MOLECULAR

PHYLOGENETICS
AND
EVOLUTION
Molecular Phylogenetics and Evolution 34 (2005) 67–80
www.elsevier.com/locate/ympev

Molecular phylogenetics and evolutionary history of the neotropical

Satyrine Subtribe Euptychiina (Nymphalidae: Satyrinae)
Debra Murraya,*, Dorothy Pashley Prowellb
a
150S Dirac Science Library, School of Computational Science and Information Technology, Florida State University
Tallahassee, FL 32306-4120, USA
b
Department of Entomology, Louisiana State University, USA

Received 29 December 2003; revised 17 June 2004

Abstract

The Euptychiina is one of the more diverse lineages of satyrine butterflies, represented by over 300 species. The first phylogenetic
analyses of the subtribe is presented based on 2506 aligned nucleotide sequences obtained from 69 individuals spanning 28 ingroup
genera and nine outgroup genera. Two genes were used, the mitochondrial gene cytochrome oxidase 1 (1268 bp) and the nuclear
gene elongation factor-1a (1238 bp). The subtribe is never recovered as monophyletic in analyses using parsimony, maximum like-
lihood, or Bayesian inference. Several euptychiine genera are placed basal to the ingroup, but support is found only for Euptychia
and Oressinoma. Three main lineages within the ingroup were clearly defined and many taxonomic groupings within the clades
strongly supported. The majority of genera tested were paraphyletic or polyphyletic. Based on results presented here and novel host
use, a close relationship of Euptychia to the Indo-Australian tribe Ragadiini is hypothesized. Origins of the group remain unclear,
but the basal position of most of the Nearctic genera is discussed.
Ó 2004 Elsevier Inc. All rights reserved.

Keywords: COI; EF-1a; Molecular systematics; Butterflies; Euptychia; Selaginella

1. Introduction ships among European satyrines and the validity of

Satyrinae is the second largest nymphalid butterfly
subfamily with 2500–3000 species worldwide, yet has re-
ceived little attention from systematists, and many tradi-
tional taxonomic groups are untested. There has been
only one comprehensive treatment of the Satyrinae
(Miller, 1968), downranked here to reflect accepted clas-
sification of satyrines as a subfamily as opposed to a
family (Ackery, 1984; de Jong et al., 1996; Ehrlich,
1958; Harvey, 1991; Kristensen, 1976). Miller (1968)
provided few diagnostic characters for tribal and sub-
tribal groupings, and his proposed phylogeny was not
based on an explicit data matrix or cladistic analysis.
Martı́n et al. (2000) investigated phylogenetic relation-
*
Corresponding author. Fax: +850 645 1323.
E-mail address: murrayde@uky.edu (D. Murray).
MillerÕs (1968) classification as it related to those taxa,
and although regional in scope, found paraphyly at
the higher taxonomic levels. The question of monophyly
of the subfamily is equally ambiguous (Harvey, 1991).
Neither Miller (1968) nor authors following him were
able to delineate the Satyrinae with synapomorphies
(Ackery, 1984; Garcı́a-Barros and Martı́n, 1991; Har-
vey, 1991). The enlarged forewing costal vein and the
closed hindwing discal cell are often cited as the defining
characteristics, however there are numerous exceptions,
and these traits are not unique to satyrines (Ackery
et al., 1999). One genus has been moved from Satyrinae
to Morphinae, and the placement of other genera is
questioned (Ackery, 1984; DeVries et al., 1985). Re-
cently two molecular studies found a non-monophyletic
Satyrinae. Brower (2000), based on limited satyrine
exemplars within a larger Nymphalidae study and using

1055-7903/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2004.08.014
68 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80
one gene, found a polyphyletic Satyrinae, although only
his successive weighting tree produced resolution among
satyrine taxa. Wahlberg et al. (2003) reported similar
findings based on fewer satyrine taxa but more genes.
However, the authors concluded that more sampling is
needed to resolve relationships among Satyrinae and
its sister groups.
The majority of satyrine species are found in the neo-
tropics, represented by a small ancestral tribe, Haeterini,
and two diverse Satyrini subtribes, Euptychiina and
Pronophilina. Historically, the two latter subtribes were
delineated in part based on geography (Miller, 1968),
with euptychiines occurring in the lowlands and prono-
philines in the highlands. Neither subtribe has been the
subject of a published phylogenetic study. Euptychiina,
the focus of this work, currently includes over 300 species
grouped into 43 genera, 12 of which are monotypic. Spe-
cies range from central United States to Argentina, occur-
ring in all habitat types from lowlands to cloud forests.
Like most all satyrines, euptychiine host plants are exclu-
sively monocots with one exception found in Euptychia.
The subtribe was circumscribed based on a few wing,
antennal, and leg characters (Miller, 1968), but none un-
ique to Euptychiina. Most euptychiine genera were
erected by Forster (1964) in his study of the Bolivian fau-
na. However, he did not delineate the genera with diag-
nostic characters, but instead referred to line drawings
of male genitalia, leaving it up to the reader to deduce gen-
eric differences. No structural detail was shown in his fig-
ures, suggesting he examined only overall gross
morphology, ignoring potentially informative characters.
The lack of diagnostic characters for the subtribe Eupty-
chiina is compounded by the fact that Miller placed For-
sterÕs ill-defined genera within the subtribe without
examination, citing time constraints. Based on the ques-
tionable taxonomic history of the Euptychiina, some
authors instead use Euptychia sensu lato or Cissia as
catch-all genera (DeVries, 1987; Emmel and Austin,
1990). In addition to poorly delimited genera, no work
has addressed euptychiine interrelationships. The few
revisions published have focused on a single genus (Mill-
er, 1972, 1974, 1976, 1978) or species group (Singer et al.,
1983), without information on higher level classification
nor the use of rigorous phylogenetic methods. In an effort
to clarify euptychiine taxonomy, Lamas (unpublished), as
part of a larger project on neotropical butterflies, assem-
bled an annotated checklist of euptychiine species, synon-
omizing species and placing some within genera that
Forster did not. However, his work was not based on
intensive morphological study or phylogenetic analysis.
In summary, little is known of evolutionary relation-
ships within Euptychiina. The general goal of this work
is to advance our understanding of a poorly studied, di-
verse group of organisms, the satyrines, with an intense
study of one of the more speciose subtribes, the Eupty-
chiina. In doing so, this paper presents the first phyloge-
netic analysis for the subtribe. DNA sequence data were
used to infer relationships among euptychiine genera,
investigate monophyly of the delimited genera, and test
monophyly of the subtribe.
2. Materials and methods
2.1. Taxon sampling
Fifty-eight species of the butterfly subtribe Euptychi-
ina, representing 28 genera, were included in this study
(Table 1). Because the taxonomic status of many eupty-
chiine groups is questionable, more than one exemplar
was included from 14 genera to explore hypotheses of
monophyly. Samples suitable for DNA extraction were
not obtained for some euptychiine groups, including
several monotypic genera with narrowly distributed spe-
cies. Species names follow Lamas (unpublished). Speci-
mens listed as ‘‘nr’’ could not be accurately placed
within known species and likely represent new species.
Basic taxonomic work is lacking for most euptychiine
groups, and undescribed species, synonyms, and unre-
solved species groups are common.
Several satyrine outgroups were used in this study,
representing all major groups in the subfamily. Higher le-
vel relationships within the subfamily have not been
tested, and the sister group to the euptychiines is un-
known. Morphological studies (Miller, 1968; Murray,
2001a) suggested that Haeterini is an ancestral satyrine
tribe. Two exemplars from this tribe were used to root
the tree, Cithaerias pireta and Haetera piera. The remain-
ing outgroups were not designated as such in analyses.
From the diverse Satyrini tribe, representatives of the
high Andean subtribe Pronophilina and Old World sub-
tribe Ypthimina were selected. Ypthimina was hypothe-
sized to be closely related to the Euptychiina (Miller,
1968; Ackery, 1988). Two exemplars, one Asian (Ypt-
hima confusa) and one African (Y. doleta), were included.
Two representatives from the Pronophilina, Nelia
nemyroides and Neomaneus monachus, were also selected,
as both this group and the euptychiines have been sepa-
rated in part due to their geographic location (Miller,
1968). Finally, representatives from two other putative
ancestral tribes were included, Bicyclus madetes, B. fune-
bris, Enodia portlandia and Lethe mekara from Elymini-
ini and Melanitis leda from Biini. Preliminary analyses
suggested that at least two euptychiine genera, Euptychia
and Oressinoma, diverged early in satyrine evolution and
these outgroups were included to explore those results.
2.2. Molecular methods
For most samples, field collected tissues were stored
in 95% EtOH, preserving whole bodies or only abdo-
mens and legs. DNA was extracted using a QIAGEN
 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 69

Table 1
Species examined in this study, their localities, and GenBank accession numbers
Tribe (Subtribe) species Collecting locality COI EF-1a
Outgroup
Haeterini (Haeterina)
Cithaerias pireta (Cramer) Ecuador: Napo Province AY508517 AY509045
Haetera piera (Linnaeus) Peru: Madre de Dı́os Province AY508518 AY509046
Biini (Melanitina)
Melanitis leda (Linnaeus) Australia: Queensland AY508560 AY509086
Elyminiini (Lethina)
Enodia portlandia Fabricius USA: Louisiana AY508536 AY509062
Lethe mekaraa Moore Malaysia AY508550 AY509076
Elyminiini (Mycalesina)
Bicyclus funebrisa Gúeria-Méneville Ghana: Ashanti Region AY508520 AY509048
Bicyclus madetes Hewitson Ghana: Ashanti Region TreeBaseb Treebaseb
Satyrini (Ypthimina)
Ypthima confusaaShirozu and Shima Thailand: Chiang Mai Province AY508584 AY509109
Ypthima doletaa Kirby Ghana: Ashanti Region AY508585 AY509110
Satyrini (Pronophilina)
Nelia nemyroidesa (Blanchard) Chile: Los Lagos Region AY508562 AY509088
Neomaenas monachusa (Blanchard) Chile: Los Lagos Region AY508563 AY509089
Ingroup
Satyrini (Euptychiina)
Caeruleuptychia nr. caerulea Peru: Madre de Dı́os Province AY508522 AY509050
Caeruleuptychia coelicaa (Hewitson) Ecuador: Napo Province AY508524 AY509051
Caeruleuptychia umbrosa (Butler) Ecuador: Napo Province AY508523
Caeruleuptychia sp. Peru: Madre de Dı́os Province AY508521 AY509049
Cepheuptychia cephus (Fabricius) Ecuador: Napo Province AY508525 AY509052
Chloreuptychia agathaa (Butler) Ecuador: Napo Province AY508526 AY509053
Chloreuptychia arnaca (Fabricius) Ecuador: Napo Province AY508527 AY509054
Chloreuptychia heresis (Godart) Ecuador: Napo Province AY508528 AY509055
Cissia confusa (Staudinger) Costa Rica: Heredia Province AY508532 AY509059
Cissia myncea (Cramer) Peru: Madre de Dı́os Province AY508556 AY509082
Cissia penelope (Fabricius) Ecuador: Napo Province AY508530 AY509057
Cissia similis (Butler) Belize: Orange Walk District AY508529 AY509056
Cissia terrestris (Butler) Peru: Madre de Dı́os Province AY508531 AY509058
Cissia sp. Ecuador: Pichincha Province AY508533
Cyllopsis gemma (Hübner) USA: North Carolina AY508534 AY509060
Cyllopsis rogersi (Godman and Salvin) Costa Rica: Heredia Province AY508535 AY509061
Erichthodes erichtho (Butler) Peru: Madre de Dı́os Province AY508537 AY509063
Euptychia picea Butler Ecuador: Napo Province AY508542 AY509068
Euptychia westwoodi Butler Costa Rica: Heredia Province AY508543 AY509069
Euptychia sp. Ecuador: Pichincha Province AY508541 AY509067
Euptychoides albofasciataa (Hewitson) Ecuador: Sucumbios Province AY508540 AY509066
Euptychoides nossis (Hewitson) Ecuador: Pichincha Province AY508539 AY509065
Euptychoides eugenia (C Felder and R Felder) Ecuador: Pichincha Province AY508538 AY509064
Forsterinaria boliviana (Godman) Ecuador: Pichincha Province AY508545 AY509071
Forsterinaria inornata (C Felder and R Felder) Ecuador: Pichincha Province AY508544 AY509070
Harjesia sp. Ecuador: Napo Province AY508546 AY509072
Hermeuptychia harmonia (Butler) Ecuador: Pichincha Province AY508549 AY509075
Hermeuptychia hermes (Fabricius) Costa Rica: Puntarenas Province AY508548 AY509074
Hermeuptychia sosybius (Fabricius) USA: Louisiana AY508547 AY509073
Magneuptychia alcinoe (C Felder and R Felder) Ecuador: Pichincha Province AY508551 AY509077
Magneuptychia fugitiva Lamas 1997 Peru: Madre de Dı́os Province AY508552 AY509078
Magneuptychia nr lea Peru: Madre de Dı́os Province AY508554 AY509080
Magneuptychia moderata (Weymer) Ecuador: Napo Province AY508553 AY509079
Magneuptychia tiessa (Hewitson) Ecuador: Pichincha Province AY508557 AY509083
Magneuptychia sp. Ecuador: Napo Province AY508555 AY509081
Megeuptychia antonoe (Cramer) Ecuador: Napo Province AY508559 AY509085
Megisto cymela (Cramer) USA: Louisiana AY508558 AY509084
Neonympha areolata (J.E. Smith) USA: Louisiana AY508564 AY509090
Oressinoma sorata Salvin and Godman Ecuador: Pichincha Province AY508561 AY509087
Paramacera allyni L.D. Miller USA: Arizona AY508565 AY509091
Parataygetis lineata (Godman and Salvini) Ecuador: Pichincha Province AY508569 AY509095
Pareuptychia hesionides Forster Ecuador: Napo Province AY508567 AY509093
(continued on next page)
70 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Table 1 (continued)
Tribe (Subtribe) species Collecting locality COI EF-1a
Pareuptychia metaleuca (Boisduval) Ecuador: Pichincha Province AY508566 AY509092
Pareuptychia ocirrhoe (Fabricius) Ecuador: Napo Province AY508568 AY509094
Pindis squamistrigaa R Felder Mexico: Guanajuato AY508570 AY509096
Posttaygetis penelea (Cramer) Ecuador: Napo Province AY508571 AY509097
Pseudodebis marpessa (Hewitson) Peru: Madre de Dı́os Province AY508573 AY509099
Pseudodebis valentina (Cramer) Ecuador: Napo Province AY508574 AY509100
Satyrotaygetis satyrina (H.W. Bates) Costa Rica: Puntarenas Province AY508575 AY509101
Splendeuptychia ashna (Hewitson) Peru: Madre de Dı́os Province AY508576 AY509102
Splendeuptychia itonis (Hewitson) Ecuador: Napo Province AY508577
Taygetis celia (Cramer) Ecuador: Pichincha Province AY508572 AY509098
Taygetis laches (Fabricius) Ecuador: Napo Province AY508581 AY509106
Taygetis puritana (A.G. Weeks) Ecuador: Pichincha Province AY508578 AY509103
Taygetis sosis Hopffer Ecuador: Napo Province AY508580 AY509105
Taygetis virgilia (Cramer) Belize: Orange Walk District AY508579 AY509104
Yphthimoides erigone (Butler) Ecuador: Napo Province AY508583 AY509108
Yphthimoides renata (Stoll) Belize: Orange Walk District AY508582 AY509107
Vouchers held by primary author except where noted.
a
Vouchers at Oregon State Arthropod Collection.
b
From Monteiro and Pierce (2001) data matrix submitted to TreeBase.

DNeasy Tissue Kit (QIAGEN, Valencia, CA) from
either the thorax or the anterior abdomen. The remain-
ing body and wings were kept as voucher material. For a
few butterflies where no fresh material was available,
DNA was extracted from dried specimens.
Two genes were selected, a mitochondrial gene, cyto-
chrome oxidase I (COI) and a nuclear gene, elongation
factor-1a (EF-1a). Both have been used extensively in
insect molecular systematics (Caterino et al., 2000; Si-
mon et al., 1994). COI was amplified using olgionucleo-
tide primers as published in Simon et al. (1994) (forward
Ron = CI-J-1751, reverse Nancy = CI-N-2191; forward
Jerry = CI-J-2183) with the exception of Pat2 (reverse
50 TCCATTACATATAATCTGCCATATTAG). EF-
1a primers were taken from Cho et al. (1995) (M3,
rcM51-1, M46-1, rcM4). Reactions contained 2.5 U
Taq DNA polymerase, 1.5 mM MgCl2, 200 lM dNTP,
0.5 lM of each primer, and 1–5 ll of template DNA.
Thermal conditions were 1 min denaturing at 95 °C,
1 min annealing at 45 °C, and 1.5 min extension at
72 °C for 26 cycles, with a 5 min final extension at
72 °C. Samples were purified using QIAGEN PCR Puri-
fication kit (QIAGEN, Valencia, CA).
Cleaned products were cycle-sequenced using floures-
cent dye-labeled terminators (ABI Big Dye Terminator
Cycle Sequencing Kit, Applied Biosystems, Perkin–El-
mer) and then run on an ABI 377 sequencer. Amplifica-
tion profile was 96 °C for 15 s, 50 °C for 20 s, and 60 °C
for 4 min, cycled 25 times. The resulting samples were
cleaned using recommended manufacturing protocol
for ethanol precipitation. Samples were sequenced in
both directions to minimize base calling errors and
ambiguities. Aligning and editing of sequences were per-
formed in SeqEd 1.0.3 (Applied Biosystems 1992).
BLAST searches were conducted on all sequences to
check for possible contamination.
For three samples extracted from dried specimens,
recovered DNA material was low and sequences could
not be obtained from the nuclear gene EF-1a. Samples
were retained in the partitioned COI analyses and coded
as missing data for combined analyses.
2.3. Phylogenetic analyses
Data were analyzed using three approaches, maxi-
mum parsimony (MP), maximum likelihood (ML),
and Bayesian inference. Parsimony analyses were per-
formed in PAUP* 4.0b10 (Swofford, 2002) using heuris-
tic searches with tree-bisection-reconnection (TBR)
branch swapping and 1000 random-addition sequence
replicates with 10 trees held at each step. Initially data
sets were not weighted, but preliminary results and pre-
vious studies have shown potential problems with COI,
including saturation and rate heterogeneity. Potential
saturation in the data set was assessed visually, plotting
transitions and transversions for each codon position
against genetic distance. When rates curves suggested
saturation at the third codon position for COI, MP
searches were conducted with these sites removed and,
as suggested by previous authors (Barker and Lanyon,
2000; Griffiths, 1997; Reeder, 1995), with differentially
weighted transitions with respect to transversions (ti:tv),
here weighted as 1:2 and 1:3. Differing rates of nucleo-
tide substitution among the two genes and codon posi-
tion were also explored using ML.
Prior to maximum likelihood analyses, best-fit mod-
els of nucleotide substitution were selected with likeli-
hood ratio tests as implemented by Modeltest (version
3.06) (Posada and Crandall, 1998). Models of evolution
and parameters were estimated for data partitioned by
gene and also combined. For each likelihood ratio test,
Modeltest selected the general time reversible model
 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 71

with variable sites assumed to follow a discrete gamma
distribution and some sites assumed to be invariable
(GTR + I + C) (Yang, 1994). ML searches were imple-
mented in PAUP* using model parameters and the
TBR branch swapping.
Bayesian analyses were conducted in MrBayes (Huel-
senbeck and Ronquist, 2001) under the GTR + I + C
model, using four Markov Chain Monte Carlo
(MCMC) chains, three heated and one cold, and a ran-
dom starting tree. Parameter values were not specified
but estimated as part of the analyses. To assess coverage
of tree space, duplicate analyses continued for either
100,000 or 1 million generations, with trees sampled
every 10 generations. Log likelihoods were viewed
graphically, and all trees before stationary were dis-
carded as burn-in. If the resulting consensus trees from
duplicate analyses were in agreement, no more runs were
initiated.
Bootstrap support values and posterior probabilities
were used to assess the robustness of the findings. Boot-
strap values were computed from 1000 pseudoreplicates
randomized 10 times with TBR addition sequence. Due
to computational time, calculations of bootstrap values
under the maximum likelihood criterion were conducted
with ‘‘fast’’ heuristic searches replicated 100 times. With
large replicates, fast bootstrapping produces similar re-
sults as full bootstrapping methods (DeBry and Olm-
stead, 2000; Mort et al., 2000).
Dataset congruence between gene partitions was
tested using the partition homogeneity test (Swofford,
2002), also referred to as the incongruence length differ-
ence (ILD) test (Farris et al., 1994) as implemented in
PAUP*. Several recent papers have pointed out prob-
lems with this test (Cunningham, 1997; Dowton and
Austin, 2002), but it can be a useful measure of incon-
gruence for data sets of equal size, as they are in this
study.
The Shimodairan Hasegawa test statistic (Goldman
et al., 2000; Shimodaria and Hasegawa, 1999) was used
to compare alternative phylogenetic hypotheses. For
each analysis all topologies obtained were compared
simultaneously to statistically test whether or not they
were significantly worse than the optimal ML tree.
The SH tests were conducted in PAUP* using the RELL
(resampling estimated log-likelihood) method and 1000
bootstrap replicates.
3. Results
3.1. Molecular characterization
A 1291 bp fragment of COI and a 1263 bp fragment
of EF-1a were sequenced, with 25 ambiguous sites from
the fragment ends excluded from the data set. Base pair
composition of COI showed a strong AT bias (71%),
typical for insect mitochondrial DNA (Clary and Wol-
stenholme, 1985; Crozier and Crozier, 1993). Significant
base composition heterogeneity was found only at the
third codon position of COI. Relative rates of nucleotide
substitution were greater for COI than EF-1a (Table 2),
and more than two times faster at the third codon posi-
tion. Second codon position nucleotides of EF-1a
showed the slowest rate of substitution and had fewer
informative sites than any other position for either gene.
Overall average mean sequence divergence among in-
group taxa for COI was 8.9% (excluding paraphyletic
taxa), with intrageneric divergences of monophyletic
genera ranging from 0.05% to 7.2%. For EF-1a, se-
quence divergences among the ingroup range from 3%
to 9% (excluding paraphyletic taxa) and 0.01–5% for
intrageneric comparisons (monophyletic genera only).
3.2. Combined analyses
An ILD test of the two genes failed to reject the null
hypothesis of homogeneity (P = 0.30). In a combined
gene data set, the subtribe Euptychiina was not found
to be monophyletic (Figs. 1 and 2). Euptychia species
and Oressinoma sorata were excluded from the ingroup,
strongly supported in Bayesian analysis (Table 3). The
unweighted MP analysis resulted in a soft polytomy at
the basal ingroup node. When weighting schemes were
implemented, this was resolved to paraphyly of Eupty-
chiina with both genera basal to the remaining ingroup
and nodal support of 99%. When euptychiine mono-
phyly was constrained, the unweighted MP tree length
increased by only eight steps (TL = 6581, CI = 0.243,

Table 2
Base composition and variable sites by codon position
Gene Position A C G T v2 P Informative sites % CI Relative rate
COI First 0.297 0.158 0.228 0.317 22.396 1.000 100 23.6 0.294 0.559
Second 0.191 0.241 0.147 0.422 5.832 1.000 27 6.38 0.463 0.092
Third 0.395 0.074 0.010 0.521 527.724 0.000 352 83.21 0.184 3.446
All 0.295 0.157 0.128 0.420 102.714 1.000 479 38.00 0.209 1.300
EF-1a First 0.247 0.305 0.175 0.273 76.351 1.000 22 5.30 0.470 0.134
Second 0.284 0.177 0.383 0.156 11.279 1.000 10 2.41 0.616 0.051
Third 0.173 0.357 0.192 0.277 147.123 0.996 317 76.39 0.293 1.698
All 0.259 0.263 0.245 0.233 56.451 1.000 349 28.01 0.314 0.700
72 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Fig. 1. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on combined
COI + EF-1a data matrix. Bayesian posterior probabilities are given above nodes. Values below nodes are posterior probabilities when taxa with
missing data are removed from analysis. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Exemplars marked with (*) are
paraphyletic taxa. Shaded boxes mark clades.

RI = 0.383). However, this topology and the MP tree
were significantly worse explanations of the data than
the others (diff
ln L = 42.48, P < 0.016; diff
ln
L = 92.42, P 6 0.000 respectively).
Although the non-monophyly of Euptychiina was a
consistent result, relationships among outgroups, the ex-
cluded euptychiine genera, and among the most basal
members of the ingroup remained poorly resolved. Be-
cause distant outgroups could be affected by long
branch attraction (Felsenstein, 1978; Smith, 1994),
resulting in erroneous groupings, C. pireta, H. piera,
M. leda, E. portlandia, and L. mekara were sequentially
removed and the data set re-analyzed. Results showed
reduced resolution among basal taxa and to a lesser ex-
tent, among the ingroup taxa, but did not change the
respective topologies and both O. sorata and Euptychia
species remained paraphyletic with respect to the in-
group. Distant outgroups, then, did not appear to influ-
ence erroneous pairings, but instead added phylogenetic
signal to the overall results, and in particular to the ba-
sal groups.
Eight of the 14 euptychiine genera represented by
more than one species were polyphyletic or paraphyletic
in all analyses of the combined data set (Table 4). Six
species were included from a particularly large genus,
Magneuptychia, and none formed a monophyletic group
with any other member. Similar evidence for artificial
groupings was found for the genera Cissia and Eupty-
choides. Five euptychiine genera were well supported
as monophyletic in all analyses (Table 4). The one area
of incongruence revolved around Caeruleuptychia,
weakly suggested as monophyletic in MP and ML anal-
 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 73

Fig. 2. Strict consensus of four most parsimonious trees (tree length = 6573, CI = 0.243, RI = 0.383) based on COI + EF-1a data matrix and
unweighted analysis. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold. Exemplars
marked with (*) are paraphyletic taxa. Shaded boxes mark clades.

Table 3
Paraphyletic taxa by partition and analysis
Taxa COI COI COI EF-1a EF-1a EF-1a Combine Combine Combine
MP ML Bayes MP ML Bayes MP ML Bayes
Oressinoma sorataa 26 19 60 71 31 91 99c 35 92
Euptychia species 31 29 100 71 31 91 99c 35 92
Paramacera allynia 26 0b 67
Cyllopsis species 26
Cissia penelopea 0b 0b 60
Bootstrap and posterior probabilities percentages given for node with highest value that supports the exclusion of the taxon from the ingroup.
a
Tested with more than one individual.
b
Not found paraphyletic in bootstrap consensus tree.
c
From weighted analysis.

yses. Because the disagreement in gene topologies could Removal of the taxa did not resolve the question of
have been affected by missing data for Caeruleuptychia Caeruleuptychia monophyly, but did affect results under
umbrosa, this taxon and the other two taxa with missing the Bayesian method. Posterior probabilities were
data for EF-1a were removed and the data re-analyzed. slightly higher for many nodes, suggesting that the miss-
74 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Table 4
Assessment of monophyly of euptychiine genera where more than one species of the genus is present in data set
Taxa COI MP COI ML COI Bayes EF-1a MP EF-1a ML EF-1a Bayes Combine MP Combine ML Combine Bayes
a
Caeruleuptychia 36 16 81 0 0 0 28 0 0
Chloreuptychia 0 0 0 0 0 0 0 0 0
Cissia 0 0 0 0 0 0 0 0 0
Cyllopsis 88 86 100 91 92 100 93 100 95
Euptychia 72 72 100 98 92 100 99 96 100
Euptychoides 0 0 0 0 0 0 0 0 0
Forsterinaria 100 100 100 100 100 100 100 100 100
Hermeuptychia 100 100 100 100 100 100 100 100 100
Magneuptychia 0 0 0 0 0 0 0 0 0
Pareuptychia 93 92 100 97 100 100 100 100 100
Pseudodebis 0 0 51 0 0 0 0 0 0
Splendeuptychia 0 0 0 ? ? ? 0 0 0
Taygetis 0 0 0 0 0 0 0 0 0
Yphthimoides 0 0 0 0 0 0 0 0 0
Bootstrap percentages or posterior probabilities presented for monophyletic genera. A ‘‘0’’ indicates no support for monophyly found (i.e., para-
phyletic or polyphyletic). Posterior probabilities given as percentages. A‘‘?’’ designates missing data.
a
Not found monophyletic in bootstrap consensus tree.

ing data contributed to some noise in the data set. Sig-
nificantly, basal nodes near where Splendeuptychia itonis
was placed increased to 1.00PP (Fig. 1) and the node
separating Caeruleuptychia sp. + Caeruleuptychia umb-
rosa from the remaining Cissia clade increased from
0.78PP to 0.97PP. Topologies remained mostly un-
changed except the Chloreuptychia + Cepheuptychia
group was found to be sister to the Pareuptychia clade,
a result that was more consistent with morphology.
Conversely, removal of the taxa had no affect on MP
topologies or bootstrap values.
Within the ingroup three large lineages were recov-
ered, referred to as the ‘‘Cissia,’’ ‘‘Pareuptychia,’’ and
‘‘Taygetis clades.’’ Clades contained identical members
in all analyses and branching patterns were largely con-
gruent within the clades. The Taygetis clade was most
congruent and the Cissia clade most divergent, due to
the variable placement of Cissia terrestris and Caer-
uleuptychia spp. Support for clades ranged from weak
(ML analyses) to strong (Bayesian, all 1.00 PP).
3.3. Phylogenetic analysis based on individual genes
Individual gene phylogenies were generally congruent
with respect to several findings. Euptychiina was recov-
ered as polyphyletic, the majority of the euptychiine gen-
era were not monophyletic, and the three named clades
were monophyletic, with one exception discussed below
(Figs. 3 and 4). Regions of notable conflict between the
gene phylogenies revolved around genera excluded from
the ingroup, the monophyly of Caeruleuptychia and
Pseudodebis, and the placement of Yphthimoides renata
and Euptychoides eugenia.
All single gene analyses, except EF-1a MP analysis,
found other genera in addition to Euptychia species
and O. sorata excluded from the ingroup (Table 3).
COI MP analysis was most incongruent (Fig. 3), and
neither weighted analyses nor removal of third codon
position sites improved results.
All analyses produced congruent well supported re-
sults for the monophyletic euptychiine genera (Table
4) except for Caeruleuptychia, monophyletic in COI
but not EF-1a analyses, and Pseudodebis, weakly sug-
gested as monophyletic only in COI Bayesian analysis.
No analyses found any of the remaining seven tested
euptychiine genera monophyletic.
All analyses found the Taygetis, Pareuptychia, and
Cissia clades monophyletic except again the COI parti-
tion under MP unweighted criteria. Differences were
confined to two exemplars, Yphthimoides renata and
Euptychoides eugenia (Fig. 3). The placement of both
taxa was unique, especially Y. renata, typically found
near the base of the ingroup clustered with Megisto cym-
ela. Weighted trees produced a topology more consistent
with ML and Bayesian analyses in this regard.
4. Discussion
This study represents the first phylogenetic analysis of
the satyrine butterfly subtribe Euptychiina. Indeed, this
is the first significant contribution to understanding neo-
tropical satyrine evolution, where two hyperdiverse sub-
tribes, Pronophilina and Euptychiina, compose the
majority of satyrine species. Both groups were hypothe-
sized to have moved into South America from Paleotrop-
ical origins as two independent radiations. Findings from
this study suggest a more complex evolutionary history
for the lowland satyrines than previously thought. Ram-
pant paraphyly and polyphyly among euptychiine genera
demonstrate the great need for a species level revision of
these butterflies. Diversification of the group is found in
three main lineages and these clades can serve as the basis
for future systematic inquiry.
 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80 75

Fig. 3. Strict consensus of 25 most parsimonious trees (tree length = 4309, CI = 0.209, RI = 0.334) based on COI data matrix. Results incongruent
with respect to all other analyses. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold.
Taxa marked with (*) paraphyletic. Shaded boxes illustrate clades.

4.1. Monophyly of Euptychiina
A monophyletic Euptychiina was not recovered un-
der any optimality criteria, data partition, or weighting
scheme. Moreover, a constrained monophyletic Eupty-
chiina was a significantly worse explanation of the
data. However, evidence for evolutionary relationships
among basal taxa was weak, and topologies were char-
acterized by short internodes with little branch sup-
port. The difficulty lies in resolving relationships of
the euptychiine genera not found as members of the in-
group, but with unknown relationships to other saty-
rines. Increased outgroup sampling was included in
an effort to break up long branches among these taxa,
but this did not greatly increase basal phylogenetic res-
olution. Nonetheless, the data suggest Oressinoma and
Euptychia do not share a common ancestor with the
remaining subtribe. Strongest support comes from the
exclusion of the nominant genus, Euptychia, with high
posterior probabilities found in all analyses. In evaluat-
ing the results, Bayesian posterior probabilities were
viewed with caution as the possibility of overinflated
values has been suggested in the literature (Alfaro
et al., 2003; Douady et al., 2003). However, combined
weighted parsimony (99%) also strongly supported
these results. The Euptychia clade was typically found
with only the distant outgroups the Haeterini and M.
leda as more basal and are as distant from the ingroup
(12%) as they are from the outgroups (12–13%), sug-
gesting that Euptychia diverged early in satyrine evolu-
tion. Oressinoma sorata was also consistently basal to
the ingroup, with more support for this result provided
by the EF-1a data. Oressinoma is a small genus com-
posed of two closely related species and is morpholog-
ically distinct from other euptychiines, and neotropical
satyrines in general, by having swollen medial and sub-
76 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80

Fig. 4. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on EF-1a data matrix.
Bayesian posterior probabilities are given above nodes. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Paraphyletic taxa marked
with a (*). Shaded boxes illustrate clades.

medial but not costal veins on the forewing (Miller,
1968; DeVries, 1987). Results from Murray (2001a)
suggested long-branch attraction between C. penelope
and O. sorata in the COI data set, and problematic
placement of C. penelope is seen here as well, where
it clusters with either pronophiline outgroups or with
other euptychiine genera, including Oressinoma, within
a clade containing outgroups. Previous work has also
suggested that Oressinoma is not closely related to
the euptychiines. Huelsenbeck et al. (2001) applied
Bayesian analysis to the data set of Brower (2000)
and found a polyphyletic Euptychiina. Although the
taxon sampling of euptychiines was low, Oressinoma
clustered with another basal satyrine Tisiphone
(0.83PP), while the remaining euptychiines were part
of a more derived clade containing other Satyrini sub-
tribes (0.99PP). Brower (2000) found similar results in
weighted parsimony analysis.
Correct resolution of the basal nodes may depend on
the addition of critical southern taxa. In a morphologi-
cal analysis containing partial characters for representa-
tives of several large Brazilian genera, Parythimoides,
Moneuptychia, and Pharneuptychia, the genera clustered
with other basal ingroup taxa (Murray, 2001a). In addi-
tion, Yphthimoides is a large genus with most species en-
demic to southern Brazil, as are most Pharneuptychia,
Parythimoides, and Moneuptychia species. Therefore,
an important biogeographical area is absent from this
study, and these taxa are linked to the basal node of
the subtribe where resolution is weakest.
 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80
4.2. Relationships within Euptychiina
With one exception, all analyses recovered three ma-
jor lineages containing identical members, labeled ‘‘Cis-
sia,’’ Pareuptychia,’’ and ‘‘Taygetis clades.’’ Certain
monophyletic groups were consistently recovered within
these clades and were well supported with high posterior
probabilities and bootstrap values. However, little can
be surmised of the relationships among the clades them-
selves. The Taygetis clade was most often basal to the
more derived Pareuptychia and Cissia clades, but inter-
nodes were extremely short and poorly supported.
Branching patterns were most congruent within the
Taygetis clade. All members of this clade were once in-
cluded within Taygetis until Forster (1964) split them
into several genera. Although many of his genera are
artificial (i.e. Magneuptychia), at least some of the Tay-
getis clade genera appear valid based on morphological
data (Murray, 2003). However, placement of Taygetis
celia and T. puritana within Pseudodebis renders the
genus paraphyletic. Both Taygetis and Pseudodebis are
morphologically similar, supported by only a few syna-
pomorphies (Murray, 2001b), but molecular results sug-
gest two distinct clades. Genetic distance between the
two clades is on average 6.3% and within the two clades
4.6 and 3.8%. Although Miller correctly surmised that
neither T. celia nor T. puritana belong within Taygetis
(Miller personal communication), his proposed new
genus for these two species would still leave Pseudodebis
paraphyletic by these results. One other genus formerly
within Taygetis, Satyrotaygetis, is clearly not related to
the remaining group, and at least the nominant species
is closely related to Magneuptychia tiessa, which appears
to be its South American replacement.
The namesake of the Pareuptychia clade, Pareupty-
chia, is consistently well supported as monophyletic.
Addition of other species within the genus also results
in a robustly supported clade (data not shown). This
genus is united morphologically by atypical black egg
coloration, not known from any other satyrine group
or perhaps any butterfly species. The eggs are actually
translucent white as most euptychiine eggs, but darken
to opaque black within 24 h and become indistinguish-
able from parasitized euptychiine eggs (Murray,
2001a). Support for other branching patterns within
the Pareuptychia clade is weaker, with the exception of
S. satyrina + M. tiessa. One surprising result was the
polyphyly of the Euptychoides, a genus composed of
10 species which are superficially similar and one of
the few groups which have invaded the Andean cloud
forests. When preliminary results suggested non-mono-
phyly of the original two species, a third member was in-
cluded, but this species failed to form a monophyletic
clade with either of the other species. E. albofasciata is
most often sister to S. satyrina + M. tiessa, also found
within cloud forests. However the remaining species
77
are sister to lowland groups, suggesting multiple inva-
sions into the more atypical higher altitude habitats.
The Cissia clade encompasses some of the more spec-
iose Euptychiina genera. The clade is characterized by
numerous short internodes and poor support for inter-
nal branching, especially basal nodes, indicative most
likely of rapid diversification within the clade and/or
the inadequate amount of sampling and genes to cor-
rectly resolve relationships. The clade does not contain
any monophyletic genera except possibly Caeruleupty-
chia, where monophyly is not resolved by the results.
All other genera have exemplars found outside the clade.
Therefore, they may be only distantly related to other
members of their respective genera, an indication of
the complex taxonomic problems within the group. Cis-
sia is perhaps not the most apt name for this clade, given
that the type species for the genus Cissia, C. penelope, is
not a member of the clade, but until the genera are taxo-
nomically revised, the name will hold as many of the
members of this clade are generally ‘‘Cissia-like.’’ Singer
et al. (1983) recognized several sub-groups within Cissia
based on larval data. Although they did not discuss
whether or not the genus was monophyletic, they sepa-
rated C. penelope from other Cissia species, results cor-
roborated here. The robustly supported C.
confusa + Cissia sp. + C. myncea + M. fugitiva clade
corresponds to one of their other sub-groups. C. pseudo-
confusa also falls within this clade (data not shown).
As mentioned, basal relationships within the ingroup
are unclear, but there are a few well supported clades.
Cyllopsis + Paramacera is consistently well supported
and placed most often as sister to the remaining in-
group. M. cymela is often sister to Y. renata + C. penel-
ope, but support for this is much weaker.
Hermeuptychia, a well supported monophyletic genus,
is also often basal within the ingroup, sister to the rest
of the ingroup or sister to the Taygetis clade. However,
support is lacking and placement is not consistent.
Placement of other non-clade members is even more var-
iable. These include species of Chloreuptychia, Ceph-
euptychia, Magneuptychia, and Splendeuptychia.
Splendeuptychia itonis is often linked with Pindis
squamistriga, a surprising result morphologically, but
this relationship is not supported. However, S. itonis is
clearly not closely related to S. ashna, a result supported
by morphological evidence (Murray, 2001a). Splen-
deuptychia is the most speciose Euptychiina genus, with
an estimated 50 species (Lamas, unpublished), and ap-
pears composed of two disparate groups, represented
here by S. itonis and S. ashna. Splendeuptychia ashna
is well supported as a member of the Cissia clade, but
the placement of S. itonis is uncertain. Although both
are specialized feeders on bamboo, S. ashna is a detriti-
vore on dead bamboo leaves on the forest floor (Mur-
ray, 2001a). A detritivorous feeding habit is not
known among other satyrine butterflies.
78 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80
4.3. Evolutionary history
Currently our knowledge of satyrine relationships is
sketchy, and hypotheses on the evolutionary origins of
neotropical satyrines remain highly speculative (Viloria,
2003). Satyrines are thought to have originated in the
Neotropics during the Cretaceous (Miller, 1968), based
largely on the endemic distribution of the purported
ancestral satyrine tribe, Haeterini, in the neotropics
and the neotropical distribution of close relatives the
Brassolinae and Morphinae. Grasses, an important host
for satyrines, are also thought to have originated during
the Cretaceous period and then diversified in the early
Tertiary, 65–25 mya (Clark et al., 1995; Judziewicz
et al., 1999). Although grasses may have played a vital
role in the subsequent diversification of satyrines, early
groups such as the Haeterini utilize other monocots
which arose earlier than grasses. Few satyrine fossils
are known, but the fossil record suggests that by the Oli-
gocene, satyrines had become well established. The ear-
liest known satyrine, an undescribed species near the
tribe Elyminiini, dates from the lower middle Eocene,
48–51 mya (Durden and Rose, 1978). Satyrines from
the subtribe Lethina are well represented in eastern Eur-
ope from the upper Oligocene (Nel et al., 1993). How-
ever, lacking a phylogenetic analysis of the subfamily
and resolution of satyrine monophyly, a neotropical ori-
gin for the group cannot be evaluated.
What are the likely origins for euptychiine butter-
flies? Miller (1968) hypothesized that the group colo-
nized the neotropics from distant relatives in the
Paleotropics, or more specifically, from the earliest
Ypthimina butterflies. Support for a sister relationship
of the euptychiines and ypthimines was not found in
this study, although sampling among satyrines other
than the focal group was sparse. Surprisingly, pronophi-
lines were suggested as sister to the remaining ingroup,
although results were complicated by inconsistent place-
ment of paraphyletic taxa, i.e., P. allyni + pronophi-
lines. A close relationship between euptychiines and
pronophilines has not been given consideration in the
literature and is not supported by morphology (Miller,
1968; Viloria, 2003). Most likely this sister relationship
is an artifact of inadequate sampling. However, both
Brower (2000) and Huelsenbeck et al. (2001) in a re-
analysis of BrowerÕs data, found a euptychiine + pron-
ophiline clade.
The data do suggest an interesting pattern among the
more ancestral members of the ingroup. Basal taxa are
overwhelmingly Nearctic in distribution. The Nearctic
euptychiine genera are represented by Neonympha, Meg-
isto, Paramacera, Pindis, Cyllopsis, and Hermeuptychia.
The latter two speciose genera have broad distributions
into Central and South America, but the majority of
Cyllopsis species are found in northern Central America.
In the combined analyses, Cyllopsis + Paramacera are
suggested to be the sister clade to the remaining ingroup.
Only Neonympha occupies a more derived placement in
the phylogeny, clustered with other members of the
Pareuptychia clade where species are neotropical in dis-
tribution. Although extensive floral and faunal exchange
from South America across the isthmus began after the
Pliocene (Marshall, 1985; Stehi and Webb, 1985), eupty-
chiines likely had already diversified by this time.
Among these genera, secondary invasion of the Nearctic
with the connection of the land bridge may have oc-
curred only within Neonympha.
The nominant genus, Euptychia, was found basal to
the ingroup. Robustly supported as monophyletic in this
study, the genus is also supported by larval synapomor-
phies and a highly unusual host (DeVries, 1987; Murray,
2001a; Singer et al., 1983). All known hosts for satyrines
are monocots, except for Euptychia species and members
of a small Indo-Australian tribe, Ragadiini. The major-
ity of hosts for these groups are members of Selaginell-
aceae, with a few Euptychia species also recorded from
Bryopsida (mosses) (DeVries, 1985, 1987; Fukuda,
1983; Murray, 2001a; Singer et al., 1971; Singer and
Mallet, 1985). Lycopsida is an archaic plant order dom-
inant from the late Devonian to late Carboniferous peri-
ods and represented today primarily by Selaginella.
Although many insect orders were present during the
Carboniferous period and some are thought to have
fed on lycopsids (Kukalová-Peck, 1991), few species
are recorded on them today (Mound et al., 1994). Saty-
rines are the only Lepidoptera recorded using Selagi-
nella as larval food plants.
Miller (1968) pointed out several distinctive features
of ragadiines that ‘‘set them apart’’ from other satyrines,
but was unsure of their systematic placement, believing
the group was intermediate between more ancestral
satyrines, the Elymniini, and the Satyrini, and felt that
Euptychiina (including Euptychia) was only distantly re-
lated to Ragadiini. Considering that the data suggest
Euptychia is only distantly related to the remaining sub-
tribe, the intriguing hypothesis can be proposed of a
close relationship between the euptychiines and the rag-
adiines based on novel host use. There is some support
for this from larval morphology. Satyrines worldwide
are conserved not only in gross morphology, but also
in mouthparts and setal arrangements (Garcı́a-Barros,
1987; Murray, 2001a,b, 2003; Sourakov, 1996), there-
fore the presence of large tubercles on the dorsum in
both Euptychia and Ragadia species is striking. Other
shared traits include the extremely large stemma 3 and
the shape of the adfrontal suture and mandibles. How-
ever, these similarities could be explained by conver-
gences associated with a unique diet and not due to
common ancestry. A close relationship of the ragadiines
and Euptychia species would involve a more complex
biogeographical scenario to the colonization of the trop-
ical Americas than is currently hypothesized, and this
 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80
pattern may represent a deep gondwanian relationship.
However, a better understanding of the biogeographical
history of Euptychia must await a comprehensive study
of higher level satyrine relationships.
Acknowledgments
We appreciate the assistance and support from
numerous colleagues. We thank Chris Carlton, Fred
Sheldon, and Andy Brower for comments on an earlier
draft of the manuscript. The Organization of Tropical
Studies, Rı́o Bravo Research Station, Yasuni Biological
Station, and Maquipucuna Research Station provided
excellent support during field collecting trips. We thank
Lee Miller and Gerardo Lamas for useful discussion on
satyrine taxonomy and evolution. This project was sup-
ported by funds from the Department of Entomology at
Louisiana State University, the Rice Endowment at
Oregon State University, the Organization for Tropical
Studies, American Women in Science, Sigma Xi, and
the US Peace Corps. Many people also provided DNA
material and we are grateful to Jim Tuttle, Dan Lang,
Andy Brower, Susan Pell, Chris Carlton and Victoria
Moseley. Murray also greatly appreciates the generosity
of André Freitas for allowing her to examine his collec-
tion of larvae.
References
Ackery, P.R., 1984. Systematic and faunistic studies on butterflies. In:
Vane-Wright, R.I., Ackery, P.R. (Eds.), The Biology of Butterflies.
Princeton University Press, Princeton, pp. 9–21.
Ackery, P.R., 1988. Hostplants and classification: a review of
nymphalid butterflies. Biological Journal of the Linnean Society
33, 95–203.
Ackery, P.R., de Jong, R., Vane-Wright, R.I., 1999. The butterflies:
Hedyloidea, Hesperioidea and Papilionoidea. Handbook of Zool-
ogy 4, 263–300.
Alfaro, M.E., Zoller, S., Lutzoni, F., 2003. Bayes or bootstrap? A
Simulation study comparing the performance of Bayesian Markov
Chain Monte Carlo sampling and bootstrapping in assessing
phylogenetic confidence. Molecular Biology and Evolution 20,
255–266.
Barker, F.K., Lanyon, S.M., 2000. The impact of parsimony weighting
schemes on inferred relationships among toucans and neotropical
barbets (Aves: Piciformes). Molecular Phylogenetics and Evolution
15, 215–234.
Brower, A.V.Z., 2000. Phylogenetic relationships among the Nymp-
halidae (Lepidoptera) inferred from partial sequences of the
wingless gene. Proceedings of the Royal Society of London, Series
B 267, 1201–1211.
Caterino, M.S., Cho, S., Sperling, F.A.H., 2000. The current state of
insect molecular systematics: A thriving tower of babel. Annual
Review of Entomology 45, 1–54.
Cho, S., Mitchell, A., Regier, J.C., Mitter, C., Poole, R.W.,
Friedlander, T.P., Zhao, S., 1995. A highly conserved nuclear gene
for low-level phylogenetics: elongation factor-1a recovers mor-
phology-based tree for Heliothine moths. Molecular Biology and
Evolution 12, 650–656.
79
Clark, L.G., Zhang, W., Wendel, J.F., 1995. A phylogeny of the grass
family (Poaceae) based on ndnF sequence data. Systematic Botany
20, 436–460.
Clary, D.O., Wolstenholme, D.R., 1985. The mitochondrial DNA
molecule of Drosophila yakuba: Nucleotide sequence, gene organi-
zation, and genetic code. Journal of Molecular Evolution 22, 252–
271.
Crozier, R.H., Crozier, Y.C., 1993. The mitochondrial genome of the
honeybee Apis mellifera: Complete sequence and genome organi-
zation. Genetics 133, 97–117.
Cunningham, C.W., 1997. Can three incongruence tests predict when
data should be combined?. Molecular Biology and Evolution 14,
733–740.
DeBry, R.W., Olmstead, R.G., 2000. A simulation study of reduced
tree-search effort in bootstrap resampling analysis. Systematic
Biology 49, 171–179.
de Jong, R., Vane-Wright, R.I., Ackery, P.R., 1996. The higher
classification of butterflies (Lepidoptera): problems and prospects.
Entomologica Scandinavica 27, 65–101.
DeVries, P.J., 1985. Hostplant records and natural history notes on
Costa Rican butterflies (Papilionidae, Pieridae & Nymphalidae).
Journal of Research on the Lepidoptera 24, 290–333.
DeVries, P.J., 1987. The butterflies of Costa Rica and their natural
history, vol. I: Papilionidae, Pieridae, and Nymphalidae. Princeton
University Press, Princeton.
DeVries, P.J., Kitching, I.J., Vane-Wright, R.I., 1985. The systematic
position of Antirrhea and Caerois, with comments on the classi-
fication of the Nymphalidae (Lepidoptera). Systematic Entomol-
ogy 10, 11–32.
Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery, E.,
2003. Comparison of Bayesian and maximum likelihood bootstrap
measures of phylogenetic reliability. Molecular Biology and Evo-
lution 20, 248–254.
Dowton, M., Austin, A.D., 2002. Increased congruence does not
necessarily indicate increased phylogenetic accuracy. The behavior
of the incongruence length difference test in mixed-model analyses.
Systematic Biology 51, 19–31.
Durden, C.J., Rose, H., 1978. Butterflies from the Middle Eocene: the
earliest occurrence of fossil Papilionoidea. Pierce-Sellards Series of
the Texas Memorial Museum 29, 1–25.
Ehrlich, P.R., 1958. The comparative morphology, phylogeny and
higher classification of the butterflies (Lepidoptera: Papilionoidea).
University of Kansas Science Bulletin 39, 307–370.
Emmel, T.C., Austin, G.T., 1990. The tropical rain forest butterfly
fauna of Rondonia, Brazil: Species diversity and conservation.
Tropical Lepidoptera 1, 1–12.
Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1994. Testing
significance of incongruence. Cladistics 10, 315–320.
Felsenstein, J., 1978. Cases in which parsimony or compatibility
methods will be positively misleading. Systematic Zoology 27, 401–
410.
Forster, V.W., 1964. Beiträge zur Kenntnis der Insektenfauna Boliv-
iens XIX. Veröffentlichungen der Zoologischen Staatssammlung,
München 8, 51–188.
Fukuda, H., 1983. Life histories of two satyrid butterflies feeding on
selaginellas. Tyô to Ga 33, 132–144.
Garcı́a-Barros, E., 1987. Morphology and chaetotaxy of the first
larvae of six species of the Satyrus series (Lepidoptera: Nymphal-
idae). Systematic Entomology 12, 332–344.
Garcı́a-Barros, E., Martı́n, J., 1991. Immature stages of Hipparchia
Fabricius and the systematics of the ÔSatyrus seriesÕ (Lepidoptera:
Nymphalidae: Satyrinae). Systematic Entomology 16, 407–426.
Goldman, N., Anderson, J., Rodrigo, A., 2000. Likelihood-based tests
of topologies in phylogenetics. Systematic Biology 49, 652–670.
Griffiths, C.S., 1997. Correlation of functional domains and rates of
nucleotide substitution in cytochrome b. Molecular Phylogenetics
and Evolution 7, 352–365.
80 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 67–80
Harvey, D.J., 1991. Higher classification of the Nymphalidae. In:
Nijhout, H.F. (Ed.), The Development and Evolution of Butterfly
Wing Patterns. Smithsonian Institution Press, Washington DC, pp.
259–274.
Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of
phylogenetic trees. Bioinformatics 17, 754–755.
Huelsenbeck, J.P., Ronquist, F., Nielsen, R., 2001. Bayesian inference
of phylogeny and its impact on evolutionary biology. Science 294,
2310–2314.
Judziewicz, E.J., Clark, L.G., Londoño, X., Stern, P., 1999. American
Bamboos. Smithsonian Institution Press, Washington D.C.
Kristensen, N.P., 1976. Remarks on the family-level phylogeny of
butterflies. Zeitschrift fuer Zoologische Systematic und Evolu-
tionsforschung 14, 25–33.
Kukalová-Peck, J., 1991. Fossil history and the evolution of hexapod
structures. In: The Insects of Australia. Melbourne University
Press, Melbourne, pp. 141–179.
Marshall, L.G., 1985. Geochronology and land-mammal biochronol-
ogy of the trans-American faunal interchange. In: Stehli, F.G.,
Webb, S.D. (Eds.), The Great American Biotic Interchange.
Plenum Press, New York, pp. 49–85.
Martı́n, J.F., Gilles, A., Descimon, H., 2000. Molecular phylogeny and
evolutionary patterns of the European satyrids (Lepidoptera:
Satyridae) as revealed by mitochondrial gene sequences. Molecular
Phylogenetics and Evolution 15, 70–82.
Miller, L.D., 1968. The higher classification, phylogeny and zoogeog-
raphy of the Satyridae (Lepidoptera). Memoirs of the American
Entomological Society 24, 1–174.
Miller, L.D., 1972. Revision of the Euptychiini (Satyridae): 1.
Introduction and Paramacera Butler. Bulletin of the Allyn
Museum 8, 1–18.
Miller, L.D., 1974. Revision of the Euptchiini (Satyridae): 2. Cyllopsis
R. Felder. Bulletin of the Allyn Museum 20, 1–98.
Miller, L.D., 1976. Revision of the Euptychiini (Satyridae): 3. Megisto
Hubner. Bulletin of the Allyn Museum 33, 1–23.
Miller, L.D., 1978. Revision of the Euptychiini (Satyridae): 4. Pindis
R. Felder. Bulletin of the Allyn Museum 50, 1–12.
Mort, M.E., Soltis, P.E., Soltis, D.E., Mabry, M.L., 2000. Comparison
of three methods for estimating internal support on phylogenetic
trees. Systematic Biology 49, 160–171.
Mound, L.A., Martin, J.H., Polaszek, A., 1994. The insect fauna of
Selaginella (Pteridophyta: Lycopsida), with description of three
new species. Journal of Natural History 28, 1403–1415.
Murray, D.L., 2001. Systematics of euptychiine butterflies (Nymphal-
idae: Satyrinae: Euptychiina) based on larval morphology and
DNA sequence data and the evolution of life history traits. Ph.D.
dissertation, Louisiana State University, Baton Rouge, LA.
Murray, D.L., 2001b. Immature stages and biology of Taygetis
Hübner (Lepidoptera: Nymphalidae). Proceedings of the Entomo-
logical Society of Washington 103, 932–945.
Murray, D.L., 2003. Immature stages and biology of Posttaygetis
penelea Cramer (Lepidoptera: Nymphalidae: Satyrinae). Proceed-
ings of the Entomological Society of Washington 105, 548–554.
Nel, A., Nel, J., Balme, C., 1993. Un nouveau Lepidoptere Satyrinae
fossile de lÕOligocene du Sud-Est de la France (Insecta, Lepidoptera,
Nymphalidae). Linneana Belgica 14, 20–36.
Posada, D., Crandall, K.A., 1998. Modeltest: Testing the model of
DNA substitution. Bioinformatics 14, 271–275.
Reeder, T.W., 1995. Phylogenetic relationships among Phrynosomatid
lizards as inferred from mitochondrial ribosomal DNA sequences:
Substitutional bias and information content of transitions relative
to transversions. Molecular Phylogenetics and Evolution 4, 203–
222.
Shimodaria, H., Hasegawa, M., 1999. Multiple comparisons of log-
likelihoods with applications to phylogenetic inference. Molecular
Biology and Evolution 13, 964–969.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P.,
1994. Evolution, weighting, and phylogenetic utility of mitochon-
drial gene sequences and a compilation of conserved polymerase
chain reaction primers. Annals of the Entomological Society of
America 87, 651–701.
Singer, M.C., Mallet, J., 1985. Moss-feeding by a Satyrinae butterfly.
Journal of Research on the Lepidoptera 24, 392.
Singer, M.C., Ehrlich, P.R., Gilbert, L.E., 1971. Butterfly feeding on
lycopsid. Science 172, 1341–1342.
Singer, M.C., DeVries, P.J., Ehrlich, P.R., 1983. The Cissia confusa
species-group in Costa Rica and Trinidad (Lepidoptera: Satyrinae).
Zoological Journal of the Linnean Society 79, 101–119.
Smith, A.B., 1994. Rooting molecular trees: Problems and strategies.
Biological Journal of the Linnean Society 51, 279–292.
Sourakov, A., 1996. Notes on the genus Calisto with descriptions of
the immature stages (Part 1) (Lepidoptera: Nymphalidae: Satyri-
nae). Tropical Lepidoptera 7, 91–112.
Stehi, F.G., Webb, S.D., 1985. A kaleidoscope of plates, faunal and
floral dispersals, and sea level changes. In: Stehi, F.G., Webb, S.D.
(Eds.), The Great American Biotic Interchange. Plenum Press, New
York, pp. 3–6.
Swofford, D.L., 2002. PAUP* Phylogenetic analysis using parsimony
and other methods. Test version 4.0b5. Sinauer, Sunderland, MA.
Viloria, A., 2003. Historical biogeography and the origins of the
satyrine butterflies of the tropical Andes (Lepidoptera: Rhopalo-
cera). In: Morrone, J.J., Bousquets, J.L. (Eds.), Una Perspectiva
Latinoamericana de la Biogeografı́a. Las Prensas de Ciencias,
Facultad de Ciencias Mexico City, pp. 247–261.
Wahlberg, N., Weingartner, E., Nylin, S., 2003. Towards a better
understanding of the higher systematics of Nymphalidae (Lepi-
doptera: Papilionoidea). Molecular Phylogenetics and Evolution
28, 473–484.
Yang, Z., 1994. Estimating the pattern of nucleotide substitution.
Journal of Molecular Evolution 39, 105–111.