Está en la página 1de 24

Navegación de artículos

  

Identi cación in situ de la proteína sintomática


fermentativa Coprothermobacter spp. Participa en el
proceso de digestión anaerobia termofílica. 
Maria Cristina Gagliano , Camilla Maria Braguglia ,Simona Rossetti, 

FEMS Microbiology Letters , Volumen 358, Número 1, septiembre de 2014, páginas 55–63,
https://doi.org/10.1111/1574-6968.12528
Publicado: 01 de septiembre de 2014 Historia del articulo 

PDF  Vista dividida  Citar  permisos Permisos  Compartir 

Resumen
Las bacterias termó las han atraído recientemente gran atención debido a su aplicación
potencial para mejorar diferentes procesos bioquímicos, como la digestión anaeróbica
de diversos sustratos, el tratamiento de aguas residuales o la producción de hidrógeno.
En este estudio, informamos sobre el diseño de una sonda de oligonucleótidos dirigida a
16S rRNA especí ca para detectar miembros del género Coprothermobacter caracterizado
por una fuerte actividad de proteasa para degradar proteínas y péptidos. Las sondas
CTH485 y las sondas auxiliares de nuevo diseño hCTH429 y hCTH439 se optimizaron
para su uso en la hibridación in situ con uorescencia (FISH) en muestras de lodo
anaeróbico termofílico. En el lugarel sondeo reveló que los mecanismos
termoadaptativos que dan forma al gen 16S rRNA pueden afectar la identi cación de
microorganismos termofílicos. La novedosa sonda FISH desarrollada amplía la
Saltar al contenido principal
posibilidad de estudiar la extensa interacción sintró ca termofílica de
Coprothermobacter spp. con arqueas metanogénicas hidrogenotró cas, cuyo
establecimiento es un gran bene cio para todo el sistema anaeróbico.
Navegación de artículos

Saltar al contenido principal


Ver la gran diapositiva de descarga
Navegación de artículos

La detección in situ de la proteína fermentativa Coprothermobacter permite analizar de manera eficiente


su interacción sintrófica con metanógenos hidrogenotróficos y su papel en los procesos biotecnológicos
termofílicos y los sistemas anaeróbicos no convencionales.

Keywords: Coprothermobacter , digestión anaerobia termofílica , FISH , sintrofia , bacterias


proteolíticas
Tema: Hibridación in situ fluorescente, arqueas, digestión, endopeptidasas, genes,
hidrógeno, oligonucleótidos, péptidos, ARN ribosomal, ARN, ribosomal, 16s, bacterias,
sondas fluorescentes, fango fisiológico, microorganismos

Introducción

La digestión anaeróbica (EA) es una de las pocas tecnologías sostenibles que producen
energía y tratan ujos de desechos. Debido a sus ventajas relacionadas principalmente con la
mayor eliminación de materia orgánica, la producción de metano y la eliminación de
patógenos, los procesos anaeróbicos que operan en condiciones termofílicas han atraído una
gran atención (Ho et al ., 2013 ). Nuestro conocimiento sobre los consorcios microbianos
involucrados en este proceso es limitado debido a la falta de datos logenéticos y metabólicos
sobre estos microorganismos predominantemente no cultivados (Rivière et al ., 2009 ). Una
mayor comprensión de la identidad y la función de los componentes microbianos permitiría,
por lo tanto, un mejor control de los procesos biológicos.

Coprothermobacter proteolyticus se aisló originalmente de un cultivo de enriquecimiento


metanogénico inoculado de un digestor termofílico (Ollivier et al ., 1985 ). Coprothermobacter
se asocia generalmente con la población microbiana de digestores anaeróbicos debido a sus
propiedades proteolíticas. Esto lo convierte en un candidato ideal para facilitar el tratamiento
y el procesamiento a alta temperatura de aguas residuales ricas en proteínas (Cai et al ., 2011 ).
Coprothermobacter spp. se identi caron en varios estudios centrados en el análisis de la
estructura de la comunidad microbiana a partir de reactores termofílicos anaeróbicos que
tratan lodos de aguas residuales (Hatamoto et al .,2008 ; Kobayashi et al ., 2008 ; Lee et al .,
2009 ; Luo et al ., 2013 ; Pervin et al ., 2013 ), otros sustratos como desechos de matadero
(Palatsi et al ., 2011 ), desechos de alimentos y estiércol de ganado (Tandishabo et al ., 2012 ).
Saltar al contenido principal
El crecimiento de Coprothermobacter spp. en los sustratos de proteínas también está
estrechamente relacionado con la producción de hidrógeno (Kawagoshi et al ., 2005 ;
Tandishabo et al ., 2012 ). En particular,Coprothermobacter puede lograr la degradación de
Navegación de artículos
proteínas en asociación sintró ca con arqueas metanogénicas hidrogenotró cas (Sasaki et al
., 2011b ).

Para estudiar y controlar los ecosistemas anaeróbicos naturales, así como los procesos de
ingeniería anaeróbica, los métodos de detección in situ como la hibridación in situ
uorescente (FISH) se utilizan ampliamente para la identi cación, cuanti cación y, en
combinación con otras técnicas, la caracterización de poblaciones microbianas de nidas
logenéticamente. . De hecho, solo las herramientas basadas en microscopía pueden vincular
marcadores de ADN extraídos aislados con células individuales intactas en sus entornos
naturales y excluir los sesgos debidos a la extracción de ácido nucleico y la PCR. Hasta la
fecha, considerando el potencial aplicativo del análisis FISH, no hay una sonda especí ca
para el biocontrol in situ de Coprothermobacterspp. está disponible. En este estudio , se diseñó
una nueva sonda oligonucleotídica, dirigida a la mayoría de los miembros del género
Coprothermobacter . La sonda se optimizó para su aplicación en muestras de lodos
termofílicos a través del diseño de sondas auxiliares especí cas.

materiales y métodos

Microorganismos y fijación celular.


Las siguientes cepas de referencia se usaron en este estudio: C. proteolyticus cepa BT (DSM
5265) y Sulfurihydrogenibium rodmanii cepa UZ3-5 (DSM 19533) se usaron en la optimización
de la sonda FISH como controles positivos y negativos, respectivamente. El material celular
se recogió de los cultivos activos líquidos y se jó inmediatamente en formaldehído
(concentración nal 2% v / v) durante 3 horas a 4 ° C. Las muestras jas se ltraron a través
de ltros de membrana de policarbonato (tamaño de poro 0,2 μm, diámetro 47 mm,
Millipore) mediante vacío suave (<0,2 bar) y los ltros se almacenaron a -20 ° C hasta su
posterior procesamiento.

Muestras de lodos
Las muestras de lodo se obtuvieron de digestores anaeróbicos termofílicos a escala de
laboratorio (55 ° C) alimentados con lodo activado residual residual pretratado (WAS), como
se detalla en Gianico et al . ( 2013 ). Alícuotas de 1,5 ml de licor mixto (con un rango de 15 a 30
Saltar al contenido
-1 principal
TS g L ) se congelaron inmediatamente a -20 ° C para una extracción adicional de ADN o se
jaron con paraformaldehído y etanol para análisis FISH como se describe en Amann et al . (
1990 ).
Navegación de artículos
Diseño de sondas oligonucleotídicas y ayudantes.
Las secuencias de sondas y auxiliares y las condiciones de rigurosidad se muestran en la
Tabla 1 . Los auxiliares de oligonucleótidos y la sonda se adquirieron de Bio-Fab Research
(Italia). Las regiones objetivo candidatas para el diseño de sondas y ayudantes se
seleccionaron a través del análisis de la estructura secundaria de ARNr generada con el
software SFOLD (Ding et al ., 2005 , http://sfold.wadsworth.org ). Las especi cidades y la
cobertura de las SONDAS se veri caron in silico contra la base de datos del gen rRNA 16S de
SILVA (versión 115) mediante TESTPROBE (Quast et al ., 2013 , http://www.arb-
silva.de/search/testprobe/). Finalmente, para probar la posible efectividad de las sondas en la
hibridación, se simuló FISH in silico a través del software MATHFISH (Yilmaz et al ., 2011 ,
http://math sh.cee.wisc.edu/index.html ). El software calcula la e ciencia de hibridación de
una sonda con respecto a una secuencia objetivo. La alineación de secuencias con TESTPROBE
se realizó utilizando la base de datos SSU PARC , que contiene todas las secuencias alineadas
con un valor de identidad de alineación igual y superior a 50.

tabla 1
Lista de sondas y ayudantes utilizados en este estudio

Nombre  Grupo objetivo  Escherichia Secuencia de sondeo (5′ – 3 Formamida Cobertu


coli ′)  (%)  (% de
numeración  secuenc
objetivo

CTH485  Coprothermobacter  485–503  TCCCTTTCTACTGGGGTA  30  71.3 

hCTH429  Ayudante CTH485  429–451  TCGTCCCCCAGTCCAGGAGTTT  -  69.9 

hCTH439  Ayudante CTH485  439–461  CCGTCCTTCCTCGTCCCCCAGT  -  60.2 

ARCH915  Archaea  915–934  GTGCTCCCCCGCCAATTCCT  20, 35  79.1 

MB311  Metanobacteriales  311–333  ACCTTGTCTCAGGTTCCATCTCC  30  94.8 

EUB388
Saltar I, Las bacterias 
al contenido principal 338–355  GCTGCCTCCCGTAGGAGT, 20  91.9, 0.6
II y III  GCAGCCACCCGTAGGTGT y 1.4 
GCTGCCACCCGTAGGTGT 
Navegación de artículos Ver grande

PEZ
Los ensayos de FISH se realizaron en células recogidas con ltro de acuerdo con el
procedimiento publicado anteriormente (Pernthaler et al ., 2001 ). Para veri car más a fondo
la especi cidad de la nueva sonda, también se aplicaron sondas especí cas de dominio,
ARC915, sonda para Archaea y EUB338mix, sondas para bacterias (Tabla 1 ). La tinción
uorescente DAPI (4 ', 6-diamidino-2-fenilindol) también se realizó simultáneamente para
determinar el número total de células. El FISH en muestras de lodo jo se realizó como se
describió anteriormente (Braguglia et al ., 2012 ). Identi car metanobacteriales termofílicos.El
protocolo se modi có aplicando un tratamiento previo enzimático con pseudomureina
endopeptidasa como se describe en Nakamura et al . ( 2006 ).

Microscopía y cuantificación de señales.


Las muestras se examinaron mediante microscopía de epi uorescencia (Olympus BX51). La
señal de uorescencia se cuanti có en al menos 10 imágenes microscópicas tomadas de las
muestras con una cámara digital (Olympus XM-10) y la CELDA DE software F . La intensidad
de la señal de uorescencia se consideró el valor gris medio (intensidades de píxeles)
utilizando el paquete de software IMAGEJ (versión 1.37V , Wayne Rasband, Instituto Nacional
de la Salud, Bethesda, MD).

Extracción de ADN genómico y amplificación por PCR de genes 16S


rRNA
El ADN se extrajo de c . 700 mg de lodos termó los tomados al nal del proceso de digestión,
utilizando el protocolo descrito en Rossetti et al . ( 2008 ). Los genes de 16S rDNA se
ampli caron utilizando los cebadores 27F (AGAGTTTGATCMTGGCTCAG) y 1492R
(TACGGYTACCTTGTTACGACTT) para bacterias , como se describe en Rossetti et al . ( 2003 ).

Clonación y secuenciación del gen 16S rRNA


La clonación de los productos de PCR se llevó a cabo utilizando el sistema de vector fácil
pGEM-T en células competentes de Escherichia coli JM109 (Promega) de acuerdo con las
Saltar al contenido principal
instrucciones del fabricante. Los insertos positivos se ampli caron a partir de plásmidos
recombinantes de colonias blancas mediante PCR de colonias, utilizando los cebadores de
secuenciación T7 (TAATACGACTCACTATAGGG) y M13 (22 mer, Promega)
(TCACACAGGAAACAGCTATGAC), como se describe en Chen ( 2003 ). Los productos de PCR se
Navegación de artículos
puri caron utilizando un kit de puri cación de PCR QIAquick (Qiagen, Países Bajos). Se
secuenciaron los insertos del gen 16S rRNA y se determinaron las identidades de secuencia.
Los resultados del análisis clonal se informan en Información de apoyo, Fig. S1. Todas las
secuencias del gen 16S rRNA pertenecientes al género Coprothermobacter diferían en <2%. Un
gen 16S rRNA secuencia completa deCoprothermobacter se envió a GenBank con el número de
acceso KF971872 .

Resultados

Diseño de sonda FISH específica para especies de


Coprothermobacter.
En la taxonomía bacteriana actual, el género Coprothermobacter se clasi ca en el lo
Firmicutes . Sin embargo, Nishida et al . ( 2011 ) mostraron que Coprothermobacter
representaba un grupo taxonómico mayormente relacionado con Dictyoglomi y Thermotoga .
De hecho, ninguna de las sondas dirigidas al lo Firmicutes (sondas LGC354 a, b, c) se enfocó
en el gen rRNA 16S de C. PROTEOLYTICUS (como se comprobó al probar las secuencias de
sondas en TESTPROBE ), y no se obtuvo hibridación en nuestras muestras de lodo. Detectar in
situmiembros de este género, se produjo una sonda FISH especí ca. El diseño de la sonda
para la detección de especies de Coprothermobacter se realizó sobre la base de una región
objetivo identi cada por el software CASSIS en el trabajo de Bader et al . ( 2011 , material
complementario). La secuencia de rma con la mejor cobertura grupal en el árbol
logenético de Coprothermobacter encontrada por CASSIS se utilizó en nuestro estudio para
diseñar una sonda FISH, al comparar esta secuencia con las secuencias del gen 16S rRNA
recuperadas de nuestro análisis clonal (Fig. S1), y Con secuencias presentes en la base de
datos de SILVA . Esta secuencia, que cubre el nucleótido 485–503 ( E. colinumeración), fue
complementaria al 70.9% de las secuencias de Coprothermobacter presentes en la base de
datos SILVA SSU 115 (sonda CTH485 en la Tabla 1 ). La alineación de la secuencia TESTPROBE
mostró que la sonda CTH485 también coincidía completamente con las 20 secuencias de
grupos pertenecientes a microorganismos inculturables, pero todas las secuencias de la base
de datos son aproximadamente c . 500 pb y algunos de estos tienen un bajo valor Pintail.

CTH485 optimización de la sonda FISH


Saltar al contenido principal

Cultura pura
Coprothermobacter proteolyticus cepa BT (DSM 5265) se utilizó como control positivo en la
Navegación de artículos
optimización de la sonda FISH. La cepa UZ3-5 de Sulfurihydrogenibium rodmanii, el pariente
más cercano cultivado de Coprothermobacter spp., Se utilizó como control negativo para la
sonda CTH485. Esta sonda tenía tres desapareamientos con la secuencia del gen 16S rRNA de
la cepa UZ3-5 (Fig. 1 a). La concentración óptima de formamida para la rigurosidad de la
sonda se determinó mediante la realización de una serie de experimentos de FISH en
diferentes incrementos de formamida a partir del 0% de formamida (Fig. S2). La
concentración óptima de formamida fue la concentración más alta antes de que disminuyera
la intensidad de la señal. La rigurosidad óptima para la sonda CTH485 resultó en un 30% (Fig.
2una). No se detectó señal de uorescencia cuando esta sonda se aplicó a la cepa UZ3-5 de S.
rodmanii.

Figura 1

Ver la gran diapositiva de descarga

Alineaciones de diferencia para sondas CTH485 (a) y ARC915 (b). Las secuencias del gen 16S rRNA en los sitios
objetivo de las sondas se muestran para organismos de referencia representativos. Las letras en mayúsculas
indican cambios de nucleótidos que conducen a desajustes fuertes; las letras minúsculas indican cambios que
conducen a desajustes débiles.

Figura 2

Saltar al contenido principal


Navegación de artículos

Ver la gran diapositiva de descarga

Análisis FISH de Coprothermobacter proteolyticus (DSMZ 5265) utilizando la sonda CTH485 (a), y de lodo
anaeróbico termofílico (b) utilizando la sonda junto con el ayudante CTH439. Barra de escala: 10 μm.

Lodos anaerobios termofilicos

La sonda CTH485, aunque optimizada y validada en un cultivo puro de C. proteolyticus, no


funcionó correctamente cuando se analizó el lodo termofílico: la señal de uorescencia era
muy débil y no era claramente distinguible de la uorescencia de fondo. Por lo tanto, sobre la
base de la estructura secundaria de centroide del conjunto del gen 16S rRNA de C. proteolyticus
(Fig. S3), se evaluó la accesibilidad de la región objetivo de la sonda. Se diseñaron dos
oligonucleótidos auxiliares no marcados para abrir la hélice y hacer que el objetivo sea más
accesible para la sonda. Entre una gama de opciones, se eligieron los ayudantes hCTH429 y
hCTH439 (Tabla 1). La elección se basó tanto en la base de los valores de temperatura de
fusión (58.6 y 62.3 ° C, respectivamente, más altos que la temperatura de fusión de 48 ° C de
Saltar al contenido principal
CTH485) como en los resultados obtenidos de la prueba in silico de secuencias en MATHFISH
(como se describe en Materiales y métodos). Cuando la sonda CTH485 se aplicó junto con las
sondas auxiliares hCTH429 o hCTH439 en cultivo puro de Coprothermobacter, se obtuvieron
Navegación de artículos
resultados similares como en el caso de la aplicación de sonda única, con la excepción de un
desplazamiento de la desintegración de la señal de uorescencia en alrededor del 40% de
formamida. En cambio, se observó una diferencia notable con la aplicación combinada de
sonda y auxiliares a muestras jas que se originaron en un digestor de lodos anaeróbicos
termó los. En presencia de sondas auxiliares hCTH429 o hCTH439, las células mostraron
una buena señal de uorescencia. La señal de uorescencia fue mayor en presencia de
hCTH439 con respecto a hCTH429 (+ 15%). Con una severidad que se eleva a 40% de
formamida, la señal de uorescencia fue detectable solo en presencia de hCTH439. Esta señal
fue un 16% más baja que la intensidad de la señal de uorescencia registrada al 30% de
formamida en las mismas condiciones. El uso de la sonda CTH485 junto con el hCTH439 al
30% de formamida (Fig.2 b) fue, por lo tanto, la solución óptima para el análisis de lodos
anaeróbicos termofílicos. La diferencia observada en la emisión de uorescencia de la sonda
CTH485 cuando se aplicó en cultivo puro y en lodo termofílico no se relacionó con la
e ciencia de hibridación, generalmente afectada por la accesibilidad y a nidad de la sonda al
objetivo (Tabla S1). Por el contrario, la diferencia observada entre el cultivo puro y el lodo
probablemente se debió a cambios siológicos de la estructura 3D del gen 16S rRNA de C.
proteolyticusen un hábitat complejo como el digestor anaeróbico que opera bajo condiciones
termofílicas. La aplicación de las sondas CTH485 y hCTH439 a muestras de lodos
termofílicos, tomadas de tres digestores anaeróbicos alimentados con WAS pretratado
térmicamente, condujo a la identi cación de la mayoría de la población bacteriana (Tabla 2 ,
Fig. S4). La abundancia relativa de Coprothermobacter recuperada en las diferentes muestras
de lodo osciló entre el 60% y el 90% del total de bacterias (Tabla 2 ).

Tabla 2
Abundancia relativa de Coprothermobacter identificada con la sonda CTH485 y hCTH439 de bacterias totales o
de células teñidas con DAPI total

−1
Digestor % Coprothermobacter / % Coprothermobacter / OLR (g vs. L TRH
−1
No.  células totales  bacterias totales  día )  (día) 

1  43.3  93  1  15 

2  49.7  sesenta y cinco  1.8  8 

3  42.9  69  3.7  8 

Los parámetros operativos de los tres reactores termofílicos anaeróbicos alimentados con lodos activados
Saltar al contenido principal
pretratados térmicamente se detallan en Gianico et al . ( 2013 ).

Ver grande
Navegación de artículos
Unión inespecífica de Coprothermobacter spp. con sonda ARC915
Vale la pena señalar que en este estudio se observó una unión no especí ca de la sonda
ARC915 con células Coprothermobacter . La unión inespecí ca se observó cuando la sonda se
aplicó en muestras de lodos termofílicos o cuando se probó directamente en el cultivo puro de
la cepa BT de C. proteolyticus , trabajando en las condiciones de rigurosidad ampliamente
aplicadas para la sonda ARC915 (20% y 35% de formamida). Fig. S5). La hibridación de
células Coprothermobacter en muestras de lodo termofílico con las sondas CTH485 y ARC915
se muestra en la Fig. 3 a. La diferente morfología de las células arqueas, con respecto a
Coprothemobacter , en lodos termofílicos, se destacó usando un tratamiento previo de
pseudomureina endopeptidasa (Nakamuraet al ., 2006 ) y la sonda especí ca MB311, como se
muestra en la Fig. 3 b. La posición y tipología de los desajustes del gen rRNA 16 de
Coprothermobacter spp. con la secuencia diana de la sonda de ARC915 se presentan en la Fig. 1
b, en donde la secuencia de C. proteolyticus se utilizó DSM5265 como modelo. Dos
emparejamientos fuertes (U / T: U / T y C: C) y un emparejamiento débil (g: u / t) se
encuentran en el extremo de la cadena objetivo y esto puede explicar la unión incompleta de
la sonda ARC915. Los desajustes en los extremos de una sonda son signi cativamente más
estables que los desajustes en la sección central, donde la dependencia posicional es mínima
(Yilmaz et al ., 2008). La especi cidad de la cubierta y la determinación del peso no
coincidente con TESTPROBE demostraron que la sonda ARC915 cubre la mayoría de las
secuencias de Coprothermobacter spp. presente en la base de datos (88.7%), y el peso de los
desajustes fue de 2.3. La distribución de peso posicional utilizada en TESTPROBE no consideró
los diferentes parámetros termodinámicos involucrados en la hibridación contra diferentes
organismos, como el valor de energía libre del sitio objetivo, la energía libre de plegado de la
sonda y la posición de falta de coincidencia, como se informó en Yilmaz et al . ( 2008 ). De
acuerdo con estas observaciones, una evaluación de la estabilidad de desajuste con la
herramienta de análisis de desajuste del software MATHFISH se realizó utilizando la secuencia
de ARC915 contra Metanohermobacter thermoautotrophicus cepa 16H 16S (número de acceso
074260.1 ) como secuencia objetivo y C. proteolyticus 16S (número de acceso 074653.1 ) como
secuencia no objetivo (Fig. S6a yb). En general, los valores de ΔG y la tendencia de e ciencia
0
de hibridación mostraron que la sonda se hibridó con el organismo no objetivo y con el
objetivo hasta c . 30% de formaldehído. De acuerdo con los resultados in silico , se realizó una
hibridación en muestras de lodos termofílicos con la sonda ARC915 al 30, 40 y 50% de
formamida. Como se ve en la Fig. 4a, la sonda se unió tanto a las células objetivo ( lamentos
delgados
Saltar arcaeales)
al contenido como a las células no objetivo ( barras pequeñas de Coprothermobacter ,
principal
detectadas también con sondas EUB338mix y CTH485) con la misma emisión de
uorescencia obtenida al 30% de formamida. En 40% de formamida, se observó una marcada
diferencia en la emisión de uorescencia entre las células diana y no diana (Fig. 4 b). Sólo en
Navegación de artículos
50% de formamida eran Coprothermobacter células ya no detectable (Fig. 4 c), junto con una
pérdida notable de la uorescencia de las células archaeal que no afectan a la cantidad de
células detectadas (datos no mostrados).

Fig. 3

Ver la gran diapositiva de descarga

Las células Coprothermobacter se hibridaron con la sonda CTH485 + hCTH439 y ARC915 al 30% de formamida
(a); Células arqueas pertenecientes a Methanobacteriales visualizadas con sonda MB311 al 35% de formamida,
después del pretratamiento enzimático con pseudomureina endopetidasa, como se describe en materiales y
métodos (b. Barra de escala: 10 μm.

Fig. 4

Saltar al contenido principal


Navegación de artículos

Ver la gran diapositiva de descarga

Análisis FISH de lodos termofílicos utilizando la sonda ARC915 en tres condiciones de rigurosidad diferentes,
30% (a), 40% (b) y 50% (c). Células de Coprothermobacter spp. (no objetivo; algunos indicados con flechas) son
las varillas cortas; Los filamentos delgados son células de Archaea (células diana). Barra de escala: 10 μm.

Discusión

Entre la variedad de métodos moleculares aplicados en muestras ambientales, FISH se


aprecia como una herramienta versátil, económica y cuantitativa para analizar la estructura
de la comunidad microbiana. En este estudio Coprothermobacter spp. se destacaron y
cuanti caron mediante FISH en muestras de lodos anaeróbicos termofílicos (Tabla 2 )
utilizando sondas de ayuda sin marcar. La diferencia entre la identi cación en cultivo puro o
lodo no se relacionó con la e ciencia de hibridación, como se describe en la Tabla S1, pero
probablemente se debió a los diferentes mecanismos de adaptación que realizan los
microorganismos termofílicos dependiendo de si viven solos o en sintro a (Nakamura et al.
al ., 2006 ; Sasaki et al ., 2011b ).

Existen fuertes mecanismos termoadaptativos que juegan un papel en la con guración de la


composición de nucleótidos del ARNr 16S y su ensamblaje dentro de la subunidad 30S del
ribosoma en procariotas a temperaturas extremas.

El contenido de GC del ARN ribosomal 16S es proporcional a la temperatura de crecimiento


bacteriano debido a la mayor estabilidad de la estructura secundaria debido al mayor número
de enlaces de hidrógeno entre pares de bases (Nakashima et al ., 2013 ). El contenido de GC
para el gen 16S rRNA de Coprothermobacter r es aproximadamente el 60%, en línea con el
contenido de GC informado para varios organismos termofílicos (Yamane et al ., 2011 ). Los
microorganismos termofílicos pueden lograr la termoestabilización del gen 16S rRNA por
modi cación química de nucleótidos como la metilación del grupo 2′-OH de residuos de
azúcar
Saltar que se encuentran
al contenido principal exclusivamente en las regiones más conservadas del rRNA maduro
que interactúan con las proteínas ribosómicas (Torchet y Maurel,2007 ).
Además, Li & Breaker ( 1999 ) y Deutscher ( 2003 ) describieron un aumento en la
Navegación de artículos
susceptibilidad del ARN a la degradación por enzimas naturales a alta temperatura. Las
proteínas ribosómicas de microorganismos termofílicos poseen características especiales en
comparación con las mesofílicas. Estas incluyen las interacciones con el gen 16S rRNA
(Gruber et al ., 2003 ), como un mayor número de sitios de unión altamente móviles o la
presencia de residuos con carga más positiva (Burton et al ., 2012). Por lo tanto, en células en
crecimiento, la estabilidad del ARNr sería muy probablemente una consecuencia de la
protección de las proteínas ribosómicas contra la acción de las ARNasas. Una interacción más
cercana entre proteínas y rRNA en ambientes naturales a altas temperaturas puede
razonablemente afectar la accesibilidad del gen 16S rRNA y la desnaturalización simple puede
no ser su ciente. El último sugiere que una interpretación basada en la estructura del
objetivo puede resolver parcialmente estos problemas.

El gen 16S rRNA puede existir en varias estructuras; La predicción de la estructura secundaria
de ARN por minimización de energía libre ha sido el estándar durante más de dos décadas.
Aquí hemos utilizado el enfoque de Ding et al . ( 2005 ), con la generación de la estructura
secundaria de centroide de conjunto del gen 16S rRNA utilizando el programa SFOLD ; El
centroide conjunto mejora las predicciones especí cas de la estructura secundaria porque es
representativo de un conjunto de posibles estructuras de ARN.

Como se describe en Fuchs et al . ( 2000 ), la mejora de la señal más efectiva se logra mediante
oligonucleótidos auxiliares directamente adyacentes y por ayudantes que se dirigen a la
región complementaria del sitio objetivo de la sonda. Además, el ayudante debe tener la
especi cidad exacta de la sonda. En este trabajo, los ayudantes de oligonucleótidos sin
marcar fueron diseñados combinando estos tres requisitos; como se muestra en la Fig. S3b, la
sonda hCTH439 era adyacente y complementaria a la región objetivo, y esta fue
probablemente la razón por la que funcionó mejor. Sin embargo, hCTH439 tuvo una
cobertura de secuencia 10% menor en la base de datos de SILVA con respecto a hCTH429. Por
lo tanto, teniendo en cuenta que hCTH429 también funcionó al 30% de formamida, pueden
usarse alternativamente de acuerdo con las especies deCoprothermobacter presente en la
muestra. Por lo tanto, una investigación especí ca sobre las estructuras secundarias del
ARNr es una herramienta valiosa para comprender la "dinámica de hibridación" y mejorar la
e ciencia de la sonda. La unión no especí ca de la sonda ARC915 a miembros de
Coprothermobacter spp. no se ha informado anteriormente porque en todos los estudios
previos la presencia de este microorganismo se determinó solo mediante la construcción del
análisis clonal de ARNr 16S (Kawagoshi et al ., 2005 ; Cheon et al ., 2008 ; Kobayashi et al .,
2008
Saltar al ;contenido
Lee et al .principal
, 2009 ; Rivière et al ., 2009; Sasaki et al ., 2011a ; Luo et al ., 2013 ) o por qPCR
(Tandishabo et al ., 2012 ) sin ninguna validación FISH. Dada la probada y bien documentada
coexistencia de este microorganismo con Archaea hidrogenotró ca en ambientes
termofílicos (Sasaki et al ., 2011a , b ), se necesita un enfoque de caracterización cauteloso
Navegación de artículos
para analizar dichos entornos complejos. Nuestra sugerencia es re nar la rigurosidad cada
vez, según el tipo y la complejidad de la muestra y la abundancia de Coprothermobacter y
Archaea., usando la sonda CTH485 como referencia para resaltar las celdas no objetivo. La
detección in situ de Coprothermobacter permite analizar de manera e ciente su interacción
sintró ca con metanógenos hidrogenotró cos y su papel en los procesos biotecnológicos
termofílicos.

Independientemente de la complejidad en la identi cación de células Coprothermobacter en su


entorno natural, la detección in situ dirigida al rRNA en lodos termofílicos sigue siendo una
herramienta molecular indispensable debido a su capacidad única para: (1) permitir que los
microorganismos se estudien en su contexto natural, destacando posibles interacciones
célula a célula; (2) identi car las células metabólicamente activas y su variación en relación
con los parámetros operativos durante el proceso de digestión; (3) resaltar los posibles
cambios en la morfología celular en comparación con las células cultivadas puras; (4) re nar
y con rmar los datos recopilados a partir del análisis clonal que puede llevar a una
subestimación o sobreestimación de los miembros de la población microbiana.

Expresiones de gratitud

Este trabajo fue apoyado por el proyecto ROUTES. Este proyecto ha recibido nanciación del
Séptimo Programa de la Unión Europea para investigación, desarrollo tecnológico y
demostración en virtud del acuerdo de subvención No. 265156. Los autores agradecen al Dr.
Kohei Nakamura por proporcionar pseudomurein endopeptidase y por las sugerencias
críticas sobre el análisis de FISH. Los autores agradecen al Dr. Fabrizio Sabba por los útiles
comentarios. Los autores no tienen con icto de intereses que declarar.

Amann Rhode Island Aglutinante BJ Olson RJ Chisholm SO Devereux R Stahl DA (1990)


Combinación de sondas de oligonucleótidos dirigidos a 16S rRNA con citometría de flujo para
analizar poblaciones microbianas mixtas. Appl Environ Microbiol  56: 1919-1925.
Google Académico PubMed  

Bader KC Grotho do Meier H (2011) Búsqueda exhaustiva y relajada de firmas de


oligonucleótidos en conjuntos de datos de secuencia agrupados jerárquicamente. Bioinformática 
27: 1546-1554El material complementario está disponible en
http://www.lrr.in.tum.de/~cassis/supplementary_material/section_3_5.html
Saltar al contenido principal .
Google Académico Referencia cruzada PubMed  
Braguglia CM Gagliano MC Rossetti S (2012) Pretratamiento con ultrasonido de alta frecuencia
Navegación de artículos
para la digestión anaerobia de lodos: efecto sobre la estructura del flóculo y la población
microbiana. Bioresour Technol  110: 43-49.
Google Académico Referencia cruzada PubMed  

Aparejo segundo Zimmermann MONTE Jernigan RL Wang Y (2012) Una investigación


computacional sobre la conexión entre las propiedades dinámicas de las proteínas ribosómicas y
el ensamblaje de los ribosomas.. PLoS Comput Biol  8: e1002530.
Google Académico Referencia cruzada PubMed  

Cai H Gu J Wang Y (2011). Complemento de proteasa de la bacteria termófila Coprothermobacter


proteolyticus. Procedimientos de la Conferencia Internacional sobre Bioinformática y Biología
Computacional BIOCOMP'11  (Arabina HORA tran QN, eds), pp. 18-21. ISBN:Las Vegas,
NVDisponible en http://www.lidi.info.unlp.edu.ar/WorldComp2011-Mirror/BIC5011.pdf .
 

Chen L (2003) La alteración de la actividad de ADN adenina metilasa (Dam) en Pasteurella


multocida provoca un aumento de la frecuencia de mutación espontánea y atenuación en
ratones. Microbiología  149: 2283-2290.
Google Académico Referencia cruzada PubMed  

Cheon J Hidaka T Mori S Koshikawa H Tsuno H (2008) Aplicabilidad del método de clonación
aleatoria para analizar la comunidad microbiana en digestores anaeróbicos a gran escala. J Biosci
Bioeng  106: 134-140.
Google Académico Referencia cruzada PubMed  

Crocetti sol Murto METRO Björnsson L (2006) Una actualización y optimización de sondas de
oligonucleótidos dirigidas a arqueas metanogénicas para su uso en la hibridación de
fluorescencia in situ (FISH). Métodos de Microbiol J  sesenta y cinco: 194-201.
Google Académico Referencia cruzada PubMed  

Deutscher MP (2003) Degradación del RNA estable en bacterias. J Biol Chem  278: 45041-45044.
Google Académico Referencia cruzada PubMed  

Timbre Y Chan CY Lawrence CE (2005) Predicción de la estructura secundaria del ARN por
Saltar al contenido
centroides en unprincipal
conjunto de Boltzmann ponderado. ARN  11: 1157-1166.
Google Académico Referencia cruzada PubMed  
Fuchs BM Glöckner FO Wulf J Amann R (2000) Los oligonucleótidos auxiliares no marcados
Navegación de artículos
aumentan la accesibilidad in situ al ARNr 16S de las sondas de oligonucleótidos marcadas con
fluorescencia. Appl Environ Microbiol  66: 3603-3607.
Google Académico Referencia cruzada PubMed  

Gianico UNA Braguglia CM Cesarini R Mininni sol (2013) Reducción de la temperatura de la


hidrólisis a 134 ° C antes de la digestión anaerobia termofílica de los residuos de lodos activados
al aumentar la carga orgánica. Bioresour Technol  143: 96-103.
Google Académico Referencia cruzada PubMed  

Gruber T Köhrer do Pulmón segundo Shcherbakov re Piendl W (2003) La afinidad de la proteína


ribosomal S8 de las arqueas mesófilas y (hiper) termófilas y las bacterias para 16S rRNA se
correlaciona con las temperaturas de crecimiento de los organismos. FEBS Lett  549: 123-128.
Google Académico Referencia cruzada PubMed  

Hatamoto METRO Imachi H Yashiro Y Ohashi UNA Harada H (2008) Detection of active butyrate-
degrading microorganisms in methanogenic sludges by RNA-based stable isotope probing. Appl
Environ Microbiol  74: 3610–3614.
Google Scholar Crossref PubMed  

Ho DP Jensen PD Batstone DJ (2013) Methanosarcinaceae and acetate-oxidizing pathways


dominate in high-rate thermophilic anaerobic digestion of waste-activated sludge. Appl Environ
Microbiol  79: 6491–6500.
Google Scholar Crossref PubMed  

Kawagoshi Y Hino N Fujimoto A Nakao M Fujita Y Sugimura S Furukawa K (2005) E ect of inoculum
conditioning on hydrogen fermentation and pH e ect on bacterial community relevant to
hydrogen production. J Biosci Bioeng  100: 524–530.
Google Scholar Crossref PubMed  

Kobayashi T Li YY Harada H (2008) Analysis of microbial community structure and diversity in the
thermophilic anaerobic digestion of waste activated sludge. Water Sci Technol  57: 1199–1205.
Google Scholar Crossref PubMed  

Lee M Hidaka T Tsuno H (2009) Two-phased hyperthermophilic anaerobic co-digestion of waste


Saltar al contenido
activated sludgeprincipal
with kitchen garbage. J Biosci Bioeng  108: 408–413.
Google Scholar Crossref PubMed  
Li Y Breaker R (1999) Kinetics of RNA degradation by specific base catalysis of transesterification
Navegación de artículos
involving the 2′-hydroxyl group. J Am Chem Soc  121: 5364–5372.
Google Scholar Crossref  

Luo G Wang W Angelidaki I (2013) Anaerobic digestion for simultaneous sewage sludge treatment
and CO biomethanation: process performance and microbial ecology. Environ Sci Technol  47:
10685–10693.
Google Scholar PubMed  

Nakamura K Terada T Sekiguchi Y Shinzato N Meng X-Y Enoki M Kamagata Y (2006) Application of
pseudomurein endoisopeptidase to fluorescence in situ hybridization of methanogens within the
family Methanobacteriaceae. Appl Environ Microbiol  72: 6907–6913.
Google Scholar Crossref PubMed  

Nakashima H Fukuoka A Saitou Y (2013) Hydrogen bonds are related to the thermal stability of
16S rRNA. J Biomed Sci Eng  6: 19–24.
Google Scholar Crossref  

Nishida H Beppu T Ueda K (2011) Whole-genome comparison clarifies close phylogenetic


relationships between the phyla Dictyoglomi and Thermotogae. Genomics  98: 370–375.
Google Scholar Crossref PubMed  

Ollivier BM Mah RA. Ferguson TJ Boone DR Garcia JL Robinson R (1985) Emendation of the genus
Thermobacteroides:Thermobacteroides proteolyticus sp. nov., a proteolytic acetogen from a
methanogenic enrichment. Int J Syst Bacteriol  35: 425–428.
Google Scholar Crossref  

Palatsi J Viñas M Guivernau M Fernandez B Flotats X (2011) Anaerobic digestion of slaughterhouse


waste: main process limitations and microbial community interactions. Bioresour Technol  102:
2219–2227.
Google Scholar Crossref PubMed  

Pernthaler J Glockner FO Schonhuber W Amann R (2001) Fluorescence in situ hybridization (FISH)


with rRNA-target oligonucleotide probes. Methods Microbiol  30: 207–226.
Google Scholar Crossref  
Saltar al contenido principal

Pervin HM Dennis PG Lim HJ Tyson GW Batstone DJ Bond PL (2013) Drivers of microbial


community composition in mesophilic and thermophilic temperature-phased anaerobic
digestion pre-treatment reactors. Water Res  47: 7098–7108.
Navegación de artículos
Google Scholar Crossref PubMed  

Quast C Pruesse E Yilmaz P Gerken J Schweer T Yarza P Peplies J Glöckner FO (2013) The SILVA
ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic
Acids Res  41: D590–D596.
Google Scholar Crossref PubMed  

Rivière D Desvignes V Pelletier E Chaussonnerie S Guermazi S Weissenbach J Li T Camacho P Sghir


A (2009) Towards the definition of a core of microorganisms involved in anaerobic digestion of
sludge. ISME J  3: 700–714.
Google Scholar Crossref PubMed  

Rossetti S Blackall L Majone M Hugenholtz P Plumb JJ Tandoi V (2003) Kinetic and phylogenetic
characterization of an anaerobic dechlorinating microbial community. Microbiology  149: 459–
469.
Google Scholar Crossref PubMed  

Rossetti S Aulenta F Majone M Crocetti G Tandoi V (2008) Structure analysis and performance of a
microbial community from a contaminated aquifer involved in the complete reductive
dechlorination of 1, 1, 2, 2-tetrachloroethane to ethene. Biotechnol Bioeng  100: 240–249.
Google Scholar Crossref PubMed  

Sasaki D Hori T Haruta S Ueno Y Ishii M Igarashi Y (2011a) Methanogenic pathway and community
structure in a thermophilic anaerobic digestion process of organic solid waste. J Biosci Bioeng 
111: 41–46.
Google Scholar Crossref  

Sasaki K Morita M Sasaki D Nagaoka J Matsumoto N Ohmura N Shinozaki H (2011b) Syntrophic


degradation of proteinaceous materials by the thermophilic strains Coprothermobacter
proteolyticus and Methanothermobacter thermautotrophicus. J Biosci Bioeng  112: 469–472.
Google Scholar Crossref  

Tandishabo K Nakamura K Umetsu K Takamizawa K (2012) Distribution and role of


Coprothermobacter spp. in anaerobic digesters. J Biosci Bioeng  114: 518–520.
Saltar al contenido principal
Google Scholar Crossref PubMed  

Torchet C Maurel MC (2007) RNAs in extreme environments. Chem Biodivers  4: 1957–1971.


Google Scholar Crossref PubMed  
Navegación de artículos

Yamane K Hattori Y Ohtagaki H Fujiwara K (2011) Microbial diversity with dominance of 16S rRNA
gene sequences with high GC contents at 74 and 98 °C subsurface crude oil deposits in Japan.
FEMS Microbiol Ecol  76: 220–235.
Google Scholar Crossref PubMed  

Yilmaz LS Bergsven LI Noguera DR (2008) Systematic evaluation of single mismatch stability


predictors for fluorescence in situ hybridization. Environ Microbiol  10: 2872–2885.
Google Scholar Crossref PubMed  

Yilmaz LS Parnerkar S Noguera DR (2011) MATHFISH , a web tool that uses thermodynamics-based
mathematical models for in silico evaluation of oligonucleotide probes for fluorescence in situ
hybridization. Appl Environ Microbiol  77: 1118–1122.
Google Scholar Crossref PubMed  

Author notes

Editor: Robert Gunsalus

ROUTES project

European Union's Seventh Programme265156

© 2014 Federación de Sociedades de Microbiología Europea. Publicado por John Wiley & Sons Ltd

Dato suplementario

Fig. S1. Clones bacterianos a partir de lodos digeridos termófilos.

Fig. S2. Perfil de unión de la sonda CTH485 en cultivo puro de Coprothermobacter proteolyticus .

Fig. S3. Diseño de ayudantes de oligonucleótidos sin etiquetar con el so ware por SEPARADO .

Fig. S4. Células Coprothermobacter en lodos termófilos visualizados con la sonda CTH485 + hCTH439 (a la
izquierda) y tinción DAPI del mismo campo microscópico (a la derecha).
Saltar al contenido principal
Fig. S5. Aspecific binding of Coprothermobacter with ARC915 probe observed in thermophilic sludge samples
(A) and in a pure culture of Coprothermobacter proteolyticus DSM5265 (B), at two di erent stringency
conditions (20% and 35%). Bar is 10 μm.
Fig. S6. Mismatch analysis with MATHFISH so ware package for ARC915 probe sequence against 16S rRNA
Navegación de artículos
sequence of Methanothermobacter thermoautotrophicus strain ΔH and of Coprothermobacter proteolyticus
strain DSM5265.

Table S1. Calculated ΔGo values with MATHFISH so ware package for CTH485 probe sequence against 16S
rRNA sequence of Coprothermobacter proteolyticus strain DSM5265.

- pdf file

Ver métricas

Alertas de correo electrónico


Alerta de nuevo problema
En alerta de problema en curso
Alertas anticipadas de artículos
Artículo actividad alerta

Recibe ofertas exclusivas y


actualizaciones de Oxford Academic

Saltar al contenido principal

Más sobre este tema


Diversidad de arqueas metanogénicas en un
Navegación de artículos
sedimento de manglar y aislamiento de una
nueva cepa de Methanococcoides

Enumeración de arqueas y bacterias en basalto


de fondo marino mediante PCR cuantitativa en
tiempo real y microscopía de fluorescencia

Uso de proteínas fluorescentes verdes como


marcador para estudios ecológicos de
comunidades de lodos activados

Uso de acetato para el enriquecimiento de


microorganismos electroquímicamente activos
y sus análisis de 16S rDNA

Artículos relacionados en
Web de la Ciencia

Google Académico

Citando artículos vía


Web de la Ciencia (6)

Google Académico

CrossRef

Último Mas leido Más citados

Tipificación molecular de aislamientos de


Streptococcus agalactiae de serotipo Ia de
tilapia en el sur de China

Interacciones entre endófitos septados oscuros,


hongos ectomicorrizales y patógenos de la raíz
in vitro

Saltar al contenido
El efecto principalen la microbiota
de los simbióticos
fecal dominante y la producción de ácidos
grasos de cadena corta en cerdas
El butirato dietético suprime la inflamación
Navegación de artículos
mediante la modulación de la microbiota
intestinal en ratones alimentados con dieta alta
en grasa

Las señales fluorescentes asociadas con el


Complejo respiratorio I revelaron cambios
conformacionales en el sitio catalítico

About FEMS Microbiology Letters Facebook


Editorial Board Twitter

Policies LinkedIn
Author Guidelines Purchase

Contact Us Recommend to your Library


Advertising and Corporate Services

Journals Career Network

Online
Saltar ISSN 1574-6968
al contenido principal
Print ISSN 0378-1097
Copyright © 2019 Federation of European Microbiological Societies
Navegación de artículos

About Us Connect
Contact Us Join Our Mailing List
Careers OUPblog
Help Twitter
Access & Purchase Facebook
Rights & Permissions YouTube
Open Access Tumblr

Resources Explore
Authors Shop OUP Academic
Librarians Oxford Dictionaries
Societies Oxford Index
Sponsors & Advertisers Epigeum
Press & Media OUP Worldwide
Agents University of Oxford

Oxford University Press is a department of the University of


Oxford. It furthers the University's objective of excellence in
research, scholarship, and education by publishing worldwide

Copyright © 2019 Oxford University Press Cookie Policy Privacy Policy Aviso Legal
Mapa del sitio Accesibilidad Obtener Adobe Reader

También podría gustarte