UNIVERSIDAD CATOLICA AGROPECUARIA DEL TROPICO SECO (UCATSE) FACULTAD DE CIENCIAS MÉDICAS (FMC) CARRERA DE MEDICINA GENÉTICA MÉDICA

ACTIVIDAD METODOLOGICA: Trabajo de estudio independiente TEMA: Bases cromosómicas. DESARROLLO: 1. ¿Qué es el código genético? 2. Indique ¿qué es un codón y señale en cuál de las moléculas de RNA contiene los codones? 3. Indique ¿qué es un anticodón y señale en cuál de las moléculas de arna contiene los anticodones? 4. Enumere todos los elementos implicados en la traducción. 5. ¿Qué es la activación de los aa?, ¿Qué enzima realiza la activación de aa? 6. Mencione ¿cuál es el azúcar pentosa del nucleótido de: DNA: RNA: 7. Menciones cuales son las 4 bases nitrogenadas que pueden contener el nucleótido de: DNA: RNA: 8. Señale diferencias estructurales entre las moléculas de DNA y RNA, en cuanto a los indicado en el siguiente cuadro: Molécula de DNA Molécula de RNA Numero de cadena polinucleotidas Dirección de las cadenas Empaquetamiento de las bases Propiedad: Replicación, transcripción ó traducción 9. Mencione los tipos de RNA y describa cual es su función: 10. Señale semejanzas y diferencias entre la síntesis del DNA y del RNA, en cuanto a lo indicado en el siguiente cuadro. DNA RNA Propiedades o mecanismos por el cual se sintetiza

Lic. María José Moreira Espinoza/sporseia@hotmail.com

Mencione cuales son las otras proteínas o enzimas que requiere la replicación de DNA. ¿CUÁL sería la cadena polinucléotida del DNA complementaria a ella. 13.com .UNIVERSIDAD CATOLICA AGROPECUARIA DEL TROPICO SECO (UCATSE) FACULTAD DE CIENCIAS MÉDICAS (FMC) CARRERA DE MEDICINA GENÉTICA MÉDICA Molécula molde que utiliza Nucleotidos trifosfatos que necesitan Dirección de la síntesis Enzimas de polemización que utiliza Número de moléculas que origina 11. Señale para la siguiente secuencia de DNA: 3´agggccaatagctttccgatagac5´ a. ¿Cuál sería la cadena polinucléotida de RNA que originaria esta secuencia después de realizada la transcripción? Lic. María José Moreira Espinoza/sporseia@hotmail. 12. Porque la replicación del DNA es semiconservativa. b.

Lic. Explicar el mecanismo y uso de los Microarrays. Describir las características que debe tener un cebador Mencionar cual es la importancia de la aplicación de la Reacción en cadena de la polimerasa en la genética médica. Definir marcador molecular de ADN 6. Describir las técnicas avanzadas en l Definir los marcadores moleculares de DNA. María José Moreira Espinoza/sporseia@hotmail. Enumere y describa las técnicas de genética molecular más importantes para el estudio de enfermedades hereditarias. 4. Explique la técnica del PCR.com .UNIVERSIDAD CATOLICA AGROPECUARIA DEL TROPICO SECO (UCATSE) FACULTAD DE CIENCIAS MÉDICAS (FMC) CARRERA DE MEDICINA GENÉTICA MÉDICA ACTIVIDAD METODOLOGICA: Seminario TEMA: TÉCNICAS DE GENETICA MOLECULAR APLICADAS A MEDICINA OBJETIVOS: Explicar la técnica de la reacción en cadena de la polimerasa. DESARROLLO 1. Citar 3 ejemplos de aplicaciones de la PCR en medicina. ¿Cuáles son las características que debe tener un cebador? 3. Explicar el mecanismo y los usos de los microarrays. 5. 2.

Sign up to vote on this title
UsefulNot useful