Está en la página 1de 17

BIOLOGÍA

Actividad de aprendizaje I

La clonación de la oveja Dolly


Dolly la oveja, como primer mamífero en ser clonado de una célula adulta, es de sobra el clon más famoso del mundo. No
obstante, la clonación ha existido en la naturaleza desde los albores de la vida. Desde las bacterias asexuales a las ‘aves
vírgenes’ en pulgones, los clones nos rodean y no son, en esencia, distintos de otros organismos. Un clon posee la misma
secuencia de ADN que su progenitor y, por lo tanto, son genéticamente idénticos. Antes de Dolly, ya se habían producido
varios clones en el laboratorio, incluidos sapos, ratones y vacas que se clonaron de una célula adulta. Este fue el mayor logro
científico ya que demostró que el ADN de células adultas, a pesar de haberse especializado en un solo tipo de célula, puede
usarse para crear un organismo entero.

¿Cómo se clonó Dolly?


La clonación animal a partir de una célula adulta es mucho
más difícil que de una célula embrionaria. Así pues, cuando
los investigadores del Instituto Roslin de Escocia crearon a
Dolly, único cordero nacido después de 277 intentos, fue una
noticia de gran importancia en todo el mundo.

Para fabricar a Dolly, los investigadores usaron una célula de


ubre de una oveja blanca de la raza Finn Dorset de seis años
de edad. Tuvieron que encontrar un modo de ‘reprogramar’
las células de ubre para mantenerlas vivas sin que crecieran.
Lo consiguieron alterando su medio de crecimiento (la
‘sopa’ en la que las células se mantenían vivas). Entonces
inyectaron la célula en un óvulo no fecundado al cual se
le había eliminado el núcleo, e hicieron que las células se
fusionaran mediante pulsos eléctricos. Realizaron un cultivo
de esta célula durante seis o siete días para ver si se dividía
y desarrollaba con normalidad, antes de implantarla a una
madre de alquiler, otra oveja hembra escocesa de cara
negra. Dolly salió con la cara blanca.

De 277 fusiones celulares, se desarrollaron 29 embriones


tempranos que se implantaron a 13 madres de alquiler, pero
solamente un embarazo llegó a término y el cordero de raza
Finn Dorset 6LLS de 6.6 kg (alias Dolly) nació después de 148
días.

¿Qué le pasó a Dolly?


Dolly vivió una existencia llena de mimos en el Instituto Roslin. Se apareó y produjo crías normales de forma natural. De
este modo se demostró que este tipo de animales clonados pueden reproducirse. Nació el 5 de julio de 1996 y se le practicó
la eutanasia el 14 de febrero de 2003, a la edad de seis años y medio. Las ovejas pueden vivir hasta la edad de 11 o 12 años,
pero Dolly sufría artritis en una articulación de una pata trasera y adenomatosis pulmonar ovejuna, un virus que induce la
aparición de tumor pulmonar y que es frecuente en ovejas criadas en el exterior.

El ADN del núcleo se empaqueta en forma de cromosomas, que se acortan cada vez que la célula se replica. Esto significa
que los cromosomas de Dolly eran un poco más pequeños que los de otras ovejas de su edad y su envejecimiento temprano
podría explicarse por el hecho de que se desarrolló del núcleo de una oveja de 6 años de edad.

Dolly tampoco era del todo idéntica a su madre genética porque las mitocondrias, que son las plantas de producción de
energía que se mantienen fuera del núcleo, las heredó de la madre donadora de óvulos.

¿Por qué clonar una oveja?


La oveja Dolly se creó en el Instituto Roslin como parte de una investigación para producir medicamentos en la leche de
animales de granja. Los investigadores han conseguido transferir genes humanos que producen proteínas útiles en ovejas y
vacas, de forma que puedan producir, por ejemplo, el agente anticoagulante IX para tratar la hemofilia o la alfa-1-antitripsina
para tratar la fibrosis quística y otras enfermedades pulmonares.

Insertar estos genes en el interior de animales es un proceso difícil y laborioso; la clonación permite a los investigadores
realizarlo únicamente una vez y clonar el animal transgénico resultante, para desarrollar crías de reserva. El desarrollo de la
tecnología de la clonación desencadenó nuevas formas de producir medicamentos y está mejorando nuestra comprensión
del desarrollo y la genética.

1
BIOLOGÍA

Desde Dolly
Desde 1996, cuando Dolly nació, otras ovejas han sido clonadas a partir de células adultas para producir gatos, conejos,
caballos, burros, cerdos, cabras y vacas. En el año 2004 se clonó un ratón usando el núcleo de una neurona olfativa,
lo que demostró que el núcleo del donador puede provenir de cualquier tejido del cuerpo que habitualmente no se
divida. El perfeccionamiento de esta técnica ha significado que la clonación de animales está resultando más barata
y más fiable. Esto ha creado un mercado de servicios comerciales que ofrecen animales domésticos clonados o cría
de ganado de élite, pero todavía llevan una etiqueta de precio que indica 100.000 dólares.

Los avances realizados a través de la clonación de animales han permitido el desarrollo de un posible nuevo tratamiento
para prevenir las enfermedades mitocondriales en humanos que se transmiten de la madre al bebé. Alrededor de 1
entre 6.000 personas nace con mitocondrias defectuosas, lo que puede llevar al desarrollo de enfermedades como
la distrofia muscular. Para prevenir esto, el material genético del embrión se extrae y se coloca en un óvulo donado
por otra mujer que contiene mitocondrias funcionales. Se trata del mismo proceso que se usa para la clonación de
células embrionarias en animales. Sin esta intervención, existe la seguridad de que las mitocondrias defectuosas
pasarán a la siguiente generación.

En la actualidad no está permitido el uso de este tratamiento en humanos. No obstante, el Human Fertilization &
Embriology Authority del Reino Unido ha informado que existe apoyo público generalizado para que se legalice la
terapia y hacerla así disponible para los pacientes.

Tomado de: http://www.animalresearch.info/es/avances-medicos/linea-de-tiempo/la-clonacion-de-la-oveja-dolly/

EJERCITANDO TU COMPRENSIÓN LECTORA:

1. En la lectura resalta las ideas principales.

2. De acuerdo al contexto del artículo científico escribe el significado de las siguientes palabras:
Célula embrionaria. Enfermedades mitocondriales.
Célula de ubre. Eutanasia.
Ovulo no fecundado. Cromosomas.
Madre de alquiler. Animal transgénico.
Contesta las siguientes preguntas de acuerdo a la información del texto:
3. ¿Por qué la oveja Dolly nació con la cara blanca?

A. El ovulo no fertilizado provino de una hembra escocesa de cara negra


B. La célula de ubre fue de una oveja blanca
C. La madre de alquiler era una oveja hembra de cara negra
D. Fusionaron el núcleo de la oveja negra adulta con el óvulo de la oveja de cara negra.

4. ¿Cuál fue la razón por la que Dolly padecía de vejez prematura?


A. Por una afección cardiaca
B. Había una anomalía cromosómica
C. Padecía de artritis
D. Tenía un tumor en un pulmón

PREGUNTAS TIPO I
Conteste las preguntas 1 y 2 teniendo en cuenta la siguiente información

Nombres comunes, abreviaciones y símbolos


para aminoacidos
Nombre Abreviación Símbolo
Alanina Ala A
Arginina Arg R
Asparagina Asn N
Aspartico (ácido) Asp D
Cisteina Cys C
Glutamina Gln Q
Glutámico (ácido) Glu E
Glicina Gly G
Histidina His H
Isoleucina Ile I
Leucina Leu L
Lisina Lys K
Metionina Met M
Fenilalanina Phe F
Prolina Pro P
Serina Ser S
Treonina Thr T
Triptofan Trp W
Tirosina Tyr Y
Valina Val V

https://socratic.org/questions/how-can-there-be-64-codon-combinations-but-only-20-possible-amino-acids

2
BIOLOGÍA

1. Se quiere estudiar la secuencia de nucleótidos de un segmento de ADN, por lo que se cuenta con los siguientes
aminoácidos phe-met-asp-trp; los posibles codones que codificaron a este grupo de aminoácidos son:
A. UUU-AUG-GAU-CGU C. UUC-AUG-GAU-UGG
B. UUC-AAU-GGU-UGG D. UUU-AUG-AGU-UGG

2. En cierto análisis de una proteína encontrada en un virus se logró determinar que dicho virus está constituido
por 158 aminoácidos que constituyen la subunidad básica a partir de la cual se construye la cápside del virus, la
siguiente imagen muestra la secuencia de nucleótidos más no la de los aminoácidos que la conforman.

ACCCAATTTTCACCGTAT
Teniendo en cuenta la información anterior, se puede decir que los aminoácidos que conforman la cápside son:

A. Thr-gln-phe-ser-pro-tyr C. Thr-gln-phe-ser-pro-thr
B. Tyr-gln-phe-ser-pro-thr D. Thr-gly-phe-ser-pro-tyr
3. El modelo representa una red trófica marina

La pesca indiscriminada de varias especies de atún ha llevado a las organizaciones ambientales a implementar
estrategias para impedir su extinción. Con base en la información anterior, ¿qué le sucedería al ecosistema marino, a
mediano plazo, si se extingue el atún?

A. Disminuirían las poblaciones de pez loro debido al aumento de su principal depredador.


B. Aumentarían las poblaciones de tiburones, porque podrán alimentarse de todos los otros niveles tróficos.
C. Aumentaría la cantidad de zooplancton, porque disminuirían la presión de sus depredadores.
D. Disminuiría la abundancia de productores, porque aumentarían los consumidores primarios.

4. Algunos organismos contienen millones de neuronas que reaccionan constantemente, de forma directa, a los
estímulos del medio, las cuales son conocidas como receptores sensoriales, y se clasifican en cinco categorías a
saber:

receptores de dolor, termorreceptores, mecanorreceptores, quimiorreceptores y fotorreceptores, según el tipo


de estímulo especifico al que respondan, como la luz, los sonidos, los movimientos, las sustancias químicas, las
presiones y los cambios de temperatura.

Algunos mamíferos producen unas sustancias, diferentes en cada especie denominadas feromonas, que
constituyen un elaborado lenguaje químico. El tipo de receptor que es estimulado por esta situación es:

A. Receptor del dolor


B. Fotorreceptor
C. Quimiorreceptor
D. Termorreceptor

3
BIOLOGÍA

5. La pubertad es un periodo de rápido crecimiento y maduración sexual, en el que el sistema reproductor se vuelve
funcional. Al término de la pubertad los órganos reproductores están plenamente desarrollados. Estos cambios
aparecen y se acentúan durante los primeros años de la adolescencia; en las mujeres, por lo general entre los 10
y 12 años, y en los varones, entre los 12 y 14. Esto no quiere decir, que en las edades posteriores el cuerpo no siga
viviendo modificaciones, sino que en estos periodos los cambios son más evidentes e intensos.

La pubertad empieza cuando el hipotálamo ordena


a la pituitaria que produzca mayores cantidades de
dos hormonas que afectan a las gónadas. Estas son
la hormona estimulante de folículos y la hormona
luteinizante. En los varones, la influencia de las hormonas
sexuales provoca cambios en su cuerpo y en sus genitales,
así como la producción de los espermatozoides en los
testículos. Los estrógenos y progesterona producen
en las mujeres cambios en el cuerpo, la maduración y
liberación de los óvulos, y la menstruación.

Según el texto anterior, el órgano que controla las


secreciones de la glándula pituitaria y ayuda a coordinar
las interacciones de los sistemas nervioso y endocrino es:

A. Tálamo
B. Hipotálamo
C. Hormona estimulante
D. Testículos

6. Las bacterias se reproducen de forma asexual ya que al momento de aumentar su tamaño duplican su información
genética y se dividen produciendo dos copias exactas de la bacteria original, se dice que esta forma de reproducción
es exponencial puesto que en muy poco tiempo se forman colonias enteras de estos organismos.

Teniendo en cuenta que existen otros tipos de reproducción asexual, es correcto afirmar que las bacterias se
reproducen mediante

A. Fisión binaria.
B. Gemación.
C. Esporulación.
D. Fragmentación.

6. Los espermatozoides tienen como función la fecundación de un óvulo. Su estructura es muy sencilla constan
de: un núcleo, un cuello y un flagelo, éste último es de gran utilidad para movilizarse por el aparato reproductor
femenino en busca del óvulo. Los espermatozoides cuentan con muy pocos organelos; sin embargo, uno de estos
se encuentra en gran proporción debido a su importancia.

Teniendo en cuenta la función de los espermatozoides, usted podría suponer que el organelo más abundante en
estas células es:

A. La mitocondria.
B. El lisosoma.
C. El aparato de Golgi.
D. La vacuola.

Actividad de aprendizaje II

¿Por qué es importante la Evolución?


El descubrimiento y comprensión de los procesos de la evolución es uno de los logros más importantes de la historia
de la ciencia. La evolución explica satisfactoriamente la diversidad de la vida en la Tierra, y ha sido corroborada
repetidamente por medio de la observación y la experimentación en un amplio espectro de disciplinas científicas.

La ciencia evolutiva sienta las bases de la biología contemporánea, ha abierto las puertas a formas completamente
nuevas de investigación ambiental, agrícola y médica, y ha conducido al desarrollo de técnicas que pueden ayudar
a prevenir y combatir enfermedades. Lamentablemente, los intentos de introducir conceptos no científicos sobre la
evolución en las aulas están menoscabando la eficacia de la enseñanza de la ciencia en las escuelas.

4
BIOLOGÍA

La teoría de la evolución ha sido probada y confirmada.


Todos sabemos por experiencia propia que los caracteres biológicos pasan de padres a hijos; ésta es la base de
la evolución. A veces, los caracteres cambian entre generaciones. Si un carácter nuevo tiene como resultado una
mejora para los descendientes en su ambiente natural y hace que produzcan más descendencia que hereda el
carácter, ese carácter llegará a estar ampliamente distribuido con el tiempo.

Si el nuevo carácter hace que los descendientes tengan una menor capacidad para sobrevivir y, por lo tanto, dejen
menos descendencia, el carácter tenderá a desaparecer. La selección natural es el proceso por el cual algunos
caracteres tienen éxito y otros fracasan en el ambiente donde vive el organismo. Por cada forma de vida que vemos
hoy en día hubo muchas otras que no tuvieron éxito y se extinguieron.

Los científicos ya no ponen en duda las bases del proceso evolutivo. El concepto ha resistido el análisis exhaustivo
de decenas de miles de especialistas en biología, medicina, antropología, geología, química y otros campos. Los
descubrimientos en los diferentes campos se han reafirmado unos a otros y las pruebas de la evolución se han
seguido acumulando durante 150 años.

El registro fósil
El concepto de evolución está apoyado por los hallazgos fósiles en capas de roca de diferentes edades de la historia
de la Tierra. En general, los fósiles más similares a las formas de vida actuales se encuentran en las capas de roca
más jóvenes, mientras que muchos fósiles que sólo se parecen remotamente a la vida en la actualidad se dan en las
capas más antiguas.

Basándose en estos hallazgos, los naturalistas propusieron que las especies cambian, o evolucionan, con el tiempo
y la selección natural se ha identificado como la fuerza conductora detrás de estos cambios. Desde entonces, los
científicos han encontrado una cantidad abrumadora de fósiles en capas de roca de edades diferentes que han
confirmado reiteradamente las modificaciones en las formas de vida que predice la teoría de la evolución.

La investigación del ADN


La biología molecular y la genética han revelado cómo funciona la evolución a nivel molecular. Aún desconocida
cuando la evolución y la selección natural se propusieron por primera vez en 1859, la genética ha mostrado que los
caracteres se transmiten de padres a hijos mediante el ADN, una molécula que se encuentra en todos los seres vivos
y que dirige la manera en que las células crecen y se reproducen.

Los estudios sobre el ADN apoyan las conclusiones de otras ramas de la ciencia. Por ejemplo, se ha visto que las
especies que parecen tener una relación más lejana por sus posiciones en el registro fósil tienen en proporción
mayores diferencias en su ADN que las especies que aparecen relacionadas más estrechamente en el registro fósil.

La comparación entre las secuencias de ADN del ser humano y el chimpancé en el gen que codifica la hormona
leptina (que está relacionada con el metabolismo de las grasas) revela sólo cinco diferencias en 250 nucleótidos.
Donde las secuencias del ser humano y el chimpancé difieren se puede usar el nucleótido correspondiente del gorila
(columnas sombreadas) para obtener el nucleótido que probablemente existía en el ancestro común de las personas,
los chimpancés y los gorilas. En dos casos se corresponden los nucleótidos humanos y los del gorila, mientras que, en
los otros tres, las secuencias del gorila y el chimpancé son idénticas.

Es muy probable que el ancestro común del gorila, el chimpancé y el ser humano tuviera el nucleótido que coincide
en dos de los tres organismos actuales, ya que esto habría requerido sólo un cambio en el ADN en vez de dos.

Gorila A
Humano GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG
GTGCCCATCCAAAAAGTCCAGGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG
Chimpancé
Gorila ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGAC
Humano ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAGGTCACCGGTTTGGAC
G
Chimpancé
Gorila C
Humano TTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC
TTCATTCCTGGGCTCCACCCTATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC
Chimpancé
Gorila TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTG
Humano TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACATGATCCAAATATCCAACGACCTG
A
Chimpancé
Gorila GAGAACCTCCGGGATCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG
Humano GAGAACCTCCGGGACCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG
C
Chimpancé

5
BIOLOGÍA

Ascendencia común
Existen comportamientos y estructuras comunes
entre muchas especies. Un humano escribe, una vaca
anda, una ballena nada y un murciélago vuela con
estructuras hechas de huesos que son diferentes en
detalle, pero también increíblemente parecidos ente sí.
Cuando se comparan los fósiles en estructura y edad,
se hace evidente que una especie ancestral dio lugar
a toda una serie de especies sucesoras con la misma
disposición básica de los huesos de las extremidades. Se
ha demostrado que las líneas evolutivas de dos especies
actuales cualesquiera se pueden reconstruir hacia atrás
en el tiempo hasta que se unen en un ancestro común.

El registro fósil, las investigaciones sobre el ADN, las


pruebas de que las especies tienen ancestros comunes
y otros hallazgos constituyen una evidencia abrumadora
de que la evolución por selección natural es el mecanismo
por el cual surgió y se diversificó la vida en la Tierra.

La naturaleza impone una dirección al desarrollo


evolutivo. Aunque los delfines (izquierda) están
relacionados más directamente con los humanos que
con los tiburones, sus cuerpos han evolucionado para
adaptarse a un ambiente acuático.

Los huesos de los miembros anteriores de los


vertebrados terrestres y de algunos vertebrados
acuáticos son notablemente parecidos porque han
evolucionado a partir de los miembros anteriores de
un ancestro común.

http://davidhuerta.typepad.com/blog/2010/07/ciencia-y-evoluci%C3%B3n.html

Ejercitando tu comprension lectora:

1. En la lectura resalta las ideas principales.

2. De acuerdo al contexto del artículo científico escribe el significado de las siguientes palabras:

Generaciones. Naturalistas.
Descendientes. Biología molecular.
Ancestro. Secuencias de ADN.
Selecciona natural. Gen.
Antropología. Hormona Leptina.
Fósil.

Contesta las siguientes preguntas de acuerdo a la información del texto:

3. ¿El ADN del gorila, el chimpancé y el humano varían?

A. Si, debido a que la secuencia de nucleótidos de estos tres organismos no se parece en nada
B. No, porque la comparación entre las secuencias de ADN del ser humano y el chimpancé son idénticas
C. No, porque las secuencias de nucleótidos del gorila y chimpancé son idénticas.
D. Si, aunque tiene sus diferencias en cuanto a la secuencia de nucleótidos es probable que el ancestro común de
estos tres organismos tuviera un nucleótido que coincide.

4. ¿Cómo sustentaría el hecho de que todos tenemos un ancestro común?


A. El movimiento es igual para todos los organismos vivos.
B. La estructura parecida, pero con función diferente
C. Al comparar los fósiles en estructura y edad
D. Igual proceso embrionario de las especies.

6
BIOLOGÍA

PREGUNTAS TIPO I
1. Estudiantes de un colegio de Bogotá, deben estudiar el efecto de ciertos elementos químicos en el crecimiento de
las plantas; para ello, la profesora les proporcionó información sobre la función de los siguientes elementos:

ELEMENTOS FUNCIÓN
Potasio (K) Permite que los estomas se abran totalmente.
Magnesio (Mg) Contribuye al color verde de las hojas, ya que es componente de la clorofila.
Calcio (Ca) Ayuda a la germinación de la planta.
Fosforo (P) Favorece el crecimiento y el desarrollo.

Realizaron el siguiente experimento con luz:

1 2 3 4 5 6

H2O + K H2O + Mg H2O + Ca H2O + P K + Ca + P H2O

La hipótesis que puede ser comprobada a partir de este experimento es:

A. El exceso de agua y la falta de drenaje dañan la semilla e impiden la geminación.


B. Las plantas del tratamiento 2 abrirá los estomas fácilmente.
C. La planta del tratamiento 3 posiblemente germinará más rápido
D. El agua contiene los elementos necesarios para hacer crecer la planta normalmente; por ello, la única que
sobrevivirá es la del tratamiento 6.

2. Definir la pregunta: ¿Qué es la vida? No ha sido fácil para los científicos, La dificultad está en la enorme diversidad
de la vida y en su complejidad. Para comenzar, todos los seres vivos están formados por elementos comunes:
carbono, hidrogeno, oxigeno, nitrógeno, fosforo y azufre; poseen células, se alimentan transformando la energía
lumínica del sol en energía química de enlace o pueden obtener energía consumiendo sustancias del entorno.

Abundancia de los elementos químicos de la corteza


terrestre (Incluye oceános y atmósfera)

COMPOSICIÓN ATÓMICA DE TRES ORGANISMOS 3,40%


4,70%
ELEMENTO % HUMANO % ALFALFA % E. COLI 7,50%
Carbono 19.37 11.34 12.14
Hidrógeno 9.31 8.72 9.94
Nitrógeno 5.14 0.83 3.04 9,20%
49,50%
Oxígeno 62.81 77.90 73.68
Fósforo 0.63 0.71 0.60 25,70%
Azufre 0.64 0.10 0.32
Total 97.90% 99.60% 99.72%

Calcio Otros
Hierro Silicio
Aluminio Oxigeno
Según los datos reportados se puede afirmar que:

A. El carbono es el elemento que ocupa el cuarto puesto, en términos de abundancia en los seres vivos.
B. El hidrógeno es un gas que está en una proporción de 9.31% en los seres vivos. Forma el agua y siempre vendrá
combinado con otros elementos.
C. Elementos como el hierro, el calcio, y el aluminio son usados por los seres vivos en proporciones intermedias ya
que en la corteza terrestre se encuentra en grandes cantidades.
D. El elemento más abundante en la corteza terrestre y en los seres vivos es el oxígeno, posiblemente porque lo
necesitan para liberar la energía de los alimentos.

7
BIOLOGÍA

3. A continuación, se muestra los resultados de las pruebas de laboratorio de dos pacientes.

Intervalo biológico de
Exámenes realizados Paciente 1 Paciente 2
referencia
Ácido Úrico 2.4 – 5.7 mg/ dL 5 mg/dL 5 mg /Dl
Colesterol Total Menor de 200 mg /dL 211.0 mg/dL 134.0 mg /dL
Glucemia pre 85.3 mg /dL 100.3 mg /dL
60 – 100 mg/dL
Glucemia post 56.7 mg /dL 150.7 mg /dL

De acuerdo a los resultados es válido afirmar:


A. El paciente 1 produce mayor cantidad de insulina después del desayuno
B. El paciente 2 presenta deficiencia en la producción de glucagón, debido al aumento de los niveles de azúcar en la
sangre después de la ingesta de alimentos.
C. Los dos pacientes presentan deficiencia en el hígado
D. El paciente 1 está en riesgo de sufrir un paro cardiaco por el aumento de los niveles de colesterol.

4. Lee atentamente el texto:


La nutrición animal es el proceso complejo, mediante el cual: ç

1. Los organismos introducen alimentos al cuerpo, que trituran y reducen a pequeños fragmentos. 2. Estos sufren
trasformaciones químicas, que los convierten en sustancias más simples denominadas nutrientes. 3. Que traviesan
la pared del intestino delgado. 4. Dichos nutrientes junto con el oxígeno pasan a la sangre para ser transportados por
todas las células. También circulan sustancias de desecho como el dióxido de carbono. 5. Producto de la liberación
de la energía contenida en los alimentos, acción que es llevada a cabo por las mitocondrias. 6. Finalmente, todas las
sustancias de desecho formadas durante el metabolismo celular son eliminadas por medio de los órganos como la
piel, el hígado, los pulmones y el sistema urinario, con el fin de limpiar la sangre.

La etapa relacionada con la descripción en el número 5 se refiere a:


A. Digestión
B. Absorción
C. Circulación
D. Respiración

Responde las preguntas 5 y 6 con la información de la siguiente tabla:

DISTRIBUCION REGIONAL DE VERTEBRADOS EN COLOMBIA


NUMERO DE ESPECIES
Región
Mamíferos Aves Reptiles Anfibios Peces
Amazonia 210 868 187 152 1400
Caribe 100 951 101 32 370
Pacifica 100 600 192 185 570
Andina 162 500 193 205 146
Orinoquia 86 644 119 28 496
Insular 29 172 48 13 20

5. Las regiones Caribe y Pacifica tienen el mismo número 6. El grupo más abundante de organismos en el país es
de especies en: el de:

A. Mamíferos A. Mamíferos
B. Aves B. Aves
C. Reptiles C. Reptiles
D. Anfibios D. Anfibios

8
BIOLOGÍA

7. Dos especies diferentes, el oso hormiguero colombiano y el oso hormiguero australiano, se parece entre sí, a pesar
de que el colombiano es mamífero y el australiano es un marsupial. Una de las razones que explicaría el parecido
entre estas dos especies no relacionadas es que

A. Se reprodujeron entre si
B. Son iguales genéticamente
C. Evolucionaron en ambientes similares
D. Hubo migraciones de Suramérica a Australia

Actividad de aprendizaje I

Tan letal como el ébola y más que la peste... pero erradicable


La enfermedad de Carrión se hace fuerte con los más débiles: la población en mayor situación de riesgo son las
personas de las zonas rurales con menos recursos, sobre todo mujeres embarazadas y niños.

Sus pueblos no figuran en nuestros mapas. Ellos no salen en la foto. Y, de entrada, el nombre de la maldición que los
persigue tampoco inspira terror. Sin embargo, esta enfermedad se encuentra olvidada entre las olvidadas, ostenta
el dudoso honor de figurar entre las infecciones bacterianas más agresivas: con una tasa de mortalidad en su fase
aguda de entre el 44% y el 88%, resulta tan letal como el ébola y más que la peste.

Originariamente endémica de los valles andinos de Perú, Ecuador y Colombia, ahora que los patógenos parecen
haberle tomado el gusto a eso de viajar —y ahí están las epidemias de ébola y de chikungunya para recordárnoslo—
ha iniciado su expansión hacia territorios vecinos, amenazando con llegar hasta donde el vector que la transmite, la
mosca titira, consiga llevarla.

A todo ello, se añaden otras dificultades que la convierten en un reto para la ciencia:

1. La propia condición de olvidada, su circunscripción a regiones remotas, hace que no existan datos sobre el número
de personas al que afecta. Los datos rigurosos son una herramienta indispensable para diseñar estrategias específicas
de salud pública.

2. La existencia en las zonas endémicas de un gran número de personas que no desarrollan la enfermedad pero que
son portadoras de la bacteria que la causa, Bartonella bacilliformis, contribuye a que siga perpetuándose en las áreas
con presencia del insecto vector. Estos portadores asintomáticos, que actúan como reservorios, pasan desapercibidos
para el sistema sanitario.

3. La bacteria media en zonas remotas de países con sistemas sanitarios débiles, donde la capacidad para
diagnosticarla adecuadamente es muy limitada.

Hasta ahí las malas noticias. Ahora, las buenas.


Las muertes que causa son perfectamente evitables. A diferencia de lo que ocurre con el ébola o con el chikungunya,
para la enfermedad de Carrión sí que existe tratamiento. Por suerte, los antibióticos todavía son efectivos contra ella.

9
BIOLOGÍA

Por el momento y pese a que factores como el cambio


climático contribuyen a su expansión, se encuentra
restringida a una zona geográfica limitada. Eso, unido
al hecho de que no se conoce ningún reservorio animal,
permite alcanzar una conclusión esperanzadora:

si se desarrolla una herramienta de diagnóstico eficaz,


se mejora —y mucho— la capacidad de los sistemas de
salud locales para la vigilancia epidemiológica de los
portadores asintomáticos y se administra tratamiento
de forma masiva a las poblaciones endémicas,
la enfermedad de Carrión es — ¿lo adivinan? —
potencialmente erradicable. Ahora, ¿quién debería dar
el primer paso?

RECUPERADO http://elpais.com/elpais/2014/11/10/planeta_futuro/1415622037

Ejercitando tu comprension lectora:

1. En la lectura resalta las ideas principales.

2. De acuerdo al contexto del artículo científico escribe el significado de las siguientes palabras:

Endémica Portadores asintomáticos


Zonas rurales Reservorios
Patógenos Antibióticos
Epidemias Infección bacteriana

Contesta las siguientes preguntas de acuerdo a la información del texto:

3. La bacteria Bartonella bacilliformis, causa la 4. ¿Si se administra tratamiento de forma masiva


enfermedad del Carrión, ¿Como se explica el hecho de a poblaciones endémicas se puede erradicar la
pasar desapercibido por el sistema sanitario? enfermedad de Carrión?

A. Por los portadores asintomáticos A. No, porque el tratamiento no es eficaz


B. Por la población rural B. No, por el cambio climático
C. Por los viajeros C. Si, suministrando antibióticos
D. No hay registros fiables D. Si, al restringir la zona geográfica afectada

PREGUNTAS TIPO I

1. Uno de los hábitos más comunes en los niños es la ingesta de dulces, lo que en ocasiones genera que los dientes
tengan caries. La caries es producida por las bacterias que descomponen los restos de comida, en este caso los
azúcares que quedan en los espacios de los dientes; esto hace que los ácidos producto de la descomposición
desgasten el esmalte y debiliten los dientes, quedando expuestos al ataque de las bacterias.

El mal aliento de la mañana tiene un olor característico, al de alcohol, que se debe principalmente a:

A. La hidrólisis de la saliva, para descomponer los alimentos depositados en los espacios de los dientes.
B. Síntesis de proteínas, para romper las proteínas y los carbohidratos.
C. Fermentación de los azúcares depositados en los espacios de los dientes.
D. La secreción de ácidos, para descomponer los alimentos.

Características del organismo SOFIA JOAQUIN ANA


Tienen citoplasma y organelos SI SI NO
Tiene núcleo definido SI NO SI
Produce esporas SI SI NO
Produce su propio alimento NO SI INDEFINIDO

10
BIOLOGÍA

2. La tabla anterior muestra algunas características de microorganismos causantes de enfermedades en estas tres
personas. Según esto, puede decirse que lo más probable es que la enfermedad de

A. Sofía sea causada por hongos, la de Joaquín por bacterias y las de Ana por virus
B. Sofía se causada por virus, Joaquín por bacterias y la de Ana por hongos.
C. Sofía sea causada por bacterias, las de Joaquín por hongos y las de Ana por virus.
D. Sofía sea causada por hongos, la de Joaquín por virus y la de Ana por bacterias.

3. Algunos alimentos como los ajos y las cebollas son ricos en azufre que evita lesiones en las articulaciones. De
igual manera, los pescados ricos en ácidos grasos omega-3 (salmón, atún, y las sardinas), aceleran la curación de
los ligamentos dañados debido a que aumentan la entrada de nuevas células en la zona lesionada y aceleran la
síntesis de colágeno.

Además, los pescados contienen vitamina D, que es necesaria para la formación normal de los huesos y permite
una mejor utilización del calcio y el fósforo.

De acuerdo al texto se puede inferir que:

A. Una persona que consume una dieta rica en pescado es más propensa a sufrir problemas de lesiones en las
articulaciones.
B. Una persona que consume una dieta rica en pescado es menos propensa a sufrir problemas de lesiones en las
articulaciones.
C. Una persona que consume una dieta rica en ajos y cebolla es más propensa a sufrir problemas de lesiones en las
articulaciones.
D. Una persona que consume una dieta rica en ajos y cebolla es menos propensa a sufrir problemas de lesiones en
las articulaciones.

4. La tiroides es una glándula bilobulada situada en el cuello. Las hormonas tiroideas, la tiroxina y la triyodotironina
aumentan el consumo de oxígeno y estimulan la tasa de actividad metabólica, regulan el crecimiento y la
maduración de los tejidos del organismo y actúan sobre el estado de alerta físico y mental.

La tiroides también secreta una hormona denominada calcitonina, que disminuye los niveles de calcio en la sangre
e inhibe su reabsorción ósea. Con base en la información anterior se puede afirmar que el efecto del déficit de la
hormona tiroidea en personas genera.

A. Pérdida del desarrollo intelectual y el retraso en el crecimiento.


B. Aumento del consumo de oxígeno.
C. Niveles de calcio bajos.
D. Estados de alerta física y mentalmente.

11
BIOLOGÍA

5. La imagen muestra estructuras homólogas es decir órganos que tienen la misma estructura interna, pero con
diferentes funciones para algunos animales, una posible explicación de la presencia de estas estructuras en
animales tan diversos podría ser:

A. Todas estas estructuras son utilizadas para producir algún tipo de movimiento.
B. Durante alguna etapa del proceso evolutivo hace millones de años estas especies se cruzaron entre si lo cual le
heredó dichas estructuras.
C. Aquellos grupos que se han desarrollado partir de un ancestro común presentan una estructura y un desarrollo
embrionario más parecido que los presentados en grupos de origen diferente.
D. Todas estas estructuras son análogas pues cumplen la misma función, pero con diferente estructura y con un
origen embrionario diferente.

6. Unos estudiantes realizaron el siguiente experimento: tomaron dos plantas y las cubrieron con una bolsa plástica
transparente; ubicaron una de ellas en un lugar expuesto a la luz solar y la otra en un sitio completamente oscuro.
Al cabo de unas horas, se dieron cuenta que se habían formado gotas de agua en el interior de las bolsas que
cubrían las bolsas; sin embargo, había mayor número de ellas en las plantas expuestas a la luz solar.

Esto puede deberse a que:

A. La planta expuesta a la luz solar aumento su temperatura y, por lo tanto, transpiró más.
B. La planta que no fue expuesta a la luz mostro mayor transpiración, debido a la disminución de temperatura.
C. El agua proviene de las hojas y fue incorporada por el tallo de la planta.
D. Las plantas eliminaron el agua por las hojas, mediante el proceso de absorción

7. Observa detenidamente las características de los organismos invertebrados y vertebrados:

1. 2. 3. 4. 5.

6. 7. 8. 9. 10.

Los organismos que se ubican en las casillas 1, 4, 6 y 7 pertenecen a los:


A. Artrópodos
B. Equinodermos
C. Anélidos
D. Moluscos

12
BIOLOGÍA

Actividad de aprendizaje II

El alcohol y el hígado
Cuando el alcohol llega al estómago, avanza hasta el intestino delgado, donde pasa a la circulación sanguínea.
El estómago es el primer órgano que procesa el alcohol: cerca del 20% se absorbe a través del revestimiento del
estómago y el 80% es absorbido a través del intestino delgado.

Una vez que el alcohol llega a la circulación sanguínea, se envía al hígado, donde debe ser asimilado. Después de
tomar una copa, la concentración de alcohol en la sangre alcanza su nivel máximo en 30-45 minutos y vuelve al nivel
normal una hora después, siempre que no se beba más.

El hígado es el encargado de convertir el alcohol en una sustancia que sea inocua para el cuerpo. Hay que señalar
que puede haber una pequeña cantidad de alcohol que no llegue al hígado, ya que se excreta mediante la orina y
la respiración. Ese es el motivo por el que los alcoholímetros pueden detectar la cantidad de alcohol consumida con
una prueba de aliento.

El hígado
Existen determinadas enzimas hepáticas que se encargan de convertir el alcohol en una sustancia inocua: la alcohol-
deshidrogenasa (ADH), la aldehído-deshidrogenasa (ALDH) y el citocromo P450IIE1 (CYP2E1). La ADH es la principal
enzima encargada de convertir el alcohol. En bebedores crónicos, el hígado fabrica más CYP2E1 en un esfuerzo por
compensar la ingesta excesiva de alcohol. Por desgracia, la producción extra de CYP2E1 no contrarresta realmente los
efectos que provoca en el hígado el abuso prolongado de alcohol.

En personas que no tienen enfermedades hepáticas, el abuso crónico de alcohol provoca depósitos de grasa en
los hepatocitos, lo cual ocasiona inflamación y necrosis celular. Pasado un tiempo, la pérdida de hepatocitos causa
cicatrices leves en el hígado, y después de años de abuso crónico, estas cicatrices se extienden y provocan cirrosis en
el hígado. Si se combinan los efectos del abuso del alcohol con la hepatitis C, los daños en el hígado pueden aparecer
con mucha más rapidez.

Existen diferencias en los motivos que ocasionan intoxicación etílica. Algunos factores que influyen en el grado de
absorción, y por lo tanto, de intoxicación, son los siguientes:

• La cantidad de alcohol consumida en un momento dado; el hígado sólo puede metabolizar una determinada
cantidad por hora.

• La velocidad del metabolismo difiere según la concentración de enzimas ADH y ALDH en el hígado, y esta varía
según el sexo, la raza y el origen étnico.

• Los alimentos ingeridos influyen en la cantidad de alcohol que puede absorber el organismo. Si el estómago está
lleno, se ralentiza la absorción de alcohol.

Los alimentos ricos en carbohidratos y grasa ayudan a ralentizar el proceso por el que el estómago impulsa la comida
(y el alcohol absorbido) hasta el intestino delgado, y por lo tanto influyen en la cantidad de tiempo que tarda en
absorberse el alcohol. La mezcla de alcohol con otras bebidas también influye en la absorción del mismo: cuando éste
se mezcla con jugo de frutas o agua, se absorbe más lentamente que cuando se mezcla con bebidas carbonatadas.

• El tejido muscular contiene más agua que el tejido graso, por lo que cuanta más masa muscular tenga una persona,
más diluido estará el alcohol.

13
BIOLOGÍA

Diferencias por sexos


El alcohol se metaboliza de forma diferente en los hombres que en las mujeres. La cantidad de agua en el organismo
influye en la velocidad de absorción del alcohol. En general, las mujeres tienen más proporción de grasa en el cuerpo
(menos agua); los hombres tienen más masa muscular (más agua).

Por este motivo, las mujeres tendrán concentraciones más altas de alcohol en el cuerpo que los hombres que
consumen la misma cantidad. Además de las diferencias por sexos, la composición de agua total en el organismo
desciende a medida que nos hacemos mayores, por lo que una persona de 60 años tiene menos proporción de agua
en el cuerpo que otra menor de 40 años.

Pero el principal motivo por el que las mujeres metabolizan el alcohol de forma diferente es que tienen menos
enzimas ADH. La ADH es la enzima que se encarga de convertir el alcohol hasta niveles que el hígado pueda procesar
de forma segura. Esto significa que las mujeres que beben la misma cantidad que los hombres absorben el doble de
alcohol en la sangre que un hombre que beba lo mismo.

Esa es la razón por la que se han establecido recomendaciones de consumo de alcohol diferentes entre hombres y
mujeres sanos (sin enfermedades hepáticas): Las mujeres no deben tomar más de 1 bebida alcohólica al día, y los
hombres no deben beber más de 2 al día.

Recuperado: http://www.hcvadvocate.org/hepatitis%5Csp_factsheets/alcohol.pdf PAGS 1 Y 2

Ejercitando tu comprension lectora:

1. En la lectura resalta las ideas principales.

2. De acuerdo al contexto del artículo científico escribe el significado de las siguientes palabras:

Inocua Enzimas hepáticas


Ralentizar Bebedor crónico
Hepatocitos Hepatitis C
Necrosis Intoxicación etílica
Concentración de alcohol Absorción
Excretar Metabolismo
Contesta las siguientes preguntas de acuerdo a la información del texto:

3. ¿Por qué los alcoholímetros pueden detectar grados de alcohol a través del aliento?

A. El 20% de alcohol lo procesa el estomago


B. El 80% de alcohol lo absorbe el intestino delgado
C. Una pequeña concentración de alcohol se expulsa por la respiración
D. El hígado transforma el alcohol

4. ¿Por qué las mujeres se embriagan más rápido con respecto a los hombres?
A. Debido a que no tienen el estómago lleno, deben ingerir carbohidratos.
B. Poseen más masa muscular y contiene más agua
C. Tienen más enzimas ADH y metabolizan el alcohol más rápido
D. Poseen más grasa corporal, por lo tanto, menor cantidad de agua.

PREGUNTAS TIPO I

1. Proceso por el cual una célula se divide para formar cuatro células hijas; 2. Las células hijas son genéticamente
idénticas a la célula madre; 3. Se producen células haploides; 4. Proceso por el cual una célula de divide para formar
dos células hijas; 5. Mediante este proceso se forman las células sexuales; 6. Entrecruzamiento de cromosomas;
7. Produce variabilidad genética; 8. Es típica en las células somáticas; 9. Se producen células diploides; 10. Se da
cuando hay regeneración de tejidos.

Los procesos de meiosis son respectivamente:

A. 1, 3, .4, 5, .6
B. 2, 4, 8, 9, 10
C. 1, 3, 5, 6, 7
D. 2, 4, 6, 8, 10

14
BIOLOGÍA

2. Antes de que surgiera la vida, los rayos, la luz ultravioleta y el calor formaron moléculas orgánicas en el agua y
componentes de la atmósfera primitiva para la tierra. Por casualidad, algunas moléculas de ARN pudieron haber
tenido propiedades enzimáticas, catalizando el proceso de copiado de ellas mismas a partir de nucleótidos en las
aguas de la tierra.

Según lo anterior se puede inferir:

A. El ARN se convirtió en la primera molécula portadora de información, al actuar como una enzima catalizadora.
B. El ARN se convirtió en la primera molécula portadora de información al degradar proteínas.
C. El ARN se convirtió en la primera molécula portadora de información al existir en la atmósfera primitiva.
D. El ARN se convirtió en la primera molécula portadora de información al sintetizar copias de ella misma.

3. Lee detenidamente la siguiente carta:


Querido Primo:
Espero que al recibir esta carta te encuentres bien de salud. Me contaron que estas estudiando genética. Tal vez puedas
ayudarme. Resulta que la semana pasada estuve en una reunión familiar con mis abuelos, mis papas y mis dos hermanos,
y observándolos con detenimiento, me di cuenta de que todos poseen ojos oscuros, excepto yo, que los tengo verdes.

Esta situación me ha tenido un poco confundida, ya que, te confieso, he empezado a dudar si soy realmente hija
legitima de mis padres o si soy adoptada. Te envió esta carta para que, con tus conocimientos acerca de genética, me
ayudes a descifrar este problema y saber si existe alguna probabilidad de que este errada, para así salir de esta horrible
incertidumbre.

No siendo más, me despido. Con cariño, tu prima Emma.

Partiendo del hecho de que la prima Emma si es hija legitima de sus padres. El genotipo de Emma seria:

A. AA
B. Aa
C. aa
D. Aa

4. En la siguiente grafica se presenta el número de cromosomas que poseen las células sexuales de cuatro especies
de animales:

CROMOSOMAS POR ESPECIE

45
Número de cromosomas

40 40

35 35

30 30

25
20 20

15
10
5
0
Número de la especie

Según la gráfica el número de cromosomas que contiene los gametos de la especie 2 es:

A. 10
B. 20
C. 30
D. 40

15
BIOLOGÍA

5. Las células requieren nutrientes del exterior y deben eliminar sustancias de desecho procedentes del metabolismo
y mantener su medio interno estable.

Para posibilitar este intercambio, la membrana celular presenta una permeabilidad selectiva. En la imagen, se
representa dos de los principales tipos de transporte de sustancia a través de la membrana, según la imagen el
motivo por el cual se requiere energía en forma de ATP en el transporte activo puede ser que

http://www.wikillerato.org/La_membrana_plasm%C3%A1tica.html
A. Este se produce siempre en contra del gradiente, es decir, de donde hay menos, hacia el medio donde hay más,
lo que requiere energía.
B. Este se produce siempre a favor del gradiente, es decir, de donde hay más, hacia el medio a donde hay menos lo
que requiere energía.
C. La bicapa lipídica de la célula requiere consumo constante de energía independiente del tipo de transporte que
realice.
D. La célula requiere mantener concentraciones iguales de todas las sustancias a ambos lados de la membrana lo
que consume demasiada energía.

6. Si la célula es colocada en un medio hipertónico se esperaría que

A. Elimine agua buscando nivelar las concentraciones


hasta el punto de generar una plasmólisis.
B. Permanezca constante pues esto no afecta el
movimiento de líquidos a través de la membrana.
C. Absorba agua generando una turgencia y hasta
estallar.
D. El agua salga de la célula por difusión facilitada con
gasto de energía.

Las preguntas 7 y 8 se contestan utilizando la siguiente información:


Membrana semipermeable
Molécula de agua Molécula sucrosa

La ósmosis es el proceso espontáneo por el cual


las moléculas de disolvente pasan a través de una
membrana semipermeable, desde una disolución
de menor concentración hasta una disolución de
concentración mayor de soluto.

Si una membrana semipermeable (como el celofán)


separa dos disoluciones, las moléculas del disolvente
pueden pasar a través de la membrana en ambas
direcciones, pero la velocidad con la que pasan hacia la
disolución más concentrada es mayor que la velocidad
en la dirección opuesta.

16
BIOLOGÍA

7. En una piscina se encuentran sales disueltas en gran cantidad; si se permanece mucho tiempo en un medio como
este, el tejido humano, formado por células que tienen bajas concentraciones de sales, tiende a arrugarse. La
figura que mejor representa la ósmosis en esta situación es:

A. B. C. D.

8. Al colocar un par de soluciones A y B separadas por una membrana semipermeable (la solución A está formada por
agua y la B agua y sal de cocina), lo más probable es que la porción que contiene la solución

A. A aumenta de tamaño ya que ingresan a esta los iones que provienen de la solución B.
B. B disminuye de tamaño debido a que de allí salen los iones de esta, por efecto de la solución A.
C. A disminuye de tamaño ya que el agua pasa a la solución B que tiene mayor concentración.
D. A aumenta de tamaño ya que el agua pasa de la solución de B a la solución A, porque ésta última tiene menor
concentración.

BIBLIOGRAFÍA
ICFES. Saber 5° y 9°. Cuadernillo de prueba. Ciencias Naturales, 9° grado. Calendario B. Año 2012

Evaluaciones 1290. Ciencias Naturales. Aprender para vivir. Ediciones SM S. A., 2012.

GLOSARIO
ADN: es un ácido nucleico que contiene las instrucciones genéticas usadas en el desarrollo y funcionamiento de
todos los organismos vivos y algunos virus, y es responsable de su transmisión hereditaria. La función principal de la
molécula de ADN es el almacenamiento a largo plazo de información para construir otros componentes de las células,
como las proteínas y las moléculas de ARN. Los segmentos de ADN que llevan esta información genética son llamados
genes, pero las otras secuencias de ADN tienen propósitos estructurales o toman parte en la regulación del uso de esta
información genética. https://es.wikipedia.org/wiki/%C3%81cido_desoxirribonucleico

ARN: es un ácido nucleico formado por una cadena de ribonucleótidos. Está presente tanto en las células procariontes
como en los eucariontes, y es el único material genético de ciertos virus (virus ARN). El ARN se puede definir como la
molécula formada por una cadena simple de ribonucleótidos, cada uno de ellos formado por ribosa, un fosfato y una
de las cuatro bases nitrogenadas (adenina, guanina, citosina y uracilo). El ARN celular es lineal y monocatenario (de una
sola cadena), pero en el genoma de algunos virus es de doble hebra. https://es.wikipedia.org/wiki/%C3%81cido_ribonucleico

FERMENTACIÓN ALCOHÓLICA: La fermentación alcohólica es un proceso anaeróbico realizado por las levaduras y
algunas clases de bacterias. Estos microorganismos transforman el azúcar en alcohol etílico y dióxido de carbono. La
fermentación alcohólica, comienza después de que la glucosa entra en la celda.
https://www.tempeh.info/es/fermentacion-alcoholica.php

GLÁNDULA: Una glándula es un órgano del cuerpo que tiene la función es sintetizar sustancias para secretarlas. La
liberación de estas sustancias puede ser en el torrente sanguíneo, como las hormonas, o en el interior de una cavidad
corporal o en la superficie exterior. http://www.enciclopediasalud.com/categorias/cuerpo-humano/articulos/que-es-una-
glandula-glandulas-endocrinas

GRADIENTE: Un gradiente de concentración es una magnitud fisicoquímica que describe en qué dirección y en qué
proporción se produce el mayor cambio en la concentración de un soluto disuelto en una solución no homogénea en
torno a un punto en particular. https://es.wikipedia.org/wiki/Gradiente_de_concentraci%C3%B3n

HIDRÓLISIS: Literalmente significa destrucción, descomposición o alteración de una sustancia química por el agua.
https://www.ecured.cu/Hidr%C3%B3lisis

HIPERTÓNICO: En biología, una solución es aquella que tiene mayor concentración de soluto en el medio externo, por
lo que una célula en dicha solución pierde agua (H2O) debido a la diferencia de presión, es decir, a la presión osmótica,
llegando incluso a morir por deshidratación. https://es.wikipedia.org/wiki/Hipertónico

HIPOTÓNICO: Una solución hipotónica, denominada también hipotona, es una solución en la cual el solvente (como
puede ser un plasma diluido) tiene una menor concentración de soluto (sales, etc.) que la que hay en el medio celular
interno (o citoplasma). https://es.wikipedia.org/wiki/Hipotónico

ISOTÓNICO: Un medio o solución isotónico es aquel en el cual la concentración de soluto es igual fuera y dentro de
una célula. En hematología, se dice de las soluciones que tienen la misma concentración de sales que los glóbulos rojos.
son isotónicas. Por tanto, tienen la misma presión osmótica que la sangre y no producen la deformación de los glóbulos
rojos. Aplicando este término a la contracción muscular, se dice que una contracción es isotónica cuando la tensión del
músculo permanece constante. https://es.wikipedia.org/wiki/Isot%C3%B3nico

17

También podría gustarte