Está en la página 1de 4

PLANES COMPLEMENTARIOS DE APOYO

Asignatura: Ciencias Naturales y Ed Ambiental Grado: 11° Periodo: II Año: 2017

RECOMENDACIONES

Cada periodo el docente formula una pregunta problematizadora o situación problema relacionada con las metas de
aprendizaje que le ayudan al estudiante a prepararse para sustentar sus conocimientos y niveles de competencia desde
cada área. Este proceso está programado para el viernes 26 de Mayo de 2017. El estudiante debe consultar los
referentes bibliográficos citados por el docente en cada asignatura y entregar los tres productos del periodo por medio de
trabajos escritos empleando normas básicas que den cuenta de las competencias adquiridas.

1. Pregunta problematizadora
¿Qué impacto tiene el uso indiscriminado de compuestos orgánicos como los hidrocarburos en el ambiente?
2. Metas de aprendizaje
 Al finalizar el periodo, los estudiantes estarán en la capacidad de reconocer los beneficios y perjuicios que traen los
hidrocarburos al ambiente.

3. Productos del periodo


 Presentar el cuaderno de química al día, en el cual deben estar resueltas todas las actividades (consultas, talleres y
ejercicios) de la clase. Además, incluir la entrega de la guía de actividades con los puntos trabajados de la página 83
a la 86 durante el periodo.

 Resuelve los siguientes problemas teniendo en cuenta las fórmulas trabajadas durante el periodo.
A. Un compuesto contiene 26,58% de K, 35,4% de Cr y 38,02% de O. ¿Cuál es su fórmula empírica?
B. Calcular la composición centesimal del sulfato de amonio (NH4)2SO4

 Para cada uno de los siguientes ítems, realice:


a. Tipos de enlace: Sigma (σ ¿ y Pi ( π ¿ .
b. Cadena principal y numeración (Teniendo en cuenta las normas).
c. Estructura o nombre, según sea el caso.
B.
A.

D.
C. 4 - Ter-Butil – 7 – metil – 1 – Octino
4. Referencias bibliográficas
 Química II Santillana
 Libro “La química del carbono”
(http://www7.uc.cl/sw_educ/educacion/grecia/plano/html/pdfs/cra/quimica/NM2/RQ2O102.pdf)

 Tener en cuenta los siguientes enlaces:

https://www.youtube.com/watch?v=Xi1b4MVLBkQ (Nomenclatura de Hidrocarburos)


https://www.youtube.com/watch?v=NjLgUxIGX98 (Nomenclatura de Hidrocarburos)
https://www.youtube.com/watch?v=6Pb2MkQogWE (Composición Porcentual)
https://www.youtube.com/watch?v=_ECCKx9Rw6E (Fórmula empírica y molecular)

COMPONENTE FÍSICO
1. Pregunta Problematizadora
¿Qué efectos tiene una carga eléctrica en el espacio y sobre otras cargas?
2. Metas de aprendizaje

 Identificar los conceptos de carga, electrización, fuerza y campo eléctrico.


 Identificar los diferentes métodos de electrización y los materiales: contacto, inducción y polarización.
 Determinar la magnitud de la fuerza eléctrica entre cargas mediante la descomposición vectorial de
fuerzas.
3. Productos del periodo

1. Dos cargas puntuales se encuentran cargadas con 3 µC y 24 µC. Si se acercan a una distancia de 1 cm, ¿cuál
es la fuerza de atracción entre ellas?
2. Dos cargas puntuales positivas de 3 µC y 4 µC se encuentran en el aire separadas 2 cm. Calcular la fuerza
resultante que las cargas ejercen sobre otra también positiva de 2 µC situada en el punto medio de la línea que
une las dos primeras.

3. Calcular la magnitud y la dirección de la fuerza que experimenta una carga negativa de 6 x109C, si se encuentra
dentro de un campo eléctrico de intensidad 4 N/C.
4. En los vértices de un triángulo equilátero de 4 cm de lado están colocadas tres cargas de 8x10-8C,
respectivamente. Calcula el valor de la fuerza ejercida por las otras dos y describe cómo es su dirección.
5. Referencias bibliográficas
 Física de Santillana 11
 Física de Tippens 11
 Física de Michell Valero 11

COMPONENTE BIOLÓGICO
1. Problematizing question:

What impact does the indiscriminate use of organic compounds such as hydrocarbons has on the
environment?

2. Learning Goals

I am able to acknowledge the importance of microorganisms and its applicability in biotechnology.

I am able to identify potential uses for processes and products made by biological organisms to be applied in
human situations.

I am able to assume a constructive attitude towards the proper use of biotechnology in our environment,
recognizing its potential advantages and disadvantages.

3. Academic products
➢ Make a conceptual map on the different branches of Biotechnology. (Definition and examples).
➢ From the following nucleotide sequences, determine their amino acids, taking into account their start and
stop codon.
a. ADN 5' ATGCCGCTACCGGGAAAATAGGCCCTTTATT 3'
b. ADN 3' ATCCCTAGTATTATGTTTCCCCGATAACGATAC 5'

➢ Answer the question with arguments: Would you edit the genes of your next child to be better than the
previous one, given the link http://elpais.com/elpais/2017/01/12/buenavida/1484239772_049539.html
(Maximum one page)

4. Bibliographic references
Lectura de texto: “Código genético”
https://www.ecured.cu/C%C3%B3digo_gen%C3%A9tico
Lectura de texto: “¿Qué es la biotecnología?”
http://www.centrobiotecnologia.cl/comunidad/que-es-la-biotecnologia/

Video: “¿Qué es la biotecnología?”


https://www.youtube.com/watch?v=QFV-hpGO8s8

Lectura: Guerra a la Mafia: Biotecnología ¿Qué te cuento?


http://www.editorialhelice.es/showbook/biotecnologia/index.html

Lectura: “¡Qué buena idea! Biotecnología para los más jóvenes


http://asabiotecnologia.com.ar/uploads/seccionarchivo/Libro_completo-Qu%C3%A9_buena_idea-Biotecnolog
%C3%ADa_para_los_m%C3%A1s_j%C3%B3venes_(2).pdf

Video: “Alimentos transgénicos – Micro 5”


https://www.youtube.com/watch?v=5P5AnfcWnOg&feature=youtu.be

También podría gustarte