Está en la página 1de 115

000-114

“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CARTILLA DE ACTIVIDADES

3º AÑO
LENGUA Y LITERATURA

Prof: Soruco Anahi (Periodo Octubre-Noviembre)


Código Classroom: 7yhib5j

1
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Fecha: CLASE : 40 ( 80’min)

El Cuento Policial

¿Qué es el relato Policial?

Un relato policíaco o relato de detectives es un subgénero


literario que agrupa a las narraciones breves o de mayor
extensión de hechos ficticios relacionados directamente
con criminales y con la justicia, generalmente teniendo
como tema principal la resolución de un misterio, la
persecución de un delincuente, o temas similares.

Tipologías

A) Tradicionales

De enigma: Un difícil crimen tiene lugar y sólo el detective


lo resuelve gracias a sus dones deductivos. El lector no
puede participar activamente en la aclaración del crimen, ya que es el sagaz detective
quien tiene todas las respuestas.

De problema: El crimen es resuelto por medio de pruebas físicas, psicológicas y


declaraciones de testigos y sospechosos. El lector puede intervenir activamente a medida
que se lleva a cabo la investigación.

B) Negros

Duro o Negro: El detective trabaja por un sueldo y se ven involucradas cuestiones, como
por ejemplo, marginalidades o negocios turbios. Aquí es de gran ayuda la experiencia del
detective.

De suspenso (thriller): La trama es ya secundaria y lo más importante es el ambiente


angustioso en el cual se encuentra el protagonista, esto atrapa al lector

De espionaje: La sofisticada trama se centra en un espía o agente secreto que debe


intervenir en conflictos que involucran a distintos países, para prevenir enfrentamientos
bélicos.

2
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Ambiente y Trama

Ambiente: Es cotidiano, familiar al lector. En los primeros relatos el crimen ocurría


en espacios interiores, en cuartos cerrados. En la actualidad, la violencia se desata
en las calles, ante la sorpresa o indiferencia de los posibles testigos.
Trama: La acción brinda el mayor suspenso. Deja siempre un hilo o eslabón por
resolver. Con rigor deductivo, el investigador y el lector desentrañan el enigma al
reunir esos hilos en el desenlace. Al principio se proponen varias soluciones
fáciles, a primera vista tentadoras, que sin embargo resultan falsas. Hay una
solución inesperada, a la cual sólo se llega al final. Para la solución del enigma se
desecha todo elemento sobrenatural o inexplicable. Es un relato hecho para que el
lector participe en desentrañar el misterio; ingresa en el mismo como un
investigador más.

Los personajes

Se presentan en una perspectiva antitética: el policía, el detective, el inspector; el asesino


y el espía, o sea los buenos y los malos. Por lo general son tipos, tienen caracteres bien
definidos y no evolucionan a lo largo del relato. Pueden ser:

 Investigador: Es el que investiga los hecho sucedidos (héroe del relato), de gran
inteligencia deductiva y analítica.
 Acompañante: No suele tener un gran aporte, no hace nada (un amigo que
acompaña y escucha). En general es el que relata, y el lector se identifica con él ya
que es el último en comprender.
 Sospechosos: Resultan siendo siempre los culpables del hecho (pueden ser más
de uno, y se van descartando según las pruebas).
 Testigos: ofrecen datos que pueden ayudar a esclarecer el misterio.
 Criminal: puede ser un ladrón, un asesino, un traficante, un chantajista, un
falsificador o una mente maestra del delito. En general, es la némesis del
detective.

Actividad

 Elaboren un esquema conceptual con los aspectos más importantes del Cuento
policial.

3
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Fecha: CLASE : 41 ( 80’min)

Selección de Cuentos policiales

LA PIEZA DEL ROMPECABEZAS

Cuando se sentó junto a la mesa, en la sala principal, el detective Stanford ya había


inspeccionado la habitación del anciano. El cuerpo inmóvil asomaba a un lado de la cama;
la sangre ya seca había teñido la manta oscura y parte del suelo. Por lo demás, no había
indicios que hicieran sospechar un robo, pues todo aparentaba estar en su sitio. Tampoco
había rastro alguno del arma homicida. Nervioso ante las circunstancias que parecían
involucrarlo, Raymond, sobrino del anciano y único heredero, se sentó frente al
investigador. Con un ligero tartamudeo, respondía a las preguntas de rutina, al tiempo que
giraba una pieza de rompecabezas entre sus dedos largos para calmarse.

Aseguraba haber permanecido gran parte de la noche sentado en la sala, entretenido en


el armado de un rompecabezas que, todavía a medio terminar, ocupaba el centro de la
mesa. Aclaró que su tío había preferido no acompañarlo en el juego. Se había acostado
temprano, poco después de cenar, y había cerrado la puerta de su cuarto.

—Seguramente por eso no oí nada —agregó, disculpándose, pero el investigador no le


prestaba atención.

Estaba concentrado en una pieza que había tomado de un pequeño montón e intentaba
colocarla para continuar con el armado de la figura. De nuevo en silencio, Raymond volvía
a entretenerse con la pieza que, ahora, hacía tambalear entre los dedos hasta dejarla
caer sobre la mesa y, con rapidez, volvía a recogerla. El investigador apenas se detuvo en
ese gesto. Una mansión de estilo oriental había comenzado a dibujarse en el centro del
rompecabezas y la forma se completaba con agilidad a medida que Stanford lograba
ubicar más piezas.

4
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Pronto ese entusiasmo se contagió a Raymond. El sudor dejó de recorrer su frente y las
palabras ya no se repetían cuando hablaba. Se lo veía más tranquilo, como si el juego
compartido lo hubiera alejado de las sospechas, de las tensiones, como si se hubiera
relajado.

Para completar la figura de la puerta de la mansión que se adivinaba, Raymond dejó la


pieza con la que había jugueteado desde hacía rato sobre la mesa. Con velocidad, tomó
otras dos y las ubicó, satisfecho por el encastre perfecto. Detrás de la casa, un dragón
rojo se delineaba incompleto aún. Stanford fue el primero en advertirlo.

A esa altura del juego, las preguntas se habían suspendido y el intercambio entre ellos se
reducía a miradas cómplices que festejaban las jugadas convenientes. En efecto, si
hubieran tenido que decidir un ganador, Raymond contaba con amplia ventaja cuando el
investigador tomó la pieza olvidada. La ventaja crecía mientras era Stanford quien ahora
giraba la pieza una y otra vez sin lograr colocarla. La figura del rompecabezas estaba a
punto de completarse, cuando por fin habló:

—Tendremos que suspender el juego —anunció Stanford, con calma, y dejó la pieza del
rompecabezas en el centro de la mesa, entre ambos.

Raymond lo observaba sin comprender. El entusiasmo se había desvanecido y el sudor


regresaba.

—Creo que el color rojo del dragón es ligeramente más claro que el que puede
observarse aquí —afirmó

Stanford apenas rozando el borde, pero con aire de sabiduría. El silencio se apoderó de
Raymond: la huella de sangre marcada en la pieza lo había delatado.

LA ARAÑA NO TENÍA PATAS

El edificio Natokami era tan alto que parecía construido con la ambición de mirar frente a
frente a la Luna. Me demoré unos instantes en contemplar su gigantesca fachada de
cristal y sentí, por un momento, un mareo anticipador del vértigo que previsiblemente me
invadiría.

Entré en el inmaculado edificio y me recibió un corpulento y musculoso vigilante, que me


informó que el inspector y los demás agentes me esperaban en la azotea del edificio. No
pude dejar de maravillarme cuando observé que el vigilante llevaba unos guantes de
cuero puestos, a pesar de que las mangas de su camisa no le cubrían ni los codos.
Demasiadas películas norteamericanas, pensé.

5
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

El ascensor, en un tiempo increíblemente rápido, me subió hasta la azotea, justo por


encima del piso treinta y tres. Cuando las puertas se abrieron, un frío extraño y denso me
obligó a subirme el cuello de la chaqueta.

Sin pensarlo dos veces, encendí un cigarrillo y contemplé la noche. El inspector me hizo
una seña para que me acercara hasta el balcón que le separaba del abismo. Cuando
llegué, me agarré a la barandilla de tal manera que ni un luchador de sumo lograría
soltarme. Mis piernas comenzaban a flaquear.

—¡Borges, Borges, Borges! Me sigue resultando extraño que alguien con su sangre fría
se asuste tanto de las alturas. Además...

—Señor inspector, si continúa usted haciendo observaciones gratuitas me veré en la


obligación de o bien retirarme o bien caer desmayado y mortalmente pálido. Ninguna de
las dos opciones me es particularmente atractiva; así que, por favor, hábleme del asunto.

El inspector me miró divertido y comenzó a relatarme lo ocurrido:

—Verá, este edificio se diseñó con un propósito bien claro: evitar los robos. Las puertas
de los departamentos son prácticamente inexpugnables, y hay cámaras custodiando cada
pasillo. Sin embargo, nadie pensó que los ladrones podrían subir hasta el piso treinta y
tres por la fachada, romper el cristal de la ventana y hacerse con una importante colección
de joyas. Y eso es exactamente lo que ha ocurrido esta noche.

Un par de hombres llevaron a cabo tan increíble plan, pero salió mal. Cuando descendía
el segundo, un hombre excepcionalmente pequeño, la cuerda se desprendió de la terraza
y el ladrón se precipitó hacia el vacío. Su cómplice, supongo que horrorizado, huyó, pero,
eso sí, llevándoseel botín. Hasta aquí todo está muy claro. Pero hay varias cosas que no
entiendo. Por ejemplo: no hay marcas en la fachada de pisadas o señales de ningún tipo
que delaten el hecho de que alguien ha escalado por ella. Tampoco logro comprender
cómo pudieron desde allá abajo lanzar una cuerda de la que sí hemos encontrado
muestras en esta azotea, y asegurarla para emprender la escalada. Y todo ello sin hacer
ruido alguno... ¿Cómo es todo esto posible?

—Creo que todas esas preguntas, y alguna más, se las podrá contestar el vigilante...

—Tenía usted razón en pensar que el robo lo cometieron dos personas, pero equivocó las
perspectivas. En primer lugar, tal y como usted ha señalado, ¿cómo es posible arrojar una
cuerda desde tanta distancia y asegurarla en una barandilla? La respuesta es simple:
alguien ata la cuerda a la barandilla y la desciende lentamente, para evitar golpes, hasta
el suelo. Una vez allí, el ladrón se la ata a su cintura y espera. Su cómplice en la terraza,
un hombre muy vigoroso, va tirando de la cuerda hasta que su compañero, un sujeto

6
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

excepcionalmente pequeño, como usted indicó, le hace una señal que lo detiene a la
altura indicada. Abre la ventana, entra en la casa, lo que da un descanso a su forzudo
amigo, y vuelve a colocarse la cuerda para salir al exterior. Pero durante el descenso
ocurre un accidente. La cuerda se desliza demasiado deprisa por las manos del hombre
fuerte, quemándole dolorosamente las palmas, y deja caer a su cómplice. Baja corriendo,
sale del edificio y recupera el botín antes de dar la alarma. De resultas de las
quemaduras, nuestro hombre tiene que ponerse unos guantes que oculten las heridas a la
policía, que está a punto de llegar... Pregúntele al vigilante de este edificio por qué lleva
guantes de cuero en pleno verano... Y ahora, si me lo permite, quisiera regresar a tierra
firme. Buenas noches, inspector.

La pieza ausente (de Pablo de Santis)

Comencé a coleccionar rompecabezas cuando tenía quince años. Hoy no hay nadie en
esta ciudad ‐dicen‐ más hábil que yo para armar esos juegos que exigen paciencia y
obsesión. Cuando leí en el diario que habían asesinado a Nicolás Fabbri, adiviné que
pronto sería llamado a declarar.

Fabbri era Director del Museo del Rompecabezas. Tuve razón: a las doce de la noche la
llamada de un policía me citó al amanecer en las puertas del museo. Me recibió un
detective alto, que me tendió la mano distraídamente mientras decía su nombre en voz
baja

‐Lainez‐ como si pronunciara una mala palabra. Le pregunté por la causa de la muerte:
“Veneno” dijo entre dientes.

Me llevó hasta la sala central del Museo, donde está el rompecabezas que representa el
plano de la ciudad, con dibujos de edificios y monumentos. Mil veces había visto ese ro
mpecabezas: nunca dejaba de maravillarme.

Era tan complicado que parecía siempre nuevo, como si, a medida que la ciudad
cambiaba, manos secretas alteraran sus innumerables fragmentos. Noté que faltaba una
pieza. Lainez buscó en su bolsillo. Sacó un pañuelo, un cortaplumas, un dado, y al final
apareció la pieza. «Aquí la tiene. Encontramos a Fabbri muerto sobre el rompecabezas.
Antes de morir arrancó esta pieza. Pensamos que quiso dejarnos una señal.

Miré la pieza. En ella se dibujaba el edificio de una biblioteca, sobre una calle angosta. Se
leía, en letras diminutas, Pasaje La Piedad.

7
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

‐Sabemos que Fabbri tenía enemigos ‐dijo Lainez-. Coleccionistas resentidos, como
Santandrea, varios contrabandistas de rompecabezas, hasta un ingeniero loco,
constructor de juguetes, con el que se peleó una vez.

‐Troyes ‐dije‐. Lo recuerdo bien.

‐También está Montaldo, el vicedirector del Museo, que quería ascender a toda costa.
¿Relaciona a alguno de ellos con esa pieza? ‐Dije que no.

‐ ¿Ve la B mayúscula, de Biblioteca? Detuvimos a Benveniste, el anticuario, pero tenía


una buena coartada.

También combinamos las letras de La Piedad buscando anagramas. Fue inútil. Por eso
pensé en usted. Miré el tablero: muchas veces había sentido vértigo ante lo minucioso de
esa pasión, pero por primera vez sentí el peso de todas las horas inútiles. El gigantesco
rompecabezas era un monstruoso espejo en el que ahora me obligaban a reflejarme. Sólo
los hombres incompletos podíamos entregarnos a aquella locura. Encontré (sin buscarla,
sin interesarme) la solución.

‐Llega un momento en el que los coleccionistas ya no vemos las piezas. Jugamos en


realidad con huecos, con espacios vacíos. No se preocupe por las inscripciones en la
pieza que Fabbri arrancó: mire mejor la forma del hueco.

Laínez miró el punto vacío en la ciudad parcelada: leyó entonces la forma de una M.
Montaldo fue arrestado de inmediato. Desde entonces, cada mes me envía por correo un
pequeño rompecabezas que fabrica en la prisión con madera y cartones. Siempre
descubro, al terminar de armarlos, la forma de una pieza ausente, y leo en el hueco la
inicial de mi nombre.

Actividad

Trabajamos en grupo y respondemos:

A-LA PIEZA DEL ROMPECABEZAS

1-¿Qué tipo de cuento policial es: de enigma o negro? Justifica tu respuesta.


2-¿Qué tipo de narrador cuenta la historia y en qué persona gramatical lo hace?
3-¿Cuáles son los personajes del cuento? ¿Qué características posee cada uno de ellos?
4-¿Qué actitud tiene Raymond cuando el investigador lo interroga?

8
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

5-Según su parecer, ¿consideran que el investigador finge concentrarse en el juego para


lograr que Raymond se relaje o no?
B- LA ARAÑA NO TENIA PATAS

1-Lo que acabas de leer es un cuento policial ¿Por qué?


2-¿Qué tipo de cuento policial es? ¿Cómo lo clasificarías? ¿Por qué?
3-Con respecto al narrador, ¿te parece que sabe menos, igual o más que el protagonista?
Explica con tus palabras el por qué de tu respuesta.
4-Según lo que respondiste anteriormente, ¿qué narrador posee el cuento?
5-¿Qué características posee el personaje principal? Da ejemplos.
C-LA PIEZA AUSENTE

1-¿Por qué motivo llaman a declarar al protagonista? ¿Era sospechoso? Explica.


2-¿Qué pista había dejado la víctima sobre su asesino?
3-¿Qué deducciones habían sacado los detectives a partir de esa pista? ¿Quiénes eran
los posibles culpables?
4-El protagonista dice que encuentra la solución sin buscarla, ¿qué explicación da acerca
de esto?
5-Montaldo fue arrestado como el autor del crimen, ¿por qué?

9
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Fecha: CLASE : 42 ( 80’min)

Esquema Actancial de Greimas

El modelo actancial se utilizó inicialmente en la literatura y la narrativa por cuestiones de


análisis relacionados con el lenguaje y el discurso. Es una propuesta realizada por el
lingüista Greimas y publicada en el texto titulado” La semántica estructural”

Esquema Actancial, busca propone una nueva forma de abordar el análisis personajes
por el rol que cumple dentro de la obra y no por lo que son. También Greimas se encarga
de instaura el concepto de Actante dentro de los estudios literarios.

Elementos de un esquema actancial:

Un “actante” es una unidad autónoma con capacidad de acción, siendo precisamente el


sujeto quien realiza la acción, por ejemplo, “Él baila” (sujeto + verbo).

 Sujeto: el actante que desea un objeto” (O)


 Objeto: es lo que se desea puede ser (un ser amado, dinero, honor, felicidad,
poder o cualquier otro valor…).
 Ayudante: Es el actante encargado de orientar al sujeto (S)
 Oponente: Actante cuya función radica en ser la fuerza opresora que limita la
acción.
 Destinatario: Es el conjunto de hechos deseados o destinatario orientado del
deseo.
 Destinador: Son las fuerzas o entidades de naturaleza social, ideológica o moral
(Dios, el orden establecido, la libertad, el delito, la lujuria, la ambición, un fantasma,
entre otros.)

Por ejemplo: Si tomamos el cuento de Caperucita Roja.

10
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Trabajo de exposición

Trabajo Grupal

 Elaboren una presentación de diapositivas utlizando el esquema actancial de


Greimas. Para ello se les asignara un cuento policial por grupo.

Para tener en cuenta:

* En la misma presentación analicen los elementos del cuento policial presentes en el


relato elegido.

* Para finalizar, socializaremos sus trabajos en una exposición oral grupal la


próxima clase.

11
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Fecha: CLASE : 43 ( 80’min)

Exposición- Esquema Estancial de Cuentos Policiales

Aspectos a tener en cuenta para la exposición oral

 Defensa de un cuento policial mediante la utilización de un Esquema Actancial


CONOCIMIENTO DEL TEMA:

 Plena comprensión de lo que se habla (la memoria está bien siempre que no sustituya
a la comprensión).
 Aporte de datos, de detalles.
 Resolución de dudas si la audiencia las plantea.
ESTILO DE LA PRESENTACIÓN:

 Gestos
 Voz (volumen, tono).
 Mirada a la audiencia.
 Postura.
 Oraciones completas y bien elaboradas.
 Uso de vocabulario específico.
 Recursos para mantener la atención y el interés.
HERRAMIENTAS INFORMÁTICAS:

 Dominio.
 Presentación atractiva y clara.

DURACIÓN:

 Aproximadamente 10 minutos.
¡¡¡IMPORTANTE!!!

Rubricas para trabajo grupal

Criterios Principiante En progreso Satisfactorio Avanzado

(20% x Menos de 5 5-6 7-8 9-10


criterios, total
de 100%) 0% a 5% 6% a 10% 11% a 15% 16 a 20%

12
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Cuesta hablar en Intentan hablar Se evidencia Comienzan


Expresión público. Se les solo, se requiere preparación previa solos la
fluida y deben realizar realizar preguntas para la exposición. exposición, es
vocabulario muchas preguntas disparadoras para Se requieren notable la
apropiado. para que intenten que empiecen a realizar mínimas preparación
emitir respuestas. exponer. No se preguntas para previa (en
En sus discursos preparan para que continúen. Se contenido y
no emplean emplear corrigen cuando práctica),
vocabulario vocabulario no emplean empleando
técnico. apropiado. vocabulario vocabulario
técnico. apropiado.

Creatividad en No utilizan Disponen de Utilizan recursos, Utilizan variedad


su disertación recursos, o recursos, pero no no muy de recursos, y
con la evidencian los usan organizados. los utilizan en
utilización de esmero en la adecuadamente toda la
recursos presentación. para la exposición. exposición.
(vídeos, no se evidencia Se nota algo de Están muy bien
imágenes, etc.) organización. desorganización organizados
y organización. para exponer.

Capacidad de No domina el Domina Domina el tema y Domina


síntesis e tema medianamente el es capaz de perfectamente
interpretación suficientemente tema. resolver algunas el tema y es
dudas. capaz de
resolver todas
las dudas.

Se adecua al Ofrece una Ofrece una Ofrece una Ofrece una


tiempo exposición exposición exposición exposición
establecido desorganizada, organizada de adecuadamente altamente
poco clara y sin manera adecuada, organizada y usa organizada,
respetar el tiempo aunque sin el tiempo respetando los
establecido. terminar en el establecido. tiempos
tiempo establecidos.
establecido.

Participación Solo una de las La mitad de las Casi todas las Todas las
equitativa y personas del personas del personas del personas han
ayuda mutua equipo ha tomado equipo han equipo han tomado parte
parte activa y ha tomado parte tomado parte activa haciendo
ayudado a los activa. activa y ha propuestas y
demás. ayudado a los ayudando a los
demás. demás.

13
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

MATEMÁTICA 3°AÑO
En esta tercera y última etapa los alumnos trabajarán en grupo.
A continuación se detallan las rúbricas que se tendrán en cuenta para ser evaluados en el
momento de defender sus producciones.
EXPOSICIÓN ORAL
Principiante En progreso Satisfactorio Avanzado
Menos de 5 5-6 7-8 9-10 Total
0 a 5% 6 a 10% 11 a 15% 16 a 20%
La presentación Tuvo dificultad El contenido Todo el
1. CONTENI- realizada no explicando está contenido
DO: SE tiene relación cómo el directamente está
con el tema. contenido y el relacionado directamente
RELACIONA
tema se con el tema. relacionado
CON EL
relacionan. Incluye con el tema.
TEMA
Muchas muchos Fue
DETALLA-
opiniones no detalles desarrollado
DO Y
fueron demostrados. y demostrado
PRECISO.
respaldas con a fondo,
(20%) los hechos. apoyado por
los hechos.
Poco o sin Demuestra un Demuestra un Ha
2. CONOCI- conocimiento conocimiento conocimiento demostrado
MIENTO: del tema. básico de la importante en completo
Incapaz de materia. Capaz el tema. Es conocimiento
DEMUES-
responder de responder a capaz de del tema.
TRA
preguntas de la la audiencia responder Capaz de
CONOCI-
audiencia. usando partes satisfactoria- responder las
MIENTO
de la mente a la preguntas de
DEL TEMA.
presentación. audiencia. la audiencia,
(20%) ejemplifica el
tema.
3. Habla Habla Se expresa de Tranquilo y
PRESENTA- constantemente constantemente manera elocuente. Se
CIÓN: demasiado demasiado elocuente y ajusta al
FLUIDEZ, rápido o lento. rápido o lento. emplea ritmo.
USO DE La presentación La presentación terminología Cumple con
TERMINO- sobre paso los sobre paso los adecuada. el tiempo
LOGÍA 10 min o tuvo 10 min o tuvo La pactado de la
ADECUADA. una duración una duración presentación
presentación
RITMO. muy corta. muy corta. de 10 min.
sobrepasa los

14
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Emplea la
(20%) No emplea la Pero emplea 10 min o tuvo terminología
terminología algunas una duración adecuada.
adecuada. terminologías muy corta.
adecuadas.
No emplea Posee material Posee material Explica
4. USO DE material de de apoyo pero de apoyo y lo usando
MATERIAL apoyo, láminas, no lo emplea emplea diapositivas,
DE APOYO. diapositivas o la para explicar. escasamente láminas y
maqueta. para sustentar muestra el
(20%) sus trabajo de
explicaciones. laboratorio.
Total

TRABAJO DE INVESTIGACIÓN GRUPAL

Instructivo

 Diseño de página: Márgenes superior 2,5 cm, inferior 1,5 cm ; derecho e izquierdo
2 cm.
 Orientación vertical A4.
 Fuente: Arial 12 para el cuerpo, 14 para los títulos.
 Párrafo: Justificado. Interlineado 1,15 líneas. No te olvides de las sangrías al inicio
de una nueva oración.
 Número de página

Carátula

 Nombre del Colegio: Colegio Privado Jean Piaget


 Título: Trabajo de Investigación
 Espacio Curricular: Matemática
 Curso: 3° Año
 Profesora: González, Sandra
 Integrantes del grupo: Apellidos y Nombres ( Máximo 4 alumnos)
 Fecha y Año

15
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

En los trabajos de Investigación, el grupo deberá explicar a través de soportes gráficos,


videos o power point el teorema de Pitágoras y las Razónes Trigonométricas.

Deberán tener en cuenta los siguientes items:

 Fuente de informaciones bibliográficas consultadas (Bibliografía o Webgrafía).


 El origen del saber desarrollado
 Las propiedades utilizadas para su resolución
 Su relación con la vida cotidiana a través de una situación problemática.
(para qué sirve)
 Fecha de presentación: Viernes 6 de Noviembre
 Fecha de exposición: Jueves 12 de Noviembre

Horario: 08:00 a 09:20hs Miércoles 21 de Octubre

Clase Expositiva de los grupos


Tema: Sistema de ecuaciones lineales con dos incógnitas.

Horario: 09:30 a 10:50hs Jueves 22 de Octubre

Trabajo en grupo

Actividad N°30: Resolver los siguientes sistemas.

1)

2)

Aplicar el método gráfico y el método más conveniente.

Nota:Los alumnos deberán resolver y presentar dicha actividad finalizada la hora.

16
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Horario:08:0 a 09:20hs Miércoles 28 de Octubre

Teorema de PITÁGORAS

Teorema que se aplica únicamente a TRIÁNGULOS RECTÁNGULOS.

17
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Enunciado:

En todo triángulo RECTÁNGULO el cuadrado de la hipotenusa es igual a la suma


de los cuadrados de los catetos.
O bien, la suma de los cuadrados de los catetos es igual al cuadrado de la
hipotenusa.

Ejemplos:
Hallar el valor del lado desconocido en cada una de las siguientes figuras.

7cm Cálculo de

10 cm

Cálculo de
11cm

9cm

Cálculo de

10cm

18
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

TRABAJO EN GRUPO
ActividadN° 31: Identifiquen los catetos y calculen el lado desconocido.

1) 4)

2) 5)

3m 1,6 m

8m
0,5m

3) 6)

19
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Actividad N° 32
Problemas de aplicación
1- Calcula el área de un rectángulo sabiendo que un par de lados iguales miden
y la diagonal de la misma
2- Halla la altura de un triángulo rectángulo isósceles. Los lados iguales miden
.

Horario: 09:30 a 10:50hs Jueves 29 de Octubre

Clase de consulta y resolución de actividades

WEBGRAFIÁ https://www.youtube.com/watch?v=IHRI25pRoRw (Razones


trigonométricas)

Horario: 08:00 a 09: 20hs Miércoles 4 de Noviembre

RAZÓNES TRIGONOMÉTRICAS
Recordar que todo triángulo rectángulo tiene:

 Dos ángulos agudos.


 La hipotenusa siempre es mayor que cualquiera de los catetos.
 El cuadrado de la hipotenusa es igual a la suma de los cuadrados de los catetos.

Hasta ahora para calcular la longitud de un lado de un triángulo rectángulo era


necesario conocer los otros dos lados y, entonces, aplicábamos el Teorema de Pitágoras.

Ahora podremos calcular un lado por medio de las RAZÓNES TRIGONOMÉTRICAS.

Razones trigonométricas de un ángulo agudo de un TRIÁNGULO


RECTÁNGULO
En un triángulo rectángulo se cumple que:
B
 Los ángulos agudos son complementarios

 El teorema de PITÁGORAS
A C

20
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

En un triángulo rectángulo cada lado recibe un nombre especial al relacionarlo con uno
de los ángulos del mismo.
Si al lado lo relacionamos con , es b cateto opuesto a .
c cateto adyacente a
a Hipotenusa del triángulo.

Para estudiar las razones trigonométricas debemos tener en cuenta siguiente regla

SOH- CAH-TOA

Regla Nemotécnica

En donde la letra S representa la función seno, la C de coseno y la T de tangente.

Sus funciones inversas son la cosecante la secante y la cotangente

Funciones Directas Funciones Inversas

Estas razones, dependen sólo del ángulo y no de las medidas de los lados del
triángulo rectángulo

Se lee: el seno es la razón entre en cateto opuesto y la hipotenusa


el coseno es la razón entre en cateto adyacente y la hipotenusa
la tangente es la razón entre en cateto opuesto y el cateto adyacente

21
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Ejemplos
Dado los siguiente triángulos rectángulos encontrar las 6 razones trigonométricas

3 5

SOH CAH TOA

CÁLCULO DE RAZONES TRIGONOMÉTRICAS

Cálculo de razones trigonométricas con calculadora


Si se conoce el ángulo y se quiere hallar el valor de la razón trigonométrica, se deben
seguir estos pasos.

sin 3 0

cos 5 2 °‘ “ 4 5 ° ´”

22
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Si se conoce la razón trigonométrica y se quiere saber a qué ángulo corresponde, se


deben seguir estos pasos.

SHIFT sin 0 . 4 ° ´”

SHIFT cos (-) 0 . 5


T
1 4 ° ´”

Actividades N° 33
Calculen las siguientes razones trigonométricas

Calculen el valor del ángulo utilizando la calculadora.

23
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Actividad N° 34

25m
m

37m

Horario: 08:00 a 09:20hs Jueves 5 de Noviembre

Actividad para resolver en grupo

Actividad N° 35: Problemas de Aplicación

1) Calcula qué longitud debe tener una escalera para qué, apoyada en la pared,
alcance una altura de , al formar con el plano de la base un ángulo de 58°1’
2) Calcula los lados de un campo rectangular sabiendo que un alambrado que lo
atraviesa diagonalmente tiene una longitud de y forma con uno de los lados
limítrofes un ángulo de 37°26’.
3) Halla el perímetro y la superficie de :
a) Un triángulo isósceles en el que uno de sus ángulos iguales mide 40° sus
lados iguales miden (Recuerda que la altura correspondiente al lado
desigual divide al triángulo isósceles en dos triángulos rectángulos).
b) Un rectángulo en el que un lado mide y forma con la diagonal un ángulo
de
c) Un rombo en el que una diagonal mide y es bisectriz de un ángulo

24
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Horario: 08:00 a 09:20hs Miércoles 11 de Noviembre

Consulta y revisión de SABERES

Horario: 09:30hs a 10:50hs Jueves 12 de Noviembre

TEOREMA DE PITÁGORAS Y RAZÓNES TRIGONOMÉTRICAS

EXPOSICIÓN GRUPAL DE LOS SABERES

25
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CARTILLA N°7 CIENCIAS BIOLOGICAS

PERIODO OCTUBRE/NOVIEMBRE

3°AÑO “U” DIVISION

PROFESORA MARIA LAURA FIGUEROA


AÑO 2020

26
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CLASE N°41

FECHA: Lunes 19 de Octubre de 2020. Horario de clases de


11:40hs a 13:00hs.

TEMA: Ejemplos de Selección Natural.

El proceso de selección natural refiere a uno de los mecanismos de evolución


de las especies de seres vivos, propuesto por Charles Darwin y Alfred Russel
Wallace, a partir del cual explicaron el diseño de la naturaleza.

La selección natural se produce gracias a la progresiva adaptación de las


especies a su medio ambiente. Cuando individuos con ciertas características
poseen una tasa de supervivencia más alta que otros miembros de una
población, pasan estas características genéticas heredables a su
descendencia.

La selección natural es la base central de todo el cambio evolutivo, siendo


también el proceso a través del cual los organismos mejor adaptados
desplazan a los menos adaptados por la acumulación lenta y progresiva de
los cambios genéticos.

La contribución de un individuo a la siguiente generación se reconoce


como eficacia biológica, y se trata de un carácter cuantitativo que engloba a
muchos otros, relacionados con la supervivencia del más apto y la
reproducción diferencial de diferentes genotipos.

La tesis fundamental de la selección natural radica en que los rasgos son


hereditarios, pero sin embargo existe una variabilidad en el rasgo entre
diferentes ejemplares. De este modo, hay una adecuación biológica al
ambiente, y solo ciertas características de las nuevas apariciones se extienden
a la totalidad de la población.

27
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Las generaciones están en una permanente evolución, y es precisamente


el conjunto de las variaciones que se producen a lo largo de las
generaciones lo que constituye el proceso evolutivo.

Ejemplos de selección natural

1. La evolución de la medicina se funda precisamente en que a partir del


uso de antibióticos para virus o bacterias se logra matar algunas de
ellas, pero las que sobreviven se vuelven más resistentes.
2. El pelaje blanco de los animales del ártico, que les permite ocultarse en
la nieve.
3. El camuflaje de los saltamontes, que los hace parecer hojas.
4. Los movimientos del alcatraz de pata azul macho, para atraer a su
pareja.
5. Las jirafas, de las que sobrevivieron las de cuello más largo.
6. El cambio de color de un camaleón cuando tiene una presa, o para
protegerse.
7. El proceso de clonación, constantemente en desarrollo pero ya probado
en los hechos, potencialmente podría interferir con la selección natural.
8. Los escarabajos de color marrón tienen mayor posibilidad de
supervivencia, y tiene más descendientes volviéndose frecuente la
población.
9. El caso de la totalidad de las especies que fueron desapareciendo, y que
aún lo siguen haciendo.
10. Las chitas, de las que han sobrevivido las más rápidas.
11. La evolución del ser humano en diferentes especies, denominados
homínidos.
12. La deformación de la mandíbula de la serpiente para tragar una presa
más grande.

28
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

13. El cambio de coloración de algunas polillas, motivado por la revolución


industrial en Inglaterra. (Aquí el cambio en el medio ambiente fue
generado por el hombre)
14. La danza de meneo de las abejas.
15. La resistencia a los insecticidas de algunos insectos, que evidencian la
cuestión de la selección como fuente de supervivencia.
16. La forma del pico de los pinzones se modificó a lo largo del tiempo, pues
tras las sequías se endurecieron permitiendo comer semillas más duras.
17. La capacidad de los seres humanos de aprender a hablar.
18. Las orquídeas que son capaces de engañar a las avispas para que se
‘apareen’ con ellas.
19. Las serpientes rey no venenosas, que se mimetizan con las víboras de
coral venenosas.
20. Los rituales de cortejo de las aves.

ACTIVIDAD

 Luego de la lectura comprensiva de los ejemplos de Selección Natural,


elige con tu equipo un ejemplo de los citados.
 A continuación elaboren una lámina en la que grafiquen y expliquen en
que consiste el ejemplo y en qué condiciones de produjeron esas
adaptaciones.
 Utilizaremos esta lámina para construir un mural de la Diversidad que
presentaremos en la exposición.

CLASE N°42

FECHA: Martes 20 de Octubre del 2020. Horario de clases


de 8:00hs a 9:20hs.

TEMA: Ejercicios de repaso.

1) Problema 1

El color de la semilla de chicharo puede ser amarillo(A) o verde(a). En


una serie de experimentos controlados, se efectuaron varias cruzas
entre plantas con los siguientes resultados:
FENOTIPO DE LAS SEMILLAS
FENOTIPO DE LOS RESULTANTES DEL CRUCE (F1)
PROGENITORES

29
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Amarilla X Verde 86 AMARILLAS +86 VERDES


Amarilla X Amarilla Todas amarillas
Verde X Verde Todas Verdes
Teniendo en cuenta exclusivamente los datos presentados.
a) ¿Qué relación de dominancia/recesividad hay entre los factores
que regulan las dos alternativas?
b) Señalen los genotipos más probables de los progenitores
indicados en la tabla, y de sus descendientes.
c) Escriban las proporciones fenotípicas y genotípicas de la F1 de
cada una de las cruzas.
2) .Problema 2
Los resultados de cruzas entre plantas de flores rojas (B) y flores
blancas(b) se indican en la siguiente tabla. De esos datos, señalen
cual es el alelo dominante y cuál es el alelo recesivo. Además
proporcionen el genotipo de los progenitores de cada una de las
cruzas.

Genotipo de los cruces


Flores rojas X Flores blancas ¾ flores rojas y ¼ flores blancas
Flores blancas X Flores blancas Todos con flores blancas
Flores rojas X Flores blancas ½ flores rojas y ½ flores blancas

3) .Analiza el siguiente fragmento de ADN y realiza la


correspondiente transcripción.
ACGTCCGGATGCAATACGCAT

4) En las siguientes preguntas, responde solamente “si” o “no”.


a) Según Darwin , ¿un órgano que no se usa, se atrofia?
b) Los individuos de una misma especie son diferentes unos de
otros debido a cambios en su ambiente.
c) Darwin no pudo argumentar su teoría sobre la selección natural
como mecanismo impulsor para la evolución. Y por ello fue
rechazado por los científicos.
d) Lo que Darwin no podía fundamentar era de qué manera se
transmitían las características de una generación a otra.
e) Darwin sostenía que las especies están emparentadas de
alguna manera o por la existencia de un antecesor común.

5) Completa este crucigrama con el término que corresponda.

30
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

A) D_ _ _ _ _ _ _ _
B) _A _ _ _ _ _ _ _
C) _R_______
D) W______
E) _I______
F) _ _ _ _ _ _ _ _N

Consignas
A) Nombre del Puerto de partida del memorable viaje de Darwin.
B) Isla en la cual Darwin encuentra las diferentes especies de
pájaros para su observación y estudio.
C) Uno de los países que recorrió en su viaje.
D) Naturalista explorador, geógrafo, antropólogo, y biólogo británico,
conocido por haber propuesto una teoría de la Evolución a través
de la selección natural independiente de la de Charles Darwin que
motivo a este a publicar su propia teoría.
E) Especie de ave encontrada en las Islas Galápagos que fue
determinante en la teoría de la evolución.
F) La selección de las especies, obra monumental que publica
Darwin, marca la teoría de la….

CLASE N°43

FECHA: Lunes 26 de Octubre de 2020. Horario de clases de


9:30hs a 10:50hs

TEMA: Evaluación.
Tomaremos los 80 minutos de la clase de hoy para el desarrollo de la
evaluación grupal. La misma consta de 20 consignas a resolver con su equipo
de trabajo. Para aprobar el presente examen deben resolver correctamente y
de forma completa seis (6) puntos.

Los temas a evaluar se encuentran detallados en las cartillas anteriores y


desarrollados en las clases dictadas a lo largo del todo el periodo, con su
correspondiente ejercitación, correcciones y devoluciones pertinentes.

Los criterios que se tendrán en cuenta también han sido debidamente


socializados e informados.

31
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

En caso de no poder asistir a la evaluación virtual programada y notificada con


tiempo suficiente de anticipación, justificar con certificado médico, de lo
contrario se considerara desaprobado. Del mismo modo se considerara
desaprobado a aquel alumno que no colabore en la resolución de la evaluación
con su equipo.

Al finalizar el tiempo designado para la resolución de la evaluación(80 minutos)


los alumnos deben enviar una (1) evaluación por grupo con el nombre de todos
los integrantes y los datos que se les pide en la misma, ya sea por wsp privado
o por mail( en este último caso avisar que se envió por este medio la
evaluación).

CLASE N° 44

FECHA: Martes 27 de Octubre de 2020. Horario de clases de


9:30hs a 10:50hs.

TEMA: Selección Natural y Evolución de algunas especies.


Cada caso de evolución por selección natural tiene una explicación construida
en base a la lógica y las evidencias a través del razonamiento científico.

En esta actividad los alumnos analizaran la evidencia de los cambios en


diferentes especies que son el resultado del proceso de selección natural
estudiado hasta aquí.

Por ejemplo, las jirafas no tienen el cuello más largo porque lo estiran, lo tienen
más largo porque las las jirafas con cuellos más largos alcanzan más y mejores
hojas de los árboles en zonas áridas. Entonces las jirafas que nacen con
cuellos más largos sobreviven mejor y sus hijos también tendrán cuellos más
largos (poblaciones, no individuos). En este caso la unidad de selección es el
individuo, pero la que evoluciona es la población.

ACTIVIDAD

 Cada grupo elegirá una de las siguientes especies del listado.(no puede
repetirse)
 Realicen una investigación bibliográfica sobre los cambios sufridos por
dicha especie a lo largo de los años.
 Expliquen el proceso de evolución de esa especie en relación a los
cambios y presiones del ambiente.
 Elaboren un gráfico (en una lámina o cartulina) que muestre dicho
proceso evolutivo.
 Cada grupo expondrá su producción en la siguiente clase.

32
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Listado de especies a elegir:


-Zorro de agua
-Zorro del desierto
-Ratones de bolsillo
-Eohippus( antecesor de los equinos)
-Jirafas
-Polillas Biston betularia.
-Insectos resistentes a los insecticidas.

CLASE N°45

FECHA: Martes 3 de Noviembre de 2020. Horario de clases de


8:00hs a 9:20hs.

TEMA: Exposiciones grupales de ejemplos de evolución.


La clase de hoy estará destinada a las exposiciones grupales de las
investigaciones realizadas sobre las especies elegidas que evidencian un claro
proceso evolutivo. Cada equipo tendrá 15 minutos para exponer y explicar los
cambios sufridos por las especies y el ambiente en el que viven. Dichas
explicaciones las harán utilizando la lámina realizada como una técnica
expositiva.

Mientras cada grupo exponga la clase tomara nota para elaborar la conclusión
final del trabajo, teniendo en cuenta como cada especie adquirió esos cambios
y que ventajas adaptativas les otorgo.

CLASE N°46

FECHA: Lunes 9 de Noviembre del 2020. Horario de clases de


11:40hs a 13:00hs.

TEMA: Elaboración de fabulas para la exposición.


ACTIVIDAD

 Confeccionen en grupo una fábula cortita sobre la especie elegida para


la exposición anterior.
 La fábula debe incluir el proceso evolutivo con las adaptaciones y los
cambios en el ambiente, es decir un lugar determinado.
 También debe incluir dibujos que enriquezcan la fábula para la
exposición.(personajes animados)

33
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

 Al final de la fábula deben resaltar la MORALEJA elaborada por el


equipo.
 Las fabulas confeccionadas por cada equipo serán presentadas en la
exposición junto con el Mural de la Diversidad.

RECORDATORIO

La fábula es un género literario que consiste en una narración breve con


intención didáctica o moralizadora, cuyos personajes, casi siempre animales o
cosas humanizados, desarrollan acciones y conductas en un lugar determinado,
cuyas consecuencias encarnan una lección o moraleja, una enseñanza explicita .

34
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Cartilla de Historia

tercer año
Cartilla pedagógica virtual

Vamos a seguir aprendiendo es hora de que podamos ver tus capacidades,


estás preparado para un nuevo camino, para poder desarrollar herramientas
creativas para que pueda la familia observar como trabajamos juntos
¡¡¡¡Empecemos ¡!!

Clase 19 de octubre

Horario 9:30 a 10:50

Tema: Constitución de 1853- Separación de Buenos Aires

Actividad 1 : Seguramente ya lo estudiaste en Construcción ciudadana , por eso te


pido que definas que es una Constitución y transcribe el Preámbulo

Actividad 2: Lee el siguiente texto y desarrolla una síntesis de la misma

35
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Luego de que Urquiza venciera a Rosas en la batalla de Caseros, se vio la ocasión


propicia para la reunión de un Congreso Constituyente. Como paso previo se firmó el
Acuerdo de San Nicolás el 20 de mayo de 1852, donde concurrieron todos los
representantes provinciales, con excepción de la provincia de Buenos Aires, que se
había desvinculado de la Confederación luego de la revolución del 11 de septiembre
de 1852. Por el acuerdo de San Nicolás se convino la convocatoria a un Congreso
Constituyente, a reunirse en la ciudad de Santa Fe.

Sin embargo, faltaba aún lograr la unificación nacional y de ideas. Buenos Aires no
confió en Urquiza, y reunidos por separado de las provincias, los porteños, en su
Legislatura, dividieron sus opiniones sobre si aceptar o no el acuerdo de San Nicolás.
Se pronunciaron a favor: Vicente Fidel López y Juan María Gutiérrez, y en contra,
Bartolomé Mitre y Dalmacio Vélez Sársfield.

LA CONSTITUCIÓN DE 1853

El Congreso constituyente, fue inaugurado en la ciudad de Santa Fe, sin


representación porteña, el 20 de noviembre de 1852. En esa ocasión, Justo José de
Urquiza, designado por el acuerdo de San Nicolás, Director Provisional, con amplios
poderes, sostuvo que debía hablarse de fórmulas conciliadoras, y no de ideas
incompatibles, y que esas ideas de unidad deberían dejarse asentadas en una
Constitución que evite la anarquía y el despotismo. A ambas posturas antagónicas,
calificó de “monstruos que devoran a los pueblos”. El primero llenándolo de sangre y el
segundo de vergüenza.

Tomando como antecedente el libro de Juan Bautista Alberdi “Bases y puntos de


partida para la organización política de la República Argentina” y los textos
constitucionales que la precedieron (constituciones de 1819 y 1826) tanto a nivel
nacional como internacional (Constitución de Estados Unidos) y el Pacto Federal de
1831, se redactó el Anteproyecto de Constitución con el aporte decisivo de los
diputados Benjamín Gorostiaga y Juan María Gutiérrez. Teniendo como base directa
el ideario de Alberdi se logró un texto liberal, tendiente al progreso de la nación, pero
sin dejar de lado sus tradiciones.

Los proyectos presentados fueron tres. El de Pedro De Angelis, el de Alberdi, y el de


Benjamín Gorostiaga, que finalmente prevaleció.

Previamente se suscitó un debate para saber si había llegado el momento propicio


para el dictado de la constitución, ante la pregunta del diputado Zenteno que veía que
la nación aún no estaba totalmente pacificada. Gutiérrez opinó que justamente sería
esta Ley Suprema con la finalidad de afianzar la seguridad y la justicia, la que lograría
ese fin. El diputado Seguí apoyó esta idea, pero en contra se manifestó Zavalía que no
observaba en el pueblo costumbres republicanas.

Finalmente el proyecto de la comisión fue aprobado por 14 votos contra 4.

36
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

La Constitución fue sancionada el 1 de mayo de 1853, y promulgada por Urquiza el 25


de mayo de ese mismo año

Actividad 3 : Observa el siguiente video y realiza una síntesis del mismo

https://www.youtube.com/watch?v=XYkQsQyC38g

Actividad 4 : Busca la bandera del Estado de Buenos Aires y la Bandera de la


Confederación

Clase 23 de octubre

Horario 8 a 9:20

Tema: Batalla de Pavón

En 1859 Justo José de Urquiza venció a los grupos rebeldes de la provincia de


Buenos Aires en la batalla de Cepeda. En 1860, una vez incorporada Buenos Aires a
la Confederación, dejó el cargo de presidente a Santiago Derqui (1860-1861), aunque
continuó como gobernador de Entre Ríos.

Actividad 1 : Lee el siguiente texto y desarrolla un resumen

El 17 de septiembre de 1861 tuvo lugar la batalla de Pavón entre las fuerzas porteñas,
comandadas por el general Bartolomé Mitre, y las tropas de la Confederación
Argentina, al mando del general Justo José de Urquiza. En un combate dudoso,
Urquiza retiró sus tropas, aun teniendo superioridad numérica. La victoria fue para los
porteños, que extenderían su dominio a todo el país. La batalla de Pavón suscito
polémicas y especulaciones que aún perduran, pero al margen de las interpretaciones
sobre los entretelones de la batalla, lo cierto es que Pavón abrió el camino a la
organización nacional y puso fin a la separación entre la Confederación Argentina y la
provincia de Buenos Aires, producida en 1852. A continuación, transcribimos un
artículo de José María Rosa sobre la batalla, sus interpretaciones y consecuencias.

Fuente: Retorno, 5 de noviembre de 1964, por José María Rosa.

Chocan cerca de la estancia de Palacios, junto al arroyo Pavón en la provincia de


Santa Fe, los ejércitos de Urquiza y Mitre. A Urquiza, a pesar de Caseros, lo rodea el
pueblo entero; Mitre representa la oligarquía porteña. Aquél es un militar de
experiencia, éste ha sido derrotado hasta por los indios en Sierra Chica. El resultado
no parece dudoso, todos suponen que pasará como en Cepeda, en octubre de 1859,
cuando el ejército federal derrotó a los libertadores.

Parece que va a ser así. La caballería de Mitre se desbanda. Ceden su izquierda y su


derecha ante las cargas federales. Apenas si el centro mantiene una débil resistencia
que no puede prolongarse, y Mitre como Aramburu en Curuzú Cuatiá, emprende la

37
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

fuga. Hasta que le llega un parte famoso: “¡No dispare, general, que ha ganado!”. Y
Mitre vuelve a recoger los laureles de su primera –y única– victoria militar.

¿Que ha pasado? Inexplicablemente Urquiza no ha querido coronar la victoria.


Lentamente, al tranco de sus caballos para que nadie dude que la retirada es
voluntaria, ha hecho retroceder a los invictos jinetes entrerrianos. Inútilmente los
generales Virasoro y López Jordán, en partes que fechan “en el campo de la victoria”
le demuestran el triunfo obtenido. Creen en una equivocación de Urquiza. ¡Si nunca ha
habido triunfo más completo! Pero Urquiza sigue su retirada, se embarca en Rosario
para Diamante, y ya no volverá de Entre Ríos.

¿Qué pasó en Pavón? Es un misterio no aclarado todavía. Se dice que intervino la


masonería fallando el pleito en contra del pueblo, sin que Urquiza pagara las costas
(las pagó el país), que un misterioso norteamericano de apellido Yatemon fue y vino
entre uno y otro campamento la noche antes de la batalla concertando un arreglo, que
Urquiza desconfiaba del presidente Santiago Derqui, que estaba cansado y prefirió
arreglarse con Mitre, dejando a salvo su persona, su fortuna y su gobierno en Entre
Ríos. Todo puede conjeturarse. Menos que lo que dirá en su parte de batalla: que
abandonó la lucha “enfermo y disgustado al extremo por el encarnizado combate”.
¡Urquiza con desmayos de niña clorótica!

LA MASACRE DEL PUEBLO

Derqui ingenuamente intentará la resistencia. El grueso del ejército federal está intacto
y lo pone a las órdenes de Juan Saa, mientras espera el regreso de Urquiza. Lo cree
enfermo y le escribe deseándole “un pronto restablecimiento para que vuelva cuanto
antes o ponerse al frente de las tropas”. Pero Urquiza no vuelve, no quiere volver. A
cuarenta días de la batalla, el 27 de octubre, el inocente Derqui todavía escribe al
sensitivo guerrero interesándose por su salud y rogándole que “tome el mando”.

La trompetería oligárquica anuncia la gran victoria, aunque Mitre no puede mover a los
suyos de la estancia de Palacios porque no tiene caballada. Sarmiento, desde Buenos
Aires, le escribe el 20 de septiembre: “No trate de economizar sangre de gauchos.
Este es un abono que es preciso hacer útil al país. La sangre es lo único que tienen de
seres humanos” (Archivo Mitre, tomo IX, pág. 363). Para Urquiza quiere medidas
radicales “o Southampton o la horca”. En Southampton pasaba su ancianidad, pobre
pero jamás amargado, Juan Manuel de Rosas.

Ni uno ni otro. Urquiza no será un prófugo. Quedará en Entre Ríos y no perderá ni el


gobierno de esa provincia ni una sola de sus muchas vacas. Derqui, Pedenera, Saa, el
Chacho Peñaloza, Virasoro, Juan Pablo López esperan que vuelva Urquiza de Entre
Ríos y en una sola carga desbarate las atemorizadas tropas mitristas. Por toda la
República, de Rosario al Norte, vibra el grito ¡Viva Urquiza! en desafío a los oligarcas:
todos llevan al pecho la roja divisa federal con el dístico “Defendemos la ley federal

38
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

jurada. Son traidores quienes la combaten”. Urquiza tiene trece provincias consigo y
un partido que es todo, o casi todo, en la República. Se lo espera con impaciencia.
Derqui suponiendo que es el obstáculo para el regreso del general, opta por eliminarse
de la escena y en un buque inglés se va silenciosamente a Montevideo, renunciando
la presidencia. Lo reemplaza Pedernera, que tiene toda la confianza de Urquiza. Pero
Urquiza no viene.

Entonces las divisiones mitristas a las órdenes de Sandes, Iseas Irrazabal Flores,
Paunero, Arredondo (todos jefes extranjeros) entran implacables en el interior o
cumplir el consejo de Sarmiento. Hombre encontrado con la divisa federal es
degollado; si no lo llevan es mandado a un cantón de fronteras a pelear con los indios.
No importa que tenga hijos y mujer. Es gaucho, y debe ser eliminado del mapa
político. Todo el país debe “civilizarse”.

Venancio Flores, antiguo presidente uruguayo, a las órdenes de los porteños,


sorprende en Cañada de Gómez el 22 de noviembre al grueso del ejército federal que
sigue esperando órdenes de Urquiza. Ahí están sin saber a quién obedecer, ni qué
hacer. Flores pasa tranquilamente a degüello a la mayoría e incorpora a los otros a
sus filas. Nuestras guerras civiles no se habían distinguido por su lenidad
precisamente, pero ahora se colma la medida. Hasta Gelly y Obes, ministro de Guerra
de Mitre, se estremece con la hecatombe: “El suceso de la Cañada de Gómez –
informa– es uno de los hechos de armas que aterrorizan al vencedor… Este suceso es
la segunda edición de Villamayor, corregida y aumentada”. (En Villamayor, Mitre había
hecho fusilar al coronel Gerónimo Costa y sus compañeros por el solo delito de ser
federales).

Esa limpieza de criollo que hace el ejército de la Libertad entre 1861 y 1862 es la
página más negra de nuestra historia, no por desconocida menos real. Debe ponerse
el país “a un mismo color” eliminando a los federales. Como los incorporados por
Flores desertan en la primera ocasión, en adelante no habrá más incorporaciones:
degüellos, nada más que degüellos. No los hace Mitre, que no se ensucia las manos
con esas cosas; tampoco Paunero ni Arredondo. Serán Flores, Sandes, Irrazabal,
todos extranjeros. Y los ejecutores materiales tampoco son criollos: se buscan
mafiosos traídos de Sicilia: “En la matanza de la Cañada de Gómez –escribe José
María Roxas y Patrón a Juan Manuel de Rosas-, los italianos hicieron despertar en lo
otra vida a muchos que, cansados de los trabajos del día, dormían profundamente“ (A.
Saldías: La evolución republicana, pág. 406).

Así avanza la ola criminal, estableciendo “El reinado de la libertad“, como dice La
Nación Argentina, el diario de Mitre.

Sarmiento sigue con sus aplausos: “Los gauchos son bípedos implumes de tan infame
condición, que nada se gana con tratarlos mejor”, dice el apóstol de la civilización. Los
pobres criollos que caen en manos de los libertadores, sólo pueden exclamar ¡Viva

39
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Urquiza! al sentir el filo de la cuchilla. Algunos consiguen disparar al monte a hacer


una vida de animales bravíos.

Seguirá la matanza en Córdoba, San Luis, Mendoza, San Juan, La Rioja, mientras se
oiga el ¡Viva Urquiza! en alguna pulpería o se vea la roja cinta de la infamia. Que viva
Urquiza mientras mueren los federales. Y Urquiza vive tranquilo en su palacio San
José de Entre Ríos, porque ha concertado con Mitre que se le deje su fortuna y su
gobierno a condición de abandonar a los federales. Dentro de poco hará votar por
Mitre en las elecciones de presidente.

“Pavón no es solo una “victoria militar –escribe Mitre o su ministro de Guerra– es sobre
todo el triunfo de la civilización sobre los elementos de la barbarie”

Actividad 2 : Analiza con la docente las teorías sobre lo que sucedió en Pavón

Actividad 3 : Busca imágenes sobre los tres presidentes que formaron el Estado
Argentino ( Mitre, Sarmiento , Alvear)

Clase 26 de octubre

Horario 930 a 1050

Tema Evaluación de Rosas

Actividad 1 : Lee la siguiente evaluación y realízala en el proceso de la clase

Clase 29 de octubre

Horario 8 a 9.20

Tema : Entrevistas Históricas

Actividad 1 : Elige un compañero para realizar la nueva actividad propuesta,


selecciona junto a la docente una de las siguientes presidencias

 Bartolomé Mitre
 Domingo Faustino Sarmiento
 Nicolás Avellaneda

Actividad 2: Busca las características de la presidencia seleccionada, realiza un


resumen para tus compañeros

Actividad 3 : Elabora una entrevista personal entre un periodista llamado Mariano


moreno y el presidente que hayas seleccionado , la entrevista debe describir no solo la
ideología reinante del presidente si no también las obras principales de su gobierno

40
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Actividad 4 : Busca personificar al presidente y al periodista para realizar la entrevista ,


gravándola ( ojo no hace falta que te encuentres con tu pareja para hacer el trabajo
por que puedes editar la entrevista en un video )

Actividad 5: Solicita la asesoría de la docente para la realización de los videos

Actividad 6 : La entrega de los videos será el día cinco de noviembre

Clase 5 de noviembre

Horario 8 a 9:20

Tema : Momentos negros de 1860-1880

Actividad 1 : Recuerda con la docente lo que sucedió en la Guerra de la Triple Alianza

Actividad 2 : Observa el Siguiente video sobre la zamba del Chacho Peñaloza

https://www.youtube.com/watch?v=Jmiikaf7Baw

Actividad 3 : Busca la biografía del Chacho Peñaloza, establece como fue asesinado ,
reflexiona sobre la participación de Domingo Faustino Sarmiento

Actividad 4 Escucha atentamente los mitos falsos de la historia

Actividad 5 Desarrolla una línea de tiempo desde 1860 a 1880 sobre las presidencias
Argentina utilizando imágenes

Clase 9 de noviembre

Horario 9 :30 a 10:50

Tema : Campaña del desierto – Roca –

Actividad 1: Busca un billete de 100 pesos, aparte de Eva Perón, que otro personaje
histórico aparece. Desarrolla la biografía del mismo

Actividad 2 :Observa el siguiente video y realiza una síntesis del mismo ,

https://www.youtube.com/watch?v=OV7fqAN9sDI

Actividad 3 : Realiza una reflexión personal sobre lo que fue la Conquista del desierto

Actividad 4 : Busca las imágenes sobre el etnocidio que produjo Roca

Actividad 5 : ¿ Crees que la Argentina discrimina a los pueblos originarios? Averigua


algún litigio de tierras contra alguna comunidad aborigen

Clase 12 de noviembre

41
"Año del Fallecimiento Bicentenario del del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Horario 8 a 920

Tema: Generación del 80

Actividad 1 : Realiza una línea de tiempo sobre las presidencias argentinas desde
1880 a 1890

Actividad 2 . Observa el siguiente video señala las características del proyecto político
originado por la generación del 80 desde su perspectiva económica , política y social

https://www.youtube.com/watch?v=QJjETT6ENrw

Presta atención a lo que expresa el video por que serán los datos para ser evaluados

Actividad 3 : A veces las situaciones , palabras y lemas se parece , por que expresan
una ideología , busca la frase que caracteriza al actual gobierno provincial cuando
asumió y la frase central de partido PAN

42
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Colegio privado Jean Piaget


Cartilla de Geografía
3 año U
Docente: Aban Oscar

Sector industrial en la Argentina

1
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Un periodo de crecimiento industrial fue el gobierno de Juan Domingo Perón, se crearon


fábricas de equipamientos militares, y se radicaron varias industrias pesadas (como las
automotrices), esas industrias surgieron a través de subsidios del estado con el objetivo de
producir productos que se exportaban, se formaron industrias nacionales fuertes en los
sectores de la industria pesada. Los primeros seis meses del gobierno de Arturo Frondizi
serían de gran expansión, se continuaron los proyectos industriales que había comenzado el
peronismo, además se radicaron mayor cantidad de industrias a través de la política de los
capitales extranjeros, y se forjó el abastecimiento de materias primas como petróleo (industrias
petroquímicas y combustibles), acero (industrias pesadas). Pero además, se había cubierto
aquella demanda de automotores que existía en Argentina, logrando responder a esa
demanda con automotores de fabricación nacional, objetivo anhelado desde el gobierno de
Perón

Las industrias argentinas han tenido en el presente siglo un enorme desarrollo, cuyo factor
decisivo fue la Segunda Guerra Mundial. Aunque su evolución es reciente, las actividades
manufactureras como la fabricación de vinos, aceite, tejidos y curtido de cueros, ya se
desarrollaban desde la época colonial.

A partir de 1990, en cumplimiento de la Ley de Reforma del Estado, el gobierno comienza a


llevar adelante un proceso de privatización con la venta de empresas públicas, que incluyó en
el sector industrial, distintas petroquímicas, refinerías de petróleo, talleres navales, siderurgias,
fábricas militares y otras manufacturas. Con ello también se inicia una fase de importantes
inversiones privadas, nacionales y extranjeras, manifestada en la radicación de nuevas
industrias y en la compra o fusión de las ya existentes.

La agrupación geográfica de la actividad fabril obedece a una serie de factores que inciden en
la localización de los establecimientos industriales, entre los que deben considerarse: la
existencia de materia prima, la disponibilidad de energía, la provisión de mano de obra y de
agua, la proximidad a los mercados de consumo y la vinculación con los medios de transporte,
a los que debe sumarse la acción desarrollada por el Estado, mediante la implementación de
regímenes promocionales para mejorar las posibilidades de asentamiento en ciertas áreas del
territorio. La mayor concentración industrial se presenta en la zona del litoral del río de la Plata
y la margen derecha del río Paraná, conformándose allí el denominado cordón industrial, o
costa industrial argentina, que se extiende entre Santa Fe y La Plata

Las industrias de mayor volumen y que dejan mayores saldos exportables, son las
manufactureras de origen animal y vegetal, especialmente las alimenticias. Dentro de ellas
sobresalen: la industria frigorífica, cuyos principales establecimientos se encuentran en
Buenos Aires, Rosario, Córdoba, Entre Ríos y San Luis; la lechera principalmente en Buenos
Aires, Santa Fe y Córdoba; la molinera en Buenos Aires, Capital Federal, Santa Fe y Córdoba,
la azucarera en Tucumán, Jujuy, Salta y Santa Fe; la aceitera en Santa Fe, Gran Buenos
Aires, Entre Ríos, Capital Federal, Córdoba y Mendoza; las conservas de pescado en Mar del
Plata, Necochea, Puerto Deseado y Ushuaia.

Con la expansión de la superficie cultivada de soja y girasol a fines de la década del setenta,
se produjo un gran desarrollo de la industria oleaginosa; este sector manufacturero produce
aceites y harinas proteicas, muy solicitadas para la fabricación de alimentos balanceados

2
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

utilizados en la cría intensiva de aves, porcinos y bovinos. El 90 % del consumo interno es de


aceite de girasol.

El 95 % de la producción oleaginosa se vende al exterior, representando un ingreso cercano a


los 4.000 millones de dólares en 1995, superando a las carnes y los combustibles. La
Argentina es el líder mundial en exportaciones de aceite de soja y girasol, siendo enviados a
66 países, principalmente en África y Asia, en especial el Sudeste asiático. Las harinas
proteicas por su parte se exportan a 34 países, fundamentalmente europeos.

La industria láctea cuenta con plantas muy importantes para el procesamiento de la leche y la
producción de una vasta línea de alimentos que incluyen crema, mantecas, yogures, dulces y
una considerable variedad de quesos, cubriendo la demanda interna y exportando a más de 40
países.

En el sector bebidas, sobresale la industria vitivinícola en Mendoza, San Juan, Río Negro,
Salta y La Rioja, y la cervecera en Gran Buenos Aires, Córdoba, Santa Fe y Mendoza.

La vitivinicultura argentina tuvo sus inicios en época de la colonización española, a mediados


del siglo XVI, en que cepas y semillas traídas del Viejo Mundo fueron cultivadas por
sacerdotes católicos con excelentes resultados. El desarrollo de esta industria fue lento en los
primeros tiempos, aunque a comienzos de este siglo alcanzó rápidamente un lugar destacado,
llegando a ser la tercera industria nacional por su importancia entre las alimenticias.

La región vitivinícola se ubica principalmente en el Oeste del país, al pie de la Cordillera de los
Andes, donde la vid encuentra las mejores condiciones ecológicas para su desarrollo. vasija
que supera los cincuenta millones de hectolitros, estando el proceso de producción y
elaboración controlado por un organismo modelo, considerado único en el mundo dentro de
este rubro: el Instituto Nacional de Vitivinicultura.

Las modernas instalaciones, los más nuevos métodos de vinificación, así como el control de
este organismo que garantiza y certifica la aptitud para el consumo de los productos, ha

3
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

permitido la obtención de vinos, champagne y otros productos de excelente calidad, que salen
al exterior compitiendo ventajosamente en el mercado internacional con los más afamados del
mundo, obteniendo galardones que son prueba fehaciente de sus extraordinarias
características.

La industria procesadora de la fruta posee su mayor desarrollo en la zona cuyana, las


provincias de Río Negro y del Neuquén y en la Mesopotamia. La producción comprende
básicamente mermeladas, jaleas, envasados al natural, deshidratados y jugos concentrados.
Este último rubro tuvo en 1995 una producción global superior a los 70 millones de kilos, de los
cuales el 10 % se volcó al mercado interno y el 90 % restante se exportó, fundamentalmente a
los EE.UU. y Japón.

Otro grupo importante lo constituye el de las industrias textiles, entre las que se destacan la
textil algodonera y la textil lanera, cuyos mayores centros manufactureros se encuentran en la
Capital Federal. los Alrededores de Buenos Aires, Chaco, Corrientes y Santiago del Estero
para la algodonera; mientras que la elaboración de lanas se realiza en Buenos Aires, Chubut,
Santa Cruz y Río Negro y con desarrollo más reciente los nuevos centros textiles de fibras
acrílicas en La Rioja y San Luis.

Entre las industrias forestales, sobresalen la extracción del tanino, la maderera y la mueblera,
localizadas en las provincias del Chaco, Buenos Aires, Santa Fe, Misiones, Mendoza y
Neuquén. La de celulosa y papel, con importantes establecimientos dedicados a la producción
de papel para diarios, sobresaliendo Papel Prensa inaugurada en 1978 en Buenos Aires;
Celulosa Argentina S.A. y Alto Paraná S.A. en Misiones; y Papel del Tucumán inaugurada en
1982 en la provincia homónima.

Entre las industrias de origen mineral, un lugar preponderante corresponde a las destilerías de
petróleo, ubicadas en Buenos Aires, Chubut, Neuquén y Salta, entre otras provincias,
sobresaliendo la Destilería La Plata, la mayor y más moderna del país; seguida por las
destilerías Luján de Cuyo, San Lorenzo, Campo Durán y Plaza Huincul.

4
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Dentro de la industria del petróleo y sus derivados, también se destacan PASA, Petroquímica
Argentina S.A. ubicada en San Lorenzo (Santa Fe) la más grande en su tipo en América
Latina; Petroquímica Río Tercero S.A., en Córdoba, que comenzó a funcionar en 1981;
Petroquímica General Mosconi ubicada en Ensenada (Buenos Aires) inaugurada en 1984;
Carboclor en Campana, que comenzó a funcionar en Octubre de 1994; a las que se suman
Fertineu S.A. en Neuquén y Fertinoa en Salta, con producción de fertilizantes, conjuntamente
con Petrosur de Campana.

Actividades

Realizar un cuadro comparativo con las principales características de los distintos sectores
industriales en el país

Principales atractivos turísticos

Un atractivo turístico es un sitio o un hecho que genera interés entre los viajeros. De este
modo, puede tratarse de un motivo para que una persona tome la decisión de visitar una
ciudad o un país.

Parque Nacional Talampaya

En la jurisdicción de La Rioja se localiza, una extensa reserva que resguarda ciertas áreas
antiguas y prehistóricas más significativas del país. Con un registro de alrededor de 240 años,
los dinosaurios vagabundeaban por esta provincia, y los restos prehistóricos hallados en el
parque ratifican ese suceso. Para los que no poseen interés en la prehistoria, la litera seca del
popular río Talampaya, el rojo intenso de su profundidad, las piedras de forma inusual y el
ostentoso panorama son motivación suficiente para visitar esta extraordinario seducción
turística en Argentina.

Iglesia San Francisco

5
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Este bello templo tiene un registro del siglo XVII, el Santuario de San Francisco es una de las
distribuciones coloniales más extraordinarios en la bella localidad de Salta. Este santuario de
diseño italiano es acreditado por sus delicadas columnas blancos y una transformada torre de
diversos niveles que se alumbra por la noche. Con su cubierta arqueado y su biblioteca de
registros, en lo profundo de la capilla es equivalentemente digno de evocación. Este hito
arquitectónico vale la pena su visita si llegas a visitar la capital provincial de Salta.

Quebrada de Cafayate

La bella Quebrada de Cafayate es un pomposo cañón en la provincia de Valles Calchaquíes.


La roca arenisca, las alineaciones peñascosas inusuales y los colores atrayentes hacen que

6
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

este sea un efectivo componente para la lista de aspiraciones para los excursionistas. Los
recorridos constituidos aprueban ir de expedición o conducir a lo extenso del Río de las
Conchas, andando hacia el collado y el centro del cañón. En la base, las Cordilleras de
Carahuasi son una discrepancia audaz, creando vistas de representaciones pictóricas
perfectas.

Delta del Tigre

Justo en la zona norte de Buenos Aires se localiza la localidad de Tigre, un lugar que funciona
como eje vital del delta adyacente. Si bien la localidad brinda un amplio museo, bellas tiendas
y un agitado mercado al aire libre, el efectivo atractivo es dispersarse por el Tigre e indagar el
delta del río en buque. Reserve su lugar en un tours guiado, o súbase directamente a uno de
los coches acuáticos particulares, y perciba las casas particulares a lo extenso de los canales,
los numerosos intermedios flotantes de transporte usados en la zona hacen de su viaje ideal.

Cerro Catedral

7
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Situado en la Jurisdicción de los Lagos, junto de San Carlos de Bariloche, Loma Catedral es la
parada de esquí más popular y optimizado de América del Sur. La tierra provocadora, el
acceso fuera de la vía y las subestructuras de snowboard lo transforman en un destino
multitudinario para los apasionados de los juegos de invierno y las festividades de esquí. En la
época baja, el complejo turístico da la bienvenida a viajeros, salteadores y corredores que
pretenden dominar el terreno y regocijarse de las extraordinarias vistas de las montañas.

Aconcagua

Subir el cerro Aconcagua es una acción para efectivos aventureros. El Aconcagua es el cerro
más alto de los Andes y acreditada como una de las Siete cimas del mundo. Es un lugar
turístico originalmente atractivo debido a su enorme altura y ascenso accesible. Utilizando
indiscutibles rutas, los alpinistas logran alcanzar la cumbre sin jarcias o componente técnico.
Los turistas igualmente logran explorar los glaciares próximos y numerosos otros lugares
naturales situados dentro del Parque Jurisdiccional de Aconcagua de la localidad de Mendoza.

Actividad

En grupo buscar un lugar turístico de Argentina y describir sus principales características (en
qué ciudad se encuentra, si cuenta con hospedaje, transporte para llegar al lugar, gastronomía
y entretenimiento).

Circuitos Turísticos

Se conoce como ruta turística al camino o recorrido que se destaca por sus atractivos para el
desarrollo del turismo. Estas rutas pueden sobresalir por sus características naturales o por
permitir el acceso a un patrimonio cultural o histórico de importancia

El Noroeste argentino (NOA) es una de las regiones autóctonas del país integrada por las
provincias de Jujuy, Salta, Tucumán, Catamarca, La Rioja y Santiago del Estero. Allí con sólo
mirar el horizonte y apreciar sus variados colores, ya se invita al viajero a sumergirse en sus

8
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

costumbres y tradiciones; y acariciar su espíritu que propone disfrutar de la tranquilidad y


también animarse a la aventura. Cuenta con unos 300.000 kilómetros cuadrados con bruscas
transiciones climáticas y paisajísticas: la Puna (Jujuy) desciende desde sus 4000 metros hasta
las llanuras Chaco salteñas.

Sus picos de más de 6000 metros de altura, los restos de antiguas civilizaciones, pueblos de
adobe, capillas jesuíticas, ríos, arroyos, bodegas, artesanías, todo forma parte de un paisaje
árido, cálido y misterioso al mismo tiempo.

"Si se decide viajar a esta región, la mejor manera de hacerlo es en avión a Salta y a partir de
allí se pueden ir sumando provincias y ciudades para visitar. Es la mejor opción ya que hay
más frecuencias de vuelos con algunas aerolíneas a esa provincia. También se recomienda
contratar alguna empresa o guía de turismo local si no se conoce muy bien la zona", detalló la
especialista.

"En Salta y Jujuy se pueden encontrar las principales empresas de alquiler de autos. Es
importante recorrer la región en un vehículo resistente y llevar repuestos neumáticos por las
dudas

Actividad

En grupo armar un circuito turístico de algunas de las regiones de la Argentina

9
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

3rd Year
Subject: English
Teacher: Frank Troncoso

Criterios a tener en cuenta:


 Resolución de los ejercicios en base a la actividad y lectura comprensiva.
 Se valora el progreso que el alumno realice y el proceso o camino que ha
realizado hacia el objetivo planteado.
 Trabajos completos.

Present Simple vs Present Continuous

1
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Differences between the Present Simple and Present Continuous: Uses

 Simple Present: We use this tense to talk about the habitual actions, routines
or general truths.
 Present Continuous: We use this tense to talk about actions at the moment of
speaking or temporary actions.

Present Simple
Su formación es muy fácil, se utiliza la forma verbal en presente. Por ejemplo:
Example: John plays football on Saturdays. (Juan juega fútbol los sábados).
Example: We watch television in the afternoon. (Nosotros vemos televisión por la
tarde).
Example: Susan lives in London. (Susan vive en Londres).

Present Continuous
Se utiliza el auxiliar to be más el gerundio del verbo principal, es decir, la forma
acabada en -ing. Por ejemplo:
Example: John is playing football now. (Juan está jugando fútbol ahora)
Example: We are watching television at the moment. (Nosotros estamos viendo
televisión en este momento).
Example: I am going to the cinema. (Estoy yendo al cine).

Para recordar mejor los usos de cada tiempo verbal y sus reglas
gramaticales puedes mirar las cartillas anteriores

2
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

3
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Activity No 1: Choose the correct option


1) Marie--‐Claude isn't a Canadian. I she comes from France.
A. believe

B. B. ? am believing

2) Look! Junko into the water.


A. ? jumps

B. ? is jumping

3) I you're crazy!
A. ? think

B. ? am thinking

4) Don't give Jan any cheese. She it!


A. ? hates

B. ? is hating

5) I to Toronto next Thursday. Do you want to come?


A. ? go

B. ? am going

6) Once a week, I to an art class at the college.


A. ? go
B. ? am going

7) I lunch in the cafeteria every day.


A. ? have

B. ? am having

8) Salman is rich — he a Mercedes.


A. ? drives

B. ? is driving

9) You won't find Jerry at home right now. He in the library.


A. ? studies

B. ? is studying

10) It quite hard — perhaps we shouldn't go out tonight.


A. ? snows

B. ? is snowing

4
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Activity No 2
Choose the correct tense verb between Present Simple and Present Continuous

1 My brother swim/swims/is swimming at the sea now.

2 I always am doing/do/does my homework.

3 Mary is watching/watches/watchs TV at the moment.

4 My grandmother never is sunbathing/sunbaths/sunbathes on the beach.

5 My friends sometimes play/are playing/plays tennis after school.

6 We sits/are sitting/sit in the garden now.

7 Mum is making/makes/make dinner at the moment.

8 You always are driving/drive/drives to work.

9 We usually goes/are going/go on holiday at Christmas.

10 She never are tiding/tidy/tidies her room.

5
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Activity No 3

Activity No 4
Complete the sentences below using one of the verbs in the box in the correct form.
You may use each verb once only.

6
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

cook work finish read visit


play wait know eat speak

1. He is finishing his report. He will bring it into the office when it is complete.

2. I always __________ tennis on Fridays.

3. We often ____________ my grandparents on weekends.

4. My mother ____________ a delicious food.

5. I ___________ the answer to your problem. Get a new computer.

6. "Where is John?" "He ___________ for an important telephone call in his office."

7. Karen ___________ a book now.

8. My brother _____________ in a factory.

9. They ___________ a pizza at the moment.

10. The teacher ___________ two languages.

Activity No 5

7
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

(meet)

8
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Board game

9
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Rúbrica para trabajo grupal


Criterios de
Evaluación e
Principiante En progreso Satisfactorio Avanzado
Indicadores de
Porcentajes 0% - 25% 26% - 50% 51% - 75% 76% - 100%

Puntualidad
Presentación en
tiempo y forma de
los trabajos
Gramática
Pronunciación
Vocabulario

10
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CARTILLA DE EDUCACION FISICA

VII

PROFESORES: RODRIGUEZ M. FERNANDA

ROMAY R. JORGE

2020

1
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

6TA CARTILLA DE ACTIVIDADES (19 DE OCTUBRE AL 13 DE NOVIEMBRE)


Titulo Bachiller Orientado en Ciencias Naturales
Horas Ciclo (Básico u
Espacio Curricular Curso División
Cátedras Orientado)
1-2-3-4-5 Ciclo Común
Educación Física 9 HS
AÑO Ciclo Orientado
Carácter (Titular, Provisional,
Docente (Apellido y Nombre)
Suplente)
Rodríguez, María Fernanda – Romay, Jorge Rafael Provisional

PROYECTO COPA PIAGET 5G 2020


COLEGIO JEAN PIAGET

TORNEO: FUTBOL FREESTYLE – JUMP ROPE

Fundamentación

En el marco del desarrollo del proyecto “desestructurando clases virtuales”, se llevará


a cabo el tradicional torneo COPA PIAGET 2020.

Así mismo los registros que desde la institución se vienen llevando, muestran
cada vez un número mayor de ausencias entre los estudiantes y los motivos son
diversos, algunos de ellos simplemente argumentan pérdida de interés por
agotamiento, otros angustia y sobrecarga de tareas. Atendiendo estas realidades
llegamos a la reflexión de desestructurar las clases para dar calma y respiro a los
jóvenes, es que esta Área reorganizará el dictado de clases en esta instancia,
realizando un torneo intercurso respetando sus horarios habituales.

2
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Objetivos:

- Romper la estructura de las clases virtuales


- Dar calma y descanso a los jóvenes
- Contener a los jóvenes de una forma diferente.
Objetivo Específicos

 Interactuar con otros a través del lenguaje, el juego, diversas acciones.


 Descubrir la importancia de orientar su vida desde los valores:
o conocimiento personal y del otro.
o aceptación, respeto, diálogo, cooperación, solidaridad.
o fortaleza de voluntad, paciencia, perseverancia.
o actitud positiva, alegría, esperanza.
 Promover la práctica deportiva como una eficaz herramienta en la formación
integral.
 Promover una metodología de trabajo, en nuestro medio, con un sustento
técnico-pedagógico que respete las características psico-físicas de los jóvenes.
 Aumentar el número de adolescentes en la práctica del deporte
 Estimular la creatividad e imaginación para confección del material.

Bases:

1. Del Torneo Intercurso

a. El torneo es de carácter masculino (FUTBOL FREESTYLE y femenino (JUMP

ROPE), está abierto a cualquier estudiante secundario perteneciente a la

Institución del Colegio Privado Jean Piaget. La inscripción de los jugadores será

por cursos, y la forma del torneo será por eliminación, con 2 tentativas por

desafío con excepción de semifinal y final.

b. El fixture del torneo se elaborará de acuerdo a la cantidad de jugadores inscrito.

c. El torneo se desarrollará durante los días: Lunes, Miércoles (masculino) y

Martes, Jueves (femenino).

d. El torneo se realizara por la plataforma ZOOM en el horario de educación física.

FUTBOL FREESTYLE

3
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

2. De los desafíos

a. En primera ronda los jugadores de cada curso deberán pasar diferentes

desafíos para clasificar.

b. Los jugadores clasificados de cada curso pasaran a la segunda ronda donde

competirán con los demás jugadores clasificados de cada curso.

c. Los desafíos irán aumentando su dificultad, donde los jugadores deberán

cumplir con el desafio para poder clasificar a la siguiente instancia

d. A partir de las semifinales los jugadores tendrán técnica libre (cada jugador

inventara una coreografía de jueguitos con la pelota, el cual tendrá un tiempo

minimo y máximo de 1 minuto.

e. La final se realizará con los dos jugadores finalista que lleguen a esta instancia

y se realizará un Zoom presencial donde toda la institucion podrá presenciar de

esta final

3. De los jugadores

a. Los jugadores deberán elegir un nombre fantasía que los representen, que no

fuere ofensivo o de mal gusto.

b. Los jugadores necesariamente deberán ser estudiantes del Colegio Jean

Piaget.

4. Durante el desafio

a. En la primera ronda los jugadores tendrán 2 tentativas y se puntualizara la que

mejor se desempeño

b. Si los jugadores no pueden completar el desafio ya sea por no completar

cantidad o tiempo, se considera que no clasifica a la siguiente instancia.

4
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

c. En semifinales y finales solo tendrán 1 sola tentativa de una duración de 1

minuto como mínimo y máximo

5. Sanciones

a. Si el jugador se sale de la pantalla de zoom y no se puede ver el desafío, se

considera desafío no completado y deberá pasar a la segunda tentativa si es

que le quedase una oportunidad mas.

b. Si el jugador apaga la pantalla de zoom y no se puede ver el desafío, se

considera desafío no completado y deberá pasar a la segunda tentativa si es

que le quedase una oportunidad mas

6. Varios

 La organización se reserva el derecho de llenar cualquier vacío reglamentario en

las presentes bases, y de introducir nuevas acomodaciones al calendario si

fuera necesario.

7. Premios:

 Primer lugar.
 Segundo lugar.

5
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

El salto de la soga: “Juego que consiste en saltar por encima de una soga que pasa
por debajo de los pies y sobre la cabeza del que salta”. El salto de la soga es
considerado un ejercicio físico con numerosos beneficios para la salud, ya que se trata
de una actividad aeróbica. Ha sido siempre un juego popular practicado desde hace
siglos, pero hoy en día es considerado un deporte del que cada vez existen más
modalidades para ser practicadas por los amantes de la soga.

Postura básica para el salto de la soga debe tener las siguientes características:

 Tener la cuerda con la altura adecuada. Esto se determina por la altura de la


persona, la cual se coloca de pie pisar la cuerda con pies juntos y con las
manos a la altura de las axilas. La agarradera de la cuerda debe llegar a ese
nivel.
 Los pies deben estar paralelos y juntos.
 El peso de cuerpo debe recaer en los metatarsos de los pies, nunca en los
talones.
 Tobillos, rodillas y cadera deben de estar relajado.
 Los codos deben de estar apretados a las costillas.
 Antebrazos deben de estar frente a la cadera e inclinados ligeramente hacia
abajo.
 Movimiento circular de la muñeca.
 Hombros deben estar relajados y hacia abajo.
 Cabeza erguida.
 Ojos deben estar enfocados hacia adelante.

REGLAS GENERALES PARA JUGAR.


La única regla existente que se aplica al juego en equipo o grupal en este juego es: Si
alguna jugadora falla, continuará inmediatamente el juego la siguiente participante que
formen parte del grupo, así se continúa hasta que todas las participantes del mismo
equipo fallen. Cada jugadora solo puede tener un fallido al comenzar el salto

Objetivo:

 No pisar la soga o tocarla con los pies o piernas mientras se salta.


 Saltar continuamente, no se puede interrumpir o se perderá.
 Gana quien realice mayor cantidad de saltos.
 Pierde quien toca la soga o quien para.

6
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Indumentaria
 Utilizar zapatillas deportivas adecuadas, que amortigüe adecuadamente los
impactos.
 Con respecto a la ropa deportiva, debe ser ligera y que no entorpezca los
movimientos de la soga. Por eso debería utilizarse ropa deportiva adecuada.
 La joyería no está permitida, o por lo menos, cubierta con seguridad con una
cinta
 Los accesorios para el cabello deben ser asegurados. A los saltadores no se les
dará un nuevo intento debido a la interferencia de sus accesorios de pelo.
 Cordones de los calzados bien ajustados.

Equipo:
Estará formado por 4 integrantes la cual deberán presentar su lista de buena fe a los
profesores responsables, designado nombre y apellido, curso, nombre del equipo y
nombre del delegado.

7
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Colegio Privado Jean Piaget

Construcción para la
Ciudadanía
TERCER AÑO

8
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

OBJETIVOS

Comprender y analizar la importancia que reviste la relación social de las personas


dentro de la sociedad
Asumir actitudes solidarias y participativas para el ejercicio pleno de la ciudadanía.
Internalizar progresivamente normas y valores para lograr una buena convivencia
en sociedad.
Valorar el fundamento central de los derechos humanos.
Conocer e identificar los distintos organismos internacionales que forman parte del
Derecho Internacional. Apreciar la importancia de la defensa de los derechos
humanos para el desarrollo integral del ser humano. Identificar y diferenciar las
características de los Derechos Humanos para asegurar el debido goce y respeto
por las personas y las instituciones de gobierno. Analizar y reconocer los derechos
establecidos en la Declaración Universal de los Derechos Humanos. Conocer e
identificar a través de situaciones la violación de los derechos humanos. Conocer
la importancia de los Derechos Civiles, Derechos Sociales Económicos y
culturales, Derechos de los Consumidores.

CRITERIOS DE EVALUACIÓN:
Evaluación Procesual. Retroalimentación.
Evaluación constante, teniendo en cuenta las capacidades abordadas (Resolución
de problemas, Pensamiento Crítico, Aprender a Aprender, Trabajo
con otros, Compromiso y responsabilidad, Comunicación) Interpretación
y desarrollo correcto de las consignas . Responsabilidad, interés y
participación.
Legibilidad y prolijidad en la presentación de trabajos prácticos.
Presentación de trabajos prácticos en tiempo y forma.
Presentar los trabajos prácticos con nombre y apellido, curso, materia.

9
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CONTENIDO Y ACTIVIDADES.
CLASE DIA MIERCOLES 21 DE OCTUBRE
HORARIO: 09:30- 10:10- 10:10-10:50 hs.
TEMA: CONSTITUCION NACIONAL

La Constitución Nacional

El verbo constituir significa crear, dar origen y forma a alguna cosa. Por ello, la norma
jurídica que da nacimiento y origen a un Estado recibe el nombre de Constitución. Así,
la constitución nacional se considera la ley más importante dentro de un estado de
derecho. En ella se establecen los grandes lineamientos de la organización de una
comunidad: por un lado, el texto constitucional establece y consagra los derechos que
conforman el ámbito de libertad de los habitantes, y por otro, establece la forma de
gobierno y de organización del Estado. A su vez, la Constitución planea los objetivos y
los valores que comparten y promueven los miembros de la sociedad que deciden
conformar un Estado.
Después de la Revolución de Mayo surgió la necesidad de dictar una
Constitución para la Nación Argentina, con la finalidad de constituir la
unión nacional, afianzar la justicia y consolidar la paz interior. La reunión
inicial se celebró el 31 de mayo de 1852 en la ciudad de San Nicolás de
los Arroyos, encuentro que se recuerda como Acuerdo de San Nicolás.
Pero el 1º de mayo de 1853 los diputados de las distintas provincias (con
excepción de Buenos Aires), reunidos en Santa Fe, sancionaron la
Constitución Nacional.

ACTIVIDAD:

1_ NOS VAMOS PREPARANDO PARA LA EXPO PIAGET

Investigar y profundizar el tema estudiado para la exposición.


 Elaborar materiales y recursos para una mejor exposición, por ejemplo; elaborar
un power point, realizar afiches, dibujos,etc.
 Relacionar el tema con el contexto actual de la provincia.

10
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CONTENIDOS Y ACTIVIDADES
CLASE DIA VIERNES 23 DE OCTUBRE
HORARIO: 10:10 - 10:50hs /
TEMA:

DERECHO AL DESARROLLO EN LA CONSTITUCIÓN NACIONAL

En el año 1994, en el Capítulo Segundo -de la Parte Dogmática- de la


Constitución Nacional, se incorpora como art. 41, EL CUAL ESTABLECE,
que tenemos derecho a disfrutar de un ambiente sano así como también a
la vez sostiene que, ese mismo ambiente debe ser apto para el desarrollo
humano, es decir el desarrollo de todos los hombres y de ‘el todo’ del
hombre»

1- Qué se entiende por desarrollo humano

Marcelo A. López Alfonsín y Carlos E. Tambusi hacen notar que la


Constitución Argentina es la primera que incorpora el Desarrollo Humano,
de acuerdo con la visión del Programa de las Naciones Unidas para el
Desarrollo, destacando que este es un concepto «amplio e integral», que
no es «simplemente un llamado a la protección ambiental, sino que implica
un nuevo concepto de crecimiento económico, que provee justicia y
oportunidades para toda la gente del mundo»

El desarrollo humano es un proceso en el cual se amplían las


oportunidades del ser humano. En principio estas oportunidades pueden
ser infinitas y cambiar con el tiempo. Sin embargo a todos los niveles del
desarrollo, «las tres más esenciales son disfrutar» de una vida prolongada
y saludable, «adquirir» conocimientos y «tener acceso» a los recursos
necesarios para lograr un nivel de vida decente.Si no se poseen estas
oportunidades esenciales muchas cosas alternativas continuarán siendo
inaccesibles.

ACTIVIDAD:

1_ NOS VAMOS PREPARANDO PARA LA EXPO PIAGET

 Investigar y profundizar los temas estudiados para la exposición.

 Elaborar materiales y recursos para una mejor exposición, por ejemplo; elaborar
un power point, realizar afiches, dibujos,etc.
 Relacionar el tema con el contexto actual de la provincia.

11
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CONTENIDO Y ACTIVIDADES.
CLASE DIA MIERCOLES 28 DE OCTUBRE
HORARIO: 09:30- 10:10- 10:10-10:50 hs.
TEMA:

DERECHO A LA PAZ

En la 18a. reunión de la Conferencia General de la


UNESCO (París, 1974), se aprobó una resolución que
contiene una definición de paz, la cual constituye un
reconocimiento a las nuevas conceptualizaciones que
a partir de 1950 emergieron de las investigaciones
sobre la paz. Hoy, la misma aún se considera un
referente válido para inspirar los procesos de
construcción de paz que se gestan en el mundo. En la
misma se afirma lo siguiente

"La paz no puede consistir únicamente en la ausencia de conflictos armados, sino


que entraña principalmente un proceso de progreso, de justicia y respeto mutuo,
destinado a garantizar la edificación de una sociedad en la que cada cual pueda
encontrar su verdadero lugar y gozar de la parte de los recursos intelectuales y
materiales del mundo que le corresponde".

"la paz duradera es premisa y requisito para el ejercicio de todos los derechos y
deberes humanos".

Pero hay que tener en claro que la paz no es:

“la paz del silencio, de los hombres y mujeres silenciosos, silenciados. La paz de
la libertad -y por tanto de leyes justas-, de la alegría, de la igualdad, de la
solidaridad, donde todos los ciudadanos cuentan, conviven, comparte".

La paz es un anhelo perpetuo de los seres humanos y no sólo entendida como


ausencia de conflicto. Como corolario de ella, los derechos humanos son el
producto de un proceso dinámico, es decir, que surgen nuevos compromisos,
necesidades y deberes, pero sobre todo, surge una toma de conciencia de los
individuos, los grupos sociales, los pueblos y los Estados. El derecho humano a la
paz es el resultado de esa evolución.

La educación implica indagar y profundizar las acciones a favor de una propuesta


de paz positiva, afianzándola así, como un eje principal y fundamental en la
construcción del derecho humano a la paz Sin duda, la educación es la
herramienta más valiosa para contribuir y promover los derechos humanos.

12
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CONTENIDOS Y ACTIVIDADES
CLASE DIA VIERNES 30 DE OCTUBRE
HORARIO: 10:10 - 10:50hs /
TEMA.

LA PAZ Y LOS DERECHOS HUMANOS


Así, la Declaración Universal de los Derechos Humanos establece que […] la
educación tendrá por objeto el pleno desarrollo de la personalidad humana y el
fortalecimiento del respeto a los derechos del hombre y a las libertades
fundamentales; favorecerá la comprensión, la tolerancia y la amistad entre las
naciones y todos los grupos étnicos y religiosos; y promoverá el desarrollo de las
actividades de las Naciones Unidas para el mantenimiento de la paz.

La rica relación que existe entre los derechos humanos y la paz ha conducido en
los últimos años a una reclamación de la paz como un nuevo derecho humano.
Desde un concepto de paz que no se limita a definirla como la mera ausencia de
guerra, los derechos humanos ocupan un lugar esencial en el concepto actual de
paz entendida como paz positiva. En virtud de esta nueva comprensión de la paz,
desde diferentes instancias, entre las que destaca la unesco, se está proponiendo
el reconocimiento de un derecho humano a la paz como integrante de los
derechos humanos de la tercera generación o derechos de la solidaridad.

La relación estrecha y creciente entre la paz y los derechos humanos se ha


puesto de manifiesto fundamentalmente a partir de los horrores de la II Guerra
Mundial, y con la creación de las naciones unidas y la aprobación de su Carta en
1945. Desde ese momento, ha existido un creciente consenso internacional en
torno a que derechos humanos, paz internacional y desarrollo están
interrelacionados y dependen uno de otro (Bhandare, 1994:2). Es decir, el
concepto de paz evoluciona, y se va a convertir a partir de ahora en una “paz
positiva y dinámica, que comporta el respeto de los derechos humanos y el
desarrollo integral de los pueblos”

ACTIVIDAD:

1_PROFUNDIZAMOS EL TEMA.

 Como podrías ayudar a promover la paz en el colegio, en tu barrio, en tu


familia.
 -¿Qué significa para vos la PAZ?

13
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CONTENIDO Y ACTIVIDADES.
CLASE DIA MIERCOLES 4 DE NOVIEMBRE
HORARIO: 09:30- 10:10- 10:10-10:50 hs.
TEMA:

DERECHO A LA AUTODETERMINACION DE LOS PUEBLOS

El principio de la autodeterminación consiste en el derecho que asiste a los pueblos


de elegir libremente su organización política, económica y social, entendiendo por eso
la posibilidad de darse su propia forma de gobierno, realizar las prácticas culturales y
religiosas que desee y estar libre de cualquier dominación extranjera de tipo colonial
que le impida guiar su destino en forma soberana. Así, podemos establecer dos
dimensiones de la autodeterminación, íntimamente relacionadas: • la dimensión
interna fundada en la libertad de los pueblos para elegir, mantener y cambiar su forma
de vida y su identidad sin segregaciones raciales, religiosas o de cualquier otro tipo; •
y la dimensión Internacional basada en la posibilidad de que los pueblos se organicen
como Estados soberanos frente al resto del mundo y puedan realizar políticas
autónomas sin la injerencia extranjera ni el sometimiento a ningún otro Estado (por
eso la autodeterminación no se agota con la conquista de la inde-pendencia y perdura
a través del tiempo). El derecho a la autodeterminación de los pueblos es uno de los
pitares del derecho internacional establecido en la Carta de las Naciones Unidas de
1945. Además, ha sido un principio fundamental para los procesos de
descolonización que llevaron adelante durante la segunda mitad del siglo xx los
territorios coloniales de África y Asia, que dieron como resultado el surgimiento de
más de 60 nuevos Estados independientes. En esos años de lucha por la
descolonización, la ONU acompañó a los pueblos con distintas resoluciones como la
Declaración sobre la concesión de la Independencia a los países y pueblos
coloniales, de 1960, o la Declaración relativa a los principios de derecho internacional
referentes a las relaciones de amistad y a la cooperación entre los Estados, de 1970.
Una de las ideas que sostienen la auto-determinación es la convicción de que a los
pueblos en situación de dominación y dependencia se les niegan sus derechos
fundamentales y, en consecuencia, cons-tituyen una fuente de conflicto que amenaza
la paz mundial. Los principios que sostienen este derecho en la actualidad volvieron a
adquirir una relevancia vital gracias a los nuevos escenarios de la globalización: ante
la fuerte movilidad de los capitales globales (corporaciones internacionales y capitales
financieros), las nuevas formas de injerencia económica y política (por ejemplo, a
través de los organismos como el FMI o el Banco Mundial) o las transferencias
culturales a través de los medios de comunicación, entre otros fenómenos del siglo
xxi, el derecho a la autodeterminación no pierde vigencia.

14
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

ACTIVIDAD: LECTURA COMPRENSIVA Y PROFUNDIZACION DEL TEMA.


ORGANIZACIÓN DE LOS GRUPOS.

CONTENIDOS Y ACTIVIDADES
CLASE DIA VIERNES 6 DE NOVIEMBRE
HORARIO: 10:10 - 10:50hs /
TEMA:

DERECHO A LA AUTODETERMINACION DE LOS PUEBLOS

Caso práctico: El caso Malvinas


En la disputa que mantiene la Argentina con el Reino Unido por el ejercicio de la
soberanía sobre las Islas Malvinas, el derecho a la autodeterminación ha sido y es
objeto de discusión entre ambos Estados. Veamos cuáles son los argumentos
principales que se ponen en juego en la cuestión.

Ya en la década del 60 la cuestión Malvinas adquirió un fuerte peso en la agenda internacional a


partir de la resolución 1524 de la ONU en la que se llama a poner fin "al colonialismo en todas sus
formas y manifestaciones" sobre la base de dos principios: el de la autodeterminación y el de
integridad territorial. Por el lado británico, se pretendía aplicar el principio de autodeterminación
sobre la base de que los habitantes de las islas debían elegir libremente su propio destino. Por el
lado argentino, en cambio, se rechazó este planteo y se sostuvo la primacía de la integridad
territorial argumentando que el Reino Unido ocupó las islas por la fuerza en 1833, vulnerando la
integridad del territorio argentino. Desde la posición que sostiene la Argentina es importante
considerar que en el derecho internacional público el término "pueblo" no se aplica a cualquier
grupo o colectivo de personas, sino que se utiliza allí donde los colectivos humanos comparten
una continuidad histórica y cultural y son poseedores de características étnicas, culturales y
organizativas que los diferencian de la sociedad nacional del territorio que habitan. Por lo tanto,
no todo asentamiento humano, sea temporario o de larga duración, puede ser considerado
"pueblo", y por eso no corresponda aplicar el derecho de la autodeterminación a los habitantes de
las Islas Malvinas. La Asamblea General de la ONU apoyó el argumento argentino con la
Resolución 2065 de 1965, en la que sostiene que debe aplicarse el principio de integridad
territorial y llama al Reino Unido y a la Argentina a negociar para resolver el conflicto por la
Soberanía de Malvinas reconociendo que solo hay dos partes en la disputa. Veamos algunos de los
argumentos que ofrece la Argentina: Las islas forman parte de la plataforma continental de la
Argentina y la proximidad de Malvinas al territorio continental argentino es evidente. • El
territorio de Malvinas fue heredado de España luego de la Independencia, del mismo modo que se
heredó el territorio continental argentino. • El Reino Unido considera que las islas Malvinas son
un Territorio Británico de Ultramar por elección, es decir, no son un país independiente. • Los
isleños son súbditos de la Corona Británica como miembros de la Commonwealth y son
ciudadanos británicos con los mismos derechos que, por ejemplo, un londinense. • La defensa y
las relaciones internacionales de las islas son llevadas a cabo por el Reino Unido. • Aunque los
isleños tienen un gobierno local, este depende del gobernador nombrado por la Corona Británica,
autoridad máxima de las islas. • Menos del 50 por ciento de la población es nacida en las islas, y la
"forma de vida" de los kelpers es el trasplante del modo de vida británico. • Los kelpers son más
bien una población trasplantada puesto que el Reino Unido mantiene intereses político-
estratégicos y económicos en las islas.

15
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CONTENIDO Y ACTIVIDADES.
CLASE DIA MIERCOLES 11 DE NOVIEMBRE
HORARIO: 09:30- 10:10- 10:10-10:50 hs.
TEMA: AVANCES DE LA ELABORACION DE TRABAJOS GRUPALES.

 PRESENTACION DE LOS AVANCES DE LOS TABAJOS GRUPALES QUE


VAN A PRESENTAR EN LA EXPO PIAGET.
 CONSULTAS PARA EVADIR DUDAS CON RESPECTO A LA
ACTIVIDAD.
 CORRECCION DE LAS ACTIVIDADES.

CONTENIDOS Y ACTIVIDADES
CLASE DIA VIERNES 13 DE NOVIEMBRE
HORARIO: 10:10 - 10:50hs /
TEMA: : PRESENTACION DEL TRABAJO A EXPONER

 PRESENTACION DE LA ELABORACION FINAL


DEL TRABAJO A EXPONER EN LA EXPO PIAGET.

 DEFENSA DEL TRABAJO.

16
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Titulo Bachiller Orientado en Ciencias Naturales


Espacio Curricular Curso División Horas Cátedras Ciclo (Básico u Orientado)
ARTE 3 “U” 3 ORIENTADO
Docente (Apellido y Nombre) Carácter (Titular, Provisional, Suplente)
CALAPIÑA SONIA ISABEL TITULAR

CARTILLA DIDACTICA 7- 2020

EL LENGUAJE VISUAL

El lenguaje visual es un sistema de comunicación de ideas, pensamientos y conocimiento que utiliza


las imágenes como medio de expresión, es decir, transmite mensajes a través de signos visuales.

Signos y sintaxis del lenguaje visual. Elementos básicos.

Como cualquier lenguaje posee unos elementos básicos, los signos o imágenes, y una manera de
ordenarlos o codificarlos, sintaxis.

Significante y significado.

Los signos poseen a su vez dos componentes: significante y significado. El significante es el vehículo
del significado, es solo su apariencia externa, mientras que el significado es el contenido semántico
que le da sentido.

SIGNO Y SÍMBOLO.

Las imágenes y signos, que representan hechos, valores y sentimientos se denominan símbolos. El
simbolismo esta ligado a la psicología de cada cultura, de modo que la misma figura puede significar
cosas diferente en diferentes culturas.

El Logotipo, el pictograma, la señal.

Un logotipo es un elemento gráfico, que sirve para representar a una persona, producto, empresa o
institución. Los logotipos suelen encerrar símbolos de aquello que representan, y su funcionalidad
radica en su capacidad para comunicar el mensaje que se requiere.
Lo mismo ocurre con las señales o pictogramas, el significado se concentra en imágenes más
sencillas que encierran todo su contenido.

NIVEL DE ICONICIDAD DE LA IMAGEN

Dentro de una imagen debemos distinguir el grado de parecido de esta representación (la imagen) con

17
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

lo representado. Si es muy grande diremos que tiene un alto grado de iconicidad y bajo si el parecido
es poco.
No todos los medios de representación de imágenes captan la realidad con el mismo grado de
iconicidad. Por ejemplo, una fotografía registra la realidad muy fielmente, sobre todo en color pero su
iconicidad es menor que la del cine pues, éste además, representa el movimiento y el sonido. En la
pintura, se ha representado la realidad con muy diferentes grados de iconicidad.
Mientras el estilo realista que representa fielmente la realidad, el estilo figurativo que se aleja de la
realidad pero nos permite reconocerla y el estilo abstracto que no la representa.

Imagen realista, figurativa, analítica y abstracta

Realista: Representa fielmente la realidad o utiliza imágenes fieles a lo real. Por ejemplo la fotografía,
o dibujos con mucha precisión y parecido con el real.

Figurativo: Representa formas basadas en la realidad pero expresadas con un estilo libre. Puede ser
una representación basada en la realidad manipulada. Ejemplo de este tipo de imágenes las vemos en
el cubismo de Picasso.

Abstracto: El estilo abstracto ya no representa formas inspiradas directamente en la realidad. Son


formas y estructuras nuevas creadas que expresan un mundo particular. Exigen voluntad y esfuerzo
para su comprensión.

Analíticas: representaciones detalladas por medio de procesos científicos. Son representaciones


complejas dirigidas a un publico especifico que necesitan del conocimiento de normas y códigos para
su lectura.

FUNCIÓN DE LA IMAGEN

Según su finalidad los mensajes visuales o imágenes se pueden clasificar así: informativos,
descriptivos, expresivos, poéticos, estéticos, o apelativos.

Informativa: son los mensajes visuales que notifican un hecho, indican alguna situación, etc...Como
las señales de información de las carreteras.

18
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Descriptiva: Aquellas que además de ofrecernos información nos describen y detallan la naturaleza
de ese algo.

Apelativa: Intentan convencerte o persuadirte, reclamando la atención. Esta vinculada a la imagen


publicitaria.

Expresiva: Aquellas imágenes que manifiestan sentimientos o sensaciones. Suelen ser muy
expresivas las imágenes de las películas de amor, o las fotografías que apelan al sentimiento, como el
fotoperiodismo de guerra. Dentro de esta encontramos la variante de función Poética: Las que buscan
un juego similar al de la poesía pero en las imágenes. Es una función no habitual, que se expresa al a
perfección con la obra de Joan Brossa.

Estética: Son imágenes que buscan el componente de la belleza.


Ha estado históricamente ligado al campo de las producciones artísticas.

(VER Dos ejemplos de peliculas esteticas ambas relacionadas con la fotografia y la


naturaleza; "Tierra: la pelicula de nuestro planeta", 1998, y "Home" 2009. Esta última estuvo realizada
con motivo del Día Internacional del Medioambiente, 5 de Junio de 2009, por Luc Besson y el fotografo
francés Arthus Bertrand.)

INTERACCIÓN DE DISTINTOS LENGUAJES.

Los mensajes visuales utilizan códigos muy diversos que interactúan para crear un mensaje global.
Las diferentes formas de manifestación icónica, se relacionan para crear significados. En la pintura, la
fotografía, o en el cine intervienen constantemente los gestos que pertenecen al lenguaje corporal.

También en la pintura contemporánea están reflejados los elementos del lenguaje multimedia, o en la
arquitectura los de la pintura. En el comic, aparecen elementos del lenguaje del cine y en la animación
intervienen lenguajes de ámbitos muy diferentes desde la pintura, a la escultura. En la publicidad esta
constantemente el lenguaje escrito.

En una sociedad en que la imagen es tan importante, los lenguajes se entremezclan convirtiéndose en
híbridos y enriqueciendo sus recursos.

(VER el collage en el cine, "Fast Film" de Wildrich.)

EL LENGUAJE DEL PUNTO, EL PIXEL, LA LINEA Y EL PLANO.

Punto y Pixel

El Punto es la unidad grafica básica, y la mas sencilla de representar.sin embargo podemos usarlo
para crear formas mas complejas mediante su agrupacion: una sucesion crea una linea y una

19
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

agrupacion una masa. De hecho los puntillistas lo utilizaron como elemento para la pintura.

El elemento analogo en la era digital es el Pixel. Existen multitud de tipos de imagen digital, pero son
aquellas que responden a mapa de bits, las que possen como unidad minima el Pixel, que se puede
apreciar al ampliar muchisimo la imagen. De la misma manera existe un movimiento de arte basado en
el se llama pixel art.

La linea, el plano.

La Linea es un elemento fundamental en la plastica y la comunicacion visual, y existe aplicada de muy


diversas maneras: manual, o geometrica, recta, curva, horizontal, vertical, diagonal, a trazos, etc... De
la misma manera los nuevos lenguajes de ilustracion digital como el Ilustrator nos dan muchisimas
variantes de linea.

Es un elemento muy dinamizador por eso tendra muycha importancia en el apartado de composicion.
La horizontal, produce calma, la vertical equilibrio, la curva es dinamica Tambien sierve para crear
direccion y mediante la repeticion de trazos conseguir volumen en los abjetos.

El Plano o la Forma es el espacio delimitado por un contorno silueta y que posee una estructura.
Existen formas bidimensionales y tridimensionales, y organicas, naturales o creadas con un fin
determinado. Estan a su vez condicionadas por la naturaleza de la linea que las delimita. Posee
ademas unas caracteristicas especificas como color y textura.

EL COLOR: CLASIFICACION, GAMAS, ARMONÍAS Y CONTRASTER.

El color

Es uno de los elementos mas importantes y expresivos del lenguaje visual, y ademas esta altamente
codificado respecto de la cultura.
Pueden ser color luz o color pigmento. Los luz son los irradiados por una fuente luminosa como el
monitor del ordenador o la TV, y los pigmento son los colores materiales, como los de las temperas, y
ambos se comportan de manera diferente.

Su clasificacion esta organizada en el circulo cromatico, y se organizan respcto de los primarios, Cyan,

20
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Magenta, Amarillo, los intermedios seran los secundarios y asi sucesivamente.


Mediante la semejanza o cercania en el circulo cromatico se establecen gamas cromaticas. Y respecto
de las diferencias y semejanzas se establecen contrastes o armonias que pueden ser de distintos
tipos, produciendo apectos muy diferentes.

La ausencia de color también un recurso expresivo, ejemplo de ello es el cuadro de Picasso dedicado
a los horrores de la guerra, EL GUERNICA.

COMPOSICION Y ESQUEMAS COMPOSITIVOS

La Composicion.

La Composicion en el arte y cualquier otra forma de representacion visual, es la forma en que


ordenamos los elementos en el espacio determinado. En la fotografia o el cine se llama encuadre.
Sin embargo no es un elemento aislado sino que necesita de los anteriormente vistos para definirse.

Cada elemento ocupara un espacio en el campo de vision. Si el peso de unos se compensa con el de
los otros la composicion resultara equilibrada. Sin embargo no solo debemos tener en cuanta los
pesos sino las fuerzas de dinamismo que las formas pueden generar como vimos en las lineas.

LA LUZ DEFINE Y EXPRESA

La Luz es un elemento fuertemente expresivo. Define a los elementos en el espacio y modela sus
formas. Es un elemento que estudiaremos en temas como el cine, la fortografia o las tecnicas
picooricas por su determinante importancia. Sin embargo aqui solo lo veremos como indicador de
expresividad. Las luces suaves seran indicativos de dulzura y equilibrio y las contrastadas de
dramatismo, muy utilizadas en las pelicuras de terror, cine negro y comic en blanco y negro. Una
bellisima forma de expresarse con la luz es la del arquitecto Tadao Ando.

21
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

LA TEXTURA

La Textura ofrece informacion sobre la superficie de los objetos. Es un elemento que posee cualidades
opticas y tactiles.
Pueden ser reales, matericas, como las de los cuadros de Tapices, o simuladas mediante puntos,
lineas, etc...
Tambien pueden ser geometricas u organicas. Las geometricas como la laceria mozarebe, y las
organicas como las de una fotografia de arena.Podemos encontrar texcturas naturales y ariticiales. A
continuacion veremos algunos ejemplos.

Las nuevas tendencias de diseño grafico y multimedia se nutren mucho de la creacion de texturas y
superposicion de elementos.
Sin embargo tambien la pintura, la escultura, la ceramica o la fotografia posee este elemento dentro de
su repertorio de caracteristicas.

LA PINTURA TÉCNICAS HÚMEDAS Y SECAS. CARACTERÍSTICAS.

La pintura es el arte de representar elementos sobre un plano. Lo que la diferencia del dibujo es que
su elemento principal es además de la línea la mancha. Como hemos visto antes existen técnicas
como la aguada que comparten elementos en común con las técnicas pictóricas así que existe una
línea muy fina entre lo que es dibujo y lo que es pintura. Lo mismo pasa con el pastel.

Se llaman técnicas secas a aquellas que se aplican directamente y no necesitan ni de secado, ni de


agua, ni medios para diluir. De ahí que distingamos por ejemplo entre la acuarela y el pastel.

22
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Carboncillo

Es muy apto para bocetos y estudios previos por su rapidez de ejecución. Sin embargo es una técnica
muy sucia que requiere de un papel granulado y un fijador.
Es muy utilizado también para simular volúmenes.

Lápiz y lápiz de color

Existen gran variedad de lápices, negro de diferentes durezas y de colores, y son fáciles de manejar,
además podemos realizar detalles con mejor definición que con el carbón que es más para crear
encajes y volumen.

Pluma o rotulador. La tinta china.

La pluma emplea básicamente la línea, sin embargo los avances técnicos han dado paso a rotuladores
que simulan a la pluma creando gran variedad de anchos, para realizar planos, que son más difíciles
de crear con la pluma.
Existen muchas maneras de crear degradados a través de trazos gráficos y a menudo se combina con
la tinta. Son muy destacados los delicados y estéticos trazos de la caligrafía japonesa y árabe.

23
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Ceras

La cera es un material graso que se puede aplicar directamente o quemando la materia prima, lo que
se llama encáustica. Es de fácil uso aunque poco utilizado en el arte, y de poca definición de trazo.

Pastel

Es un material utilizado sobre todo por los impresionistas. De difícil fijación como el carboncillo y de
aplicaciones diversas. El precursor de la técnica es Degas y también Toulousse Lautrec posee
magníficos ejemplos.

Técnicas húmedas. La acuarela, el gouache o el acrílico y el óleo.

Como hemos visto las técnicas húmedas eran las que utilizaban las pinturas diluidas o disueltas en
algún medio, generalmente aceite en el caso del óleo o agua en el caso de acuarela o gouache. La
pintura ha sido eminentemente realista y usaba sobre todo el óleo inventado por un holandés en el
s.XVI, desde el Impresionismo la propia pintura ha creado multitud de expresiones y técnicas.
Enumeraremos por orden de aparición algunos de estos movimientos y formas de representación.
Impresionismo, Realismo, Cubismo, Expresionismo, Suprematismo, Neoplasticismo, Informalismo,
Pop Art, Minimalismo, Artes Procesuales como el Body Painting

La acuarela

La acuarela es una pintura que se disuelve en agua. Los colores son transparentes y es una técnica
difícil de controlar. El papel debe ser muy absorbente para poder retener el agua y se emplean tanto

24
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

pinceles de pelo fino como esponjas.


Es común también realizar un primer esbozo del dibujo a lápiz duro.

El óleo

Posee los útiles básicos como el pincel sin embargo añade otros para la aplicación de óleo en pasta
como es la espátula. Dada su naturaleza texturada se pueden conseguir relieves en el cuadro como
Vann Gogh, con sus pinceladas en forma de trazo.
Se disuelve en trementina generalmente y es de secado lento aunque se puede acelerar.

El acrílico

Es un material que nace con la tecnología y los disolventes sintéticos. Es similar en aplicación al óleo y
de naturaleza también espesa pero es de secado mucho más rápido y dependiendo de la calidad del
acrílico es de viveza de color baja. Otra técnica similar es el Gouache o tempera. Aqui teneis un
ejemplo de David Hockney.

25
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Otras técnicas pictóricas. El graffiti y el assemblaje.

El Graffiti es una técnica pictórica generalmente realizada en la calle. Sin embargo el origen de la
técnica es social más que artístico. Actualmente esta reconocido por los museos de arte mas
importantes del mundo, como la Tate Gallery. Busca a BANKSY, HARING, o BASQUIAT. Tambien
podeis ver el trailer del documantal que Banksy presentó este 2010 en el Festival de cine de Berlin, la
Berlinale.

El Assemblaje es una especie de collage tridimensional. Mientras que el collage de Picasso estaba
compuesto de objetos reales pero se quedaba dentro del plano 2D, el assemblaje recorre a objetos
mucho más volumétricos creando verdaderos cuadros escultura. Busca a Rauschemberg o
Wesselman. La imagen pertenece a Frank Stella.

TÉCNICAS DE ESTAMPACIÓN. EL GRABADO.

El Grabado constituye un conjunto de técnicas que se basan en la estampación para reproducir


imágenes. Para ello se necesita una matriz donde previamente se ha realizado el dibujo, en hueco en
relieve o en plano, y tres entintarla y preparar esta se realiza la estampa.

Existen multitud de técnicas desde el aguafuerte en calcografía o matriz metálica, que define finos y
cuidados trazos, hasta la xilografía más tosca y menos complicada. La primera ha sido utilizada por
Rembrandt, o Goya y la segunda por los expresionistas.

26
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

El monotipo: entre la pintura y la estampación.

El monotipo sin embargo se basa en pintar sobre una superficie y después estamparla, no se realizan
incisiones sobre la matriz sino que es pintada, de ahí que sea un intermedio entre la pintura y el
grabado.

27
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CIENCIAS FISICO QUIMICA

3º AÑO “U”

COLEGIO JEAN PIAGET

PROFESORA: SARA GRACIELA LUNA

OCTUBRE – NOVIEMBRE

2020

28
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Alumnos:

Estamos pasando por una forma distinta de aprender y comunicarnos, debemos


adaptarnos a los nuevos desafíos en Educación, por eso dentro de las pautas
de trabajo áulico virtual, algunas consideraciones:

 Estar presente en el horario correspondiente a cada clase


 Participar en las actividades dentro del aula
 Consultas dentro del horario de clase
 Realizar los trabajos solicitados en tiempo y forma
 Contar con una Tabla Periódica de Elementos (en la cartilla de junio hay
una)

Las actividades realizadas en este período, en esta cartilla, serán evaluadas


mediante una rúbrica en la que se tendrán en cuenta los siguientes criterios:

 Presentación del trabajo en tiempo y forma


 Manejo y articulación de conceptos, conocimientos e información en el
desarrollo de la producción final
 Enfoque y creatividad en la selección y preparación de recursos para el
desarrollo de la presentación
 Organización, análisis, comparación e interpretación de la información.
 Habilidad en la defensa de la producción utilizando coherencia y lenguaje
científico adecuado.

CLASE VIERNES 23 DE OCTUBRE – HORARIO 11.40 a 13.00

MESA DE EXAMEN

CLASE VIERNES 30 DE OCTUBRE – HORARIO 11.40 a 13.00

Tema: Energía y Calor

29
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Energía

La energía se define como la capacidad de realizar trabajo, de producir movimiento, de


generar cambio. Es inherente a todos los sistemas físicos, y la vida en todas sus formas, se
basa en la conversión, uso, almacenamiento y transferencia de energía.

Puede presentarse como energía potencial (energía almacenada) o como energía cinética
(energía en acción), siendo estas dos formas interconvertibles, es decir, la energía potencial
liberada se convierte en energía cinética, y ésta cuando se acumula se transforma en energía
potencial

La energía no puede ser creada ni destruida, sólo transformada de una forma en otra
(Primera Ley de la Termodinámica).

Según su origen puede ser:

 Energía química: es la contenida en los compuestos químicos y que, a través de


distintos procesos, susceptible de ser liberada.
 Energía nuclear: contenida en los núcleos atómicos y liberada a través de los procesos
de fisión y fusión nuclear. Es también llamada energía atómica.
 Energía eléctrica: es la que se manifiesta como resultado del flujo de electrones a lo
largo de un conductor.
 Energía mecánica: es la producida por la materia en movimiento.
 Energía radiante: está contenida en los distintos tipos de radiación electromagnética.

Estas formas son interconvertibles, y son ejemplo de ello la conversión de:

 Energía nuclear en energía eléctrica, producida en las centrales nucleares.


 Energía química en energía mecánica, producida en motores de combustión.
 Energía eléctrica en energía radiante (luz y calor), producida en las lámparas.

La vida, en todas sus formas, es completamente dependiente de la energía. En todos los


procesos vitales está involucrada la energía. Los vegetales consumen energía solar (energía
radiante) para poder, a través del proceso fotosintético, elaborar sustancias energéticas
(hidratos de carbono) que les permiten disponer de la energía química necesaria para
desarrollar sus funciones vitales. Los organismos animales se nutren energéticamente, en
forma directa (herbívoros) o indirecta (carnívoros) de los vegetales es decir de la energía
solar.

El ser humano ha desarrollado, a través de su historia, sistemas de vida en los que además
de la energía necesaria para su subsistencia biológica (alimento) consume energía para
mantener y desarrollar sus sistemas culturales y satisfacer así necesidades extra alimentarias

30
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

(vivienda, transporte, bienes y servicios, etc.). Para ello la humanidad ha recurrido al uso de
distintas fuentes energéticas; en un principio fue el fuego, la energía solar, la energía animal,
la energía eólica (viento), la hidráulica (agua)... y en el último siglo la energía de combustibles
fósiles (petróleo, gas y carbón) y la nuclear.

La Revolución Industrial (siglo XIX) fue el inicio de una serie de cambios tecnológicos,
económicos y sociales que concluyeron en la consolidación de un modelo de subsistencia,
aún vigente, sustentado energéticamente en el uso de los combustibles fósiles, cuyas fuentes
son recursos naturales no renovables (limitados en el tiempo).

Actualmente el 80% del consumo mundial de energía proviene de ellos, y el 20 % restante se


reparte en energía hidroeléctrica (~15%) y energía nuclear (~4%). El aumento de la población
mundial y su efecto sobre el comportamiento de los modelos de producción y consumo de
bienes y servicios, han provocado un marcado incremento en el consumo energético.

Uno de los rasgos principales de nuestros sistemas de producción de energía es que son a
nivel mundial técnicamente poco eficientes (grandes pérdidas en la producción y transporte) y
además su distribución es poco equitativa: 1/5 de la población mundial consume más del 70%
de la energía producida globalmente.

Si bien el consumo mundial promedio es de 2,2 kw (kilovatios) por persona, en términos


reales, se observa una fuerte asimetría en su distribución: en América del Norte 10
kw/persona, en otros países industrializados entre 5 y 7 kw, y el resto del mundo, es decir, las
mayores partes de la humanidad consume menos de 2 kw, concretamente un promedio de
450 vatios/persona.

Este consumo está indisolublemente vinculado al nivel de vida en términos materiales (acceso
a alimentación, vivienda, salud, educación, servicios); existe una fuerte conexión entre
energía y bienestar material humano.

Nuestras fuentes energéticas principales (combustibles fósiles) y sus tecnologías representan


por sus características técnicas y la magnitud del consumo una gran amenaza para la salud,
el bienestar económico y la estabilidad ambiental. Sus efectos colaterales, tanto en la
producción como en el uso, producen la liberación de gases de efecto invernadero y tóxicos
involucrados en múltiples procesos contaminantes. Estas emisiones gaseosas provenientes
de la combustión de combustibles fósiles representan ~ 27% de los gases de efecto
invernadero.

Las otras dos fuentes, que en importancia le siguen, también poseen impactos ambientales, al
menos, controvertidos: la energía hidroeléctrica en cuanto a la problemática de los grandes
embalses y la energía nuclear en lo que respecta a la peligrosidad de accidentes
(ej.:accidente de Chernobyl, Ucrania), y al problema que representa el destino final de los
residuos nucleares, que son altamente radiactivos y tóxicos y que aún no está resuelto.

31
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Dadas estas características, la primera actitud individual y colectiva a adoptar, debería ser el
consumo racional, tanto de la energía (luz, combustibles) como de productos ya que su
fabricación implica, también consumo energético.

Estos viejos modelos energéticos (combustibles fósiles) eran medianamente aptos cuando el
“mundo era más chico” (menor población mundial, menor consumo); el mundo de hoy
necesita nuevas estrategias energéticas, energías más “limpias”, más eficientes y más
diversas. Estas nuevas formas están incluidas en las llamadas energías alternativas:

 Energía Solar: aprovechable en su forma térmica (calor) y fotovoltáica (electricidad).


 Energía Eólica: aprovechable transformándola en energía eléctrica y /o mecánica.
 Energía Geotérmica: aprovechable en forma térmica, eléctrica y mecánica.
 Energía de Biomasa: generando adecuadamente “biogás”.
 Energía de Mareas: aplicada a generadores eléctricos
 Energía Hidráulica a partir de sistemas hidroeléctricos en pequeña y mediana escala
excluyendo las grandes represas

Alternativas:

• Uso racional de la energía.


• Adoptar pautas de consumo biorracionales.
• Aprovechamiento de energías alternativas.

Calor

El calor se define como la transferencia de energía térmica desde un cuerpo caliente a


uno más frío.

Según la teoría cinética molecular de la materia, todas las sustancias están formadas por
partículas en constante movimiento, que chocan entre sí. El movimiento de estas partículas

32
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

determina la energía cinética o energía de movimiento de un cuerpo. El valor promedio de la


rapidez del movimiento de las partículas que conforman a un cuerpo se
denomina temperatura. Por lo tanto, esta propiedad constituye un parámetro que entrega
información acerca de la energía interna del cuerpo. La temperatura está muy relacionada con
el calor, sin embargo, ambos conceptos no son sinónimos, ya que el calor corresponde a la
transferencia de energía que ocurre entre dos cuerpos que se encuentran a diferente
temperatura, específicamente desde el que está a mayor temperatura hacia el que presenta
una menor.

Equilibrio térmico
Ya mencionamos que el calor sigue un sentido determinado: desde el cuerpo de mayor
temperatura a otro de menor. La transferencia de energía entre dos cuerpos se produce hasta
que se alcance el equilibrio térmico, es decir, hasta que ambos tengan la misma temperatura.

Actividad
1. Averigua valores de consumo energético mundial en 2019
2. ¿Qué sucedió con las energías limpias en 2020?

CLASE VIERNES 6 DE NOVIEMBRE – HORARIO 11.40 a 13.00

Propagación del calor


El calor puede ser transmitido mediante tres mecanismos: conducción, convección y
radiación.
 Conducción: es la propagación de calor al interior de un material que es sometido a una
diferencia de temperatura. Por ejemplo, si el extremo de una varilla metálica se acerca a una
llama, la temperatura de este objeto irá aumentando hacia el otro extremo. En este caso, las
partículas del metal que están en contacto con la fuente de calor, vibrarán con mayor rapidez
y amplitud, transmitiendo este movimiento a las partículas próximas. De esta forma, el calor
se transmite hacia el extremo del cuerpo que no está en contacto directo con la llama. Existen
objetos que transfieren de mejor manera el calor que otros, por lo que se les clasifica en
conductores o aislantes. Los conductores térmicos presentan átomos cuyos electrones son
atraídos débilmente por los núcleos, por lo tanto, pueden pasar de un átomo a otro,
transfiriendo energía. Un ejemplo de conductores térmicos son los metales. Por el contrario,
los aislantes térmicos tienen átomos con un número relativamente pequeño de electrones
libres, característica que los hace malos conductores de calor, por ejemplo, la fibra de vidrio.

 Convección: corresponde a la transferencia de calor mediante el movimiento de fluidos,


como el aire o el agua. Por ejemplo, si se calienta agua en una olla, el agua que está en el

33
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

fondo y recibe el calor de manera más directa, disminuye su densidad y se eleva. Al mismo
tiempo, el agua de la superficie, más densa, desciende. El movimiento continuo del agua
forma corrientes de convección.

 Radiación: tanto en la conducción como en la convección, se requiere de un medio material


para que se produzca la propagación del calor. Pero existe un mecanismo a través del cual el
calor puede ser transmitido en ausencia de materia: la radiación. La energía del sol llega a la
Tierra mediante este proceso. Todos los cuerpos del universo emiten calor por radiación,
específicamente radiación infrarroja, que no podemos ver. Los cuerpos con mayor
temperatura emiten mayor cantidad de radiación.

Fuentes de calor
El calor tiene múltiples usos, como en la calefacción de los espacios y en procesos
industriales. Pero ¿cómo se obtiene el calor? El calor se puede conseguir como fuente
energética primaria o secundaria. El calor primario se obtiene de fuentes naturales, como la
geotermia, que corresponde al calor interno de la Tierra, y la energía solar. El calor
secundario se produce a partir de la fisión de combustibles nucleares y la quema de
combustibles como el carbón mineral, el gas natural y el petróleo; y también mediante la
electricidad en calderas eléctricas o bombas de calor.
Los dos usos más importantes del calor en el país corresponden al manejo en la industria y a
la calefacción de hogares, oficinas y centros comerciales, entre otros. El uso industrial se
encuentra estrechamente relacionado a la elaboración de diversos productos, que van desde
la producción de metales, hasta la elaboración de alimentos.
El segundo está asociado a la calidad de vida de las personas y a su nivel de confort, como
disfrutar de una temperatura agradable durante los meses de invierno, sobre todo en aquellas
zonas del país con climas extremos.

Calor y medio ambiente


En el sector Industrial, los procesos que requieren calor generan gran parte de las emisiones
contaminantes de fábricas, refinerías u otros. Por lo tanto, su uso eficiente es fundamental
para lograr mitigar los efectos que tiene la contaminación en zonas cercanas a las industrias.
Por otra parte, en el sector comercial, público y residencial, el calor es la mayor fuente de
emisiones de gases contaminantes. En este sentido, es de suma importancia hacer un uso
responsable y eficiente de la calefacción, con medidas como el mejoramiento de la aislación
de las casas, el uso de equipos de calefacción eficaces y el empleo de combustibles limpios.

El calor en los cambios de fase


Si a un cuerpo se le suministra energía térmica aumenta su temperatura. En cambio, si cede
energía calorífica al exterior, se enfría. Esto sucede así siempre y cuando, este cuerpo no

34
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

esté cambiando de fase. Es de decir, durante la transformación de sólido a líquido, de líquido


a gas y viceversa la variación de calor no implica un cambio de temperatura hasta que la
transformación esté completada.

La energía requerida para la transición de fase de una unidad de masa de una sustancia se
denomina calor específico de la transformación de fase.

Cambios de fase del agua

Un ejemplo de este fenómeno lo podemos observar con el agua.

Si al agua líquida se le suministra calor, esta aumenta la temperatura hasta llegar a los 100
grados Celsius. Entonces, en ebullición. A partir de esta temperatura la transferencia de
energía se utiliza para cambiar el estado líquido a gas (vapor de agua).

En este momento la temperatura permanecerá constante hasta que toda el agua sea vapor.
Cuando toda el agua es vapor, la temperatura puede seguir subiendo.

CLASE VIERNES 13 DE NOVIEMBRE – HORARIO 11.40 a 13.00

Tema: Trabajo Práctico Grupal – Energía

Actividad Final

Como actividad final de todos los temas desarrollados en relación a energía y calor les
propongo la realización de éste trabajo de investigación el cual será defendido, en grupo
mediante una exposición. El trabajo debe ser presentado en Word, con letra arial 12,
justificado. La defensa de la actividad será por zoom, meet o videollamada.

Energía

• Imaginen el mundo sin electricidad. ¿Qué cosas eran difíciles de hacer o prácticamente
imposibles antes de que se utilizara la energía eléctrica en forma masiva? Realicen una lista.

• Elijan un tipo de central (térmica, hidroeléctrica o nuclear). Ubiquen un ejemplo de ese tipo
de central en la Argentina. ¿Cómo se llama y dónde queda?

• Revisen distintos materiales (libros, revistas, sitios de Internet) y realicen un informe con
algunas características (positivas y negativas) de la central que eligieron que consideren
importantes.

35
"Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

• La energía eólica es la que aprovecha la fuerza del viento para generar electricidad. El
adjetivo “eólico” proviene del nombre propio Eolo. Averigüen quién era este personaje de la
mitología griega.

• Busquen información acerca de las fuentes de energía más utilizadas en la localidad en que
viven. Analicen si son renovables o no y si podrían ser reemplazadas por fuentes de energía
alternativas.

36
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CARTILLA DE
ACTIVIDADES Y
CONTENIDOS DE
EPSITEMOLOGIA DE
LAS CIENCIAS
NATURALES 3ER AÑO

COLEGIO PRIVADO JEAN


PIAGET
CICLO LECTIVO 2020

37
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CRITERIOS DE EVALUACION

Los alumnos de 3ER año deberán cumplir con los siguientes ítems durante el
desarrollo de las actividades y las mismas corresponden a un criterio de evaluación

• Estar presentes en las clases mediante la plataforma de classroom (aplicación


de google) en donde se tomara asistencia en el horario de clases o durante cualquier
momento de la misma.

• Los alumnos deberán estar presentes no solo en la plataforma classroom sino


también, que deberán consignar el presente para esta asignatura con su participación
en la aplicación de Google Meet, en donde se desarrollaran las actividades durante el
horario de clases establecidos desde el inicio del ciclo lectivo 2020.

• Presentar las actividades (fotos de las carpetas, documentos en archivo) solo en


la plataforma de classroom.

• Los alumnos pueden trabajar en sus carpetas o en las cartillas si lo desean,


pero deberán presentar el material momento de volver a las aulas.

Por cualquier inquietud o inconveniente comunicarse con la preceptora.

CONSIDERACIONES GENERALES
Las actividades propuestas para el periodo Septiembre- Octubre estarán consignadas
bajo los criterios de realización grupal, es decir que luego de la explicación de los
contenidos y actividades planificados los alumnos deberán establecer grupos de
trabajo “rotativos” donde desarrollaran las actividades, por lo tanto deberán realizar la
lectura previa, anticipada del soporte teórico para poder entregar las producciones
dentro del horario de clases en los días y horarios habituales.

Las actividades que no sean entregadas dentro del horario de clases se consignaran
como trabajo no realizado y escasa participación. Esta metodología es aplicada con la
única finalidad de que los alumnos realicen las actividades dentro de los horarios
correspondientes pudiendo evacuar dudas si llegaran a surgir y fomentar la entrega de
las mismas en tiempo y forma.

Asi mismo se informa que las producciones finales de los alumnos serán evaluados
siguiendo la siguiente rubrica procesual.

RUBRICA DE EVALUACIÓN

APELLIDO Y NOMBRE DEL ALUMNO:

MATERIA:

38
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

PUNTAJE INSUFICIENTE REGULAR BIEN MUY BIEN EXCELENTE


1-3 4-5 6-7 8-9 10
DESEMPEÑOS
ESPERADOS
Manejo y
articulación de
conceptos,
conocimientos e
información en el
desarrollo de la
producción final
Enfoque y
creatividad en la
selección y
preparación de
recursos para el
desarrollo de la
presentación
Organización
Análisis,
Comparación e
interpretación de la
información.

Habilidad en la
defensa de la
producción
utilizando
coherencia y
utilización pertinente
del lenguaje
científico adecuado

Por dudas o inquietudes mis horarios de consulta son de lunes a viernes de 8:00 a
18:00hs

GRAFION, MARCELA NOEMI

PROFESORA DE EPISTEMOLOGIA DE LAS CIENCIAS NATURALES

COLEGIO PRIVADO JEAN PIAGET

ACTIVIDADES
39
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CLASE Nº1: REVISION

TEMA: CONTEXTOS Y SU APLICACIÓN

La propuesta de Javier Echeverría y de su equipo (1995) es la de considerar cuatro contextos


para la actividad científica. En primer lugar el Contexto de enseñanza que supone la
enseñanza de conceptos lingüísticos e imágenes científicas, técnicas operatorias y de manejo
de equipos. Toda esta fase abarca desde el inicio de su estudio hasta el momento de su inicio
en la actividad profesional.
Este contexto también involucra la difusión y la divulgación (en revistas, videos, programas,
etc.) así el contexto se abre a un número mayor de destinatarios más que solo a los que están
involucrados profesionalmente con el tema. En segundo lugar, el Contexto de innovación que
lleva a veces a descubrimientos, nuevas invenciones o innovaciones. Para este segundo
ámbito, es importante el uso de laboratorios donde prima la producción del conocimiento, en el
que puede haber un importante componente de construcción de artefactos. La actividad que se
investiga está preconstruida socialmente, pues el énfasis inicial de la producción de nuevos
aparatos surge con respecto a la moda la palabra innovación abarca tanto descubrimientos
como invenciones.
El tercero es el Contexto de valoración, en el que se sostiene que tan importante es evaluar
el descubrimiento de un nuevo hecho científico, como evaluar el interés de una nueva
formalización o simbolización. En muchos casos los diseños e invenciones van a ser valorados
en función de su viabilidad, su aplicabilidad, competitividad y también en función de su utilidad.
Este tercer contexto de la actividad científica está fuertemente enlazado a la sociedad y no
solo a la comunidad científica. La viabilidad de la innovación con respecto al ámbito social
parte mucho sobre su técnica de marketing, persuasión, atracción al público y hasta relaciones
publicas que se puedan llegar a dar para ser favorecido. Siempre hay una sanción o juicio
social sobre la actividad científica. No se contrasta con la experiencia para determinar la
validez o invalidez de la actividad tecnocientífica y sus novedades, sino los agentes sociales y
sus contrastaciones cuyas tablas de valores pueden ser cambiantes. Por último está el
Contexto de aplicación, donde se da el gran salto del laboratorio a la vida cotidiana, donde
se verifica la realidad del trabajo en sí, después de la correlación de los anteriores contextos.
En este contexto también juega un papel muy importante la sociedad así como su viabilidad
económica. Se realiza un juicio global, fuera de la actividad científica.
Sin embargo, Díaz y Rivera (2010) proponen pensar incluso, más allá de estos cuatro
contextos propuestos por Echeverría porque consideran que, la ampliación de contextos
propuesta por Echeverría no describe los juegos de poder específicos de las distintas prácticas
sociales (o formas de vida) que interactúan con los diferentes juegos de lenguaje propios de la
actividad científico-tecnológica. Pero al considerar a la praxis científica como transformadora
del mundo, Echeverría amplía los límites tradicionales de la reflexión epistemológica. No
obstante, no pone el acento en la materialidad de las prácticas, pero sí en los valores éticos
que rigen los diferentes contextos en los que se desarrolla la actividad tecnocientífica. Se trata,
sostienen las autoras, de iniciar el camino hacia una epistemología ampliada a la reflexión
ética y también a la reflexión político-social, en la cual no sólo se considere el proceso racional
de invención de teorías y su posible (y discutible) justificación, sino también su carga
axiológica que se manifiesta plenamente cuando enfatizamos la dimensión institucional y
social de la ciencia considerada como actividad que se desarrolla en múltiples ámbitos o
contextos:
La ampliación de contextos propuesta por Javier Echeverría no describe los juegos de poder
específicos de las distintas prácticas sociales (o formas de vida) que interactúan con los
diferentes juegos de lenguaje propios de la actividad científico-tecnológica. Pero al considerar
a la praxis científica como transformadora del mundo, Echeverría amplía los límites
tradicionales de la reflexión epistemológica. No obstante, no pone el acento en la materialidad
de las prácticas, pero sí en los valores éticos que rigen los diferentes contextos de dicha
actividad. (Díaz y Rivera, 2000, p. 374)

40
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Aunque Echeverría consideran Díaz y Rivera (2000), presenta los cuatro contextos separados
con fines analíticos, destaca asimismo la profunda interacción que se produce entre ellos. No
hay educación para la ciencia sin innovaciones, ni innovaciones sin aplicación, ni educación,
innovación o aplicación sin valoraciones en todos y cada uno de los contextos. Pero estos
contextos, tal como los elabora Echeverría, aun cuando tienen en cuenta elementos que van
mucho más allá de la simple validación formal exigida por la epistemología tradicional, siguen
perteneciendo – en un sentido amplio – a la historia interna de la ciencia. Una historia interna
cargada de axiología, por cierto, pero vista desde una perspectiva que no duda que el
conocimiento producido por la ciencia es el modo por excelencia de conocimiento y que,
además, cuenta con elementos idóneos para confrontar su validez universal.
Finalmente, las autoras indican que el aporte axiológico-científico de Echeverría invita a seguir
pensando. Sobre todo por provenir de un pensador que toma distancia, aunque con respeto y
simpatía, de los relativismos en general. A partir de los análisis de Echeverría se develan
aspectos axiológicos de una actividad científica que, durante mucho tiempo, se consideró
neutral desde el punto de vista ético. Pero que, cada vez más, se revela preñada de deber ser.
Un deber ser cuya acción normalizadora, tradicionalmente, se ha travestido con los más
sofisticados conceptos teóricos, para lucir meramente cognitiva (Díaz y Rivera, 2000).
Pretendemos por lo tanto, señala Díaz (2007), una epistemología y una metodología no sólo
teórica e instrumental, sino también práctica (en sentido kantiano, es decir moral) y social.
Entendemos incluso que este tipo de reflexión no debería realizarse exclusivamente entre
expertos. Tal vez sea hora de instalar la discusión ética desde el origen mismo de las
investigaciones científicas. Hora de discutir entre expertos, posibles usuarios y comunidad en
general la pertinencia ética de llevar adelante proyectos que tocan (en general) puntos
inquietantes de nuestro ser, tales como el milagro de la vida, la incertidumbre de la existencia y
el misterio de la muerte, el proceso de humanización y de educación del hombre, entre otros.
Si esto es así, la reflexión ética, entonces, no debería comenzar a posteriori de la investigación
científica, sino en su a priori histórico y continuar durante el desarrollo metodológico y su
consumación técnica.
ACTIVIDAD

1) REVISAR LAS ACTIVIDADES DE LOS DIAS 30 DE JUNIO Y 02 DE JULIO

CLASE Nº 2

TEMA: CONTEXTOS Y SU APLICACIÓN

INVESTIGACIÓN, DIFUSIÓN Y APLICACIÓN EN LA CIENCIA


Fue en 1938 cuando Hans Reichenbach introduce las expresiones "contexto de
descubrimiento" y "contexto de justificación", en el marco de su discusión sobre las
relaciones entre metodologia y epistemología (Reichenbach, 1938: 410). Posteriormente,
y siguiendo la misma terminología, se habló también de un "contexto de
aplicación" (Klimovsky, 1994:29).
Una ciencia sin contexto de aplicación sería una mera especulación que satisface la curiosidad
intelectual, sin contexto de difusión un conocimiento secreto sólo compartido por una élite, y
sin contexto de investigación un conocimiento sostenido por el frágil soporte de la intuición.
Las etapas de la investigación, la difusión y la aplicación se cumplen también en el saber
cotidiano. Por algún motivo a alguien se le ocurrió que el vinagre era eficaz para limpiar vidrios,

41
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

y hace una prueba para ver si esto es cierto (contexto de investigación). Una vez confirmada
su hipótesis, la comenta con sus familiares y amigos (contexto de difusión), quienes a su vez
utilizarán ese conocimiento para limpiar vidrios (contexto de aplicación).
CONTEXTO DE INVESTIGACIÓN
El contexto de investigación es la parte de la actividad científica donde se proponen nuevas
hipótesis o teorías (descubrimiento) y se las somete a prueba (justificación).
La investigación en sentido amplio incluye tanto la investigación pura o básica como la
investigación aplicada, siendo la diferencia entre ellas su finalidad: la investigación básica se
propone ampliar y profundizar el conocimiento de la realidad (por ejemplo conocer la estructura
íntima de la materia), pensando más en satisfacer su curiosidad que en buscarle una utilidad
muchas veces lejana, mientras que la investigación aplicada se propone utilizar ese
conocimiento con una finalidad práctica (por ejemplo cómo obtener un material
superconductor).
La investigación no es una tarea fácil: investigar es como querer agarrar un trozo de hielo con
la mano enjabonada: ya de por si es difícil agarrar el hielo (la realidad es compleja), y aún más
si estamos enjabonados (cegados por nuestros prejuicios y expectativas).
a) Descubrimiento.- En el contexto de descubrimiento se descubren nuevos hechos (por
ejemplo la radiación cósmica de fondo), o nuevas correlaciones entre hechos (por
ejemplo entre el calor y la dilatación de los metales). Los descubrimientos de hechos
pueden ser fortuitos (por ejemplo los rayos X, por Roentgen), pueden ser producto de la
invención o perfeccionamiento de instrumentos de observación (los satélites de Júpiter,
por Galileo), pueden estar orientados por hipótesis previas (la hipótesis de la infinitud
del universo puede motivar a los astrónomos a buscar astros que están más allá de los
límites de la observación actual), etcétera.
El descubrimiento de hechos o de correlaciones entre ellos no es la única tarea del contexto de
descubrimiento. Los hechos suscitan problemas, y los problemas requieren respuestas
llamadas hipótesis. Por lo tanto, este contexto incluye también la creación de problemas y de
hipótesis.
Nótese entonces la diferencia entre descubrir y crear: en este contexto, descubrir
significa poner al descubierto algo que estaba oculto (estrellas, amebas, neuronas,
átomos), y crear significa producir algo nuevo (un objeto como puede serlo un
telescopio, una idea como puede serlo una hipótesis o un axioma, un procedimiento
más económico para fabricar algo, un nuevo uso para un objeto, o un nuevo elemento
químico).
El aspecto libre y creativo del contexto de descubrimiento es lo que llevó a Reichenbach a
establecer una diferencia con el contexto de justificación.

b) Justificación.- La tarea central de este contexto es poner a prueba (‘justificar’) las


hipótesis o teorías planteadas en la etapa anterior, para lo cual dispone de un conjunto
de reglas metodológicas generalmente bien definidas.
En la medida en que estos enunciados coincidan con los hechos, serán verdaderos, y por
tanto habremos corroborado la hipótesis. En la medida en que no coincidan con los hechos
serán declarados falsos, y entonces habremos refutado la hipótesis. No obstante, la historia de
la ciencia muestra que frecuentemente, cuando la hipótesis corre peligro de ser refutada, se la
intenta salvar mediante la formulación de hipótesis auxiliares e hipótesis ad hoc, con lo cual los

42
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

tres destinos posibles de una hipótesis son, en definitiva: o bien se corrobora, o bien se refuta,
o bien se la salva de la refutación.
Por último, digamos que, mientras que en la etapa de descubrimiento un estímulo para
formular una hipótesis es la detección de alguna contradicción entre hechos y teoría, lo que
obliga a formular una nueva teoría para explicarlos, en la etapa de justificación un estímulo
podría ser una contradicción entre dos teorías, lo que obligará a diseñar algún experimento
(llamado experimento crucial) que permita refutar una de ellas y seguir sosteniendo la otra.
El contexto de investigación es el principal motor del progreso científico. La ciencia evoluciona
de lo particular a lo general y de lo probable a lo seguro. De lo primero se ocupa
especialmente la etapa del descubrimiento, que parte de observaciones de hechos (lo
particular) para plantear hipótesis (lo general). De lo segundo se ocupa la etapa de la
justificación, porque la prueba de la hipótesis suele consistir en hacerla menos improbable.
CONTEXTO DE DIFUSIÓN
En el contexto de difusión de la ciencia se transmite el conocimiento científico resultante del
contexto de investigación, y como tal forma parte del proceso más general de transmisión intra
e intergeneracional de la cultura. Podemos imaginarnos este contexto con la clásica imagen de
Arquímedes saliendo apresuradamente de la bañadera al grito de ¡Eureka!, en alusión al
descubrimiento del principio de la hidrostática que hoy lleva su nombre.
Cuando el destinatario es la comunidad científica, la intercomunicación entre los
científicos permite, entre otras cosas, la continuación de promisorias investigaciones
alguna vez interrumpidas. Kuhn asignaba gran importancia a la difusión (Kuhn, 1975:270-
293), desde el momento que un paradigma se instaura como consecuencia de un consenso
dentro de la comunidad científica, consenso que sólo puede establecerse si hubo una previa
difusión de la teoría candidata a constituirse en paradigma.
Cuando el destinatario es el público en general, la información es presentada por los
periodistas científicos en un lenguaje accesible y entretenido que terminará influyendo sobre la
cosmovisión del mundo de las personas e incluso sobre sus hábitos más cotidianos.
La divulgación científica no está exenta de peligros, pudiendo convertirse en una
‘divulgarización’ del conocimiento cuando, en su afán por simplificar utilizando metáforas
supuestamente didácticas, termina desnaturalizando el saber original.
Otras veces es la imagen misma del científico lo que termina distorsionándose cuando se lo
presenta como un individuo extravagante, distraído, pobre, asexuado, solitario e insensible.
En el contexto de difusión el saber científico no sólo se transmite a otros investigadores,
realimentándose con el contexto de investigación, sino también a los profesionales, lo que da
comienzo al contexto de aplicación.
CONTEXTO DE APLICACIÓN
La difusión del conocimiento científico puede simplemente satisfacer la curiosidad de las
personas, pero también satisface la necesidad de resolver problemas y es aquí donde
adquiere relevancia en contexto de aplicación.
La ciencia provee, en efecto, herramientas para controlar la realidad como curar enfermos,
construir edificios o ganar guerras, herramientas que pueden ser en ocasiones más eficaces
que el sentido común, la intuición, la experiencia o el ingenio. Esto es así porque la ciencia

43
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

provee una teoría que orienta el control de la realidad: lo que se ‘aplica’ en el contexto de
aplicación es principalmente un marco teórico.
De la teoría a la práctica.- El salto de la teoría a la práctica comienza a ensayarse en la misma
universidad cuando los alumnos, futuros profesionales, asisten a las ‘clases teóricas’ y a los
‘trabajos prácticos’ y, en ocasiones, también a las ‘pasantías’ donde inician su entrenamiento
como profesionales, sea observando a otros más experimentados o actuando bajo la
supervisión de ellos.

ACTIVIDAD

1) REALIZAR LA LECTURA DEL TEXTO y AÑADIR ANOTACIONES


MAGINALES

CLASE Nº3

METODOLOGIA DE TRABAJO

1) Las actividades se desarrollaran con la modalidad de trabajo en grupo hasta 3


integrantes
2) Al grupo de alumnos se les propone desarrollar las siguientes actividades como
experimentos
 ALCOHOL EN GEL CASERO
 CREMA PARA MANOS CASERA
 TOALLITAS DESINFECTANTES CASERAS
 DESENGRASANTE CASERO
 LIMPIADOR DE VIDRIOS CASERO
 QUITAMANCHAS EN TELAS CASERO

a) Para trabajar en esta etapa deberán tener sus apuntes de las actividades
trabajadas desde el mes de Mayo, Junio y Julio hasta la fecha
b) El grupo de alumnos deberá seleccionar una actividad para realizar
c) Los avances diarios serán evaluados en los momentos de clases, por lo que
en cada clase los alumnos deberán evidenciar sus progresos

INSTRUCTIVO DE TRABAJO

1) Una vez conformados los grupos y habiendo seleccionado el experimento a


realizar los alumnos deberán armar una carpeta de trabajo en donde TODOS
los integrantes deberán ir elaborando en paralelo su desarrollo, la misma
incluirá actividades de fundamento teórico y sección de evidencias

CONFECCION DE LA CARPETA (Que todos deben tener)

a) Armar una carpeta


b) Caratula
c) Título del trabajo

44
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

d) Nombre de los integrantes en todas las hojas


e) En el desarrollo del trabajo deberán aplicar cada paso del método científico,
es decir que en función de la actividad seleccionada irán desarrollando y
explicando cada uno de los pasos del método científico ya analizado en
clases.
f) Al llegar a la conclusión deberán realizar la articulación con la teoría de los
contextos, es decir que luego de ejecutar todos los pasos del método al
llegar a la conclusión deberán seleccionar una de las dos teorías de los
contextos trabajadas en clases y deberán justificar su conclusión utilizando
cada uno de los contextos de la teoría que elijan.
g) Cada miembro del grupo deberá realizar el experimento y registrar el paso a
paso con fotografías y videos que registren su proceso, esto deberá estar
incluido en una sección de la carpeta de su trabajo que se denominara
ANEXO
h) La carpeta final será enviada por classroom el día Jueves 12 de Noviembre
hasta las 13:00 hs.

CLASE Nº4

INTRODUCCION

 ¿Qué experimento elegimos?


 ¿Por qué elegimos ese experimento?
 ¿de dónde sacamos la información para realizar el experimento?
 ¿Qué elementos necesitamos?
 ¿por dónde nos comunicaremos? Tendremos horarios?

OBSERVACION

 El grupo de alumnos deberá buscar en grupos de Facebook, youtube,


instagram, etc. el video del experimento que eligieron
 Deberán realizar una descripción detallada de toda experiencia que realizaran
Respetando los criterios de objetividad, unificable, etc.

45
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CLASE Nº5

INDUCCION

 De lo que describieron ¿qué es lo más importante que desean explicar?

HIPOTESIS

 ¿Cómo se formulaba una hipótesis?


 ¿Tiene un problema?
 ¿Tiene una posible solución?
 ¿Tiene una suposición?

CLASE Nº6

EXPERIMENTACION

 Aquí deberán explicar paso por paso como fueron desarrollando la


comprobación de la hipótesis
 Deberán comprobar sus fuentes
 Podrán sugerir alternativas para desarrollar el experimentos y sugerir una
posible refutación

CLASE Nº7

1) HABIENDO REALIZADO LA LECTURA DE LOS TEXTOS PROPUESTOS EN


LA CLASE 1 Y 2 COMPLETAR EL SIGUIENTE CUADRO

IDEAS PRINCIPALES JAVIER ECHEVERRIA HANS REICHENBACH

CLASE Nº8

CONCLUSION / TEORIA

46
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

 Aquí deberán realizar el análisis de todas las acciones realizadas, tanto las
implicadas con la teoría, como aquellas que ejercieron para la ejecución y
puesta en marcha del experimento
 En la elaboración de la conclusión deberán realizar la selección de una de los
teorías de los contextos (Javier Echeverria o Hans Reichenbach) y fundamentar
el cómo su experimento explicaría lo que las teorías de los contextos establecen
 Los alumnos deberán realizar el envió de la actividad a través de la plataforma
de classroom el jueves 12 de Noviembre hasta las 13:00 hs

47
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

CARTILLA DE

CONTENIDOS Y

ACTIVIDADES DE

19 de octubre al 12 de noviembre
CICLO LECTIVO 2020

48
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Abordaje de contenidos y actividades para el periodo de Suspensión áulicas establecido por el


Ministerio de educación, para evitar la propagación del Coronavirus (COVID-19).

RUBRICA DE EVALUACIÓN

APELLIDO Y NOMBRE DEL ALUMNO: MATERIA:

LUGAR Y FECHA:

PUNTAJE INSUFICIENTE REGULAR BIEN MUY BIEN EXCELENTE


1-mar 4-may 6-jul 8-sep 10
DESEMPEÑOS ESPERADOS
Manejo y articulación de conceptos,
conocimientos e información en el
desarrollo de la producción final
Enfoque y creatividad en la selección y
preparación de recursos para el
desarrollo de la presentación
Organización, análisis, Comparación e
interpretación de la información.
Habilidad en la defensa de la
producción utilizando coherencia y
utilización pertinente del lenguaje
científico adecuado

FIRMA Y ACALARACIÓN DEL DOCENTE

Clase: lunes 19 de octubre, de 11.00 a 11.40


“Desarrollo de trabajo grupal Virtual”
Clase: jueves 22 de octubre, de 11.40 a 13.00
“Presentación final de trabajos grupales y exposición”
Clase: lunes 26 de octubre, de 11.00 a 11.40
Suelo
Los suelos representan una parte muy importante de nuestro medioambiente. Su
desarrollo es un proceso complejo de interacciones entre las rocas y el ciclo
hidrológico que produce por medio de meteorización los principales componentes del
suelo.
El material originario o roca madre tiene influencia fundamental sobre las
características de los suelos, como así también el clima (sobre todo las precipitaciones

49
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

y la temperatura), el relieve o topografía, los seres vivos que lo habitan y también la


edad o tiempo que lleva desarrollándose un suelo. Para generar escasos centímetros
de suelo, pueden ser necesarios cientos o incluso miles de años, y de ahí la
importancia de su preservación.

Perfil del suelo

El espesor que puede alcanzar un suelo es variable y a ese desarrollo vertical se lo


denomina perfil. Al perfil se lo separa en varias capas u horizontes.
 Horizonte A de lixiviación o eluviación: es la capa
superior y superficial, bien aireada, con raíces y
microorganismos. En general, es de tonos oscuros cuando
hay gran contenido en humus. El agua meteórica se va
infiltrando, solubiliza y transporta sales hacia niveles
inferiores, que precipitan en el siguiente horizonte.
 Horizonte B de precipitación o iluvial: aquí se
acumulan las arcillas y oxidos de hierro que han sido
arrastradas por el agua del horizonte superior, por lo que es
menos poroso. Es de color más claro que el A, amarillo a
pardo rojizo.
 Horizonte C o zona de transición: está formado por la
roca madre en proceso de desintegración. Es el más
profundo, siendo la capa de tránsito hacia la roca Madre. Está
integrado por una combinación de los fragmentos de dicha
roca madre, arena y arcilla. Actúa de receptor de soluciones
que el agua arrastra desde las capas superiores.
 Horizonte D: es la capa más profunda del suelo, está formado por la roca
madre fragmentada, por lo que también recibe el nombre de Horizonte R.
Actividad

1. Rellenar un frasco (en lo posible de vidrio) con


diferentes materiales (roca, arena, restos vegetales, etc) para
representar cada una de las capas u horizontes, que
corresponden al perfil del suelo.
2. Rotular e identificar con nombre cada una de las capas
u horizontes.

50
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Clase: jueves 29 de octubre, de 11.40 a 13.00


Características evaluables del suelo
POROSIDAD: es la capacidad del suelo de tener poros o espacios vacíos entre
sus partículas componentes. A menor tamaño de las partículas menor será la
porosidad del suelo y viceversa.
PERMEABILIDAD: es la capacidad del suelo para permitir el paso del agua. A
mayor porosidad, mayor permeabilidad, y viceversa.
CAPILARIDAD: es la capacidad del suelo que le permite retener agua entre sus
partículas. A mayor porosidad, mayor permeabilidad y menor capilaridad.

ACTIVIDAD
1. Observar atentamente el experimento llevado a cabo por la docente, y luego
responder:
a) ¿Cuál de los materiales (frasco A o B) presenta mayor porosidad? ¿A
qué se debe?
b) ¿Cuál de los materiales (frasco A o B) presenta mayor permeabilidad?
¿A qué se debe?
c) ¿Cuál de los materiales (frasco A o B) presenta mayor capilaridad? ¿A
qué se debe?

Pautas para trabajo grupal virtual


Fecha de presentación: 05 de noviembre del 2.020
Tema: Suelos de la Argentina
Subtema:
Consignas
1. Investigar en diferentes fuentes bibliográficas información sobre el/los tipo/s de
suelo/s asignado/s.
2. Indicar:
a) Características (color, textura, etc)
b) Zonas de la Argentina en el que se lo/s encuentra.
c) Actividad económica que se puede llevar a cabo en ese tipo de suelo.
3. Preparar un recurso para el desarrollo de la presentación.

51
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

Clase: lunes 02 de noviembre, de 11.00 a 11.40


FERIADO

Clase: jueves 05 de noviembre, de 11.40 a 13.00


“Presentación final del trabajo Grupal y Exposición”

Clase: lunes 09 de noviembre, de 11.00 a 11.40


Atmosfera
Es una fina y sutil cubierta gaseosa que envuelve a la Tierra y la protege de
temperaturas extremas al filtrar, reflejar y difundir la radiación del Sol. Esta constituida
por una mezcla de gases, así como por elementos sólidos y líquidos que se mantienen
en suspensión tales como polvo atmosférico, sales marinas, humo, cristales, de hielo,
gotas de agua, microorganismos, etc.

Composición química de la atmosfera

El nitrógeno (78%), oxigeno (21%), argón (1%) y otros gases nobles constituyen el
99,95% de su volumen. El resto de sus componentes, como el dióxido de carbono
(CO2), el ozono y el vapor de agua, se representan en proporciones variables, y tienen
un papel importante en ciertos fenómenos meteorológicos.
Capas de la atmosfera
Actividad

1. Copiar y pegar el siguiente link en tu navegador:


https://www.youtube.com/watch?v=PbbSHYkAaFo.

2. A partir del análisis del video:


a. Realizar un gráfico de la atmosfera, donde identifiques cada una de las 5
capas con su extensión en km.
b. Caracterizar brevemente cada una de las capas.

Clase: jueves 12 de noviembre, de 11.40 a 13.00


Hidrosfera
Se denomina Hidrosfera a la capa de agua que se encuentra sobre la superficie de la
tierra (océanos, mares, ríos, lagos, etc) y también parte de la que se encuentra bajo la
superficie (aguas subterráneas).
Cubre aproximadamente el 70% de la superficie terrestre por lo que tiene gran
importancia en muchos de los procesos y fenómenos que se producen en el planeta.

52
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

El ciclo del agua


En la hidrosfera el agua Cambia de estado permanentemente pasa del estado líquido
al gaseoso a través de la evaporación, del gaseoso a líquido por condensación, del
líquido al sólido por congelamiento y del sólido líquido por fusión. Mientras sufre
dichos cambios, viaja a través del planeta con destinos diversos y constituye el ciclo
del agua o ciclo hidrológico.

Actividad

1. Observar y analizar la siguiente imagen, luego redactar con sus palabras un texto
sobre “el ciclo del agua”, explicando en detalle cada una de sus etapas.

53
000-114
“Año del Bicentenario del Fallecimiento del General Manuel José Joaquín del Corazón de Jesús Belgrano”

2. Pensar y responder: ¿Con cuántos de los sistemas terrestres se relacionan el ciclo


hidrológico?

3. Investigar y responder: ¿Cuál es la importancia del agua?

54

También podría gustarte