura 2. Diferencias fenotípicas de los ratones al consumir una dieta alta en grasas.
A) Ratón wild-type. B) Ratón knock-out.

Posteriormente se identificó una variante en la base de datos de SNPs


(dbSNP) en humanos que corresponde al gen CRTC3 de los ratones. Se asoció esta
variante con mayor peso, IMC y circunferencia de cadera en población México-
Americana (Tabla 3), sin embargo, en la población de blancos no hispanos el
polimorfismo no se asocia con estos parámetros.

12
Tabla 3. Resultados de la asociación entre la variante S72N y medidas
16
antropométricas en México-Americanos.

En 2013, Zejin y col. evaluaron en población China dos SNPs del gen CRTC3,
buscando asociación con sobrepeso, obesidad y dislipidemias, encontraron que el
rs3862434 está asociado con mayores niveles de colesterol en sangre en los
individuos con el genotipo AA. El segundo SNP evaluado fue el rs1635252,
localizado en el promotor, y se encontró asociado con el riesgo de sobrepeso e
hipertrigliceridemia; el alelo T tiene mayor riesgo comparado con el C (OR 1.23,
17
95%CI 1.02–1.48, p=0.024; OR 1.22, 95%CI 1.00–1.48, p=0.048, respectivamente).

I.6.2.1 CRTCs

La familia de los CRTCs (Coactivador Transcripcional Regulado por CREB),


consta de tres miembros: CRTC1, CRTC2 y CRTC3, los cuales tienen estructuras
modulares similares, todos contienen un dominio amino terminal de unión a CREB
(CBD), un dominio central regulatorio (REG), un dominio de splicing (SD) y un
dominio de transactivación carboxilo terminal (TAD).
En hepatocitos se ha observado que la exposición a AMPc y calcio, pero no a
otras señales, conduce a la defosforilación mediada por calcineurina y la
traslocación de los CRTCs al núcleo, donde se unen a CREB (Figura 3).

13
Figura 3. Traslocación del CRTC defosforilado al núcleo y su efecto.

Las señales de AMP cíclico y calcio regulan genes blanco cuya transcripción
está regulada por CREB al estimular la traslocación al núcleo de los CRTCs. Bajo
condiciones basales, los CRTCs se encuentran fosforilados y secuestrados en el
citoplasma mediante interacciones con proteínas 14-3-3. Las señales de AMPc y
calcio promueven la defosforilación de CRTC mediante la inhibición de la cinasas
inducibles por sal (SIKs que fosforilan a los CRTCs), y mediante la inducción de la
calcineurina fosfatasa de CRTC, respectivamente. El CRTC defosforilado es
18
traslocado al núcleo, donde se une a CREB y estimula su actividad.

I.6.2.1.1 GEN CRTC3

El Coactivador Transcripcional Regulado por CREB 3, o también conocido por


CRTC3 o TORC3, es el gen que codifica para la proteína CRTC3.

La variante S72N que corresponde al rs8033595, está descrita como una


mutación puntual con cambio de sentido en la cual hay una sustitución de un
nucleótido: una Guanina (G) por una Adenina (A) (GA), esto provoca un cambio en
el codón, con lo que finalmente se produce un aminoácido diferente al esperado, en
este caso una Asparagina (N) en lugar de una Serina (S), (SN).

14
I.6.2.1.1.1 LOCALIZACIÓN GENÓMICA DEL GEN CRTC3

El gen CRTC3 se localiza en el brazo largo del cromosoma 15, en la banda


26.1 (Figura 4). 19

Figura 4. Localización cromosómica del gen CRTC3.

I.6.2.1.1.2 SECUENCIA NUCLEOTÍDICA DEL ARNm

La secuencia de nucleótidos del ARNm que codifica para la proteína CRTC3


reportada en el GenBank es la siguiente:

NCBI Reference Sequence: NM_022769.4 20

I.6.2.1.1.3 CARACTERÍSTICAS DE LA PROTEÍNA

La proteína CRTC3 está formada de 619 aminoácidos y su masa es de


66,959 Da.

I.6.2.1.1.4 SECUENCIA DE AMINOÁCIDOS

La variante S72N produce un cambio de aminoácido en la posición 72, de una


Serina (S) a una Asparagina (N). En la Figura 5 se muestra la secuencia de
aminoácidos de la proteína CRTC3 y se señala con una flecha el aminoácido
sustituido.

Figura 5. Localización de la Serina 72 en la secuencia de aminoácidos original de la proteína


21
CRTC3.

15
I.6.2.1.1.5 MECANISMO DE ACCIÓN PROPUESTO

Song y col., sugieren que en condiciones originales la proteína CRTC3


producida es fosforilable y puede ser exportada al citosol, sin embargo, cuando se
da el cambio de Serina por Asparagina, la proteína CRTC3 no puede ser fosforilada
(aún cuando el cambio de aminoácido no se da en la serina que comúnmente se
fosforila), y queda anclada en el núcleo, donde puede estar disminuyendo la señal
de catecolaminas del receptor β-adrenérgico, reduciendo la actividad de la adenilato
ciclasa, y toda la casacada, al sobreactivar la expresión de RGS2 (proteína
estimulante de la actividad GTPasa de la subunidad α Gs), en los adipocitos, lo que
resulta en una reducción tanto de la oxidación de ácidos grasos como de la lipólisis,
generando la acumulación de tejido adiposo y aumentando el riesgo de sobrepeso y
obesidad (Figura 6).16

Figura 6. Mecanismo de acción de la proteína CRTC3 con el polimorfismo S72N.

16
I.7 REACCIÓN EN CADENA DE LA POLIMERASA (PCR)

La reacción en cadena de la polimerasa (PCR) punto final, desarrollada en


1983 por Kary B. Mullis, es una técnica usada para obtener numerosas copias de un
segmento específico de ADN, basada en el proceso natural de las células para
replicar ADN.

Para llevar a cabo una reacción de PCR se necesitan 5 componentes básicos:


un ADN molde, cebadores o primers, dNTPs, ADN polimerasa y MgCl 2.

El componente integral es el ADN molde, es decir, la secuencia de ADN que


se quiere obtener en gran cantidad, por ejemplo, un gen.

Para replicar éste fragmento se requieren los cebadores o primers, que son
dos secuencias cortas de nucleótidos; estas secuencias deben ser conocidas y
complementarias al ADN molde, una al inicio y otra al final de la secuencia de
interés. Cuando los cebadores se alinean con su secuencia complementaria en el
ADN molde, se forma una región de cadena doble, que sirve para que la ADN
polimerasa comience a añadir los dNTPs.

Además del molde y los cebadores, se necesitan nucleótidos libres que son
usados para construir las nuevas hebras de ADN, conocidos como dNTPs, o desoxi -
nucleótidos trifosfato.

La ADN polimerasa es la enzima que construye la nueva hebra de ADN


añadiendo los dNTPs complementarios al ADN molde, inicia la construcción al
reconocer el sitio en el que se unieron los cebadores.

Finalmente, el Cloruro de Magnesio (MgCl2) se añade a la reacción ya que


sirve como cofactor para la unión de la Taq polimerasa a los cebadores.

La PCR consta de tres fases que se repiten varias veces (Figura 7). La
primera fase es la desnaturalización, que consiste en la separación de la doble

17
cadena de ADN en dos cadenas sencillas, se lleva a cabo al aumentar la
temperatura a 95ºC, cada una de las cadenas servirá como molde. La segunda fase
es la de alineamiento de los cebadores, en la cual la temperatura se reduce a
55ºC-59ºC aproximadamente, esto sirve para que los cebadores se unan a sus
secuencias complementarias en la cadena de ADN molde. La tercera fase es la
elongación, en la que la temperatura se aumenta a 72ºC, es ahí cuando la ADN
polimerasa comienza a añadir los nucleótidos libres al final de los cebadores
alineados. Estas fases se repiten entre 25 y 35 veces. Al final de cada ciclo el
número de copias se duplica.

Figura 7. Fases de la PCR.

En el procedimiento original de PCR, uno de los problemas era que la ADN


polimerasa debía ser reemplazada al final de cada ciclo pues no era estable a las
altas temperaturas usadas para la desnaturalización. En 1987, se descubrió una
ADN polimerasa termoestable llamada Taq, es una enzima aislada de la bacteria
termófila Thermus aquaticus, la cual habita en aguas termales del Parque Nacional
22
de Yellowstone.

18
I.8 FRAGMENTOS DE RESTRICCIÓN DE LONGITUD POLIMÓRFICA (RFLP)

RFLP (Restriction Fragment Length Polymorphism), por sus siglas en inglés,


es la diferencia en secuencias homólogas de ADN que puede ser detectada por la
presencia de fragmentos de diferente longitud después de digerir el ADN con una
23
endonucleasa de restricción específica.

I.8.1 ENDONUCLEASAS DE RESTRICCIÓN

Son enzimas que rompen enlaces fosfodiéster por en medio de una doble
hebra de ADN. Las endonucleasas de restricción rompen enlaces sólo cuando
reconocen una secuencia determinada de nucleótidos del ADN, denominada
secuencia o sitio de restricción.

Existen tres tipos de endonucleasas de restricción:

Tipo I: cortan entre 400 pares de bases y 7 kilobases de distancia en


dirección 5´del sitio de restricción.
Tipo II: son las más utilizadas, cortan sobre la misma secuencia o sitio de
restricción que reconocen
Tipo III: cortan a unos 25 pares de bases de su sitio de restricción.

Las endonucleasas de restricción fueron descubiertas en bacterias y, de hecho,


24
toman su nombre de éstas.

I.8.1.1 BsrDI

La endonucleasa de restricción BsrDI fue aislada del Bacillus


stearothermophilus D70, su sitio de restricción es:

5´…G C A A T G N N…3´

3´…C G T T A C N N…5´ 25

19
El sitio de restricción de la enzima BsrDI coincide con la secuencia del SNP
rs8033595, y puesto que las endonucleasas tienen una alta especificidad para
reconocer la secuencia exacta, la BsrDI puede ser utilizada para genotipificar, ya
que logra discernir entre la secuencia que contiene el cambio del nucleótido (A  G)
y la secuencia original.

Para genotipificar mediante PCR-RFLP, lo primero que se hace es amplificar


por PCR un fragmento del gen de interés, cuidando que el sitio de restricción de la
endonucleasa esté en el centro de la secuencia del fragmento. Una vez que se tiene
el producto de PCR, se trata con la enzima de restricción y finalmente se hace una
electroforesis en gel de agarosa, obteniendo un patrón de bandas que indican el
genotipo al compararlos con el marcador de peso molecular (Figura 8). 25

Figura 8. Patrón de bandas obtenidas por PCR-RFLP.

20
II. PREGUNTA DE INVESTIGACIÓN

¿Existirá asociación entre la variante S72N del gen CRTC3 y la composición


corporal en alumnos de 11 a 16 años de una escuela secundaria de la Cd. de San
Luis Potosí?

III. JUSTIFICACIÓN

Al estandarizar una técnica que nos permita identificar el genotipo de los individuos
para el gen CRCT3, podremos:

Conocer la frecuencia alélica de la variante S72N en nuestra población,


con la finalidad de:

i. Encontrar una explicación genética al aumento de la prevalencia en


obesidad y sobrepeso en nuestra población.

ii. Investigar si existe asociación entre la expresión diferencial de la


variante y el fenotipo, y qué señales lo activan.

iii. Utilizar la técnica para hacer un tamiz a edades tempranas como


estrategia de prevención de sobrepeso, obesidad y posiblemente
alteraciones metabólicas.

21
IV. HIPÓTESIS

La variante S72N del gen CRTC3 se asocia con la composición corporal y


dislipidemias en alumnos de 11 a 16 años de una escuela secundaria de la Cd. de
San Luis Potosí.

V. OBJETIVOS
V.1 Objetivo primario
o Determinar si existe asociación directa entre la variante S72N del
gen CRTC3, identificada mediante PCR-RFLP, y la composición
corporal y dislipidemias en alumnos de 11 a 16 años de la escuela
secundaria Justo A. Zamudio de la Cd. de San Luis Potosí.

V. 2 Objetivos específicos
o Determinar el IMC de los alumnos de 11 a 16 años de la escuela
secundaria Justo A. Zamudio de la Cd. de San Luis Potosí.
o Clasificar a los alumnos de acuerdo a su IMC en: bajo peso, normal,
sobrepeso u obeso de acuerdo a los criterios de la CDC.
o Determinar el porcentaje de grasa corporal de los alumnos mediante
bioimpedancia.
o Obtener el perfil glucolipídico de las muestras de los alumnos.
o Genotipificar las muestras de sangre de los alumnos mediante RFLP
con la enzima BsrDI.
o Determinar si existe asociación entre el genotipo y la composición
corporal y perfil glucolipídico en los alumnos.

22
VI. METODOLOGÍA

VI.1 DISEÑO EXPERIMENTAL

Estudio transversal. Estudio piloto externo.

VI.2 LUGAR DE REALIZACIÓN

Escuela secundaria Justo A. Zamudio, perteneciente al sector 1 de la


Secretaría de Educación del Gobierno del Estado (SEGE), localizada
en la cabecera municipal de San Luis Potosí (Secundaria).
Laboratorio de Investigación Traslacional en Farmacología. Facultad
de Medicina. UASLP.
Laboratorio de Bioquímica. Facultad de Medicina. UASLP.
Laboratorio de Genómica Viral y Humana. Facultad de Medicina.
UASLP.

VI.3 UNIVERSO DE ESTUDIO

Alumnos de 11 a 16 años de la escuela secundaria Justo A. Zamudio de


la Cd. de San Luis Potosí.

VI.4 Criterios de selección

VI.4.1 Criterios de inclusión


 Alumnos de secundaria, de 11 a 15 años y 11 meses cumplidos
al momento de la toma de muestra.
 Ambos sexos.

VI.4.2 Criterios de exclusión


 Alumnos con enfermedades endocrinológicas, así como
síndromes diagnosticados.
 Alumnos que sean hijos de extranjeros.

23
VI.4.3 Criterios de eliminación
 Alumnos cuya muestra sea insuficiente para la extracción de
DNA.

VII. PLAN DE TRABAJO


1. Se obtuvo la carta de aprobación del Comité de Bioética de la Facultad de
Medicina de la UASLP.
2. Se obtuvo la autorización del Director de la Secundaria Justo A. Zamudio,
para informar a los padres de familia sobre la realización del estudio.
3. Se llevó a cabo una reunión con los padres de familia para informarles sobre
la realización del estudio.
4. Se obtuvo una lista de los alumnos inscritos en la secundaria (total de 543
alumnos incluidos tres grados de secundaria de turno matutino y vespertino),
y mediante aleatorización se seleccionó a los participantes en el estudio.
5. Se les informó a los estudiantes que fueron seleccionados para el estudio, y
se les preguntó si deseaban participar, a aquellos que aceptaron participar se
les entregó la carta de consentimiento informado.
6. Se obtuvo la carta de consentimiento informado firmada por los padres de los
alumnos que aceptaron participar en el estudio.
7. Se obtuvieron las mediciones antropométricas: peso y talla del alumno con
ropa ligera y sin zapatos.
8. Se analizó la composición corporal del alumno mediante bioimpedancia
eléctrica (BIA).
9. Se obtuvieron dos muestras de sangre del alumno mediante punción venosa,
la cual fue recolectada en un tubo vacutainer con anticoagulante (tubo con
tapa lila), para extraer el ADNg, y en un tubo vacutainer sin anticoagulante
(tubo con tapa roja), para el perfil glucolipídico (datos obtenidos por la
colaboración con la Facultad de Enfermería de la UASLP).
10. Se diseñaron los cebadores utilizados para amplificar el fragmento del gen
CRTC3 (ANEXO I).
11. Se extrajo el ADN genómico utilizando el kit Wizard (ANEXO II).
24
12. Se midió la concentración de ADNg obtenido utilizando el Nanodrop 2000
(ANEXO III).
13. Se amplificó el fragmento de ADN de interés mediante PCR punto final
(ANEXO IV).
14. Se verificó la amplificación del fragmento de interés mediante electroforesis
en un gel de agarosa al 2.5% (ANEXO V).
15. Se obtuvo una fotografía del gel de agarosa teñido con bromuro de etidio para
observar el tamaño de los productos amplificados (ANEXO VI).
16. Se digirió el producto amplificado con la endonucleasa de restricción BsrDI
(ANEXO VII).
17. Se identificó el genotipo mediante electroforesis en un gel de agarosa al 3%
(ANEXO V).
18. Se clasificó a los alumnos de acuerdo a su IMC en: peso normal, sobrepeso u
obesidad, utilizando las tablas de crecimiento de la CDC.
19. Se evaluó la asociación entre el genotipo y la composición corporal y el perfil
lipídico.

25
VIII. DESCRIPCIÓN OPERACIONAL DE LAS VARIABLES

ESCALA DE VALORES
CÓDIGO NOMBRE SIGNIFICADO UNIDADES
MEDICIÓN POSIBLES

Relación del peso


Percentila del corporal con la talla
PIMC Índice de Masa comparado con Continua 0-100 percentila
Corporal adolescentes de la
misma edad y sexo
Porcentaje de grasa
Porcentaje de
PGC Grasa Corporal
de la composición Continua 0-100 %
corporal
Coactivador de la
Genotipo para el gen
Regulación 0=GG
CRTC3 Transcripcional de
CRTC3 identificado Categórica
1=AA/AG
-
por PCR-RFLP
CREB 3
Concentración de
COL Colesterol total
colesterol en suero
Continua 0-∞ mg/dL

HDL Lipoproteína de Concentración de


HDL en suero Continua 0-∞ mg/dL
alta densidad
Lipoproteína de Concentración de
LDL baja densidad LDL en suero
Continua 0-∞ mg/dL
Lipoproteína de Concentración de
VLDL muy baja densidad VLDL en suero
Continua 0-∞ mg/dL

Concentración de
TG Triglicéridos
triglicéridos en suero
Continua 0-∞ mg/dL

CIN Cintura
Circunferencia de la
Continua 0-∞ cm
Cintura

CAD Cadera Circunferencia de la Continua 0-∞ cm


Cadera
Relación entre la
Índice Cintura- circunferencia de la
ICC Cadera cintura y la de la
Continua 0-∞ -
cadera
Área de Superficie Cálculo de la
ASC Continua 0-∞ m2
Corporal superficie del cuerpo

EDAD Edad Edad en años Continua 11-16 años


Sexo al que 0=Masculino
SEXO Sexo
pertenece el alumno
Dicotómica
1=Femenino
-

26
IX. TAMAÑO DE LA MUESTRA
El estudio fue un piloto externo. El análisis programado es de regresión
múltiple con el uso de modelos lineales para explicar la variabilidad del Índice
de Masa Corporal (IMC), Porcentaje de Grasa Corporal (PGC), Colesterol
(COL), HDL, LDL, VLD, Triglicéridos (TG), Circunferencia de cintura y cadera
(CIN, CAD), Índice Cintura-Cadera (ICC) y Área de Superficie Corporal (ASC),
consideradas en el modelo como “variable de salida”. Se calcularon 10
repeticiones por grado de libertad de las variables explicativas (edad, CRTC3
y sexo), con un grado de libertad para cada una, calculándose una n=30
como mínimo. Los modelos propuestos son:

Variable de salida ~ EDAD + CRTC3 + SEXO

X. ANÁLISIS ESTADÍSTICO

Se realizó el análisis descriptivo de cada una de las variables, para las


continuas se reporta la media y la desviación estándar si su distribución
cumple con los requisitos de normalidad. Los datos cualitativos se expresan
en porcentaje o distribución de frecuencia.

Los datos se analizaron mediante una regresión múltiple, las variables


de salida son: IMC, PGC, COL, HDL, LDL, VLDL, CIN, CAD, ICC, y su
variabilidad se trató de explicar mediante modelos lineales con las variables
explicativas: edad, sexo y genotipo para el gen CRTC3.

XI. ASPECTOS ÉTICOS


Se obtuvo la autorización del Comité de Ética de la Facultad de
Medicina de la Universidad Autónoma de San Luis Potosí para la
realización de este estudio. (ANEXO VIII).
La investigación se llevó a cabo tomando en cuenta las normas
establecidas para investigaciones en seres humanos determinados por
la OMS.
27
Las maniobras diagnósticas que se utilizaron se consideran de riesgo
menor por lo que no transgreden las normas de la Conferencia de
Helsinki de 1964 y su revisión de 2008.
Se obtuvo el consentimiento de los padres a través de un documento
en dónde se especificó el objetivo del estudio, los métodos y las
técnicas que se utilizaron.
Se aseguró la confidencialidad de los datos obtenidos.

XII. RECURSOS MATERIALES

El financiamiento para la realización de este estudio fue otorgado por:

Fondo de Apoyo a la Investigación: C12-FAI-03-65.65


Fondo Interinstitucional de Investigación en Salud: FS15-12
Fondos concurrentes de la UASLP
PROMEP

Se contó con beca para la realización de los estudios de maestría

Beca CONACyT para estudiante de maestría

Además de tres becas para Movilidad Internacional (Estancia en el Centro de


Biología Molecular Severo Ochoa en Madrid, España (ANEXO IX)):

Beca Mixta CONACyT para movilidad estudiantil


Beca FUNSALUD para rotaciones
Beca para movilidad por parte de la Secretaría de Investigación y Posgrado
de la UASLP

28
XIII. RESULTADOS

XIII.1 DESCRIPCIÓN DE LA POBLACIÓN

Se obtuvieron las medidas antropométricas, bioimpedancia eléctrica y perfil


glucolipídico de 48 alumnos de la secundaria Justo A. Zamudio de la Ciudad de San
Luis Potosí (Tabla 4). El porcentaje de hombres y mujeres incluidos en el estudio fue
de 44% y 56% respectivamente.

VARIABLE Media ± sd
EDAD (años) 13.70 ± 1.05
PESO (kg) 56.81 ± 13.65
TALLA (cm) 158.96 ± 8.01
CINTURA (cm) 73.22 ± 9.47
CADERA (cm) 90.94 ± 10.03
GRASA CORPORAL (%) 29.95 ± 7.26
IMC (Percentil) 64.91 ± 29.92
ICC 0.80 ± 0.06
GLUCOSA (mg/dL) 74.35 ± 8.16
COLESTEROL TOTAL (mg/dL) 169.47 ± 25.8
HDL (mg/dL) 51.41 ± 7.41
LDL (mg/dL) 94.37 ± 24.44
VLDL (mg/dL) 23.68 ± 5.57
TRIGLICÉRIDOS (mg/dL) 119.06 ± 27.64
ÁREA DE SUPERFICIE CORPORAL (m2) 1.57 ± 0.18

Tabla 4. Descripción de las variables antropométricas y perfil glucolipídico de la población estudiada.


Se presenta la media ± desviación estándar. n=48.

29
XIII.2 CLASIFICACIÓN POR PERCENTILA DEL IMC

Se clasificó a los alumnos de acuerdo a la percentila de su IMC (Tabla


5), utilizando la herramienta de la CDC: “Children's BMI Tool for Schools”, la
cual es una hoja de cálculo en la que se introduce el peso, talla, sexo, fecha de
nacimiento y fecha en que se realizaron las mediciones antropométricas, para
calcular el percentil en el que se ubica el IMC de cada alumno respecto a los
adolescentes de su edad y sexo.

SEXO SEXO
TOTAL
MASCULINO FEMENINO
Total de alumnos evaluados 21 27 48
Bajo peso (<percentila 5) 0% 4% 2%
Peso Normal (percentila 5-85) 67% 59% 63%
Sobrepeso (≥percentila 85) 19% 22% 20%
Obesidad (≥percentila 95) 14% 15% 15%
*Term inology based on: Barlow SE and the Expert Com m ittee. Expert com m ittee
recommendations regarding the prevention, assessment, and treatment of child and adolescent
overw eight and obesity: sum m ary report. Pediatrics. 2007;120 (suppl 4):s164-92.

Tabla 5. Clasificación por percentila del IMC de la población.

El total de sobrepeso y obesidad fue del 35%. En el grupo del sexo


femenino, tanto la prevalencia de sobrepeso como la de obesidad, son
mayores que en el grupo del sexo masculino.

30
XIII.3 COMPOSICIÓN CORPORAL Y PERFIL GLUCOLIPÍDICO POR
PERCENTILA DEL ÍNDICE DE MASA CORPORAL

Se realizó un análisis comparativo de los parámetros antropométricos y perfil


glucolipídico por grupo, con los datos de los 48 alumnos, dividiéndolos por grupos de
acuerdo a la percentila de su IMC (Tabla 6).

PN SP OB
media±sd media±sd media±sd
EDAD (años) 13.7±0.91 13.3±1.05 14.42±1.39
PESO (kg) 50.08±7.54 61.34±6.93 81.01±11.97
TALLA (cm) 158.18±7.9 157.85±6.36 161.85±9.49
PIMC (percentila) 50.88±24.81 90.57±3.13 97.6±1.27
PGC (%) 27.12±6.69 34.34±4.12 36.54±6.79
GLUCOSA (mg/dL) 74.53±8.74 74.4±6.62 75±8.28
COLESTEROL TOTAL (mg/dL) 164±23.85 180±21.5 178.57±36.57
HDL (mg/dL) 52.06±8.11 52.5±6.15 46.71±4.99
LDL (mg/dL) 88.03±21.74 103.8±21.46 108.57±33.4
VLDL (mg/dL) 23.9±6.47 23.7±3.56 23.28±4.38
TRIGLICÉRIDOS (mg/dL) 119.8±32.55 118.3±17.93 119.6±18.13
CINTURA (cm) 68.48±5.75 78.5±5.24 88.25±6.194
CADERA (cm) 86.37±6.72 93.6±5.15 108.1±7.64
ICC 0.78±0.05 0.83±0.03 0.81±0.06
ÁREA DE SUPERFICIE CORPORAL 1.48±0.137 1.62±0.11 1.856±0.17

Tabla 6. Descripción de las variables antropométricas y perfil glucolipídico clasificados de acuerdo a


la percentila del IMC. Se muestra la media ± desviación estándar. PN: Peso Normal, SP: Sobrepeso,
OB: Obesidad. n=48.

31
XIII.3.1 COMPOSICIÓN CORPORAL Y PERFIL GLUCOLIPÍDICO
POR PERCENTILA DEL IMC POR SEXO

Posteriormente los datos se analizaron por sexo, y se realizó la misma


comparación de composición corporal y perfil glucolipídico de acuerdo a la percentila
de su IMC (Tabla 7).

FEMENINO MASCULINO

PN SP OB PN SP OB

EDAD (años) 14.1±0.77 13.66±1.21 15.25±1.25 13.3±0.94 12.75±0.5 13.75±0.95

PESO (kg) 51.2±6.34 59.43±5.56 77.42±8.04 49.38±8.83 64.2±8.64 84.95±13.6

TALLA (cm) 157.1±5.66 154.1±1.96 155.8±1.89 159.9±10.2 163.5±6.64 169.3±7.93

PIMC (percentila) 58.4±17.6 90.35±3.27 97.62±1.23 44.82±28.8 90.9±3.38 97.55±1.32

PGC (%) 31.0±4.57 35.36±2.66 40.75±3.08 23.4±5.96 32.8±5.81 32.72±6.37

GLUCOSA
71.9±6.53 72.33±4.92 72±10.16 77.2±10.41 77.5±8.34 83±8.36
(mg/dL)
COLESTEROL
167.7±26.6 173.2±23.7 177.8±21.0 161±20.58 190.3±14.8 175.3±48.0
(mg/dL)
HDL (mg/dL) 51.4±7.32 50.5±5.57 46.75±6.94 52.84±9.52 55.5±6.45 46.75±1.25

LDL (mg/dL) 90.9±22.5 99.33±23.8 109.3±16.3 85.46±21.8 110.5±18.4 103±45.26

VLDL (mg/dL) 25.4±7.87 23.33±3.5 21.75±4.64 22.69±3.75 24.25±4.11 25.5±3.1

TRIGLICÉRIDOS
127.1±40.0 116.3±17.8 114±17.1 113.5±18.2 121.3±20.5 128±16.51
(mg/dL)
CINTURA (cm) 69.2±5.42 77.66±5.26 86.32±3.61 67.88±6.38 79.75±5.73 91.5±7.33

CADERA (cm) 89.7±5.87 93.58±4.2 110.5±7.85 83.07±5.63 93.5±7.08 105.1±6.08

ICC 0.76±0.04 0.82±0.03 0.78±0.05 0.81±0.05 0.84±0.03 0.86±0.03

ÁREA DE
1.49±0.1 1.57±0.07 1.77±0.09 1.49±0.17 1.69±0.13 1.95±0.17
SUPERFICIE
CORPORAL
Tabla 7. Descripción de las variables antropométricas y perfil glucolipídico clasi ficados por percentila
del IMC por sexo. Se muestran las medias ± desviación estándar. PN: Peso Normal, SP: Sobrepeso,
OB: Obesidad. Femenino n=27. Masculino n=21.

32
XIII.4 FRECUENCIA ALÉLICA

Se genotipificaron las 48 muestras de los alumnos de secundaria, mediante


PCR-RFLP y se calculó la frecuencia alélica de la variante S72N, y la distribución de
las frecuencias alélicas por sexo.

En la población que estudiamos, la frecuencia del alelo A es del 32% y la del


alelo G es del 68%. Al calcular la frecuencia alélica por sexo, obtuvimos los
siguientes datos:

Masculino Femenino
A 36% 28%
G 64% 72%
Tabla 8. Distribución de las frecuencias alélicas por sexo. n=48.

XIII.4.1 FRECUENCIA ALÉLICA POR SEXO

Además se calculó la distribución de los genotipos según la clasificación de la


percentila del IMC y el sexo:

AA AG GG
Bajo Peso Masculino 0 0 0
Femenino 0 0 1
Peso Normal Masculino 1 5 8
Femenino 2 7 7
Sobrepeso Masculino 0 4 0
Femenino 0 1 5
Obesidad Masculino 1 2 0
Femenino 0 3 1

Tabla 9. Distribución de genotipos por percentilas del IMC y sexo. AA= Homocigotos para el
polimorfismo rs8033595. AG= Hetericigotos para el polimorfismo. GG= Homocigotos sin el
polimorfismo. n=48.

33
XIII.5 ASOCIACIÓN ENTRE EL GENOTIPO Y LA COMPOSICIÓN COPORAL
Y PERFIL GLUCOLIPÍDICO.

Se analizaron los datos de 48 alumnos de secundaria, evaluando la


asociación del rs8033595 con los datos de composición corporal y perfil
glucolipídico. El modelo inicial incluyó por cada variable los siguientes términos:

Variable de salida ~ EDAD + SEXO + CRTC3

Para las variables Colesterol total, LDL y Circunferencia de cadera, los


términos significativos fueron CRTC3 y SEXO. La variable EDAD no fue significativa
en ninguno de los modelos.

Se agregó un término de interacción entre SEXO y CRTC3, siendo


significativo para los tres modelos (Tabla 11), por lo que se analizaron por separado
los grupos masculino y femenino.

R2 R2 R2
VARIABLE p (COL) p (LDL) p (CAD)
ajustada ajustada ajustada
CRTC3 0.012 0.020 0.044
SEXO 0.029 0.0976 0.035 0.0771 0.009 0.101
CRTC3:SEXO 0.010 0.017 0.089

Tabla 10. Interacción entre las variables explicativas: CRTC3 y SEXO, para los modelos de las
variables de salida: Colesterol total, LDL y Circunferencia de la cadera.

Al analizar a los grupos masculino y femenino por separado para las variables
de salida: Colesterol total, LDL y Circunferencia de la cadera, el término CRTC3 fue
significativo en el grupo de sexo masculino. En la Tabla 12 se muestran los valores
de p para cada una de las variables explicativas y en ambos grupos.

34
Masculino Femenino
F p F p
PGC 1.79 0.19 0.34 056
PIMC 2.9 0.10 0.19 0.67
Glucosa 1.04 0.32 0.96 0.33
Colesterol Total 6.64 0.018* 1.14 0.29
HDL 0.11 0.73 0.52 0.47
LDL 4.9 0.039* 1.17 0.29
VLDL 1.68 0.21 1.17 0.29
Triglicéridos 1.57 0.22 0.93 0.34
Cintura 2.96 0.10 0.005 0.93
Cadera 4.42 0.049* 0.06 0.80
ICC 0.07 0.78 0.19 0.66
Superficie Corporal 3.64 0.07 0.37 0.54

Tabla 11. Asociación entre la variante S72N y las variables de salida. Se muestra el valor de F y p. Se
considera como diferencia significativa cuando la p<0.05. Las diferencias significativas se resaltan en
negrita y con un asterisco (*).

Se encontró asociación entre la variante S72N y niveles mayores de


colesterol total en sangre (Figura 9), LDL (Figura 10) y circunferencia de la cadera
(Figura 10). Sin embargo, esta asociación sólo se observó en el grupo del sexo
masculino.
A) B)

Figura 9. Asociación del genotipo con los niveles de colesterol total. El grupo “AG+AA” representa a los
individuos con la variante S72N, tanto homocigotos como heterocigotos. A) Sexo Masculino. B) Sexo
Femenino.

35
A) B)

Figura 10. Asociación del genotipo con los niveles de LDL. El grupo “AG+AA” representa a los
individuos con la variante S72N, tanto homocigotos como heterocigotos. A) Sexo Masculino. B) Sexo
Femenino.

A) B)

Figura 11. Asociación del genotipo con la circunferencia de la cadera El grupo “AG+AA” representa a
los individuos con la variante S72N, tanto homocigotos como heterocigotos. A) Sexo Masculino. B)
Sexo Femenino.

36
En cuanto al Porcentaje de Grasa Corporal (Figura 12) y a la Percentila del
IMC (Figura 13), se observan valores mayores para el grupo con la variante S72N,
sin embargo, las diferencias no son estadísticamente significativas. Y es solamente
en el grupo de los hombres.

A) B)

Figura 12. Asociación del genotipo con el Porcentaje de Grasa Corporal. El grupo “AG+AA” representa
a los individuos con la variante S72N, tanto homocigotos como heterocigotos. A) Sexo Masculino. B)
Sexo Femenino.

A) B)

Figura 13. Asociación del genotipo con la percentila del Índice de Masa Corporal. El grupo “AG+AA”
representa a los individuos con la variante S72N, tanto homocigotos como heterocigotos. A) Sexo
Masculino. B) Sexo Femenino.

37
XIV. DISCUSIÓN

Debido al incremento en la prevalencia de sobrepeso y obesidad a nivel

mundial, y a las co-morbilidades asociadas a estos padecimientos, se ha intentado

identificar un factor que ayude a identificar a los individuos que son más susceptibles

a desarrollarlos, o bien, encontrar un blanco terapéutico para aquellos que ya

padecen estas condiciones.

Pese a que se han reportado varios polimorfismos asociados con el riesgo de

desarrollar obesidad, estos sólo se asocian en ciertas poblaciones y al momento de

evaluarlos en una población genéticamente distinta, los resultados son

inconsistentes.

La prevalencia de obesidad y sobrepeso en adolescentes reportada en nuestro

estudio es muy similar a los datos reportados en la Encuesta Nacional de Salud y

Nutrición 2012; encontrando una prevalencia global del 35%.

En mujeres, la prevalencia de sobrepeso que nosotros obtuvimos fue de 22%

mientras que la ENSANUT reporta 23.7%, y para obesidad nosotros obtuvimos una

prevalencia del 15%, mientras que la ENSANUT reporta que es del 12.1%.

En el caso de los hombres, nosotros reportamos una prevalencia de sobrepeso

de 19%, y la ENSANUT reporta que es del 19.5%; en el caso de obesidad

ENSANUT reporta una prevalencia del 14.5% y nosotros hemos encontrado una

prevalencia del 14%.

En cuanto a la frecuencia del alelo, los resultados que obtuvimos también son

similares a los publicados por Song y col., ellos reportan una frecuencia alélica del

38
34% para el alelo A y nosotros obtuvimos una frecuencia del 32%, y para el alelo G

nuestra frecuencia es del 68% y ellos reportaron 66%.

Al evaluar el genotipo por sexo y percentila del IMC, notamos que la mayor parte

de los individuos con la variante S72N, ya sean homocigotos o heterocigotos, se

sitúan en el grupo de peso normal. Nuestra suposición es que la población evaluada

no ha sido expuesta, todavía, a un ambiente que favorezca la expresión de la

variante; al igual que sucedió en el modelo animal, donde los mayores efectos

sucedieron al cambiarles la dieta de una normal a una alta en grasas.

Al analizar los datos para encontrar la asociación entre el polimorfismo y la

composición corporal y/o el perfil lipídico, encontramos que existía una interacción

con el sexo, por lo cual decidimos analizar por separado los datos de los hombres y

las mujeres.

Song y col., evaluaron la asociación entre el polimorfismo rs8033595 del gen

CRTC3 y mayor peso, IMC y circunferencia de cadera, pero sólo en población

México-Americana. Nosotros encontramos que los individuos con el polimorfismo,

tienen mayores niveles de colesterol en sangre, LDL y circunferencia de la cadera,

pero esta asociación únicamente se dio en el grupo de los hombres.

Posiblemente en el grupo de las mujeres hay varios factores de confusión, por

ejemplo, los cambios hormonales propios de la adolescencia, que están impidiendo

que el efecto del polimorfismo pueda dilucidarse. Es conveniente evaluar este

polimorfismo en población de distinta edad.

En cuanto al porcentaje de grasa corporal y la percentila del IMC, las diferencias

no son estadísticamente significativas, a pesar de observarse valores mayores en

39
los individuos con el polimorfismo, posiblemente esto se debe a que nuestra muestra

es muy pequeña.

Aunque éste fue un estudio piloto con una muestra pequeña, planeado para

obtener la frecuencia alélica del polimorfismo rs8033595 en mexicanos y una

descripción inicial del efecto clínico del polimorfismo, los resultados obtenidos

demuestran que el efecto del gen, al menos en el grupo de hombres, parecer ser

mayor que el evaluado en los estudios previos, donde pese al gran número de

individuos incluidos, las diferencias observadas no son tan grandes.

Aún es necesario realizar estudios más detallados acerca del mecanismo por

el cual el polimorfismo está relacionado con mayores niveles de colesterol y LDL, sin

embargo, una probable explicación es que la proteína CRTC3 mutada está

constantemente activa en el núcleo y unida a CREB, donde quizás está

interactuando con la transcripción de genes que regulan la biosíntesis de esteroles o

bien, el metabolismo de lípidos.

Para la genotipificación estandarizamos una técnica que tiene varias ventajas,

entre ellas, la alta especificidad de la endonucleasa para reconocer el sitio de

restricción, además de que es fácilmente reproducible, y el equipo de laboratorio

requerido para su realización es el básico de cualquier laboratorio de biología

molecular, finalmente su costo es reducido comparado con otros métodos, por lo

cual podría ser utilizado para realizar un screening e identificar a los individuos que

por tener el polimorfismo sean más susceptibles a tener niveles mayores de

colesterol y LDL, que están asociados a ateroesclerosis y riesgo cardiovascular.

40
XV. LIMITACIONES Y PERSPECTIVAS

El objetivo inicial de esta tesis fue evaluar los niveles de expresión de la

variante en una población de adolescentes mediante PCR en tiempo real.

Suponíamos que la mayor diferencia se encontraría entre individuos heterocigotos,

teniendo mayores niveles expresión de la variante aquellos que tuvieran mayor peso

corporal, IMC y circunferencia de cadera.

Distintas estrategias fueron probadas para evaluar los niveles de expresión; la

primera fue utilizar curvas de disociación de alta resolución utilizando un par de

cebadores en común, esperábamos ver una diferencia en la temperatura de

disociación que nos permitiera discernir entre la variante y la secuencia original.

Sin embargo, debido a que no conocíamos el genotipo de los individuos y a

que la diferencia entre las temperaturas era de apenas 0.5ºC, no logramos distinguir

cual curva representaba a la secuencia con la variante.

La segunda estrategia fue diseñar cebadores alelo-específico con una cola de

poli-GCs, con la finalidad de distinguir la variante de la secuencia original mediante

las temperaturas de disociación, tomando como punto de partida que conocíamos la

longitud de las colas de poli-GCs añadidas a cada cebador.

Con esta estrategia pudimos observar dos temperaturas de disociación

diferentes, sin embargo, suponemos que se estaba generando una reacción cruzada

(la característica de estos cebadores es que tienen una secuencia en común pero en

el extremo 3´ tienen la base complementaria a la secuencia que se pretende

identificar), y debido a que no se contaba con muestras control (de las cuales se

41
conociera la secuencia), no pudimos ajustar las condiciones de amplificación para

que fueran lo suficientemente astringentes y así evitar la reacción cruzada.

Posteriormente se decidió que no podríamos continuar hasta tener controles

de cada genotipo posible; para ello se diseñaron cebadores utilizados para

secuenciación, dentro de sus características la principal es que estén al menos a

100pb de distancia del sitio de la mutación. Ya que en nuestro laboratorio no

contamos con secuenciador, y los costos para hacer un screening de muestras eran

muy elevados, se buscó una endonucleasa de restricción cuyo sitio de restricción

coincidiera con la secuencia de la mutación, encontrando así a la enzima BsrDI.

Se secuenciaron 8 muestras de ADN de la colección genómica del

Laboratorio de Genómica Viral Humana de la Facultad de Medicina de la UASLP,

encontrando los tres genotipos posibles; con estas muestras se comprobó la

especificidad de la enzima BsrDI.

Para estandarizar las condiciones de amplificación del fragmento del gen

CRTC3 y del tratamiento con la endonucleasa, se colectaron muestras de

voluntarios con características fenotípicas que nos hicieran sospechar de qué

genotipo se trataría. Cabe mencionar que todos los voluntarios eran mayores de 25

años, y que a pesar de que no se realizó una comparación estadística de los valores

de peso, IMC y PGC, los individuos heterocigotos tenían mayores valores que los

individuos sin el polimorfismo.

Se planea continuar con esta línea de investigación, y dentro de las

perspectivas a mediano y largo plazo se encuentran:

- Evaluación de los niveles de expresión de la variante en los individuos con

genotipo heterocigoto u homocigoto para la variante.


42
- Evaluación de la expresión diferencial entre células del tejido adiposo vs

monocitos, ya que de no encontrar diferencias, o bien, de encontrar una

relación proporcional, se podría proponer la evaluación de la expresión en

sangre periférica como biomarcador del riesgo de desarrollar obesidad o

dislipidemias a edades tempranas.

- Encontrar los factores que modifican la expresión de la variante, sobretodo en

pacientes heterocigotos, evaluando en un modelo in vitro de cultivos primarios

de adipocitos provenientes de pacientes cuyo genotipo para la variante S72N

sea conocido, las variaciones en la expresión al ser expuestos a distintas

condiciones, tales como: hiperglicemia, hipercolesterolemia,

hipertrigliceridemia o una combinación de las tres, y evaluar los tiempos de

exposición necesarios para activar o desactivar la expresión de la variante.

- Diseñar un estudio para evaluar el cambio de dieta en pacientes con

sobrepeso y obesidad cuyo genotipo para la variante S72N sea heterocigoto u

homocigoto para la variante, y así investigar si existe una expresión

diferencial inducida por dieta y ejercicio.

- Se planea evaluar también los polimorfismos evaluados por Zejin y col., en

población China, buscando si en nuestra población existe la misma

asociación entre dichos polimorfismos y dislipidemias, además de crear un

modelo en el que se incluyan los tres polimorfismos para ver si además hay

interacciones entre ellos.

- Desarrollar una estrategia para bloquear la actividad de la proteína CRTC3.

43
XVI. CONCLUSIONES

- La prevalencia de sobrepeso y obesidad global en la población estudiada fue

del 35%. La prevalencia de sobrepeso en mujeres fue del 23.7% y de

obesidad del 12.1%. En el caso de los hombres, la prevalencia de sobrepeso

fue de 19% y la de obesidad del 14%.

- Se han estandarizado las condiciones de la técnica de PCR-RFLP para la

detección del SNP rs8033595 del gen CRTC3, utilizando como material de

inicio el ADN genómico extraído de muestras de sangre periférica.

- La frecuencia alélica fue de 32% para el alelo A y 68% para el alelo G.

- El polimorfismo rs8033595 está asociado con mayores niveles de colesterol

en sangre, LDL y circunferencia de la cadera, en adolescentes del sexo

masculino.

44
XVII. BIBLIOGRAFÍA

1. Barnett A, Kumar S. Obesity and Diabetes. [en línea]. Great Britain: Wiley-
Blackwell. 24-abr-2009; citado: 23-may-2011. Disponible en:
http://onlinelibrary.wiley.com/doi/10.1002/9780470741474.fmatter/pdf.
2. Lyon H, Hirschhorn J. Genetics of common forms of obesity: a brief overview.
Am J Clin Nutr 2005. 82 (1):2155-2175.
3. NOM, Norma Oficial Mexicana. “NOM-008-SSA3-2010, para el tratamiento
integral del sobrepeso y la obesidad.” 2010.
4. Paredes R. El Ejercicio Actual de la Medicina: Sobrepeso y Obesidad en el
Niño y el Adolescente. [en línea]. México: UNAM. 2007; citado: 16-ene-2012.
Disponible en:
http://www.facmed.unam.mx/eventos/seam2k1/2007/ago_01_ponencia.html
5. CDC. Center for Disease Control and Prevention. [en línea]. Atlanta, USA:
CDC. 27-abr-2010; citado: 30-mar-2011. Disponible en:
http://www.cdc.gov/obesity/childhood/basics.html (accessed 2011-03-30)
6. Alvero-Cruz J, Fernández-García J, Barrera-Expósito J, Alvarez-Carnero E,
Carrillo de Albornoz-Gil M, Martín-Fernández M, Reina-Gómez A.
Composición corporal en niños y adolescentes. Archivos de medicina del
deporte 2009; XXVI (131):228-237.
7. Freedman DS, Mei Z, Srinivasan SR, Berenson GS, Dietz WH. Cardiovascular
risk factors and excess adiposity among overweight children and adolescents:
the Bogalusa Heart Study. Pediatr 2007; 150 (1): 12-17.
8. OMS. Organización Mundial de la Salud. Obesidad y sobrepeso. [en línea].
May-2012; citado: 12-may-2012. Disponible en:
http://www.who.int/mediacentre/factsheets/fs311/es/
9. Gutiérrez JP, Rivera-Dommarco J, Shamah-Levy T, Villalpando-Hernández S,
Franco A, Cuevas-Nasu L, Romero-Martínez M, Hernández-Ávila M. Encuesta
Nacional de Salud y Nutrición 2012. Resultados Nacionales. [en línea].
Cuernavaca, México: Instituto Nacional de Salud Pública. 2012; citado: 23-

45
nov-2013. Disponible en:
http://ensanut.insp.mx/informes/ENSANUT2012ResultadosNacionales.pdf
10. Bell CG, Walley AJ, Froguel P. The Genetics of Human Obesity. Nat Rev
Genet. 2005. 6(3):221-34.
11. Nestle, M. Food Marketing and Childhood Obesity — A Matter of Policy. N
Engl J Med 2006. 354:2527-2529.
12. Barquera S, Tolentino L. Geografía de las enfermedades asociadas con la
nutrición en México: una perspectiva de transición epidemiológica. [en línea]
Instituto Nacional de Salud Pública de México. 2005. 11(43):133-149.
Disponible en: http://www.redalyc.org/articulo.oa?id=11204307
13. Farooqi S, O'Rahilly S. Genetics of obesity in humans. Endocr Rev. 2006;
27(7):710-18.
14. Sabin MA1, Werther GA, Kiess W. Genetics of obesity and overgrowth
syndromes. Best Pract Res Clin Endocrinol Metab. 201; 25(1):207-20.
15. Razquin C, Marti A, Martinez JA. Evidences on three relevant obesogenes:
MC4R, FTO and PPARc. Approaches for personalized nutrition. Mol Nutr
Food Res. 201; 55(1):136-49.
16. Song Y1, Altarejos J, Goodarzi MO, Inoue H, Guo X, Berdeaux R, et al.
CRTC3 links catecholamine signalling to energy balance. Nature. 2010;
468(7326):933-9.
17. Ou Z, Wang G, Li Q, Ma Z, Dai M, Zou F. CRTC3 polymorphisms were
associated with the plasma level of total cholesterol and the risks of
overweight and hypertriglyceridemia in a Chinese Han population. Mol Biol
Rep. 2014;41(1):125-30
18. Altarejos J, Montminy M. CREB and the CRTC co-activators: sensors for
hormonal and metabolic signals. Nat Rev Mol Cell Biol. 201;12(3):141-51
19. Weizmann Institute of Science. CREB Regulated Transcription Coactivator 3.
[en línea]. Weizmann Institute of Science. Israel. 23-oct-2013; citado: 23-nov-
2013. Disponible en:
http://www.genecards.org/cgi-bin/carddisp.pl?gene=CRTC3

46
20. Skalova A, Vanecek T, Simpson RH, Vazmitsel MA, Majewska H, Mukensnabl
P, et al. CRTC1-MAML2 and CRTC3-MAML2 fusions were not detected in
metaplastic Warthin tumor and metaplastic pleomorphic adenoma of salivary
glands. [en línea]. Am. J. Surg. Pathol. 2013; 37 (11), 1743-1750. Disponible
en: http://www.ncbi.nlm.nih.gov/nuccore/NM_022769.4
21. UniProt Consortium. Q6UUV7 [72], CREB-regulated transcription coactivator
3, Homo sapiens. [en línea] EMBL-EMB: UK. Citado: 23-nov-2013. Disponible
en: http://www.uniprot.org/uniprot/Q6UUV7#Q6UUV7-1
22. Pombo M. Tratado de endocrinología pediátrica. 2ª edición. España:
Ediciones Díaz de Santos. 1997.
23. NCBI. Restriction Fragment Length Polymorphism (RFLP). [en línea]. NCBI:
USA. Citado: 23-nov-2013. Disponible en:
http://www.ncbi.nlm.nih.gov/genome/probe/doc/TechRFLP.shtml
24. Pray L. Restriction enzymes. Nature Education. 2008; 1(1):38 [en línea].
Citado: 23-nov-2013. Disponible en:
http://www.nature.com/scitable/topicpage/restriction-enzymes-545
25. New England Biolabs. BsrDI. [en línea]. Citado: 23-nov-2013. Disponible en:
https://www.neb.com/products/r0574-bsrdi

47
ANEXO I: OBTENCIÓN DE SECUENCIAS Y DISEÑO DE CEBADORES

Con base en el estudio publicado por Song y col. se buscó la variante S72N
del gen CRTC3, asociada en dicho estudio con obesidad en población México-
Americana; la variante se puede encontrar en el sitio “gene-cards” bajo la referencia:
rs8033595.

Se identificó la posición del SNP en la secuencia del gen CRTC3 de la base


de datos del GeneBank. Los cebadores se diseñaron tomando en cuenta que debían
estar a una distancia mínima de 100 bases respecto al sitio de la mutación, con la
finalidad de que los fragmentos obtenidos al tratar los productos de PCR con la
endonucleasa fueran de distintos tamaños, y poder discernir comparando con el
marcador de peso molecular.

Las características de los cebadores fueron verificadas en el sitio de


Integrated DNA Technologies (IDT), con la herramienta OligoAnalyzer 3.1.

SELF-DIMER HETERO-DIMER
HAIRPIN
ID SECUENCIA GC% TM (ºC) (kcal.m ole -1)
Delta G Delta G
(kcal/m ole) (kcal/m ole)
Fwd CCTCTCAGCGTTCTTAAA TC 45 50.7 -5.4 -4.85
-7.06
Rev GACTTTCCAAAAGAAGACTG 40 48.8 -1.74 -5.49

Utilizando la herramienta Primer-BLAST del sitio NCBI se realizó un


alineamiento de los cebadores contra la base de datos del genoma humano para
comprobar la especificidad de los cebadores y para verificar el tamaño del amplicón.

48
ANEXO II: PURIFICACIÓN DE ADN GENÓMICO.

Para la extracción y purificación de ADN genómico se utilizó el kit comercial


Wizard® Genomic DNA Purification Kit A1120.
Se hicieron modificaciones al protocolo proporcionado por la casa comercial
debido a que las muestras de sangre habían sido conservadas en refrigeración
por dos años en tubos vacutainer con EDTA.
1. Transferir 300 µl de sangre total con EDTA a un microtubo estéril de 2 ml y
añadir 900 µl de Solución de Lisis Celular. Mezclar por inversión 6 veces.
2. Incubar a temperatura ambiente por 10 minutos, invirtiendo el tubo 3 veces
durante este periodo.
3. Centrifugar a 14 000 rpm por 20 segundos a temperatura ambiente.
4. Decantar el sobrenadante invirtiendo el tubo y dejando secar en una toalla de
papel, dejando un volumen residual aproximado de 20 µl.
5. Agitar con vórtex vigorosamente durante 20 segundos, hasta que todas las
células blancas estén completamente resuspendidas.
6. Pipetear con punta amarilla 10 veces para terminar de disgregar las células.
Agregar 300 µl de Solución de Lisis Nuclear a las células resuspendidas y
pipetear despacio 6 veces para lisar completamente las células.
7. Añadir 100 µl de Solución de Precipitación de Proteínas al lisado nuclear y
agitar con vórtex vigorosamente durante 20 segundos.
8. Centrifugar a 14,000 rpm por 3 minutos a temperatura ambiente. Al finalizar
debe verse una pastilla café que contiene las proteínas.
9. Transferir el sobrenadante a un microtubo estéril de 1.5 ml que contenga 300
µl de Isopropanol.
10. Mezclar suavemente invirtiendo el tubo 5 veces. Incubar 1 hora a -20ºC.
11. Centrifugar a 14,000 rpm por 10 minutos a temperatura ambiente.
12. Decantar el sobrenadante invirtiendo cuidadosamente el tubo (para evitar que
se desprenda la pastilla) y dejando secar sobre una toalla de papel.
13. Añadir 300 µl de Etanol al 70% , lavar suavemente invirtiendo 2 veces el tubo.
14. Centrifugar a 14,000 rpm por 10 minutos a temperatura ambiente.

49
15. Decantar el etanol invirtiendo suavemente el tubo y dejando secar sobre una
toalla de papel.
16. Dejar secar la pastilla a 37ºC por 30 minutos.
17. Resuspender en 20 µl de agua libre de DNasas (pipeteando 10 veces), y
dejar a temperatura ambiente toda la noche.

50
ANEXO III: CUANTIFICACIÓN DE ADN MEDIANTE ESPECTROFOTOMETRÍA

Se utilizó el Nanodrop 2000 para cuantificar la concentración de ADN genómico


extraído, así como para verificar su pureza.
1. Iniciar el programa dando clic en el ícono “Nanodrop 2000” que está en el
escritorio.
2. El programa le pedirá que seleccione el tipo de muestra antes de empezar,
elegir “NUCLEIC ACIDS”.
3. Una vez que se ha abierto la ventana, el programa mostrará un aviso que dice
que debe asegurarse que el brazo del pedestal se encuentra abajo para hacer
una verificación rutinaria, después de asegurarse que el brazo se encuentra
abajo, dar clic en “OK”.
4. Levantar el brazo del pedestal y pipetear 2 µl de agua libre de DNasas.

5. Bajar el brazo del pedestal e iniciar la medición dando clic en el ícono


“Blank”. La columna de líquido se formará automáticamente entre el brazo y
la base del pedestal, el haz de luz pasará a través de ella, y la medición
estará hecha.
6. Cuando se haya completado la medición, subir el brazo del pedestal y limpiar
ambas partes del pedestal (brazo y base) con un pañuelo desechable.

7. Levantar el brazo del pedestal y pipetear 2 µl de la muestra.

51
8. Bajar el brazo del pedestal e iniciar la medición dando clic en el ícono
“Measure”.
9. Cuando se haya completado la medición, subir el brazo del pedestal y limpiar
ambas partes del pedestal (brazo y base) con un pañuelo desechable.
10. Repetir del paso 9 al 11 con cada una de las muestras.
11. El programa indica la concentración de la muestra en ng/µl e indica la relación
de las absorbancias a 260nm (longitud de onda a la cual absorbe el DNA) y
280nm (longitud de onda a la cual absorben las proteínas). Además de
proporcionar las curvas de absorbancia como la que se muestra a
continuación:

Curvas de absorbancia de las muestras problema obtenidas mediante espectofotometría con el


Nanodrop 2000

12. Si la relación 260/280 es mayor o igual a 1.8, significa que la muestra tiene
mayor absorbancia a 260nm, lo que indica que está libre de impurezas
proteínicas.

52
ANEXO IV: AMPLIFICACIÓN DEL FRAGMENTO DEL GEN CRTC3 POR PCR EN
PUNTO FINAL.

1. Se estandarizaron las condiciones para la amplificación de un producto de


261pb que contiene aproximadamente a la mitad, el sitio de restricción de la
endonucleasa BsrDI utilizada para la genotipificación.
2. El primer parámetro que se tomó en cuenta fue la temperatura de
alineamiento de los cebadores. Se probó un gradiente de temperaturas con
diferencia de 3ºC, desde 50ºC hasta 59ºC con una concentración de MgCl 2 de
1.0 mM.

Rampa de temperatura de alineamiento de los cebadores. 50ºC, 53ºC, 56ºC y 59ºC, para
amplificar el fragmento del gen CRTC3.

La temperatura de alineamiento de los cebadores que fue elegida


con base a la intensidad de la banda y la ausencia de productos inespecíficos
fue 59ºC.
3. Posteriormente se hizo una titulación de MgCl2, probando 5 concentraciones,
desde 1.0mM hasta 3.0mM con intervalos de 0.5mM.

Titulación de MgCl2 para amplificar el fragmento del gen CRTC3.

La concentración final de MgCl2 elegida fue 1.0mM, con base en la


intensidad de la banda y la ausencia de productos inespecíficos.

53
4. Finalmente se llevó a cabo una titulación con distintas concentraciones finales
de cebadores. Se probaron 5 concentraciones 100, 200, 400, 500 y 800 nM.
5. La concentración final de cebadores fue de 500 nM con base en la
intensidad de la banda.
6. La reacción se llevó a cabo en un volumen final de 25µl con los siguientes
componentes:
Reactivo Conc. Conc. µl para
inicial final vf=25µl
Buffer 10X 1X 2.5
MgCl2 50mM 1mM 0.5
dNTPs 10mM 0.2mM 0.5
Cebador sentido 10µM 0.5µM 1.25
Cebador antisentido 10µM 0.5µM 1.25
Taq polimerasa 5U 0.04U 0.2
ADN molde 100ng 20ng 5.0

7. Las condiciones de amplificación utilizadas fueron las siguientes:

54
ANEXO V: ELECTROFORESIS EN GEL DE AGAROSA
Se utilizaron dos concentraciones de agarosa para preparar los geles, la
primera fue de 2.5% para verificar la amplificación del producto de PCR de
261pb.
La segunda concentración fue de 3% y se utilizó para identificar el genotipo
de los productos de PCR digeridos con la enzima BsrDI.

1. Para preparar los geles con diferentes concentraciones, solamente cambia la


cantidad de agarosa que se utiliza.
a. Para un gel al 2.5% pesar 0.75g de agarosa, para el gel al 3% pesar
0.9g de agarosa.
b. Mezclar la agarosa con 30ml de buffer TBE 1X en un matraz
Erlenmeyer.
c. Colocar en una placa de calentamiento con agitación y dejar que llegue
al punto de ebullición.
d. Retirar de la placa y dejar enfriar hasta que sea tolerable al tacto.
e. Agregar 2µl de bromuro de etidio.
f. Vaciar en la bandeja de plástico con el peine colocado.
g. Dejar polimerizar 30 minutos a temperatura ambiente.
h. Retirar el peine, halando hacia arriba de manera firme.
2. Cargar las muestras
a. Colocar la bandeja con el gel dentro de la cámara electroforética,
cuidando que los pocillos queden del lado del anión (color negro).
b. Mezclar 2.5 µl de buffer de carga y 8.0 µl de muestra sobre un trozo de
parafilm.
c. Cargar 10.5 µl en cada pocillo.
3. Condiciones de corrida
Para verificar la amplificación del producto de PCR de 261pb:
a. Programar la fuente de poder a 75V por 30 minutos.

55
b. Conectar los cables de la cámara electroforética a la fuente de poder,
haciendo coincidir los colores de los cables.
c. Iniciar la corrida.
Para identificar el genotipo de los productos de PCR digeridos con la enzima
BsrDI:
a. Programar la fuente de poder a 50V por 90 minutos.
b. Conectar los cables de la cámara electroforética a la fuente de poder,
haciendo coincidir los colores de los cables.
c. Iniciar la corrida.

56
ANEXO VI: FOTODOCUMENTADOR

Para observar la localización e intensidad de las bandas de los productos


amplificados y de los productos digeridos con la enzima BsrDI, se utilizó el
fotodocumentador del Departamento de Microbiología de la Facultad de
Medicina de la UASLP.

1. Iniciar el programa Kodak.


2. Colocar el gel en el fotodocumentador y cerrar la puerta de éste
3. Clic en “Initiate capture”.
4. Una vez que aparezca el cuadro donde se muestra la imagen dar clic en
“Preview”.
5. Encender el transiluminador.
6. Enfocar
7. Cuando ya se haya enfocado la imagen dar clic en “Capture”
8. Clic en “File>Export>Image”
9. Seleccionar el nombre del archivo y guarder.

PCR para la amplificación del fragmento del gen CRTC3 (261pb).

57
ANEXO VII: PATRÓN DE BANDEO PARA CADA GENOTIPO POSIBLE

Se seleccionaron ocho muestras de la colección genómica del Laboratorio de


Genómica Viral Humana de la UASLP. Dichas muestras fueron secuenciadas en el
laboratorio con el método de Sanger. Se analizaron los electroferogramas y se eligió
1 muestra de cada genotipo posible para usarlas como controles en el método PCR-
RFLP.

Se obtuvieron los productos de PCR de las 3 muestras y posteriormente se trataron


con la endonucleasa BsrDI. Se obtuvo el patrón de bandas para cada genotipo
posible.

Patrón de bandas para genotipificación con PCR-RFLP.

GENOTIPO NÚMERO DE FRAGMENTO 1 FRAGMENTO 2 FRAGMENTO 3


BANDAS (bp) (bp) (bp)
AA 2 143 118 -
GA 3 261 143 118
GG 1 261 - -

Número de bandas y tamaño de los fragmentos esperados según el genotipo del gen CRTC3 en
pares de bases (bp).

58
ANEXO VIII: CARTA DE APROBACIÓN DEL COMITÉ DE BIOÉTICA

59
ANEXO IX: MOVILIDAD INTERNACIONAL

Maestría en Ciencias en Investigación Clínica

DEFECTOS CONGÉNITOS DE GLICOSILACIÓN: ANÁLISIS DEL TRÁFICO INTRACELULAR DE LA PROTEÍNA


DPAGT1 Y EVALUACIÓN DE LA ACTIVIDAD ENZIMÁTICA DE LA PROTEÍNA PMM2.

Proyecto de estancia de investigación

AMÉRICA SUSANA MARES GARCÍA


TUTOR: DRA. BELÉN PÉREZ GONZÁLEZ
MADRID 2012

60
INTRODUCCIÓN
La glicosilación es una de las modificaciones co y post-traduccionales más comunes, se
estima que el 50% de las proteínas están glicosiladas. Esta modificación juega un papel vital
en los procesos biológicos, tales como, reconocimiento molecular y señalización intra e
intercelular. Los glicanos pueden influir en la función de la proteína afectando su
plegamiento, solubilidad, estabilidad y el reconocimiento de sus sitios de unión.
Las alteraciones en la glicosilación han sido asociadas a varias enfermedades, por lo que el
entendimiento detallado de la estructura de las glicoproteínas, puede proporcionar
información útil en la investigación biomédica y el descubrimiento de fármacos para
entender y tratar estas enfermedades.

Los desórdenes congénitos de glicosilación (CDG), son un grupo de más de 30 desórdenes


autosómicos recesivos causados por una glicosilación deficiente, afectando principalmente
la vía de la N-glicosilación. Las reacciones defectuosas de glicosilación, pueden ser
organizadas en cinco categorías, basado en la actividad enzimática y en la localización
subcelular. La primera categoría comprende las enzimas citosólicasfosfomanomutasa 2
(PMM2) y manosa fosfato isomerasa (MPI) [Matthijs et al., 1997; Niehues et al., 1998]. La
segunda categoría incluye la N-acetilglucosaminil y manosiltransferasa, enzimas involucradas
en el ensamblaje del oligosacáridounido al dolicol en el lado citosólico de la membrana del
retículo endoplásmico [Thiel et al., 2003; Wu et al., 2003; Grubenmann et al., 2004]. La
tercera y cuarta categorías incluyen las enzimas manosiltransferasa y glucosiltransferasa que
elonganel oligosacárido unido al dolicol orientado al lumen[Imbach et al., 1999; Körner et al.,
1999; Chantret et al., 2002, 2003; Frank et al., 2004], mientras que la última categoría
comprende a las proteínas que modifican al dolicol o afectan la disponibilidad de los
carbohidratos unidos a dolicol para la vía de ensamblaje [Imbach et al., 2000b; Schenk et al.,
2001; Kranz et al., 2007b; Haeuptle et al., 2008; Lefeber et al., 2009].

Los síntomas de los CDGs incluyen retraso en el desarrollo, ataxia, convulsiones, fibrosis
hepática, retinopatía, disfunción cardiaca y coagulopatías. La prevalencia de las CDGs a nivel

61
mundial está estimada en 1:20.000, y existe una morbi-mortalidad muy significativa asociada
con este desorden, el 20% de los niños no sobreviven más de 5 años de edad, y los que lo
hacen desarrollan problemas médicos importantes durante sus vidas.

La deficiencia de fosfomanomutasa (PMM)2, es un defecto en el segundo paso de la vía de la


manosa (transformación de manosa-6-P en manosa-1-P), que normalmente da lugar a la
síntesis de manosa-GDP. Este azúcar nucleotídico es el donador de manosas utilizado en el
RE para ensamblar el precursor del oligosacárido dolicol-pirofosfato. La deficiencia de
manosa-GDP causa la hipoglicosilación de numerosas glicoproteínas, incluidas proteínas
séricas, enzimas lisosomales y glicoproteínas de membrana. PMM2-CDG es el desorden de
N-glicosilación más frecuente, y tiene un espectro muy amplio de manifestaciones clínicas. El
sistema nervioso está afectado en todos los pacientes, y otros órganos están involucrados en
distintas formas.

La deficiencia de dolicol fosfato N-acetilglucosamina-1 fosfato transferasa (DPAGT1) causa la


CDG tipo Ij. Esta enzima cataliza la primera transferencia del azúcar al lípido acarreador
dolicol-fosfato para construir un intermediario en la vía de proteínas N-glicosiladas: UDP-N-

acetilglucosamina+dolicol-fosfato→dolicolpirofosfato-N-acetilglucosamina+UMP.

OBJETIVOS:
El objetivo de los experimentos realizados para la proteína DPAGT1, ha sido analizar el
efecto de las mutaciones en el tráfico intracelular de DPAGT1, por lo que se han co-
transfectadocultivos de células COS-7 con la proteína recombinante DPAGT1 fusionada a
GFP y DsRed-calreticulina (marcador del retículo endoplásmico), y posteriormente se
observa la localización intracelular de ambos marcadores mediante microscopía FRET.

Para la proteína PMM2 el objetivo principal ha sido evaluar la actividad enzimática basal en
distintos tipos celulares, para posteriormente elegir al que tuviese la menor actividad
yluegousarla para transfectarla con proteína PMM2 recombinante, tanto wild-type como

62
con mutaciones introducidas utilizando mutagénesis dirigida, y así evaluar el efecto de las
mutaciones sobre la actividad de la proteína.

MATERIALES Y MÉTODOS:

1. LÍNEAS CELULARES Y CONDICIONES DE CULTIVO

Se mantuvieron cultivos de 3 líneas celulares establecidas para los experimentos: COS-7,


HEK, HEP3B y una línea de fibroblastos transformados: GM8680T2. Todas eran células
adherentes y se mantuvieron en placas de cultivo p100, con 8ml de medio MEM
suplementado previamente con 5% de suero fetal bovino (FBS), L-glutamina 2mM y 0,1% de
mezcla de antibióticos (penicilina/estreptomicina), bajo condiciones estándar de cultivo
(37°C, 95% de humedad relativa y 5% de CO 2).

2. EXTRACCIÓN DE PROTEÍNAS

Las células fueron recogidas de las placas utilizando 1ml de tripsina -EDTA durante 5 minutos
a 37°C, posteriormente se agregaron 4ml de medio MEM y se centrifugaron 5 minutos a
1500 rpm, el pellet se resuspendió en 1ml de PBS 1X y se centrifugó a máxima velocidad por
1 minuto, el sobrenadante se descartó. El pellet se resuspendióen 270ul de buffer de
resuspensión y 30ul de inhibidor de proteasas. Las células fueron lisadas, congelándolas en
nitrógeno líquido y descongelándolas a 37°C tres veces, y posteriormente se centrifugaron a
1500 rpm por 5 minutos a 4°C., la concentración de proteínas fue determinada mediante el
método de Bradford (Bradford, 1976) byBio-Rad ProteinAssayReagent (Bio-Rad), midiendo la
absorbancia a 595nm e interpolando los resultados en la curva patrón realizada con
concentraciones conocidas de albúmina de suero bovino (BSA) 1mg/ml.

3. ANÁLISIS DEL TRÁFICO INTRACELULAR DE LA PROTEÍNA DPAGT1

Células COS-7 (175.000 células por placa) fueron co-transfectadas con cDNA de DPAGT1
humana fusionada a GFP en el plásmido pCMV6-AC-GFP (RG201787, OriGene) y con el
vector de calreticulina-DsRed Living Color® específico para retículo endoplásmico (BD
LinvingColors ™ FluorescentProteins, BD Biosciences). Este procedimiento fue desarrollado

63
utilizando el kit jetPEI® Polyplustransfection™, con una cantidad total de DNA de 3ug (ratio
N/P=5) en una proporción
1:1. Posteriormente, las células fueron incubadas a 37°C por 48 horas, y luego observadas
con un microscopio invertido (Axiovert200, Zeiss) con filtros fluorescentes para GFP, DsRed y
Dapi, con un aumento de 63x.

4. MUTAGÉNESIS SITIO-DIRIGIDA

Las mutaciones c.791T>G y c.358C>A fueron introducidas en el vector DPAGT1-GFP con


cebadores específicos diseñados de acuerdo a las instrucciones del kit QuikChange II Site-
DirectedMutagenesis (Stratagene).

5. ACTIVIDAD DE LA PROTEÍNA PMM2

La actividad enzimática de la proteína PMM2 se midió a partir de los extractos totales de los
cultivos celulares, esta medición se llevó a cabo mediante el método de Van Shaftigen (1995)
(6), modificado por Koning (1998) (7) midiendo en un espectofotómetro a 340nm la
formación de NADPH en una reacción enzimática acoplada. Para este proceso hemos
dispuesto de Tampón Hepes 100mM (pH 7,1), Tampón Hepes 10mM (pH 7,1), Tampón de
parada (Tampón de Parada (CO 3-2/HCO3- 0,5 M, pH 10,7), MgCl 2 100 mM, Nicotinamida
Adenina Dinucleótido Fosfato 12 mM (NADP+), Glucosa-6-fosfato Deshidrogenasa 800 µg/µL
(G-6-PDH), FosfoglucosaIsomerasa 800 µg/µL (PGI), FosfomanosaIsomerasa 320 µg/µL (PMI),
Glucosa-1,6-difosfato (G-1,6-diP) y Manosa-1-Fosfato 8 mM (Man-1-P). Se probaron distintas
concentraciones de los extractos totales de proteína para identificar a qué concentración se
saturaba la reacción. La reacción se dispara con Man-1-P y se detiene a los 30 minutos con el
tampón de parada.

64
RESULTADOS
1. Para evaluar el efecto de cada mutación en la localización y la estabilidad de la
proteína DPAGT1, se realizó una co-transfección de células COS-7 con la proteína
recombinante DPAGT1 fusionada a GFP y DsRed-calreticulina (marcador de retículo
endoplásmico). Se evaluaron 6 mutaciones: c.358C>A (p.Leu120Met), c.1154T>G
(p.Leu385Arg), c.902G>A (p.Arg301Hys), c.329T>C (p.Phe110Ser), c.901C>T
(p.Arg301Cys) y c.791T>G (p.Val264Gly).

WT p.Leu120Met p.Leu385Arg p.Arg301Hys

DPAGT1-GFP

DsRed-
Calreticulina

MERGE

Figura 1. Co-detección de DPAGT1-GFP (verde) y DsRed-calreticulina (rojo) en células COS-7 co-transfectadas


con los plásmidos respectivos. El Merge (amarillo) muestra la superposición de ambos colores. WT = wild type.

65
WT p.Phe110Ser p.Arg301Cys p.Val264Gly

DPAGT1-GFP

DsRed-
Calreticulina

MERGE

Figura 2. Co-detección de DPAGT1-GFP (verde) y DsRed-calreticulina (rojo) en células COS-7 co-transfectadas


con los plásmidos respectivos. El Merge (amarillo) muestra la superposición de ambos colores. WT = wild type.

66
2. Se evaluó la actividad basal de la proteína PMM2 en extractos totales de cuatro
líneas celulares establecidas para elegir a la que tuviese la menor actividad basal y
posteriormente utilizarla para hacer transfecciones con la proteína nativa y las
proteínas mutantes, con el objetivo de evaluar los posibles efectos que pudiesen
tener las mutaciones sobre la actividad de la proteína.

6.00 7.00

5.00 6.00

5.00
4.00
4.00
mU

3.00

mU
3.00
2.00
2.00
1.00 1.00
0.00 0.00
0 100 200 300 0 100 200 300 400
-1.00
ug proteína extracto total COS-7 ug proteína extracto total HEP3B

A) B)
7.00 7.00

6.00 6.00

5.00 5.00

4.00 4.00
mU
mU

3.00 3.00

2.00 2.00

1.00 1.00

0.00 0.00
0 100 200 300 400 0 100 200 300
-1.00
ug proteína extracto total HEK293 ug proteína extracto total GM8680T2
C) D)

Figura 3. Curvas de actividad basal de la proteína PMM2 en distintas líneas celulares.


A) CélulasCOS-7 B) Células HEP3B C) Células HEK293 D) Fibroblastos transformados.

67
CONCLUSIONES:
La proteína DPAGT1 nativa se localiza en retículo endoplásmico, por lo que para
evaluar si alguna de las mutaciones (p.Leu120Met, p.Leu385Arg, p.Arg301Hys, p.Phe110Ser,
p.Arg301Cys y p.Val264Gly) causaba efectos en la correcta localización de la proteína, se co-
transfectaron las células con DsRed-calreticulina (para marcar el retículo endoplásmico) y la
proteína DPAGT1 fusionada a GFP; con esto se comparó la localización de la proteína nativa
respecto a la de las proteínas mutadas, observamos que no existe diferencia, por lo cual
inferimos que ninguna de las mutaciones evaluadas provocan efectos en la correcta
localización de la proteína DPAGT1.
Sin embargo, un efecto que se presentó durante el experimento, fue una disminución
en la fluorescencia emitida por las proteínas con las mutaciones p.Val264Gly, p.Leu385Arg y
p.Arg301Cys, siendo más evidente la disminución en esta última; probablemente estas
mutaciones tengan un efecto sobre la estabilidad en la proteína.
Se observó que la actividad basal de la proteína PMM2 en los distintos tipos celulares
es muy similar, sin embargo la línea celular con menor actividad basal fue COS-7 (células de
riñón de mono verde africano), comparada con la actividad basal de las otras líneas celulares:
HEK293 (células embrionarias de riñónhumano), HEP3B (células de hepatocarcinoma
humano) y GM8680T2 (fibroblastos transformados), por lo cual la línea celular que será
utilizada para los experimentos de transfección, será la línea celular COS-7.

68

También podría gustarte