Está en la página 1de 3

wTALLER EXPRESIÓN GÉNICA

BIOLOGÍA FUNCIONAL
FUNDACIÓN UNIVERSITARIA SAN MARTÍN

1. Realice el esquema de un gen procariota y un gen eucariota en el que describa:


a. Región reguladora (incluya en el esquema las secuencias).
b. Cuáles son los nombres de las regiones promotoras y como están constituidas en cada caso.
c. Región estructural (incluya en el caso eucariotas la secuencia de delimitación de intrones)
d. Determine como podría ser el gen moncistronico y como policistronico.
2) En la secuencia de ADN hay un péptido,usted debe encontrarlo. Para ello debe determinar:
a. Si el gen es eucariota o procariota.EUCARIOTA
b. Si el gen es eucariota si hay intrones. NO TIENE
c. Si el gen es procariota encontrar varias proteínas. ES EUCARIOTA
Reconocer el codón (o codones) de incio y los codones de parada.
d. Construir el péptido usando el código genético. MET-ASP-ASN- MET- HIS- ALA-PRO-ARG-ASP-LEU--
THR-HIS-CYS-THR- SER- ARG- LEU- TYR-ISO –HIS-GLN-VAL-SER-GLN-ISO-PHE-ASP-ASP-ISO-
LEU-PHE- HIS-THR-SER-LEU-VAL-STOP
e. ¿Cuantos codones tiene la secuencia? 37
f. ¿Cuantos aminoácidos constituyen el péptido? 36

3’TAGCACACATTCCATACAAGGCCAACCCGCCTGTCTTCCGGTTAGAACTTCATCAGCACGAGGGCTTAGCATGGTAC

CAGTCCCGCGGGATATTTTTGGTGAGAGTGTTTAGAGCTAGC TAC CTA TTG TAC GTA CGT GGA TCT CTAGAT

AUG GAU AAC AUG CAU GCA CCU AGA GAU


CUA

TGC GTG ACG AGG TCG TCT AAT ATG TAT GTG GTC CAT TCA GTT TAA AAG CTG CTG TAT GAT AAA

ACG CAC UGC ACC AGC AGA UUA UAC AUA CAC CAG GUA AGU CAA AUU UUC GAC GAC AUA CUA
UUU

GTA TGT TCG AAT CAC ACT GTG AGG TCC TCC CCT ATA AGA GTT TGT GGT TGA ATG CAC ACG TCA

CAU ACA AGC UUA GUG UGA

CAA AGA AGT TTC TGA GAA TGC TTG TCC ATT CAA AGA TAT TAC GGT TTC CAA CGA AGT CCT CAA
AAC CGT CAA AGT CCG ATA TCC ACT TGC AGA TTT TAT AAA AAG AGT GTT TCA AAG CTG CTC TGG
GAA AAG AAA GCT TAT TTG GTT ATT TGC ACA CAT CAC AAA GTA GTT TCT GAA AAT GCT G 5’

3)Utilizando los siguientes péptidos construya un gen policistrónico. El gen debe tener un tamaño aproximado de 100 pares de bases
(pb).
a. Ala-gly-tyr-gln-val-ser
b. Phe-phe-val-ala-pro-lis
c. Tyr-Leu-leu-His-arg-Lis

3’ GAA AAG ATA GGT ATATTA AGU UUC UGA GAA UGC UUG UCC AUG GCC GGC UAU CAA GUU
AGC UGA AUG UUU UUG GUA GCG CCU AAA AUG UAU CUU CUA CAC AGA AAU UAG
GAA AAG ATA GGT TTC CAA TG 5’

4) Construya un gen monocistronico utilizando la secuencia a continuación. (No olvide incluir intrones). Use de la figura la
cadena de 21 aminoácidos (a.a.) La secuencia debe tener al menos 200 pb.

GTC TTA TTT CAT CCT AAC ATA TAC GCG CCT TTA ACA GGT GGG CAG ACG AAT GTC ATG

GTA TCG ATT AGC ATATTT TGA ATG CAA ATT TTT AAC CGA ATC TGA ATG CAC ACG TCA

TAC CCA ATA GTC GAT CAA GTC TGC AAG ATA TCA TGC GAA AAG ATA GGT TTG TCC

ATT CAA AGA TAT TGA GTC GTC GTC CATTCA

INTRONES CODONES DE PARADA CODON DE INICIO CAJA TATA

También podría gustarte