Está en la página 1de 61

UNIVERSIDAD NACIONAL DE COLOMBIA

FACULTAD DE CIENCIAS -INSTITUTO DE CIENCIAS


NATURALES-

BIOLOGÍA EVOLUTIVA (2017774-1)

Módulo de especie y especiación


Semestre II de 2018

Profesor: Carlos A. Parra O.


La Especie en Biología
La especie se usa en …

• Taxonomía
• Evolución
• Genética
• Sistemática
• Ecología
• Diversidad Biológica
• Conservación
… pero …
Ha pesar de ser la unidad de la biología (de lo
que más se habla directa o indirectamente) …

•¿Sabemos qué es la especie?


•¿Estamos de acuerdo en su definición y límites?
•¿Poseemos métodos claros para su percepción?
•¿Hablamos todos el mismo lenguaje?
El intento de aplicar una definición
para el árbol de la vida:
¿Un concepto para múltiples grupos?
Especies en vertebrados
Especies en fósiles e icnofósiles
Especies en insectos
https://biomesfourth09.wikispaces.com/file/view/Ulva_lactuca.jpg/107722645/Ulva_lactuca.jpg

© C. Parra-O.
Especies en plantas
Especies en bacterias, organismos unicelulares y hongos
Conceptos de especie
“Concepto” tipológico de Especie
• Los individuos eran miembros de una
especie dada si estos se parecían lo
suficiente al “tipo” o referente de esta, y
además poseían ciertos caracteres
morfológicos que eran propiedades fijas
y “esenciales”.

Problema: Existe variación dentro de una


especie!!
LA MISMA ESPECIE…

© Futuyma 2009

Las formas “azules” y blancas del ganso de la nieve (Chen


caerulescens) se expresan por dos alelos diferentes de un solo locus
LA MISMA ESPECIE…

Dimorfismo sexual
LA MISMA ESPECIE…

© Futuyma 2009

Variación mimética en las hembras de Papilio dardanus, ocasionada


por varios genes ligados
LA MISMA ESPECIE…

© Futuyma 2009

Variación en caracteres “cuantitativos” como pigmentación de la


piel, color y textura del pelo y características faciales
Concepto taxonómico (morfológico) de
Especie
La especie taxonómica se fundamenta en
semejanzas y diferencias morfológicas, dado
que es un conjunto de individuos
morfológicamente similares que difieren de
otros conjuntos semejantes (Grant 1989).

DISCONTINUIDAD MORFOLÓGICA
PERO…

© Futuyma 2009

Variación concreta en diversos caracteres (tamaño corporal y proporciones,


diferencias en tamaño, número y disposición de cuernos y escamas,
patrones de color, y hábitat)
Concepto biológico de Especie

• Una especie es un conjunto de individuos fértiles


entre sí, en los cuales hay impedimento para
cruzarse con grupos similares debido a sus
propiedades fisiológicas (Dobzhansky 1935).

• Especies son grupos de poblaciones naturales real


o potencialmente reproduciéndose entre sí y con
aislamiento reproductivo de otros grupos (Mayr
1942).
AISLAMIENTO REPRODUCTIVO –
BARRERAS PRECRUZAMIENTO
Fenómenos que impiden la transferencia de
gametos entre miembros de diferentes especies

• Aislamiento ecológico: parejas potenciales no se


encuentran

– Aislamiento temporal (reproducción en diferentes


épocas)

– Aislamiento de hábitat (se reproducen en


diferentes hábitats)
Aislamiento reproductivo – barreras
precruzamiento (por microhábitat)

21 © Raven 1999
AISLAMIENTO REPRODUCTIVO –
BARRERAS PRECRUZAMIENTO (cont.)
• Parejas potenciales se encuentran pero no
se cruzan

- Aislamiento etológico o comportamental

– Aislamiento de polinizadores
(e.g., diferentes especies de polinizadores)

22 M. lewisii M. cardinalis
AISLAMIENTO REPRODUCTIVO –
BARRERAS POSTCRUZAMIENTO
• Barreras precigóticas: ocurre cópula o
transferencia de gametos, pero no se
forman cigotos

– Aislamiento mecánico

© Futuyma 2009
23
AISLAMIENTO REPRODUCTIVO –
BARRERAS POSTCRUZAMIENTO
• Barreras precigóticas: ocurre cópula o
transferencia de gametos, pero no se
forman cigotos (continuación)

– Aislamiento por comportamiento copulatorio


– Aislamiento gamético
X
X
24
AISLAMIENTO REPRODUCTIVO –
BARRERAS POSTCRUZAMIENTO
Barreras poscigóticas: se forman cigotos
híbridos, pero su capacidad de sobrevivir es
limitada

– EXTRÍNSECAS (problemas por el medio)

• Inviabilidad ecológica: híbridos no poseen nicho


ecológico en el cual puedan competir con las
especies parentales.
• Esterilidad por comportamiento: híbridos no
pueden conseguir pareja.
AISLAMIENTO REPRODUCTIVO –
BARRERAS POSTCRUZAMIENTO
Barreras poscigóticas: se forman cigotos
híbridos, pero su capacidad de sobrevivir es
limitada

– INTRÍNSECAS (problemas independientes


del medio)
• Inviabilidad del híbrido: problemas de desarrollo
pueden causar reducción de la supervivencia.
• Esterilidad de híbrido: habilidad reducida para
producir gametos viables.

‘Mula’ (‘yegua’ X ‘burro’)


Bdelloidea (Rotíferos bdeloides)

La reproducción sexual ha desaparecido; no existen machos. Hembras partenogenéticas.


Más de 300 especies!!
Y en plantas…

© Raven 1999

Han estado separadas en la naturaleza al menos 50 millones de años.


28 Producen híbridos fértiles!
Y en plantas… Alopoliploide

Autopoliploide

29 Poliploidía es un mecanismo de especiación conocido en plantas © Raven 1999


Concepto Evolutivo de Especie

• Una especie es un linaje único (una secuencia


ancestro – descendiente) de poblaciones u
organismos que mantienen su identidad de otros
linajes y que posee sus propias tendencias
evolutivas y destino histórico (Wiley 1978).
Concepto Filogenético de Especie
• Una especie filogenética es una agrupación
irreductible (basal) de organismos que es distinto
de otra agrupación por características
diagnósticas, y dentro de la cual hay un patrón
parental de ancestro y descendencia (Cracraft
1989).
Concepto Ecológico de Especie

• Una especies es un linaje (o un conjunto muy


cercano de linajes) que ocupa una zona
adaptativa mínimamente diferente de otro linaje
en su ámbito de distribución y el cual evoluciona
separadamente de otros linajes fuera de su
rango (Van Valen 1976).
Los sentidos de “especie”
(Reydon 2005)

• “Especie” es un término que denota múltiples


conceptos distintos con distintos roles en la
biología teórica.
• El problema de la especie debe verse como una
colección de distintos problemas conceptuales:
hay tantos problemas de especie como hay
propuestas
El concepto más popular
• Especies son grupos de poblaciones
naturales real o potencialmente
reproduciéndose entre sí y con aislamiento
reproductivo de otros grupos (Mayr 1942).

• CADA QUIEN USARÁ EL CONCEPTO


QUE MÁS LE CONVENGA
Especie y otras categorías
Especies de especies

• Especie • Cronoespecie
• Superespecie • Semiespecie
• Subespecie • Filoespecie
• Metaespecie • Teratoespecie
• Morfoespecie • Agamoespecie
• Paraespecie • Bioespecie

37
El desafío de la taxonomía por ADN
Código de barras de ADN (DNA
Barcode)

Una secuencia corta


permite la
discriminación de
especies
Código de barras de ADN (DNA Barcode)

ATGCCCTTATCCTCCAA

ATGCGCTTATCCACCAA

TTGCGCTTATGGACCAA

http://espanol.earthsky.org/la-humanidad/codigos-de-barras-de-adn-para-los-frutos-de-mar
Taxonomía molecular: ¿Una realidad?

ATGCCCTTATCCTCCAAAATTTGCGCGTAT
• Perfiles moleculares: análisis para diferenciación
entre variación intra e interespecies.
• Ventajas: Datos de ejemplares únicos (sin afectar
morfología); separación de taxones crípticos;
todos los estadios y morfos accesibles; única
técnica para todos los taxones.
COI and the Kingdom Animalia
The Mitochondrial Genome
D-Loop Small ribosomal RNA

Cytochrome b Large ribosomal RNA

ND1
ND6

ND5
ND2

H-strand
L-strand

ND4

ND4L
COI
COII
ND3
COIII ATPase subunit 8
ATPase subunit 6
45
Barcode of Life Data Systems (BOLD)

151.720 especies descritas con Códigos de barras, 1’574.635


registros de Códigos de barras
A Field Guide for the Third Millennium

Lo que se
pretende que
algún día
exista!
CODIGO DE BARRAS DE ADN EN PLANTAS

51
© Chen et al 2010
rbcL
Subunidad
http://www.educa.madrid.org/web/cc.nsdelas
abiduria.madrid/Ejercicios/2b/Biologia/organu
los/Organulos/cloroplasto.gif
grande
ribulosa-
1,5-
bifosfato
carboxilasa

Ciclo Calvin
– fijación de
matK C
maturasa

Función en
la unión de
segmentos
de ARN

© Steane 2005
No sólo para identificación de
especies…

• Descubrir nuevas especies


• Inventarios y estudios ecológicos
• Identificación de fragmentos de material
vegetal (raíces)
• Verificación de hierbas medicinales y
recursos alimenticios
• Control de tráfico ilegal de especies en
peligro
¿Preguntas eternas?

• Proponer o discutir sobre las definiciones de


especie.

• Estimar riquezas de especies.

• Comparar regiones o paisajes con unidades


llamadas “especies”.
ESPECIACIÓN ALOPÁTRICA

© Futuyma 2009
ESPECIACIÓN ALOPÁTRICA (MEDIOS)

© Raven 1999
1.5-2 ma

ADN
menos
1 ma

http://www.bonobo.org/wheredobonobolive.html 57
ESPECIACIÓN PERIPÁTRICA

© Futuyma 2009
ESPECIACIÓN PERIPÁTRICA

59 © Futuyma 2009
ESPECIACIÓN SIMPÁTRICA

60
© Futuyma 2009
ESPECIACIÓN SIMPÁTRICA

61 © Futuyma 2009